WorldWideScience

Sample records for radiation inhibits vigna

  1. Mobile phone radiation inhibits Vigna radiata (mung bean) root growth by inducing oxidative stress

    Energy Technology Data Exchange (ETDEWEB)

    Sharma, Ved Parkash [Department of Environment and Vocational Studies, Panjab University, Chandigarh 160014 (India); Department of Zoology, Panjab University, Chandigarh 160014 (India); Singh, Harminder Pal, E-mail: hpsingh_01@yahoo.com [Department of Environment and Vocational Studies, Panjab University, Chandigarh 160014 (India); Kohli, Ravinder Kumar; Batish, Daizy Rani [Department of Botany, Panjab University, Chandigarh 160014 (India)

    2009-10-15

    During the last couple of decades, there has been a tremendous increase in the use of cell phones. It has significantly added to the rapidly increasing EMF smog, an unprecedented type of pollution consisting of radiation in the environment, thereby prompting the scientists to study the effects on humans. However, not many studies have been conducted to explore the effects of cell phone EMFr on growth and biochemical changes in plants. We investigated whether EMFr from cell phones inhibit growth of Vigna radiata (mung bean) through induction of conventional stress responses. Effects of cell phone EMFr (power density: 8.55 {mu}W cm{sup -2}; 900 MHz band width; for 1/2, 1, 2, and 4 h) were determined by measuring the generation of reactive oxygen species (ROS) in terms of malondialdehyde and hydrogen peroxide (H{sub 2}O{sub 2}) content, root oxidizability and changes in levels of antioxidant enzymes. Our results showed that cell phone EMFr significantly inhibited the germination (at {>=}2 h), and radicle and plumule growths ({>=}1 h) in mung bean in a time-dependent manner. Further, cell phone EMFr enhanced MDA content (indicating lipid peroxidation), and increased H{sub 2}O{sub 2} accumulation and root oxidizability in mung bean roots, thereby inducing oxidative stress and cellular damage. In response to EMFr, there was a significant upregulation in the activities of scavenging enzymes, such as superoxide dismutases, ascorbate peroxidases, guaiacol peroxidases, catalases and glutathione reductases, in mung bean roots. The study concluded that cell phone EMFr inhibit root growth of mung bean by inducing ROS-generated oxidative stress despite increased activities of antioxidant enzymes.

  2. Mobile phone radiation inhibits Vigna radiata (mung bean) root growth by inducing oxidative stress

    International Nuclear Information System (INIS)

    Sharma, Ved Parkash; Singh, Harminder Pal; Kohli, Ravinder Kumar; Batish, Daizy Rani

    2009-01-01

    During the last couple of decades, there has been a tremendous increase in the use of cell phones. It has significantly added to the rapidly increasing EMF smog, an unprecedented type of pollution consisting of radiation in the environment, thereby prompting the scientists to study the effects on humans. However, not many studies have been conducted to explore the effects of cell phone EMFr on growth and biochemical changes in plants. We investigated whether EMFr from cell phones inhibit growth of Vigna radiata (mung bean) through induction of conventional stress responses. Effects of cell phone EMFr (power density: 8.55 μW cm -2 ; 900 MHz band width; for 1/2, 1, 2, and 4 h) were determined by measuring the generation of reactive oxygen species (ROS) in terms of malondialdehyde and hydrogen peroxide (H 2 O 2 ) content, root oxidizability and changes in levels of antioxidant enzymes. Our results showed that cell phone EMFr significantly inhibited the germination (at ≥2 h), and radicle and plumule growths (≥1 h) in mung bean in a time-dependent manner. Further, cell phone EMFr enhanced MDA content (indicating lipid peroxidation), and increased H 2 O 2 accumulation and root oxidizability in mung bean roots, thereby inducing oxidative stress and cellular damage. In response to EMFr, there was a significant upregulation in the activities of scavenging enzymes, such as superoxide dismutases, ascorbate peroxidases, guaiacol peroxidases, catalases and glutathione reductases, in mung bean roots. The study concluded that cell phone EMFr inhibit root growth of mung bean by inducing ROS-generated oxidative stress despite increased activities of antioxidant enzymes.

  3. Analysis of radiation-induced genome alterations in Vigna unguiculata

    Directory of Open Access Journals (Sweden)

    van der Vyver C

    2011-09-01

    Full Text Available Christell van der Vyver1, B Juan Vorster2, Karl J Kunert3, Christopher A Cullis41Institute for Plant Biotechnology, Department of Genetics, University of Stellenbosch, Stellenbosch, South Africa; 2Department of Plant Production and Soil Science, and 3Department of Plant Science, Forestry and Agricultural Biotechnology Institute, University of Pretoria, Pretoria, South Africa; 4Case Western Reserve University, Department of Biology, Cleveland, OH, USAAbstract: Seeds from an inbred Vigna unguiculata (cowpea cultivar were gamma-irradiated with a dose of 180 Gy in order to identify and characterize possible mutations. Three techniques, ie, random amplified polymorphic DNA, microsatellites, and representational difference analysis, were used to characterize possible DNA variation among the mutants and nonirradiated control plants both immediately after irradiation and in subsequent generations. A large portion of putative radiation-induced genome changes had significant similarities to chloroplast sequences. The frequency of mutation at three of these isolated polymorphic regions with chloroplast similarity was further determined by polymerase chain reaction screening using a large number of individual parental, M1, and M2 plants. Analysis of these sequences indicated that the rate at which various regions of the genome is mutated in irradiation experiments differs significantly and also that mutations have variable “repair” rates. Furthermore, regions of the nuclear DNA derived from the chloroplast genome are highly susceptible to modification by radiation treatment. Overall, data have provided detailed information on the effects of gamma irradiation on the cowpea genome and about the ability of the plant to repair these genome changes in subsequent plant generations.Keywords: mutation breeding, gamma radiation, genetic mutations, cowpea, representational difference analysis

  4. Effect of gamma radiation on seed germination and seedling vigour in cowpea [Vigna unguiculata (L.) Walp.

    International Nuclear Information System (INIS)

    Thimmaiah, S.K.; Mahadevu, P; Srinivasappa, K.N.; Shankara, A.N.

    1998-01-01

    Cowpea [Vigna unguiculata (L.) Walp.) is regarded as hardy and one of the important tropical legumes. The plants respond differently to mutagenic treatments. Ionizing radiations affect a wide range of physiological and biochemical activities of plants. The purpose of this paper is to report the effect of gamma radiation on seed germination and seedling vigour of two important cowpea varieties viz., KBC-1 and TVX-994-02E in M 1 generation under laboratory conditions. (author)

  5. biostudy on vigna sinensis beetle, callosobruchus chinensis l.and its control by gamma radiation

    International Nuclear Information System (INIS)

    Hasan, A.I.A.

    2005-01-01

    the present study carried out to determine: 1.the effects of the separate and combined effect of bacillus thuringiensis and gamma radiation on some biological aspects of callosobruchus chinensis. 2. the weight loss in infected seeds and total population of the pest after store it for different on adult beetles to determine the proteins, lipids and carbohydrates contents. 4. some analysis in the cowpea vigna anguiculata seeds to investigate the nutritive value after different treatments with bacillus thuringiensis (b.t) and gamma radiation

  6. Increased stability of thylakoid components in Vigna sinensis seedlings grown under ultraviolet-B enhanced radiation

    International Nuclear Information System (INIS)

    Nedunchezhian, N.; Kulandaivelu, G.

    1994-01-01

    Chloroplasts isolated from Vigna sinensis L. seedlings grown under cool fluorescent (control chloroplasts) and ultraviolet-B (UV-B)-enhanced fluorescent (UV chloroplasts) radiation, when incubated at 10, 20, 30 and 40-degrees-C, showed large variations in the photosynthetic electron transport reactions. The overall electron transport activity in both control and UV chloroplasts incubated at 40-degrees-C decreased rapidly. In contrast to this, at 30-degrees-C the control chloroplasts got inactivated very rapidly during the 30 min of incubation while the UV chloroplasts showed high stability. A similar trend was also noticed at 20-degrees-C. At 10-degrees-C, although the rate of inactivation was slow, UV chloroplasts were more stable than control chloroplasts. A similar trend was noticed in photosystem (PS) 2 activity. In contrast to overall electron transport and PS2 reactions, PS1 activity showedonly marginal changes at all temperatures. The polypeptide profiles of chloroplasts exposed to UV-B irradiation for 60 min at different temperatures revealed marked decreases in the level of the 23 and 33 kDa polypeptides in control chloroplasts while in UV chloroplasts these polypeptides were highly stable. In addition, UV chloroplasts contained several new polypeptides of both high and low molecular masses. The polypeptide pattern indicated that higher photochemical activity of UV chloroplasts over the control chloroplasts could be due to stabilization of PS2 core complexes by the new polypeptides induced under UV-B enhanced radiation

  7. Quarantine treatment by gamma radiation for different development stages of Callosobruchus maculatus in bean Vigna sinensis

    International Nuclear Information System (INIS)

    Arthur, Valter; Machi, André R.; Franco, Suely S.H.

    2017-01-01

    The loss of stored grain caused by insects generates a problem of economic order of importance, due to concern about the increased supply of food for the world population is expanding. Associated with this fact, there is the problem of nutritional deficiency due to lack of protein, especially for the less privileged populations. The use of ionizing radiation in grains and products stored without a doubt can solve the problem of the losses in these products, since it does not induce resistance to insects and leaves no toxic residue in the products, and is considered an effective and safe method. The aim of the experiment was to determine the effect of ionizing radiation from cobalt-60 as a quarantine treatment for the different stages of development of Callosobruchus maculatus (Fabr., 1972) (Coleóptera, Chysomilidae) in bean Vigna sinensis. The experiment was conducted in the laboratory of Radiobiology and Environment CENA/USP, Piracicaba, SP, Brazil. Bean samples infested with eggs, larvae, pre-pupae and pupae C. maculatus, the experiment consisted of 4 replicates for each stage of the insect's life cycle, and each repetition consisted of 20 individuals (eggs, larvae, pre-pupae and pupae), a total of 200 subjects per treatment which were irradiated with doses of 0 (control), 25, 50, 75 and 100 Gy, a source of cobalt-60, Gammabeam-650 type, in a rate dose of 1.3 kGy / h. The experiment was conducted in a room with a relative of 25 ± 2 ° C temperature and humidity of 70 ± 5%. After 35 days of irradiation process were carried out evaluations of the number of insects emerged in each repetition within the treatments. From the results obtained it was concluded that the dose lethal to eggs and larvae was 25 Gy, while for pre-pupae was 50 Gy, to pupae 100 Gy was not sufficient to control the adult emergence. (author)

  8. Quarantine treatment by gamma radiation for different development stages of Callosobruchus maculatus in bean Vigna sinensis

    Energy Technology Data Exchange (ETDEWEB)

    Arthur, Valter; Machi, André R.; Franco, Suely S.H., E-mail: arthur@cena.usp.br [Centro de Energia Nuclear na Agricultura (CENA/USP), Piracicaba, SP (Brazil). laboratório de Radiobiologia e Ambiente; Fontes, Lucia da Silva, E-mail: lsfontes@uol.com.br [Universidade Federal do Piauí (UFPI), Teresina, PI (Brazil). Dept. de Biologia; Harder, Márcia N.C., E-mail: marcia.harder@fatec.sp.gov.br [Faculdade de Tecnologia de Piracicaba (FATEC), SP (Brazil). Dep. Roque Trevisan; Rossi, Rodrigo S.; Arthur, Paula B.; Franco, José G., E-mail: paula.arthur@hotmail.com, E-mail: zegilmar60@gamil.com, E-mail: gilmita@uol.com.br [Instituto de Pesquisas Energéticas e Nucleares (IPEN/CNEN-SP), São Paulo, SP (Brazil)

    2017-07-01

    The loss of stored grain caused by insects generates a problem of economic order of importance, due to concern about the increased supply of food for the world population is expanding. Associated with this fact, there is the problem of nutritional deficiency due to lack of protein, especially for the less privileged populations. The use of ionizing radiation in grains and products stored without a doubt can solve the problem of the losses in these products, since it does not induce resistance to insects and leaves no toxic residue in the products, and is considered an effective and safe method. The aim of the experiment was to determine the effect of ionizing radiation from cobalt-60 as a quarantine treatment for the different stages of development of Callosobruchus maculatus (Fabr., 1972) (Coleóptera, Chysomilidae) in bean Vigna sinensis. The experiment was conducted in the laboratory of Radiobiology and Environment CENA/USP, Piracicaba, SP, Brazil. Bean samples infested with eggs, larvae, pre-pupae and pupae C. maculatus, the experiment consisted of 4 replicates for each stage of the insect's life cycle, and each repetition consisted of 20 individuals (eggs, larvae, pre-pupae and pupae), a total of 200 subjects per treatment which were irradiated with doses of 0 (control), 25, 50, 75 and 100 Gy, a source of cobalt-60, Gammabeam-650 type, in a rate dose of 1.3 kGy / h. The experiment was conducted in a room with a relative of 25 ± 2 ° C temperature and humidity of 70 ± 5%. After 35 days of irradiation process were carried out evaluations of the number of insects emerged in each repetition within the treatments. From the results obtained it was concluded that the dose lethal to eggs and larvae was 25 Gy, while for pre-pupae was 50 Gy, to pupae 100 Gy was not sufficient to control the adult emergence. (author)

  9. The Effect of Shoot/Root Competition of Black night shade (Solanum nigrum on Growth and Seed Yield of Mung Bean (Vigna radiate L.

    Directory of Open Access Journals (Sweden)

    M Goldani

    2015-04-01

    Full Text Available In order to study the competition effects of Solanum nigrum on Vigna radiate yield, an additive experiment was conducts at Ferdowsi University of Mashhad experimental Greenhouse. The type of design was completely randomized block. Treatments included three density of Solanum nigrum (2, 4, and 6 plants m-2 and three types of competition (root, shoot and both of them planted at constant density of Vigna radiate plus weed free check in each block. The results indicated that competitions had significant effects (P

  10. Ionizing radiation induced changes in phenotype, photosynthetic pigments and free polyamine levels in Vigna radiata (L.) Wilczek

    International Nuclear Information System (INIS)

    Sengupta, Mandar; Chakraborty, Anindita; Raychaudhuri, Sarmistha Sen

    2013-01-01

    Effects of gamma rays on the free polyamine (PA) levels were studied in Vigna radiata (L.) Wilczek. Seeds exposed to different doses of gamma rays were checked for damage on phenotype, germination frequency and alteration in photosynthetic pigments. Free polyamine levels were estimated from seeds irradiated in dry and water imbibed conditions. Polyamine levels of seedlings grown from irradiated seeds, and irradiated seedlings from unexposed seeds were also measured. Damage caused by gamma irradiation resulted in decrease in final germination percentage and seedling height. Photosynthetic pigments decreased in a dose dependent manner as marker of stress. Polyamines decreased in irradiated dry seeds and in seedlings grown from irradiated seeds. Radiation stress induced increase in free polyamines was seen in irradiated imbibed seeds and irradiated seedlings. Response of polyamines towards gamma rays is dependent on the stage of the life cycle of the plant. - Highlights: ► Gamma irradiation of Vigna radiata (L.) Wilczek seeds and seedlings. ► Decrease in germination frequency. ► Increase in seedling injury with increased dosage of gamma rays. ► Decrease in chlorophyll and carotenoid pigments. ► Change in free polyamine levels

  11. Vigna unguiculasta

    African Journals Online (AJOL)

    Vigna ... content, level of starch damage and foaming capacity; Iron was least affected in TDF and SI while. Ife brown was the least ... cowpea in storage is reported to reach 100% sometimes, if left ..... potato flake quality as influenced by free starch.

  12. Transcriptome sequencing of mung bean (Vigna radiate L.) genes and the identification of EST-SSR markers.

    Science.gov (United States)

    Chen, Honglin; Wang, Lixia; Wang, Suhua; Liu, Chunji; Blair, Matthew Wohlgemuth; Cheng, Xuzhen

    2015-01-01

    Mung bean (Vigna radiate (L.) Wilczek) is an important traditional food legume crop, with high economic and nutritional value. It is widely grown in China and other Asian countries. Despite its importance, genomic information is currently unavailable for this crop plant species or some of its close relatives in the Vigna genus. In this study, more than 103 million high quality cDNA sequence reads were obtained from mung bean using Illumina paired-end sequencing technology. The processed reads were assembled into 48,693 unigenes with an average length of 874 bp. Of these unigenes, 25,820 (53.0%) and 23,235 (47.7%) showed significant similarity to proteins in the NCBI non-redundant protein and nucleotide sequence databases, respectively. Furthermore, 19,242 (39.5%) could be classified into gene ontology categories, 18,316 (37.6%) into Swiss-Prot categories and 10,918 (22.4%) into KOG database categories (E-value SSR), and 2,303 sequences contained more than one SSR together in the same expressed sequence tag (EST). A total of 13,134 EST-SSRs were identified as potential molecular markers, with mono-nucleotide A/T repeats being the most abundant motif class and G/C repeats being rare. In this SSR analysis, we found five main repeat motifs: AG/CT (30.8%), GAA/TTC (12.6%), AAAT/ATTT (6.8%), AAAAT/ATTTT (6.2%) and AAAAAT/ATTTTT (1.9%). A total of 200 SSR loci were randomly selected for validation by PCR amplification as EST-SSR markers. Of these, 66 marker primer pairs produced reproducible amplicons that were polymorphic among 31 mung bean accessions selected from diverse geographical locations. The large number of SSR-containing sequences found in this study will be valuable for the construction of a high-resolution genetic linkage maps, association or comparative mapping and genetic analyses of various Vigna species.

  13. Soil compaction and gamma radiation ({sup 60}Co) in the development of the cowpea beans [Vigna unguiculata, (L) Walp]; Compactacao do solo e radiacao gama ({sup 60}Co) no desenvolvimento do feijao caupi [Vigna unguiculata, (L) Walp

    Energy Technology Data Exchange (ETDEWEB)

    Viana, Eliane Ferreira; Colaco, Waldeciro [Universidade Federal de Pernambuco (UFPE), Recife, PE (Brazil). Dept. de Energia Nuclear. Radioagronomia]. E-mails: aroucha@ufpe.br; wcolaco@ufpe.br

    2005-08-15

    The objective is to investigate the effect of compaction and increased doses of gamma radiation on the development of cowpea [Vigna unguiculata, (L) Walp] var. IPA-206 cultivated in a Neossolo fluvic soil, artificially compacted. Significant differences were observed in plant height, with the increase doses in soil density (1.30 Mg.m{sup -3} - compacted soil and 1.70 Mg.m{sup -3} - non-compacted soil), and in response to increased doses of irradiation (y-rays) [ [0, 100, 200 and 300 Gy). The diameter of the stem was significantly reduced in response to the increase in soil density, however the same did not occur in relation to the doses of irradiation (y-rays) holding capacity of the soil was reduced in response to the increase in soil density. (author)

  14. Vigna unguiculata L.

    African Journals Online (AJOL)

    user

    2012-02-16

    Feb 16, 2012 ... via organogenesis from cotyledonary node of cowpea. (Vigna unguiculata L. ... cowpea (Vigna unguiculata L. Walp) has been established. The cotyledonary node ..... Genomic/Proteomic Technol. 3: 45-47. Pellegrineschi A ...

  15. Induction of heat shock-like proteins in Vigna sinensis seedlings growing under ultraviolet-B (280-320 nm) enhanced radiation

    International Nuclear Information System (INIS)

    Nedunchezhian, N.; Annamalainathan, K.; Kulandaivelu, G.

    1992-01-01

    The effect of ultraviolet-B (UV-B) enhanced fluorescent radiation on protein profile and protein synthesis has been investigated in Vigna sinensis L. cv. Walp seedlings growing at various temperatures. In seedlings growing at 30°C, UV-B radiation decreased the level of several proteins as seen in Coomassie brilliant blue stained gel. However, fluorography of the same gel indicates induction of three sets of proteins in the range of 70. 53 and 16 k Da. Such induction under UV-B enhanced radiation resembled that found after heat shock treatments. In seedlings at 10 and 20°C, induction of such proteins varied both qualitatively and quantitatively. At 40°C. UV-B enhanced radiation caused a cumulative effect with temperature. Strong induction of specific proteins by UV-B radiation in seedlings growing under normal temperature indicates a possible protective role

  16. Evaluation of yield in Gamma Radiated Lines Selected from Mutated Generations of Mungbean (Vigna radiata)

    International Nuclear Information System (INIS)

    Aye Thandar; Phyu Hnin Htike; Myo Myint

    2010-12-01

    The induced mutation through different gamma radiation frequencies 50, 100, 150, 200, 250, 300, 350, 400, 450 and 500Gy in mungbean was studied for yield components in M3 generation. A Randomized Complete Block Design (RCBD) was employed with three replications in this experiment. The data collected from M3 generation were subjected to statistical analysis with the help of Excel (Microsoft office 2007) and for pairs wise comparison of groups was by SPSS program.In primary yield components, there were no significant difference in M3 generation of pods per plant, pod length and seeds per pod except 100 seeds weight. The plant treated with 250 Gy and 400Gy exploited the maximum value of one hundred seeds weight and yield per plant , respectively. Although there was no significant difference in secondary yield components; 50% flowering days, 50% maturity days and plant height in this generation, highest plant height at 200Gy and early flowering and maturity at 300Gy were obserded. The selection of individual plants in the M3 generation was carried out for high yield. In mutant selection, 250Gy and 400Gy revealed relatively more number of plants having good characters such as more number of pods per plant and longer pod length but not in other treatments and control.

  17. Increase in the yield of mung bean (Vigna radiata [L.] R. Wilczek) with storage of radiation-modified kappa-carrageenan

    International Nuclear Information System (INIS)

    Aurigue, F.B.; Montefalcon, D.R.V.; Dela Cruz, R.M.M.; Abad, L.V.

    2015-01-01

    Kappa-carrageenan is a sulphated polysaccharide naturally present in seaweeds. Upon gamma radiation, radiolysis produces low molecular weight κ-carrageenan with the cleavage of some of its sulphate groups. Consequently, the acidic solution may further hydrolyze κ-carrageenan. The study aims to determine the effects of application by foliar spraying of freshly prepared irradiated κ-carrageenan solution and those which has been stored for 3 months on the yield of potted mungbean (Vigna radiata) plants. Foliar application of radiation-modified κ-carrageenan solution on the Kulabo variety two weeks after sowing, at flower initiation, and at fruit formation stage resulted in 30.8% increase in pod yield and 50.2% increase in seed yield compared to plants similarly treated with NitroPlus inoculants only. Pod yield and seed yield advantage over the control plants (no inoculants and no fertilizer) were 57.2% and 83% respectively no fertilizer was used in all treatments. These result confirm the previous finding that irradiated κ-carrageenan solution sprayed every two weeks inoculants only. There was 200% yield advantage over the negative control. The increase in yield is attributed to the longer length of pod, higher number of seed per pod, heavier 100-seed weight. Interestingly, the 3 months-old solution gave better result compared to a freshly irradiated one. There was 26.5% and 26.8% difference in pod yield and seed yield, respectively. Compared with the Control plants of the Kulabo variety, those sprayed with stored κ-carrageenan solution had 105% advantage in seed yield. It was proposed that the degradation process of the oligo-κ-carrageenan continue during storage because of the acidic nature of the solution. Undoubtedly, irradiated κ-carrageenan solution has plant growth promoting activity that increase yield mung bean by spraying on the leaves at least three times before fruit development.(author)

  18. Heat enhances radiation inhibition of wound healing

    International Nuclear Information System (INIS)

    Twomey, P.; Hill, S.; Joiner, M.; Hobson, B.; Denekamp, J.

    1987-01-01

    To study the effect of hyperthermia on the inhibition of healing by radiation, the authors used 2 models of wound tensile strength in mice. In one, tensile strength of 1 cm strips of wounded skin was measured. In the other, strength was measured on 2 by 1 by .3 cm surgical prosthetic sponges of polyvinyl alcohol which has been cut, resutured, and implanted subcutaneously. Granulation tissue grows into the pores of the sponges which gradually fill with collagen. Tensile strength in both models was measured on day 14 using a constant strain extensiometer. The wounds were given graduated doses of ortho-voltage radiation with or without hyperthermia. Maximum radiation sensitivity occurred during the period of rapid neovascularization in the first 5 days after wounding, when a loss of 80% in wound strength occurred with doses less than 20 gray. For single radiation doses given 48 hours after wounding, the authors found a steep dose-response curve with half maximum reduction in strength occurring in both models at approximately 10 gray. Hyperthermia was produced in two ways. Skin wounds were heated in a circulating water bath. In the sponge model, more uniform heating occurs with an RF generator scaled to the mouse. At a dose of 43 C for 30 minutes, no inhibition of healing by heat alone was found. However the combination of heat and radiation produced definite enhancement of radiation damage, with thermal enhancement ratios of up to 1.9 being observed

  19. Comparative nutritional analysis between Vigna radiata and Vigna ...

    African Journals Online (AJOL)

    Vigna radiata (mung bean) and Vigna mungo (mash bean) of the family Fabaceae are among staple food in Pakistan. The experiments were conducted on these beans to determine the proximate composition such as moisture, ash, fibre, fat and protein content. The protein isolates from V. radiata and V. mungo was ...

  20. Radiation metagenesis and inhibition of DNA synthesis

    International Nuclear Information System (INIS)

    Dubinina, L.G.; Sergievskaya, S.P.; Kurashova, Z.I.; Dubinin, N.P.

    1983-01-01

    The study of modification of radiation mutagenesis and inhibition of the DNA synthesis by means of 1-β-D arabinofuranosylcytosine (ara-C) is carried out. It is shown that ara-C-acting on chromosomes in the G 1 phase and G 2 phase does not cause mutations in the C capillaris cells. The modification by means of ara-C radiation effect in the G 1 phase and G 2 phase correlates with duration and time of administering ara-C before and after irradiation. A new form of ara-C DNA synthesis inhibitor interaction with mutation processes has been found out. Protective effect of the DNA synthesis inhibitor (ara-C) from mutageneous radiation effect is stressed. Sensibilization of the radiation mutagenesis during cell treafment by the DNA synthesis inhibitor (ara-C) is shown. It is pointed out that emergence of sensibilization or protective effect, i. e. antimutagenesis phenomenon depends on conditions under which the synthesis inhibitor acted in G 1 and G 2 phases

  1. Evaluation of sowing patterns and weed control on mung bean (Vigna radiate L. Wilczek - black cumin (Nigella sativa L. intercropping system

    Directory of Open Access Journals (Sweden)

    parviz Rezvani Moghadam

    2016-04-01

    Full Text Available In order to study different arrangements and weed controls effects on mung bean (Vigna radiate L. Wilczek – black cumin (Nigella sativa L. intercropping an experiment was conducted at the Research Station of Faculty of Agriculture, Ferdowsi University of Mashhad, Iran, during growing season 2005 – 2006. Sixteen treatments comprising combinations of eight sowing patterns [A1: Sole black cumin, A2: Sole mung bean, A3: 3 rows black cumin– 2 rows mung bean, A4: 3 rows black cumin – 2 rows mung bean, A5: 2 rows black cumin – 1 rows mung bean, A6: 1 row black cumin – 2 rows mung bean, A7: 3 rows black cumin – 3 rows mung bean (Striped, A8: 1 row black cumin – 1 row mung bean (alternative rows] and two weed controls [V1: unweeded, V2: completely hand weeding] were arranged in a factorial experiment based on randomized complete block design with three replications. Results showed that in intercropping systems leaf area index (LAI of mung bean reduced but in the case of black cumin increased. Mung bean total dry matter in intercropping system did not differ comparing with sole crop but total dry matter in black cumin increased. All yield components in both crops affected by sowing patterns and weed control treatments. Number of branches/plant, number of pods or follicules/plant and number of seed/pods or follicules increased in A8, A4, A5 and A3 sowing patterns in mung bean and A3, A5 and A7 sowing patterns in black cumin compared with other arrangements. By increasing mung bean ratio in rows, the number of weed species, weed density, dry weight of weeds and abundance of weed species decreased. In unweeded treatment, number of branches/plant, number of pods or follicules/plant and number of seed/pods or follicules decreased in both crops. Land equivalent ratio (LER was more than 1.00 in all sowing patterns.

  2. Genetical analysis of the induced variation by gamma radiation in quantitative characters of Caupi [Vigna unguiculata (L.) Walp.

    International Nuclear Information System (INIS)

    Araujo, J.P.P. de.

    1987-10-01

    Genetical analysis procedures of the cobalt 60 gamma radiation effects in the induced mutations in quantitative characters of Caupi BR-1 Poty. The following characters were evaluated: day to first flower (FI), number of pods per plant (NVP), pod lenght (CMV), number of suds per pod (NSV), 100 seed wright (PCS), seed yield per plant (PSP) and seed yield per plant estimated by yield components (PSPE). The resistance of irradiated populations to cowpea aphid-borne mosaic virus (CpAMV)was also evaluated. (L.M.J.) [pt

  3. Vigna unguiculata [Linn] Walp varieties

    African Journals Online (AJOL)

    Walp) have differential effects on blood glucose when equal amounts are consumed. Objective: To ... Previous studies have described the benefit of consumption of ... Beans (Vigna unguiculata) are one of the staple local foods consumed by ...

  4. Study of oxygen inhibition effect on radiation curing

    International Nuclear Information System (INIS)

    Xiao Bin; Yang Xuemei; Zhao Pengji; Zeng Shuqing; Jiang Bo; Zhou Yong; Huang Wei; Zhou Youyi

    1995-01-01

    Michacl addition reaction product was used in the research of oxygen inhibition effect of radiation curing. The experimental results was measured by the content of gel and percentage of double bonds. It was proved that 9% of Michacl addition product could speed up 1.2 times of the radiation curing rate at 30 kGy of EB irradiation. This kind of formulation can withstand oxygen inhibition effect obviously, so it was the foundation of application for radiation curing in atmospheric condition

  5. Plant growth promoter effect of radiation degraded Kappa-carrageenan on mungbean (Vigna radiate [L.] R. Wilczek) and peanut (Arachis Hypogaea L.) plants

    International Nuclear Information System (INIS)

    Abad, L.V.; Magsino, G.; Aurigue, F.B.; Montefalcon, D.V.; Lopez, G.E.P.; Dela Cruz, R.M.M.

    2015-01-01

    Kappa Carrageenan are hydrophilic polymers that comprise the main structural polysaccharides of numerous species of seaweed Eucheuma. They are composed of D-galactose units linked alternately with α(1,3) D-galactose-4-sulfated and β(1-4)-3,6-anhydro-D-galactose. Earlier studies indicate that irradiated κ-carrageenan enchances the growth of some plants such as rice bokchoi, and mustard. This study aims to determine the effects of radiation modified κ-carrageenan solution on mungbean and peanut plants and to identify its effective molecular weight range as plants growth promoter. Oligomers from radiation modified κ-carrageenan solution on mungbean and peanut plants. Results on plants sprayed with PGP revealed improvement of the agronomic traits of mungbean and peanut plants. Best PGP effects were manisfested in oligo-carrageenan sprayed plants treated with inoculants + fertilizer with an increase in yield of 200% and 154% for mungbean and peanuts, respectively. Likewise, spraying with oligo-carrageenan alone increased yield by 127% and 140%. Recent studies conducted on the effect of radiation modified κ-carrageenan on rice plants indicated an average of 30% increase in yield of rice in three (3) multi-location sites (Laguna, Nueva Ecija and Bulacan). Plants indicated resistance against Tungro virus. It also showed improved stem strength, enhancing its lodging resistance. The radiation modified κ-carrageenan solution which had an Mw of 6.9 kDa was fractionated into different molecular weight cut-offs of 5 kDa, 3 kDa and 1 kDa. Analysis by gel permeation chromatography of these samples indicated Mw of 5.2 kDa, 4.0 kDa, and 3.8 kDa, respectively. Treatment of pechay by foliar spraying of these solution indicated that plant growth promoter effect increased in the order of 1kDa > 3kDa > 5kDa. (author)

  6. Potential ability of hot water adzuki (Vigna angularis) extracts to inhibit the adhesion, invasion, and metastasis of murine B16 melanoma cells.

    Science.gov (United States)

    Itoh, Tomohiro; Umekawa, Hayato; Furuichi, Yukio

    2005-03-01

    The 40% ethanol eluent of the fraction of hot-water extract from adzuki beans (EtEx.40) adsorbed onto DIAION HP-20 resin has many biological activities, for example, antioxidant, antitumorigenesis, and intestinal alpha-glucosidase suppressing activities. This study examined the inhibitory effect of EtEx.40 on experimental lung metastasis and the invasion of B16-BL6 melanoma cells. EtEx.40 was found significantly to reduce the number of tumor colonies. It also inhibited the adhesion and migration of B16-BL6 melanoma cells into extracellular matrix components and their invasion into reconstituted basement membrane (matrigel) without affecting cell proliferation in vitro. These in vivo data suggest that EtEx.40 possesses a strong antimetastatic ability, which might be a lead compound in functional food development.

  7. Cellular transformation by radiation: induction, promotion, and inhibition

    International Nuclear Information System (INIS)

    Borek, C.

    1981-01-01

    Radiation oncogenesis induced in utero in hamsters is expressed at a lower frequency than that induced in vitro. Quantitative studies carried out on hamster embryo cells indicate that neutrons are more effective in their carcinogenic potential than x-rays but also more toxic, that splitting the dose of x-rays at low doses leads to enhanced transformation, but that at high doses protracted radiation has a sparing effect. At all dose ranges survival was increased by protracting the radiation dose, thus suggesting that different repair processes must be involved for survival and transformation. In our qualitative studies, once cells are transformed by radiation, they exhibit a wide range of structural and functional phenotypic changes, some of which are membrane-associated and are expressed within days after induction. Our current studies on nutritional and hormonal influences on radiation transformation indicate the following: Pyrolysate products from broiled protein foods act in synergism with radiation to produce transformation, whereas vitamin A analogs are powerful, preventive agents. Retinoids inhibit both x-ray-induced transformation and its promotion by TPA; these modifications (enhancement by TPA, inhibition by retinoids) are not reflected in sister chromatid exchanges, but are reflected in the level of membrane associated enzymes Na/K ATPase. Whereas retinoids modify late events (expression, promotion), we find that thyroid hormone plays a crucial role in the early phases of radiation and chemically induced transformation. Our recent success in transforming human skin fibroblasts will enable quantitative and qualitative studies of radiation carcinogenesis in a system relevant to man

  8. Modulation of radiation response by histone deacetylase inhibition

    International Nuclear Information System (INIS)

    Chinnaiyan, Prakash; Vallabhaneni, Geetha; Armstrong, Eric M.S.; Huang, Shyh-Min; Harari, Paul M.

    2005-01-01

    Purpose: Histone deacetylase (HDAC) inhibitors, which modulate chromatin structure and gene expression, represent a class of anticancer agents that hold particular potential as radiation sensitizers. In this study, we examine the capacity of the HDAC inhibitor suberoylanilide hydroxamic acid (SAHA) to modulate radiation response in human tumor cell lines and explore potential mechanisms underlying these interactions. Methods and materials: Cell proliferation: Exponentially growing tumor cells were incubated in medium containing 0-10 μM of SAHA for 72 h. Cells were fixed/stained with crystal violet to estimate cell viability. Apoptosis: Caspase activity was analyzed by fluorescence spectroscopy using a fluorescein labeled pan-caspase inhibitor. Cells were harvested after 48 h of exposure to SAHA (1.0 μM), radiation (6 Gy), or the combination. Whole cell lysates were evaluated for poly(ADP-ribose) polymerase (PARP) cleavage by western blot analysis. Radiation survival: Cells were exposed to varying doses of radiation ± 3 days pretreatment with SAHA (0.75-1.0 μM). After incubation intervals of 14-21 days, colonies were stained with crystal violet and manually counted. Immunocytochemistry: Cells were grown and treated in chamber slides. At specified times after treatment with SAHA, cells were fixed in paraformaldehyde, permeabilized in methanol, and probed with primary and secondary antibody solutions. Slides were analyzed using an epifluorescent microscope. Results: SAHA induced a dose-dependent inhibition of proliferation in human prostate (DU145) and glioma (U373vIII) cancer cell lines. Exposure to SAHA enhanced radiation-induced apoptosis as measured by caspase activity (p < 0.05) and PARP cleavage. The impact of SAHA on radiation response was further characterized using clonogenic survival analysis, which demonstrated that treatment with SAHA reduced tumor survival after radiation exposure. We identified several oncoproteins and DNA damage repair proteins

  9. Apparatus and method for inhibiting the generation of excessive radiation

    International Nuclear Information System (INIS)

    Hernandez, F.; Chamberlain, J.

    1991-01-01

    This patent describes an apparatus for generating electron radiation or X-ray radiation. It comprises accelerator means for generating and accelerating electrons to form an electron beam which has a predetermined low intensity level for the generation of the electron radiation or a predetermined high intensity level for the generation of the X-ray radiation; supporting means for supporting a scattering foil and a target and for selectively moving either the foil into the trajectory of the electron beam having the low intensity level for generating the electron radiation upon impingement of the electrons there or on the target into the trajectory of the electron beam having the high intensity level for generating the X-ray radiation upon impingement of the electrons thereon; detecting means operable by the supporting means for sensing the position of the target relative to the trajectory of the electron beam; and inhibiting means coupled to the accelerator means and to the detecting means for preventing the generation of an electron beam having the high intensity level if the foil and not the target is positioned in the trajectory of the electron beam

  10. Seed yield and agronomic parameters of cowpea (Vigna ...

    African Journals Online (AJOL)

    Jane

    2011-10-12

    Oct 12, 2011 ... 1Department of Field Crops, Faculty of Agriculture, Bozok University, Sivas ... Key words: Vigna unguiculata, seed yield, thousand seed weight, Black Sea. INTRODUCTION. The cowpea (Vigna unguiculata L.) is an important.

  11. Induction, development, and inhibition of radiation-induced macrobodies

    International Nuclear Information System (INIS)

    Adam, W.J.; Grunewald, R.

    1975-01-01

    Coleus shoots were exposed to 100,000 R of γ radiation and the fine structure of the apical meristems was examined. Meristems were fixed at various postirradiation times. An ultrastructural body was found associated with irradiated tissue, bound by a single membrane, containing dense osmiophilic bodies, and usually associated with radiation-induced vacuoles. The development of these new bodies, and the effects of both dose rate and light during the postirradiation period on their development were examined. Reduction of the dose rate by a factor of two inhibited the formation of these macrobodies through the 24 hour postirradiation period. Meristems kept in the dark during the 24 hour postirradiation period had macrobodies similar in form to the macrobodies from the meristems of the 16 hour postirradiation period which were exposed to light. Superlethal doses were used to achieve these results. Similarities between our results and those achieved with lower lethal doses are discussed

  12. Inhibition of proteolytic ferments by taurin in radiation sickness

    International Nuclear Information System (INIS)

    Dokshina, G.A.; Klimova, A.D.; Yartsev, E.I.; Yakovlev, V.G.

    1975-01-01

    The application of taurin potassium phosphate (TKPh) as radioprotective remedy resulted in a considerable influence on the activity of the proteolytic ferments in the irradiated organism. White male rats with a weight of 160 to 180 g being kept in cages without any food for 12 hours before this experiment were irradiated with a gamma unit GUM-Co-60 with a dose of 700 rad (LDsub(70/30)). A 4% solution of the preparation was injected in an amount of 40 mg per rat 1, 3, 5, 7 days after irradiation. Under the effect of ionizing radiation there was a progredient increase of proteolytic ferment activity of liver and spleen which was detected already 30 min after irradiation with maximum rate of proteolysis on the 21st day. After injection of the preparation a two-phase reaction developed: on the 7th to 12th day an increased activity of cathepsins in the tissue and in the following time up to the 30th day of observation an inhibition of ferment activity was demonstrated. Simultaneously it was found that the radiation-induced corticosteroid level was prevented by the preparation. A similar effect was also shown by TKPh inhibiting proteolytic ferment activity in experiments with rats with preceding application of hydrocortisone in high doses. The obtained results permit the assumption that the radioprotective activity of taurin comes about by its effect in the direction of structural integrity of the cell membranes leading to a normalization of the hormonal and fermentative events

  13. Inhibition of seagrass photosynthesis by ultraviolet-B radiation

    International Nuclear Information System (INIS)

    Trocine, R.P.; Rice, J.D.; Wells, G.N.

    1981-01-01

    Effects of ultraviolet-B radiation on the photosynthesis of seagrasses (Halophila engelmanni Aschers, Halodule wrightii Aschers, and Syringodium filiforme (Kuetz) were examined. The intrinsic tolerance of each seagrass to ultraviolet-B, the presence and effectiveness of photorepair mechanisms to ultraviolet-B-induced photosynthetic inhibition, and the role of epiphytic growth as a shield from ultraviolet-B were investigated. Halodule was found to possess the greatest photosynthetic tolerance for ultraviolet-B. Photosynthesis in Syringodium was slightly more sensitive to ultraviolet-B while Halophila showed relatively little photosynthetic tolerance. Evidence for a photorepair mechanism was found only in Halodule. Syringodium appeared to rely primarily on a thick epidermal cell layer to reduce photosynthetic damage. Halophila seemed to have no morphological or photorepair capabilities to deal with ultraviolet-B. This species appeared to rely on epiphytic and detrital shielding and the shade provided by other seagrasses to reduce ultraviolet-B irradiation to tolerable levels. The presence of epiphytes on leaf surfaces was found to reduce the extent of photosynthetic inhibition from ultraviolet-B exposure in all species. Halophila appears to obtain an increased photosynthetic tolerance to ultraviolet-B as an indirect benefit of chloroplast clumping to avoid photo-oxidation by intense levels of photosynthetically active radiation

  14. Inhibition of ribosomal RNA synthesis in yeast by ionizing radiations

    Energy Technology Data Exchange (ETDEWEB)

    Weber, K; Kiefer, J [Giessen Univ. (Germany, F.R.). Strahlenzentrum

    1984-12-01

    Synthesis of ribosomal RNA(r-RNA) was measured for 1 h after exposure of Saccharomyces cerevisiae to ..gamma..-rays, X-rays or ..cap alpha.. particles. ..gamma..- or X-ray induced transcription inhibition was always found to decrease exponentially with dose. D/sub 0/ values of 2150 or 1950 Gy were determined in wild-type cells, corresponding to a mean energy of about 60 eV per r-RNA gene. The finding of differential sensitivities of the two high molecular-weight r-RNA species which are cotranscribed from r-DNA is compatible with the existence of a transcription terminating mechanism. Cells from a mutant strain (rad-9), radiation sensitive to colony forming ability, showed an approximately equal sensitivity for transcription inhibition compared to the wild-type (D/sub 0/ (2095) = 2400 Gy). Inactivation of r-RNA synthesis in cells exposed to ..cap alpha..-particles at room-temperature showed a decreased sensitivity with higher particle fluences ('resistant tail'). This phenomenon was drastically reduced if the temperature during irradiation was lowered to 4/sup 0/C and completely abolished when dried cells were used. An inactivation cross-section for ..cap alpha..-particle induced transcription inhibition of about 0.02 ..mu..m/sup 2/ can be derived from the experimental data.

  15. Inhibition of seagrass photosynthesis by ultraviolet-B radiation.

    Science.gov (United States)

    Trocine, R P; Rice, J D; Wells, G N

    1981-07-01

    Effects of ultraviolet-B radiation on the photosynthesis of seagrasses (Halophila engelmanni Aschers, Halodule wrightii Aschers, and Syringodium filiforme Kütz) were examined. The intrinsic tolerance of each seagrass to ultraviolet-B, the presence and effectiveness of photorepair mechanisms to ultraviolet-B-induced photosynthetic inhibition, and the role of epiphytic growth as a shield from ultraviolet-B were investigated.Halodule was found to possess the greatest photosynthetic tolerance for ultraviolet-B. Photosynthesis in Syringodium was slightly more sensitive to ultraviolet-B while Halophila showed relatively little photosynthetic tolerance. Evidence for a photorepair mechanism was found only in Halodule. This mechanism effectively attenuated photosynthetic inhibition induced by ultraviolet-B dose rates and dosages in excess of natural conditions. Syringodium appeared to rely primarily on a thick epidermal cell layer to reduce photosynthetic damage. Halophila seemed to have no morphological or photorepair capabilities to deal with ultraviolet-B. This species appeared to rely on epiphytic and detrital shielding and the shade provided by other seagrasses to reduce ultraviolet-B irradiation to tolerable levels. The presence of epiphytes on leaf surfaces was found to reduce the extent of photosynthetic inhibition from ultraviolet-B exposure in all species.Observations obtained in this study seem to suggest the possibility of anthocyanin and/or other flavonoid synthesis as an adaptation to long term ultraviolet-B irradiation by these species. In addition, Halophila appears to obtain an increased photosynthetic tolerance to ultraviolet-B as an indirect benefit of chloroplast clumping to avoid photo-oxidation by intense levels of photosynthetically active radiation.

  16. DEVELOPMENTAL CHANGES IN THE GERMINATION, GROWTH AND CHLOROPHYLLASE ACTIVITY OF VIGNA MUNGO L. USING SEAWEED EXTRACT OF ULVA RETICULATA FORSSKAL.

    OpenAIRE

    Ganapathy Selvam G.; Balamurugan M.; Thinakaran T.; Sivakumar K

    2013-01-01

    The effect of seaweed extract prepared from Ulva reticulata on seed germination, seedling growth and chlorophyllase activity of Vigna mungo L. was studied. 100% germination was recorded in the seeds treated with lower concentration of seaweed extract. The V. mungo seeds soaked with lower concentrations of the seaweed extracts showed higher rates of germination, while the higher concentrations of the extracts inhibited the germination.

  17. Method of inhibiting the onset of acute radiation syndrome and also inhibiting the onset of septicemia and a composition therefor

    Energy Technology Data Exchange (ETDEWEB)

    Ribi, E E

    1986-01-14

    A method is described for inhibiting the onset of acute radiation syndrome caused by the exposure of warm-blooded animals to a whole body dose of at least 100 rads of x-radiation. Also described is a method for inhibiting the onset of septicemia. The methods comprise administering to a warm-blooded animal an effective amount of a pharmaceutical preparation containing refined detoxified endotoxin in combination with a pharmaceutically acceptable carrier.

  18. Physiological and molecular characterization of cowpea [Vigna ...

    African Journals Online (AJOL)

    Diaga Diouf

    Cowpea, Vigna unguiculata (L.) Walp. presents phenotypical variabilities and in order to study the genetic diversity of cultivated Senegalese varieties, two experimental approaches were used. First, a physiological characterization based on nitrogen fixation was used to assess cowpea breeding lines. Inoculation with two ...

  19. Male sterile mutant in Vigna radiata

    International Nuclear Information System (INIS)

    Pande, Kalpana; Raghuvanshi, S.S.

    1987-01-01

    Single and combined treatment of γ-rays and 0.25 per cent EMS were tried on Vigna radiata variety K851. A male sterile mutant was isolated in M 2 generation. Experiments indicated male sterility to be recessive and monogenic in nature. 6 figures. (author)

  20. The inhibitory effect of metals and other ions on acid phosphatase activity from Vigna aconitifolia seeds.

    Science.gov (United States)

    Srivastava, Pramod Kumar; Anand, Asha

    2015-01-01

    Sensitivity of acid phosphatase from Vigna aconitifolia seeds to metal ions, fluoride, and phosphate was examined. All the effectors had different degree of inhibitory effect on the enzyme. Among metal ions, molybdate and ferric ion were observed to be most potent inhibitors and both exhibited mixed type of inhibition. Acid phosphatase activity was inhibited by Cu2+ in a noncompetitive manner. Zn and Mn showed mild inhibition on the enzyme activity. Inhibition kinetics analysis explored molybdate as a potent inhibitor for acid phosphatase in comparison with other effectors used in this study. Fluoride was the next most strong inhibitor for the enzyme activity, and caused a mixed type of inhibition. Phosphate inhibited the enzyme competitively, which demonstrates that inhibition due to phosphate is one of the regulatory factors for enzyme activity.

  1. Phylogenetic analysis of subgenus vigna species using nuclear ribosomal RNA ITS: evidence of hybridization among Vigna unguiculata subspecies.

    Science.gov (United States)

    Vijaykumar, Archana; Saini, Ajay; Jawali, Narendra

    2010-01-01

    Molecular phylogeny among species belonging to subgenus Vigna (genus Vigna) was inferred based on internal transcribed spacer (ITS) sequences of 18S-5.8S-26S ribosomal RNA gene unit. Analysis showed a total of 356 polymorphic sites of which approximately 80% were parsimony informative. Phylogenetic reconstruction by neighbor joining and maximum parsimony methods placed the 57 Vigna accessions (belonging to 15 species) into 5 major clades. Five species viz. Vigna heterophylla, Vigna pubigera, Vigna parkeri, Vigna laurentii, and Vigna gracilis whose position in the subgenus was previously not known were placed in the section Vigna. A single accession (Vigna unguiculata ssp. tenuis, NI 1637) harbored 2 intragenomic ITS variants, indicative of 2 different types of ribosomal DNA (rDNA) repeat units. ITS variant type-I was close to ITS from V. unguiculata ssp. pubescens, whereas type-II was close to V. unguiculata ssp. tenuis. Transcript analysis clearly demonstrates that in accession NI 1637, rDNA repeat units with only type-II ITS variants are transcriptionally active. Evidence from sequence analysis (of 5.8S, ITS1, and ITS2) and secondary structure analysis (of ITS1 and ITS2) indicates that the type-I ITS variant probably does not belong to the pseudogenic rDNA repeat units. The results from phylogenetic and transcript analysis suggest that the rDNA units with the type-I ITS may have introgressed as a result of hybridization (between ssp. tenuis and ssp. pubescens); however, it has been epigenetically silenced. The results also demonstrate differential evolution of ITS sequence among wild and cultivated forms of V. unguiculata.

  2. X-ray radiation and development inhibition of Helicoverpa armigera Hübner (Lepidoptera: Noctuidae)

    International Nuclear Information System (INIS)

    Kim, Junheon; Jung, Soon-Oh; Jang, Sin Ae; Kim, Jeongmin; Park, Chung Gyoo

    2015-01-01

    Effect of X-ray radiation on the development inhibition was evaluated for all stages of the life cycle of Helicoverpa armigera to determine a radiation dose for potential quarantine treatment against the insect. ED 99 values for inhibition of hatching, pupation, and adult emergence from irradiated eggs were 413, 210, and 154 Gy, respectively. ED 99 values for inhibition of pupation and adult emergence from irradiated larvae were 221 and 167 Gy, respectively. Pupa was the most tolerant to X-ray radiation. ED 99 value for inhibition of adult emergence from irradiated pupae was as high as 2310 Gy, whereas that for inhibition of F 1 egg hatching was only 66 Gy. ED 99 value for inhibition of hatching of F 1 eggs which were laid by irradiated adults was estimated to 194 Gy. X-ray irradiation against H. armigera is recommended as an alternative method to methyl bromide fumigation for phytosanitary treatments during quarantine. X-ray radiation dose of 200 Gy is proposed as a potential quarantine treatment dose for H. armigera eggs and larvae. - Highlights: • X-ray irradiation induced abnormal development of Helicoverpa armigera. • ED 99 value for inhibition of pupation and adult emergence of irradiated egg was estimated at 210 and 154 Gy, respectively. • ED 99 value for inhibition of pupation and adult emergence of irradiated larva was estimated at 221 and 167 Gy, respectively

  3. Inhibition of phosphatidylinositol-3-kinase causes increased sensitivity to radiation through a PKB-dependent mechanism

    International Nuclear Information System (INIS)

    Gottschalk, Alexander R.; Doan, Albert; Nakamura, Jean L.; Stokoe, David; Haas-Kogan, Daphne A.

    2005-01-01

    Purpose: To identify whether inhibition of phosphatidylinositol-3-kinase (PI3K) causes increased radiosensitivity through inhibition of protein kinase B (PKB), implicating PKB as an important therapeutic target in prostate cancer. Methods and Materials: The prostate cancer cell line LNCaP was treated with the PI3K inhibitor LY294002, radiation, and combinations of the two therapies. Apoptosis and survival were measured by cell cycle analysis, Western blot analysis for cleaved poly (ADP-ribose) polymerase, and clonogenic survival. To test the hypothesis that inhibition of PKB is responsible for LY294002-induced radiosensitivity, LNCaP cells expressing a constitutively active form of PKB were used. Results: The combination of PI3K inhibition and radiation caused an increase in apoptosis and a decrease in clonogenic survival when compared to either modality alone. The expression of constitutively activated PKB blocked apoptosis induced by combination of PI3K inhibition and radiation and prevented radiosensitization by LY294002. Conclusion: These data indicate that PI3K inhibition increases sensitivity of prostate cancer cell lines to ionizing radiation through inactivation of PKB. Therefore, PTEN mutations, which lead to PKB activation, may play an important role in the resistance of prostate cancer to radiation therapy. Targeted therapy against PKB could be beneficial in the management of prostate cancer patients

  4. Inhibition of radiation-induced polyuria by histamine receptor antagonists

    Energy Technology Data Exchange (ETDEWEB)

    Donlon, M.A.; Melia, J.A.; Helgeson, E.A.; Wolfe, W.W.

    1986-03-01

    In previous studies the authors have demonstrated that gamma radiation results in polyuria, which is preceded by polydypsia. This suggests that the increased thirst elicited by radiation causes increased urinary volume (UV). Histamine, which is released following radiation exposure, also elicits drinking by nonirradiated rats when administered exogenously. In this study the authors have investigated both the role of water deprivation and the effect of histamine receptor antagonists (HRA) on radiation-induced polyuria. Sprague-Dawley rats were housed individually in metabolic cages. Water was allowed ad libitum except in deprivation experiments where water was removed for 24 hr immediately following radiation. Cimetidine (CIM), an H2 HRA, and dexbromopheniramine (DXB), an H1 HRA, were administered i.p. (16 and 1 mg/kg, respectively) 30 min prior to irradiation (950 rads from a cobalt source). UV was determined at 24-hr intervals for 3 days preceding irradiation and 24 hr postirradiation. UV in DXB treated rats was significantly reduced 24 hr postirradiation (CON = 427 +/- 54%; DXB = 247 +/- 39% of preirradiated CON) compared to postirradiation control values. CIM did not affect postirradiation UV. These data suggest that radiation-induced polyuria is caused by polydypsia which is, in part, mediated by histamine induced by an H1 receptor.

  5. Inhibition of radiation-induced polyuria by histamine receptor antagonists

    International Nuclear Information System (INIS)

    Donlon, M.A.; Melia, J.A.; Helgeson, E.A.; Wolfe, W.W.

    1986-01-01

    In previous studies the authors have demonstrated that gamma radiation results in polyuria, which is preceded by polydypsia. This suggests that the increased thirst elicited by radiation causes increased urinary volume (UV). Histamine, which is released following radiation exposure, also elicits drinking by nonirradiated rats when administered exogenously. In this study the authors have investigated both the role of water deprivation and the effect of histamine receptor antagonists (HRA) on radiation-induced polyuria. Sprague-Dawley rats were housed individually in metabolic cages. Water was allowed ad libitum except in deprivation experiments where water was removed for 24 hr immediately following radiation. Cimetidine (CIM), an H2 HRA, and dexbromopheniramine (DXB), an H1 HRA, were administered i.p. (16 and 1 mg/kg, respectively) 30 min prior to irradiation (950 rads from a cobalt source). UV was determined at 24-hr intervals for 3 days preceding irradiation and 24 hr postirradiation. UV in DXB treated rats was significantly reduced 24 hr postirradiation (CON = 427 +/- 54%; DXB = 247 +/- 39% of preirradiated CON) compared to postirradiation control values. CIM did not affect postirradiation UV. These data suggest that radiation-induced polyuria is caused by polydypsia which is, in part, mediated by histamine induced by an H1 receptor

  6. Effects of smoke and tea on radiation-induced bone marrow cell mutation and marrow inhibition

    International Nuclear Information System (INIS)

    Gao Yong; Zhang Weiguang

    2004-01-01

    Objective: To provide scientific information for the prevention and treatment of the radiation damage by analyzing the effects of smoke and tea on radiation-induced bone marrow cell mutation and marrow inhibition. Methods: 7 group mice were exposed to smoke and/or tea and/or radiation respectively. There were also b blank control group and a cyclophosphamide positive control group. The frequencies of micronucleated polychromatic erythrocytes (MPCE), the ratio of polychromatic erythrocytes (PCE) to mature erythrocytes (RBC) in marrow, and the count of peripheral blood hemoleukocyte were observed. Results: The frequencies of MPCE in the groups irradiated with γ-rays were significantly higher than that in the blank control group (P<0.05 or 0.01). The smoke + radiation group's frequency was significantly higher than single radiation group (P<0.05). The ratios of PCE to RBC in the groups irradiated were significantly lower than that in the blank control group (P<0.01). The counts of peripheral blood hemoleukocyte in the groups irradiated were significantly lower than the blank control group (P<0.01). Conclusion: Radiation were able to cause marrow cell mutation and induce marrow inhibition. Smoke increases the effect of radiation-induced marrow cell mutation. Tea and smoke could not affect radiation-induced bone marrow inhibition

  7. Inhibition of photosystem II by UV-B-radiation

    International Nuclear Information System (INIS)

    Tevini, M.; Pfister, K.

    1985-01-01

    The effect of UV-B-radiation on PSII activity of spinach chloroplasts was analyzed by measuring the integrity of the herbicide-binding protein (HBP 32), by measurement of fluorescence induction in the presence of Diuron (DCMU), and by mathematical analysis of the fluorescence induction curves. It was shown that UV-B inactivates the PSII α-centers but not PSII β-centers. However, the possibility cannot be excluded that in addition the donor site of PSII near the reaction center is attacked by UV-B-radiation. (orig.)

  8. Transgene expression in cowpea ( Vigna unguiculata (L.) Walp ...

    African Journals Online (AJOL)

    Transgene expression in cowpea ( Vigna unguiculata (L.) Walp.) ... and Bar genes for β-glucuronidase expression and bialaphos resistance respectively. ... expression also showed positive signals under PCR and Southern analysis giving ...

  9. Pollination and yield responses of cowpea (Vigna unguiculata L ...

    African Journals Online (AJOL)

    STORAGESEVER

    2009-05-04

    May 4, 2009 ... Key words: Apis mellifera adansonii, Vigna unguiculata, bee plant, foraging, pollination, increased yield. INTRODUCTION. There are ... several techniques such as fire-prone, crop rotations, ..... Inventory of melliferous plants.

  10. Genetic analysis of Myanmar Vigna species in responses to salt ...

    African Journals Online (AJOL)

    Genetic analysis of Myanmar Vigna species in responses to salt stress at the ... of reduction was highly dependent on different genotypes and salinity levels. ... the mechanism of salt tolerance and for the provision of genetic resources for ...

  11. survey of the symptoms and viruses associated with cowpea (vigna

    African Journals Online (AJOL)

    Osondu

    2012-10-29

    Oct 29, 2012 ... of the prevalence of virus disease symptoms and to specifically identify the viruses infecting cowpea. (Vigna unguiculata . ... 1Department of Crop Protection, Faculty of Agriculture,. University of ..... emerging viruses. This will ...

  12. Gimeracil sensitizes cells to radiation via inhibition of homologous recombination

    International Nuclear Information System (INIS)

    Takagi, Masaru; Sakata, Koh-ichi; Someya, Masanori; Tauchi, Hiroshi; Iijima, Kenta; Matsumoto, Yoshihisa; Torigoe, Toshihiko; Takahashi, Akari; Hareyama, Masato; Fukushima, Masakazu

    2010-01-01

    Background and purpose: 5-Chloro-2,4-dihydroxypyridine (Gimeracil) is a component of an oral fluoropyrimidine derivative S-1. Gimeracil is originally added to S-1 to yield prolonged 5-FU concentrations in tumor tissues by inhibiting dihydropyrimidine dehydrogenase, which degrades 5-FU. We found that Gimeracil by itself had the radiosensitizing effect. Methods and materials: We used various cell lines deficient in non-homologous end-joining (NHEJ) or homologous recombination (HR) as well as DLD-1 and HeLa in clonogenic assay. γ-H2AX focus formation and SCneo assay was performed to examine the effects of Gimeracil on DNA double strand break (DSB) repair mechanisms. Results: Results of γ-H2AX focus assay indicated that Gimeracil inhibited DNA DSB repair. It did not sensitize cells deficient in HR but sensitized those deficient in NHEJ. In SCneo assay, Gimeracil reduced the frequency of neo-positive clones. Additionally, it sensitized the cells in S-phase more than in G0/G1. Conclusions: Gimeracil inhibits HR. Because HR plays key roles in the repair of DSBH caused by radiotherapy, Gimeracil may enhance the efficacy of radiotherapy through the suppression of HR-mediated DNA repair pathways.

  13. The Addition of Manganese Porphyrins during Radiation Inhibits Prostate Cancer Growth and Simultaneously Protects Normal Prostate Tissue from Radiation Damage

    Directory of Open Access Journals (Sweden)

    Arpita Chatterjee

    2018-01-01

    Full Text Available Radiation therapy is commonly used for prostate cancer treatment; however, normal tissues can be damaged from the reactive oxygen species (ROS produced by radiation. In separate reports, we and others have shown that manganese porphyrins (MnPs, ROS scavengers, protect normal cells from radiation-induced damage but inhibit prostate cancer cell growth. However, there have been no studies demonstrating that MnPs protect normal tissues, while inhibiting tumor growth in the same model. LNCaP or PC3 cells were orthotopically implanted into athymic mice and treated with radiation (2 Gy, for 5 consecutive days in the presence or absence of MnPs. With radiation, MnPs enhanced overall life expectancy and significantly decreased the average tumor volume, as compared to the radiated alone group. MnPs enhanced lipid oxidation in tumor cells but reduced oxidative damage to normal prostate tissue adjacent to the prostate tumor in combination with radiation. Mechanistically, MnPs behave as pro-oxidants or antioxidants depending on the level of oxidative stress inside the treated cell. We found that MnPs act as pro-oxidants in prostate cancer cells, while in normal cells and tissues the MnPs act as antioxidants. For the first time, in the same in vivo model, this study reveals that MnPs enhance the tumoricidal effect of radiation and reduce oxidative damage to normal prostate tissue adjacent to the prostate tumor in the presence of radiation. This study suggests that MnPs are effective radio-protectors for radiation-mediated prostate cancer treatment.

  14. A systemic administration of liposomal curcumin inhibits radiation pneumonitis and sensitizes lung carcinoma to radiation

    Directory of Open Access Journals (Sweden)

    Shi HS

    2012-05-01

    Full Text Available Hua-shan Shi1,* Xiang Gao,1,3,* Dan Li,1,* Qiong-wen Zhang,1 Yong-sheng Wang,2 Yu Zheng,1 Lu-Lu Cai,1 Ren-ming Zhong,2 Ao Rui,1 Zhi-yong Li,1 Hao Zheng,1 Xian-cheng Chen,1 Li-juan Chen,11State Key Laboratory of Biotherapy and Cancer Center, West China Hospital, West China Medicine School, Sichuan University, Chengdu, Sichuan, People's Republic of China; 2State Key Laboratory of Biotherapy and Department of Thoracic Oncology, West China Hospital, West China Medical School, Sichuan University, Chengdu, Sichuan, People's Republic of China; 3Deparment of Pathophysiology, College of Preclinical and Forensic Medical Sciences, Sichuan University, Chengdu, People's Republic of China*These authors contributed equally to this workAbstract: Radiation pneumonitis (RP is an important dose-limiting toxicity during thoracic radiotherapy. Previous investigations have shown that curcumin is used for the treatment of inflammatory conditions and cancer, suggesting that curcumin may prevent RP and sensitize cancer cells to irradiation. However, the clinical advancement of curcumin is limited by its poor water solubility and low bioavailability after oral administration. Here, a water-soluble liposomal curcumin system was developed to investigate its prevention and sensitizing effects by an intravenous administration manner in mice models. The results showed that liposomal curcumin inhibited nuclear factor-κB pathway and downregulated inflammatory factors including tumor necrosis factor-α, interleukin (IL-6, IL-8, and transforming growth factor-β induced by thoracic irradiation. Furthermore, the combined treatment with liposomal curcumin and radiotherapy increased intratumoral apoptosis and microvessel responses to irradiation in vivo. The significantly enhanced inhibition of tumor growth also was observed in a murine lung carcinoma (LL/2 model. There were no obvious toxicities observed in mice. The current results indicate that liposomal curcumin can effectively

  15. Inhibition of autophagy induced by TSA sensitizes colon cancer cell to radiation.

    Science.gov (United States)

    He, Gang; Wang, Yan; Pang, Xueli; Zhang, Bo

    2014-02-01

    Radiotherapy is one of the main treatments for clinical cancer therapy. However, its application was limited due to lack of radiosensitivity in some cancers. Trichostatin A (TSA) is a classic histone deacetylases inhibitor (HDACi) that specifically inhibits the biochemical functions of HDAC and is demonstrated to be an active anticancer drug. However, whether it could sensitize colon cancer to radiation is not clear. Our results showed that TSA enhanced the radiosensitivity of colon cancer cells as determined by CCK-8 and clonogenic survival assay. Moreover, apoptotic cell death induced by radiation was enhanced by TSA treatment. Additionally, TSA also induced autophagic response in colon cancer cells, while autophagy inhibition led to cell apoptosis and enhanced the radiosensitivity of colon cancer cells. Our data suggested that inhibition of cytoprotective autophagy sensitizes cancer cell to radiation, which might be further investigated for clinical cancer radiotherapy.

  16. Inhibition of radiation-induced lipid peroxidation by means of gallic polydisulphide

    International Nuclear Information System (INIS)

    Losev, Yu.P.; Amadyan, M.G.; Oganesyan, N.M.; Fedulov, A.S.; Abramyan, A.K.; Shagoyan, A.G.; Khachkavanktsyan, A.S.

    1999-01-01

    Inhibition of radiation-induced lipid peroxidation by means of gallic polydisulphade has been studied. Rats were exposed to X-rays in doses 4,8 and 5,25 Gy. Lipid peroxidation was analysed in blood plasma, membranes of erythrocytes and homogenates of liver and spleen tissues of rats. Polydisulphide of gallic acid was used as inhibitor of lipid peroxidation because of its effective antioxidant properties as have been reported previously. It has been demonstrated that gallic disulphide exhibited high inhibition efficiency in conditions of radiation-induced lipid peroxidation due to the effect of intra-molecular synergism

  17. Chemical inhibition of cell recovery after irradiation with sparsely and densely ionizing radiation

    Energy Technology Data Exchange (ETDEWEB)

    Evastratova, Ekaterina S.; Petin, Vladislav [A. Tsyb Medical Radiological Research Centre-branch of the National Medical Research Radiological Centre of the Ministry of Health of the Russian Federation, Obninsk (Russian Federation); Kim, Jin Hong; Kim, Jin Kyu [Korea Atomic Energy Research Institute, Advanced Radiation Technology Institute (ARTI), Jeongeup (Korea, Republic of); Lim, Youg Khi [Dept. of Radiological Science, Gachon University, Incheon (Korea, Republic of)

    2017-02-15

    The dependence of cell survival on exposure dose and the duration of the liquid holding recovery (LHR) was obtained for diploid yeast cells irradiated with ionizing radiation of different linear energy transfer (LET) and recovering from radiation damage without and with various concentrations of cisplatin - the most widely used anticancer drug. The ability of yeast cells to recover from radiation damage was less effective after cell exposure to high-LET radiation, when cells were irradiated without drug. The increase in cisplatin concentration resulted in the disappearance of this difference whereas the fraction of irreversible damage was permanently enlarged independently of radiation quality. The probability of cell recovery was shown to be constant for various conditions of irradiation and recovery. A new mechanism of cisplatin action was suggested according with which the inhibition of cell recovery after exposure to ionizing radiations was completely explained by the production of irreversible damage.

  18. Chemical inhibition of cell recovery after irradiation with sparsely and densely ionizing radiation

    International Nuclear Information System (INIS)

    Evastratova, Ekaterina S.; Petin, Vladislav; Kim, Jin Hong; Kim, Jin Kyu; Lim, Youg Khi

    2017-01-01

    The dependence of cell survival on exposure dose and the duration of the liquid holding recovery (LHR) was obtained for diploid yeast cells irradiated with ionizing radiation of different linear energy transfer (LET) and recovering from radiation damage without and with various concentrations of cisplatin - the most widely used anticancer drug. The ability of yeast cells to recover from radiation damage was less effective after cell exposure to high-LET radiation, when cells were irradiated without drug. The increase in cisplatin concentration resulted in the disappearance of this difference whereas the fraction of irreversible damage was permanently enlarged independently of radiation quality. The probability of cell recovery was shown to be constant for various conditions of irradiation and recovery. A new mechanism of cisplatin action was suggested according with which the inhibition of cell recovery after exposure to ionizing radiations was completely explained by the production of irreversible damage

  19. Partial inhibition of in vitro pollen germination by simulated solar ultraviolet-B radiation

    International Nuclear Information System (INIS)

    Flint, S.D.; Caldwell, M.M.

    1984-01-01

    Pollen from four temperate-latitude taxa were treated with UV radiation in a portion of the UV-B (280-320 nm) waveband during in vitro germination. Inhibition of germination was noted in this pollen compared to samples treated identically except for the exclusion of the UV-B portion of the spectrum. Levels similar to maximum solar UV-B found in temperate-latitude areas failed to inhibit pollen germination significantly, while levels similar to maximum solar UV-B found in equatorial alpine locations caused partial inhibition of germination in three of the four taxa examined

  20. Effects of ceramide inhibition on radiation-induced apoptosis in human leukemia MOLT-4 cells

    Energy Technology Data Exchange (ETDEWEB)

    Takahashi, Eriko; Inanami, Osamu; Asanuma, Taketoshi; Kuwabara, Mikinori [Hokkaido Univ., Graduate School of Veterinary Medicine, Sapporo, Hokkaido (Japan)

    2006-03-15

    In the present study, using inhibitors of ceramide synthase (fumonisin B{sub 1}), ketosphinganine synthetase (L-cycloserine), acid sphingomyelinase (D609 and desipramine) and neutral sphingomyelinase (GW4869), the role of ceramide in X-ray-induced apoptosis was investigated in MOLT-4 cells. The diacylglycerol kinase (DGK) assay showed that the intracellular concentration of ceramide increased time-dependently after X irradiation of cells, and this radiation-induced accumulation of ceramide did not occur prior to the appearance of apoptotic cells. Treatment with D609 significantly inhibited radiation-induced apoptosis, but did not inhibit the increase of intracellular ceramide. Treatment with desipramine or GW4869 prevented neither radiation-induced apoptosis nor the induced increase of ceramide. On the other hand, fumonisin B{sub 1} and L-cycloserine had no effect on the radiation-induced induction of apoptosis, in spite of significant inhibition of the radiation-induced ceramide. From these results, it was suggested that the increase of the intracellular concentration of ceramide was not essential for radiation-induced apoptosis in MOLT-4 cells. (author)

  1. Effects of ceramide inhibition on radiation-induced apoptosis in human leukemia MOLT-4 cells

    International Nuclear Information System (INIS)

    Takahashi, Eriko; Inanami, Osamu; Asanuma, Taketoshi; Kuwabara, Mikinori

    2006-01-01

    In the present study, using inhibitors of ceramide synthase (fumonisin B 1 ), ketosphinganine synthetase (L-cycloserine), acid sphingomyelinase (D609 and desipramine) and neutral sphingomyelinase (GW4869), the role of ceramide in X-ray-induced apoptosis was investigated in MOLT-4 cells. The diacylglycerol kinase (DGK) assay showed that the intracellular concentration of ceramide increased time-dependently after X irradiation of cells, and this radiation-induced accumulation of ceramide did not occur prior to the appearance of apoptotic cells. Treatment with D609 significantly inhibited radiation-induced apoptosis, but did not inhibit the increase of intracellular ceramide. Treatment with desipramine or GW4869 prevented neither radiation-induced apoptosis nor the induced increase of ceramide. On the other hand, fumonisin B 1 and L-cycloserine had no effect on the radiation-induced induction of apoptosis, in spite of significant inhibition of the radiation-induced ceramide. From these results, it was suggested that the increase of the intracellular concentration of ceramide was not essential for radiation-induced apoptosis in MOLT-4 cells. (author)

  2. VU-B radiation inhibits the photosynthetic electron transport chain in chlamydomonas reinhardtii

    International Nuclear Information System (INIS)

    Cai, W.; Li, X.; Chen, L.

    2016-01-01

    UV radiation of sunlight is one of harmful factors for earth organisms, especially for photoautotrophs because they require light for energy and biomass production. A number of works have already been done regarding the effects of UV-B radiation at biochemical and molecular level, which showed that UV-B radiation could inhibit photosynthesis activity and reduce photosynthetic electron transport. However quite limited information can accurately make out inhibition site of UV-B radiation on photosynthetic electron transport. In this study, this issue was investigated through measuring oxygen evolution activity, chlorophyll a fluorescence and gene expression in a model unicellular green alga Chlamydomonas reinhardtii. Our results indicated that UV-B radiation could evidently decrease photosynthesis activity and inhibit electron transport by blocking electron transfer process from the first plastoquinone electron acceptors QA to second plastoquinone electron acceptors QB, but not impair electron transfer from the water oxidizing complex to QA. The psbA gene expression was also altered by UV-B radiation, where up-regulation occurred at 2, 4 and 6h after exposure and down-regulation happened at 12 and 24 h after exposure. These results suggested that UV-B could affects D1 protein normal turnover, so there was not enough D1 for binding with QB, which may affect photosynthetic electron transport and photosynthesis activity. (author)

  3. Effects of epidermal growth factor receptor kinase inhibition on radiation response in canine osteosarcoma cells.

    Science.gov (United States)

    Mantovani, Fernanda B; Morrison, Jodi A; Mutsaers, Anthony J

    2016-05-31

    Radiation therapy is a palliative treatment modality for canine osteosarcoma, with transient improvement in analgesia observed in many cases. However there is room for improvement in outcome for these patients. It is possible that the addition of sensitizing agents may increase tumor response to radiation therapy and prolong quality of life. Epidermal growth factor receptor (EGFR) expression has been documented in canine osteosarcoma and higher EGFR levels have been correlated to a worse prognosis. However, effects of EGFR inhibition on radiation responsiveness in canine osteosarcoma have not been previously characterized. This study examined the effects of the small molecule EGFR inhibitor erlotinib on canine osteosarcoma radiation responses, target and downstream protein expression in vitro. Additionally, to assess the potential impact of treatment on tumor angiogenesis, vascular endothelial growth factor (VEGF) levels in conditioned media were measured. Erlotinib as a single agent reduced clonogenic survival in two canine osteosarcoma cell lines and enhanced the impact of radiation in one out of three cell lines investigated. In cell viability assays, erlotinib enhanced radiation effects and demonstrated single agent effects. Erlotinib did not alter total levels of EGFR, nor inhibit downstream protein kinase B (PKB/Akt) activation. On the contrary, erlotinib treatment increased phosphorylated Akt in these osteosarcoma cell lines. VEGF levels in conditioned media increased after erlotinib treatment as a single agent and in combination with radiation in two out of three cell lines investigated. However, VEGF levels decreased with erlotinib treatment in the third cell line. Erlotinib treatment promoted modest enhancement of radiation effects in canine osteosarcoma cells, and possessed activity as a single agent in some cell lines, indicating a potential role for EGFR inhibition in the treatment of a subset of osteosarcoma patients. The relative radioresistance of

  4. Inhibition of Protease-activated Receptor 1 Ameliorates Intestinal Radiation Mucositis in a Preclinical Rat Model

    Energy Technology Data Exchange (ETDEWEB)

    Wang, Junru; Kulkarni, Ashwini [Division of Radiation Health, University of Arkansas for Medical Sciences, Little Rock, Arkansas (United States); Chintala, Madhu [Schering-Plough Research Institute, Kenilworth, New Jersey (United States); Fink, Louis M. [Nevada Cancer Institute, Las Vegas, Nevada (United States); Hauer-Jensen, Martin, E-mail: mhjensen@life.uams.edu [Division of Radiation Health, University of Arkansas for Medical Sciences, Little Rock, Arkansas (United States); Surgery Service, Central Arkansas Veterans Healthcare System, Little Rock, Arkansas (United States)

    2013-01-01

    Purpose: To determine, using a specific small-molecule inhibitor of protease-activated receptor 1 (PAR1) signaling, whether the beneficial effect of thrombin inhibition on radiation enteropathy development is due to inhibition of blood clotting or to cellular (PAR1-mediated) thrombin effects. Methods and Materials: Rats underwent fractionated X-irradiation (5 Gy Multiplication-Sign 9) of a 4-cm small-bowel segment. Early radiation toxicity was evaluated in rats receiving PAR1 inhibitor (SCH602539, 0, 10, or 15 mg/kg/d) from 1 day before to 2 weeks after the end of irradiation. The effect of PAR1 inhibition on development of chronic intestinal radiation fibrosis was evaluated in animals receiving SCH602539 (0, 15, or 30 mg/kg/d) until 2 weeks after irradiation, or continuously until termination of the experiment 26 weeks after irradiation. Results: Blockade of PAR1 ameliorated early intestinal toxicity, with reduced overall intestinal radiation injury (P=.002), number of myeloperoxidase-positive (P=.03) and proliferating cell nuclear antigen-positive (P=.04) cells, and collagen III accumulation (P=.005). In contrast, there was no difference in delayed radiation enteropathy in either the 2- or 26-week administration groups. Conclusion: Pharmacological blockade of PAR1 seems to reduce early radiation mucositis but does not affect the level of delayed intestinal radiation fibrosis. Early radiation enteropathy is related to activation of cellular thrombin receptors, whereas platelet activation or fibrin formation may play a greater role in the development of delayed toxicity. Because of the favorable side-effect profile, PAR1 blockade should be further explored as a method to ameliorate acute intestinal radiation toxicity in patients undergoing radiotherapy for cancer and to protect first responders and rescue personnel in radiologic/nuclear emergencies.

  5. Changes in peroxidases associated with radiation-induced sprout inhibition in garlic (Allium sativum L.)

    International Nuclear Information System (INIS)

    Croci, C.A.; Curvetto, N.R.; Orioli, G.A.; Arguello, J.A.

    1991-01-01

    The effects of an acute dose of γ-rays (10 Gy) to post-dormant garlic cloves on inner sprout growth and changes in peroxidases and soluble proteins were evaluated up to 100 days of storage in darkness at 19±1 0 C and 42±2% relative humidity. Radiation-induced inhibition of sprout growth became evident after 25 days of treatment and was synchronous with a marked increase in peroxidase activity. Thin-layer isoelectric focusing revealed that radiation induced an increase in the number of anodic peroxidase isoenzymes at 100 days, suggesting modifications in the vascularization process. Neither the soluble protein content nor the protein pattern were affected by irradiation. These results are discussed in terms of a possible mediating effect of peroxidase on radiation-induced sprout inhibition in garlic. (author)

  6. Changes in peroxidases associated with radiation-induced sprout inhibition in garlic (Allium sativum L. )

    Energy Technology Data Exchange (ETDEWEB)

    Croci, C.A.; Curvetto, N.R.; Orioli, G.A. (Universidad Nacional del Sur, Bahia Blanca (Argentina)); Arguello, J.A. (Universidad Nacional de Cordoba (Argentina). Dept. de Biologia Aplicada)

    1991-02-01

    The effects of an acute dose of {gamma}-rays (10 Gy) to post-dormant garlic cloves on inner sprout growth and changes in peroxidases and soluble proteins were evaluated up to 100 days of storage in darkness at 19+-1{sup 0}C and 42+-2% relative humidity. Radiation-induced inhibition of sprout growth became evident after 25 days of treatment and was synchronous with a marked increase in peroxidase activity. Thin-layer isoelectric focusing revealed that radiation induced an increase in the number of anodic peroxidase isoenzymes at 100 days, suggesting modifications in the vascularization process. Neither the soluble protein content nor the protein pattern were affected by irradiation. These results are discussed in terms of a possible mediating effect of peroxidase on radiation-induced sprout inhibition in garlic. (author).

  7. Improvement of the antioxidant and hypolipidaemic effects of cowpea flours (Vigna unguiculata) by fermentation: results of in vitro and in vivo experiments.

    Science.gov (United States)

    Kapravelou, Garyfallia; Martínez, Rosario; Andrade, Ana M; López Chaves, Carlos; López-Jurado, María; Aranda, Pilar; Arrebola, Francisco; Cañizares, Francisco J; Galisteo, Milagros; Porres, Jesús M

    2015-04-01

    The antioxidant capacity and hypolipidaemic effects of Vigna unguiculata, as well as their potential improvement by different fermentation and thermal processes were studied using in vitro and in vivo methods. Phenolic content and reducing capacity of legume acetone extract were significantly increased by different fermentation processes, and by the thermal treatment of fermented legume flours. TBARS inhibiting capacity was increased by fermentation but not by thermal treatment. A higher ability to decrease Cu(2+)/H2O2-induced electrophoretic mobility of LDL was found in fermented when compared to raw legume extracts, and a higher protective effect on short term metabolic status of HT-29 cells was found for raw and lactobacillus-fermented Vigna followed by naturally fermented Vigna extracts. Significant improvements in plasma antioxidant capacity and hepatic activity of antioxidant enzymes were observed in rats that consumed fermented legume flours when compared to the untreated legume or a casein-methionine control diet. In addition, liver weight and plasma levels of cholesterol and triglycerides were also positively affected by untreated or naturally fermented Vigna. V. unguiculata has demonstrated its potential as a functional food with interesting antioxidant and lipid lowering properties, which can be further augmented by fermentation processes associated or not to thermal processing. © 2014 Society of Chemical Industry.

  8. Enhancement of Radiation Response in Osteosarcoma and Rhabomyosarcoma Cell Lines by Histone Deacetylase Inhibition

    International Nuclear Information System (INIS)

    Blattmann, Claudia; Oertel, Susanne; Ehemann, Volker

    2010-01-01

    Purpose: Histone deacetylase inhibitors (HDACIs) can enhance the sensitivity of cells to photon radiation treatment (XRT) by altering numerous molecular pathways. We investigated the effect of pan-HDACIs such as suberoylanilide hydroxamic acid (SAHA) on radiation response in two osteosarcoma (OS) and two rhabdomyosarcoma (RMS) cell lines. Methods and Materials: Clonogenic survival, cell cycle analysis, and apoptosis were examined in OS (KHOS-24OS, SAOS2) and RMS (A-204, RD) cell lines treated with HDACI and HDACI plus XRT, respectively. Protein expression was investigated via immunoblot analysis, and cell cycle analysis and measurement of apoptosis were performed using flow cytometry. Results: SAHA induced an inhibition of cell proliferation and clonogenic survival in OS and RMS cell lines and led to a significant radiosensitization of all tumor cell lines. Other HDACI such as M344 and valproate showed similar effects as investigated in one OS cell line. Furthermore, SAHA significantly increased radiation-induced apoptosis in the OS cell lines, whereas in the RMS cell lines radiation-induced apoptosis was insignificant with and without SAHA. In all investigated sarcoma cell lines, SAHA attenuated radiation-induced DNA repair protein expression (Rad51, Ku80). Conclusion: Our results show that HDACIs enhance radiation action in OS and RMS cell lines. Inhibition of DNA repair, as well as increased apoptosis induction after exposure to HDACIs, can be mechanisms of radiosensitization by HDACIs.

  9. First Report of Cucumber mosaic virus Isolated from Wild Vigna angularis var. nipponensis in Korea

    Directory of Open Access Journals (Sweden)

    Mi-Kyeong Kim

    2014-06-01

    Full Text Available A viral disease causing severe mosaic, necrotic, and yellow symptoms on Vigna angularis var. nipponensis was prevalent around Suwon area in Korea. The causal virus was characterized as Cucumber mosaic virus (CMV on the basis of biological and nucleotide sequence properties of RNAs 1, 2 and 3 and named as CMV-wVa. CMV-wVa isolate caused mosaic symptoms on indicator plants, Nicotiana tabacum cv. Xanthi-nc, Petunia hybrida, and Cucumis sativus. Strikingly, CMV-wVa induced severe mosaic and malformation on Cucurbita pepo, and Solanum lycopersicum. Moreover, it caused necrotic or mosaic symptoms on V. angularis and V. radiate of Fabaceae. Symptoms of necrotic local or pin point were observed on inoculated leaves of V. unguiculata, Vicia fava, Pisum sativum and Phaseolus vulgaris. However, CMV-wVa isolate failed to infect in Glycine max cvs. ‘Sorok’, ‘Sodam’ and ‘Somyeong’. To assess genetic variation between CMV-wVa and the other known CMV isolates, phylogenetic analysis using 16 complete nucleotide sequences of CMV RNA1, RNA2, and RNA3 including CMV-wVa was performed. CMV-wVa was more closely related to CMV isolates belonging to CMV subgroup I showing about 85.1–100% nucleotide sequences identity to those of subgroup I isolates. This is the first report of CMV as the causal virus infecting wild Vigna angularis var. nipponensis in Korea.

  10. Effect of superoxide dismutase and catalase on radiation-induced inhibition of human lymphocyte blastogenesis

    International Nuclear Information System (INIS)

    Knox, S.; Misra, H.P.; Rosenblatt, L.S.; Shifrine, M.

    1980-01-01

    Mitogen-induced lymphocyte blastogenesis was measured following x-irradiation (0 to 400 R) in the presence or absence of SOD, under aerobic or anaerobic conditions. No significant differences were observed between radiation survival curves under these different conditions. SOD had no radioprotective effect, and an o.e.r. of 1.11 was obtained, demonstrating the lack of oxygen dependence of radiation-induced inhibition of lymphocyte blastogenesis. Following x-irradiation at 200 R, neither SOD nor catalase, alone or together, added before or after irradiation, was radioprotective

  11. Growth of antarctic cyanobacteria under ultraviolet radiation: UVA counteracts UVB inhibition

    International Nuclear Information System (INIS)

    Quesada, A.; Mouget, J.L.; Vincent, W.F.

    1995-01-01

    A mat-forming cyanobacterium (Phormidium murayi West and West) isolated from an ice-shelf pond in Antarctica was grown under white light combined with a range of UVA and UVB irradiance. The 4-day growth rate decreased under increasing ultraviolet (UV) radiation, with a ninefold greater response to UVB relative to UVA. In vivo absorbance spectra showed that UVA and to a greater extent UVB caused a decrease in phycocyanin/chlorophyll a and an increase in carotenoids/chlorophyll a. The phycocyanin/chlorophyll a ratio was closely and positively correlated to the UVB-inhibited growth rate. Under fixed spectral gradients of UV radiation, the growth inhibition effect was dominated by UVB. However, at specific UVB irradiances the inhibition of growth depended on the ratio of UVB to UVA, and growth rates increased linearly with increasing UVA. These results are consistent with the view that UVB inhibition represents the balance between damage and repair processes that are each controlled by separate wavebands. They also underscore the need to consider UV spectral balance in laboratory and field assays of UVB toxicity. 49 refs., 6 figs

  12. Coniferyl aldehyde attenuates radiation enteropathy by inhibiting cell death and promoting endothelial cell function.

    Science.gov (United States)

    Jeong, Ye-Ji; Jung, Myung Gu; Son, Yeonghoon; Jang, Jun-Ho; Lee, Yoon-Jin; Kim, Sung-Ho; Ko, Young-Gyo; Lee, Yun-Sil; Lee, Hae-June

    2015-01-01

    Radiation enteropathy is a common complication in cancer patients. The aim of this study was to investigate whether radiation-induced intestinal injury could be alleviated by coniferyl aldehyde (CA), an HSF1-inducing agent that increases cellular HSP70 expression. We systemically administered CA to mice with radiation enteropathy following abdominal irradiation (IR) to demonstrate the protective effects of CA against radiation-induced gastrointestinal injury. CA clearly alleviated acute radiation-induced intestinal damage, as reflected by the histopathological data and it also attenuated sub-acute enteritis. CA prevented intestinal crypt cell death and protected the microvasculature in the lamina propria during the acute and sub-acute phases of damage. CA induced HSF1 and HSP70 expression in both intestinal epithelial cells and endothelial cells in vitro. Additionally, CA protected against not only the apoptotic cell death of both endothelial and epithelial cells but also the loss of endothelial cell function following IR, indicating that CA has beneficial effects on the intestine. Our results provide novel insight into the effects of CA and suggest its role as a therapeutic candidate for radiation-induced enteropathy due to its ability to promote rapid re-proliferation of the intestinal epithelium by the synergic effects of the inhibition of cell death and the promotion of endothelial cell function.

  13. Inhibition of gastric secretion in guinea pig by relatively low dose ionizing radiation

    International Nuclear Information System (INIS)

    Batzri, S.; Catravas, G.

    1988-01-01

    We evaluated the effect of a single dose of ionizing radiation on gastric secretion in awake guinea pigs equipped with a permanent gastric cannula. Changes in gastric secretion were measured using a dye dilution technique. Infusion of histamine increased acid and fluid output and there was a positive correlation (r = 0.93) between the two. Total body irradiation with 400 cGy, like cimetidine, suppressed acid and fluid secretion under basal conditions and during histamine stimulation by 50-90%. Recovery from the radiation damage was only partial after one week. Irradiation inhibited the rise in gastric juice volume during histamine stimulation and also reduced the normal gain in body weight of the guinea pig. These results demonstrate that ionizing radiations have an immediate and long lasting effects on the gastric mucosal function of the guinea pig

  14. Effectiveness and efficiency of chemical mutagens in cowpea (Vigna ...

    African Journals Online (AJOL)

    STORAGESEVER

    2008-11-19

    Nov 19, 2008 ... A study was undertaken in a cowpea (Vigna unguiculata (L.) Walp.) variety CO 6 to assess the efficiency and effectiveness of chemical mutagens; ethyl methane sulphonate (EMS), diethyl sulphate (DES) and sodium azide (SA). EMS treatments were found highly effective than the other chemicals.

  15. Pollination and yield responses of cowpea ( Vigna unguiculata L ...

    African Journals Online (AJOL)

    To determine the apicultural value of Vigna unguiculata (L.) Walp. (Fabaceae) and evaluate the Apis mellifera adansonii Latreille (Hymenoptera: Apidae) activity on its pod and seed yields, the bee foraging and pollinating activities were studied in Ngaoundéré. The experiment was carried out within the University of ...

  16. Recovery of herbicide-resistant Azuki bean [ Vigna angularis (Wild ...

    African Journals Online (AJOL)

    ... of the bar gene as determined by assaying for resistance to bialaphos applied directly to leaves. This result demonstrates the feasibility of introducing potentially useful agronomic traits into azuki bean through genetic engineering. Key Words: Agrobacterium tumefaciens, bar gene, bialaphos, transgenic, Vigna angulazris.

  17. Susceptibility Of Five Cowpea ( Vigna unguiculata ) Varieties To ...

    African Journals Online (AJOL)

    Susceptibility Of Five Cowpea ( Vigna unguiculata ) Varieties To Attack By Callosobruchus maculatus (Fab.) ... in Ghana were screened for susceptibility to the cowpea beetle, C. maculatus, in storage for a period of 30 days in the laboratory at an ambient temperature of 27.5 ± 0.9oC and relative humidity of 64.6 ± 2%.

  18. Weed control in cowpea ( Vigna unguiculata (L) Walp) with ...

    African Journals Online (AJOL)

    Field experiments were conducted between 1994 and 1997 at the University of Ilorin Teaching and Research Farm, Ilorin (8o29`N; 4o35`E), in the southern Guinea savanna agro-ecological zone, to evaluate the efficacy of pre-emergence applications of two imidazolinone-based herbicide mixtures in cowpea (Vigna ...

  19. Generation mean analysis of dual purpose traits in cowpea (Vigna ...

    African Journals Online (AJOL)

    Fadiji

    2012-06-07

    Jun 7, 2012 ... Frequency analysis showed that all the F2 populations for fodder yield exhibited a continuous distribution, suggesting that inheritance of fodder yield is ... Key words: Gene effects, fodder, Vigna unguiculata, generation mean analysis. .... using the ABC scaling test (Mather, 1949), incorporating the weighted ...

  20. Plants regeneration from African cowpea variety (Vigna unguiculata ...

    African Journals Online (AJOL)

    STORAGESEVER

    2008-08-18

    Aug 18, 2008 ... Vigna unguiculata (L.) Walp. plant was efficiently regenerated from cotyledonary node explants. The shoots multiplication rate was ... Africa, insect pests are often responsible for 100% losses of cowpea yields (Singh and .... 26 days after acclimatization first flower buds were observed; thus plants were ...

  1. Genetic diversity of Bambara groundnut ( Vigna subterranea (L ...

    African Journals Online (AJOL)

    The existence of genetic diversity in germplasm collections is crucial for cultivar development. Genetic relationships among 105 Bambara groundnuts (Vigna subterranea (L) Verdc.) accessions from Kenya were evaluated using 12 microsatellite markers. The Bambara landraces were collected from farmers in the western ...

  2. Heat stable peroxidases from Vigna species (V) | Mbassi | African ...

    African Journals Online (AJOL)

    Shoots of three landraces of a Vigna species from two climatic areas of Cameroon were evaluated for their content of heat-resistant peroxidases. The peroxidase activity in the three landraces was detected with a greater catalytic efficiency for oxidation of O-dianisidine relative to ABTS (2, 2'-azino-bis-(3- ...

  3. Selection and evaluation of Rhizobial strains of Vigna radiata L ...

    African Journals Online (AJOL)

    STORAGESEVER

    2008-10-20

    Oct 20, 2008 ... Selection and evaluation of Rhizobial strains of Vigna radiata L. beneficial to ... This study aimed to select suitable strains that can be used as inoculants to enhance legume production and simultaneously reduce the use of ... contributor to natural or biological N2 fixation and allows legumes to grow in the ...

  4. Effect Of Sprouting On Available Lysine Content Of Cowpea ( Vigna ...

    African Journals Online (AJOL)

    This study was conducted to determine the effect of sprouting on available Lysine content of cowpea (Vigna unguiculata) flour and the performance of the flour used for producing “moi – moi” (steamed bean cake). Cowpea seed was subjected to sprouting for different periods of 1 day, 2 days and 3 days for samples B, C and ...

  5. Radiation-induced inhibition of human lymphocyte blastogenesis: the effect of superoxide dismutase and catalase

    International Nuclear Information System (INIS)

    Knox, S.; Misra, H.P.; Shifrine, M.

    1982-01-01

    Mitogen-induced lymphocyte blastogenesis was measured following X-irradiation (0-4 Gy) in the presence or absence of superoxide dismutase (SOD), under aerobic and anaerobic conditions. There were no significant differences between radiation survival curves under these different conditions, nor did SOD have any radioprotective effect. This demonstrates lack of oxygen dependence of radiation-induced inhibition of lymphocyte blastogenesis. Following X-irradiation at 2 Gy, neither SOD nor catalase, alone or together, added before or after irradiation, were radioprotective. In comparison to controls, both enzymes depressed lymphocyte proliferation when added at levels as low as 25 μg catalase or 100 μg SOD/ml media. When SOD and catalase were added together, the greatest depression of blastogenesis was obtained with increasing levels of SOD relative to increasing levels of catalase, indicating that SOD was largely responsible for this depression. The suppressive effect of administration of SOD (p 2 - and/or H 2 O 2 are not involved in radiation-induced inhibition of lymphocyte blastogenesis. (author)

  6. Catalase inhibits ionizing radiation-induced apoptosis in hematopoietic stem and progenitor cells.

    Science.gov (United States)

    Xiao, Xia; Luo, Hongmei; Vanek, Kenneth N; LaRue, Amanda C; Schulte, Bradley A; Wang, Gavin Y

    2015-06-01

    Hematologic toxicity is a major cause of mortality in radiation emergency scenarios and a primary side effect concern in patients undergoing chemo-radiotherapy. Therefore, there is a critical need for the development of novel and more effective approaches to manage this side effect. Catalase is a potent antioxidant enzyme that coverts hydrogen peroxide into hydrogen and water. In this study, we evaluated the efficacy of catalase as a protectant against ionizing radiation (IR)-induced toxicity in hematopoietic stem and progenitor cells (HSPCs). The results revealed that catalase treatment markedly inhibits IR-induced apoptosis in murine hematopoietic stem cells and hematopoietic progenitor cells. Subsequent colony-forming cell and cobble-stone area-forming cell assays showed that catalase-treated HSPCs can not only survive irradiation-induced apoptosis but also have higher clonogenic capacity, compared with vehicle-treated cells. Moreover, transplantation of catalase-treated irradiated HSPCs results in high levels of multi-lineage and long-term engraftments, whereas vehicle-treated irradiated HSPCs exhibit very limited hematopoiesis reconstituting capacity. Mechanistically, catalase treatment attenuates IR-induced DNA double-strand breaks and inhibits reactive oxygen species. Unexpectedly, we found that the radioprotective effect of catalase is associated with activation of the signal transducer and activator of transcription 3 (STAT3) signaling pathway and pharmacological inhibition of STAT3 abolishes the protective activity of catalase, suggesting that catalase may protect HSPCs against IR-induced toxicity via promoting STAT3 activation. Collectively, these results demonstrate a previously unrecognized mechanism by which catalase inhibits IR-induced DNA damage and apoptosis in HSPCs.

  7. Experimental and clinical research on the inhibition of scarring formation after glaucoma surgery 90Sr radiation

    International Nuclear Information System (INIS)

    Wei Meien; Wang Guzhu; Li Shuqing

    1994-01-01

    Beta radiation of 90 Sr can inhibit the scarring formation so that the success rate of filtration surgery may be improved. After success in animal experiment, trabeculectomy was performed with small sclera flap on 31 eyes of 23 cases of patients with a high risk of scarring formation. Local 90 Sr radiation with a total dosage of 30.24 Gy were given by several times 3 days postoperatively, combined with local use of steroids. The patients were followed-up at 1 to 24 months, averaging 7 months. The intraocular pressure were successfully controlled in 90.3% of the patients. No lens impairment and other complications were observed. This procedure is an adoptive method in preventing scarring formation after glaucoma filtering surgery

  8. Action spectrum for inhibition by ultraviolet radiation of photosystem 2 activity in spinach thylakoids

    International Nuclear Information System (INIS)

    Bornman, J.F.; Bjoern, L.O.; Aakerlund, H.-E.

    1984-01-01

    The effect of ultraviolet (UV) radiation (half-band width 10 nm) in the wavelength range 248-340 nm on chlorophyll fluorescence from a thin layer of spinach thylakoid suspension was investigated. It was found that the parameter most sensitive to UV radiation was the rise time of variable fluorescence. The increase in rise time was proportional to UV photon fluence and was used for the determination of an action spectrum. The action spectrum falls off from a maximum at ca. 275 nm towards longer wavelengths and rises from a minimum at 260 nm towards shorter wavelengths. The results also suggest that the UV inhibition is mainly on the PS 2 oxidizing side. Possibly damage is also inflicted to the PS 2 reaction center. (orig.)

  9. Kinetics of radiation-induced apoptosis in neonatal urogenital tissues with and without protein synthesis inhibition

    Energy Technology Data Exchange (ETDEWEB)

    Gobe, G.C.; Harmon, B.; Schoch, E.; Allan, D.J. [Queensland Univ., St. Lucia, QLD (Australia). Dept. of Chemistry

    1996-12-31

    The difference in incidence of radiation-induced apoptosis between two neonatal urogenital tissues, kidney and testis, was analysed over a 24h period. Concurrent administration of cycloheximide (10mg/kg body weight), a protein synthesis inhibitor, with radiation treatment was used to determine whether new protein synthesis had a role in induction of apoptosis in this in vivo model. Many chemotherapeutic drugs act via protein synthesis inhibition, and we believe that the results of this latter analysis may provide information for the planning of concurrent radio and chemotherapy. Apoptosis was quantified using morphological parameters, and verified by DNA gel electrophoresis for the typical banding pattern, and by electron microscopy. The proliferative index in tissues was studied, using [6-{sup 3}H]-thymidine uptake ( 1h prior to euthanasia and collection of tissues) and autoradiography as indicators of cell proliferation (S-phase). Tissue was collected 2, 4, 6, 8, and 24h after radiation treatment. Expression of one of the apoptosis-associated genes, Bcl-2 (an apoptosis inhibitor/cell survival gene), was studied using immunohistochemistry. Apoptosis peaked at 4h in the testis and 6h in the kidney, emphasising the necessity of knowing tissue differences in radiation response if comparing changes at a particular time. A higher proportion (almost five fold) of the apoptotic cells died in S-phase in the kidney than the testis, over the 24h. Protein synthesis inhibition completely negated induction of apoptosis in both tissues. Necrosis was not identified at any time. Cycloheximide treatment greatly diminished Bcl-2 expression. The differences in response of the two tissues to irradiation relates to their innate cell (genetic) controls, which may be determined by their state of differentiation at time of treatment, or the tissue type. This in vivo study also suggests the model may be useful for analysis of other cancer therapies for example polychemotherapies or chemo

  10. Kinetics of radiation-induced apoptosis in neonatal urogenital tissues with and without protein synthesis inhibition

    International Nuclear Information System (INIS)

    Gobe, G.C.; Harmon, B.; Schoch, E.; Allan, D.J.

    1996-01-01

    The difference in incidence of radiation-induced apoptosis between two neonatal urogenital tissues, kidney and testis, was analysed over a 24h period. Concurrent administration of cycloheximide (10mg/kg body weight), a protein synthesis inhibitor, with radiation treatment was used to determine whether new protein synthesis had a role in induction of apoptosis in this in vivo model. Many chemotherapeutic drugs act via protein synthesis inhibition, and we believe that the results of this latter analysis may provide information for the planning of concurrent radio and chemotherapy. Apoptosis was quantified using morphological parameters, and verified by DNA gel electrophoresis for the typical banding pattern, and by electron microscopy. The proliferative index in tissues was studied, using [6- 3 H]-thymidine uptake ( 1h prior to euthanasia and collection of tissues) and autoradiography as indicators of cell proliferation (S-phase). Tissue was collected 2, 4, 6, 8, and 24h after radiation treatment. Expression of one of the apoptosis-associated genes, Bcl-2 (an apoptosis inhibitor/cell survival gene), was studied using immunohistochemistry. Apoptosis peaked at 4h in the testis and 6h in the kidney, emphasising the necessity of knowing tissue differences in radiation response if comparing changes at a particular time. A higher proportion (almost five fold) of the apoptotic cells died in S-phase in the kidney than the testis, over the 24h. Protein synthesis inhibition completely negated induction of apoptosis in both tissues. Necrosis was not identified at any time. Cycloheximide treatment greatly diminished Bcl-2 expression. The differences in response of the two tissues to irradiation relates to their innate cell (genetic) controls, which may be determined by their state of differentiation at time of treatment, or the tissue type. This in vivo study also suggests the model may be useful for analysis of other cancer therapies for example polychemotherapies or chemo

  11. Inhibition of Hepres virus plaquing capacity in human diploid fibroblasts treated with Gilvocarcin V plus near UV radiation

    International Nuclear Information System (INIS)

    Bockstahler, L.E.; Hitchins, V.M.; Carney, P.G.; Olvey, K.M.; Lytle, C.D.

    1990-01-01

    The capacity of human fibroblasts to support plaque formation by Herpes simplex virus following treatment of the cells with gilvocarcin V, a polyaromatic C-glycoside, plus near ultraviolet radiation (UVA, 320-400 nm) was examined. Gilvocarcin V, plus UVA radiation, effectively inhibited host cell capacity at concentrations five orders of magnitude lower than that of 8-methyoxypsoralen required for capacity inhibition at similar levels of UVA radiation. This result extends the observation of unusual biological potency of UVA-activated gilvocarcins from bacterial cells to human cells. (author)

  12. Inhibition of apoptosis: the Consequence of Low Doses of Ionizing Radiation

    International Nuclear Information System (INIS)

    Osmak, M.; Abramic, M.; Brozovic, A.; Hadzija, M.

    1998-01-01

    In our previous studies we have shown that human cervical carcinoma HeLa cells exposed to low repeated doses of ionising radiation became resistant to cisplatin. The aim of the present study was to determine the molecular mechanisms involved in this resistance. With this purpose, the profile of cytosolic proteins was examined and the induction of apoptosis followed for control and preirradiated Hela cells. The profile of cytosolic proteins was analysed by SDS-electrophoresis. The kinetic of apoptosis was followed by fluorescent microscope in control HeLa and preirradiated HeLa cells during 72 hours after l hour cell treatment with 50 or 150 μM cisplatin. Analysis of DNA fragmentation was done by agarose gel electrophoresis. SDS-electrophoresis of the cytosolic proteins from parental Hela and preirradiated Hela cells exhibited similar pattern. Contrary to that, significantly lower number of apoptotic cells was determined in preirradiated than in control cells following the treatment with cisplatin. The nucleosome ladder was observed in human cervical carcinoma cells 12 hours after the cisplatin treatment. In conclusion, our in vitro studies indicate that repeated low doses of irradiation can cause drug resistance due to the inhibition of apoptosis. To our knowledge, it is shown for the first time that even low doses of ionising radiation may inhibit apoptosis. (author)

  13. Inhibition of ERK1/2 or AKT Activity Equally Enhances Radiation Sensitization in B16F10 Cells

    Science.gov (United States)

    Kalal, Bhuvanesh Sukhlal; Fathima, Faraz; Pai, Vinitha Ramanath; Sanjeev, Ganesh; Krishna, Chilakapati Murali; Upadhya, Dinesh

    2018-01-01

    Background The aim of the study was to evaluate the radiation sensitizing ability of ERK1/2, PI3K-AKT and JNK inhibitors in highly radiation resistant and metastatic B16F10 cells which carry wild-type Ras and Braf. Methods Mouse melanoma cell line B16F10 was exposed to 1.0, 2.0 and 3.0 Gy of electron beam radiation. Phosphorylated ERK1/2, AKT and JNK levels were estimated by ELISA. Cells were exposed to 2.0 and 3.0 Gy of radiation with or without prior pharmacological inhibition of ERK1/2, AKT as well as JNK pathways. Cell death induced by radiation as well as upon inhibition of these pathways was measured by TUNEL assay using flow cytometry. Results Exposure of B16F10 cells to 1.0, 2.0 and 3.0 Gy of electron beam irradiation triggered an increase in all the three phosphorylated proteins compared to sham-treated and control groups. B16F10 cells pre-treated with either ERK1/2 or AKT inhibitors equally enhanced radiation-induced cell death at 2.0 as well as 3.0 Gy (P < 0.001), while inhibition of JNK pathway increased radiation-induced cell death to a lesser extent. Interestingly combined inhibition of ERK1/2 or AKT pathways did not show additional cell death compared to individual ERK1/2 or AKT inhibition. This indicates that ERK1/2 or AKT mediates radiation resistance through common downstream molecules in B16F10 cells. Conclusions Even without activating mutations in Ras or Braf genes, ERK1/2 and AKT play a critical role in B16F10 cell survival upon radiation exposure and possibly act through common downstream effector/s. PMID:29581812

  14. Gamma radiation inhibits the appearance of induced ornithine decarboxylase activity in Chinese hamster cells

    International Nuclear Information System (INIS)

    Ben-Hur, E.; Heimer, Y.M.; Riklis, E.

    1981-01-01

    Ornithine decarboxylase activity of Chinese hamster cells (ODC, EC 4.1.1.17) can be induced in plateau phase by change of medium. Exposure of the cells to gamma radiation before induction reduces the amount of ODC activity induced. The dose-response curve is exponential with a D 0 of 106 krad. Exposure of BUdR-substituted cells is more effective in reducing ODC induction at high doses, with a D 0 of 38 krad. Cells can recover from the reduction incurred by 74 krad if enzyme induction is delayed for 2 hours after exposure. Treatment of the cells with psoralen-plus-light completely inhibits RNA synthesis without affecting protein synthesis (Heimer, Ben-Hur and Riklis 1977, 1978). Using this procedure it is shown that the effect of gamma radiation on inducible ODC activity is due not only to DNA damage but also involves a post-transcriptional effect. This conclusion is supported by employing a heat shock to inhibit protein synthesis prior to gamma-irradiation of log-phase cells. In such cells the increased activity of ODC upon transfer to 37 0 C is due primarily to enzyme synthesis using pre-existing RNA species during the first few hours. A low concentration of actinomycin D, which inhibits rRNA synthesis, applied during the recovery period, prevents the recovery of the cells' capacity for maximal ODC induction. This may indicate that, in order to recover, the cells have to repair damage to the ribosomes as well as to DNA. (author)

  15. Hyperthermia and PARP1-inhibition for sensitization of radiation and cisplatin treatment of cervical carcinoma cells

    International Nuclear Information System (INIS)

    Franken, Nicolaas; Oei, Arlene; Leeuwen, Caspar van; Stalpers, Lukas; Rodermond, Hans; Bel, Arjan; Kok, Petra; Crezee, Hans

    2014-01-01

    Ionizing radiation causes single and double strand breaks (SSBs and DSBs). DSBs are among the most critical DNA lesions and can be repaired via either non-homologous end joining (NHEJ) in which PARP1, Ku70 and DNA-PKcs are important, or homologous recombination (HR), where BRCA2 and Rad51 are essential. Hyperthermia disturbs HR by temporary inactivation of BRCA2. Cisplatin disrupts NHEJ and PARP1-inhibitor blocks Poly-(ADP-ribose)polymerase- 1, which is important in SSB repair, NHEJ and backup-NHEJ. Our goal was to investigate the additional effectiveness of hyperthermia and PARP1-inhibition on radiation and/or cisplatin treatment. Cervical carcinoma cells (SiHa) were treated at different temperature levels levels (41.0-43.0℃, PARP1-inhibitor (100 μM; NU1025), gamma-irradiation doses (0-8 Gy) or cisplatin (1'R for 1 h). Clonogenic assays were carried out to measure survival and γH2AX staining was used to visualize DSBs. To elucidate mechanisms of action expression levels of DNA repair proteins BRCA2 and DNA-PKcs were investigated after 42.0℃ (1 h) using western blot. Combined hyperthermia and radiation resulted in an increased number of γH2AX foci as compared to radiation alone. Hyperthermia treatment in combination with cisplatin and PARP1 inhibitor and with radiation and PARP1 inhibitor significantly decreased cell survival. Western blot demonstrated a decreased expression of BRCA2 protein at 30 min after hyperthermia treatment. Adding PARP1-inhibitor significantly improves the effectiveness of combined hyperthermia radiotherapy and combined hyperthermia-cisplatin treatment on cervical carcinoma cells. Hyperthermia affects DNA-DSB repair as is indicated by increased γH2AX foci numbers and decreased BRCA2 expression. (author)

  16. Radiosensitization In Vivo by Histone Deacetylase Inhibition with No Increase in Early Normal Tissue Radiation Toxicity.

    Science.gov (United States)

    Groselj, Blaz; Ruan, Jia-Ling; Scott, Helen; Gorrill, Jessica; Nicholson, Judith; Kelly, Jacqueline; Anbalagan, Selvakumar; Thompson, James; Stratford, Michael R L; Jevons, Sarah J; Hammond, Ester M; Scudamore, Cheryl L; Kerr, Martin; Kiltie, Anne E

    2018-02-01

    As the population ages, more elderly patients require radiotherapy-based treatment for their pelvic malignancies, including muscle-invasive bladder cancer, as they are unfit for major surgery. Therefore, there is an urgent need to find radiosensitizing agents minimally toxic to normal tissues, including bowel and bladder, for such patients. We developed methods to determine normal tissue toxicity severity in intestine and bladder in vivo , using novel radiotherapy techniques on a small animal radiation research platform (SARRP). The effects of panobinostat on in vivo tumor growth delay were evaluated using subcutaneous xenografts in athymic nude mice. Panobinostat concentration levels in xenografts, plasma, and normal tissues were measured in CD1-nude mice. CD1-nude mice were treated with drug/irradiation combinations to assess acute normal tissue effects in small intestine using the intestinal crypt assay, and later effects in small and large intestine at 11 weeks by stool assessment and at 12 weeks by histologic examination. In vitro effects of panobinostat were assessed by qPCR and of panobinostat, TMP195, and mocetinostat by clonogenic assay, and Western blot analysis. Panobinostat resulted in growth delay in RT112 bladder cancer xenografts but did not significantly increase acute (3.75 days) or 12 weeks' normal tissue radiation toxicity. Radiosensitization by panobinostat was effective in hypoxic bladder cancer cells and associated with class I HDAC inhibition, and protein downregulation of HDAC2 and MRE11. Pan-HDAC inhibition is a promising strategy for radiosensitization, but more selective agents may be more useful radiosensitizers clinically, resulting in fewer systemic side effects. Mol Cancer Ther; 17(2); 381-92. ©2017 AACR See all articles in this MCT Focus section, "Developmental Therapeutics in Radiation Oncology." ©2017 American Association for Cancer Research.

  17. Improvement of the Chinese bean [Vigna Unguiculata (L.) Walp.], through radioinduced mutagenesis; Mejoramiento de Frijol Chino [Vigna Unguiculata (L.) Walp.], Mediante Mutagenesis Radioinducida

    Energy Technology Data Exchange (ETDEWEB)

    Salmeron E, J.; Bueno J, J.E.; Valencia E, F.; Solis M, M. [Colegio Superior Agropecuario del Estado de Guerrero, Iguala (Mexico); Cervantes S, T. [Instituto de Recursos Geneticos y Productividad (Mexico); Cruz T, E. de la [ININ, Carretera Mexico-La Marquesa S/N, La Marquesa Ocoyoacac, Mexico. C.P. 52750 (Mexico)]. e-mail: csaegro@prodigy.net.mx

    2006-07-01

    The advances in the process of genetic improvement of the Chinese bean (Vigna Unguiculata (L.) are presented, high nutritious value that it is evaluating as alternative for marginal areas producers of the State of Guerrero. The method of improvement applied it is recurrent radiation, continued by selection cycles applying the method of progeny by plant. The applied radiation doses were 200 and 250 Gray. The established selection approaches are: resistant plants or tolerant to the plagues attack and illnesses, vigorous, with more height to the first sheath, of compact and certain growth, with short internodes, bigger number of sheaths by plant and of grains by sheath, bigger number of grain size, among others. The obtained results show that the dose that induces bigger variability and that it has propitiated the biggest quantity in possible mutants it is 200Gy. Precocious plants with more height to the first sheath, with certain growth as well as with bigger number and sheaths size have been detected. The selected plants have incorporated to an increment process by means of the progeny method by plant. (Author)

  18. Effects of irradiation on physical and sensory characteristics of cowpea seed cultivars ( Vigna unguiculata L. Walp)

    Science.gov (United States)

    Ocloo, F. C. K.; Darfour, B.; Ofosu, D. O.; Wilson, D. D.

    2012-01-01

    Cowpeas ( Vigna unguiculata L. Walp) are leguminous seeds widely produced and consumed in most developing countries of sub-Saharan Africa where they are a good source of affordable proteins, minerals and vitamins to the mainly carbohydrate-based diet of sub-Saharan Africa. At storage cowpea may be attacked by insects that cause severe damage to the seeds. The objective of this study was to investigate the effects of gamma irradiation on some physical and sensory characteristics of cowpea seed cultivars. Four cowpea cultivars were irradiated with gamma radiation at dose levels of 0.25, 0.50, 0.75, 1.0 and 1.5 kGy. Moisture content, thousand grain weight and bulk densities were determined as well as the amount of water absorbed during soaking and some sensory characteristics were equally determined. All the physical parameters studied were not significantly ( p>0.05) affected by the radiation. There was no significant ( p>0.05) effect of the radiation on the sensory attributes like flavour, taste, texture, softness and colour of the cowpea seeds. Similarly, the radiation did not affect significantly ( p>0.05) the acceptability of the treated cowpea cultivars.

  19. Biofertilizing efficiency of Sargassum polycystum extract on growth and biochemical composition of Vigna radiata and Vigna mungo

    Directory of Open Access Journals (Sweden)

    B Bharath

    2018-01-01

    Full Text Available Objective: To evaluate the effect of marine brown alga Sargassum polycystum extract on growth and biochemical parameters of Vigna radiata and Vigna mungo.Methods: Different concentrations of algal extracts (0.5%, 1.0%, 2.0%, 3.0%, 4.0%, and 5.0% were prepared and applied to the crops at every 10-day intervals under natural conditions. After 30 d, the plants were harvested to evaluate the growth and biochemical parameters.Results: Seaweed liquid fertilizers treated seedlings showed maximum growth in 3.0% concentration when compared to the untreated seedlings. Similarly, biochemical parameters such as photosynthetic pigments, protein, reducing sugar, total sugar and amino acids exhibited increases in 3.0% concentration seaweed extract. Decreases in growth and biochemical parameters were noticed in concentrations higher than 3.0%.Conclusions: Presence of micronutrients and growth regulating substances in the liquid extract help healthier and faster productivity of the crop.

  20. Experimental assessment of the role of the blood flow inhibition in hyperglycemia-enhanced radiation injury to tumor

    International Nuclear Information System (INIS)

    Kozin, S.V.; Sevast'yanov, A.I.; Yarmonenko, S.P.

    1986-01-01

    Experimental assessment of the role of the blood flow inhibition in enhancement of radiation injury to tumors using short-term hyperglycemia was provided. Experiments on mice with Ehrlich solid carcinoma showed the dependence of a rise of the antitumor effect of preceding radiation induced by glucose and glucose combined with mexamin on a degree of the blood flow inhibition under the influence of these modifying agents. It was established that a considerable enhancement of radiation injury occured but in such tumors where short-term hyperglycemia and mexamin decreased the blood flow level not less than 5-10 fold as estimated by 133 Xe clearance. The results of the above experiments showed that the noticeable inhibition of the blood flow in tumors was a necessary tough, probably, not the only condition for a high efficacy of short-term hyperglycemia used an ajuvant to radiotherapy

  1. Targeting DNA repair with PNKP inhibition sensitizes radioresistant prostate cancer cells to high LET radiation.

    Directory of Open Access Journals (Sweden)

    Pallavi Srivastava

    Full Text Available High linear energy transfer (LET radiation or heavy ion such as carbon ion radiation is used as a method for advanced radiotherapy in the treatment of cancer. It has many advantages over the conventional photon based radiotherapy using Co-60 gamma or high energy X-rays from a Linear Accelerator. However, charged particle therapy is very costly. One way to reduce the cost as well as irradiation effects on normal cells is to reduce the dose of radiation by enhancing the radiation sensitivity through the use of a radiomodulator. PNKP (polynucleotide kinase/phosphatase is an enzyme which plays important role in the non-homologous end joining (NHEJ DNA repair pathway. It is expected that inhibition of PNKP activity may enhance the efficacy of the charged particle irradiation in the radioresistant prostate cancer cell line PC-3. To test this hypothesis, we investigated cellular radiosensitivity by clonogenic cell survival assay in PC-3 cells.12Carbon ion beam of62 MeVenergy (equivalent 5.16 MeV/nucleon and with an entrance LET of 287 kev/μm was used for the present study. Apoptotic parameters such as nuclear fragmentation and caspase-3 activity were measured by DAPI staining, nuclear ladder assay and colorimetric caspase-3method. Cell cycle arrest was determined by FACS analysis. Cell death was enhanced when carbon ion irradiation is combined with PNKPi (PNKP inhibitor to treat cells as compared to that seen for PNKPi untreated cells. A low concentration (10μM of PNKPi effectively radiosensitized the PC-3 cells in terms of reduction of dose in achieving the same survival fraction. PC-3 cells underwent significant apoptosis and cell cycle arrest too was enhanced at G2/M phase when carbon ion irradiation was combined with PNKPi treatment. Our findings suggest that combined treatment of carbon ion irradiation and PNKP inhibition could enhance cellular radiosensitivity in a radioresistant prostate cancer cell line PC-3. The synergistic effect of PNKPi

  2. Effects of Pharmacological Inhibition and Genetic Deficiency of Plasminogen Activator Inhibitor-1 in Radiation-Induced Intestinal Injury

    International Nuclear Information System (INIS)

    Abderrahmani, Rym; Francois, Agnes; Buard, Valerie; Benderitter, Marc; Sabourin, Jean-Christophe; Crandall, David L.; Milliat, Fabien

    2009-01-01

    Purpose: To investigate effects of plasminogen activator inhibitor 1 (PAI-1) genetic deficiency and pharmacological PAI-1 inhibition with PAI-039 in a mouse model of radiation-induced enteropathy. Methods and Materials: Wild-type (Wt) and PAI-1 -/- knockout mice received a single dose of 19 Gy to an exteriorized localized intestinal segment. Sham and irradiated Wt mice were treated orally with 1 mg/g of PAI-039. Histological modifications were quantified using a radiation injury score. Moreover, intestinal gene expression was monitored by real-time PCR. Results: At 3 days after irradiation, PAI-039 abolished the radiation-induced increase in the plasma active form of PAI-1 and limited the radiation-induced gene expression of transforming growth factor β1 (TGF-β1), CTGF, PAI-1, and COL1A2. Moreover, PAI-039 conferred temporary protection against early lethality. PAI-039 treatment limited the radiation-induced increase of CTGF and PAI-1 at 2 weeks after irradiation but had no effect at 6 weeks. Radiation injuries were less severe in PAI-1 -/- mice than in Wt mice, and despite the beneficial effect, 3 days after irradiation, PAI-039 had no effects on microscopic radiation injuries compared to untreated Wt mice. Conclusions: A genetic deficiency of PAI-1 is associated with amelioration of late radiation enteropathy. Pharmacological inhibition of PAI-1 by PAI-039 positively impacts the early, acute phase increase in plasma PAI-1 and the associated radiation-induced gene expression of inflammatory/extracellular matrix proteins. Since PAI-039 has been shown to inhibit the active form of PAI-1, as opposed to the complete loss of PAI-1 in the knockout animals, these data suggest that a PAI-1 inhibitor could be beneficial in treating radiation-induced tissue injury in acute settings where PAI-1 is elevated.

  3. Overexpression of SKP2 Inhibits the Radiation-Induced Bystander Effects of Esophageal Carcinoma

    Directory of Open Access Journals (Sweden)

    Xiao-Chun Wang

    2017-02-01

    Full Text Available Background: To investigate the effects of S-phase kinase protein 2 (SKP2 expression on the radiation induced bystander effect (RIBE in esophageal cancer (EC cells. Materials and Methods: Western blot was used to detect the levels of SKP2, Rad51, and Ku70 in EC cells. Positive transfection, RNAi, micronucleus (MN, and γ-H2AX focus formation assay were used to investigate the effects of SKP2 on RIBE induced by irradiated cells. Results: We found a significant negative correlation between SKP2 expression and MN frequency (p < 0.05 induced by RIBE. The results were further confirmed by positive transfection, RNAi, and rescue experiments.γ-H2AX focus formation assay results indicated that overexpression of SKP2 in the irradiated cells inhibited the DNA damage of RIBE cells. However, when SKP2 expression decreased in irradiated cells, the DNA damage of RIBE cells increased. Increased or decreased expression levels of SKP2 had effects on Rad51 expression under the conditions of RIBE. Conclusions: These results showed, for the first time, that SKP2 expression can inhibit RIBE of EC cells. The mechanism may function, at least partly, through the regulation of Rad51 in the ability to repair DNA damage.

  4. Aqueous extract of Pinus caribaea inhibits the damage induced by ultraviolet radiations, in plasmid DNA

    Directory of Open Access Journals (Sweden)

    Marioly Vernhes Tamayo

    2017-08-01

    Full Text Available Context: The incidence of solar ultraviolet radiation (UV on Earth has increased due to diminish of the ozone layer. This enviromental agent is highly genotoxic causing numerous damage in DNA molecule. Nowadays there is a growing interest in the search of compounds capable to minimize these effects. In particular, phytocompounds have been tested as excelent candidates for their antigenotoxic properties. Aims: To evaluate the protective effect of the aqueous extract of Pinus caribaea (EPC against the damage induced by the UVB and UVC radiation. Methods: The cell-free plasmid DNA assay was employed. The forms of plasmid were separated electrophoretically in agarose gel. For genotoxic and photoprotective evaluation of P. caribaea, different concentrations of the extract (0.1 – 2.0 mg/mL and exposure times were evaluated. The CPD lesions were detected enzymatically. Additionally, the transmittance of the aqueous extract against 254 nm and 312 nm was measured. Results: None of the concentrations were genotoxic in 30 min of treatment, for superior times a clastogenic effect was observed. The EPC despite inhibiting the activity of the enzyme T4 endo V, impedes photolesions formation in DNA at concentrations ≥ 0.1 mg/mL. Conclusions: The EPC has photoprotective properties, this effect could be related with its antioxidants and absorptives capacities.

  5. Effect of storage on the amino acid composition and biological quality of irradiated macacar beans Vigna unguiculata (L.) Walp

    International Nuclear Information System (INIS)

    Coelho, L.C.B.B.; de Medeiros, R.B.; Flores, H.

    1978-01-01

    The effects of two doses of gamma radiation (100 and 1,000 krad) upon the stability over a 6-month storage period of the amino acid composition and protein efficiency ratio (PER) of the macacar bean Vigna unguiculata (L.) Walp were investigated. No important differences were noted when the aminograms of irradiated and nonirradiated beans, either raw or cooked were compared. Nevertheless, the losses of lysine, arginine, and histidine due to cooking were greater in the irradiated beans. The PER of nonirradiated was higher than that of irradiated beans before and after the 6 months of storage, and was always lowest in the beans subjected to the higher dose of radiation. Qualitatively, an association was observed between the nutritional value (PER) and small decreases in the content of certain amino acids which resulted mainly from increased thermal lability of the irradiated bean protein

  6. Effects of irradiation on physical and sensory characteristics of cowpea seed cultivars (Vigna unguiculata L. Walp)

    International Nuclear Information System (INIS)

    Ocloo, F.C.K.; Darfour, B.; Ofosu, D.O.; Wilson, D.D.

    2012-01-01

    Cowpeas (Vigna unguiculata L. Walp) are leguminous seeds widely produced and consumed in most developing countries of sub-Saharan Africa where they are a good source of affordable proteins, minerals and vitamins to the mainly carbohydrate-based diet of sub-Saharan Africa. At storage cowpea may be attacked by insects that cause severe damage to the seeds. The objective of this study was to investigate the effects of gamma irradiation on some physical and sensory characteristics of cowpea seed cultivars. Four cowpea cultivars were irradiated with gamma radiation at dose levels of 0.25, 0.50, 0.75, 1.0 and 1.5 kGy. Moisture content, thousand grain weight and bulk densities were determined as well as the amount of water absorbed during soaking and some sensory characteristics were equally determined. All the physical parameters studied were not significantly (p>0.05) affected by the radiation. There was no significant (p>0.05) effect of the radiation on the sensory attributes like flavour, taste, texture, softness and colour of the cowpea seeds. Similarly, the radiation did not affect significantly (p>0.05) the acceptability of the treated cowpea cultivars. - Highlights: → We investigated the effects of gamma irradiation on some physical and sensory characteristics of cowpea seed cultivars. → Four cowpea cultivars were irradiated at dose levels of 0.25, 0.50, 0.75, 1.0 and 1.5 kGy. → Physical parameters were not significantly (p>0.05) affected by the radiation. → Sensory attributes considered were not significantly influenced by the radiation doses used.

  7. Effects of irradiation on physical and sensory characteristics of cowpea seed cultivars (Vigna unguiculata L. Walp)

    Energy Technology Data Exchange (ETDEWEB)

    Ocloo, F.C.K., E-mail: fidelis_ocloo@yahoo.com [Radiation Technology Centre, Biotechnology and Nuclear Agriculture Research Institute, Ghana Atomic Energy Commission. P.O. Box LG 80, Legon (Ghana); Darfour, B.; Ofosu, D.O. [Radiation Technology Centre, Biotechnology and Nuclear Agriculture Research Institute, Ghana Atomic Energy Commission. P.O. Box LG 80, Legon (Ghana); Wilson, D.D. [Department of Zoology, University of Ghana, Legon (Ghana)

    2012-01-15

    Cowpeas (Vigna unguiculata L. Walp) are leguminous seeds widely produced and consumed in most developing countries of sub-Saharan Africa where they are a good source of affordable proteins, minerals and vitamins to the mainly carbohydrate-based diet of sub-Saharan Africa. At storage cowpea may be attacked by insects that cause severe damage to the seeds. The objective of this study was to investigate the effects of gamma irradiation on some physical and sensory characteristics of cowpea seed cultivars. Four cowpea cultivars were irradiated with gamma radiation at dose levels of 0.25, 0.50, 0.75, 1.0 and 1.5 kGy. Moisture content, thousand grain weight and bulk densities were determined as well as the amount of water absorbed during soaking and some sensory characteristics were equally determined. All the physical parameters studied were not significantly (p>0.05) affected by the radiation. There was no significant (p>0.05) effect of the radiation on the sensory attributes like flavour, taste, texture, softness and colour of the cowpea seeds. Similarly, the radiation did not affect significantly (p>0.05) the acceptability of the treated cowpea cultivars. - Highlights: > We investigated the effects of gamma irradiation on some physical and sensory characteristics of cowpea seed cultivars. > Four cowpea cultivars were irradiated at dose levels of 0.25, 0.50, 0.75, 1.0 and 1.5 kGy. > Physical parameters were not significantly (p>0.05) affected by the radiation. > Sensory attributes considered were not significantly influenced by the radiation doses used.

  8. Far-infrared radiation inhibits proliferation, migration, and angiogenesis of human umbilical vein endothelial cells by suppressing secretory clusterin levels.

    Science.gov (United States)

    Hwang, Soojin; Lee, Dong-Hoon; Lee, In-Kyu; Park, Young Mi; Jo, Inho

    2014-04-28

    Far-infrared (FIR) radiation is known to lessen the risk of angiogenesis-related diseases including cancer. Because deficiency of secretory clusterin (sCLU) has been reported to inhibit angiogenesis of endothelial cells (EC), we investigated using human umbilical vein EC (HUVEC) whether sCLU mediates the inhibitory effects of FIR radiation. Although FIR radiation ranging 3-25μm wavelength at room temperature for 60min did not alter EC viability, further incubation in the culture incubator (at 37°C under 5% CO2) after radiation significantly inhibited EC proliferation, in vitro migration, and tube formation in a time-dependent manner. Under these conditions, we found decreased sCLU mRNA and protein expression in HUVEC and decreased sCLU protein secreted in culture medium. Expectedly, the replacement of control culture medium with the FIR-irradiated conditioned medium significantly decreased wound closure and tube formation of HUVEC, and vice versa. Furthermore, neutralization of sCLU with anti-sCLU antibody also mimicked all observed inhibitory effects of FIR radiation. Moreover, treatment with recombinant human sCLU protein completely reversed the inhibitory effects of FIR radiation on EC migration and angiogenesis. Lastly, vascular endothelial growth factor also increased sCLU secretion in the culture medium, and wound closure and tube formation of HUVEC, which were significantly reduced by FIR radiation. Our results demonstrate a novel mechanism by which FIR radiation inhibits the proliferation, migration, and angiogenesis of HUVEC, via decreasing sCLU. Copyright © 2013 Elsevier Ireland Ltd. All rights reserved.

  9. Inhibition and anti-inhibition effects of positronium formation in cyclohexane and their relation to radiation chemistry

    International Nuclear Information System (INIS)

    Ito, Y.; Miyake, Y.; Tabata, Y.

    1982-01-01

    Positronium formation in cyclohexane has been studied using C 2 H 5 Br or CCl 4 as an inhibitor and C 6 F 6 as an anti-inhibitor. The results are analyzed using an empirical formula which is well established in radiation chemistry for electron scavenging reactions in cyclohexane. The reactivity parameters derived from the radiation chemistry are shown to successfully reproduce the experimental results. Very close correlation between positronium formation and radiation chemistry is evident, and the spur reaction model of positronium formation is corroborated. From a simple model of the positron spur in which only a single ion pair and a positron is assumed, it is estimated that about 75% of the spur electron combines with the positron. (author)

  10. Growth inhibition of human pancreatic cancer cells by lipofection mediated IGF-1R antisense oligodeoxynucletides in combination with ionizing radiation

    International Nuclear Information System (INIS)

    Pan Yaozhen; Sun Chengyi; Wang Yuzhi

    2004-01-01

    Objective: To study the growth inhibition of human pancreatic cancer cells (PC-3) by lipofection-mediated and ionizing radiation improving transfection of IGF-1R antisense oligodeoxynucletides (ASON) in vitro. Methods: Colonigenicity of PC-3 cells in vitro after 60 Co γ-radiation was observed for ascertaining their radiosensitivity and optimal radiation dose was selected according to the radiation sensitivity. PC-3 cells were transfected by two ways: 1) by lipofection-mediated IGF-1R ASON combined with ionizing radiation. 2) by lipo-ASON alone without ionizing radiation. Cell growth was assessed by MTT method. The expression of IGF-1R at mRNA level was examined by RT-PCR. Flow cytometry was used to demonstrate apoptotic changes in lipo-ASON-treated cells. Results: The inhibitory efficiency of lipo-ASON combined with ionizing radiation was higher than that without ionizing radiation (P < 0.05). The apoptotic efficiency and the decreased level of IGF-1R at mRNA were significantly improved (P < 0.05). Conclusion: Lipofection-mediated and ionizing radiation-promoted transfection of IGF-1R antisense oligodeoxynucletides (ASON) significantly decreases IGF-1R at mRNA level and induces apoptosis of human pancreatic cancer cells in vitro

  11. Improvement of the Chinese bean [Vigna Unguiculata (L.) Walp.], through radioinduced mutagenesis

    International Nuclear Information System (INIS)

    Salmeron E, J.; Bueno J, J.E.; Valencia E, F.; Solis M, M.; Cervantes S, T.; Cruz T, E. de la

    2006-01-01

    The advances in the process of genetic improvement of the Chinese bean (Vigna Unguiculata (L.) are presented, high nutritious value that it is evaluating as alternative for marginal areas producers of the State of Guerrero. The method of improvement applied it is recurrent radiation, continued by selection cycles applying the method of progeny by plant. The applied radiation doses were 200 and 250 Gray. The established selection approaches are: resistant plants or tolerant to the plagues attack and illnesses, vigorous, with more height to the first sheath, of compact and certain growth, with short internodes, bigger number of sheaths by plant and of grains by sheath, bigger number of grain size, among others. The obtained results show that the dose that induces bigger variability and that it has propitiated the biggest quantity in possible mutants it is 200Gy. Precocious plants with more height to the first sheath, with certain growth as well as with bigger number and sheaths size have been detected. The selected plants have incorporated to an increment process by means of the progeny method by plant. (Author)

  12. Development of unigene-derived SSR markers in cowpea (Vigna unguiculata) and their transferability to other Vigna species.

    Science.gov (United States)

    Gupta, S K; Gopalakrishna, T

    2010-07-01

    Unigene sequences available in public databases provide a cost-effective and valuable source for the development of molecular markers. In this study, the identification and development of unigene-based SSR markers in cowpea (Vigna unguiculata (L.) Walp.) is presented. A total of 1071 SSRs were identified in 15 740 cowpea unigene sequences downloaded from the National Center for Biotechnology Information. The most frequent SSR motifs present in the unigenes were trinucleotides (59.7%), followed by dinucleotides (34.8%), pentanucleotides (4%), and tetranucleotides (1.5%). The copy number varied from 6 to 33 for dinucleotide, 5 to 29 for trinucleotide, 5 to 7 for tetranucleotide, and 4 to 6 for pentanucleotide repeats. Primer pairs were successfully designed for 803 SSR motifs and 102 SSR markers were finally characterized and validated. Putative function was assigned to 64.7% of the unigene SSR markers based on significant homology to reported proteins. About 31.7% of the SSRs were present in coding sequences and 68.3% in untranslated regions of the genes. About 87% of the SSRs located in the coding sequences were trinucleotide repeats. Allelic variation at 32 SSR loci produced 98 alleles in 20 cowpea genotypes. The polymorphic information content for the SSR markers varied from 0.10 to 0.83 with an average of 0.53. These unigene SSR markers showed a high rate of transferability (88%) across other Vigna species, thereby expanding their utility. Alignment of unigene sequences with soybean genomic sequences revealed the presence of introns in amplified products of some of the SSR markers. This study presents the distribution of SSRs in the expressed portion of the cowpea genome and is the first report of the development of functional unigene-based SSR markers in cowpea. These SSR markers would play an important role in molecular mapping, comparative genomics, and marker-assisted selection strategies in cowpea and other Vigna species.

  13. CSF1R inhibition prevents radiation pulmonary fibrosis by depletion of interstitial macrophages.

    Science.gov (United States)

    Meziani, Lydia; Mondini, Michele; Petit, Benoît; Boissonnas, Alexandre; Thomas de Montpreville, Vincent; Mercier, Olaf; Vozenin, Marie-Catherine; Deutsch, Eric

    2018-03-01

    Radiation-induced lung fibrosis (RIF) is a delayed side-effect of chest radiotherapy, frequently associated with macrophage infiltration.We aimed to characterise the role of pulmonary macrophages in RIF using human lung biopsies from patients receiving radiotherapy for thorax malignancies and a RIF model developed in C57BL/6 mice after 16-Gy thorax irradiation.High numbers of macrophages (both interstitial and alveolar) were detected in clinical and preclinical RIF. In the preclinical model, upregulation of T-helper (Th)2 cytokines was measured, whereas Th1 cytokines were downregulated in RIF tissue lysate. Bronchoalveolar lavage demonstrated upregulation of both types of cytokines. At steady state, tissue-infiltrating macrophages (IMs) expressed 10-fold more arginase (Arg)-1 than alveolar macrophages (AMs), and a 40-fold upregulation of Arg-1 was found in IMs isolated from RIF. IMs, but not AMs, were able to induce myofibroblast activation in vitro In addition, whereas depletion of AMs using Clodrosome didn't affect RIF score, depletion of IMs using a clinically available colony-stimulating factor receptor-1 (CSF1R) neutralising antibody was antifibrotic.These findings suggest differential contributions of alveolar versus interstitial macrophages in RIF, highlighting the fibrogenic role of IMs. The CSF1/CSF1R pathway was identified as a new therapeutic target to inhibit RIF. Copyright ©ERS 2018.

  14. Constituents from Vigna vexillata and Their Anti-Inflammatory Activity

    Directory of Open Access Journals (Sweden)

    Guo-Feng Chen

    2012-08-01

    Full Text Available The seeds of Vigna genus are important food resources and there have already been many reports regarding their bioactivities. In our preliminary bioassay, the chloroform layer of methanol extracts of V. vexillata demonstrated significant anti-inflammatory bioactivity. Therefore, the present research is aimed to purify and identify the anti-inflammatory principles of V. vexillata. One new sterol (1 and two new isoflavones (2,3 were reported from the natural sources for the first time and their chemical structures were determined by the spectroscopic and mass spectrometric analyses. In addition, 37 known compounds were identified by comparison of their physical and spectroscopic data with those reported in the literature. Among the isolates, daidzein (23, abscisic acid (25, and quercetin (40 displayed the most significant inhibition of superoxide anion generation and elastase release.

  15. Toxic effects of low concentrations of Cu on nodulation of cowpea (Vigna unguiculata)

    Energy Technology Data Exchange (ETDEWEB)

    Kopittke, Peter M. [School of Land and Food Sciences, University of Queensland, St. Lucia, Qld 4072 (Australia)]. E-mail: p.kopittke@uq.edu.au; Dart, Peter J. [School of Land and Food Sciences, University of Queensland, St. Lucia, Qld 4072 (Australia); Menzies, Neal W. [School of Land and Food Sciences, University of Queensland, St. Lucia, Qld 4072 (Australia)

    2007-01-15

    Although Cu is phytotoxic at Cu{sup 2+} activities as low as 1-2 {mu}M, the effect of Cu{sup 2+} on the nodulation of legumes has received little attention. The effect of Cu{sup 2+} on nodulation of cowpea (Vigna unguiculata (L.) Walp. cv. Caloona) was examined in a dilute solution culture system utilising a cation exchange resin to buffer solution Cu{sup 2+}. The nodulation process was more sensitive to increasing Cu{sup 2+} activities than both shoot and root growth; whilst a Cu{sup 2+} activity of 1.0 {mu}M corresponded to a 10% reduction in the relative yield of the shoots and roots, a Cu{sup 2+} activity of 0.2 {mu}M corresponded to a 10% reduction in nodulation. This reduction in nodulation with increasing Cu{sup 2+} activity was associated with an inhibition of root hair formation in treatments containing {>=}0.77 {mu}M Cu{sup 2+}, rather than to a reduction in the size of the Rhizobium population. - The nodulation process was more sensitive to increasing Cu{sup 2+} activities than either shoot or root growth.

  16. PRODUCTION COMPONENTS OF Vigna unguiculata (L. Walp IRRIGATED WITH BRACKISH WATER UNDER DIFFERENT LEACHING FRACTIONS

    Directory of Open Access Journals (Sweden)

    JOSÉ FRANCISCO DE CARVALHO

    2016-01-01

    Full Text Available The objective of this work was to evaluate the production components of cowpea ( Vigna unguiculata L. Walp subjected to irrigation with brackish water and different leaching fractions. The experiment was conducted in a lysimeter system of the Department of Agricultural Engineering of the Federal Rural University of Pernambuco, Recife campus. The treatments, consisting of two water salinity levels (ECw (1.2 and 3.3 dS m - 1 and five leaching fractions (0, 5, 10, 15 and 20%, were evaluated using a completely randomized design in a 2x5 factorial arrangement with four replications. The variables evaluated were: number of pods per plant, 100 - grain weight, number of grains per pod, grain and shoot dry weight, grain yield and harvest index. The soil salinity increased with increasing salinity of the water used for irrigation, and reduced with increasing leaching fraction. The salinity of the water used for irrigation influenced only the variables number of pods per plant and grain yield. The estimated leaching fractions of 9.1% and 9.6% inhibited the damage caused by salinity on the number of pods per plant and grain yield, respectively. Therefore, the production of V. unguiculata irrigated with brackish water, leaching salts from the plant root environment, is possible under the conditions evaluated.

  17. Toxic effects of low concentrations of Cu on nodulation of cowpea (Vigna unguiculata)

    International Nuclear Information System (INIS)

    Kopittke, Peter M.; Dart, Peter J.; Menzies, Neal W.

    2007-01-01

    Although Cu is phytotoxic at Cu 2+ activities as low as 1-2 μM, the effect of Cu 2+ on the nodulation of legumes has received little attention. The effect of Cu 2+ on nodulation of cowpea (Vigna unguiculata (L.) Walp. cv. Caloona) was examined in a dilute solution culture system utilising a cation exchange resin to buffer solution Cu 2+ . The nodulation process was more sensitive to increasing Cu 2+ activities than both shoot and root growth; whilst a Cu 2+ activity of 1.0 μM corresponded to a 10% reduction in the relative yield of the shoots and roots, a Cu 2+ activity of 0.2 μM corresponded to a 10% reduction in nodulation. This reduction in nodulation with increasing Cu 2+ activity was associated with an inhibition of root hair formation in treatments containing ≥0.77 μM Cu 2+ , rather than to a reduction in the size of the Rhizobium population. - The nodulation process was more sensitive to increasing Cu 2+ activities than either shoot or root growth

  18. Colony stimulating factor 1 receptor inhibition delays recurrence of glioblastoma after radiation by altering myeloid cell recruitment and polarization

    Science.gov (United States)

    Stafford, Jason H.; Hirai, Takahisa; Deng, Lei; Chernikova, Sophia B.; Urata, Kimiko; West, Brian L.; Brown, J. Martin

    2016-01-01

    Background Glioblastoma (GBM) may initially respond to treatment with ionizing radiation (IR), but the prognosis remains extremely poor because the tumors invariably recur. Using animal models, we previously showed that inhibiting stromal cell–derived factor 1 signaling can prevent or delay GBM recurrence by blocking IR-induced recruitment of myeloid cells, specifically monocytes that give rise to tumor-associated macrophages. The present study was aimed at determining if inhibiting colony stimulating factor 1 (CSF-1) signaling could be used as an alternative strategy to target pro-tumorigenic myeloid cells recruited to irradiated GBM. Methods To inhibit CSF-1 signaling in myeloid cells, we used PLX3397, a small molecule that potently inhibits the tyrosine kinase activity of the CSF-1 receptor (CSF-1R). Combined IR and PLX3397 therapy was compared with IR alone using 2 different human GBM intracranial xenograft models. Results GBM xenografts treated with IR upregulated CSF-1R ligand expression and increased the number of CD11b+ myeloid-derived cells in the tumors. Treatment with PLX3397 both depleted CD11b+ cells and potentiated the response of the intracranial tumors to IR. Median survival was significantly longer for mice receiving combined therapy versus IR alone. Analysis of myeloid cell differentiation markers indicated that CSF-1R inhibition prevented IR-recruited monocyte cells from differentiating into immunosuppressive, pro-angiogenic tumor-associated macrophages. Conclusion CSF-1R inhibition may be a promising strategy to improve GBM response to radiotherapy. PMID:26538619

  19. Inhibition of MAPK and PKC pathways by 60Co γ-radiation in cultured vascular smooth muscle cells

    International Nuclear Information System (INIS)

    Jia Guanghong; Ma Yexin; Xiao Jianming

    2002-01-01

    Objective: To investigate the signal transduction pathways inhibited by 60 Co γ-radiation in cultured vascular smooth muscle cells (VSMC). Methods: The cultured VSMC were irradiated with 60 Co γ-radiation of 3.5, 7.0 and 14 Gy respectively. VSMC proliferation was measured by 3 H-TdR incorporation, while PKC, MAPK activities were determined by radioactivity assay. Results: Proliferation of VSMC was inhibited by 7.0, 14 Gy 60 Co γ-irradiation and the activities of PKC, MAPK were decreased significantly. Conclusion: Inhibitory effect of 7.0, 14 Gy 60 Co γ-irradiation on proliferation of VSMC might be resulted from decrease of the activity of PKC, MAPK

  20. JNK inhibition sensitizes tumor cells to radiation-induced premature senescence via Bcl-2/ROS/DDR signaling pathway

    International Nuclear Information System (INIS)

    Lee, Jae Seon; Lee, Je Jung

    2009-01-01

    Premature senescence is considered as a cellular defense mechanism to prevent tumorigenesis. Although recent evidences demonstrate that c-Jun N-terminal kinase (JNK) is involved in the senescence process, the target and exact mechanism of JNK signaling in the regulation of cell proliferation has yet to be defined. In this study, we investigated the role of JNK in premature senescence and demonstrated JNK inhibition sensitized tumor cells to radiation-induced premature senescence

  1. Inhibition of DNA repair by whole body irradiation induced nitric oxide leads to higher radiation sensitivity in lymphocytes

    International Nuclear Information System (INIS)

    Sharma, Deepak; Santosh Kumar, S.; Raghu, Rashmi; Maurya, D.K.; Sainis, K.B.

    2007-01-01

    Full text: It is well accepted that the sensitivity of mammalian cells is better following whole body irradiation (WBI) as compared to that following in vitro irradiation. However, the underlying mechanisms are not well understood. Following WBI, the lipid peroxidation and cell death were significantly higher in lymphocytes as compared to that in vitro irradiated lymphocytes. Further, WBI treatment of tumor bearing mice resulted in a significantly higher inhibition of EL-4 cell proliferation as compared to in vitro irradiation of EL-4 cells. The DNA repair was significantly slower in lymphocytes obtained from WBI treated mice as compared to that in the cells exposed to same dose of radiation in vitro. Generation of nitric oxide following irradiation and also its role in inhibition of DNA repair have been reported, hence, its levels were estimated under both WBI and in vitro irradiation conditions. Nitric oxide levels were significantly elevated in the plasma of WBI treated mice but not in the supernatant of in vitro irradiated cells. Addition of sodium nitroprusside (SNP), a nitric oxide donor to in vitro irradiated cells inhibited the repair of DNA damage and sensitized cells to undergo cell death. It also enhanced the radiation-induced functional impairment of lymphocytes as evinced from suppression of mitogen-induced IL-2, IFN-γ and bcl-2 mRNA expression. Administration of N G -nitro-L-arginine-methyl-ester(L-NAME), a nitric oxide synthase inhibitor, to mice significantly protected lymphocytes against WBI-induced DNA damage and inhibited in vivo radiation-induced production of nitric oxide. Our results indicated that nitric oxide plays a role in the higher radiosensitivity of lymphocytes in vivo by inhibiting repair of DNA damage

  2. Hypoxia-activated chemotherapeutic TH-302 enhances the effects of VEGF-A inhibition and radiation on sarcomas.

    Science.gov (United States)

    Yoon, C; Lee, H-J; Park, D J; Lee, Y-J; Tap, W D; Eisinger-Mathason, T S K; Hart, C P; Choy, E; Simon, M C; Yoon, S S

    2015-06-30

    Human sarcomas with a poor response to vascular endothelial growth factor-A (VEGF-A) inhibition and radiation therapy (RT) have upregulation of hypoxia-inducible factor 1α (HIF-1α) and HIF-1α target genes. This study examines the addition of the hypoxia-activated chemotherapy TH-302 to VEGF-A inhibition and RT (a.k.a. trimodality therapy). Trimodality therapy was examined in two xenograft models and in vitro in tumour endothelial cells and sarcoma cell lines. In both mouse models, VEGF-A inhibition and radiation showed greater efficacy than either therapy alone in slowing sarcoma growth. When TH-302 was added, this trimodality therapy completely blocked tumour growth with tumours remaining dormant for over 3 months after cessation of therapy. Trimodality therapy caused 2.6- to 6.2-fold more endothelial cell-specific apoptosis than bimodality therapies, and microvessel density and HIF-1α activity were reduced to 11-13% and 13-20% of control, respectively. When trimodality therapy was examined in vitro, increases in DNA damage and apoptosis were much more pronounced in tumour endothelial cells compared with that in sarcoma cells, especially under hypoxia. The combination of TH-302, VEGF-A inhibition, and RT is highly effective in preclinical models of sarcoma and is associated with increased DNA damage and apoptosis in endothelial cells and decreased HIF-1α activity.

  3. Bystander effects in UV-induced genomic instability: Antioxidants inhibit delayed mutagenesis induced by ultraviolet A and B radiation

    Directory of Open Access Journals (Sweden)

    Dahle Jostein

    2005-01-01

    Full Text Available Abstract Background Genomic instability is characteristic of many types of human cancer. Recently, we reported that ultraviolet radiation induced elevated mutation rates and chromosomal instability for many cell generations after ultraviolet irradiation. The increased mutation rates of unstable cells may allow them to accumulate aberrations that subsequently lead to cancer. Ultraviolet A radiation, which primarily acts by oxidative stress, and ultraviolet B radiation, which initially acts by absorption in DNA and direct damage to DNA, both produced genomically unstable cell clones. In this study, we have determined the effect of antioxidants on induction of delayed mutations by ultraviolet radiation. Delayed mutations are indicative of genomic instability. Methods Delayed mutations in the hypoxanthine phosphoribosyl transferase (hprt gene were detected by incubating the cells in medium selectively killing hprt mutants for 8 days after irradiation, followed by a 5 day period in normal medium before determining mutation frequencies. Results The UVB-induced delayed hprt mutations were strongly inhibited by the antioxidants catalase, reduced glutathione and superoxide dismutase, while only reduced glutathione had a significant effect on UVA-induced delayed mutations. Treatment with antioxidants had only minor effects on early mutation frequenies, except that reduced glutathione decreased the UVB-induced early mutation frequency by 24 %. Incubation with reduced glutathione was shown to significantly increase the intracellular amount of reduced glutathione. Conclusion The strong effects of these antioxidants indicate that genomic instability, which is induced by the fundamentally different ultraviolet A and ultraviolet B radiation, is mediated by reactive oxygen species, including hydrogen peroxide and downstream products. However, cells take up neither catalase nor SOD, while incubation with glutathione resulted in increased intracellular levels of

  4. Radiosensitive Down syndrome lymphoblastoid lines have normal ionizing-radiation-induced inhibition of DNA synthesis

    International Nuclear Information System (INIS)

    Ganges, M.B.; Robbins, J.H.; Jiang, H.; Hauser, C.; Tarone, R.E.

    1988-01-01

    The extent of X-ray-induced inhibition of DNA synthesis was determined in radiosensitive lymphoblastoid lines from 3 patients with Down syndrome and 3 patients with ataxia telangiectasia (AT). Compared to 6 normal control lines, the 3 AT lines were abnormally resistant to X-ray-induced inhibition of DNA synthesis, while the 3 Down syndrome lines had normal inhibition. These results demonstrate that radiosensitive human cells can have normal X-ray-induced inhibition of DNA synthesis and provide new evidence for the dissociation of radioresistant DNA synthesis. (author). 27 refs.; 1 fig.; 1 tab

  5. DNA Repair Inhibition by Mercuric Chloride in Earthworms after Exposure to Radiation

    Energy Technology Data Exchange (ETDEWEB)

    Ryu, Tae Ho; Kim, Jin Kyu [Korea Atomic Energy Research Institute, Daejeon (Korea, Republic of); Nili, Mohammad [Dawnesh Radiation Research Institute, Barcelona (Spain); An, Kwang Guk [Chungnam National University, Daejeon (Korea, Republic of)

    2011-10-15

    All organisms are being exposed to harmful factors present in the environment. Ionizing radiation can damage DNA through a series of molecular events depending on the radiation energy. The biological effects due to the combined action of ionizing radiation with the other factor are hard to estimate and predict in advance. Recently International Commission on Radiological Protection (ICRP) requires the effect data of ionizing radiation on non-human biota for the radiological protection of the environment. Earthworms have been identified by the ICRP as one of the reference animals and plants to be used in environmental radiation protection. Particularly, the earthworm Eisenia fetida can be used as a bio-indicator of pollution in soil. This study was performed to investigate the acute genotoxic effects of radiation and the synergistic effects between radiation and mercury in earthworm, E. fetida

  6. DNA Repair Inhibition by Mercuric Chloride in Earthworms after Exposure to Radiation

    International Nuclear Information System (INIS)

    Ryu, Tae Ho; Kim, Jin Kyu; Nili, Mohammad; An, Kwang Guk

    2011-01-01

    All organisms are being exposed to harmful factors present in the environment. Ionizing radiation can damage DNA through a series of molecular events depending on the radiation energy. The biological effects due to the combined action of ionizing radiation with the other factor are hard to estimate and predict in advance. Recently International Commission on Radiological Protection (ICRP) requires the effect data of ionizing radiation on non-human biota for the radiological protection of the environment. Earthworms have been identified by the ICRP as one of the reference animals and plants to be used in environmental radiation protection. Particularly, the earthworm Eisenia fetida can be used as a bio-indicator of pollution in soil. This study was performed to investigate the acute genotoxic effects of radiation and the synergistic effects between radiation and mercury in earthworm, E. fetida

  7. Species differences in ligand specificity of auxin-controlled elongation and auxin transport: comparing Zea and Vigna

    Science.gov (United States)

    Zhao, Hu; Hertel, Rainer; Ishikawa, Hideo; Evans, Michael L.

    2002-01-01

    The plant hormone auxin affects cell elongation in both roots and shoots. In roots, the predominant action of auxin is to inhibit cell elongation while in shoots auxin, at normal physiological levels, stimulates elongation. The question of whether the primary receptor for auxin is the same in roots and shoots has not been resolved. In addition to its action on cell elongation in roots and shoots, auxin is transported in a polar fashion in both organs. Although auxin transport is well characterized in both roots and shoots, there is relatively little information on the connection, if any, between auxin transport and its action on elongation. In particular, it is not clear whether the protein mediating polar auxin movement is separate from the protein mediating auxin action on cell elongation or whether these two processes might be mediated by one and the same receptor. We examined the identity of the auxin growth receptor in roots and shoots by comparing the response of roots and shoots of the grass Zea mays L. and the legume Vigna mungo L. to indole-3-acetic acid, 2-naphthoxyacetic acid, 4,6-dichloroindoleacetic acid, and 4,7-dichloroindoleacetic acid. We also studied whether or not a single protein might mediate both auxin transport and auxin action by comparing the polar transport of indole-3-acetic acid and 2-naphthoxyacetic acid through segments from Vigna hypocotyls and maize coleoptiles. For all of the assays performed (root elongation, shoot elongation, and polar transport) the action and transport of the auxin derivatives was much greater in the dicots than in the grass species. The preservation of ligand specificity between roots and shoots and the parallels in ligand specificity between auxin transport and auxin action on growth are consistent with the hypothesis that the auxin receptor is the same in roots and shoots and that this protein may mediate auxin efflux as well as auxin action in both organ types.

  8. Inhibition of trihalomethane formation in city water by radiation-ozone treatment and rapid composting of radiation disinfected sewage sludge

    International Nuclear Information System (INIS)

    Takehisa, M.; Arai, H.; Arai, M.

    1985-01-01

    Humic acid and Fulvic acid in natural water are precursors of carcinogenic THM which is formed during chlorine disinfection in city water processing. The radiation-oxidation process in the presence of ozone is effective to remove the precursors. The THM formation was reduced more than the decrease in TOC by the combination treatment. This is mainly due to a change in the chemical structure of the oxidation products. A composting of radiation disinfected sludge cake for agricultural reuse could be achieved within 3 days primary fermentation in a sewage plant. The rapid fermentation with use of radiation is effective to scale down of a fermentor of composting plant and the process reduces a health risk from the workers as well as final users. (author)

  9. Inhibition of trihalomethane formation in city water by radiation-ozone treatment and rapid composting of radiation disinfected sewage sludge

    Energy Technology Data Exchange (ETDEWEB)

    Takehisa, M; Arai, H; Arai, M

    1985-01-01

    Humic acid and Fulvic acid in natural water are precursors of carcinogenic THM which is formed during chlorine disinfection in city water processing. The radiation-oxidation process in the presence of ozone is effective to remove the precursors. The THM formation was reduced more than the decrease in TOC by the combination treatment. This is mainly due to a change in the chemical structure of the oxidation products. A composting of radiation disinfected sludge cake for agricultural reuse could be achieved within 3 days primary fermentation in a sewage plant. The rapid fermentation with use of radiation is effective to scale down a fermentor of a composting plant and the process reduces health risk for the workers as well as final users.

  10. Activation of adenosine receptors and inhibition of cyclooxygenases: two recent pharmacological approaches to modulation of radiation suppressed hematopoiesis

    International Nuclear Information System (INIS)

    Hofer, M.; Pospisil, M.; Vacek, A.; Hola, J.; Weiterova, L.; Streitova, D.; Znojil, V.

    2008-01-01

    Searching for drugs conforming to requirements for protection and/or treatment of radiation-induced damage belongs to the most important tasks of current radiobiology. In the Laboratory of Experimental Hematology, Institute of Biophysics, v.v.i., Academy of Sciences of the Czech Republic, Brno, Czech Republic, two original approaches for stimulation of radiation-suppressed hematopoiesis have been tested in recent years, namely activation of adenosine receptors and inhibition of cyclooxygenases. Non-selective activation of adenosine receptors, induced by combined administration of dipyridamole, a drug preventing adenosine uptake and supporting thus its extracellular receptor-mediated action, and adenosine monophosphate, an adenosine prodrug, has been found to stimulate hematopoiesis when the drugs were given either pre- or post-irradiation. When synthetic adenosine receptor agonists selective for individual adenosine receptor subtypes were tested, stimulatory effects in myelosuppressed mice have been found after administration of IB-MECA, a selective adenosine A3 receptor agonist. Non-selective cyclooxygenase inhibitors, inhibiting both cyclooxygenase-1 (COX-1) and cyclooxygenase-2 (COX-2), indomethacin, diclofenac, or flurbiprofen, have been observed to act positively on radiation-perturbed hematopoiesis in sublethally irradiated mice. However, their undesirable gastrointestinal side effects have been found to negatively influence survival of lethally irradiated animals. Recently tested selective COX-2 inhibitor meloxicam, preserving protective action of COX-1-synthesized prostaglandins in the gastrointestinal tissues, has been observed to retain the hematopoiesis-stimulating effects of non-selective cyclooxygenase inhibitors and to improve the survival of animals exposed to lethal radiation doses. These findings bear evidence for the possibility to use selective adenosine A3 receptor agonists and selective COX-2 inhibitors in human practice for treatment of

  11. MiR-124 Inhibits Growth and Enhances Radiation-Induced Apoptosis in Non-Small Cell Lung Cancer by Inhibiting STAT3

    Directory of Open Access Journals (Sweden)

    Mengjie Wang

    2017-12-01

    Full Text Available Background/Aims: A growing body of evidence indicates that the abnormal expression of microRNAs (miRNAs play an important role in sensitizing the cellular response to ionizing radiation (IR. The aim of this study was to investigate whether the expression of miR-124 correlated with radiosensitivity in the context of non-small-cell lung carcinoma (NSCLC. Methods: Quantitative reverse transcription polymerase chain reaction (RT-PCR was used to quantify miR-124 expression in NSCLC tissues and cell lines. The role of miR-124 in NSCLC proliferation and radiosensitivity was analyzed using CCK-8 and flow cytometry apoptosis assays. Luciferase activity assays, RT-PCR, and Western blot assays were performed to confirm the target gene of miR-124. Results: In this study, we found that miR-124 was downregulated both in clinical NSCLC samples and in cell lines. miR-124 inhibited the proliferation of NSCLC cells and enhanced the apoptosis of NSCLC cells exposed to ionizing radiation. We identified signal transducer and activator of transcription 3 (STAT3 as a direct target of miR-124 by using target prediction algorithms and luciferase assays. Overexpression of STAT3 in A549 cell lines restored the enhanced radiosensitivity induced by miR-124. Conclusion: Taking these observations into consideration, we illustrated that miR-124 is a potential target for enhancing the radiosensitivity of NSCLC cells by targeting STAT3.

  12. Lead and radiation induced hepatic lesions in Swiss albino mice and their inhibition by vitamin E

    International Nuclear Information System (INIS)

    Gajawat, Sunita; Goyal, P.K.

    2002-01-01

    The present study has been carried out to access the protective role of vitamin E against hepato-toxicity induced by lead and radiation. The present study demonstrates that the application of vitamin E prior to lead and gamma radiation exposure is quite potential to provide protection against hepatic lesions induced by such teratogens

  13. Topical W-7 inhibits ultraviolet radiation-induced melanogenesis in Skh:HR2 pigmented hairless mice

    Energy Technology Data Exchange (ETDEWEB)

    Dowdy, J.C. [Univ. of Memphis, Div. of Molecular Sciences and Microbiology, Memphis, Tennessee (United States); Anthony, F.A.; Costlow, M.E. [Schering-Plough HealthCare Products, Inc., Advanced Product Research, Memphis, Tennessee (United States)

    1995-08-01

    We studied the effect of N-(6-aminohexyl)-5-chloro-1-napthalenesulfonamide (W-7) on ultraviolet radiation (UVR)-induced melanogenesis (tanning) in Skh:HR2 pigmented hairless mice. Topically pretreated mice were exposed to subminimal edematogenic as well as edematogenic UVR doses to establish whether W-7-UVR-induced edema prophylaxis allows increased melanogenesis while preventing edema. Ultraviolet light-irradiated vehicle control animals developed visible trans; however, both W-7-treated groups failed to tan. Topical W-7 before UVR exposure inhibited UVR induction of dopa oxidase activity in melanocytes by 49% (P=0.029) and inhibited UVR-induced deposition of melanin in the epidermis by 88% (P=0.006). Topical W-7 blocked 23% of the UVR but this blockage could not account for the inhibition of dopa oxidase and melanization. We conclude that, in addition to preventing edema, W-7 inhibits UVR-induced melanogenesis, possibly by affecting Ca{sup 2+}-calmodulin and/or protein kinase C-dependent processes. (au) 30 refs.

  14. Homologous recombination in mammalian cells: effect of p53 and Bcl-2 proteins, replication inhibition and ionizing radiations

    International Nuclear Information System (INIS)

    Saintigny, Yannick

    1999-01-01

    The control of cell cycle, associated with the mechanisms of replication, DNA repair/recombination allows the cells to maintain their genetic integrity. The p53 protein ensures the control of G1/S transition. Its inactivation would allow to initial replication on damaged matrix and lead to the block of replication forks followed by DNA strand breaks, good substrates for recombination. This work shows that the expression of mutant p53 protein stimulates both spontaneous and radio-induced homologous recombination, independently of the control of cell cycle. Moreover, the use of a set of replication inhibitors show that inhibition of the replication elongation stimulates recombination more strongly than the initiation inhibition. Replication arrest by these inhibitors also significantly increases the number of DNA strand breaks. These results highlighted a point of action of p53 protein on the ultimate stages of the homologous recombination mechanism. Lastly, the expression of Bcl-2 protein inhibits apoptosis and increases survival, but specifically inhibits conservative recombination, after radiation as well as in absence of apoptotic stress. The extinction of this mechanism of DNA repair is associated with an increase of mutagenesis. Taken together, these results allow ta consider the maintenance of the genetic stability as a cellular network involving different pathways. A multiple stages model for tumoral progression can be deduced. (author) [fr

  15. Topical W-7 inhibits ultraviolet radiation-induced melanogenesis in Skh:HR2 pigmented hairless mice

    International Nuclear Information System (INIS)

    Dowdy, J.C.; Anthony, F.A.; Costlow, M.E.

    1995-01-01

    We studied the effect of N-(6-aminohexyl)-5-chloro-1-napthalenesulfonamide (W-7) on ultraviolet radiation (UVR)-induced melanogenesis (tanning) in Skh:HR2 pigmented hairless mice. Topically pretreated mice were exposed to subminimal edematogenic as well as edematogenic UVR doses to establish whether W-7-UVR-induced edema prophylaxis allows increased melanogenesis while preventing edema. Ultraviolet light-irradiated vehicle control animals developed visible trans; however, both W-7-treated groups failed to tan. Topical W-7 before UVR exposure inhibited UVR induction of dopa oxidase activity in melanocytes by 49% (P=0.029) and inhibited UVR-induced deposition of melanin in the epidermis by 88% (P=0.006). Topical W-7 blocked 23% of the UVR but this blockage could not account for the inhibition of dopa oxidase and melanization. We conclude that, in addition to preventing edema, W-7 inhibits UVR-induced melanogenesis, possibly by affecting Ca 2+ -calmodulin and/or protein kinase C-dependent processes. (au) 30 refs

  16. Polo-like kinase 1 (PLK1) inhibition suppresses cell growth and enhances radiation sensitivity in medulloblastoma cells

    International Nuclear Information System (INIS)

    Harris, Peter S; Foreman, Nicholas K; Vibhakar, Rajeev; Venkataraman, Sujatha; Alimova, Irina; Birks, Diane K; Donson, Andrew M; Knipstein, Jeffrey; Dubuc, Adrian; Taylor, Michael D; Handler, Michael H

    2012-01-01

    Medulloblastoma is the most common malignant brain tumor in children and remains a therapeutic challenge due to its significant therapy-related morbidity. Polo-like kinase 1 (PLK1) is highly expressed in many cancers and regulates critical steps in mitotic progression. Recent studies suggest that targeting PLK1 with small molecule inhibitors is a promising approach to tumor therapy. We examined the expression of PLK1 mRNA in medulloblastoma tumor samples using microarray analysis. The impact of PLK1 on cell proliferation was evaluated by depleting expression with RNA interference (RNAi) or by inhibiting function with the small molecule inhibitor BI 2536. Colony formation studies were performed to examine the impact of BI 2536 on medulloblastoma cell radiosensitivity. In addition, the impact of depleting PLK1 mRNA on tumor-initiating cells was evaluated using tumor sphere assays. Analysis of gene expression in two independent cohorts revealed that PLK1 mRNA is overexpressed in some, but not all, medulloblastoma patient samples when compared to normal cerebellum. Inhibition of PLK1 by RNAi significantly decreased medulloblastoma cell proliferation and clonogenic potential and increased cell apoptosis. Similarly, a low nanomolar concentration of BI 2536, a small molecule inhibitor of PLK1, potently inhibited cell growth, strongly suppressed the colony-forming ability, and increased cellular apoptosis of medulloblastoma cells. Furthermore, BI 2536 pretreatment sensitized medulloblastoma cells to ionizing radiation. Inhibition of PLK1 impaired tumor sphere formation of medulloblastoma cells and decreased the expression of SRY (sex determining region Y)-box 2 (SOX2) mRNA in tumor spheres indicating a possible role in targeting tumor inititiating cells. Our data suggest that targeting PLK1 with small molecule inhibitors, in combination with radiation therapy, is a novel strategy in the treatment of medulloblastoma that warrants further investigation

  17. Inhibition of intestinal epithelial apoptosis improves survival in a murine model of radiation combined injury.

    Directory of Open Access Journals (Sweden)

    Enjae Jung

    Full Text Available World conditions place large populations at risk from ionizing radiation (IR from detonation of dirty bombs or nuclear devices. In a subgroup of patients, ionizing radiation exposure would be followed by a secondary infection. The effects of radiation combined injury are potentially more lethal than either insult in isolation. The purpose of this study was to determine mechanisms of mortality and possible therapeutic targets in radiation combined injury. Mice were exposed to IR with 2.5 Gray (Gy followed four days later by intratracheal methicillin-resistant Staphylococcus aureus (MRSA. While either IR or MRSA alone yielded 100% survival, animals with radiation combined injury had 53% survival (p = 0.01. Compared to IR or MRSA alone, mice with radiation combined injury had increased gut apoptosis, local and systemic bacterial burden, decreased splenic CD4 T cells, CD8 T cells, B cells, NK cells, and dendritic cells, and increased BAL and systemic IL-6 and G-CSF. In contrast, radiation combined injury did not alter lymphocyte apoptosis, pulmonary injury, or intestinal proliferation compared to IR or MRSA alone. In light of the synergistic increase in gut apoptosis following radiation combined injury, transgenic mice that overexpress Bcl-2 in their intestine and wild type mice were subjected to IR followed by MRSA. Bcl-2 mice had decreased gut apoptosis and improved survival compared to WT mice (92% vs. 42%; p<0.01. These data demonstrate that radiation combined injury results in significantly higher mortality than could be predicted based upon either IR or MRSA infection alone, and that preventing gut apoptosis may be a potential therapeutic target.

  18. Inhibition of intestinal epithelial apoptosis improves survival in a murine model of radiation combined injury.

    Science.gov (United States)

    Jung, Enjae; Perrone, Erin E; Brahmamdan, Pavan; McDonough, Jacquelyn S; Leathersich, Ann M; Dominguez, Jessica A; Clark, Andrew T; Fox, Amy C; Dunne, W Michael; Hotchkiss, Richard S; Coopersmith, Craig M

    2013-01-01

    World conditions place large populations at risk from ionizing radiation (IR) from detonation of dirty bombs or nuclear devices. In a subgroup of patients, ionizing radiation exposure would be followed by a secondary infection. The effects of radiation combined injury are potentially more lethal than either insult in isolation. The purpose of this study was to determine mechanisms of mortality and possible therapeutic targets in radiation combined injury. Mice were exposed to IR with 2.5 Gray (Gy) followed four days later by intratracheal methicillin-resistant Staphylococcus aureus (MRSA). While either IR or MRSA alone yielded 100% survival, animals with radiation combined injury had 53% survival (p = 0.01). Compared to IR or MRSA alone, mice with radiation combined injury had increased gut apoptosis, local and systemic bacterial burden, decreased splenic CD4 T cells, CD8 T cells, B cells, NK cells, and dendritic cells, and increased BAL and systemic IL-6 and G-CSF. In contrast, radiation combined injury did not alter lymphocyte apoptosis, pulmonary injury, or intestinal proliferation compared to IR or MRSA alone. In light of the synergistic increase in gut apoptosis following radiation combined injury, transgenic mice that overexpress Bcl-2 in their intestine and wild type mice were subjected to IR followed by MRSA. Bcl-2 mice had decreased gut apoptosis and improved survival compared to WT mice (92% vs. 42%; p<0.01). These data demonstrate that radiation combined injury results in significantly higher mortality than could be predicted based upon either IR or MRSA infection alone, and that preventing gut apoptosis may be a potential therapeutic target.

  19. Inhibition of radiation-induced EGFR nuclear import by C225 (Cetuximab) suppresses DNA-PK activity

    International Nuclear Information System (INIS)

    Dittmann, Klaus; Mayer, Claus; Rodemann, Hans-Peter

    2005-01-01

    Background and purpose: Inhibition of EGFR-function can induce radiosensitization in tumor cells. Purpose of our investigation was to identify the possible molecular mechanism of radiosensitization following treatment with anti-EGFR-antibody C225 (Cetuximab). Materials and methods: The effect of C225 on radiation response was determined in human cell lines of bronchial carcinoma (A549) and breast adenoma cells (MDA MB 231). The molecular effects of C225 on EGFR-function after irradiation were analyzed applying western blotting, immune-precipitation and kinase assays. Effects on DNA-repair were detected by quantification of γ-H2AX positive foci 24 h after irradiation. Results: The EGFR specific antibody C225 induced radiosensitization in A549 and also in MDA MB 231 cells. Radiosensitization in A549 was associated with blockage of radiation-induced EGFR transport into the nucleus, and immobilized the complex of EGFR with DNA-dependent protein kinase (DNA-PK) in the cytoplasm. As a consequence radiation-induced DNA-PK activation was abolished, a process that is essential for DNA-repair after radiation exposure. Likewise C225 treatment increased the residual amount of γ-H2AX-positive foci 24 h after irradiation in A549 and in MDA MB 231 cells. Conclusions: Our results suggest that irradiation induced DNA-PK activation-essential for DNA repair-may be hampered specifically by use of the anti-EGFR-antibody C225. This process is associated with radiosensitization

  20. Inhibition of EGFR or IGF-1R signaling enhances radiation response in head and neck cancer models but concurrent inhibition has no added benefit

    International Nuclear Information System (INIS)

    Raju, Uma; Molkentine, David P; Valdecanas, David R; Deorukhkar, Amit; Mason, Kathryn A; Buchholz, Thomas A; Meyn, Raymond E; Ang, Kie-Kian; Skinner, Heath

    2015-01-01

    Interaction between the epidermal growth factor receptor (EGFR) and the insulin-like growth factor receptor (IGF-1R) has been well established in many cancer types. We investigated the effects of cetuximab (EGFR antibody) and IMC-A12 (IGF-1R antibody) on the response of head and neck squamous cell carcinoma (HNSCC) to radiation therapy (RT). The effects of cetuximab and IMC-A12 on cell viability and radiosensitivity were determined by clonogenic cell survival assay. Formation of nuclear γ-H2AX and 53BP1 foci was monitored by immunofluorescence. Alterations in target signaling were analyzed by Western blots. In vivo tumor growth delay assay was performed to determine the efficacy of triple therapy with IMC-A12, cetuximab, and RT. In vitro data showed that cetuximab differentially affected the survival and the radiosensitivity of HNSCC cells. Cetuximab suppressed DNA repair that was evident by the prolonged presence of nuclear γ-H2AX and 53BP1 foci. IMC-A12 did not have any effect on the cell survival. However, it increased the radiosensitivity of one of the cell lines. EGFR inhibition increased IGF-1R expression levels and also the association between EGFR and IGF-1R. Addition of IMC-A12 to cetuximab did not increase the radiosensitivity of these cells. Tumor xenografts exhibited enhanced response to RT in the presence of either cetuximab or IMC-A12. Concurrent treatment regimen failed to further enhance the tumor response to cetuximab and/or RT. Taken together our data suggest that concomitant inhibition of both EGFR and IGF-1R pathways did not yield additional therapeutic benefit in overcoming resistance to RT

  1. Selenoprotein P Inhibits Radiation-Induced Late Reactive Oxygen Species Accumulation and Normal Cell Injury

    Energy Technology Data Exchange (ETDEWEB)

    Eckers, Jaimee C.; Kalen, Amanda L.; Xiao, Wusheng; Sarsour, Ehab H.; Goswami, Prabhat C., E-mail: prabhat-goswami@uiowa.edu

    2013-11-01

    Purpose: Radiation is a common mode of cancer therapy whose outcome is often limited because of normal tissue toxicity. We have shown previously that the accumulation of radiation-induced late reactive oxygen species (ROS) precedes cell death, suggesting that metabolic oxidative stress could regulate cellular radiation response. The purpose of this study was to investigate whether selenoprotein P (SEPP1), a major supplier of selenium to tissues and an antioxidant, regulates late ROS accumulation and toxicity in irradiated normal human fibroblasts (NHFs). Methods and Materials: Flow cytometry analysis of cell viability, cell cycle phase distribution, and dihydroethidium oxidation, along with clonogenic assays, were used to measure oxidative stress and toxicity. Human antioxidant mechanisms array and quantitative real-time polymerase chain reaction assays were used to measure gene expression during late ROS accumulation in irradiated NHFs. Sodium selenite addition and SEPP1 overexpression were used to determine the causality of SEPP1 regulating late ROS accumulation and toxicity in irradiated NHFs. Results: Irradiated NHFs showed late ROS accumulation (4.5-fold increase from control; P<.05) that occurs after activation of the cell cycle checkpoint pathways and precedes cell death. The mRNA levels of CuZn- and Mn-superoxide dismutase, catalase, peroxiredoxin 3, and thioredoxin reductase 1 increased approximately 2- to 3-fold, whereas mRNA levels of cold shock domain containing E1 and SEPP1 increased more than 6-fold (P<.05). The addition of sodium selenite before the radiation treatment suppressed toxicity (45%; P<.05). SEPP1 overexpression suppressed radiation-induced late ROS accumulation (35%; P<.05) and protected NHFs from radiation-induced toxicity (58%; P<.05). Conclusion: SEPP1 mitigates radiation-induced late ROS accumulation and normal cell injury.

  2. Temperature-specific inhibition of human red cell Na+/K+ ATPase by 2450-MHz microwave radiation

    Energy Technology Data Exchange (ETDEWEB)

    Allis, J.W.; Sinha-Robinson, B.L.

    1987-01-01

    The ATPase activity in human red blood cell membranes was investigated in vitro as a function of temperature and exposure to 2450-MHz continuous wave microwave radiation to confirm and extend a report of Na+ transport inhibition under certain conditions of temperature and exposure. Assays were conducted spectrophotometrically during microwave exposure with a custom-made spectrophotometer-waveguide apparatus. Temperature profiles of total ATPase and Ca+2 ATPase (ouabain-inhibited) activity between 17 and 31 degrees C were graphed as an Arrhenius plot. Each data set was fitted to two straight lines which intersect between 23 and 24 degrees C. The difference between the total and Ca+2 ATPase activities, which represented the Na+/K+ ATPase activity, was also plotted and treated similarly to yield an intersection near 25 degrees C. Exposure of membrane suspensions to electromagnetic radiation, at a dose rate of 6 W/kg and at five temperatures between 23 and 27 degrees C, resulted in an activity change only for the Na+/K+ ATPase at 25 degrees C. The activity decreased by approximately 35% compared to sham-irradiated samples. A possible explanation for the unusual temperature/microwave interaction is proposed.

  3. The Vigna Genome Server, 'VigGS': A Genomic Knowledge Base of the Genus Vigna Based on High-Quality, Annotated Genome Sequence of the Azuki Bean, Vigna angularis (Willd.) Ohwi & Ohashi.

    Science.gov (United States)

    Sakai, Hiroaki; Naito, Ken; Takahashi, Yu; Sato, Toshiyuki; Yamamoto, Toshiya; Muto, Isamu; Itoh, Takeshi; Tomooka, Norihiko

    2016-01-01

    The genus Vigna includes legume crops such as cowpea, mungbean and azuki bean, as well as >100 wild species. A number of the wild species are highly tolerant to severe environmental conditions including high-salinity, acid or alkaline soil; drought; flooding; and pests and diseases. These features of the genus Vigna make it a good target for investigation of genetic diversity in adaptation to stressful environments; however, a lack of genomic information has hindered such research in this genus. Here, we present a genome database of the genus Vigna, Vigna Genome Server ('VigGS', http://viggs.dna.affrc.go.jp), based on the recently sequenced azuki bean genome, which incorporates annotated exon-intron structures, along with evidence for transcripts and proteins, visualized in GBrowse. VigGS also facilitates user construction of multiple alignments between azuki bean genes and those of six related dicot species. In addition, the database displays sequence polymorphisms between azuki bean and its wild relatives and enables users to design primer sequences targeting any variant site. VigGS offers a simple keyword search in addition to sequence similarity searches using BLAST and BLAT. To incorporate up to date genomic information, VigGS automatically receives newly deposited mRNA sequences of pre-set species from the public database once a week. Users can refer to not only gene structures mapped on the azuki bean genome on GBrowse but also relevant literature of the genes. VigGS will contribute to genomic research into plant biotic and abiotic stresses and to the future development of new stress-tolerant crops. © The Author 2015. Published by Oxford University Press on behalf of Japanese Society of Plant Physiologists. All rights reserved. For permissions, please email: journals.permissions@oup.com.

  4. 1950MHz Radio Frequency Electromagnetic Radiation Inhibits Testosterone Secretion of Mouse Leydig Cells.

    Science.gov (United States)

    Lin, Yan-Yun; Wu, Tao; Liu, Jun-Ye; Gao, Peng; Li, Kang-Chu; Guo, Qi-Yan; Yuan, Meng; Lang, Hai-Yang; Zeng, Li-Hua; Guo, Guo-Zhen

    2017-12-23

    More studies that are focused on the bioeffects of radio-frequency (RF) electromagnetic radiation that is generated from the communication devices, but there were few reports with confirmed results about the bioeffects of RF radiation on reproductive cells. To explore the effects of 1950 MHz RF electromagnetic radiation (EMR) on mouse Leydig (TM3) cells. TM3 cells were irradiated or sham-irradiated continuously for 24 h by the specific absorption rate (SAR) 3 W/kg radiation. At 0, 1, 2, 3, 4, and 5 days after irradiation, cell proliferation was detected by cell counting kit-8 (CCK-8) method, cell cycle distribution, percentage of apoptosis, and cellular reactive oxygen species (ROS) were examined by flow cytometry, Testosterone level was measured using enzyme-linked immunosorbent assay (ELISA) assay, messenger ribonucleic acid (mRNA) expression level of steroidogenic acute regulatory protein (StAR) and P450scc in TM3 cells was detected by real-time polymerase chain reaction (PCR). After being irradiated for 24 h, cell proliferation obviously decreased and cell cycle distribution, secretion capacity of Testosterone, and P450scc mRNA level were reduced. While cell apoptosis, ROS, and StAR mRNA level did not change significantly. The current results indicated that 24 h of exposure at 1950 MHz 3 W/kg radiation could cause some adverse effects on TM3 cells proliferation and Testosterone secretion, further studies about the biological effects in the reproductive system that are induced by RF radiation are also needed.

  5. Serrated leaf mutant in mungbean (Vigna radiata (L) Wilczek)

    International Nuclear Information System (INIS)

    Malik, I.A.; Ghulam, Sarwar; Yousaf, Ali; Saleem, M.

    1988-01-01

    Dry dormant seeds of mungbean (Vigna radiata (L) Wilczek) were treated with gamma rays (15, 30 and 60 kR). The serrated leaf mutation was noticed in M 2 of cultivar Pak 32 treated with 60 kR. Cf 14 plants, 3 showed the altered leaf structure and the others were normal. The feature of this mutant was the deep serration of leaflet margins. The mutant had large thick leaflets with prominent venation. The mutant bred true in the M 3 and successive generation. Details of the morphological characteristics of the mutant are presented. The mutant exhibited slower growth particularly during the early stages of development, flowered later and attained shorter height. There was an increase in the number of pods, in seed weight and in seed protein content, but number of seed per pod was considerably reduced. The seed coat colour showed a change from green to yellowish green. In the mutant's flowers the stamina were placed much below the stigma level and the stigma sometimes protruded the corolla. Outcrossing of 4% recorded in some of the mutant lines revealed a reduced cleistogamy. The low number of seeds per pod in the mutant could be due to reduced pollen fertility. The mutant behaved as monogenic recessive. The symbols SL/sl are proposed for this allelic pair. The mutant may have use as a green manure crop because of its large foliage and for the breeders as a genetic marker

  6. Regeneration and genetic transformation of cowpea (Vigna unguiculata Walp.)

    International Nuclear Information System (INIS)

    Filippone, E.; Colucci, G.; Ciardi, F.; Monti, L.

    1997-01-01

    Regeneration of cowpea (Vigna unguiculata Walp.) was achieved through massive bud formation induced in apical and lateral meristems by the herbicide Thidiazuron (TDZ). The effect of TDZ (5, 10, or 20 μM) was tested in vitro on four different cowpea genotypes. Thidiazuron, even at the highest concentration, had no effect on seed germination. After one month of culture, multiple bud cluster formation was observed in all genotypes tested; about 80% of shoot apices regenerated multiple buds, whilst only 34% of cotyledonary nodes behaved in the same way. Histology of regenerating multiple bud clusters revealed that regeneration initiated from pre-existing meristems in the apex and cotyledonary node. Thidiazuron at 10 μM appeared to be the best concentration to produce clusters with high number of buds, ranging from 5 to 10. Shoot elongation occurred only on MS medium without TDZ. On the same medium, 75% of elongated shoots rooted. For genetic transformation of cowpea, a direct DNA transfer methods in plants under in vivo conditions was tested by electroporation of plasmid DNA into the nodal meristematic cells. Some transformed plants were obtained, and produced T 1 transformed progenies; their transgenic nature was confirmed by Southern analysis. (author). 21 refs, 2 figs, 3 tabs

  7. Regeneration and genetic transformation of cowpea (Vigna unguiculata Walp.)

    Energy Technology Data Exchange (ETDEWEB)

    Filippone, E; Colucci, G; Ciardi, F; Monti, L [Department of Agronomy and Plant Genetics, Univ. of Naples Federico 11, Portici (Italy)

    1997-07-01

    Regeneration of cowpea (Vigna unguiculata Walp.) was achieved through massive bud formation induced in apical and lateral meristems by the herbicide Thidiazuron (TDZ). The effect of TDZ (5, 10, or 20 {mu}M) was tested in vitro on four different cowpea genotypes. Thidiazuron, even at the highest concentration, had no effect on seed germination. After one month of culture, multiple bud cluster formation was observed in all genotypes tested; about 80% of shoot apices regenerated multiple buds, whilst only 34% of cotyledonary nodes behaved in the same way. Histology of regenerating multiple bud clusters revealed that regeneration initiated from pre-existing meristems in the apex and cotyledonary node. Thidiazuron at 10 {mu}M appeared to be the best concentration to produce clusters with high number of buds, ranging from 5 to 10. Shoot elongation occurred only on MS medium without TDZ. On the same medium, 75% of elongated shoots rooted. For genetic transformation of cowpea, a direct DNA transfer methods in plants under in vivo conditions was tested by electroporation of plasmid DNA into the nodal meristematic cells. Some transformed plants were obtained, and produced T{sub 1} transformed progenies; their transgenic nature was confirmed by Southern analysis. (author). 21 refs, 2 figs, 3 tabs.

  8. Adzuki beans (Vigna angularis seed quality under several drying conditions

    Directory of Open Access Journals (Sweden)

    Osvaldo Resende

    2012-03-01

    Full Text Available This study analyzed the drying process and the seed quality of adzuki beans (Vigna angularis. Grains of adzuki beans, with moisture content of 1.14 (decimal dry basis at harvest and dried until the moisture content of 0.11 (decimal dry basis. were used. Drying was done in an experimental drier maintened at controlled temperatures of 30, 40, 50, 60, and 70 ºC and relative humidity of 52.0, 28.0, 19.1, 13.1, and 6.8%, respectively. Physiological and technological seed quality was evaluated using the germination test, Index of Germination Velocity (IGV, electrical conductivity, and water absorption, respectively. Under the conditions tested in the present study, it can be concluded that drying time for adzuki beans decreases with the higher air temperatures of 60 and 70 ºC, and it affected the physiological and technological seed quality. Thus, to avoid compromising adzuki seeds quality, it is recommended to promote its drying up to 50 ºC.

  9. DNA damage and photosynthetic inhibition induced by solar ultraviolet radiation in tropical phytoplankton (Lake Titicaca, Bolivia)

    NARCIS (Netherlands)

    Helbling, EW; Villafane, VE; Buma, AGJ; Andrade, M; Zaratti, F

    Experiments were conducted during October 1998 in Lake Titicaca, Bolivia (16 degrees S, 68 degrees W, 3810 m a.s.l), to determine the effects of solar ultraviolet radiation (UVR) on phytoplankton photosynthetic rates and DNA damage. Water samples were taken daily and incubated ir? situ or in

  10. Inhibition of oxygen-dependent radiation-induced damage by the nitroxide superoxide dismutase mimic, tempol

    International Nuclear Information System (INIS)

    Mitchell, J.B.; DeGraff, W.; Kaufman, D.; Krishna, M.C.; Samuni, A.; Finkelstein, E.; Ahn, M.S.; Hahn, S.M.; Gamson, J.; Russo, A.

    1991-01-01

    Stable nitroxide radicals have been previously shown to function as superoxide dismutase (SOD)2 mimics and to protect mammalian cells against superoxide and hydrogen peroxide-mediated oxidative stress. These unique characteristics suggested that nitroxides, such as 4-hydroxy-2,2,6,6-tetramethylpiperidine-1-oxyl (Tempol), might protect mammalian cells against ionizing radiation. Treating Chinese hamster cells under aerobic conditions with 5, 10, 50, and 100 mM Tempol 10 min prior to X-rays resulted in radiation protection factors of 1.25, 1.30, 2.1, and 2.5, respectively. However, the reduced form of Tempol afforded no protection. Tempol treatment under hypoxic conditions did not provide radioprotection. Aerobic X-ray protection by Tempol could not be attributed to the induction of intracellular hypoxia, increase in intracellular glutathione, or induction of intracellular SOD mRNA. Tempol thus represents a new class of non-thiol-containing radiation protectors, which may be useful in elucidating the mechanism(s) of radiation-induced cellular damage and may have broad applications in protecting against oxidative stress

  11. Inhibition of Chk1 by CEP-3891 accelerates mitotic nuclear fragmentation in response to ionizing Radiation

    DEFF Research Database (Denmark)

    Syljuåsen, Randi G; Sørensen, Claus Storgaard; Nylandsted, Jesper

    2004-01-01

    The human checkpoint kinase Chk1 has been suggested as a target for cancer treatment. Here, we show that a new inhibitor of Chk1 kinase, CEP-3891, efficiently abrogates both the ionizing radiation (IR)-induced S and G(2) checkpoints. When the checkpoints were abrogated by CEP-3891, the majority (64...

  12. SN-38 Acts as a Radiosensitizer for Colorectal Cancer by Inhibiting the Radiation-induced Up-regulation of HIF-1α.

    Science.gov (United States)

    Okuno, Takayuki; Kawai, Kazushige; Hata, Keisuke; Murono, Koji; Emoto, Shigenobu; Kaneko, Manabu; Sasaki, Kazuhito; Nishikawa, Takeshi; Tanaka, Toshiaki; Nozawa, Hiroaki

    2018-06-01

    Hypoxia offers resistance to therapy in human solid tumors. The aim of the study was to investigate whether SN-38, the active metabolite of irinotecan, acts as a radiosensitizer through inhibition of hypoxia-inducible factor (HIF)-1α in the human colorectal cancer (CRC) cells. HT29 and SW480 cells were cultured with SN-38 (0-4 μM) immediately after irradiation (0-8 Gy). HIF-1α expression was assessed using flow-cytometry and western blot analysis. Cell proliferation was evaluated by the calcein assay. Apoptosis and cell cycle were determined by flow-cytometry. Radiation up-regulated HIF-1α, and SN-38 inhibited the radiation-induced HIF-1α. The combination of radiation and SN-38 inhibited cell proliferation more than radiation alone; treatment with SN-38 after radiation exposure did not increase the number of apoptotic cells, whereas, it enhanced the S and G 2 /M cell-cycle arrest and decreased the population of cells in G 1 Conclusion: SN-38 inhibits the radiation-induced up-regulation of HIF-1α and acts as a radiosensitizer by inducing cell-cycle arrest in CRC cells. Copyright© 2018, International Institute of Anticancer Research (Dr. George J. Delinasios), All rights reserved.

  13. 2-deoxy-d-glucose (2-DG) inhibits radiation induced carcinogenesis (skin tumors) in mice

    International Nuclear Information System (INIS)

    Singh, Saurabh; Bhuria, Vikas; Pandey, Sanjay; Saluja, Daman; Dwarakanath, B.S.

    2014-01-01

    One of the late effects of radiation exposure i.e. carcinogenesis is exemplified by atomic bomb survivors, radiotherapy patients and occupational workers. Enhanced glucose metabolism (Warburg's effect) is a fundamental metabolic change in transformed cells which drives tumorigenesis. It is suggested that Dietary Energy Restriction (DER) that targets glucose metabolism may afford protection against radiation-induced carcinogenesis. However, DER is practically difficult to sustain in humans. Therefore, we have hypothesized that the glycolytic inhibitor, 2-deoxy-D-glucose (2-DG), a potential energy restriction mimetic agent (ERMA) may impair the process of tumorigenesis as an alternative to DER. In the present studies we investigated the effects of dietary 2-DG on radiation induced papillomas in mice. Swiss albino mice (male) were irradiated with a fractionated dose schedule (1.5 Gy ionizing radiation/week for four weeks) focally on the shaved back followed by the application of tumor promoting agent (TPA) once weekly till the termination of the study. Mice were administered 2-DG (0.2% and 0.4% w/v) containing water starting a week after last irradiation. A significant reduction in the tumor incidence, tumor burden, besides increase in the latency period was observed in the 2-DG fed mice. The average tumor incidence (papillomas formation) was reduced to 25% and 37% in 0.2% and 0.4% 2-DG group respectively from 47% in the control group with a significant delay in the onset. Under these conditions, 2-DG considerably enhanced the level of reduced glutathione (GSH) with a concomitant decrease in the lipid peroxidation. 2-DG fed tumor bearing mice showed decrease in splenic CD4 + to CD8 + T-cell ratio and prevented the tumor induced augmentation of T-regulatory cells (CD4 + CD25 + ) which correlated with an increase in CD8 + (CTLs) cells. Dietary 2-DG also reduced the tumor associated and radiation induced angiogenesis. These observations suggest that dietary 2-DG

  14. Inhibition of radiation-induced transformation in vitro by bacterial endotoxins

    International Nuclear Information System (INIS)

    Carew, J.A.; Collins, M.F.; Kennedy, A.R.

    1988-01-01

    Bacterial endotoxins (lipopolysaccharides) were found to suppress X-ray-induced malignant transformation of C3H/10T1/2 cells. Endotoxins were effective if present either throughout the 6-week transformation assay period, or for the final 4-week phase, but not when present only for the initial 2-week phase. Neither growth nor survival of C3H/10T1/2 cells, or a radiation-transformed cell line derived from them, were affected by endotoxins. Also, the endotoxins did not affect the formation of foci by the radiation transformed cells when these cells were co-cultured with untransformed cells. These results suggest that endotoxins exert their effect directly upon the transformation process itself, perhaps at a 'late' step in the conversion of an untransformed to a transformed cell. (author)

  15. Radiation-induced inhibition of human endothelial cells replicating in culture

    International Nuclear Information System (INIS)

    DeGowin, R.L.; Lewis, L.J.; Mason, R.E.; Borke, M.K.; Hoak, J.C.

    1976-01-01

    The radiosensitivity of some tumors may depend upon the sensitivity of their microvasculature to radiation. Heretofore, the dose-response of human endothelial cells replicating in tissue culture has not been published. In studies reported here, we exposed flasks containing 4 to 7 x 10 4 genetically identical human endothelial cells to doses of x irradiation from 125 to 1000 rad. During the phase of logarithmic growth, cell counts were compared to those of an unirradiated control to construct a dose--response curve. Similar studies were performed with normal fibroblasts. We found that 160 rad suppressed endothelial cell replication by 37 percent. Although recovery was evident with doses of 500 rad, no net increase in cell number occurred in 3 weeks in flasks of endothelial cells that received 750 or 1000 rad. Fibroblasts were slightly less sensitive under these conditions. To our knowledge, this is the first report of a radiation dose--response curve for human endothelial cells replicating in culture

  16. Homozygous mutations in the Fhit gene results in resistance to ionizing radiation and inhibition of apoptosis

    International Nuclear Information System (INIS)

    Turner, B.C.; Potoczek, M.B.; Ottey, M.; Croce, C.M.; Huebner, K.

    2001-01-01

    Purpose: The Fhit gene was identified because it represents the most active constitutive chromosome fragile site and has functions often associated with a tumor suppressor gene. Mutations in the Fhit locus have been identified in many cancer-derived cell lines, primary human tumors including lung, head and neck, colon, breast, and esophagus, and are associated with tobacco-induced lung cancers. In this study, we examined the cellular response of mouse epithelial cells with complete loss of Fhit to therapeutic doses of ionizing radiation and the prognostic importance of Fhit protein in early stage breast cancer patients treated with breast conserving therapy. Materials and Methods: Mouse epithelial cell lines containing either homozygous mutant Fhit -/- or wild-type Fhit +/+ were derived from mice (C57BL/6J X 129/SvJ) with either wild-type or inactivated Fhit gene. Clonogenic cell survival assays were carried out on subconfluent cells in logarithmic growth using a 137 Cs irradiator and survival curves were plotted as the log of the surviving cells versus dose and corrected for cloning efficiency. Apoptosis following ionizing radiation was determined by flow cytometry using the Annexin-V FITC kit and DAPI staining. Paraffin-embedded breast tumor blocks were obtained from 42 women with local breast tumor recurrence and 42 matched breast cancer patients without local cancer relapse treated with breast conserving therapy and stained with a 1:4000 dilution of polyclonal antibody to the Fhit protein and scored based on both intensity and distribution of Fhit staining within the invasive breast cancer component. Results: Treatment of Fhit -/- mouse epithelial cells with single fraction doses of ionizing radiation including 2, 4, 6, and 10 Gy result in 4-6 fold increase in cellular survival compared with isogenic parental cells from Fhit +/+ mice. Fhit -/- epithelial cells displayed 3-5 fold lower levels of apoptosis in response to both low and high doses of ionizing

  17. Inhibition of radiation-induced transformation in vitro by bacterial endotoxins

    Energy Technology Data Exchange (ETDEWEB)

    Carew, J A; Collins, M F; Kennedy, A R

    1988-05-01

    Bacterial endotoxins (lipopolysaccharides) were found to suppress X-ray-induced malignant transformation of C3H/10T1/2 cells. Endotoxins were effective if present either throughout the 6-week transformation assay period, or for the final 4-week phase, but not when present only for the initial 2-week phase. Neither growth nor survival of C3H/10T1/2 cells, or a radiation-transformed cell line derived from them, were affected by endotoxins. Also, the endotoxins did not affect the formation of foci by the radiation transformed cells when these cells were co-cultured with untransformed cells. These results suggest that endotoxins exert their effect directly upon the transformation process itself, perhaps at a 'late' step in the conversion of an untransformed to a transformed cell.

  18. SiRNA-mediated IGF-1R inhibition sensitizes human colon cancer SW480 cells to radiation

    International Nuclear Information System (INIS)

    Yavari, Kamal; Taghikhani, Mohammad; Mesbah-Namin, Seyed A.; Maragheh, Mohammad Ghannadi; Babaei, Mohammad Hosein; Arfaee, Ali Jabbary; Madani, Hossein; Mirzaei, Hamid Reza

    2010-01-01

    Purpose. Insulin like growth factor receptor 1 (IGF-1R) is well-documented to play a key role in radiation response and tumor radiosensitivity, thus offering an attractive clinic drug target to enhance tumor sensitivity to anti-cancer radiotherapy. Material and methods. Human colon carcinoma SW480 cells were transfected with the specific small interference RNA (siRNA) expression vector (pkD-shRNA-IGF-1R-V2) designed to target IGF-1R mRNA. The expression of IGF-1R mRNA and its protein among the transfected and untransfected cells were detected by semi-quantitative RT-PCR and ELISA assay. The changes in cell radiosensitivity were examined by MTT assay. Results. Transfection of mammalian expression vector pkD containing IGF-1R siRNA was shown to reduce IGF-1R mRNA levels by up to 95%. ELISA assay detected a similar inhibition of IGF-1R protein levels in cells transfected with IGF-1R siRNA. SW480 cells transfected with the expression vector for siRNA significantly rendered cells more sensitive to radiation and the highest radiation enhancement ratio was 2.02 ± 0.08. Conclusion. These data provide the first evidence that specific siRNA fragment (pkD-shRNA-IGF-1R-V2) targeting human IGF-1R mRNA is able to enhance colon cancer radiosensitivity. Also results indicated that, combining IGF-1R siRNA and radiation significantly enhances antitumor efficacy compared with either modality alone

  19. Targeting DNA double strand break repair with hyperthermia and DNA-PKcs inhibition to enhance the effect of radiation treatment.

    Science.gov (United States)

    van Oorschot, Bregje; Granata, Giovanna; Di Franco, Simone; Ten Cate, Rosemarie; Rodermond, Hans M; Todaro, Matilde; Medema, Jan Paul; Franken, Nicolaas A P

    2016-10-04

    Radiotherapy is based on the induction of lethal DNA damage, primarily DNA double-strand breaks (DSB). Efficient DSB repair via Non-Homologous End Joining or Homologous Recombination can therefore undermine the efficacy of radiotherapy. By suppressing DNA-DSB repair with hyperthermia (HT) and DNA-PKcs inhibitor NU7441 (DNA-PKcsi), we aim to enhance the effect of radiation.The sensitizing effect of HT for 1 hour at 42°C and DNA-PKcsi [1 μM] to radiation treatment was investigated in cervical and breast cancer cells, primary breast cancer sphere cells (BCSCs) enriched for cancer stem cells, and in an in vivo human tumor model. A significant radio-enhancement effect was observed for all cell types when DNA-PKcsi and HT were applied separately, and when both were combined, HT and DNA-PKcsi enhanced radio-sensitivity to an even greater extent. Strikingly, combined treatment resulted in significantly lower survival rates, 2 to 2.5 fold increase in apoptosis, more residual DNA-DSB 6 h post treatment and a G2-phase arrest. In addition, tumor growth analysis in vivo showed significant reduction in tumor growth and elevated caspase-3 activity when radiation was combined with HT and DNA-PKcsi compared to radiation alone. Importantly, no toxic side effects of HT or DNA-PKcsi were found.In conclusion, inhibiting DNA-DSB repair using HT and DNA-PKcsi before radiotherapy leads to enhanced cytotoxicity in cancer cells. This effect was even noticed in the more radio-resistant BCSCs, which are clearly sensitized by combined treatment. Therefore, the addition of HT and DNA-PKcsi to conventional radiotherapy is promising and might contribute to more efficient tumor control and patient outcome.

  20. The Lemna minor growth inhibition test as basis to evaluate radiation or radionuclide-induced effects on freshwater plants

    Energy Technology Data Exchange (ETDEWEB)

    Horemans, N.; Van Hees, M.; Van Hoeck, A.; Vandenhove, H. [Belgian Nuclear Research Centre, SCK.CEN, Boeretang 200, 2400 Mol (Belgium)

    2014-07-01

    The setting of radiation protection criteria for wildlife is based on tiered Environmental Risk Assessments (ERA) methods. At various points in such a tiered ERA robust and transparent benchmark values are needed to indicate the levels of exposure that are considered safe to the environment. Although not ideal these benchmark values are today mainly based on laboratory-based experiments in which the toxic effects of radiation or radionuclides to one selected species exposed under standardised growth conditions is studied. As such an eco-toxicity test has been developed for the floating macrophyte Lemna minor that can be used to test the effect of different chemicals in freshwater. Here the use of this test to estimate effects of radiation or radionuclides and its relevance to the environment will be discussed. First single dose response curves are shown that were set up according to the guidelines for gamma, uranium and as a reference also cadmium. According to the guidelines growth inhibition can be calculated on different endpoints like frond number and frond area. The choice of this endpoint seems to be of major importance as dependent on the stressor significant shifts in the EC50 values, the concentration giving 50% effect, were observed. For gamma radiation a recovery experiment was set up in irradiated plants were allowed to grow again for 7 days in control conditions. It was shown that plant growth rate did not catch up with that of the non-irradiated group. On the contrary, plant cultures that showed a growth inhibition above 40% immediately after irradiation completely collapsed during the recovery period indicating no recovery from the gamma induced damage and resulting in a 3-fold lower EC50 value after 7 days recovery. The relevance of these data to the environment will be further discussed. Finally the influence of different cations on the uranium speciation and toxicity are studied. These experiments are the first steps to set up a biotic ligand

  1. Nodulation studies with induced mutants of black gram (Vigna mungo L.)

    International Nuclear Information System (INIS)

    Mahna, S.K.; Garg, Rekha; Parvateesam, M.

    1990-01-01

    Mutation breeding has been widely used to generate genetic variability in plants, but reports of mutations affecting the root system are less common. In the present work, black gram (Vigna mungo L. var T9), has been used for studies on the effect of induced mutations on nodulation patterns

  2. Photoperiod regulation of development and growth in bambara groundnut (Vigna subterranea).

    NARCIS (Netherlands)

    Linnemann, A.R.; Westphal, E.; Wessel, M.

    1995-01-01

    The influence of constant photoperiods of 10, 12, 14 and 16 h on development and growth in two bambara groundnut genotypes (Vigna subterranea (L.) Verdc., syn. Voandzeia subterranea (L.) Thouars) was studied in a greenhouse experiment in the Netherlands. Data on dry matter accumulation were

  3. Aperçu de la culture du voandzou ( Vigna subterranea (L.) Verdcourt ...

    African Journals Online (AJOL)

    Aperçu de la culture du voandzou ( Vigna subterranea (L.) Verdcourt) au Burkina Faso: enjeux et perspectives d'amélioration de sa productivité. ... 2016 International Formulae Group. All rights reserved. ... The favorite variety is the cream-colored white hilum for its organoleptic, agronomic and aesthetic qualities. Lack of ...

  4. Recent advances in cowpea [ Vigna unguiculata (L.) Walp.] “omics ...

    African Journals Online (AJOL)

    After decades of research on cowpea, significant amount of omics datasets are available and useful in understanding the genetic relationship between Vigna unguiculata ssp. unguiculata and other species belonging to the same genus as well as its genetic variation. Besides, the development of genetic map allowed the ...

  5. Potential biochemical markers for selection of disease resistance in Vigna radiata

    International Nuclear Information System (INIS)

    Badere, R.S.; Koche, D.K.; Choudhary, A.D.; Pawar, S.E.

    2001-01-01

    The Vigna radiata (L.) Wilczek (Green gram), a major pulse crop is prone to damaging diseases caused by Erysiphe polygoni, Cercospora canescens and Rhizoctonia sp. Therefore, the development of multiple resistance is a major breeding objective in green gram. Resistance to powdery mildew has already been developed, however, there are no reports on the development of resistance to Cercospora in green gram. Owing to limitation of conventional screening methods, the improvement for multiple disease resistance is inadequate, in this crop. It needs an efficient and quick selection method, for screening the plant population at an early stage. It is well established that the resistant interaction, in plants, involves accumulation of antibiotic compound phytoalexin (Genestein in Vigna radiata) and induction of enzymes such as β-1,3 gulcanase and Chitinases. These compounds are not only induced by pathogens but also pathogen-derived elicitors. These biochemical compounds can be used as resistance indicative biochemical markers for screening the natural or mutagen induced genetic diversity in populations of Vigna radiata in non-destructive manner. It, however, needs a systematic study of plant defense response. This paper deals with the response of resistant and susceptible cultivars of vigna radiata to Cercospora elicitor and development of non-destructive selection method for disease resistance. (author)

  6. Isolation and characterization of mold fungi and insects infecting sawmill wood, and their inhibition by gamma radiation

    Science.gov (United States)

    Kalawate, Aparna; Mehetre, Sayaji

    2015-12-01

    This article describes the isolation, identification, and characterization of wood-rotting fungi and insects, and their inhibition was studied using gamma radiation. Products manufactured from plantation timber species are deteriorated by wood-rotting fungi such as Hypocrea lixii, Fusarium proliferatum, and Aspergillus flavus, and insects such as powderpost beetles. Proper preservation methods are necessary for ensuring a long service life of wood products. In this study, wood samples were treated with 2.5% copper ethanolamine boron (CEB) (10% w/v) and subsequently irradiated with gamma rays (10 kGy). It was observed that CEB-treated and gamma-irradiated samples controlled fungi and powderpost beetles significantly. As wood is a dead organic material, penetration of chemicals into it is very difficult. Gamma rays easily pass through wooden objects with hidden eggs and dormant spores of insects and fungi, respectively. Gamma irradiation was proved very effective in reducing damage caused by both fungi and insects.

  7. Inhibition of radiation induced migration of human head and neck squamous cell carcinoma cells by blocking of EGF receptor pathways

    International Nuclear Information System (INIS)

    Pickhard, Anja C; Schlegel, Jürgen; Arnold, Wolfgang; Reiter, Rudolf; Margraf, Johanna; Knopf, Andreas; Stark, Thomas; Piontek, Guido; Beck, Carolin; Boulesteix, Anne-Laure; Scherer, Elias Q; Pigorsch, Steffi

    2011-01-01

    Recently it has been shown that radiation induces migration of glioma cells and facilitates a further spread of tumor cells locally and systemically. The aim of this study was to evaluate whether radiotherapy induces migration in head and neck squamous cell carcinoma (HNSCC). A further aim was to investigate the effects of blocking the epidermal growth factor receptor (EGFR) and its downstream pathways (Raf/MEK/ERK, PI3K/Akt) on tumor cell migration in vitro. Migration of tumor cells was assessed via a wound healing assay and proliferation by a MTT colorimeritric assay using 3 HNSCC cell lines (BHY, CAL-27, HN). The cells were treated with increasing doses of irradiation (2 Gy, 5 Gy, 8 Gy) in the presence or absence of EGF, EGFR-antagonist (AG1478) or inhibitors of the downstream pathways PI3K (LY294002), mTOR (rapamycin) and MEK1 (PD98059). Biochemical activation of EGFR and the downstream markers Akt and ERK were examined by Western blot analysis. In absence of stimulation or inhibition, increasing doses of irradiation induced a dose-dependent enhancement of migrating cells (p < 0.05 for the 3 HNSCC cell lines) and a decrease of cell proliferation (p < 0.05 for the 3 HNSCC cell lines). The inhibition of EGFR or the downstream pathways reduced cell migration significantly (almost all p < 0.05 for the 3 HNSCC cell lines). Stimulation of HNSCC cells with EGF caused a significant increase in migration (p < 0.05 for the 3 HNSCC cell lines). After irradiation alone a pronounced activation of EGFR was observed by Western blot analysis. Our results demonstrate that the EGFR is involved in radiation induced migration of HNSCC cells. Therefore EGFR or the downstream pathways might be a target for the treatment of HNSCC to improve the efficacy of radiotherapy

  8. Psoralen plus ultraviolet radiation-induced inhibition of DNA synthesis and viability in human lymphoid cells in vitro

    Energy Technology Data Exchange (ETDEWEB)

    Kraemer, K H; Waters, H L [National Cancer Inst., Bethesda, MD (USA); Ellingson, O L; Tarone, R E

    1979-08-01

    The present study investigated whether conditions of 8-methoxypsoralen (8-MOP) concentration and of exposure to high intensity long wavelength ultraviolet radiation (UV-A) during psoriasis and mycosis fungoides therapy might be sufficient to result directly in decreased lymphoid cell DNA synthesis and viability in vitro. Tritiated thymidine (/sup 3/HtdR) incorporation and cell growth following UV-A exposure alone or with 8-MOP was examined in peripheral blood lymphocytes and in Ebstein-Barr virus transformed human lymphoblastoid cell lines. UV-A exposure alone induced a dose-dependent inhibition of /sup 3/HTdR incorporation in both types of lymphoid cells. Pre-incubation with 0.1 ..mu..g/ml 8-MOP before UV-A exposure induced a significantly greater inhibition of /sup 3/HTdr incorporation. Further inhibition of /sup 3/HTdR incorporation was observed by preincubation of the lymphoblastoid cells with 1.0 ..mu..g/ml 8-MOP but not in the lymphocytes. The concentration of viable lymphoblastoid cells did not decrease below the original concentration after the highest dose of UV-A alone (29,00 J/m/sup 2/) but preincubation with 0.1 ..mu..g/ml 8-MOP resulted in 40% and 0.6% survival respectively after 3000 J/m/sup 2/. This study suggested that the low doses of 8-MOP and UV-A received by patients' lymphocytes may be sufficient to explain the decreased DNA synthesis found in their circulating leucocytes. (author).

  9. A novel Nrf2 activator from microbial transformation inhibits radiation-induced dermatitis in mice

    International Nuclear Information System (INIS)

    Nakagami, Yasuhiro; Masuda, Kayoko

    2016-01-01

    Nuclear factor erythroid 2-related factor 2 (Nrf2) is a transcriptional factor that regulates many antioxidants, and we have recently succeeded in obtaining a novel Nrf2 activator, RS9, from microbial transformation. RS9 is categorized as a triterpenoid, and well-known triterpenoids such as RTA 402 (bardoxolone methyl) and RTA 408 have been tested in clinical trials. RTA 408 lotion is currently being tested in patients at risk for radiation dermatitis. This prompted us to study the profiles of RS9 in the skin. All the above triterpenoids increased the level of an Nrf2-targeted gene, NADPH:quinone oxidoreductase-1, in normal human epidermal keratinocytes. Among them, the activity of RS9 was prominent; furthermore, the cellular toxicity was less compared with RTA compounds. BALB/c mice were irradiated with 30 Gy/day on Day 0, and compounds were topically applied on the back once daily from Day 1 to Day 30. Dermatitis scores peaked on Day 18, with a score of 2.6 in vehicle-treated mice, and topical applications of 0.1% RTA 402, RTA 408 and RS9 reduced the scores to 1.8, 2.0 and 1.4, respectively. Moreover, the percentage of animals with scores ≥2 was analyzed, and 0.1% RS9 suppressed the percentage from 100% to 47%. These results imply that RS9 has potential efficacy for treating radiation dermatitis.

  10. Progression of renal cell carcinoma is inhibited by genistein and radiation in an orthotopic model

    International Nuclear Information System (INIS)

    Hillman, Gilda G; Wang, Yu; Che, Mingxin; Raffoul, Julian J; Yudelev, Mark; Kucuk, Omer; Sarkar, Fazlul H

    2007-01-01

    We have previously reported the potentiation of radiotherapy by the soy isoflavone genistein for prostate cancer using prostate tumor cells in vitro and orthotopic prostate tumor models in vivo. However, when genistein was used as single therapy in animal models, it promoted metastasis to regional para-aortic lymph nodes. To clarify whether these intriguing adverse effects of genistein are intrinsic to the orthotopic prostate tumor model, or these results could also be recapitulated in another model, we used the orthotopic metastatic KCI-18 renal cell carcinoma (RCC) model established in our laboratory. The KCI-18 RCC cell line was generated from a patient with papillary renal cell carcinoma. Following orthotopic renal implantation of KCI-18 RCC cells and serial in vivo kidney passages in nude mice, we have established a reliable and predictable metastatic RCC tumor model. Mice bearing established kidney tumors were treated with genistein combined with kidney tumor irradiation. The effect of the therapy was assessed on the primary tumor and metastases to various organs. In this experimental model, the karyotype and histological characteristics of the human primary tumor are preserved. Tumor cells metastasize from the primary renal tumor to the lungs, liver and mesentery mimicking the progression of RCC in humans. Treatment of established kidney tumors with genistein demonstrated a tendency to stimulate the growth of the primary kidney tumor and increase the incidence of metastasis to the mesentery lining the bowel. In contrast, when given in conjunction with kidney tumor irradiation, genistein significantly inhibited the growth and progression of established kidney tumors. These findings confirm the potentiation of radiotherapy by genistein in the orthotopic RCC model as previously shown in orthotopic models of prostate cancer. Our studies in both RCC and prostate tumor models demonstrate that the combination of genistein with primary tumor irradiation is a more

  11. GSK-3β Inhibition Attenuates LPS-Induced Death but Aggravates Radiation-Induced Death via Down-Regulation of IL-6

    Directory of Open Access Journals (Sweden)

    Bailong Li

    2013-12-01

    Full Text Available Background: Exposure of high dose ionizing radiation is lethal. Signal pathways involved in radiation biology reaction still remain illdefined. Lipopolysaccharides (LPS, the ligands of Toll-like receptor 4(TLR4, could elicit strong immune responses. Glycogen synthase kinase-3β(GSK-3β promotes the production of inflammatory molecules and cell migration. Inhibition of GSK-3β provides protection against inflammation in animal models. The aim of the study was to investigate role of GSK-3β in LPS shock and ionizing radiation. Methods: WT or IL-6-/-mice or cells were pretreated with SB216763, a GSK-3β inhibitor, and survival of the mice was determined. Cell viability was assayed by Cell Counting Kit. Apoptosis was assayed by Annexin V-PI double staining. Serum concentrations of IL-6 and TNF-α were determined by ELISA. Results: SB216763 attenuated LPS induced mice or cell death but aggravated radiation induced mice or cell death. SB216763 reduced IL-6, but not TNF-α levels in vivo. IL-6-/- mice were more resistant to LPS-induced death but less resistant to radiation-induced death than wild type mice. Conclusions: Inhibition of GSK-3β conferred resistance to LPS shock but fostered death induced by ionizing radiation. Inhibition of GSK-3β was effective by reducing IL-6.

  12. Inhibition of lipid peroxidation induced by γ- radiation and AAPH in rat liver and brain mitochondria by mushrooms

    International Nuclear Information System (INIS)

    Lakshmi, B.; Janardhanan, K.K.; Tilak, J.C.; Devasagayam, T.P.A.; Adhikari, S.

    2005-01-01

    Exposure to radiation or 2.2' Azobis(2-amidopropane) dihydrochloride (AAPH) induces generation of reactive oxygen species (ROS) especially hydroxyl radical ( . OH) and peroxyl radical (ROO . ), which are capable of inducing lipid peroxidation. Our earlier studies have demonstrated that extracts of the medicinal and edible mushrooms Ganoderma lucidum, Pleurotus florida, Pleurotus sajor-caju and Phellinus rimosus possessed significant antioxidant activity, measured as radical scavenging. In the present study, we examined the protective effect of these mushroom extracts against radiation- and AAPH-induced lipid peroxidation using rat liver and brain mitochondria as model systems. The results obtained showed that the investigated mushroom extracts significantly inhibited the formation of lipid hydroperoxide and thiobarbituric acid reactive substances, indicating membrane protective effects. The finding suggests the profound protective effect of the extracts of the fruiting bodies of G. lucidum, P. florida, P. sajor-caju and P. rimosus against lipid peroxidation by two major forms of ROS capable of inducing this type of damage in a major organelle, the mitochondria from both rat liver and brain. This observation can possibly explain the health benefits of these mushrooms. (author)

  13. Temperature-specific inhibition of human red cell (Na/sup +//K/sup +/) ATPase by 2450-MHz microwave radiation

    Energy Technology Data Exchange (ETDEWEB)

    Allis, J.W.; Sinha-Robinson, B.L.

    1987-01-01

    The ATPase activity in human red blood cell membranes was investigated in vitro as a function of temperature and exposure to 2450-MHz (CW) microwave radiation. Assays were conducted spectrophotometrically during microwave exposure with a custom-made spectrophotometer-waveguide apparatus. Temperature profiles of total ATPase and Ca+2 ATPase (ouabain-inhibited) activity between 17 and 31 C were graphed as an Arrhenius plot. Each data set was fitted to two straight lines which intersected between 23 and 24 C. The difference between the total and Ca+2 ATPase activities, which represented the Na+/K+ ATPase activity, was also plotted and treated similarly to yield an intersection near 25 C. Exposure of membrane suspensions to a 6 W/kg dose rate at 1 C intervals between 23 and 27 C, resulted in an activity change only for the Na+/K+ ATPase at 25 C. The activity decreased by approximately 35% compared to sham-irradiated samples. An hypothesis based on the interaction of microwave radiation with enzyme structure during a conformational rearrangement is proposed as an explanation for the effect.

  14. Pharmacological inhibition of radiation induced in vitro tumor cell/endothelium cell interactions and in vivo metastasis processes

    International Nuclear Information System (INIS)

    Herzog, Melanie

    2013-01-01

    Exposure of endothelial cells with ionizing radiation (IR) or treatment with inflammatory cytokines (e. g. TNFα) induces a Rho-GTPase and NF-κB dependent activation of the expression of various cell adhesion molecules, including E-selectin. E-selectin mediates the adhesion of tumor cells (TC) to endothelial cells and is probably involved in the extravasation step of circulating tumor cells. HMG-CoA reductase inhibitors (e. g. lovastatin) inhibit the function of Rho-GTPases and thus are anticipated to attenuate Rho-regulated cell-cell-adhesion as well. This study focuses on the influence of IR and TNFα on the expression of endothelial- and/or tumor cell-specific pro-adhesive factors and whether these effects are influenced by lovastatin. To this end, the effect of IR and TNFα on cell-cell-interactions between human colon carcinoma cells (HT29) and human umbilical vein endothelial cells (HUVEC) was investigated using an ELISA-based cell adhesion-assay. Moreover, the influence of pre-treatment with lovastatin and other types of inhibitors on HUVEC-HT29 adhesion was monitored. Additionally, we investigated the effect of lovastatin on mRNA expression level of different cell adhesion molecules, metastatic factors and DNA-repair genes upon radiation exposure by qRT-PCR. To scrutinize the in vivo relevance of the data obtained, we investigated the effect of total body irradiation (TBI) on the mRNA expression of pro-adhesive factors in BALB/c mice. To analyze tumor cell extravasation, tumor cells were injected into the lateral tail vein of immundeficient mice, followed by total body irradiation (TBI, 4 Gy). After four weeks a large increase of lung metastases was monitored, which could be blocked by preatreatment of the mice with lovastatin, the Rac1-specific small-molecule inhibitor NSC23766 as well as the sLe x -mimetic glycyrrhizin. Summarizing, we provide evidence, that irradiation promotes upregulation of different cell adhesion molecules in vitro and stimulates

  15. Effect of Nano-ZnO Particle Suspension on Growth of Mung (Vigna radiata and Gram (Cicer arietinum Seedlings Using Plant Agar Method

    Directory of Open Access Journals (Sweden)

    Pramod Mahajan

    2011-01-01

    Full Text Available The present study demonstrates an effect of nano-ZnO particles on the growth of plant seedlings of mung (Vigna radiate and gram (Cicer arietinum. The study was carried out in plant agar media to prevent precipitation of water-insoluble nanoparticles in the test units. Various concentrations of nano-ZnO particles in suspension form were introduced to the agar media, and their effect on the root and shoot growth of the seedlings was examined. The main experimental approach, using correlative light and scanning electron microscopy provided evidence of adsorption of nanoparticles on the root surface. Absorption of nanoparticles by seedlings root was also detected by inductive coupled plasma/atomic emission spectroscopy (ICP-AES. It was found that at certain optimum concentration, the seedlings displayed good growth over control, and beyond that, retardation in growth was observed.

  16. Radiation

    International Nuclear Information System (INIS)

    2013-01-01

    The chapter one presents the composition of matter and atomic theory; matter structure; transitions; origin of radiation; radioactivity; nuclear radiation; interactions in decay processes; radiation produced by the interaction of radiation with matter

  17. Pilot plant experiments for the sprout inhibition of onions by ionizing radiation

    International Nuclear Information System (INIS)

    Kalman, B.; Kiss, I.; Farkas, J.

    1978-01-01

    Experiments have been carried out with varieties grown from seed and sown onions, the former playing a decisive role in the onion production in Hungary. The results of pilot plant experiments proved the favourable and at the same time loss-decreasing effect of irradiation. During drying of onions treated and stored on large scale the yield-increasing effect of irradiation has been proved. In case of varieties grown from sown onions the saving of raw materials was almost 24 and 7%, respectively. In case of varieties grown from seed onions the yield-increase due to irradiation could not be observed each year. The decisive advantage of radiation treatment is direct yield-increase. However, the investigations of dried onions proved that the characteristics of the still not visible sprouts were affected favourably by irradiation, too. The consumer response to the irradiated onions has been favourable for several years. Though the consumers had a free choice, they distinctly insisted on buying irradiated onions on the basis of their favourable experience in using such onions. In order to utilize the results, an equipment has been designed for the economic operation of the onion-irradiating plants. (P.J.)

  18. Inhibition of the CXCL12/CXCR4-axis as preventive therapy for radiation-induced pulmonary fibrosis.

    Directory of Open Access Journals (Sweden)

    Hui-Kuo G Shu

    Full Text Available A devastating late injury caused by radiation is pulmonary fibrosis. This risk may limit the volume of irradiation and compromise potentially curative therapy. Therefore, development of a therapy to prevent this toxicity can be of great benefit for this patient population. Activation of the chemokine receptor CXCR4 by its ligand stromal cell-derived factor 1 (SDF-1/CXCL12 may be important in the development of radiation-induced pulmonary fibrosis. Here, we tested whether MSX-122, a novel small molecule and partial CXCR4 antagonist, can block development of this fibrotic process.The radiation-induced lung fibrosis model used was C57BL/6 mice irradiated to the entire thorax or right hemithorax to 20 Gy. Our parabiotic model involved joining a transgenic C57BL/6 mouse expressing GFP with a wild-type mouse that was subsequently irradiated to assess for migration of GFP+ bone marrow-derived progenitor cells to the irradiated lung. CXCL12 levels in the bronchoalveolar lavage fluid (BALF and serum after irradiation were determined by ELISA. CXCR4 and CXCL12 mRNA in the irradiated lung was determined by RNase protection assay. Irradiated mice were treated daily with AMD3100, an established CXCR4 antagonist; MSX-122; and their corresponding vehicles to determine impact of drug treatment on fibrosis development. Fibrosis was assessed by serial CTs and histology. After irradiation, CXCL12 levels increased in BALF and serum with a corresponding rise in CXCR4 mRNA within irradiated lungs consistent with recruitment of a CXCR4+ cell population. Using our parabiotic model, we demonstrated recruitment of CXCR4+ bone marrow-derived mesenchymal stem cells, identified based on marker expression, to irradiated lungs. Finally, irradiated mice that received MSX-122 had significant reductions in development of pulmonary fibrosis while AMD3100 did not significantly suppress this fibrotic process.CXCR4 inhibition by drugs such as MSX-122 may alleviate potential

  19. Inhibition of the CXCL12/CXCR4-axis as preventive therapy for radiation-induced pulmonary fibrosis.

    Science.gov (United States)

    Shu, Hui-Kuo G; Yoon, Younghyoun; Hong, Samuel; Xu, Kaiming; Gao, Huiying; Hao, Chunhai; Torres-Gonzalez, Edilson; Nayra, Cardenes; Rojas, Mauricio; Shim, Hyunsuk

    2013-01-01

    A devastating late injury caused by radiation is pulmonary fibrosis. This risk may limit the volume of irradiation and compromise potentially curative therapy. Therefore, development of a therapy to prevent this toxicity can be of great benefit for this patient population. Activation of the chemokine receptor CXCR4 by its ligand stromal cell-derived factor 1 (SDF-1/CXCL12) may be important in the development of radiation-induced pulmonary fibrosis. Here, we tested whether MSX-122, a novel small molecule and partial CXCR4 antagonist, can block development of this fibrotic process. The radiation-induced lung fibrosis model used was C57BL/6 mice irradiated to the entire thorax or right hemithorax to 20 Gy. Our parabiotic model involved joining a transgenic C57BL/6 mouse expressing GFP with a wild-type mouse that was subsequently irradiated to assess for migration of GFP+ bone marrow-derived progenitor cells to the irradiated lung. CXCL12 levels in the bronchoalveolar lavage fluid (BALF) and serum after irradiation were determined by ELISA. CXCR4 and CXCL12 mRNA in the irradiated lung was determined by RNase protection assay. Irradiated mice were treated daily with AMD3100, an established CXCR4 antagonist; MSX-122; and their corresponding vehicles to determine impact of drug treatment on fibrosis development. Fibrosis was assessed by serial CTs and histology. After irradiation, CXCL12 levels increased in BALF and serum with a corresponding rise in CXCR4 mRNA within irradiated lungs consistent with recruitment of a CXCR4+ cell population. Using our parabiotic model, we demonstrated recruitment of CXCR4+ bone marrow-derived mesenchymal stem cells, identified based on marker expression, to irradiated lungs. Finally, irradiated mice that received MSX-122 had significant reductions in development of pulmonary fibrosis while AMD3100 did not significantly suppress this fibrotic process. CXCR4 inhibition by drugs such as MSX-122 may alleviate potential radiation-induced lung

  20. Ccdc94 protects cells from ionizing radiation by inhibiting the expression of p53.

    Directory of Open Access Journals (Sweden)

    Shelly Sorrells

    Full Text Available DNA double-strand breaks (DSBs represent one of the most deleterious forms of DNA damage to a cell. In cancer therapy, induction of cell death by DNA DSBs by ionizing radiation (IR and certain chemotherapies is thought to mediate the successful elimination of cancer cells. However, cancer cells often evolve to evade the cytotoxicity induced by DNA DSBs, thereby forming the basis for treatment resistance. As such, a better understanding of the DSB DNA damage response (DSB-DDR pathway will facilitate the design of more effective strategies to overcome chemo- and radioresistance. To identify novel mechanisms that protect cells from the cytotoxic effects of DNA DSBs, we performed a forward genetic screen in zebrafish for recessive mutations that enhance the IR-induced apoptotic response. Here, we describe radiosensitizing mutation 7 (rs7, which causes a severe sensitivity of zebrafish embryonic neurons to IR-induced apoptosis and is required for the proper development of the central nervous system. The rs7 mutation disrupts the coding sequence of ccdc94, a highly conserved gene that has no previous links to the DSB-DDR pathway. We demonstrate that Ccdc94 is a functional member of the Prp19 complex and that genetic knockdown of core members of this complex causes increased sensitivity to IR-induced apoptosis. We further show that Ccdc94 and the Prp19 complex protect cells from IR-induced apoptosis by repressing the expression of p53 mRNA. In summary, we have identified a new gene regulating a dosage-sensitive response to DNA DSBs during embryonic development. Future studies in human cancer cells will determine whether pharmacological inactivation of CCDC94 reduces the threshold of the cancer cell apoptotic response.

  1. Association analysis of salt tolerance in cowpea (Vigna unguiculata (L.) Walp) at germination and seedling stages.

    Science.gov (United States)

    Ravelombola, Waltram; Shi, Ainong; Weng, Yuejin; Mou, Beiquan; Motes, Dennis; Clark, John; Chen, Pengyin; Srivastava, Vibha; Qin, Jun; Dong, Lingdi; Yang, Wei; Bhattarai, Gehendra; Sugihara, Yuichi

    2018-01-01

    This is the first report on association analysis of salt tolerance and identification of SNP markers associated with salt tolerance in cowpea. Cowpea (Vigna unguiculata (L.) Walp) is one of the most important cultivated legumes in Africa. The worldwide annual production in cowpea dry seed is 5.4 million metric tons. However, cowpea is unfavorably affected by salinity stress at germination and seedling stages, which is exacerbated by the effects of climate change. The lack of knowledge on the genetic underlying salt tolerance in cowpea limits the establishment of a breeding strategy for developing salt-tolerant cowpea cultivars. The objectives of this study were to conduct association mapping for salt tolerance at germination and seedling stages and to identify SNP markers associated with salt tolerance in cowpea. We analyzed the salt tolerance index of 116 and 155 cowpea accessions at germination and seedling stages, respectively. A total of 1049 SNPs postulated from genotyping-by-sequencing were used for association analysis. Population structure was inferred using Structure 2.3.4; K optimal was determined using Structure Harvester. TASSEL 5, GAPIT, and FarmCPU involving three models such as single marker regression, general linear model, and mixed linear model were used for the association study. Substantial variation in salt tolerance index for germination rate, plant height reduction, fresh and dry shoot biomass reduction, foliar leaf injury, and inhibition of the first trifoliate leaf was observed. The cowpea accessions were structured into two subpopulations. Three SNPs, Scaffold87490_622, Scaffold87490_630, and C35017374_128 were highly associated with salt tolerance at germination stage. Seven SNPs, Scaffold93827_270, Scaffold68489_600, Scaffold87490_633, Scaffold87490_640, Scaffold82042_3387, C35069468_1916, and Scaffold93942_1089 were found to be associated with salt tolerance at seedling stage. The SNP markers were consistent across the three models and

  2. Mammalian Target of Rapamycin Inhibition With Rapamycin Mitigates Radiation-Induced Pulmonary Fibrosis in a Murine Model

    Energy Technology Data Exchange (ETDEWEB)

    Chung, Eun Joo [Radiation Oncology Branch, Center for Cancer Research, National Institutes of Health, Bethesda, Maryland (United States); Sowers, Anastasia; Thetford, Angela [Radiation Biology Branch, Center for Cancer Research, National Institutes of Health, Bethesda, Maryland (United States); McKay-Corkum, Grace; Chung, Su I. [Radiation Oncology Branch, Center for Cancer Research, National Institutes of Health, Bethesda, Maryland (United States); Mitchell, James B. [Radiation Biology Branch, Center for Cancer Research, National Institutes of Health, Bethesda, Maryland (United States); Citrin, Deborah E., E-mail: citrind@mail.nih.gov [Radiation Oncology Branch, Center for Cancer Research, National Institutes of Health, Bethesda, Maryland (United States)

    2016-11-15

    Purpose: Radiation-induced pulmonary fibrosis (RIPF) is a late toxicity of therapeutic radiation. Signaling of the mammalian target of rapamycin drives several processes implicated in RIPF, including inflammatory cytokine production, fibroblast proliferation, and epithelial senescence. We sought to determine if mammalian target of rapamycin inhibition with rapamycin would mitigate RIPF. Methods and Materials: C57BL/6NCr mice received a diet formulated with rapamycin (14 mg/kg food) or a control diet 2 days before and continuing for 16 weeks after exposure to 5 daily fractions of 6 Gy of thoracic irradiation. Fibrosis was assessed with Masson trichrome staining and hydroxyproline assay. Cytokine expression was evaluated by quantitative real-time polymerase chain reaction. Senescence was assessed by staining for β-galactosidase activity. Results: Administration of rapamycin extended the median survival of irradiated mice compared with the control diet from 116 days to 156 days (P=.006, log-rank test). Treatment with rapamycin reduced hydroxyproline content compared with the control diet (irradiation plus vehicle, 45.9 ± 11.8 μg per lung; irradiation plus rapamycin, 21.4 ± 6.0 μg per lung; P=.001) and reduced visible fibrotic foci. Rapamycin treatment attenuated interleukin 1β and transforming growth factor β induction in irradiated lungs compared with the control diet. Type II pneumocyte senescence after irradiation was reduced with rapamycin treatment at 16 weeks (3-fold reduction at 16 weeks, P<.001). Conclusions: Rapamycin protected against RIPF in a murine model. Rapamycin treatment reduced inflammatory cytokine expression, extracellular matrix production, and senescence in type II pneumocytes.

  3. Inhibition of radiation-induced DNA strand breaks by hoechst 33258: OH-radical scavenging and DNA radical quenching

    International Nuclear Information System (INIS)

    Adhikary, A.; Bothe, E.; Von Sonntag, C.; Adhikary, A.

    1997-01-01

    The minor-groove-binding dye Hoechst 33258 has been found to protect pBR322 DNA in aqueous solution against radiation-induced single-strand breaks (ssb). This protective effect has been assumed to be largely due to the scavenging of the strand-break-generating OH radicals by Hoechst. From D 37 values for ssb at different Hoechst concentrations the value of the OH radical scavenging constant of DNA-bound Hoechst has been estimated at k Ho/DNA = 2.7 * 10 11 dm 3 mol -1 . This unexpectedly high value has led us to study the reactions of OH radicals with Hoechst in the absence and in the presence of double-stranded calf thymus DNA (ds DNA) by pulse radiolysis, and the formation of radiation-induced ssb by low angle laser light scattering. The D 37 /D 37 0 values at different Hoechst concentrations agree with the values obtained by Martin and al. and demonstrate the protection. However, this protection cannot be explained on the basis of OH radical scavenging alone using the above rate constants. There must, in addition, be some quenching of DNA radicals. Hoechst radicals are formed in the later ms time range, i.e a long time after the disappearance of the OH radicals. This delayed Hoechst radical formation has been assigned to a a reaction of DNA radicals with Hoechst, thereby inhibiting strand breakage. In confirmation, pulse radiolysis of aqueous solution of nucleotides in the presence of Hoechst yields a similar delayed Hoechst radical formation. The data indicate that in DNA the cross-section of this quenching has a diameter of 3 to 4 base pairs per Hoechst molecule. (N.C.)

  4. Differences in inhibition by beta-arabinofuranosyladenine (araA) of radiation induced DNA damage repair in exponentially growing and plateau-phase CHO-cells

    International Nuclear Information System (INIS)

    Iliakis, G.; Seaner, R.

    1988-01-01

    The effect of beta-arabinofuranosyladenine (araA) on the repair of radiation induced DNA damage, as measured by the DNA unwinding technique, was studied in exponentially growing and plateau-phase CHO-cells after exposure to X-rays. Induction of DNA damage by radiation was found to be similar in exponentially growing and plateau-phase cells. In the absence of araA, repair of radiation induced DNA damage proceeded with similar kinetics in exponentially growing and plateau-phase cells. AraA at concentrations between 0-1500 μM inhibited DNA repair both in exponentially growing and in plateau-phase cells. However, the degree of inhibition was significantly higher (by a factor of 3) in plateau-phase cells. A similar degree of repair inhibition by araA was observed in plateau-phase cells treated in their conditioned medium, as well as in plateau-phase cells that were transferred in fresh growth medium just before treatment initiation. These results indicate the importance of biochemical parameters associated with alterations in the growth state of the cells for the inhibitory effect of araA and may help in the elucidation of the molecular mechanism(s) underlying repair inhibition by inhibitors of DNA replication. (orig.)

  5. Inhibiting TGFβ1 has a protective effect on mouse bone marrow suppression following ionizing radiation exposure in vitro

    International Nuclear Information System (INIS)

    Zhang Heng; Yan Hao; Wang Xinzhuo; Niu Jingxiu; Wang Hui; Wang Yingai; Meng Aimin; Li Jin

    2013-01-01

    Ionizing radiation (IR) causes not only acute tissue damage but also residual bone marrow (BM) suppression. The induction of residual BM injury is primarily attributable to the induction of reactive oxygen species (ROS) pressure in hematopoietic cells. In this study, we examined if SB431542, a transforming growth factor β1 (TGFβ1) inhibitor, can mitigate IR-induced BM suppression in vitro. Our results showed that treatment with SB431542 protected mice bone marrow mononuclear cells (BMMNCs), hematopoietic progenitor cells (HPCs) and hematopoietic stem cells (HSCs) from IR-induced suppression using cell viability assays, clonogenic assays and competitive repopulation assays. Moreover, expression of gene-related ROS production in hematopoietic cells was analyzed. The expression of NADPH oxidative 1 (NOX1), NOX2 and NOX4 was increased in irradiated BMMNCs, and that of NOX2 and NOX4 was reduced by SB431542 treatment. Therefore, the results from this study suggest that SB431542, a TGFβ1 inhibitor, alleviates IR-induced BM suppression at least in part via inhibiting IR-induced NOX2 and NOX4 expression. (author)

  6. Effect of gamma radiation in peanuts for inhibition of Aspergillus flavus and nutritional composition; Irradiacao gama em amendoim para controle de Aspergillus flavus

    Energy Technology Data Exchange (ETDEWEB)

    Costa, L.F.; Silva, E.B. da, E-mail: lauryfrancis@gmail.com [Universidade Federal de Pernambuco (UFPE), Recife, PE (Brazil). Departamento de Energia Nuclear; Oliveira, I.S. [Universidade Federal de Pernambuco (CAV/UFPE), Vitoria de Santo Antao, PE (Brazil). Centro Academico de Vitoria

    2013-08-15

    Care in food storage, controlling humidity and temperature, prevents fungal diseases in peanuts and the development of filamentous fungi in food and feed, which can result in the production of toxins known as mycotoxins. Ionizing radiation is a preventive method of food security, promoting inhibition of buds, delayed maturation, reduction of microbial load, elimination of pathogenic microorganisms, sterilization and disinfection in grains, cereals, fruits and spices. This work aimed to evaluate the effects of gamma radiation on the growth inhibition of aflatoxigenic fungi and on nutritional composition in peanut. Samples were collected directly from the producer (Petrolandia) and Supply Central of Pernambuco (CEASA-PE), and then grains inside / outside pods were packed and subjected to irradiation at doses of 6, 9, 12 and 15 kGy. Fungal growth and nutritional composition of the samples before and after irradiation were analyzed and statistical analysis using the Mann-Whitney-Wilcoxon. The results showed that the samples originated from CEASA-PE had the highest rates of contamination. The radiation was effective in the inhibition of aflatoxigenic fungi, achieving to eliminate the action of fungi, regardless of dose. Only one non-irradiated sample, originated from CEASA-PE, showed positive production of aflatoxins in the middle LCA. No significant difference in the values of the nutritional composition, with increasing radiation dose. The irradiation was shown to be an effective process for preserving peanuts, because it prevents the growth of fungi, particularly aflatoxin producer, making it safer for consumption, without changing its nutritional composition. (author)

  7. Radiation-induced enteropathy: Molecular basis of pentoxifylline–vitamin E anti-fibrotic effect involved TGF-β1 cascade inhibition

    International Nuclear Information System (INIS)

    Hamama, Saad; Gilbert-Sirieix, Marie; Vozenin, Marie-Catherine; Delanian, Sylvie

    2012-01-01

    Background: Radiation-induced fibrosis is a serious late complication of radiotherapy. Pentoxifylline–vitamin E has proven effective and safe in clinical trials in the treatment of fibrosis, while the molecular mechanism of its activity is yet unexplored. Methods: Ten patients suffering from radiation-induced enteropathy were treated with pentoxifylline–vitamin E combination with SOMA score as the primary endpoint. In parallel, primary smooth muscle cells isolated from intestinal samples isolated from humans with radiation enteropathy were incubated with pentoxifylline, trolox (vit. E hydrophilic analogous) or their combination. Activation of the TGF-β1/Smad and Rho/ROCK pathways was subsequently investigated using Q-RT-PCR, gene reporter, Western-blot, ELISA and immunohistochemistry. Results: Pentoxifylline–vitamin E combination induces regression of symptoms (SOMA) by −41% and −80% at 6 and 18 months. In vitro, pentoxifylline and trolox synergize to inhibit TGF-β1 protein and mRNA expression. This inhibitory action is mediated at the transcriptional level and leads to subsequent inhibition of TGF-β1/Smad targets (Col Iα1, FN1, PAI-1, CTGF), while it has no effect on the Rho/ROCK pathway. Conclusions: The anti-fibrotic effect of combined pentoxifylline–vitamin E is at least in part mediated by inhibition of the TGF-β1 cascade. It strengthens previous clinical data showing pentoxifylline–vitamin E synergy and supports its use as a first-line treatment of radiation-induced fibrosis.

  8. Anti-inflammatory and Anti-apoptotic Effect of Valproic Acid and Doxycycline Independent from MMP Inhibition in Early Radiation Damage

    Directory of Open Access Journals (Sweden)

    Ferda Hoşgörler

    2016-10-01

    Full Text Available Background: Matrix metalloproteinase (MMP inhibitors decrease inflammation in normal tissues and suppress cancer progress in normal tissues. Valproic acid (VA and doxycycline (DX are MMP inhibitors that have radio-protective effects. Their ability to inhibit MMPs in irradiated tissue is unknown and the role of MMPs in radio-protective effects has not been tested to date. Aims: The purpose of this study was to examine whether administration of VA and DX to rats before irradiation affects tissue inflammation and apoptosis in the early phase of radiation, and whether the effect of these drugs is mediated by MMP inhibition. Study Design: Animal experimentation. Methods: Twenty-six Wistar rats were randomized into four groups: control (CTRL, radiation (RT, VA plus radiation (VA+RT, and DX plus radiation (DX+RT.Three study groups were exposed to a single dose of abdominal 10 Gy gamma radiation; the CTRL group received no radiation. Single doses of VA 300 mg/kg and DX 100 mg/kg were administered to each rat before radiation and all rats were sacrificed 8 hours after irradiation, at which point small intestine tissue samples were taken for analyses. Levels of inflammatory cytokines (TNF-α, IL-1β, and IL-6 and matrix metalloproteinases (MMP-2 and MMP 9 were measured by ELISA, MMP activities were measured by gelatin and casein zymography and apoptosis was assessed by terminal deoxynucleotidyl transferase dUTP nick end labeling assay. Results: VA decreased the levels of TNF-α and IL-1β proteins insignificantly and decreased apoptosis significantly in the irradiated tissue, but did not inhibit MMPs. In contrast, VA protected the basal MMP activities, which decreased in response to irradiation. No effect of DX was observed on the levels of inflammatory cytokines or activities of MMPs in the early phases of radiation apoptosis. Conclusion: Our findings indicated that VA protects against inflammation and apoptosis, and DX exhibits anti-apoptotic effects in

  9. Combination treatment with ionising radiation and gefitinib ('Iressa', ZD1839), an epidermal growth factor receptor (EGFR) inhibitor, significantly inhibits bladder cancer cell growth in vitro and in vivo

    International Nuclear Information System (INIS)

    Colquhoun, AJ; Mchugh, LA; Tulchinsky, E.; Kriajevska, M.; Mellon, JK

    2007-01-01

    External beam radiotherapy (EBRT) is the principal bladder-preserving monotherapy for muscle-invasive bladder cancer. Seventy percent of muscle-invasive bladder cancers express epidermal growth factor receptor (EGFR), which is associated with poor prognosis. Ionising radiation (IR) stimulates EGFR causing activation of cytoprotective signalling cascades and thus may be an underlying cause of radioresistance in bladder tumours. We assessed the ability of IR to activate EGFR in bladder cancer cells and the effect of the anti-EGFR therapy, gefitinib on potential radiation-induced activation. Subsequently we assessed the effect of IR on signalling pathways downstream of EGFR. Finally we assessed the activity of gefitinib as a monotherapy, and in combination with IR, using clonogenic assay in vitro, and a murine model in vivo. IR activated EGFR and gefitinib partially inhibited this activation. Radiation-induced activation of EGFR activated the MAPK and Akt pathways. Gefitinib partially inhibited activation of the MAPK pathway but not the Akt pathway. Treatment with combined gefitinib and IR significantly inhibited bladder cancer cell colony formation more than treatment with gefitinib alone (p=0.001-0.03). J82 xenograft tumours treated with combined gefitinib and IR showed significantly greater growth inhibition than tumours treated with IR alone (p=0.04). Combining gefitinib and IR results in significantly greater inhibition of invasive bladder cancer cell colony formation in vitro and significantly greater tumour growth inhibition in vivo. Given the high frequency of EGFR expression by bladder tumours and the low toxicity of gefitinib there is justification to translate this work into a clinical trial. (author)

  10. PENGARUH JENIS DAN DOSIS PUPUK BOKASHI TERHADAP PERTUMBUHAN DAN HASIL KACANG PANJANG (Vigna sinensis L.

    Directory of Open Access Journals (Sweden)

    Achmad Djunaedy

    2009-03-01

    Full Text Available The purpose of this Research to determine the effect of fertilizer type and dose of bokashi of growth and yield bean (Vigna sinensis L.. Results of research: 1 bokashi fertilizer and chicken manure effect on plant length and number of leaves at the age of 24 days after the plant, 2 dose of fertilizer bokashi or chicken manure is best for the total fruit weight per plant is 20 tons / ha.

  11. Genotypic Variation in Phosphorus Use Efficiency for Symbiotic Nitrogen Fixation in Voandzou (Vigna Subterranea)

    Energy Technology Data Exchange (ETDEWEB)

    Andriamananjara, A.; Rabeharisoa, L. [Laboratoire des Radio-isotopes, Universite d' Antananarivo, Antananarivo (Madagascar); Abdou, M. Malam [Laboratoire Banques de genes CERRA / KOLLO, Institut National de Recherche Agronomique du Niger (INRAN), Niamey (Niger); Masse, D. [Institut de Recherche pour le Developpement, UMR Eco and Sols, Montpellier, (France); Amenc, L.; Pernot, C.; Drevon, J. J. [Institut National de la Recherche Agronomique, UMR Eco and Sols, Montpellier (France)

    2013-11-15

    Vigna subterranea, known as voandzou or Bambara groundnut as an African indigenous crop which is often neglected or under-used in African subsistence agriculture. Preliminary research and country perceptions have shown its agronomic and nutritional properties, in particular under atypical climates of arid and tropical areas, and in saline soils. There is a high potential to increase the production by optimizing symbiotic nitrogen fixation (SNF) through effective inoculation even in nitrate-rich environments. In this study, Vigna subterranea inoculated with the reference strain of Bradyrhizobium sp. Vigna CB756 was studied in order to assess the symbiotic fixation potential of different cultivars and landraces of Madagascar, Niger and Mali under low-P and sufficient-P conditions. Six voandzou cultivars inoculated with Bradyrhizobium sp. Vigna CB756, were grown under hydroaeroponic culture for 6 weeks supplied with four phosphorus levels of 15, 30, 75 and 250 {mu}mol plant{sup -1} week{sup -1} in order to establish the response curve of voandzou to P supply, and to induce P deficient and sufficient levels. In another experiment five tolerant cultivars with high SNF and five sensitive cultivars with low SNF were chosen after a preliminary screening of 54 voandzou genotypes, including 50 landraces from Madagascar, Niger and Mali supplied with 2 P levels as P deficient and P sufficient (30 and 75 {mu}mol plant{sup -1} week{sup -1} ) under hydroaeroponic conditions. Genotypic variation in SFN for the high phosphorus use efficiency (PUE) was observed among the 54 cultivars and landraces. Variability was especially related to the nodule and shoot biomass, nodule permeability, nodule respiration and gene phytase expression. Contrasting cultivars and landraces in terms of PUE for SNF were selected for further evaluation under field conditions. (author)

  12. Inhibition of gamma-radiation induced DNA damage in plasmid pBR322 by TMG, a water-soluble derivative of vitamin E.

    Science.gov (United States)

    Rajagopalan, Rema; Wani, Khalida; Huilgol, Nagaraj G; Kagiya, Tsutomu V; Nair, Cherupally K Krishnan

    2002-06-01

    Alpha-tocopherol monoglucoside (TMG), a water-soluble derivative of alpha-tocopherol, has been examined for its ability to protect DNA against radiation-induced strand breaks. Gamma radiation, up to a dose of 6 Gy (dose rate, 0.7 Gy/minute), induced a dose-dependent increase in single strand breaks (SSBs) in plasmid pBR322 DNA. TMG inhibited the formation of gamma-radiation induced DNA single strand breaks (SSBs) in a concentration-dependent manner; 500 microM of TMG protected the single strand breaks completely. It also protected thymine glycol formation induced by gamma-radiation in a dose-dependent manner, based on an estimation of thymine glycol by HPLC.

  13. Inhibition of {gamma}-radiation induced DNA damage in plasmid pBR322 by TMG, a water-soluble derivative of vitamin E

    Energy Technology Data Exchange (ETDEWEB)

    Rajagopalan, R.; Nair, C.K.K. [Bhabha Atomic Research Centre, Mumbai (India); Wani, K.; Huilgol, N.G. [Nanavati Hospital and MRC, Vile Parle (India); Kagiya, Tsutomu V. [Kinki Research Foundation, Kyoto (Japan)

    2002-06-01

    Alpha-tocopherol monoglucoside (TMG), a water-soluble derivative of {alpha}-tocopherol, has been examined for its ability to protect DNA against radiation-induced strand breaks. Gamma radiation, up to a dose of 6 Gy (dose rate, 0.7 Gy/minute), induced a dose-dependent increase in single strand breaks (SSBs) in plasmid pBR322 DNA. TMG inhibited the formation of {gamma}-radiation induced DNA single strand breaks (SSBs) in a concentration-dependent manner; 500 {mu}M of TMG protected the single strand breaks completely. It also protected thymine glycol formation induced by {gamma}-radiation in a dose-dependent manner, based on an estimation of thymine glycol by HPLC. (author)

  14. Inhibition of γ-radiation induced DNA damage in plasmid pBR322 by TMG, a water-soluble derivative of vitamin E

    International Nuclear Information System (INIS)

    Rajagopalan, R.; Nair, C.K.K.; Wani, K.; Huilgol, N.G.; Kagiya, Tsutomu V.

    2002-01-01

    Alpha-tocopherol monoglucoside (TMG), a water-soluble derivative of α-tocopherol, has been examined for its ability to protect DNA against radiation-induced strand breaks. Gamma radiation, up to a dose of 6 Gy (dose rate, 0.7 Gy/minute), induced a dose-dependent increase in single strand breaks (SSBs) in plasmid pBR322 DNA. TMG inhibited the formation of γ-radiation induced DNA single strand breaks (SSBs) in a concentration-dependent manner; 500 μM of TMG protected the single strand breaks completely. It also protected thymine glycol formation induced by γ-radiation in a dose-dependent manner, based on an estimation of thymine glycol by HPLC. (author)

  15. De novo transcriptomic analysis of cowpea (Vigna unguiculata L. Walp.) for genic SSR marker development.

    Science.gov (United States)

    Chen, Honglin; Wang, Lixia; Liu, Xiaoyan; Hu, Liangliang; Wang, Suhua; Cheng, Xuzhen

    2017-07-11

    Cowpea [Vigna unguiculata (L.) Walp.] is one of the most important legumes in tropical and semi-arid regions. However, there is relatively little genomic information available for genetic research on and breeding of cowpea. The objectives of this study were to analyse the cowpea transcriptome and develop genic molecular markers for future genetic studies of this genus. Approximately 54 million high-quality cDNA sequence reads were obtained from cowpea based on Illumina paired-end sequencing technology and were de novo assembled to generate 47,899 unigenes with an N50 length of 1534 bp. Sequence similarity analysis revealed 36,289 unigenes (75.8%) with significant similarity to known proteins in the non-redundant (Nr) protein database, 23,471 unigenes (49.0%) with BLAST hits in the Swiss-Prot database, and 20,654 unigenes (43.1%) with high similarity in the Kyoto Encyclopedia of Genes and Genomes (KEGG) database. Further analysis identified 5560 simple sequence repeats (SSRs) as potential genic molecular markers. Validating a random set of 500 SSR markers yielded 54 polymorphic markers among 32 cowpea accessions. This transcriptomic analysis of cowpea provided a valuable set of genomic data for characterizing genes with important agronomic traits in Vigna unguiculata and a new set of genic SSR markers for further genetic studies and breeding in cowpea and related Vigna species.

  16. Enhancing Growth of Vigna radiata in the Presence of Pseudomonas aeruginosa Biopolymer and Metarhizium anisopliae Spores

    Directory of Open Access Journals (Sweden)

    Bhagwan N. Rekadwad

    2016-01-01

    Full Text Available Exopolysaccharide producing Pseudomonas aeruginosa NCIM 2945 (PANCL belonging to gamma-proteobacterium and entomopathogenic fungus Metarhizium anisopliae MCC 1129 (MAMCC belonging to Ascomycota were studied for their morphological features biochemical characteristics and plant growth promotion ability. Optimum growth of PANCL was recorded after 24 h at temperature 30°C and pH 7.0. Gram-negative PANCL appeared as white in color, one mm size, circular, opaque, and nonconsistent elevated colonies with entire margin. It has utilized dextrose, fructose, maltose, and sorbitol as carbon source and produced acid in the medium. PANCL was sensitive to Polymyxin B (300 µgm/disc followed by Neomycin (30 µgm/disc, Gentamycin (10 µgm/disc, and Chloramphenicol (30 µgm/disc. PANCL has secreted extracellular lipase, amylase, protease, and exopolysaccharides (EPS. Another fungal strain MAMCC sporulated after 168 h at temperature 30°C and pH 7.0. MAMCC has septate-white mycelium and bears dirty green colored spores. Growth of MAMCC was enhanced in the presence of Neem and Karela-Amla oil (0.1 mL each. Extracellular polysaccharide produced by PANCL and spores of MAMCC promoted growth of dicotyledon Vigna radiata (Mung individually as well as in consortium. Considerable increase in dry weight of Vigna radiata was recorded. Thus, reported PANCL and MAMCC strains have promoted growth Vigna radiata and may be a solution for sustainable agriculture.

  17. Inhibition of potentially lethal radiation damage repair in normal and neoplastic human cells by 3-aminobenzamide: an inhibitor of poly(ADP-ribosylation)

    International Nuclear Information System (INIS)

    Thraves, P.J.; Mossman, K.L.; Frazier, D.T.; Dritschilo, A.

    1986-01-01

    The effect of 3-aminobenzamide (3AB), an inhibitor of poly(ADP-ribose) synthetase, on potentially lethal damage repair (PLDR) was investigated in normal human fibroblasts and four human tumor cell lines from tumors with varying degrees of radiocurability. The tumor lines selected were: Ewing's sarcoma, a bone tumor considered radiocurable and, human lung adenocarcinoma, osteosarcoma, and melanoma, three tumors considered nonradiocurable. PLDR was measured by comparing cell survival when cells were irradiated in a density-inhibited state and replated at appropriate cell numbers at specified times following irradiation to cell survival when cells were replated immediately following irradiation. 3AB was added to cultures 2 hr prior to irradiation and removed at the time of replating. Different test radiation doses were used for the various cell lines to obtain equivalent levels of cell survival. In the absence of inhibitor, PLDR was similar in all cell lines tested. In the presence of 8 mM 3AB, differential inhibition of PLDR was observed. PLDR was almost completely inhibited in Ewing's sarcoma cells and partially inhibited in normal fibroblast cells and osteosarcoma cells. No inhibition of PLDR was observed in the lung adenocarcinoma or melanoma cells. Except for the osteosarcoma cells, inhibition of PLDR by 3AB correlated well with radiocurability

  18. A stakeless yard long bean cultivar derived from an interspecific cross between cowpea Vigna unguiculata L. (Walp) and yard long bean Vigna sesquipedalis L. (Verdc.)

    International Nuclear Information System (INIS)

    Luadthong, Sanit

    1990-01-01

    Full text: 'Yard long bean' is an important vegetable in the Thai diet, particularly in Northeast Thailand. However, growing 'yard long beans' requires stakes for supporting the twining stems and keeping the pod from touching the ground. Staking costs money, takes time and needs labour. An ideal cultivar would be a 'yard long bean' with erect plant type and under 80 cm in height that produces typical long bean pods and allows convenient picking during the harvest time. An attempt to breed such a cultivar was made by crossing cowpea Vigna unguiculata L. (Walp.) with' yard long bean' Vigna sesquipedalis L. (Verdc.) in 1984. This resulted in a new cultivar 'KKU 25'. This cultivar, having erect plant type, requires no staking for supporting the stem and produces long fresh pods with acceptable taste which can be harvested within 43 days. The average pod length is 48 cm, and pod diameter 1.43 cm. In a preliminary yield trial, an average fresh pod yield of 16 t/ha was obtained. (author)

  19. Celecoxib Induced Tumor Cell Radiosensitization by Inhibiting Radiation Induced Nuclear EGFR Transport and DNA-Repair: A COX-2 Independent Mechanism

    International Nuclear Information System (INIS)

    Dittmann, Klaus H.; Mayer, Claus; Ohneseit, Petra A.; Raju, Uma; Andratschke, Nickolaus H.; Milas, Luka; Rodemann, H. Peter

    2008-01-01

    Purpose: The purpose of the study was to elucidate the molecular mechanisms mediating radiosensitization of human tumor cells by the selective cyclooxygenase (COX)-2 inhibitor celecoxib. Methods and Materials: Experiments were performed using bronchial carcinoma cells A549, transformed fibroblasts HH4dd, the FaDu head-and-neck tumor cells, the colon carcinoma cells HCT116, and normal fibroblasts HSF7. Effects of celecoxib treatment were assessed by clonogenic cell survival, Western analysis, and quantification of residual DNA damage by γH 2 AX foci assay. Results: Celecoxib treatment resulted in a pronounced radiosensitization of A549, HCT116, and HSF7 cells, whereas FaDu and HH4dd cells were not radiosensitized. The observed radiosensitization could neither be correlated with basal COX-2 expression pattern nor with basal production of prostaglandin E2, but was depended on the ability of celecoxib to inhibit basal and radiation-induced nuclear transport of epidermal growth factor receptor (EGFR). The nuclear EGFR transport was strongly inhibited in A549-, HSF7-, and COX-2-deficient HCT116 cells, which were radiosensitized, but not in FaDu and HH4dd cells, which resisted celecoxib-induced radiosensitization. Celecoxib inhibited radiation-induced DNA-PK activation in A549, HSF7, and HCT116 cells, but not in FaDu and HH4dd cells. Consequentially, celecoxib increased residual γH2AX foci after irradiation, demonstrating that inhibition of DNA repair has occurred in responsive A549, HCT116, and HSF7 cells only. Conclusions: Celecoxib enhanced radiosensitivity by inhibition of EGFR-mediated mechanisms of radioresistance, a signaling that was independent of COX-2 activity. This novel observation may have therapeutic implications such that COX-2 inhibitors may improve therapeutic efficacy of radiation even in patients whose tumor radioresistance is not dependent on COX-2

  20. Validating the pivotal role of the immune system in low-dose radiation-induced tumor inhibition in Lewis lung cancer-bearing mice.

    Science.gov (United States)

    Zhou, Lei; Zhang, Xiaoying; Li, Hui; Niu, Chao; Yu, Dehai; Yang, Guozi; Liang, Xinyue; Wen, Xue; Li, Min; Cui, Jiuwei

    2018-04-01

    Although low-dose radiation (LDR) possesses the two distinct functions of inducing hormesis and adaptive responses, which result in immune enhancement and tumor inhibition, its clinical applications have not yet been elucidated. The major obstacle that hinders the application of LDR in the clinical setting is that the mechanisms underlying induction of tumor inhibition are unclear, and the risks associated with LDR are still unknown. Thus, to overcome this obstacle and elucidate the mechanisms mediating the antitumor effects of LDR, in this study, we established an in vivo lung cancer model to investigate the participation of the immune system in LDR-induced tumor inhibition and validated the pivotal role of the immune system by impairing immunity with high-dose radiation (HDR) of 1 Gy. Additionally, the LDR-induced adaptive response of the immune system was also observed by sequential HDR treatment in this mouse model. We found that LDR-activated T cells and natural killer cells and increased the cytotoxicity of splenocytes and the infiltration of T cells in the tumor tissues. In contrast, when immune function was impaired by HDR pretreatment, LDR could not induce tumor inhibition. However, when LDR was administered before HDR, the immunity could be protected from impairment, and tumor growth could be inhibited to some extent, indicating the induction of the immune adaptive response by LDR. Therefore, we demonstrated that immune enhancement played a key role in LDR-induced tumor inhibition. These findings emphasized the importance of the immune response in tumor radiotherapy and may help promote the application of LDR as a novel approach in clinical practice. © 2018 The Authors. Cancer Medicine published by John Wiley & Sons Ltd.

  1. Métodos para avaliação da qualidade fisiológica de sementes de feijão vigna Methods for evaluation of physiological quality of vigna bean seeds

    Directory of Open Access Journals (Sweden)

    Antonieta Laurinda Francisco Bias

    1999-07-01

    Full Text Available Visando comparar diferentes testes de vigor quanto à avaliação da qualidade fisiológica, quatro lotes de sementes de feijão vigna (Vigna unguiculata W. de duas cultivares ('EPACE-10' e 'IPA-206' foram armazenados por 180 dias (novembro/94 a maio/95, em condições normais de ambiente em Pelotas, RS. Bimestralmente, foram conduzidos testes de germinação, envelhecimento acelerado, condutividade elétrica, frio sem solo, emergência de plântulas em campo e peso de matéria seca da parte aérea das plântulas. A análise e a interpretação dos resultados indicaram que a avaliação da qualidade fisiológica de sementes de feijão vigna deve ser fundamentada no conjunto das informações fornecidas por diferentes testes de vigor. O teste de frio sem solo, dentre os testes estudados, é o que apresenta melhor relação com a emergência das plântulas em campo. O peso de matéria seca da parte aérea das plântulas não é eficiente na separação de lotes de sementes de feijão vigna em diferentes níveis de vigor.The aim of this research was to compare vigor tests for seed quality evaluation. Four seed lots of vigna bean (Vigna unguiculata W. of two cultivares (EPACE-10 and IPA-206, were stored for six months (november/94 to may/95 at natural environmen conditions of Pelotas, RS, Brazil and evaluated at two month intervals, throught the following tests: germination, accelerated aging, cold test without soil, electrical condutivity, seedling dry weight and field emergence tests. The analysis and interpretation of the results showed that the evaluation of the physiological quality of vigna bean seeds needs to be based on different vigor tests. Among the tests, the cold test without soil was the best related with seedling field emergence. The seedling dry weight was not effective to separate vigna bean seed lots in different vigor levels.

  2. Inhibition of Vascular Endothelial Growth Factor A and Hypoxia-Inducible Factor 1α Maximizes the Effects of Radiation in Sarcoma Mouse Models Through Destruction of Tumor Vasculature

    International Nuclear Information System (INIS)

    Lee, Hae-June; Yoon, Changhwan; Park, Do Joong; Kim, Yeo-Jung; Schmidt, Benjamin; Lee, Yoon-Jin; Tap, William D.; Eisinger-Mathason, T.S. Karin; Choy, Edwin; Kirsch, David G.; Simon, M. Celeste

    2015-01-01

    Purpose: To examine the addition of genetic or pharmacologic inhibition of hypoxia-inducible factor 1α (HIF-1α) to radiation therapy (RT) and vascular endothelial growth factor A (VEGF-A) inhibition (ie trimodality therapy) for soft-tissue sarcoma. Methods and Materials: Hypoxia-inducible factor 1α was inhibited using short hairpin RNA or low metronomic doses of doxorubicin, which blocks HIF-1α binding to DNA. Trimodality therapy was examined in a mouse xenograft model and a genetically engineered mouse model of sarcoma, as well as in vitro in tumor endothelial cells (ECs) and 4 sarcoma cell lines. Results: In both mouse models, any monotherapy or bimodality therapy resulted in tumor growth beyond 250 mm 3 within the 12-day treatment period, but trimodality therapy with RT, VEGF-A inhibition, and HIF-1α inhibition kept tumors at <250 mm 3 for up to 30 days. Trimodality therapy on tumors reduced HIF-1α activity as measured by expression of nuclear HIF-1α by 87% to 95% compared with RT alone, and cytoplasmic carbonic anhydrase 9 by 79% to 82%. Trimodality therapy also increased EC-specific apoptosis 2- to 4-fold more than RT alone and reduced microvessel density by 75% to 82%. When tumor ECs were treated in vitro with trimodality therapy under hypoxia, there were significant decreases in proliferation and colony formation and increases in DNA damage (as measured by Comet assay and γH2AX expression) and apoptosis (as measured by cleaved caspase 3 expression). Trimodality therapy had much less pronounced effects when 4 sarcoma cell lines were examined in these same assays. Conclusions: Inhibition of HIF-1α is highly effective when combined with RT and VEGF-A inhibition in blocking sarcoma growth by maximizing DNA damage and apoptosis in tumor ECs, leading to loss of tumor vasculature

  3. Inhibition of Vascular Endothelial Growth Factor A and Hypoxia-Inducible Factor 1α Maximizes the Effects of Radiation in Sarcoma Mouse Models Through Destruction of Tumor Vasculature

    Energy Technology Data Exchange (ETDEWEB)

    Lee, Hae-June [Department of Surgery, Massachusetts General Hospital and Harvard Medical School, Boston, Massachusetts (United States); Division of Radiation Effects, Korea Institute of Radiological and Medical Sciences, Seoul (Korea, Republic of); Yoon, Changhwan [Department of Surgery, Memorial Sloan-Kettering Cancer Center, New York, New York (United States); Park, Do Joong [Department of Surgery, Memorial Sloan-Kettering Cancer Center, New York, New York (United States); Department of Surgery, Seoul National University Bundang Hospital, Sungnam (Korea, Republic of); Kim, Yeo-Jung [Abramson Family Cancer Research Institute, Perelman School of Medicine, University of Pennsylvania, Philadelphia, Pennsylvania (United States); Schmidt, Benjamin [Department of Surgery, Massachusetts General Hospital and Harvard Medical School, Boston, Massachusetts (United States); Lee, Yoon-Jin [Department of Surgery, Massachusetts General Hospital and Harvard Medical School, Boston, Massachusetts (United States); Division of Radiation Effects, Korea Institute of Radiological and Medical Sciences, Seoul (Korea, Republic of); Tap, William D. [Department of Medicine, Memorial Sloan-Kettering Cancer Center, New York, New York (United States); Eisinger-Mathason, T.S. Karin [Abramson Family Cancer Research Institute, Perelman School of Medicine, University of Pennsylvania, Philadelphia, Pennsylvania (United States); Choy, Edwin [Department of Medicine, Massachusetts General Hospital and Harvard Medical School, Boston, Massachusetts (United States); Kirsch, David G. [Department of Pharmacology and Cancer Biology, Duke University Medical Center, Durham, North Carolina (United States); Department of Radiation Oncology, Duke University Medical Center, Durham, North Carolina (United States); Simon, M. Celeste [Abramson Family Cancer Research Institute, Perelman School of Medicine, University of Pennsylvania, Philadelphia, Pennsylvania (United States); Howard Hughes Medical Institute (United States); and others

    2015-03-01

    Purpose: To examine the addition of genetic or pharmacologic inhibition of hypoxia-inducible factor 1α (HIF-1α) to radiation therapy (RT) and vascular endothelial growth factor A (VEGF-A) inhibition (ie trimodality therapy) for soft-tissue sarcoma. Methods and Materials: Hypoxia-inducible factor 1α was inhibited using short hairpin RNA or low metronomic doses of doxorubicin, which blocks HIF-1α binding to DNA. Trimodality therapy was examined in a mouse xenograft model and a genetically engineered mouse model of sarcoma, as well as in vitro in tumor endothelial cells (ECs) and 4 sarcoma cell lines. Results: In both mouse models, any monotherapy or bimodality therapy resulted in tumor growth beyond 250 mm{sup 3} within the 12-day treatment period, but trimodality therapy with RT, VEGF-A inhibition, and HIF-1α inhibition kept tumors at <250 mm{sup 3} for up to 30 days. Trimodality therapy on tumors reduced HIF-1α activity as measured by expression of nuclear HIF-1α by 87% to 95% compared with RT alone, and cytoplasmic carbonic anhydrase 9 by 79% to 82%. Trimodality therapy also increased EC-specific apoptosis 2- to 4-fold more than RT alone and reduced microvessel density by 75% to 82%. When tumor ECs were treated in vitro with trimodality therapy under hypoxia, there were significant decreases in proliferation and colony formation and increases in DNA damage (as measured by Comet assay and γH2AX expression) and apoptosis (as measured by cleaved caspase 3 expression). Trimodality therapy had much less pronounced effects when 4 sarcoma cell lines were examined in these same assays. Conclusions: Inhibition of HIF-1α is highly effective when combined with RT and VEGF-A inhibition in blocking sarcoma growth by maximizing DNA damage and apoptosis in tumor ECs, leading to loss of tumor vasculature.

  4. Infectividad y efectividad de rizobios aislados de Suelos de la Costa Caribe Colombiana en Vigna unguiculata

    Directory of Open Access Journals (Sweden)

    Jonathan Alberto Mendoza Labrador

    2014-07-01

    Full Text Available Título en español: Infectividad y efectividad de rizobios aislados de Suelos de la Costa Caribe Colombiana  en Vigna unguiculata Título en ingles: Infectivity and effectiveness of isolated rhizobia from colombian caribbean soils in Vigna unguiculata Título corto: Infectividad y efectividad de rizobios aislados de Suelos Resumen:  Es el primer estudio en Colombia que abarca una evaluación de rizobios nativos asociados a frijol Caupí (Vigna unguiculata L. Walp. en los departamentos del Cesar y la Guajira. En esta investigación, se demostró que la utilización de  aislamientos de rizobios nativos aislados a partir de  nódulos,  mejoraron el desarrollo del frijol Caupí  (Vigna unguiculata L. Walp., siendo estas bacterias más eficientes que los tratamientos químicos y absolutos (sin inóculo ni fertilización y que las cepas inducidas mejorando además, la fijación biológica de nitrógeno y la tasa fotosintética. Como aportes del estudio, se determinó que en condiciones de invernadero la fertilización biológica fue más eficiente que la química y que, de acuerdo a los resultados obtenidos de las diferentes variables agronómicas evaluadas, esto podría influir positivamente en los rendimientos nutricionales del cultivo, base alimentaria de los sistemas ganaderos de estas regiones del país y  fuente alimenticia  de la comunidad indígena y de bajos recursos económicos.  Palabras clave Nodulación, fijación Biológica de Nitrógeno, Fertilización, Tasa Fotosintética Abstract:  This is the first study in Colombia which covers an evaluation of native rhizobium associated to the Caupí bean   (Vigna unguiculata L. Walp. in the departaments of Cesar and Guajira. In this research it was demonstrated that the use of native rhizobium isolated from nodes, improved the development of the Caupí bean (Vigna unguiculata L. Walp., being this bacteria more efficient than the chemical and absolute treatments (without inoculum and

  5. Evaluation of the role of damage to photosystem II in the inhibition of CO2 assimilation in pea leaves on exposure to UV-B radiation

    International Nuclear Information System (INIS)

    Nogues, S.; Baker, N.R.

    1995-01-01

    Mature pea (Pisum sativum L., cv. Meteor) leaves were exposed to two levels of UV-B radiation, with and without supplementary UV-C radiation, during 15 h photoperiods. Simultaneous measurements of CO 2 assimilation and modulated chlorophyll fluorescence parameters demonstrated that irradiation with UV-B resulted in decreases in CO 2 assimilation that are not accompanied by decreases in the maximum quantum efficiency of photosystem II (PSII) primary photochemistry. Increased exposure to UV-B resulted in a further loss of CO 2 assimilation and decreases in the maximum quantum efficiency of PSII primary photochemistry, which were accompanied by a loss of the capacity of thylakoids isolated from the leaves to bind atrazine, thus demonstrating that photodamage to PSII reaction centres had occurred. Addition of UV-C to the UV-B treatments increased markedly the rate of inhibition of photosynthesis, but the relationships between CO 2 assimilation and PSII characteristics remained the same, indicating that UV-B and UV-C inhibit leaf photosynthesis by a similar mechanism. It is concluded that PSII is not the primary target site involved in the onset of the inhibition of photosynthesis in pea leaves induced by irradiation with UV-B. (author)

  6. Kaempferol protects against gamma radiation-induced mortality and damage via inhibiting oxidative stress and modulating apoptotic molecules in vivo and vitro.

    Science.gov (United States)

    Wang, Jing; Li, Tiejun; Feng, Jingjing; Li, Li; Wang, Rong; Cheng, Hao; Yuan, Yongfang

    2018-04-20

    To investigate the potential protective effect of kaempferol, a representative flavonoid, against radiation induced mortality and injury in vivo and vitro.C57BL/6 male mice and human umbilical venous endothelial cells (HUVECs) were pretreated with kaempferol before radiation. We found that kaempferol can effectively increase 30-day survival rate after 8.5 Gy lethal total body irradiation (TBI). Mice were sacrificed at 7th day after 7 Gy TBI, we found kaempferol against radiation-induced tissues damage, by inhibiting the oxidative stress, and attenuating morphological changes and cell apoptosis. In vitro, kaempferol increased HUVECs cell viability and decrease apoptosis. It also mitigated oxidative stress and restored the abnormal expression of prx-5, Cyt-c, Caspase9 and Caspase3 in mRNA and protein level in HUVECs after radiation. Taken together, it suggests kaempferol can protect against gamma-radiation induced tissue damage and mortality. The present study is the first report of the radioprotective role of kaempferol in vivo and vitro. Copyright © 2018 Elsevier B.V. All rights reserved.

  7. FIXING ABILITY OF COWPEA (Vigna unguiculata (L) Walp)

    African Journals Online (AJOL)

    sys01

    2011-09-03

    Sep 3, 2011 ... mixture and later thinned to two plants per stand at two weeks after planting (2 WAP).,This gave a total population of about 80, 000 plants per ... nitrogen requirement from the atmosphere. Root nodules formed by soil rhizobia ..... solar radiation requirements on growth and nitrogen fixation of soybean,.

  8. THE ALLELOPATHIC EFFECT OF SHREDDED LEAVES OF ARTOCARPUS HETEROPHYLLUS AND A. ALTILIS ON VIGNA RADIATA L

    OpenAIRE

    Romilly Margaret Mendez* & Glaxy Ezekel.V

    2017-01-01

    In the present study, an attempt has been made to study the effect of Artocarpus heterophyllus Lam. and Artocarpus altilis (Parkinson) Fosberg on seed germination, seedling growth and total phenolic content of Vigna radiata L. The objective of this study is to assess the rate of germination, growth of the seedlings and the chlorophyll content of the cultivar seeds exposed to four concentrations (10 ppm, 1 ppm, 0.1 ppm and 0.01 ppm) of the leaf extracts of A. heterophyllus and A. altilis. I...

  9. Induction of chlorophyll chimeras and chlorophyll mutations in mungbean (Vigna radiata) cv. T44

    International Nuclear Information System (INIS)

    Singh, V.P.; Yadav, R.D.S.

    1993-01-01

    Uniform and healthy seeds of mungbean (Vigna radiata) cv. T44 were exposed to varying doses of gamma rays, ethyl methane sulphonate (EMS) and combination treatment of gamma rays with EMS. The data were recorded for seed germination, plant survival, frequency and spectrum of chlorophyll chimeras in M 1 and chlorophyll mutations in M 2 generation. Among all, the combination treatments were found most effective for inducing chlorophyll chimeras and chlorophyll mutations than the gamma rays or EMS alone. Of the mutants under reference, the albino, xantha and chlorina showed monogenic recessive while viridis exhibited digenic recessive inheritance. (author). 8 refs., 2 tabs

  10. COMPOSICIÓN NUTRICIONAL Y FACTORES ANTINUTRICIONAL DE ESPECIES POCO CONOCIDAS DE VIGNA

    Directory of Open Access Journals (Sweden)

    Chinnamadasamy Kalidass

    2012-11-01

    Full Text Available Las semillas de Vigna trilobata, V. radiata var. sublobata, V. umbellata, V. unguiculata subsp. cylindrica, V. aconitifolia, V. vexillata and V. bourneae se colectaron de diferentes regiones geográficas en el oeste de Ghats Tamil Nadu. Se analizó su composición proximal y mineral, vitaminas (niacina y ácido ascórbico, perfiles de ácidos grasos, perfiles de aminoácidos de la proteína total de la semillas, digestibilidad de la proteína in vitro (IVPD y algunos factores antinutricionales. La proteína cruda tuvo un rango entre 18.24 a 26.12%, lípidos totales de 3.8 a 6.48%, fibra dietética total de 3.42 a 7.48%, cenizas de 3.10 a 4.12% y carbohidratos de 59.44 a 72.06%. Los valores de energía de la semilla estuvieron entre 1584.87 a 1644.34 kJ100g-1MS, los cuales fueron comparables con otras leguminosas. Los perfiles de ácidos grasos de todas las especies de Vigna revelaron altas concentraciones de ácido oleico, linoleico y linolenico. Los perfiles de aminoácidos esenciales del total de proteína de la semilla se compararon favorablemente con los requerimientos de la FAO/WHO (1991, con excepción de ciertas deficiencias de aminoácidos azufrados en todas las especies de Vigna El IVPD de las diferentes especies de Vigna tuvo un rango de 70.38 a 79.12%. Sustancias antinutricionales como el total de fenoles libres, taninos, L-DOPA (3-4 dihidroxifenilalanina, ácido fitico, cinacina hidrogenada, actividad inhibidora de la tripsina, oligosacáridos y actividad fitohematoaglutinadora también se determinaron. Los factores antinutricionales que fueron detectados, se presume que presentan una pequeña significancia si los frijoles son procesados correctamente.

  11. First Report of Cowpea Mild Mottle Carlavirus on Yardlong Bean (Vigna unguiculata subsp. sesquipedalis in Venezuela

    Directory of Open Access Journals (Sweden)

    Edgloris Marys

    2012-12-01

    Full Text Available Yardlong bean (Vigna unguiculata subsp. sesquipedalis plants with virus-like systemic mottling and leaf distortion were observed in both experimental and commercial fields in Aragua State, Venezuela. Symptomatic leaves were shown to contain carlavirus-like particles. RT-PCR analysis with carlavirus-specific primers was positive in all tested samples. Nucleotide sequences of the obtained amplicons showed 84%–74% similarity to corresponding sequences of Cowpea mild mottle virus (CPMMV isolates deposited in the GenBank database. This is the first report of CPMMV in Venezuela and is thought to be the first report of CPMMV infecting yardlong bean.

  12. UVR-induced photosynthetic inhibition dominates over DNA damage in marine dinoflagellates exposed to fluctuating solar radiation regimes

    NARCIS (Netherlands)

    Helbling, E. Walter; Buma, Anita G. J.; van de Poll, Willem; Fernandez Zenoff, M. Veronica; Villafane, Virginia E.

    2008-01-01

    The combined effect of solar radiation (UV-B (280-315 nm), UWA (315-400 nm) and PAR (400-700 nm)) and vertical mixing (i.e., fluctuating radiation regimes) on the marine dinoflagellates Gymnodinium chlorophorum, Heterocapsa triquetra and Prorocentrum micans was investigated during the austral spring

  13. Genetic diversity and population structure analysis of accessions in the Chinese cowpea [Vigna unguiculata (L.) Walp.] germplasm collection

    Science.gov (United States)

    Cowpea (Vigna unguiculata) is an important legume crop with diverse uses. The species is presently a minor crop, and evaluation of its genetic diversity has been very limited. In this study, a total of 200 genic and 100 genomic simple sequence repeat (SSR) markers were developed from cowpea unigene ...

  14. Transformation of Cowpea Vigna unguiculata Cells with an Antibiotic Resistance Gene Using a Ti-Plasmid-Derived Vector

    NARCIS (Netherlands)

    Hille, Jacques; Goldbach, Rob

    1986-01-01

    A chimaeric antibiotic resistance gene was transferred to cowpea (Vigna unguiculata), a member of the legume family. This transfer was established by inoculating cowpea leaf discs with an Agrobacterium tumefaciens strain harboring a Ti-plasmid-derived vector that contained two copies of a chimaeric

  15. The phosphorus and nitrogen nutrition of bambara groundnut (Vigna subterranea (L.) Verdc.) in Botswana soils : an exploratory study

    NARCIS (Netherlands)

    Ramolemana, G.M.

    1999-01-01

    Bambara groundnut ( Vigna subterranea (L.) Verdec.) is a legume crop grown especially by small farmers mainly in semi-arid parts of Africa both in mixed cultivation and pure stands. It is considered as a hardy crop because of its drought tolerance, resistance to pests

  16. Functional inhibition of Ubiquitin conjugating Enzyme (UBE2C) reduces proliferation and sensitizes cervical and breast cancer cells to radiation, doxorubicin, tamoxifen and letrozole

    International Nuclear Information System (INIS)

    Bose, Mayil Vahanan; Rawat, Akhilesh; Gopisetty, Gopal; Thangarajan, Rajkumar; Ganesharaja, Selvaluxmy

    2014-01-01

    Cervical cancer is the second most common cancer in women, worldwide. About 80% of cervical cancer cases occur in developing countries. Breast cancer has overtaken cervical cancer in most of the urban centers in India. In recent years, interest in the role of Ubiquitin conjugating Enzyme E2C (UBE2C) in cancer has shown a dramatic increase. Several studies have reported UBE2C as a potential oncogene and therapeutic target. The objective of the study was to elucidate radiation and chemo-sensitivity in response to functional inhibition of UBE2C in cervical and breast cancer cell lines. Taqman Real time PCR was performed to measure UBE2C levels in cervical and breast cancer cell lines. A dominant negative form of UBE2C (DN-UBE2C) was used to functionally inhibit wild type UBE2C. Cell proliferation and anchorage independent growth were measured by colorimetric assay and soft agar assay respectively. Radiation and chemo response of cell lines were assessed by colorimetric assay and clonogenic assay. Difference in sensitivity to radiation was observed among the cervical cancer cell lines studied. The growth rate of SiHa and HeLa transfected with DN- UBE2C was significantly reduced compared to vector control. Further, DN-UBE2C mediated radio-sensitivity was correlated with a significant decrease in resistance to radiation by SiHa and HeLa cells after transfection when compared to control cultures. Similarly, both the growth rate and the anchorage independent growth of MCF7 and MDAMB231 cells transfected with DN-UBE2C were significantly reduced compared to cells transfected with vector alone. MCF7 and MDAMB231 cells expressing DN-UBE2C were significantly more sensitive to different doses of radiation and doxorubicin compared to controls. In addition, DN-UBE2C transfected MCF7 cells were more sensitive to inhibition by tamoxifen and letrozole compared to vector controls. These results suggest that UBE2C can be used as a potential therapeutic target for cervical and breast

  17. Inhibition of COX-2 expression by topical diclofenac enhanced radiation sensitivity via enhancement of TRAIL in human prostate adenocarcinoma xenograft model

    Science.gov (United States)

    2013-01-01

    Background COX-2 inhibitors have an antitumor potential and have been verified by many researchers. Treatment of cancer cells with external stressors such as irradiation can stimulate the over-expression of COX-2 and possibly confer radiation resistance. In this study, we tested if topical diclofenac, which inhibits both COX-1 and COX-2, administration rendered prostate tumor cells sensitize to the effects of radiation. Methods LNCaP-COX-2 and LNCaP-Neo cells were treated with 0 to 1000 μM diclofenac. Next, a clonogenic assay was performed in which cells were subjected to irradiation (0 to 4 Gy) with or without diclofenac. COX-2 expression and other relevant molecules were measured by real-time PCR and immunohistochemistry after irradiation and diclofenac treatment. In addition, we assessed the tumor volumes of xenograft LNCaP-COX-2 cells treated with topical diclofenac with or without radiation therapy (RT). Results LNCaP-COX-2 and LNCaP-Neo cell lines experienced cytotoxic effects of diclofenac in a dose related manner. Clonogenic assays demonstrated that LNCaP-COX-2 cells were significantly more resistant to RT than LNCaP-Neo cells. Furthermore, the addition of diclofenac sensitized LNCaP-COX-2 not but LNCaP-Neo cells to the cytocidal effects of radiation. In LNCaP-COX-2 cells, diclofenac enhanced radiation-induced apoptosis compared with RT alone. This phenomenon might be attributed to enhancement of RT-induced TRAIL expression as demonstrated by real-time PCR analysis. Lastly, tumor volumes of LNCaP-COX-2 cells xenograft treated with diclofenac or RT alone was >4-fold higher than in mice treated with combined diclofenac and radiation (pdiclofenac enhances the effect of RT on prostate cancer cells that express COX-2. Thus, diclofenac may have potential as radiosensitizer for treatment of prostate cancer. PMID:23289871

  18. Morphology of seeds and seedlings of four species of Vigna Savi (Leguminosae, Phaseolinae

    Directory of Open Access Journals (Sweden)

    Fabiana Soledad Ojeda

    2013-09-01

    Full Text Available Four neotropical species of Vigna Savi (Leguminosae, Phaseolinae have potential value as forage crops or ornamentals and could be cultivated in tropical or subtropical areas, even on floodplains. In order to obtain useful data for their culture and taxonomy, the seed morphology, germination pattern (hypogeal or epigeal and seedling development were studied. The studied species belong to different sections of the genus: V. adenantha (G.F.W. Meyer Maréchal, Mascherpa & Stainier (Sect. Leptospron; V. candida (Vell. Maréchal, Mascherpa & Stainier (Sect. Sigmoidotropis; V. caracalla (L. Verdc. (Sect. Caracallae and V. luteola (Jacq. Benth. (Sect. Vigna. The seeds were collected during fieldwork conducted in northwestern and northeastern Argentina. The qualitative and quantitative characters of the seeds were registered, after which they were sown. The development of the emerged seedlings was followed, first in a greenhouse and thereafter in open field. We recorded the type of germination, the thigmotropic movements of the hypocotyl and of the stem, seedling architecture and plant longevity. These traits allowed us to differentiate the species and construct an identification key that could be useful for agronomic or floricultural purposes. The data obtained partially support the current taxonomic treatment of the genus.

  19. [Use of Phaseolus vulgaris and Vigna sinensis in a fermented dairy drink].

    Science.gov (United States)

    Granito, Marisela; Trujillo, Lesma; Guerra, Marisa

    2004-06-01

    The objective of this work was to develop a new kind fermented dairy drink, partially substituted with clear varieties of Phaseolus vulgaris (caraota) and Vigna sinensis (frijol). The formulation of fermented dairy drinks included sterile extracts of caraota and frijol, as partial substitutes which replaced milk: 10, 20 and 30%. The mixtures were inoculated with 2% of a mixture of Lactobacillus acidophillus, Streptococcus thermophilus and Bifidobacterium sp. and were incubated at 42 degrees C for 7 hours. Mango and guava jams were used as flavorings at 20%. On the basis of the sensorial evaluation the mixtures 10% frijol-mango, 10% frijol-guava, 30% caraota-mango and 20% caraota-guava were selected. In the selected fermented dairy drinks, the levels of protein, soluble and insoluble fiber, available and resistant starches were increased and the protein digestibility was 81%. The technical feasibility of partial substitution of milk with extracts of Phaseolus vulgaris or Vigna sinensis. For the elaboration of a fermented dairy drink similar to the liquid yogurt kind was demonstrated.

  20. Detection of Aflatoxin Producing Aspergillus flavus in Post-harvest Contaminated Vigna ungulculata Seeds

    Directory of Open Access Journals (Sweden)

    Ajay Kumar Gautam

    2014-07-01

    Full Text Available The present study was carried out with a specific objective to study postharvest spoilage of Lobhiya (Vigna unguiculata seeds contaminated with Aspergillus flavus. Infected seeds were collected and cultured on potato dextrose agar (PDA media, at 25±2 °C. Aspergillus flavus isolates were primarily characterized by its morphological and microscopic characteristics. Collected fungal isolates were also screened for their afaltoxigenic nature on preliminary basis and at molecular level. For preliminary screening, 5 mm disc of fungal culture was soaked with few drops of liquid ammonia. Color change from yellow pigment to plum-red with different intensities showed the mycotoxic nature of the fungus. DNA from fungal isolates was isolated and amplified using PCR with aflatoxin specific primers, apa-2, ver-1 and omt-1. Amplicons of 1032 bp, 895 bp and 596 bp were obtained in most of the isolates regardless of primer set used which was useful to differentiate between mycotoxic and nontoxic isolates of A. flavus. The isolation of aflatoxigenic strains of A. flavus during post-harvest period of lobhiya seeds raise a serious concern over the quality of seeds and a threat to heath of consumers. It was concluded that Aspergillus flavus is responsible for postharvest spolilage of Lobhiya (Vigna unguiculata.

  1. Development and Validation of EST-SSR Markers from the Transcriptome of Adzuki Bean (Vigna angularis).

    Science.gov (United States)

    Chen, Honglin; Liu, Liping; Wang, Lixia; Wang, Suhua; Somta, Prakit; Cheng, Xuzhen

    2015-01-01

    The adzuki bean (Vigna angularis (Ohwi) Ohwi and Ohashi) is an important grain legume of Asia. It is cultivated mainly in China, Japan and Korea. Despite its importance, few genomic resources are available for molecular genetic research of adzuki bean. In this study, we developed EST-SSR markers for the adzuki bean through next-generation sequencing. More than 112 million high-quality cDNA sequence reads were obtained from adzuki bean using Illumina paired-end sequencing technology, and the sequences were de novo assembled into 65,950 unigenes. The average length of the unigenes was 1,213 bp. Among the unigenes, 14,547 sequences contained a unique simple sequence repeat (SSR) and 3,350 sequences contained more than one SSR. A total of 7,947 EST-SSRs were identified as potential molecular markers, with mono-nucleotide A/T repeats (99.0%) as the most abundant motif class, followed by AG/CT (68.4%), AAG/CTT (30.0%), AAAG/CTTT (26.2%), AAAAG/CTTTT (16.1%), and AACGGG/CCCGTT (6.0%). A total of 500 SSR markers were randomly selected for validation, of which 296 markers produced reproducible amplicons with 38 polymorphic markers among the 32 adzuki bean genotypes selected from diverse geographical locations across China. The large number of SSR-containing sequences and EST-SSR markers will be valuable for genetic analysis of the adzuki bean and related Vigna species.

  2. The effect of ultraviolet radiation on early stages of activation of human lymphocytes: inhibition is independent of effects on DNA

    DEFF Research Database (Denmark)

    Castellanos, G; Owens, T; Rudd, C

    1982-01-01

    whether activation was measured by the incorporation of labelled leucine, uridine, or thymidine. If UV was applied at 44 h after culture in presence of Con A, the incorporation of [3H]thymidine measured 4 h later was seen to be inhibited but transcription and translation were scarcely affected. UV...... lymphocytes, when this was measured by means of 86Rb uptake after 2-4 h culture. The mitogen-stimulated activation of cation pump function has previously been shown to be unaffected by concentrations of cycloheximide and actinomycin D which produce virtually complete inhibition of protein and RNA synthesis...

  3. Radiations

    International Nuclear Information System (INIS)

    Pujol Mora, J.

    1999-01-01

    The exposition to ionizing radiations is a constant fact in the life of the human being and its utilization as diagnostic and therapeutic method is generalized. However, it is notorious how as years go on, the fear to the ionizing radiation seems to persist too, and this fact is not limited to the common individual, but to the technical personnel and professional personnel that labors with them same. (S. Grainger) [es

  4. Radiation

    International Nuclear Information System (INIS)

    Davidson, J.H.

    1986-01-01

    The basic facts about radiation are explained, along with some simple and natural ways of combating its ill-effects, based on ancient healing wisdom as well as the latest biochemical and technological research. Details are also given of the diet that saved thousands of lives in Nagasaki after the Atomic bomb attack. Special comment is made on the use of radiation for food processing. (U.K.)

  5. Exogenous Spermidine Alleviates Low Temperature Injury in Mung Bean (Vigna radiata L. Seedlings by Modulating Ascorbate-Glutathione and Glyoxalase Pathway

    Directory of Open Access Journals (Sweden)

    Kamrun Nahar

    2015-12-01

    Full Text Available The role of exogenous spermidine (Spd in alleviating low temperature (LT stress in mung bean (Vigna radiata L. cv. BARI Mung-3 seedlings has been investigated. Low temperature stress modulated the non-enzymatic and enzymatic components of ascorbate-glutathione (AsA-GSH cycle, increased H2O2 content and lipid peroxidation, which indicate oxidative damage of seedlings. Low temperature reduced the leaf relative water content (RWC and destroyed leaf chlorophyll, which inhibited seedlings growth. Exogenous pretreatment of Spd in LT-affected seedlings significantly increased the contents of non-enzymatic antioxidants of AsA-GSH cycle, which include AsA and GSH. Exogenous Spd decreased dehydroascorbate (DHA, increased AsA/DHA ratio, decreased glutathione disulfide (GSSG and increased GSH/GSSG ratio under LT stress. Activities of AsA-GSH cycle enzymes such as ascorbate peroxidase (APX, monodehydroascorbate reductase (MDHAR, dehydroascorbate reductase (DHAR and glutathione reductase (GR increased after Spd pretreatment in LT affected seedlings. Thus, the oxidative stress was reduced. Protective effects of Spd are also reflected from reduction of methylglyoxal (MG toxicity by improving glyoxalase cycle components, and by maintaining osmoregulation, water status and improved seedlings growth. The present study reveals the vital roles of AsA-GSH and glyoxalase cycle in alleviating LT injury.

  6. Sprout inhibition in garlic (Allium sativum) and onion (Allium cepa L.) by gamma irradiation. Part of a coordinated programme on pre-commercial scale radiation treatment of food

    International Nuclear Information System (INIS)

    Curzio, O.A.

    1982-04-01

    With the aim of verifying the possibilities and circumstances of sprout inhibition and storage life extension of onion and garlic by gamma irradiation, onion bulbs of variety Valenciana Sintetica 14 and garlic bulbs of a coloured locally grown variety were subjected to irradiation with 3 Krad of 60 Co gamma rays. The dose rate was 2440 rad/min; the irradiation conditions warranted a Dsub(max)/Dsub(min) ratio of 1.25. The irradiated bulbs and control samples of non-irradiated bulbs were investigated for a period of 270 to 330 days. Weight loss, external and internal sprouting, signs of decay, and the percentage of commercial bulbs were observed with the following results. Weight loss was found to be less in irradiated bulbs than in controls - 22% against 40% for onion and 33% against 65% for garlic. The dose of gamma radiation employed was proved to be sufficient for sprout inhibition in both species and for partial inhibition of decay and softening. The aroma of garlic was not impaired by irradiation. For both products, gamma irradiation was found to prolong the period of commercial utilizability

  7. Dose- and time-dependent radiation inhibition of RNA and glycosaminoglycan synthesis in embryonic cartilage: an in vitro study

    Energy Technology Data Exchange (ETDEWEB)

    Cornelissen, M.; Thierens, H.; De Ridder, L. (Ghent Rijksuniversiteit (Belgium))

    1990-05-01

    Radiation effects on the RNA and glycosaminoglycan (GAG) synthesis of embryonic cartilaginous tibiae were studied in vitro during a 4- or 7-day culture period. Before culture, tibiae received single radiation doses of 20, 50 or 100 Gy. A limited, dose-dependent immediate effect on RNA and GAG synthesis was found. This effect was unchanged for 2 days. After this period a time-dependent delayed effect was observed. For each radiation dose, and for each precursor, the same time-related pattern was found. At the end of the culture period acid phosphatase activity, an early indicator of apoptosis, was higher in irradiated tibiae than in controls. No other morphological ultrastructural differences were observed at this time. The authors conclude that metabolic alterations are probably due to stimulation of initial stages of the apoptotic process in the irradiated cartilage cells. (author).

  8. Radiation

    International Nuclear Information System (INIS)

    Winther, J.F.; Ulbak, K.; Dreyer, L.; Pukkala, E.; Oesterlind, A.

    1997-01-01

    Exposure to solar and ionizing radiation increases the risk for cancer in humans. Some 5% of solar radiation is within the ultraviolet spectrum and may cause both malignant melanoma and non-melanocytic skin cancer; the latter is regarded as a benign disease and is accordingly not included in our estimation of avoidable cancers. Under the assumption that the rate of occurrence of malignant melanoma of the buttocks of both men and women and of the scalp of women would apply to all parts of the body in people completely unexposed to solar radiation, it was estimated that approximately 95% of all malignant melanomas arising in the Nordic populations around the year 2000 will be due to exposure to natural ultraviolet radiation, equivalent to an annual number of about 4700 cases, with 2100 in men and 2600 in women, or some 4% of all cancers notified. Exposure to ionizing radiation in the Nordic countries occurs at an average effective dose per capita per year of about 3 mSv (Iceland, 1.1 mSv) from natural sources, and about 1 mSv from man-made sources. While the natural sources are primarily radon in indoor air, natural radionuclides in food, cosmic radiation and gamma radiation from soil and building materials, the man-made sources are dominated by the diagnostic and therapeutic use of ionizing radiation. On the basis of measured levels of radon in Nordic dwellings and associated risk estimates for lung cancer derived from well-conducted epidemiological studies, we estimated that about 180 cases of lung cancer (1% of all lung cancer cases) per year could be avoided in the Nordic countries around the year 2000 if indoor exposure to radon were eliminated, and that an additional 720 cases (6%) could be avoided annually if either radon or tobacco smoking were eliminated. Similarly, it was estimated that the exposure of the Nordic populations to natural sources of ionizing radiation other than radon and to medical sources will each give rise to an annual total of 2120

  9. Effects of 17β-estradiol on radiation transformation in vitro; inhibition of effects by protease inhibitors

    International Nuclear Information System (INIS)

    Kennedy, A.R.; Weichselbaum, R.R.

    1981-01-01

    The effects of 17β-estradiol, given either alone or with X-radiation, on the induction of malignant transformation were investigated in vitro. Treatment with 10 -6 M 17β-estradiol for 6 weeks, or 10 -5 M 17β-estradiol for only 5 days, induced malignant transformation in C3H 10T1/2 cells. Estradiol also acted as a cocarcinogen for X-ray induced transformation; the results indicated an additive effect when the cells were exposed to both agents together. The protease inhibitors antipain and leupeptin suppressed estradiol induced transformation as well as the additive effect observed for estradiol-radiation transformation. (author)

  10. Curcumin sensitizes prostate cancer cells to radiation partly via epigenetic activation of miR-143 and miR-143 mediated autophagy inhibition.

    Science.gov (United States)

    Liu, Jianbo; Li, Min; Wang, Yuewei; Luo, Jianchao

    2017-08-01

    Curcumin has been reported as a radiosensitizer in prostate cancer. But the underlying mechanism is not well understood. In this study, we firstly assessed how curcumin affects the expression of miR-143/miR-145 cluster. Then, we investigated whether miR-143 is involved in regulation of radiosensitivity and its association with autophagy in prostate cancer cells. Our data showed that PC3, DU145 and LNCaP cells treated with curcumin had significantly restored miR-143 and miR-145 expression. Curcumin showed similar effect as 5-AZA-dC on reducing methylation of CpG dinucleotides in miR-143 promoter. In addition, curcumin treatment reduced the expression of DNMT1 and DNMT3B, which contribute to promoter hypermethylation of the miR-143/miR-145 cluster. Therefore, we infer that curcumin can restore miR-143 and miR-145 expression via hypomethylation. MiR-143 overexpression and curcumin pretreatment enhanced radiation induced cancer cell growth inhibition and apoptosis. MiR-143 and curcumin remarkably reduced radiation-induced autophagy in PC3 and DU145 cells. MiR-143 overexpression alone also reduced the basal level of autophagy in DU145 cells. Mechanistically, miR-143 can suppress autophagy in prostate cancer cells at least via downregulating ATG2B. Based on these findings, we infer that curcumin sensitizes prostate cancer cells to radiation partly via epigenetic activation of miR-143 and miR-143 mediated autophagy inhibition.

  11. Gamma radiation induced oxidative stress and apoptosis inhibiting properties of bacterial secondary metabolite RK-IP-006.G in J774A.1 murine cell line

    International Nuclear Information System (INIS)

    Malhotra, Poonam; Gupta, Ashutosh K.; Singh, Praveen K.; Chhachhia, Neha; Singh, Shravan K.; Raj Kumar

    2014-01-01

    Redox imbalance due to radiation induced oxidation of vital bio-macromolecules activates inflammatory response cascade leading to cell death. In present study, bacterial secondary metabolite, RK-IP-006.G, was evaluated for its oxidative stress and apoptosis inhibiting activities in irradiated J774A.1 murine macrophage cell line. Radiation induced intracellular ROS generation and its inhibition upon RK-IP-006.G pretreatment was estimated using 2',7'dichlorodihydroflurescein diacetate (DCFDA). Modulation in mitochondrial membrane potential (MMP) in irradiated cells and its protection by RK-IP-006.G pretreatment was evaluated using Rhodamine-123. Modulation in protein expression in irradiated and RK-IP-006.G treated J774A.1 cells was assessed by SDS-PAGE. Compensatory effect of RK-IP-006.G treatment on TNF-α expression in irradiated cells was estimated using ELISA assay. APO-BrDU assay was performed to evaluate radiation-induced apoptosis in irradiated cells. Radiation-induced cell damage and protective ability of RK-IP-006.G was also evaluated using Differential Interference Contrast Microscopy. Results of the study indicated significant (p< 0.05) decrease in DCFDA fluorescence in irradiated cells that were pretreated (∼2h) with RK-IP-006.G (0.25 μg/ml) as compared to irradiated cells. Similarly, significant (p<0.05) decrease in MMP was observed in irradiated cells pretreated with RK-IP-006.G (0.25 μg/ml) as compared to only irradiated cells at 1 h time point. SDS-PAGE analysis clearly demonstrated up-regulation of some prominent proteins in irradiated cells pretreated with RK-IP-006.G at 2-4h after treatment as compared to irradiated control. Significant (p<0.05) down regulation in TNF-α expression was observed in irradiated cells that pretreated with RK-IP-006.G compared to irradiated controls. APO-BrDU assay revealed significant reduction in apoptosis in irradiated cells pretreated with RK-IP-006.G when compared to irradiated control. The findings

  12. Effects of EMS, NMU and gamma-rays in Vigna radiata(L) Wilczek

    International Nuclear Information System (INIS)

    Chaturvedi, S.N.; Singh, V.P.

    1981-01-01

    Irrespective of the varieties involved, EMS for germination, NMU for pollen fertility and gamma-rays for seed fertility and seedling height in M 1 generation and NMU for chlorophyll mutations were proved to be most efficient. A distinct difference in genotypic response was also noticed. Variety Pusa Baisakhi was also found to be more sensitive than variety S-8. (author)

  13. PARP inhibition versus PARP-1 silencing: different outcomes in terms of single-strand break repair and radiation susceptibility

    International Nuclear Information System (INIS)

    Godon, C.; Cordelieres, F.P.; Giocanti, N.; Megnin-Chanet, F.; Hall, J.; Favaudon, V.; Godon, C.; Giocanti, N.; Megnin-Chanet, F.; Hall, J.; Favaudon, V.; Cordelieres, F.P.; Cordelieres, F.P.; Biard, D.

    2008-01-01

    The consequences of PARP-1 disruption or inhibition on DNA single-strand break repair (SSBR) and radio-induced lethality were determined in synchronized, iso-genic HeLa cells stably silenced or not for poly(ADP-ribose) polymerase-1 (PARP-1) (PARP-1(KD)) or XRCC1 (XRCC1(KD)). PARP-1 inhibition prevented XRCC1-YFP recruitment at sites of 405 nm laser micro irradiation, slowed SSBR 10-fold and triggered the accumulation of large persistent foci of GFP-PARP-1 and GFP-PCNA at photo damaged sites. These aggregates are presumed to hinder the recruitment of other effectors of the base excision repair (BER) pathway.PARP-1 silencing also prevented XRCC1-YFP recruitment but did not lengthen the lifetime of GFP-PCNA foci. Moreover, PARP-1(KD) and XRCC1(KD) cells in S phase completed SSBR as rapidly as controls, while SSBR was delayed in G1. Taken together, the data demonstrate that a PARP-1- and XRCC1-independent SSBR pathway operates when the short patch repair branch of the BER is deficient. Long patch repair is the likely mechanism, as GFP-PCNA recruitment at photo-damaged sites was normal in PARP-1(KD) cells. PARP-1 silencing elicited hyper-radiosensitivity, while radiosensitization by a PARP inhibitor reportedly occurs only in those cells treated in S phase. PARP-1 inhibition and deletion thus have different outcomes in terms of SSBR and radiosensitivity. (authors)

  14. Leaf crinkle disease in urdbean (Vigna mungo L. Hepper): An overview on causal agent, vector and host.

    Science.gov (United States)

    Gautam, Narinder Kumar; Kumar, Krishna; Prasad, Manoj

    2016-05-01

    Urdbean leaf crinkle disease (ULCD) is an economically significant widespread and devastating disease resulting in extreme crinkling, puckering and rugosity of leaves inflicting heavy yield losses annually in major urdbean-producing countries of the world. This disease is caused by urdbean leaf crinkle virus (ULCV). Urdbean (Vigna mungo L. Hepper) is relatively more susceptible than other pulses to leaf crinkle disease. Urdbean is an important and useful crop cultivated in various parts of South-East Asia and well adapted for cultivation under semi-arid and subtropical conditions. Aphids, insects and whiteflies have been reported as vectors of the disease. The virus is also transmitted through sap inoculation, grafting and seed. The loss in seed yield in ULCD-affected urdbean crop ranges from 35 to 81%, which is dependent upon type of genotype location and infection time. The diseased material and favourable climatic conditions contribute for the widespread viral disease. Anatomical and biochemical changes take place in the affected diseased plants. Genetic variations have been reported in the germplasm screening which suggest continuous screening of available varieties and new germplasm to search for new traits (new genes) and identify new sources of disease resistance. There are very few reports on breeding programmes for the development and release of varieties tolerant to ULCD. Mostly random amplified polymorphic DNA (RAPD) as well as inter-simple sequence repeat (ISSR) molecular markers have been utilized for fingerprinting of blackgram, and a few reports are there on sequence-tagged micro-satellite site (STMS) markers. There are so many RNA viruses which have also developed strategies to counteract silencing process by encoding suppressor proteins that create hindrances in the process. But, in the case of ULCV, there is no report available indicating which defence pathway is operating for its resistance in the plants and whether same silencing suppression

  15. Mesenchymal stem cell-conditioned medium prevents radiation-induced liver injury by inhibiting inflammation and protecting sinusoidal endothelial cells

    International Nuclear Information System (INIS)

    Chen Yixing; Zeng Zhaochong; Sun Jing; Huang Yan; Zhang Zhenyu; Zeng Haiying

    2015-01-01

    Current management of radiation-induced liver injury is limited. Sinusoidal endothelial cell (SEC) apoptosis and inflammation are considered to be initiating events in hepatic damage. We hypothesized that mesenchymal stem cells (MSCs) possess anti-apoptotic and anti-inflammatory actions during hepatic irradiation, acting via paracrine mechanisms. This study aims to examine whether MSC-derived bioactive components are protective against radiation-induced liver injury in rats. MSC-conditioned medium (MSC-CM) was generated from rat bone marrow–derived MSCs. The effect of MSC-CM on the viability of irradiated SECs was examined by flow cytometric analysis. Activation of the Akt and ERK pathways was analyzed by western blot. MSC-CM was also delivered to Sprague–Dawley rats immediately before receiving liver irradiation, followed by testing for pathological features, changes in serum hyaluronic acid, ALT, and inflammatory cytokine levels, and liver cell apoptosis. MSC-CM enhanced the viability of irradiated SECs in vitro and induced Akt and ERK phosphorylation in these cells. Infusion of MSC-CM immediately before liver irradiation provided a significant anti-apoptotic effect on SECs and improved the histopathological features of injury in the irradiated liver. MSC-CM also reduced the secretion and expression of inflammatory cytokines and increased the expression of anti-inflammatory cytokines. MSC-derived bioactive components could be a novel therapeutic approach for treating radiation-induced liver injury. (author)

  16. Utilization of Diamine Oxidase Enzyme from Mung Bean Sprouts (Vigna radiata L) for Histamine biosensors

    Science.gov (United States)

    Karim, Abdul; Wahab, A. W.; Raya, I.; Natsir, H.; Arif, A. R.

    2018-03-01

    This research is aimed to utilize the diamine oxidase enzyme (DAO) which isolated from mung bean sprouts (Vigna radiata L) to develop histamine biosensors based on electode enzyme with the amperometric method (cyclic voltammetry).The DAO enzyme is trapped inside the membrane of chitin-cellulose acetate 2:1 and glutaraldehyde which super imposed on a Pt electrode. Histamine will be oxidized by DAO enzyme to produce aldehydes and H2O2 that acting as electron transfer mediators.The performance of biosensors will be measured at various concentrations of glutaraldehyde, temperature changes and different range of pH. Recently, it has been found that the optimal conditions obtained from the paramaters as follows; at 25% of glutaraldehyde, temperature of 37°C and pH of 7.4. Eventually, the results provided an expectation for applying histamine biosensors in determining the freshness and safety of fish specifically skombroidae families.

  17. Development of 12 Chloroplast Microsatellite Markers in Vigna unguiculata (Fabaceae and Amplification in Phaseolus vulgaris

    Directory of Open Access Journals (Sweden)

    Lei Pan

    2014-03-01

    Full Text Available Premise of the study: Vigna unguiculata is an economically important legume, and the complexity of its variability and evolution needs to be further understood. Based on publicly available databases, we developed chloroplast microsatellite primers to investigate genetic diversity within V. unguiculata and its related species Phaseolus vulgaris. Methods and Results: Twelve polymorphic chloroplast microsatellite markers were developed and characterized in 62 V. unguiculata individuals. The number of alleles per locus varied between two and four, the unbiased haploid diversity per locus ranged from 0.123 to 0.497, and the polymorphism information content varied from 0.114 to 0.369. In cross-species amplifications, nine of these markers showed polymorphism in 29 P. vulgaris individuals. Conclusions: The newly developed chloroplast microsatellite markers exhibit variation in V. unguiculata as well as their transferability in P. vulgaris. These markers can be used to investigate genetic diversity and evolution in V. unguiculata and P. vulgaris.

  18. GENETIC OF DIVERSITY AND RELATIONSHIP BAMBARA GROUNDNUT (Vigna Subteranea L. GENOTYPE LANDRACES OF WEST JAVA

    Directory of Open Access Journals (Sweden)

    Enceng Sobari

    2017-12-01

    Full Text Available Bambara groundnut (Vigna subteranea L. is one of underutliized crops in Indonesia. Bambara groundnut is potential to be developed and can be utilized as an alternative food source in Indonesia. Bambara groundnut greatly varies and has a very wide area of adaptation. The experiment was conducted at the experimental field station at Ciparanje in Padjadjaran University. Starting on September 2014 until March 2015 with Randomized Block Design (RBD and repeated two times. The research used 30 accessions originally from various locations in West Java (Bandung, Tasikmalaya, Garut, Sumedang, Bogor, Majalengka and East Java (Lamongan, Madura. Genetic variability of Bambara groundnut landrace  in some West Java showed broad criteria on the characters fresh pod weight, dry pod weight, weight of 100 seeds, and weight per plot. Genotypes which had many similarities in some characters based on euclidian distance coefficient had close relationship.

  19. Measurements of experimental precision for trials with cowpea (Vigna unguiculata L. Walp.) genotypes.

    Science.gov (United States)

    Teodoro, P E; Torres, F E; Santos, A D; Corrêa, A M; Nascimento, M; Barroso, L M A; Ceccon, G

    2016-05-09

    The aim of this study was to evaluate the suitability of statistics as experimental precision degree measures for trials with cowpea (Vigna unguiculata L. Walp.) genotypes. Cowpea genotype yields were evaluated in 29 trials conducted in Brazil between 2005 and 2012. The genotypes were evaluated with a randomized block design with four replications. Ten statistics that were estimated for each trial were compared using descriptive statistics, Pearson correlations, and path analysis. According to the class limits established, selective accuracy and F-test values for genotype, heritability, and the coefficient of determination adequately estimated the degree of experimental precision. Using these statistics, 86.21% of the trials had adequate experimental precision. Selective accuracy and the F-test values for genotype, heritability, and the coefficient of determination were directly related to each other, and were more suitable than the coefficient of variation and the least significant difference (by the Tukey test) to evaluate experimental precision in trials with cowpea genotypes.

  20. Programmed cell death during development of cowpea (Vigna unguiculata (L.) Walp.) seed coat.

    Science.gov (United States)

    Lima, Nathália Bastos; Trindade, Fernanda Gomes; da Cunha, Maura; Oliveira, Antônia Elenir Amâncio; Topping, Jennifer; Lindsey, Keith; Fernandes, Kátia Valevski Sales

    2015-04-01

    The seed coat develops primarily from maternal tissues and comprises multiple cell layers at maturity, providing a metabolically dynamic interface between the developing embryo and the environment during embryogenesis, dormancy and germination of seeds. Seed coat development involves dramatic cellular changes, and the aim of this research was to investigate the role of programmed cell death (PCD) events during the development of seed coats of cowpea [Vigna unguiculata (L.) Walp.]. We demonstrate that cells of the developing cowpea seed coats undergo a programme of autolytic cell death, detected as cellular morphological changes in nuclei, mitochondria, chloroplasts and vacuoles, DNA fragmentation and oligonucleosome accumulation in the cytoplasm, and loss of membrane viability. We show for the first time that classes 6 and 8 caspase-like enzymes are active during seed coat development, and that these activities may be compartmentalized by translocation between vacuoles and cytoplasm during PCD events. © 2014 John Wiley & Sons Ltd.

  1. Solid state characterization and rheological properties of native and modified Bambara groundnut (Vigna subterranean starches

    Directory of Open Access Journals (Sweden)

    Michael Odeniyi

    2017-09-01

    Full Text Available This study was designed to determine the suitability of native, pregelatinized and carboxymethylated Vigna subterranean (Bambara nut starches for pharmaceutical applications, through their characterization by means of physicochemical, rheological, thermal, morphological and instrumental spectroscopic methods. The native starch was extracted from Bambara nut, after which it was used to prepare both pregelatinized and carboxymethylated forms. Microscopy revealed increased in granular size on modification. Both pregelatinized and carboxymethylated Bambara starches had better flow properties and swellability compared to the native starch. Native Bambara starch had greater tendency to retrogradation, was more sensitive to heat and heat change, these were alleviated by both pregelatinization and carboxymethylation. DSC confirmed that carboxymethylated Bambara starch was the most thermally stable starch. Presence of functional groups and crystallinity were established by FTIR and XRD, respectively. Native and modified Bambara starches can be used as locally and readily available alternative excipients in pharmaceutical formulations.

  2. Yield and Quality of Mung Bean (Vigna radiata (l. R. Wilczek Seeds Produced in Poland

    Directory of Open Access Journals (Sweden)

    Kamil MISIAK

    2017-11-01

    Full Text Available The aim of the experiment was to do field and laboratory assessments of yield and quality of mung bean (Vigna radiata (L. R. Wilczek seeds cultivated in Western Poland. Mean yield of seeds per plant was higher for common bean (Phaseolus vulgaris L. than for mung one: 13.1 g and 2.58 g, respectively. The mean 1000 mung seeds weight was 50.9 g and their germination – 78 %. Germination capacities of seeds of both beans in the field were similar. Mung beans, compared to common bean, had much smaller seeds, started to bloom later and produced mature seeds later than the latter. Mung bean seeds had more total proteins and Magnesium and Copper than common bean seeds. In Western Poland, production of high quality mung bean seeds was possible.

  3. UV Radiation Activates Toll-Like Receptor 9 Expression in Primary Human Keratinocytes, an Event Inhibited by Human Papillomavirus 38 E6 and E7 Oncoproteins.

    Science.gov (United States)

    Pacini, Laura; Ceraolo, Maria Grazia; Venuti, Assunta; Melita, Giusi; Hasan, Uzma A; Accardi, Rosita; Tommasino, Massimo

    2017-10-01

    and c-Jun, play key roles in UV-activated TLR9 expression. The E6 and E7 oncoproteins from beta HPV38 strongly inhibit UV-activated TLR9 expression by preventing the recruitment of p53 and c-Jun to the TLR9 promoter. Our findings provide additional support for the role that beta HPV types play in skin carcinogenesis by preventing activation of specific pathways upon exposure of PHKs to UV radiation. Copyright © 2017 American Society for Microbiology.

  4. Molecular cytogenetic characterisation and phylogenetic analysis of the seven cultivated Vigna species (Fabaceae).

    Science.gov (United States)

    She, C-W; Jiang, X-H; Ou, L-J; Liu, J; Long, K-L; Zhang, L-H; Duan, W-T; Zhao, W; Hu, J-C

    2015-01-01

    The genomic organisation of the seven cultivated Vigna species, V. unguiculata, V. subterranea, V. angularis, V. umbellata, V. radiata, V. mungo and V. aconitifolia, was determined using sequential combined PI and DAPI (CPD) staining and dual-colour fluorescence in situ hybridisation (FISH) with 5S and 45S rDNA probes. For phylogenetic analyses, comparative genomic in situ hybridisation (cGISH) onto somatic chromosomes and sequence analysis of the internal transcribed spacer (ITS) of 45S rDNA were used. Quantitative karyotypes were established using chromosome measurements, fluorochrome bands and rDNA FISH signals. All species had symmetrical karyotypes composed of only metacentric or metacentric and submetacentric chromosomes. Distinct heterochromatin differentiation was revealed by CPD staining and DAPI counterstaining after FISH. The rDNA sites among all species differed in their number, location and size. cGISH of V. umbellata genomic DNA to the chromosomes of all species produced strong signals in all centromeric regions of V. umbellata and V. angularis, weak signals in all pericentromeric regions of V. aconitifolia, and CPD-banded proximal regions of V. mungo var. mungo. Molecular phylogenetic trees showed that V. angularis and V. umbellata were the closest relatives, and V. mungo and V. aconitifolia were relatively closely related; these species formed a group that was separated from another group comprising V. radiata, V. unguiculata ssp. sesquipedalis and V. subterranea. This result was consistent with the phylogenetic relationships inferred from the heterochromatin and cGISH patterns; thus, fluorochrome banding and cGISH are efficient tools for the phylogenetic analysis of Vigna species. © 2014 German Botanical Society and The Royal Botanical Society of the Netherlands.

  5. Vigna radiata as a New Source for Biotransformation of Hydroquinone to Arbutin

    Directory of Open Access Journals (Sweden)

    Zahra Tofighi, Mohsen Amini, Mahzad Shirzadi, Hamideh Mirhabibi, Negar Ghazi Saeedi, Narguess Yassa

    2016-06-01

    Full Text Available Background: The suspension culture of Vigna radiata was selected for biotransformation of hydroquinone to its β-D-glucoside form (arbutin as an important therapeutic and cosmetic compound. Methods: The biotransformation efficiency of a Vigna radiata cell culture in addition to different concentrations of hydroquinone (6-20 mg/100 ml was investigated after 24 hours in comparison to an Echinacea purpurea cell culture and attempts were made to increase the efficacy of the process by adding elicitors. Results: Arbutin was accumulated in cells and found in the media only in insignificant amounts. The arbutin content of the biomass extracts of V. radiata and E. purpurea was different, ranging from 0.78 to 1.89% and 2.00 to 3.55% of dry weight, respectively. V. radiata demonstrated a bioconversion efficiency of 55.82% after adding 8 mg/100 ml precursor, which was comparable with result of 69.53% for E. purpurea cells after adding 10 mg/100 ml hydroquinone (P>0.05. In both cultures, adding hydroquinone in two portions with a 24-hour interval increased the biotransformation efficiency. Different concentrations of methyl jasmonate (25, 50, and 100 µM and chitosan (50 and 100 µg/ml as elicitors increased the bio-efficiency percentage of the V. radiata culture in comparison with the flask containing only hydroquinone. Conclusion: This is the first report of the biotransformation possibility of V. radiata cultures. It was observed the bioconversion capacity increased by adding hydroquinone in two portions, which was comparable to adding an elicitor.

  6. Sensitivity studies of the common bean (Vigna unguiculata) and maize (Zea mays) to different soil types from the crude oil drilling site at Kutchalli, Nigeria

    Energy Technology Data Exchange (ETDEWEB)

    Anoliefo, G.O. [Dept. of Botany, Univ. of Benin, Benin City (Nigeria); Isikhuemhen, O.S. [Dept. of Natural Resources and Environmental Design, NC Agricultural and Technical State Univ., Greensboro, NC (United States); Ohimain, E.I. [Rohi Biotechnologies Ltd., Port Harcourt (Nigeria)

    2006-02-15

    Background, aims and scope. The economic growth that Nigeria has enjoyed as a result of oil revenue has its drawback through exposure of people in the oil producing areas to environmental contamination, due largely to the increase in the movement of oil. Activities associated with oil well drilling on agricultural lands have led to serious economic losses on the communities affected. The local people in most of these communities are peasants who do not know how to react to drilling wastes or polluted fields where they have their crops. A case under study is the Kutchalli oil drilling area. Methods. Waste pit soil from drilling waste dumps in Kutchalli oil drilling area was tested whole and in combinations with 'clean' soil for their abilities to support plant growth and development in common bean (Vigna unguiculata) and maize (Zea mays). Seed germination, plant height, leaf area, biomass accumulation, respiratory activity as well as soil chemical analysis were used to access the ability of waste pit soil to support plant growth and development in the test plants. Results, discussion and conclusions. Waste pit soil completely inhibited the germination of bean and maize seeds. Waste pit soil in combinations with different proportions of Kutchalli soil gave growth (germination, height of plants, number of leaves, leaf area, etc.) values that were inferior to the control soil (Kutchalli) and the independent control soil (Monguno). Seeds planted in the test soil combinations containing waste pit soil showed significantly low respiratory activity. Waste pit soil seems to be toxic to plant growth and development. Drilling mud in combination with native Kutchalli soil significantly enhanced plant growth and development. Recommendations and outlook. The seed germination, growth and development inhibition by waste pit soil suggests its toxicity. We want to suggest the need for strict control and monitoring of waste pit soil in oil drilling sites. (orig.)

  7. Melanoma cells show a heterogeneous range of sensitivity to ionizing radiation and are radiosensitized by inhibition of B-RAF with PLX-4032

    International Nuclear Information System (INIS)

    Sambade, Maria J.; Peters, Eldon C.; Thomas, Nancy E.; Kaufmann, William K.; Kimple, Randall J.; Shields, Janiel M.

    2011-01-01

    Purpose: To assess the relative radiosensitivities of a large collection of melanoma cell lines and to determine whether pharmacologic inhibition of mutant B-RAF with PLX-4032 can radiosensitize B-Raf+ melanoma cells. Materials and methods: A large collection of melanoma cell lines (n = 37) were treated with 0-8 Gy IR and clonogenic survival assays used to generate survival curves to rank relative radiosensitivities among the cell lines. The ability of a B-RAF inhibitor, PLX-4032, to radiosensitize highly radioresistant B-Raf+ cells was also assessed by clonogenic cell survival and spheroid invasion assays and the effects of treatment on the cell cycle assessed by FACS. Results: Melanoma cell lines displayed a very large, heterogeneous range of SF2 values (1.002-0.053) with a mean of 0.51. Cell lines with surviving fractions of 0.29 or less at SF2 and SF4 were observed at a high frequency of 18.9% and 70.2%, respectively. Treatment of B-Raf+ cells with the B-RAF inhibitor PLX-4032 in combination with radiation provided enhanced inhibition of both colony formation and invasion, and radiosensitized cells through an increase in G 1 arrest. Conclusions: Our data suggest that melanomas are not uniformly radioresistant with a significant subset displaying inherent radiosensitivity. Pharmacologic inhibition of B-RAF with PLX-4032 effectively radiosensitized B-Raf+ melanoma cells suggesting that this combination approach could provide improved radiotherapeutic response in B-Raf+ melanoma patients.

  8. Radiosensitization by inhibiting survivin in human hepatoma HepG2 cells to high-LET radiation

    International Nuclear Information System (INIS)

    Jin Xiaodong; Li Qiang; Wu Qingfeng; Li Ping; Gong Li; Hao Jifang; Dai Zhongying; Matsumoto, Yoshitaka; Furusawa, Yoshiya

    2011-01-01

    In this study, whether survivin plays a direct role in mediating high-linear energy transfer (LET) radiation resistance in human hepatoma cells was investigated. Small interfering RNA (siRNA) targeting survivin mRNA was designed and transfected into human hepatoma HepG2 cells. Real-time polymerase chain reaction (PCR) and western blotting analyses revealed that survivin expression in HepG2 cells decreased at both transcriptional and post-transcriptional levels after treatment with survivin-specific siRNA. Caspase-3 activity was determined with a microplate reader assay as well. Following exposure to high-LET carbon ions, a reduced clonogenic survival effect, increased apoptotic rates and caspase-3 activity were observed in the cells treated with the siRNA compared to those untreated with the siRNA. The cells with transfection of the survivin-specific siRNA also increased the level of G 2 /M arrest. These results suggest that survivin definitely plays a role in mediating the resistance of HepG2 cells to high-LET radiation and depressing survivin expression might be useful to improve the therapeutic efficacy of heavy ions for radioresistant solid tumors. (author)

  9. Physiological Responses of Bambara Groundnut (Vigna subterranea L. Verdc) to Short Periods of Water Stress During Different Developmental Stages

    OpenAIRE

    R. Vurayai; V. Emongor and B. Moseki

    2011-01-01

    The study was conducted to evaluate the responses of bambara groundnut (Vigna subterranea L. Verdc) to short periods of water stress imposed at different growth stages, and the recuperative ability of the species from drought stress. A major problem associated with Bambara groundnut production is its very low yields due to intra-seasonal and inter-seasonal variability in rainfall in semi-arid regions. The response pattern of physiological processes to water stress imposed at different growth ...

  10. The mitochondrial genome of the legume Vigna radiata and the analysis of recombination across short mitochondrial repeats.

    Directory of Open Access Journals (Sweden)

    Andrew J Alverson

    2011-01-01

    Full Text Available The mitochondrial genomes of seed plants are exceptionally fluid in size, structure, and sequence content, with the accumulation and activity of repetitive sequences underlying much of this variation. We report the first fully sequenced mitochondrial genome of a legume, Vigna radiata (mung bean, and show that despite its unexceptional size (401,262 nt, the genome is unusually depauperate in repetitive DNA and "promiscuous" sequences from the chloroplast and nuclear genomes. Although Vigna lacks the large, recombinationally active repeats typical of most other seed plants, a PCR survey of its modest repertoire of short (38-297 nt repeats nevertheless revealed evidence for recombination across all of them. A set of novel control assays showed, however, that these results could instead reflect, in part or entirely, artifacts of PCR-mediated recombination. Consequently, we recommend that other methods, especially high-depth genome sequencing, be used instead of PCR to infer patterns of plant mitochondrial recombination. The average-sized but repeat- and feature-poor mitochondrial genome of Vigna makes it ever more difficult to generalize about the factors shaping the size and sequence content of plant mitochondrial genomes.

  11. Effects of 17 beta-estradiol on radiation transformation in vitro; inhibition of effects by protease inhibitors

    International Nuclear Information System (INIS)

    Kennedy, A.R.; Weichselbaum, R.R.

    1981-01-01

    We have investigated the effects of 17 beta-estradiol, given both alone and with X-irradiation, on the induction of malignant transformation in vitro. Treatment with 10(-6)M 17 beta-estradiol for 6 weeks, or 10(-5)M 17 beta-estradiol for only 5 days, induced malignant transformation in C3H 10T1/2 cells. Estradiol also acted as a cocarcinogen for X-ray induced transformation; the results indicate an additive effect when the cells were exposed to both agents together. The protease inhibitors antipain and leupeptin suppressed estradiol induced transformation as well as the additive effect observed for estradiol-radiation transformation

  12. Effects of 17 beta-estradiol on radiation transformation in vitro; inhibition of effects by protease inhibitors

    Energy Technology Data Exchange (ETDEWEB)

    Kennedy, A.R.; Weichselbaum, R.R.

    1981-01-01

    We have investigated the effects of 17 beta-estradiol, given both alone and with X-irradiation, on the induction of malignant transformation in vitro. Treatment with 10(-6)M 17 beta-estradiol for 6 weeks, or 10(-5)M 17 beta-estradiol for only 5 days, induced malignant transformation in C3H 10T1/2 cells. Estradiol also acted as a cocarcinogen for X-ray induced transformation; the results indicate an additive effect when the cells were exposed to both agents together. The protease inhibitors antipain and leupeptin suppressed estradiol induced transformation as well as the additive effect observed for estradiol-radiation transformation.

  13. Effect of Long Period Cooling Storage on the Nucleic Acid of Harvested Cowpea Seeds ( Vigna Sinensis L.) Treated by Gamma Irradiation and Micro Elements

    International Nuclear Information System (INIS)

    Saleh, O.I.; Salama, I.M.

    2015-01-01

    Cowpea seeds ( Vigna sinensis L.) were exposed to 40 and 80 Gy gamma radiation, in order to study the effect of long period under cooling storage by using RAPD and ISSR PCR facilities. The obtained results indicated that RAPD protocol gave 65% monomorphic and 56% polymorphic fragments between the samples as compared to storage and non-storage controls. While , ISSR protocol gave 83% monomorphic and 85% polymorphic fragments. It should be mentioned that other percentage s 86% and 91% were found among samples in case of using another primers. The results could be summarized as follow: 1-Primer OP - B01 gave 7 monomorphic and 13 polymorphic fragments (65%). 2 - The Primer OP - B02 and Primer OP - B05 gave 4 monomorphic fragments with 14 polymorphic fragments (79%). 3 - The Primer HA-98 gave 4 monomorphic fragments with 19 detected polymorphic 83%. 4 - The Primer HA - 99 and HB-12 gave 3 monomorphic fragments and 17 polymorphic 85 and 86%, respectively. 5 - The Primer HB - 13 gave 2 monomorphic fragments with 21 detected polymorphic fragments 91%. 6 - The primer HA-98 gave 83% while the primer HA - 99 gave 85%. The previous results showed some polymorphism differences among the samples, while the primer HB-12 gave 86% and the primer HB-13 91% exhibited high levels of polymorphism. The DNA of stored cowpea seeds which were exposed to 80 Gy in the presence of zinc showed the highest differentiation , while radiation dose 40 Gy treated with zinc or boron, 80 Gy with boron and 40 or 80 Gy treatment alone compared to the two controls (storage and non storage)

  14. Vigna unguiculata

    African Journals Online (AJOL)

    VIC

    2012-12-07

    Dec 7, 2012 ... Processing of raw meat into products does not only add value and extend the shelf life of meat ... The research was conducted at the Meat Processing Unit and Laboratories of the. University for ... oven (Turbofan, Blue seal, UK). .... therefore likely to reduce the sensory characteristics of food products [23].

  15. Vigna radiata

    Indian Academy of Sciences (India)

    Table 2. Cluster mean for different traits. Characters/ Days to 50% Days to Plant height Plant yield. 100-seed. Pods per Pods per Pod length Seeds per clusters flowering maturity. (cm). (gm) weight (gm) plant cluster. (cm) pod. Cluster I. 34.00. 6.20. 29.64. 4.89. 4.71. 13.15. 3.29. 6.69. 8.74. Cluster II. 35.17. 61.00. 31.29. 5.26.

  16. Vigna un

    African Journals Online (AJOL)

    user

    2010-11-11

    Nov 11, 2010 ... storage duration on the levels of anti-nutrients: nitrates, oxalates and ... local markets, sorted to remove blemished leaves and foreign materials, washed in ... C. Fermentation, heat-treatment and drying of vegetables led to ...

  17. Vigna unguiculata

    African Journals Online (AJOL)

    Aghomotsegin

    2015-07-08

    Jul 8, 2015 ... significant economic importance worldwide with high protein and mineral ... Therefore, the rapid spread of this parasitic weed to new regions would constitute a severe threat to cowpea .... way to develop stable and durable Striga resistant cultivars. .... before reaching reproductive stage due to severe attack.

  18. Electromagnetic noise inhibits radiofrequency radiation-induced DNA damage and reactive oxygen species increase in human lens epithelial cells

    Science.gov (United States)

    Wu, Wei; Wang, KaiJun; Ni, Shuang; Ye, PanPan; Yu, YiBo; Ye, Juan; Sun, LiXia

    2008-01-01

    Purpose The goal of this study was to investigate whether superposing of electromagnetic noise could block or attenuate DNA damage and intracellular reactive oxygen species (ROS) increase of cultured human lens epithelial cells (HLECs) induced by acute exposure to 1.8 GHz radiofrequency field (RF) of the Global System for Mobile Communications (GSM). Methods An sXc-1800 RF exposure system was used to produce a GSM signal at 1.8 GHz (217 Hz amplitude-modulated) with the specific absorption rate (SAR) of 1, 2, 3, and 4 W/kg. After 2 h of intermittent exposure, the ROS level was assessed by the fluorescent probe, 2',7'-dichlorodihydrofluorescein diacetate (DCFH-DA). DNA damage to HLECs was examined by alkaline comet assay and the phosphorylated form of histone variant H2AX (γH2AX) foci formation assay. Results After exposure to 1.8 GHz RF for 2 h, HLECs exhibited significant intracellular ROS increase in the 2, 3, and 4 W/kg groups. RF radiation at the SAR of 3 W/kg and 4 W/kg could induce significant DNA damage, examined by alkaline comet assay, which was used to detect mainly single strand breaks (SSBs), while no statistical difference in double strand breaks (DSBs), evaluated by γH2AX foci, was found between RF exposure (SAR: 3 and 4 W/kg) and sham exposure groups. When RF was superposed with 2 μT electromagnetic noise could block RF-induced ROS increase and DNA damage. Conclusions DNA damage induced by 1.8 GHz radiofrequency field for 2 h, which was mainly SSBs, may be associated with the increased ROS production. Electromagnetic noise could block RF-induced ROS formation and DNA damage. PMID:18509546

  19. Transient impairment of hippocampus-dependent learning and memory in relatively low-dose of acute radiation syndrome is associated with inhibition of hippocampal neurogenesis

    International Nuclear Information System (INIS)

    Kim, Joong-Sun; Lee, Hae-June; Kim, Jong-Choon

    2008-01-01

    Neurogenesis in the adult hippocampus, which occurs constitutively, is vulnerable to ionizing radiation. In the relatively low-dose exposure of acute radiation syndrome (ARS), the change in the adult hippocampal function is poorly understood. This study analyzed the changes in apoptotic cell death and neurogenesis in the DGs of hippocampi from adult ICR mice with single whole-body gamma-irradiation using the TdT-mediated dUTP-biotin nick end-labeling (TUNEL) method and immunohistochemical markers of neurogenesis, Ki-67 and doublecortin (DCX). In addition, the hippocampus-dependent learning and memory tasks after single whole-body gamma-irradiation were examined in order to evaluate the hippocampus-related behavioral dysfunction in the relatively low-dose exposure of ARS. The number of TUNEL-positive apoptotic nuclei in the dentate gyrus (DG) was increased 6-12 h after acute gamma-irradiation (a single dose of 0.5 to 4 Gy). In contrast, the number of Ki-67- and DCX-positive cells began to decrease significantly 6 h postirradiation, reaching its lowest level 24 h after irradiation. The level of Ki-67 and DCX immunoreactivity decreased in a dose-dependent manner within the range of irradiation applied (0-4 Gy). In passive avoidance and object recognition memory test, the mice trained 1 day after acute irradiation (2 Gy) showed significant memory deficits, compared with the sham controls. In conclusion, the pattern of the hippocampus-dependent memory dysfunction is consistent with the change in neurogenesis after acute irradiation. It is suggested that a relatively low dose of ARS in adult ICR mice is sufficiently detrimental to interrupt the functioning of the hippocampus, including learning and memory, possibly through the inhibition of neurogenesis. (author)

  20. Analysis of simple sequence repeats in rice bean (Vigna umbellata using an SSR-enriched library

    Directory of Open Access Journals (Sweden)

    Lixia Wang

    2016-02-01

    Full Text Available Rice bean (Vigna umbellata Thunb., a warm-season annual legume, is grown in Asia mainly for dried grain or fodder and plays an important role in human and animal nutrition because the grains are rich in protein and some essential fatty acids and minerals. With the aim of expediting the genetic improvement of rice bean, we initiated a project to develop genomic resources and tools for molecular breeding in this little-known but important crop. Here we report the construction of an SSR-enriched genomic library from DNA extracted from pooled young leaf tissues of 22 rice bean genotypes and developing SSR markers. In 433,562 reads generated by a Roche 454 GS-FLX sequencer, we identified 261,458 SSRs, of which 48.8% were of compound form. Dinucleotide repeats were predominant with an absolute proportion of 81.6%, followed by trinucleotides (17.8%. Other types together accounted for 0.6%. The motif AC/GT accounted for 77.7% of the total, followed by AAG/CTT (14.3%, and all others accounted for 12.0%. Among the flanking sequences, 2928 matched putative genes or gene models in the protein database of Arabidopsis thaliana, corresponding with 608 non-redundant Gene Ontology terms. Of these sequences, 11.2% were involved in cellular components, 24.2% were involved molecular functions, and 64.6% were associated with biological processes. Based on homolog analysis, 1595 flanking sequences were similar to mung bean and 500 to common bean genomic sequences. Comparative mapping was conducted using 350 sequences homologous to both mung bean and common bean sequences. Finally, a set of primer pairs were designed, and a validation test showed that 58 of 220 new primers can be used in rice bean and 53 can be transferred to mung bean. However, only 11 were polymorphic when tested on 32 rice bean varieties. We propose that this study lays the groundwork for developing novel SSR markers and will enhance the mapping of qualitative and quantitative traits and marker

  1. Identification of Mungbean yellow mosaic India virus infecting Vigna mungo var. silvestris L.

    Directory of Open Access Journals (Sweden)

    Kamaal NAIMUDDIN

    2011-05-01

    Full Text Available Normal 0 14 false false false IT ZH-TW X-NONE MicrosoftInternetExplorer4 /* Style Definitions */ table.MsoNormalTable {mso-style-name:"Tabella normale"; mso-tstyle-rowband-size:0; mso-tstyle-colband-size:0; mso-style-noshow:yes; mso-style-priority:99; mso-style-qformat:yes; mso-style-parent:""; mso-padding-alt:0cm 5.4pt 0cm 5.4pt; mso-para-margin-top:0cm; mso-para-margin-right:0cm; mso-para-margin-bottom:10.0pt; mso-para-margin-left:0cm; line-height:115%; mso-pagination:widow-orphan; font-size:11.0pt; font-family:"Calibri","sans-serif"; mso-ascii-font-family:Calibri; mso-ascii-theme-font:minor-latin; mso-hansi-font-family:Calibri; mso-hansi-theme-font:minor-latin; mso-bidi-font-family:"Times New Roman"; mso-bidi-theme-font:minor-bidi;} Yellow mosaic of Vigna mungo var.  silvestris, a wild relative of blackgram (Vigna mungo [L.] Hepper, was noticed at the Indian Institute of Pulses Research, Kanpur, India during 2008–2010, with an incidence of 100 per cent. The observed symptoms, consisting of veinal yellowing and scattered bright yellow spots, were suggestive of infection with a begomovirus. To characterize the virus, several sets of primer pairs were designed to amplify the targeted DNA fragments of the causal virus. The sequence data revealed that the coat protein (AV1 gene of the begomovirus under study contained a single open reading frame with 774 nucleotides, coding for 257 amino acids. Comparative analysis of the coat protein (AV1 gene of the virus under study (FJ821189 showed a 97 and 99% similarity with Mungbean yellow mosaic India virus (MYMIV-Mungbean strain at the nucleotide and the amino acid levels respectively. Sequence homology of different genes (AC1, AC2, AC3 and AC4 of the isolate under study (FJ663015 with MYMIV-Mungbean (EU523045 was 94–97% for the nucleotides and 91–99% for the amino acids sequence. Therefore, the begomovirus infecting V. mungo var. silvestris at Kanpur is to be considered a strain of MYMIV and is

  2. Genotypic Variation in Phosphorus Use Efficiency for Symbiotic Nitrogen Fixation in Cowpea (Vigna Unguiculata)

    Energy Technology Data Exchange (ETDEWEB)

    Andriamananjara, A. [LRI-SRA, Laboratoire des Radio-isotopes, Universite d' Antananarivo, Antananarivo (Madagascar); Abdou, M. Malam [Laboratoire Banques de genes CERRA / KOLLO, Institut National de Recherche Agronomique du Niger (INRAN), Niamey (Niger); Pernot, C.; Drevon, J. J. [Institut National de la Recherche Agronomique, UMR Eco and Sols, Montpellier (France)

    2013-11-15

    Cowpea (Vigna unguiculata L. Walp) is an important food legume. In Africa, it is mostly cultivated under such environmental constraints as drought and pest, and nutrient deficiency. In particular low soil phosphorus strongly limits crop production for the poor farmers with limited access to P fertilizers. Therefore breeding cowpea for the tolerance to P deficiency is considered as an alternative to increase the productivity of traditional cowpea-cereal cropping systems in soils with low P availability. This paper reports cowpea genotypic-variation in P use efficiency for symbiotic nitrogen fixation as a contribution to select tolerant cowpea lines under P deficiency. Eighty cowpea cultivars inoculated with the reference strain of Bradyrhizobium sp. Vigna CB756 were pre-screened as a single replicate under hydroaeroponic culture for 6 weeks under P deficiency versus P sufficiency, namely 15 vs 30 {mu}mol plant{sup -1} week{sup -1}. Large variability in nodule number per plant, and in shoot growth as a function of nodule mass, was observed among the diversity of cowpea lines. From this pre-screening experiment, the 40 cowpea lines showing the highest SNF-potential, i.e. high nodulation linked with high N{sub 2}-dependent growth under P sufficiency, and the most contrasting tolerance to P deficiency, i.e. highest vs lowest N{sub 2}-dependent growth under P deficiency, were grown again in glasshouse hydroaeroponics with 6 replicates. As an illustration of the most contrasting lines, the nodulation was decreased under P deficiency by less than 20% for IT82E-18 whereas by more than 80% for IT95K-1105-5 or SUVITA 2. The variations in nodulation were correlated with variations in growth with mean value of additional growth per unit increase in nodule biomass of 23 g shoot DW g-1 nodule DW under P sufficiency, showing 3 lines showing exceptionally high potential for symbiotic nitrogen fixation, versus 28 g shoot DW g{sup -1} nodule DW showing large variation among lines

  3. On the interaction of UV-B radiation (280-315 mm) with water stress in crop plants

    International Nuclear Information System (INIS)

    Balakumar, T.; Vincent, V.H.B.; Paliwal, K.

    1993-01-01

    Cowpea (Vigna unguiculata L. Walp.) seedlings (3-day-old) were subjected to 4 kinds of experimental treatments: (1) control without exposure to any stress (-D-UV), (2) moderate water stress with no UV-B irradiation (+D-UV), (3) no water stress but exposure to UV-B radiation (-D+UV), and (4) moderate water stress and exposure to UV-B (+D+UV). UV-B and drought stress in the combined form elicited beneficial effects on the morphological and growth characteristics, and a few additive inhibitory effects in some functional processes. An increase in the specific leaf weight (SLW) was observed in the combination of stresses, which could be a defence mechanism against UV-B. The combination of stresses promoted the synthesis of anthocyanins and phenolic compounds. The responses of plants to the combination of stresses indicate that during simultaneous exposure of plants to multiple stresses, one form of stress could minimize the damage by the other. The enhancement of superoxide dismutase (SOD) and catalase activities appear to serve as acclimation mechanisms to scavenge the toxic, free radicals of oxygen produced under stress conditions. However, the inhibition in nitrate metabolism was greater in the combined stresses than in either of the stresses imposed separately. The results of this study illustrate that the interaction of stresses during simultaneous multiple stress conditions brings out certain beneficial effects. (author)

  4. Effect of gamma radiation as a method of storing brown flaxseed after 6 months of storage, inhibiting contamination by aflatoxigenic fungi

    Energy Technology Data Exchange (ETDEWEB)

    Costa, Laury Francis; Silva, Edvane Borges da Silva, E-mail: lauryfrancis@gmail.com, E-mail: edvborges@yahoo.com [Universidade Federal de Pernambuco (UFPE), Recife, PE (Brazil). Dept. de Energia Nuclear; Oliveira, Idjane Santana, E-mail: idjaneoliveira@gmail.com [Universidade Federal de Pernambuco (CAV/UFPE), Vitoria de Santo Antao, PE (Brazil). Centro Academico de Vitoria

    2013-07-01

    Flaxseed is an oilseed rich in proteins, lipids and dietary fiber. The brown flaxseed is grown in warm climates and humid, like Brazil, and has shelled tougher than the golden linseed. As the tropical climate is ideal environment for the growth of toxigenic fungi, flaxseed may be exposed to contamination. Four different samples of brown flaxseed were collected in sealed packages obtained from health food stores. Aliquots of grains were separated, packed with PVC film, identified according to the company (E1, E2, E3, E4) and subjected to the process of gamma irradiation doses: 2.5, 5.0, 7.5 and 10 kGy, beyond the control sample that was not exposed. This material was stored in a cool dry place in the laboratory for six months. After that time, the grains were sown in DRBC, to check the growth of total fungi, and in AFPA, to check the growth of aflatoxigenic fungi. After sowing grains, the Petri dishes were randomly distributed on the bench, at room temperature. There was no growth of aflatoxigenic fungi in irradiated samples after incubation, demonstrating that radiation could inhibit fungal contamination during the storage time. Germinated grains were observed in both culture media, in all doses and in the control samples. The germination of flaxseed was inversely proportional to the dose applied to the grains, to both culture media. Irradiation showed to be an effective method for brown flaxseed conservation and maintaining the germination. (author)

  5. Combined treatment with D-allose, docetaxel and radiation inhibits the tumor growth in an in vivo model of head and neck cancer

    Science.gov (United States)

    Hoshikawa, Hiroshi; Kamitori, Kazuyo; Indo, Kanako; Mori, Terushige; Kamata, Mizuna; Takahashi, Tomoko; Tokuda, Masaaki

    2018-01-01

    The present study was designed to evaluate the effect of one rare sugar, D-allose, on normal human cells and cutaneous tissue, and to investigate the radiosensitizing and chemosensitizing potential of D-allose in an in vivo model of head and neck cancer. Results indicated that D-allose did not inhibit the growth of normal human fibroblasts TIG-1 cells, and no apoptotic changes were observed after D-allose and D-glucose treatment. The mRNA expression levels of thioredoxin interacting protein (TXNIP) in TIG-1 cells after D-allose treatment increased by 2-fold (50.4 to 106.5). Conversely, the mRNA expression levels of TXNIP in HSC3 cancer cells increased by 74-fold (1.5 to 110.6), and the thioredoxin (TRX)/TXNIP ratio was markedly reduced from 61.7 to 1.4 following D-allose treatment. Combined multiple treatments with docetaxel, radiation and D-allose resulted in the greatest antitumor response in the in vivo model. Hyperkeratosis, epidermal thickening and tumor necrosis factor-α immunostaining were observed following irradiation treatment, but these pathophysiological reactions were reduced following D-allose administration. Thus, the present findings suggest that D-allose may enhance the antitumor effects of chemoradiotherapy whilst sparing normal tissues. PMID:29456721

  6. Effect of gamma radiation as a method of storing brown flaxseed after 6 months of storage, inhibiting contamination by aflatoxigenic fungi

    International Nuclear Information System (INIS)

    Costa, Laury Francis; Silva, Edvane Borges da Silva; Oliveira, Idjane Santana

    2013-01-01

    Flaxseed is an oilseed rich in proteins, lipids and dietary fiber. The brown flaxseed is grown in warm climates and humid, like Brazil, and has shelled tougher than the golden linseed. As the tropical climate is ideal environment for the growth of toxigenic fungi, flaxseed may be exposed to contamination. Four different samples of brown flaxseed were collected in sealed packages obtained from health food stores. Aliquots of grains were separated, packed with PVC film, identified according to the company (E1, E2, E3, E4) and subjected to the process of gamma irradiation doses: 2.5, 5.0, 7.5 and 10 kGy, beyond the control sample that was not exposed. This material was stored in a cool dry place in the laboratory for six months. After that time, the grains were sown in DRBC, to check the growth of total fungi, and in AFPA, to check the growth of aflatoxigenic fungi. After sowing grains, the Petri dishes were randomly distributed on the bench, at room temperature. There was no growth of aflatoxigenic fungi in irradiated samples after incubation, demonstrating that radiation could inhibit fungal contamination during the storage time. Germinated grains were observed in both culture media, in all doses and in the control samples. The germination of flaxseed was inversely proportional to the dose applied to the grains, to both culture media. Irradiation showed to be an effective method for brown flaxseed conservation and maintaining the germination. (author)

  7. Effects of Chk1 inhibition on the temporal duration of radiation-induced G2 arrest in HeLa cells

    International Nuclear Information System (INIS)

    Nahar, Kamrun; Goto, Tatsuaki; Kaida, Atsushi; Deguchi, Shifumi; Miura, Masahiko

    2014-01-01

    Chk1 inhibitor acts as a potent radiosensitizer in p53-deficient tumor cells by abrogating the G2/M check-point. However, the effects of Chk1 inhibitor on the duration of G2 arrest have not been precisely analyzed. To address this issue, we utilized a cell-cycle visualization system, fluorescent ubiquitination-based cell-cycle indicator (Fucci), to analyze the change in the first green phase duration (FGPD) after irradiation. In the Fucci system, G1 and S/G2/M cells emit red and green fluorescence, respectively; therefore, G2 arrest is reflected by an elongated FGPD. The system also allowed us to differentially analyze cells that received irradiation in the red or green phase. Cells irradiated in the green phase exhibited a significantly elongated FGPD relative to cells irradiated in the red phase. In cells irradiated in either phase, Chk1 inhibitor reduced FGPD almost to control levels. The results of this study provide the first clear information regarding the effects of Chk1 inhibition on radiation-induced G2 arrest, with special focus on the time dimension. (author)

  8. In Vitro Seeds Germination and Seedling Growth of Bambara Groundnut (Vigna subterranea (L.) Verdc. (Fabaceae)).

    Science.gov (United States)

    Koné, Mongomaké; Koné, Tchoa; Silué, Nakpalo; Soumahoro, André Brahima; Kouakou, Tanoh Hilaire

    2015-01-01

    Bambara groundnut (Vigna subterranea (L.) Verdc.) is an indigenous grain legume. It occupies a prominent place in the strategies to ensure food security in sub-Saharan Africa. Development of an efficient in vitro regeneration system, a prerequisite for genetic transformation application, requires the establishment of optimal conditions for seeds germination and plantlets development. Three types of seeds were inoculated on different basal media devoid of growth regulators. Various strengths of the medium of choice and the type and concentration of carbon source were also investigated. Responses to germination varied with the type of seed. Embryonic axis (EA) followed by seeds without coat (SWtC) germinated rapidly and expressed a high rate of germination. The growth performances of plantlets varied with the basal medium composition and the seeds type. The optimal growth performances of plants were displayed on half strength MS basal medium with SWtC and EA as source of seeds. Addition of 3% sucrose in the culture medium was more suitable for a maximum growth of plantlets derived from EA.

  9. Genetic diversity of Rhizobia isolates from Amazon soils using cowpea (Vigna unguiculata as trap plant

    Directory of Open Access Journals (Sweden)

    F.V. Silva

    2012-06-01

    Full Text Available The aim of this work was to characterize rhizobia isolated from the root nodules of cowpea (Vigna unguiculata plants cultivated in Amazon soils samples by means of ARDRA (Amplified rDNA Restriction Analysis and sequencing analysis, to know their phylogenetic relationships. The 16S rRNA gene of rhizobia was amplified by PCR (polymerase chain reaction using universal primers Y1 and Y3. The amplification products were analyzed by the restriction enzymes HinfI, MspI and DdeI and also sequenced with Y1, Y3 and six intermediate primers. The clustering analysis based on ARDRA profiles separated the Amazon isolates in three subgroups, which formed a group apart from the reference isolates of Bradyrhizobium japonicum and Bradyrhizobium elkanii. The clustering analysis of 16S rRNA gene sequences showed that the fast-growing isolates had similarity with Enterobacter, Rhizobium, Klebsiella and Bradyrhizobium and all the slow-growing clustered close to Bradyrhizobium.

  10. Vigna subterranea ammonium transporter gene (VsAMT1: Some bioinformatics insights

    Directory of Open Access Journals (Sweden)

    Adewole T. Adetunji

    2015-12-01

    Full Text Available Ammonium transporters (AMTs play a role in the uptake of ammonium, the form in which nitrogen is preferentially absorbed by plants. Vigna subterranea (VsAMT1 and Solanum tuberosum (StAMT1 AMT1s were characterized using molecular biology and bioinformatics methods. AMT1-specific primers were designed and used to amplify the AMT1 internal regions. Nucleotide sequencing, alignment and phylogenetic analysis assigned VsAMT1 and StAMT1 to the AMT1 family. The deduced amino acid sequences showed that VsAMT1 is 92% and 89% similar to Phaseolus vulgaris PvAMT1.1 and Glycine max AMT1 respectively, while StAMT1 is 92% similar to Solanum lycopersicum LeAMT1.1, and correspond to the 5th–10th trans-membrane domains. Residues VsAMT1 D23 and StAMT1 D15 are predicted to be essential for ammonium transport, while mutations of VsAMT1 W1A-L and S87A and StAMT1 S76A may further enhance ammonium transport. In addition to nitrogen uptake from the roots, VsAMT1 may also contribute to interactions with rhizobia.

  11. The AVRDC - The World Vegetable Center mungbean (Vigna radiata) core and mini core collections.

    Science.gov (United States)

    Schafleitner, Roland; Nair, Ramakrishnan Madhavan; Rathore, Abhishek; Wang, Yen-wei; Lin, Chen-yu; Chu, Shu-hui; Lin, Pin-yun; Chang, Jian-Cheng; Ebert, Andreas W

    2015-04-29

    Large ex situ germplasm collections generally harbor a wide range of crop diversity. AVRDC--The World Vegetable Center is holding in trust the world's second largest mungbean (Vigna radiata) germplasm collection with more than 6,700 accessions. Screening large collections for traits of interest is laborious and expensive. To enhance the access of breeders to the diversity of the crop, mungbean core and mini core collections have been established. The core collection of 1,481 entries has been built by random selection of 20% of the accessions after geographical stratification and subsequent cluster analysis of eight phenotypic descriptors in the whole collection. Summary statistics, especially the low differences of means, equal variance of the traits in both the whole and core collection and the visual inspection of quantile-quantile plots comparing the variation of phenotypic traits present in both collections indicated that the core collection well represented the pattern of diversity of the whole collection. The core collection was genotyped with 20 simple sequence repeat markers and a mini core set of 289 accessions was selected, which depicted the allele and genotype diversity of the core collection. The mungbean core and mini core collections plus their phenotypic and genotypic data are available for distribution to breeders. It is expected that these collections will enhance the access to biodiverse mungbean germplasm for breeding.

  12. Simultaneous selection for cowpea (Vigna unguiculata L.) genotypes with adaptability and yield stability using mixed models.

    Science.gov (United States)

    Torres, F E; Teodoro, P E; Rodrigues, E V; Santos, A; Corrêa, A M; Ceccon, G

    2016-04-29

    The aim of this study was to select erect cowpea (Vigna unguiculata L.) genotypes simultaneously for high adaptability, stability, and yield grain in Mato Grosso do Sul, Brazil using mixed models. We conducted six trials of different cowpea genotypes in 2005 and 2006 in Aquidauana, Chapadão do Sul, Dourados, and Primavera do Leste. The experimental design was randomized complete blocks with four replications and 20 genotypes. Genetic parameters were estimated by restricted maximum likelihood/best linear unbiased prediction, and selection was based on the harmonic mean of the relative performance of genetic values method using three strategies: selection based on the predicted breeding value, having considered the performance mean of the genotypes in all environments (no interaction effect); the performance in each environment (with an interaction effect); and the simultaneous selection for grain yield, stability, and adaptability. The MNC99542F-5 and MNC99-537F-4 genotypes could be grown in various environments, as they exhibited high grain yield, adaptability, and stability. The average heritability of the genotypes was moderate to high and the selective accuracy was 82%, indicating an excellent potential for selection.

  13. Distribution and Prevalence of Parasitic Nematodes of Cowpea (Vigna unguiculata) in Burkina Faso.

    Science.gov (United States)

    Sawadogo, A; Thio, B; Kiemde, S; Drabo, I; Dabire, C; Ouedraogo, J; Mullens, T R; Ehlers, J D; Roberts, P A

    2009-06-01

    A comprehensive survey of the plant parasitic nematodes associated with cowpea (Vigna unguiculata) production fields was carried out in the three primary agro-climatic zones of Burkina Faso in West Africa. Across the three zones, a total of 109 samples were collected from the farms of 32 villages to provide a representative coverage of the cowpea production areas. Samples of rhizosphere soil and samples of roots from actively growing cowpea plants were collected during mid- to late-season. Twelve plant-parasitic nematode genera were identified, of which six appeared to have significant parasitic potential on cowpea based on their frequency and abundance. These included Helicotylenchus, Meloidogyne, Pratylenchus, Scutellonema, Telotylenchus, and Tylenchorhynchus. Criconemella and Rotylenchulus also had significant levels of abundance and frequency, respectively. Of the primary genera, Meloidogyne, Pratylenchus, and Scutellonema contained species which are known or suspected to cause losses of cowpea yield in other parts of the world. According to the prevalence and distribution of these genera in Burkina Faso, their potential for damage to cowpea increased from the dry Sahelian semi-desert zone in the north (annual rainfall < 600 mm/year), through the north-central Soudanian zone (annual rainfall of 600-800 mm/year), to the wet Soudanian zone (annual rainfall ≥ 1000 mm) in the more humid south-western region of the country. This distribution trend was particularly apparent for the endoparasitic nematode Meloidogyne and the migratory endoparasite Pratylenchus.

  14. Prioritising in situ conservation of crop resources: a case study of African cowpea (Vigna unguiculata).

    Science.gov (United States)

    Moray, C; Game, E T; Maxted, N

    2014-06-17

    Conserving crop wild relatives (CWR) is critical for maintaining food security. However, CWR-focused conservation plans are lacking, and are often based on the entire genus, even though only a few taxa are useful for crop improvement. We used taxonomic and geographic prioritisation to identify the best locations for in situ conservation of the most important (priority) CWR, using African cowpea (Vigna unguiculata (L.) Walp.) as a case study. Cowpea is an important crop for subsistence farmers in sub-Saharan Africa, yet its CWR are under-collected, under-conserved and under-utilised in breeding. We identified the most efficient sites to focus in situ cowpea CWR conservation and assessed whether priority CWR would be adequately represented in a genus-based conservation plan. We also investigated whether priority cowpea CWR are likely to be found in existing conservation areas and in areas important for mammal conservation. The genus-based method captured most priority CWR, and the distributions of many priority CWR overlapped with established conservation reserves and targets. These results suggest that priority cowpea CWR can be conserved by building on conservation initiatives established for other species.

  15. Effect of gamma irradiation and cooking on cowpea bean grains ( Vigna unguiculata L. Walp)

    Science.gov (United States)

    Lima, Keila dos Santos Cople; Souza, Luciana Boher e.; Godoy, Ronoel Luiz de Oliveira; França, Tanos Celmar Costa; Lima, Antônio Luís dos Santos

    2011-09-01

    Leguminous plants are important sources of proteins, vitamins, carbohydrates, fibers and minerals. However, some of their non-nutritive elements can present undesirable side effects like flatulence provoked by the anaerobic fermentation of oligosaccharides, such as raffinose and stachyose, in the gut. A way to avoid this inconvenience, without any change in the nutritional value and post-harvesting losses, is an irradiation process. Here, we evaluated the effects of gamma irradiation on the amino acids, thiamine and oligosaccharide contents and on the fungi and their toxin percentages in cowpea bean ( Vigna unguiculata L. Walp) samples. For irradiation doses of 0.0, 0.5, 1.0, 2.5, 5.0 and 10.0 kGy the results showed no significant differences in content for the uncooked samples. However, the combination of irradiation and cooking processes reduced the non-nutritive factors responsible for flatulence. Irradiation also significantly reduced the presence of Aspergillus, Penicilium, Rhizopus and Fusarium fungi and was shown to be efficient in grain conservation for a storage time of 6 months.

  16. Diallelic analysis to obtain cowpea (Vigna unguiculata L. Walp.) populations tolerant to water deficit.

    Science.gov (United States)

    Rodrigues, E V; Damasceno-Silva, K J; Rocha, M M; Bastos, E A

    2016-05-13

    The purpose of this study was to identify parents and obtain segregating populations of cowpea (Vigna unguiculata L. Walp.) with the potential for tolerance to water deficit. A full diallel was performed with six cowpea genotypes, and two experiments were conducted in Teresina, PI, Brazil in 2011 to evaluate 30 F2 populations and their parents, one under water deficit and the other under full irrigation. A triple-lattice experimental design was used, with six 2-m-long rows in each plot. Sixteen plants were sampled per plot. The data were subjected to analysis of variance, and general and specific combining ability estimates were obtained based on the means. Additive effects were more important than non-additive effects, and maternal inheritance had occurred. The genotypes BRS Xiquexique, Pingo de Ouro-1-2, and MNC99-510F-16-1 were the most promising for use in selection programs aimed at water deficit tolerance. The hybrid combinations Pingo de Ouro-1-2 x BRS Xiquexique, BRS Xiquexique x Santo Inácio, CNCx 698-128G x MNC99-510F-16-1, Santo Inácio x CNCx 698-128G, MNC99-510F-16-1 x BRS Paraguaçu, MNC99- 510F-16-1 x Pingo de Ouro-1-2, and MNC99-510F-16-1 x BRS Xiquexique have the potential to increase grain production and tolerate water deficit.

  17. Identification of QTL controlling domestication-related traits in cowpea (Vigna unguiculata L. Walp).

    Science.gov (United States)

    Lo, Sassoum; Muñoz-Amatriaín, María; Boukar, Ousmane; Herniter, Ira; Cisse, Ndiaga; Guo, Yi-Ning; Roberts, Philip A; Xu, Shizhong; Fatokun, Christian; Close, Timothy J

    2018-04-19

    Cowpea (Vigna unguiculata L. Walp) is a warm-season legume with a genetically diverse gene-pool composed of wild and cultivated forms. Cowpea domestication involved considerable phenotypic changes from the wild progenitor, including reduction of pod shattering, increased organ size, and changes in flowering time. Little is known about the genetic basis underlying these changes. In this study, 215 recombinant inbred lines derived from a cross between a cultivated and a wild cowpea accession were used to evaluate nine domestication-related traits (pod shattering, peduncle length, flower color, days to flowering, 100-seed weight, pod length, leaf length, leaf width and seed number per pod). A high-density genetic map containing 17,739 single nucleotide polymorphisms was constructed and used to identify 16 quantitative trait loci (QTL) for these nine traits. Based on annotations of the cowpea reference genome, genes within these regions are reported. Four regions with clusters of QTL were identified, including one on chromosome 8 related to increased organ size. This study provides new knowledge of the genomic regions controlling domestication-related traits in cowpea as well as candidate genes underlying those QTL. This information can help to exploit wild relatives in cowpea breeding programs.

  18. Active aggregation among sexes in bean flower thrips (Megalurothrips sjostedti) on cowpea (Vigna unguiculata).

    Science.gov (United States)

    Niassy, Saliou; Ekesi, Sunday; Maniania, Nguya K; Orindi, Benedict; Moritz, Gerald B; de Kogel, Willem J; Subramanian, Sevgan

    2016-01-01

    Male sexual aggregations are a common territorial, mating-related or resource-based, behaviour observed in diverse organisms, including insects such as thrips. The influence of factors such as plant substrate, time of day, and geographic location on aggregation of thrips is uncertain, therefore we monitored the dispersion of male and female bean flower thrips (BFT), Megalurothrips sjostedti (Trybom) (Thysanoptera: Thripidae), on cowpea, Vigna unguiculata (L.) Walp. (Fabaceae), over three cowpea growth stages and across three cowpea-growing areas of Kenya. Our results indicated that for all the crop growth stages, the density of BFTs varied over the time of day, with higher densities at 10:00, 13:00, and 16:00 hours than at 07:00 hours. Thrips densities did not differ among blocks at the budding stage, but they did at peak flowering and podding stages. Dispersion indices suggested that both male and female BFTs were aggregated. Active male aggregation occurred only on green plant parts and it varied across blocks, crop stages, and locations. Similarly, active female aggregation was observed in peak flowering and podding stages. Such active aggregation indicates a semiochemical or behaviour-mediated aggregation. Identification of such a semiochemical may offer new opportunities for refining monitoring and management strategies for BFT on cowpea, the most important grain legume in sub-Saharan Africa.

  19. Highly distinct chromosomal structures in cowpea (Vigna unguiculata), as revealed by molecular cytogenetic analysis.

    Science.gov (United States)

    Iwata-Otsubo, Aiko; Lin, Jer-Young; Gill, Navdeep; Jackson, Scott A

    2016-05-01

    Cowpea (Vigna unguiculata (L.) Walp) is an important legume, particularly in developing countries. However, little is known about its genome or chromosome structure. We used molecular cytogenetics to characterize the structure of pachytene chromosomes to advance our knowledge of chromosome and genome organization of cowpea. Our data showed that cowpea has highly distinct chromosomal structures that are cytologically visible as brightly DAPI-stained heterochromatic regions. Analysis of the repetitive fraction of the cowpea genome present at centromeric and pericentromeric regions confirmed that two retrotransposons are major components of pericentromeric regions and that a 455-bp tandem repeat is found at seven out of 11 centromere pairs in cowpea. These repeats likely evolved after the divergence of cowpea from common bean and form chromosomal structure unique to cowpea. The integration of cowpea genetic and physical chromosome maps reveals potential regions of suppressed recombination due to condensed heterochromatin and a lack of pairing in a few chromosomal termini. This study provides fundamental knowledge on cowpea chromosome structure and molecular cytogenetics tools for further chromosome studies.

  20. Sprouting characteristics and associated changes in nutritional composition of cowpea (Vigna unguiculata).

    Science.gov (United States)

    Devi, Chingakham Basanti; Kushwaha, Archana; Kumar, Anil

    2015-10-01

    Cowpea (Vigna unguiculata), is an important arid legume with a good source of energy, protein, vitamins, minerals and dietary fibre. Sprouting of legumes enhances the bioavailability and digestibility of nutrients and therefore plays an important role in human nutrition. Improved varieties of grain cowpea viz. Pant Lobia-1 (PL-1) and Pant Lobia-2 (PL-2) and Pant Lobia-3 (PL-3) were examined for sprouting characteristics and associated changes in nutritional quality. Soaking time, sprouting time and sprouting temperature combinations for desirable sprout length of ¼ to ½ inch for cowpea seed samples were standardized. All the observations were taken in triplicate except soaking time, where six observations were taken in a completely randomized design of three treatments. Results revealed that optimum soaking time of PL-1 and PL-2 seed was 3 h whereas PL-3 required 9 h. Sprouting period of 24 h at 25 °C was found to be desirable for obtaining good sprouts. Significant improvement in nutritional quality was observed after sprouting at 25 °C for 24 h; protein increased by 9-12 %, vitamin C increased by 4-38 times, phytic acid decreased by 4-16 times, trypsin inhibitor activity decreased by 28-55 % along with an increase of 8-20 % in in-vitro protein digestibility.

  1. Toxic effects of Pb2+ on growth of cowpea (Vigna unguiculata)

    International Nuclear Information System (INIS)

    Kopittke, Peter M.; Asher, Colin J.; Kopittke, Rosemary A.; Menzies, Neal W.

    2007-01-01

    A concentration as low as 1 μM lead (Pb) is highly toxic to plants, but previous studies have typically related plant growth to the total amount of Pb added to a solution. In the present experiment, the relative fresh mass of cowpea (Vigna unguiculata) was reduced by 10% at a Pb 2+ activity of 0.2 μM for the shoots and at a Pb 2+ activity of 0.06 μM for the roots. The primary site of Pb 2+ toxicity was the root, causing severe reductions in root growth, loss of apical dominance (shown by an increase in branching per unit root length), the formation of localized swellings behind the root tips (due to the initiation of lateral roots), and the bending of some root tips. In the root, Pb was found to accumulate primarily within the cell walls and intercellular spaces. - The Pb 2+ ion reduced the growth of cowpea by 10% at a solution activity of 0.2 μM for the shoots and 0.06 μM for the roots

  2. The effect of sodium chloride salinity on germination and productivity of mung bean (Vigna Mungo Linn.)

    International Nuclear Information System (INIS)

    Jabeen, M.; Azim, F.; Ibrar, M.; Hussain, F.; Ilahi, I.

    2003-01-01

    The germination was significantly declined at salinity levels of 5.0 dSm/sup -1/ and above in the laboratory experiment while in the pot experiment germination significantly reduced at salinity levels of 7.5 dSm/sup -1/ and above. Radicle and plumule lengths were also significantly reduced at 5.0 dSm/sup -1/ and higher levels of NaCl. Plant height, number of branches and number of leaves significantly decreased at 10.0 dSm/sup -1/ and higher levels of salinity. The number of seeds was significantly dwindled at 7.5 dSm/sup -1/ and above. Similarly, chlorophyll contents were also significantly low at 7.5 dSm/sup -1/ and higher concentrations. It was concluded that Vigna mungo might not show promising growth and productivity in saline habitats. However, under mild saline conditions it might be grown not only to supplement the crop yield, but also as a source of fodder and soil reclamation measure. (author)

  3. 28-Homobrassinolide mitigates boron induced toxicity through enhanced antioxidant system in Vigna radiata plants.

    Science.gov (United States)

    Yusuf, Mohammad; Fariduddin, Qazi; Ahmad, Aqil

    2011-11-01

    The objective of this study was to establish relationship between boron induced oxidative stress and antioxidant system in Vigna radiata plants and also to investigate whether brassinosteroids will enhance the level of antioxidant system that could confer tolerance to the plants from the boron induced oxidative stress. The mung bean (V. radiata cv. T-44) plants were administered with 0.50, 1.0 and 2.0 mM boron at 6 d stage for 7 d along with nutrient solution. At 13 d stage, the seedlings were sprayed with deionized water (control) or 10(-8) M of 28-homobrassinolide and plants were harvested at 21 d stage to assess growth, leaf gas-exchange traits and biochemical parameters. The boron treatments diminished growth, water relations and photosynthetic attributes along with nitrate reductase and carbonic anhydrase activity in the concentration dependent manner whereas, it enhanced lipid peroxidation, electrolyte leakage, accumulation of H(2)O(2) as well as proline, and various antioxidant enzymes in the leaves of mung bean which were more pronounced at higher concentrations of boron. However, the follow-up application of 28-homobrassinolide to the boron stressed plants improved growth, water relations and photosynthesis and further enhanced the various antioxidant enzymes viz. catalase, peroxidase and superoxide dismutase and content of proline. The elevated level of antioxidant enzymes as well as proline could have conferred tolerance to the B-stressed plants resulting in improved growth, water relations and photosynthetic attributes. Copyright © 2011 Elsevier Ltd. All rights reserved.

  4. TRUE METABOLIZABLE ENERGY AND DIGESTIBILITY OF FIVE Vigna unguiculata VARIETIES IN CHICKENS

    Directory of Open Access Journals (Sweden)

    Luis Armando Sarmiento-Franco

    2010-11-01

    Full Text Available This study was carried out to evaluate the effect of heat-treatment on grain true metabolizable energy (TME, dry matter and gross energy digestibilities of five Vigna unguiculata varieties: H82, T782, TM97, C666 y XL. The grain of the former three varieties were heat-treated, and offered raw or cooked, whereas grain of the late two varieties were used only row, resulting in a total of eight treatments. The heat treatment consisted of watering the grains with boiling water for 30 minutes and drying at 60°C.  Forty-five Hubbard male chickens (2.1 ± 0.2 kg housed in individual wire pens were used to evaluate the treatments. Five chickens from each treatment were fed 40 g of treated grain in mash form, using the force-feeding technique. Additionally, five fasted chickens were used to calculate the endogenous energy and DM losses. The data were submitted to an analysis of variance according to the randomized statistical model; to evaluate the effect of heat treatment orthogonal contrasts were performed. There were no significant differences in all the variables neither among varieties nor between heat treatments (P>0.05. TME values in this study were similar to those found in the literature and equivalent to the TME value of soybean meal, a conventional feedstuff used in the poultry industry.

  5. Effect of simulated acid rain (sar) on some morphochemical aspects of mash (vigna mungo l.)

    International Nuclear Information System (INIS)

    Imran, H.A.; Hussain, M.; Hussain, S.

    2014-01-01

    The studies were conducted to evaluate the effect of simulated acid rain (SAR) at early plant growth on some morphochemical characters of two varieties of Mash (Vigna mungo L.) namely Mash 97 and Var. 95009. Different pH values were made by using H/sub 2/SO/sub 4/, HNO/sub 3/, and combination of both. The data revealed that low pH (3.5) of either sulphuric acid or the combination of H/sub 2/SO/sub 4/ and HNO/sub 3/ affected more severely at all parameters including number of leaves, shoot: root ratio, water contents of shoot and Potassium ion concentration. Whereas for a few parameters like plant height and number of branches the simulated acid rain of solution of pH 4.5 and 3.5 by using HNO/sub 3/ proved a bit better for plant growth, the root length was increased in case of SAR of solution of pH 3.5 by using H/sub 2/SO/sub 4/+HNO/sub 3/. Foliar application of SAR of solution of pH greater than 4.5 showed some improvement in crop growth due to fertilizer effect of solution's components. (author)

  6. Evaluation of ecophysiological characteristics of intercropping of millet (Panicum miliaceum L. and cowpea (Vigna unguiculata L.

    Directory of Open Access Journals (Sweden)

    A. Ghanbari

    2016-04-01

    Full Text Available In order to evaluate millet (Panicum miliaceum L. and cowpea (Vigna unguiculata L. intercropping, an experiment was conducted during 2008-2009 at Agriculture Research Center of Zabol University, Iran. The experiment was as randomized complete block design with three replications. Treatment s consisted of sole crop of millet, sole crop of cowpea, 25% millet + 100% cowpea, 50% millet + 50% cowpea, 75% millet + 100% cowpea and 100% millet + 100% cowpea. The results showed that intercropping treatments had significant effect (P < 1% on millet and bean seed yield, LER, dry matter of weeds, PAR, temperature and (P < 5% on soil moisture content. The highest seed yield of millet and cowpea obtained from treatments of sole crops. The LER for most intercrops was greater than one which indicated that intercropping had advantage over sole crop. For weeds management and control the results indicated that weed suppressing effects in intercropping treatments is better than sole crops treatment, so that the lowest dry matter of weeds obtained from 100% millet + 100% cowpea treatment. PAR in all of stages showed that the highest PAR interception obtained from intercropping treatments specially 100% millet + 100% cowpea treatment. In addition to the lowest of soil moisture content and temperature obtained from this treatment.

  7. A study on Maruca vitrata infestation of Yard-long beans (Vigna unguiculata subspecies sesquipedalis

    Directory of Open Access Journals (Sweden)

    R.C. Jayasinghe

    2015-09-01

    Full Text Available Globally, Maruca vitrata (Geyer is a serious yield constraint on food legumes including Yard-long bean (Vigna unguiculata subspecies sesquipedalis. However, there is a dearth of information on its damage potential, distribution and population dynamics in Yard-long beans. In the present study, the level of M. vitrata larval infestation on flowers and pods of Yard-long beans in Sri Lanka was determined with respect to three consecutive cropping seasons, Yala, Off and Maha. Results indicated that larval infestation and abundance varied with developmental stage of flowers and pods, cropping season and their combined interactive effects. Flowers of Yard-long beans were more prone to M. vitrata larval attack compared to pods. Abundance and level of infestation of M. vitrata varied with plant parts, having a ranking of flower buds (highest > open flowers > mature pods > immature pods (lowest. Peak infestation was observed six and eight weeks after planting on flowers and pods, respectively. Among the three cropping seasons, M. vitrata infestation was found to be higher during Maha and Off seasons compared to Yala. The findings of this study contribute to the identified knowledge gap regarding the field biology of an acknowledged important pest, M. vitrata, in a previously understudied crop in Sri Lanka.

  8. Cluster analysis technique for assessing variability in cowpea (Vigna unguiculata L. Walp accessions from Nigeria

    Directory of Open Access Journals (Sweden)

    Ajayi Abiola Toyin

    2013-01-01

    Full Text Available The genetic variability among 10 accessions of cowpea, Vigna unguiculata (L. Walp was studied by the use of 13 qualitative and 13 quantitative traits. From the results on qualitative traits, dendrogram grouped the 10 accessions into two major clusters, 1 and 2.Cluster 1 had 3 accessions and cluster 2 had 2 sub-clusters (I and II, having 2 accessions in sub-cluster I and 5 accessions in sub-cluster II. The dendrogram revealed two major clusters, 1 and 2, for quantitative data, for the 10 accessions. At distance of 4 and 6, cluster 1 had two sub-clusters (I and II, with sub-cluster I having 5 accessions, sub-cluster II having 4 accessions while cluster 2 had only 1 accession. This study made the observation that identification of the right agro-morphological traits of high discriminating capacity is essential, before embarking on any genetic diversity; as it was revealed that some traits discriminated more efficiently among the accessions than others. A group of accessions, which are NGSA1, NGSA2, NGSA3, NGSA4, NGSA7, NGSA9 and NGSA10, was identified as being different from the others for number of seeds per pod, pod length, plant height, peduncle length, seed weight and number of pods per plant. These accessions may be good for cowpea improvement programs.

  9. Effect of gamma irradiation and cooking on cowpea bean grains (Vigna unguiculata L. Walp)

    Energy Technology Data Exchange (ETDEWEB)

    Santos Cople Lima, Keila dos, E-mail: keila@ime.eb.br [Nuclear Engineering Department, Military Institute of Engineering, Rio de Janeiro/RJ, Praca General Tiburcio, 80, CEP 22290-270 Rio de Janeiro/RJ (Brazil); Boher e Souza, Luciana [Nuclear Engineering Department, Military Institute of Engineering, Rio de Janeiro/RJ, Praca General Tiburcio, 80, CEP 22290-270 Rio de Janeiro/RJ (Brazil); Oliveira Godoy, Ronoel Luiz de [Technological Center, Embrapa Food Agroindustry, Av. das Americas, 29501, CEP 23020-470 Rio de Janeiro/RJ (Brazil); Costa Franca, Tanos Celmar; Santos Lima, Antonio Luis dos [Chemical Engineering Department, Military Institute of Engineering, Praca General Tiburcio, 80, CEP 22290-270 Rio de Janeiro/RJ (Brazil)

    2011-09-15

    Leguminous plants are important sources of proteins, vitamins, carbohydrates, fibers and minerals. However, some of their non-nutritive elements can present undesirable side effects like flatulence provoked by the anaerobic fermentation of oligosaccharides, such as raffinose and stachyose, in the gut. A way to avoid this inconvenience, without any change in the nutritional value and post-harvesting losses, is an irradiation process. Here, we evaluated the effects of gamma irradiation on the amino acids, thiamine and oligosaccharide contents and on the fungi and their toxin percentages in cowpea bean (Vigna unguiculata L. Walp) samples. For irradiation doses of 0.0, 0.5, 1.0, 2.5, 5.0 and 10.0 kGy the results showed no significant differences in content for the uncooked samples. However, the combination of irradiation and cooking processes reduced the non-nutritive factors responsible for flatulence. Irradiation also significantly reduced the presence of Aspergillus, Penicilium, Rhizopus and Fusarium fungi and was shown to be efficient in grain conservation for a storage time of 6 months. - Highlights: > In this study we evaluated cowpea beans subjected to different doses of gamma irradiation > Cowpea bean grains represent an important source of vegetal protein for Brazilian population. > Non-nutritive factors were reduced by irradiation and cooking. > Several genera of fungus were reduced by irradiation without affecting the nutritional content. > Irradiation helps the cooking process preserving thermosensible nutrients.

  10. Toxic effects of Pb{sup 2+} on growth of cowpea (Vigna unguiculata)

    Energy Technology Data Exchange (ETDEWEB)

    Kopittke, Peter M. [School of Land, Crop and Food Sciences and CRC for Contamination Assessment and Remediation of the Environment, University of Queensland, St. Lucia, Queensland 4072 (Australia)], E-mail: p.kopittke@uq.edu.au; Asher, Colin J. [School of Land, Crop and Food Sciences, University of Queensland, St. Lucia, Queensland 4072 (Australia); Kopittke, Rosemary A. [Department of Primary Industries and Fisheries, 80 Meiers Road, Indooroopilly, Queensland 4068 (Australia); Menzies, Neal W. [School of Land, Crop and Food Sciences and CRC for Contamination Assessment and Remediation of the Environment, University of Queensland, St. Lucia, Queensland 4072 (Australia)

    2007-11-15

    A concentration as low as 1 {mu}M lead (Pb) is highly toxic to plants, but previous studies have typically related plant growth to the total amount of Pb added to a solution. In the present experiment, the relative fresh mass of cowpea (Vigna unguiculata) was reduced by 10% at a Pb{sup 2+} activity of 0.2 {mu}M for the shoots and at a Pb{sup 2+} activity of 0.06 {mu}M for the roots. The primary site of Pb{sup 2+} toxicity was the root, causing severe reductions in root growth, loss of apical dominance (shown by an increase in branching per unit root length), the formation of localized swellings behind the root tips (due to the initiation of lateral roots), and the bending of some root tips. In the root, Pb was found to accumulate primarily within the cell walls and intercellular spaces. - The Pb{sup 2+} ion reduced the growth of cowpea by 10% at a solution activity of 0.2 {mu}M for the shoots and 0.06 {mu}M for the roots.

  11. De novo transcriptome assembly of two Vigna angularis varieties collected from Korea

    Directory of Open Access Journals (Sweden)

    Yeonhwa Jo

    2016-06-01

    Full Text Available The adzuki bean (Vigna angularis, a member of the family Fabaceae, is widely grown in Asia, from East Asia to the Himalayas. The adzuki bean is known as an ingredient that adds sweetness to diverse desserts made in Eastern Asian countries. Libraries prepared from two V. angularis varieties referred to as Taejin Black and Taejin Red were paired-end sequenced using the Illumina HiSeq 2000 system. The raw data in this study can be available in NCBI SRA database with accession numbers of SRR3406660 and SRR3406553. After de novo transcriptome assembly using Trinity, we obtained 324,219 and 280,056 transcripts from Taejin Black and Taejin Red, respectively. We predicted a total of 238,321 proteins and 179,519 proteins for Taejin Black and Taejin Red, respectively, by the TransDecoder program. We carried out BLASTP on the predicted proteins against the Swiss-Prot protein sequence database to predict the putative functions of identified proteins. Taken together, we provide transcriptomes of two adzuki bean varieties by RNA-Seq, which might be usefully applied to generate molecular markers.

  12. Biochemical Changes under Chromium Stress on Germinating Seedlings of Vigna radiata

    Directory of Open Access Journals (Sweden)

    Bhavin SUTHAR

    2014-03-01

    Full Text Available Hexavalant chromium is considered the most toxic form because of its high solubility in water. Cr is known to induce production of elevated concentration of reactive oxygen species (ROS resulted in macromolecule damage. Plants are having unique mechanisms to overcome ROS induced damage by accumulation of proline, ascorbate and glutathione and increasing the activities of antioxidant enzymes such as superoxide dismutase (SOD, catalase (CAT, glutathione reductase (GR, and ascorbate peroxidaes (APX, peroxidise (POX. In the present investigation effects of chromium on seed germination of Mung bean (Vigna radiata 'Gujarat Mung-4’ were studied. Seeds were treated with different Cr concentrations (50, 100, 150 and 200 4M for seven days. On 7th day root and shoot length was measured and activities of antioxidant enzyme SOD, APX, POX, CAT and GR were checked along with protein, proline and lipid peroxidation. It was observed that there is gradual decrease in shoot and root length with respect to the increase in Cr concentration. Level of lipid peroxidation significantly increased along with proline and antioxidant enzyme activity at higher Cr concentration. Lipid peroxidation is an indication of membrane damage due to elevated production of reactive oxygen species (ROS. To combat oxidative damage by ROS antioxidant enzyme activity increased significantly, which indicates that antioxidant enzymes (SOD, CAT, APX and GR play a crucial role during Cr stress during germination of V. radiata.

  13. Effects of ozone on growth, net photosynthesis and yield of two African varieties of Vigna unguiculata.

    Science.gov (United States)

    Tetteh, Rashied; Yamaguchi, Masahiro; Wada, Yoshiharu; Funada, Ryo; Izuta, Takeshi

    2015-01-01

    To assess the effects of O(3)on growth, net photosynthesis and yield of two African varieties of cowpea(Vigna unguiculata L.), Blackeye and Asontem were exposed as potted plants to air that was either filtered to remove O(3) (FA), non-filtered air (NF), non-filtered with added O3 of approximately 50 nL L(-1) (ppb) from 11:00 to 16:00 (NF + O(3)) for 88 days in open-top chambers. The mean O(3) concentration (11:00-16:00) during the exposure period had a range from 16 ppb in the FA treatment to 118 ppb in the NF + O(3) treatment. Net photosynthetic rate and leaf area per plant were significantly reduced by exposure to O(3), reducing the growth of both varieties. Exposure to O(3) significantly reduced the 100-seed weight and number of seeds per pod. As a result, cowpea yield was significantly reduced by long-term exposure to O(3), with no difference in sensitivity between the varieties.

  14. Identification of Bradyrhizobium elkanii Genes Involved in Incompatibility with Vigna radiata

    Directory of Open Access Journals (Sweden)

    Hien P. Nguyen

    2017-12-01

    Full Text Available The establishment of a root nodule symbiosis between a leguminous plant and a rhizobium requires complex molecular interactions between the two partners. Compatible interactions lead to the formation of nitrogen-fixing nodules, however, some legumes exhibit incompatibility with specific rhizobial strains and restrict nodulation by the strains. Bradyrhizobium elkanii USDA61 is incompatible with mung bean (Vigna radiata cv. KPS1 and soybean cultivars carrying the Rj4 allele. Here, we explored genetic loci in USDA61 that determine incompatibility with V. radiata KPS1. We identified five novel B. elkanii genes that contribute to this incompatibility. Four of these genes also control incompatibility with soybean cultivars carrying the Rj4 allele, suggesting that a common mechanism underlies nodulation restriction in both legumes. The fifth gene encodes a hypothetical protein that contains a tts box in its promoter region. The tts box is conserved in genes encoding the type III secretion system (T3SS, which is known for its delivery of virulence effectors by pathogenic bacteria. These findings revealed both common and unique genes that are involved in the incompatibility of B. elkanii with mung bean and soybean. Of particular interest is the novel T3SS-related gene, which causes incompatibility specifically with mung bean cv. KPS1.

  15. Bruchid egg induced transcript dynamics in developing seeds of black gram (Vigna mungo.

    Directory of Open Access Journals (Sweden)

    Indrani K Baruah

    Full Text Available Black gram (Vigna mungo seeds are a rich source of digestible proteins, however, during storage these seeds are severely damaged by bruchids (Callosobruchus spp., reducing seed quality and yield losses. Most of the cultivated genotypes of black gram are susceptible to bruchids, however, few tolerant genotypes have also been identified but the mechanism of tolerance is poorly understood. We employed Suppression Subtractive Hybridization (SSH to identify specifically, but rarely expressed bruchid egg induced genes in black gram. In this study, Suppression Subtractive Hybridization (SSH library was constructed to study the genes involved in defense response in black gram against bruchid infestation. An EST library of 277 clones was obtained for further analyses. Based on CAP3 assembly, 134 unigenes were computationally annotated using Blast2GOPRO software. In all, 20 defense related genes were subject to quantitative PCR analysis (qPCR out of which 12 genes showed up-regulation in developing seeds of the pods oviposited by bruchids. Few major defense genes like defensin, pathogenesis related protein (PR, lipoxygenase (LOX showed high expression levels in the oviposited population when compared with the non-oviposited plants. This is the first report on defense related gene transcript dynamics during the bruchid-black gram interaction using SSH library. This library would be useful to clone defense related gene(s such as defensin as represented in our library for crop improvement.

  16. Reduction in flatulence factors in mung beans (Vigna radiata) using low-dose gamma-irradiation

    International Nuclear Information System (INIS)

    Machaiah, J.P.; Pednekar, M.D.; Thomas, P.

    1999-01-01

    Mungbeans (Vigna radiata), control and gamma-irradiated at insect disinfestation dose levels (0.25 and 0.75 kGy) were germinated (0-6 Bays) and the qualitative and quantitative changes in soluble carbohydrates were studied in detail. The key flatulence-producing raffinose family oligosaccharides inmungbeans were degraded in the irradiated samples at the onset of the germination (0-2 days) compared to the control where it occurred much later (>4days). However, the reducing sugars, mainly glucose, fructose and galactose, which are metabolised easily, were enhanced in the irradiated samples. At low dose (0.25 kGy), irradiation had no effect on germination and sprout length, indicating that irradiated beans are suitable for use as sprouted beans. These observations clearly indicate that gamma-irradiation at insect disinfestation dose levels improved the digestibility and nutritional quality of mung beans by reducing the content of oligosaccharides responsible for intestinal gas production. (C) 1999 Society of Chemical Industry

  17. Growth, photosynthesis, and antioxidant responses of Vigna unguiculata L. treated with hydrogen peroxide

    Directory of Open Access Journals (Sweden)

    Syed Aiman Hasan

    2016-12-01

    Full Text Available Cowpea (Vigna unguiculata L. is an important legume well grown in semiarid and arid environment. Hydrogen peroxide solutions (0.1, 0.5, 1.0, and 1.5 mM have been used to optimize growth and photosynthetic performance of cowpea plant at two growth stages [30 and 45 DAS (days of sowing]. Foliar application of H2O2 at 0.5 > 1.0 mM solution at 29 DAS optimally promoted the photosynthetic attributes [leaf chlorophyll content, net photosynthetic rate (PN, water use efficiency, and maximum quantum yield of PSII (Fv/Fm] and growth performance [root and shoot length; fresh and dry weight] of plants where the responses were more significant at the later growth stage. It was favored by activity of enzymes as carbonic anhydrase [CA; E.C. 4.2.1.1] and nitrate reductase [NR, E.C. 1.6.6.1] and those of antioxidant enzymes viz. peroxidase [POX; EC 1.11.1.7], catalase [CAT; EC 1.11.1.6], and superoxide dismutase [SOD; EC 1.15.1.1] and leaf proline content. Strengthened root system and antioxidant activity, particularly leaf proline level appeared to be the key factor for efficient photosynthesis and growth responses.

  18. Increased antioxidant activity and polyphenol metabolites in methyl jasmonate treated mung bean (Vigna radiata sprouts

    Directory of Open Access Journals (Sweden)

    Li LI

    Full Text Available Abstract Mung bean sprouts are a popular health food both in China and worldwide. We determined the optimal concentration of exogenous methyl jasmonate (MeJA for the promotion of the sprouting in mung beans (Vigna radiata. The 1,1-diphenyl-2- picrylhydrazyl radical (DPPH scavenging test showed that MeJA application resulted in significantly improved antioxidant capacity in the sprouts 72 h later. Measurement of total polyphenols in MeJA-treated beans from 0 to 168 h, using Folin–Ciocalteu colorimetry, showed that the polyphenols changing was significantly correlated with antioxidant activity. The main polyphenols isovitexin, kaempferol-3-O-rutinoside, daidzein, genistein, isoquercitrin, p-coumaric acid, and caffeic acid were quantified using high-performance liquid chromatography (HPLC/QqQ MS and partial least squares discriminant analysis (PLS-DA. MeJA promoted the production of polyphenols, metabolites, and antioxidants in the sprouts; therefore, its use may allow sprouts to be prepared more quickly or increase their nutritional value.

  19. EMF radiations (1800 MHz)-inhibited early seedling growth of maize (Zea mays) involves alterations in starch and sucrose metabolism.

    Science.gov (United States)

    Kumar, Arvind; Singh, Harminder Pal; Batish, Daizy R; Kaur, Shalinder; Kohli, Ravinder Kumar

    2016-07-01

    The present study investigated the impact of 1800-MHz electromagnetic field radiations (EMF-r), widely used in mobile communication, on the growth and activity of starch-, sucrose-, and phosphate-hydrolyzing enzymes in Zea mays seedlings. We exposed Z. mays to modulated continuous wave homogenous EMF-r at specific absorption rate (SAR) of 1.69±0.0 × 10(-1) W kg(-1) for ½, 1, 2, and 4 h. The analysis of seedlings after 7 days revealed that short-term exposure did not induce any significant change, while longer exposure of 4 h caused significant growth and biochemical alterations. There was a reduction in the root and coleoptile length with more pronounced effect on coleoptile growth (23 % reduction on 4-h exposure). The contents of photosynthetic pigments and total carbohydrates declined by 13 and 18 %, respectively, in 4-h exposure treatments compared to unexposed control. The activity of starch-hydrolyzing enzymes-α- and β-amylases-increased by ∼92 and 94 %, respectively, at an exposure duration of 4 h, over that in the control. In response to 4-h exposure treatment, the activity of sucrolytic enzymes-acid invertases and alkaline invertases-was increased by 88 and 266 %, whereas the specific activities of phosphohydrolytic enzymes (acid phosphatases and alkaline phosphatases) showed initial increase up to ≤2 h duration and then declined at >2 h exposure duration. The study concludes that EMF-r-inhibited seedling growth of Z. mays involves interference with starch and sucrose metabolism.

  20. Population structure analysis and association mapping of seed antioxidant content in USDA cowpea (Vigna unguiculata L. Walp.) core collection using SNPs

    Science.gov (United States)

    Cowpea (Vigna unguiculata (L) Walp.) is an important legume and the antioxidants in cowpea seeds have been recognized as health-promoting compounds for human. The objectives of this study were to analyze the population structure of cowpea collections using single nucleotide polymorphism (SNP) and to...

  1. Alleviation of Cu and Pb rhizotoxicities in cowpea (Vigna unguiculata) as related to ion activities at root-cell plasma membrane surface

    Science.gov (United States)

    Cations, such as Ca and Mg, are generally thought to alleviate toxicities of trace metals through site-specific competition (as incorporated in the biotic ligand model, BLM). Short term (48 h) experiments were conducted using cowpea (Vigna unguiculata L. Walp.) seedlings in simple nutrient solution...

  2. 8-prenylnaringenin and tamoxifen inhibit the shedding of irradiated epithelial cells and increase the latency period of radiation-induced oral mucositis. Cell culture and murine model

    Energy Technology Data Exchange (ETDEWEB)

    Ryck, Tine de; Impe, Annouchka van; Bracke, Marc E. [Ghent University, Laboratory of Experimental Cancer Research, Department Radiation Oncology and Experimental Cancer Research, Ghent (Belgium); Vanhoecke, Barbara W. [Ghent University, Laboratory of Experimental Cancer Research, Department Radiation Oncology and Experimental Cancer Research, Ghent (Belgium); Ghent University, Laboratory of Microbial Ecology and Technology (LabMET), Ghent (Belgium); Heyerick, Arne [Ghent University, Laboratory of Pharmacognosy and Phytochemistry, Ghent (Belgium); Vakaet, Luc; Neve, Wilfried de [Ghent University Hospital, Department of Radiation Oncology, Ghent (Belgium); Mueller, Doreen [Medical Faculty and University Hospital Carl Gustav Carus, Technische Universitaet Dresden, Department of Radiotherapy and Radiation Oncology, OncoRay-National Center for Radiation Research in Oncology, Dresden (Germany); Schmidt, Margret [Medical Faculty and University Hospital Carl Gustav Carus, Technische Universitaet Dresden, Department of Radiotherapy and Radiation Oncology, OncoRay-National Center for Radiation Research in Oncology, Dresden (Germany); German Cancer Consortium (DKTK) partner site Dresden and German Cancer Center (DKFZ), Heidelberg (Germany); Doerr, Wolfgang [Medical Faculty and University Hospital Carl Gustav Carus, Technische Universitaet Dresden, Department of Radiotherapy and Radiation Oncology, OncoRay-National Center for Radiation Research in Oncology, Dresden (Germany); Medical University, Department of Radiation Oncology, CCC, and CD-Laboratory RadOnc, Vienna (Austria)

    2015-05-01

    The major component in the pathogenesis of oral radiation-induced mucositis is progressive epithelial hypoplasia and eventual ulceration. Irradiation inhibits cell proliferation, while cell loss at the surface continues. We conceived to slow down this desquamation by increasing intercellular adhesion, regulated by the E-cadherin/catenin complex. We investigated if 8-prenylnaringenin (8-PN) or tamoxifen (TAM) decrease the shedding of irradiated human buccal epithelial cells in vitro and thus delay the ulcerative phase of radiation-induced mucositis in vivo. In vitro, aggregates of buccal epithelial cells were irradiated and cultured in suspension for 11 days. 8-PN or TAM were investigated regarding their effect on cell shedding. In vivo, the lower tongue surface of mice was irradiated with graded single doses of 25 kV X-rays. The incidence, latency, and duration of the resulting mucosal ulcerations were analyzed after topical treatment with 8-PN, TAM or solvent. 8-PN or TAM prevented the volume reduction of the irradiated cell aggregates during the incubation period. This was the result of a higher residual cell number in the treated versus the untreated irradiated aggregates. In vivo, topical treatment with 8-PN or TAM significantly increased the latency of mucositis from 10.9 to 12.1 and 12.4 days respectively, while the ulcer incidence was unchanged. 8-PN and TAM prevent volume reduction of irradiated cell aggregates in suspension culture. In the tongues of mice, these compounds increase the latency period. This suggests a role for these compounds for the amelioration of radiation-induced mucositis in the treatment of head and neck tumors. (orig.) [German] Die wesentliche Komponente in der Pathogenese der radiogenen Mukositis ist eine progressive epitheliale Hypoplasie und letztendlich Ulzeration. Die Bestrahlung hemmt die Zellproliferation, waehrend der Zellverlust an der Oberflaeche fortbesteht. Wir versuchten, diese Desquamation durch eine Stimulation der

  3. Biogenic synthesis and spatial distribution of silver nanoparticles in the legume mungbean plant (Vigna radiata L.).

    Science.gov (United States)

    Kumari, Rima; Singh, Jay Shankar; Singh, Devendra Pratap

    2017-01-01

    The present investigation aimed to study the in vivo synthesis of silver nanoparticles (AgNPs) in the legume Vigna radiata. The level of plant metabolites such as total phenolics, lipid, terpenoids, alkaloids and amino acid increased by 65%, 133%, 19%, 67% and 35%, respectively, in AgNO 3 (100 mg L -1 ) treated plants compared to control. Whereas protein and sugar contents in the treated plants were reduced by 38% and 27%, respectively. FTIR analysis of AgNO 3 (20-100 mg L -1 ) treated plants exhibited changes in the IR regions between 3297 and 3363 cm -1 , 1635-1619 cm -1 , 1249-1266 cm -1 and that corresponded to alterations in OH groups of carbohydrates, OH and NH groups of amide I and II regions of protein, when compared with the control. Transmission electron micrographs showed the spatial distribution of AgNPs in the chloroplast, cytoplasmic spaces, vacuolar and nucleolar plant regions. Metal quantification in different tissues of plants exposed to 20-100 mg L -1 AgNO 3 showed about a 22 fold accumulation of Ag in roots as compared to shoots. The phytotoxic parameters such as percent seed germination and shoot elongation remained almost unaltered at low AgNO 3 doses (20-50 mg L -1 ). However, at higher levels of exposure (100 mg L -1 ), the percent seed germination as well as root and shoot elongation exhibited concentration dependent decline. In conclusion, synthesis of AgNPs in V. radiata particularly at lower doses of AgNO 3 , could be used as a sustainable and environmentally safe technology for large scale production of metal nanoparticles. Copyright © 2016 Elsevier Masson SAS. All rights reserved.

  4. [Use of cowpea (Vigna sinensis) as a chicken complement in an infant formula].

    Science.gov (United States)

    Modernell, Marisa Guerra; Granito, Marisela; Paolini, Mariangel; Olaizola, Cristina

    2008-09-01

    Legumes represent an important protein source worldwide. In Venezuela, they are generally prepared at home and are consumed by adults, as soup or stew, while children eat them in very small quantities. In order to include legumes in the children's diet, the following work was done using cowpea (Vigna sinensis) as an complement of chicken in the preparation of a nutritionally balanced formula, adapted to the requirements of children. Several formulas were developed and three of them were selected based on their acceptability. In the first formula, the protein source was only of chicken. In the second formula, the chicken was partially substituted by cowpea, and in the third formula, the protein source was only made of cowpea. Other formula ingredients included rice, pumpkin (Curcubita maxima), carrot and some seasonings. Proximal analysis, protein quality (as protein efficiency ratio and protein digestibility) and sensory evaluation (7-point hedonic scale) were performed on the formulas. The proximal composition was similar in the three formulas: protein (3.5%), fat (1.3%) and carbohydrates (19.7%), with a good distribution of the energy contribution (98.9 kcal/100 g or 413.8 kJ/100 g). The protein quality and protein digestibility were higher for the chicken-cowpea formula than for the cowpea one. The acceptability with the mothers was higher for the chicken-cowpea formula than for the cowpea one. The acceptability of the chicken-cowpea formula with children was 77% (7-point hedonic facial scale) and 92% (measuring consumption). Due to the high acceptability and good protein quality, the chicken-cowpea formula could be included in the lunch meal of the children in daycare homes.

  5. Evaluation of aminoacids in irradiated beans (Vigna unguiculata (L.) Walp) by high performance liquid chromatography (HPLC)

    Energy Technology Data Exchange (ETDEWEB)

    Lima, Keila S. Cople; Souza, Luciana B.; Coelho, Maysa J.; Lima, Antonio L. Santos; Hernandes, Nilber K. [Instituto Militar de Engenharia (IME), Rio de Janeiro, RJ (Brazil). Secao de Engenharia Nuclear]. E-mail: keila@ime.eb.br; Godoy, Ronoel L.O. [EMBRAPA Agroindustria de Alimentos, Rio de Janeiro, RJ (Brazil)]. E-mail: ronoel@ctaa.embrapa.br

    2007-07-01

    Fradinho-bean (Vigna unguiculata (L.) Walp) is originated from Africa and is known in Brazil as 'caupi', 'corda' or 'macassar'. It is grown in the interior of Northeast Brazil (semi-arid region) and can be found in parts of the North, being one of the most important components of people's diet in those regions. The Northeast area produces around 429,375 ton of fradinho-bean per year. Leguminous plants are very important sources of proteins, vitamins, carbohydrates and minerals. This kind of bean is an excellent source of proteins (around 23- 25% of its nutritional content), being superior to regular beans (Phaseolus vulgaris). The irradiation process is an alternative to avoid post-harvesting losses, without changing the nutritional value of food. This study has the objective to evaluate the effect of different gamma irradiation doses (0.0; 0.5; 1.0; 2.5; 5.0 and 10.0 kGy) on aminoacid content of fradinho-bean by high performance liquid chromatography (HPLC) and the accompanying of the grains during storage time of 6 months. After irradiation, the bean grains went through a milling process in order to make flour for posterior extraction. A liquid chromatographer Waters, model Alliance 2695, with fluorescent detector Waters 2475, having a mobile phase with gradient elution of sodium acetate. acetonitrile and Milli-Q water, was employed. The flux used was 1 mL/min and the injection volume of 10 {mu}L. The column (C 18 150.0 x 3.9 mm) was kept at 36 deg C. The results show that gamma irradiation is a promise process for fradinho bean during conservation storage time of 6 months, until the dose of 10.0 kGy. Even the most radio-sensitive aminoacids like aromatics and basic lateral chains were preserved. (author)

  6. Effects of cowpea (Vigna unguiculata) root mucilage on microbial community response and capacity for phenanthrene remediation.

    Science.gov (United States)

    Sun, Ran; Belcher, Richard W; Liang, Jianqiang; Wang, Li; Thater, Brian; Crowley, David E; Wei, Gehong

    2015-07-01

    Biodegradation of polycyclic aromatic hydrocarbons (PAHs) is normally limited by their low solubility and poor bioavailability. Prior research suggests that biosurfactants are synthesized as intermediates during the production of mucilage at the root tip. To date the effects of mucilage on PAH degradation and microbial community response have not been directly examined. To address this question, our research compared 3 cowpea breeding lines (Vigna unguiculata) that differed in mucilage production for their effects on phenanthrene (PHE) degradation in soil. The High Performance Liquid Chromatography results indicated that the highest PHE degradation rate was achieved in soils planted with mucilage producing cowpea line C1, inoculated with Bradyrhizobium, leading to 91.6% PHE disappearance in 5 weeks. In root printing tests, strings treated with mucilage and bacteria produced larger clearing zones than those produced on mucilage treated strings with no bacteria or bacteria inoculated strings. Experiments with 14C-PHE and purified mucilage in soil slurry confirmed that the root mucilage significantly enhanced PHE mineralization (82.7%), which is 12% more than the control treatment without mucilage. The profiles of the PHE degraders generated by Denaturing gradient gel electrophoresis suggested that cowpea C1, producing a high amount of root mucilage, selectively enriched the PHE degrading bacteria population in rhizosphere. These findings indicate that root mucilage may play a significant role in enhancing PHE degradation and suggests that differences in mucilage production may be an important criterion for selection of the best plant species for use in phytoremediation of PAH contaminated soils. Copyright © 2015. Published by Elsevier B.V.

  7. A novel symbiovar (aegeanense) of the genus Ensifer nodulates Vigna unguiculata.

    Science.gov (United States)

    Tampakaki, Anastasia P; Fotiadis, Christos T; Ntatsi, Georgia; Savvas, Dimitrios

    2017-10-01

    Cowpea (Vigna unguiculata) forms nitrogen-fixing root nodules with diverse symbiotic bacteria, mainly slow-growing rhizobial species belonging to the genus Bradyrhizobium, although a few studies have reported the isolation of fast-growing rhizobia under laboratory and field conditions. Although much research has been done on cowpea-nodulating bacteria in various countries around the world, very limited information is available on cowpea rhizobia in European soils. The aim of this study was to study the genetic and phenotypic diversity of indigenous cowpea-nodulating rhizobia in Greece. The genetic diversity of indigenous rhizobia associated with cowpea was investigated through a polyphasic approach. ERIC-PCR based fingerprinting analysis grouped the isolates into three groups. Based on the analysis of the 16S rRNA genes, IGS and on the concatenation of six housekeeping genes (recA, glnII, gyrB, truA, thrA and SMc00019), rhizobial isolates were classified within the species Ensifer fredii. However, symbiotic gene phylogenies, based on nodC, nifH and rhcRST genes, showed that the Ensifer isolates are markedly diverged from type and reference strains of E. fredii and formed one clearly separate cluster. The E. fredii strains were able to nodulate and fix nitrogen in cowpea but not in soybean and common bean. The present study showed that cowpea is nodulated under field conditions by fast-growing rhizobia belonging to the species E. fredii. Based on the phylogenies, similarity levels of symbiotic genes and the host range, the Ensifer isolates may constitute a new symbiovar for which the name 'aegeanense' is proposed. © 2017 Society of Chemical Industry. © 2017 Society of Chemical Industry.

  8. Genetic variation for phytic acid content in mungbean (Vigna radiata L. Wilczek

    Directory of Open Access Journals (Sweden)

    Vinod Janardan Dhole

    2015-03-01

    Full Text Available Mungbean (Vigna radiata L. Wilczek is a short-duration legume crop cultivated for seeds that are rich in protein and carbohydrates. Mungbeans contain phytic acid (PA, an anti-nutritional factor that is the main storage form of organic phosphorus in seeds. It is a strong inhibitor against the absorption of nutrients including iron, zinc, calcium and magnesium in monogastric animals. Genotypes with low phytic acid (lpa in seed may show increased assimilation of nutrients and be useful in breeding lpa cultivars. The present study was conducted to identify lpa sources, genetic variation, heritability, and association with seed coat color, inorganic phosphorus (IP, and seed size in 102 mungbean genotypes including released varieties, land races, mutants, and wild species grown in two seasons: summer 2011 and rabi 2012. PA and IP in dry seeds were estimated by modified colorimetric method and Chen's modified method, respectively. PA, IP, and 100-seed weight differed significantly in the two seasons. PA content in 102 genotypes ranged from 5.74 to 18.98 mg g− 1 and 5.85 to 20.02 mg g− 1 in summer 2011 and rabi 2012, respectively. High heritability was found for PA (0.87 and 0.86 and seed size (0.82 and 0.83 but low heritability for IP (0.61 and 0.60. A negative correlation was found between PA and seed size (r = − 0.183 and − 0.267. Yellow and green seed coat genotypes contained significantly less PA than black seed coat genotypes. Cluster analysis revealed the distinctness of wild species, land races and cultivated varieties on the basis of PA content. The genotypes YBSM (6.001 mg g− 1 and JL-781 (6.179 mg g− 1 showed lowest PA. These lpa sources can be used to develop high-yielding mungbean cultivars with low phytic acid.

  9. Variabilidade e correlações entre caracteres agronômicos em caupi (Vigna unguiculata

    Directory of Open Access Journals (Sweden)

    Lopes Ângela Celis de Almeida

    2001-01-01

    Full Text Available O caupi (Vigna unguiculata (L. Walp é um alimento básico das populações do Nordeste brasileiro, devendo merecer atenção com vistas a melhoria da qualidade de grãos, resistência a doenças e pragas e aumento de produtividade. Este trabalho teve por objetivo estudar a variabilidade e o potencial genético de 28 linhagens, escolhidas após uma seleção para cor, tamanho de grãos e resistência a viroses. A produtividade apresentou coeficiente de variação genético de 23,90%, e o valor agronômico, de 3,56%. O número de vagens por pedúnculo apresentou a menor estimativa do coeficiente de determinação genético (4,51%, e o peso de 100 grãos, a maior (81,74%. O coeficiente de determinação genético da produtividade foi de 34,15%. As maiores estimativas de ganho genético foram as do peso de 100 grãos (21,73% e da produtividade (19,77%. As correlações genotípicas foram superiores às fenotípicas e às de ambiente, destacando-se as correlações entre número de ramos secundários e produtividade (68,13%, e valor agronômico e produtividade (100%. Estes resultados mostram amplas possibilidades de seleção entre as linhagens com relação à maioria dos caracteres estudados.

  10. Phosphorus Response and Amino Acid Composition of Different Green Gram (Vigna radiata L. Genotypes from Myanmar

    Directory of Open Access Journals (Sweden)

    M. Kywe

    2007-10-01

    Full Text Available Mungbean or green gram (Vigna radiata L. is an important component of rice-based cropping systems in Myanmar, where grain yields of around 800 kg ha^(-1 are much below its yield potential of 3000 kg ha^(-1. The reasons for this shortfall are as under-investigated as is the genotype-specific response of this crop to phosphorus (P application, which is critically low in many Myanmar soils, and the genetic variation in grain quality. For green gram quality, the concentration of lysine, an essential amino acid is particularly important given its scarcity in many cereal-based diets of Southeast Asia. The purpose of this study therefore was to investigate the effects of P application on the root and shoot growth, yield and its components for a range of green gram varieties, and to analyse the protein concentration and amino acid composition in green gram seed of different origins. To this end from 2001 to 2003, field experiments were conducted under rain-fed conditions in Yezin and Nyaung Oo. Fifteen landraces and five introduced green gram cultivars were grown at two levels of P (0 and 15 kg ha^(-1. There were large genotypic differences in P effects and a significant interaction between green gram genotypes and P for shoot and root growth. An unexpected benefit of P application was a reduction of pest and plant virus infestation in the field. Significant genotypic differences in the amino acid profile of seeds were also observed. The results indicate the potential for breeding efforts to increase seed yield and protein quality in green gram.

  11. Influence of distillery effluent on germination and growth of mung bean (Vigna radiata) seeds

    Energy Technology Data Exchange (ETDEWEB)

    Kannan, A. [Biomembrane Toxicology Division, Industrial Toxicology Research Centre, Post Box No. 80, M.G. Marg, Lucknow 226001 (India); Upreti, Raj K. [Biomembrane Toxicology Division, Industrial Toxicology Research Centre, Post Box No. 80, M.G. Marg, Lucknow 226001 (India)], E-mail: upretirk@rediffmail.com

    2008-05-01

    Distillery effluent or spent wash discharged as waste water contains various toxic chemicals that can contaminate water and soil and may affect the common crops if used for agricultural irrigation. Toxic nature of distillery effluent is due to the presence of high amounts of organic and inorganic chemical loads and its high-acidic pH. Experimental effects of untreated (Raw) distillery effluent, discharged from a distillery unit (based on fermentation of alcohol from sugarcane molasses), and the post-treatment effluent from the outlet of conventional anaerobic treatment plant (Treated effluent) of the distillery unit were studied in mung bean (Vigna radiata, L.R. Wilczek). Mung bean is a commonly used legume crop in India and its neighboring countries. Mung bean seeds were presoaked for 6 h and 30 h, respectively, in different concentrations (5-20%, v/v) of each effluent and germination, growth characters, and seedling membrane enzymes and constituents were investigated. Results revealed that the leaching of carbohydrates and proteins (solute efflux) were much higher in case of untreated effluent and were also dependent to the presoaking time. Other germination characters including percentage of germination, speed of germination index, vigor index and length of root and embryonic axis revealed significant concentration-dependent decline in untreated effluent. Evaluation of seedlings membrane transport enzymes and structural constituents (hexose, sialic acid and phospholipids) following 6 h presoaking of seeds revealed concentration-dependent decline, which were much less in treated effluent as compared to the untreated effluent. Treated effluent up to 10% (v/v) concentration reflected low-observed adverse effect levels.

  12. Effect of Nitrogen Nutritional Stress on some Mineral Nutrients and Photosynthetic Apparatus of Zea mays L. and Vigna unguiculata L.

    Directory of Open Access Journals (Sweden)

    Akinbode Foluso OLOGUNDUDU

    2013-08-01

    Full Text Available The study investigated the responses of maize (Zea mays L. and cowpea (Vigna unguiculata L. Walp. seedlings metabolic activities and photosynthetic apparatus to nitrogen nutritional stress. Germination of seeds was done using treated sand in sixty plastic pots and the seedlings were divided into four nutrient regimes. A group of the seedlings was nutrient stressed by administering 200 ml of complete nutrient solution minus nitrogen (-N while the other groups were fed with five times (X5N and ten times (X10N the optimal concentration of nitrogen and the last regime was fed with full nutrient solution (FN. The photosynthetic parameters studied included chlorophylls ‘a’ and ‘b’ respectively; carotenes and xanthophyll while the mineral elements investigated include potassium, calcium and magnesium. The result of the growth analysis showed that nitrogen deficiency promotes an increase in the content of abscisic acid (ABA, causing stomatal closure and a reduction in photosynthesis. This explains the higher rate of leaf abscission in -N plants. A comparison of calcium ion and magnesium ion concentrations in both optimal and stressed conditions reveals that the two ions show antagonism in uptake. There is a correlation between nitrogen and magnesium accumulation as magnesium ion plays a vital role in chlorophyll biosynthesis, protein synthesis and photosynthesis. The pattern of accumulation of photosynthetic apparatus in both maize and cowpea follow a similar pattern. Chlorophyll a dictated the growth pattern of other photosynthetic apparatus in both Zea mays and Vigna unguiculata.

  13. Effect of Nitrogen Nutritional Stress on Some Growth Parameters of Zea mays L. and Vigna unguiculata (L. Walp.

    Directory of Open Access Journals (Sweden)

    Akinbode Foluso OLOGUNDUDU

    2013-02-01

    Full Text Available This study investigated the responses of maize (Zea mays L. and cowpea (Vigna unguiculata L. Walp. seedlings growth parameters to nitrogen nutritional stress. This was with a view to determining whether nitrogen nutritional stress would retard or enhance maize and cowpea growth, partly, wholly or not at all through its effect on biomass accumulation and some morphological parameters. Germination of seeds was done using treated sand in sixty plastic pots. A group of the seedlings was nutrient stressed by administering 200 ml of complete nutrient solution minus nitrogen (-N while the other groups were fed with five times (X5N and ten times (X10N the optimal concentration of nitrogen and the last regime was fed with full nutrient solution (FN. The effects of optimal concentration and nitrogen stress on the growth rates (as measured by their fresh and dry weight were studied. The result of the growth analysis showed that there was increase in shoot height with supraoptimal concentrations of nitrogen treatments (X10N and X5N while there was a decrease in shoot height with minus nitrogen (-N regimes. The observed higher biomass (dry matter yield under the FN regimes in both Zea mays and Vigna unguiculata were attributed to optimal nutrient assimilation rate.

  14. Efficacy of insecticides against army worm (spodoptera mauritia) on mung bean (vigna radiata l.) under arid climate

    International Nuclear Information System (INIS)

    Abbas, G.; Aslam, M.; Khokhar, M.B.; Khattak, J.Z.K.; Malik, A.U.

    2011-01-01

    Influence of Bifenthrine (Talstar) at the rate 375 ml ha/sup -1/, Deltaphos 10+350 EC at the rate 500 ml ha/sup -1/, Lorsban 40 EC at the rate 850 ml ha/sup -1/, Triazofos (20/400 EC) at the rate 750 ml ha/sup -1/and Karate 5 EC at the rate 1250 ml ha/sup -1/ was studied on mung bean (Vigna radiata L.) yield under arid climate at Adaptive Research Farm, Karor during two kharif seasons of 2007 and 2008. Experiments were laid out in randomized complete block design with six a test variety. All the chemicals showed significant impact on mung crop as compared to that in control treatments. AZRI- 2006, a promising variety of mung bean (Vigna radiata L.) for arid climate was used as plots, but the treatment of Deltaphos 10+350 EC at the rate 350 ml ha/sup -1/consistently proved better than other treatments. (author)

  15. Assembled genomic and tissue-specific transcriptomic data resources for two genetically distinct lines of Cowpea ( Vigna unguiculata (L.) Walp).

    Science.gov (United States)

    Spriggs, Andrew; Henderson, Steven T; Hand, Melanie L; Johnson, Susan D; Taylor, Jennifer M; Koltunow, Anna

    2018-02-09

    Cowpea ( Vigna unguiculata (L.) Walp) is an important legume crop for food security in areas of low-input and smallholder farming throughout Africa and Asia. Genetic improvements are required to increase yield and resilience to biotic and abiotic stress and to enhance cowpea crop performance. An integrated cowpea genomic and gene expression data resource has the potential to greatly accelerate breeding and the delivery of novel genetic traits for cowpea. Extensive genomic resources for cowpea have been absent from the public domain; however, a recent early release reference genome for IT97K-499-35 ( Vigna unguiculata  v1.0, NSF, UCR, USAID, DOE-JGI, http://phytozome.jgi.doe.gov/) has now been established in a collaboration between the Joint Genome Institute (JGI) and University California (UC) Riverside. Here we release supporting genomic and transcriptomic data for IT97K-499-35 and a second transformable cowpea variety, IT86D-1010. The transcriptome resource includes six tissue-specific datasets for each variety, with particular emphasis on reproductive tissues that extend and support the V. unguiculata v1.0 reference. Annotations have been included in our resource to allow direct mapping to the v1.0 cowpea reference. Access to this resource provided here is supported by raw and assembled data downloads.

  16. A SNP and SSR Based Genetic Map of Asparagus Bean (Vigna. unguiculata ssp. sesquipedialis) and Comparison with the Broader Species

    Science.gov (United States)

    Xu, Pei; Wu, Xiaohua; Wang, Baogen; Liu, Yonghua; Ehlers, Jeffery D.; Close, Timothy J.; Roberts, Philip A.; Diop, Ndeye-Ndack; Qin, Dehui; Hu, Tingting; Lu, Zhongfu; Li, Guojing

    2011-01-01

    Asparagus bean (Vigna. unguiculata ssp. sesquipedialis) is a distinctive subspecies of cowpea [Vigna. unguiculata (L.) Walp.] that apparently originated in East Asia and is characterized by extremely long and thin pods and an aggressive climbing growth habit. The crop is widely cultivated throughout Asia for the production of immature pods known as ‘long beans’ or ‘asparagus beans’. While the genome of cowpea ssp. unguiculata has been characterized recently by high-density genetic mapping and partial sequencing, little is known about the genome of asparagus bean. We report here the first genetic map of asparagus bean based on SNP and SSR markers. The current map consists of 375 loci mapped onto 11 linkage groups (LGs), with 191 loci detected by SNP markers and 184 loci by SSR markers. The overall map length is 745 cM, with an average marker distance of 1.98 cM. There are four high marker-density blocks distributed on three LGs and three regions of segregation distortion (SDRs) identified on two other LGs, two of which co-locate in chromosomal regions syntenic to SDRs in soybean. Synteny between asparagus bean and the model legume Lotus. japonica was also established. This work provides the basis for mapping and functional analysis of genes/QTLs of particular interest in asparagus bean, as well as for comparative genomics study of cowpea at the subspecies level. PMID:21253606

  17. A SNP and SSR based genetic map of asparagus bean (Vigna. unguiculata ssp. sesquipedialis and comparison with the broader species.

    Directory of Open Access Journals (Sweden)

    Pei Xu

    Full Text Available Asparagus bean (Vigna. unguiculata ssp. sesquipedialis is a distinctive subspecies of cowpea [Vigna. unguiculata (L. Walp.] that apparently originated in East Asia and is characterized by extremely long and thin pods and an aggressive climbing growth habit. The crop is widely cultivated throughout Asia for the production of immature pods known as 'long beans' or 'asparagus beans'. While the genome of cowpea ssp. unguiculata has been characterized recently by high-density genetic mapping and partial sequencing, little is known about the genome of asparagus bean. We report here the first genetic map of asparagus bean based on SNP and SSR markers. The current map consists of 375 loci mapped onto 11 linkage groups (LGs, with 191 loci detected by SNP markers and 184 loci by SSR markers. The overall map length is 745 cM, with an average marker distance of 1.98 cM. There are four high marker-density blocks distributed on three LGs and three regions of segregation distortion (SDRs identified on two other LGs, two of which co-locate in chromosomal regions syntenic to SDRs in soybean. Synteny between asparagus bean and the model legume Lotus. japonica was also established. This work provides the basis for mapping and functional analysis of genes/QTLs of particular interest in asparagus bean, as well as for comparative genomics study of cowpea at the subspecies level.

  18. La collection de base des espèces sauvages de Phaseolus et Vigna : historique, gestion et conservation

    Directory of Open Access Journals (Sweden)

    Thierry Vanderborght

    1998-01-01

    Full Text Available The base collection of wild species of Phaseolus and Vigna: history, management and conservation.The National Botanic Garden of Belgium ensures the management of a base collection of botanical and wild forms in the tribe Phaseoleae and the sub-tribe Phaseolinae. The main objective is to conserve on a long terni basic the largest possible genetic diversity through seed semples stored at - 20°C. The collection provided the basic material for the investigations conducted at the University Faculty of Agricultural Sciences of Gembloux in fields as diverse as taxonomy, genome analysis, definition of genetic réservoirs, agronomie and chemical evaluations, interspecific hybridization and plant breeding. The results have allowed to becter understand the organization of genetic diversity in the studied plant material and to highlight the wealthy genetic potentiel of the collection. The latter should be preserved and valorized for the genetic improvement of food legumes, in particular within the two genera Phaseolus and Vigna.

  19. Involvement of abscisic acid in regulating antioxidative defense systems and IAA-oxidase activity and improving adventitious rooting in mung bean [Vigna radiata (L.) Wilczek] seedlings under cadmium stress.

    Science.gov (United States)

    Li, Shi-Weng; Leng, Yan; Feng, Lin; Zeng, Xiao-Ying

    2014-01-01

    In vitro experiments were conducted to investigate the effects of abscisic acid (ABA) and Cd on antioxidative defense systems and indole-3-acetic acid (IAA) oxidase during adventitious rooting in mung bean [Vigna radiata (L.) Wilczek] seedlings. The exogenous ABA significantly enhanced the number and fresh weight of the adventitious roots. CdCl2 strongly inhibited adventitious rooting. Pretreatment with 10 μM ABA clearly alleviated the inhibitory effect of Cd on rooting. ABA significantly reduced superoxide dismutase (SOD), ascorbate peroxidase (APX), peroxidase (POD), and catalase (CAT) activities, as well as the levels of glutathione (GSH) and ascorbic acid (ASA) during adventitious rooting. ABA strongly increased IAA-oxidase activity during the induction (0-12 h) and expression (after 48 h) phases and increased the phenols levels. Cd treatment significantly reduced the activities of SOD, APX, POD, and IAA oxidase, as well as GSH level. Cd strongly increased ASA levels. ABA pretreatment counteracted Cd-induced alterations of certain antioxidants and antioxidative enzymes, e.g., remarkably rescued APX and POD activities, reduced the elevated SOD and CAT activities and ASA levels, and recovered the reduced GSH levels, caused by Cd stress. Thus, the physiological effects of the combination of ABA and Cd treatments were opposite of those obtained with Cd treatment alone, suggesting that ABA involved in the regulation of antioxidative defense systems and the alleviation of wounding- and Cd-induced oxidative stress.

  20. Adzuki beans (Vigna angularis seed quality under several drying conditions Qualidade de sementes de feijão adzuki (Vigna angularis submetidas a diversas condições de secagem

    Directory of Open Access Journals (Sweden)

    Osvaldo Resende

    2012-03-01

    Full Text Available This study analyzed the drying process and the seed quality of adzuki beans (Vigna angularis. Grains of adzuki beans, with moisture content of 1.14 (decimal dry basis at harvest and dried until the moisture content of 0.11 (decimal dry basis. were used. Drying was done in an experimental drier maintened at controlled temperatures of 30, 40, 50, 60, and 70 ºC and relative humidity of 52.0, 28.0, 19.1, 13.1, and 6.8%, respectively. Physiological and technological seed quality was evaluated using the germination test, Index of Germination Velocity (IGV, electrical conductivity, and water absorption, respectively. Under the conditions tested in the present study, it can be concluded that drying time for adzuki beans decreases with the higher air temperatures of 60 and 70 ºC, and it affected the physiological and technological seed quality. Thus, to avoid compromising adzuki seeds quality, it is recommended to promote its drying up to 50 ºC.Objetivou-se no presente trabalho analisar o processo de secagem do feijão adzuki (Vigna angularis, bem como avaliar a qualidade das sementes, submetidas à secagem em diversas condições de ar. Foram utilizados grãos de feijão adzuki (Vigna angularis, colhidos com teor de água de 1,14 (decimal base seca e secos até o teor de 0,11 (decimal base seca. A secagem do feijão adzuki foi realizada em secador experimental mantido nas temperaturas controladas de 30, 40, 50, 60 e 70 ºC e umidades relativas de 52,0; 28,0; 19,1; 13,1 e 6,8%, respectivamente. Para analisar a qualidade fisiológica e tecnológica das sementes realizou-se o teste de germinação, Índice de Velocidade de Germinação (IVG, condutividade elétrica e absorção de água, respectivamente. Nas condições em que foi desenvolvido o presente trabalho,conclui-se que o tempo de secagem do feijão adzuki diminui para as temperaturas mais elevadas do ar de 60 e 70 ºC e afetam as qualidades fisiológica e tecnológica das sementes. Assim, para

  1. Increased UV-B radiation reduces N2-fixation in tropical leguminous crops

    International Nuclear Information System (INIS)

    Anupa Singh

    1997-01-01

    Net photosynthesis, leaf area, biomass, and number, size and activity of nodules were examined in three leguminous plants subjected under field conditions to supplemental UV-B radiation equivalent to a 15% ozone depletion at 25 degrees N latitude. Enhanced UV-B radiation adversely affected the net photosynthetic rate, growth characteristics and nodule activity in all three species. Maximum reduction in net photosynthesis occurred in Phaseolus mungo cv. Pant U-30, whereas the greatest reduction in nitrogenase activity occurred in Vigna radiata. (author)

  2. Reverse resistance to radiation in KYSE-150R esophageal carcinoma cell after epidermal growth factor receptor signal pathway inhibition by cetuximab

    International Nuclear Information System (INIS)

    Jing Zhao; Gong Ling; Xie Congying; Zhang Li; Su Huafang; Deng Xia; Wu Shixiu

    2009-01-01

    Background and purpose: The purpose of our study is to examine the capacity of cetuximab to reverse radiation resistance and investigate molecular mechanisms in human radiation-resistant esophageal carcinoma cell line KYSE-150R. Materials and methods: The radioresistant cell line KYSE-150R was established by using fractionated irradiation (FIR). The KYSE-150R cell line was exposed to radiation, treatment with cetuximab, and combined treatment. Cell cycle distribution and apoptosis were analyzed using flow cytometry. Radiation survival was analyzed using clonogenic assays. RT 2 profiler TM PCR array was performed to analyze EGF/PDGF signaling pathway genes. Results: The established esophageal carcinoma cell line KYSE-150R showed higher radioresistance than parental cell line. Cetuximab could reverse the radiation resistance of KYSE-150R cells. Cell cycle analysis showed that combination with radiation and cetuximab resulted in the accumulation of cells in G1 and G2/M phases, with the reduction of cells within the S phase. Cetuximab enhanced the apoptosis induced by radiation. RT 2 profiler TM array showed that some intracellular signaling genes deriving from EGF/PDGF signaling pathway regulated by cetuximab. Conclusions: Irradiation combined with EGFR blocked by cetuximab may reverse the resistance to radiation in radioresistant esophageal carcinoma cell. The mechanisms may include cell cycle perturbation and enhancement of radiation-induced apoptosis. Further studies are needed to evaluate the role of cetuximab in combination with radiotherapy in the management of esophageal carcinoma.

  3. Radiation interception and the accumulation of biomass and nitrogen by soybean and three tropical annual forage legumes

    International Nuclear Information System (INIS)

    Pengelly, B.C.; Blamey, F.P.C.; Muchow, R.C.

    1999-01-01

    Field experiments were conducted at Gatton and Dalby in southeastern Queensland to determine parameters associated with radiation interception and biomass and nitrogen (N) accumulation for the ley legume species, phasey bean (Macroptilum lathyroides (L.) Urban) and vigna, (Vigna trilobata (L.) Verdc.). Sesbania (Sesbania cannabina Retz.), a native legume species, and soybean (Glycine max (L.) Merrill)) were included in the study for comparison. The most important differences between species related to differences in radiation interception, radiation-use efficiency (RUE), N-accumulation efficiency and the partitioning of N to plant parts. During early growth, soybean intercepted more radiation than the other species, primarily because of its greater leaf area index (LAI). Sesbania had the highest RUE (1.08 g MJ −1 ) followed by phasey bean (0.94 g MJ −1 ), soybean (0.89 g MJ −1 ) and vigna (0.77 g MJ −1 ). The efficiency of N-accumulation was greater in soybean (0.028 g N g −1 ) and phasey bean (0.030 g N g −1 ) than in vigna (0.022 g N g −1 ) and sesbania (0.021 g N g −1 ). In all species, the proportion of N allocated to leaves declined throughout the experimental period, being more rapid in soybean than in sesbania and phasey bean. Despite this decline in total N partitioned to the leaves, both soybean and phasey bean maintained a relatively stable specific leaf nitrogen (SPLN) throughout the experimental periods although sesbania and vigna displayed rapid decreases in SPLN. The large variation between species in RUE and N-accumulation efficiency indicates that the development of ley legume cultivars with a combination of traits for more efficient legume production, water use and soil N-accumulation in the water-limited environments of the grain belt of eastern Australia may be possible. The sensitivity of forage production, water use and soil N-accumulation to variation in RUE and N-accumulation efficiency needs to be quantified using modeling

  4. First report of natural infection of Vigna mungo var. silvestris L. by Groundnut bud necrosis virus, a tospovirus

    Directory of Open Access Journals (Sweden)

    Mohammad AKRAM

    2010-09-01

    Full Text Available In the autumn of 2008, Vigna mungo var. silvestris growing in the experimental field of the Indian Institute of Pulses Research, Kanpur, India, showed chlorosis around some lateral veins and vein branches (mainly near the leaflet margin, downward curling of the leaf margins, necrosis of the stems and petioles, and twisting of the leaflets. Disease incidence was 20%. Symptoms indicated that the cause was Groundnut bud necrosis virus. The virus was identified on the basis of the symptoms on the diagnostic host, and the reverse transcription polymerase chain reaction (RT-PCR using specific primers of the NSm and NP genes. To our knowledge this is the first report of Groundnut bud necrosis virus on V. mungo var. silvestris.

  5. Effect of Gamma Irradiation Doses and Micro Elements on Some Physical, Chemical and Crop Parameters of Vigna sinensis

    International Nuclear Information System (INIS)

    Hussein, L.O.S.; Saleh, O.I.; Abdullah, M.I.

    2011-01-01

    The present work aim to expose Vigna sinensis L. (cowpea) seeds to gamma rays at dose levels 40, 80 and 120 Gy and to spray the growing plants with micro elements; boron (B) and zinc (Zn) after one month of planting; until harvest date, for increasing crop quality and quantity. Some physical parameters, some chemical analysis, the yield and net percentage of the produced crop were evaluated. The result obtained refer that, the 40 Gy dose enhanced most of physical, chemical and yield parameters of cowpea crop. Moreover, the harvested crop was increased and improved in case of those produced from plants sprayed with different concentrations of B or Zn plus 40 Gy dose as compared with the other treatments used followed by the dose of 80 Gy. Meanwhile, the dose of 120 Gy gave the least enhancement on the quality and quantity of the aforementioned treatments in cowpea crop

  6. Genetic variability in dinitrogen fixation between cowpea [Vigna unguiculata (L.) Walp] cultivars determined using the nitrogen-15 isotope dilution technique

    International Nuclear Information System (INIS)

    Ndiaye, M.A.F.; Spencer, M.M.; Gueye, M.

    2000-01-01

    N fixed in 16 cultivars of cowpea [Vigna unguiculata (L.) Walp] inoculated with effective Bradyrhizobium strains collected from the West African MIRCEN culture collection was measured by 15N isotope dilution technique. In all plant parts, significant differences in the percentage of N derived from the atmosphere (%Ndfa) and the amount of Ndfa occurred between the cultivars. Ndoute variety exhibited the highest %Ndfa (74.33% in shoots; 60.90% in roots) and accumulated more fixed N (960 mg N plant–1 and 38 mg N plant–1 in shoots and roots, respectively). Therefore this cultivar should be selected as the highest N-fixing cowpea cultivar. It also should be used in a breeding programme to contribute to the development of cultivars that could stimulate an intensive use of cowpea in many different cropping systems in Africa with a view to maintaining soil fertility. (Authors)

  7. Identification of water storage tissue in the stem of cowpea plant (Vigna unguliculata Walp) by neutron radiography

    International Nuclear Information System (INIS)

    Nakanishi, T.M.; Don-Jin, K.; Ishii, R.; Matsubayashi, M.

    1999-01-01

    Cowpea (Vigna unguliculata Walp) is considered one of the most drought resistant species among the pulse crops. It was suggested that in the lower part of the stem, parenchymatous tissue for storing water has been developed for the function of drought resistance. However, such tissue has not been identified yet. In order to identify the water storing tissue in the stem of cowpea plant, the authors performed neutron radiography, which provides a non-destructive image of water distribution pattern in a plant. Common bean plant and soybean plant were used as references. Comparing the neutron radiograph for the stems of the plants, i.e., cowpea, common bean and soybean plants, the parenchymatous tissue with water storing function was distinguished in the intermode between primary leaf and the first trifoliate leaf specifically in cowpea plant. (author)

  8. Effect of (/sup 60/cobalt) gamma rays on growth and root rot diseases in mungbean (vigna radiata L.)

    International Nuclear Information System (INIS)

    Ikram, N.; Dawar, S.; Zaki, M.J.; Abass, Z.

    2010-01-01

    Present investigation showed that gamma rays influences suppressive effect on root rot fungi such as Macrophomina phaseolina (Tassi) Goid, Rhizoctonia solani Kuhn and Fusarium spp., and inducive effect on growth parameters of mung bean (Vigna radiata L.). Seeds of mung bean were treated with gamma rays (/sup 60/Cobalt) at time periods of 0 and 4 minutes and stored for 90 days at room temperature to determine its effect on growth parameters and infection of root infecting fungi. All treatments of gamma rays enhanced the growth parameters as compared to untreated plants. Infection of M. phaseolina, R. solani and Fusarium spp., were significantly decreased on mung bean seeds treated with gamma rays. Gamma rays significantly increased the growth parameters and controlled the root rot fungi up to 90 days of storage of seeds. (author)

  9. Antioxidant Activity of the Extracts of Some Cowpea (Vigna unguiculata (L Walp. Cultivars Commonly Consumed in Pakistan

    Directory of Open Access Journals (Sweden)

    Vincenzo De Feo

    2013-02-01

    Full Text Available The present investigation has been carried out to determine the antioxidant activity of the methanolic extracts obtained from four cultivars of cowpea (Vigna unguiculata (L Walp. seeds. Phenolic compounds present in the extracts showed the antioxidant and antiradical properties when investigated using a linoleic acid peroxidation model, FRAP, ORAC and TRAP assays, as well as DPPH, hydroxyl, nitric oxide and superoxide radical scavenging activity. The HPLC analysis of the cowpea extracts showed the presence of neochlorogenic acid, chlorogenic acid and caffeic acids. The results indicated that methanolic extract of the cowpea resembled in the aforementioned activities those from other leguminous seeds and pulses. Phenolic constituents contained in cowpea may have a future role as ingredients in the development of functional foods.

  10. Phylogenetic multilocus sequence analysis of indigenous slow-growing rhizobia nodulating cowpea (Vigna unguiculata L.) in Greece.

    Science.gov (United States)

    Tampakaki, Anastasia P; Fotiadis, Christos T; Ntatsi, Georgia; Savvas, Dimitrios

    2017-04-01

    Cowpea (Vigna unguiculata) is a promiscuous grain legume, capable of establishing efficient symbiosis with diverse symbiotic bacteria, mainly slow-growing rhizobial species belonging to the genus Bradyrhizobium. Although much research has been done on cowpea-nodulating bacteria in various countries around the world, little is known about the genetic and symbiotic diversity of indigenous cowpea rhizobia in European soils. In the present study, the genetic and symbiotic diversity of indigenous rhizobia isolated from field-grown cowpea nodules in three geographically different Greek regions were studied. Forty-five authenticated strains were subjected to a polyphasic approach. ERIC-PCR based fingerprinting analysis grouped the isolates into seven groups and representative strains of each group were further analyzed. The analysis of the rrs gene showed that the strains belong to different species of the genus Bradyrhizobium. The analysis of the 16S-23S IGS region showed that the strains from each geographic region were characterized by distinct IGS types which may represent novel phylogenetic lineages, closely related to the type species of Bradyrhizobium pachyrhizi, Bradyrhizobium ferriligni and Bradyrhizobium liaoningense. MLSA analysis of three housekeeping genes (recA, glnII, and gyrB) showed the close relatedness of our strains with B. pachyrhizi PAC48 T and B. liaoningense USDA 3622 T and confirmed that the B. liaoningense-related isolate VUEP21 may constitute a novel species within Bradyrhizobium. Moreover, symbiotic gene phylogenies, based on nodC and nifH genes, showed that the B. pachyrhizi-related isolates belonged to symbiovar vignae, whereas the B. liaoningense-related isolates may represent a novel symbiovar. Copyright © 2017 Elsevier GmbH. All rights reserved.

  11. Development of Gene-Based SSR Markers in Rice Bean (Vigna umbellata L. Based on Transcriptome Data.

    Directory of Open Access Journals (Sweden)

    Honglin Chen

    Full Text Available Rice bean (Vigna umbellata (Thunb. Ohwi & Ohashi is a warm season annual legume mainly grown in East Asia. Only scarce genomic resources are currently available for this legume crop species and no simple sequence repeat (SSR markers have been specifically developed for rice bean yet. In this study, approximately 26 million high quality cDNA sequence reads were obtained from rice bean using Illumina paired-end sequencing technology and assembled into 71,929 unigenes with an average length of 986 bp. Of these unigenes, 38,840 (33.2% showed significant similarity to proteins in the NCBI non-redundant protein and nucleotide sequence databases. Furthermore, 30,170 (76.3% could be classified into gene ontology categories, 25,451 (64.4% into Swiss-Prot categories and 21,982 (55.6% into KOG database categories (E-value < 1.0E-5. A total of 9,301 (23.5% were mapped onto 118 pathways using the Kyoto Encyclopedia of Genes and Genome (KEGG pathway database. A total of 3,011 genic SSRs were identified as potential molecular markers. AG/CT (30.3%, AAG/CTT (8.1% and AGAA/TTCT (20.0% are the three main repeat motifs. A total of 300 SSR loci were randomly selected for validation by using PCR amplification. Of these loci, 23 primer pairs were polymorphic among 32 rice bean accessions. A UPGMA dendrogram revealed three major clusters among 32 rice bean accessions. The large number of SSR-containing sequences and genic SSRs in this study will be valuable for the construction of high-resolution genetic linkage maps, association or comparative mapping and genetic analyses of various Vigna species.

  12. Radiation treatment of foodstuffs

    International Nuclear Information System (INIS)

    Luther, T.; Huebner, G.

    1990-10-01

    In addition to fundamental demands on radiation and safety engineering of irradiation facilities, the necessity arises to optimize irradiation conditions by using facilities to capacity and thus reducing irradiation costs. The following subjects are dealt with in detail: rehabilitation of a pilot plant for radiation treatment of onions; examination of radiation resistance of components and equipment parts of food irradiation facilities; chemical dosimetry; relative measurement of the intensity of radioactive sources; thermo- and chemiluminescence to prove irradiation of foodstuffs; radiation induced sprout inhibition of potatoes; laboratory tests of delayed maturation of tomatoes; radiation treatment of strawberries; radiation treatment of forage; radiation induced sprout inhibition of acid-treated onions; radiation treatment of starch and potatoe products; radiation treatment of cosmetics; the universal radiation source UNI 88/26 for gamma irradiation facilities; microbiological aspects of food irradiation, and introduction of chicken irradiation on an industrial scale. (BBR) [de

  13. Radiation-use efficiency of soybean, mungbean and cowpea under different environmental conditions

    International Nuclear Information System (INIS)

    Muchow, R.C.; Robertson, M.J.; Pengelly, B.C.

    1993-01-01

    Radiation-use efficiency (RUE), defined as the amount of biomass accumulated per unit radiation intercepted, is a key measure of the photosynthetic performance of crops growing in different environments. The RUE of soybean (Glycine max L.), mungbean (Vigna radiata) and cowpea (Vigna unguiculata) growing under well-watered field conditions in tropical and subtropical environments was determined from frequent biomass samplings and continous logging of intercepted radiation throughout growth. The slope of the relationship between net biomass accumulation and intercepted radiation was linear throughout most of growth, almost until the end of pod-filling in all species and all environments. The decrease in RUE just prior to maturity was associated with losses of biomass due to leaf shedding, and also with a decline in specific leaf nitrogen. The RUE during the linear phase was slightly higher in cowpea than in mungbean and soybean. For each species, the RUE was similar in different environments despite large differences in air temperature, water vapour saturation deficit and incident radiation. It was concluded that RUE under well-watered conditions is constant throughout most of growth and unaffected by the aerial environment. Baseline values of RUE were 0.88 g MJ -1 for soybean, 0.94 g MJ -1 for mungbean, and 1.05 g MJ -1 for cowpea. (author)

  14. Efficacy of Carbofuran in Controlling Root-Knot Nematode (Meloidogyne javanica Whitehead, 1949) on Cultivars of Bambara Groundnut (Vigna subterranea (L.) Verdc.) in Yola, Nigeria

    OpenAIRE

    Jada, M. Y.; Gungula, D. T.; Jacob, I.

    2011-01-01

    Bambara groundnut (Vigna subterrenea L. Verdc.) is an important crop produced in Adamawa State of Nigeria. However, the production of the crop is seriously threatened by root-knot nematodes (RKNs; Meloidogyne spp.). Since cultural methods have not been very effective in controlling RKN, carbofuran was evaluated to determine its efficacy in controlling M. javanica in Yola during 2002 and 2003. Three bambara groundnut cultivars (Kwachanjiwa, Kwaheuma, and Kwatolotolo) were evaluated using three...

  15. Screening and Identification of putative long non coding RNAs from transcriptome data of a high yielding blackgram (Vigna mungo, Cv. T9

    Directory of Open Access Journals (Sweden)

    Pankaj Kumar Singh

    2018-04-01

    Full Text Available Blackgram (Vigna mungo is one of primary legumes cultivated throughout India, Cv.T9 being one of its common high yielding cultivar. This article reports RNA sequencing data and a pipeline for prediction of novel long non-coding RNAs from the sequenced data. The raw data generated during sequencing are available at Sequence Read Archive (SRA of NCBI with accession number- SRX1558530 Keywords: Blackgram, Long non-coding RNA, Legumes, RNA sequencing data

  16. The effect of ATM kinase inhibition on the initial response of human dental pulp and periodontal ligament mesenchymal stem cells to ionizing radiation.

    Science.gov (United States)

    Cmielova, Jana; Havelek, Radim; Kohlerova, Renata; Soukup, Tomas; Bruckova, Lenka; Suchanek, Jakub; Vavrova, Jirina; Mokry, Jaroslav; Rezacova, Martina

    2013-07-01

    This study evaluates early changes in human mesenchymal stem cells (MSC) isolated from dental pulp and periodontal ligament after γ-irradiation and the effect of ataxia-telangiectasia mutated (ATM) inhibition. MSC were irradiated with 2 and 20 Gy by (60)Co. For ATM inhibition, specific inhibitor KU55933 was used. DNA damage was measured by Comet assay and γH2AX detection. Cell cycle distribution and proteins responding to DNA damage were analyzed 2-72 h after the irradiation. The irradiation of MSC causes an increase in γH2AX; the phosphorylation was ATM-dependent. Irradiation activates ATM kinase, and the level of p53 protein is increased due to its phosphorylation on serine15. While this phosphorylation of p53 is ATM-dependent in MSC, the increase in p53 was not prevented by ATM inhibition. A similar trend was observed for Chk1 and Chk2. The increase in p21 is greater without ATM inhibition. ATM inhibition also does not fully abrogate the accumulation of irradiated MSC in the G2-phase of the cell-cycle. In irradiated MSC, double-strand breaks are tagged quickly by γH2AX in an ATM-dependent manner. Although phosphorylations of p53(ser15), Chk1(ser345) and Chk2(thr68) are ATM-dependent, the overall amount of these proteins increases when ATM is inhibited. In both types of MSC, ATM-independent mechanisms for cell-cycle arrest in the G2-phase are triggered.

  17. Characterisation and determination of virus resistance among cowpea [Vigna unguiculata (L.) Walp.] Genotypes

    International Nuclear Information System (INIS)

    Tettey, Carlos Kweku

    2017-07-01

    Several households in Ghana feed on cowpea [Vigna unguiculata (L.) Walp.] which serves as good source of protein. However, cowpea viral diseases and the lack of adaptable cultivars have become a limiting factor in cowpea production. This work therefore sought to explore morphogenetic diversity and viral resistance traits in cowpea germplasm to improve productivity. Thirty-eight exotic and local cowpea genotypes were cultivated at the Teaching and Research Field of the School of Agriculture, the University of Cape Coast. Two plants were maintained per stand at planting distance of 50 cm x 30 cm with three replications in a randomized complete block layout during the major (June – September) and minor seasons (November – February). The cowpea genotypes were characterised using both morphological and molecular methods to assess diversity in the coastal savanna agro-ecological zone of Ghana. They were also screened for resistance to cowpea viruses using visual scale on-field and DAS-ELISA protocol. The cowpeas showed significant (P < 0.05) variations in plant height, canopy diameter, number of branches, area of leaf, days to 50% flowering, days to pod maturity, pod length, number of seeds per pod and hundred seed weight. There were significant and positive correlations between pod weight and seed yield (r = 0.985, P < 0.05), plant height and canopy diameter (r = 0.576, P < 0.05), canopy diameter and number of branches (r = 0.576) as well as pod length and the number of seeds per pod (r = 0.530, P < 0.05). Hundred seed weight ranged from 10.03 g to 22.7 g. On the whole, 23 quantitative and qualitative parameters differentiated the cowpea genotypes into two main clusters with sub-clusters. Genomic analysis involving nine polymorphic SSR primers showed a mean genetic diversity of 0.7, polymorphic information content of 0.67 and allele frequency of 0.4 among the cowpea genotypes, which were differentiated into two main clusters with sub-clusters. Incidence and severity

  18. CGKB: an annotation knowledge base for cowpea (Vigna unguiculata L. methylation filtered genomic genespace sequences

    Directory of Open Access Journals (Sweden)

    Spraggins Thomas A

    2007-04-01

    Full Text Available Abstract Background Cowpea [Vigna unguiculata (L. Walp.] is one of the most important food and forage legumes in the semi-arid tropics because of its ability to tolerate drought and grow on poor soils. It is cultivated mostly by poor farmers in developing countries, with 80% of production taking place in the dry savannah of tropical West and Central Africa. Cowpea is largely an underexploited crop with relatively little genomic information available for use in applied plant breeding. The goal of the Cowpea Genomics Initiative (CGI, funded by the Kirkhouse Trust, a UK-based charitable organization, is to leverage modern molecular genetic tools for gene discovery and cowpea improvement. One aspect of the initiative is the sequencing of the gene-rich region of the cowpea genome (termed the genespace recovered using methylation filtration technology and providing annotation and analysis of the sequence data. Description CGKB, Cowpea Genespace/Genomics Knowledge Base, is an annotation knowledge base developed under the CGI. The database is based on information derived from 298,848 cowpea genespace sequences (GSS isolated by methylation filtering of genomic DNA. The CGKB consists of three knowledge bases: GSS annotation and comparative genomics knowledge base, GSS enzyme and metabolic pathway knowledge base, and GSS simple sequence repeats (SSRs knowledge base for molecular marker discovery. A homology-based approach was applied for annotations of the GSS, mainly using BLASTX against four public FASTA formatted protein databases (NCBI GenBank Proteins, UniProtKB-Swiss-Prot, UniprotKB-PIR (Protein Information Resource, and UniProtKB-TrEMBL. Comparative genome analysis was done by BLASTX searches of the cowpea GSS against four plant proteomes from Arabidopsis thaliana, Oryza sativa, Medicago truncatula, and Populus trichocarpa. The possible exons and introns on each cowpea GSS were predicted using the HMM-based Genscan gene predication program and the

  19. Regulatory T Cells Contribute to the Inhibition of Radiation-Induced Acute Lung Inflammation via Bee Venom Phospholipase A₂ in Mice.

    Science.gov (United States)

    Shin, Dasom; Lee, Gihyun; Sohn, Sung-Hwa; Park, Soojin; Jung, Kyung-Hwa; Lee, Ji Min; Yang, Jieun; Cho, Jaeho; Bae, Hyunsu

    2016-04-30

    Bee venom has long been used to treat various inflammatory diseases, such as rheumatoid arthritis and multiple sclerosis. Previously, we reported that bee venom phospholipase A₂ (bvPLA₂) has an anti-inflammatory effect through the induction of regulatory T cells. Radiotherapy is a common anti-cancer method, but often causes adverse effects, such as inflammation. This study was conducted to evaluate the protective effects of bvPLA₂ in radiation-induced acute lung inflammation. Mice were focally irradiated with 75 Gy of X-rays in the lung and administered bvPLA₂ six times after radiation. To evaluate the level of inflammation, the number of immune cells, mRNA level of inflammatory cytokine, and histological changes in the lung were measured. BvPLA₂ treatment reduced the accumulation of immune cells, such as macrophages, neutrophils, lymphocytes, and eosinophils. In addition, bvPLA₂ treatment decreased inflammasome-, chemokine-, cytokine- and fibrosis-related genes' mRNA expression. The histological results also demonstrated the attenuating effect of bvPLA₂ on radiation-induced lung inflammation. Furthermore, regulatory T cell depletion abolished the therapeutic effects of bvPLA₂ in radiation-induced pneumonitis, implicating the anti-inflammatory effects of bvPLA₂ are dependent upon regulatory T cells. These results support the therapeutic potential of bvPLA₂ in radiation pneumonitis and fibrosis treatments.

  20. Inhibition of Genotoxic Effects of UVC Radiation on Human Keratinocyte HaCaT Cells by Echinacea Purpurea (L.) Moench Herbal Extract

    International Nuclear Information System (INIS)

    Kosalec, I.; Segvic Klaric, M.; Kopjar, N.; Milic, M.

    2013-01-01

    Exposure of skin to ultraviolet (UV) radiation might provoke acute and chronic inflammation and oxidative stress which might cause DNA damage leading to skin photoaging and photocarcinogenesis. Previously we showed that Echinacea purpurea (L.) Moench (EH) extract, rich in phenolic acids, has protective effect on human blood lymphocytes exposed to UVC radiation. In this study we checked whether the pre-treatment of human keratinocyte HaCaT cells with lyophilisate of EH (1 and 10 mg/mL) could reduce or prevent primary DNA damage induced by UVC radiation (253.7 nm) in laboratory conditions. Prior to that experiment we examined cell viability using MTT test upon exposure to EH and UVC (30 and 60 min) alone and in combination. Primary DNA damage in HaCaT cells was studied using the alkaline comet assay. Exposure of cells to EH and UVC alone or EH in combination with UV radiation did not reduce cell viability. Opposite to that UV radiation (30 and 60 min) caused a significant increase in the level of primary DNA damage (P < 0.001). Pre-treatment of cells with both concentrations of EH was not genotoxic to HaCaT cells. Only concentration of 1 mg/mL EH successfully protected the cells against the effects of 30 min exposure to UVC radiation. Positive results obtained in this study speak in favour of continuing the research on effectiveness of Echinacea purpurea preparations and their potential application in developing cosmetic products for skin protection.(author)

  1. Inhibition of Photo-Genotoxic Effects of UV Radiation on Human Peripheral Blood Lymphocites by Echinacea Purpurea (L.) Moench Herbal Extract

    International Nuclear Information System (INIS)

    Segvic Klaric, M.; Kosalec, I.; Vladimir-Knezevic, S.; Blazekovic, B.; Milic, M.; Kopjar, N.

    2011-01-01

    Ultraviolet (UV) radiation has many negative effects on human skin, including acute and chronic inflammation and oxidative stress which might cause DNA damage leading to skin photoaging and photocarcinogenesis. It was suggested that intake of phenolic acids, which are active components of some medicinal plants, might reduce DNA damage caused by UV radiation. Therefore, the purpose of this study was to check wheather the pretreatment of human peripheral blood lymphocytes with lyophilisate of Echinacea purpurea (L.) Moench (EH) extract (1 and 10 mg/mL) could reduce or prevent primary DNA damage induced by UVC radiation (253.7 nm) in laboratory conditions. Primary DNA damage was studied using the alkaline comet assay on isolated human blood lymphocytes. Plant extract used in this experiment contains phenolic acids (3.47 %), flavonoids (0.13 %), tannins (0.86 %) and proanthocyanidins (0.26 %). HPLC analysis showed that lyophilisate of EH extract contains 3.65 % of chicoric acid. Exposure of lymphocytes to UV radiation (30 and 60 min) caused a significant increase in the level of primary DNA damage (P < 0.001). Pretreatment of cells with both concentrations of EH was not genotoxic, and successfully protected the cells against the effects of UV radiation (30 min). Both concentrations of EH significantly reduced comet tail length after 60 min of UV radiation, while only pre-treatment with 1 mg/mL significantly reduced the values of tail intensity and tail moment (P < 0.001). Positive results obtained in this study speak in favour of continuing the research on effectiveness of Echinacea purpurea preparations and their potential application in developing cosmetic products for skin protection. (author)

  2. Radiation-induced sprout and growth inhibition in vegetables with special reference to the susceptibility to microbial attacks and the effect of calcium

    International Nuclear Information System (INIS)

    Skou, J.P.

    1979-03-01

    Experiments have shown ionizing irradiation to be an effective method for sprout and growth inhibition but it is necessary to keep the doses at the absolute minimum in order to avoid unwanted by-effects One of the by-effects is an increased susceptibility to storage rot in potatoes, onions and carrots. This effect is connected with the wounding and bruising caused by digging up and handling as the wound healing process is inhibited simultaneously with the sprout inhibition. Patogens increase tissue permeability during pathogenesis and, as irradiation has an analogous effect on tissues it might facilitate the growth of the pathogens. Irradiation softens the tissue and mobilizes the calcium in the tissue; this may thereby make the tissue more accessible to microbial attack. An external supply of calcium increases the firmness of tissue, reduces tissue permeability, and may compensate for the loss of calcium in irradiated tissue mainly as a result of a surplus of calcium in the wounds. Botrytis cinerea and Sclerotinia sclerotiorum were some of the most wide spread and serious pathogens in carrots, which vegetable were the main object of the studies. Culture filtrates of these fungi had a strong macerating activity on carrot tissues. The effect, which results from activity and interaction of pectolytic enzymes and oxalic acid, could be reduced or nullified by calcium. A diversity of the groups of pectolytic enzymes are widely distributed among organisms and not confined to plant pathogens. Because of this, because there exists pectolytic enzymes for every condition and pectic substances, and because calcium is not very inhibiting to all kinds of pectolytic enzymes it is not to be expected that the protective effect of calcium will always be expressed to the same extent on storage of the products. (author)

  3. Gamma radiation influence on oviposition and longevity of 'Callosobruchus maculatus' (Fabr., 1972) (Coleoptera, Bruchidae)

    International Nuclear Information System (INIS)

    Walder, J.M.M.; Wiendl, F.M.

    1973-01-01

    It was verified that 'Callosobruchus maculatus' (Fabr.), a serious pest attacking seeds of 'Vigna sinensis', is highly susceptible to gamma radiation for sterilization. A dosis of 5 krad causes the egg fertility to decrease from 90% to only 1%. Adults irradiated with 10 krad become totally infertile. Doses of 10 krad and more cause an increase of about 19% in the longevity of females, but decreases the longetivy of males by about 5%. Also, irradiation causes a decrease in the total number of eggs, inversely proportional to the dosage increase [pt

  4. Gamma radiation influence on oviposition and longevity of 'Callosobruchus maculatus' (Fabr. , 1972) (Coleoptera, Bruchidae)

    Energy Technology Data Exchange (ETDEWEB)

    Walder, J M.M. [Centro de Energia Nuclear na Agricultura, Piracicaba (Brazil); Wiendl, F M [Sao Paulo Univ., Piracicaba (Brazil). Escola Superior de Agricultura Luiz de Queiroz

    1973-03-01

    It was verified that 'Callosobruchus maculatus' (Fabr.), a serious pest attacking seeds of 'Vigna sinensis', is highly susceptible to gamma radiation for sterilization. A dosis of 5 krad causes the egg fertility to decrease from 90% to only 1%. Adults irradiated with 10 krad become totally infertile. Doses of 10 krad and more cause an increase of about 19% in the longevity of females, but decreases the longevity of males by about 5%. Also, irradiation causes a decrease in the total number of eggs, inversely proportional to the dosage increase.

  5. Construction of an SSR and RAD-Marker Based Molecular Linkage Map of Vigna vexillata (L.) A. Rich.

    Science.gov (United States)

    Marubodee, Rusama; Ogiso-Tanaka, Eri; Isemura, Takehisa; Chankaew, Sompong; Kaga, Akito; Naito, Ken; Ehara, Hiroshi; Tomooka, Norihiko

    2015-01-01

    Vigna vexillata (L.) A. Rich. (tuber cowpea) is an underutilized crop for consuming its tuber and mature seeds. Wild form of V. vexillata is a pan-tropical perennial herbaceous plant which has been used by local people as a food. Wild V. vexillata has also been considered as useful gene(s) source for V. unguiculata (cowpea), since it was reported to have various resistance gene(s) for insects and diseases of cowpea. To exploit the potential of V. vexillata, an SSR-based linkage map of V. vexillata was developed. A total of 874 SSR markers successfully amplified single DNA fragment in V. vexillata among 1,336 SSR markers developed from Vigna angularis (azuki bean), V. unguiculata and Phaseolus vulgaris (common bean). An F2 population of 300 plants derived from a cross between salt resistant (V1) and susceptible (V5) accessions was used for mapping. A genetic linkage map was constructed using 82 polymorphic SSR markers loci, which could be assigned to 11 linkage groups spanning 511.5 cM in length with a mean distance of 7.2 cM between adjacent markers. To develop higher density molecular linkage map and to confirm SSR markers position in a linkage map, RAD markers were developed and a combined SSR and RAD markers linkage map of V. vexillata was constructed. A total of 559 (84 SSR and 475 RAD) markers loci could be assigned to 11 linkage groups spanning 973.9 cM in length with a mean distance of 1.8 cM between adjacent markers. Linkage and genetic position of all SSR markers in an SSR linkage map were confirmed. When an SSR genetic linkage map of V. vexillata was compared with those of V. radiata and V. unguiculata, it was suggested that the structure of V. vexillata chromosome was considerably differentiated. This map is the first SSR and RAD marker-based V. vexillata linkage map which can be used for the mapping of useful traits.

  6. Inhibition of G1-phase arrest induced by ionizing radiation in hematopoietic cells by overexpression of genes involved in the G1/S-phase transition

    International Nuclear Information System (INIS)

    Epperly, M.; Berry, L.; Halloran, A.; Greenberger, J.S.

    1995-01-01

    D-type cyclins and cyclin-dependent kinase (cdk-4) are likely involved in regulating passage of cells through the G 1 phase of the cell cycle. A decrease in the proportion of cells in G 1 , a relatively radiation-sensitive phase of the cell cycle, should result in increased resistance to ionizing radiation; however, the effect of such overexpression on X-ray-induced G 1 -phase arrest is not known. Radiation survival curves were obtained at a dose rate of either 8 cGy/min or 1 Gy/min for subclones of the IL-3-dependent hematopoietic progenitor cell line 32D cl 3 expressing transgenes for either cyclin-D1, D2 or D3 or cdk-4. We compared the results to those with overexpression of the transgene for Bcl-2, whose expression enhances radiation survival and delays apoptosis. Cells overexpressing transgenes for each D-type cyclin or Bcl-2 had an increased number of cells in S phase compared to parent line 32D cl 3; however, overexpression of cdk-4 had no effect on cell cycle distribution. Cell death resulting from withdrawal of IL-3 was not affected by overexpression of D2, cdk-4 or Bcl-2. Flow cytometry 24 h after 5 Gy irradiation demonstrated that overexpression of each G 1 -phase regulatory transgene decreased the proportion of cells at the G 1 /S-phase border. Western analysis revealed induction of cyclin-D protein levels by irradiation, but no change in the D O , but a significant increase in the rvec n for cyclin-D or cdk-4 transgene-overexpressing clones at 1 Gy/min (P 1 /S-phase arrest. 31 refs., 4 figs., 4 tabs

  7. Inhibition of repair activity induced by γ-radiation, UV-rays and radiomimetics in the in vitro cultured cells of patients wiyh schizophrenia

    International Nuclear Information System (INIS)

    Zasukhina, G.D.; Zharikov, N.M.; L'vova, G.N.; Vasil'eva, I.M.; Chekova, V.V.; Alekhina, N.I.; Ivanova, T.N.

    1986-01-01

    A study was made of the processes of repair, virus reactivation, and formation of sister chromatid exchages (SCE) in blood cells of patients with schizophrenia after the effect of γ-radiation and 4-nitroquinoline-1-oxide. These processes were estimated by 12 criteria. The mutagen-induced disturbances in the processes of repair and SCE formation were found in cells of patients with schizophrenia and were absent in the control cells of healthy donors

  8. Description du système racinaire de trois espèces fourragères en zone soudano-sahélienne: Andropogon gayanus, Vigna unguiculata et Stylosanthes hamata

    OpenAIRE

    Groot, J.J.R.; Traoré, M.; Koné, D.

    1998-01-01

    Description of root systems of three fodder crops in the Soudano-Sahelian area: Andropogon gayanus, Vigna unguiculata and Stylosanthes hamata. Root systems of fodder crops (Andropogon gayanus, Vigna unguiculata and Stylosanthes hamata) were studied at two Research Stations in Mali in 1992, using soil monoliths. In this method, roots are studied throughout the soil profile in cubical compartments of 1 dm3. Root biomass production of A. gayanus planted in 1951 was 4 t.ha-1 against 5 t.ha-1 ...

  9. Cellular Inhibition of Checkpoint Kinase 2 (Chk2) and Potentiation of Camptothecins and Radiation by the Novel Chk2 Inhibitor PV1019 [7-Nitro-1H-indole-2-carboxylic acid {4-[1-(guanidinohydrazone)-ethyl]-phenyl}-amide

    Energy Technology Data Exchange (ETDEWEB)

    Jobson, Andrew G.; Lountos, George T.; Lorenzi, Philip L.; Llamas, Jenny; Connelly, John; Cerna, David; Tropea, Joseph E.; Onda, Akikazu; Zoppoli, Gabriele; Kondapaka, Sudhir; Zhang, Guangtao; Caplen, Natasha J.; Cardellina, II, John H.; Yoo, Stephen S.; Monks, Anne; Self, Christopher; Waugh, David S.; Shoemaker, Robert H.; Pommier, Yves; (NIH)

    2010-04-05

    Chk2 is a checkpoint kinase involved in the ataxia telangiectasia mutated pathway, which is activated by genomic instability and DNA damage, leading to either cell death (apoptosis) or cell cycle arrest. Chk2 provides an unexplored therapeutic target against cancer cells. We recently reported 4,4'-diacetyldiphenylurea-bis(guanylhydrazone) (NSC 109555) as a novel chemotype Chk2 inhibitor. We have now synthesized a derivative of NSC 109555, PV1019 (NSC 744039) [7-nitro-1H-indole-2-carboxylic acid {l_brace}4-[1-(guanidinohydrazone)-ethyl]-phenyl{r_brace}-amide], which is a selective submicromolar inhibitor of Chk2 in vitro. The cocrystal structure of PV1019 bound in the ATP binding pocket of Chk2 confirmed enzymatic/biochemical observations that PV1019 acts as a competitive inhibitor of Chk2 with respect to ATP. PV1019 was found to inhibit Chk2 in cells. It inhibits Chk2 autophosphorylation (which represents the cellular kinase activation of Chk2), Cdc25C phosphorylation, and HDMX degradation in response to DNA damage. PV1019 also protects normal mouse thymocytes against ionizing radiation-induced apoptosis, and it shows synergistic antiproliferative activity with topotecan, camptothecin, and radiation in human tumor cell lines. We also show that PV1019 and Chk2 small interfering RNAs can exert antiproliferative activity themselves in the cancer cells with high Chk2 expression in the NCI-60 screen. These data indicate that PV1019 is a potent and selective inhibitor of Chk2 with chemotherapeutic and radiosensitization potential.

  10. Microvirga vignae sp. nov., a root nodule symbiotic bacterium isolated from cowpea grown in semi-arid Brazil.

    Science.gov (United States)

    Radl, Viviane; Simões-Araújo, Jean Luiz; Leite, Jakson; Passos, Samuel Ribeiro; Martins, Lindete Míria Vieira; Xavier, Gustavo Ribeiro; Rumjanek, Norma Gouvêa; Baldani, José Ivo; Zilli, Jerri Edson

    2014-03-01

    16S rRNA gene sequence analysis of eight strains (BR 3299(T), BR 3296, BR 10192, BR 10193, BR 10194, BR 10195, BR 10196 and BR 10197) isolated from nodules of cowpea collected from a semi-arid region of Brazil showed 97 % similarity to sequences of recently described rhizobial species of the genus Microvirga. Phylogenetic analyses of four housekeeping genes (gyrB, recA, dnaK and rpoB), DNA-DNA relatedness and AFLP further indicated that these strains belong to a novel species within the genus Microvirga. Our data support the hypothesis that genes related to nitrogen fixation were obtained via horizontal gene transfer, as sequences of nifH genes were very similar to those found in members of the genera Rhizobium and Mesorhizobium, which are not immediate relatives of the genus Microvirga, as shown by 16S rRNA gene sequence analysis. Phenotypic traits, such as host range and carbon utilization, differentiate the novel strains from the most closely related species, Microvirga lotononidis, Microvirga zambiensis and Microvirga lupini. Therefore, these symbiotic nitrogen-fixing bacteria are proposed to be representatives of a novel species, for which the name Microvirga vignae sp. nov. is suggested. The type strain is BR3299(T) ( = HAMBI 3457(T)).

  11. Evaluating the freezing impact on the proximate composition of immature cowpea (Vigna unguiculata L.) pods: classical versus spectroscopic approaches.

    Science.gov (United States)

    Machado, Nelson; Oppolzer, David; Ramos, Ana; Ferreira, Luis; Rosa, Eduardo As; Rodrigues, Miguel; Domínguez-Perles, Raúl; Barros, Ana Irna

    2017-10-01

    Freezing represents a common conservation practice regarding vegetal foodstuffs. Since compositional features need to be monitored during storage, the development of rapid monitoring tools suitable for assessing nutritional characteristics arises as a pertinent issue. In this study, cowpea (Vigna unguiculata L.) pods, both fresh and after 6 and 9 months of freezing at -18 °C, were evaluated by high-performance liquid chromatography for their content of protein as well as of essential and nonessential amino acids, while their Fourier transform infrared spectra in the mid infrared (MIR) and near infrared (NIR) ranges were concomitantly registered to assess the feasibility of this approach for the traceability of these frozen matrices. For the NIR interval, the application of the 1st derivative to the spectral data retrieved the best results, while for lower concentrations the application of the Savitzky-Golay algorithm was indispensable to achieve quantification models for the amino acids. MIR is also suitable for this purpose, though being unable to quantify amino acids with concentrations below 0.07 mmol g -1 dry weight, irrespective of the data treatment used. The spectroscopic approach constitutes a methodology suitable for monitoring the impact of freezing on the nutritional properties of cowpea pods, allowing accurate quantification of the protein and amino acid contents, while NIR displayed better performance. © 2017 Society of Chemical Industry. © 2017 Society of Chemical Industry.

  12. Effects of chemical and biological pesticides on plant growth parameters and rhizospheric bacterial community structure in Vigna radiata

    Energy Technology Data Exchange (ETDEWEB)

    Singh, Sunil; Gupta, Rashi; Sharma, Shilpi, E-mail: shilpi@dbeb.iitd.ac.in

    2015-06-30

    Highlights: • Non-target effects of pesticides employing qualitative and quantitative approaches. • Qualitative shifts in resident and active bacterial community structure. • Abundance of 16S rRNA gene and transcripts were reduced significantly. • Effects of biological pesticide similar to chemical pesticides on rhizospheric bacteria. - Abstract: With increasing application of pesticides in agriculture, their non-target effects on soil microbial communities are critical to soil health maintenance. The present study aimed to evaluate the effects of chemical pesticides (chlorpyrifos and cypermethrin) and a biological pesticide (azadirachtin) on growth parameters and the rhizospheric bacterial community of Vigna radiata. Qualitative and quantitative analysis by PCR-denaturing gradient gel electrophoresis (DGGE) and q-PCR, respectively, of the 16S rRNA gene and transcript were performed to study the impact of these pesticides on the resident and active rhizospheric bacterial community. While plant parameters were not affected significantly by the pesticides, a shift in the bacterial community structure was observed with an adverse effect on the abundance of 16S rRNA gene and transcripts. Chlorpyrifos showed almost complete degradation toward the end of the experiment. These non-target impacts on soil ecosystems and the fact that the effects of the biopesticide mimic those of chemical pesticides raise serious concerns regarding their application in agriculture.

  13. A protein with amino acid sequence homology to bovine insulin is present in the legume Vigna unguiculata (cowpea

    Directory of Open Access Journals (Sweden)

    Venâncio T.M.

    2003-01-01

    Full Text Available Since the discovery of bovine insulin in plants, much effort has been devoted to the characterization of these proteins and elucidation of their functions. We report here the isolation of a protein with similar molecular mass and same amino acid sequence to bovine insulin from developing fruits of cowpea (Vigna unguiculata genotype Epace 10. Insulin was measured by ELISA using an anti-human insulin antibody and was detected both in empty pods and seed coats but not in the embryo. The highest concentrations (about 0.5 ng/µg of protein of the protein were detected in seed coats at 16 and 18 days after pollination, and the values were 1.6 to 4.0 times higher than those found for isolated pods tested on any day. N-terminal amino acid sequencing of insulin was performed on the protein purified by C4-HPLC. The significance of the presence of insulin in these plant tissues is not fully understood but we speculate that it may be involved in the transport of carbohydrate to the fruit.

  14. In silico genome-wide identification and characterization of the glutathione S-transferase gene family in Vigna radiata.

    Science.gov (United States)

    Vaish, Swati; Awasthi, Praveen; Tiwari, Siddharth; Tiwari, Shailesh Kumar; Gupta, Divya; Basantani, Mahesh Kumar

    2018-05-01

    Plant glutathione S-transferases (GSTs) are integral to normal plant metabolism and biotic and abiotic stress tolerance. The GST gene family has been characterized in diverse plant species using molecular biology and bioinformatics approaches. In the current study, in silico analysis identified 44 GSTs in Vigna radiata. Of the total 44 GSTs identified, chromosomal locations of 31 GSTs were confirmed. The pI value of GST proteins ranged from 5.10 to 9.40. The predicted molecular weights ranged from 13.12 to 50 kDa. Subcellular localization analysis revealed that all GSTs were predominantly localized in the cytoplasm. The active site amino acids were confirmed to be serine in tau, phi, theta, zeta, and TCHQD; cysteine in lambda, DHAR, and omega; and tyrosine in EF1G. The gene architecture conformed to the two-exon/one-intron and three-exon/two-intron organization in the case of tau and phi classes, respectively. MEME analysis identified 10 significantly conserved motifs with the width of 8-50 amino acids. The motifs identified were either specific to a specific GST class or were shared by multiple GST classes. The results of the current study will be of potential importance in the characterization of the GST gene family in V. radiata, an economically important leguminous crop.

  15. Effect of biologically treated petroleum sludge on seed germination and seedling growth of Vigna unguiculata (L. Walp. (Fabaceae

    Directory of Open Access Journals (Sweden)

    Jeyabalan Sangeetha

    2014-06-01

    Full Text Available The present investigation was carried out to study the response of different concentrations of treated petroleum sludge on seed germination, root and shoot length and tolerance of Vigna unguiculata (L. Walp. The biologically treated petroleum sludge with bacterial consortium showed 54.8% reduction in total petroleum hydrocarbons. Treated sludge was utilized with agricultural soil in known concentration for the assessment of growth of V. unguiculata. A remarkable absence of seed germination was observed at higher sludge concentration. The different concentrations of treated petroleum sludge showed severe decline on the length, weight and vigour index of the tested seedlings with increasing sludge concentrations. The results showed that the difference in rate of seed germination was significant among various concentrations. Under environmental stress condition, germination is the most critical phase of life cycle in crop plants. In this present study, the high oil content found to alter the osmotic relation between seed and water and thus reduce the amount of water absorbed. It was concluded that the concentration of nutrients and oil present in the treated sludge were toxic to the plant.

  16. Nontarget effects of chemical pesticides and biological pesticide on rhizospheric microbial community structure and function in Vigna radiata.

    Science.gov (United States)

    Singh, Sunil; Gupta, Rashi; Kumari, Madhu; Sharma, Shilpi

    2015-08-01

    Intensive agriculture has resulted in an indiscriminate use of pesticides, which demands in-depth analysis of their impact on indigenous rhizospheric microbial community structure and function. Hence, the objective of the present work was to study the impact of two chemical pesticides (chlorpyrifos and cypermethrin) and one biological pesticide (azadirachtin) at two dosages on the microbial community structure using cultivation-dependent approach and on rhizospheric bacterial communities involved in nitrogen cycle in Vigna radiata rhizosphere through cultivation-independent technique of real-time PCR. Cultivation-dependent study highlighted the adverse effects of both chemical pesticide and biopesticide on rhizospheric bacterial and fungal communities at different plant growth stages. Also, an adverse effect on number of genes and transcripts of nifH (nitrogen fixation); amoA (nitrification); and narG, nirK, and nirS (denitrification) was observed. The results from the present study highlighted two points, firstly that nontarget effects of pesticides are significantly detrimental to soil microflora, and despite being of biological origin, azadirachtin exerted negative impact on rhizospheric microbial community of V. radiata behaving similar to chemical pesticides. Hence, such nontarget effects of chemical pesticide and biopesticide in plants' rhizosphere, which bring out the larger picture in terms of their ecotoxicological effect, demand a proper risk assessment before application of pesticides as agricultural amendments.

  17. Effects of chemical and biological pesticides on plant growth parameters and rhizospheric bacterial community structure in Vigna radiata.

    Science.gov (United States)

    Singh, Sunil; Gupta, Rashi; Sharma, Shilpi

    2015-06-30

    With increasing application of pesticides in agriculture, their non-target effects on soil microbial communities are critical to soil health maintenance. The present study aimed to evaluate the effects of chemical pesticides (chlorpyrifos and cypermethrin) and a biological pesticide (azadirachtin) on growth parameters and the rhizospheric bacterial community of Vigna radiata. Qualitative and quantitative analysis by PCR-denaturing gradient gel electrophoresis (DGGE) and q-PCR, respectively, of the 16S rRNA gene and transcript were performed to study the impact of these pesticides on the resident and active rhizospheric bacterial community. While plant parameters were not affected significantly by the pesticides, a shift in the bacterial community structure was observed with an adverse effect on the abundance of 16S rRNA gene and transcripts. Chlorpyrifos showed almost complete degradation toward the end of the experiment. These non-target impacts on soil ecosystems and the fact that the effects of the biopesticide mimic those of chemical pesticides raise serious concerns regarding their application in agriculture. Copyright © 2015 Elsevier B.V. All rights reserved.

  18. Combined Effects of Ozone and Drought on the Physiology and Membrane Lipids of Two Cowpea (Vigna unguiculata (L.) Walp) Cultivars.

    Science.gov (United States)

    Rebouças, Deborah Moura; De Sousa, Yuri Maia; Bagard, Matthieu; Costa, Jose Helio; Jolivet, Yves; De Melo, Dirce Fernandes; Repellin, Anne

    2017-03-03

    The interactive effects of drought and ozone on the physiology and leaf membrane lipid content, composition and metabolism of cowpea (Vigna unguiculata (L.) Walp.) were investigated in two cultivars (EPACE-1 and IT83-D) grown under controlled conditions. The drought treatment (three-week water deprivation) did not cause leaf injury but restricted growth through stomatal closure. In contrast, the short-term ozone treatment (130 ppb 12 h daily during 14 day) had a limited impact at the whole-plant level but caused leaf injury, hydrogen peroxide accumulation and galactolipid degradation. These effects were stronger in the IT83-D cultivar, which also showed specific ozone responses such as a higher digalactosyl-diacylglycerol (DGDG):monogalactosyldiacylglycerol (MGDG) ratio and the coordinated up-regulation of DGDG synthase (VuDGD2) and ω-3 fatty acid desaturase 8 (VuFAD8) genes, suggesting that membrane remodeling occurred under ozone stress in the sensitive cultivar. When stresses were combined, ozone did not modify the stomatal response to drought and the observed effects on whole-plant physiology were essentially the same as when drought was applied alone. Conversely, the drought-induced stomatal closure appeared to alleviate ozone effects through the reduction of ozone uptake.

  19. Using artificial neural networks to select upright cowpea (Vigna unguiculata) genotypes with high productivity and phenotypic stability.

    Science.gov (United States)

    Barroso, L M A; Teodoro, P E; Nascimento, M; Torres, F E; Nascimento, A C C; Azevedo, C F; Teixeira, F R F

    2016-11-03

    Cowpea (Vigna unguiculata) is grown in three Brazilian regions: the Midwest, North, and Northeast, and is consumed by people on low incomes. It is important to investigate the genotype x environment (GE) interaction to provide accurate recommendations for farmers. The aim of this study was to identify cowpea genotypes with high adaptability and phenotypic stability for growing in the Brazilian Cerrado, and to compare the use of artificial neural networks with the Eberhart and Russell (1966) method. Six trials with upright cowpea genotypes were conducted in 2005 and 2006 in the States of Mato Grosso do Sul and Mato Grosso. The data were subjected to adaptability and stability analysis by the Eberhart and Russell (1966) method and artificial neural networks. The genotypes MNC99-537F-4 and EVX91-2E-2 provided grain yields above the overall environment means, and exhibited high stability according to both methods. Genotype IT93K-93-10 was the most suitable for unfavorable environments. There was a high correlation between the results of both methods in terms of classifying the genotypes by their adaptability and stability. Therefore, this new approach would be effective in quantifying the GE interaction in upright cowpea breeding programs.

  20. NaCl Effects on In Vitro Germination and Growth of Some Senegalese Cowpea (Vigna unguiculata (L.) Walp.) Cultivars

    Science.gov (United States)

    Thiam, Mahamadou; Ourèye SY, Mame

    2013-01-01

    Cowpea (Vigna unguiculata (L.) Walp.) is one of the most important grain legumes in sub-Saharian regions. It contributes to man food security by providing a protein-rich diet. However, its production is limited by abiotic stresses such as salinity. This study aims to evaluate the salt tolerance of 15 cowpea cultivars, at germination stage. The seed germination process consisted of sowing them in agarified water (8 g·L−1) supplemented with 6 different concentrations of NaCl (0, 10, 50, 100, 150, and 200 mM). Results highlighted that high salt concentrations drastically reduced germination and significantly delayed the process for all varieties. A cowpea varietal effect towards the salt tolerance was noticed. Genotypes Diongoma, 58-78, and 58-191 were more salt-tolerant cultivars while Mougne and Yacine were more salt-sensitive ones as confirmed in the three groups of the dendrogram. NaCl effects on the early vegetative growth of seedlings were assessed with a tolerant (58-191) and a susceptible (Yacine) cultivar. Morphological (length and dry biomass) and physiological (chlorophyll and proline contents) parameter measurements revealed a negative effect of high (NaCl). However, 58-191 was much more salt tolerant, and the chlorophyll and proline contents were higher than those of Yacine genotype at increasing salt concentrations. PMID:25937976

  1. New observations on gametogenic development and reproductive experimental tools to support seed yield improvement in cowpea [Vigna unguiculata (L.) Walp].

    Science.gov (United States)

    Salinas-Gamboa, Rigel; Johnson, Susan D; Sánchez-León, Nidia; Koltunow, Anna M G; Vielle-Calzada, Jean-Philippe

    2016-06-01

    Cowpea reproductive tools. Vigna unguiculata L. Walp. (cowpea) is recognized as a major legume food crop in Africa, but seed yields remain low in most varieties adapted to local conditions. The development of hybrid cowpea seed that could be saved after each generation, enabling significant yield increases, will require manipulation of reproductive development from a sexual to an asexual mode. To develop new technologies that could support the biotechnological manipulation of reproductive development in cowpea, we examined gametogenesis and seed formation in two transformable, African-adapted, day-length-insensitive varieties. Here, we show that these two varieties exhibit distinct morphological and phenological traits but share a common developmental sequence in terms of ovule formation and gametogenesis. We present a reproductive calendar that allows prediction of male and female gametogenesis on the basis of sporophytic parameters related to floral bud size and reproductive organ development, determining that gametogenesis occurs more rapidly in the anther than in the ovule. We also show that the mode of megagametogenesis is of the Polygonum-type and not Oenothera-type, as previously reported. Finally, we developed a whole-mount immunolocalization protocol and applied it to detect meiotic proteins in the cowpea megaspore mother cell, opening opportunities for comparing the dynamics of protein localization during male and female meiosis, as well as other reproductive events in this emerging legume model system.

  2. Spectrum and frequency of chlorophyll mutations in urdbean (Vigna mungo L. Hepper) induced by EMS and gamma rays

    International Nuclear Information System (INIS)

    Sharma, A.K.; Singh, V.P.; Sarma, M.K.

    2006-01-01

    In mutation breeding experiment, plants with altered characteristics such as chlorophyll changes, sterility, plant lethality etc. could be the marker of the mutability of a variety. In fact, spectrum and frequency of chlorophyll mutations have been studied in the great detail. The chlorophyll mutation is the clear-cut indication of non-directional nature of mutation and possibility of induction of useful mutations. The spectrum and frequency of chlorophyll mutation was estimated by using gamma rays (100, 200, 300 and 400 Gy doses), EMS (0.2, 0.4, 0.6 and 0.8%) and combination of gamma rays (100, 200, 300 400 Gy) with 0.2 % concentration EMS on two cultivars, namely, Pant Urd-19 and Pant Urd-30 of urdbean ( Vigna mungo L. Hepper). Five different types of chlorophyll mutations viz., albina, xantha, viridis, chlorina and maculata were identified in both the cultivars. Almost all the combination treatments produced maximum frequency and wider spectrum of chlorophyll mutations followed by single treatment of gamma rays or EMS. The frequency of chlorophyll mutation increased with higher doses of mutagens but decreased at highest dose. Proc. Nat. Acad. Sci. India. 76(8), I, 2006. 64-68. (author)

  3. RESIDU PESTISIDA PADA SAYURAN KUBIS (Brassica oleracea L. DAN KACANG PANJANG ( Vigna sinensis L. YANG DIPASARKAN DI PASAR BADUNG DENPASAR

    Directory of Open Access Journals (Sweden)

    K Agung Sudewa

    2012-11-01

    Full Text Available Pesticides residue of organophosphate and carbamate i.e. diazinon, chlorpyriphos, fentoate, carbaril and BPMC were tested on cabbage (Brassica oleracea L. and long bean (Vigna sinensis L.. The purpose of this study was to know the level of pesticides residue remaining on cabbage and long bean marketed in Badung Market, Denpasar.The samples were determined proportionally based on purposive sampling method. The proportion of sample was 10% of the total cabbage and snake bean sold in Badung market.Result of present study showed that residue of insecticides such as diazinon, chlorpyriphos, fentoate, carbaril, and BPMC remaining on the head of cabbage and snake bean marketed in Badung market was affected by the frequencies of their use in the field, in which chlorpyriphos was used by 60-65% of the farmers and carbaril by 40% of the farmers. Their residues on cabbage anf snake bean were 0.525 ppm and 1.296 ppm for chlorpyriphos (organophosphate; 0.303 ppm and 0.471 ppm for carbaril (carbamate. These result suggested that residue of chlorpyriphos on cabbage and snake bean were higher than MRL (Maximum Residue Limit for vegetable crops, i.e. 0.5 ppm.

  4. Tolerance and toxicity levels of boron in mung bean (vigna radiata (l.) wilczek) cultivars at early growth stages

    International Nuclear Information System (INIS)

    Hasnain, A.; Mahmood, S.; Akhtar, S.; Malik, S.A.; Bashir, N.

    2011-01-01

    Boron (B) toxicity has been recognized as a serious problem in arid and semi arid regions of the world. This study was aimed to determine critical levels of B by studying phenotypic variation for B-tolerance/ toxicity at the germination and seedling stage in three mung bean (Vigna radiata) cultivars; M-6, M-8 and 96009. Boron levels ranging from 0-20 ppm were applied using Boric acid. Germination, growth and photosynthetic attributes were significantly (p<0.001) influenced by varying B levels. However, the cultivars were significantly invariable for germination, seedling height and leaf number. B levels (5-10 ppm) appeared to be nutritionally critical whereas, 15-20 ppm induced B toxicity. The toxicity was expressed in terms of reduction in plant's growth as well as by visible symptoms which included chlorosis and necrosis of the foliage. The present study also demonstrated variation in B tolerance at the seedling stage in these cultivars. Among the tested cultivars, M-6 and M-8 exhibited better growth responses as compared with 96009. Fresh biomass and shoot: root ratio appeared to serve as selection criteria for B tolerance. The study further suggested screening of cultivars/ accessions on a large scale to explore more diversity of traits as well as the use of biochemical markers for mechanistic understanding of B tolerance. (author)

  5. Effects of chemical and biological pesticides on plant growth parameters and rhizospheric bacterial community structure in Vigna radiata

    International Nuclear Information System (INIS)

    Singh, Sunil; Gupta, Rashi; Sharma, Shilpi

    2015-01-01

    Highlights: • Non-target effects of pesticides employing qualitative and quantitative approaches. • Qualitative shifts in resident and active bacterial community structure. • Abundance of 16S rRNA gene and transcripts were reduced significantly. • Effects of biological pesticide similar to chemical pesticides on rhizospheric bacteria. - Abstract: With increasing application of pesticides in agriculture, their non-target effects on soil microbial communities are critical to soil health maintenance. The present study aimed to evaluate the effects of chemical pesticides (chlorpyrifos and cypermethrin) and a biological pesticide (azadirachtin) on growth parameters and the rhizospheric bacterial community of Vigna radiata. Qualitative and quantitative analysis by PCR-denaturing gradient gel electrophoresis (DGGE) and q-PCR, respectively, of the 16S rRNA gene and transcript were performed to study the impact of these pesticides on the resident and active rhizospheric bacterial community. While plant parameters were not affected significantly by the pesticides, a shift in the bacterial community structure was observed with an adverse effect on the abundance of 16S rRNA gene and transcripts. Chlorpyrifos showed almost complete degradation toward the end of the experiment. These non-target impacts on soil ecosystems and the fact that the effects of the biopesticide mimic those of chemical pesticides raise serious concerns regarding their application in agriculture

  6. Detection and validation of single feature polymorphisms in cowpea (Vigna unguiculata L. Walp using a soybean genome array

    Directory of Open Access Journals (Sweden)

    Wanamaker Steve

    2008-02-01

    Full Text Available Abstract Background Cowpea (Vigna unguiculata L. Walp is an important food and fodder legume of the semiarid tropics and subtropics worldwide, especially in sub-Saharan Africa. High density genetic linkage maps are needed for marker assisted breeding but are not available for cowpea. A single feature polymorphism (SFP is a microarray-based marker which can be used for high throughput genotyping and high density mapping. Results Here we report detection and validation of SFPs in cowpea using a readily available soybean (Glycine max genome array. Robustified projection pursuit (RPP was used for statistical analysis using RNA as a surrogate for DNA. Using a 15% outlying score cut-off, 1058 potential SFPs were enumerated between two parents of a recombinant inbred line (RIL population segregating for several important traits including drought tolerance, Fusarium and brown blotch resistance, grain size and photoperiod sensitivity. Sequencing of 25 putative polymorphism-containing amplicons yielded a SFP probe set validation rate of 68%. Conclusion We conclude that the Affymetrix soybean genome array is a satisfactory platform for identification of some 1000's of SFPs for cowpea. This study provides an example of extension of genomic resources from a well supported species to an orphan crop. Presumably, other legume systems are similarly tractable to SFP marker development using existing legume array resources.

  7. Yield and Yield Components of Vetch (Vigna radiata as Affected by the Use of Vermicompost and Phosphate Bio-fertilizer

    Directory of Open Access Journals (Sweden)

    Mohammad Mehdi Rahimi

    2016-06-01

    Full Text Available To evaluate the effects different levels of phosphate biofertilizer barvar-2 and vermi compost on yield and yield components of vetch plant (Vigna radiata L.in Yasouj a factorial experiments was performed in completely randomized design in crop year of 2013. Experimental treatments were phosphate biofertilizer barvar-2 at 3 levels (0, 50, 100 gram per hectare and vermicompost at 4 levels (0, 10, 20, 30 ton per hectare. In this study stem height, root length, biological yield, seed yield and harvest index was measured. ANOVA and comparison of means showed that vermicompost significantly increased stem height, economic and biological yields. Results, also, indicated that highest yield and biomass, 4.3 and 18.8 g/plant, observed respectively when 100 g/ha of barvar-2 and 30 t/ha of vermi compost were used. Using both of phosphate biofertilizer barvar-2 and vermicompost was better than their individnal usage. This indicates that combined use of these 2 factors would produce higher yield. It can be concluded that application of 100 g/ha of barvar-2 and 30 t/ha of vermicompost would a proper recommendation.

  8. Economic evaluation (quantitative for Mung bean (Vigna radiata production in the Kamin Region, Sadat Shahr, Fars province

    Directory of Open Access Journals (Sweden)

    Mahmood Reza Sadikhani

    2016-11-01

    Full Text Available Although one of the biggest disadvantages of an economic evaluation, is volatility of price and instability of economic conditions, But for land use planning, economic considerations play a key role in land use and making decision. Cost is an important factor that encourage farmers to grow special crop. Thus, in addition to the qualitative and quantitative evaluation, Land Suitability can be based on net or gross profit per unit area of land to be assessed in economic terms. The economic evaluation is based on net income or gross income from the land. The purpose of this study was to assess the economic evaluation for part of Saadat Shahr (Kamin region for Mung bean (Vigna radiata. 8 drilled profiles in order to see the profiles were chosen and after collecting data on real output, the variable cost of producing the product and the critical values and estimated gross profit are calculated and land suitability classes were determined. The results showed that one unit has a moderate suitability (S2 and two units have suitable classes (S1 from separate units.

  9. Determination of the irradiation dose for the inhibition (D-10 radiation doses) of some gram negative and gram positive bacteria in peptone saline water

    International Nuclear Information System (INIS)

    Ayhan, H.; Tutluer, H.

    1994-01-01

    Determination of the irradiation dose for the inhibition of some pathogenic bacteria which cause food poisoning and spoilage were aimed. For this purpose, Salmonella typhi, Salmonella typhimurium,Salmonella enteridits,Klebsiella pneumonia, Pseudomonas fluorescence,Proteus vulgaris, Aeromonas hydrophila ,(gram-negative bacteria) and Bacillus cereus, Staphylococcus aureus strain 24,Staphylococcus aureus ATCC 6538 P,Staphylococcus epidermidis strain 115 and Clostridium perfringens A4TTK,(gram-positive bacteria) were used.Sensitivity of above mentioned bacteria to gamma rays (source Cs-137) was examined in saline with 0.1% peptone at different temperatures.Survivor plots (log.10 number of survivors versus dose) were determined by regression analysis of the data.Decimal reduction doses (D values in kGy) were calculated as the slope obtained from the regression analysis

  10. Biochemical mechanisms of skin radiation burns inhibition and healing by the volumetric autotransplantation of fibroblasts and of keratinocytes with fibroblasts composition

    Directory of Open Access Journals (Sweden)

    L. V. Altukhova

    2015-09-01

    Full Text Available Mechanisms of influence of volumetric autotransplantation of fibroblasts and of the mixture of fibroblasts and keratinocytes on the development of the local 3rd degree X-ray burn and the radiation skin ulcer in guinea pigs were investigated. We used deepadministration into the irradiation zone on its perimeter of 6 doses, which contained (150–160×103 fibroblasts and (130–140×103 keratinocytes in 100 µl. It is shown that this autotransplantation carried out 1 hour after the irradiation, and then every 24 hours, reduces the area of burn on the 35th day, compared to the control by 63%. Radiation ulcer appears on the 10th day after irradiation and is completely healed on the 25th day. With the same regimen of administration of only fibroblasts containing (200–210×103 cells in 100 µl, these parameters of treatment were equal to 31% on 4th and 35th day, respectively. It is shown that as a result of radiation in the area of burn the level of gene expression of collagen types I and III, elastin, fibronectin, vinculin, decorin, hyaluronansynthases 1, 2, 3, matrix metalloproteinases 1, 2, 3, 7, 9 and hyaluronidase is reduced. Besides, in the burn area the level of gene expression of transforming growth factor α, fibroblast growth factors 1, 2, 8 and anti-inflammatory cytokines – interleukin 10 and transforming growth factor-β1 – is reduced, while the level of gene expression of proinflammatory cytokine (interleykin1β increases. Both types of autotransplantation cause the growth of the expression level of all the structural genes and regulatory proteins of biopolymers and decrease in the expression level of interleukin 1β, which leads to activation of tissue regeneration and healing of the burn wound. Reasonsfor the higher efficiency of autotransplantation using the mixture of fibroblasts and keratinocytes compared to autotransplantation by fibroblasts only are both the larger total number of live cells regularly replacing dead cells in

  11. Pharmacological inhibition of radiation induced in vitro tumor cell/endothelium cell interactions and in vivo metastasis processes; Pharmakologische Hemmung strahleninduzierter Tumorzell-Endothelzell-Interaktionen in vitro und Metastasierungsprozesse in vivo

    Energy Technology Data Exchange (ETDEWEB)

    Herzog, Melanie

    2013-05-07

    Exposure of endothelial cells with ionizing radiation (IR) or treatment with inflammatory cytokines (e. g. TNFα) induces a Rho-GTPase and NF-κB dependent activation of the expression of various cell adhesion molecules, including E-selectin. E-selectin mediates the adhesion of tumor cells (TC) to endothelial cells and is probably involved in the extravasation step of circulating tumor cells. HMG-CoA reductase inhibitors (e. g. lovastatin) inhibit the function of Rho-GTPases and thus are anticipated to attenuate Rho-regulated cell-cell-adhesion as well. This study focuses on the influence of IR and TNFα on the expression of endothelial- and/or tumor cell-specific pro-adhesive factors and whether these effects are influenced by lovastatin. To this end, the effect of IR and TNFα on cell-cell-interactions between human colon carcinoma cells (HT29) and human umbilical vein endothelial cells (HUVEC) was investigated using an ELISA-based cell adhesion-assay. Moreover, the influence of pre-treatment with lovastatin and other types of inhibitors on HUVEC-HT29 adhesion was monitored. Additionally, we investigated the effect of lovastatin on mRNA expression level of different cell adhesion molecules, metastatic factors and DNA-repair genes upon radiation exposure by qRT-PCR. To scrutinize the in vivo relevance of the data obtained, we investigated the effect of total body irradiation (TBI) on the mRNA expression of pro-adhesive factors in BALB/c mice. To analyze tumor cell extravasation, tumor cells were injected into the lateral tail vein of immundeficient mice, followed by total body irradiation (TBI, 4 Gy). After four weeks a large increase of lung metastases was monitored, which could be blocked by preatreatment of the mice with lovastatin, the Rac1-specific small-molecule inhibitor NSC23766 as well as the sLe{sup x}-mimetic glycyrrhizin. Summarizing, we provide evidence, that irradiation promotes upregulation of different cell adhesion molecules in vitro and

  12. Comportamento hídrico e crescimento do feijão vigna cultivado em solos salinizados Hydric behaviour and growth of cowpea cultivated in salinized soils

    Directory of Open Access Journals (Sweden)

    José B. M. Coelho

    2013-04-01

    Full Text Available A salinização dos solos reduz a capacidade das plantas de absorver água o que, em geral, provoca diminuição na sua taxa de crescimento. As respostas das plantas ao estresse salino são melhor correlacionadas com o potencial osmótico do que com a condutividade elétrica do extrato de saturação do solo. Com o objetivo de avaliar os efeitos do estresse salino no crescimento, evapotranspiração e potencial osmótico foliar do feijoeiro vigna [Vigna unguiculata L. (Walp.] conduziu-se um experimento em casa de vegetação da Universidade Federal Rural de Pernambuco (Recife, PE, Brasil. Os tratamentos constaram de um arranjo fatorial 2 x 4 composto de duas texturas de solo e quatro níveis de salinidade do solo (4, 8 e 12 dS m-1 a 25 ºC além da testemunha sem a adição de sais com cinco repetições. Concluiu-se que a salinidade do solo causa redução no consumo de água, no potencial osmótico foliar, na altura das plantas, no número de folhas e na biomassa seca da parte aérea do feijoeiro vigna.Soil salinization reduces the capacity of plants to absorb water, and in general causes decrease in plant growth. Plant responses to salt stress are better correlated with osmotic potential compared to electrical conductivity of soil saturation extract. In order to evaluate the effect of salt stress on growth, water use and leaf osmotic potential of cowpea [Vigna unguiculata L. (Walp.], an experiment was carried out in a greenhouse of the Federal Rural University of Pernambuco (Recife-PE, Brazil. The Treatments were in a factorial arrangement of 2 x 4, comprising of two soil textures and four levels of soil salinity (4, 8 and 12 dS m-1 at 25 °C, and the control without salt addition with five replications. It was concluded that soil salinity causes reduction in water consumption, leaf osmotic potential, plant height, number of leaves and dry biomass of shoot of cowpea.

  13. Corrosion inhibition

    Energy Technology Data Exchange (ETDEWEB)

    Fisher, A O

    1965-12-29

    An acid corrosion-inhibiting composition consists essentially of a sugar, and an alkali metal salt selected from the group consisting of iodides and bromides. The weight ratio of the sugar to the alkali metal salt is between 2:1 and about 20,000:1. Also, a corrosion- inhibited phosphoric acid composition comprising at least about 20 wt% of phosphoric acid and between about 0.1 wt% and about 10 wt% of molasses, and between about 0.0005 wt% and about 1 wt% of potassium iodide. The weight ratio of molasses to iodide is greater than about 2:1. (11 claims)

  14. Nodulação e produtividade de Vigna unguiculata (L. Walp. por cepas de rizóbio em Bom Jesus, PI Yield and nodulation of Vigna unguiculata (L. Walp. inoculated with rhizobia strains in Bom Jesus, PI

    Directory of Open Access Journals (Sweden)

    Elaine Martins Costa

    2011-03-01

    Full Text Available Objetivou-se avaliar a resposta de Vigna unguiculata (L. Walp. cv. "BR 17 Gurguéia" à inoculação com duas cepas isoladas de solos de mineração de bauxita em reabilitação: UFLA 3-164 e UFLA 3-155 e três cepas INPA 03 11B (BR 3301; UFLA 03 84 (BR 3302 e BR 3267 (SEMIA 6462, autorizadas pelo MAPA como inoculantes para a cultura do feijão-caupi. O experimento foi conduzido em campo na Universidade Federal do Piauí, Campus Professora Cinobelina Elvas, Bom Jesus, PI. Utilizou-se o delineamento experimental em blocos casualizados com sete tratamentos e com seis repetições, sendo cinco cepas citadas e dois controles não inoculados, um com N-mineral (70 kg ha-1 de N e outra sem N mineral. Foram avaliados a nodulação (número e massa seca de nódulos, o crescimento (massa seca da parte aérea, o rendimento de grãos e o teor e acúmulo de nitrogênio na parte aérea e nos grãos, além da eficiência relativa. A inoculação das sementes com as cepas de bactérias diazotróficas simbióticas resultou em rendimentos de grãos equivalente à testemunha adubada com nitrogênio mineral. A cepa em fase de teste, UFLA 3-155 apresentou rendimento de grãos igual à cepa recomendada INPA 03 11B (BR 3301, podendo também ser testada em outras regiões brasileiras. Entre as cepas aprovadas pelo MAPA a INPA 03 11B (BR 3301 apresentou a maior produção de grãos.It evaluates the effect of inoculation with two rhizobia strains isolated from soils under rehabilitation after bauxite mining: UFLA 3-164 and UFLA 3-155, compared to inoculation with strains INPA 03 11B (BR 3301; UFLA 03 84 (BR 3302 and BR 3267 (SEMIA 6462, officially authorized as inoculant to cowpea by MAPA, in Vigna unguiculata (L. Walp cv. "BR 17 Gurgueia". The experiment was carried out at the 'Universidade Federal do Piauí, Campus Professora Cinobelina Elvas, Bom Jesus, PI,' in a randomized block design, white seven treatments and six replications. Treatments were the five strains and

  15. SU-F-T-675: Down-Regulating the Expression of Cdc42 and Inhibition of Migration of A549 with Combined Treatment of Ionizing Radiation and Sevoflurane

    International Nuclear Information System (INIS)

    Feng, Y; Feng, J; Huang, Z

    2016-01-01

    Purpose: Cdc42 is involved in cell transformation, proliferation, invasion and metastasis of human cancer cells. Cdc42 overexpression has been reported in several types of cancers. This study investigated the combined treatment effects of ionizing radiation and sevoflurane on down-regulating Cdc42 expression and suppressing migration of human adenocarcinoma cell line A549. Methods: Samples of A549 cells with Cdc42 overexpression were created and Cdc42 expression was determined by Western blotting. Increase of migration speed by Cdc42-HA overexpression was confirmed with an initial in-vitro scratch assay. The cells grown in culture media were separated into 2 groups of 6 samples: one for the control and the other was treated with 4% sevoflurane for 5hrs prior to a single-fraction radiation of 4Gy using a 6MV beam. Cell migration speeds of the 2 groups were measured with an initial in-vitro scratch assay. The scratch was created with a pipette tip immediately after treatment and images at 4 post-treatment time points (0h, 3h, 6h, 12h) were acquired. The distance between the two separated sides at 0h was used as reference and subsequent changes of the distance over time was defined as the cell migration speed. Image processing and measurement were performed with an in-house software. The experiment was repeated three times independently to evaluate the repeatability and reliability. Statistical analysis was performed with SPSS 19.0. Results: Western blotting showed the treatment down-regulated Cdc42 overexpression. Quantitative analysis and two-tailed t-test showed that cell migration speed of the treated group was higher than the control group at all time points after treatment (p < 0.02). Conclusion: Combined treatment of 6MV photon and sevoflurane can cause the effects of down-regulating Cdc42 overexpression and decrease of migration speed of A549 cells which provides potential of clinical benefit for the cancer therapy. More investigation is needed to further

  16. SU-F-T-675: Down-Regulating the Expression of Cdc42 and Inhibition of Migration of A549 with Combined Treatment of Ionizing Radiation and Sevoflurane

    Energy Technology Data Exchange (ETDEWEB)

    Feng, Y [East Carolina University, Greenville, NC (United States); Feng, J [Tianjin University, Tianjin (China); Huang, Z [East Carolina University, Greenville, NC (United States)

    2016-06-15

    Purpose: Cdc42 is involved in cell transformation, proliferation, invasion and metastasis of human cancer cells. Cdc42 overexpression has been reported in several types of cancers. This study investigated the combined treatment effects of ionizing radiation and sevoflurane on down-regulating Cdc42 expression and suppressing migration of human adenocarcinoma cell line A549. Methods: Samples of A549 cells with Cdc42 overexpression were created and Cdc42 expression was determined by Western blotting. Increase of migration speed by Cdc42-HA overexpression was confirmed with an initial in-vitro scratch assay. The cells grown in culture media were separated into 2 groups of 6 samples: one for the control and the other was treated with 4% sevoflurane for 5hrs prior to a single-fraction radiation of 4Gy using a 6MV beam. Cell migration speeds of the 2 groups were measured with an initial in-vitro scratch assay. The scratch was created with a pipette tip immediately after treatment and images at 4 post-treatment time points (0h, 3h, 6h, 12h) were acquired. The distance between the two separated sides at 0h was used as reference and subsequent changes of the distance over time was defined as the cell migration speed. Image processing and measurement were performed with an in-house software. The experiment was repeated three times independently to evaluate the repeatability and reliability. Statistical analysis was performed with SPSS 19.0. Results: Western blotting showed the treatment down-regulated Cdc42 overexpression. Quantitative analysis and two-tailed t-test showed that cell migration speed of the treated group was higher than the control group at all time points after treatment (p < 0.02). Conclusion: Combined treatment of 6MV photon and sevoflurane can cause the effects of down-regulating Cdc42 overexpression and decrease of migration speed of A549 cells which provides potential of clinical benefit for the cancer therapy. More investigation is needed to further

  17. The distinguishing effects of low-intensity electromagnetic radiation of different extremely high frequencies on Enterococcus hirae: growth rate inhibition and scanning electron microscopy analysis.

    Science.gov (United States)

    Hovnanyan, K; Kalantaryan, V; Trchounian, A

    2017-09-01

    A low-intensity electromagnetic field of extremely high frequency has inhibitory and stimulatory effects on bacteria, including Enterococcus hirae. It was shown that the low-intensity (the incident power density of 0·06 mW cm -2 ) electromagnetic field at the frequencies of 51·8 GHz and 53 GHz inhibited E. hirae ATCC 9790 bacterial growth rate; a stronger effect was observed with 53 GHz, regardless of exposure duration (0·5 h, 1 h or 2 h). Scanning electron microscopy analysis of these effects has been done; the cells were of spherical shape. Electromagnetic field at 53 GHz, but not 51·8 GHz, changed the cell size-the diameter was enlarged 1·3 fold at 53 GHz. These results suggest the difference in mechanisms of action on bacteria for electromagnetic fields at 51·8 GHz and 53 GHz. A stronger inhibitory effect of low-intensity electromagnetic field on Enterococcus hirae ATCC 9790 bacterial growth rate was observed with 53 GHz vs 51·8 GHz, regardless of exposure duration. Scanning electron microscopy analysis showed that almost all irradiated cells in the population have spherical shapes similar to nonirradiated ones, but they have increased diameters in case of irradiated cells at 53 GHz, but not 51·8 GHz. The results are novel, showing distinguishing effects of low-intensity electromagnetic field of different frequencies. They could be applied in treatment of food and different products in medicine and veterinary, where E. hirae plays an important role. © 2017 The Society for Applied Microbiology.

  18. Phosphorus Use Efficiency for Symbiotic Fixation Nitrogen in Voandzou (Vigna Subterranea) Using Isotopic Exchange Method in Rhizotron

    Energy Technology Data Exchange (ETDEWEB)

    Andriamananjara, A.; Rabeharisoa, L. [Laboratoire des Radio-isotopes, Universite d' Antananarivo, Antananarivo (Madagascar); Masse, D. [Institut de Recherche pour le Developpement, UMR Eco and Sols, Montpellier, (France); Amenc, L.; Pernot, C.; Drevon, J. J. [Institut National de la Recherche Agronomique, UMR Eco and Sols, Montpellier, (France); Morel, C. [INRA-ENITA, Villenave d' Ornon (France)

    2013-11-15

    Low bioavailability of nitrogen and phosphorus is one of the main constraints in the acid soils with high P-fixing capacity. Plants adapt to low nutrient availability through various biological and physico-chemical mechanisms. Since genetic variation of N{sub 2} fixation exists in numerous legume species, optimization of symbiotic nitrogen fixation (SNF) under P deficiency could be a way to the replenishment of soil fertility in tropical soils. As the genetic potential of crops like Vigna subterranea (Bambara groundnut or voandzou) is little studied, although its agronomic potential is interesting for the farmers of Africa, a physiological study through legume screening for N{sub 2} fixation was performed with 54 cultivars from Madagascar, Niger and Mali, inoculated with the reference strain of Bradyrhizobium sp. Vigna CB756 in hydroponic culture under P deficiency and sufficiency (30 and 75 {mu}mol KH{sub 2}PO{sub 4} plant{sup -1} week {sup -1}, respectively), corresponding respectively to 28 and 70 mg P kg{sup -1} of soil. Large variability of nodulation and plant biomass was found among cultivars. These two parameters were generally correlated and the slope of the plant biomass regression as a function of nodulation was considered as an indicator of the efficiency in use of the rhizobial symbiosis. For the two cultivars most tolerant to P deficiency, V1 and V4 from Madagascar, the increase in use efficiency of the rhizobial symbiosis under P deficiency was linked with an increase in nodulated root O{sub 2} consumption linked to N{sub 2} fixation, and in phytase gene expression observed on the nodule sections by in situ RT- PCR. As the complexity of P compartments makes it difficult to assess the P bioavailability in the plant rhizosphere, an isotopic {sup 32}P exchange method was carried out in a rhizotron in order to assess the direct effect of the roots on P mobilization in rhizosphere soil, comparing V1 and V4 with 28 or 70 mg P kg{sup -1} of soil. Throughout

  19. Phytotoxicity attenuation in Vigna radiata under heavy metal stress at the presence of biochar and N fixing bacteria.

    Science.gov (United States)

    Seneviratne, Mihiri; Weerasundara, Lakshika; Ok, Yong Sik; Rinklebe, Jörg; Vithanage, Meththika

    2017-01-15

    This study assesses the effect of N-fixing bacteria and biochar synergism on plant growth and development of Vigna mungo under heavy metal stress (HM). Heavy metal stress is a worldwide problem, which causes critical effects on plant life due to oxidative stress. Application of biochar is a recent biological remediation technique, which often leads to an immobilization of heavy metals in soil. . Synergism of bacteria and biochar is a novel aspect to enhance plant growth under heavy metal stress. Woody biochar a byproduct of a dendro power industry was added as 1, 2.5 and 5% amounts combination with Bradyrhizobium japonicum, where mung seedlings were planted in serpentine soil rich in Ni, Mn, Cr and Co. Pot experiments were conducted for 12 weeks. The plant height, heavy metal uptake by plants, soil bioavailable heavy metal contents, soil N and P and microbial biomass carbon (MBC) were measured. The plant growth was enhanced with biochar amendment but a retardation was observed with high biochar application (5%). The soil N and P increased with the increase of biochar addition percentage while soil MBC showed reductions at 5% biochar amendment. Both soil bioavailable fractions of HM and up take of HMs by plants were gradually reduced with increase in biochar content. Based on the results, 2.5% biochar synergism with bacteria was the best for plant growth and soil nutrition status. Despite the synergism, available N was negatively correlated with the decrease of bioavailable metal percentage in soil whereas it was conversely for P. Copyright © 2016 Elsevier Ltd. All rights reserved.

  20. Halopriming of seeds imparts tolerance to NaCl and PEG induced stress in Vigna radiata (L.) Wilczek varieties.

    Science.gov (United States)

    Jisha, K C; Puthur, Jos T

    2014-07-01

    The investigation was carried out to study the effect of halopriming on NaCl and polyethylene glycol-6000 (PEG-6000) induced stress tolerance potential of three Vigna radiata (L.) Wilczek varieties, with varied abiotic stress tolerance potential. Halopriming is a seed priming technique in which the seeds were soaked in various salt solutions (in this study NaCl was used). The results of the study indicated that the application of stresses (both NaCl and PEG) induced retardation of growth attributes (measured in terms of shoot length, fresh weight, dry weight) and decrease in physiological attributes like total chlorophyll content, metabolites, photosynthetic and mitochondrial activity of the seedlings in all three V. radiata (L.) varieties. However, halopriming of the seeds could reduce the extent of decrease in these biological attributes. NaCl and PEG stress also caused increase in MDA content (a product of membrane lipid peroxidation) in all the varieties studied and this increase was significantly minimized under halopriming. From the present investigation it was evident that among the green gram varieties studied, Pusa Vishal, a NaCl tolerant variety showed enhanced tolerance to NaCl and PEG induced stress, when the seeds were subjected to halopriming followed by Pusa Ratna (stress sensitive variety). Pusa 9531 (drought tolerant variety) also showed positive halopriming effects but it was less significant when compared to other two varieties. It could be concluded that halopriming improved the drought and salinity stress tolerance potential of all varieties and it was significantly higher in the Pusa Vishal as compared to Pusa 9531 and Pusa Ratna.

  1. Physicochemical and micro-structural properties of flours, starch and proteins from two varieties of legumes: bambara groundnut (Vigna subterranea).

    Science.gov (United States)

    Kaptso, Kuaté Giscard; Njintang, Yanou Nicolas; Nguemtchouin, Mbouga Marie Goletti; Scher, Joël; Hounhouigan, Joseph; Mbofung, Carl Moses

    2015-08-01

    This work is part of a large study aimed to evaluate the potential of bambara groundnut (Vigna subterranea) flour as starting raw material for the preparation of a widely cherished legume-based food product known as koki. Towards this objective, the flours from two varieties of bambara groundnut along with their respective starch and protein isolates were analyzed for some physicochemical and microstructural properties. It was observed that bambara flour contained appreciable amount of proteins (24.0-25.5 g/100 g), carbohydrates (57.9-61.7 g/100 g), fiber (3.45-3.68 g/100 g) and ash (3.65-3.85 g/100 g) with marginal differences between both varieties. The properties of starch and proteins isolated from the flours were different from one variety to another. In particular the starch granules of the white variety were larger (size range 10-35 μm) and polygonal while those from the black variety were smaller (size range 6-15 μm) and spherical in shape. In addition, the peak of gelatinization temperature was higher for white variety (81.7 °C) than for black variety (77.5 °C). The gelatinization temperature and the enthalpy of gelatinization of starch in the flours were systematically lower than for the starch isolates, suggesting an interaction of starch with other components on the gelatinization process.

  2. Characterization of a novel Y2K-type dehydrin VrDhn1 from Vigna radiata.

    Science.gov (United States)

    Lin, Chia-Hui; Peng, Po-Hsin; Ko, Chia-Yun; Markhart, Albert H; Lin, Tsai-Yun

    2012-05-01

    A novel dehydrin gene (VrDhn1) was isolated from an embryo cDNA library of Vigna radiata (L.) Wilczek (mungbean) variety VC1973A. The intronless VrDhn1 gene encodes a protein belonging to the Y(2)K-type dehydrin family. VrDhn1 protein accumulated in embryos and cotyledons during seed maturation and disappeared 2 days after seed imbibition (DAI). The expression of VrDhn1 mRNA and accumulation of VrDhn1 protein were at high levels in mature seeds, but neither mRNA nor protein was detected in mungbean vegetative tissues under normal growth conditions. The VrDhn1 mRNA level was extremely high in mature seeds and decreased to ∼30% at 1 DAI, and was not detectable at ~7 DAI. Tissue dehydration, salinity and exogenous ABA markedly induced VrDhn1 transcripts in plants as measured by quantitative real-time reverse transcription-PCR (qRT-PCR). VrDhn1 protein was not detected using immunoblots in seedlings under stress treatments. In mature seeds or 1 DAI seedlings, VrDhn1 proteins were immunolocalized in the nucleus and cytoplasm. VrDhn1 exhibited low affinity for non-specific interaction with DNA using electrophoretic mobility shift assays (EMSAs), and the exogenous addition of Zn(2+) or Ni(2+) stimulated interaction. The His-tagged VrDhn1 (30.17 kDa) protein showed a molecular mass of 63.1 kDa on gel filtration, suggesting a dimer form. This is the first report showing that a Y(2)K-type VrDhn1 enters the nucleus and interacts with DNA during seed maturation.

  3. Combined efficacy of Vigna radiata (L. R. Wilczek and Amorphophallus paeoniifolius (Dennst. Nicolson on serum lipids in albino rats

    Directory of Open Access Journals (Sweden)

    P.B. Benil

    2017-09-01

    Full Text Available Coronary Artery Disease (CAD is a major killer disease throughout the world. Dyslipidemia is a major contributor to the risk of CAD. Several dietary articles traditionally used in India and other South Asian countries reduced dyslipidemia. The present study was undertaken to evaluate the combined effect of Mung bean (Vigna radiata and Elephant foot yam (Amorphophallus paeoniifolius on serum lipids and atherogenic indices in albino rats and to compare it with a standard drug Cholestyramine. Thirty healthy albino rats of both sexes (150–200 g were randomized to 5 groups of 6 animals each. The grouping were done based on the following criteria: Group I: Normal Control Group, Group II: (Standard Group: Cholestyramine resin 5 mg/kg bw, Group III: (Half Dose Group: Drug powder at 540 mg/kg bw, Group IV: (Effective Dose Group: Drug powder at 1080 mg/kg bw, and Group V: (Double Dose Group: Drug powder at 2160 mg/kg bw. Lipid profile was estimated at the beginning and after 30 days of treatment. The Effective and Double doses of the drug reduced Total cholesterol along with levels of Triglycerides, Low density lipoprotein and Very low density lipoprotein levels significantly (p < 0.01 along with a significant (p < 0.01 increase in high density lipoproteins (HDL in rats. There was also significant (p < 0.01 improvement in atherogenic indices like Castelli Risk Index I, Non HDL C/HDL, Castelli risk Index II, TG/HDL, Atherogenic coefficient and Atherogenic Index of Plasma. The combination of powdered sprouted mung bean and yam powder have excellent lipid lowering potential.

  4. Genetic diversity and a population structure analysis of accessions in the Chinese cowpea [Vigna unguiculata (L. Walp.] germplasm collection

    Directory of Open Access Journals (Sweden)

    Honglin Chen

    2017-10-01

    Full Text Available Cowpea (Vigna unguiculata is an important legume crop with diverse uses. The species is presently a minor crop, and evaluation of its genetic diversity has been very limited. In this study, a total of 200 genic and 100 genomic simple sequence repeat (SSR markers were developed from cowpea unigene and genome sequences, respectively. Among them, 27 genic and 27 genomic SSR markers were polymorphic and were used for assessment of genetic diversity and population structure in 105 selected cowpea accessions. A total of 155 alleles and 2.9 alleles per marker were identified, and the average polymorphic information content (PIC value was 0.3615. The average PIC of genomic SSRs (0.3996 was higher than that of genic SSRs (0.3235, and most of the polymorphic genomic SSRs were composed of di- and trinucleotide repeats (51.9% and 37.0% of all loci, respectively. The low level of detected genetic diversity may be attributed to a severe genetic bottleneck that occurred during the cowpea domestication process. The accessions were classified by structure and cluster analysis into four subgroups that correlated well with their geographic origins or collection sites. The classification results were also consistent with the results from principal coordinate analysis and can be used as a guide during future germplasm collection and selection of accessions as breeding materials for cultivar improvement. The newly developed genic and genomic SSR markers described in this study will be valuable genomic resources for the assessment of genetic diversity, population structure, evaluation of germplasm accessions, construction of genetic maps, identification of genes of interest, and application of marker-assisted selection in cowpea breeding programs.

  5. Expanding the repertoire of microsatellite markers for polymorphism studies in Indian accessions of mung bean (Vigna radiata L. Wilczek).

    Science.gov (United States)

    Shrivastava, Divya; Verma, Priyanka; Bhatia, Sabhyata

    2014-09-01

    Limited availability of validated, polymorphic microsatellite markers in mung bean (Vigna radiata), an important food legume of India, has been a major hurdle towards its improvement and higher yield. The present study was undertaken in order to develop a new set of microsatellite markers and utilize them for the analysis of genetic diversity within mung bean accessions from India. A GA/CT enriched library was constructed from V. radiata which resulted in 1,250 putative recombinant clones of which 850 were sequenced. SSR motifs were identified and their flanking sequences were utilized to design 328 SSR primer pairs. Of these, 48 SSR markers were employed for assessing genetic diversity among 76 mung bean accessions from various geographical locations in India. Two hundred and thirty four alleles with an average of 4.85 alleles per locus were detected at 48 loci. The polymorphic information content (PIC) per locus varied from 0.1 to 0.88 (average: 0.49 per locus). The observed and expected heterozygosities ranged from 0.40 to 0.95 and 0.40 to 0.81 respectively. Based on Jaccard's similarity matrix, a dendrogram was constructed using the unweighted pair-group method with arithmetic averages (UPGMA) analysis which revealed that one accession from Bundi, Rajasthan was clustered out separately while remaining accessions were grouped into two major clusters. The markers generated in this study will help in expanding the repertoire of the available SSR markers thereby facilitating analysis of genetic diversity, molecular mapping and ultimately broadening the scope for genetic improvement of this legume.

  6. Mechanism of Resistance in Mungbean [Vigna radiata (L. R. Wilczek var. radiata] to bruchids, Callosobruchus spp. (Coleoptera: Bruchidae

    Directory of Open Access Journals (Sweden)

    Abdul R. War

    2017-06-01

    Full Text Available Mungbean [Vigna radiata (L. R. Wilczek var. radiata] is an important pulse crop in Asia, and is consumed as dry seeds and as bean sprouts. It is an excellent source of digestible protein. Bruchids [Callosobruchus chinensis (L. and Callosobruchus maculatus (F.] are the important pests of mungbean and cause damage in the field and in storage. Bruchid infestation reduces the nutritional and market value of the grain and renders seeds unfit for human consumption, agricultural and commercial uses. These pests are controlled mainly by fumigation with highly toxic chemicals such as carbon disulfide, phosphene, and methyl bromide, or by dusting with several other insecticides, which leave residues on the grain, thus, threatening food safety. Some plant-based extracts have been found useful in controlling bruchids, but are not fully successful due to their short-term activity, rapid degradability, and potentially negative effect on seed germination. Although some wild sources of bruchid resistance in mungbean have been reported, which have been used to develop bruchid- resistant lines, undesirable genetic linkages threaten the proper exploitation of genetic diversity from wild germplasm into commercial cultivars. Further, biotype variation in bruchids has rendered some mungbean lines susceptible that otherwise would have been resistant to the pest. Host plant resistance is a cost-effective and a safe alternative to control bruchids in mungbean and is associated with morphological, biochemical, and molecular traits. These traits affect insect growth and development, thereby, reduce the yield losses by the pests. Understanding the defense mechanisms against insect pests could be utilized in exploiting these traits in crop breeding. This review discusses different traits in mungbean involved in defense against bruchids and their utility in pest management. We also highlight the breeding constraints for developing bruchid-resistant mungbean and how can these

  7. Simple and rapid methods for purification and characterization of active coagulants from the seeds of Vigna unguiculata and Parkinsonia aculeata.

    Science.gov (United States)

    Marobhe, N J; Dalhammar, G; Gunaratna, K R

    2007-06-01

    The coagulating properties of aqueous crude extracts and purified proteins of Vigna unguiculata and Parkinsonia aculeata seeds, which are traditional water coagulants in rural areas of Tanzania, were studied. The coagulation activity assays were done using one millilitre (ml) of kaolin water samples. Coagulating proteins were purified in two-step ion exchange chromatography. The properties of coagulant protein were compared with Moringa oleifera. Coagulating components eluted by 0.6 M NaCl in both coagulants are cationic proteins that have the molecular mass of about 6 kDa, which is very similar to that of M. oleifera. The proteins of V. unguiculata and P. aculeata eluted by 0.3 M NaCl also harbour coagulation activity but proteins eluted with 0.6 M NaCl have higher activity. The dosage for coagulation using purified proteins of both coagulants is about 5 to 10 times lower than that of crude seed extracts. The optimum floc settling time of water treated by crude seed extracts and purified proteins ranged between two and two and half hours. Coagulating proteins of both coagulants eluted by 0.6 M NaCl are thermoresistant and retained coagulation activity of 87% to 92% after boiling for two hours at 80 degrees C and one hour at 95 degrees C. Thermotolerant proteins of V. unguiculata eluted by 0.6 M NaCl and P. aculeata have wider pH range of 5.5 to 8.5 for coagulation activity than those of M. oleifera proteins. The present investigation reveals the possibility of using purified natural coagulants for water treatment to produce safe drinking water.

  8. Changes in some biophysical and biochemical parameters of mungbean [vigna radiata (L.) wilczek] grown on chromium-contaminated soils treated with solid tea wastage

    International Nuclear Information System (INIS)

    Azmat, R.; Akhtar, H.

    2010-01-01

    The success of solid tea wastage treatment technology in remediating chromium (111) contamination in the soil has been demonstrated on growth of Vigna radiata. The present research was designed to study the effect of chromium (Cr3/sup +/) on plant growth, potassium (K), phosphorus (P), protease activity and proline profile of Vigna radiata as a bio indicator in the presence and absence of the solid tea surface as a bio sorbent to control the mobility of Cr3/sup +/ in the soil. Results showed toxic effects of Cr3/ sup +/ on plant growth and development, which include high protease activity with prominent proline and decreased potassium and phosphorus contents at elevated concentration of metal. Proline content is the only amino acid that accumulates to a greater extent in the leaves of plants under stress. An increase in proline contents in leaves, stem and root with high concentration of Cr3/s sup +/ gets reduced in a solid tea wastage amended plants. Metabolic alteration by Cr3/ sup +/exposure and their control by solid tea wastage already described in the first report, showed direct effect on enzymes or other metabolites or by its ability to generate reactive oxygen species which may cause oxidative stress. It is suggested that the plant can grow under chromium stress if some suitable adsorbent (like tea wastage) is mixed with the soil which can protect the plants from the phyto toxicity of Cr 3/sup +/ by altering various metabolic processes. (author)

  9. A High Density Genetic Map Derived from RAD Sequencing and Its Application in QTL Analysis of Yield-Related Traits in Vigna unguiculata

    Directory of Open Access Journals (Sweden)

    Lei Pan

    2017-09-01

    Full Text Available Cowpea [Vigna unguiculata (L. Walp.] is an annual legume of economic importance and widely grown in the semi-arid tropics. However, high-density genetic maps of cowpea are still lacking. Here, we identified 34,868 SNPs (single nucleotide polymorphisms that were distributed in the cowpea genome based on the RAD sequencing (restriction-site associated DNA sequencing technique using a population of 170 individuals (two cowpea parents and 168 F2:3 progenies. Of these, 17,996 reliable SNPs were allotted to 11 consensus linkage groups (LGs. The length of the genetic map was 1,194.25 cM in total with a mean distance of 0.066 cM/SNP marker locus. Using this map and the F2:3 population, combined with the CIM (composite interval mapping method, eleven quantitative trait loci (QTL of yield-related trait were detected on seven LGs (LG4, 5, 6, 7, 9, 10, and 11 in cowpea. These QTL explained 0.05–17.32% of the total phenotypic variation. Among these, four QTL were for pod length, four QTL for thousand-grain weight (TGW, two QTL for grain number per pod, and one QTL for carpopodium length. Our results will provide a foundation for understanding genes related to grain yield in the cowpea and genus Vigna.

  10. Phytochemical distribution in hull and cotyledon of adzuki bean (Vigna angularis L.) and mung bean (Vigna radiate L.), and their contribution to antioxidant, anti-inflammatory and anti-diabetic activities.

    Science.gov (United States)

    Luo, Jiaqiang; Cai, Weixi; Wu, Tong; Xu, Baojun

    2016-06-15

    Total saponin content, total phenolics content, total flavonoids content, condensed tannin content in hull, cotyledon and whole grain of both adzuki bean and mung bean were determined by colorimetric methods. Vitexin and isovitexin contents in mung bean were determined by HPLC. Antioxidant effects were evaluated with DPPH scavenging activity and ferric reducing antioxidant power assay. In vitro anti-inflammatory and anti-diabetic effects of beans were evaluated by protease and aldose reductase inhibitory assays, respectively. The results indicated that the bean hulls were the most abundant in phytochemicals and largely contributed antioxidant activities, anti-inflammatory effects and anti-diabetic effects of whole grains. The result showed that mung bean hull was the most abundant with vitexin at 37.43 mg/g and isovitexin at 47.18 mg/g, respectively. Most of the phytochemicals and bioactivities were most predominantly contributed by the bean hulls with exception for condensed tannin of mung bean; which was more abundant in the cotyledon than its hull. Copyright © 2016 Elsevier Ltd. All rights reserved.

  11. Activation of Telomerase by Ionizing Radiation: Differential Response to the Inhibition of DNA Double-Strand Break Repair by Abrogation of Poly(ADP-ribosyl)ation, by LY294002, or by Wortmannin

    International Nuclear Information System (INIS)

    Neuhof, Dirk; Zwicker, Felix; Kuepper, Jan-Heiner; Debus, Juergen; Weber, Klaus-Josef

    2007-01-01

    Purpose: Telomerase activity represents a radiation-inducible function, which may be targeted by a double-strand break (DSB)-activated signal transduction pathway. Therefore, the effects of DNA-PK inhibitors (Wortmannin and LY294002) on telomerase upregulation after irradiation were studied. In addition, the role of trans-dominant inhibition of poly(ADP-ribosyl)ation, which strongly reduces DSB rejoining, was assessed in comparison with 3-aminobenzamide. Methods and Materials: COM3 rodent cells carry a construct for the dexamethasone-inducible overexpression of the DNA-binding domain of PARP1 and exhibit greatly impaired DSB rejoining after irradiation. Telomerase activity was measured using polymerase chain reaction ELISA 1 h after irradiation with doses up to 10 Gy. Phosphorylation status of PKB/Akt and of PKCα/β II was assessed by western blotting. Results: No telomerase upregulation was detectable for irradiated cells with undisturbed DSB rejoining. In contrast, incubation with LY294002 or dexamethasone yielded pronounced radiation induction of telomerase activity that could be suppressed by Wortmannin. 3-Aminobenzamide not only was unable to induce telomerase activity but also suppressed telomerase upregulation upon incubation with LY294002 or dexamethasone. Phospho-PKB was detectable independent of irradiation or dexamethasone pretreatment, but was undetectable upon incubations with LY294002 or Wortmannin, whereas phospho-PKC rested detectable. Conclusions: Telomerase activation postirradiation was triggered by different treatments that interfere with DNA DSB processing. This telomerase upregulation, however, was not reflected by the phosporylation status of the putative mediators of TERT activation, PKB and PKC. Although an involvement of PKB in TERT activation is not supported by the present findings, a respective role of PKC isoforms other than α/β II cannot be ruled out

  12. Food irradiation with ionizing radiation

    International Nuclear Information System (INIS)

    Hrudkova, A.; Pohlova, M.; Sedlackova, J.

    1974-01-01

    Application possibilities are discussed of ionizing radiation in inhibiting plant germination, in radiopasteurization and radiosterilization of food. Also methods of combining radiation with thermal food sterilization are discussed. The problems of radiation doses and of hygienic purity of irradiated foodstuffs are dealt with. (B.S.)

  13. A compendium of transcription factor and Transcriptionally active protein coding gene families in cowpea (Vigna unguiculata L.).

    Science.gov (United States)

    Misra, Vikram A; Wang, Yu; Timko, Michael P

    2017-11-22

    Cowpea (Vigna unguiculata (L.) Walp.) is the most important food and forage legume in the semi-arid tropics of sub-Saharan Africa where approximately 80% of worldwide production takes place primarily on low-input, subsistence farm sites. Among the major goals of cowpea breeding and improvement programs are the rapid manipulation of agronomic traits for seed size and quality and improved resistance to abiotic and biotic stresses to enhance productivity. Knowing the suite of transcription factors (TFs) and transcriptionally active proteins (TAPs) that control various critical plant cellular processes would contribute tremendously to these improvement aims. We used a computational approach that employed three different predictive pipelines to data mine the cowpea genome and identified over 4400 genes representing 136 different TF and TAP families. We compare the information content of cowpea to two evolutionarily close species common bean (Phaseolus vulgaris), and soybean (Glycine max) to gauge the relative informational content. Our data indicate that correcting for genome size cowpea has fewer TF and TAP genes than common bean (4408 / 5291) and soybean (4408/ 11,065). Members of the GROWTH-REGULATING FACTOR (GRF) and Auxin/indole-3-acetic acid (Aux/IAA) gene families appear to be over-represented in the genome relative to common bean and soybean, whereas members of the MADS (Minichromosome maintenance deficient 1 (MCM1), AGAMOUS, DEFICIENS, and serum response factor (SRF)) and C2C2-YABBY appear to be under-represented. Analysis of the AP2-EREBP APETALA2-Ethylene Responsive Element Binding Protein (AP2-EREBP), NAC (NAM (no apical meristem), ATAF1, 2 (Arabidopsis transcription activation factor), CUC (cup-shaped cotyledon)), and WRKY families, known to be important in defense signaling, revealed changes and phylogenetic rearrangements relative to common bean and soybean that suggest these groups may have evolved different functions. The availability of detailed

  14. Diel pattern of circadian clock and storage protein gene expression in leaves and during seed filling in cowpea (Vigna unguiculata).

    Science.gov (United States)

    Weiss, Julia; Terry, Marta I; Martos-Fuentes, Marina; Letourneux, Lisa; Ruiz-Hernández, Victoria; Fernández, Juan A; Egea-Cortines, Marcos

    2018-02-14

    Cowpea (Vigna unguiculata) is an important source of protein supply for animal and human nutrition. The major storage globulins VICILIN and LEGUMIN (LEG) are synthesized from several genes including LEGA, LEGB, LEGJ and CVC (CONVICILIN). The current hypothesis is that the plant circadian core clock genes are conserved in a wide array of species and that primary metabolism is to a large extent controlled by the plant circadian clock. Our aim was to investigate a possible link between gene expression of storage proteins and the circadian clock. We identified cowpea orthologues of the core clock genes VunLHY, VunTOC1, VunGI and VunELF3, the protein storage genes VunLEG, VunLEGJ, and VunCVC as well as nine candidate reference genes used in RT-PCR. ELONGATION FACTOR 1-A (ELF1A) resulted the most suitable reference gene. The clock genes VunELF3, VunGI, VunTOC1 and VunLHY showed a rhythmic expression profile in leaves with a typical evening/night and morning/midday phased expression. The diel patterns were not completely robust and only VungGI and VungELF3 retained a rhythmic pattern under free running conditions of darkness. Under field conditions, rhythmicity and phasing apparently faded during early pod and seed development and was regained in ripening pods for VunTOC1 and VunLHY. Mature seeds showed a rhythmic expression of VunGI resembling leaf tissue under controlled growth chamber conditions. Comparing time windows during developmental stages we found that VunCVC and VunLEG were significantly down regulated during the night in mature pods as compared to intermediate ripe pods, while changes in seeds were non-significant due to high variance. The rhythmic expression under field conditions was lost under growth chamber conditions. The core clock gene network is conserved in cowpea leaves showing a robust diel expression pattern except VunELF3 under growth chamber conditions. There appears to be a clock transcriptional reprogramming in pods and seeds compared to

  15. Effect of bambara groundnut flour (Vigna subterranea (L.) Verdc.) supplementation on chemical, physical, nutritional and sensory evaluation of wheat bread.

    Science.gov (United States)

    Abdualrahman, Mohammed A Y; Ali, Ali O; Elkhalifa, Elamin A; Sulieman, Abdelmoneim E

    2012-09-01

    Bambara groundnut (Vigna subterrenea (L) Verdc) is a major source of vegetable protein in sub-Saharan Africa. And the aim of this study was to enhance the nutritional value of wheat bread through the addition of bambara groundnut flour to wheat four. For this, bambara groundnut seeds were soaked in tap water, manually decorticated, sun dried and milled into fine flour. Proximate analysis of flours of de-hulled bambara groundnut and wheat were conducted. Flour of de-hulled bambara groundnut was used for bread supplementation in ratios of 5, 10 and 15%. Rheological properties of the control flour and wheat flour supplemented with 10% of de-hulled bambara groundnut flour were conducted. The total area and dough development time increased. However, water absorption, stability and extensibility respectively decreased, from 71.3; 8.5; 190 in the control flour to 71.0; 5.5; 180 in the 10% supplemented flour. The increases in the resistance to extension and proportional number from 260 to 280 and 1.37 to 1.56, respectively resulted in stiff dough. The most important effect of wheat bread supplementation was the improvement of protein quantity from 13.74 +/- 0.02% for the control bread to 15.49 +/- 0.02, 17.00 +/- 0.05 and 18.98 +/- 0.02% for the 5, 10 and 15% blending ratios, respectively. The in-vitro protein digestibility progressively increased from 84.33 +/- 0.03 in the control bread to 85.42 +/- 0.04, 86.57 +/- 0.04 and 87.64 +/- 0.03 in breads containing 5, 10 and 15% bambara groundnut flour. The sensory attributes of different types of bread showed that, a significant difference was observed in texture, colour and overall acceptability. However, the panelists gave higher score for 10% de-hulled bambara groundnut flour bread than bread made from other blends. The loaf weights, loaf volume and specific volume increased. However, while the loaf weight increased with addition of 15% de-hulled bambara groundnut flour, both of loaf volume and specific volume decreased

  16. Cleavage of ST6Gal I by Radiation-Induced BACE1 Inhibits Golgi-Anchored ST6Gal I-Mediated Sialylation of Integrin β1 and Migration in Colon Cancer Cells

    International Nuclear Information System (INIS)

    Lee, Minyoung; Park, Jung-Jin; Ko, Young-Gyu; Lee, Yun-Sil

    2012-01-01

    Previously, we found that β-galactoside α2,6-sialyltransferase (ST6Gal I), an enzyme that adds sialic acids to N-linked oligosaccharides of glycoproteins and is frequently overexpressed in cancer cells, is up-regulated by ionizing radiation (IR) and cleaved to a form possessing catalytic activity comparable to that of the Golgi-localized enzyme. Moreover, this soluble form is secreted into the culture media. Induction of ST6Gal I significantly increased the migration of colon cancer cells via sialylation of integrin β1. Here, we further investigated the mechanisms underlying ST6Gal I cleavage, solubilization and release from cells, and addressed its functions, focusing primarily on cancer cell migration. We performed immunoblotting and lectin affinity assay to analyze the expression of ST6 Gal I and level of sialylated integrin β1. After ionizing radiation, migration of cells was measured by in vitro migration assay. α2, 6 sialylation level of cell surface was analyzed by flow cytometry. Cell culture media were concentrated and then analyzed for soluble ST6Gal I levels using an α2, 6 sialyltransferase sandwich ELISA. We found that ST6Gal I was cleaved by BACE1 (β-site amyloid precursor protein-cleaving enzyme), which was specifically overexpressed in response to IR. The soluble form of ST6Gal I, which also has sialyltransferase enzymatic activity, was cleaved from the Golgi membrane and then released into the culture media. Both non-cleaved and cleaved forms of ST6Gal I significantly increased colon cancer cell migration in a sialylation-dependent manner. The pro-migratory effect of the non-cleaved form of ST6Gal I was dependent on integrin β1 sialylation, whereas that of the cleaved form of ST6Gal I was not, suggesting that other intracellular sialylated molecules apart from cell surface molecules such as integrin β1 might be involved in mediating the pro-migratory effects of the soluble form of ST6Gal I. Moreover, production of soluble form ST6Gal I by

  17. Effect of soaking and fermentation on content of phenolic compounds of soybean (Glycine max cv. Merit) and mung beans (Vigna radiata [L] Wilczek).

    Science.gov (United States)

    María Landete, José; Hernández, Teresa; Robredo, Sergio; Dueñas, Montserrat; de Las Rivas, Blanca; Estrella, Isabel; Muñoz, Rosario

    2015-03-01

    Mung beans (Vigna radiata [L] Wilczek) purchased from a Spanish company as "green soybeans", showed a different phenolic composition than yellow soybeans (Glycine max cv. Merit). Isoflavones were predominant in yellow soybeans, whereas they were completely absent in the green seeds on which flavanones were predominant. In order to enhance their health benefits, both types of bean were subjected to technological processes, such as soaking and fermentation. Soaking increased malonyl glucoside isoflavone extraction in yellow beans and produced an increase in apigenin derivatives in the green beans. Lactobacillus plantarum CECT 748 T fermentation produced an increase in the bioactivity of both beans since a conversion of glycosylated isoflavones into bioactive aglycones and an increase of the bioactive vitexin was observed in yellow and green beans, respectively. In spite of potential consumer confusion, since soybean and "green soybean" are different legumes, the health benefits of both beans were enhanced by lactic fermentation.

  18. Barrières pré-zygotiques chez les hybrides entre formes sauvages du niébé, Vigna unguilata (L. Walp.

    Directory of Open Access Journals (Sweden)

    Baudoin JP.

    2006-01-01

    Full Text Available Hybrids pre-zygotic barriers between wild forms of cowpea. The wild forms of cowpea, Vigna unguiculata, constitute an important gene pool insufficiently exploited for the improvement of the cultivated form. In order to promote the use of these wild forms in the genetic improvement programmes, we undertook to understand the various incompatibility reactions which appear in the crosses between wild forms. Efforts were concentrated to understand the incompatibility barriers in the hybridizations between subsp. baoulensis NI 933 and the other wild forms of V. unguiculata. Thanks to the use of the aniline blue fluorescence, we observed a high frequency of pre-zygotic barriers. They appear in three sites, i.e. the higher and lower third of the style, and within the ovary. However, these incompatibility barriers are not absolute. Indeed, in our hybridizations, more than 4% of the ovules were fertilized in the various studied combinations.

  19. Efficacy of Carbofuran in Controlling Root-Knot Nematode (Meloidogyne javanica Whitehead, 1949 on Cultivars of Bambara Groundnut (Vigna subterranea (L. Verdc. in Yola, Nigeria

    Directory of Open Access Journals (Sweden)

    M. Y. Jada

    2011-01-01

    Full Text Available Bambara groundnut (Vigna subterrenea L. Verdc. is an important crop produced in Adamawa State of Nigeria. However, the production of the crop is seriously threatened by root-knot nematodes (RKNs; Meloidogyne spp.. Since cultural methods have not been very effective in controlling RKN, carbofuran was evaluated to determine its efficacy in controlling M. javanica in Yola during 2002 and 2003. Three bambara groundnut cultivars (Kwachanjiwa, Kwaheuma, and Kwatolotolo were evaluated using three application timings (at planting, 3 and 6 weeks after planting, and none. Results indicated that applying carbofuran at planting provided the greatest reduction in M. javanica population levels, which lead to increased yields in bambara groundnuts compared to the other two application timings. Furthermore, both Kwachanjiwa and Kwatolotolo provided similar high yields compared to Kwaheuma, which was most likely related to the M. javanica tolerance in these cultivars.

  20. Performance of cowpea (Vigna unguiculata) and pearl millet (Pennisetum glaucum) intercropped under Parkia biglobosa in an agroforestry system in Burkina Faso

    DEFF Research Database (Denmark)

    Osman, Ahmed Nur; Ræbild, Anders; Christiansen, Jørgen Lindskrog

    2011-01-01

    In agroforestry systems, crop yields under trees are often low compared to outside. This study explored crop management under trees for improved production and income for farmers. Cowpea (Vigna unguiculata) and pearl millet (Pennisetum glaucum) sole and intercrops were grown under and outside...... the trees and intercrops flowered earlier than sole crops. Cowpea sole crops had significant grain yield losses of up to 21% under trees compared to outside, and pearl millet yield was reduced up to 67% under trees. Intercrop yields were less affected by growth under trees. LER was significantly higher...... under the trees than outside, and were always larger than unity indicating benefits of intercropping over sole cropping. Intercropping with two rows of cowpea and one row of millet gave significantly higher economic benefit than mixture with one row of each of the crops. Results indicate...

  1. Nitrogen fixation by mung bean (Vigna radiata L.) under field conditions in the Philippines as quantified by 15N isotope dilution

    International Nuclear Information System (INIS)

    Rosales, C.M.; Rivera, F.; Hautia, R.A.; Del Rosario, E.

    1995-05-01

    Nitrogen fixation by five mung bean genotypes (Vigna radiata L.) was estimated using two reference crops at two locations in the Philippines. The percentage of N derived from fixation and the amount of N-fixed ranged from 64 to 87% and 43 to 85 kg N/ha respectively at one location and from 36.6 to 72% and 21 to 85 kg N/ha at another location using cotton as reference crop. Maize was not a good reference crop. The highest mung bean seed yields obtained were 1.99 t/ha and 0.86 t/ha in the two locations. As to residual benefits, corn dry matter seeds yield were higher when grown following N 2 -fixing mung bean than after non-fixing corn or cotton. (author). 25 refs., 1 fig., 5 tabs

  2. Isolation and screening of rhizobia for auxin biosynthesis and growth promotion of mung bean (Vigna radiata L. seedlings under axenic conditions

    Directory of Open Access Journals (Sweden)

    Muhammad Ashfaq Anjum, Zahir Ahmad Zahir, Muhammad Arshad and Muhammad Ashraf

    2011-04-01

    Full Text Available A series of screening experiments to evaluate the effectiveness of rhizobia for producing auxins and improvegrowth and nodulation of mungbean (Vigna radiata L. were carried out under axenic conditions. Forty fouriolatess of rhizobia were isolated using standard procedures. Auxin biosynthesis by these rhizobial isolates wasdetermined in the absence and presence of L-Trp, a physiological precursor of auxins. Rhizobial isolates variedwidely in auxins biosynthesis capabilities. On the basis of auxins biosynthesis, a pouch experiment was conductedfor screening thirty four efficient isolates of rhizobia for the growth promotion of mung bean. Results of pouch studyshowed that inoculation with selected rhizobial isolates increased the root /shoot length, fresh, and dry shoot weightof mung bean up to 33, 59, 71, 148, 107 and 188%, respectively, over untreated control. Further studies are neededunder glasshouse and field conditions for confirmation of these results.

  3. Effect of extrusion conditions and lipoxygenase inactivation treatment on the physical and nutritional properties of corn/cowpea (Vigna unguiculata) blends.

    Science.gov (United States)

    Sosa-Moguel, Odri; Ruiz-Ruiz, Jorge; Martínez-Ayala, Alma; González, Rolando; Drago, Silvina; Betancur-Ancona, David; Chel-Guerrero, Luis

    2009-01-01

    The influence of lipoxygenase inactivation and extrusion cooking on the physical and nutritional properties of corn/cowpea (Vigna unguiculata) blends was studied. Corn was blended in an 80:15 proportion with cowpea flour treated to inactivate lipoxygenase (CI) or non-inactivated cowpea flour (CNI). Extrusion variables were temperature (150 degrees C, 165 degrees C and 180 degrees C) and moisture (15%, 17% and 19%). Based on their physical properties, the 165 degrees C/15% corn:CNI, and 165 degrees C/15% corn:CI, and 150 degrees C/15% corn:CI blends were chosen for nutritional quality analysis. Extrudate chemical composition indicated high crude protein levels compared with standard corn-based products. With the exception of lysine, essential amino acids content in the three treatments met FAO requirements. Extrusion and lipoxygenase inactivation are promising options for developing corn/cowpea extruded snack products with good physical properties and nutritional quality.

  4. Observations préliminaires de la variabilité entre quelques morphotypes de voandzou (Vigna subterranea L. Verdc., Fabaceae de Côte d'Ivoire

    Directory of Open Access Journals (Sweden)

    Zoro Bi IA.

    2005-01-01

    Full Text Available Preliminary observations of variability between some morphotypes of bambara groundnut (Vigna subterranea L. Verdc., Fabaceae from Côte d’Ivoire. Bambara groundnut (Vigna subterranea L. Verdc., is a food legume mainly cultivated by women for whom it represents a source of income for the household. In Côte d’Ivoire, the cultivation of bambara groundnut is located in the western and northern parts of the country. These zones are characterised by contrasted agroecology including tropical rain forest and dry savanna. In these zones, bambara groundnut plays a key role in both food and culture of peoples. Four morphotypes of Côte d’Ivoire (ICU, BPR, RBU, NFU were used in a preliminary study to assess the phenotypic variability between morphotypes. For each morphotype, 100 individuals were sampled to analyse 26 agromorphological traits selected from the list of bambara groundnut descriptors. Results of statistical analyses showed an important variability among morphotypes suggesting that 22 of these characters could be powerful to distinguish diversity among bambara groundnut morphotypes of Côte d’Ivoire. Three morphotypes (ICU, BPR and RBU show a shorter reproductive cycle than the other (NFU. In our experimental conditions, morphotypes with a shorter reproductive cycle give a higher percentage of matured pods (87 to 95%, compared to morphotype NFU (60%. The morphotype ICU was particularly earlier, maturing 90 days after sowing (DAS, whereas the long reproductive cycle morphotype (NFU required about 137 days. Based on the analysed agronomic traits, possibilities to improve bambara groundnut yield and to promote its cultivation in Côte d’Ivoire are discussed.

  5. Effet comparé des poudres de Nicotiana tabacum L, Cymbopogon citratus (D.C. Stapf et de l'huile de Ricinus communis L sur la conservation des graines de Vigna unguiculata (L Walp

    Directory of Open Access Journals (Sweden)

    Gakuru, S.

    1995-01-01

    Full Text Available Compared Effect of Nicotiana tabacum L, Cymbopogon citratus (D.C. Stapf Powders and Castor Oil Ricinus communis L. on Conservation of Cowpea Vigna Unguiculata (L. Walp Grains. The effect of powder of tobacco Nicotiana tabacum L. and citronella grass Cymbopogon citratus (D.C. Stapf and castor oil Ricinus communis L. on conservation of cowpea Vigna unguiculata (L. Walp. grains was investigated in Kisangani, Zaire. After 5 months of conservation, infestation rates by bean weevil Acanthoscelides obtectus Say were 72.5 %, 74.5 %, 49.5 % and 5 % respectively for the check, the samples treated by 1 % of citronella grass and tobacco powder and 1 % of castor oil. The powder dose of 7.5 % did not give more interesting results.

  6. Radiation chemistry

    International Nuclear Information System (INIS)

    Rodgers, F.; Rodgers, M.A.

    1987-01-01

    The contents of this book include: Interaction of ionizing radiation with matter; Primary products in radiation chemistry; Theoretical aspects of radiation chemistry; Theories of the solvated electron; The radiation chemistry of gases; Radiation chemistry of colloidal aggregates; Radiation chemistry of the alkali halides; Radiation chemistry of polymers; Radiation chemistry of biopolymers; Radiation processing and sterilization; and Compound index

  7. Influence du décalage du semis du niébé (Vigna unguiculata (L.) Walp) par rapport au maïs (Zea mays L.) sur la croissance et le rendement du niébé

    OpenAIRE

    Osiru, DSO.; Ocaya, CP.; Adipala, E.

    2002-01-01

    Effect of Time of Planting Cowpea (Vigna unguiculata (L.) Walp) Relative to Maize (Zea mays L.) on Growth and Yield of Cowpea. Field investigations were carried out for three seasons in two locations of Uganda to examine yield benefits when cowpea and maize are planted under intensive farming conditions. Additive mixtures of cowpea were planted into maize thrice at 2 weekly intervals together with sole crops. Time of introducing cowpea into maize significantly affected both the growth and yie...

  8. Radiation and radiation protection

    International Nuclear Information System (INIS)

    Landfermann, H.H.; Solbach, C.

    1992-11-01

    The brochure explains the major types of radiation, the radiation sources, effects, uses, and risks, as well as the regulatory system adopted by the government in order to keep the risks as low as possible. (orig./DG) [de

  9. Sprout inhibition in roots, tubers and bulbs

    International Nuclear Information System (INIS)

    Luna C, P.C.

    1992-05-01

    The treatment with ionizing radiations to low dose impedes that appear sprouts in the tubers (potatoes); bulbs (onion and garlic) and in roots like the ginger and the yucca. The purpose is to inhibit the germination during the process of manipulation and storage, and this way to avoid the lost ones post crop of these products. The radiation dose required to inhibit the germination goes to depend of: the development conditions, the differences of variety, of the storage state of the bulbs and the conditions of cured and storage. (Author)

  10. Radiation measurement

    International Nuclear Information System (INIS)

    Go, Sung Jin; Kim, Seung Guk; No, Gyeong Seok; Park, Myeong Hwan; Ann, Bong Seon

    1998-03-01

    This book explains technical terms about radiation measurement, which are radiation, radiation quantity and unit such as prefix of international unit, unit for defence purposes of radiation, coefficient of radiation and interaction, kinds and principles of radiation detector, ionization chamber, G-M counter, G-M tube, proportional counter, scintillation detector, semiconductor radiation detector, thermoluminescence dosimeter, PLD, others detector, radiation monitor, neutron detector, calibration of radiation detector, statistics of counting value, activation analysis and electronics circuit of radiation detector.

  11. COWPEA (VIGNA UNGUICULATA)

    African Journals Online (AJOL)

    DR. AMINU

    The protein contents of the weaning food blends met ... Dietary Allowance (RDA) for infants (0 – 1 year), though the fat contents were ... foods along side breast milk as from four months, ... grams (100g) of the cleaned pearl millet (raw grain).

  12. Vigna mungo L. Hepper

    African Journals Online (AJOL)

    satyam

    2013-03-13

    Mar 13, 2013 ... Genetic engineering allows these genes to be transferred to cultivated varieties in order to enhance the tolerance to various stresses and hence stabilize .... primer: 5'. AATATCACGGGTAGCCAACG 3' and reverse primer 5'.

  13. Vigna mungo (L.) Hepper

    African Journals Online (AJOL)

    PRECIOUS

    2009-11-02

    Nov 2, 2009 ... Available online at http://www.academicjournals.org/AJB .... g/100 g, Trifolium alexandrianum green manure (GM) @ 4 g/100 g. (on dry weight ... MN-S with concentrated sugar solution as an ad- ..... as an alternative fertilizer.

  14. Vigna subterranea L. Verdc

    African Journals Online (AJOL)

    2015-07-04

    Jul 4, 2015 ... This leads to significant non-productive water losses through soil ... esized that total crop water use could be improved if crop estab- lishment was ...... which allowed for maintenance of high tissue water potential. The red ...

  15. (VIGNA SUBTERRANEA [L.] VERDC.)

    African Journals Online (AJOL)

    User

    2015-12-02

    Dec 2, 2015 ... Latin America, probably through the slave trade, and is found in Sri-Lanka, Malaysia, Philippines and India, and. Brazil (Rassel, 1960; Goli et al., 1997). Bambara nut is an important source of dietary protein in sub-Saharan Africa, with protein levels of 16-25%. (Brough et al., 1993); carbohydrates and oil ...

  16. Vigna subterranea L. Verdc

    African Journals Online (AJOL)

    2012-05-14

    May 14, 2012 ... Effects of irrigation levels and seed coat colour on growth, development, yield and water-use efficiency of local bambara groundnut landrace selections were ..... Therefore, there is a need to down-regulate photosynthesis in.

  17. (Vigna radiata) seeds

    African Journals Online (AJOL)

    hp

    and maximum activity was observed at 70°C. The optimal pH value of the enzyme activity was found to be 5.2. There was a ... expresses its isozymes in many plants such as soyabean .... Firstly, it can change the ionization of the enzyme.

  18. (Vigna radiata (L.) Wilczek)

    Indian Academy of Sciences (India)

    hectare with 1.02 million tonne production (average during. 2000–2003). This crop provides ... rinsed with 70% ethanol for 10–15 min and dried at room temperature overnight. .... gating generation led to differentiation. Cluster IV exhibited.

  19. Thixotropic, radiation curable compositions

    International Nuclear Information System (INIS)

    Miller, L.S.

    1976-01-01

    A reactive metal oxide or metal hydroxide, such as ZnO, MgO, HgO or Ba(OH) 2 and acrylic or methacrylic acid are added to a liquid, hydrophobic, essentially solvent-free coating vehicle capable of being cured by high-energy radiation. The resulting coating composition, as compared to the vehicle alone, can be cured with lower radiation doses, is less susceptible to oxygen inhibition of curing with ionizing radiation and exhibits a thixotropic viscosity which prevents excessive penetration of the coating into porous substrates and contributes non-drip, low-flow characteristics to the composition

  20. Efectividad de cepas rizobianas nativas de sabana en Vigna unguiculata (L. Walp. cv. C4A-3

    Directory of Open Access Journals (Sweden)

    Juliana Mayz

    2010-07-01

    Full Text Available Título en inglés: Effectiveness of savannah native rhizobial strains in Vigna unguiculata (L. Walp. cv. C4A-3 Resumen Se estima que la población mundial se incrementará y demandará mayor cantidad de alimentos y uso de fertilizantes nitrogenados. En Venezuela, el frijol es altamente consumido y se cultiva en las sabanas orientales, cuyas características edáficas pueden afectar negativamente la población rizobiana. Estos planteamientos refuerzan la importancia de la evaluación de la flora rizobiana nativa, y enfatizan la necesidad de aumentar la explotación de la fijación biológica de nitrógeno. En este contexto, se evaluaron 6 cepas rizobianas en el cultivar C4A-3, aisladas, de frijol cv. Tejero Criollo y previamente catalogadas como efectivas (JV91, JV94 y JV101 e inefectivas (JV99, JV103, y JV104 en el cultivar TC9-6. El experimento se llevó a cabo en umbráculo por 45 días, donde además se incluyeron dos tratamientos control no inoculados. La suspensión de las cepas individualmente cultivadas se usó para inoculación. De acuerdo con la tipología de la nodulación (número de nódulos, peso total y por nódulo, tamaño y color, los valores de los parámetros de crecimiento (peso seco, altura y número de hojas del vástago y los estimados de la concentración de nitrógeno y nitrógeno total, las cepas JV91, JV99 y JV101, fueron las más efectivas en la fijación de nitrógeno. El nitrógeno total y la concentración de nitrógeno tuvieron una correlación significativa con peso seco, altura y número de hojas del vástago. Los resultados muestran la existencia de cepas efectivas en los suelos de sabana para este cultivar, y enfatizan la importancia de evaluar las cepas indígenas, antes de proceder a la inoculación con foráneas. Palabras clave: Rhizobium; frijol; fijación de nitrógeno; Venezuela. Abstract It is estimated that world-wide population will increase and demand higher amount of food and use of nitrogen

  1. Radiation protection

    International Nuclear Information System (INIS)

    Koelzer, W.

    1975-01-01

    Physical and radiological terms, quantities, and units. Basic principles of radiation protection (ICRP, IAEA, EURATOM, FRG). Biological effects of ionizing radiation. Objectives of practical radiation protection. (HP) [de

  2. Inhibition of GRP78 abrogates radioresistance in oropharyngeal carcinoma cells after EGFR inhibition by cetuximab.

    Directory of Open Access Journals (Sweden)

    Chaonan Sun

    Full Text Available The EGFR-specific mAb cetuximab is one of the most effective treatments for oropharyngeal carcinoma, while patient responses to EGFR inhibitors given alone are modest. Combination treatment with radiation can improve the efficacy of treatment through increasing radiosensitivity, while resistance to radiation after administration of cetuximab limits its efficiency. Radiation and drugs can damage the endoplasmic reticulum (ER homeostatic state and result in ER stress (ERS, subsequently causing resistance to radiation and drugs. Whether the ERS pathway is involved in radioresistance after administration of cetuximab has not been reported. Herein, we show that cetuximab could increase the radiosensitivity of FaDu cells but not Detroit562 cells. In addition, cetuximab inhibited the radiation-induced activation of the ERS signalling pathway IRE1α/ATF6-GRP78 in FaDu cells, while this effect was absent in Detroit562 cells. Silencing GRP78 increased the radiosensitivity of oropharyngeal carcinoma cells and inhibited radiation-induced DNA double-strand-break (DSB repair and autophagy. More interestingly, silencing GRP78 abrogated resistance to cetuximab and radiation in Detroit562 cells and had a synergistic effect with cetuximab in increasing the radiosensitivity of FaDu cells. Immunohistochemistry showed that overexpression of both GRP78 and EGFR was associated with a poor prognosis in oropharyngeal carcinoma patients (P<0.05. Overall, the results of this study show that radioresistance after EGFR inhibition by cetuximab is mediated by the ERS signalling pathway IRE1α/ATF6-GRP78. This suppression was consequently unable to inhibit radiation-induced DSB repair and autophagy in oropharyngeal carcinoma cells, which conferred resistance to radiotherapy and cetuximab. These results suggest that the cooperative effects of radiotherapy and cetuximab could be further improved by inhibiting GRP78 in non-responsive oropharyngeal carcinoma patients.

  3. Ultraviolet radiation

    International Nuclear Information System (INIS)

    Hawk, J.

    1986-01-01

    Ultraviolet radiation (UVR) from the sun or artificial sources is reflected or transmitted at the surface of the skin, about 5% of normally incident rays being directly reflected. The transmitted fraction is scattered, photochemically absorbed or dissipated as heat within the skin, or passes from it to contribute to the variable total amount of reflected and transmitted radiation. The UVR absorbers in skin are not definitely known, but DNA is a definite target and probably lipoprotein membranes, RNA, proteins, mucopolysaccharides, elastin and collagen. Photochemical or free radical damage to absorber or nearby organelles leads to pharmacological, ultrastructural, histological and clinical changes. Most frequent DNA damage is pyrimidine dimer formation, apparently inhibiting cell function and replication. This is largely enzymatically repaired in man in the dark by excision repair, post-replication repair and possible other enzymatic mechanisms, and at least in some organisms by light-induced photoreactivation repair. UVR exposure causes well recognized acute and chronic clinical syndromes in man. These are discussed in this paper

  4. DNA repair related to radiation therapy

    International Nuclear Information System (INIS)

    Klein, W.

    1979-01-01

    The DNA excision repair capacity of peripheral human lymphocytes after radiation therapy has been analyzed. Different forms of application of the radiation during the therapy have been taken into account. No inhibition of repair was found if cells were allowed a certain amount of accomodation to radiation, either by using lower doses or longer application times. (G.G.)

  5. Quality characteristics of gamma irradiated cowpea (vigna unguiculata, L. walp) cultivars in Ghana and their resultant flours

    International Nuclear Information System (INIS)

    Darfour, B.

    2010-01-01

    Cowpeas are leguminous seeds widely produced and consumed in most developing countries of sub Saharan Africa. During storage, cowpeas may be attacked by a number of biological agents (microorganisms, rodents, and insects) which results in losses in the quality and quantity of the stored seeds. These losses can be minimized by irradiating the stored cowpea against microorganisms and insects attacks primarily Callosobruchus maculatus. The aim of this study was to evaluate quality characteristics of gamma irradiated cowpea cultivars and their resultant flours. Four cowpea cultivars were irradiated with gamma radiation at dose levels of 0.25 kGy, 0.5 kGy, 0.75 kGy, 1.0 kGy and 1.5 kGy. The unirradiated cultivars were used as controls. A portion of the samples were hammer milled, passed through sieve of 250μm and stored at 4 o C for analysis. Physicochemical, functional, pasting and sensory properties were determined using standards and/or appropriate methods. Moisture sorption isotherms of the cowpea samples were also determined. Radiosensitivity and storage studies on Callosobruchus maculatus were also done for one month. In general, significant effect (p 0.05) affected by the irradiation. All the physical parameters studied were not significantly (p > 0.05) affected by the radiation. Generally, significant increase (p o C. There was no significant (p > 0.05) effect of the radiation on the sensory attributes like flavour, taste, texture, softness and colour of the cowpea seeds. Similarly, the radiation did not affect significantly (p > 0.05) the acceptability of the treated cowpea cultivars. Irradiating at even a dose of 0.25 kGy killed the insects on average within eight days. There was significant difference (p < 0.05) in the percent mortality between the irradiated and the non-irradiated weevils. The percent mortality increased with increase in the radiation dose. It was established that at the lower doses studied although the radiation effect did not follow any

  6. Construction and analysis of an SSH cDNA library of early heat-induced genes of Vigna aconitifolia variety RMO-40.

    Science.gov (United States)

    Rampuria, Sakshi; Joshi, Uma; Palit, Paramita; Deokar, Amit A; Meghwal, Raju R; Mohapatra, T; Srinivasan, R; Bhatt, K V; Sharma, Ramavtar

    2012-11-01

    Moth bean ( Vigna aconitifolia (Jacq.) Marechal) is an important grain legume crop grown in rain fed areas of hot desert regions of Thar, India, under scorching sun rays with very little supplementation of water. An SSH cDNA library was generated from leaf tissues of V. aconitifolia var. RMO-40 exposed to an elevated temperature of 42 °C for 5 min to identify early-induced genes. A total of 488 unigenes (114 contigs and 374 singletons) were derived by cluster assembly and sequence alignment of 738 ESTs; out of 206 ESTs (28%) of unknown proteins, 160 ESTs (14%) were found to be novel to moth bean. Only 578 ESTs (78%) showed significant BLASTX similarity (pathways. Four hundred and fifty-two ESTs were further annotated with InterProScan (IPS), and no IPS was assigned to 153 ESTs. In addition, the expression level of 27 ESTs in response to heat stress was evaluated through semiquantitative RT-PCR assay. Approximately 20 different signaling genes and 16 different transcription factors have been shown to be associated with heat stress in moth bean for the first time.

  7. Nutritive Evaluation of the Bambara Groundnut Ci12 Landrace [Vigna subterranea (L.) Verdc. (Fabaceae)] Produced in Côte d'Ivoire.

    Science.gov (United States)

    Yao, Denis N'Dri; Kouassi, Kouakou Nestor; Erba, Daniela; Scazzina, Francesca; Pellegrini, Nicoletta; Casiraghi, Maria Cristina

    2015-09-07

    The nutritional evaluation of the Bambara groundnut Ci12 landrace (Vigna subterranea (L.) Verdc.) seeds produced in Côte d'Ivoire shows a 19% content of protein, containing all the essential amino acids with tryptophan as the limiting amino acid, a total dietary fiber level of 10%, with a low soluble fraction content, and a fat content of 1.4%, with a high proportion of total unsaturated fatty acids (61%) of which 36% were n-6 fatty acids. This legume contains phosphorus, as the major mineral, followed by magnesium and calcium, and trace elements (iron, copper and zinc). It is characterized by the same amount of α-tocopherol and antioxidant capacity as common legumes. The high concentration of essential amino acids, n-6 fatty acids and minerals, mainly Fe, in the Ci12 landrace of Bambara groundnut indicates that this local legume has the potentiality to improve the nutritional status in Côte d'Ivoire and it could be regarded as a nutrient dense food.

  8. Nutritive Evaluation of the Bambara Groundnut Ci12 Landrace [Vigna subterranea (L.) Verdc. (Fabaceae)] Produced in Côte d’Ivoire

    Science.gov (United States)

    N’Dri Yao, Denis; Kouassi, Kouakou Nestor; Erba, Daniela; Scazzina, Francesca; Pellegrini, Nicoletta; Casiraghi, Maria Cristina

    2015-01-01

    The nutritional evaluation of the Bambara groundnut Ci12 landrace (Vigna subterranea (L.) Verdc.) seeds produced in Côte d’Ivoire shows a 19% content of protein, containing all the essential amino acids with tryptophan as the limiting amino acid, a total dietary fiber level of 10%, with a low soluble fraction content, and a fat content of 1.4%, with a high proportion of total unsaturated fatty acids (61%) of which 36% were n-6 fatty acids. This legume contains phosphorus, as the major mineral, followed by magnesium and calcium, and trace elements (iron, copper and zinc). It is characterized by the same amount of α-tocopherol and antioxidant capacity as common legumes. The high concentration of essential amino acids, n-6 fatty acids and minerals, mainly Fe, in the Ci12 landrace of Bambara groundnut indicates that this local legume has the potentiality to improve the nutritional status in Côte d’Ivoire and it could be regarded as a nutrient dense food. PMID:26370971

  9. Influence of Rhizobacterium Inoculation on NaCl Salinity Tolerance in Pusa Sukomal and RC101 Varieties of Cowpea (Vigna unguiculata L.

    Directory of Open Access Journals (Sweden)

    Sadhna Chaturvedi

    2017-06-01

    Full Text Available Soil salinity is one of the most severe factors limiting growth and physiological response in cowpea plants. In the present study, the effect of rhizobacterium strains BR2 and BR3 on the growth of cowpea (Vigna unguiculata L. varieties—Pusa Sukomal and RC101—tolerance to 0, 25, 50, and 75 mM concentrations of NaCl salinity was evaluated. The rate of growth, in general, was high in plants irrigated with 25 mM NaCl saline water as compared to control, and thereafter, the growth reduced with increase in salinity concentrations. The results revealed that treating the seeds with rhizobacteria accompanied by NaCl salinity increased growth parameters of the cowpea plant as compared to the seeds irrigated with sodium chloride alone. Treatment with rhizobacteria mitigated the harmful effect of NaCl, and the growth was significantly better than the plants growing in saline water without rhizobacterium inoculation. The overall performance of Pusa Sukomal with BR3 strain was found to be better than the other combinations tested. Flowering in field plants started within 45 days of sowing, and the seeds in plants irrigated with saline water, in the presence of rhizobacterium, were found to be healthy as compared to control seeds. Seed protein profile was analyzed by SDS PAGE gel studies.

  10. Genetic Parameters and Combining Ability Effects of Parents for Seed Yield and other Quantitative Traits in Black Gram [Vigna mungo (L. Hepper

    Directory of Open Access Journals (Sweden)

    Supriyo CHAKRABORTY

    2010-06-01

    Full Text Available Line x tester analysis was carried out in black gram [Vigna mungo (L. Hepper], an edible legume, to estimate the gca (general combining ability effects of parents (3 lines and 3 testers and the SCA (specific combining ability effects of 9 crosses for seed yield and other eleven quantitative traits. Though additive and nonadditive gene actions governed the expression of quantitative traits, the magnitude of nonadditive gene action was higher than that of additive gene action for each quantitative trait. Two parents viz. �UG157� and �DPU915� were good general combiners. Two crosses namely �PDB 88-31�/�DPU 915� and �PLU 277�/�KAU7� had high per se performance along with positive significant SCA effect for seed yield/plant. The degree of dominance revealed overdominance for all the traits except clusters/plant with partial dominance. The predictability ratio also revealed the predominant role of nonadditive gene action in the genetic control of quantitative traits. Narrow sense heritability was also low for each trait. Recurrent selection or biparental mating followed by selection which can exploit both additive and nonadditive gene actions would be of interest for yield improvement in black gram. Due to presence of high magnitude of nonadditive gene action, heterosis breeding could also be attempted to develop low cost hybrid variety using genetic male sterility system in black gram.

  11. Genetic Parameters and Combining Ability Effects of Parents for Seed Yield and other Quantitative Traits in Black Gram [Vigna mungo (L. Hepper

    Directory of Open Access Journals (Sweden)

    Supriyo CHAKRABORTY

    2010-06-01

    Full Text Available Line x tester analysis was carried out in black gram [Vigna mungo (L. Hepper], an edible legume, to estimate the gca (general combining ability effects of parents (3 lines and 3 testers and the SCA (specific combining ability effects of 9 crosses for seed yield and other eleven quantitative traits. Though additive and nonadditive gene actions governed the expression of quantitative traits, the magnitude of nonadditive gene action was higher than that of additive gene action for each quantitative trait. Two parents viz. UG157 and DPU915 were good general combiners. Two crosses namely PDB 88-31/DPU 915 and PLU 277/KAU7 had high per se performance along with positive significant SCA effect for seed yield/plant. The degree of dominance revealed overdominance for all the traits except clusters/plant with partial dominance. The predictability ratio also revealed the predominant role of nonadditive gene action in the genetic control of quantitative traits. Narrow sense heritability was also low for each trait. Recurrent selection or biparental mating followed by selection which can exploit both additive and nonadditive gene actions would be of interest for yield improvement in black gram. Due to presence of high magnitude of nonadditive gene action, heterosis breeding could also be attempted to develop low cost hybrid variety using genetic male sterility system in black gram.

  12. Curbing the Growth of Wax Bean (Vigna unguiculata L. via a Novel Complex of Nano Zinc Oxide/Vermicompost

    Directory of Open Access Journals (Sweden)

    Farideh BEHBOUDI

    2016-12-01

    Full Text Available Vermicompost (VC samples were prepared from manure and spent mushroom compost (SMC and were impregnated with zinc oxide nanoparticles (ZnO NPs, giving ZnO NPs/VC complexes that were added into the soil in which wax beans (Vigna unguiculata L. were then planted. The study was carried out through a factorial experiment in a randomized complete block design with three factors. The experimental factors included: ZnO NPs (0, 0.4, 0.8 and 1.2 mg kg-1, two substrate types (cow manure and SMC and VC (2.5, 5 and 7.5 weight percentages. To the substrate types, adult earthworms (Eisenia fetida were added. Specifically, after three months, the prepared VC was soaked in ZnO NPs solutions, mixed with soil (according to cultivation substrate weight, then employed in wet plantation of wax beans. The obtained results showed that with increasing ZnO NPs, leaves’ chlorophyll, grains number per pod, stem length, hundred grains weight, grain yield, and the grain protein content significantly decreased. In general, the usage of these NPs in the applied amounts could curb the undesired growth of this species.

  13. Treatment of Cr/sup 3+/ contaminated soil by solid tea wastage I. A study of physiological processes of Vigna radiata

    International Nuclear Information System (INIS)

    Azmat, R.; Akhter, Y.; Sara Qureshi, S.; Ahmed, T.

    2010-01-01

    This study describes the option of using domestic tea waste in soil contaminated with the Cr/sup 3+/ trace metal due to industrial and mine activity, continuously discharging in the land and aquatic resources. This disposal of industrial wastage without proper treatment is responsible for the lowering of crop productivity with the accumulation of essential and non essential trace metals in the plants. On the other hand domestic waste management in soil and aquatic resources are also accountable for the reduced field productivity. This research discusses the proper domestic waste management in the agriculture land for the cultivation of crop in the contaminated soil. Vigna radiata has been selected as a crop to check the effects of Cr/sup 3+/ and its deletion in the contaminated soil. The highest yield was obtained when soil was mixed with tea wastage instead of spreaded tea wastage. Seed germination, morphology and physiology of 15 days old plant showed remarkable improvement in the plant growth including seed germination with activated tea wastage in the presence of Cr/sup 3+/ as compared to those plants which were grown in Cr/sup 3+/ contaminated soil only. Biochemical analysis of seedling showed an increase in the concentration of chlorophyll, carbohydrates, protein and amino acids, which confirms the remediation of contaminated soil through tea wastage. It was concluded that proper use of domestic waste can be helpful to increase the soil fertility and can concentrate the heavy toxic metals in it through complex formation. (author)

  14. Characterization of VuMATE1 expression in response to iron nutrition and aluminum stress reveals adaptation of rice bean (Vigna umbellata to acid soils through cis regulation

    Directory of Open Access Journals (Sweden)

    Meiya eLiu

    2016-04-01

    Full Text Available Rice bean (Vigna umbellata VuMATE1 appears to be constitutively expressed at vascular system but root apex, and Al stress extends its expression to root apex. Whether VuMATE1 participates in both Al tolerance and Fe nutrition, and how VuMATE1 expression is regulated is of great interest. In this study, the role of VuMATE1 in Fe nutrition was characterized through in planta complementation assays. The transcriptional regulation of VuMATE1 was investigated through promoter analysis and promoter-GUS reporter assays. The results showed that the expression of VuMATE1 was regulated by Al stress but not Fe status. Complementation of frd3-1 with VuMATE1 under VuMATE1 promoter could not restore phenotype, but restored with 35SCaMV promoter. Immunostaining of VuMATE1 revealed abnormal localization of VuMATE1 in vasculature. In planta GUS reporter assay identified Al-responsive cis-acting elements resided between -1228 and -574 bp. Promoter analysis revealed several cis-acting elements, but transcription is not simply regulated by one of these elements. We demonstrated that cis regulation of VuMATE1 expression is involved in Al tolerance mechanism, while not involved in Fe nutrition. These results reveal the evolution of VuMATE1 expression for better adaptation of rice bean to acidic soils where Al stress imposed but Fe deficiency pressure released.

  15. Use of two varieties of hard-to-cook beans (Phaseolus vulgaris) and cowpeas (Vigna unguiculata) in the processing of koki (a steamed legume product).

    Science.gov (United States)

    Mbofung, C M; Rigby, N; Waldron, K

    1999-01-01

    Koki is a nutritious cowpea-based food product usually processed by steam cooking whipped cowpea (Vigna unguiculata) paste mixed with spices and palm oil. A study was carried out to investigate the effect of the partial replacement of cowpeas (CP) with hard-to-cook (HTC) beans on the chemical, nutritional and sensory characteristics of koki. Towards this objective, two varieties of beans--Phaseolus vulgaris (red kidney beans--RKB and mottled brown beans--MBB), each with the HTC defect, were separately incorporated into cowpea paste in the following Bean:CP ratios 0:100, 20:80, 30:70, 40:60, 50:50, 60:40 and processed into koki. Incorporation of dry HTC beans into cowpeas in the making of koki affected the bulking properties of the uncooked paste, the nutrient composition, essential amino acid content, antinutritional factors, digestibility as well as the sensory attributes of cooked koki. Sensory tests showed that a highly acceptable, nutritious and digestible koki can be processed from cowpeas partially replaced with dry HTC bean paste up to levels of about 40-50% depending on the variety of dry bean used.

  16. Impact of pesticides on plant growth promotion of Vigna radiata and non-target microbes: comparison between chemical- and bio-pesticides.

    Science.gov (United States)

    Gupta, Sukriti; Gupta, Rashi; Sharma, Shilpi

    2014-08-01

    To compare the target and non-target effects of two chemical-pesticides (chlorpyrifos and endosulfan) with that of a bio-pesticide (azadirachtin), Vigna radiata (mung bean) was grown in a randomized pot experiment with recommended and higher application rates of pesticides. Colony counts enumerating specific microbial populations, viz. fungi, Pseudomonas, nitrogen-fixing bacteria, and phosphate-solubilizing microorganisms, were performed. In addition, several plant growth parameters such as root and shoot lengths were also monitored. It was observed that the pesticides exerted a suppressive effect on different microbial communities under study in the initial 30 days period. The bacterial and fungal populations in chlorpyrifos treated plants increased thereafter. Endosulfan resulted in enhancement of fungi and nitrogen-fixing bacteria, although phosphate-solubilizing microorganisms were suppressed at higher application rates. Azadirachtin, which is gaining popularity owing to its biological origin, did not result in enhancement of any microbial populations; on the other hand, it had a deleterious effect on phosphate-solubilizing bacteria. This study is the first to evaluate the non-target effects of pesticides with a comparison between chemical- and bio-pesticides, and also stresses the importance of critical investigation of bio-pesticides before their wide spread application in agriculture.

  17. Biochemical studies of amylase, lipase and protease in Callosobruchus maculatus (Coleoptera: Chrysomelidae) populations fed with Vigna unguiculata grain cultivated with diazotrophic bacteria strains.

    Science.gov (United States)

    Silva, L B; Torres, É B; Nóbrega, R A S; Lopes, G N; Vogado, R F; Pavan, B E; Fernandes-Junior, P I

    2017-12-01

    The objective of this study was to evaluate the enzymatic activity of homogenates of insects fed on grain of cowpea, Vigna unguiculata (L.), cultivars grown with different nitrogen sources. For the experiment we used aliquots of the homogenate of 100 unsexed adult insects, emerged from 10 g of grain obtained from four cowpea cultivars: 'BRS Acauã', 'BRS Carijó', 'BRS Pujante', and 'BRS Tapaihum' grown under different regimes of nitrogen sources: mineral fertilizer, inoculation with strains of diazotrophs (BR 3267, BR 3262, BR 3299; INPA 03-11B, 03-84 UFLA, as well as the control (with soil nitrogen). The parameters evaluated were enzymatic activities of insect protease, amylase and lipase and the starch content of the grains. There were differences in the enzymatic activity of amylase, lipase and protease of insect homogenate according to the food source. A lower activity of the enzyme amylase from C. maculatus homogenate was observed when insects were fed grain of the cultivar BRS Carijó. A lower activity of lipase enzyme from C. maculatus homogenate was observed when the insects fed on grain from the interaction of the cultivar Tapaihum inoculated with BR 3262 diazotrophs. The lowest proteolytic activity was observed in homogenate of insects fed on interaction of 'BRS Carijó' inoculated with BR 3262 diazotrophs. Starch content correlated positively with the amylase activity of C. maculatus homogenate. The cultivar BRS Carijó had a different behavior from the other cultivars, according to the cluster analysis.

  18. Cowpea (Vigna unguiculata L. Walp), a renewed multipurpose crop for a more sustainable agri-food system: nutritional advantages and constraints.

    Science.gov (United States)

    Gonçalves, Alexandre; Goufo, Piebiep; Barros, Ana; Domínguez-Perles, Raúl; Trindade, Henrique; Rosa, Eduardo A S; Ferreira, Luis; Rodrigues, Miguel

    2016-07-01

    The growing awareness of the relevance of food composition for human health has increased the interest of the inclusion of high proportions of fruits and vegetables in diets. To reach the objective of more balanced diets, an increased consumption of legumes, which constitutes a sustainable source of essential nutrients, particularly low-cost protein, is of special relevance. However, the consumption of legumes also entails some constraints that need to be addressed to avoid a deleterious impact on consumers' wellbeing and health. The value of legumes as a source of nutrients depends on a plethora of factors, including genetic characteristics, agro-climatic conditions, and postharvest management that modulate the dietary effect of edible seeds and vegetative material. Thus, more comprehensive information regarding composition, especially their nutritional and anti-nutritional compounds, digestibility, and alternative processing procedures is essential. These were the challenges to write this review, which focusses on the nutritional and anti-nutritional composition of Vigna unguiculata L. Walp, an emerging crop all over the world intended to provide a rational support for the development of valuable foods and feeds of increased commercial value. © 2016 Society of Chemical Industry. © 2016 Society of Chemical Industry.

  19. Effect of different home-cooking methods on the bioaccessibility of zinc and iron in conventionally bred cowpea (Vigna unguiculata L. Walp) consumed in Brazil.

    Science.gov (United States)

    Pereira, Elenilda J; Carvalho, Lucia M J; Dellamora-Ortiz, Gisela M; Cardoso, Flávio S N; Carvalho, José L V

    2016-01-01

    The cowpea (Vigna unguiculata L. Wap.) is an excellent source of iron and zinc. However, iron from plant sources is poorly absorbed compared with iron from animal sources. The objective of this study was to evaluate iron and zinc bioaccessibility in cowpea cultivars after processing. Zinc and iron bioaccessibilities in cowpea samples were determined based on an in vitro method involving simulated gastrointestinal digestion with suitable modifications. When water-soaked beans were cooked in a regular pan, the highest percentage of bioaccessible iron obtained was 8.92%, whereas when they were cooked in a pressure cooker without previous soaking, the highest percentage was 44.33%. Also, the percentage of bioaccessible zinc was 52.78% when they were cooked in a regular pan without prior soaking. Higher percentages of bioaccessible iron were found when cooking was done in a pressure cooker compared with regular pan cooking. In all cultivars, cooking of cowpea beans in both pressure cooker and in a regular pan yielded higher percentages of bioaccessible zinc compared with availability of bioaccessible iron. Iron bioaccessibility values suggest that cooking in a regular pan did not have a good effect on iron availability, since the percentage of bioaccessible iron was lower than that of zinc. The determination of iron and zinc bioaccessibility makes it possible to find out the actual percentage of absorption of such minerals and allows the development of efficient strategies for low-income groups to access foods with high levels of these micronutrients.

  20. Use of ex vitro composite plants to study the interaction of cowpea (Vigna unguiculata L.) with the root parasitic angiosperm Striga gesnerioides

    Science.gov (United States)

    2012-01-01

    Background Cowpea (Vigna unguiculata L.) is an important grain and forage legume grown throughout sub-Saharan Africa primarily by subsistence farmers on poor, drought prone soils. Genetic improvement of the crop is being actively pursued and numerous functional genomics studies are underway aimed at characterizing gene controlling key agronomic characteristics for disease and pest resistances. Unfortunately, similar to other legumes, efficient plant transformation technology is a rate-limiting step in analysis of gene function in cowpea. Results Here we describe an optimized protocol for the rapid generation of transformed hairy roots on ex vitro composite plants of cowpea using Agrobacterium rhizogenes. We further demonstrate the applicability of cowpea composite plants to study gene expression involved in the resistance response of the plant roots to attack by the root parasitic weed, Striga gesnerioides. The utility of the new system and critical parameters of the method are described and discussed herein. Conclusions Cowpea composite plants offer a rapid alternative to methods requiring stable transformation and whole plant regeneration for studying gene expression in resistance or susceptibility responses to parasitic weeds. Their use can likely be readily adapted to look at the effects of both ectopic gene overexpression as well as gene knockdown of root associated defense responses and to the study of a broader range of root associated physiological and aphysiological processes including root growth and differentiation as well as interactions with other root pests, parasites, and symbionts. PMID:22741546

  1. A multi-parent advanced generation inter-cross (MAGIC) population for genetic analysis and improvement of cowpea (Vigna unguiculata L. Walp.).

    Science.gov (United States)

    Huynh, Bao-Lam; Ehlers, Jeffrey D; Huang, Bevan Emma; Muñoz-Amatriaín, María; Lonardi, Stefano; Santos, Jansen R P; Ndeve, Arsenio; Batieno, Benoit J; Boukar, Ousmane; Cisse, Ndiaga; Drabo, Issa; Fatokun, Christian; Kusi, Francis; Agyare, Richard Y; Guo, Yi-Ning; Herniter, Ira; Lo, Sassoum; Wanamaker, Steve I; Xu, Shizhong; Close, Timothy J; Roberts, Philip A

    2018-03-01

    Multi-parent advanced generation inter-cross (MAGIC) populations are an emerging type of resource for dissecting the genetic structure of traits and improving breeding populations. We developed a MAGIC population for cowpea (Vigna unguiculata L. Walp.) from eight founder parents. These founders were genetically diverse and carried many abiotic and biotic stress resistance, seed quality and agronomic traits relevant to cowpea improvement in the United States and sub-Saharan Africa, where cowpea is vitally important in the human diet and local economies. The eight parents were inter-crossed using structured matings to ensure that the population would have balanced representation from each parent, followed by single-seed descent, resulting in 305 F 8 recombinant inbred lines each carrying a mosaic of genome blocks contributed by all founders. This was confirmed by single nucleotide polymorphism genotyping with the Illumina Cowpea Consortium Array. These lines were on average 99.74% homozygous but also diverse in agronomic traits across environments. Quantitative trait loci (QTLs) were identified for several parental traits. Loci with major effects on photoperiod sensitivity and seed size were also verified by biparental genetic mapping. The recombination events were concentrated in telomeric regions. Due to its broad genetic base, this cowpea MAGIC population promises breakthroughs in genetic gain, QTL and gene discovery, enhancement of breeding populations and, for some lines, direct releases as new varieties. © 2018 The Authors. The Plant Journal published by John Wiley & Sons Ltd and Society for Experimental Biology.

  2. A major QTL corresponding to the Rk locus for resistance to root-knot nematodes in cowpea (Vigna unguiculata L. Walp.).

    Science.gov (United States)

    Huynh, Bao-Lam; Matthews, William C; Ehlers, Jeffrey D; Lucas, Mitchell R; Santos, Jansen R P; Ndeve, Arsenio; Close, Timothy J; Roberts, Philip A

    2016-01-01

    Genome resolution of a major QTL associated with the Rk locus in cowpea for resistance to root-knot nematodes has significance for plant breeding programs and R gene characterization. Cowpea (Vigna unguiculata L. Walp.) is a susceptible host of root-knot nematodes (Meloidogyne spp.) (RKN), major plant-parasitic pests in global agriculture. To date, breeding for host resistance in cowpea has relied on phenotypic selection which requires time-consuming and expensive controlled infection assays. To facilitate marker-based selection, we aimed to identify and map quantitative trait loci (QTL) conferring the resistance trait. One recombinant inbred line (RIL) and two F2:3 populations, each derived from a cross between a susceptible and a resistant parent, were genotyped with genome-wide single nucleotide polymorphism (SNP) markers. The populations were screened in the field for root-galling symptoms and/or under growth-chamber conditions for nematode reproduction levels using M. incognita and M. javanica biotypes. One major QTL was mapped consistently on linkage group VuLG11 of each population. By genotyping additional cowpea lines and near-isogenic lines derived from conventional backcrossing, we confirmed that the detected QTL co-localized with the genome region associated with the Rk locus for RKN resistance that has been used in conventional breeding for many decades. This chromosomal location defined with flanking markers will be a valuable target in marker-assisted breeding and for positional cloning of genes controlling RKN resistance.

  3. Polyphenolic extracts from cowpea (Vigna unguiculata) protect colonic myofibroblasts (CCD18Co cells) from lipopolysaccharide (LPS)-induced inflammation--modulation of microRNA 126.

    Science.gov (United States)

    Ojwang, Leonnard O; Banerjee, Nivedita; Noratto, Giuliana D; Angel-Morales, Gabriela; Hachibamba, Twambo; Awika, Joseph M; Mertens-Talcott, Susanne U

    2015-01-01

    Cowpea (Vigna unguiculata) is a drought tolerant crop with several agronomic advantages over other legumes. This study evaluated varieties from four major cowpea phenotypes (black, red, light brown and white) containing different phenolic profiles for their anti-inflammatory property on non-malignant colonic myofibroblasts (CCD18Co) cells challenged with an endotoxin (lipopolysaccharide, LPS). Intracellular reactive oxygen species (ROS) assay on the LPS-stimulated cells revealed antioxidative potential of black and red cowpea varieties. Real-time qRT-PCR analysis in LPS-stimulated cells revealed down-regulation of proinflammatory cytokines (IL-8, TNF-α, VCAM-1), transcription factor NF-κB and modulation of microRNA-126 (specific post-transcriptional regulator of VCAM-1) by cowpea polyphenolics. The ability of cowpea polyphenols to modulate miR-126 signaling and its target gene VCAM-1 were studied in LPS-stimulated endothelial cells transfected with a specific inhibitor of miR-126, and treated with 10 mg GAE/L black cowpea extract where the extract in part reversed the effect of the miR-126 inhibitor. This suggests that cowpea may exert their anti-inflammatory activities at least in part through induction of miR-126 that then down-regulate VCAM-1 mRNA and protein expressions. Overall, Cowpea therefore is promising as an anti-inflammatory dietary component.

  4. Tillage and residue management effect on soil properties, crop performance and energy relations in greengram (Vigna radiata L. under maize-based cropping systems

    Directory of Open Access Journals (Sweden)

    J.R. Meena

    2015-12-01

    Full Text Available Effect of tillage and crop residue management on soil properties, crop performance, energy relations and economics in greengram (Vigna radiata L. was evaluated under four maize-based cropping systems in an Inceptisol of Delhi, India. Soil bulk density, hydraulic conductivity and aggregation at 0–15 cm layer were significantly affected both by tillage and cropping systems, while zero tillage significantly increased the soil organic carbon content. Yields of greengram were significantly higher in maize–chickpea and maize–mustard systems, more so with residue addition. When no residue was added, conventional tillage required 20% higher energy inputs than the zero tillage, while the residue addition increased the energy output in both tillage practices. Maize–wheat–greengram cropping system involved the maximum energy requirement and the cost of production. However, the largest net return was obtained from the maize–chickpea–greengram system under the conventional tillage with residue incorporation. Although zero tillage resulted in better aggregation, C content and N availability in soil, and reduced the energy inputs, cultivation of summer greengram appeared to be profitable under conventional tillage system with residue incorporation.

  5. Effect of Trichoderma harzianum biomass and Bradyrhizobium sp. strain NC 92 to control leaf blight disease of bambara groundnut (Vigna subterranea caused by Rhizoctonia solani in the field

    Directory of Open Access Journals (Sweden)

    Mana Kanjanamaneesathian

    2007-01-01

    Full Text Available Four hundred and sixty two strains of Trichoderma spp. were isolated from 23 soil samples in which groundnut (Arachis hypogaea L. and bambara groundnut (Vigna subterranea L. had been planted in Songkhla, Phattalung, Nakhon Si Thammarat, Narathiwat and Yala provinces. These fungi were tested against Rhizoctonia solani, a causal agent of leaf blight of bambara groundnut, using dual culture technique on PDA medium. Among 462 isolates tested, 226 isolates had an ability to overgrow R. solani completely. Further testing found 13 isolates having the ability to parasitize mycelia of R. solani. Among these isolates, ThB-1-54 produced a cellulolytic enzyme on congo-red agar. This isolate was later identified as T. harzianum Rifai. In the field test, applying biomass of the isolate ThB-1-54 cultured on ground mesocarp fiber of oil palm, the combination of the isolate ThB-1-54 on ground mesocarp fiber of oil palm and Bradyrhizobium sp. (strain NC 92, or fungicide (iprodione had no effect on disease severity, yield, or the amount of total nitrogen content in stems or seeds of bambara groundnut plant.

  6. A facile biomimetic preparation of highly stabilized silver nanoparticles derived from seed extract of Vigna radiata and evaluation of their antibacterial activity

    Science.gov (United States)

    Choudhary, Manoj Kumar; Kataria, Jyoti; Cameotra, Swaranjit Singh; Singh, Jagdish

    2016-01-01

    The significant antibacterial activity of silver nanoparticles draws the major attention toward the present nanobiotechnology. Also, the use of plant material for the synthesis of metal nanoparticles is considered as a green technology. In this context, a non-toxic, eco-friendly, and cost-effective method has been developed for the synthesis of silver nanoparticles using seed extract of mung beans ( Vigna radiata). The synthesized nanoparticles have been characterized by UV-visible spectroscopy (UV-Vis), Fourier transform infrared spectroscopy (FT-IR), transmission electron microscopy (TEM), atomic absorption spectroscopy (AAS), and X-ray diffraction (XRD). The UV-visible spectrum showed an absorption peak at around 440 nm. The different types of phytochemicals present in the seed extract synergistically reduce the Ag metal ions, as each phytochemical is unique in terms of its structure and antioxidant function. The colloidal silver nanoparticles were observed to be highly stable, even after 5 months. XRD analysis showed that the silver nanoparticles are crystalline in nature with face-centered cubic geometry and the TEM micrographs showed spherical particles with an average size of 18 nm. Further, the antibacterial activity of silver nanoparticles was evaluated by well-diffusion method and it was observed that the biogenic silver nanoparticles have an effective antibacterial activity against Escherichia coli and Staphylococcus aureus. The outcome of this study could be useful for nanotechnology-based biomedical applications.

  7. Structural characterization of silver nanoparticles phyto-mediated by a plant waste, seed hull of Vigna mungo and their biological applications

    Science.gov (United States)

    Varadavenkatesan, Thivaharan; Vinayagam, Ramesh; Selvaraj, Raja

    2017-11-01

    Nanobiotechnology has rapidly become a critical facet of nanotechnology. The green synthesis of silver nanoparticles, making use of the hull of black gram (Vigna mungo), paves the way for a simple and eco-friendly utilization of a domestic waste to a product with antioxidant and anticoagulant activities. The emergence of silver nanoparticles was characterized by a variety of methods UV-visible spectrophotometry, scanning electron microscopy added to energy dispersive spectroscopy, X-ray diffractometry, particle size distribution and FT-IR spectroscopy analyses. A discrete band at 421 nm was obtained from UV-visible spectroscopy of the silver nanoparticle suspension. The extract sourced from the hull of black gram showed evidence of the presence of a variety of functional moieties of phytochemicals using FTIR spectroscopy. These were also deemed responsible for maintaining the stability of silver nanoparticles. SEM and EDAX techniques combined, proved that the zero-valent silver nanoparticles were lesser than 100 nm in size. The crystallinity of the nanoparticles was confirmed, as deduced by the (1 1 1) plane, from XRD analysis. The potential of the phytochemicals in maintaining the steadiness of nanoparticles was implied by the zeta potential value that stood at -30.3 mV. In the current study, we have endeavored to comprehend the antioxidant and anticoagulant nature of the green-synthesized benign silver nanoparticles.

  8. Physical, proximate, functional and pasting properties of flour produced from gamma irradiated cowpea (Vigna unguiculata, L. Walp)

    International Nuclear Information System (INIS)

    Darfour, B.; Wilson, D.D.; Ofosu, D.O.; Ocloo, F.C.K.

    2012-01-01

    Cowpeas are leguminous seeds widely produced and consumed in most developing countries of sub Saharan Africa. The aim of this study was to determine the physical, proximate, functional and pasting properties of flour obtained from gamma irradiated cowpea. Four cowpea cultivars were irradiated with gamma radiation at dose levels of 0.25, 0.5, 0.75, 1.0 and 1.5 kGy with the unirradiated cultivars serving as controls. The samples were hammer milled, sieved and stored at 4 °C for analysis. Physical, proximate, functional, pasting properties were determined using appropriate methods. In general, the irradiation dose applied to cowpea for insect control did not significantly affect the physical and proximate properties of the flour. However, significant increase (p<0.05) was achieved in paste bulk density, water and oil absorption capacities, foam capacities and least gelation concentrations of flour in general, which may be attributed to the irradiation. The radiation reduced the swelling power and water solubility index significantly. The peak temperature, peak viscosity and setback viscosity of the pastes were significantly (p<0.05) reduced while breakdown viscosity was significantly (p<0.05) increased by the radiation. It was established that the doses used on cowpea affected both the functional and pasting properties of the flour. - Highlights: ► We investigated the effects of gamma irradiation of cowpea on quality characteristics of its resultant flour. ► Flour was prepared from four cowpea cultivars irradiated at 0, 0.25, 0.5, 0.75, 1.0 and 1.5 kGy. ► Proximate and physical properties of flour from irradiated cowpea were generally not affected by the radiation doses used. ► Functional properties of flour samples were affected by gamma irradiation of cowpea. ► Pasting parameters studied were also affected by the radiation at various radiation doses.

  9. Effect of gamma radiation of 60Co in the variability of chinese bean [Vigna unguiculata (l.) Walpers] en R4M4

    International Nuclear Information System (INIS)

    Salmeron E, J.; Bueno J, J.E.; Valencia E, F.; Cervantes S, T.; Cruz T, E. De la

    2007-01-01

    Selection of plants of Chinese bean coming from seed irradiated with gammas of 60 Co in the generation R 4 M 4 (fourth recurrent irradiation, fourth segregate generation) were carried out, taking as selection approaches the plant architecture, the numbers of sheaths for plant, sheath longitude, position of the sheaths, grain size and resistance to plagues and illnesses. 17 lines were selected for grain and 3 lines with fodder characteristics of black grain color were also obtained. (Author)

  10. Silicon and Nitrate Differentially Modulate the Symbiotic Performances of Healthy and Virus-Infected Bradyrhizobium-nodulated Cowpea (Vigna unguiculata), Yardlong Bean (V. unguiculata subsp. sesquipedalis) and Mung Bean (V. radiata).

    Science.gov (United States)

    Izaguirre-Mayoral, Maria Luisa; Brito, Miriam; Baral, Bikash; Garrido, Mario José

    2017-09-15

    The effects of 2 mM silicon (Si) and 10 mM KNO₃ (N)-prime signals for plant resistance to pathogens-were analyzed in healthy and Cowpea chlorotic mottle virus (CCMV) or Cowpea mild mottle virus (CMMV)-infected Bradyrhizobium -nodulated cowpea, yardlong bean and mung bean plants. In healthy plants of the three Vigna taxa, nodulation and growth were promoted in the order of Si + N > N > Si > controls. In the case of healthy cowpea and yardlong bean, the addition of Si and N decreased ureide and α-amino acids (AA) contents in the nodules and leaves in the order of Si + N> N > Si > controls. On the other hand, the addition of N arrested the deleterious effects of CCMV or CMMV infections on growth and nodulation in the three Vigna taxa. However, the addition of Si or Si + N hindered growth and nodulation in the CCMV- or CMMV-infected cowpea and yardlong bean, causing a massive accumulation of ureides in the leaves and nodules. Nevertheless, the AA content in leaves and nodules of CCMV- or CMMV-infected cowpea and yardlong bean was promoted by Si but reduced to minimum by Si + N. These results contrasted to the counteracting effects of Si or Si + N in the CCMV- and CMMV-infected mung bean via enhanced growth, nodulation and levels of ureide and AA in the leaves and nodules. Together, these observations suggest the fertilization with Si + N exclusively in virus-free cowpea and yardlong bean crops. However, Si + N fertilization must be encouraged in virus-endangered mung bean crops to enhance growth, nodulation and N-metabolism. It is noteworthy to see the enhanced nodulation of the three Vigna taxa in the presence of 10 mM KNO₃.

  11. Influence de différents traitements de prégermination des graines de Vigna unguiculata (L. Walp. sur les performances germinatives et la tolérance au stress hydrique

    Directory of Open Access Journals (Sweden)

    Boucelha, L.

    2015-01-01

    Full Text Available Influence of different pre-germination treatments of Vigna unguiculata (L. Walp. seeds on germination performance and water stress tolerance. Description of the subject. Priming or hardening is a pregermination treatment. This treatment consists of incorporating an osmotic seed treatment (osmopriming or a hormonal (hormopriming and/or a redehydration (hydropriming treatment. The approach allows the elimination of dormancy, homogenization (synchronization of germination, better growth, earlier flowering and a tolerance to abiotic stresses such as drought and salinity. In this kind of treatment, the seed is soaked and then dehydrated before radicle breakthrough, i.e. during the reversible phase of germination. Thus, the seed can return to its initial stage without any damage. Objectives. In this paper, we aimed to study the consequences of hydropriming and osmopriming (by PEG6000 at 10 and 30% on cowpea seeds (Vigna unguiculata, on germination performance and on the water stress tolerance of plants from these seeds. Method. Vigna unguiculata seeds were hydroprimed, hydroprimed twice or osmoprimed (with PEG6000 10 and 30%. For each treatment, germination performance (germination capacity, speed and the water stress tolerance of the plants were studied. Results. Results showed that increased hardness of the seed allowed a faster, more uniform germination and better growth of both the radicle and aerial parts. We also demonstrated that a double redehydration was more effective in improving these parameters. Conclusions. Application of these pretreatments, adapted according to the plant species, will has the capacity to improve seed germination and crop yield, as well as tolerance to water deficit.

  12. Γ-Ionizing radiation activated EGFR-p38/ERK-STAT3/CREB-1-EMT pathway for promotion of the migration/invasion of lung cancer cell and its inhibition by podophyllotoxin acetate

    Energy Technology Data Exchange (ETDEWEB)

    Cho, Jeong Hyun; Um, Hong Duck; Park, Jong Kuk [Korea Institute of Radiological and Medical Sciences, Seoul (Korea, Republic of)

    2016-05-15

    In this study, we sought to identify the intracellular machinery responsible for IR induced cancer invasion/migration. We report that IR activates the EGFR - p38/ERK - CREB-1/STAT3 pathway, which triggers EMT and increases invasion/migration of lung cancer. Moreover, we show that podophyllotoxin acetate (PA) inhibits IR-induced invasion/migration at least partly by blocking EGFR - p38/ERK - STAT3/ CREB-1signaling and thereby suppressing EMT. Our results revealed that IR increased the invasion/migration of A549 cells, and this effect was decreased by 10 nM PA treatment. PA also inhibited the expressions/activities of matrix metalloprotase (MMP) -2, MMP-9, and vimentin, suggesting that PA could block the IR-induced epithelial-mesenchymal transition (EMT). The IR induced increases in invasion/migration were associated with the activation of EGFR-AKT, and PA inhibited this effect. P38 and p44/42 ERK were also involved in IR induced invasion/migration, and combined treatments with PA plus inhibitors of each MAPK synergistically blocked this invasion/migration. In terms of transcription factors (TFs), IR-induced increases in cyclic AMP response element-binding protein-1 (CREB-1) and signal transducer and activator of transcription 3 (STAT3) increased invasion/migration and EMT. PA also inhibited these transcription factors and then blocked IR-induced invasion/migration.

  13. Γ-Ionizing radiation activated EGFR-p38/ERK-STAT3/CREB-1-EMT pathway for promotion of the migration/invasion of lung cancer cell and its inhibition by podophyllotoxin acetate

    International Nuclear Information System (INIS)

    Cho, Jeong Hyun; Um, Hong Duck; Park, Jong Kuk

    2016-01-01

    In this study, we sought to identify the intracellular machinery responsible for IR induced cancer invasion/migration. We report that IR activates the EGFR - p38/ERK - CREB-1/STAT3 pathway, which triggers EMT and increases invasion/migration of lung cancer. Moreover, we show that podophyllotoxin acetate (PA) inhibits IR-induced invasion/migration at least partly by blocking EGFR - p38/ERK - STAT3/ CREB-1signaling and thereby suppressing EMT. Our results revealed that IR increased the invasion/migration of A549 cells, and this effect was decreased by 10 nM PA treatment. PA also inhibited the expressions/activities of matrix metalloprotase (MMP) -2, MMP-9, and vimentin, suggesting that PA could block the IR-induced epithelial-mesenchymal transition (EMT). The IR induced increases in invasion/migration were associated with the activation of EGFR-AKT, and PA inhibited this effect. P38 and p44/42 ERK were also involved in IR induced invasion/migration, and combined treatments with PA plus inhibitors of each MAPK synergistically blocked this invasion/migration. In terms of transcription factors (TFs), IR-induced increases in cyclic AMP response element-binding protein-1 (CREB-1) and signal transducer and activator of transcription 3 (STAT3) increased invasion/migration and EMT. PA also inhibited these transcription factors and then blocked IR-induced invasion/migration

  14. INHIBITION IN SPEAKING PERFORMANCE

    OpenAIRE

    Humaera, Isna

    2015-01-01

    The most common problem encountered by the learner in the languageacquisition process is learner inhibition. Inhibition refers to a temperamentaltendency to display wariness, fearfulness, or restrain in response tounfamiliar people, objects, and situations. There are some factors that causeinhibition, such as lack of motivation, shyness, self-confidence, self-esteem,and language ego. There are also levels of inhibition, it refers to kinds ofinhibition and caused of inhibition itself. Teacher ...

  15. Ionizing radiation, radiation sources, radiation exposure, radiation effects. Pt. 2

    International Nuclear Information System (INIS)

    Schultz, E.

    1985-01-01

    Part 2 deals with radiation exposure due to artificial radiation sources. The article describes X-ray diagnosis complete with an analysis of major methods, nuclear-medical diagnosis, percutaneous radiation therapy, isotope therapy, radiation from industrial generation of nucler energy and other sources of ionizing radiation. In conclusion, the authors attempt to asses total dose, genetically significant dose and various hazards of total radiation exposure by means of a summation of all radiation impacts. (orig./WU) [de

  16. Effect of Radiation Processing on Protein Quality of Certain Legumes

    International Nuclear Information System (INIS)

    El-Niely, H.F.G

    2007-01-01

    The Effects of irradiation (dose levels of 5, 7.5 and 10 kGy) on nutritive characteristics of peas (Pisum satinum L), cow peas (Vigna unguiculata L.Walp), lentils (Lens culinaris Med), kidney beans (Phaseolus vulgaris L), and chickpeas (Cicer arietinurn L) were examined. Analyses included proximate composition, levels of anti-nutrients (phytic acid, tannins), available lysine (AL), in vitro protein digestibility (IVPD), and protein efficiency ratio (PER) in the growing rat. The results showed that moisture, crude protein, crude fat, crude fiber, and ash were unchanged by the irradiation. Radiation processing significantly (p<0.05) reduced the levels of phytic acid (PA), tannins (TN), and available lysine (AE). IVPD and PER were significantly enhanced in a dose-dependent manner, relative to unirradiated control samples, for all legumes. The data sets for each legume exhibited high correlation coefficients between radiation dose and PA, TN, AE, IVPD, and PER. These results demonstrate the benefits of irradiation on the nutritional properties of these legumes

  17. Atoms, radiation, and radiation protection

    International Nuclear Information System (INIS)

    Turner, J.E.

    1986-01-01

    This book describes basic atomic and nuclear structure, the physical processes that result in the emission of ionizing radiations, and external and internal radiation protection criteria, standards, and practices from the standpoint of their underlying physical and biological basis. The sources and properties of ionizing radiation-charged particles, photons, and neutrons-and their interactions with matter are discussed in detail. The underlying physical principles of radiation detection and systems for radiation dosimetry are presented. Topics considered include atomic physics and radiation; atomic structure and radiation; the nucleus and nuclear radiation; interaction of heavy charged particles with matter; interaction of beta particles with matter; phenomena associated with charged-particle tracks; interaction of photons with matter; neutrons, fission and criticality; methods of radiation detection; radiation dosimetry; chemical and biological effects of radiation; radiation protection criteria and standards; external radiation protection; and internal dosimetry and radiation protection

  18. Natural radiation

    International Nuclear Information System (INIS)

    Feliciano, Vanusa Maria Delage

    2016-01-01

    Cosmic radiation, as well as cosmogenic radiation, terrestrial radiation, radon and thorium are introduced in this chapter 3. The distribution of natural radiation sources is treated, where the percentage distribution of the contribution relative to exposure to radiation from natural and artificial sources is also included

  19. Genotypic difference in "1"3"7Cs accumulation and transfer from the contaminated field in Fukushima to azuki bean (Vigna angularis)

    International Nuclear Information System (INIS)

    Win, Khin Thuzar; Oo, Aung Zaw; Kojima, Katsuhiro; Salem, Djedidi; Yamaya, Hiroko; Bellingrath-Kimura, Sonoko Dorothea; Tomooka, Norihiko; Kaga, Akito; Ohkama-Ohtsu, Naoko; Yokoyama, Tadashi

    2016-01-01

    The screening of mini-core collection of azuki bean accessions (Vigna angularis (Willd.) Ohwi & Ohashi) for comparative uptake of "1"3"7Cs in their edible portions was done in field trials on land contaminated by the Fukushima Daiichi Nuclear Power Plant (FDNPP) accident. Ninety seven azuki bean accessions including their wild relatives from a Japanese gene bank, were grown in a field in the Fukushima prefecture, which is located approximately 51 km north of FDNPP. The contamination level of the soil was 3665 ± 480 Bq kg"−"1 dry weight ("1"3"7Cs, average ± SD). The soil type comprised clay loam, where the sand: silt: clay proportion was 42:21:37. There was a significant varietal difference in the biomass production, radiocaesium accumulation and transfer factor (TF) of radiocaesium from the soil to edible portion. Under identical agricultural practice, the extent of "1"3"7Cs accumulation by seeds differed between the accessions by as much as 10-fold. Inter-varietal variation was expressed at the ratio of the maximum to minimum observed "1"3"7Cs transfer factor for seeds ranged from 0.092 to 0.009. The total biomass, time to flowering and maturity, and seed yield had negative relationship to "1"3"7Cs activity concentration in seeds. The results suggest that certain variety/varieties of azuki bean which accumulated less "1"3"7Cs in edible portion with preferable agronomic traits are suitable to reduce the "1"3"7Cs accumulation in food chain on contaminated land. - Highlights: • Varietal difference in the biomass, "1"3"7Cs accumulation and transfer factor was found in azuki. • "1"3"7Cs accumulation by seeds differed between the azuki bean accessions by as much as 10 folds. • Different accumulation patterns among the azuki bean accessions depends on their growth performance.

  20. Effect of different home-cooking methods on the bioaccessibility of zinc and iron in conventionally bred cowpea (Vigna unguiculata L. Walp consumed in Brazil

    Directory of Open Access Journals (Sweden)

    Elenilda J. Pereira

    2016-03-01

    Full Text Available Background: The cowpea (Vigna unguiculata L. Wap. is an excellent source of iron and zinc. However, iron from plant sources is poorly absorbed compared with iron from animal sources. Objectives: The objective of this study was to evaluate iron and zinc bioaccessibility in cowpea cultivars after processing. Methods: Zinc and iron bioaccessibilities in cowpea samples were determined based on an in vitro method involving simulated gastrointestinal digestion with suitable modifications. Results: When water-soaked beans were cooked in a regular pan, the highest percentage of bioaccessible iron obtained was 8.92%, whereas when they were cooked in a pressure cooker without previous soaking, the highest percentage was 44.33%. Also, the percentage of bioaccessible zinc was 52.78% when they were cooked in a regular pan without prior soaking. Higher percentages of bioaccessible iron were found when cooking was done in a pressure cooker compared with regular pan cooking. In all cultivars, cooking of cowpea beans in both pressure cooker and in a regular pan yielded higher percentages of bioaccessible zinc compared with availability of bioaccessible iron. Conclusions: Iron bioaccessibility values suggest that cooking in a regular pan did not have a good effect on iron availability, since the percentage of bioaccessible iron was lower than that of zinc. The determination of iron and zinc bioaccessibility makes it possible to find out the actual percentage of absorption of such minerals and allows the development of efficient strategies for low-income groups to access foods with high levels of these micronutrients.

  1. Gel-free/label-free proteomic, photosynthetic, and biochemical analysis of cowpea (Vigna unguiculata [L.] Walp.) resistance against Cowpea severe mosaic virus (CPSMV).

    Science.gov (United States)

    Varela, Anna Lidia N; Komatsu, Setsuko; Wang, Xin; Silva, Rodolpho G G; Souza, Pedro Filho N; Lobo, Ana Karla M; Vasconcelos, Ilka M; Silveira, Joaquim A G; Oliveira, Jose T A

    2017-06-23

    Cowpea severe mosaic virus (CPSMV) causes significant losses in cowpea (Vigna unguiculata) production. In this present study biochemical, physiological, and proteomic analysis were done to identify pathways and defense proteins that are altered during the incompatible interaction between the cowpea genotype BRS-Marataoã and CPSMV. The leaf protein extracts from mock- (MI) and CPSMV-inoculated plantlets (V) were evaluated at 2 and 6days post-inoculation (DPI). Data support the assumptions that increases in biochemical (high hydrogen peroxide, antioxidant enzymes, and secondary compounds) and physiological responses (high photosynthesis index and chlorophyll content), confirmed by label-free comparative proteomic approach, in which quantitative changes in proteasome proteins, proteins related to photosynthesis, redox homeostasis, regulation factors/RNA processing proteins were observed may be implicated in the resistance of BRS-Marataoã to CPSMV. This pioneering study provides information for the selection of specific pathways and proteins, altered in this incompatible relationship, which could be chosen as targets for detailed studies to advance our understanding of the molecular, physiological, and biochemistry basis of the resistance mechanism of cowpea and design approachs to engineer plants that are more productive. This is a pioneering study in which an incompatible relationship between a resistant cowpea and Cowpea severe mosaic virus (CPSMV) was conducted to comparatively evaluate proteomic profiles by Gel-free/label-free methodology and some physiological and biochemical parameters to shed light on how a resistant cowpea cultivar deals with the virus attack. Specific proteins and associated pathways were altered in the cowpea plants challenged with CPSMV and will contribute to our knowledge on the biological process tailored by cowpea in response to CPSMV. Copyright © 2017 Elsevier B.V. All rights reserved.

  2. Transcriptional profiling of root-knot nematode induced feeding sites in cowpea (Vigna unguiculata L. Walp. using a soybean genome array

    Directory of Open Access Journals (Sweden)

    Das Sayan

    2010-08-01

    Full Text Available Abstract Background The locus Rk confers resistance against several species of root-knot nematodes (Meloidogyne spp., RKN in cowpea (Vigna unguiculata. Based on histological and reactive oxygen species (ROS profiles, Rk confers a delayed but strong resistance mechanism without a hypersensitive reaction-mediated cell death process, which allows nematode development but blocks reproduction. Results Responses to M. incognita infection in roots of resistant genotype CB46 and a susceptible near-isogenic line (null-Rk were investigated using a soybean Affymetrix GeneChip expression array at 3 and 9 days post-inoculation (dpi. At 9 dpi 552 genes were differentially expressed in incompatible interactions (infected resistant tissue compared with non-infected resistant tissue and 1,060 genes were differentially expressed in compatible interactions (infected susceptible tissue compared with non-infected susceptible tissue. At 3 dpi the differentially expressed genes were 746 for the incompatible and 623 for the compatible interactions. When expression between infected resistant and susceptible genotypes was compared, 638 and 197 genes were differentially expressed at 9 and 3 dpi, respectively. Conclusions In comparing the differentially expressed genes in response to nematode infection, a greater number and proportion of genes were down-regulated in the resistant than in the susceptible genotype, whereas more genes were up-regulated in the susceptible than in the resistant genotype. Gene ontology based functional categorization revealed that the typical defense response was partially suppressed in resistant roots, even at 9 dpi, allowing nematode juvenile development. Differences in ROS concentrations, induction of toxins and other defense related genes seem to play a role in this unique resistance mechanism.

  3. Genome wide linkage disequilibrium in Chinese asparagus bean (Vigna. unguiculata ssp. sesquipedialis) germplasm: implications for domestication history and genome wide association studies.

    Science.gov (United States)

    Xu, P; Wu, X; Wang, B; Luo, J; Liu, Y; Ehlers, J D; Close, T J; Roberts, P A; Lu, Z; Wang, S; Li, G

    2012-07-01

    Association mapping of important traits of crop plants relies on first understanding the extent and patterns of linkage disequilibrium (LD) in the particular germplasm being investigated. We characterize here the genetic diversity, population structure and genome wide LD patterns in a set of asparagus bean (Vigna. unguiculata ssp. sesquipedialis) germplasm from China. A diverse collection of 99 asparagus bean and normal cowpea accessions were genotyped with 1127 expressed sequence tag-derived single nucleotide polymorphism markers (SNPs). The proportion of polymorphic SNPs across the collection was relatively low (39%), with an average number of SNPs per locus of 1.33. Bayesian population structure analysis indicated two subdivisions within the collection sampled that generally represented the 'standard vegetable' type (subgroup SV) and the 'non-standard vegetable' type (subgroup NSV), respectively. Level of LD (r(2)) was higher and extent of LD persisted longer in subgroup SV than in subgroup NSV, whereas LD decayed rapidly (0-2 cM) in both subgroups. LD decay distance varied among chromosomes, with the longest (≈ 5 cM) five times longer than the shortest (≈ 1 cM). Partitioning of LD variance into within- and between-subgroup components coupled with comparative LD decay analysis suggested that linkage group 5, 7 and 10 may have undergone the most intensive epistatic selection toward traits favorable for vegetable use. This work provides a first population genetic insight into domestication history of asparagus bean and demonstrates the feasibility of mapping complex traits by genome wide association study in asparagus bean using a currently available cowpea SNPs marker platform.

  4. Caracterização química, atividade antioxidante e formulação de doces com feijão azuki (Vigna angularis

    Directory of Open Access Journals (Sweden)

    Daniela Castilho Orsi

    2017-08-01

    Full Text Available Resumo No Japão, o feijão azuki é comumente usado na elaboração de doce, observando-se que a sua casca vermelha é rica em antioxidantes. No Brasil, o feijão azuki ainda é pouco consumido e o doce de feijão é pouco conhecido pelos brasileiros. O objetivo deste estudo foi caracterizar quimicamente o feijão azuki vermelho (Vigna angularis, bem como avaliar a influência do cozimento sobre o seu teor de compostos fenólicos e a sua atividade antioxidante. Buscou-se também avaliar a composição química dos doces formulados com feijão azuki. Os resultados obtidos para a composição química mostraram que o feijão azuki apresentou elevados teores de carboidratos (65,60 g/100 g e proteínas (17,87 g/100 g. O feijão azuki cozido, comparado ao feijão azuki cru, perdeu grande parte dos compostos fenólicos, mas ainda manteve quase metade da atividade antioxidante. Os doces de feijão azuki em massa e em pasta apresentaram, respectivamente, alto teor de carboidratos de 67,09 e 46,20 g/100 g, teores de proteínas de 4,02 e 6,48 g/100 g, e baixo teor de lipídios de 0,33 e 2,73 g/100 g. O feijão azuki vermelho mostrou ter um bom potencial tecnológico para sua utilização no processamento dos doces de feijão.

  5. CARACTERÍSTICAS DA SOLUBILIDADE PROTÉICA E ISOLAMENTO DA GLOBULINA PRINCIPAL DE CAUPÍ (Vigna unguiculata (L. Walp. CULTIVAR BR 14-MULATO

    Directory of Open Access Journals (Sweden)

    Valdir Augusto NEVES

    2009-07-01

    Full Text Available

    O objetivo do trabalho foi determinar a composição química, características de solubilidade das proteínas e o isolamento da globulina principal de caupí cultivar BR-14 Mulato. A farinha descorticada apresentou 29,32% de proteína, 3,59% de cinzas, 1,4% de extrato etéreo. A solubilidade das proteínas da farinha mostrou-se dependente das condições de extração, tais como: tipo e concentração de sal, tempo e pH. A extração fracionada e seqüencial das proteínas mostrou que 77,94% da proteína total foi solubilizada, a fração globulina com 41,99% do total, seguido da albumina 10,11% e glutelina 7,81%. A globulina principal isolada e submetida à cromatografia de filtração em gel mostrou um peso molecular de 174 kDa. Apresentou um elevado grau de homogeneidade na eletroforese em gel de poliacrilamida contendo dodecilsulfato de sódio, revelando ser constituída de cerca de 5 subunidades, com predomínio de duas majoritárias na faixa de 40 a 50 kDa e um teor de glícides de 1,10%. PALAVRAS-CHAVE: Caupí BR-14 MULATO; Vigna unguiculata; composição química; solubilidade; fracionamento.

  6. Transcriptional Slippage and RNA Editing Increase the Diversity of Transcripts in Chloroplasts: Insight from Deep Sequencing of Vigna radiata Genome and Transcriptome.

    Directory of Open Access Journals (Sweden)

    Ching-Ping Lin

    Full Text Available We performed deep sequencing of the nuclear and organellar genomes of three mungbean genotypes: Vigna radiata ssp. sublobata TC1966, V. radiata var. radiata NM92 and the recombinant inbred line RIL59 derived from a cross between TC1966 and NM92. Moreover, we performed deep sequencing of the RIL59 transcriptome to investigate transcript variability. The mungbean chloroplast genome has a quadripartite structure including a pair of inverted repeats separated by two single copy regions. A total of 213 simple sequence repeats were identified in the chloroplast genomes of NM92 and RIL59; 78 single nucleotide variants and nine indels were discovered in comparing the chloroplast genomes of TC1966 and NM92. Analysis of the mungbean chloroplast transcriptome revealed mRNAs that were affected by transcriptional slippage and RNA editing. Transcriptional slippage frequency was positively correlated with the length of simple sequence repeats of the mungbean chloroplast genome (R2=0.9911. In total, 41 C-to-U editing sites were found in 23 chloroplast genes and in one intergenic spacer. No editing site that swapped U to C was found. A combination of bioinformatics and experimental methods revealed that the plastid-encoded RNA polymerase-transcribed genes psbF and ndhA are affected by transcriptional slippage in mungbean and in main lineages of land plants, including three dicots (Glycine max, Brassica rapa, and Nicotiana tabacum, two monocots (Oryza sativa and Zea mays, two gymnosperms (Pinus taeda and Ginkgo biloba and one moss (Physcomitrella patens. Transcript analysis of the rps2 gene showed that transcriptional slippage could affect transcripts at single sequence repeat regions with poly-A runs. It showed that transcriptional slippage together with incomplete RNA editing may cause sequence diversity of transcripts in chloroplasts of land plants.

  7. Resistência de genótipos de feijão-caupi [Vigna unguiculata (L. Walp.] ao Ataque do Caruncho Callosobruchus maculatus (Fabr. (Coleoptera: Chrysomelidae

    Directory of Open Access Journals (Sweden)

    Westerllanya Medeiros

    2017-04-01

    Abstract. The Cowpea weevil Callosobruchus maculatus (Fabr. is considered the main Prague during storage of grains of Cowpea [Vigna unguiculata (L. Walp.]. Due to the economic losses caused by this insect, is of paramount importance to develop studies to select varieties resistant to this pest. In this study assessed the effect of genotypes of V. unguiculata about the behavior and the development of C. maculatus in two consecutive generations. The study was conducted in laboratory with conditions of temperature and relative humidity monitored, in completely randomized design using BRS Epace 10, Capela, BRS Urubuquara, BRS Pajeu, Itaim, BRS Rouxinol, Pingo de ouro, BRS Corujinha, IT85 F-2687 and BR 17 Gurguéia genotypes with eight repetitions. In each genotype were confined 10 adults of c. maculatus for it was held the oviposition. After a period of five days, the adults were removed from the pots containing the genotypes. Waited-if the emergence of adults (first generation and new infestation was held in the same access to obtain the second generation. The parameters evaluated were number of eggs, egg viability, total number of adults emergency, viability of immature phase, average period of development and dry weight of adults. IT85 F2687 genotype presented resistance of non-preference for oviposition and the genotypes BR 17 Gurguéia and BRS Urubuquara presented antibiose type resistance in relation to C. maculatus. BR 17 Gurguéia genotype was the strongest among the genotypes studied in relation to c. maculatus. The genotypes Capela and Itaim were characterized as susceptible to C. maculatus.

  8. Kajian Jumlah Biji per Lubang Tanam dan Paket Pupuk terhadap Pertumbuhan dan Hasil Kacang Hijau (Vigna radiata L. Varietas Vima-1

    Directory of Open Access Journals (Sweden)

    I PUTU PANCA DIANTARA PUTRA

    2016-05-01

    Full Text Available Study of the Number of the Amount of Beed a Hole Planting and Packages Fertilizer onGrowth and Yield of Mung Bean (Vigna radiata L. Varieties Vima-1. Mung bean (Vignaradiata L. is one of bean plant – nuts for many consumption in Indonesia. The low productwas’nt cultivation techniques that supposed to, including the amount of seed each holeplanting and fertilizer giving them. The study aims to determine the amount seed hole theplanting and fertilizer best to the growth and yield of mung bean varieties vima-1. Researchcarried out in Subak Basangbe, Perean Kangin village, Baturiti – Tabanan, in October –December, 2014. The study was designed using a factorial randomized block design. The firstfactor the amount of seed a hole planting (1, 2, 3 seed, factor two of fertilizer (organicfertilizer compost, fertilizer chemical urea + TSP + KCl, organic fertilizer liquid biourin,organic fertilizer compost and fertilizer chemical urea + TSP + KCl, organic fertilizercompost and organic fertilizer liquid biourin, fertilizer chemical urea + TSP + KCl andorganic fertilizer liquid biourin. The growth of mung bean varieties Vima-1 is mainly ofplant height and number of leaves affected very real by the number of seeds planting hole andfertilizer package. Treatment of the amount of seed planting hole and fertilizer packages tovery significant effect on yield components, especially the number of pods and number ofseeds of plants on mung bean varieties Vima-1. Treatment of the amount of seed planting holeaffects most of the components of plant growth and yield components of mung bean. Thehighest yield on three planting seeds per hole that is 3,67 t / ha dry weight oven.

  9. Radiation enteritis

    International Nuclear Information System (INIS)

    Ochsner, S.F.; Head, L.H.

    1973-01-01

    A comprehensive review of radiation enteritis is presented. Experience in clinical radiation therapy has indicated that the small bowel is the segment of the alimentary tract that is most susceptible to radiation damage. (U.S.)

  10. Radiation monitor

    International Nuclear Information System (INIS)

    Pao, C.T.; Green, W.K.

    1978-01-01

    A system for indicating radiation from a radioactive fluid such as a gas wherein simultaneous indications of the activity concentration of radioactivity of the gas, the radiation dose rate and average energy of the radiation are provided

  11. Radiation protection

    International Nuclear Information System (INIS)

    Ures Pantazi, M.

    1994-01-01

    This work define procedures and controls about ionizing radiations. Between some definitions it found the following topics: radiation dose, risk, biological effects, international radioprotection bodies, workers exposure, accidental exposure, emergencies and radiation protection

  12. Radiation sickness

    Science.gov (United States)

    ... exposure to ionizing radiation. There are two main types of radiation: nonionizing and ionizing. Nonionizing radiation comes in the form of light, radio waves, microwaves and radar. These forms usually don't cause tissue damage. ...

  13. Preferência do pulgão-preto, Aphis craccivora Koch, a diferentes genótipos de feijão-de-corda, Vigna unguiculata (L. Walp Black aphid, Aphis craccivora Koch, preference to different cowpea, Vigna unguiculata (L. Walp. cultivars

    Directory of Open Access Journals (Sweden)

    João Gutemberg Leite Moraes

    2007-12-01

    Full Text Available Este trabalho foi desenvolvido visando a avaliar a resposta de cultivares de feijão-de-corda, Vigna unguiculata (L. Walp., à presença do pulgão-preto (Aphis craccivora Koch. Os experimentos foram conduzidos de agosto a outubro de 2004, em casa-de-vegetação da Universidade Federal do Ceará (UFC. As cultivares foram: "Epace-10", "Epace-11", "Patativa", "Pingo de Ouro", "Pitiúba", "BR-10 Piauí", "BR-12 Canindé", "BR-14 Mulato" e "BR-17 Gurguéia". O experimento constou de três ensaios, cada um com cinco tratamentos e seis repetições, sendo o delineamento estatístico inteiramente casualizado. Os genótipos foram cultivados em copos plásticos de 300ml e mantidos em gaiolas protegidas por tela antiafídeos. As plantas foram infestadas após doze dias do plantio através da liberação de cinco fêmeas adultas do pulgão-preto por planta. As avaliações foram realizadas após o terceiro e o quinto dia da infestação, constando da contagem direta das formas adulta e jovem do inseto presentes nas plantas. Os dados obtidos foram analisados através de análise de variância e pelo teste de Tukey em 5% de probabilidade de erro. As cultivares "Epace-10" e "Patativa" foram as menos preferidas por A. craccivora.This research was conducted with the intention of evaluating the response of different cowpea, Vigna unguiculata (L. Walp, cultivars to the black aphid (Aphis craccivora Koch. The bioassays were conducted from August through October of 2004 in a greenhouse at the Ceará Federal University (UFC campus. The cowpea cultivars used were: Epace-10, Epace-11, Patativa, Pingo de Ouro, Pitiúba, BR-10 Piauí, BR-12 Canindé, BR-14 Mulato and BR-17 Gurguéia. Each assay had five treatments and six replications in a completely randomized block design. The genotypes were raised in a 300ml plastic cup and maintained in cages protected by an insect proof net. Plants were infested twelve days after planting with five adult females per plant

  14. Ionizing radiation

    International Nuclear Information System (INIS)

    Kruger, J.

    1989-01-01

    Ionizing radiation results in biological damage that differs from other hazardous substances and is highly dangerous to man. Ionizing radiation cannot be perceived by man's sense organs and the biological damage cannot be detected immediately afterwards (except in very high doses). Every human being is exposed to low doses of radiation. The structure of the atom; sources of ionizing radiation; radiation units; biological effects; norms for radiation protection; and the national control in South Africa are discussed. 1 fig., 5 refs

  15. Effet du mode de conservation de l'huile de Jatropha curcas L. sur son efficacité dans la lutte contre les principaux insectes ravageurs du niébé (Vigna unguiculata (L. Walp. au Niger

    Directory of Open Access Journals (Sweden)

    Abdoul Habou, Z.

    2014-01-01

    Full Text Available Influence of the Conservation Mode of Jatropha curcas L. oil on its Efficacy in the Control of Major Insect Pests of Cowpea (Vigna unguiculata (L. Walp in Niger. Jatropha curcas oil has an insecticidal activity harnessed by the farmers in Niger. In this study, we compared the insecticidal activity of two batches of oil conserved during 70 days, one exposed to light and the other kept in the dark. The insecticidal efficacy was evaluated in a field with three concentrations (5, 10 and 15% trial on the main pests of Cowpea (Vigna unguiculata (L. Walp and in a laboratory test on Megalurothrips sjostedti Trybon (Thysanoptera: Thripidae with different concentrations of crude oil (50; 100; 150 and 200 µl. No difference in insecticidal effect was found between the two modes of oil conservation, both in the laboratory and in the field. In the field, regardless of the mode of conservation, the concentrations of 10% of J. curcas oil enables a reduction of over than 80% of thrips, aphids, and bugs compared to the control. Its increased seeds yield more than 50%. The concentration of 15% gives an insecticidal effect comparable to that of the reference treatment (deltaméthrine but induces phytotoxicity symptoms on the leaves of Cowpea.

  16. Specific inhibition of Wee1 kinase and Rad51 recombinase: A strategy to enhance the sensitivity of leukemic T-cells to ionizing radiation-induced DNA double-strand breaks

    International Nuclear Information System (INIS)

    Havelek, Radim; Cmielova, Jana; Kralovec, Karel; Bruckova, Lenka; Bilkova, Zuzana; Fousova, Ivana; Sinkorova, Zuzana; Vavrova, Jirina; Rezacova, Martina

    2014-01-01

    Highlights: • Pre-treatment with the inhibitors increased the sensitivity of Jurkat cells to irradiation. • Combining both inhibitors together resulted in a G2 cell cycle arrest abrogation in Jurkat. • Jurkat cells pre-treated with inhibitors were positive for γH2AX foci 24 h upon irradiation. • Pre-treatment with Rad51 RI-1 had no effect on apoptosis induction in MOLT-4 cells. • When dosed together, the combination decreased MOLT-4 cell survival. - Abstract: Present-day oncology sees at least two-thirds of cancer patients receiving radiation therapy as a part of their anticancer treatment. The objectives of the current study were to investigate the effects of the small molecule inhibitors of Wee1 kinase II (681641) and Rad51 (RI-1) on cell cycle progression, DNA double-strand breaks repair and apoptosis following ionizing radiation exposure in human leukemic T-cells Jurkat and MOLT-4. Pre-treatment with the Wee1 681641 or Rad51 RI-1 inhibitor alone increased the sensitivity of Jurkat cells to irradiation, however combining both inhibitors together resulted in a further enhancement of apoptosis. Jurkat cells pre-treated with inhibitors were positive for γH2AX foci 24 h upon irradiation. MOLT-4 cells were less affected by inhibitors application prior to ionizing radiation exposure. Pre-treatment with Rad51 RI-1 had no effect on apoptosis induction; however Wee1 681641 increased ionizing radiation-induced cell death in MOLT-4 cells

  17. Interactive effects of UV-B irradiation and triadimefon on nodulation and nitrogen metabolism in Vigna radiata plants

    International Nuclear Information System (INIS)

    Rajendiran, K.; Ramanujam, M.P.

    2006-01-01

    Supply of aqueous solution of triadimefon (20 mg/cubic dm) to unstressed green gram plants increased the contents of soluble proteins, amino acids, nitrate and nitrite, and the activity of nitrate reductase in the leaves and nitrate reductase in nodules. The nitrogenase activity in nodules and roots was also increased. Number and fresh mass of nodules and their nitrate and nitrite contents were also higher than those of the controls. In contrast, the UV-B stress (12.2 kJ/square m/d) suppressed nodulation and nitrogen metabolism in leaves and roots in comparison with plants under natural UV-B (10 kJ/square m/d). Triadimefon-treated plants did not show such severe inhibitions after exposure to elevated UV-B. Thus, triadimefon increased their tolerance to UV-B stress

  18. Radiation carcinogenesis

    International Nuclear Information System (INIS)

    1978-01-01

    The Cancergram deals with all aspects of radiation carcinogenesis. The term radiation here includes U-V radiation and the entire electromagnetic spectrum, electron and other charged particle beams, neutrons, and alpha and beta radiation from radioactive substances. Abstracts included concern relationships between radiation and carcinogenesis in humans, experimental induction of tumors in animals by irradiation, studies on the mechanism of radiation carcinogenesis at the cellular level, studies of RBE, dose response or dose threshold in relation to radiation carcinogenesis, and methods and policies for control of radiation exposure in the general population. In general, this Cancergram excludes abstracts on radio-therapy, radiologic diagnosis, radiation pathology, and radiation biology, where these articles have no bearing on radiation carcinogenesis

  19. Physical, proximate, functional and pasting properties of flour produced from gamma irradiated cowpea (Vigna unguiculata, L. Walp)

    Science.gov (United States)

    Darfour, B.; Wilson, D. D.; Ofosu, D. O.; Ocloo, F. C. K.

    2012-04-01

    Cowpeas are leguminous seeds widely produced and consumed in most developing countries of sub Saharan Africa. The aim of this study was to determine the physical, proximate, functional and pasting properties of flour obtained from gamma irradiated cowpea. Four cowpea cultivars were irradiated with gamma radiation at dose levels of 0.25, 0.5, 0.75, 1.0 and 1.5 kGy with the unirradiated cultivars serving as controls. The samples were hammer milled, sieved and stored at 4 °C for analysis. Physical, proximate, functional, pasting properties were determined using appropriate methods. In general, the irradiation dose applied to cowpea for insect control did not significantly affect the physical and proximate properties of the flour. However, significant increase (pcowpea affected both the functional and pasting properties of the flour.

  20. Effect of 8-methoxypsoralen plus long-wave ultraviolet (PUVA) radiation on mast cells. II. In vitro PUVA inhibits degranulation of rat peritoneal mast cells induced by compound 48/80

    International Nuclear Information System (INIS)

    Toda, K.; Danno, K.; Tachibana, T.; Horio, T.

    1986-01-01

    Rat peritoneal mast cells incubated with a histamine liberator, compound 48/80, showed a significantly reduced capacity for releasing histamine following in vitro treatment with 0.1 micrograms/ml of 8-methoxypsoralen (8-MOP) plus 1-5 J/cm2 of long-wave ultraviolet (UVA) irradiation (PUVA). No remarkable inhibition in histamine release was observed in the cells treated with 8-MOP only. Irradiation with 5 J/cm2 of UVA alone exerted an inhibitory effect on histamine release, to a lesser extent than PUVA. PUVA irradiation did not bring any decrease in cell viability or any spontaneous release of histamine from irradiated cells as shown by phase-contrast microscopy and by histamine assay, respectively. These results suggest that PUVA treatment may cause a noncytotoxic disturbance at mast cell membranes or on surface receptors, leading to a decreased capacity for secreting chemical mediators

  1. Radiation practices and radiation measurements

    International Nuclear Information System (INIS)

    2008-03-01

    The guide presents the principal requirements on accuracy of radiation measurements and on the approval, calibration and operating condition inspections of radiation meters, together with requirements for dosimetric services measuring the individual radiation doses of workers engaged in radiation work (approved dosimetric services). The Guide also sets out the definitions of quantities and units used in radiation measurements. The radiation protection quantities used for assessing the harmful effects of radiation and for expressing the maximum values for radiation exposure (equivalent dose and effective dose) are set out in Guide ST 7.2. This Guide concerns measurements of ionizing radiation involved in radiation practices, the results of which are used for determining the radiation exposure of workers engaged in radiation work and members of the public, and of patients subject to the use of radiation in health services, or upon the basis of which compliance with safety requirements of appliances currently in use and of their premises of use or of the workplaces of workers is ensured. The Guide also concerns measurements of the radon concentration of inhaled air in both workplaces and dwellings. The Guide does not apply to determining the radiation exposure of aircrews, determination of exposure caused by internal radiation, or measurements made to protect the public in the event of, or in preparation for abnormal radiation conditions

  2. Infrared Radiation and Blackbody Radiation

    OpenAIRE

    2005-01-01

    tut present graph Tutorial Presentation Graph Interactive Media Element This interactive tutorial covers the following: How infrared radiation was discovered., The regions of infrared radiation and their relations to temperature., The nature of blackbody radiation and Planck's radiation law., The relationship between temperature and the power emitted by radiation.The interactions in this tutorial include clicking to reveal new information, and questions that help students...

  3. Using violet laser-induced chlorophyll fluorescence emission spectra for crop yield assessment of cowpea (Vigna unguiculata (L) Walp) varieties

    Science.gov (United States)

    Anderson, Benjamin; Buah-Bassuah, Paul K.; Tetteh, Jonathan P.

    2004-07-01

    The use of violet laser-induced chlorophyll fluorescence (LICF) emission spectra to monitor the growth of five varieties of cowpea in the University of Cape Coast Botanical Garden is presented. Radiation from a continuous-wave violet laser diode emitting at 396 nm through a fibre is closely incident on in vivo leaves of cowpea to excite chlorophyll fluorescence, which is detected by an integrated spectrometer with CCD readout. The chlorophyll fluorescence spectra with peaks at 683 and 731 nm were used for growth monitoring of the cowpea plants over three weeks and analysed using Gaussian spectral functions with curve fitted parameters to determine the peak positions, area under the spectral curve and the intensity ratio F683/F731. The variation in the intensity ratio of the chlorophyll bands showed sensitive changes indicating the photosynthetic activity of the cowpea varieties. A discussion of the fluorescence result as compared to conventional assessment is presented with regard to discrimination between the cowpea varieties in terms of crop yield performance.

  4. Allelopathic Effect of Wheat and Barley Residues on Yield and Yield Components of Cowpea (Vigna sinensis L. and Weeds Control

    Directory of Open Access Journals (Sweden)

    M Shahbyki

    2018-02-01

    residue at a rate of 4 and 8 ton ha-1 significantly decreased weed density than non-weeding treatment. Seed number per pod, biological and grain yield of cowpea significantly increased in the soil incorporation with wheat residue at a rate of 8 ton ha-1 compared to control. Our results showed that weeding and soil incorporation with wheat residue at a rate of 8 ton ha-1 increased cowpea yield by 78.23 and 80.79% compared to no weeding treatment, respectively. Wheat is a potent source of bioactive phytotoxic compounds representing three main classes as phenolic (hydroxybenzoic, vanillic, pcoumaric, syringic and ferulic acids being most frequently reported and transferulic and trans-pcoumaric acids being the dominant acids, cyclic hydroxamic acids (a class of alkaloids and short chain fatty acids. It is reported that wheat extract compounds can interfere with basic processes of receiver plants as photosynthesis, cell division, respiration and protein synthesis and indirectly provoke other forms of stresses. Thus, these compounds can reduce weed germination and growth. Another important effect of these allelochemicals is the activation of cellular antioxidant system in response to uncontrolled production and accumulation of reactive oxygen species. The reason for increase in grain yield was the control of weeds and probably the allelopathic effects of crop water extracts promoted the wheat growth which ultimately increases grain yield. Conclusions The present study concluded that wheat phytotoxins in straw inhibited germination and seedling growth of weeds, and the inhibition was concentration-dependent. Also wheat straw added to soil increased yield and some traits of cowpea. In general, the results showed that wheat straw can reduce weed suppression and can improve characteristics of plant, moreover, decreased environment risks of chemical inputs and ensure sustainability of production in long time.

  5. Bowman-Birk Protease Inhibitor from Vigna unguiculata Seeds Enhances the Action of Bradykinin-Related Peptides

    Directory of Open Access Journals (Sweden)

    Alice da Cunha M. Álvares

    2014-10-01

    Full Text Available The hydrolysis of bradykinin (Bk by different classes of proteases in plasma and tissues leads to a decrease in its half-life. Here, Bk actions on smooth muscle and in vivo cardiovascular assays in association with a protease inhibitor, Black eyed-pea trypsin and chymotrypsin inhibitor (BTCI and also under the effect of trypsin and chymotrypsin were evaluated. Two synthetic Bk-related peptides, Bk1 and Bk2, were used to investigate the importance of additional C-terminal amino acid residues on serine protease activity. BTCI forms complexes with Bk and analogues at pH 5.0, 7.4 and 9.0, presenting binding constants ranging from 103 to 104 M−1. Formation of BTCI-Bk complexes is probably driven by hydrophobic forces, coupled with slight conformational changes in BTCI. In vitro assays using guinea pig (Cavia porcellus ileum showed that Bk retains the ability to induce smooth muscle contraction in the presence of BTCI. Moreover, no alteration in the inhibitory activity of BTCI in complex with Bk and analogous was observed. When the BTCI and BTCI-Bk complexes were tested in vivo, a decrease of vascular resistance and consequent hypotension and potentiating renal and aortic vasodilatation induced by Bk and Bk2 infusions was observed. These results indicate that BTCI-Bk complexes may be a reliable strategy to act as a carrier and protective approach for Bk-related peptides against plasma serine proteases cleavage, leading to an increase in their half-life. These findings also indicate that BTCI could remain stable in some tissues to inhibit chymotrypsin or trypsin-like enzymes that cleave and inactivate bradykinin in situ.

  6. Bioactive Properties of Phaseolus lunatus (Lima Bean) and Vigna unguiculata (Cowpea) Hydrolyzates Incorporated into Pasta. Residual Activity after Pasta Cooking.

    Science.gov (United States)

    Drago, Silvina R; Franco-Miranda, Hanai; Cian, Raúl E; Betancur-Ancona, David; Chel-Guerrero, Luis

    2016-09-01

    The aims of the study were to study the inclusion of P. lunatus (PLH) and V. unguiculata (VUH) protein hydrolyzates with bioactive properties into a pasta-extruded product and determine residual activity after extrusion or pasta cooking. Both protein hydrolyzates showed angiotensin-converting enzyme inhibition (ACEI) and antioxidant activity (TEAC). PLH showed higher ACEI but lower TEAC than VUH (97.19 ± 0.23 vs. 91.95 ± 0.29 % and 244.7 ± 3.4 vs. 293.7 ± 3.3 μmol Trolox/g, respectively). They were included at 5 or 10 % into wheat pasta. Control pasta had the lowest ACEI activity or TEAC (22.01 ± 0.76 % or 14.14 ± 1.28 μmol Trolox/g, respectively). Higher activity remained in pasta with PLH than VUH after extrusion, and higher the level of addition, higher the ACEI was. Pasta had practically the same ACEI activity after cooking, thus active compounds were not lost by temperature or lixiviation. Regarding TEAC, higher activity remained in pasta with 10 % VUH (31.84 ± 0.17 μmol Trolox/g). Other samples with hydrolyzates had the same activity. After cooking, pasta with hydrolyzates had higher TEAC values than control, but these were not modified by the level of incorporation. Moreover, the profile changed because pasta with PLH had the highest TEAC values (21.39 ± 0.01 and 20.34 ± 0.15 for 5 or 10 % hydrolyzates, respectively). Cooking decreased this activity (~ 20 %), for all samples. Although a certain loss of antioxidant activity was observed, pasta could be a good vehicle for bioactive compounds becoming a functional food.

  7. Biopotency of serine protease inhibitors from cowpea (Vigna unguiculata) seeds on digestive proteases and the development of Spodoptera littoralis (Boisduval).

    Science.gov (United States)

    Abd El-latif, Ashraf Oukasha

    2015-05-01

    Serine protease inhibitors (PIs) have been described in many plant species and are universal throughout the plant kingdom, where trypsin inhibitors is the most common type. In the present study, trypsin and chymotrypsin inhibitory activity was detected in the seed flour extracts of 13 selected cultivars/accessions of cowpea. Two cowpea cultivars, Cream7 and Buff, were found to have higher trypsin and chymotrypsin inhibitory potential compared to other tested cultivars for which they have been selected for further purification studies using ammonium sulfate fractionation and DEAE-Sephadex A-25 column. Cream7-purified proteins showed two bands on sodium dodecyl sulfate polyacrylamide gel electrophoresis (SDS-PAGE) corresponding to molecular mass of 17.10 and 14.90 kDa, while the purified protein from Buff cultivar showed a single band corresponding mass of 16.50 kDa. The purified inhibitors were stable at temperature below 60°C and were active at wide range of pH from 2 to 12. The kinetic analysis revealed noncompetitive type of inhibition for both inhibitors against both enzymes. The inhibitor constant (Ki ) values suggested high affinity between inhibitors and enzymes. Purified inhibitors were found to have deep and negative effects on the mean larval weight, larval mortality, pupation, and mean pupal weight of Spodoptera littoralis, where Buff PI was more effective than Cream7 PI. It may be concluded that cowpea PI gene(s) could be potential insect control protein for future studies in developing insect-resistant transgenic plants. © 2014 Wiley Periodicals, Inc.

  8. Aluminium-induced excessive ROS causes cellular damage and metabolic shifts in black gram Vigna mungo (L.) Hepper.

    Science.gov (United States)

    Chowra, Umakanta; Yanase, Emiko; Koyama, Hiroyuki; Panda, Sanjib Kumar

    2017-01-01

    Aluminium-induced oxidative damage caused by excessive ROS production was evaluated in black gram pulse crop. Black gram plants were treated with different aluminium (Al 3+ ) concentrations (10, 50 and 100 μM with pH 4.7) and further the effects of Al 3+ were characterised by means of root growth inhibition, histochemical assay, ROS content analysis, protein carbonylation quantification and 1 H-NMR analysis. The results showed that aluminium induces excessive ROS production which leads to cellular damage, root injury, stunt root growth and other metabolic shifts. In black gram, Al 3+ induces cellular damage at the earliest stage of stress which was characterised from histochemical analysis. From this study, it was observed that prolonged stress can activate certain aluminium detoxification defence mechanism. Probably excessive ROS triggers such defence mechanism in black gram. Al 3+ can induce excessive ROS initially in the root region then transported to other parts of the plant. As much as the Al 3+ concentration increases, the rate of cellular injury and ROS production also increases. But after 72 h of stress, plants showed a lowered ROS level and cellular damage which indicates the upregulation of defensive mechanisms. Metabolic shift analysis also showed that the black gram plant under stress has less metabolic content after 24 h of treatment, but gradually, it was increased after 72 h of treatment. It was assumed that ROS played the most important role as a signalling molecule for aluminium stress in black gram.

  9. Radiation curable coatings having nonadherent surfaces

    International Nuclear Information System (INIS)

    Gaske, J.E.; Georgas, N.T.

    1977-01-01

    Radiation polymerizable coatings having nonadherent surfaces are provided utilizing nonaqueous emulsions of a liquid alkyl hydrogen polysiloxane in a radiation polymerizable polyethylenic liquid. Polyacrylates in combination with amines, and ultraviolet photosensitizers are particularly contemplated for rapid nonair inhibited ultraviolet cure. 13 claims

  10. Interdependence of plant water status with photosynthetic performance and root defense responses in Vigna radiata (L.) Wilczek under progressive drought stress and recovery.

    Science.gov (United States)

    Sengupta, Debashree; Guha, Anirban; Reddy, Attipalli Ramachandra

    2013-10-05

    The present study investigates the interdependence of plant water status with foliar and root responses in Vigna radiata L.Wilczek under progressive drought. Vegetatively-mature V. radiata plants were subjected to water withdrawal for 3 and 6days (D3 and D6, respectively) and then re-watered subsequently for 6days (6R) for stress-recovery. Changes in plant water status were expressed in terms of leaf and root moisture contents (LMC and RMC, respectively) and leaf relative water content (LRWC). Progressive drought caused apparent decrease in LRWC, LMC and RMC depicting significant level of dehydration of leaf and root tissues. Stomatal limitation alone could not account for the observed decrease in net CO2 assimilation rates (Pn) due to comparatively less decrease in sub-stomatal CO2 (Ci) concentrations with respect to other gas exchange parameters indicating possible involvement of non-stomatal limitations. Analysis of polyphasic chl a fluorescence kinetics during progressive drought showed decreased energy connectivity among PSII units as defined by a positive L-band with highest amplitude during D6. Efficiency of electron flux from OEC towards PSII acceptor side was not significantly affected during drought conditions as evidenced by the absence of a positive K-band. Increasing root-level water-limitation enforced a gradual oxidative stress through H2O2 accumulation and membrane lipid peroxidation in V. radiata roots exhibiting drastic enhancement of proline content and a significant but gradual increase in ascorbic acid content as well as guaiacol peroxidase activity under progressive drought. Expression analysis of Δ(1) pyrroline-5-carboxylate synthetase (P5CS) through real time PCR and enzyme activity studies showed a strong positive correlation between VrP5CS gene expression, enzyme activity and proline accumulation in the roots of V. radiata under progressive drought and recovery. Drought-induced changes in root moisture content (RMC) showed positive linear

  11. Global changes in gene expression during compatible and incompatible interactions of cowpea (Vigna unguiculata L.) with the root parasitic angiosperm Striga gesnerioides.

    Science.gov (United States)

    Huang, Kan; Mellor, Karolina E; Paul, Shom N; Lawson, Mark J; Mackey, Aaron J; Timko, Michael P

    2012-08-17

    Cowpea, Vigna unguiculata L. Walp., is one of the most important food and forage legumes in the semi-arid tropics. While most domesticated forms of cowpea are susceptible to the root parasitic weed Striga gesnerioides, several cultivars have been identified that show race-specific resistance. Cowpea cultivar B301 contains the RSG3-301 gene for resistance to S. gesnerioides race SG3, but is susceptible to race SG4z. When challenged by SG3, roots of cultivar B301 develop a strong resistance response characterized by a hypersensitive reaction and cell death at the site of parasite attachment. In contrast, no visible response occurs in B301 roots parasitized by SG4z. Gene expression in the roots of the cowpea cultivar B301 during compatible (susceptible) and incompatible (resistant) interactions with S. gesnerioides races SG4z and SG3, respectively, were investigated at the early (6 days post-inoculation (dpi)) and late (13 dpi) stages of the resistance response using a Nimblegen custom design cowpea microarray. A total of 111 genes were differentially expressed in B301 roots at 6 dpi; this number increased to 2102 genes at 13 dpi. At 13 dpi, a total of 1944 genes were differentially expressed during compatible (susceptible) interactions of B301 with SG4z. Genes and pathways involved in signal transduction, programmed cell death and apoptosis, and defense response to biotic and abiotic stress were differentially expressed in the early resistance response; at the later time point, enrichment was primarily for defense-related gene expression, and genes encoding components of lignifications and secondary wall formation. In compatible interactions (B301-SG4z), multiple defense pathways were repressed, including those involved in lignin biosynthesis and secondary cell wall modifications, while cellular transport processes for nitrogen and sulfur were increased. Distinct changes in global gene expression profiles occur in host roots following successful and unsuccessful

  12. Leaf morphology in Cowpea [Vigna unguiculata (L.) Walp]: QTL analysis, physical mapping and identifying a candidate gene using synteny with model legume species.

    Science.gov (United States)

    Pottorff, Marti; Ehlers, Jeffrey D; Fatokun, Christian; Roberts, Philip A; Close, Timothy J

    2012-06-12

    Cowpea [Vigna unguiculata (L.) Walp] exhibits a considerable variation in leaf shape. Although cowpea is mostly utilized as a dry grain and animal fodder crop, cowpea leaves are also used as a high-protein pot herb in many countries of Africa. Leaf morphology was studied in the cowpea RIL population, Sanzi (sub-globose leaf shape)