Nemec, Antonia A; Bush, Korie B; Towle-Weicksel, Jamie B; Taylor, B Frazier; Schulz, Vincent; Weidhaas, Joanne B; Tuck, David P; Sweasy, Joann B
2016-11-01
Repair of DNA damage is critical for maintaining the genomic integrity of cells. DNA polymerase lambda (POLL/Pol λ) is suggested to function in base excision repair (BER) and nonhomologous end-joining (NHEJ), and is likely to play a role in damage tolerance at the replication fork. Here, using next-generation sequencing, it was discovered that the POLL rs3730477 single-nucleotide polymorphism (SNP) encoding R438W Pol λ was significantly enriched in the germlines of breast cancer patients. Expression of R438W Pol λ in human breast epithelial cells induces cellular transformation and chromosomal aberrations. The role of estrogen was assessed as it is commonly used in hormone replacement therapies and is a known breast cancer risk factor. Interestingly, the combination of estrogen treatment and the expression of the R438W Pol λ SNP drastically accelerated the rate of transformation. Estrogen exposure produces 8-oxoguanine lesions that persist in cells expressing R438W Pol λ compared with wild-type (WT) Pol λ-expressing cells. Unlike WT Pol λ, which performs error-free bypass of 8-oxoguanine lesions, expression of R438W Pol λ leads to an increase in mutagenesis and replicative stress in cells treated with estrogen. Together, these data suggest that individuals who carry the rs3730477 POLL germline variant have an increased risk of estrogen-associated breast cancer. The Pol λ R438W mutation can serve as a biomarker to predict cancer risk and implicates that treatment with estrogen in individuals with this mutation may further increase their risk of breast cancer. Mol Cancer Res; 14(11); 1068-77. ©2016 AACR. ©2016 American Association for Cancer Research.
Hemochromatosis C282Y gene mutation as a potential susceptibility ...
African Journals Online (AJOL)
G.M. Mokhtar
2017-08-12
Aug 12, 2017 ... Background: Hereditary hemochromatosis is the most frequent cause of primary iron overload that is associated with HFE gene's mutation especially the C282Y mutation. The interaction between hemoglo- bin chain synthesis' disorders and the C282Y mutation may worsen the clinical picture of beta-.
Ancestral association between HLA and HFE H63D and C282Y gene mutations from northwest Colombia.
Rodriguez, Libia M; Giraldo, Mabel C; Velasquez, Laura I; Alvarez, Cristiam M; Garcia, Luis F; Jimenez-Del-Rio, Marlene; Velez-Pardo, Carlos
2015-03-01
A significant association between HFE gene mutations and the HLA-A*03-B*07 and HLA-A*29-B*44 haplotypes has been reported in the Spanish population. It has been proposed that these mutations are probably connected with Celtic and North African ancestry, respectively. We aimed to find the possible ancestral association between HLA alleles and haplotypes associated with the HFE gene (C282Y and H63D) mutations in 214 subjects from Antioquia, Colombia. These were 18 individuals with presumed hereditary hemochromatosis ("HH") and 196 controls. The HLA-B*07 allele was in linkage disequilibrium (LD) with C282Y, while HLA-A*23, A*29, HLA-B*44, and B*49 were in LD with H63D. Altogether, our results show that, although the H63D mutation is more common in the Antioquia population, it is not associated with any particular HLA haplotype, whereas the C282Y mutation is associated with HLA-A*03-B*07, this supporting a northern Spaniard ancestry.
Ancestral association between HLA and HFE H63D and C282Y gene mutations from northwest Colombia
Directory of Open Access Journals (Sweden)
Libia M Rodriguez
2015-03-01
Full Text Available A significant association between HFE gene mutations and the HLA-A*03-B*07 and HLA-A*29-B*44 haplotypes has been reported in the Spanish population. It has been proposed that these mutations are probably connected with Celtic and North African ancestry, respectively. We aimed to find the possible ancestral association between HLA alleles and haplotypes associated with the HFE gene (C282Y and H63D mutations in 214 subjects from Antioquia, Colombia. These were 18 individuals with presumed hereditary hemochromatosis (“HH” and 196 controls. The HLA-B*07 allele was in linkage disequilibrium (LD with C282Y, while HLA-A*23, A*29, HLA-B*44, and B*49 were in LD with H63D. Altogether, our results show that, although the H63D mutation is more common in the Antioquia population, it is not associated with any particular HLA haplotype, whereas the C282Y mutation is associated with HLA-A*03-B*07, this supporting a northern Spaniard ancestry.
Association of HFE gene C282Y and H63D mutations with liver cirrhosis in the Lithuanian population
Directory of Open Access Journals (Sweden)
Simonas Juzėnas
2016-01-01
Conclusions: Heterozygous C282Y mutation of the HFE gene was associated with liver cirrhosis in the Lithuanian population. In gender-related analysis, heterozygous C282Y and homozygous H63D mutations were linked to liver cirrhosis in men, not in women.
Energy Technology Data Exchange (ETDEWEB)
Tu, Chao [Macromolecular Crystallography Laboratory, National Cancer Institute, Frederick, MD 21702 (United States); Tan, Yu-Hong [Department of Molecular Biology and Biochemistry, University of California at Irvine, Irvine, CA 92697 (United States); Shaw, Gary [Macromolecular Crystallography Laboratory, National Cancer Institute, Frederick, MD 21702 (United States); Zhou, Zheng; Bai, Yawen [Laboratory of Biochemistry and Molecular Biology, National Cancer Institute, Bethesda, MD 20892 (United States); Luo, Ray [Department of Molecular Biology and Biochemistry, University of California at Irvine, Irvine, CA 92697 (United States); Ji, Xinhua, E-mail: jix@ncifcrf.gov [Macromolecular Crystallography Laboratory, National Cancer Institute, Frederick, MD 21702 (United States)
2008-05-01
The impact of hotspot mutation R282Q on the structure of human p53 DNA-binding domain has been characterized by X-ray crystallography and molecular-dynamics simulations. Tumor suppressor p53 is a sequence-specific DNA-binding protein and its central DNA-binding domain (DBD) harbors six hotspots (Arg175, Gly245, Arg248, Arg249, Arg273 and Arg282) for human cancers. Here, the crystal structure of a low-frequency hotspot mutant, p53DBD(R282Q), is reported at 1.54 Å resolution together with the results of molecular-dynamics simulations on the basis of the structure. In addition to eliminating a salt bridge, the R282Q mutation has a significant impact on the properties of two DNA-binding loops (L1 and L3). The L1 loop is flexible in the wild type, but it is not flexible in the mutant. The L3 loop of the wild type is not flexible, whereas it assumes two conformations in the mutant. Molecular-dynamics simulations indicated that both conformations of the L3 loop are accessible under biological conditions. It is predicted that the elimination of the salt bridge and the inversion of the flexibility of L1 and L3 are directly or indirectly responsible for deactivating the tumor suppressor p53.
Association of HFE gene C282Y and H63D mutations with liver cirrhosis in the Lithuanian population.
Juzėnas, Simonas; Kupčinskas, Juozas; Valantienė, Irena; Šumskienė, Jolanta; Petrenkienė, Vitalija; Kondrackienė, Jūrate; Kučinskas, Laimutis; Kiudelis, Gediminas; Skiecevičienė, Jurgita; Kupčinskas, Limas
2016-01-01
Liver cirrhosis is the end-stage disease of chronic liver injury. Due to differences in the natural course of chronic liver diseases, identification of genetic factors that influence individual outcomes is warranted. HFE-linked hereditary hemochromatosis (HH) predisposes disease progression to cirrhosis; however, the role of heterozygous C282Y or H63D mutations in the development of cirrhosis in the presence of other etiological factors is still debated. The aim of this study was to determine the association between heterozygous C282Y and H63D mutations and non-HH liver cirrhosis in Lithuanian population. The patient cohort consisted of 209 individuals. Diagnosis of cirrhosis was confirmed by clinical, laboratory parameters, liver biopsy, and radiological imaging. Control samples were obtained from 1005 randomly selected unrelated healthy individuals. HFE gene mutations were determined using the PCR-RFLP method. The most common causes of cirrhosis were hepatitis C (33.9%), hepatitis B (13.6%), and alcohol (25.8%). C282Y allele was associated with the presence of cirrhosis (OR=2.07; P=0.005); this was also observed under recessive model for C282Y (OR=2.06, P=0.008). The prevalence of C282Y allele was higher in cirrhotic men than in controls (7.0% vs. 2.8%, P=0.002). The carriage of H63D risk allele (OR=1.54; P=0.02), heterozygous C282Y/wt and homozygous H63D/H63D genotypes were associated with liver cirrhosis in males (OR=2.48, P=0.008, and OR=4.13, P=0.005, respectively). Heterozygous C282Y mutation of the HFE gene was associated with liver cirrhosis in the Lithuanian population. In gender-related analysis, heterozygous C282Y and homozygous H63D mutations were linked to liver cirrhosis in men, not in women. Copyright © 2016 The Lithuanian University of Health Sciences. Production and hosting by Elsevier Urban & Partner Sp. z o.o. All rights reserved.
Directory of Open Access Journals (Sweden)
Li Ma
2013-08-01
Full Text Available AIM: To screen mutations in the retinitis pigmentosa 1 (RP1 gene and the rhodopsin (RHO gene in Chinese patients with retinitis pigmentosa sine pigmento (RPSP and describe the genotype-phenotype relationship of the mutations.METHODS:Twenty affected, unrelated Chinese individuals with RPSP (4 autosomal dominant RPSP, 12 autosomal recessive RPSP and 4 unknown inheritance pattern were recruited between 2009 and 2012. The clinical features were determined by complete ophthalmologic examinations. Polymerase chain reaction (PCR and direct DNA sequencing were used to screen the entire coding region and splice junctions of the RP1 gene and the RHO gene. The cosegregation analysis and population frequency studies were performed for patients with identified mutations.RESULTS: Five variants in the RP1 gene and one in the RHO gene were detected in 20 probands. Four missense changes (rs444772, rs446227, rs414352, rs441800 and one non-coding variant (rs56340615 were common SNPs and none of them showed a significant relationship with RPSP. A missense mutation p.R1443W was identified in the RP1 gene in three affected individuals from a family with autosomal dominant RPSP and was found to cosegregate with the phenotype in this family, suggestive of pathogenic. In addition, population frequency analysis showed the p.R1443W mutation was absent in 300 healthy controls.CONCLUSION: The identification of p.R1443W mutation cosegregating in a family with autosomal dominant RPSP highlights an atypical phenotype of the RP1 gene mutation, while RHO gene is not associated with the pathogenesis of RPSP in this study. To our knowledge, this is the fist mutation identified to associate with RPSP.
Ma, Li; Sheng, Xun-Lun; Li, Hui-Ping; Zhang, Fang-Xia; Liu, Ya-Ni; Rong, Wei-Ning; Zhang, Jian-Ling
2013-01-01
To screen mutations in the retinitis pigmentosa 1 (RP1) gene and the rhodopsin (RHO) gene in Chinese patients with retinitis pigmentosa sine pigmento (RPSP) and describe the genotype-phenotype relationship of the mutations. Twenty affected, unrelated Chinese individuals with RPSP (4 autosomal dominant RPSP, 12 autosomal recessive RPSP and 4 unknown inheritance pattern) were recruited between 2009 and 2012. The clinical features were determined by complete ophthalmologic examinations. Polymerase chain reaction (PCR) and direct DNA sequencing were used to screen the entire coding region and splice junctions of the RP1 gene and the RHO gene. The cosegregation analysis and population frequency studies were performed for patients with identified mutations. Five variants in the RP1 gene and one in the RHO gene were detected in 20 probands. Four missense changes (rs444772, rs446227, rs414352, rs441800) and one non-coding variant (rs56340615) were common SNPs and none of them showed a significant relationship with RPSP. A missense mutation p.R1443W was identified in the RP1 gene in three affected individuals from a family with autosomal dominant RPSP and was found to cosegregate with the phenotype in this family, suggestive of pathogenic. In addition, population frequency analysis showed the p.R1443W mutation was absent in 300 healthy controls. The identification of p.R1443W mutation cosegregating in a family with autosomal dominant RPSP highlights an atypical phenotype of the RP1 gene mutation, while RHO gene is not associated with the pathogenesis of RPSP in this study. To our knowledge, this is the fist mutation identified to associate with RPSP.
Association of the germline TP53 R337H mutation with breast cancer in southern Brazil
International Nuclear Information System (INIS)
Assumpção, Juliana G; Zeferino, Luiz Carlos; Dufloth, Rozany M; Brandalise, Silvia Regina; Yunes, José Andres; Seidinger, Ana Luíza; Mastellaro, Maria José; Ribeiro, Raul C; Zambetti, Gerard P; Ganti, Ramapriya; Srivastava, Kumar; Shurtleff, Sheila; Pei, Deqing
2008-01-01
The germline TP53-R337H mutation is strongly associated with pediatric adrenocortical tumors (ACT) in southern Brazil; it has low penetrance and limited tissue specificity in most families and therefore is not associated with Li-Fraumeni syndrome. However, other tumor types, mainly breast cancer, have been observed in carriers of several unrelated kindreds, raising the possibility that the R337H mutation may also contribute to breast tumorigenesis in a genetic background-specific context. We conducted a case-control study to determine the prevalence of the R337H mutation by sequencing TP53 exon 10 in 123 women with breast cancer and 223 age- and sex-matched control subjects from southern Brazil. Fisher's test was used to compare the prevalence of the R337H. The R337H mutation was found in three patients but in none of the controls (p = 0.0442). Among the carriers, two had familial history of cancer meeting the Li-Fraumeni-like criteria. Remarkably, tumors in each of these three cases underwent loss of heterozygosity by eliminating the mutant TP53 allele rather than the wild-type allele. Polymorphisms were identified within the TP53 (R72P and Ins16) and MDM2 (SNP309) genes that may further diminish TP53 tumor suppressor activity. These results demonstrate that the R337H mutation can significantly increase the risk of breast cancer in carriers, which likely depends on additional cooperating genetic factors. These findings are also important for understanding how low-penetrant mutant TP53 alleles can differentially influence tumor susceptibility
Association of the germline TP53 R337H mutation with breast cancer in southern Brazil
Directory of Open Access Journals (Sweden)
Srivastava Kumar
2008-12-01
Full Text Available Abstract Background The germline TP53-R337H mutation is strongly associated with pediatric adrenocortical tumors (ACT in southern Brazil; it has low penetrance and limited tissue specificity in most families and therefore is not associated with Li-Fraumeni syndrome. However, other tumor types, mainly breast cancer, have been observed in carriers of several unrelated kindreds, raising the possibility that the R337H mutation may also contribute to breast tumorigenesis in a genetic background-specific context. Methods We conducted a case-control study to determine the prevalence of the R337H mutation by sequencing TP53 exon 10 in 123 women with breast cancer and 223 age- and sex-matched control subjects from southern Brazil. Fisher's test was used to compare the prevalence of the R337H. Results The R337H mutation was found in three patients but in none of the controls (p = 0.0442. Among the carriers, two had familial history of cancer meeting the Li-Fraumeni-like criteria. Remarkably, tumors in each of these three cases underwent loss of heterozygosity by eliminating the mutant TP53 allele rather than the wild-type allele. Polymorphisms were identified within the TP53 (R72P and Ins16 and MDM2 (SNP309 genes that may further diminish TP53 tumor suppressor activity. Conclusion These results demonstrate that the R337H mutation can significantly increase the risk of breast cancer in carriers, which likely depends on additional cooperating genetic factors. These findings are also important for understanding how low-penetrant mutant TP53 alleles can differentially influence tumor susceptibility.
C282Y polymorphism in the HFE gene is associated with risk of breast cancer.
Liu, Xiaoyan; Lv, Chunlei; Luan, Xiaorong; Lv, Ming
2013-10-01
The C282Y and H63D polymorphisms in the HFE gene have been implicated in susceptibility of breast cancer, but a number of studies have reported inconclusive results. The aim of this study is to investigate the association between the C282Y and H63D polymorphisms in the HFE gene and breast cancer risk by meta-analysis. We searched PubMed and Embase databases, covering all related studies until March 2, 2013. Statistical analysis was performed using STATA 10.0. A total of 7 studies including 1,720 cases and 18,296 controls for HFE C282Y polymorphism and 5 studies including 942 cases and 1,571 controls for HFE H63D polymorphism were included in the meta-analysis. The results showed that HFE C282Y polymorphism was significantly associated with increased risk of breast cancer under homozygotes vs. wild-type model (OR = 2.06, 95%CI = 1.19-3.58) and recessive model (OR = 1.98, 95%CI = 1.14-3.44) but not under heterozygotes vs. wild-type model (OR = 0.97, 95%CI = 0.70-1.35), dominant model (OR = 1.00, 95%CI = 0.72-1.40) and multiplicative model (OR = 1.04, 95%CI = 0.76-1.42). However, we did not find any association between HFE H63D polymorphism and breast cancer risk under all genetic models. This current meta-analysis suggested that C282Y polymorphism rather than H63D might be associated with increased risk of breast cancer.
Directory of Open Access Journals (Sweden)
Shen Xi-Zhong
2010-03-01
Full Text Available Abstract Background Hereditary hemochromatosis (HH is an autosomal recessive disorder mainly associated with homozygosity for the C282Y and H63D mutations in the hemochromatosis (HFE gene. The reports about the C282Y and H63D mutations and hepatocellular carninoma (HCC were controversial. To clarify the relationship between C282Y and H63D mutations and HCC, a meta-analysis including nine studies (1102 HCC cases and 3766 controls, mainly came from European populations was performed. Methods The association was measured using random-effect (RE or fixed-effect (FE odds ratios (ORs combined with 95% confidence intervals (CIs according to the studies' heterogeneity. Results Meta-analysis of nine studies showed that Y allele of C282Y was associated with HCC risk: RE OR reached 1.50 (95%CI: 1.05-2.14, p for heterogeneity = 0.02, I2 = 0.57. Subgroup analysis of seven studies also showed Y allele was associated with HCC risk in healthy populations: RE OR reached 1.61 (95%CI: 1.08-2.39, p for heterogeneity = 0.04, I2 = 0.55. We further did subgroup analysis in alcoholic liver cirrhosis (LC patients of four studies (224 cases and 380 controls and found that both the dominant model and Y allele of C282Y were associated with HCC risk (FE OR reached 4.06, 95%CI: 2.08-7.92 and 3.41, 95%CI: 1.81-6.41, respectively. There was no distinct heterogeneity among the studies (I2 = 0. Sensitivity analyses showed the results were robust in the subgroup analysis of alcoholic LC patients. Conclusions C282Y mutation was associated with HCC in European alcoholic LC patients.
R102W mutation in the RS1 gene responsible for retinoschisis and recurrent glaucoma
Directory of Open Access Journals (Sweden)
Xiu-Feng Huang
2014-02-01
Full Text Available AIM: To identify the mutations in RS1 gene associated with typical phenotype of X-linked juvenile retinoschisis (XLRS and a rare condition of concomitant glaucoma.METHODS: Complete ophthalmic examinations were performed in the proband. The coding regions of the RS1 gene that encode retinoschisin were amplified by polymerase chain reaction and directly sequenced.RESULTS: The proband showed a typical phenotype of XLRS with large peripheral retinal schisis in both eyes, involving the macula and combined with foveal cystic change, reducing visual acuity. A typical phenotype of recurrent glaucoma with high intraocular pressure (IOP and reduced visual field was also demonstrated with the patient. Mutation analysis of RS1 gene revealed R102W (c.304C>T mutations in the affected male, and his mother was proved to be a carrier with the causative mutation and another synonymous polymorphism (c.576C>CT.CONCLUSION: We identified the genetic variations of a Chinese family with typical phenotype of XLRS and glaucoma. The severe XLRS phenotypes associated with R102W mutations reveal that the mutation determines a notable alteration in the function of the retinoschisin protein. Identification of the disease-causing mutation is beneficial for future clinical references.
Alzheimer disease-like clinical phenotype in a family with FTDP-17 caused by a MAPT R406W mutation
DEFF Research Database (Denmark)
Lindquist, S.G.; Holm, I.E.; Schwartz, M.
2008-01-01
We report clinical, molecular, neuroimaging and neuropathological features of a Danish family with autosomal dominant inherited dementia, a clinical phenotype resembling Alzheimer's disease and a pathogenic mutation (R406W) in the microtubule associated protein tau (MAPT) gene. Pre-symptomatic an......We report clinical, molecular, neuroimaging and neuropathological features of a Danish family with autosomal dominant inherited dementia, a clinical phenotype resembling Alzheimer's disease and a pathogenic mutation (R406W) in the microtubule associated protein tau (MAPT) gene. Pre...
HFE gene C282Y variant is associated with colorectal cancer in Caucasians: a meta-analysis.
Chen, Weidong; Zhao, Hua; Li, Tiegang; Yao, Hongliang
2013-08-01
The HFE gene has been suggested to play an important role in the pathogenesis of colorectal cancer. However, the results have been conflicting. In this study, we performed a meta-analysis to clarify the association of HFE gene C282Y variant with colorectal cancer. PubMed and Embase were retrieved to identify the potential literature. Pooled odds ratio (OR) with 95 % confidence interval (CI) was calculated using fixed- or random-effects model. A total of eight papers including nine studies (7,588 colorectal cancer cases and 81,571 controls) for HFE gene C282Y variant were included in the meta-analysis. The result indicated that HFE gene C282Y variant was significantly associated with colorectal cancer under recessive model (OR = 2.00, 95 % CI = 1.32-3.04), with no evidence of between-study heterogeneity (I (2) = 0.2 %, p = 0.432). Further subgroup analysis by number of cases suggested the effect was significant in studies with more than 500 cases (OR = 2.51, 95 % CI = 1.58-3.98, I (2) = 0.0 %, p = 0.921), but not in studies with less than 500 cases (OR = 0.75, 95 % CI = 0.28-1.97, I (2) = 0.0 %, p = 0.622). The current meta-analysis supported the positive association of HFE gene C282Y variant with colorectal cancer. Further large-scale studies with the consideration for gene-gene/gene-environment interactions should be conducted to investigate the association.
HFE Mutations C282Y and H63D in Iranian Population With Type 2 Diabetes
Directory of Open Access Journals (Sweden)
Golchin
2015-04-01
Full Text Available Background Type 2 diabetes (T2D is a common metabolic disease caused by insulin secretion defects, which is associated with a variety of complications such as retinopathy, nephropathy, and neuropathy. Objectives Regarding the relationship between type 2 diabetes and hereditary chromatists, we conducted a genetic analysis on two previously reported mutations C282Y and H63D related to the HFE gene in our population. Patients and Methods Altogether, 145 patients with type 2 diabetes and 145 healthy controls were examined. A genotyping assay performed using electrophoresis of the DNA digestion products from MboI and RsaI for H63D and C282Y, respectively. Results Results showed a significant difference between case and controls regarding C282Y (P value < 0.001 and H63D genotypes (P value = 0.013. We also found a relationship between both mutations and nephropathy. Moreover, the difference between C282Y genotypes of patients with retinopathy and healthy controls were statistically significant (P value = 0.020 while there was no association between H63D and retinopathy. In addition, observed differences of both mutations were significant when nephropathic patients compared to the controls. Conclusions Our study showed a significant association between H63D and C282Y mutations and the risk of type 2 diabetes in Iranian population.
HFE gene C282Y, H63D and S65C mutations frequency in the Transylvania region, Romania.
Trifa, Adrian P; Popp, Radu A; Militaru, Mariela S; Farcaş, Marius F; Crişan, Tania O; Gana, Ionuţ; Cucuianu, Andrei; Pop, Ioan V
2012-06-01
HFE-associated haemochromatosis is one of the most frequent autosomal recessive disorders in the Caucasian population. Although most of the cases are homozygous individuals for the C282Y mutation, another two mutations, H63D and S65C, have been reported to be associated with milder forms of the disease. This study was a first attempt to evaluate the distribution of these HFE gene mutations in the Transylvania region. Two-hundred and twenty-five healthy, unrelated volunteers originating from the Transylvania region, Romania, were screened for the HFE gene C282Y, H63D and S65C mutations, using molecular genetics assays (Polymerase Chain Reaction-Restriction Fragments Length Polymorphism). For the C282Y mutation, 7 heterozygotes (3.1%) were found, but no homozygous individual. In the case of the H63D mutation, 40 heterozygotes (17.8%) and 4 homozygotes (1.75%) for the mutant allele were evidenced. We found a compound heterozygous genotype (C282Y/H63D) in one individual (0.45%). Thus, the allele frequencies of the C282Y and H63D were 1.75% and 10.9%, respectively. Three individuals (1.3%) were found to harbour the S65C mutation in a heterozygous state, but none in a homozygous state: the allele frequency of the mutant allele was 0.75%. The distribution of the HFE gene C282Y, H63D and S65C mutations found in our group matches the tendencies observed in other European countries: a decreasing gradient from Northern to Southern Europe for the C282Y mutation; high frequency for the H63D mutation, and low frequency for the S65C mutation in most of the countries.
Directory of Open Access Journals (Sweden)
Sheila R Costford
Full Text Available BACKGROUND: AMP-activated protein kinase (AMPK is a heterotrimeric enzyme that is evolutionarily conserved from yeast to mammals and functions to maintain cellular and whole body energy homeostasis. Studies in experimental animals demonstrate that activation of AMPK in skeletal muscle protects against insulin resistance, type 2 diabetes and obesity. The regulatory gamma(3 subunit of AMPK is expressed exclusively in skeletal muscle; however, its importance in controlling overall AMPK activity is unknown. While evidence is emerging that gamma subunit mutations interfere specifically with AMP activation, there remains some controversy regarding the impact of gamma subunit mutations. Here we report the first gain-of-function mutation in the muscle-specific regulatory gamma(3 subunit in humans. METHODS AND FINDINGS: We sequenced the exons and splice junctions of the AMPK gamma(3 gene (PRKAG3 in 761 obese and 759 lean individuals, identifying 87 sequence variants including a novel R225W mutation in subjects from two unrelated families. The gamma(3 R225W mutation is homologous in location to the gamma(2R302Q mutation in patients with Wolf-Parkinson-White syndrome and to the gamma(3R225Q mutation originally linked to an increase in muscle glycogen content in purebred Hampshire Rendement Napole (RN- pigs. We demonstrate in differentiated muscle satellite cells obtained from the vastus lateralis of R225W carriers that the mutation is associated with an approximate doubling of both basal and AMP-activated AMPK activities. Moreover, subjects bearing the R225W mutation exhibit a approximately 90% increase of skeletal muscle glycogen content and a approximately 30% decrease in intramuscular triglyceride (IMTG. CONCLUSIONS: We have identified for the first time a mutation in the skeletal muscle-specific regulatory gamma(3 subunit of AMPK in humans. The gamma(3R225W mutation has significant functional effects as demonstrated by increases in basal and AMP
Tomasic, Nikica Ljubas; Piterkova, Lucie; Huff, Chad; Bilic, Ernest; Yoon, Donghoon; Miasnikova, Galina Y; Sergueeva, Adelina I; Niu, Xiaomei; Nekhai, Sergei; Gordeuk, Victor; Prchal, Josef T
2013-04-01
Mutations of VHL (a negative regulator of hypoxia-inducible factors) have position-dependent distinct cancer phenotypes. Only two known inherited homozygous VHL mutations exist and they cause polycythemia: Chuvash R200W and Croatian H191D. We report a second polycythemic Croatian H191D homozygote distantly related to the first propositus. Three generations of both families were genotyped for analysis of shared ancestry. Biochemical and molecular tests were performed to better define their phenotypes, with an emphasis on a comparison with Chuvash polycythemia. The VHL H191D mutation did not segregate in the family defined by the known common ancestors of the two subjects, suggesting a high prevalence in Croatians, but haplotype analysis indicated an undocumented common ancestor ∼six generations ago as the founder of this mutation. We show that erythropoietin levels in homozygous VHL H191D individuals are higher than in VHL R200W patients of similar ages, and their native erythroid progenitors, unlike Chuvash R200W, are not hypersensitive to erythropoietin. This observation contrasts with a report suggesting that polycythemia in VHL R200W and H191D homozygotes is due to the loss of JAK2 regulation from VHL R200W and H191D binding to SOCS1. In conclusion, our studies further define the hematologic phenotype of VHL H191D and provide additional evidence for phenotypic heterogeneity associated with the positional effects of VHL mutations.
Analysis of HFE and non-HFE gene mutations in Brazilian patients with hemochromatosis.
Bittencourt, Paulo Lisboa; Marin, Maria Lúcia Carnevale; Couto, Cláudia Alves; Cançado, Eduardo Luiz Rachid; Carrilho, Flair José; Goldberg, Anna Carla
2009-01-01
Approximately one-half of Brazilian patients with hereditary hemochromatosis (HH) are neither homozygous for the C282Y mutation nor compound heterozygous for the H63D and C282Y mutations that are associated with HH in Caucasians. Other mutations have been described in the HFE gene as well as in genes involved in iron metabolism, such as transferrin receptor 2 (TfR2) and ferroportin 1 (SCL40A1). To evaluate the role of HFE, TfR2 and SCL40A1 mutations in Brazilian subjects with HH. Nineteen male subjects (median age 42 [range: 20-72] years) with HH were evaluated using the Haemochromatosis StripAssay A. This assay is capable of detecting twelve HFE mutations, which are V53M, V59M, H63D, H63H, S65C, Q127H, P160delC, E168Q, E168X, W169X, C282Y and Q283, four TfR2 mutations, which are E60X, M172K, Y250X, AVAQ594-597del, and two SCL40A1 mutations, which are N144H and V162del. In our cohort, nine (47%) patients were homozygous for the C282Y mutation, two (11%) were heterozygous for the H63D mutation, and one each (5%) was either heterozygous for C282Y or compound heterozygous for C282Y and H63D. No other mutations in the HFE, TfR2 or SCL40A1 genes were observed in the studied patients. One-third of Brazilian subjects with the classical phenotype of HH do not carry HFE or other mutations that are currently associated with the disease in Caucasians. This observation suggests a role for other yet unknown mutations in the aforementioned genes or in other genes involved in iron homeostasis in the pathogenesis of HH in Brazil.
Analysis of HFE and non-HFE gene mutations in Brazilian patients with hemochromatosis
Directory of Open Access Journals (Sweden)
Paulo Lisboa Bittencourt
2009-01-01
Full Text Available BACKGROUND: Approximately one-half of Brazilian patients with hereditary hemochromatosis (HH are neither homozygous for the C282Y mutation nor compound heterozygous for the H63D and C282Y mutations that are associated with HH in Caucasians. Other mutations have been described in the HFE gene as well as in genes involved in iron metabolism, such as transferrin receptor 2 (TfR2 and ferroportin 1 (SCL40A1. AIMS: To evaluate the role of HFE, TfR2 and SCL40A1 mutations in Brazilian subjects with HH. PATIENTS AND METHODS: Nineteen male subjects (median age 42 [range: 20-72] years with HH were evaluated using the Haemochromatosis StripAssay A®. This assay is capable of detecting twelve HFE mutations, which are V53M, V59M, H63D, H63H, S65C, Q127H, P160delC, E168Q, E168X, W169X, C282Y and Q283, four TfR2 mutations, which are E60X, M172K, Y250X, AVAQ594-597del, and two SCL40A1 mutations, which are N144H and V162del. RESULTS: In our cohort, nine (47% patients were homozygous for the C282Y mutation, two (11% were heterozygous for the H63D mutation, and one each (5% was either heterozygous for C282Y or compound heterozygous for C282Y and H63D. No other mutations in the HFE, TfR2 or SCL40A1 genes were observed in the studied patients. CONCLUSIONS: One-third of Brazilian subjects with the classical phenotype of HH do not carry HFE or other mutations that are currently associated with the disease in Caucasians. This observation suggests a role for other yet unknown mutations in the aforementioned genes or in other genes involved in iron homeostasis in the pathogenesis of HH in Brazil.
Gomes, K B; Carvalho, M G; Coelho, F F; Rodrigues, I F; Soares, A L; Guimarães, D A; Fernandes, A P
2009-10-27
Hereditary hemochromatosis is one of the most common autosomal recessive diseases; it is characterized by excess absorption of iron. Clinically, the major challenge is to diagnose increased iron deposition before irreversible tissue damage has occurred. C282Y and H63D are the main mutations related to hereditary hemochromatosis; these mutations have been reported to be associated with increased risk of developing diabetes mellitus type 2 (DM2). We investigated whether these mutations are associated with increased risk for the development of DM2 in women in Brazil. Seventy-two women with clinical diagnosis of DM2 under treatment with hypoglycemic agents and a control group composed of 72 women with no clinical history of diabetes were studied. The C282Y and H63D mutations were determined by PCR-RFLP. Significant differences were not observed for C282Y and H63D, when we compared diabetic and non-diabetic women. We suggest that mutations C282Y and H63D in the HFE gene are not significant risk factors for the development of DM2 in Brazilian women.
Jennings, J. E.; Georgitsi, M.; Holdaway, I.; Daly, Adrian; Tichomirowa, M.; Beckers, Albert; Aaltonen, Lauri A; Karhu, A.; Cameron, F. J.
2009-01-01
OBJECTIVE: Mutations in the aryl hydrocarbon receptor-interacting protein (AIP) were recently shown to confer a pituitary adenoma predisposition in patients with familial isolated pituitary adenomas (FIPA). We report a large Samoan FIPA kindred from Australia/New Zealand with an R271W mutation that was associated with aggressive pituitary tumors. DESIGN AND METHODS: Case series with germline screening of AIP and haplotype analyses among R271W families. RESULTS: This previously unreported kind...
DEFF Research Database (Denmark)
Rasmussen, Mikkel A.; Hjermind, Lena E.; Hasholt, Lis F.
2016-01-01
Skin fibroblasts were obtained from a 59-year-old woman diagnosed with frontotemporal dementia. The disease is caused by a R406W mutation in microtubule-associated protein tau (MAPT). Induced pluripotent stem cells (iPSCs) were established by electroporation with episomal plasmids containing hOCT4...
DEFF Research Database (Denmark)
Rasmussen, Mikkel A.; Hjermind, Lena Elisabeth; Hasholt, Lis Frydenreich
2016-01-01
Skin fibroblasts were obtained from a 28-year-old pre-symptomatic woman carrying a R406W mutation in microtubule-associated protein tau (MAPT), known to cause frontotemporal dementia. Induced pluripotent stem cell (iPSCs) were established by electroporation with episomal plasmids containing hOCT4...
Ding, Wei; Ren, Jin; Ren, Hui; Wang, Dan
2017-12-08
LncRNA HOX transcript antisense RNA (HOTAIR) is involved in lots of cancers. The pro-survival protein Bcl-w is frequently found in cancer development. However, the effect of HOTAIR on Bcl-w in breast cancer is not well documented. In this study, we first evaluated the correlation between HOTAIR level and Bcl-w expression in clinical breast cancer tissues. We observed that the expression levels of Bcl-w were much higher in the breast cancer samples than that in their paired noncancerous tissues. Moreover, the levels of HOTAIR were positively associated with those of Bcl-w in clinical breast cancer samples. As expected, we observed that HOTAIR was able to up-regulate the expression of Bcl-w in breast cancer cells. Mechanistically, we found that miR-206 was capable of inhibiting the expression of Bcl-w by directly binding to the 3'UTR of Bcl-w mRNA. Interestingly, HOTAIR could increase the expression of Bcl-w through sequestering miR-206 at post-transcriptional level. Functionally, our data showed that HOTAIR-induced Bcl-w by miR-206 facilitated the proliferation of breast cancer cells. Thus, we conclude that HOTAIR up-regulates Bcl-w to enhance cell proliferation through sequestering miR-206 in breast cancer. Our finding provides new insights into the mechanism of breast cancer mediated by HOTAIR.
Directory of Open Access Journals (Sweden)
G.M. Mokhtar
2018-04-01
Full Text Available Background: Hereditary hemochromatosis is the most frequent cause of primary iron overload that is associated with HFE gene’s mutation especially the C282Y mutation. The interaction between hemoglobin chain synthesis’ disorders and the C282Y mutation may worsen the clinical picture of beta-thalassemia major (β-TM. Aim: To establish the prevalence of the C282Y mutations in Egyptian β-TM patients and to address its adverse effects. Methods: Two-hundred and five β-TM patients were recruited and divided into two groups based on their serum ferritin (SF; group I (N = 125 (SF ≤ 2500 ng/dl and group II (N = 80 (SF > 2500 ng/dl. All patients were subjected to clinical and laboratory assessment with special emphasis on iron overload complications. Genotyping was assessed by polymerase chain reaction for detection of C282Y mutation in HFE gene. Results: The C282Y mutation was not detected in the studied β-TM neither in homozygous nor heterozygous state. There were several iron overload complications including cardiac complication (9.1%, liver disease (36.6%, delayed puberty (56.6%, primary (35.71% and secondary amenorrhea (21.42%, short stature (27.3%, diabetes (3.4%, neutropenia (9.7%, arthralgia (10.2%, gastrointestinal (21.1%, depression (2.9% and others (12.05%. Group I showed a statistically significant lower rate of taking iron-rich diet when compared to group II. Group II showed significant longer mean duration of disease, higher total transfusion rate per life, lower mean HbF% level, higher mean HbA% level, and higher rate of elevated liver enzymes than patients with SF ≤ 2500 ng/dl. Conclusion: The C282Y mutation was not detected in the studied cohort of Egyptian β-TM patients neither in homozygous nor heterozygous state in spite of manifestations of iron overload complications. Keywords: Beta-thalassemia major, Hereditary hemochromatosis, The C282Y mutation, Iron overload complications, Egyptian
The HCM-linked W792R mutation in cardiac myosin-binding protein C reduces C6 FnIII domain stability.
Smelter, Dan F; de Lange, Willem J; Cai, Wenxuan; Ge, Ying; Ralphe, J Carter
2018-06-01
Cardiac myosin-binding protein C (cMyBP-C) is a functional sarcomeric protein that regulates contractility in response to contractile demand, and many mutations in cMyBP-C lead to hypertrophic cardiomyopathy (HCM). To gain insight into the effects of disease-causing cMyBP-C missense mutations on contractile function, we expressed the pathogenic W792R mutation (substitution of a highly conserved tryptophan residue by an arginine residue at position 792) in mouse cardiomyocytes lacking endogenous cMyBP-C and studied the functional effects using three-dimensional engineered cardiac tissue constructs (mECTs). Based on complete conservation of tryptophan at this location in fibronectin type II (FnIII) domains, we hypothesized that the W792R mutation affects folding of the C6 FnIII domain, destabilizing the mutant protein. Adenoviral transduction of wild-type (WT) and W792R cDNA achieved equivalent mRNA transcript abundance, but not equivalent protein levels, with W792R compared with WT controls. mECTs expressing W792R demonstrated abnormal contractile kinetics compared with WT mECTs that were nearly identical to cMyBP-C-deficient mECTs. We studied whether common pathways of protein degradation were responsible for the rapid degradation of W792R cMyBP-C. Inhibition of both ubiquitin-proteasome and lysosomal degradation pathways failed to increase full-length mutant protein abundance to WT equivalence, suggesting rapid cytosolic degradation. Bacterial expression of WT and W792R protein fragments demonstrated decreased mutant stability with altered thermal denaturation and increased susceptibility to trypsin digestion. These data suggest that the W792R mutation destabilizes the C6 FnIII domain of cMyBP-C, resulting in decreased full-length protein expression. This study highlights the vulnerability of FnIII-like domains to mutations that alter domain stability and further indicates that missense mutations in cMyBP-C can cause disease through a mechanism of
Directory of Open Access Journals (Sweden)
Mohun Ramratnam
Full Text Available Most studies of the mechanisms leading to hereditary dilated cardiomyopathy (DCM have been performed in reconstituted in vitro systems. Genetically engineered murine models offer the opportunity to dissect these mechanisms in vivo. We generated a gene-targeted knock-in murine model of the autosomal dominant Arg141Trp (R141W mutation in Tnnt2, which was first described in a human family with DCM. Mice heterozygous for the mutation (Tnnt2R141W/+ recapitulated the human phenotype, developing left ventricular dilation and reduced contractility. There was a gene dosage effect, so that the phenotype in Tnnt2R141W/+mice was attenuated by transgenic overexpression of wildtype Tnnt2 mRNA transcript. Male mice exhibited poorer survival than females. Biomechanical studies on skinned fibers from Tnnt2R141W/+ hearts showed a significant decrease in pCa50 (-log[Ca2+] required for generation of 50% of maximal force relative to wildtype hearts, indicating Ca2+ desensitization. Optical mapping studies of Langendorff-perfused Tnnt2R141W/+ hearts showed marked increases in diastolic and peak systolic intracellular Ca2+ ([Ca2+]i, and prolonged systolic rise and diastolic fall of [Ca2+]i. Perfused Tnnt2R141W/+ hearts had slower intrinsic rates in sinus rhythm and reduced peak heart rates in response to isoproterenol. Tnnt2R141W/+ hearts exhibited a reduction in phosphorylated phospholamban relative to wildtype mice. However, crossing Tnnt2R141W/+ mice with phospholamban knockout (Pln-/- mice, which exhibit increased Ca2+ transients and contractility, had no effect on the DCM phenotype. We conclude that the Tnnt2 R141W mutation causes a Ca2+ desensitization and mice adapt by increasing Ca2+-transient amplitudes, which impairs Ca2+ handling dynamics, metabolism and responses to β-adrenergic activation.
Was the C282Y mutation an Irish Gaelic mutation that the Vikings helped disseminate?
DEFF Research Database (Denmark)
Olsson, Karl Sigvard; Konar, Jan; Dufva, Inge Hoegh
2011-01-01
The HLA-related hemochromatosis mutation C282Y is thought to have originated in Ireland in a person with HLA-A3-B14 and was spread by Vikings. Irish people with two HLA-A3 alleles had a high risk of hemochromatosis. In this study, from west Sweden, we wanted to test these hypotheses.......The HLA-related hemochromatosis mutation C282Y is thought to have originated in Ireland in a person with HLA-A3-B14 and was spread by Vikings. Irish people with two HLA-A3 alleles had a high risk of hemochromatosis. In this study, from west Sweden, we wanted to test these hypotheses....
Ocular phenotypes associated with two mutations (R121W, C126X) in the Norrie disease gene.
Kellner, U; Fuchs, S; Bornfeld, N; Foerster, M H; Gal, A
1996-06-01
To describe the ocular phenotypes associated with 2 mutations in the Norrie disease gene including a manifesting carrier. Ophthalmological examinations were performed in 2 affected males and one manifesting carrier. Genomic DNA was analyzed by direct sequencing of the Norrie disease gene. Family I: A 29-year-old male had the right eye enucleated at the age of 3 years. His left eye showed severe temporal dragging of the retina and central scars. Visual acuity was 20/300. DNA analysis revealed a C-to-T transition of the first nucleotide in codon 121 predicting the replacement of arginine-121 by tryptophan (R121W). Both the mother and maternal grandmother carry the same mutation in heterozygous form. Family 2: A 3-month-old boy presented with severe temporal dragging of the retina on both eyes and subsequently developed retinal detachment. Visual acuity was limited to light perception. His mother's left eye was amaurotic and phthitic. Her right eye showed severe retinal dragging, visual acuity was reduced to 20/60. DNA analysis revealed a T-to-A transversion of the third nucleotide in codon 126 creating a stop codon (C126X). The mother and maternal grandmother were carriers. Mutations in the Norrie disease gene can lead to retinal malformations of variable severity both in hemizygous males and manifesting carriers.
HFE H63D mutation frequency shows an increase in Turkish women with breast cancer
Directory of Open Access Journals (Sweden)
Guler Emine
2006-02-01
Full Text Available Abstract Background The hereditary hemochromatosis gene HFE plays a pivotal role in iron homeostasis. The association between cancer and HFE hetero- or homozygosity has previously been shown including hepatocellular and nonhepatocellular malignancies. This study was performed to compare frequencies of HFE C282Y and H63D variants in Turkish women with breast cancer and healthy controls. Methods Archived DNA samples of Hacettepe University Oncology Institute were used in this study. The HFE gene was investigated by PCR-RFLP. Results All subjects studied were free from C282Y mutation. Thirty-nine patients had H63D mutation and were all heterozygous. H63D allele frequency was 22.2% (39/176 in the breast cancer patients, and 14% (28/200 in the healthy volunteers. Statistical analysis of cases with HFE H63D phenotype showed significant difference between breast cancer and healthy volunteers (P = 0.02. Conclusion Our results suggest that HFE H63D mutation frequencies were increased in the breast cancer patients in comparison to those in the general population. Also, odds ratios (odds ratio = 2.05 computed in this study suggest that H63D has a positive association with breast cancer.
Directory of Open Access Journals (Sweden)
Nathan R. Jones
2015-12-01
Full Text Available Background: Polymorphisms in the hemochromatosis (HFE gene are associated with excessive iron absorption from the diet, and pro-oxidant effects of iron accumulation are thought to be a risk factor for several types of cancer. Methods: The C282Y (rs1800562 and H63D (rs1799945 polymorphisms were genotyped in 301 oral cancer cases and 437 controls and analyzed in relation to oral cancer risk, and serum iron biomarker levels from a subset of 130 subjects. Results: Individuals with the C282Y allele had lower total iron binding capacity (TIBC (321.2 ± 37.2 µg/dL vs. 397.7 ± 89.0 µg/dL, p = 0.007 and higher percent transferrin saturation (22.0 ± 8.7 vs. 35.6 ± 22.9, p = 0.023 than wild type individuals. Iron and ferritin levels approached significantly higher levels for the C282Y allele (p = 0.0632 and p = 0.0588, respectively. Conclusions: Iron biomarker levels were elevated by the C282Y allele, but neither (rs1800562 nor (rs1799945 was associated with oral cancer risk in blacks and whites.
2016-05-01
25 other candidate genes in the Fanconi anemia-BRCA pathway: ATR, BABAM1, BAP1, BLM, BRCC3, BRE, CHEK1, ERCC1, ERCC4 (FANCQ), FANCA , FANCB, FANCC...AWARD NUMBER: W81XWH-13-1-0484 TITLE: Cancer Risks Associated with Inherited Mutations in Ovarian Cancer Susceptibility Genes Beyond BRCA1 and...DNA repair genes on small core biopsy specimens iv) begun accessioning samples from the phase 2 rucaparib trial (Ariel 2, NCT01891344). 15
Meulemans, Ann; Seneca, Sara; Pribyl, Thomas; Smet, Joel; Alderweirldt, Valerie; Waeytens, Anouk; Lissens, Willy; Van Coster, Rudy; De Meirleir, Linda; di Rago, Jean-Paul; Gatti, Domenico L; Ackerman, Sharon H
2010-02-05
Studies in yeast have shown that a deficiency in Atp12p prevents assembly of the extrinsic domain (F(1)) of complex V and renders cells unable to make ATP through oxidative phosphorylation. De Meirleir et al. (De Meirleir, L., Seneca, S., Lissens, W., De Clercq, I., Eyskens, F., Gerlo, E., Smet, J., and Van Coster, R. (2004) J. Med. Genet. 41, 120-124) have reported that a homozygous missense mutation in the gene for human Atp12p (HuAtp12p), which replaces Trp-94 with Arg, was linked to the death of a 14-month-old patient. We have investigated the impact of the pathogenic W94R mutation on Atp12p structure/function. Plasmid-borne wild type human Atp12p rescues the respiratory defect of a yeast ATP12 deletion mutant (Deltaatp12). The W94R mutation alters the protein at the most highly conserved position in the Pfam sequence and renders HuAtp12p insoluble in the background of Deltaatp12. In contrast, the yeast protein harboring the corresponding mutation, ScAtp12p(W103R), is soluble in the background of Deltaatp12 but not in the background of Deltaatp12Deltafmc1, a strain that also lacks Fmc1p. Fmc1p is a yeast mitochondrial protein not found in higher eukaryotes. Tryptophan 94 (human) or 103 (yeast) is located in a positively charged region of Atp12p, and hence its mutation to arginine does not alter significantly the electrostatic properties of the protein. Instead, we provide evidence that the primary effect of the substitution is on the dynamic properties of Atp12p.
Whitehall, V L J; Dumenil, T D; McKeone, D M; Bond, C E; Bettington, M L; Buttenshaw, R L; Bowdler, L; Montgomery, G W; Wockner, L F; Leggett, B A
2014-11-01
The CpG Island Methylator Phenotype (CIMP) is fundamental to an important subset of colorectal cancer; however, its cause is unknown. CIMP is associated with microsatellite instability but is also found in BRAF mutant microsatellite stable cancers that are associated with poor prognosis. The isocitrate dehydrogenase 1 (IDH1) gene causes CIMP in glioma due to an activating mutation that produces the 2-hydroxyglutarate oncometabolite. We therefore examined IDH1 alteration as a potential cause of CIMP in colorectal cancer. The IDH1 mutational hotspot was screened in 86 CIMP-positive and 80 CIMP-negative cancers. The entire coding sequence was examined in 81 CIMP-positive colorectal cancers. Forty-seven cancers varying by CIMP-status and IDH1 mutation status were examined using Illumina 450K DNA methylation microarrays. The R132C IDH1 mutation was detected in 4/166 cancers. All IDH1 mutations were in CIMP cancers that were BRAF mutant and microsatellite stable (4/45, 8.9%). Unsupervised hierarchical cluster analysis identified an IDH1 mutation-like methylation signature in approximately half of the CIMP-positive cancers. IDH1 mutation appears to cause CIMP in a small proportion of BRAF mutant, microsatellite stable colorectal cancers. This study provides a precedent that a single gene mutation may cause CIMP in colorectal cancer, and that this will be associated with a specific epigenetic signature and clinicopathological features.
Directory of Open Access Journals (Sweden)
Bittencourt P.L.
2002-01-01
Full Text Available The hemochromatosis gene, HFE, is located on chromosome 6 in close proximity to the HLA-A locus. Most Caucasian patients with hereditary hemochromatosis (HH are homozygous for HLA-A3 and for the C282Y mutation of the HFE gene, while a minority are compound heterozygotes for C282Y and H63D. The prevalence of these mutations in non-Caucasian patients with HH is lower than expected. The objective of the present study was to evaluate the frequencies of HLA-A antigens and the C282Y and H63D mutations of the HFE gene in Brazilian patients with HH and to compare clinical and laboratory profiles of C282Y-positive and -negative patients with HH. The frequencies of HLA-A and C282Y and H63D mutations were determined by PCR-based methods in 15 male patients (median age 44 (20-72 years with HH. Eight patients (53% were homozygous and one (7% was heterozygous for the C282Y mutation. None had compound heterozygosity for C282Y and H63D mutations. All but three C282Y homozygotes were positive for HLA-A3 and three other patients without C282Y were shown to be either heterozygous (N = 2 or homozygous (N = 1 for HLA-A3. Patients homozygous for the C282Y mutation had higher ferritin levels and lower age at onset, but the difference was not significant. The presence of C282Y homozygosity in roughly half of the Brazilian patients with HH, together with the findings of HLA-A homozygosity in C282Y-negative subjects, suggest that other mutations in the HFE gene or in other genes involved in iron homeostasis might also be linked to HH in Brazil.
ASSOCIATION OF HFE GENE MUTATION IN THALASSEMIA MAJOR PATIENTS
Directory of Open Access Journals (Sweden)
Amit Kumar Tiwari
2016-11-01
Full Text Available BACKGROUND Thalassemia major patients are dependent on frequent blood transfusion and consequently develop iron overload. HFE gene mutations (C282Y, H63D and S65C in hereditary haemochromatosis has been shown to be associated with iron overload. The study aims at finding the association of HFE gene mutations in β-thalassemia major patients. MATERIALS AND METHODS A descriptive observational pilot study was conducted including fifty diagnosed -thalassemia major cases. DNA analysis by PCR-RFLP method for HFE gene mutations was performed. RESULTS Only H63D mutation (out of three HFE gene mutations was detected in 8 out of 50 cases. Observed frequency of H63D mutation was 16%. While frequency of C282Y and S65C were 0% each. CONCLUSION The frequency of HFE mutation in -thalassemia major is not very common.
DEFF Research Database (Denmark)
Milman, Nils; á Steig, Torkil; Koefoed, Pernille
2004-01-01
on the HFE gene was assessed by genotyping using the polymerase chain reaction (PCR) technique and calculated from direct allele counting. We found no C282Y homozygous subjects; 28 (14.0%) subjects were C282Y heterozygous and four subjects were C282Y/H63D compound heterozygous (2.0%). The C282Y allele......The aim of the study was to assess the frequencies of the hereditary hemochromatosis HFE mutations C282Y, H63D, and S65C in the population in the Faroe Islands. The series comprised 200 randomly selected blood donors of Faroese heritage. The frequency of the C282Y, H63D, and S65C mutations.......6%. Screening of larger groups of the Faroese population for HFE mutations especially C282Y should be considered in order to establish the penetrance....
Age-related cancer mutations associated with clonal hematopoietic expansion
Xie, Mingchao; Lu, Charles; Wang, Jiayin; McLellan, Michael D.; Johnson, Kimberly J.; Wendl, Michael C.; McMichael, Joshua F.; Schmidt, Heather K.; Yellapantula, Venkata; Miller, Christopher A.; Ozenberger, Bradley A.; Welch, John S.; Link, Daniel C.; Walter, Matthew J.; Mardis, Elaine R.; Dipersio, John F.; Chen, Feng; Wilson, Richard K.; Ley, Timothy J.; Ding, Li
2015-01-01
Several genetic alterations characteristic of leukemia and lymphoma have been detected in the blood of individuals without apparent hematological malignancies. We analyzed blood-derived sequence data from 2,728 individuals within The Cancer Genome Atlas, and discovered 77 blood-specific mutations in cancer-associated genes, the majority being associated with advanced age. Remarkably, 83% of these mutations were from 19 leukemia/lymphoma-associated genes, and nine were recurrently mutated (DNMT3A, TET2, JAK2, ASXL1, TP53, GNAS, PPM1D, BCORL1 and SF3B1). We identified 14 additional mutations in a very small fraction of blood cells, possibly representing the earliest stages of clonal expansion in hematopoietic stem cells. Comparison of these findings to mutations in hematological malignancies identified several recurrently mutated genes that may be disease initiators. Our analyses show that the blood cells of more than 2% of individuals (5–6% of people older than 70 years) contain mutations that may represent premalignant, initiating events that cause clonal hematopoietic expansion. PMID:25326804
Variable expressivity of FGF3 mutations associated with deafness and LAMM syndrome
Directory of Open Access Journals (Sweden)
Griffith Andrew J
2011-02-01
Full Text Available Abstract Background Recessive mutations of fibroblast growth factor 3 (FGF3 can cause LAMM syndrome (OMIM 610706, characterized by fully penetrant complete labyrinthine aplasia, microtia and microdontia. Methods We performed a prospective molecular genetic and clinical study of families segregating hearing loss linked to FGF3 mutations. Ten affected individuals from three large Pakistani families segregating FGF3 mutations were imaged with CT, MRI, or both to detect inner ear abnormalities. We also modeled the three dimensional structure of FGF3 to better understand the structural consequences of the three missense mutations. Results Two families segregated reported mutations (p.R104X and p.R95W and one family segregated a novel mutation (p.R132GfsX26 of FGF3. All individuals homozygous for p.R104X or p.R132GfsX26 had fully penetrant features of LAMM syndrome. However, recessive p.R95W mutations were associated with nearly normal looking auricles and variable inner ear structural phenotypes, similar to that reported for a Somali family also segregating p.R95W. This suggests that the mild phenotype is not entirely due to genetic background. Molecular modeling result suggests a less drastic effect of p.R95W on FGF3 function compared with known missense mutations detected in fully penetrant LAMM syndrome. Since we detected significant intrafamilial variability of the inner ear structural phenotype in the family segregating p.R95W, we also sequenced FGF10 as a likely candidate for a modifier. However, we did not find any sequence variation, pointing out that a larger sample size will be needed to map and identify a modifier. We also observed a mild to moderate bilateral conductive hearing loss in three carriers of p.R95W, suggesting either a semi-dominant effect of this mutant allele of FGF3, otitis media, or a consequence of genetic background in these three family members. Conclusions We noted a less prominent dental and external ear phenotype in
Altès, Albert; Bach, Vanessa; Ruiz, Angels; Esteve, Anna; Felez, Jordi; Remacha, Angel F; Sardà, M Pilar; Baiget, Montserrat
2009-10-01
Most hereditary hemochromatosis (HH) patients are homozygous for the C282Y mutation of the HFE gene. Nevertheless, penetrance of the disease is very variable. In some patients, penetrance can be mediated by concomitant mutations in other iron master genes. We evaluated the clinical impact of hepcidin (HAMP) and hemojuvelin mutations in a cohort of 100 Spanish patients homozygous for the C282Y mutation of the HFE gene. HAMP and hemojuvelin mutations were evaluated in all patients by bidirectional direct cycle sequencing. Phenotype-genotype interactions were evaluated. A heterozygous mutation of the HAMP gene (G71D) was found in only one out of 100 cases. Following, we performed a study of several members of that family, and we observed several members had a digenic inheritance of the C282Y mutation of the HFE gene and the G71D mutation of the HAMP gene. This mutation in the HAMP gene did not modify the phenotype of the individuals who were homozygous for the C282Y mutation. One other patient presented a new polymorphism in the hemojuvelin gene, without consequences in iron load or clinical course of the disease. In conclusion, HAMP and hemojuvelin mutations are rare among Spanish HH patients, and their impact in this population is not significant.
Genetic variation at 9p22.2 and ovarian cancer risk for BRCA1 and BRCA2 mutation carriers
DEFF Research Database (Denmark)
Ramus, Susan J; Kartsonaki, Christiana; Gayther, Simon A
2011-01-01
Germline mutations in the BRCA1 and BRCA2 genes are associated with increased risks of breast and ovarian cancers. Although several common variants have been associated with breast cancer susceptibility in mutation carriers, none have been associated with ovarian cancer susceptibility. A genome-w...
International Nuclear Information System (INIS)
Li, Wan-Ming; Hu, Ting-Ting; Zhou, Lin-Lin; Feng, Yi-Ming; Wang, Yun-Yi; Fang, Jin
2016-01-01
The PIK3CA H1047R mutation is considered to be a potential predictive biomarker for EGFR-targeted therapies. In this study, we developed a novel PCR-PFLP approach to detect the PIK3CA H1047R mutation in high effectiveness. A 126-bp fragment of PIK3CA exon-20 was amplified by PCR, digested with FspI restriction endonuclease and separated by 3 % agarose gel electrophoresis for the PCR-RFLP analysis. The mutant sequence of the PIK3CA H1047R was spiked into the corresponding wild-type sequence in decreasing ratios for sensitivity analysis. Eight-six cases of formalin-fixed paraffin-embedded colorectal cancer (CRC) specimens were subjected to PCR-RFLP to evaluate the applicability of the method. The PCR-RFLP method had a capability to detect as litter as 0.4 % of mutation, and revealed 16.3 % of the PIK3CA H1047R mutation in 86 CRC tissues, which was significantly higher than that discovered by DNA sequencing (9.3 %). A positive association between the PIK3CA H1047R mutation and the patients’ age was first found, except for the negative relationship with the degree of tumor differentiation. In addition, the highly sensitive detection of a combinatorial mutation of PIK3CA, KRAS and BRAF was achieved using individual PCR-RFLP methods. We developed a sensitive, simple and rapid approach to detect the low-abundance PIK3CA H1047R mutation in real CRC specimens, providing an effective tool for guiding cancer targeted therapy
Koika, Vasiliki; Varnavas, Petros; Valavani, Helen; Sidis, Yisrael; Plummer, Lacey; Dwyer, Andrew; Quinton, Richard; Kanaka-Gantenbein, Christine; Pitteloud, Nelly; Sertedaki, Amalia; Dacou-Voutetakis, Catherine; Georgopoulos, Neoklis A
2013-03-01
FGFR1 mutations have been identified in both Kallmann syndrome and normosmic HH (nIHH). To date, few mutations in the FGFR1 gene have been structurally or functionally characterized in vitro to identify molecular mechanisms that contribute to the disease pathogenesis. We attempted to define the in vitro functionality of two FGFR1 mutants (R254W and R254Q), resulting from two different amino acid substitutions of the same residue, and to correlate the in vitro findings to the patient phenotypes. Two unrelated GnRH deficient probands were found to harbor mutations in FGFR1 (R254W and R254Q). Mutant signaling activity and expression levels were evaluated in vitro and compared to a wild type (WT) receptor. Signaling activity was determined by a FGF2/FGFR1 dependent transcription reporter assay. Receptor total expression levels were assessed by Western blot and cell surface expression was measured by a radiolabeled antibody binding assay. The R254W maximal receptor signaling capacity was reduced by 45% (p<0.01) while R254Q activity was not different from WT. However, both mutants displayed diminished total protein expression levels (40 and 30% reduction relative to WT, respectively), while protein maturation was unaffected. Accordingly, cell surface expression levels of the mutant receptors were also significantly reduced (35% p<0.01 and 15% p<0.05, respectively). The p.R254W and p.R254Q are both loss-of-function mutations as demonstrated by their reduced overall and cell surface expression levels suggesting a deleterious effect on receptor folding and stability. It appears that a tryptophan substitution at R254 is more disruptive to receptor structure than the more conserved glutamine substitution. No clear correlation between the severity of in vitro loss-of-function and phenotypic presentation could be assigned. Copyright © 2012 Elsevier B.V. All rights reserved.
Directory of Open Access Journals (Sweden)
Rupreht Ruth
2007-11-01
Full Text Available Abstract Background Hereditary hemochromatosis (HH is a common genetic disease characterized by excessive iron overload that leads to multi-organ failure. Although the most prevalent genotype in HH is homozygosity for C282Y mutation of the HFE gene, two additional mutations, H63D and S65C, appear to be associated with a milder form of HH. The aim of this study was to develop a high-throughput assay for HFE mutations screening based on TaqMan technology and to determine the frequencies of HFE mutations in the Slovenian population. Methods Altogether, 1282 randomly selected blood donors from different Slovenian regions and 21 HH patients were analyzed for the presence of HFE mutations by an in-house developed real-time PCR assay based on TaqMan technology using shorter non-interfering fluorescent single nucleotide polymorphism (SNP-specific MGB probes. The assay was validated by RFLP analysis and DNA sequencing. Results The genotyping assay of the H63D, S65C and C282Y mutations in the HFE gene, based on TaqMan technology proved to be fast, reliable, with a high-throughput capability and 100% concordant with genotypes obtained by RFLP and DNA sequencing. The observed frequency of C282Y homozygotes in the group of HH patients was only 48%, others were of the heterogeneous HFE genotype. Among 1282 blood donors tested, the observed H63D, S65C and C282Y allele frequency were 12.8% (95% confidence interval (CI 11.5 – 14.2%, 1.8% (95% CI 1.4 – 2.5% and 3.6% (95% CI 3.0 – 4.5%, respectively. Approximately 33% of the tested subjects had at least one of the three HH mutations, and 1% of them were C282Y homozygotes or compound heterozygotes C282Y/H63D or C282Y/S65C, presenting an increased risk for iron overload disease. A significant variation in H63D allele frequency was observed for one of the Slovenian regions. Conclusion The improved real-time PCR assay for H63D, S65C and C282Y mutations detection is accurate, fast, cost-efficient and ready for
Kucinskas, Laimutis; Juzenas, Simonas; Sventoraityte, Jurgita; Cedaviciute, Ruta; Vitkauskiene, Astra; Kalibatas, Vytenis; Kondrackiene, Jurate; Kupcinskas, Limas
2012-04-01
HFE-hemochromatosis is a common autosomal recessive disease caused by HFE gene mutations and characterized as iron overload and failure of different organs. The aim of this study was to determine the prevalence of C282Y (c.845 G>A), H63D (c.187 C>G), and S65C (c.193A>T) alleles of HFE gene in the Lithuanian population. One thousand and eleven healthy blood donors of Lithuanian nationality were examined in four different ethnic Lithuanian regions to determine HFE gene alleles and genotype frequencies. The samples of DNA were analyzed for the presence of restriction fragment length polymorphism and validated by DNA sequencing. Among 1,011 blood donors tested, the frequency of C282Y, H63D, and S65C alleles were 2.6%, 15.9%, and 1.9%, respectively. One third of the tested subjects (n = 336) had at least one of the C282Y or H63D HFE gene mutations. The screening of Lithuanian blood donors has detected 13 (1.3%) subjects with a genotype C282Y/C282Y or C282Y/H63D responsible for the development of HFE-hemochromatosis. The prevalence of C282Y mutation was significantly higher among the inhabitants of Zemaitija (Somogitia) at the Baltic Sea area (5.9%) in comparison to the regions of continental part of Lithuania (2.4% in Dzukija, 2.3% in Aukstaitija, and 2% in Suvalkija, p HFE gene mutations in ethnic Lithuanians showed that the frequencies of H63D, C282Y, and S65C of HFE gene alleles are similar to the other North-Eastern Europeans, especially in the Baltic region (Estonia, Latvia), Poland, and part of Russia (Moscow region).
DEFF Research Database (Denmark)
Nimsanor, Natakarn; Poulsen, Ulla; Rasmussen, Mikkel A.
2016-01-01
pluripotent stem cells (iPSCs) hold great promise to model FTDP-17 as such cells can be differentiated in vitro to the required cell type. Furthermore, gene-editing approaches allow generating isogenic gene-corrected controls that can be used as a very specific control. Here, we report the generation......Frontotemporal dementia with parkinsonism linked to chromosome 17q21.2 (FTDP-17) is an autosomal-dominant neurodegenerative disorder. Mutations in the MAPT (microtubule-associated protein tau) gene can cause FTDP-17, but the underlying pathomechanisms of the disease are still unknown. Induced...... of genetically corrected iPSCs from a pre-symptomatic carrier of the R406W mutation in the MAPT-gene....
p53 gene mutation hotspots in skin cancer and ultraviolet induced mutation
International Nuclear Information System (INIS)
Ikehata, Hironobu
1998-01-01
Presence of certain hotspots is known in the mutation of p53 gene in skin cancer, which are codons 177, 196, 245, 248, 278 and 282 located in the exon 5-8. In these regions, mutations like C to T and CC to TT are frequent and thereby suggest that they are resulted from pyrimidine-dimers produced by ultraviolet light (UV). In cyclobutane pyrimidine dimerization (CPD), conversion of cytosine to thymine by deamination is suggested to be the primary reaction. Although studies using UVC (254 nm) suggesting that the mutation hotspots are low repair efficiency regions could not completely explain the all hotspots, those using UVB and sunlight (UVB and UVA) revealed that CPD was efficiently produced even in such regions as not explained by studies with UVC alone. Therefore, the latter studies are conceivably reasonable since the skin cancer is induced by natural sunlight. Exon 5-8 DNA is completely methylated and the absorption coefficient of 5-methylcytosine is 5-6 times as large as that of cytosine at wavelength around 290 nm. These indicate the importance of UVB in mutation of mammalian cells possessing the ability to methylate DNA. (K.H.)
International Nuclear Information System (INIS)
Giacomazzi, Juliana; Hainaut, Pierre; Ashton-Prolla, Patricia; Selistre, Simone; Duarte, Juliana; Ribeiro, Jorge Pinto; Vieira, Paulo JC; Souza Macedo, Gabriel de; Rossi, Cristina; Czepielewski, Mauro; Netto, Cristina Brinkmann Oliveira
2013-01-01
Adrenocortical carcinomas (ACCs) are among the most common childhood cancers occurring in infants affected with the Li-Fraumeni and Li- Fraumeni-like (LFS/LFL) syndromes, which are caused by dominant germline mutations in the TP53 gene. In Brazil, a particular mutation, occurring in the tetramerisation domain of the gene, p.R337H, is exceedingly common due to a founder effect and is strongly associated with ACC. In this report, we describe the phenotype and long-term clinical follow-up of a female child diagnosed with ACC and homozygous for the TP53 p.R337H founder mutation. At age 11 months, the patient was diagnosed with a virilising anaplastic adrenal cortical tumour, which was completely excised without disturbing the adrenal capsule. Family history was consistent with an LFL tumour pattern, and genotyping identified the TP53 p.R337H mutation in both alleles in genomic DNA from lymphocytes and fibroblasts. Haplotype analysis confirmed the occurrence of the mutation in the same founder haplotype previously described in other Brazilian patients. No other germline or somatic TP53 mutations or rearrangements were identified. At age 9 years, the child was asymptomatic and had no evidence of endocrine derangements. Full body and brain magnetic resonance imaging (MRI) failed to detect any suspicious proliferative lesions, and cardiopulmonary exercise testing results were within the normal reference for the child’s age, ruling out a major exercise capacity deficiency. This is the first clinical and aerobic functional capacity documentation of a patient who carries two mutant TP53 alleles and no wild-type allele. Our results support the hypothesis that TP53 p.R337H, the most common TP53 mutation ever described in any population, is a conditional mutant. Furthermore, our observations over a long period of clinical follow-up suggest that TP53 p.R337H homozygotes do not have a more severe disease phenotype than do heterozygote carriers of the same mutation. Patients with
R248Q mutation--Beyond p53-DNA binding.
Ng, Jeremy W K; Lama, Dilraj; Lukman, Suryani; Lane, David P; Verma, Chandra S; Sim, Adelene Y L
2015-12-01
R248 in the DNA binding domain (DBD) of p53 interacts directly with the minor groove of DNA. Earlier nuclear magnetic resonance (NMR) studies indicated that the R248Q mutation resulted in conformation changes in parts of DBD far from the mutation site. However, how information propagates from the mutation site to the rest of the DBD is still not well understood. We performed a series of all-atom molecular dynamics (MD) simulations to dissect sterics and charge effects of R248 on p53-DBD conformation: (i) wild-type p53 DBD; (ii) p53 DBD with an electrically neutral arginine side-chain; (iii) p53 DBD with R248A; (iv) p53 DBD with R248W; and (v) p53 DBD with R248Q. Our results agree well with experimental observations of global conformational changes induced by the R248Q mutation. Our simulations suggest that both charge- and sterics are important in the dynamics of the loop (L3) where the mutation resides. We show that helix 2 (H2) dynamics is altered as a result of a change in the hydrogen bonding partner of D281. In turn, neighboring L1 dynamics is altered: in mutants, L1 predominantly adopts the recessed conformation and is unable to interact with the major groove of DNA. We focused our attention the R248Q mutant that is commonly found in a wide range of cancer and observed changes at the zinc-binding pocket that might account for the dominant negative effects of R248Q. Furthermore, in our simulations, the S6/S7 turn was more frequently solvent exposed in R248Q, suggesting that there is a greater tendency of R248Q to partially unfold and possibly lead to an increased aggregation propensity. Finally, based on the observations made in our simulations, we propose strategies for the rescue of R248Q mutants. © 2015 Wiley Periodicals, Inc.
C282Y and H63D Mutation Frequencies in a Population from Central Spain
Directory of Open Access Journals (Sweden)
S. Alvarez
2001-01-01
Full Text Available Objectives: To determine the frequency of hereditary hemochromatosis gene mutations, C282Y and H63D, from 125 autochthonous blood donors originating from a Central region of Spain, to provide epidemiological data about HFE gene in the Iberian Peninsula.
Directory of Open Access Journals (Sweden)
Selma Ünal
2014-09-01
Full Text Available OBJECTIVE: This study was planned in order to determine the effect of C282Y mutation in development of secondary hemochromatosis in beta-thalassemia patients and to determine the prevalence and allele frequency of this mutation in a healthy control group. METHODS: Eighty-seven children and young adults (46 males and 41 females; mean age: 15.6±6.1 years, range: 3-30 years with beta-thalassemia major (BTM and 13 beta-thalassemia intermedia (BTI patients (6 males and 7 females; mean age: 19.6±3.5 years, range: 13-26 years were included in the study. The control group comprised 100 healthy blood donors. RESULTS: Neither heterozygous nor homozygous HFE gene C282Y mutation was detected in patients with BTM or BTI, or in control group. CONCLUSION: The C282Y mutation, which is supposed to be responsible for the majority of hereditary hemochromatosis, was not found to have a role in the development of hemochromatosis in beta-thalassemia patients and was not detected in a healthy Turkish population. However, research on larger cohorts of individuals is required in order to determine the exact prevalence of the HFE gene mutation in Turkish populations from diverse ethnic origins and whether it would have an impact on iron loading in thalassemic populations.
Li, Cheng; Liu, Junjie; Wang, Sida; Chen, Yuanyuan; Yuan, Zhigang; Zeng, Jian; Li, Zhixian
2015-01-01
To retrospectively analyze and compare the ultrasonographic characteristics and BI-RADS-US classification between patients with BRCA1 mutation-associated breast cancer and those without BRCA1 gene mutation in Guangxi, China. The study was performed in 36 lesions from 34 BRCA1 mutation-associated breast cancer patients. A total of 422 lesions from 422 breast cancer patients without BRCA1 mutations served as control group. The comparison of the ultrasonographic features and BI-RADS-US classification between two the groups were reviewed. More complex inner echo was disclosed in BRCA1 mutation-associated breast cancer patients (x(2) = 4.741, P = 0.029). The BI-RADS classification of BRCA1 mutation-associated breast cancer was lower (U = 6094.0, P = 0.022). BRCA1 mutation-associated breast cancer frequently displays as microlobulated margin and complex echo. It also shows more benign characteristics in morphology, and the BI-RADS classification is prone to be underestimated.
The association between smoking and cancer incidence in BRCA1 and BRCA2 mutation carriers.
Ko, Kwang-Pil; Kim, Shana J; Huzarski, Tomasz; Gronwald, Jacek; Lubinski, Jan; Lynch, Henry T; Armel, Susan; Park, Sue K; Karlan, Beth; Singer, Christian F; Neuhausen, Susan L; Narod, Steven A; Kotsopoulos, Joanne
2018-06-01
Tobacco smoke is an established carcinogen, but the association between tobacco smoking and cancer risk in BRCA mutation carriers is not clear. The aim of this study was to evaluate prospectively the association between tobacco smoking and cancer incidence in a cohort of BRCA1 and BRCA2 mutation carriers. The study population consisted of unaffected BRCA mutation carriers. Information on lifestyle including smoking histories, reproductive factors, and past medical histories was obtained through questionnaires. Incident cancers were updated biennially via follow-up questionnaires. Hazard ratios (HRs) and 95% confidence intervals (CIs) were estimated using time-dependent Cox regression models. There were 700 incident cancers diagnosed over 26,711 person-years of follow-up. The most frequent cancers seen in BRCA mutation carriers were breast (n = 428; 61%) and ovarian (n = 109; 15%) cancer. Compared to nonsmokers, (ever) smoking was associated with a modest increased risk of all cancers combined (HR = 1.17; 95%CI 1.01-1.37). Women in the highest group of total pack-years (4.3-9.8) had an increased risk of developing any cancer (HR = 1.27; 95%CI 1.04-1.56), breast cancer (HR = 1.33, 95%CI 1.02-1.75), and ovarian cancer (HR = 1.68; 95%CI 1.06-2.67) compared to never smokers. The associations between tobacco smoking and cancer did not differ by BRCA mutation type or by age at diagnosis. This prospective study suggests that tobacco smoking is associated with a modest increase in the risks of breast and ovarian cancer among women with BRCA1 or BRCA2 mutation. © 2018 UICC.
Ryan, Neil A J; Morris, Julie; Green, Kate; Lalloo, Fiona; Woodward, Emma R; Hill, James; Crosbie, Emma J; Evans, D Gareth
2017-12-01
Lynch syndrome is caused by dominantly inherited germline mutations that predispose individuals to colorectal, endometrial, ovarian, and other cancers through inactivation of the cellular mismatch repair system. Lynch syndrome–associated cancers are amenable to surveillance strategies that may improve survival. The age at which surveillance should start is disputed. To determine whether mutated gene and type of mutation influence age at onset of Lynch syndrome–associated cancers. A retrospective cohort study of individuals with Lynch syndrome–associated colorectal, endometrial, and/or ovarian cancers whose medical records were included in the clinical database of a large quaternary referral center for genomic medicine in the Northwest of England. Mutated gene (MLH1, MSH2, MSH6, and/or PMS2) and type of mutation (truncating, splicing, or large rearrangement). Age at cancer diagnosis. A total of 1063 individuals with proven Lynch syndrome were included, 495 male and 568 female (mean age 52 years; age range, 10-93 years [children were included in the database, but no children developed cancer]). There were 546 men and women with colorectal cancer, 162 women with endometrial cancer, and 49 women with ovarian cancer; mean follow-up was 68.2 months. Among MLH1 mutation carriers, mutations in MLH1 were associated with colorectal cancer in 249 (61%) of 409 men and women; endometrial cancer in 53 of 196 (27%) women; and ovarian cancer in 15 (8%) of 196 women. Among MSH2 mutation carriers, mutations in MSH2 (the most prevalent mutations overall) were most commonly associated with female-specific cancers: endometrial cancer in 83 (30%) of 279 women; ovarian cancer in 28 (10%) of 279 women; and colorectal cancer in 239 (50%) 479 men and women. Mutations in MSH6 were less prevalent, and MSH6 mutation carriers presented with colorectal and endometrial cancer at later ages than carriers of mutations in MSH2 or MLH1. When stratified by mutation type, women with truncating
Common filaggrin gene mutations and risk of cervical cancer
DEFF Research Database (Denmark)
Bager, Peter; Wohlfahrt, Jan; Sørensen, Erik
2015-01-01
BACKGROUND: As carriers of filaggrin gene (FLG) mutations may have a compromised cervical mucosal barrier against human papillomavirus infection, our primary objective was to study their risk of cervical cancer. METHODS: We genotyped 586 cervical cancer patients for the two most common FLG...... mutations, R501X and 2282del4, using blood from the Copenhagen Hospital Biobank, Denmark. Controls (n = 8050) were genotyped in previous population-based studies. Information on cervical cancer, mortality and emigration were obtained from national registers. Odds ratios (OR) were estimated by logistic...... and stratification by cancer stage. RESULTS: The primary results showed that FLG mutations were not associated with the risk of cervical cancer (6.3% of cases and 7.7% of controls were carriers; OR adjusted 0.81, 95% CI 0.57-1.14; OR adjusted+ weighted 0.96, 95% CI 0.58-1.57). Among cases, FLG mutations increased...
Synthetic Lethal Therapeutic Approaches for ARID1A-Mutated Ovarian Cancer
2017-10-01
Award Number: W81XWH-16-1-0496 TITLE: Synthetic lethal therapeutic approaches for ARID1A-mutated ovarian cancer PRINCIPAL INVESTIGATOR: Rugang...AND SUBTITLE Synthetic lethal therapeutic approaches for ARID1A-mutated ovarian cancer 5a. CONTRACT NUMBER 5b. GRANT NUMBER W81XWH-16-1-0496 5c...Release; Distribution Unlimited 13. SUPPLEMENTARY NOTES 14. ABSTRACT Epithelial ovarian cancer (EOC) is the leading cause of death among gynecological
Association of HFE gene mutations with nonalcoholic fatty liver disease in the Iranian population.
Saremi, L; Lotfipanah, S; Mohammadi, M; Hosseinzadeh, H; Sayad, A; Saltanatpour, Z
2016-10-31
To determine whether the HFE gene variants H63D and C282Y are associated with NAFLD in persons with type 2 diabetes, we conducted a case-control study including 145 case of NAFLD patients with a history of type 2 diabetes and 145 matching control. The genomic DNA was extracted from the peripheral venous blood and the genotyping of HFE gene mutations was analyzed using the PCR-RFLP technique. Statistical analysis was performed using SPSS 12.0 software by χ2 test, t test and ANOVA (P<0.05). Data showed no increased frequency of HFE mutations in persons with type 2 diabetes and no association between H63D mutation and NAFLD in the study population. Also, we analyzed index of physiological variables including FBS, lipid profile (TC, TG, LDL-C, and HDL-C), BMI, HbA1c, and micro albuminuria and Cr levels). Data showed there are no relationship between these indexes and HFE gene mutations and either NAFLD as a complication of diabetes. But our results showed a relationship between C282Y mutation and NAFLD in persons with type 2 diabetes. C282Y mutation might be a genetic marker of NAFLD in Iranian population.
Directory of Open Access Journals (Sweden)
Su X
2016-11-01
Full Text Available Xingyun Su,1 Xiaoxia Jiang,1 Weibin Wang,1 Haiyong Wang,1 Xin Xu,2 Aihui Lin,1 Xiaodong Teng,3 Huiling Wu,4 Lisong Teng1 1Department of Surgical Oncology, 2Department of Medical Oncology, 3Department of Pathology, 4Department of Plastic Surgery, First Affiliated Hospital, School of Medicine, Zhejiang University, Hangzhou, Zhejiang, People’s Republic of China Abstract: The clinicopathological and prognostic significance of telomerase reverse transcriptase (TERT promoter mutations have been widely investigated in thyroid cancer; however, the results are still discrepant. Systematic searches were performed in PubMed, Web of Science, Scopus, Ovid, and the Cochran Library databases for relevant articles prior to April 2016. Mutation rates were synthesized by R statistical software. The odds ratio or standardized mean difference with 95% confidence interval was pooled by Stata. A total of 22 studies with 4,907 cases were included in this meta-analysis. TERT promoter mutations tended to present in aggressive histological types including poorly differentiated thyroid cancer (33.37%, anaplastic thyroid cancer (38.69%, and tall-cell variant papillary thyroid cancer (30.23%. These promoter mutations were likely to exist in older patients and males and were well associated with larger tumor size, extrathyroidal extension, vascular invasion, lymph node metastasis, distant metastasis, advanced tumor stage, disease recurrence/persistence, and mortality. In addition, TERT promoter mutations (especially C228T tended to coexist with BRAFV600E mutation, which indicated more aggressive tumor behavior. Therefore, TERT promoter mutations may be promising biomarkers for early diagnosis, risk stratification, prognostic prediction, and management of thyroid cancer. Keywords: TERT promoter mutations, thyroid cancer, clinicopathological features, prognosis, BRAFV600E mutation
Long QT Syndrome–Associated Mutations in Intrauterine Fetal Death
Crotti, Lia; Tester, David J.; White, Wendy M.; Bartos, Daniel C.; Insolia, Roberto; Besana, Alessandra; Kunic, Jennifer D.; Will, Melissa L.; Velasco, Ellyn J.; Bair, Jennifer J.; Ghidoni, Alice; Cetin, Irene; Van Dyke, Daniel L.; Wick, Myra J.; Brost, Brian; Delisle, Brian P.; Facchinetti, Fabio; George, Alfred L.; Schwartz, Peter J.; Ackerman, Michael J.
2013-01-01
Importance Intrauterine fetal death or stillbirth occurs in approximately 1 out of every 160 pregnancies and accounts for 50% of all perinatal deaths. Postmortem evaluation fails to elucidate an underlying cause in many cases. Long QT syndrome (LQTS) may contribute to this problem. Objective To determine the spectrum and prevalence of mutations in the 3 most common LQTS susceptible genes (KCNQ1, KCNH2, and SCN5A) for a cohort of unexplained cases. Design, Setting, and Patients In this case series, retrospective postmortem genetic testing was conducted on a convenience sample of 91 unexplained intrauterine fetal deaths (mean [SD] estimated gestational age at fetal death, 26.3 [8.7] weeks) that were collected from 2006-2012 by the Mayo Clinic, Rochester, Minnesota, or the Fondazione IRCCS Policlinico San Matteo, Pavia, Italy. More than 1300 ostensibly healthy individuals served as controls. In addition, publicly available exome databases were assessed for the general population frequency of identified genetic variants. Main Outcomes and Measures Comprehensive mutational analyses of KCNQ1 (KV7.1, LQTS type 1), KCNH2 (HERG/KV11.1, LQTS type 2), and SCN5A (NaV1.5, LQTS type 3) were performed using denaturing high-performance liquid chromatography and direct DNA sequencing on genomic DNA extracted from decedent tissue. Functional analyses of novel mutations were performed using heterologous expression and patch-clamp recording. Results The 3 putative LQTS susceptibility missense mutations (KCNQ1, p.A283T; KCNQ1, p.R397W; and KCNH2[1b], p.R25W), with a heterozygous frequency of less than 0.05% in more than 10000 publicly available exomes and absent in more than 1000 ethnically similar control patients, were discovered in 3 intrauterine fetal deaths (3.3% [95% CI, 0.68%-9.3%]). Both KV7.1-A283T (16-week male) and KV7.1-R397W (16-week female) mutations were associated with marked KV7.1 loss-of-function consistent with in utero LQTS type 1, whereas the HERG1b-R25W mutation
Associations between mutations and a VNTR in the human phenylalanine hydroxylase gene
Energy Technology Data Exchange (ETDEWEB)
Goltsov, A.A.; Eisensmith, R.C.; Woo, S.L.C. (Baylor College of Medicine, Houston, TX (United States)); Konecki, D.S.; Lichter-Konecki, U.
1992-09-01
The HindIII RFLP in the human phenylalanine hydroxylase (PAH) gene is caused by the presence of an AT-rich (70%) minisatellite region. This region contains various multiples of 30-bp tandem repeats and is located 3 kb downstream of the final exon of the gene. PCR-mediated amplification of this region from haplotyped PAH chromosomes indicates that the previously reported 4.0-kb HindIII allele contains three of these repeats, while the 4.4-kb HindIII allele contains 12 of these repeats. The 4.2-kb HindIII fragment can contain six, seven, eight, or nine copies of this repeat. These variations permit more detailed analysis of mutant haplotypes 1, 5, 6, and, possibly, others. Kindred analysis in phenylketonuria families demonstrates Mendelian segregation of these VNTR alleles, as well as associations between theses alleles and certain PAH mutations. The R261Q mutation, associated with haplotype 1, is associated almost exclusively with an allele containing eight repeats; the R408W mutation, when occurring on a haplotype 1 background, may also be associated with the eight-repeat VNTR allele. Other PAH mutations associated with haplotype 1, R252W and P281L, do not appear to segregate with specific VNTR alleles. The IVS-10 mutation, when associated with haplotype 6, is associated exclusively with an allele containing seven repeats. The combined use of this VNTR system and the existing RFLP haplotype system will increase the performance of prenatal diagnostic tests based on haplotype analysis. In addition, this VNTR may prove useful in studies concerning the origins and distributions of PAH mutations in different human populations. 32 refs., 3 figs., 3 tabs.
DEFF Research Database (Denmark)
Nimsanor, Natakarn; Poulsen, Ulla; Rasmussen, Mikkel A.
2016-01-01
pluripotent stem cells (iPSCs) hold great promise to model FTDP-17 as such cells can be differentiated in vitro to the required cell type. Furthermore, gene-editing approaches allow generating isogenic gene-corrected controls that can be used as a very specific control. Here, we report the generation......Frontotemporal dementia with parkinsonism linked to chromosome 17q21.2 (FTDP-17) is an autosomal-dominant neurodegenerative disorder. Mutations in the MAPT (microtubule-associated protein tau) gene can cause FTDP-17, but the underlying pathomechanisms of the disease are still unknown. Induced...... of genetically corrected iPSCs from a 59-year-old female FTD-17 patient carrying an R406W mutation in the MAPT-gene....
PMS2 mutations in childhood cancer.
De Vos, Michel; Hayward, Bruce E; Charlton, Ruth; Taylor, Graham R; Glaser, Adam W; Picton, Susan; Cole, Trevor R; Maher, Eamonn R; McKeown, Carole M E; Mann, Jill R; Yates, John R; Baralle, Diana; Rankin, Julia; Bonthron, David T; Sheridan, Eamonn
2006-03-01
Until recently, the PMS2 DNA mismatch repair gene has only rarely been implicated as a cancer susceptibility locus. New studies have shown, however, that earlier analyses of this gene have had technical limitations and also that the genetic behavior of mutant PMS2 alleles is unusual, in that, unlike MLH1 or MSH2 mutations, PMS2 mutations show low heterozygote penetrance. As a result, a dominantly inherited cancer predisposition has not been a feature reported in families with PMS2 mutations. Such families have instead been ascertained through childhood-onset cancers in homozygotes or through apparently sporadic colorectal cancer in heterozygotes. We present further information on the phenotype associated with homozygous PMS2 deficiency in 13 patients from six families of Pakistani origin living in the United Kingdom. This syndrome is characterized by café-au-lait skin pigmentation and a characteristic tumor spectrum, including leukemias, lymphomas, cerebral malignancies (such as supratentorial primitive neuroectodermal tumors, astrocytomas, and glioblastomas), and colorectal neoplasia with an onset in early adult life. We present evidence for a founder effect in five families, all of which carried the same R802-->X mutation (i.e., arginine-802 to stop) in PMS2. This cancer syndrome can be mistaken for neurofibromatosis type 1, with important management implications including the risk of the disorder occurring in siblings and the likelihood of tumor development in affected individuals.
Sun, Dezhong; Zhang, Xiaoyan; Zhang, Xiaolei
2018-02-28
Several studies have evaluated the association of miR-146a C/G with head and neck cancer (HNC) susceptibility, and overall cancer risk, but with inconclusive outcomes. To drive a more precise estimation, we carried out this meta-analysis. The literature was searched from MEDLINE (mainly PubMed), Embase, the Cochrane Library, and Google Scholar databases to identify eligible studies. A total of 89 studies were included. The results showed that miR-146a C/G was significantly associated with increased HNC risk in dominant model ( I 2 =15.6%, P heterogeneity =0.282, odds ratio (OR) =1.088, 95% confidence interval (CI) =1.002-1.182, P =0.044). However, no cancer risk was detected under all genetic models. By further stratified analysis, we found that rs4919510 mutation contributed to the risk of HNC amongst Asians under homozygote model ( I 2 =0, P heterogeneity =0.541, OR =1.189, 95% CI =1.025-1.378, P =0.022), and dominant model ( I 2 =0, P heterogeneity =0.959, OR =1.155, 95% CI =1.016-1.312, P =0.028). Simultaneously, in the stratified analysis by source of controls, a significantly increased cancer risk amongst population-based studies was found under homozygote model, dominant model, recessive model, and allele comparison model. However, no significant association was found in the stratified analysis by ethnicity and source of control. The results indicated that miR-146a C/G polymorphism may contribute to the increased HNC susceptibility and could be a promising target to forecast cancer risk for clinical practice. However, no significant association was found in subgroup analysis by ethnicity and source of control. To further confirm these results, well-designed large-scale case-control studies are needed in the future. © 2018 The Author(s).
Distinct effects of the recurrent Mlh1G67R mutation on MMR functions, cancer, and meiosis
Avdievich, Elena; Reiss, Cora; Scherer, Stefan J.; Zhang, Yongwei; Maier, Sandra M.; Jin, Bo; Hou, Harry; Rosenwald, Andreas; Riedmiller, Hubertus; Kucherlapati, Raju; Cohen, Paula E.; Edelmann, Winfried; Kneitz, Burkhard
2008-01-01
Mutations in the human DNA mismatch repair (MMR) gene MLH1 are associated with hereditary nonpolyposis colorectal cancer (Lynch syndrome, HNPCC) and a significant proportion of sporadic colorectal cancer. The inactivation of MLH1 results in the accumulation of somatic mutations in the genome of tumor cells and resistance to the genotoxic effects of a variety of DNA damaging agents. To study the effect of MLH1 missense mutations on cancer susceptibility, we generated a mouse line carrying the ...
Hao, Lin; Sen, Sandeep; Sugumar, Dhivya
2015-02-01
The current study presents the case of a 63-year-old patient exhibiting refractory anemia with ringed sideroblasts associated with marked thrombocytosis (RARS-T), who was positive for the MPL W515L mutation, but negative for the JAK2 V617F mutation. Following diagnosis, the patient remained asymptomatic for over three years, however, in August 2012, the patient relapsed and was administered with supportive treatment in the form of subcutaneous darbepoetin α at a dose of 300 μg/week, which resulted in an increased hemoglobin concentration, allowing the patient to remain transfusion-independent. The MPL W515L mutation has been reported in two previous cases of myelodysplastic/myeloproliferative neoplasms (MDS/MPN) with ringed sideroblasts, however, to the best of our knowledge, the current report is the first to present a case of RARS-T with an MPL W515L mutation. A clinical trial designed to evaluate the efficacy of a targeted agent against the JAK2 V617F mutation is currently ongoing, with the aim of providing a novel therapeutic strategy for treating MDS/MPN patients. As MPL is located upstream of the JAK-STAT signaling pathway, it is a possible therapeutic target in MDS/MPN patients positive for an MPL W515L mutation, but negative for a JAK2 V617F mutation.
Null missense ABCR (ABCA4) mutations in a family with stargardt disease and retinitis pigmentosa.
Shroyer, N F; Lewis, R A; Yatsenko, A N; Lupski, J R
2001-11-01
To determine the type of ABCR mutations that segregate in a family that manifests both Stargardt disease (STGD) and retinitis pigmentosa (RP), and the functional consequences of the underlying mutations. Direct sequencing of all 50 exons and flanking intronic regions of ABCR was performed for the STGD- and RP-affected relatives. RNA hybridization, Western blot analysis, and azido-adenosine triphosphate (ATP) labeling was used to determine the effect of disease-associated ABCR mutations in an in vitro assay system. Compound heterozygous missense mutations were identified in patients with STGD and RP. STGD-affected individual AR682-03 was compound heterozygous for the mutation 2588G-->C and a complex allele, [W1408R; R1640W]. RP-affected individuals AR682-04 and-05 were compound heterozygous for the complex allele [W1408R; R1640W] and the missense mutation V767D. Functional analysis of the mutation V767D by Western blot and ATP binding revealed a severe reduction in protein expression. In vitro analysis of ABCR protein with the mutations W1408R and R1640W showed a moderate effect of these individual mutations on expression and ATP-binding; the complex allele [W1408R; R1640W] caused a severe reduction in protein expression. These data reveal that missense ABCR mutations may be associated with RP. Functional analysis reveals that the RP-associated missense ABCR mutations are likely to be functionally null. These studies of the complex allele W1408R; R1640W suggest a synergistic effect of the individual mutations. These data are congruent with a model in which RP is associated with homozygous null mutations and with the notion that severity of retinal disease is inversely related to residual ABCR activity.
Wang, Zuoyun; Sun, Yihua; Gao, Bin; Lu, Yi; Fang, Rong; Gao, Yijun; Xiao, Tian; Liu, Xin-Yuan; Pao, William; Zhao, Yun; Chen, Haiquan; Ji, Hongbin
2014-01-01
Germline mutations are responsible for familial cancer syndromes which account for approximately 5-10% of all types of cancers. These mutations mainly occur at tumor suppressor genes or genome stability genes, such as DNA repair genes. Here we have identified a cancer predisposition family, in which eight members were inflicted with a wide spectrum of cancer including one diagnosed with lung cancer at 22years old. Sequencing analysis of tumor samples as well as histologically normal specimens identified two germline mutations co-existing in the familial cancer syndrome, the mutation of tumor suppressor gene P53 V157D and mismatch repair gene PMS2 R20Q. We further demonstrate that P53 V157D and/or PMS2 R20Q mutant promotes lung cancer cell proliferation. These two mutants are capable of promoting colony formation in soft agar as well as tumor formation in transgenic drosophila system. Collectively, these data have uncovered the important role of co-existing germline P53 and PMS2 mutations in the familial cancer syndrome development. Copyright © 2013 Elsevier Ireland Ltd. All rights reserved.
A FGF3 mutation associated with differential inner ear malformation, microtia, and microdontia.
Ramsebner, Reinhard; Ludwig, Martin; Parzefall, Thomas; Lucas, Trevor; Baumgartner, Wolf-Dieter; Bodamer, Olaf; Cengiz, Filiz Basak; Schoefer, Christian; Tekin, Mustafa; Frei, Klemens
2010-02-01
Analysis of association between genotype and phenotype. Prospective genetic study in a family. Auditory investigations, computer tomography, and genetic sequencing of the fibroblast growth factor 3 (FGF3) gene were performed on a Somali family presenting with autosomal recessive, hearing impairment, microdontia, and outer ear morphologies ranging from normal auricle development to microtia assessed as type 1 Weerda dysplasia in affected individuals. Computed tomography imaging identified differential inter- and intraindividual malformations of the inner ear including labyrinth aplasia, development of a common cavity to the presence of a cochlear with 1.5 windings (Mondini malformation) in affected individuals, symptoms similar to those described as labyrinth aplasia, microtia, and microdontia (LAMM) syndrome, caused by mutations in FGF3. Genetic sequencing revealed the presence of a novel p.R95W missense mutation in FGF3 segregating with pathology. The p.R95W mutation substitutes a positively charged arginine for a polar tryptophan in the highly conserved RYLAM consensus of the beta 6 sheet of FGF3 that interacts with FGFR2. These findings describe, for the first time, variable inner ear malformations and outer ear dysplasia in the presence of constant microdontia, associated with homozygous inheritance of the p.R95W mutation in FGF3, mirroring phenotypes observed in mouse models ablating FGF3/FGFR2 signaling.
Spínola, Carla; Brehm, António; Spínola, Hélder
2011-01-01
Hereditary HFE Hemochromatosis is an inherited disorder of iron metabolism that results from mutations in the HFE gene. Almost all patients with hereditary hemochromatosis show a C282Y mutation in homozygosity or in compound heterozygosity with H63D. Also, the mutation S65C has been shown to be associated to a milder iron overload. Since allele and genotype frequencies of these three variants of the HFE gene vary between populations, the determination of their prevalence in Madeira Island will clarify the population susceptibility to hereditary hemochromatosis. One hundred and fifty-four samples from Madeira Island were genotyped for the three most common HFE gene mutations, H63D, C282Y, and S65C, by polymerase chain reaction followed by restriction fragment length polymorphism analysis. Results have shown a prevalence of 20.5%, 0.33%, and 1% for H63D, C282Y, and S65C, respectively. Accordingly to our estimates, both genotypes associated to hereditary hemochromatosis, C282Y homozygotes and C282/H63D compound heterozygotes, could be present in Madeira Island population in 1,648 individuals, which represents 0.65% of the total population.
Aragon Han, Patricia; Kim, Hyun-seok; Cho, Soonweng; Fazeli, Roghayeh; Najafian, Alireza; Khawaja, Hunain; McAlexander, Melissa; Dy, Benzon; Sorensen, Meredith; Aronova, Anna; Sebo, Thomas J.; Giordano, Thomas J.; Fahey, Thomas J.; Thompson, Geoffrey B.; Gauger, Paul G.
2016-01-01
Background: Studies have demonstrated an association of the BRAFV600E mutation and microRNA (miR) expression with aggressive clinicopathologic features in papillary thyroid cancer (PTC). Analysis of BRAFV600E mutations with miR expression data may improve perioperative decision making for patients with PTC, specifically in identifying patients harboring central lymph node metastases (CLNM).
Heath, Kathleen M; Axton, Jacob H; McCullough, John M; Harris, Nathan
2016-05-01
The C282Y allele is the major cause of hemochromatosis as a result of excessive iron absorption. The mutation arose in continental Europe no earlier than 6,000 years ago, coinciding with the arrival of the Neolithic agricultural revolution. Here we hypothesize that this new Neolithic diet, which originated in the sunny warm and dry climates of the Middle East, was carried by migrating farmers into the chilly and damp environments of Europe where iron is a critical micronutrient for effective thermoregulation. We argue that the C282Y allele was an adaptation to this novel environment. To address our hypothesis, we compiled C282Y allele frequencies, known Neolithic sites in Europe and climatic data on temperature and rainfall for statistical analysis. Our findings indicate that the geographic cline for C282Y frequency in Europe increases as average temperatures decrease below 16°C, a critical threshold for thermoregulation, with rainy days intensifying the trend. The results indicate that the deleterious C282Y allele, responsible for most cases of hemochromatosis, may have evolved as a selective advantage to culture and climate during the European Neolithic. © 2016 The Authors American Journal of Physical Anthropology Published by Wiley Periodicals, Inc.
Atik, Tahir; Aykut, Ayca; Hazan, Filiz; Onay, Huseyin; Goksen, Damla; Darcan, Sukran; Tukun, Ajlan; Ozkinay, Ferda
2016-06-01
To evaluate the spectrum of PTPN11 gene mutations in Noonan syndrome patients and to study the genotype-phenotype associations. In this study, twenty Noonan syndrome patients with PTPN11 mutations were included. The patients underwent a detailed clinical and physical evaluation. To identify inherited cases, parents of all mutation positive patients were analyzed. Thirteen different PTPN11 mutations, two of them being novel, were detected in the study group. These mutations included eleven missense mutations: p.G60A, p.D61N, p.Y62D, p.Y63C, p.E69Q, p.Q79R, p.Y279C,p.N308D, p.N308S, p.M504V, p.Q510R and two novel missense mutations: p.I56V and p.I282M. The frequency of cardiac abnormalities and short stature were found to be 80 % and 80 %, respectively. Mental retardation was not observed in patients having exon 8 mutations. No significant correlations were detected between other phenotypic features and genotypes. By identifying genotype-phenotype correlations, this study provides information on phenotypes observed in NS patients with different PTPN11 mutations.
Radioprotection of IDH1-Mutated Cancer Cells by the IDH1-Mutant Inhibitor AGI-5198.
Molenaar, Remco J; Botman, Dennis; Smits, Myrthe A; Hira, Vashendriya V; van Lith, Sanne A; Stap, Jan; Henneman, Peter; Khurshed, Mohammed; Lenting, Krissie; Mul, Adri N; Dimitrakopoulou, Dionysia; van Drunen, Cornelis M; Hoebe, Ron A; Radivoyevitch, Tomas; Wilmink, Johanna W; Maciejewski, Jaroslaw P; Vandertop, W Peter; Leenders, William P; Bleeker, Fonnet E; van Noorden, Cornelis J
2015-11-15
Isocitrate dehydrogenase 1 (IDH1) is mutated in various types of human cancer to IDH1(R132H), a structural alteration that leads to catalysis of α-ketoglutarate to the oncometabolite D-2-hydroxyglutarate. In this study, we present evidence that small-molecule inhibitors of IDH1(R132H) that are being developed for cancer therapy may pose risks with coadministration of radiotherapy. Cancer cells heterozygous for the IDH1(R132H) mutation exhibited less IDH-mediated production of NADPH, such that after exposure to ionizing radiation (IR), there were higher levels of reactive oxygen species, DNA double-strand breaks, and cell death compared with IDH1 wild-type cells. These effects were reversed by the IDH1(R132H) inhibitor AGI-5198. Exposure of IDH1 wild-type cells to D-2-hydroxyglutarate was sufficient to reduce IDH-mediated NADPH production and increase IR sensitivity. Mechanistic investigations revealed that the radiosensitivity of heterozygous cells was independent of the well-described DNA hypermethylation phenotype in IDH1-mutated cancers. Thus, our results argue that altered oxidative stress responses are a plausible mechanism to understand the radiosensitivity of IDH1-mutated cancer cells. Further, they offer an explanation for the relatively longer survival of patients with IDH1-mutated tumors, and they imply that administration of IDH1(R132H) inhibitors in these patients may limit irradiation efficacy in this setting. ©2015 American Association for Cancer Research.
Assessment of SLX4 Mutations in Hereditary Breast Cancers.
Directory of Open Access Journals (Sweden)
Sohela Shah
Full Text Available SLX4 encodes a DNA repair protein that regulates three structure-specific endonucleases and is necessary for resistance to DNA crosslinking agents, topoisomerase I and poly (ADP-ribose polymerase (PARP inhibitors. Recent studies have reported mutations in SLX4 in a new subtype of Fanconi anemia (FA, FA-P. Monoallelic defects in several FA genes are known to confer susceptibility to breast and ovarian cancers.To determine if SLX4 is involved in breast cancer susceptibility, we sequenced the entire SLX4 coding region in 738 (270 Jewish and 468 non-Jewish breast cancer patients with 2 or more family members affected by breast cancer and no known BRCA1 or BRCA2 mutations. We found a novel nonsense (c.2469G>A, p.W823* mutation in one patient. In addition, we also found 51 missense variants [13 novel, 23 rare (MAF1%], of which 22 (5 novel and 17 rare were predicted to be damaging by Polyphen2 (score = 0.65-1. We performed functional complementation studies using p.W823* and 5 SLX4 variants (4 novel and 1 rare cDNAs in a human SLX4-null fibroblast cell line, RA3331. While wild type SLX4 and all the other variants fully rescued the sensitivity to mitomycin C (MMC, campthothecin (CPT, and PARP inhibitor (Olaparib the p.W823* SLX4 mutant failed to do so.Loss-of-function mutations in SLX4 may contribute to the development of breast cancer in very rare cases.
DEFF Research Database (Denmark)
Poon, Anna Fong-Yee; Li, Tong; Pires, Carlota
2016-01-01
Mutations in presenilin 1 (PSEN1) lead to the most aggressive form of familial Alzheimer's disease (AD). Human induced pluripotent stem cells (hiPSCs) derived from AD patients can be differentiated and used for disease modeling. Here, we derived hiPSC from skin fibroblasts obtained from an AD...... patient carrying a L282F mutation in PSEN1. We transfected skin fibroblasts with episomal iPSC reprogramming vectors targeting human OCT4, SOX2, L-MYC, KLF4, NANOG, LIN28, and short hairpin RNA against TP53. Our hiPSC line, L282F-hiPSC, displayed typical stem cell characteristics with consistent...... expression of pluripotency genes and the ability to differentiation into the three germ layers....
MPL W515L/K Mutations in Chronic Myeloproliferative Neoplasms.
Akpınar, Timur Selçuk; Hançer, Veysel Sabri; Nalçacı, Meliha; Diz-Küçükkaya, Reyhan
2013-03-01
The MPL gene encodes the thrombopoietin receptor. Recently MPL mutations (MPL W515L or MPL W515K) were described in patients with essential thrombocythemia (ET) and primary (idiopathic) myelofibrosis (PMF). The prevalence and the clinical importance of these mutations are not clear. In the present study, we aimed to investigate the frequency and clinical significance of MPL W515L/K mutations in our patients with ET and PMF. A total of 77 patients (66 were diagnosed with ET and 11 with PMF) and 42 healthy controls were included in the study. Using peripheral blood samples, the presence of MPL W515L/K mutations and JAK-2 V617F mutation were analyzed by real-time polymerase chain reaction. In our study, MPL W515L/K or JAK-2 V617F mutations were not observed in healthy controls. JAK-2 V617F mutation was present in 35 patients, of whom 29 had ET (43.9%, 29/66) and 6 had PMF (54.5%, 6/11). In the patient group, MPL W515L/K mutations were found in only 2 PMF cases, and these cases were negative for JAK-2 V617F mutation. The prevalence of MPL W515L/K mutations in the patient group was 2.6%, and the prevalence of MPL W515L/K mutations among the cases negative for the JAK-2 V617F mutation was found to be 4.8%. The 2 cases with MPL W515L/K mutations had long follow-up times (124 months and 71 months, respectively), had no thrombotic or hemorrhagic complications, and had no additional cytogenetic anomalies. MPL W515L/K mutations may be helpful for identifying clonal disease in MPN patients with no established Ph chromosome or JAK-2 V617F mutation. None declared.
EnviroTeach, 1992
1992-01-01
Introduces networking projects for studying rivers and water quality. Describes two projects in South Africa (Project W.A.T.E.R and SWAP) associated with the international network, Global Rivers Environmental Education Network. Discusses water test kits and educational material developed through Project W.A.T.E.R. (Water Awareness through…
Mastellaro, Maria J; Seidinger, Ana L; Kang, Guolian; Abrahão, Renata; Miranda, Eliana C M; Pounds, Stanley B; Cardinalli, Izilda A; Aguiar, Simone S; Figueiredo, Bonald C; Rodriguez-Galindo, Carlos; Brandalise, Silvia R; Yunes, José A; Barros-Filho, Antônio de A; Ribeiro, Raul C
2017-08-15
The tumor protein p53 (TP53) arginine-to-histidine mutation at codon 337 (R337H) predisposes children to adrenocortical tumors (ACTs) and, rarely, to other childhood tumors, but its impact on adult cancer remains undetermined. The objective of this study was to investigate the frequency and types of cancer in relatives of children with ACT who carry the TP53 R337H mutation. TP53 R337H testing was offered to relatives of probands with ACT. The parental lineage segregating the R337H mutation was identified in all families. The frequency and distribution of cancer types were compared according to R337H status. The authors' data also were compared with those publicly available for children with TP53 mutations other than R337H. The mean and median follow-up times for the probands with ACT were 11.2 years and 9.7 years (range, 3-32 years), respectively. During this time, cancer was diagnosed in 12 of 81 first-degree relatives (14.8%) carrying the R337H mutation but in only 1 of 94 noncarriers (1.1%; P = .0022). At age 45 years, the cumulative risk of cancer was 21% (95% confidence interval, 5%-33%) in carriers and 2% (95% confidence interval, 0%-4%) in noncarriers (P = .008). The frequency of cancer was higher in the R337H segregating lineages than in the nonsegregating lineages (249 of 1410 vs 66 of 984 individuals; P cancer were the most common types. TP53 R337H carriers have a lifelong predisposition to cancer with a bimodal age distribution: 1 peak, represented by ACT, occurs in the first decade of life, and another peak of diverse cancer types occurs in the fifth decade. The current findings have implications for genetic counseling and surveillance of R337H carriers. Cancer 2017;123:3150-58. © 2017 American Cancer Society. © 2017 American Cancer Society.
Energy Technology Data Exchange (ETDEWEB)
Kharlyngdoh, Joubert Banjop; Asnake, Solomon; Pradhan, Ajay; Olsson, Per-Erik, E-mail: per-erik.olsson@oru.se
2016-09-15
Point mutations in the AR ligand-binding domain (LBD) can result in altered AR structures leading to changes of ligand specificity and functions. AR mutations associated to prostate cancer (PCa) have been shown to result in receptor activation by non-androgenic substances and anti-androgenic drugs. Two AR mutations known to alter the function of anti-androgens are the AR{sub T877A} mutation, which is frequently detected mutation in PCa tumors and the AR{sub W741C} that is rare and has been derived in vitro following exposure of cells to the anti-androgen bicalutamide. AR activation by non-androgenic environmental substances has been suggested to affect PCa progression. In the present study we investigated the effect of AR mutations (AR{sub W741C} and AR{sub T877A}) on the transcriptional activation following exposure of cells to an androgenic brominated flame retardant, 1,2-dibromo-4-(1,2 dibromoethyl) cyclohexane (TBECH, also named DBE-DBCH). The AR mutations resulted in higher interaction energies and increased transcriptional activation in response to TBECH diastereomer exposures. The AR{sub T877A} mutation rendered AR highly responsive to low levels of DHT and TBECH and led to increased AR nuclear translocation. Gene expression analysis showed a stronger induction of AR target genes in LNCaP cells (AR{sub T877A}) compared to T-47D cells (AR{sub WT}) following TBECH exposure. Furthermore, AR knockdown experiments confirmed the AR dependency of these responses. The higher sensitivity of AR{sub T877A} and AR{sub W741C} to low levels of TBECH suggests that cells with these AR mutations are more susceptible to androgenic endocrine disrupters. - Highlights: • TBECH, is an endocrine disrupting compound that differ in activity depending on AR structure and sequence. • TBECH interaction with the human AR-LBD containing the mutations W741C and T877A is increased compared to the wild type receptor • The mutations, W741C and T877A, are more potent than the wild type
MPL W515L/K Mutations in Chronic Myeloproliferative Neoplasms
Directory of Open Access Journals (Sweden)
Timur Selçuk Akpınar
2013-03-01
Full Text Available OBJECTIVE: The MPL gene encodes the thrombopoietin receptor. Recently MPL mutations (MPL W515L or MPL W515K were described in patients with essential thrombocythemia (ET and primary (idiopathic myelofibrosis (PMF. The prevalence and the clinical importance of these mutations are not clear. In the present study, we aimed to investigate the frequency and clinical significance of MPL W515L/K mutations in our patients with ET and PMF. METHODS: A total of 77 patients (66 were diagnosed with ET and 11 with PMF and 42 healthy controls were included in the study. Using peripheral blood samples, the presence of MPL W515L/K mutations and JAK-2 V617F mutation were analyzed by real-time polymerase chain reaction. RESULTS: In our study, MPL W515L/K or JAK-2 V617F mutations were not observed in healthy controls. JAK-2 V617F mutation was present in 35 patients, of whom 29 had ET (43.9%, 29/66 and 6 had PMF (54.5%, 6/11. In the patient group, MPL W515L/K mutations were found in only 2 PMF cases, and these cases were negative for JAK-2 V617F mutation. The prevalence of MPL W515L/K mutations in the patient group was 2.6%, and the prevalence of MPL W515L/K mutations among the cases negative for the JAK-2 V617F mutation was found to be 4.8%. The 2 cases with MPL W515L/K mutations had long follow-up times (124 months and 71 months, respectively, had no thrombotic or hemorrhagic complications, and had no additional cytogenetic anomalies. CONCLUSION: MPL W515L/K mutations may be helpful for identifying clonal disease in MPN patients with no established Ph chromosome or JAK-2 V617F mutation.
Study the Molecular Association between a Deletion Mutation in CHEK2 gene (5395 bp and Breast Cancer
Directory of Open Access Journals (Sweden)
Manijeh Jalilvand
2015-07-01
Full Text Available Background & Objectives: Breast cancer is the most common cancer among women and the second most common cause of cancer death. Genetic factors play an important role in the development of breast cancer. Among these genetic factors, CHEk2 (checkpoint kinase 2 gene, as a tumor suppressor gene, plays a critical role in DNA repair. Germline mutations in CEHK2 result in the loss of this feature. One of the mutations in CHEK2 gene is a 5395 bp deletion mutation which has been associated with the increasing risk of Breast Cancer in some populations in the world. In the present study, we investigated the association between a 5395 bp deletion mutation in CHEK2 gene and the risk of Breast Cancer in the women of an Iranian population. Methods: Pathologic information of 38 cases under the age of 45 and 62 cases over the age of 45 referring to surgery ward of Milad Hospital in Tehran were extracted. 100 healthy controls were included in the study as well. After obtaining informed consent, 5 mL whole blood was taken DNA was successfully isolated. Multiplex PCR was used to investigate the association between a 5395bp deletion mutation in CHEK2 gene and increasing risk of Breast Cancer among patients. Results: The 5395bp deletion mutation in CHEK2 gene was not found in any of the participating groups of patients or heathy controls. Conclusion: The present study revealed that there is no significant relation between increasing the risk of Breast Cancer and bearing large deletion mutation in exon 9 and exon 10 of CHECK2 gene.
Directory of Open Access Journals (Sweden)
Davoli Roberta
2009-08-01
Full Text Available Abstract Background Agouti and Extension loci control the relative amount of eumelanin and pheomelanin production in melanocytes that, in turn, affects pigmentation of skin and hair. The Extension locus encodes the melanocortin 1 receptor (MC1R whose permanent activation, caused by functional mutations, results in black coat colour, whereas other inactivating mutations cause red coat colour in different mammals. Results The whole coding region of the MC1R gene was sequenced in goats of six different breeds showing different coat colours (Girgentana, white cream with usually small red spots in the face; Maltese, white with black cheeks and ears; Derivata di Siria, solid red; Murciano-Granadina, solid black or solid brown; Camosciata delle Alpi, brown with black stripes; Saanen, white; F1 goats and the parental animals. Five single nucleotide polymorphisms (SNPs were identified: one nonsense mutation (p.Q225X, three missense mutations (p.A81V, p.F250V, and p.C267W, and one silent mutation. The stop codon at position 225 should cause the production of a shorter MC1R protein whose functionality may be altered. These SNPs were investigated in a larger sample of animals belonging to the six breeds. The Girgentana breed was almost fixed for the p.225X allele. However, there was not complete association between the presence of red spots in the face and the presence of this allele in homozygous condition. The same allele was identified in the Derivata di Siria breed. However, its frequency was only 33%, despite the fact that these animals are completely red. The p.267W allele was present in all Murciano-Granadina black goats, whereas it was never identified in the brown ones. Moreover, the same substitution was present in almost all Maltese goats providing evidence of association between this mutation and black coat colour. Conclusion According to the results obtained in the investigated goat breeds, MC1R mutations may determine eumelanic and pheomelanic
Association of a novel point mutation in MSH2 gene with familial multiple primary cancers
Directory of Open Access Journals (Sweden)
Hai Hu
2017-10-01
Full Text Available Abstract Background Multiple primary cancers (MPC have been identified as two or more cancers without any subordinate relationship that occur either simultaneously or metachronously in the same or different organs of an individual. Lynch syndrome is an autosomal dominant genetic disorder that increases the risk of many types of cancers. Lynch syndrome patients who suffer more than two cancers can also be considered as MPC; patients of this kind provide unique resources to learn how genetic mutation causes MPC in different tissues. Methods We performed a whole genome sequencing on blood cells and two tumor samples of a Lynch syndrome patient who was diagnosed with five primary cancers. The mutational landscape of the tumors, including somatic point mutations and copy number alternations, was characterized. We also compared Lynch syndrome with sporadic cancers and proposed a model to illustrate the mutational process by which Lynch syndrome progresses to MPC. Results We revealed a novel pathologic mutation on the MSH2 gene (G504 splicing that associates with Lynch syndrome. Systematical comparison of the mutation landscape revealed that multiple cancers in the proband were evolutionarily independent. Integrative analysis showed that truncating mutations of DNA mismatch repair (MMR genes were significantly enriched in the patient. A mutation progress model that included germline mutations of MMR genes, double hits of MMR system, mutations in tissue-specific driver genes, and rapid accumulation of additional passenger mutations was proposed to illustrate how MPC occurs in Lynch syndrome patients. Conclusion Our findings demonstrate that both germline and somatic alterations are driving forces of carcinogenesis, which may resolve the carcinogenic theory of Lynch syndrome.
Association of mutations in the hemochromatosis gene with shorter life expectancy
DEFF Research Database (Denmark)
Bathum, L; Christiansen, L; Nybo, H
2001-01-01
BACKGROUND: To investigate whether the frequency of carriers of mutations in the HFE gene associated with hereditary hemochromatosis diminishes with age as an indication that HFE mutations are associated with increased mortality. It is of value in the debate concerning screening for hereditary...... hemochromatosis to determine the significance of heterozygosity. METHODS: Genotyping for mutations in exons 2 and 4 of the HFE gene using denaturing gradient gel electrophoresis in 1784 participants aged 45 to 100 years from 4 population-based studies: all 183 centenarians from the Danish Centenarian Study, 601...... in the distribution of mutations in exon 2 in the different age groups. CONCLUSIONS: In a high-carrier frequency population like Denmark, mutations in HFE show an age-related reduction in the frequency of heterozygotes for C282Y, which suggests that carrier status is associated with shorter life expectancy....
Anandapadamanaban, Madhanagopal; Pilstål, Robert; Andresen, Cecilia; Trewhella, Jill; Moche, Martin; Wallner, Björn; Sunnerhagen, Maria
2016-08-02
MexR is a repressor of the MexAB-OprM multidrug efflux pump operon of Pseudomonas aeruginosa, where DNA-binding impairing mutations lead to multidrug resistance (MDR). Surprisingly, the crystal structure of an MDR-conferring MexR mutant R21W (2.19 Å) presented here is closely similar to wild-type MexR. However, our extended analysis, by molecular dynamics and small-angle X-ray scattering, reveals that the mutation stabilizes a ground state that is deficient of DNA binding and is shared by both mutant and wild-type MexR, whereas the DNA-binding state is only transiently reached by the more flexible wild-type MexR. This population shift in the conformational ensemble is effected by mutation-induced allosteric coupling of contact networks that are independent in the wild-type protein. We propose that the MexR-R21W mutant mimics derepression by small-molecule binding to MarR proteins, and that the described allosteric model based on population shifts may also apply to other MarR family members. Copyright © 2016 Elsevier Ltd. All rights reserved.
Gurrin, Lyle C; Osborne, Nicholas J; Constantine, Clare C; McLaren, Christine E; English, Dallas R; Gertig, Dorota M; Delatycki, Martin B; Southey, Melissa C; Hopper, John L; Giles, Graham G; Anderson, Gregory J; Olynyk, John K; Powell, Laurie W; Allen, Katrina J
2008-12-01
There are few longitudinal studies of serum ferritin (SF) and transferrin saturation (TS) levels in individuals homozygous for the C282Y mutation. We characterized the development of elevated iron measures in C282Y homozygotes followed for 12 years. From 31,192 people aged 40-69 years at baseline, we identified 203 C282Y homozygotes (95 males), of whom 116 had SF and fasting TS levels measured at baseline (mean age, 55 years) and 86 were untreated and had iron measures at follow-up (mean, 12 years later). The probabilities of SF at follow-up exceeding clinical thresholds were predicted from baseline SF and TS under a multivariate normal model. For C282Y homozygotes, at baseline, 84% of males and 65% of females had elevated SF and 37% of males and 3% of females had SF >1000 microg/L. For males with SF 300-1000 microg/L at baseline, the predicted probability of progressing to SF >1000 microg/L at follow-up was between 13% and 35% and, for females, between 16% and 22%. For C282Y homozygotes with normal baseline SF, 1000 microg/L if left untreated. The majority of C282Y homozygotes who are likely to develop SF levels sufficient to place them at risk of iron overload-related disease will have done so by mean age 55 years. TS >95% at mean age 55 years in males increases the likelihood that SF levels will be elevated at mean age 65 years, but this effect is absent in females, most likely because of physiologic blood loss associated with menstruation.
Tavera-Tapia, A; Pérez-Cabornero, L; Macías, J A; Ceballos, M I; Roncador, G; de la Hoya, M; Barroso, A; Felipe-Ponce, V; Serrano-Blanch, R; Hinojo, C; Miramar-Gallart, M D; Urioste, M; Caldés, T; Santillan-Garzón, S; Benitez, J; Osorio, A
2017-02-01
There is still a considerable percentage of hereditary breast and ovarian cancer (HBOC) cases not explained by BRCA1 and BRCA2 genes. In this report, next-generation sequencing (NGS) techniques were applied to identify novel variants and/or genes involved in HBOC susceptibility. Using whole exome sequencing, we identified a novel germline mutation in the moderate-risk gene ATM (c.5441delT; p.Leu1814Trpfs*14) in a family negative for mutations in BRCA1/2 (BRCAX). A case-control association study was performed to establish its prevalence in Spanish population, in a series of 1477 BRCAX families and 589 controls further screened, and NGS panels were used for ATM mutational screening in a cohort of 392 HBOC Spanish BRCAX families and 350 patients affected with diseases not related to breast cancer. Although the interrogated mutation was not prevalent in case-control association study, a comprehensive mutational analysis of the ATM gene revealed 1.78% prevalence of mutations in the ATM gene in HBOC and 1.94% in breast cancer-only BRCAX families in Spanish population, where data about ATM mutations were very limited. ATM mutation prevalence in Spanish population highlights the importance of considering ATM pathogenic variants linked to breast cancer susceptibility.
Matta, Andrés Jenuer; Zambrano, Diana Carolina; Pazos, Alvaro Jairo
2018-04-14
To characterize punctual mutations in 23S rRNA gene of clarithromycin-resistant Helicobacter pylori ( H. pylori ) and determine their association with therapeutic failure. PCR products of 23S rRNA gene V domain of 74 H. pylori isolates; 34 resistant to clarithromycin (29 from a low-risk gastric cancer (GC) population: Tumaco-Colombia, and 5 from a high-risk population: Tuquerres-Colombia) and 40 from a susceptible population (28 from Tumaco and 12 from Túquerres) were sequenced using capillary electrophoresis. The concordance between mutations of V domain 23S rRNA gene of H. pylori and therapeutic failure was determined using the Kappa coefficient and McNemar's test was performed to determine the relationship between H. pylori mutations and clarithromycin resistance. 23S rRNA gene from H. pylori was amplified in 56/74 isolates, of which 25 were resistant to clarithromycin (20 from Tumaco and 5 from Túquerres, respectively). In 17 resistant isolates (13 from Tumaco and 4 from Túquerres) the following mutations were found: A1593T1, A1653G2, C1770T, C1954T1, and G1827C in isolates from Tumaco, and A2144G from Túquerres. The mutations T2183C, A2144G and C2196T in H. pylori isolates resistant to clarithromycin from Colombia are reported for the first time. No association between the H. pylori mutations and in vitro clarithromycin resistance was found. However, therapeutic failure of eradication treatment was associated with mutations of 23S rRNA gene in clarithromycin-resistant H. pylori ( κ = 0.71). The therapeutic failure of eradication treatment in the two populations from Colombia was associated with mutations of the 23S rRNA gene in clarithromycin-resistant H. pylori .
Selma Ünal; Günay Balta; Fatma Gümrük
2014-01-01
Objective: This study was planned in order to determine the effect of C282Y mutation in development of secondary hemochromatosis in beta-thalassemia patients and to determine the prevalence and allele frequency of this mutation in a healthy control group. Materials and Methods: Eighty-seven children and young adults (46 males and 41 females; mean age: 15.6?6.1 years, range: 3-30 years) with beta-thalassemia major (BTM) and 13 beta-thalassemia intermedia (BTI) patients (6 males and 7 females; ...
C282Y-HFE gene variant affects cholesterol metabolism in human neuroblastoma cells.
Ali-Rahmani, Fatima; Huang, Michael A; Schengrund, C-L; Connor, James R; Lee, Sang Y
2014-01-01
Although disruptions in the maintenance of iron and cholesterol metabolism have been implicated in several cancers, the association between variants in the HFE gene that is associated with cellular iron uptake and cholesterol metabolism has not been studied. The C282Y-HFE variant is a risk factor for different cancers, is known to affect sphingolipid metabolism, and to result in increased cellular iron uptake. The effect of this variant on cholesterol metabolism and its possible relevance to cancer phenotype was investigated using wild type (WT) and C282Y-HFE transfected human neuroblastoma SH-SY5Y cells. Expression of C282Y-HFE in SH-SY5Y cells resulted in a significant increase in total cholesterol as well as increased transcription of a number of genes involved in its metabolism compared to cells expressing WT-HFE. The marked increase in expression of NPC1L1 relative to that of most other genes, was accompanied by a significant increase in expression of NPC1, a protein that functions in cholesterol uptake by cells. Because inhibitors of cholesterol metabolism have been proposed to be beneficial for treating certain cancers, their effect on the viability of C282Y-HFE neuroblastoma cells was ascertained. C282Y-HFE cells were significantly more sensitive than WT-HFE cells to U18666A, an inhibitor of desmosterol Δ24-reductase the enzyme catalyzing the last step in cholesterol biosynthesis. This was not seen for simvastatin, ezetimibe, or a sphingosine kinase inhibitor. These studies indicate that cancers presenting in carriers of the C282Y-HFE allele might be responsive to treatment designed to selectively reduce cholesterol content in their tumor cells.
Fan, Cong; Zhang, Juan; Ouyang, Tao; Li, Jinfeng; Wang, Tianfeng; Fan, Zhaoqing; Fan, Tie; Lin, Benyao; Xie, Yuntao
2018-05-04
RAD50 is a highly conserved DNA double-strand break (DSB) repair gene. However, the associations between RAD50 germline mutations and the survival and risk of breast cancer have not been fully elucidated. Here, we aimed to investigate the clinical impact of RAD50 germline mutations in a large cohort of unselected breast cancer patients. In this study, RAD50 germline mutations were determined using next-generation sequencing in 7657 consecutive unselected breast cancer patients without BRCA1/2 mutations. We also screened for RAD50 recurrent mutations (L719fs, K994fs, and H1269fs) in 5000 healthy controls using Sanger sequencing. We found that 26 out of 7657 (0.34%) patients had RAD50 pathogenic mutations, and 16 patients carried one of the three recurrent mutations (L719fs, n=6 cases; K994fs, n=5 cases; and H1269fs, n=5 cases); the recurrent mutation rate was 0.21%. The frequency of the three recurrent mutations in the 5000 healthy controls was 0.18% (9/5000). These mutations did not confer an increased risk of breast cancer in the studied patients [odds ratios (OR), 1.16; 95% confidence interval (CI), 0.51-2.63; P = 0.72]. Nevertheless, multivariate analysis revealed that RAD50 pathogenic mutations were an independent unfavourable predictor of recurrence-free survival (RFS) [adjusted hazard ratio (HR) 2.66; 95% CI, 1.18-5.98; P=0.018] and disease-specific survival (DSS) (adjusted HR 4.36; 95% CI, 1.58-12.03; P=0.004) in the entire study cohort. Our study suggested that RAD50 germline mutations are not associated with an increased risk of breast cancer, but patients with RAD50 germline mutations have unfavourable survival compared with patients without these mutations. This article is protected by copyright. All rights reserved. © 2018 UICC.
Association of two mutations in the CHEK2 gene with breast cancer
International Nuclear Information System (INIS)
Bogdanova, N.; Enben-Dubrowinskaja, N.; Doerk, T.; Feshchenko, S.; Lazyuk, G.I.; Rogov, Yu.I.
2005-01-01
Cell-cycle checkpoint kinase 2 (CHEK2) is a central mediator of cellular responses to DNA damage. Ionizing radiation activates the CHEK2 protein via ATM-mediated phosphorylation and activated CHEK2 kinase can phosphorylate several substrates, including Cdc25A, p53 and E2F1, which mediate cell cycle arrest and apoptosis. CHEK2 phosphorylation of the breast cancer susceptibility protein BRCA1 regulates DNA double-strand break repair, and deletion of CHEK2 potentiate the incidence of mammary carcinomas in BRCA1 conditional mutant mice. A truncating variant of CHEK2, the 1100 delC mutation, has been identified as a low-penetrance breast-cancer susceptibility allele. Heterozygous 1100 delC carriers have an approximately 2-fold increased risk for breast cancer. The role of variants in CHEK2 other than 1100 delC is less clear. To assess the role of these CHEK2 variants in breast cancer, we conducted an association study of the I157T and IVS211G>A mutations in breast cancer case-control settings from the Belarus populations. Our series consisted of 424 breast cancer patients and 307 population controls. The missense substitution I157T was identified in 24/424 cases (5.7%) vs. 4/307 controls (1.3%; OR 54.5, 95% CI 1.6-13.2, p 5 0.005) in investigated cohorts. The splicing mutation IVS211G > A was infrequent, being observed 4/424 patients (0.9%). Heterozygous CHEK2 mutation carriers tended to be diagnosed at an earlier age, but these differences did not reach statistical significance. Family history of breast cancer did not differ between carriers and non carriers. Our data indicate that the I157T allele, and possibly the IVS211G > A allele, of the CHEK2 gene contribute to inherited breast cancer susceptibility. (authors)
Mutation analysis of the ERCC4/FANCQ gene in hereditary breast cancer.
Directory of Open Access Journals (Sweden)
Sandra Kohlhase
Full Text Available The ERCC4 protein forms a structure-specific endonuclease involved in the DNA damage response. Different cancer syndromes such as a subtype of Xeroderma pigmentosum, XPF, and recently a subtype of Fanconi Anemia, FA-Q, have been attributed to biallelic ERCC4 gene mutations. To investigate whether monoallelic ERCC4 gene defects play some role in the inherited component of breast cancer susceptibility, we sequenced the whole ERCC4 coding region and flanking untranslated portions in a series of 101 Byelorussian and German breast cancer patients selected for familial disease (set 1, n = 63 or for the presence of the rs1800067 risk haplotype (set 2, n = 38. This study confirmed six known and one novel exonic variants, including four missense substitutions but no truncating mutation. Missense substitution p.R415Q (rs1800067, a previously postulated breast cancer susceptibility allele, was subsequently screened for in a total of 3,698 breast cancer cases and 2,868 controls from Germany, Belarus or Russia. The Gln415 allele appeared protective against breast cancer in the German series, with the strongest effect for ductal histology (OR 0.67; 95%CI 0.49; 0.92; p = 0.003, but this association was not confirmed in the other two series, with the combined analysis yielding an overall Mantel-Haenszel OR of 0.94 (95% CI 0.81; 1.08. There was no significant effect of p.R415Q on breast cancer survival in the German patient series. The other three detected ERCC4 missense mutations included two known rare variants as well as a novel substitution, p.E17V, that we identified on a p.R415Q haplotype background. The p.E17V mutation is predicted to be probably damaging but was present in just one heterozygous patient. We conclude that the contribution of ERCC4/FANCQ coding mutations to hereditary breast cancer in Central and Eastern Europe is likely to be small.
Mutational analysis and clinical correlation of metastatic colorectal cancer.
Russo, Andrea L; Borger, Darrell R; Szymonifka, Jackie; Ryan, David P; Wo, Jennifer Y; Blaszkowsky, Lawrence S; Kwak, Eunice L; Allen, Jill N; Wadlow, Raymond C; Zhu, Andrew X; Murphy, Janet E; Faris, Jason E; Dias-Santagata, Dora; Haigis, Kevin M; Ellisen, Leif W; Iafrate, Anthony J; Hong, Theodore S
2014-05-15
Early identification of mutations may guide patients with metastatic colorectal cancer toward targeted therapies that may be life prolonging. The authors assessed tumor genotype correlations with clinical characteristics to determine whether mutational profiling can account for clinical similarities, differences, and outcomes. Under Institutional Review Board approval, 222 patients with metastatic colon adenocarcinoma (n = 158) and rectal adenocarcinoma (n = 64) who underwent clinical tumor genotyping were reviewed. Multiplexed tumor genotyping screened for >150 mutations across 15 commonly mutated cancer genes. The chi-square test was used to assess genotype frequency by tumor site and additional clinical characteristics. Cox multivariate analysis was used to assess the impact of genotype on overall survival. Broad-based tumor genotyping revealed clinical and anatomic differences that could be linked to gene mutations. NRAS mutations were associated with rectal cancer versus colon cancer (12.5% vs 0.6%; P colon cancer (13% vs 3%; P = .024) and older age (15.8% vs 4.6%; P = .006). TP53 mutations were associated with rectal cancer (30% vs 18%; P = .048), younger age (14% vs 28.7%; P = .007), and men (26.4% vs 14%; P = .03). Lung metastases were associated with PIK3CA mutations (23% vs 8.7%; P = .004). Only mutations in BRAF were independently associated with decreased overall survival (hazard ratio, 2.4; 95% confidence interval, 1.09-5.27; P = .029). The current study suggests that underlying molecular profiles can differ between colon and rectal cancers. Further investigation is warranted to assess whether the differences identified are important in determining the optimal treatment course for these patients. © 2014 American Cancer Society.
HNPCC: Six new pathogenic mutations
Directory of Open Access Journals (Sweden)
Epplen Joerg T
2004-06-01
Full Text Available Abstract Background Hereditary non-polyposis colorectal cancer (HNPCC is an autosomal dominant disease with a high risk for colorectal and endometrial cancer caused by germline mutations in DNA mismatch-repair genes (MMR. HNPCC accounts for approximately 2 to 5% of all colorectal cancers. Here we present 6 novel mutations in the DNA mismatch-repair genes MLH1, MSH2 and MSH6. Methods Patients with clinical diagnosis of HNPCC were counselled. Tumor specimen were analysed for microsatellite instability and immunohistochemistry for MLH1, MSH2 and MSH6 protein was performed. If one of these proteins was not detectable in the tumor mutation analysis of the corresponding gene was carried out. Results We identified 6 frameshift mutations (2 in MLH1, 3 in MSH2, 1 in MSH6 resulting in a premature stop: two mutations in MLH1 (c.2198_2199insAACA [p.N733fsX745], c.2076_2077delTG [p.G693fsX702], three mutations in MSH2 (c.810_811delGT [p.C271fsX282], c.763_766delAGTGinsTT [p.F255fsX282], c.873_876delGACT [p.L292fsX298] and one mutation in MSH6 (c.1421_1422dupTG [p.C475fsX480]. All six tumors tested for microsatellite instability showed high levels of microsatellite instability (MSI-H. Conclusions HNPCC in families with MSH6 germline mutations may show an age of onset that is comparable to this of patients with MLH1 and MSH2 mutations.
Adverse Clinical Outcome Associated With Mutations That Typify African American Colorectal Cancers.
Wang, Zhenghe; Li, Li; Guda, Kishore; Chen, Zhengyi; Barnholtz-Sloan, Jill; Park, Young Soo; Markowitz, Sanford D; Willis, Joseph
2016-12-01
African Americans have the highest incidence and mortality from colorectal cancer (CRC) of any US racial group. We recently described a panel of 15 genes that are statistically significantly more likely to be mutated in CRCs from African Americans than in Caucasians (AA-CRC genes). The current study investigated the outcomes associated with these mutations in African American CRCs (AA-CRCs). In a cohort of 66 patients with stage I-III CRCs, eight of 27 CRCs with AA-CRC gene mutations (Mut+) developed metastatic disease vs only four of 39 mutation-negative (Mut-) cases (P = .03, Cox regression model with two-sided Wald test). Moreover, among stage III cases (n = 33), Mut+ cancers were nearly three times more likely to relapse as Mut- cases (7 of 15 Mut+ vs 3 of 18 Mut-; P = .03, Cox regression model with two-sided Wald test). AA-CRC mutations may thus define a high-risk subset of CRCs that contributes to the overall disparity in CRC outcomes observed in African Americans. © The Author 2016. Published by Oxford University Press. All rights reserved. For Permissions, please e-mail: journals.permissions@oup.com.
Ortiz, Sofía C; Aguirre, Santiago J; Flores, Sofía; Maldonado, Claudio; Mejía, Juan; Salinas, Lilian
2017-11-01
High heterogeneity in the CFTR gene mutations disturbs the molecular diagnosis of cystic fibrosis (CF). In order to improve the diagnosis of CF in our country, the present study aims to define a panel of common CFTR gene mutations by sequencing 27 exons of the gene in Ecuadorian Cystic Fibrosis patients. Forty-eight Ecuadorian individuals with suspected/confirmed CF diagnosis were included. Twenty-seven exons of CFTR gene were sequenced to find sequence variations. Prevalence of pathogenic variations were determined and compared with other countries' data. We found 70 sequence variations. Eight of these are CF-causing mutations: p.F508del, p.G85E, p.G330E, p.A455E, p.G970S, W1098X, R1162X, and N1303K. Also this study is the second report of p.H609R in Ecuadorian population. Mutation prevalence differences between Ecuadorian population and other Latin America countries were found. The panel of mutations suggested as an initial screening for the Ecuadorian population with cystic fibrosis should contain the mutations: p.F508del, p.G85E, p.G330E, p.A455E, p.G970S, W1098X, R1162X, and N1303K. © 2017 NETLAB Laboratorios Especializados. Molecular Genetics & Genomic Medicine published by Wiley Periodicals, Inc.
Directory of Open Access Journals (Sweden)
Priscila Da Silva Figueiredo Celestino Gomes
Full Text Available The receptors tyrosine kinases (RTKs for the colony stimulating factor-1, CSF-1R, and for the stem cell factor, SCFR or KIT, are important mediators of signal transduction. The abnormal function of these receptors, promoted by gain-of-function mutations, leads to their constitutive activation, associated with cancer or other proliferative diseases. A secondary effect of the mutations is the alteration of receptors' sensitivity to tyrosine kinase inhibitors, compromising effectiveness of these molecules in clinical treatment. In particular, the mutation V560G in KIT increases its sensitivity to Imatinib, while the D816V in KIT, and D802V in CSF-1R, triggers resistance to the drug. We analyzed the Imatinib binding affinity to the native and mutated KIT (mutations V560G, S628N and D816V and CSF-1R (mutation D802V by using molecular dynamics simulations and energy calculations of Imatinib•target complexes. Further, we evaluated the sensitivity of the studied KIT receptors to Imatinib by measuring the inhibition of KIT phosphorylation. Our study showed that (i the binding free energy of Imatinib to the targets is highly correlated with their experimentally measured sensitivity; (ii the electrostatic interactions are a decisive factor affecting the binding energy; (iii the most deleterious impact to the Imatinib sensitivity is promoted by D802V (CSF-1R and D816V (KIT mutations; (iv the role of the juxtamembrane region, JMR, in the imatinib binding is accessory. These findings contribute to a better description of the mutation-induced effects alternating the targets sensitivity to Imatinib.
Spectrum of EGFR gene mutations in Vietnamese patients with non-small cell lung cancer.
Vu, Hoang Anh; Xinh, Phan Thi; Ha, Hua Thi Ngoc; Hanh, Ngo Thi Tuyet; Bach, Nguyen Duc; Thao, Doan Thi Phuong; Dat, Ngo Quoc; Trung, Nguyen Sao
2016-03-01
Epidermal growth factor receptor (EGFR) mutational status is a crucial biomarker for prediction of response to tyrosine kinase inhibitors in patients with non-small cell lung cancer (NSCLC). Although these mutations have been well characterized in other countries, little is known about the frequency or spectrum of EGFR mutations in Vietnamese NSCLC patients. Using Sanger DNA sequencing, we investigated mutations in EGFR exons 18-21 from 332 patients diagnosed with NSCLC at University of Medicine and Pharmacy, Ho Chi Minh City, Vietnam. DNA was extracted from formalin-fixed, paraffin-embedded tissues, followed by PCR amplification and sequencing. EGFR mutations were detected in 135 samples (40.7%), of which eight samples carried double mutations. In total, 46 different types of EGFR mutations were found, including six novel mutations (p.K713E, p.K714R, p.P794S, p.R803W, p.P848S, and p.K867E). Among the four exons investigated, exon 19 was most frequently mutated (63 out of 332 patients, 19%), with the p.E746_A750del appearing in 43 samples. Exon 21 was mutated in 56 samples (16.9%), of which 47 were p.L858R. Each of exons 18 and 20 was mutated in 12 samples (3.6%). The frequency of EGFR mutations was higher in females than in males (48.9% vs 35%, P = 0.012), but not statistically different between adenocarcinomas and other histological types of NSCLC (41.3% vs 34.5%, P = 0.478). DNA sequencing detected EGFR mutations with high frequency and revealed a broad spectrum of mutation type in Vietnamese patients with NSCLC. © 2015 Wiley Publishing Asia Pty Ltd.
Lee, Dae-Won; Han, Sae-Won; Cha, Yongjun; Bae, Jeong Mo; Kim, Hwang-Phill; Lyu, Jaemyun; Han, Hyojun; Kim, Hyoki; Jang, Hoon; Bang, Duhee; Huh, Iksoo; Park, Taesung; Won, Jae-Kyung; Jeong, Seung-Yong; Park, Kyu Joo; Kang, Gyeong Hoon; Kim, Tae-You
2017-09-15
Colorectal cancer (CRC) develops through the alteration of several critical pathways. This study was aimed at evaluating the influence of critical pathways on survival outcomes for patients with CRC. Targeted next-generation sequencing of 40 genes included in the 5 critical pathways of CRC (WNT, P53, RTK-RAS, phosphatidylinositol-4,5-bisphosphate 3-kinase [PI3K], and transforming growth factor β [TGF-β]) was performed for 516 patients with stage III or high-risk stage II CRC treated with surgery followed by adjuvant fluoropyrimidine and oxaliplatin chemotherapy. The associations between critical pathway mutations and relapse-free survival (RFS) and overall survival were analyzed. The associations were further analyzed according to the tumor location. The mutation rates for the WNT, P53, RTK-RAS, PI3K, and TGF-β pathways were 84.5%, 69.0%, 60.7%, 30.0%, and 28.9%, respectively. A mutation in the PI3K pathway was associated with longer RFS (adjusted hazard ratio [HR], 0.59; 95% confidence interval [CI], 0.36-0.99), whereas a mutation in the RTK-RAS pathway was associated with shorter RFS (adjusted HR, 1.60; 95% CI, 1.01-2.52). Proximal tumors showed a higher mutation rate than distal tumors, and the mutation profile was different according to the tumor location. The mutation rates of Kirsten rat sarcoma viral oncogene homolog (KRAS), phosphatidylinositol-4,5-bisphosphate 3-kinase catalytic subunit α (PIK3CA), and B-Raf proto-oncogene serine/threonine kinase (BRAF) were higher in proximal tumors, and the mutation rates of adenomatous polyposis coli (APC), tumor protein 53 (TP53), and neuroblastoma RAS viral oncogene homolog (NRAS) were higher in distal tumors. The better RFS with the PI3K pathway mutation was significant only for proximal tumors, and the worse RFS with the RTK-RAS pathway mutation was significant only for distal tumors. A PI3K pathway mutation was associated with better RFS for CRC patients treated with adjuvant chemotherapy, and an RTK
da Costa, Marianges Zadrozny Gouvêa; Pires, Júlia Glória Lucatelli; Nasser, Paulo Dominguez; Ferreira, Camila da Silva; Teixeira, Ana Cristina de Sá; Paranaguá-Vezozzo, Denise Cerqueira; Guarita, Dulce Reis; Carrilho, Flair José; Ono, Suzane Kioko
2016-10-01
This study aimed to investigate the association between chronic pancreatitis and smoking or genetic mutations. The study sample comprised 148 patients with chronic pancreatitis, 110 chronic alcoholic subjects without pancreatic disease, and 297 volunteer blood donors. Of the patients with chronic pancreatitis, 74% had alcoholic etiology and 26% had idiopathic pancreatitis. The frequency of smoking was 91.4% in patients with alcoholic pancreatitis, higher than 73.3% in alcoholic subjects without pancreatitis (P pancreatitis and blood donors. The N34S mutation of serine peptidase inhibitor, Kazal type 1 (SPINK1) was found in 2.7% of patients with chronic alcoholic pancreatitis, in 5.3% of patients with idiopathic pancreatitis, and in 0.4% of blood donors (P = 0.02). The P55S mutation of SPINK1 was found in 2.7% of patients with alcoholic pancreatitis and in 0.7% of blood donors (P = 0.12). The R254W mutation of chymotrypsin C was found in 0.9% of patients with alcoholic pancreatitis, in 0.9% of chronic alcoholic subjects without pancreatitis, and in 0.4% of blood donors (P = 0.75). In all cases, the mutations were heterozygous. Smoking and the N34S mutation of SPINK1 were positively correlated with chronic pancreatitis.
Introducing Pitt-Hopkins syndrome-associated mutations of TCF4 to Drosophila daughterless
Directory of Open Access Journals (Sweden)
Laura Tamberg
2015-12-01
Full Text Available Pitt-Hopkins syndrome (PTHS is caused by haploinsufficiency of Transcription factor 4 (TCF4, one of the three human class I basic helix-loop-helix transcription factors called E-proteins. Drosophila has a single E-protein, Daughterless (Da, homologous to all three mammalian counterparts. Here we show that human TCF4 can rescue Da deficiency during fruit fly nervous system development. Overexpression of Da or TCF4 specifically in adult flies significantly decreases their survival rates, indicating that these factors are crucial even after development has been completed. We generated da transgenic fruit fly strains with corresponding missense mutations R578H, R580W, R582P and A614V found in TCF4 of PTHS patients and studied the impact of these mutations in vivo. Overexpression of wild type Da as well as human TCF4 in progenitor tissues induced ectopic sensory bristles and the rough eye phenotype. By contrast, overexpression of DaR580W and DaR582P that disrupt DNA binding reduced the number of bristles and induced the rough eye phenotype with partial lack of pigmentation, indicating that these act dominant negatively. Compared to the wild type, DaR578H and DaA614V were less potent in induction of ectopic bristles and the rough eye phenotype, respectively, suggesting that these are hypomorphic. All studied PTHS-associated mutations that we introduced into Da led to similar effects in vivo as the same mutations in TCF4 in vitro. Consequently, our Drosophila models of PTHS are applicable for further studies aiming to unravel the molecular mechanisms of this disorder.
Hot spot mutations in Finnish non-small cell lung cancers.
Mäki-Nevala, Satu; Sarhadi, Virinder Kaur; Rönty, Mikko; Kettunen, Eeva; Husgafvel-Pursiainen, Kirsti; Wolff, Henrik; Knuuttila, Aija; Knuutila, Sakari
2016-09-01
Non-small cell lung cancer (NSCLC) is a common cancer with a poor prognosis. The aim of this study was to screen Finnish NSCLC tumor samples for common cancer-related mutations by targeted next generation sequencing and to determine their concurrences and associations with clinical features. Sequencing libraries were prepared from DNA isolated from formalin-fixed, paraffin-embedded tumor material of 425 patients using the AmpliSeq Colon and Lung panel covering mutational hot spot regions of 22 cancer genes. Sequencing was performed with the Ion Torrent Personal Genome Machine (PGM). Data analysis of the hot spot mutations revealed mutations in 77% of the patients, with 7% having 3 or more mutations reported in the Catalogue of Somatic Mutations in Cancer (COSMIC) database. Two of the most frequently mutated genes were TP53 (46%) and KRAS (25%). KRAS codon 12 mutations were the most recurrently occurring mutations. EGFR mutations were significantly associated with adenocarcinoma, female gender and never/light-smoking history; CTNNB1 mutations with light ex-smokers, PIK3CA and TP53 mutations with squamous cell carcinoma, and KRAS with adenocarcinoma. TP53 mutations were most prevalent in current smokers and ERBB2, ERBB4, PIK3CA, NRAS, NOTCH1, FBWX7, PTEN and STK11 mutations occurred exclusively in a group of ever-smokers, however the association was not statistically significant. No mutation was found that associated with asbestos exposure. Finnish NSCLC patients have a similar mutation profile as other Western patients, however with a higher frequency of BRAF mutations but a lower frequency of STK11 and ERBB2 mutations. Moreover, TP53 mutations occurred frequently with other gene mutations, most commonly with KRAS, MET, EGFR and PIK3CA mutations. Copyright © 2016 Elsevier Ireland Ltd. All rights reserved.
Directory of Open Access Journals (Sweden)
Yuanyang Lai
2013-12-01
Full Text Available We aimed to reveal the true status of epidermal growth factor receptor (EGFR mutations in Chinese patients with non-small cell lung cancer (NSCLC after lung resections. EGFR mutations of surgically resected fresh tumor samples from 697 Chinese NSCLC patients were analyzed by Amplification Refractory Mutation System (ARMS. Correlations between EGFR mutation hotspots and clinical features were also explored. Of the 697 NSCLC patients, 235 (33.7% patients had tyrosine kinase inhibitor (TKIs sensitive EGFR mutations in 41 (14.5% of the 282 squamous carcinomas, 155 (52.9% of the 293 adenocarcinomas, 34 (39.5% of the 86 adenosquamous carcinomas, one (9.1% of the 11 large-cell carcinomas, 2 (11.1% of the 18 sarcomatoid carcinomas, and 2 (28.6% of the 7 mucoepidermoid carcinomas. TKIs sensitive EGFR mutations were more frequently found in female patients (p < 0.001, non-smokers (p = 0.047 and adenocarcinomas (p < 0.001. The rates of exon 19 deletion mutation (19-del, exon 21 L858R point mutation (L858R, exon 21 L861Q point mutation (L861Q, exon 18 G719X point mutations (G719X, including G719C, G719S, G719A were 43.4%, 48.1%, 1.7% and 6.8%, respectively. Exon 20 T790M point mutation (T790M was detected in 3 squamous carcinomas and 3 adenocarcinomas and exon 20 insertion mutation (20-ins was detected in 2 patients with adenocarcinoma. Our results show the rates of EGFR mutations are higher in all types of NSCLC in Chinese patients. 19-del and L858R are two of the more frequent mutations. EGFR mutation detection should be performed as a routine postoperative examination in Chinese NSCLC patients.
Directory of Open Access Journals (Sweden)
Jingrui Jiang
2018-04-01
Full Text Available Oncogenic epidermal growth factor receptors (EGFRs can recruit key effectors in diverse cellular processes to propagate oncogenic signals. Targeted and combinational therapeutic strategies have been successfully applied for treating EGFR-driven cancers. However, a main challenge in EGFR therapies is drug resistance due to mutations, oncogenic shift, alternative signaling, and other potential mechanisms. To further understand the genetic alterations associated with oncogenic EGFRs and to provide further insight into optimal and personalized therapeutic strategies, we applied a proprietary comprehensive next-generation sequencing (NGS-based assay of 435 genes to systematically study the genomic profiles of 1565 unselected solid cancer patient samples. We found that activating EGFR mutations were predominantly detected in lung cancer, particularly in non-small cell lung cancer (NSCLC. The mutational landscape of EGFR-driven tumors covered most key signaling pathways and biological processes. Strikingly, the Wnt/β-catenin pathway was highly mutated (48 variants detected in 46% of the EGFR-driven tumors, and its variant number topped that in the TP53/apoptosis and PI3K-AKT-mTOR pathways. Furthermore, an analysis of mutation distribution revealed a differential association pattern of gene mutations between EGFR exon 19del and EGFR L858R. Our results confirm the aggressive nature of the oncogenic EGFR-driven tumors and reassure that a combinational strategy should have advantages over an EGFR-targeted monotherapy and holds great promise for overcoming drug resistance.
Wang, Xianshu; Pankratz, V. Shane; Fredericksen, Zachary; Tarrell, Robert; Karaus, Mary; McGuffog, Lesley; Pharaoh, Paul D. P.; Ponder, Bruce A. J.; Dunning, Alison M.; Peock, Susan; Cook, Margaret; Oliver, Clare; Frost, Debra; Sinilnikova, Olga M.; Stoppa-Lyonnet, Dominique; Mazoyer, Sylvie; Houdayer, Claude; Hogervorst, Frans B. L.; Hooning, Maartje J.; Ligtenberg, Marjolijn J.; Spurdle, Amanda; Chenevix-Trench, Georgia; Schmutzler, Rita K.; Wappenschmidt, Barbara; Engel, Christoph; Meindl, Alfons; Domchek, Susan M.; Nathanson, Katherine L.; Rebbeck, Timothy R.; Singer, Christian F.; Gschwantler-Kaulich, Daphne; Dressler, Catherina; Fink, Anneliese; Szabo, Csilla I.; Zikan, Michal; Foretova, Lenka; Claes, Kathleen; Thomas, Gilles; Hoover, Robert N.; Hunter, David J.; Chanock, Stephen J.; Easton, Douglas F.; Antoniou, Antonis C.; Couch, Fergus J.; Gregory, Helen; Miedzybrodzka, Zosia; Morrison, Patrick; Cole, Trevor; McKeown, Carole; Taylor, Amy; Donaldson, Alan; Paterson, Joan; Murray, Alexandra; Rogers, Mark; McCann, Emma; Kennedy, John; Barton, David; Porteous, Mary; Brewer, Carole; Kivuva, Emma; Searle, Anne; Goodman, Selina; Davidson, Rosemarie; Murday, Victoria; Bradshaw, Nicola; Snadden, Lesley; Longmuir, Mark; Watt, Catherine; Izatt, Louise; Pichert, Gabriella; Langman, Caroline; Dorkins, Huw; Barwell, Julian; Chu, Carol; Bishop, Tim; Miller, Julie; Ellis, Ian; Evans, D. Gareth; Lalloo, Fiona; Holt, Felicity; Male, Alison; Robinson, Anne; Gardiner, Carol; Douglas, Fiona; Claber, Oonagh; Walker, Lisa; McLeod, Diane; Eeles, Ros; Shanley, Susan; Rahman, Nazneen; Houlston, Richard; Bancroft, Elizabeth; D'Mello, Lucia; Page, Elizabeth; Ardern-Jones, Audrey; Mitra, Anita; Cook, Jackie; Quarrell, Oliver; Bardsley, Cathryn; Hodgson, Shirley; Goff, Sheila; Brice, Glen; Winchester, Lizzie; Eccles, Diana; Lucassen, Anneke; Crawford, Gillian; Tyler, Emma; McBride, Donna; Bérard, Léon; Sinilnikova, Olga; Barjhoux, Laure; Giraud, Sophie; Léone, Mélanie; Gauthier-Villars, Marion; Moncoutier, Virginie; Belotti, Muriel; de Pauw, Antoine; Bressac-de-Paillerets, Brigitte; Remenieras, Audrey; Byrde, Véronique; Caron, Olivier; Lenoir, Gilbert; Bignon, Yves-Jean; Uhrhammer, Nancy; Lasset, Christine; Bonadona, Valérie; Hardouin, Agnès; Berthet, Pascaline; Sobol, Hagay; Bourdon, Violaine; Eisinger, Françoise; Coulet, Florence; Colas, Chrystelle; Soubrier, Florent; Coupier, Isabelle; Payrat, Jean-Philippe; Fournier, Joëlle; Révillion, Françoise; Vennin, Philippe; Adenis, Claude; Rouleau, Etienne; Lidereau, Rosette; Demange, Liliane; Nogues, Catherine; Muller, Danièle; Fricker, Jean-Pierre; Longy, Michel; Sevenet, Nicolas; Toulas, Christine; Guimbaud, Rosine; Gladieff, Laurence; Feillel, Viviane; Leroux, Dominique; Dreyfus, Hélèn; Rebischung, Christine; Cassini, Cécile; Olivier-Faivre, Laurence; Prieur, Fabienne; Ferrer, Sandra Fert; Frénay, Marc; Vénat-Bouvet, Laurence; Lynch, Henry T.; Hogervorst, Frans; Vernhoef, Senno; Pijpe, Anouk; van 't Veer, Laura; van Leeuwen, Flora; Rookus, Matti; Collée, Margriet; van den Ouweland, Ans; Kriege, Mieke; Schutte, Mieke; Hooning, Maartje; Seynaeve, Caroline; van Asperen, Christi; Wijnen, Juul; Vreeswijk, Maaike; Tollenaar, Rob; Devilee, Peter; Ligtenberg, Marjolijn; Hoogerbrugge, Nicoline; Ausems, Margreet; van der Luijt, Rob; Aalfs, Cora; van Os, Theo; Gille, Hans; Waisfisz, Quinten; Meijers-Heijboer, Hanne; Gomez-Garcia, Encarna; van Roozendaal, Kees; Blok, Marinus; Oosterwijk, Jan; van der Hout, Annemieke; Mourits, Marian; Vasen, Hans; Szabo, Csilla; Pohlreich, Petr; Kleibl, Zdenek; Machackova, Eva; Lukesova, Miroslava; de Leeneer, Kim; Poppe, Bruce; de Paepe, Anne
2010-01-01
Recent studies have identified single nucleotide polymorphisms (SNPs) that significantly modify breast cancer risk in BRCA1 and BRCA2 mutation carriers. Since these risk modifiers were originally identified as genetic risk factors for breast cancer in genome-wide association studies (GWASs),
HFE gene mutations and iron status of Brazilian blood donors.
Santos, P C J L; Cançado, R D; Terada, C T; Rostelato, S; Gonzales, I; Hirata, R D C; Hirata, M H; Chiattone, C S; Guerra-Shinohara, E M
2010-01-01
Mutations of the HFE and TFR2 genes have been associated with iron overload. HFE and TFR2 mutations were assessed in blood donors, and the relationship with iron status was evaluated. Subjects (N = 542) were recruited at the Hemocentro da Santa Casa de São Paulo, São Paulo, Brazil. Iron status was not influenced by HFE mutations in women and was independent of blood donation frequency. In contrast, men carrying the HFE 282CY genotype had lower total iron-binding capacity (TIBC) than HFE 282CC genotype carriers. Men who donated blood for the first time and were carriers of the HFE 282CY genotype had higher transferrin saturation values and lower TIBC concentrations than those with the homozygous wild genotype for the HFE C282Y mutation. Moreover, in this group of blood donors, carriers of HFE 63DD plus 63HD genotypes had higher serum ferritin values than those with the homozygous wild genotype for HFE H63D mutation. Multiple linear regression analysis showed that HFE 282CY leads to a 17.21% increase (P = 0.018) and a 83.65% decrease (P = 0.007) in transferrin saturation and TIBC, respectively. In addition, serum ferritin is influenced by age (3.91%, P = 0.001) and the HFE 63HD plus DD genotype (55.84%, P = 0.021). In conclusion, the HFE 282Y and 65C alleles were rare, while the HFE 63D allele was frequent in Brazilian blood donors. The HFE C282Y and H63D mutations were associated with alterations in iron status in blood donors in a gender-dependent manner.
HFE gene mutations and iron status of Brazilian blood donors
Directory of Open Access Journals (Sweden)
P.C.J.L. Santos
2010-01-01
Full Text Available Mutations of the HFE and TFR2 genes have been associated with iron overload. HFE and TFR2 mutations were assessed in blood donors, and the relationship with iron status was evaluated. Subjects (N = 542 were recruited at the Hemocentro da Santa Casa de São Paulo, São Paulo, Brazil. Iron status was not influenced by HFE mutations in women and was independent of blood donation frequency. In contrast, men carrying the HFE 282CY genotype had lower total iron-binding capacity (TIBC than HFE 282CC genotype carriers. Men who donated blood for the first time and were carriers of the HFE 282CY genotype had higher transferrin saturation values and lower TIBC concentrations than those with the homozygous wild genotype for the HFE C282Y mutation. Moreover, in this group of blood donors, carriers of HFE 63DD plus 63HD genotypes had higher serum ferritin values than those with the homozygous wild genotype for HFE H63D mutation. Multiple linear regression analysis showed that HFE 282CY leads to a 17.21% increase (P = 0.018 and a 83.65% decrease (P = 0.007 in transferrin saturation and TIBC, respectively. In addition, serum ferritin is influenced by age (3.91%, P = 0.001 and the HFE 63HD plus DD genotype (55.84%, P = 0.021. In conclusion, the HFE 282Y and 65C alleles were rare, while the HFE 63D allele was frequent in Brazilian blood donors. The HFE C282Y and H63D mutations were associated with alterations in iron status in blood donors in a gender-dependent manner.
Johnson, Adrienne; Severson, Eric; Gay, Laurie; Vergilio, Jo-Anne; Elvin, Julia; Suh, James; Daniel, Sugganth; Covert, Mandy; Frampton, Garrett M; Hsu, Sigmund; Lesser, Glenn J; Stogner-Underwood, Kimberly; Mott, Ryan T; Rush, Sarah Z; Stanke, Jennifer J; Dahiya, Sonika; Sun, James; Reddy, Prasanth; Chalmers, Zachary R; Erlich, Rachel; Chudnovsky, Yakov; Fabrizio, David; Schrock, Alexa B; Ali, Siraj; Miller, Vincent; Stephens, Philip J; Ross, Jeffrey; Crawford, John R; Ramkissoon, Shakti H
2017-12-01
Pediatric brain tumors are the leading cause of death for children with cancer in the U.S. Incorporating next-generation sequencing data for both pediatric low-grade (pLGGs) and high-grade gliomas (pHGGs) can inform diagnostic, prognostic, and therapeutic decision-making. We performed comprehensive genomic profiling on 282 pediatric gliomas (157 pHGGs, 125 pLGGs), sequencing 315 cancer-related genes and calculating the tumor mutational burden (TMB; mutations per megabase [Mb]). In pLGGs, we detected genomic alterations (GA) in 95.2% (119/125) of tumors. BRAF was most frequently altered (48%; 60/125), and FGFR1 missense (17.6%; 22/125), NF1 loss of function (8.8%; 11/125), and TP53 (5.6%; 7/125) mutations were also detected. Rearrangements were identified in 35% of pLGGs, including KIAA1549-BRAF , QKI-RAF1 , FGFR3-TACC3 , CEP85L-ROS1 , and GOPC-ROS1 fusions. Among pHGGs, GA were identified in 96.8% (152/157). The genes most frequently mutated were TP53 (49%; 77/157), H3F3A (37.6%; 59/157), ATRX (24.2%; 38/157), NF1 (22.2%; 35/157), and PDGFRA (21.7%; 34/157). Interestingly, most H3F3A mutations (81.4%; 35/43) were the variant K28M. Midline tumor analysis revealed H3F3A mutations (40%; 40/100) consisted solely of the K28M variant. Pediatric high-grade gliomas harbored oncogenic EML4-ALK , DGKB-ETV1 , ATG7-RAF1 , and EWSR1-PATZ1 fusions. Six percent (9/157) of pHGGs were hypermutated (TMB >20 mutations per Mb; range 43-581 mutations per Mb), harboring mutations deleterious for DNA repair in MSH6, MSH2, MLH1, PMS2, POLE , and POLD1 genes (78% of cases). Comprehensive genomic profiling of pediatric gliomas provides objective data that promote diagnostic accuracy and enhance clinical decision-making. Additionally, TMB could be a biomarker to identify pediatric glioblastoma (GBM) patients who may benefit from immunotherapy. By providing objective data to support diagnostic, prognostic, and therapeutic decision-making, comprehensive genomic profiling is necessary for
SPOP Mutations in Prostate Cancer across Demographically Diverse Patient Cohorts
Directory of Open Access Journals (Sweden)
Mirjam Blattner
2014-01-01
Full Text Available BACKGROUND: Recurrent mutations in the Speckle-Type POZ Protein (SPOP gene occur in up to 15% of prostate cancers. However, the frequency and features of cancers with these mutations across different populations is unknown. OBJECTIVE: To investigate SPOP mutations across diverse cohorts and validate a series of assays employing high-resolution melting (HRM analysis and Sanger sequencing for mutational analysis of formalin-fixed paraffin-embedded material. DESIGN, SETTING, AND PARTICIPANTS: 720 prostate cancer samples from six international cohorts spanning Caucasian, African American, and Asian patients, including both prostate-specific antigen-screened and unscreened populations, were screened for their SPOP mutation status. Status of SPOP was correlated to molecular features (ERG rearrangement, PTEN deletion, and CHD1 deletion as well as clinical and pathologic features. RESULTS AND LIMITATIONS: Overall frequency of SPOP mutations was 8.1% (4.6% to 14.4%, SPOP mutation was inversely associated with ERG rearrangement (P < .01, and SPOP mutant (SPOPmut cancers had higher rates of CHD1 deletions (P < .01. There were no significant differences in biochemical recurrence in SPOPmut cancers. Limitations of this study include missing mutational data due to sample quality and lack of power to identify a difference in clinical outcomes. CONCLUSION: SPOP is mutated in 4.6% to 14.4% of patients with prostate cancer across different ethnic and demographic backgrounds. There was no significant association between SPOP mutations with ethnicity, clinical, or pathologic parameters. Mutual exclusivity of SPOP mutation with ERG rearrangement as well as a high association with CHD1 deletion reinforces SPOP mutation as defining a distinct molecular subclass of prostate cancer.
DEFF Research Database (Denmark)
Hamdi, Yosr; Soucy, Penny; Kuchenbaeker, Karoline B
2017-01-01
and ovarian cancer risks in 15,252 BRCA1 and 8211 BRCA2 mutation carriers ascertained from 54 studies participating in the Consortium of Investigators of Modifiers of BRCA1/2. RESULTS: We identified a region on 11q22.3 that is significantly associated with breast cancer risk in BRCA1 mutation carriers (most...... studies using estrogen receptor (ER)-negative or triple-negative (i.e., ER-, progesterone receptor-, and HER2-negative) cases could therefore be helpful to confirm the association of this locus with breast cancer risk.......1 and BRCA2 mutation carriers, a list of 175 genes was developed based of their involvement in cancer-related pathways. METHODS: Using data from a genome-wide map of SNPs associated with allelic expression, we assessed the association of ~320 SNPs located in the vicinity of these genes with breast...
Detection of EGFR mutations with mutation-specific antibodies in stage IV non-small-cell lung cancer
Directory of Open Access Journals (Sweden)
Viteri Santiago
2010-12-01
Full Text Available Abstract Background Immunohistochemistry (IHC with mutation-specific antibodies may be an ancillary method of detecting EGFR mutations in lung cancer patients. Methods EGFR mutation status was analyzed by DNA assays, and compared with IHC results in five non-small-cell lung cancer (NSCLC cell lines and tumor samples from 78 stage IV NSCLC patients. Results IHC correctly identified del 19 in the H1650 and PC9 cell lines, L858R in H1975, and wild-type EGFR in H460 and A549, as well as wild-type EGFR in tumor samples from 22 patients. IHC with the mAb against EGFR with del 19 was highly positive for the protein in all 17 patients with a 15-bp (ELREA deletion in exon 19, whereas in patients with other deletions, IHC was weakly positive in 3 cases and negative in 9 cases. IHC with the mAb against the L858R mutation showed high positivity for the protein in 25/27 (93% patients with exon 21 EGFR mutations (all with L858R but did not identify the L861Q mutation in the remaining two patients. Conclusions IHC with mutation-specific mAbs against EGFR is a promising method for detecting EGFR mutations in NSCLC patients. However these mAbs should be validated with additional studies to clarify their possible role in routine clinical practice for screening EGFR mutations in NSCLC patients.
Heath, Kathleen M.; Axton, Jacob H.; McCullough, John M.; Harris, Nathan
2016-01-01
ABSTRACT Objectives The C282Y allele is the major cause of hemochromatosis as a result of excessive iron absorption. The mutation arose in continental Europe no earlier than 6,000 years ago, coinciding with the arrival of the Neolithic agricultural revolution. Here we hypothesize that this new Neolithic diet, which originated in the sunny warm and dry climates of the Middle East, was carried by migrating farmers into the chilly and damp environments of Europe where iron is a critical micronut...
Directory of Open Access Journals (Sweden)
Rodolfo D. Cançado
2007-12-01
Full Text Available Hemocromatose é uma das doenças genéticas mais freqüentes no ser humano e uma das causas mais importantes de sobrecarga de ferro. Os objetivos deste estudo foram determinar a freqüência das mutações C282Y, H63D e S65C do gene HFE em doentes brasileiros com sobrecarga de ferro, verificar a coexistência de anemia hemolítica hereditária, hepatite C e consumo excessivo de bebida alcoólica nestes doentes e avaliar a influência destas variáveis sobre os depósitos de ferro do organismo. Saturação da transferrina, ferritina sérica e análise das mutações C282Y, H63D e S65C do gene HFE, pelo método da PCR, foram determinadas em cinqüenta doentes com sobrecarga de ferro atendidos no Hemocentro da Santa Casa de São Paulo entre janeiro de 2000 e maio de 2004. A freqüência de mutação do gene HFE nos doentes com sobrecarga de ferro foi de 76,0% (38/50. Saturação da transferrina e ferritina foram significativamente maiores nos doentes homozigotos para a mutação C282Y confirmando a correlação entre genótipo C282Y/C282Y e maior risco de sobrecarga de ferro. A coexistência de hepatite C, consumo excessivo de bebida alcoólica ou anemia hemolítica hereditária estão implicados em aumento dos estoques de ferro e constituem fator de risco adicional em pacientes com mutação do gene HFE para a condição de sobrecarga de ferro.Hemochromatosis is one of the most frequent genetic diseases in humans and one of the most important causes of iron overload. The aims of this study were to determine the frequency of C282Y, H63D and S65C mutations of the HFE gene in Brazilian patients with iron overload, to verify the coexistence of chronic hemolytic anemia, hepatitis C and excessive alcohol consumption and to evaluate the influence of these variables on body iron deposits. Transferrin saturation, serum ferritin and C282Y, H63D and S65C HFE gene mutations (by PCR method were determined in 50 patients with iron overload in the Hemocentro da
Directory of Open Access Journals (Sweden)
Angela N Brooks
Full Text Available Although recurrent somatic mutations in the splicing factor U2AF1 (also known as U2AF35 have been identified in multiple cancer types, the effects of these mutations on the cancer transcriptome have yet to be fully elucidated. Here, we identified splicing alterations associated with U2AF1 mutations across distinct cancers using DNA and RNA sequencing data from The Cancer Genome Atlas (TCGA. Using RNA-Seq data from 182 lung adenocarcinomas and 167 acute myeloid leukemias (AML, in which U2AF1 is somatically mutated in 3-4% of cases, we identified 131 and 369 splicing alterations, respectively, that were significantly associated with U2AF1 mutation. Of these, 30 splicing alterations were statistically significant in both lung adenocarcinoma and AML, including three genes in the Cancer Gene Census, CTNNB1, CHCHD7, and PICALM. Cell line experiments expressing U2AF1 S34F in HeLa cells and in 293T cells provide further support that these altered splicing events are caused by U2AF1 mutation. Consistent with the function of U2AF1 in 3' splice site recognition, we found that S34F/Y mutations cause preferences for CAG over UAG 3' splice site sequences. This report demonstrates consistent effects of U2AF1 mutation on splicing in distinct cancer cell types.
Lanikova, Lucie; Lorenzo, Felipe; Yang, Chunzhang; Vankayalapati, Hari; Drachtman, Richard; Divoky, Vladimir; Prchal, Josef T
2013-05-09
Germline von Hippel-Lindau (VHL) gene mutations underlie dominantly inherited familial VHL tumor syndrome comprising a predisposition for renal cell carcinoma, pheochromocytoma/paraganglioma, cerebral hemangioblastoma, and endolymphatic sac tumors. However, recessively inherited congenital polycythemia, exemplified by Chuvash polycythemia, has been associated with 2 separate 3' VHL gene mutations in exon 3. It was proposed that different positions of loss-of-function VHL mutations are associated with VHL syndrome cancer predisposition and only C-terminal domain-encoding VHL mutations would cause polycythemia. However, now we describe a new homozygous VHL exon 2 mutation of the VHL gene:(c.413C>T):P138L, which is associated in the affected homozygote with congenital polycythemia but not in her, or her-heterozygous relatives, with cancer or other VHL syndrome tumors. We show that VHL(P138L) has perturbed interaction with hypoxia-inducible transcription factor (HIF)1α. Further, VHL(P138L) protein has decreased stability in vitro. Similarly to what was reported in Chuvash polycythemia and some other instances of HIFs upregulation, VHL(P138L) erythroid progenitors are hypersensitive to erythropoietin. Interestingly, the level of RUNX1/AML1 and NF-E2 transcripts that are specifically upregulated in acquired polycythemia vera were also upregulated in VHL(P138L) granulocytes.
Vicente, Carmen; Schwab, Claire; Broux, Michaël; Geerdens, Ellen; Degryse, Sandrine; Demeyer, Sofie; Lahortiga, Idoya; Elliott, Alannah; Chilton, Lucy; La Starza, Roberta; Mecucci, Cristina; Vandenberghe, Peter; Goulden, Nicholas; Vora, Ajay; Moorman, Anthony V.; Soulier, Jean; Harrison, Christine J.; Clappier, Emmanuelle; Cools, Jan
2015-01-01
T-cell acute lymphoblastic leukemia is caused by the accumulation of multiple oncogenic lesions, including chromosomal rearrangements and mutations. To determine the frequency and co-occurrence of mutations in T-cell acute lymphoblastic leukemia, we performed targeted re-sequencing of 115 genes across 155 diagnostic samples (44 adult and 111 childhood cases). NOTCH1 and CDKN2A/B were mutated/deleted in more than half of the cases, while an additional 37 genes were mutated/deleted in 4% to 20% of cases. We found that IL7R-JAK pathway genes were mutated in 27.7% of cases, with JAK3 mutations being the most frequent event in this group. Copy number variations were also detected, including deletions of CREBBP or CTCF and duplication of MYB. FLT3 mutations were rare, but a novel extracellular mutation in FLT3 was detected and confirmed to be transforming. Furthermore, we identified complex patterns of pairwise associations, including a significant association between mutations in IL7R-JAK genes and epigenetic regulators (WT1, PRC2, PHF6). Our analyses showed that IL7R-JAK genetic lesions did not confer adverse prognosis in T-cell acute lymphoblastic leukemia cases enrolled in the UK ALL2003 trial. Overall, these results identify interconnections between the T-cell acute lymphoblastic leukemia genome and disease biology, and suggest a potential clinical application for JAK inhibitors in a significant proportion of patients with T-cell acute lymphoblastic leukemia. PMID:26206799
Characteristics and clinical correlates of MPL 515W>L/K mutation in essential thrombocythemia.
Vannucchi, Alessandro M; Antonioli, Elisabetta; Guglielmelli, Paola; Pancrazzi, Alessandro; Guerini, Vittoria; Barosi, Giovanni; Ruggeri, Marco; Specchia, Giorgina; Lo-Coco, Francesco; Delaini, Federica; Villani, Laura; Finotto, Silvia; Ammatuna, Emanuele; Alterini, Renato; Carrai, Valentina; Capaccioli, Gloria; Di Lollo, Simonetta; Liso, Vincenzo; Rambaldi, Alessandro; Bosi, Alberto; Barbui, Tiziano
2008-08-01
Among 994 patients with essential thrombocythemia (ET) who were genotyped for the MPLW515L/K mutation, 30 patients carrying the mutation were identified (3.0%), 8 of whom also displayed the JAK2V671F mutation. MPLW515L/K patients presented lower hemoglobin levels and higher platelet counts than did wild type (wt) MPL; these differences were highly significant compared with MPLwt/JAK2V617F-positive patients. Reduced hemoglobin and increased platelet levels were preferentially associated with the W515L and W515K alleles, respectively. MPL mutation was a significant risk factor for microvessel disturbances, suggesting platelet hyperreactivity associated with constitutively active MPL; arterial thromboses were increased only in comparison to MPLwt/JAK2wt patients. MPLW515L/K patients presented reduced total and erythroid bone marrow cellularity, whereas the numbers of megakaryocytes, megakaryocytic clusters, and small-sized megakaryocytes were all significantly increased. These data indicate that MPLW515L/K mutations do not define a distinct phenotype in ET, although some differences depended on the JAK2V617F mutational status of the counterpart.
Kit W-sh Mutation Prevents Cancellous Bone Loss during Calcium Deprivation.
Lotinun, Sutada; Suwanwela, Jaijam; Poolthong, Suchit; Baron, Roland
2018-01-01
Calcium is essential for normal bone growth and development. Inadequate calcium intake increases the risk of osteoporosis and fractures. Kit ligand/c-Kit signaling plays an important role in regulating bone homeostasis. Mice with c-Kit mutations are osteopenic. The present study aimed to investigate whether impairment of or reduction in c-Kit signaling affects bone turnover during calcium deprivation. Three-week-old male WBB6F1/J-Kit W /Kit W-v /J (W/W v ) mice with c-Kit point mutation, Kit W-sh /HNihrJaeBsmJ (W sh /W sh ) mice with an inversion mutation in the regulatory elements upstream of the c-Kit promoter region, and their wild-type controls (WT) were fed either a normal (0.6% calcium) or a low calcium diet (0.02% calcium) for 3 weeks. μCT analysis indicated that both mutants fed normal calcium diet had significantly decreased cortical thickness and cancellous bone volume compared to WT. The low calcium diet resulted in a comparable reduction in cortical bone volume and cortical thickness in the W/W v and W sh /W sh mice, and their corresponding controls. As expected, the low calcium diet induced cancellous bone loss in the W/W v mice. In contrast, W sh /W sh cancellous bone did not respond to this diet. This c-Kit mutation prevented cancellous bone loss by antagonizing the low calcium diet-induced increase in osteoblast and osteoclast numbers in the W sh /W sh mice. Gene expression profiling showed that calcium deficiency increased Osx, Ocn, Alp, type I collagen, c-Fms, M-CSF, and RANKL/OPG mRNA expression in controls; however, the W sh mutation suppressed these effects. Our findings indicate that although calcium restriction increased bone turnover, leading to osteopenia, the decreased c-Kit expression levels in the W sh /W sh mice prevented the low calcium diet-induced increase in cancellous bone turnover and bone loss but not the cortical bone loss.
Prevalence of deleterious ATM germline mutations in gastric cancer patients.
Huang, Dong-Sheng; Tao, Hou-Quan; He, Xu-Jun; Long, Ming; Yu, Sheng; Xia, Ying-Jie; Wei, Zhang; Xiong, Zikai; Jones, Sian; He, Yiping; Yan, Hai; Wang, Xiaoyue
2015-12-01
Besides CDH1, few hereditary gastric cancer predisposition genes have been previously reported. In this study, we discovered two germline ATM mutations (p.Y1203fs and p.N1223S) in a Chinese family with a history of gastric cancer by screening 83 cancer susceptibility genes. Using a published exome sequencing dataset, we found deleterious germline mutations of ATM in 2.7% of 335 gastric cancer patients of different ethnic origins. The frequency of deleterious ATM mutations in gastric cancer patients is significantly higher than that in general population (p=0.0000435), suggesting an association of ATM mutations with gastric cancer predisposition. We also observed biallelic inactivation of ATM in tumors of two gastric cancer patients. Further evaluation of ATM mutations in hereditary gastric cancer will facilitate genetic testing and risk assessment.
Directory of Open Access Journals (Sweden)
Magali Olivier
2007-02-01
the less frequent mutants studied, suggesting that DNE may play a role in shaping mutation patterns.
Hotspot mutations have been linked to exposure to environmental factors in several cancers: tobacco smoke in lung cancer, tobacco smoke and alcohol in head and neck cancers, aromatic-amines in bladder cancer, aflatoxine-B1 and HBV in liver cancer, and UV in skin cancer. In lung cancers, four specific mutants are observed at high frequencies, V157F, R158L, R248L and R273L. These hotspots are due to G>T transversions that have been shown to be caused by the presence of benzo(a-pyrene diol epoxide (BPDE adducts on guanines at these codons. BPDE is the main metabolite of benzo(a-pyrene, one of the most potent carcinogens present in high quantity in tobacco smoke. In hepatocellular carcinomas from less developed regions, one specific mutant is observed at a high frequency, R249S.
Although the precise mechanism remain unknown, its presence is attributed to an interaction between HBV infection and mutagenesis by the food contaminant carcinogen aflatoxine-B1. In these examples, all hotspot mutants are defective for TA. These observations show how mutagenesis by environmental carcinogens and selection of loss of trans-activation can shape TP53 mutation patterns.
In conclusion, the integration of standardized annotations on the functional impact of missense mutations in the IARC TP53 database provides a powerful framework for the analysis of ";functional"; patterns of mutations in cancers, the detection of genotype/phenotype associations and provide new insights into the factors that shape mutation patterns and influence mutation phenotype, which may have clinical interest.
Directory of Open Access Journals (Sweden)
Zhipeng Zeng
Full Text Available Brugada syndrome (BrS is an inherited arrhythmogenic syndrome leading to sudden cardiac death, partially associated with autosomal dominant mutations in SCN5A, which encodes the cardiac sodium channel alpha-subunit (Nav1.5. To date some SCN5A mutations related with BrS have been identified in voltage sensor of Nav1.5. Here, we describe a dominant missense mutation (R1629Q localized in the fourth segment of domain IV region (DIV-S4 in a Chinese Han family. The mutation was identified by direct sequencing of SCN5A from the proband's DNA. Co-expression of Wild-type (WT or R1629Q Nav1.5 channel and hβ1 subunit were achieved in human embryonic kidney cells by transient transfection. Sodium currents were recorded using whole cell patch-clamp protocols. No significant changes between WT and R1629Q currents were observed in current density or steady-state activation. However, hyperpolarized shift of steady-state inactivation curve was identified in cells expressing R1629Q channel (WT: V1/2 = -81.1 ± 1.3 mV, n = 13; R1629Q: V1/2 = -101.7 ± 1.2 mV, n = 18. Moreover, R1629Q channel showed enhanced intermediate inactivation and prolonged recovery time from inactivation. In summary, this study reveals that R1629Q mutation causes a distinct loss-of-function of the channel due to alter its electrophysiological characteristics, and facilitates our understanding of biophysical mechanisms of BrS.
Epidermal growth factor receptor (EGFR) mutations in lung cancer: preclinical and clinical data
Energy Technology Data Exchange (ETDEWEB)
Jorge, S.E.D.C.; Kobayashi, S.S.; Costa, D.B. [Harvard Medical School, Beth Israel Deaconess Medical Center, Department of Medicine, Division of Hematology/Oncology, Boston, MA (United States)
2014-09-05
Lung cancer leads cancer-related mortality worldwide. Non-small-cell lung cancer (NSCLC), the most prevalent subtype of this recalcitrant cancer, is usually diagnosed at advanced stages, and available systemic therapies are mostly palliative. The probing of the NSCLC kinome has identified numerous nonoverlapping driver genomic events, including epidermal growth factor receptor (EGFR) gene mutations. This review provides a synopsis of preclinical and clinical data on EGFR mutated NSCLC and EGFR tyrosine kinase inhibitors (TKIs). Classic somatic EGFR kinase domain mutations (such as L858R and exon 19 deletions) make tumors addicted to their signaling cascades and generate a therapeutic window for the use of ATP-mimetic EGFR TKIs. The latter inhibit these kinases and their downstream effectors, and induce apoptosis in preclinical models. The aforementioned EGFR mutations are stout predictors of response and augmentation of progression-free survival when gefitinib, erlotinib, and afatinib are used for patients with advanced NSCLC. The benefits associated with these EGFR TKIs are limited by the mechanisms of tumor resistance, such as the gatekeeper EGFR-T790M mutation, and bypass activation of signaling cascades. Ongoing preclinical efforts for treating resistance have started to translate into patient care (including clinical trials of the covalent EGFR-T790M TKIs AZD9291 and CO-1686) and hold promise to further boost the median survival of patients with EGFR mutated NSCLC.
Epidermal growth factor receptor (EGFR) mutations in lung cancer: preclinical and clinical data
International Nuclear Information System (INIS)
Jorge, S.E.D.C.; Kobayashi, S.S.; Costa, D.B.
2014-01-01
Lung cancer leads cancer-related mortality worldwide. Non-small-cell lung cancer (NSCLC), the most prevalent subtype of this recalcitrant cancer, is usually diagnosed at advanced stages, and available systemic therapies are mostly palliative. The probing of the NSCLC kinome has identified numerous nonoverlapping driver genomic events, including epidermal growth factor receptor (EGFR) gene mutations. This review provides a synopsis of preclinical and clinical data on EGFR mutated NSCLC and EGFR tyrosine kinase inhibitors (TKIs). Classic somatic EGFR kinase domain mutations (such as L858R and exon 19 deletions) make tumors addicted to their signaling cascades and generate a therapeutic window for the use of ATP-mimetic EGFR TKIs. The latter inhibit these kinases and their downstream effectors, and induce apoptosis in preclinical models. The aforementioned EGFR mutations are stout predictors of response and augmentation of progression-free survival when gefitinib, erlotinib, and afatinib are used for patients with advanced NSCLC. The benefits associated with these EGFR TKIs are limited by the mechanisms of tumor resistance, such as the gatekeeper EGFR-T790M mutation, and bypass activation of signaling cascades. Ongoing preclinical efforts for treating resistance have started to translate into patient care (including clinical trials of the covalent EGFR-T790M TKIs AZD9291 and CO-1686) and hold promise to further boost the median survival of patients with EGFR mutated NSCLC
Mutations and epimutations in the origin of cancer
Energy Technology Data Exchange (ETDEWEB)
Peltomaeki, Paeivi, E-mail: Paivi.Peltomaki@Helsinki.Fi
2012-02-15
Cancer is traditionally viewed as a disease of abnormal cell proliferation controlled by a series of mutations. Mutations typically affect oncogenes or tumor suppressor genes thereby conferring growth advantage. Genomic instability facilitates mutation accumulation. Recent findings demonstrate that activation of oncogenes and inactivation of tumor suppressor genes, as well as genomic instability, can be achieved by epigenetic mechanisms as well. Unlike genetic mutations, epimutations do not change the base sequence of DNA and are potentially reversible. Similar to genetic mutations, epimutations are associated with specific patterns of gene expression that are heritable through cell divisions. Knudson's hypothesis postulates that inactivation of tumor suppressor genes requires two hits, with the first hit occurring either in somatic cells (sporadic cancer) or in the germline (hereditary cancer) and the second one always being somatic. Studies on hereditary and sporadic forms of colorectal carcinoma have made it evident that, apart from genetic mutations, epimutations may serve as either hit or both. Furthermore, recent next-generation sequencing studies show that epigenetic genes, such as those encoding histone modifying enzymes and subunits for chromatin remodeling systems, are themselves frequent targets of somatic mutations in cancer and can act like tumor suppressor genes or oncogenes. This review discusses genetic vs. epigenetic origin of cancer, including cancer susceptibility, in light of recent discoveries. Situations in which mutations and epimutations occur to serve analogous purposes are highlighted.
Hanker, Ariella B; Brewer, Monica Red; Sheehan, Jonathan H; Koch, James P; Sliwoski, Gregory R; Nagy, Rebecca; Lanman, Richard; Berger, Michael F; Hyman, David M; Solit, David B; He, Jie; Miller, Vincent; Cutler, Richard E; Lalani, Alshad S; Cross, Darren; Lovly, Christine M; Meiler, Jens; Arteaga, Carlos L
2017-06-01
We report a HER2 T798I gatekeeper mutation in a patient with HER2 L869R -mutant breast cancer with acquired resistance to neratinib. Laboratory studies suggested that HER2 L869R is a neratinib-sensitive, gain-of-function mutation that upon dimerization with mutant HER3 E928G , also present in the breast cancer, amplifies HER2 signaling. The patient was treated with neratinib and exhibited a sustained partial response. Upon clinical progression, HER2 T798I was detected in plasma tumor cell-free DNA. Structural modeling of this acquired mutation suggested that the increased bulk of isoleucine in HER2 T798I reduces neratinib binding. Neratinib blocked HER2-mediated signaling and growth in cells expressing HER2 L869R but not HER2 L869R/T798I In contrast, afatinib and the osimertinib metabolite AZ5104 strongly suppressed HER2 L869R/T798I -induced signaling and cell growth. Acquisition of HER2 T798I upon development of resistance to neratinib in a breast cancer with an initial activating HER2 mutation suggests HER2 L869R is a driver mutation. HER2 T798I -mediated neratinib resistance may be overcome by other irreversible HER2 inhibitors like afatinib. Significance: We found an acquired HER2 gatekeeper mutation in a patient with HER2 -mutant breast cancer upon clinical progression on neratinib. We speculate that HER2 T798I may arise as a secondary mutation following response to effective HER2 tyrosine kinase inhibitors (TKI) in other cancers with HER2 -activating mutations. This resistance may be overcome by other irreversible HER2 TKIs, such as afatinib. Cancer Discov; 7(6); 575-85. ©2017 AACR. This article is highlighted in the In This Issue feature, p. 539 . ©2017 American Association for Cancer Research.
OGG1 Mutations and Risk of Female Breast Cancer: Meta-Analysis and Experimental Data
Directory of Open Access Journals (Sweden)
Kashif Ali
2015-01-01
Full Text Available In first part of this study association between OGG1 polymorphisms and breast cancer susceptibility was explored by meta-analysis. Second part of the study involved 925 subjects, used for mutational analysis of OGG1 gene using PCR-SSCP and sequencing. Fifteen mutations were observed, which included five intronic mutations, four splice site mutations, two 3′UTR mutations, three missense mutations, and a nonsense mutation. Significantly (pG and 3′UTR variant g.9798848G>A. Among intronic mutations, highest (~15 fold increase in breast cancer risk was associated with g.9793680G>A (p<0.009. Similarly ~14-fold increased risk was associated with Val159Gly (p<0.01, ~17-fold with Gly221Arg (p<0.005, and ~18-fold with Ser326Cys (p<0.004 in breast cancer patients compared with controls, whereas analysis of nonsense mutation showed that ~13-fold (p<0.01 increased breast cancer risk was associated with Trp375STOP in patients compared to controls. In conclusion, a significant association was observed between OGG1 germ line mutations and breast cancer risk. These findings provide evidence that OGG1 may prove to be a good candidate of better diagnosis, treatment, and prevention of breast cancer.
DEFF Research Database (Denmark)
Hamdi, Yosr; Soucy, Penny; Kuchenbaeker, Karoline B
2017-01-01
1 and BRCA2 mutation carriers, a list of 175 genes was developed based of their involvement in cancer-related pathways. METHODS: Using data from a genome-wide map of SNPs associated with allelic expression, we assessed the association of ~320 SNPs located in the vicinity of these genes with breast...... and ovarian cancer risks in 15,252 BRCA1 and 8211 BRCA2 mutation carriers ascertained from 54 studies participating in the Consortium of Investigators of Modifiers of BRCA1/2. RESULTS: We identified a region on 11q22.3 that is significantly associated with breast cancer risk in BRCA1 mutation carriers (most...... significant SNP rs228595 p = 7 × 10(-6)). This association was absent in BRCA2 carriers (p = 0.57). The 11q22.3 region notably encompasses genes such as ACAT1, NPAT, and ATM. Expression quantitative trait loci associations were observed in both normal breast and tumors across this region, namely for ACAT1...
The functional importance of disease-associated mutation
Directory of Open Access Journals (Sweden)
Klein Teri E
2002-09-01
Full Text Available Abstract Background For many years, scientists believed that point mutations in genes are the genetic switches for somatic and inherited diseases such as cystic fibrosis, phenylketonuria and cancer. Some of these mutations likely alter a protein's function in a manner that is deleterious, and they should occur in functionally important regions of the protein products of genes. Here we show that disease-associated mutations occur in regions of genes that are conserved, and can identify likely disease-causing mutations. Results To show this, we have determined conservation patterns for 6185 non-synonymous and heritable disease-associated mutations in 231 genes. We define a parameter, the conservation ratio, as the ratio of average negative entropy of analyzable positions with reported mutations to that of every analyzable position in the gene sequence. We found that 84.0% of the 231 genes have conservation ratios less than one. 139 genes had eleven or more analyzable mutations and 88.0% of those had conservation ratios less than one. Conclusions These results indicate that phylogenetic information is a powerful tool for the study of disease-associated mutations. Our alignments and analysis has been made available as part of the database at http://cancer.stanford.edu/mut-paper/. Within this dataset, each position is annotated with the analysis, so the most likely disease-causing mutations can be identified.
Filaggrin loss-of-function mutations and incident cancer
DEFF Research Database (Denmark)
Skaaby, T; Husemoen, L L N; Thyssen, J P
2014-01-01
BACKGROUND: Loss-of-function mutations in the filaggrin gene (FLG) could have opposing effects on cancer risk, as mutations are associated with both 10% higher serum vitamin D levels, which may protect against cancer, and with impaired skin barrier function, which may lead to higher cancer...... (HR 1·09, 95% CI 0·61-1·94), urinary cancer (HR 1·30, 95% CI 0·51-3·29), malignant melanoma (HR 1·03, 95% CI 0·41-2·58) and NMSC (HR 0·70, 95% CI 0·47-1·05). Among participants aged over 60 years at baseline, we found statistically significant lower risks of all cancers and NMSC among FLG mutation...
Directory of Open Access Journals (Sweden)
Joana Simões-Correia
Full Text Available E-cadherin is critical for the maintenance of tissue architecture due to its role in cell-cell adhesion. E-cadherin mutations are the genetic cause of Hereditary Diffuse Gastric Cancer (HDGC and missense mutations represent a clinical burden, due to the uncertainty of their pathogenic role. In vitro and in vivo, most mutations lead to loss-of-function, although the causal factor is unknown for the majority. We hypothesized that destabilization could account for the pathogenicity of E-cadherin missense mutations in HDGC, and tested our hypothesis using in silico and in vitro tools. FoldX algorithm was used to calculate the impact of each mutation in E-cadherin native-state stability, and the analysis was complemented with evolutionary conservation, by SIFT. Interestingly, HDGC patients harbouring germline E-cadherin destabilizing mutants present a younger age at diagnosis or death, suggesting that the loss of native-state stability of E-cadherin accounts for the disease phenotype. To elucidate the biological relevance of E-cadherin destabilization in HDGC, we investigated a group of newly identified HDGC-associated mutations (E185V, S232C and L583R, of which L583R is predicted to be destabilizing. We show that this mutation is not functional in vitro, exhibits shorter half-life and is unable to mature, due to premature proteasome-dependent degradation, a phenotype reverted by stabilization with the artificial mutation L583I (structurally tolerated. Herein we report E-cadherin structural models suitable to predict the impact of the majority of cancer-associated missense mutations and we show that E-cadherin destabilization leads to loss-of-function in vitro and increased pathogenicity in vivo.
International Nuclear Information System (INIS)
Silva, Edaise M da; W Achatz, Maria Isabel; Martel-Planche, Ghyslaine; Montagnini, André L; Olivier, Magali; Prolla, Patricia A; Hainaut, Pierre; Soares, Fernando A
2011-01-01
Gastric adenocarcinoma is rare in children and adolescents, with about 17 cases under age 21 in the world's literature. We report a case of invasive well-differentiated metastatic gastric cancer in a Brazilian 12-year-old boy without documented familial history of cancer. The patient, diagnosed with metastatic disease, died seven months after surgery. DNA from intra-surgical specimens revealed a TP53 mutation at codon 337 (p.R337H) in samples with neoplastic cells (dysplasia, tumor and metastasis) but not in non-transformed cells (incomplete intestinal metaplasia and non-involved celiac lymph node). In all mutation-positive tissues, p.R337H occurred on the same background, a founder allele identified by a specific haplotype previously described in Brazilian Li-Fraumeni syndrome patients. The same mutant haplotype, corresponding to a founder mutation present in 0.3% of the general population in Southern Brazil, was found in the genome of the father. Presence of this inherited haplotype in the tumor as well as in the father's germline, suggests a rare case of microchimerism in this patient, who may have harbored a small number of mutant cells originating in another individual, perhaps a dizygotic twin that died early in gestation. This case represents one of the earliest ages at diagnosis of gastric cancer ever reported. It shows that cancer inheritance can occur in the absence of an obvious germline mutation, calling for caution in assessing early cancers in populations with common founder mutations such as p.R337H in Southern Brazil
Performance of mitochondrial DNA mutations detecting early stage cancer
International Nuclear Information System (INIS)
Jakupciak, John P; Srivastava, Sudhir; Sidransky, David; O'Connell, Catherine D; Maragh, Samantha; Markowitz, Maura E; Greenberg, Alissa K; Hoque, Mohammad O; Maitra, Anirban; Barker, Peter E; Wagner, Paul D; Rom, William N
2008-01-01
Mutations in the mitochondrial genome (mtgenome) have been associated with cancer and many other disorders. These mutations can be point mutations or deletions, or admixtures (heteroplasmy). The detection of mtDNA mutations in body fluids using resequencing microarrays, which are more sensitive than other sequencing methods, could provide a strategy to measure mutation loads in remote anatomical sites. We determined the mtDNA mutation load in the entire mitochondrial genome of 26 individuals with different early stage cancers (lung, bladder, kidney) and 12 heavy smokers without cancer. MtDNA was sequenced from three matched specimens (blood, tumor and body fluid) from each cancer patient and two matched specimens (blood and sputum) from smokers without cancer. The inherited wildtype sequence in the blood was compared to the sequences present in the tumor and body fluid, detected using the Affymetrix Genechip ® Human Mitochondrial Resequencing Array 1.0 and supplemented by capillary sequencing for noncoding region. Using this high-throughput method, 75% of the tumors were found to contain mtDNA mutations, higher than in our previous studies, and 36% of the body fluids from these cancer patients contained mtDNA mutations. Most of the mutations detected were heteroplasmic. A statistically significantly higher heteroplasmy rate occurred in tumor specimens when compared to both body fluid of cancer patients and sputum of controls, and in patient blood compared to blood of controls. Only 2 of the 12 sputum specimens from heavy smokers without cancer (17%) contained mtDNA mutations. Although patient mutations were spread throughout the mtDNA genome in the lung, bladder and kidney series, a statistically significant elevation of tRNA and ND complex mutations was detected in tumors. Our findings indicate comprehensive mtDNA resequencing can be a high-throughput tool for detecting mutations in clinical samples with potential applications for cancer detection, but it is
Epidermal growth factor receptor mutation in gastric cancer.
Liu, Zhimin; Liu, Lina; Li, Mei; Wang, Zhaohui; Feng, Lu; Zhang, Qiuping; Cheng, Shihua; Lu, Shen
2011-04-01
Epidermal growth factor receptor (EGFR) and Kirsten-RAS (KRAS) mutations have been identified as predictors of response to EGFR tyrosine kinase inhibitors (TKIs) in non-small cell lung cancer. We aimed to screen the mutations of both genes in gastric carcinoma to detect the suitability of EGFR TKIs for patients with gastric carcinoma. We screened EGFR mutation in exons 19-21 and KRAS mutation in exon 2 in 58 gastric adenocarcinomas from China using high resolution melting analysis (HRMA). Positive samples were confirmed by DNA sequencing. Three EGFR missense mutations (5.2%) and 22 single nucleotide polymorphisms (SNP, Q787Q, 37.9%) were identified. To our knowledge, we report for the first time three mutation patterns of EGFR, Y801C, L858R and G863D, in gastric carcinoma. Two samples with EGFR mutation were mucinous adenocarcinoma. These three samples were collected from male patients aged over 75 years old. The frequency of KRAS mutation was 10.3% (6/58). The exclusiveness of EGFR and KRAS mutations was proven for the first time in gastric cancer. Gastric carcinoma of the mucinous adenocarcinoma type collected from older male patients may harbour EGFR mutations. The small subset of gastric adenocarcinoma patients may respond to EGFR TKIs.
Low prevalence of CHEK2 gene mutations in multiethnic cohorts of breast cancer patients in Malaysia.
Mohamad, Suriati; Isa, Nurismah Md; Muhammad, Rohaizak; Emran, Nor Aina; Kitan, Nor Mayah; Kang, Peter; Kang, In Nee; Taib, Nur Aishah Mohd; Teo, Soo Hwang; Akmal, Sharifah Noor
2015-01-01
CHEK2 is a protein kinase that is involved in cell-cycle checkpoint control after DNA damage. Germline mutations in CHEK2 gene have been associated with increase in breast cancer risk. The aim of this study is to identify the CHEK2 gene germline mutations among high-risk breast cancer patients and its contribution to the multiethnic population in Malaysia. We screened the entire coding region of CHEK2 gene on 59 high-risk breast cancer patients who tested negative for BRCA1/2 germline mutations from UKM Medical Centre (UKMMC), Hospital Kuala Lumpur (HKL) and Hospital Putrajaya (HPJ). Sequence variants identified were screened further in case-control cohorts consisting of 878 unselected invasive breast cancer patients (180 Malays, 526 Chinese and 172 Indian) and 270 healthy individuals (90 Malays, 90 Chinese and 90 Indian). By screening the entire coding region of the CHEK2 gene, two missense mutations, c.480A>G (p.I160M) and c.538C>T (p.R180C) were identified in two unrelated patients (3.4%). Further screening of these missense mutations on the case-control cohorts unveiled the variant p.I160M in 2/172 (1.1%) Indian cases and 1/90 (1.1%) Indian control, variant p.R180C in 2/526 (0.38%) Chinese cases and 0/90 Chinese control, and in 2/180 (1.1%) of Malay cases and 1/90 (1.1%) of Malay control. The results of this study suggest that CHEK2 mutations are rare among high-risk breast cancer patients and may play a minor contributing role in breast carcinogenesis among Malaysian population.
Kuchenbaecker, Karoline B.; Neuhausen, Susan L.; Robson, Mark; Barrowdale, Daniel; McGuffog, Lesley; Mulligan, Anna Marie; Andrulis, Irene L.; Spurdle, Amanda B.; Schmidt, Marjanka K.; Schmutzler, Rita K.; Engel, Christoph; Wappenschmidt, Barbara; Nevanlinna, Heli; Thomassen, Mads; Southey, Melissa; Radice, Paolo; Ramus, Susan J.; Domchek, Susan M.; Nathanson, Katherine L.; Lee, Andrew; Healey, Sue; Nussbaum, Robert L.; Rebbeck, Timothy R.; Arun, Banu K.; James, Paul; Karlan, Beth Y.; Lester, Jenny; Cass, Ilana; Terry, Mary Beth; Daly, Mary B.; Goldgar, David E.; Buys, Saundra S.; Janavicius, Ramunas; Tihomirova, Laima; Tung, Nadine; Dorfling, Cecilia M.; van Rensburg, Elizabeth J.; Steele, Linda; v O Hansen, Thomas; Ejlertsen, Bent; Gerdes, Anne-Marie; Nielsen, Finn C.; Dennis, Joe; Cunningham, Julie; Hart, Steven; Slager, Susan; Osorio, Ana; Benitez, Javier; Duran, Mercedes; Weitzel, Jeffrey N.; Tafur, Isaac; Hander, Mary; Peterlongo, Paolo; Manoukian, Siranoush; Peissel, Bernard; Roversi, Gaia; Scuvera, Giulietta; Bonanni, Bernardo; Mariani, Paolo; Volorio, Sara; Dolcetti, Riccardo; Varesco, Liliana; Papi, Laura; Tibiletti, Maria Grazia; Giannini, Giuseppe; Fostira, Florentia; Konstantopoulou, Irene; Garber, Judy; Hamann, Ute; Donaldson, Alan; Brewer, Carole; Foo, Claire; Evans, D. Gareth; Frost, Debra; Eccles, Diana; Douglas, Fiona; Brady, Angela; Cook, Jackie; Tischkowitz, Marc; Adlard, Julian; Barwell, Julian; Ong, Kai-Ren; Walker, Lisa; Izatt, Louise; Side, Lucy E.; Kennedy, M. John; Rogers, Mark T.; Porteous, Mary E.; Morrison, Patrick J.; Platte, Radka; Eeles, Ros; Davidson, Rosemarie; Hodgson, Shirley; Ellis, Steve; Godwin, Andrew K.; Rhiem, Kerstin; Meindl, Alfons; Ditsch, Nina; Arnold, Norbert; Plendl, Hansjoerg; Niederacher, Dieter; Sutter, Christian; Steinemann, Doris; Bogdanova-Markov, Nadja; Kast, Karin; Varon-Mateeva, Raymonda; Wang-Gohrke, Shan; Gehrig, Andrea; Markiefka, Birgid; Buecher, Bruno; Lefol, Cédrick; Stoppa-Lyonnet, Dominique; Rouleau, Etienne; Prieur, Fabienne; Damiola, Francesca; Barjhoux, Laure; Faivre, Laurence; Longy, Michel; Sevenet, Nicolas; Sinilnikova, Olga M.; Mazoyer, Sylvie; Bonadona, Valérie; Caux-Moncoutier, Virginie; Isaacs, Claudine; van Maerken, Tom; Claes, Kathleen; Piedmonte, Marion; Andrews, Lesley; Hays, John; Rodriguez, Gustavo C.; Caldes, Trinidad; de la Hoya, Miguel; Khan, Sofia; Hogervorst, Frans B. L.; Aalfs, Cora M.; de Lange, J. L.; Meijers-Heijboer, Hanne E. J.; van der Hout, Annemarie H.; Wijnen, Juul T.; van Roozendaal, K. E. P.; Mensenkamp, Arjen R.; van den Ouweland, Ans M. W.; van Deurzen, Carolien H. M.; van der Luijt, Rob B.; Olah, Edith; Diez, Orland; Lazaro, Conxi; Blanco, Ignacio; Teulé, Alex; Menendez, Mireia; Jakubowska, Anna; Lubinski, Jan; Cybulski, Cezary; Gronwald, Jacek; Jaworska-Bieniek, Katarzyna; Durda, Katarzyna; Arason, Adalgeir; Maugard, Christine; Soucy, Penny; Montagna, Marco; Agata, Simona; Teixeira, Manuel R.; Olswold, Curtis; Lindor, Noralane; Pankratz, Vernon S.; Hallberg, Emily; Wang, Xianshu; Szabo, Csilla I.; Vijai, Joseph; Jacobs, Lauren; Corines, Marina; Lincoln, Anne; Berger, Andreas; Fink-Retter, Anneliese; Singer, Christian F.; Rappaport, Christine; Kaulich, Daphne Gschwantler; Pfeiler, Georg; tea, Muy-Kheng; Phelan, Catherine M.; Mai, Phuong L.; Greene, Mark H.; Rennert, Gad; Imyanitov, Evgeny N.; Glendon, Gord; Toland, Amanda Ewart; Bojesen, Anders; Pedersen, Inge Sokilde; Jensen, Uffe Birk; Caligo, Maria A.; Friedman, Eitan; Berger, Raanan; Laitman, Yael; Rantala, Johanna; Arver, Brita; Loman, Niklas; Borg, Ake; Ehrencrona, Hans; Olopade, Olufunmilayo I.; Simard, Jacques; Easton, Douglas F.; Chenevix-Trench, Georgia; Offit, Kenneth; Couch, Fergus J.; Antoniou, Antonis C.; Perkins, Jo; Miedzybrodzka, Zosia; Gregory, Helen; Morrison, Patrick; Jeffers, Lisa; Cole, Trevor; Hoffman, Jonathan; James, Margaret; Paterson, Joan; Downing, Sarah; Taylor, Amy; Murray, Alexandra; McCann, Emma; Barton, David; Porteous, Mary; Drummond, Sarah; Kivuva, Emma; Searle, Anne; Goodman, Selina; Hill, Kathryn; Murday, Victoria; Bradshaw, Nicola; Snadden, Lesley; Longmuir, Mark; Watt, Catherine; Gibson, Sarah; Haque, Eshika; Tobias, Ed; Duncan, Alexis; Jacobs, Chris; Langman, Caroline; Dorkins, Huw; Serra-Feliu, Gemma; Ellis, Ian; Lalloo, Fiona; Taylor, Jane; Side, Lucy; Male, Alison; Berlin, Cheryl; Eason, Jacqueline; Collier, Rebecca; Claber, Oonagh; Jobson, Irene; McLeod, Diane; Halliday, Dorothy; Durell, Sarah; Stayner, Barbara; Shanley, Susan; Rahman, Nazneen; Houlston, Richard; Bancroft, Elizabeth; Page, Elizabeth; Ardern-Jones, Audrey; Kohut, Kelly; Wiggins, Jennifer; Castro, Elena; Mitra, Anita; Quarrell, Oliver; Bardsley, Cathryn; Goff, Sheila; Brice, Glen; Winchester, Lizzie; Eddy, Charlotte; Tripathi, Vishakha; Attard, Virginia; Lucassen, Anneke; Crawford, Gillian; McBride, Donna; Smalley, Sarah; Weaver, Joellen; Bove, Betsy; Sinilnikova, Olga; Verny-Pierre, Carole; Calender, Alain; Giraud, Sophie; Léone, Mélanie; Gauthier-Villars, Marion; Houdayer, Claude; Moncoutier, Virginie; Belotti, Muriel; Tirapo, Carole; de Pauw, Antoine; Bressac-de-Paillerets, Brigitte; Caron, Olivier; Bignon, Yves-Jean; Uhrhammer, Nancy; Lasset, Christine; Handallo, Sandrine; Hardouin, Agnès; Berthet, Pascaline; Sobol, Hagay; Bourdon, Violaine; Noguchi, Tetsuro; Remenieras, Audrey; Eisinger, François; Coupier, Isabelle; Pujol, Pascal; Peyrat, Jean-Philippe; Fournier, Joëlle; Révillion, Françoise; Vennin, Philippe; Adenis, Claude; Lidereau, Rosette; Demange, Liliane; Nogues, Catherine; Muller, Danièle; Fricker, Jean-Pierre; Barouk-Simonet, Emmanuelle; Bonnet, Françoise; Bubien, Virginie; Toulas, Christine; Guimbaud, Rosine; Gladieff, Laurence; Feillel, Viviane; Leroux, Dominique; Dreyfus, Hélène; Rebischung, Christine; Peysselon, Magalie; Coron, Fanny; Lebrun, Marine; Kientz, Caroline; Ferrer, Sandra Fert; Frénay, Marc; Vénat-Bouvet, Laurence; Delnatte, Capucine; Mortemousque, Isabelle; Coulet, Florence; Colas, Chrystelle; Soubrier, Florent; Sokolowska, Johanna; Bronner, Myriam; Collonge-Rame, Marie-Agnès; Damette, Alexandre; Lynch, Henry T.; Snyder, Carrie L.; Coene, Ilse; Crombez, Brecht; Segura, Pedro Perez; Romero, Atocha; Diaque, Paula; Aittomäki, Kristiina; Blomqvist, Carl; Aaltonen, Kirsimari; Muranen, Taru A.; Erkkilä, Irja; Palola, Virpi; Rookus, M. A.; Hogervorst, F. B. L.; van Leeuwen, F. E.; Verhoef, S.; Schmidt, M. K.; Wijnands, R.; Collée, J. M.; van den Ouweland, A. M. W.; Hooning, M. J.; Seynaeve, C.; van Deurzen, C. H. M.; Obdeijn, I. M.; van Asperen, C. J.; Wijnen, J. T.; Tollenaar, R. A. E. M.; Devilee, P.; van Cronenburg, T. C. T. E. F.; Kets, C. M.; Mensenkamp, A. R.; Ausems, M. G. E. M.; van der Luijt, R. B.; van Os, T. A. M.; Gille, J. J. P.; Waisfisz, Q.; Gómez-Garcia, E. B.; Blok, M. J.; Oosterwijk, J. C.; van der Hout, A. H.; Mourits, M. J.; de Bock, G. H.; Vasen, H. F.; Siesling, S.; Overbeek, L. I. H.; Papp, Janos; Vaszko, Tibor; Bozsik, Aniko; Pocza, Timea; Franko, Judit; Balogh, Maria; Domokos, Gabriella; Ferenczi, Judit; Balmaña, J.; Capella, Gabriel; Dumont, Martine; Tranchant, Martine
2014-01-01
Introduction: More than 70 common alleles are known to be involved in breast cancer (BC) susceptibility, and several exhibit significant heterogeneity in their associations with different BC subtypes. Although there are differences in the association patterns between BRCA1 and BRCA2 mutation
International Nuclear Information System (INIS)
Friedrichsen, Danielle M; Malone, Kathleen E; Doody, David R; Daling, Janet R; Ostrander, Elaine A
2004-01-01
The cell-cycle checkpoint kinase (CHEK)2 protein truncating mutation 1100delC has been associated with increased risk for breast or prostate cancer. Multiple studies have found an elevated frequency of the 1100delC variant in specific stratifications of breast cancer patients with a family history of the disease, including BRCA1/BRCA2 negative families and families with a history of bilateral disease or male breast cancer. However, the 1100delC mutation has only been investigated in a few population-based studies and none from North America. We report here on the frequency of three CHEK2 variants that alter protein function – 1100delC, R145W, and I175T – in 506 cases and 459 controls from a population based, case–control study of breast cancer conducted in young women from western Washington. There was a suggestive enrichment in the 1100delC variant in the cases (1.2%) as compared with the controls (0.4%), but this was based on small numbers of carriers and the differences were not statistically significant. The 1100delC variant was more frequent in cases with a first-degree family history of breast cancer (4.3%; P = 0.02) and slightly enriched in cases with a family history of ovarian cancer (4.4%; P = 0.09). The CHEK2 variants are rare in the western Washington population and, based on accumulated evidence across studies, are unlikely to be major breast cancer susceptibility genes. Thus, screening for the 1100delC variant may have limited usefulness in breast cancer prevention programs in the USA
Aragon Han, Patricia; Kim, Hyun-seok; Cho, Soonweng; Fazeli, Roghayeh; Najafian, Alireza; Khawaja, Hunain; McAlexander, Melissa; Dy, Benzon; Sorensen, Meredith; Aronova, Anna; Sebo, Thomas J.; Giordano, Thomas J.; Fahey, Thomas J.; Thompson, Geoffrey B.; Gauger, Paul G.; Somervell, Helina; Bishop, Justin A.; Eshleman, James R.; Schneider, Eric B.; Witwer, Kenneth W.; Umbricht, Christopher B.
2016-01-01
Background: Studies have demonstrated an association of the BRAFV600E mutation and microRNA (miR) expression with aggressive clinicopathologic features in papillary thyroid cancer (PTC). Analysis of BRAFV600E mutations with miR expression data may improve perioperative decision making for patients with PTC, specifically in identifying patients harboring central lymph node metastases (CLNM). Methods: Between January 2012 and June 2013, 237 consecutive patients underwent total thyroidectomy and prophylactic central lymph node dissection (CLND) at four endocrine surgery centers. All tumors were tested for the presence of the BRAFV600E mutation and miR-21, miR-146b-3p, miR-146b-5p, miR-204, miR-221, miR-222, and miR-375 expression. Bivariate and multivariable analyses were performed to examine associations between molecular markers and aggressive clinicopathologic features of PTC. Results: Multivariable logistic regression analysis of all clinicopathologic features found miR-146b-3p and miR-146b-5p to be independent predictors of CLNM, while the presence of BRAFV600E almost reached significance. Multivariable logistic regression analysis limited to only predictors available preoperatively (molecular markers, age, sex, and tumor size) found miR-146b-3p, miR-146b-5p, miR-222, and BRAFV600E mutation to predict CLNM independently. While BRAFV600E was found to be associated with CLNM (48% mutated in node-positive cases vs. 28% mutated in node-negative cases), its positive and negative predictive values (48% and 72%, respectively) limit its clinical utility as a stand-alone marker. In the subgroup analysis focusing on only classical variant of PTC cases (CVPTC), undergoing prophylactic lymph node dissection, multivariable logistic regression analysis found only miR-146b-5p and miR-222 to be independent predictors of CLNM, while BRAFV600E was not significantly associated with CLNM. Conclusion: In the patients undergoing prophylactic CLNDs, miR-146b-3p, miR-146b-5p, and miR
Activating HER2 mutations in HER2 gene amplification negative breast cancer.
Bose, Ron; Kavuri, Shyam M; Searleman, Adam C; Shen, Wei; Shen, Dong; Koboldt, Daniel C; Monsey, John; Goel, Nicholas; Aronson, Adam B; Li, Shunqiang; Ma, Cynthia X; Ding, Li; Mardis, Elaine R; Ellis, Matthew J
2013-02-01
Data from 8 breast cancer genome-sequencing projects identified 25 patients with HER2 somatic mutations in cancers lacking HER2 gene amplification. To determine the phenotype of these mutations, we functionally characterized 13 HER2 mutations using in vitro kinase assays, protein structure analysis, cell culture, and xenograft experiments. Seven of these mutations are activating mutations, including G309A, D769H, D769Y, V777L, P780ins, V842I, and R896C. HER2 in-frame deletion 755-759, which is homologous to EGF receptor (EGFR) exon 19 in-frame deletions, had a neomorphic phenotype with increased phosphorylation of EGFR or HER3. L755S produced lapatinib resistance, but was not an activating mutation in our experimental systems. All of these mutations were sensitive to the irreversible kinase inhibitor, neratinib. These findings show that HER2 somatic mutation is an alternative mechanism to activate HER2 in breast cancer and they validate HER2 somatic mutations as drug targets for breast cancer treatment. We show that the majority of HER2 somatic mutations in breast cancer patients are activating mutations that likely drive tumorigenesis. Several patients had mutations that are resistant to the reversible HER2 inhibitor lapatinib, but are sensitive to the irreversible HER2 inhibitor, neratinib. Our results suggest that patients with HER2 mutation–positive breast cancers could benefit from existing HER2-targeted drugs.
2017-10-01
goal of this application is to identify targets for the treatment of androgen receptor null castration-resistant prostate cancer in in vitro and pre...AWARD NUMBER: W81XWH-16-1-0584 TITLE : A Single Missense Mutation in 77% of Prostate Cancer Bone Metastases: Novel Opportunity for Genetic...Missense Mutation in 77% of Prostate Cancer Bone Metastases: 5a. CONTRACT NUMBER A Single Missense Mutation in 77% of Prostate Cancer Bone Metastases
Singh, Mamta; Ashwell, Margaret; Sanderson, Peter; Cade, Janet; Moreton, Jennifer; Fairweather-Tait, Susan; Roe, Mark; Marx, Joannes J M; Worwood, Mark; Cook, James D
2006-10-01
The UK Food Standards Agency convened a group of expert scientists to review current research investigating diet and carriers of genetic mutations associated with hereditary haemochromatosis. The workshop concluded that individuals who are heterozygous for the C282Y mutation of the HFE gene do not appear to respond abnormally to dietary Fe and therefore do not need to change their diet to prevent accumulation of body Fe.
Directory of Open Access Journals (Sweden)
Ana Osorio
2014-04-01
Full Text Available Single Nucleotide Polymorphisms (SNPs in genes involved in the DNA Base Excision Repair (BER pathway could be associated with cancer risk in carriers of mutations in the high-penetrance susceptibility genes BRCA1 and BRCA2, given the relation of synthetic lethality that exists between one of the components of the BER pathway, PARP1 (poly ADP ribose polymerase, and both BRCA1 and BRCA2. In the present study, we have performed a comprehensive analysis of 18 genes involved in BER using a tagging SNP approach in a large series of BRCA1 and BRCA2 mutation carriers. 144 SNPs were analyzed in a two stage study involving 23,463 carriers from the CIMBA consortium (the Consortium of Investigators of Modifiers of BRCA1 and BRCA2. Eleven SNPs showed evidence of association with breast and/or ovarian cancer at p<0.05 in the combined analysis. Four of the five genes for which strongest evidence of association was observed were DNA glycosylases. The strongest evidence was for rs1466785 in the NEIL2 (endonuclease VIII-like 2 gene (HR: 1.09, 95% CI (1.03-1.16, p = 2.7 × 10(-3 for association with breast cancer risk in BRCA2 mutation carriers, and rs2304277 in the OGG1 (8-guanine DNA glycosylase gene, with ovarian cancer risk in BRCA1 mutation carriers (HR: 1.12 95%CI: 1.03-1.21, p = 4.8 × 10(-3. DNA glycosylases involved in the first steps of the BER pathway may be associated with cancer risk in BRCA1/2 mutation carriers and should be more comprehensively studied.
Determining the Location of DNA Modification and Mutation Caused by UVB Light in Skin Cancer
2015-09-01
Award Number: W81XWH-12-1-0333 TITLE: Determining the Location of DNA Modification and Mutation Caused by UVB Light in Skin Cancer PRINCIPAL...COVERED 15 Aug 2012 – 14 Aug 2015 4. TITLE AND SUBTITLE 5a. CONTRACT NUMBER W81XWH-12-1-0333 Determining the Location of DNA Modification and Mutation ...sequencing libraries generated for both yeast and human cells show pyrimidine bias on the 5’ end, indicating that we are sequencing the dimers
R&W Club Frederick Sews for Kids | Poster
By Carolynne Keenan, Contributing Writer Sewing enthusiasts of all skill levels are invited to attend a sewing party hosted by the R&W Club Frederick on Feb. 18. Stop by the Building 549 Café Room between 10 a.m. and 4 p.m. to sew for a cause: help the club make pillowcases for ConKerr Cancer, a nonprofit organization that supports children in hospitals across the country.
Ogino, Shuji; Kawasaki, Takako; Kirkner, Gregory J; Loda, Massimo; Fuchs, Charles S
2006-11-01
The CpG island methylator phenotype (CIMP or CIMP-high) with extensive promoter methylation seems to be a distinct epigenotype of colorectal cancer. However, no study has comprehensively examined features of colorectal cancer with less extensive promoter methylation (designated as "CIMP-low"). Using real-time polymerase chain reaction (MethyLight), we quantified DNA methylation in five CIMP-specific gene promoters [CACNA1G, CDKN2A (p16), CRABP1, MLH1, and NEUROG1] in 840 relatively unbiased, population-based colorectal cancer samples, obtained from two large prospective cohort studies. CIMP-low (defined as 1/5 to 3/5 methylated promoters) colorectal cancers were significantly more common among men (38 versus 30% in women, P = 0.01) and among KRAS-mutated tumors (44 versus 30% in KRAS/BRAF wild-type tumors, P = 0.0003; 19% in BRAF-mutated tumors, P CIMP-low tumors (47%) than in CIMP-high tumors (with > or =4/5 methylated promoters, 12%, P CIMP-0 tumors (with 0/5 methylated promoters, 37%, P = 0.007). The associations of CIMP-low tumors with male sex and KRAS mutations still existed after tumors were stratified by microsatellite instability status. In conclusion, CIMP-low colorectal cancer is associated with male sex and KRAS mutations. The hypothesis that CIMP-low tumors are different from CIMP-high and CIMP-0 tumors needs to be tested further.
Directory of Open Access Journals (Sweden)
Naoto Tanaka
Full Text Available Cyclic nucleotide-gated (CNG ion channels are key mediators underlying signal transduction in retinal and olfactory receptors. Genetic defects in CNGA3 and CNGB3, encoding two structurally related subunits of cone CNG channels, lead to achromatopsia (ACHM. ACHM is a congenital, autosomal recessive retinal disorder that manifests by cone photoreceptor dysfunction, severely reduced visual acuity, impaired or complete color blindness and photophobia. Here, we report the first canine models for CNGA3-associated channelopathy caused by R424W or V644del mutations in the canine CNGA3 ortholog that accurately mimic the clinical and molecular features of human CNGA3-associated ACHM. These two spontaneous mutations exposed CNGA3 residues essential for the preservation of channel function and biogenesis. The CNGA3-R424W results in complete loss of cone function in vivo and channel activity confirmed by in vitro electrophysiology. Structural modeling and molecular dynamics (MD simulations revealed R424-E306 salt bridge formation and its disruption with the R424W mutant. Reversal of charges in a CNGA3-R424E-E306R double mutant channel rescued cGMP-activated currents uncovering new insights into channel gating. The CNGA3-V644del affects the C-terminal leucine zipper (CLZ domain destabilizing intersubunit interactions of the coiled-coil complex in the MD simulations; the in vitro experiments showed incompetent trimeric CNGA3 subunit assembly consistent with abnormal biogenesis of in vivo channels. These newly characterized large animal models not only provide a valuable system for studying cone-specific CNG channel function in health and disease, but also represent prime candidates for proof-of-concept studies of CNGA3 gene replacement therapy for ACHM patients.
The association between miR-499 polymorphism and cancer susceptibility: a meta-analysis.
Xu, Zhongfei; Zhang, Enjiao; Duan, Weiyi; Sun, Changfu; Bai, Shuang; Tan, Xuexin
2015-01-01
MicroRNAs are a class of new noncoding RNA that play important roles in the pathogenesis of tumor. Rs3746444 in miR-499 is suggested to be associated with cancer susceptibility. In the present study, we assess the association between miR-499 rs3746444 polymorphism and cancer susceptibility through a meta-analysis. We searched relevant articles from the PubMed and Embase databases. We screened all the resulting articles for adherence to the inclusion and exclusion criteria. The associations between miR-499 polymorphism and cancer susceptibility were estimated by computing the odds ratios (ORs) and 95% confidence intervals (CIs). All analyses were performed using Stata software. There are 18 datasets included in the analysis. Statistically significant associations were found between the miR-499 rs3746444 polymorphism and susceptibility to cancer (GG versus AA: OR =1.24, 95% CI: 1.01-1.52; G versus A: OR =1.11, 95% CI: 1.01-1.23). A subsequent analysis, on the basis of ethnicity for the population characteristic, showed that Asians had increased susceptibility to cancer (GG versus AA: OR =1.32, 95% CI: 1.09-1.59; GG + AG versus AA: OR = 1.17, 95% CI: 1.01-1.37). In the subgroup analysis of tumor type, none of the genetic models had statistically significant results. The meta-regression suggested that race and cancer types are not the source of heterogeneity in the present meta-analysis. No publication bias was detected by either the inverted funnel plot or Egger's test. Rs3746444 in miR-499 might be related to susceptibility to cancer.
DEFF Research Database (Denmark)
Antoniou, Antonis C; Spurdle, Amanda B; Sinilnikova, Olga M
2008-01-01
Germline mutations in BRCA1 and BRCA2 confer high risks of breast cancer. However, evidence suggests that these risks are modified by other genetic or environmental factors that cluster in families. A recent genome-wide association study has shown that common alleles at single nucleotide polymorp...
Aguilar-Martinez, Patricia; Grandchamp, Bernard; Cunat, Séverine; Cadet, Estelle; Blanc, François; Nourrit, Marlène; Lassoued, Kaiss; Schved, Jean-François; Rochette, Jacques
2011-04-01
Heterozygotes for the p.Cys282Tyr (C282Y) mutation of the HFE gene do not usually express a hemochromatosis phenotype. Apart from the compound heterozygous state for C282Y and the widespread p.His63Asp (H63D) variant allele, other rare HFE mutations can be found in trans on chromosome 6. We performed molecular investigation of the genes implicated in hereditary hemochromatosis in six patients who presented with iron overload but were simple heterozygotes for the HFE C282Y mutation at first genetic testing. Functional impairment of new variants was deduced from computational methods including molecular modeling studies. We identified four rare HFE mutant alleles, three of which have not been previously described. One mutation is a 13-nucleotide deletion in exon 6 (c.1022_1034del13, p.His341_Ala345 > LeufsX119), which is predicted to lead to an elongated and unstable protein. The second one is a substitution of the last nucleotide of exon 2 (c.340G > A, p.Glu114Lys) which modifies the relative solvent accessibility in a loop interface. The third mutation, p.Arg67Cys, also lies in exon 2 and introduces a destabilization of the secondary structure within a loop of the α1 domain. We also found the previously reported c.548T > C (p.Leu183Pro) missense mutation in exon 3. No other known iron genes were mutated. We present an algorithm at the clinical and genetic levels for identifying patients deserving further investigation. Conclusions Our results suggest that additional mutations in HFE may have a clinical impact in C282Y carriers. In conjunction with results from previously described cases we conclude that an elevated transferrin saturation level and elevated hepatic iron index should indicate the utility of searching for further HFE mutations in C282Y heterozygotes prior to other iron gene studies.
Energy Technology Data Exchange (ETDEWEB)
Chen, Steven C., E-mail: bug@uw.edu [Fred Hutchinson Cancer Research Center (FHCRC), Public Health Sciences Division, 1100 Fairview Ave. N., Seattle, WA 98109 (United States); University of Washington Department of Biochemistry, 1959 NE Pacific St., Seattle, WA 98195 (United States); Kennedy, Brian K., E-mail: bkennedy@buckinstitute.org [University of Washington Department of Biochemistry, 1959 NE Pacific St., Seattle, WA 98195 (United States); Buck Institute for Research on Aging, 8001 Redwood Boulevard, Novato, CA 94945 (United States); Lampe, Paul D., E-mail: plampe@fhcrc.org [Fred Hutchinson Cancer Research Center (FHCRC), Public Health Sciences Division, 1100 Fairview Ave. N., Seattle, WA 98109 (United States)
2013-04-01
An understanding of the molecular mechanism behind the arrhythmic phenotype associated with laminopathies has yet to emerge. A-type lamins have been shown to interact and sequester activated phospho-ERK1/2(pERK1/2) at the nucleus. The gap junction protein connexin43 (Cx43) can be phosphorylated by pERK1/2 on S279/282 (pS279/282), inhibiting intercellular communication. We hypothesized that without A-type lamins, pS279/282 Cx43 will increase due to inappropriate phosphorylation by pERK1/2, resulting in decreased gap junction function. We observed a 1.6-fold increase in pS279/282 Cx43 levels in Lmna{sup −/−} mouse embryonic fibroblasts (MEFs) compared to Lmna{sup +/+}, and 1.8-fold more pERK1/2 co-precipitated from Lmna{sup −/−} MEFs with Cx43 antibodies. We found a 3-fold increase in the fraction of non-nuclear pERK1/2 and a concomitant 2-fold increase in the fraction of pS279/282 Cx43 in Lmna{sup −/−} MEFs by immunofluorescence. In an assay of gap junctional function, Lmna{sup −/−} MEFs transferred dye to 60% fewer partners compared to Lmna{sup +/+} controls. These results are mirrored in 5–6 week-old Lmna{sup −/−} mice compared to their Lmna{sup +/+} littermates as we detect increased pS279/282 Cx43 in gap junctions by immunofluorescence and 1.7-fold increased levels by immunoblot. We conclude that increased pS279/282 Cx43 in the Lmna{sup −/−} background results in decreased cell communication and may contribute to the arrhythmic pathology in vivo. - Highlights: ► Connexin43 phosphorylation plays a role in laminopathy-associated conduction defects. ► Loss of A-type lamin activity results in release of pERK1/2 from the nucleus. ► Increased cytoplasmic localization of pERK1/2 acts to phosphorylate S279/282 of Cx43. ► Phosphorylation of S279/282 on Cx43 decreases gap junction activity in cell culture. ► Mice lacking A-type lamins have increased phosphorylation on S279/282 of Cx43.
Mutations in TP53 tumor suppressor gene in wood dust-related sinonasal cancer
DEFF Research Database (Denmark)
Holmila, Reetta; Bornholdt, Jette; Heikkilä, Pirjo
2010-01-01
The causal role of work-related exposure to wood dust in the development of sinonasal cancer has long been established by numerous epidemiologic studies. To study molecular changes in these tumors, we analyzed TP53 gene mutations in 358 sinonasal cancer cases with or without occupational exposure...... affected the ORs only slightly. Smoking did not influence the occurrence of TP53 mutation; however, it was associated with multiple mutations (p = 0.03). As far as we are aware, this is the first study to demonstrate a high prevalence of TP53 mutation-positive cases in a large collection of sinonasal...... cancers with data on occupational exposure. Our results indicate that mutational mechanisms, in particular TP53 mutations, are associated with work-related exposure to wood dust in sinonasal cancer....
Directory of Open Access Journals (Sweden)
Ying Liu
2015-10-01
Full Text Available Predisposition to breast and extrauterine Müllerian carcinomas in BRCA1 mutation carriers is due to a combination of cell-autonomous consequences of BRCA1 inactivation on cell cycle homeostasis superimposed on cell-nonautonomous hormonal factors magnified by the effects of BRCA1 mutations on hormonal changes associated with the menstrual cycle. We used the Müllerian inhibiting substance type 2 receptor (Mis2r promoter and a truncated form of the Follicle stimulating hormone receptor (Fshr promoter to introduce conditional knockouts of Brca1 and p53 not only in mouse mammary and Müllerian epithelia, but also in organs that control the estrous cycle. Sixty percent of the double mutant mice developed invasive Müllerian and mammary carcinomas. Mice carrying heterozygous mutations in Brca1 and p53 also developed invasive tumors, albeit at a lesser (30% rate, in which the wild type alleles were no longer present due to loss of heterozygosity. While mice carrying heterozygous mutations in both genes developed mammary tumors, none of the mice carrying only a heterozygous p53 mutation developed such tumors (P < 0.0001, attesting to a role for Brca1 mutations in tumor development. This mouse model is attractive to investigate cell-nonautonomous mechanisms associated with cancer predisposition in BRCA1 mutation carriers and to investigate the merit of chemo-preventive drugs targeting such mechanisms.
IDH2 Mutations Define a Unique Subtype of Breast Cancer with Altered Nuclear Polarity
Chiang, Sarah; Weigelt, Britta; Wen, Huei-Chi; Pareja, Fresia; Raghavendra, Ashwini; Martelotto, Luciano G.; Burke, Kathleen A.; Basili, Thais; Li, Anqi; Geyer, Felipe C.; Piscuoglio, Salvatore; Ng, Charlotte K.Y.; Jungbluth, Achim A.; Balss, Jörg; Pusch, Stefan; Baker, Gabrielle M.; Cole, Kimberly S.; von Deimling, Andreas; Batten, Julie M.; Marotti, Jonathan D.; Soh, Hwei-Choo; McCalip, Benjamin L.; Serrano, Jonathan; Lim, Raymond S.; Siziopikou, Kalliopi P.; Lu, Song; Liu, Xiaolong; Hammour, Tarek; Brogi, Edi; Snuderl, Matija; Iafrate, A. John; Reis-Filho, Jorge S.; Schnitt, Stuart J.
2017-01-01
Solid papillary carcinoma with reverse polarity (SPCRP) is a rare breast cancer subtype with an obscure etiology. In this study, we sought to describe its unique histopathologic features and to identify the genetic alterations that underpin SPCRP using massively parallel whole-exome and targeted sequencing. The morphologic and immunohistochemical features of SPCRP support the invasive nature of this subtype. Ten of 13 (77%) SPCRPs harbored hotspot mutations at R172 of the isocitrate dehydrogenase IDH2, of which 8 of 10 displayed concurrent pathogenic mutations affecting PIK3CA or PIK3R1. One of the IDH2 wild-type SPCRPs harbored a TET2 Q548* truncating mutation coupled with a PIK3CA H1047R mutation. Functional studies demonstrated that IDH2 and PIK3CA hotspot mutations are likely drivers of SPCRP, resulting in its reversed nuclear polarization phenotype. Our results offer a molecular definition of SPCRP as a distinct breast cancer subtype. Concurrent IDH2 and PIK3CA mutations may help diagnose SPCRP and possibly direct effective treatment. PMID:27913435
Anagnostopoulos, Theodore; Pertesi, Maroulio; Konstantopoulou, Irene; Armaou, Sofia; Kamakari, Smaragda; Nasioulas, George; Athanasiou, Athanassios; Dobrovic, Alex; Young, Mary-Anne; Goldgar, David; Fountzilas, George; Yannoukakos, Drakoulis
2008-07-01
We have performed screening in 287 breast/ovarian cancer families in Greece which has revealed that approximately 12% (8/65) of all index patients-carriers of a deleterious mutation in BRCA1 and BRCA2 genes, contain the base substitution G to A at position 5331 of BRCA1 gene. This generates the amino acid change G1738R for which based on a combination of genetic, in silico and histopathological analysis there are strong suggestions that it is a causative mutation. In this paper, we present further evidence suggesting the pathogenicity of this variant. Forty breast/ovarian cancer patients were reported in 11 Greek families: the above eight living in Greece, two living in Australia and one in USA, all containing G1738R. Twenty of these patients were screened and were all found to be carriers of the same base substitution. In addition, we have detected the same base change in five breast/ovarian cancer patients after screening 475 unselected patient samples with no apparent family history. The mean age of onset for all the above patients was 39.4 and 53.6 years for breast and ovarian cancer cases, respectively. A multi-factorial likelihood model for classification of unclassified variants in BRCA1 and BRCA2 developed previously was applied on G1738R and the odds of it being a deleterious mutation was estimated to be 11470:1. In order to explain the prevalence of this mutation mainly in the Greek population, its genealogical history was examined. DNA samples were collected from 11 carrier families living in Greece, Australia and USA. Screening of eight intragenic SNPs, three intragenic and seven extragenic microsatellite markers and comparison with control individuals, suggested a common origin for the mutation while the time to its most recent common ancestor was estimated to be 11 generations (about 275 years assuming a generational interval of 25 years) with a 1-lod support interval of 4-24 generations (100-600 years). Considering the large degree of genetic
Deihimi, Safoora; Lev, Avital; Slifker, Michael; Shagisultanova, Elena; Xu, Qifang; Jung, Kyungsuk; Vijayvergia, Namrata; Ross, Eric A; Xiu, Joanne; Swensen, Jeffrey; Gatalica, Zoran; Andrake, Mark; Dunbrack, Roland L; El-Deiry, Wafik S
2017-06-20
Deficient mismatch repair (MMR) and microsatellite instability (MSI) contribute to ~15% of colorectal cancer (CRCs). We hypothesized MSI leads to mutations in DNA repair proteins including BRCA2 and cancer drivers including EGFR. We analyzed mutations among a discovery cohort of 26 MSI-High (MSI-H) and 558 non-MSI-H CRCs profiled at Caris Life Sciences. Caris-profiled MSI-H CRCs had high mutation rates (50% vs 14% in non-MSI-H, P MLH1-mutant CRCs showed higher mutation rates in BRCA2 compared to non-MSH2/MLH1-mutant tumors (38% vs 6%, P MLH1-mutant CRCs included 75 unique mutations not known to occur in breast or pancreatic cancer per COSMIC v73. Only 5 deleterious BRCA2 mutations in CRC were previously reported in the BIC database as germ-line mutations in breast cancer. Some BRCA2 mutations were predicted to disrupt interactions with partner proteins DSS1 and RAD51. Some CRCs harbored multiple BRCA2 mutations. EGFR was mutated in 45.5% of MSH2/MLH1-mutant and 6.5% of non-MSH2/MLH1-mutant tumors (P MLH1-mutant CRC including NTRK1 I699V, NTRK2 P716S, and NTRK3 R745L. Our findings have clinical relevance regarding therapeutic targeting of BRCA2 vulnerabilities, EGFR mutations or other identified oncogenic drivers such as NTRK in MSH2/MLH1-mutant CRCs or other tumors with mismatch repair deficiency.
Directory of Open Access Journals (Sweden)
Debabani Ganguly
2015-04-01
Full Text Available Intrinsically disordered proteins (IDPs are frequently associated with human diseases such as cancers, and about one-fourth of disease-associated missense mutations have been mapped into predicted disordered regions. Understanding how these mutations affect the structure-function relationship of IDPs is a formidable task that requires detailed characterization of the disordered conformational ensembles. Implicit solvent coupled with enhanced sampling has been proposed to provide a balance between accuracy and efficiency necessary for systematic and comparative assessments of the effects of mutations as well as post-translational modifications on IDP structure and interaction. Here, we utilize a recently developed replica exchange with guided annealing enhanced sampling technique to calculate well-converged atomistic conformational ensembles of the intrinsically disordered transactivation domain (TAD of tumor suppressor p53 and several cancer-associated mutants in implicit solvent. The simulations are critically assessed by quantitative comparisons with several types of experimental data that provide structural information on both secondary and tertiary levels. The results show that the calculated ensembles reproduce local structural features of wild-type p53-TAD and the effects of K24N mutation quantitatively. On the tertiary level, the simulated ensembles are overly compact, even though they appear to recapitulate the overall features of transient long-range contacts qualitatively. A key finding is that, while p53-TAD and its cancer mutants sample a similar set of conformational states, cancer mutants could introduce both local and long-range structural modulations to potentially perturb the balance of p53 binding to various regulatory proteins and further alter how this balance is regulated by multisite phosphorylation of p53-TAD. The current study clearly demonstrates the promise of atomistic simulations for detailed characterization of IDP
EG-08IDH MUTATIONS IN GLIOMAS ASSOCIATED WITH ENCHONDROMATOSIS
Nicholas, M. Kelly; Joseph, Loren; Venneti, Sriram; Daher, Ahmad; Pytel, Peter
2014-01-01
The enchondromatoses, Ollier's disease and Maffucci syndrome, are non-heritable developmental disorders characterized by multiple enchondromas (Olllier's) in association with hemangiomas (Maffucci). Glial neoplasms are reported in both disorders but a pathogenic mechanism underlying this association has not been identified. We report a case of anaplastic astrocytoma in a 23 year old man with Maffucci syndrome whose tumor carried a substitution mutation of arginine for cysteine at position 132 (R132C) of the isocitrate dehydrogenase 1 (IDH1) protein. This mutation, commonly found in Maffucci-associated enchondromas and hemangiomas, was not detected on routine immunohistochemical (IHC) analysis of the astrocytoma using the R132H mutation-specific antibody, commonly applied in clinical laboratories. The R132C mutation was detected by polymerase chain reaction (PCR) and subsequently confirmed using a SNaPshot assay. Because somatic mosaic IDH mutations are associated with enchondromas and hemangiomas in Maffucci syndrome, we looked for the R132C mutation in a hemangioma, peripheral blood mononuclear cells (PBMNC) and histologically normal brain surrounding the tumor from this patient. The mutation was present in the hemangioma, absent in PBMNC, and present in 2% of alleles in ‘normal’ brain. The low level in surrounding brain tissue is consistent with tumor cell infiltration, not mosaicism, as a S173T p53 mutation in the tumor showed similar results. Using IHC, we further demonstrated that the mutant IDH1 protein in this glioma functions as an oncometabolite. Two repressive histone trimethylation marks were strongly positive in the tumor, supporting a role for 2-hydroxyglutarate in the inhibition of histone demethylation. Together, these data demonstrate that an IDH1 mutation common in enchodromatoses underlies the association of glial tumors reported in both Ollier's disease and Maffucci syndrome.
Effect of BRCA germline mutations on breast cancer prognosis
Baretta, Zora; Mocellin, Simone; Goldin, Elena; Olopade, Olufunmilayo I.; Huo, Dezheng
2016-01-01
Abstract Background: The contribution of BRCA germline mutational status to breast cancer patients’ prognosis is unclear. We aimed to systematically review and perform meta-analysis of the available evidence of effects of BRCA germline mutations on multiple survival outcomes of breast cancer patients as a whole and in specific subgroups of interest, including those with triple negative breast cancer, those with Ashkenazi Jewish ancestry, and patients with stage I–III disease. Methods: Sixty studies met all inclusion criteria and were considered for this meta-analysis. These studies involved 105,220 breast cancer patients, whose 3588 (3.4%) were BRCA mutations carriers. The associations between BRCA genes mutational status and overall survival (OS), breast cancer-specific survival (BCSS), recurrence-free survival (RFS), and distant metastasis-free survival (DMFS) were evaluated using random-effect models. Results: BRCA1 mutation carriers have worse OS than BRCA-negative/sporadic cases (hazard ratio, HR 1.30, 95% CI: 1.11–1.52) and worse BCSS than sporadic/BRCA-negative cases among patients with stage I–III breast cancer (HR 1.45, 95% CI: 1.01–2.07). BRCA2 mutation carriers have worse BCSS than sporadic/BRCA-negative cases (HR 1.29, 95% CI: 1.03–1.62), although they have similar OS. Among triple negative breast cancer, BRCA1/2 mutations carriers had better OS than BRCA-negative counterpart (HR 0.49, 95% CI: 0.26–0.92). Among Ashkenazi Jewish women, BRCA1/2 mutations carriers presented higher risk of death from breast cancer (HR 1.44, 95% CI: 1.05–1.97) and of distant metastases (HR 1.82, 95% CI: 1.05–3.16) than sporadic/BRCA-negative patients. Conclusion: Our results support the evaluation of BRCA mutational status in patients with high risk of harboring BRCA germline mutations to better define the prognosis of breast cancer in these patients. PMID:27749552
TOX3 mutations in breast cancer.
Directory of Open Access Journals (Sweden)
James Owain Jones
Full Text Available TOX3 maps to 16q12, a region commonly lost in breast cancers and recently implicated in the risk of developing breast cancer. However, not much is known of the role of TOX3 itself in breast cancer biology. This is the first study to determine the importance of TOX3 mutations in breast cancers. We screened TOX3 for mutations in 133 breast tumours and identified four mutations (three missense, one in-frame deletion of 30 base pairs in six primary tumours, corresponding to an overall mutation frequency of 4.5%. One potentially deleterious missense mutation in exon 3 (Leu129Phe was identified in one tumour (genomic DNA and cDNA. Whilst copy number changes of 16q12 are common in breast cancer, our data show that mutations of TOX3 are present at low frequency in tumours. Our results support that TOX3 should be further investigated to elucidate its role in breast cancer biology.
Lynch syndrome caused by germline PMS2 mutations: delineating the cancer risk.
ten Broeke, Sanne W; Brohet, Richard M; Tops, Carli M; van der Klift, Heleen M; Velthuizen, Mary E; Bernstein, Inge; Capellá Munar, Gabriel; Gomez Garcia, Encarna; Hoogerbrugge, Nicoline; Letteboer, Tom G W; Menko, Fred H; Lindblom, Annika; Mensenkamp, Arjen R; Moller, Pal; van Os, Theo A; Rahner, Nils; Redeker, Bert J W; Sijmons, Rolf H; Spruijt, Liesbeth; Suerink, Manon; Vos, Yvonne J; Wagner, Anja; Hes, Frederik J; Vasen, Hans F; Nielsen, Maartje; Wijnen, Juul T
2015-02-01
The clinical consequences of PMS2 germline mutations are poorly understood compared with other Lynch-associated mismatch repair gene (MMR) mutations. The aim of this European cohort study was to define the cancer risk faced by PMS2 mutation carriers. Data were collected from 98 PMS2 families ascertained from family cancer clinics that included a total of 2,548 family members and 377 proven mutation carriers. To adjust for potential ascertainment bias, a modified segregation analysis model was used to calculate colorectal cancer (CRC) and endometrial cancer (EC) risks. Standardized incidence ratios (SIRs) were calculated to estimate risks for other Lynch syndrome-associated cancers. The cumulative risk (CR) of CRC for male mutation carriers by age 70 years was 19%. The CR among female carriers was 11% for CRC and 12% for EC. The mean age of CRC development was 52 years, and there was a significant difference in mean age of CRC between the probands (mean, 47 years; range, 26 to 68 years) and other family members with a PMS2 mutation (mean, 58 years; range, 31 to 86 years; P PMS2 mutation, and it should be noted that we observed a substantial variation in cancer phenotype within and between families, suggesting the influence of genetic modifiers and lifestyle factors on cancer risks. © 2014 by American Society of Clinical Oncology.
Regulating Cancer-Associated Fibroblast Biology in Prostate Cancer
2017-10-01
AWARD NUMBER: W81XWH-15-1-0512 TITLE: Regulating Cancer-Associated Fibroblast Biology in Prostate Cancer PRINCIPAL INVESTIGATOR: Andrew...SUBTITLE 5a. CONTRACT NUMBER Regulating Cancer-Associated Fibroblast Biology in Prostate Cancer 5b. GRANT NUMBER W81XWH-15-1-0512 5c. PROGRAM...blocked by the addition of Pim inhibitors. These results suggest that the Pim protein kinase can regulate stromal cell biology to modulate epithelial
Allen, Katrina J; Bertalli, Nadine A; Osborne, Nicholas J; Constantine, Clare C; Delatycki, Martin B; Nisselle, Amy E; Nicoll, Amanda J; Gertig, Dorota M; McLaren, Christine E; Giles, Graham G; Hopper, John L; Anderson, Gregory J; Olynyk, John K; Powell, Lawrie W; Gurrin, Lyle C
2010-09-01
Hemochromatosis gene (HFE)-associated hereditary hemochromatosis (HH) is a genetic predisposition to iron overload and subsequent signs and symptoms of disease that potentially affects approximately 80,000 persons in Australia and almost 1 million persons in the United States. Most clinical cases are homozygous for the Cys282Tyr (C282Y) mutation in the HFE gene, with serum ferritin (SF) concentration >1000 microg/L as the strongest predictor of cirrhosis. The optimal treatment regimen for those with SF concentrations above the normal range but aged 40-69 years. An HFE-stratified random sample of 1438 participants including all C282Y homozygotes with iron studies 12 years apart were examined by physicians blinded to participants' HFE genotype. All previously undiagnosed C282Y homozygotes (35 male, 67 female) and all HFE wild-types (131 male, 160 female) with baseline and follow-up SF concentrations age when disease would be expected to have developed. These observations have implications for the management of C282Y homozygotes.
Telomerase reverse transcriptase promoter mutations in bladder cancer
DEFF Research Database (Denmark)
Allory, Yves; Beukers, Willemien; Sagrera, Ana
2014-01-01
for detection of recurrences in urine in patients with urothelial bladder cancer (UBC). DESIGN, SETTING, AND PARTICIPANTS: A set of 111 UBCs of different stages was used to assess TERT promoter mutations by Sanger sequencing and TERT messenger RNA (mRNA) expression by reverse transcription...... surveillance after diagnosis of non-muscle-invasive UBC (n=194), was tested using a SNaPshot assay. OUTCOME MEASUREMENTS AND STATISTICAL ANALYSIS: Association of mutation status with age, sex, tobacco, stage, grade, fibroblast growth factor receptor 3 (FGFR3) mutation, progression-free survival, disease...... frequent among FGFR3 mutant tumors (p=0.0002). There was no association between TERT mutations and mRNA expression (p=0.3). Mutations were not associated with clinical outcome. In urine, TERT mutations had 90% specificity in subjects with hematuria but no bladder tumor, and 73% in recurrence-free UBC...
X-linked primary immunodeficiency associated with hemizygous mutations in the moesin (MSN) gene.
Lagresle-Peyrou, Chantal; Luce, Sonia; Ouchani, Farid; Soheili, Tayebeh Shabi; Sadek, Hanem; Chouteau, Myriam; Durand, Amandine; Pic, Isabelle; Majewski, Jacek; Brouzes, Chantal; Lambert, Nathalie; Bohineust, Armelle; Verhoeyen, Els; Cosset, François-Loïc; Magerus-Chatinet, Aude; Rieux-Laucat, Frédéric; Gandemer, Virginie; Monnier, Delphine; Heijmans, Catherine; van Gijn, Marielle; Dalm, Virgil A; Mahlaoui, Nizar; Stephan, Jean-Louis; Picard, Capucine; Durandy, Anne; Kracker, Sven; Hivroz, Claire; Jabado, Nada; de Saint Basile, Geneviève; Fischer, Alain; Cavazzana, Marina; André-Schmutz, Isabelle
2016-12-01
We investigated 7 male patients (from 5 different families) presenting with profound lymphopenia, hypogammaglobulinemia, fluctuating monocytopenia and neutropenia, a poor immune response to vaccine antigens, and increased susceptibility to bacterial and varicella zoster virus infections. We sought to characterize the genetic defect involved in a new form of X-linked immunodeficiency. We performed genetic analyses and an exhaustive phenotypic and functional characterization of the lymphocyte compartment. We observed hemizygous mutations in the moesin (MSN) gene (located on the X chromosome and coding for MSN) in all 7 patients. Six of the latter had the same missense mutation, which led to an amino acid substitution (R171W) in the MSN four-point-one, ezrin, radixin, moesin domain. The seventh patient had a nonsense mutation leading to a premature stop codon mutation (R533X). The naive T-cell counts were particularly low for age, and most CD8 + T cells expressed the senescence marker CD57. This phenotype was associated with impaired T-cell proliferation, which was rescued by expression of wild-type MSN. MSN-deficient T cells also displayed poor chemokine receptor expression, increased adhesion molecule expression, and altered migration and adhesion capacities. Our observations establish a causal link between an ezrin-radixin-moesin protein mutation and a primary immunodeficiency that could be referred to as X-linked moesin-associated immunodeficiency. Copyright © 2016 American Academy of Allergy, Asthma & Immunology. Published by Elsevier Inc. All rights reserved.
Qu, Jian; Wang, Ya-Nan; Xu, Ping; Xiang, Da-Xiong; Yang, Rui; Wei, Wei; Qu, Qiang
2017-05-16
Icotinib is a novel and the third listed epidermal growth factor receptor-tyrosine kinase inhibitors (EGFR-TKIs), which exerts a good anti-tumor efficacy on non-small cell lung cancer (NSCLC). The efficacy of EGFR-TKIs has been shown to be associated with the EGFR mutation status, especially exon 19 deletion (19Del) and exon 21 L858R mutation. Therefore, a meta-analysis was performed to assess the efficacy of icotinib in NSCLC patients harboring EGFR mutations (19Del or L858R) and wild type (19Del and L858R loci wild type). A total of 24 studies were included for comparing the objective response rate (ORR) in the EGFR wild type and mutant patients treated with icotinib. The ORRs of EGFR mutant patients (19Del or L858R) are better than those of EGFR wild type patients (OR = 7.03(5.09-9.71), P icotinib treatment; EGFR 19Del patients treated with icotinib have better ORRs than EGFR L858R patients. EGFR mutation status is a useful biomarker for the evaluation of icotinib efficacy in NSCLC patients.
Novel APC gene mutations associated with protein alteration in diffuse type gastric cancer.
Ghatak, Souvik; Chakraborty, Payel; Sarkar, Sandeep Roy; Chowdhury, Biswajit; Bhaumik, Arup; Kumar, Nachimuthu Senthil
2017-06-02
The role of adenomatous polyposis coli (APC) gene in mitosis might be critical for regulation of genomic stability and chromosome segregation. APC gene mutations have been associated to have a role in colon cancer and since gastric and colon tumors share some common genetic lesions, it is relevant to investigate the role of APC tumor suppressor gene in gastric cancer. We investigated for somatic mutations in the Exons 14 and 15 of APC gene from 40 diffuse type gastric cancersamples. Rabbit polyclonal anti-APC antibody was used, which detects the wild-type APC protein and was recommended for detection of the respective protein in human tissues. Cell cycle analysis was done from tumor and adjacent normal tissue. APC immunoreactivity showed positive expression of the protein in stages I, II, III and negative expression in Stages III and IV. Two novel deleterious variations (g.127576C > A, g.127583C > T) in exon 14 sequence were found to generate stop codon (Y622* and Q625*)in the tumor samples. Due to the generation of stop codon, the APC protein might be truncated and all the regulatory features could be lost which has led to the down-regulation of protein expression. Our results indicate that aneuploidy might occurdue to the codon 622 and 625 APC-driven gastric tumorigenesis, in agreement with our cell cycle analysis. The APC gene function in mitosis and chromosomal stability might be lost and G1 might be arrested with high quantity of DNA in the S phase. Six missense somatic mutations in tumor samples were detected in exon 15 A-B, twoof which showed pathological and disease causing effects based on SIFT, Polyphen2 and SNPs & GO score and were not previously reported in the literature or the public mutation databases. The two novel pathological somatic mutations (g.127576C > A, g.127583C > T) in exon 14 might be altering the protein expression leading to development of gastric cancer in the study population. Our study showed that mutations in the APC
Citterio, Cintia E; Machiavelli, Gloria A; Miras, Mirta B; Gruñeiro-Papendieck, Laura; Lachlan, Katherine; Sobrero, Gabriela; Chiesa, Ana; Walker, Joanna; Muñoz, Liliana; Testa, Graciela; Belforte, Fiorella S; González-Sarmiento, Rogelio; Rivolta, Carina M; Targovnik, Héctor M
2013-01-30
The thyroglobulin (TG) gene is organized in 48 exons, spanning over 270 kb on human chromosome 8q24. Up to now, 62 inactivating mutations in the TG gene have been identified in patients with congenital goiter and endemic or non-endemic simple goiter. The purpose of the present study was to identify and characterize new mutations in the TG gene. We report 13 patients from seven unrelated families with goiter, hypothyroidism and low levels of serum TG. All patients underwent clinical, biochemical and imaging evaluation. Single-strand conformation polymorphism (SSCP) analysis, endonuclease restriction analysis, sequencing of DNA, genotyping, population screening, and bioinformatics studies were performed. Molecular analyses revealed seven novel inactivating TG mutations: c.378C>A [p.Y107X], c.2359C>T [p.R768X], c.2736delG [p.R893fsX946], c.3842G>A [p.C1262Y], c.5466delA [p.K1803fsX1833], c.6000C>G [p.C1981W] and c.6605C>G [p.P2183R] and three previously reported mutations: c.886C>T [p.R277X], c.6701C>A [p.A2215D] and c.7006C>T [p.R2317X]. Six patients from two families were homozygous for p.R277X mutation, four were compound heterozygous mutations (p.Y107X/p.C1262Y, p.R893fsX946/p.A2215D, p.K1803fsX1832/p.R2317X), one carried three identified mutations (p.R277X/p.C1981W-p.P2183R) together with a hypothetical micro deletion and the remaining two siblings from another family with typical phenotype had a single p.R768X mutated allele. In conclusion, our results confirm the genetic heterogeneity of TG defects and the pathophysiological importance of altered TG folding as a consequency of truncated TG proteins and missense mutations located in ACHE-like domain or that replace cysteine. Copyright © 2012 Elsevier Ireland Ltd. All rights reserved.
Mutation analysis of breast cancer gene BRCA among breast cancer Jordanian females
International Nuclear Information System (INIS)
Atoum, Manar F.; Al-Kayed, Sameer A.
2004-01-01
To screen mutations of the tumor suppressor breast cancer susceptibility gene 1 (BRCA1) within 3 exons among Jordanian breast cancer females. A total of 135 Jordanian breast cancer females were genetically analyzed by denaturing gradient electrophoresis (DGGE) for mutation detection in 3 BRCA1 exons (2, 11 and 20) between 2000-2002 in Al-Basheer Hospital, Amman, Jordan. Of the studied patients 50 had a family history of breast cancer, 28 had a family history of cancer other than breast cancer, and 57 had no family history of any cancer. Five germline mutations were detected among breast cancer females with a family history of breast cancers (one in exon 2 and 4 mutations in exon 11). Another germline mutation (within exon 11) was detected among breast cancer females with family history of cancer other than breast cancer, and no mutation was detected among breast cancer females with no family history of any cancer or among normal control females. Screening mutations within exon 2, exon 11 and exon 20 showed that most screened mutations were within BRCA1 exon 11 among breast cancer Jordanian families with a family history of breast cancer. (author)
HER2 activating mutations are targets for colorectal cancer treatment.
Kavuri, Shyam M; Jain, Naveen; Galimi, Francesco; Cottino, Francesca; Leto, Simonetta M; Migliardi, Giorgia; Searleman, Adam C; Shen, Wei; Monsey, John; Trusolino, Livio; Jacobs, Samuel A; Bertotti, Andrea; Bose, Ron
2015-08-01
The Cancer Genome Atlas project identified HER2 somatic mutations and gene amplification in 7% of patients with colorectal cancer. Introduction of the HER2 mutations S310F, L755S, V777L, V842I, and L866M into colon epithelial cells increased signaling pathways and anchorage-independent cell growth, indicating that they are activating mutations. Introduction of these HER2 activating mutations into colorectal cancer cell lines produced resistance to cetuximab and panitumumab by sustaining MAPK phosphorylation. HER2 mutants are potently inhibited by low nanomolar doses of the irreversible tyrosine kinase inhibitors neratinib and afatinib. HER2 gene sequencing of 48 cetuximab-resistant, quadruple (KRAS, NRAS, BRAF, and PIK3CA) wild-type (WT) colorectal cancer patient-derived xenografts (PDX) identified 4 PDXs with HER2 mutations. HER2-targeted therapies were tested on two PDXs. Treatment with a single HER2-targeted drug (trastuzumab, neratinib, or lapatinib) delayed tumor growth, but dual HER2-targeted therapy with trastuzumab plus tyrosine kinase inhibitors produced regression of these HER2-mutated PDXs. HER2 activating mutations cause EGFR antibody resistance in colorectal cell lines, and PDXs with HER2 mutations show durable tumor regression when treated with dual HER2-targeted therapy. These data provide a strong preclinical rationale for clinical trials targeting HER2 activating mutations in metastatic colorectal cancer. ©2015 American Association for Cancer Research.
Directory of Open Access Journals (Sweden)
Yasuko eKikuchi
2013-12-01
Full Text Available Cancer arises through accumulation of epigenetic and genetic alteration. Aberrant promoter methylation is a common epigenetic mechanism of gene silencing in cancer cells. We here performed genome-wide analysis of DNA methylation of promoter regions by Infinium HumanMethylation27 BeadChip, using 14 clinical papillary thyroid cancer samples and 10 normal thyroid samples. Among the 14 papillary cancer cases, 11 showed frequent aberrant methylation, but the other three cases showed no aberrant methylation at all. Distribution of the hypermethylation among cancer samples was non-random, which implied existence of a subset of preferentially methylated papillary thyroid cancer. Among 25 frequently methylated genes, methylation status of six genes (HIST1H3J, POU4F2, SHOX2, PHKG2, TLX3, HOXA7 was validated quantitatively by pyrosequencing. Epigenetic silencing of these genes in methylated papillary thyroid cancer cell lines was confirmed by gene re-expression following treatment with 5-aza-2'-deoxycytidine and trichostatin A, and detected by real-time RT-PCR. Methylation of these six genes was validated by analysis of additional 20 papillary thyroid cancer and 10 normal samples. Among the 34 cancer samples in total, 26 cancer samples with preferential methylation were significantly associated with mutation of BRAF/RAS oncogene (P=0.04, Fisher’s exact test. Thus we identified new genes with frequent epigenetic hypermethylation in papillary thyroid cancer, two subsets of either preferentially methylated or hardly methylated papillary thyroid cancer, with a concomitant occurrence of oncogene mutation and gene methylation. These hypermethylated genes may constitute potential biomarkers for papillary thyroid cancer.
Polymorphism and mutation analysis of genomic DNA on cancer
International Nuclear Information System (INIS)
Ohta, Tsutomu
2003-01-01
DNA repair is a universal process in living cells that maintains the structural integrity of chromosomal DNA molecules in face of damage. A deficiency in DNA damage repair is associated with an increased cancer risk by increasing a mutation frequency of cancer-related genes. Variation in DNA repair capacity may be genetically determined. Therefore, we searched single-nucleotide polymorphisms (SNPs) in major DNA repair genes. This led to the finding of 600 SNPs and mutations including many novel SNPs in Japanese population. Case-control studies to explore the contribution of the SNPs in DNA repair genes to the risk of lung cancer revealed that five SNPs are associated with lung carcinogenesis. One of these SNPs is found in RAD54L gene, which is involved in double-strand DNA repair. We analyzed and reported activities of Rad54L protein with SNP and mutations. (authors)
Mitochondrial mutations drive prostate cancer aggression
DEFF Research Database (Denmark)
Hopkins, Julia F.; Sabelnykova, Veronica Y.; Weischenfeldt, Joachim
2017-01-01
Nuclear mutations are well known to drive tumor incidence, aggression and response to therapy. By contrast, the frequency and roles of mutations in the maternally inherited mitochondrial genome are poorly understood. Here we sequence the mitochondrial genomes of 384 localized prostate cancer...... in prostate cancer, and suggest interplay between nuclear and mitochondrial mutational profiles in prostate cancer....
The association between miR-499 polymorphism and cancer susceptibility: a meta-analysis
Directory of Open Access Journals (Sweden)
Xu Z
2015-08-01
Full Text Available Zhongfei Xu, Enjiao Zhang, Weiyi Duan, Changfu Sun, Shuang Bai, Xuexin Tan Department of Oral and Maxillofacial Surgery, School of Stomatology, China Medical University, Shenyang, People’s Republic of China Background: MicroRNAs are a class of new noncoding RNA that play important roles in the pathogenesis of tumor. Rs3746444 in miR-499 is suggested to be associated with cancer susceptibility. In the present study, we assess the association between miR-499 rs3746444 polymorphism and cancer susceptibility through a meta-analysis. Methods: We searched relevant articles from the PubMed and Embase databases. We screened all the resulting articles for adherence to the inclusion and exclusion criteria. The associations between miR-499 polymorphism and cancer susceptibility were estimated by computing the odds ratios (ORs and 95% confidence intervals (CIs. All analyses were performed using Stata software. Results: There are 18 datasets included in the analysis. Statistically significant associations were found between the miR-499 rs3746444 polymorphism and susceptibility to cancer (GG versus AA: OR =1.24, 95% CI: 1.01–1.52; G versus A: OR =1.11, 95% CI: 1.01–1.23. A subsequent analysis, on the basis of ethnicity for the population characteristic, showed that Asians had increased susceptibility to cancer (GG versus AA: OR =1.32, 95% CI: 1.09–1.59; GG + AG versus AA: OR = 1.17, 95% CI: 1.01–1.37. In the subgroup analysis of tumor type, none of the genetic models had statistically significant results. The meta-regression suggested that race and cancer types are not the source of heterogeneity in the present meta-analysis. No publication bias was detected by either the inverted funnel plot or Egger’s test. Conclusion: Rs3746444 in miR-499 might be related to susceptibility to cancer. Keywords: microRNA, single-nucleotide polymorphism, tumor, risk factor
Age-related mutations associated with clonal hematopoietic expansion and malignancies.
Xie, Mingchao; Lu, Charles; Wang, Jiayin; McLellan, Michael D; Johnson, Kimberly J; Wendl, Michael C; McMichael, Joshua F; Schmidt, Heather K; Yellapantula, Venkata; Miller, Christopher A; Ozenberger, Bradley A; Welch, John S; Link, Daniel C; Walter, Matthew J; Mardis, Elaine R; Dipersio, John F; Chen, Feng; Wilson, Richard K; Ley, Timothy J; Ding, Li
2014-12-01
Several genetic alterations characteristic of leukemia and lymphoma have been detected in the blood of individuals without apparent hematological malignancies. The Cancer Genome Atlas (TCGA) provides a unique resource for comprehensive discovery of mutations and genes in blood that may contribute to the clonal expansion of hematopoietic stem/progenitor cells. Here, we analyzed blood-derived sequence data from 2,728 individuals from TCGA and discovered 77 blood-specific mutations in cancer-associated genes, the majority being associated with advanced age. Remarkably, 83% of these mutations were from 19 leukemia and/or lymphoma-associated genes, and nine were recurrently mutated (DNMT3A, TET2, JAK2, ASXL1, TP53, GNAS, PPM1D, BCORL1 and SF3B1). We identified 14 additional mutations in a very small fraction of blood cells, possibly representing the earliest stages of clonal expansion in hematopoietic stem cells. Comparison of these findings to mutations in hematological malignancies identified several recurrently mutated genes that may be disease initiators. Our analyses show that the blood cells of more than 2% of individuals (5-6% of people older than 70 years) contain mutations that may represent premalignant events that cause clonal hematopoietic expansion.
Directory of Open Access Journals (Sweden)
Alessandro C. S. Ferreira
2008-10-01
Full Text Available Classical hereditary hemochromatosis is a recessive autosomal disease related to a systemic iron overload that is frequently related to C282Y and H63D mutations in the HFE gene. In Brazil, reports on HFE gene mutation frequencies are rare, mainly in regards to a representative sample population. This study intended to determine the prevalence of C282Y and H63D mutations among individuals with clinical suspicion of hereditary hemochromatosis. A total of 1955 patients were studied with C282Y and H63D mutations being detected by the polymerase chain reaction technique followed by enzymatic restriction. The sample consisted of 76.6% men and 23.4% women. The highest percentage of analyzed individuals (56.9% was concentrated in the 41 to 60-year-old age group. Although there were no genic or genotypic differences between genders, a higher number of over 60-year-old women was observed. The C282Y mutation was found as homozygous in 2.9% of the cases and as heterozygous in 10.1%, while the H63D was homozygous in 4.3% and heterozygous in 30.6%. The C282Y and H63D mutant allele frequencies were 0.079 and 0.196, respectively. The highest frequency was observed for H63D which was in genetic equilibrium. This work is important to determine the genetic profile of the population with hereditary hemochromatosis in Brazi.A hemocromatose hereditária clássica (HH é uma doença autossômica recessiva caracterizada por uma sobrecarga sistêmica de ferro, a qual está freqüentemente relacionada às mutações C282Y e H63D no gene HFE. No Brasil, registros das freqüências das mutações no gene HFE são raros, principalmente envolvendo uma amostra representativa da população. Este estudo teve como objetivo a determinação da prevalência das mutações C282Y e H63D em indivíduos com suspeita clínica de HH. Para isto, foram estudados 1955 pacientes para os quais as mutações C282Y e H63D foram pesquisadas pela técnica de Reação em Cadeia da Polimerase
Identifying pathways affected by cancer mutations.
Iengar, Prathima
2017-12-16
Mutations in 15 cancers, sourced from the COSMIC Whole Genomes database, and 297 human pathways, arranged into pathway groups based on the processes they orchestrate, and sourced from the KEGG pathway database, have together been used to identify pathways affected by cancer mutations. Genes studied in ≥15, and mutated in ≥10 samples of a cancer have been considered recurrently mutated, and pathways with recurrently mutated genes have been considered affected in the cancer. Novel doughnut plots have been presented which enable visualization of the extent to which pathways and genes, in each pathway group, are targeted, in each cancer. The 'organismal systems' pathway group (including organism-level pathways; e.g., nervous system) is the most targeted, more than even the well-recognized signal transduction, cell-cycle and apoptosis, and DNA repair pathway groups. The important, yet poorly-recognized, role played by the group merits attention. Pathways affected in ≥7 cancers yielded insights into processes affected. Copyright © 2017 Elsevier Inc. All rights reserved.
Hemochromatosis (HFE gene mutations in Brazilian chronic hemodialysis patients
Directory of Open Access Journals (Sweden)
F.V. Perícole
2005-09-01
Full Text Available Patients with chronic renal insufficiency (CRI have reduced hemoglobin levels, mostly as a result of decreased kidney production of erythropoietin, but the relation between renal insufficiency and the magnitude of hemoglobin reduction has not been well defined. Hereditary hemochromatosis is an inherited disorder of iron metabolism. The importance of the association of hemochromatosis with treatment for anemia among patients with CRI has not been well described. We analyzed the frequency of the C282Y and H63D mutations in the HFE gene in 201 Brazilian individuals with CRI undergoing hemodialysis. The analysis of the effects of HFE mutations on iron metabolism and anemia with biochemical parameters was possible in 118 patients of this study (hemoglobin, hematocrit, ferritin levels, transferrin saturation, and serum iron. A C282Y heterozygous mutation was found in 7/201 (3.4% and H63D homozygous and heterozygous mutation were found in 2/201 (1.0% and 46/201 (22.9%, respectively. The allelic frequencies of the HFE mutations (0.017 for C282Y mutation and 0.124 for H63D mutation did not differ between patients with CRI and healthy controls. Regarding the biochemical parameters, no differences were observed between HFE heterozygous and mutation-negative patients, although ferritin levels were not higher among patients with the H63D mutation (P = 0.08. From what we observed in our study, C282Y/H63D HFE gene mutations are not related to degrees of anemia or iron stores in CRI patients receiving intravenous iron supplementation (P > 0.10. Nevertheless, the present data suggest that the H63D mutation may have an important function as a modulating factor of iron overload in these patients.
Prevalence of BRCA1 mutations in familial and sporadic greek ovarian cancer cases.
Directory of Open Access Journals (Sweden)
Alexandra V Stavropoulou
Full Text Available Germline mutations in the BRCA1 and BRCA2 genes contribute to approximately 18% of hereditary ovarian cancers conferring an estimated lifetime risk from 15% to 50%. A variable incidence of mutations has been reported for these genes in ovarian cancer cases from different populations. In Greece, six mutations in BRCA1 account for 63% of all mutations detected in both BRCA1 and BRCA2 genes. This study aimed to determine the prevalence of BRCA1 mutations in a Greek cohort of 106 familial ovarian cancer patients that had strong family history or metachronous breast cancer and 592 sporadic ovarian cancer cases. All 698 patients were screened for the six recurrent Greek mutations (including founder mutations c.5266dupC, p.G1738R and the three large deletions of exon 20, exons 23-24 and exon 24. In familial cases, the BRCA1 gene was consequently screened for exons 5, 11, 12, 20, 21, 22, 23, 24. A deleterious BRCA1 mutation was found in 43/106 (40.6% of familial cancer cases and in 27/592 (4.6% of sporadic cases. The variant of unknown clinical significance p.V1833M was identified in 9/698 patients (1.3%. The majority of BRCA1 carriers (71.2% presented a high-grade serous phenotype. Identifying a mutation in the BRCA1 gene among breast and/or ovarian cancer families is important, as it enables carriers to take preventive measures. All ovarian cancer patients with a serous phenotype should be considered for genetic testing. Further studies are warranted to determine the prevalence of mutations in the rest of the BRCA1 gene, in the BRCA2 gene, and other novel predisposing genes for breast and ovarian cancer.
Directory of Open Access Journals (Sweden)
Satoshi Katagiri
2014-01-01
Full Text Available Purpose. To investigate genetic and clinical features of patients with rhodopsin (RHO mutations in two Japanese families with autosomal dominant retinitis pigmentosa (adRP. Methods. Whole-exome sequence analysis was performed in ten adRP families. Identified RHO mutations for the cosegregation analysis were confirmed by Sanger sequencing. Ophthalmic examinations were performed to evaluate the RP phenotypes. The impact of the RHO mutation on the rhodopsin conformation was examined by molecular modeling analysis. Results. In two adRP families, we identified two RHO mutations (c.377G>T (p.W126L and c.1036G>C (p.A346P, one of which was novel. Complete cosegregation was confirmed for each mutation exhibiting the RP phenotype in both families. Molecular modeling predicted that the novel mutation (p.W126L might impair rhodopsin function by affecting its conformational transition in the light-adapted form. Clinical phenotypes showed that patients with p.W126L exhibited sector RP, whereas patients with p.A346P exhibited classic RP. Conclusions. Our findings demonstrated that the novel mutation (p.W126L may be associated with the phenotype of sector RP. Identification of RHO mutations is a very useful tool for predicting disease severity and providing precise genetic counseling.
Directory of Open Access Journals (Sweden)
Priscila Da Silva Figueiredo Celestino Gomes
Full Text Available The colony stimulating factor-1 receptor (CSF-1R and the stem cell factor receptor KIT, type III receptor tyrosine kinases (RTKs, are important mediators of signal transduction. The normal functions of these receptors can be compromised by gain-of-function mutations associated with different physiopatological impacts. Whereas KIT D816V/H mutation is a well-characterized oncogenic event and principal cause of systemic mastocytosis, the homologous CSF-1R D802V has not been identified in human cancers. The KIT D816V oncogenic mutation triggers resistance to the RTK inhibitor Imatinib used as first line treatment against chronic myeloid leukemia and gastrointestinal tumors. CSF-1R is also sensitive to Imatinib and this sensitivity is altered by mutation D802V. Previous in silico characterization of the D816V mutation in KIT evidenced that the mutation caused a structure reorganization of the juxtamembrane region (JMR and facilitated its departure from the kinase domain (KD. In this study, we showed that the equivalent CSF-1R D802V mutation does not promote such structural effects on the JMR despite of a reduction on some key H-bonds interactions controlling the JMR binding to the KD. In addition, this mutation disrupts the allosteric communication between two essential regulatory fragments of the receptors, the JMR and the A-loop. Nevertheless, the mutation-induced shift towards an active conformation observed in KIT D816V is not observed in CSF-1R D802V. The distinct impact of equivalent mutation in two homologous RTKs could be associated with the sequence difference between both receptors in the native form, particularly in the JMR region. A local mutation-induced perturbation on the A-loop structure observed in both receptors indicates the stabilization of an inactive non-inhibited form, which Imatinib cannot bind.
Da Silva Figueiredo Celestino Gomes, Priscila; Panel, Nicolas; Laine, Elodie; Pascutti, Pedro Geraldo; Solary, Eric; Tchertanov, Luba
2014-01-01
The colony stimulating factor-1 receptor (CSF-1R) and the stem cell factor receptor KIT, type III receptor tyrosine kinases (RTKs), are important mediators of signal transduction. The normal functions of these receptors can be compromised by gain-of-function mutations associated with different physiopatological impacts. Whereas KIT D816V/H mutation is a well-characterized oncogenic event and principal cause of systemic mastocytosis, the homologous CSF-1R D802V has not been identified in human cancers. The KIT D816V oncogenic mutation triggers resistance to the RTK inhibitor Imatinib used as first line treatment against chronic myeloid leukemia and gastrointestinal tumors. CSF-1R is also sensitive to Imatinib and this sensitivity is altered by mutation D802V. Previous in silico characterization of the D816V mutation in KIT evidenced that the mutation caused a structure reorganization of the juxtamembrane region (JMR) and facilitated its departure from the kinase domain (KD). In this study, we showed that the equivalent CSF-1R D802V mutation does not promote such structural effects on the JMR despite of a reduction on some key H-bonds interactions controlling the JMR binding to the KD. In addition, this mutation disrupts the allosteric communication between two essential regulatory fragments of the receptors, the JMR and the A-loop. Nevertheless, the mutation-induced shift towards an active conformation observed in KIT D816V is not observed in CSF-1R D802V. The distinct impact of equivalent mutation in two homologous RTKs could be associated with the sequence difference between both receptors in the native form, particularly in the JMR region. A local mutation-induced perturbation on the A-loop structure observed in both receptors indicates the stabilization of an inactive non-inhibited form, which Imatinib cannot bind. PMID:24828813
Whitehall, VLJ; Dumenil, TD; McKeone, DM; Bond, CE; Bettington, ML; Buttenshaw, RL; Bowdler, L; Montgomery, GW; Wockner, LF; Leggett, BA
2014-01-01
The CpG Island Methylator Phenotype (CIMP) is fundamental to an important subset of colorectal cancer; however, its cause is unknown. CIMP is associated with microsatellite instability but is also found in BRAF mutant microsatellite stable cancers that are associated with poor prognosis. The isocitrate dehydrogenase 1 (IDH1) gene causes CIMP in glioma due to an activating mutation that produces the 2-hydroxyglutarate oncometabolite. We therefore examined IDH1 alteration as a potential cause o...
DEFF Research Database (Denmark)
Antoniou, Antonis C; Wang, Xianshu; Fredericksen, Zachary S
2010-01-01
diagnosis over age 35. We took forward 96 SNPs for replication in another 5,986 BRCA1 carriers (2,974 individuals with breast cancer and 3,012 unaffected individuals). Five SNPs on 19p13 were associated with breast cancer risk (P(trend) = 2.3 × 10¿¿ to P(trend) = 3.9 × 10¿7), two of which showed independent......Germline BRCA1 mutations predispose to breast cancer. To identify genetic modifiers of this risk, we performed a genome-wide association study in 1,193 individuals with BRCA1 mutations who were diagnosed with invasive breast cancer under age 40 and 1,190 BRCA1 carriers without breast cancer...... associations (rs8170, hazard ratio (HR) = 1.26, 95% CI 1.17-1.35; rs2363956 HR = 0.84, 95% CI 0.80-0.89). Genotyping these SNPs in 6,800 population-based breast cancer cases and 6,613 controls identified a similar association with estrogen receptor-negative breast cancer (rs2363956 per-allele odds ratio (OR...
Cancer3D: understanding cancer mutations through protein structures.
Porta-Pardo, Eduard; Hrabe, Thomas; Godzik, Adam
2015-01-01
The new era of cancer genomics is providing us with extensive knowledge of mutations and other alterations in cancer. The Cancer3D database at http://www.cancer3d.org gives an open and user-friendly way to analyze cancer missense mutations in the context of structures of proteins in which they are found. The database also helps users analyze the distribution patterns of the mutations as well as their relationship to changes in drug activity through two algorithms: e-Driver and e-Drug. These algorithms use knowledge of modular structure of genes and proteins to separately study each region. This approach allows users to find novel candidate driver regions or drug biomarkers that cannot be found when similar analyses are done on the whole-gene level. The Cancer3D database provides access to the results of such analyses based on data from The Cancer Genome Atlas (TCGA) and the Cancer Cell Line Encyclopedia (CCLE). In addition, it displays mutations from over 14,700 proteins mapped to more than 24,300 structures from PDB. This helps users visualize the distribution of mutations and identify novel three-dimensional patterns in their distribution. © The Author(s) 2014. Published by Oxford University Press on behalf of Nucleic Acids Research.
Kobayashi, Yoshihisa; Mitsudomi, Tetsuya
2016-09-01
Somatic mutations in the epidermal growth factor receptor (EGFR) gene are present in approximately 20% (in Caucasians) to 40% (in East Asians) of adenocarcinomas of the lung. Targeted therapy for these lung cancers has been established based on evidence regarding mainly common mutations; that is, exon 19 deletions (Del19) and L858R. EGFR-tyrosine kinase inhibitors (TKI), gefitinib, erlotinib or afatinib showed high objective response rates (ORR) of approximately 60%. Several studies suggested that Del19 might be more sensitive to EGFR-TKI than L858R. On the other hand, it has been difficult to establish evidence for other less common mutations, accounting for 12% of all EGFR mutations, because there are many variants and many studies have excluded patients with these uncommon mutations. However, recent studies revealed that these rare genotypes could be targetable if appropriate TKI are selected. For example, G719X (X denotes A, S, C and so on), Del18, E709K, insertions in exon 19 (Ins19), S768I or L861Q showed moderate sensitivities to gefitinib or erlotinb with ORR of 30%-50%. However, afatinib appeared to be especially effective for these tumors. Although Ins20s (except for insFQEA) have been regarded as resistant mutations, osimertinib may be effective for rare subtypes of them and nazartinib (EGF816) is promising for the majority of them. For the further development of targeted therapy in all EGFR mutations, it is important to precisely detect targetable mutations, to select the most appropriate TKI for each mutation, and to continue investigating in vitro studies and collecting clinical data on even rare mutations. © 2016 The Authors. Cancer Science published by John Wiley & Sons Australia, Ltd on behalf of Japanese Cancer Association.
The landscape of cancer genes and mutational processes in breast cancer
Stephens, Philip J.; Tarpey, Patrick S.; Davies, Helen; van Loo, Peter; Greenman, Chris; Wedge, David C.; Nik-Zainal, Serena; Martin, Sancha; Varela, Ignacio; Bignell, Graham R.; Yates, Lucy R.; Papaemmanuil, Elli; Beare, David; Butler, Adam; Cheverton, Angela; Gamble, John; Hinton, Jonathan; Jia, Mingming; Jayakumar, Alagu; Jones, David; Latimer, Calli; Lau, King Wai; McLaren, Stuart; McBride, David J.; Menzies, Andrew; Mudie, Laura; Raine, Keiran; Rad, Roland; Chapman, Michael Spencer; Teague, Jon; Easton, Douglas; Langerød, Anita; Lee, Ming Ta Michael; Shen, Chen-Yang; tee, Benita Tan Kiat; Huimin, Bernice Wong; Broeks, Annegien; Vargas, Ana Cristina; Turashvili, Gulisa; Martens, John; Fatima, Aquila; Miron, Penelope; Chin, Suet-Feung; Thomas, Gilles; Boyault, Sandrine; Mariani, Odette; Lakhani, Sunil R.; van de Vijver, Marc; van 't Veer, Laura; Foekens, John
2012-01-01
All cancers carry somatic mutations in their genomes. A subset, known as driver mutations, confer clonal selective advantage on cancer cells and are causally implicated in oncogenesis(1), and the remainder are passenger mutations. The driver mutations and mutational processes operative in breast
Directory of Open Access Journals (Sweden)
Ignacio Blanco
Full Text Available While interplay between BRCA1 and AURKA-RHAMM-TPX2-TUBG1 regulates mammary epithelial polarization, common genetic variation in HMMR (gene product RHAMM may be associated with risk of breast cancer in BRCA1 mutation carriers. Following on these observations, we further assessed the link between the AURKA-HMMR-TPX2-TUBG1 functional module and risk of breast cancer in BRCA1 or BRCA2 mutation carriers. Forty-one single nucleotide polymorphisms (SNPs were genotyped in 15,252 BRCA1 and 8,211 BRCA2 mutation carriers and subsequently analyzed using a retrospective likelihood approach. The association of HMMR rs299290 with breast cancer risk in BRCA1 mutation carriers was confirmed: per-allele hazard ratio (HR = 1.10, 95% confidence interval (CI 1.04-1.15, p = 1.9 x 10(-4 (false discovery rate (FDR-adjusted p = 0.043. Variation in CSTF1, located next to AURKA, was also found to be associated with breast cancer risk in BRCA2 mutation carriers: rs2426618 per-allele HR = 1.10, 95% CI 1.03-1.16, p = 0.005 (FDR-adjusted p = 0.045. Assessment of pairwise interactions provided suggestions (FDR-adjusted pinteraction values > 0.05 for deviations from the multiplicative model for rs299290 and CSTF1 rs6064391, and rs299290 and TUBG1 rs11649877 in both BRCA1 and BRCA2 mutation carriers. Following these suggestions, the expression of HMMR and AURKA or TUBG1 in sporadic breast tumors was found to potentially interact, influencing patients' survival. Together, the results of this study support the hypothesis of a causative link between altered function of AURKA-HMMR-TPX2-TUBG1 and breast carcinogenesis in BRCA1/2 mutation carriers.
HFE p.C282Y gene variant is associated with varicose veins in Russian population.
Sokolova, Ekaterina A; Shadrina, Alexandra S; Sevost'ianova, Kseniya S; Shevela, Andrey I; Soldatsky, Evgenii Yu; Seliverstov, Evgenii I; Demekhova, Marina Yu; Shonov, Oleg A; Ilyukhin, Evgenii A; Smetanina, Mariya A; Voronina, Elena N; Zolotukhin, Igor A; Filipenko, Maxim L
2016-08-01
Recently, the association of polymorphism rs1800562 (p.C282Y) in the hemochromatosis (HFE) gene with the increased risk of venous ulceration was shown. We hypothesized that HFE gene polymorphism might be involved not only in ulceration process, but also in susceptibility to primary varicose veins. We genotyped HFE p.C282Y (rs1800562) and p.H63D (rs1799945) variants in patients with primary varicose veins (n = 463) and in the control group (n = 754). In our study, p.282Y variant (rs1800562 A allele) was significantly associated with the risk of varicose veins (OR 1.79, 95 % CI = 1.11-2.89, P = 0.02). A borderline significant reverse association of p.63D variant (rs1799945 G allele) with venous leg ulcer development was revealed in Russians (OR 0.25, 95 % CI = 0.06-1.00, P = 0.05), but not in the meta-analysis (P = 0.56). We conclude that the HFE gene polymorphism can affect the risk of developing primary varicose veins.
PIK3CA Mutation in Colorectal Cancer: Relationship with Genetic and Epigenetic Alterations
Directory of Open Access Journals (Sweden)
Katsuhiko Nosho
2008-06-01
Full Text Available Somatic PIK3CA mutations are often present in colorectal cancer. Mutant PIK3CA activates AKT signaling, which up-regulates fatty acid synthase (FASN. Microsatellite instability (MSI and CpG island methylator phenotype (CIMP are important molecular classifiers in colorectal cancer. However, the relationship between PIK3CA mutation, MSI and CIMP remains uncertain. Using Pyrosequencing technology, we detected PIK3CA mutations in 91 (15% of 590 population-based colorectal cancers. To determine CIMP status, we quantified DNA methylation in eight CIMP-specific promoters [CACNA1G, CDKN2A (p16, CRABP1, IGF2, MLH1, NEUROG1, RUNX3, and SOCS1] by real-time polymerase chain reaction (MethyLight. PIK3CA mutation was significantly associated with mucinous tumors [P = .0002; odds ratio (OR = 2.44], KRAS mutation (P < .0001; OR = 2.68, CIMP-high (P = .03; OR = 2.08, phospho–ribosomal protein S6 expression (P = .002; OR = 2.19, and FASN expression (P = .02; OR = 1.85 and inversely with p53 expression (P = .01; OR = 0.54 and β-catenin (CTNNB1 alteration (P = .004; OR = 0.43. In addition, PIK3CA G-to-A mutations were associated with MGMT loss (P = .001; OR = 3.24 but not with MGMT promoter methylation. In conclusion, PIK3CA mutation is significantly associated with other key molecular events in colorectal cancer, and MGMT loss likely contributes to the development of PIK3CA G>A mutation. In addition, Pyrosequencing is useful in detecting PIK3CA mutation in archival paraffin tumor tissue. PIK3CA mutational data further emphasize heterogeneity of colorectal cancer at the molecular level.
DEFF Research Database (Denmark)
Bolton, Kelly L; Chenevix-Trench, Georgia; Goh, Cindy
2012-01-01
Approximately 10% of women with invasive epithelial ovarian cancer (EOC) carry deleterious germline mutations in BRCA1 or BRCA2. A recent article suggested that BRCA2-related EOC was associated with an improved prognosis, but the effect of BRCA1 remains unclear....
Guanine holes are prominent targets for mutation in cancer and inherited disease.
Directory of Open Access Journals (Sweden)
Albino Bacolla
Full Text Available Single base substitutions constitute the most frequent type of human gene mutation and are a leading cause of cancer and inherited disease. These alterations occur non-randomly in DNA, being strongly influenced by the local nucleotide sequence context. However, the molecular mechanisms underlying such sequence context-dependent mutagenesis are not fully understood. Using bioinformatics, computational and molecular modeling analyses, we have determined the frequencies of mutation at G • C bp in the context of all 64 5'-NGNN-3' motifs that contain the mutation at the second position. Twenty-four datasets were employed, comprising >530,000 somatic single base substitutions from 21 cancer genomes, >77,000 germline single-base substitutions causing or associated with human inherited disease and 16.7 million benign germline single-nucleotide variants. In several cancer types, the number of mutated motifs correlated both with the free energies of base stacking and the energies required for abstracting an electron from the target guanines (ionization potentials. Similar correlations were also evident for the pathological missense and nonsense germline mutations, but only when the target guanines were located on the non-transcribed DNA strand. Likewise, pathogenic splicing mutations predominantly affected positions in which a purine was located on the non-transcribed DNA strand. Novel candidate driver mutations and tissue-specific mutational patterns were also identified in the cancer datasets. We conclude that electron transfer reactions within the DNA molecule contribute to sequence context-dependent mutagenesis, involving both somatic driver and passenger mutations in cancer, as well as germline alterations causing or associated with inherited disease.
Andrulis, IL; Mulligan, AM; Schmutzler, RK; Barrowdale, D; McGuffog, L; Robson, M; Schmidt, MK; Spurdle, AB; Neuhausen, SL; Kuchenbaecker, KB
2014-01-01
Introduction: More than 70 common alleles are known to be involved in breast cancer (BC) susceptibility and several exhibit significant heterogeneity in their associations with different BC subtypes. Although there are differences in the association patterns between BRCA1 and BRCA2 mutation carriers and the general population for several loci, no study has comprehensively evaluated the associations of all known BC susceptibility alleles with risk of BC subtypes in BRCA1 and BRC...
Telomere length, ATM mutation status and cancer risk in Ataxia-Telangiectasia families.
Renault, Anne-Laure; Mebirouk, Noura; Cavaciuti, Eve; Le Gal, Dorothée; Lecarpentier, Julie; d'Enghien, Catherine Dubois; Laugé, Anthony; Dondon, Marie-Gabrielle; Labbé, Martine; Lesca, Gaetan; Leroux, Dominique; Gladieff, Laurence; Adenis, Claude; Faivre, Laurence; Gilbert-Dussardier, Brigitte; Lortholary, Alain; Fricker, Jean-Pierre; Dahan, Karin; Bay, Jacques-Olivier; Longy, Michel; Buecher, Bruno; Janin, Nicolas; Zattara, Hélène; Berthet, Pascaline; Combès, Audrey; Coupier, Isabelle; Hall, Janet; Stoppa-Lyonnet, Dominique; Andrieu, Nadine; Lesueur, Fabienne
2017-10-01
Recent studies have linked constitutive telomere length (TL) to aging-related diseases including cancer at different sites. ATM participates in the signaling of telomere erosion, and inherited mutations in ATM have been associated with increased risk of cancer, particularly breast cancer. The goal of this study was to investigate whether carriage of an ATM mutation and TL interplay to modify cancer risk in ataxia-telangiectasia (A-T) families.The study population consisted of 284 heterozygous ATM mutation carriers (HetAT) and 174 non-carriers (non-HetAT) from 103 A-T families. Forty-eight HetAT and 14 non-HetAT individuals had cancer, among them 25 HetAT and 6 non-HetAT were diagnosed after blood sample collection. We measured mean TL using a quantitative PCR assay and genotyped seven single-nucleotide polymorphisms (SNPs) recurrently associated with TL in large population-based studies.HetAT individuals were at increased risk of cancer (OR = 2.3, 95%CI = 1.2-4.4, P = 0.01), and particularly of breast cancer for women (OR = 2.9, 95%CI = 1.2-7.1, P = 0.02), in comparison to their non-HetAT relatives. HetAT individuals had longer telomeres than non-HetAT individuals (P = 0.0008) but TL was not associated with cancer risk, and no significant interaction was observed between ATM mutation status and TL. Furthermore, rs9257445 (ZNF311) was associated with TL in HetAT subjects and rs6060627 (BCL2L1) modified cancer risk in HetAT and non-HetAT women.Our findings suggest that carriage of an ATM mutation impacts on the age-related TL shortening and that TL per se is not related to cancer risk in ATM carriers. TL measurement alone is not a good marker for predicting cancer risk in A-T families. © The Author 2017. Published by Oxford University Press.
Somatic mutation analysis of MYH11 in breast and prostate cancer
International Nuclear Information System (INIS)
Alhopuro, Pia; Karhu, Auli; Winqvist, Robert; Waltering, Kati; Visakorpi, Tapio; Aaltonen, Lauri A
2008-01-01
MYH11 (also known as SMMHC) encodes the smooth-muscle myosin heavy chain, which has a key role in smooth muscle contraction. Inversion at the MYH11 locus is one of the most frequent chromosomal aberrations found in acute myeloid leukemia. We have previously shown that MYH11 mutations occur in human colorectal cancer, and may also be associated with Peutz-Jeghers syndrome. The mutations found in human intestinal neoplasia result in unregulated proteins with constitutive motor activity, similar to the mutant myh11 underlying the zebrafish meltdown phenotype characterized by disrupted intestinal architecture. Recently, MYH1 and MYH9 have been identified as candidate breast cancer genes in a systematic analysis of the breast cancer genome. The aim of this study was to investigate the role of somatic MYH11 mutations in two common tumor types; breast and prostate cancers. A total of 155 breast cancer and 71 prostate cancer samples were analyzed for those regions in MYH11 (altogether 8 exons out of 42 coding exons) that harboured mutations in colorectal cancer in our previous study. In breast cancer samples only germline alterations were observed. One prostate cancer sample harbored a frameshift mutation c.5798delC, which we have previously shown to result in a protein with unregulated motor activity. Little evidence for a role of somatic MYH11 mutations in the formation of breast or prostate cancers was obtained in this study
Signatures of mutational processes in human cancer
Alexandrov, L.B.; Nik-Zainal, S.; Wedge, D.C.; Aparicio, S.A.; Behjati, S.; Biankin, A.V.; Bignell, G.R.; Bolli, N.; Borg, A.; Borresen-Dale, A.L.; Boyault, S.; Burkhardt, B.; Butler, A.P.; Caldas, C.; Davies, H.R.; Desmedt, C.; Eils, R.; Eyfjord, J.E.; Foekens, J.A.; Greaves, M.; Hosoda, F.; Hutter, B.; Ilicic, T.; Imbeaud, S.; Imielinsk, M.; Jager, N.; Jones, D.T.; Knappskog, S.; Kool, M.; Lakhani, S.R.; Lopez-Otin, C.; Martin, S.; Munshi, N.C.; Nakamura, H.; Northcott, P.A.; Pajic, M.; Papaemmanuil, E.; Paradiso, A.; Pearson, J.V.; Puente, X.S.; Raine, K.; Ramakrishna, M.; Richardson, A.L.; Richter, J.; Rosenstiel, P.; Schlesner, M.; Schumacher, T.N.; Span, P.N.; Teague, J.W.; Totoki, Y.; Tutt, A.N.; Valdes-Mas, R.; Buuren, M.M. van; Veer, L. van 't; Vincent-Salomon, A.; Waddell, N.; Yates, L.R.; Zucman-Rossi, J.; Futreal, P.A.; McDermott, U.; Lichter, P.; Meyerson, M.; Grimmond, S.M.; Siebert, R.; Campo, E.; Shibata, T.; Pfister, S.M.; Campbell, P.J.; Stratton, M.R.; Schlooz-Vries, M.S.; Tol, J.J. van; Laarhoven, H.W. van; Sweep, F.C.; Bult, P.; et al.,
2013-01-01
All cancers are caused by somatic mutations; however, understanding of the biological processes generating these mutations is limited. The catalogue of somatic mutations from a cancer genome bears the signatures of the mutational processes that have been operative. Here we analysed 4,938,362
DEFF Research Database (Denmark)
Therkildsen, Christina; Isinger-Ekstrand, Anna; Ladelund, Steen
2012-01-01
Founder mutations with a large impact in distinct populations have been described in Lynch syndrome. In Denmark, the MLH1 c.1667+2_1667_+8TAAATCAdelinsATTT mutation accounts for 25 % of the MLH1 mutant families. We used the national Danish hereditary nonpolyposis colorectal cancer register...... to estimate the cumulative lifetime risks for Lynch syndrome-associated cancer in 16 founder mutation families with comparison to 47 other MLH1 mutant families. The founder mutation conferred comparable risks for colorectal cancer (relative risks, RR, of 0.99 for males and 0.79 for females) and lower risks...... in 68 % with extensive inter-tumor variability despite the same underlying germline mutation. In conclusion, the Danish MLH1 founder mutation that accounts for a significant proportion of Lynch syndrome and is associated with a lower risk for extracolonic cancers....
H63D mutation in HFE gene is common in Indians and is associated ...
Indian Academy of Sciences (India)
HH affects predominantly people of northern European origin and is often ... mutation with the C282Y mutation is a known risk factor for iron overload ... or has low allele frequencies in non-Caucasian populations,. i.e. African ... who were ascertained through self-reported questionnaire. ... confidence limits of the D statistic.
Directory of Open Access Journals (Sweden)
Michael Seiler
2018-04-01
Full Text Available Summary: Hotspot mutations in splicing factor genes have been recently reported at high frequency in hematological malignancies, suggesting the importance of RNA splicing in cancer. We analyzed whole-exome sequencing data across 33 tumor types in The Cancer Genome Atlas (TCGA, and we identified 119 splicing factor genes with significant non-silent mutation patterns, including mutation over-representation, recurrent loss of function (tumor suppressor-like, or hotspot mutation profile (oncogene-like. Furthermore, RNA sequencing analysis revealed altered splicing events associated with selected splicing factor mutations. In addition, we were able to identify common gene pathway profiles associated with the presence of these mutations. Our analysis suggests that somatic alteration of genes involved in the RNA-splicing process is common in cancer and may represent an underappreciated hallmark of tumorigenesis. : Seiler et al. report that 119 splicing factor genes carry putative driver mutations over 33 tumor types in TCGA. The most common mutations appear to be mutually exclusive and are associated with lineage-independent altered splicing. Samples with these mutations show deregulation of cell-autonomous pathways and immune infiltration. Keywords: splicing, SF3B1, U2AF1, SRSF2, RBM10, FUBP1, cancer, mutation
Ding, Yuan C.; McGuffog, Lesley; Healey, Sue; Friedman, Eitan; Laitman, Yael; Shani-Shimon–Paluch; Kaufman, Bella; Liljegren, Annelie; Lindblom, Annika; Olsson, Håkan; Kristoffersson, Ulf; Stenmark-Askmalm, Marie; Melin, Beatrice; Domchek, Susan M.; Nathanson, Katherine L.; Rebbeck, Timothy R.; Jakubowska, Anna; Lubinski, Jan; Jaworska, Katarzyna; Durda, Katarzyna; Gronwald, Jacek; Huzarski, Tomasz; Cybulski, Cezary; Byrski, Tomasz; Osorio, Ana; Cajal, Teresa Ramóny; Stavropoulou, Alexandra V; Benítez, Javier; Hamann, Ute; Rookus, Matti; Aalfs, Cora M.; de Lange, Judith L.; Meijers-Heijboer, Hanne E.J.; Oosterwijk, Jan C.; van Asperen, Christi J.; García, Encarna B. Gómez; Hoogerbrugge, Nicoline; Jager, Agnes; van der Luijt, Rob B.; Easton, Douglas F.; Peock, Susan; Frost, Debra; Ellis, Steve D.; Platte, Radka; Fineberg, Elena; Evans, D. Gareth; Lalloo, Fiona; Izatt, Louise; Eeles, Ros; Adlard, Julian; Davidson, Rosemarie; Eccles, Diana; Cole, Trevor; Cook, Jackie; Brewer, Carole; Tischkowitz, Marc; Godwin, Andrew K.; Pathak, Harsh; Stoppa-Lyonnet, Dominique; Sinilnikova, Olga M.; Mazoyer, Sylvie; Barjhoux, Laure; Léoné, Mélanie; Gauthier-Villars, Marion; Caux-Moncoutier, Virginie; de Pauw, Antoine; Hardouin, Agnès; Berthet, Pascaline; Dreyfus, Hélène; Ferrer, Sandra Fert; Collonge-Rame, Marie-Agnès; Sokolowska, Johanna; Buys, Saundra; Daly, Mary; Miron, Alex; Terry, Mary Beth; Chung, Wendy; John, Esther M; Southey, Melissa; Goldgar, David; Singer, Christian F; Maria, Muy-Kheng Tea; Gschwantler-Kaulich, Daphne; Fink-Retter, Anneliese; Hansen, Thomas v. O.; Ejlertsen, Bent; Johannsson, Oskar Th.; Offit, Kenneth; Sarrel, Kara; Gaudet, Mia M.; Vijai, Joseph; Robson, Mark; Piedmonte, Marion R; Andrews, Lesley; Cohn, David; DeMars, Leslie R.; DiSilvestro, Paul; Rodriguez, Gustavo; Toland, Amanda Ewart; Montagna, Marco; Agata, Simona; Imyanitov, Evgeny; Isaacs, Claudine; Janavicius, Ramunas; Lazaro, Conxi; Blanco, Ignacio; Ramus, Susan J; Sucheston, Lara; Karlan, Beth Y.; Gross, Jenny; Ganz, Patricia A.; Beattie, Mary S.; Schmutzler, Rita K.; Wappenschmidt, Barbara; Meindl, Alfons; Arnold, Norbert; Niederacher, Dieter; Preisler-Adams, Sabine; Gadzicki, Dorotehea; Varon-Mateeva, Raymonda; Deissler, Helmut; Gehrig, Andrea; Sutter, Christian; Kast, Karin; Nevanlinna, Heli; Aittomäki, Kristiina; Simard, Jacques; Spurdle, Amanda B.; Beesley, Jonathan; Chen, Xiaoqing; Tomlinson, Gail E.; Weitzel, Jeffrey; Garber, Judy E.; Olopade, Olufunmilayo I.; Rubinstein, Wendy S.; Tung, Nadine; Blum, Joanne L.; Narod, Steven A.; Brummel, Sean; Gillen, Daniel L.; Lindor, Noralane; Fredericksen, Zachary; Pankratz, Vernon S.; Couch, Fergus J.; Radice, Paolo; Peterlongo, Paolo; Greene, Mark H.; Loud, Jennifer T.; Mai, Phuong L.; Andrulis, Irene L.; Glendon, Gord; Ozcelik, Hilmi; Gerdes, Anne-Marie; Thomassen, Mads; Jensen, Uffe Birk; Skytte, Anne-Bine; Caligo, Maria A.; Lee, Andrew; Chenevix-Trench, Georgia; Antoniou, Antonis C; Neuhausen, Susan L.
2012-01-01
Background We previously reported significant associations between genetic variants in insulin receptor substrate 1 (IRS1) and breast cancer risk in women carrying BRCA1 mutations. The objectives of this study were to investigate whether the IRS1 variants modified ovarian cancer risk and were associated with breast cancer risk in a larger cohort of BRCA1 and BRCA2 mutation carriers. Methods IRS1 rs1801123, rs1330645, and rs1801278 were genotyped in samples from 36 centers in the Consortium of Investigators of Modifiers of BRCA1/2 (CIMBA). Data were analyzed by a retrospective cohort approach modeling the associations with breast and ovarian cancer risks simultaneously. Analyses were stratified by BRCA1 and BRCA2 status and mutation class in BRCA1 carriers. Results Rs1801278 (Gly972Arg) was associated with ovarian cancer risk for both BRCA1 [Hazard ratio (HR) = 1.43; 95% CI: 1.06–1.92; p = 0.019] and BRCA2 mutation carriers (HR=2.21; 95% CI: 1.39–3.52, p=0.0008). For BRCA1 mutation carriers, the breast cancer risk was higher in carriers with class 2 mutations than class 1 (mutations (class 2 HR=1.86, 95% CI: 1.28–2.70; class 1 HR=0.86, 95%CI:0.69–1.09; p-for difference=0.0006). Rs13306465 was associated with ovarian cancer risk in BRCA1 class 2 mutation carriers (HR = 2.42; p = 0.03). Conclusion The IRS1 Gly972Arg SNP, which affects insulin-like growth factor and insulin signaling, modifies ovarian cancer risk in BRCA1 and BRCA2 mutation carriers and breast cancer risk in BRCA1 class 2 mutation carriers. Impact These findings may prove useful for risk prediction for breast and ovarian cancers in BRCA1 and BRCA2 mutation carriers. PMID:22729394
Kashofer, Karl; Regauer, Sigrid
2017-08-01
This study evaluates the frequency and type of TP53 gene mutations and HPV status in 72 consecutively diagnosed primary invasive vulvar squamous cell carcinomas (SCC) during the past 5years. DNA of formalin-fixed and paraffin embedded tumour tissue was analysed for 32 HPV subtypes and the full coding sequence of the TP53 gene, and correlated with results of p53 immunohistochemistry. 13/72 (18%) cancers were HPV-induced squamous cell carcinomas, of which 1/13 (8%) carcinoma harboured a somatic TP53 mutation. Among the 59/72 (82%) HPV-negative cancers, 59/72 (82%) SCC were HPV-negative with wild-type gene in 14/59 (24%) SCC and somatic TP53 mutations in 45/59 (76%) SCC. 28/45 (62%) SCC carried one (n=20) or two (n=8) missense mutations. 11/45 (24%) carcinomas showed a single disruptive mutation (3× frame shift, 7× stop codon, 1× deletion), 3/45 SCC a splice site mutation. 3/45 (7%) carcinomas had 2 or 3 different mutations. 18 different "hot spot" mutations were observed in 22/45 cancers (49%; 5× R273, 3× R282; 2× each Y220, R278, R248). Immunohistochemical p53 over expression was identified in most SCC with missense mutations, but not in SCC with disruptive TP53 mutations or TP53 wild-type. 14/45 (31%) patients with TP53 mutated SCC died of disease within 12months (range 2-24months) versus 0/13 patients with HPV-induced carcinomas and 0/14 patients with HPV-negative, TP53 wild-type carcinomas. 80% of primary invasive vulvar SCC were HPV-negative carcinomas with a high frequency of disruptive mutations and "hot spot" TP53 gene mutations, which have been linked to chemo- and radioresistance. The death rate of patients with p53 mutated vulvar cancers was 31%. Immunohistochemical p53 over expression could not reliably identify SCC with TP53 gene mutation. Pharmacological therapies targeting mutant p53 will be promising strategies for personalized therapy in patients with TP53 mutated vulvar cancers. Copyright © 2017. Published by Elsevier Inc.
Kruger, Larisa C.; O'Malley, Heather A.; Hull, Jacob M.; Kleeman, Amanda; Patino, Gustavo A.
2016-01-01
Voltage-gated sodium channel (VGSC) β subunits signal through multiple pathways on multiple time scales. In addition to modulating sodium and potassium currents, β subunits play nonconducting roles as cell adhesion molecules, which allow them to function in cell–cell communication, neuronal migration, neurite outgrowth, neuronal pathfinding, and axonal fasciculation. Mutations in SCN1B, encoding VGSC β1 and β1B, are associated with epilepsy. Autosomal-dominant SCN1B-C121W, the first epilepsy-associated VGSC mutation identified, results in genetic epilepsy with febrile seizures plus (GEFS+). This mutation has been shown to disrupt both the sodium-current-modulatory and cell-adhesive functions of β1 subunits expressed in heterologous systems. The goal of this study was to compare mice heterozygous for Scn1b-C121W (Scn1b+/W) with mice heterozygous for the Scn1b-null allele (Scn1b+/−) to determine whether the C121W mutation results in loss-of-function in vivo. We found that Scn1b+/W mice were more susceptible than Scn1b+/− and Scn1b+/+ mice to hyperthermia-induced convulsions, a model of pediatric febrile seizures. β1-C121W subunits are expressed at the neuronal cell surface in vivo. However, despite this, β1-C121W polypeptides are incompletely glycosylated and do not associate with VGSC α subunits in the brain. β1-C121W subcellular localization is restricted to neuronal cell bodies and is not detected at axon initial segments in the cortex or cerebellum or at optic nerve nodes of Ranvier of Scn1bW/W mice. These data, together with our previous results showing that β1-C121W cannot participate in trans-homophilic cell adhesion, lead to the hypothesis that SCN1B-C121W confers a deleterious gain-of-function in human GEFS+ patients. SIGNIFICANCE STATEMENT The mechanisms underlying genetic epilepsy syndromes are poorly understood. Closing this gap in knowledge is essential to the development of new medicines to treat epilepsy. We have used mouse models to
Identification of MPL R102P Mutation in Hereditary Thrombocytosis.
Bellanné-Chantelot, Christine; Mosca, Matthieu; Marty, Caroline; Favier, Rémi; Vainchenker, William; Plo, Isabelle
2017-01-01
The molecular basis of hereditary thrombocytosis is germline mutations affecting the thrombopoietin (TPO)/TPO receptor (MPL)/JAK2 signaling axis. Here, we report one family presenting two cases with a mild thrombocytosis. By sequencing JAK2 and MPL coding exons, we identified a germline MPL R102P heterozygous mutation in the proband and his daughter. Concomitantly, we detected high TPO levels in the serum of these two patients. The mutation was not found in three other unaffected cases from the family except in another proband's daughter who did not present thrombocytosis but had a high TPO level. The MPL R102P mutation was first described in congenital amegakaryocytic thrombocytopenia in a homozygous state with a loss-of-function activity. It was previously shown that MPL R102P was blocked in the endoplasmic reticulum without being able to translocate to the plasma membrane. Thus, this case report identifies for the first time that MPL R102P mutation can differently impact megakaryopoiesis: thrombocytosis or thrombocytopenia depending on the presence of the heterozygous or homozygous state, respectively. The paradoxical effect associated with heterozygous MPL R102P may be due to subnormal cell-surface expression of wild-type MPL in platelets inducing a defective TPO clearance. As a consequence, increased TPO levels may activate megakaryocyte progenitors that express a lower, but still sufficient level of MPL for the induction of proliferation.
Identification of MPL R102P Mutation in Hereditary Thrombocytosis
Directory of Open Access Journals (Sweden)
Christine Bellanné-Chantelot
2017-09-01
Full Text Available The molecular basis of hereditary thrombocytosis is germline mutations affecting the thrombopoietin (TPO/TPO receptor (MPL/JAK2 signaling axis. Here, we report one family presenting two cases with a mild thrombocytosis. By sequencing JAK2 and MPL coding exons, we identified a germline MPL R102P heterozygous mutation in the proband and his daughter. Concomitantly, we detected high TPO levels in the serum of these two patients. The mutation was not found in three other unaffected cases from the family except in another proband’s daughter who did not present thrombocytosis but had a high TPO level. The MPL R102P mutation was first described in congenital amegakaryocytic thrombocytopenia in a homozygous state with a loss-of-function activity. It was previously shown that MPL R102P was blocked in the endoplasmic reticulum without being able to translocate to the plasma membrane. Thus, this case report identifies for the first time that MPL R102P mutation can differently impact megakaryopoiesis: thrombocytosis or thrombocytopenia depending on the presence of the heterozygous or homozygous state, respectively. The paradoxical effect associated with heterozygous MPL R102P may be due to subnormal cell-surface expression of wild-type MPL in platelets inducing a defective TPO clearance. As a consequence, increased TPO levels may activate megakaryocyte progenitors that express a lower, but still sufficient level of MPL for the induction of proliferation.
International Nuclear Information System (INIS)
Eerola, Hannaleena; Heikkilä, Päivi; Tamminen, Anitta; Aittomäki, Kristiina; Blomqvist, Carl; Nevanlinna, Heli
2005-01-01
Histopathological features of BRCA1 and BRCA2 tumours have previously been characterised and compared with unselected breast tumours; however, familial non-BRCA1/2 tumours are less well known. The aim of this study was to characterise familial non-BRCA1/2 tumours and to evaluate routine immunohistochemical and pathological markers that could help us to further distinguish families carrying BRCA1/2 mutations from other breast cancer families. Breast cancer tissue specimens (n = 262) from 25 BRCA1, 20 BRCA2 and 74 non-BRCA1/2 families were studied on a tumour tissue microarray. Immunohistochemical staining of oestrogen receptor (ER), progesterone receptor (PgR) and p53 as well as the histology and grade of these three groups were compared with each other and with the respective information on 862 unselected control patients from the archives of the Pathology Department of Helsinki University Central Hospital. Immunohistochemical staining of erbB2 was also performed among familial cases. BRCA1-associated cancers were diagnosed younger and were more ER-negative and PgR-negative, p53-positive and of higher grade than the other tumours. However, in multivariate analysis the independent factors compared with non-BRCA1/2 tumours were age, grade and PgR negativity. BRCA2 cases did not have such distinctive features compared with non-BRCA1/2 tumours or with unselected control tumours. Familial cases without BRCA1/2 mutations had tumours of lower grade than the other groups. BRCA1 families differed from mutation-negative families by age, grade and PgR status, whereas ER status was not an independent marker
A novel truncating AIP mutation, p.W279*, in a familial isolated pituitary adenoma (FIPA) kindred.
Cansu, Güven Barış; Taşkıran, Bengür; Trivellin, Giampaolo; Faucz, Fabio R; Stratakis, Constantine A
2016-07-01
Familial isolated pituitary adenomas (FIPA) constitute 2-3% of pituitary tumours. AIP is the most commonly mutated gene in FIPA. We herein report a novel germline mutation of the AIP gene in a family with FIPA. We present two patients, a father and his 12-year-old daughter, diagnosed clinically and using laboratory measures with acromegaly-gigantism. Both underwent transsphenoidal hypophyseal surgery for macroadenomas. We initially detected a novel heterozygous germline AIP mutation, c.836G>A (p.W279*), in the father's DNA. We then found the same mutation in his affected daughter. Pituitary adenomas associated with AIP mutations mostly present as FIPA (68%) at an early age (78% occur at treatment success, and genetic counseling.
Directory of Open Access Journals (Sweden)
Tomoaki Sonoda
Full Text Available In non-small cell lung cancer (NSCLC with an epidermal growth factor receptor (EGFR mutation, 50%–65% of cases acquire resistance after treatment with EGFR-tyrosine kinase inhibitors (EGFR-TKIs because of an EGFR T790M point mutation and 3%–14% of these cases transformed to small cell lung cancer (SCLC. Generally, the EGFR T790M secondary mutation develops with ongoing ATP competitive inhibition. We present a case of a 76-year-old woman with lung adenocarcinoma harboring an EGFR-L858R mutation who received first-line gefitinib and developed SCLC transformation. She was administered several chemotherapy agents, including a platinum doublet. The primary lesion that showed SCLC transformation had reconverted to adenocarcinoma with EGFR L858R and T790M mutations at the time of a second re-biopsy. Therefore, she was administered osimertinib, which resulted in clinical remission. This case suggested that serial biopsies are necessary even after SCLC transformation. Keywords: NSCLC, EGFR mutation, SCLC transformation, T790M, Osimertinib
Association of a bitter taste receptor mutation with Balkan Endemic Nephropathy (BEN
Directory of Open Access Journals (Sweden)
Wooding Stephen P
2012-10-01
Full Text Available Abstract Background Balkan Endemic Nephropathy (BEN is late-onset kidney disease thought to arise from chronic exposure to aristolochic acid, a phytotoxin that contaminates wheat supplies in rural areas of Eastern Europe. It has recently been demonstrated that humans are capable of perceiving aristolochic acid at concentrations below 40 nM as the result of high-affinity interactions with the TAS2R43 bitter taste receptor. Further, TAS2R43 harbors high-frequency loss-of-function mutations resulting in 50-fold variability in perception. This suggests that genetic variation in TAS2R43 might affect susceptibility to BEN, with individuals carrying functional forms of the receptor being protected by an ability to detect tainted foods. Methods To determine whether genetic variation in TAS2R43 predicts BEN susceptibility, we examined genotype-phenotype associations in a case–control study. A cohort of 88 affected and 99 control subjects from western Bulgaria were genotyped with respect to two key missense variants and a polymorphic whole-gene deletion of TAS2R43 (W35S, H212R, and wt/Δ, which are known to affect taste sensitivity to aristolochic acid. Tests for association between haplotypes and BEN status were then performed. Results Three major TAS2R43 haplotypes observed in previous studies (TAS2R43-W35/H212, -S35/R212 and –Δ were present at high frequencies (0.17, 0.36, and 0.47 respectively in our sample, and a significant association between genotype and BEN status was present (P = 0.020; odds ratio 1.18. However, contrary to expectation, BEN was positively associated with TAS2R43-W35/H212, a highly responsive allele previously shown to confer elevated bitter sensitivity to aristolochic acid, which should drive aversion but might also affect absorption, altering toxin activation. Conclusions Our findings are at strong odds with the prediction that carriers of functional alleles of TAS2R43 are protected from BEN by an ability to detect and
Santos, Paulo C J L; Pereira, Alexandre C; Cançado, Rodolfo D; Schettert, Isolmar T; Sobreira, Tiago J P; Oliveira, Paulo S L; Hirata, Rosario D C; Hirata, Mario H; Figueiredo, Maria Stella; Chiattone, Carlos S; Krieger, Jose E; Guerra-Shinohara, Elvira M
2010-12-15
Rare HFE variants have been shown to be associated with hereditary hemochromatosis (HH), an iron overload disease. The low frequency of the HFE p.C282Y mutation in HH-affected Brazilian patients may suggest that other HFE-related mutations may also be implicated in the pathogenesis of HH in this population. The main aim was to screen for new HFE mutations in Brazilian individuals with primary iron overload and to investigate their relationship with HH. Fifty Brazilian patients with primary iron overload (transferrin saturation>50% in females and 60% in males) were selected. Subsequent bidirectional sequencing for each HFE exon was performed. The effect of HFE mutations on protein structure were analyzed by molecular dynamics simulation and free binding energy calculations. p.C282Y in homozygosis or in heterozygosis with p.H63D were the most frequent genotypic combinations associated with HH in our sample population (present in 17 individuals, 34%). Thirty-six (72.0%) out of the 50 individuals presented at least one HFE mutation. The most frequent genotype associated with HH was the homozygous p.C282Y mutation (n=11, 22.0%). One novel mutation (p.V256I) was indentified in heterozygosis with the p.H63D mutation. In silico modeling analysis of protein behavior indicated that the p.V256I mutation does not reduce the binding affinity between HFE and β2-microglobulin (β2M) in the same way the p.C282Y mutation does compared with the native HFE protein. In conclusion, screening of HFE through direct sequencing, as compared to p.C282Y/p.H63D genotyping, was not able to increase the molecular diagnosis yield of HH. The novel p.V256I mutation could not be implicated in the molecular basis of the HH phenotype, although its role cannot be completely excluded in HH-phenotype development. Our molecular modeling analysis can help in the analysis of novel, previously undescribed, HFE mutations. Copyright © 2010 Elsevier Inc. All rights reserved.
Krivosheev, A B; Maximov, V N; Voevoda, M I; Kuimov, A D; Kondratova, M A; Tuguleva, T A; Koval, O N; Bezrukova, A A; Bogorianova, P A; Rybina, O V
2015-01-01
The aim of the present work was to study the frequency of genotypes and alleles of C282Y and H63D HFE gene that may be associated with impaired porphyrin metabolism, as well as possible reasons for the formation of dysmetabolism porphyrins with NAFLD. The study involved 65 patients (52 men and 13 women) aged 21 to 69 years (mean age 48.5±1.5 years). Excretion uroporphyrin, coproporphyrin, 6-aminolevulinic acid of porphobilinogen in urine was determined by chromatography and spectrophotometry calculated total excretion of porphyrins. Allele frequencies C282Y and H63D were determined during the molecular genetic analysis of DNA using the polymerase chain reaction followed by analysis of length polymorphism restraktsionnyh fragments. Condition of carbohydrate metabolism was evaluated by the level of fasting blood glucose and standard glucose tolerance test. Diagnosis of insulin resistance was performed according to the criteria proposed by the European Group for the Study of insulin resistance (EGIR). Skill test for the C282Y mutation carriage and H63D in the HFE gene in 65 patients with non-alcoholic fatty liver disease. Disturbances in the metabolism of porphyrins were recorded in 43 (66.2%) patients. H63D and C282Y mutations were found in 18 (27.7%) patients, of whom 13 (72.2%) people with different options dismetabolism porphyrins and signs of insulin resistance. In 47 (72.3%) patients without mutations studied porphyrin metabolism disorders were detected in 30 (63.8 %), of which insulin resistance is registered only in 16 (34.0 %). Detection of mutations C282Y and H63D in the HFE gene in combination with disorders of porphyrin metabolism on the background of insulin resistance is likely to allow such patients considered as candidates for inclusion in the higher risk of formation of diabetes.
Blocking Breast Cancer Metastasis by Targeting RNA-Binding Protein HuR
2017-10-01
AWARD NUMBER: W81XWH-16-1-0730 TITLE: Blocking Breast Cancer Metastasis by Targeting RNA-Binding Protein HuR PRINCIPAL INVESTIGATOR: Danny Welch...NUMBER Blocking Breast Cancer Metastasis by Targeting RNA-Binding Protein HuR 5b. GRANT NUMBER 5c. PROGRAM ELEMENT NUMBER 6. AUTHOR(S) 5d. PROJECT...increased aggressiveness in breast cancer , the primary objective of this proposal is to assess whether HuR (or analogs) prevent and/or treat metastasis and/or
Germline mutations in MAP3K6 are associated with familial gastric cancer.
Directory of Open Access Journals (Sweden)
Daniel Gaston
2014-10-01
Full Text Available Gastric cancer is among the leading causes of cancer-related deaths worldwide. While heritable forms of gastric cancer are relatively rare, identifying the genes responsible for such cases can inform diagnosis and treatment for both hereditary and sporadic cases of gastric cancer. Mutations in the E-cadherin gene, CDH1, account for 40% of the most common form of familial gastric cancer (FGC, hereditary diffuse gastric cancer (HDGC. The genes responsible for the remaining forms of FGC are currently unknown. Here we examined a large family from Maritime Canada with FGC without CDH1 mutations, and identified a germline coding variant (p.P946L in mitogen-activated protein kinase kinase kinase 6 (MAP3K6. Based on conservation, predicted pathogenicity and a known role of the gene in cancer predisposition, MAP3K6 was considered a strong candidate and was investigated further. Screening of an additional 115 unrelated individuals with non-CDH1 FGC identified the p.P946L MAP3K6 variant, as well as four additional coding variants in MAP3K6 (p.F849Sfs*142, p.P958T, p.D200Y and p.V207G. A somatic second-hit variant (p.H506Y was present in DNA obtained from one of the tumor specimens, and evidence of DNA hypermethylation within the MAP3K6 gene was observed in DNA from the tumor of another affected individual. These findings, together with previous evidence from mouse models that MAP3K6 acts as a tumor suppressor, and studies showing the presence of somatic mutations in MAP3K6 in non-hereditary gastric cancers and gastric cancer cell lines, point towards MAP3K6 variants as a predisposing factor for FGC.
Many different types of genetic mutations are found in cancer cells. This infographic outlines certain types of alterations that are present in cancer, such as missense, nonsense, frameshift, and chromosome rearrangements.
HFE gene mutations in coronary atherothrombotic disease
Directory of Open Access Journals (Sweden)
Calado R.T.
2000-01-01
Full Text Available Although iron can catalyze the production of free radicals involved in LDL lipid peroxidation, the contribution of iron overload to atherosclerosis remains controversial. The description of two mutations in the HFE gene (Cys282Tyr and His63Asp related to hereditary hemochromatosis provides an opportunity to address the question of the association between iron overload and atherosclerosis. We investigated the prevalence of HFE mutations in 160 survivors of myocardial infarction with angiographically demonstrated severe coronary atherosclerotic disease, and in 160 age-, gender- and race-matched healthy control subjects. PCR amplification of genomic DNA followed by RsaI and BclI restriction enzyme digestion was used to determine the genotypes. The frequency of the mutant Cys282Tyr allele was identical among patients and controls (0.022; carrier frequency, 4.4%, whereas the mutant His63Asp allele had a frequency of 0.143 (carrier frequency, 27.5% in controls and of 0.134 (carrier frequency, 24.5% in patients. Compound heterozygotes were found in 2 of 160 (1.2% controls and in 1 of 160 (0.6% patients. The finding of a similar prevalence of Cys282Tyr and His63Asp mutations in the HFE gene among controls and patients with coronary atherothrombotic disease, indirectly questions the possibility of an association between hereditary hemochromatosis and atherosclerosis.
Średniowieczne rękopisy ze zbiorów toruńskich bibliotek i archiwów
Directory of Open Access Journals (Sweden)
Janusz Tandecki
2012-12-01
Full Text Available Największa liczba typowych bibliotecznych rękopisów średniowiecznych przechowywana jest w zbiorach Biblioteki Uniwersyteckiej w Toruniu. Wszystkie one trafiły tu po zakończeniu II wojny światowej, przede wszystkim w latach 1945-1947, gdzie w bibliotece umieszczono je wśród tzw. „zbiorów zabezpieczonych”. Obecnie w skład tego zbioru wchodzi 770 jednostek inwentarzowych oraz 6 metrów bieżących materiałów nie zinwentaryzowanych. Dzisiejszą kolekcję 71 średniowiecznych rękopisów Biblioteki UMK tworzą przede wszystkim dawne zbiory Państwowej i Uniwersyteckiej Biblioteki w Królewcu. Obejmują one dzieła religijne, prawnicze, teksty historyczne, medyczne i astronomiczne.Kolejną biblioteką toruńską, w której przechowywane są rękopisy średniowieczne jest Wojewódzka Biblioteka Publiczna-Książnica Kopernikańska w Toruniu. W jej zbiorach zachowało się w sumie 19 rękopisów (m.in. kalendarze, modlitewniki, żywoty świętych z tego okresu (do 1500 r., zapisanych po łacinie, niemiecku i w języku greckim.Spora liczba średniowiecznych ksiąg urzędowych wytworzonych w kancelarii Starego i Nowego Miasta Torunia przechowywana jest również w zasobie Archiwum Państwowego w Toruniu. Wśród nich są także rękopisy o charakterze zbliżonym do bibliotecznych.
Chan, Philip A; Huang, Austin; Kantor, Rami
2012-10-15
Tenofovir-containing regimens have demonstrated potential efficacy as pre-exposure prophylaxis (PrEP) in preventing HIV-1 infection. Transmitted drug resistance mutations associated with tenofovir, specifically the reverse transcriptase (RT) mutation K65R, may impact the effectiveness of PrEP. The worldwide prevalence of transmitted tenofovir resistance in different HIV-1 subtypes is unknown. Sequences from treatment-naïve studies and databases were aggregated and analyzed by Stanford Database tools and as per the International AIDS Society (IAS-USA) resistance criteria. RT sequences were collected from GenBank, the Stanford HIV Sequence Database and the Los Alamos HIV Sequence Database. Sequences underwent rigorous quality control measures. Tenofovir-associated resistance mutations included K65R, K70E, T69-insertion and ≥3 thymidine analogue mutations (TAMs), inclusive of M41L or L210W. A total of 19,823 sequences were evaluated across diverse HIV-1 subtypes (Subtype A: 1549 sequences, B: 9783, C: 3198, D: 483, F: 372, G: 594, H: 41, J: 69, K: 239, CRF01_AE: 1797 and CRF02_AG: 1698). Overall, tenofovir resistance prevalence was 0.4% (n=77/19,823, 95% confidence interval or CI: 0.3 to 0.5). K65R was found in 20 sequences (0.1%, 95% CI: 0.06 to 0.15). Differences in the prevalence of K65R between HIV-1 subtypes were not statistically significant. K70E and ≥3 TAMs were found in 0.015% (95% CI: 0.004 to 0.04) and 0.27% (95% CI: 0.2 to 0.4) of sequences, respectively. Prevalence of transmitted K65R and other tenofovir resistance mutations across diverse HIV-1 subtypes and recombinants is low, suggesting minimal effect on tenofovir-containing PrEP regimens.
OncoSimulR: genetic simulation with arbitrary epistasis and mutator genes in asexual populations.
Diaz-Uriarte, Ramon
2017-06-15
OncoSimulR implements forward-time genetic simulations of biallelic loci in asexual populations with special focus on cancer progression. Fitness can be defined as an arbitrary function of genetic interactions between multiple genes or modules of genes, including epistasis, restrictions in the order of accumulation of mutations, and order effects. Mutation rates can differ among genes, and can be affected by (anti)mutator genes. Also available are sampling from simulations (including single-cell sampling), plotting the genealogical relationships of clones and generating and plotting fitness landscapes. Implemented in R and C ++, freely available from BioConductor for Linux, Mac and Windows under the GNU GPL license. Version 2.5.9 or higher available from: http://www.bioconductor.org/packages/devel/bioc/html/OncoSimulR.html . GitHub repository at: https://github.com/rdiaz02/OncoSimul. ramon.diaz@iib.uam.es. Supplementary data are available at Bioinformatics online. © The Author 2017. Published by Oxford University Press.
Energy Technology Data Exchange (ETDEWEB)
Li, Xia, E-mail: dentistlx@163.com [Department of Stomatology, School of Stomatology and medicine, Foshan Stomatology Hospital, Foshan University, Foshan 528000 (China); Fan, Qinqiao [Department of Hepatobiliary Surgery, Cancer Center, Chenzhou No.1 People' s Hospital, Chenzhou 423000 (China); Li, Jinyun [Department of Head and Neck Surgery, The Affiliated Cancer Hospital of Xiangya School of Medicine, Center South University, Changsha 410013 (China); Song, Jing; Gu, Yangcong [Department of Stomatology, School of Stomatology and medicine, Foshan Stomatology Hospital, Foshan University, Foshan 528000 (China)
2017-02-01
Cancer associated fibroblasts (CAFs) are known to be involved in initiation, progression and metastasis of various cancers. However, the molecular mechanism of how CAFs affects the biological function of oral cancer (OC) has not been fully-addressed. In this study, we demonstrated that miR-124 was downregulated in oral CAFs and oral cancer cells (OCCs) when compared with matched normal fibroblasts (NFs). Hypermethylation in the promoter region of miR-124 genes was accounted for its downregulation. Interestingly, CAFs but not NFs exerted promotion effect on OCCs cell proliferation, migration and tumor growth in CAFs/NFs-OCCs co-culture. Furthermore, we identified Chemokine (C-C motif) ligand 2 (CCL2) and Interleukin 8 (IL-8) as two direct targets of miR-124. Over-expression of miR-124 in CAFs-OCCs co-culture abrogated CAFs-promoted OCCs cell growth and migration, and this inhibitory effect can be rescued by addition of CCL2 and IL-8. Finally, we showed that restoration of miR-124 expression by lentiviral infection or formulated miR-124 injection inhibited oral tumor growth in vivo suggesting miR-124 rescue could be a potential rationale for therapeutic applications in oral cancer in the future. - Highlights: • miR-124 was downregulated in oral cancer cells and cancer associated fibroblasts. • Hypermethylation in the promoter region was accounted for miR-124 downregulation. • CCL2 and IL-8 are two direct targets of miR-124. • miR-124 rescue could be a potential rationale for oral cancer therapy.
International Nuclear Information System (INIS)
Li, Xia; Fan, Qinqiao; Li, Jinyun; Song, Jing; Gu, Yangcong
2017-01-01
Cancer associated fibroblasts (CAFs) are known to be involved in initiation, progression and metastasis of various cancers. However, the molecular mechanism of how CAFs affects the biological function of oral cancer (OC) has not been fully-addressed. In this study, we demonstrated that miR-124 was downregulated in oral CAFs and oral cancer cells (OCCs) when compared with matched normal fibroblasts (NFs). Hypermethylation in the promoter region of miR-124 genes was accounted for its downregulation. Interestingly, CAFs but not NFs exerted promotion effect on OCCs cell proliferation, migration and tumor growth in CAFs/NFs-OCCs co-culture. Furthermore, we identified Chemokine (C-C motif) ligand 2 (CCL2) and Interleukin 8 (IL-8) as two direct targets of miR-124. Over-expression of miR-124 in CAFs-OCCs co-culture abrogated CAFs-promoted OCCs cell growth and migration, and this inhibitory effect can be rescued by addition of CCL2 and IL-8. Finally, we showed that restoration of miR-124 expression by lentiviral infection or formulated miR-124 injection inhibited oral tumor growth in vivo suggesting miR-124 rescue could be a potential rationale for therapeutic applications in oral cancer in the future. - Highlights: • miR-124 was downregulated in oral cancer cells and cancer associated fibroblasts. • Hypermethylation in the promoter region was accounted for miR-124 downregulation. • CCL2 and IL-8 are two direct targets of miR-124. • miR-124 rescue could be a potential rationale for oral cancer therapy.
Esteban, E; Majem, M; Martinez Aguillo, M; Martinez Banaclocha, N; Dómine, M; Gómez Aldaravi, L; Juan, O; Cajal, R; Gonzalez Arenas, M C; Provencio, M
2015-06-01
The aim of the REASON study is to determine the frequency of EGFR mutation in advanced non-small cell lung cancer (aNSCLC) patients in Spain (all histologies), and to better understand the clinical factors (gender, smoking habits and histological subtypes) that may be associated with EGFR mutations, in an unselected sample of aNSCLC patients. All newly diagnosed aNSCLC patients from 40 selected centers in Spain were prospectively included for a 6-month period. Patient characteristics were obtained from clinical records. Mutation testing was performed on available tumor samples. Exploratory analyses were performed to characterize the clinico-pathological factors associated with presence of EGFR mutations. From March 2010 to March 2011, 1113 patients were included in the study, of which 1009 patients provided sample for EGFR mutation analysis (90.7%). Mutation analysis was not feasible in 146/1113 patients (13.1%) due to either sample unavailability (79/1113; 7.1%) or sample inadequacy (67/1113; 6.0%). Twenty-five out of 1113 patients (2.3%) were excluded due to unavailable information. Most patients (99.5%) were Caucasian, 74.5% were male, and predominantly were current (38.1%) or former smokers (44.0%). Median age was 66 years (range 25-90) and 70.7% of patients had non-squamous histology (57.8% adenocarcinoma, 1.8% bronchoalveolar, 11.1% large-cell carcinoma). Exon 19 deletions and the exon 21 L858R point mutation were analyzed in 942/1009 (93.4%) samples. Mutation rate was 11.6% (82.6% exon 19 dels and 17.4% L858R). To be never smoker (38.1%), female (25.4%), with bronchioloalveolar carcinoma (22.2%) or adenocarcinoma (15.4%) histology was associated with a higher prevalence of EGFR mutations. Exons 18, 20 and 21 (excluding L858R) were analyzed in 505/942 samples, and EGFR mutations were found in 22/505 samples (4.4%). The estimated prevalence of sensitizing EGFR mutations (exon 19 del, exon 21 L858R) in an unselected samples of newly diagnosed aNSCLC patients in
F.J. Couch (Fergus); M.M. Gaudet (Mia); A.C. Antoniou (Antonis); S.J. Ramus (Susan); K.B. Kuchenbaecker (Karoline); P. Soucy (Penny); J. Beesley (Jonathan); X. Chen (Xiaoqing); X. Wang (Xing); T. Kircchoff (Tomas); L. McGuffog (Lesley); D. Barrowdale (Daniel); A. Lee (Andrew); S. Healey (Sue); O. Sinilnikova (Olga); I.L. Andrulis (Irene); H. Ozcelik (Hilmi); A.M. Mulligan (Anna Marie); M. Thomassen (Mads); A-M. Gerdes (Anne-Marie); U.B. Jensen; A.-B. Skytte (Anne-Bine); T.A. Kruse (Torben); M.A. Caligo (Maria); A. von Wachenfeldt (Anna); G. Barbany-Bustinza (Gisela); N. Loman (Niklas); M. Soller (Maria); H. Ehrencrona (Hans); P. Karlsson (Per); K.L. Nathanson (Katherine); R. Rebbeck (Timothy); S.M. Domchek (Susan); A. Jakubowska (Anna); J. Lubinski (Jan); K. Jaworska (Katarzyna); K. Durda (Katarzyna); E. Zołwocka (Elzbieta); T. Huzarski (Tomasz); T. Byrski (Tomasz); J. Gronwald (Jacek); C. Cybulski (Cezary); B. Górski (Bohdan); A. Osorio (Ana); M. Durán (Mercedes); M.I. Tejada; J. Benítez (Javier); U. Hamann (Ute); F.B.L. Hogervorst (Frans); T.A.M. van Os (Theo); F.E. van Leeuwen (Flora); E.J. Meijers-Heijboer (Hanne); J.T. Wijnen (Juul); M.J. Blok (Marinus); C.M. Kets; M.J. Hooning (Maartje); R.A. Oldenburg (Rogier); M.G.E.M. Ausems (Margreet); S. Peock (Susan); D. Frost (Debra); S.D. Ellis (Steve); R. Platte (Radka); E. Fineberg (Elena); D.G. Evans (Gareth); C. Jacobs (Chris); R. Eeles (Rosalind); J.W. Adlard (Julian); R. Davidson (Rosemarie); D. Eccles (Diana); T.J. Cole (Trevor); J. Cook (Jackie); J. Paterson (Joan); C. Brewer (Carole); F. Douglas (Fiona); S.V. Hodgson (Shirley); P.J. Morrison (Patrick); L.J. Walker (Lisa); M.E. Porteous (Mary); M.J. Kennedy (John); L. Side (Lucy); B. Bove (B.); A.K. Godwin (Andrew); D. Stoppa-Lyonnet (Dominique); M. Fassy-Colcombet (Marion); L. Castera (Laurent); F. Cornelis (Franco̧is); S. Mazoyer (Sylvie); M. Léone (Mélanie); N. Boutry-Kryza (N.); B. Bressac-de Paillerets (Brigitte); O. Caron (Olivier); P. Pujol (Pascal); I. Coupier (Isabelle); C.D. Delnatte (Capucine); L. Akloul (Linda); H. Lynch (Henry); C.L. Snyder (Carrie); S.S. Buys (Saundra); M.B. Daly (Mary); M.-B. Terry (Mary-Beth); W. Chung (Wendy); E.M. John (Esther); A. Miron (Alexander); M.C. Southey (Melissa); J.L. Hopper (John); D. Goldgar (David); C.F. Singer (Christian); C. Rappaport (Christine); M.-K. Tea; A. Fink-Retter (Anneliese); T.V.O. Hansen (Thomas); F.C. Nielsen (Finn); A. Arason (Adalgeir); J. Vijai (Joseph); S. Shah (Sonia); K. Sarrel (Kara); M. Robson (Mark); M. Piedmonte (Marion); K. Phillips (Kelly); J. Basil (Jack); W.S. Rubinstein (Wendy); J.F. Boggess (John); K. Wakeley (Katie); A. Ewart-Toland (Amanda); M. Montagna (Marco); S. Agata (Simona); E.N. Imyanitov (Evgeny); C. Isaacs (Claudine); R. Janavicius (Ramunas); C. Lazaro (Conxi); I. Blanco (Ignacio); L. Feliubadaló (L.); J. Brunet (Joan); S.A. Gayther (Simon); P.D.P. Pharoah (Paul); K. Odunsi (Kunle); B.Y. Karlan (Beth); C.S. Walsh (Christine); E. Olah; S.-H. Teo (Soo-Hwang); P.A. Ganz (Patricia); M.S. Beattie (Mary); E.J. van Rensburg (Elizabeth); C.M. Dorfling (Cecelia); O. Diez (Orland); A. Kwong (Ava); R.K. Schmutzler (Rita); B. Wapenschmidt (Barbara); C.W. Engel (Christoph); A. Meindl (Alfons); N. Ditsch (Nina); N. Arnold (Norbert); S. Heidemann (Simone); D. Niederacher (Dieter); S. Preisler-Adams (Sabine); D. Gadzicki (Dorothea); R. Varon-Mateeva (Raymonda); H. Deissler (Helmut); P.A. Gehrig (Paola A.); C. Sutter (Christian); K. Kast (Karin); B. Fiebig (Britta); W. Heinritz (Wolfram); T. Caldes (Trinidad); M. de La Hoya (Miguel); T.A. Muranen (Taru); H. Nevanlinna (Heli); M. Tischkowitz (Marc); A.B. Spurdle (Amanda); S.L. Neuhausen (Susan); Y.C. Ding (Yuan); N.M. Lindor (Noralane); Z. Fredericksen (Zachary); V.S. Pankratz (Shane); P. Peterlongo (Paolo); S. Manoukian (Siranoush); B. Peissel (Bernard); D. Zaffaroni (D.); M. Barile (Monica); L. Bernard (Loris); A. Viel (Alessandra); G. Giannini (Giuseppe); L. Varesco (Liliana); P. Radice (Paolo); M.H. Greene (Mark); P.L. Mai (Phuong); D.F. Easton (Douglas); G. Chenevix-Trench (Georgia); K. Offit (Kenneth); J. Simard (Jacques)
2012-01-01
textabstractBackground: Genome-wide association studies (GWAS) identified variants at 19p13.1 and ZNF365 (10q21.2) as risk factors for breast cancer among BRCA1 and BRCA2 mutation carriers, respectively. We explored associations with ovarian cancer and with breast cancer by tumor histopathology for
Couch, Fergus J.; Gaudet, Mia M.; Antoniou, Antonis C.; Ramus, Susan J.; Kuchenbaecker, Karoline B.; Soucy, Penny; Beesley, Jonathan; Chen, Xiaoqing; Wang, Xianshu; Kirchhoff, Tomas; McGuffog, Lesley; Barrowdale, Daniel; Lee, Andrew; Healey, Sue; Sinilnikova, Olga M.; Andrulis, Irene L.; Ozcelik, Hilmi; Mulligan, Anna Marie; Thomassen, Mads; Gerdes, Anne-Marie; Jensen, Uffe Birk; Skytte, Anne-Bine; Kruse, Torben A.; Caligo, Maria A.; von Wachenfeldt, Anna; Barbany-Bustinza, Gisela; Loman, Niklas; Soller, Maria; Ehrencrona, Hans; Karlsson, Per; Nathanson, Katherine L.; Rebbeck, Timothy R.; Domchek, Susan M.; Jakubowska, Ania; Lubinski, Jan; Jaworska, Katarzyna; Durda, Katarzyna; Zlowocka, Elzbieta; Huzarski, Tomasz; Byrski, Tomasz; Gronwald, Jacek; Cybulski, Cezary; Górski, Bohdan; Osorio, Ana; Durán, Mercedes; Tejada, María Isabel; Benitez, Javier; Hamann, Ute; Hogervorst, Frans B. L.; van Os, Theo A.; van Leeuwen, Flora E.; Meijers-Heijboer, Hanne E. J.; Wijnen, Juul; Blok, Marinus J.; Kets, Marleen; Hooning, Maartje J.; Oldenburg, Rogier A.; Ausems, Margreet G. E. M.; Peock, Susan; Frost, Debra; Ellis, Steve D.; Platte, Radka; Fineberg, Elena; Evans, D. Gareth; Jacobs, Chris; Eeles, Rosalind A.; Adlard, Julian; Davidson, Rosemarie; Eccles, Diana M.; Cole, Trevor; Cook, Jackie; Paterson, Joan; Brewer, Carole; Douglas, Fiona; Hodgson, Shirley V.; Morrison, Patrick J.; Walker, Lisa; Porteous, Mary E.; Kennedy, M. John; Side, Lucy E.; Bove, Betsy; Godwin, Andrew K.; Stoppa-Lyonnet, Dominique; Fassy-Colcombet, Marion; Castera, Laurent; Cornelis, François; Mazoyer, Sylvie; Léoné, Mélanie; Boutry-Kryza, Nadia; Bressac-de Paillerets, Brigitte; Caron, Olivier; Pujol, Pascal; Coupier, Isabelle; Delnatte, Capucine; Akloul, Linda; Lynch, Henry T.; Snyder, Carrie L.; Buys, Saundra S.; Daly, Mary B.; Terry, Marybeth; Chung, Wendy K.; John, Esther M.; Miron, Alexander; Southey, Melissa C.; Hopper, John L.; Goldgar, David E.; Singer, Christian F.; Rappaport, Christine; tea, Muy-Kheng M.; Fink-Retter, Anneliese; Hansen, Thomas V. O.; Nielsen, Finn C.; Arason, Aðalgeir; Vijai, Joseph; Shah, Sohela; Sarrel, Kara; Robson, Mark E.; Piedmonte, Marion; Phillips, Kelly; Basil, Jack; Rubinstein, Wendy S.; Boggess, John; Wakeley, Katie; Ewart-Toland, Amanda; Montagna, Marco; Agata, Simona; Imyanitov, Evgeny N.; Isaacs, Claudine; Janavicius, Ramunas; Lazaro, Conxi; Blanco, Ignacio; Feliubadalo, Lidia; Brunet, Joan; Gayther, Simon A.; Pharoah, Paul P. D.; Odunsi, Kunle O.; Karlan, Beth Y.; Walsh, Christine S.; Olah, Edith; teo, Soo Hwang; Ganz, Patricia A.; Beattie, Mary S.; van Rensburg, Elizabeth J.; Dorfling, Cecelia M.; Diez, Orland; Kwong, Ava; Schmutzler, Rita K.; Wappenschmidt, Barbara; Engel, Christoph; Meindl, Alfons; Ditsch, Nina; Arnold, Norbert; Heidemann, Simone; Niederacher, Dieter; Preisler-Adams, Sabine; Gadzicki, Dorothea; Varon-Mateeva, Raymonda; Deissler, Helmut; Gehrig, Andrea; Sutter, Christian; Kast, Karin; Fiebig, Britta; Heinritz, Wolfram; Caldes, Trinidad; de la Hoya, Miguel; Muranen, Taru A.; Nevanlinna, Heli; Tischkowitz, Marc D.; Spurdle, Amanda B.; Neuhausen, Susan L.; Ding, Yuan Chun; Lindor, Noralane M.; Fredericksen, Zachary; Pankratz, V. Shane; Peterlongo, Paolo; Manoukian, Siranoush; Peissel, Bernard; Zaffaroni, Daniela; Barile, Monica; Bernard, Loris; Viel, Alessandra; Giannini, Giuseppe; Varesco, Liliana; Radice, Paolo; Greene, Mark H.; Mai, Phuong L.; Easton, Douglas F.; Chenevix-Trench, Georgia; Offit, Kenneth; Simard, Jacques
2012-01-01
Background: Genome-wide association studies (GWAS) identified variants at 19p13.1 and ZNF365 (10q21.2) as risk factors for breast cancer among BRCA1 and BRCA2 mutation carriers, respectively. We explored associations with ovarian cancer and with breast cancer by tumor histopathology for these
Activating mutation in MET oncogene in familial colorectal cancer
Directory of Open Access Journals (Sweden)
Schildkraut Joellen M
2011-10-01
Full Text Available Abstract Background In developed countries, the lifetime risk of developing colorectal cancer (CRC is 5%, and it is the second leading cause of death from cancer. The presence of family history is a well established risk factor with 25-35% of CRCs attributable to inherited and/or familial factors. The highly penetrant inherited colon cancer syndromes account for approximately 5%, leaving greater than 20% without clear genetic definition. Familial colorectal cancer has been linked to chromosome 7q31 by multiple affected relative pair studies. The MET proto-oncogene which resides in this chromosomal region is considered a candidate for genetic susceptibility. Methods MET exons were amplified by PCR from germline DNA of 148 affected sibling pairs with colorectal cancer. Amplicons with altered sequence were detected with high-resolution melt-curve analysis using a LightScanner (Idaho Technologies. Samples demonstrating alternative melt curves were sequenced. A TaqMan assay for the specific c.2975C >T change was used to confirm this mutation in a cohort of 299 colorectal cancer cases and to look for allelic amplification in tumors. Results Here we report a germline non-synonymous change in the MET proto-oncogene at amino acid position T992I (also reported as MET p.T1010I in 5.2% of a cohort of sibling pairs affected with CRC. This genetic variant was then confirmed in a second cohort of individuals diagnosed with CRC and having a first degree relative with CRC at prevalence of 4.1%. This mutation has been reported in cancer cells of multiple origins, including 2.5% of colon cancers, and in Conclusions Although the MET p.T992I genetic mutation is commonly found in somatic colorectal cancer tissues, this is the first report also implicating this MET genetic mutation as a germline inherited risk factor for familial colorectal cancer. Future studies on the cancer risks associated with this mutation and the prevalence in different at-risk populations will
DEFF Research Database (Denmark)
Ramus, Susan J; Antoniou, Antonis C; Kuchenbaecker, Karoline B
2012-01-01
Germline mutations in BRCA1 and BRCA2 are associated with increased risks of breast and ovarian cancer. A genome-wide association study (GWAS) identified six alleles associated with risk of ovarian cancer for women in the general population. We evaluated four of these loci as potential modifiers ...
Ramus, Susan J.; Antoniou, Antonis C.; Kuchenbaecker, Karoline B.; Soucy, Penny; Beesley, Jonathan; Chen, Xiaoqing; McGuffog, Lesley; Sinilnikova, Olga M.; Healey, Sue; Barrowdale, Daniel; Lee, Andrew; Thomassen, Mads; Gerdes, Anne-Marie; Kruse, Torben A.; Jensen, Uffe Birk; Skytte, Anne-Bine; Caligo, Maria A.; Liljegren, Annelie; Lindblom, Annika; Olsson, Håkan; Kristoffersson, Ulf; Stenmark-Askmalm, Marie; Melin, Beatrice; Domchek, Susan M.; Nathanson, Katherine L.; Rebbeck, Timothy R.; Jakubowska, Anna; Lubinski, Jan; Jaworska, Katarzyna; Durda, Katarzyna; Złowocka, Elżbieta; Gronwald, Jacek; Huzarski, Tomasz; Byrski, Tomasz; Cybulski, Cezary; Toloczko-Grabarek, Aleksandra; Osorio, Ana; Benitez, Javier; Duran, Mercedes; Tejada, Maria-Isabel; Hamann, Ute; Rookus, Matti; van Leeuwen, Flora E.; Aalfs, Cora M.; Meijers-Heijboer, Hanne E. J.; van Asperen, Christi J.; van Roozendaal, K. E. P.; Hoogerbrugge, Nicoline; Collée, J. Margriet; Kriege, Mieke; van der Luijt, Rob B.; Peock, Susan; Frost, Debra; Ellis, Steve D.; Platte, Radka; Fineberg, Elena; Evans, D. Gareth; Lalloo, Fiona; Jacobs, Chris; Eeles, Ros; Adlard, Julian; Davidson, Rosemarie; Eccles, Diana; Cole, Trevor; Cook, Jackie; Paterson, Joan; Douglas, Fiona; Brewer, Carole; Hodgson, Shirley; Morrison, Patrick J.; Walker, Lisa; Porteous, Mary E.; Kennedy, M. John; Pathak, Harsh; Godwin, Andrew K.; Stoppa-Lyonnet, Dominique; Caux-Moncoutier, Virginie; de Pauw, Antoine; Gauthier-Villars, Marion; Mazoyer, Sylvie; Léoné, Mélanie; Calender, Alain; Lasset, Christine; Bonadona, Valérie; Hardouin, Agnès; Berthet, Pascaline; Bignon, Yves-Jean; Uhrhammer, Nancy; Faivre, Laurence; Loustalot, Catherine; Buys, Saundra; Daly, Mary; Miron, Alex; Terry, Mary Beth; Chung, Wendy K.; John, Esther M.; Southey, Melissa; Goldgar, David; Singer, Christian F.; tea, Muy-Kheng; Pfeiler, Georg; Fink-Retter, Anneliese; Hansen, Thomas v O.; Ejlertsen, Bent; Johannsson, Oskar Th; Offit, Kenneth; Kirchhoff, Tomas; Gaudet, Mia M.; Vijai, Joseph; Robson, Mark; Piedmonte, Marion; Phillips, Kelly-Anne; van Le, Linda; Hoffman, James S.; Ewart Toland, Amanda; Montagna, Marco; Tognazzo, Silvia; Imyanitov, Evgeny; Issacs, Claudine; Janavicius, Ramunas; Lazaro, Conxi; Blanco, Iganacio; Tornero, Eva; Navarro, Matilde; Moysich, Kirsten B.; Karlan, Beth Y.; Gross, Jenny; Olah, Edith; Vaszko, Tibor; teo, Soo-Hwang; Ganz, Patricia A.; Beattie, Mary S.; Dorfling, Cecelia M.; van Rensburg, Elizabeth J.; Diez, Orland; Kwong, Ava; Schmutzler, Rita K.; Wappenschmidt, Barbara; Engel, Christoph; Meindl, Alfons; Ditsch, Nina; Arnold, Norbert; Heidemann, Simone; Niederacher, Dieter; Preisler-Adams, Sabine; Gadzicki, Dorotehea; Varon-Mateeva, Raymonda; Deissler, Helmut; Gehrig, Andrea; Sutter, Christian; Kast, Karin; Fiebig, Britta; Schäfer, Dieter; Caldes, Trinidad; de la Hoya, Miguel; Nevanlinna, Heli; Aittomäki, Kristiina; Plante, Marie; Spurdle, Amanda B.; Neuhausen, Susan L.; Ding, Yuan Chun; Wang, Xianshu; Lindor, Noralane; Fredericksen, Zachary; Pankratz, V. Shane; Peterlongo, Paolo; Manoukian, Siranoush; Peissel, Bernard; Zaffaroni, Daniela; Bonanni, Bernardo; Bernard, Loris; Dolcetti, Riccardo; Papi, Laura; Ottini, Laura; Radice, Paolo; Greene, Mark H.; Mai, Phuong L.; Andrulis, Irene L.; Glendon, Gord; Ozcelik, Hilmi; Pharoah, Paul D. P.; Gayther, Simon A.; Simard, Jacques; Easton, Douglas F.; Couch, Fergus J.; Chenevix-Trench, Georgia; Miedzybrodzka, Zosia; Gregory, Helen; Morrison, Patrick; Jeffers, Lisa; Ong, Kai-Ren; Hoffman, Jonathan; Donaldson, Alan; James, Margaret; Downing, Sarah; Taylor, Amy; Murray, Alexandra; Rogers, Mark T.; McCann, Emma; Barton, David; Porteous, Mary; Drummond, Sarah; Kivuva, Emma; Searle, Anne; Goodman, Selina; Hill, Kathryn; Murday, Victoria; Bradshaw, Nicola; Snadden, Lesley; Longmuir, Mark; Watt, Catherine; Gibson, Sarah; Haque, Eshika; Tobias, Ed; Duncan, Alexis; Izatt, Louise; Langman, Caroline; Whaite, Anna; Dorkins, Huw; Barwell, Julian; Serra-Feliu, Gemma; Ellis, Ian; Houghton, Catherine; Taylor, Jane; Side, Lucy; Male, Alison; Berlin, Cheryl; Eason, Jacqueline; Collier, Rebecca; Claber, Oonagh; Jobson, Irene; McLeod, Diane; Halliday, Dorothy; Durell, Sarah; Stayner, Barbara; Shanley, Susan; Rahman, Nazneen; Houlston, Richard; Bancroft, Elizabeth; D'Mello, Lucia; Page, Elizabeth; Ardern-Jones, Audrey; Kohut, Kelly; Wiggins, Jennifer; Castro, Elena; Mitra, Anita; Robertson, Lisa; Quarrell, Oliver; Bardsley, Cathryn; Goff, Sheila; Brice, Glen; Winchester, Lizzie; Eddy, Charlotte; Tripathi, Vishakha; Attard, Virginia; Lucassen, Anneke; Crawford, Gillian; McBride, Donna; Smalley, Sarah; Sinilnikova, Olga; Barjhoux, Laure; Verny-Pierre, Carole; Giraud, Sophie; Léone, Mélanie; Buecher, Bruno; Houdayer, Claude; Moncoutier, Virginie; Belotti, Muriel; Tirapo, Carole; Bressac-de-Paillerets, Brigitte; Remenieras, Audrey; Byrede, Véronique; Caron, Olivier; Lenoir, Gilbert; Urhammer, Nancy; Sobol, Hagay; Bourdon, Violaine; Noguchi, Tetsuro; Eisinger, François; Coulet, Florence; Colas, Chrystelle; Soubrier, Florent; Coupier, Isabelle; Pujol, Pascal; Peyrat, Jean-Philippe; Fournier, Joëlle; Révilliion, Françoise; Vennin, Philippe; Adenis, Claude; Rouleau, Etienne; Lidereau, Rosette; Demange, Liliane; Nogues, Catherine; Muller, Danièle; Fricker, Jean-Pierre; Barouk-Simonet, Emmanuelle; Bonnet, Françoise; Bubien, Virginie; Sevenet, Nicolas; Longy, Michel; Toulas, Christine; Guimbaud, Rosine; Gladieff, Laurence; Feillel, Viviane; Leroux, Dominique; Dreyfus, Hélène; Rebischung, Christine; Peysselon, Megalie; Coron, Fanny; Prieur, Fabienne; Lebrun, Marine; Kientz, Caroline; Frénay, Marc; Vénat-Bouvet, Laurence; Delnatte, Capucine; Mortemousque, Isabelle; Lynch, Henry T.; Snyder, Carrie L.; Hogervorst, F. B. L.; Verhoef, S.; Verheus, M.; van't Veer, L. J.; van Leeuwen, F. E.; Collée, M.; van den Ouweland, A. M. W.; Jager, A.; Hooning, M. J.; Tilanus-Linthorst, M. M. A.; Seynaeve, C.; van Asperen, C. J.; Wijnen, J. T.; Vreeswijk, M. P.; Tollenaar, R. A.; Devilee, P.; Ligtenberg, M. J.; Hoogerbrugge, N.; Ausems, M. G.; van der Luijt, R. B.; van Os, T. A.; Gille, J. J. P.; Waisfisz, Q.; Gomez-Garcia, E. B.; van Roozendaal, C. E.; Blok, Marinus J.; Caanen, B.; Oosterwijk, J. C.; van der Hout, A. H.; Mourits, M. J.; Vasen, H. F.; Thorne, Heather; Niedermayr, Eveline; Gill, Mona; Collins, Lucine; Gokgoz, Nalan; Selander, Teresa; Weerasooriya, Nayana; Karlsson, Per; Nordlilng, Margareta; Bergman, Annika; Einbeigi, Zakaria; Liedgren, Sigrun; Borg, Åke; Loman, Niklas; Soller, Maria; Jernström, Helena; Harbst, Katja; Henriksson, Karin; Arver, Brita; von Wachenfeldt, Anna; Barbany-Bustinza, Gisela; Rantala, Johanna; Grönberg, Henrik; Stattin, Eva-Lena; Emanuelsson, Monica; Ehrencrona, Hans; Rosenquist, Richard; Dahl, Niklas
2012-01-01
Germline mutations in BRCA1 and BRCA2 are associated with increased risks of breast and ovarian cancer. A genome-wide association study (GWAS) identified six alleles associated with risk of ovarian cancer for women in the general population. We evaluated four of these loci as potential modifiers of
Genetic variation at 9p22.2 and ovarian cancer risk for BRCA1 and BRCA2 mutation carriers
DEFF Research Database (Denmark)
Ramus, Susan J; Kartsonaki, Christiana; Gayther, Simon A
2011-01-01
Background Germline mutations in the BRCA1 and BRCA2 genes are associated with increased risks of breast and ovarian cancers. Although several common variants have been associated with breast cancer susceptibility in mutation carriers, none have been associated with ovarian cancer susceptibility....
Shastry, B S; Pendergast, S D; Hartzer, M K; Liu, X; Trese, M T
1997-05-01
Retinopathy of prematurity (ROP) is a retinal vascular disease occurring in infants with short gestational age and low birth weight and can lead to retinal detachment (ROP stages 4 and 5). X-linked familial exudative vitreoretinopathy is phenotypically similar to ROP and has been associated with mutations in the Norrie disease (ND) gene in some cases. To determine if similar mutations in the ND gene may play a role in the development of advanced ROP. Clinical examination and molecular genetic analysis were performed on 16 children, including 2 dizygotic and 1 monozygotic twin pairs, and their parents from 13 families. Sequencing of the amplified products revealed missense mutations (R121W and L108P) in the third exon of the ND gene in 4 patients. These mutations were not present in an unaffected premature twin, 2 children with regressed stage 3 ROP, the parents, or in 50 unrelated healthy control subjects. These findings suggest that mutations in the ND gene may play a role in the development of severe ROP in premature infants.
Park, C W; Lim, J H; Youn, D-Y; Chung, S; Lim, M-H; Kim, Y K; Chang, Y S; Lee, J-H
2011-02-01
Bartter syndrome (BS) Type IV, associated with a G47R mutation in the BSND gene, is known to result in a mild renal phenotype. However, we report here on three brothers with varying degrees of renal dysfunction from mild to end-stage renal disease associated with renal barttin and ClC-K expression. The brothers had histories of polyhydramnios, prematurity, polyuria, deafness, and small body size. Laboratory findings showed hypokalemic metabolic alkalosis, normotensive hyperreninemic hyperaldosteronism, and an increased urinary excretion of sodium, potassium and chloride, consistent with BS Type IV. Microscopic examination of renal tissue showed hyperplasia of cells at the juxtaglomerular apparatus with dilated atrophic tubules and tubulointerstitial fibrosis. A weak barttin signal related to CIC-K expression in the cytoplasm of tubule cells, but not the basement membrane, was noted. A sequence analysis of the BSND gene showed that the affected males were homozygous for a missense G47R mutation in exon 1 of BSND. These findings suggest that the G47R mutation results in a dramatic decrease in barttin expression, which appears to be related to the location of CIC-K being changed from the basement membrane to the cytoplasm in the tubule and might have varying effects on renal function associated with factors other than this gene.
Bezzina, Connie R.; Rook, Martin B.; Groenewegen, W. Antoinette; Herfst, Lucas J.; van der Wal, Allard C.; Lam, Jan; Jongsma, Habo J.; Wilde, Arthur A. M.; Mannens, Marcel M. A. M.
2003-01-01
Cardiac conduction defects associate with mutations in SCN5A, the gene encoding the cardiac Na+ channel. In the present study, we characterized a family in which the proband was born in severe distress with irregular wide complex tachycardia. His older sister died at 1 year of age from severe
Directory of Open Access Journals (Sweden)
Yi-Hung Carol Tan
2010-01-01
Full Text Available Non-small cell lung cancer (NSCLC is a heterogeneous group of disorders with a number of genetic and proteomic alterations. c-CBL is an E3 ubiquitin ligase and adaptor molecule important in normal homeostasis and cancer. We determined the genetic variations of c-CBL, relationship to receptor tyrosine kinases (EGFR and MET, and functionality in NSCLC.Using archival formalin-fixed paraffin embedded (FFPE extracted genomic DNA, we show that c-CBL mutations occur in somatic fashion for lung cancers. c-CBL mutations were not mutually exclusive of MET or EGFR mutations; however they were independent of p53 and KRAS mutations. In normal/tumor pairwise analysis, there was significant loss of heterozygosity (LOH for the c-CBL locus (22%, n = 8/37 and none of these samples revealed any mutation in the remaining copy of c-CBL. The c-CBL LOH also positively correlated with EGFR and MET mutations observed in the same samples. Using select c-CBL somatic mutations such as S80N/H94Y, Q249E and W802* (obtained from Caucasian, Taiwanese and African-American samples, respectively transfected in NSCLC cell lines, there was increased cell viability and cell motility.Taking the overall mutation rate of c-CBL to be a combination as somatic missense mutation and LOH, it is clear that c-CBL is highly mutated in lung cancers and may play an essential role in lung tumorigenesis and metastasis.
Imputation of the rare HOXB13 G84E mutation and cancer risk in a large population-based cohort.
Directory of Open Access Journals (Sweden)
Thomas J Hoffmann
2015-01-01
Full Text Available An efficient approach to characterizing the disease burden of rare genetic variants is to impute them into large well-phenotyped cohorts with existing genome-wide genotype data using large sequenced referenced panels. The success of this approach hinges on the accuracy of rare variant imputation, which remains controversial. For example, a recent study suggested that one cannot adequately impute the HOXB13 G84E mutation associated with prostate cancer risk (carrier frequency of 0.0034 in European ancestry participants in the 1000 Genomes Project. We show that by utilizing the 1000 Genomes Project data plus an enriched reference panel of mutation carriers we were able to accurately impute the G84E mutation into a large cohort of 83,285 non-Hispanic White participants from the Kaiser Permanente Research Program on Genes, Environment and Health Genetic Epidemiology Research on Adult Health and Aging cohort. Imputation authenticity was confirmed via a novel classification and regression tree method, and then empirically validated analyzing a subset of these subjects plus an additional 1,789 men from Kaiser specifically genotyped for the G84E mutation (r2 = 0.57, 95% CI = 0.37–0.77. We then show the value of this approach by using the imputed data to investigate the impact of the G84E mutation on age-specific prostate cancer risk and on risk of fourteen other cancers in the cohort. The age-specific risk of prostate cancer among G84E mutation carriers was higher than among non-carriers. Risk estimates from Kaplan-Meier curves were 36.7% versus 13.6% by age 72, and 64.2% versus 24.2% by age 80, for G84E mutation carriers and non-carriers, respectively (p = 3.4x10-12. The G84E mutation was also associated with an increase in risk for the fourteen other most common cancers considered collectively (p = 5.8x10-4 and more so in cases diagnosed with multiple cancer types, both those including and not including prostate cancer, strongly suggesting
Zavitsanos, Peter J; Wazer, David E; Hepel, Jaroslaw T; Wang, Yihong; Singh, Kamaljeet; Leonard, Kara L
2018-05-18
Brain metastases (BM) occur in ∼5% of breast cancer patients. BRCA1-associated cancers are often basal-like and basal-like cancers are known to have a predilection for central nervous system metastases. We performed a matched-pair analysis of breast cancer patients with and without BRCA mutations and compared the frequency of BM in both groups. From a database of 1935 patients treated for localized breast cancer at our institution from 2009 to 2014 we identified 20 patients with BRCA1 or BRCA2 mutations and manually matched 40 patients without BRCA mutations accounting for age, stage, estrogen receptor expression, and human epidermal growth factor receptor 2 (HER2) expression. Comparisons of freedom from brain metastasis, brain metastasis-free survival, and overall survival were made using the log rank test. Testing for a basal-type phenotype using the immunohistochemistry definition (ER/PR/HER2 and either CK 5/6 or EGFR) was performed for BRCA patients who developed BM and their matched controls. We analyzed 60 patients: 20 BRCA and 40 were matched controls. Median follow-up was 37 and 49 months, respectively. Three years freedom from brain metastasis was 84% for BRCA patients and 97% for BRCA controls (P=0.049). Three years brain metastasis-free survival was 84% and 97% for the BRCA+ and controls, respectively (P=0.176). Mean time to brain failure was 11 months from diagnosis for the BRCA patients. All 3 BRCA1 patients who developed BM were of a basal-type triple negative phenotype. Breast cancer patients with germline BRCA1 mutations appear to have a shorter interval to brain progression while accounting for confounding factors.
Somatic mutations associated with MRI-derived volumetric features in glioblastoma
Energy Technology Data Exchange (ETDEWEB)
Gutman, David A.; Dunn, William D. [Emory University School of Medicine, Departments of Neurology, Atlanta, GA (United States); Emory University School of Medicine, Biomedical Informatics, Atlanta, GA (United States); Grossmann, Patrick; Alexander, Brian M. [Harvard Medical School, Department of Radiation Oncology, Dana-Farber Cancer Institute, Brigham and Women' s Hospital, Boston, MA (United States); Cooper, Lee A.D. [Emory University School of Medicine, Biomedical Informatics, Atlanta, GA (United States); Georgia Institute of Technology, Department of Biomedical Engineering, Atlanta, GA (United States); Holder, Chad A. [Emory University School of Medicine, Radiology and Imaging Sciences, Atlanta, GA (United States); Ligon, Keith L. [Brigham and Women' s Hospital, Harvard Medical School, Pathology, Dana-Farber Cancer Institute, Boston, MA (United States); Aerts, Hugo J.W.L. [Harvard Medical School, Department of Radiation Oncology, Dana-Farber Cancer Institute, Brigham and Women' s Hospital, Boston, MA (United States); Brigham and Women' s Hospital, Harvard Medical School, Radiology, Dana-Farber Cancer Institute, Boston, MA (United States)
2015-12-15
MR imaging can noninvasively visualize tumor phenotype characteristics at the macroscopic level. Here, we investigated whether somatic mutations are associated with and can be predicted by MRI-derived tumor imaging features of glioblastoma (GBM). Seventy-six GBM patients were identified from The Cancer Imaging Archive for whom preoperative T1-contrast (T1C) and T2-FLAIR MR images were available. For each tumor, a set of volumetric imaging features and their ratios were measured, including necrosis, contrast enhancing, and edema volumes. Imaging genomics analysis assessed the association of these features with mutation status of nine genes frequently altered in adult GBM. Finally, area under the curve (AUC) analysis was conducted to evaluate the predictive performance of imaging features for mutational status. Our results demonstrate that MR imaging features are strongly associated with mutation status. For example, TP53-mutated tumors had significantly smaller contrast enhancing and necrosis volumes (p = 0.012 and 0.017, respectively) and RB1-mutated tumors had significantly smaller edema volumes (p = 0.015) compared to wild-type tumors. MRI volumetric features were also found to significantly predict mutational status. For example, AUC analysis results indicated that TP53, RB1, NF1, EGFR, and PDGFRA mutations could each be significantly predicted by at least one imaging feature. MRI-derived volumetric features are significantly associated with and predictive of several cancer-relevant, drug-targetable DNA mutations in glioblastoma. These results may shed insight into unique growth characteristics of individual tumors at the macroscopic level resulting from molecular events as well as increase the use of noninvasive imaging in personalized medicine. (orig.)
Somatic mutations associated with MRI-derived volumetric features in glioblastoma
International Nuclear Information System (INIS)
Gutman, David A.; Dunn, William D.; Grossmann, Patrick; Alexander, Brian M.; Cooper, Lee A.D.; Holder, Chad A.; Ligon, Keith L.; Aerts, Hugo J.W.L.
2015-01-01
MR imaging can noninvasively visualize tumor phenotype characteristics at the macroscopic level. Here, we investigated whether somatic mutations are associated with and can be predicted by MRI-derived tumor imaging features of glioblastoma (GBM). Seventy-six GBM patients were identified from The Cancer Imaging Archive for whom preoperative T1-contrast (T1C) and T2-FLAIR MR images were available. For each tumor, a set of volumetric imaging features and their ratios were measured, including necrosis, contrast enhancing, and edema volumes. Imaging genomics analysis assessed the association of these features with mutation status of nine genes frequently altered in adult GBM. Finally, area under the curve (AUC) analysis was conducted to evaluate the predictive performance of imaging features for mutational status. Our results demonstrate that MR imaging features are strongly associated with mutation status. For example, TP53-mutated tumors had significantly smaller contrast enhancing and necrosis volumes (p = 0.012 and 0.017, respectively) and RB1-mutated tumors had significantly smaller edema volumes (p = 0.015) compared to wild-type tumors. MRI volumetric features were also found to significantly predict mutational status. For example, AUC analysis results indicated that TP53, RB1, NF1, EGFR, and PDGFRA mutations could each be significantly predicted by at least one imaging feature. MRI-derived volumetric features are significantly associated with and predictive of several cancer-relevant, drug-targetable DNA mutations in glioblastoma. These results may shed insight into unique growth characteristics of individual tumors at the macroscopic level resulting from molecular events as well as increase the use of noninvasive imaging in personalized medicine. (orig.)
Lynch syndrome caused by germline PMS2 mutations: delineating the cancer risk
Broeke, S.W. ten; Brohet, R.M.; Tops, C.M.; Klift, H.M. van der; Velthuizen, M.E.; Bernstein, I.; Capella Munar, G.; Garcia, E.; Hoogerbrugge, N.; Letteboer, T.G.; Menko, F.H.; Lindblom, A.; Mensenkamp, A.R.; Moller, P.; Os, T.A. van; Rahner, N.; Redeker, B.J.; Sijmons, R.H.; Spruijt, L.; Suerink, M.; Vos, Y.J.; Wagner, A.; Hes, F.J.; Vasen, H.F.A.; Nielsen, M.; Wijnen, J.T.
2015-01-01
PURPOSE: The clinical consequences of PMS2 germline mutations are poorly understood compared with other Lynch-associated mismatch repair gene (MMR) mutations. The aim of this European cohort study was to define the cancer risk faced by PMS2 mutation carriers. METHODS: Data were collected from 98
Directory of Open Access Journals (Sweden)
George Papaxoinis
Full Text Available The PI3K-AKT pathway is frequently activated in breast cancer. PIK3CA mutations are most frequently found in the helical (exon 9 and kinase (exon 20 domains of this protein. The aim of the present study was to examine the role of different types of PIK3CA mutations in combination with molecular biomarkers related to PI3K-AKT signaling in patients with early breast cancer.Tumor tissue samples from 1008 early breast cancer patients treated with adjuvant chemotherapy in two similar randomized trials of HeCOG were examined. Tumors were subtyped with immunohistochemistry (IHC and FISH for ER, PgR, Ki67, HER2 and androgen receptor (AR. PIK3CA mutations were analyzed by Sanger sequencing (exon 20 and qPCR (exon 9 (Sanger/qPCR mutations. In 610 cases, next generation sequencing (NGS PIK3CA mutation data were also available. PIK3CA mutations and PTEN protein expression (IHC were analyzed in luminal tumors (ER and/or PgR positive, molecular apocrine carcinomas (MAC; ER/PgR negative / AR positive and hormone receptor (ER/PgR/AR negative tumors.PIK3CA mutations were detected in 235/1008 tumors (23% with Sanger/qPCR and in 149/610 tumors (24% with NGS. Concordance between the two methods was good with a Kappa coefficient of 0.76 (95% CI 0.69-0.82. Lobular histology, low tumor grade and luminal A tumors were associated with helical domain mutations (PIK3CAhel, while luminal B with kinase domain mutations (PIK3CAkin. The overall incidence of PIK3CA mutations was higher in luminal as compared to MAC and hormone receptor negative tumors (p = 0.004. Disease-free and overall survival did not significantly differ with respect to PIK3CA mutation presence and type. However, a statistically significant interaction between PIK3CA mutation status and PTEN low protein expression with regard to prognosis was identified.The present study did not show any prognostic significance of specific PIK3CA mutations in a large group of predominantly lymph-node positive breast cancer
DEFF Research Database (Denmark)
Couch, Fergus J; Gaudet, Mia M; Antoniou, Antonis C
2012-01-01
Genome-wide association studies (GWAS) identified variants at 19p13.1 and ZNF365 (10q21.2) as risk factors for breast cancer among BRCA1 and BRCA2 mutation carriers, respectively. We explored associations with ovarian cancer and with breast cancer by tumor histopathology for these variants in mut...
Germline Mutations and Polymorphisms in the Origins of Cancers in Women
Directory of Open Access Journals (Sweden)
Kim M. Hirshfield
2010-01-01
Full Text Available Several female malignancies including breast, ovarian, and endometrial cancers can be characterized based on known somatic and germline mutations. Initiation and propagation of tumors reflect underlying genomic alterations such as mutations, polymorphisms, and copy number variations found in genes of multiple cellular pathways. The contributions of any single genetic variation or mutation in a population depend on its frequency and penetrance as well as tissue-specific functionality. Genome wide association studies, fluorescence in situ hybridization, comparative genomic hybridization, and candidate gene studies have enumerated genetic contributors to cancers in women. These include p53, BRCA1, BRCA2, STK11, PTEN, CHEK2, ATM, BRIP1, PALB2, FGFR2, TGFB1, MDM2, MDM4 as well as several other chromosomal loci. Based on the heterogeneity within a specific tumor type, a combination of genomic alterations defines the cancer subtype, biologic behavior, and in some cases, response to therapeutics. Consideration of tumor heterogeneity is therefore important in the critical analysis of gene associations in cancer.
Khurshed, Mohammed; Aarnoudse, Niels; Hulsbos, Renske; Hira, Vashendriya V V; van Laarhoven, Hanneke W M; Wilmink, Johanna W; Molenaar, Remco J; van Noorden, Cornelis J F
2018-06-07
Isocitrate dehydrogenase ( IDH1)-1 is mutated in various types of human cancer, and the presence of this mutation is associated with improved responses to irradiation and chemotherapy in solid tumor cells. Mutated IDH1 (IDH1 MUT ) enzymes consume NADPH to produce d-2-hydroxyglutarate (d-2HG) resulting in the decreased reducing power needed for detoxification of reactive oxygen species (ROS), for example. The objective of the current study was to investigate the mechanism behind the chemosensitivity of the widely-used anticancer agent cisplatin in IDH1 MUT cancer cells. Oxidative stress, DNA damage, and mitochondrial dysfunction caused by cisplatin treatment were monitored in IDH1 MUT HCT116 colorectal cancer cells and U251 glioma cells. We found that exposure to cisplatin induced higher levels of ROS, DNA double-strand breaks (DSBs), and cell death in IDH1 MUT cancer cells, as compared with IDH1 wild-type ( IDH1 WT ) cells. Mechanistic investigations revealed that cisplatin treatment dose dependently reduced oxidative respiration in IDH1 MUT cells, which was accompanied by disturbed mitochondrial proteostasis, indicative of impaired mitochondrial activity. These effects were abolished by the IDH1 MUT inhibitor AGI-5198 and were restored by treatment with d-2HG. Thus, our study shows that altered oxidative stress responses and a vulnerable oxidative metabolism underlie the sensitivity of IDH1 MUT cancer cells to cisplatin.-Khurshed, M., Aarnoudse, N., Hulsbos, R., Hira, V. V. V., van Laarhoven, H. W. M., Wilmink, J. W., Molenaar, R. J., van Noorden, C. J. F. IDH1-mutated cancer cells are sensitive to cisplatin and an IDH1-mutant inhibitor counteracts this sensitivity.
Yang, Ching-Yao; Lin, Mong-Wei; Chang, Yih-Leong; Wu, Chen-Tu
2017-12-12
Globo H is a tumor-associated carbohydrate antigen exclusively expressed in cancer cells rather than normal tissue. Globo H has been found on many cancers of epithelial origins, and become an attractive target for cancer vaccine. We aimed to study the expression of Globo H in non-small cell lung cancer (NSCLC) patients, and correlated its expression with common driver mutations, clinical outcomes, and status of immune checkpoint, programmed death-ligand 1 (PD-L1). The study enrolled 228 patients with surgically resected stage I NSCLC, including 139 patients with adenocarcinoma (ADC) and 89 patients with squamous cell carcinoma (SqCC). Using immunohistochemistry, tumors with moderate to strong membranous staining in ⩾ 1% tumor cells per section were scored as positive Globo H expression. Driver mutations including EGFR, KRAS, BRAF were detected by direct sequencing, while ALK, PI3KCA, FGFR1 and PD-L1 expression was detected by immunohistochemical (IHC) staining. Positive Globo H expression was detected in 88 of the 228 (38.6%) patients. These included 51 of 139 (36.7%) patients with ADC and 37 of 89 (41.6%) patients with SqCC. Positive Globo H expression was significantly associated with EGFR mutation and PD-L1 expression in the ADC group, and PI3KCA overexpression in the SqCC group. The survival analysis showed that Globo H expression was not an independent prognostic factor in stage I NSCLC. Globo H expression was correlated with specific driver mutations in ADC and SqCC NSCLC tumors, as well as PD-L1 status. Immunotherapy targeting Globo H may have potential application in lung cancer treatment.
Lynch Syndrome Caused by Germline PMS2 Mutations: Delineating the Cancer Risk
ten Broeke, Sanne W.; Brohet, Richard M.; Tops, Carli M.; van der Klift, Heleen M.; Velthuizen, Mary E.; Bernstein, Inge; Capellá Munar, Gabriel; Gomez Garcia, Encarna; Hoogerbrugge, Nicoline; Letteboer, Tom G. W.; Menko, Fred H.; Lindblom, Annika; Mensenkamp, Arjen R.; Moller, Pal; van Os, Theo A.; Rahner, Nils; Redeker, Bert J. W.; Sijmons, Rolf H.; Spruijt, Liesbeth; Suerink, Manon; Vos, Yvonne J.; Wagner, Anja; Hes, Frederik J.; Vasen, Hans F.; Nielsen, Maartje; Wijnen, Juul T.
2015-01-01
Purpose The clinical consequences of PMS2 germline mutations are poorly understood compared with other Lynch-associated mismatch repair gene (MMR) mutations. The aim of this European cohort study was to define the cancer risk faced by PMS2 mutation carriers. Methods Data were collected from 98 PMS2
Lynch Syndrome Caused by Germline PMS2 Mutations : Delineating the Cancer Risk
ten Broeke, Sanne W.; Brohet, Richard M.; Tops, Carli M.; van der Klift, Heleen M.; Velthuizen, Mary E.; Bernstein, Inge; Capella Munar, Gabriel; Garcia, Encarna Gomez; Hoogerbrugge, Nicoline; Letteboer, Tom G. W.; Menko, Fred H.; Lindblom, Annika; Mensenkamp, Arjen R.; Moller, Pal; Van Os, Theo A.; Rahner, Nils; Redeker, Bert J. W.; Sijmons, Rolf H.; Spruijt, Liesbeth; Suerink, Manon; Vos, Yvonne J.; Wagner, Anja; Hes, Frederik J.; Vasen, Hans F.; Nielsen, Maartje; Wijnen, Juul T.
2015-01-01
Purpose The clinical consequences of PMS2 germline mutations are poorly understood compared with other Lynch-associated mismatch repair gene (MMR) mutations. The aim of this European cohort study was to define the cancer risk faced by PMS2 mutation carriers. Methods Data were collected from 98 PMS2
A simple algebraic cancer equation: calculating how cancers may arise with normal mutation rates
Directory of Open Access Journals (Sweden)
Shibata Darryl
2010-01-01
Full Text Available Abstract Background The purpose of this article is to present a relatively easy to understand cancer model where transformation occurs when the first cell, among many at risk within a colon, accumulates a set of driver mutations. The analysis of this model yields a simple algebraic equation, which takes as inputs the number of stem cells, mutation and division rates, and the number of driver mutations, and makes predictions about cancer epidemiology. Methods The equation [p = 1 - (1 - (1 - (1 - udkNm ] calculates the probability of cancer (p and contains five parameters: the number of divisions (d, the number of stem cells (N × m, the number of critical rate-limiting pathway driver mutations (k, and the mutation rate (u. In this model progression to cancer "starts" at conception and mutations accumulate with cell division. Transformation occurs when a critical number of rate-limiting pathway mutations first accumulates within a single stem cell. Results When applied to several colorectal cancer data sets, parameter values consistent with crypt stem cell biology and normal mutation rates were able to match the increase in cancer with aging, and the mutation frequencies found in cancer genomes. The equation can help explain how cancer risks may vary with age, height, germline mutations, and aspirin use. APC mutations may shorten pathways to cancer by effectively increasing the numbers of stem cells at risk. Conclusions The equation illustrates that age-related increases in cancer frequencies may result from relatively normal division and mutation rates. Although this equation does not encompass all of the known complexity of cancer, it may be useful, especially in a teaching setting, to help illustrate relationships between small and large cancer features.
ATM/RB1 mutations predict shorter overall survival in urothelial cancer.
Yin, Ming; Grivas, Petros; Emamekhoo, Hamid; Mendiratta, Prateek; Ali, Siraj; Hsu, JoAnn; Vasekar, Monali; Drabick, Joseph J; Pal, Sumanta; Joshi, Monika
2018-03-30
Mutations of DNA repair genes, e.g. ATM/RB1 , are frequently found in urothelial cancer (UC) and have been associated with better response to cisplatin-based chemotherapy. Further external validation of the prognostic value of ATM/RB1 mutations in UC can inform clinical decision making and trial designs. In the discovery dataset, ATM/RB1 mutations were present in 24% of patients and were associated with shorter OS (adjusted HR 2.67, 95% CI, 1.45-4.92, p = 0.002). There was a higher mutation load in patients carrying ATM/RB1 mutations (median mutation load: 6.7 versus 5.5 per Mb, p = 0.072). In the validation dataset, ATM/RB1 mutations were present in 22.2% of patients and were non-significantly associated with shorter OS (adjusted HR 1.87, 95% CI, 0.97-3.59, p = 0.06) and higher mutation load (median mutation load: 8.1 versus 7.2 per Mb, p = 0.126). Exome sequencing data of 130 bladder UC patients from The Cancer Genome Atlas (TCGA) dataset were analyzed as a discovery cohort to determine the prognostic value of ATM/RB1 mutations. Results were validated in an independent cohort of 81 advanced UC patients. Cox proportional hazard regression analysis was performed to calculate the hazard ratio (HR) and 95% confidence interval (CI) to compare overall survival (OS). ATM/RB1 mutations may be a biomarker of poor prognosis in unselected UC patients and may correlate with higher mutational load. Further studies are required to determine factors that can further stratify prognosis and evaluate predictive role of ATM/RB1 mutation status to immunotherapy and platinum-based chemotherapy.
Directory of Open Access Journals (Sweden)
Yunus Kasım Terzi
2016-12-01
Full Text Available Objective: Hemochromatosis is an autosomal recessive disease that is one of the most important reasons for iron overload. Sickle cell disease is a hemoglobinopathy that occurs as a result of a homozygous mutation in the hemoglobin gene. Erythrocyte transfusion is frequently used in the treatment of this disease. Iron overload as a result of transfusion is important in the mortality and morbidity of sickle cell anemia patients as well as in other hemoglobinopathies. In this study, the effect of hemochromatosis gene (HFE p.H63D and p.C282Y mutations on transfusion-related cardiac and liver iron overload in sickle cell disease patients who carry homozygous hemoglobin S mutation has been investigated. Materials and Methods: This is a prospective single-center crosssectional study in patients with homozygous hemoglobin S mutation between the years 2008 and 2013. The patients were divided into two groups. The first group (group A, n=31 was receiving chelation therapy and the second group (group B, n=13 was not. Direct and indirect iron loads were analyzed by magnetic resonance imaging and biochemically, respectively. HFE gene mutations were analyzed by polymerase chain reaction-restriction fragment length polymorphism method. Statistical analyses were performed by independent samples t-test. Results: p.H63D mutation was detected in 10 (32.3% patients in group A and in only 1 patient (7.7% in group B. When the 2 groups were compared for iron overload, iron deposition in the liver was significantly higher in group B (p=0.046. In addition, in group A, iron deposition was significantly higher in HFE mutation carriers compared to patients without the mutation (p=0.05. Conclusion: Results of this study showed that HFE gene mutations are important in iron deposition in the liver in patients with sickle cell disease.
Sahasrabudhe, Ruta; Lott, Paul; Bohorquez, Mabel; Toal, Ted; Estrada, Ana P.; Suarez, John J.; Brea-Fernández, Alejandro; Cameselle-Teijeiro, José; Pinto, Carla; Ramos, Irma; Mantilla, Alejandra; Prieto, Rodrigo; Corvalan, Alejandro; Norero, Enrique; Alvarez, Carolina; Tapia, Teresa; Carvallo, Pilar; Gonzalez, Luz M.; Cock-Rada, Alicia; Solano, Angela; Neffa, Florencia; Valle, Adriana Della; Yau, Chris; Soares, Gabriela; Borowsky, Alexander; Hu, Nan; He, Li-Ji; Han, Xiao-You; Taylor, Philip R.; Goldstein, Alisa M.; Torres, Javier; Echeverry, Magdalena; Ruiz-Ponte, Clara; Teixeira, Manuel R.; Carvajal Carmona, Luis G.
2016-01-01
Up to 10% of cases of gastric cancer are familial, but so far, only mutations in CDH1 have been associated with gastric cancer risk. To identify genetic variants that affect risk for gastric cancer, we collected blood samples from 28 patients with hereditary diffuse gastric cancer (HDGC) not associated with mutations in CDH1 and performed whole-exome sequence analysis. We then analyzed sequences of candidate genes in 333 independent HDGC and non-HDGC cases. We identified 11 cases with mutations in PALB2, BRCA1, or RAD51C genes, which regulate homologous DNA recombination. We found these mutations in 2 of 31 patients with HDGC (6.5%) and 9 of 331 patients with sporadic gastric cancer (2.8%). Most of these mutations had been previously associated with other types of tumors and partially co-segregated with gastric cancer in our study. Tumors that developed in patients with these mutations had a mutation signature associated with somatic homologous recombination deficiency. Our findings indicate that defects in homologous recombination increase risk for gastric cancer. PMID:28024868
Directory of Open Access Journals (Sweden)
Eriko Fujita-Jimbo
Full Text Available Little is known about the molecular pathogenesis of Autism spectrum disorder (ASD, a neurodevelopmental disorder. Here we identified two mutations in the G-protein-coupled receptor 37 gene (GPR37 localized on chromosome 7q31-33, called the AUTS1 region, of ASD patients; 1585-1587 ttc del (Del312F in one Japanese patient and G2324A (R558Q in one Caucasian patient. The Del312F was located in the conserved transmembrane domain, and the R558Q was located in a conserved region just distal to the last transmembrane domain. In addition, a potential ASD-related GPR37 variant, T589M, was found in 7 affected Caucasian men from five different families. Our results suggested that some alleles in GPR37 were related to the deleterious effect of ASD. GPR37 is associated with the dopamine transporter to modulate dopamine uptake, and regulates behavioral responses to dopaminergic drugs. Thus, dopaminergic neurons may be involved in the ASD. However, we also detected the Del321F mutation in the patient's unaffected father and R558Q in not only an affected brother but also an unaffected mother. The identification of unaffected parents that carried the mutated alleles suggested that the manifestation of ASD was also influenced by factors other than these mutations, including endoplasmic reticulum stress of the mutated proteins or gender. Our study will provide the new insight into the molecular pathogenesis of ASD.
DEFF Research Database (Denmark)
Park, Jae-Gahb; Kim, Duck-Woo; Hong, Chang Won
2006-01-01
PURPOSE: The aim of study was to determine the clinical characteristics and mutational profiles of the mismatch repair genes in hereditary nonpolyposis colorectal cancer (HNPCC) patients with small bowel cancer (SBC). EXPERIMENTAL DESIGN: A questionnaire was mailed to 55 members of the Internatio......PURPOSE: The aim of study was to determine the clinical characteristics and mutational profiles of the mismatch repair genes in hereditary nonpolyposis colorectal cancer (HNPCC) patients with small bowel cancer (SBC). EXPERIMENTAL DESIGN: A questionnaire was mailed to 55 members...... of the International Society for Gastrointestinal Hereditary Tumours, requesting information regarding patients with HNPCC-associated SBC and germ line mismatch repair gene mutations. RESULTS: The study population consisted of 85 HNPCC patients with identified mismatch repair gene mutations and SBCs. SBC was the first...... HNPCC-associated malignancy in 14 of 41 (34.1%) patients for whom a personal history of HNPCC-associated cancers was available. The study population harbored 69 different germ line mismatch repair gene mutations, including 31 mutations in MLH1, 34 in MSH2, 3 in MSH6, and 1 in PMS2. We compared...
Ramus, Susan J.; Antoniou, Antonis C; Kuchenbaecker, Karoline B.; Soucy, Penny; Beesley, Jonathan; Chen, Xiaoqing; McGuffog, Lesley; Sinilnikova, Olga M.; Healey, Sue; Barrowdale, Daniel; Lee, Andrew; Thomassen, Mads; Gerdes, Anne-Marie; Kruse, Torben A.; Jensen, Uffe Birk; Skytte, Anne-Bine; Caligo, Maria A.; Liljegren, Annelie; Lindblom, Annika; Olsson, Håkan; Kristoffersson, Ulf; Stenmark-Askmalm, Marie; Melin, Beatrice; Domchek, Susan M.; Nathanson, Katherine L.; Rebbeck, Timothy R.; Jakubowska, Anna; Lubinski, Jan; Jaworska, Katarzyna; Durda, Katarzyna; Złowocka, Elżbieta; Gronwald, Jacek; Huzarski, Tomasz; Byrski, Tomasz; Cybulski, Cezary; Toloczko-Grabarek, Aleksandra; Osorio, Ana; Benitez, Javier; Duran, Mercedes; Tejada, Maria-Isabel; Hamann, Ute; Rookus, Matti; van Leeuwen, Flora E.; Aalfs, Cora M.; Meijers-Heijboer, Hanne E.J.; van Asperen, Christi J.; van Roozendaal, K.E.P.; Hoogerbrugge, Nicoline; Collée, J. Margriet; Kriege, Mieke; van der Luijt, Rob B.; Peock, Susan; Frost, Debra; Ellis, Steve D.; Platte, Radka; Fineberg, Elena; Evans, D. Gareth; Lalloo, Fiona; Jacobs, Chris; Eeles, Ros; Adlard, Julian; Davidson, Rosemarie; Eccles, Diana; Cole, Trevor; Cook, Jackie; Paterson, Joan; Douglas, Fiona; Brewer, Carole; Hodgson, Shirley; Morrison, Patrick J.; Walker, Lisa; Porteous, Mary E.; Kennedy, M. John; Pathak, Harsh; Godwin, Andrew K.; Stoppa-Lyonnet, Dominique; Caux-Moncoutier, Virginie; de Pauw, Antoine; Gauthier-Villars, Marion; Mazoyer, Sylvie; Léoné, Mélanie; Calender, Alain; Lasset, Christine; Bonadona, Valérie; Hardouin, Agnès; Berthet, Pascaline; Bignon, Yves-Jean; Uhrhammer, Nancy; Faivre, Laurence; Loustalot, Catherine; Buys, Saundra; Daly, Mary; Miron, Alex; Terry, Mary Beth; Chung, Wendy K.; John, Esther M; Southey, Melissa; Goldgar, David; Singer, Christian F; Tea, Muy-Kheng; Pfeiler, Georg; Fink-Retter, Anneliese; Hansen, Thomas v. O.; Ejlertsen, Bent; Johannsson, Oskar Th.; Offit, Kenneth; Kirchhoff, Tomas; Gaudet, Mia M.; Vijai, Joseph; Robson, Mark; Piedmonte, Marion; Phillips, Kelly-Anne; Van Le, Linda; Hoffman, James S; Toland, Amanda Ewart; Montagna, Marco; Tognazzo, Silvia; Imyanitov, Evgeny; Isaacs, Claudine; Janavicius, Ramunas; Lazaro, Conxi; Blanco, Ignacio; Tornero, Eva; Navarro, Matilde; Moysich, Kirsten B.; Karlan, Beth Y.; Gross, Jenny; Olah, Edith; Vaszko, Tibor; Teo, Soo-Hwang; Ganz, Patricia A.; Beattie, Mary S.; Dorfling, Cecelia M; van Rensburg, Elizabeth J; Diez, Orland; Kwong, Ava; Schmutzler, Rita K.; Wappenschmidt, Barbara; Engel, Christoph; Meindl, Alfons; Ditsch, Nina; Arnold, Norbert; Heidemann, Simone; Niederacher, Dieter; Preisler-Adams, Sabine; Gadzicki, Dorotehea; Varon-Mateeva, Raymonda; Deissler, Helmut; Gehrig, Andrea; Sutter, Christian; Kast, Karin; Fiebig, Britta; Schäfer, Dieter; Caldes, Trinidad; de la Hoya, Miguel; Nevanlinna, Heli; Aittomäki, Kristiina; Plante, Marie; Spurdle, Amanda B.; Neuhausen, Susan L.; Ding, Yuan Chun; Wang, Xianshu; Lindor, Noralane; Fredericksen, Zachary; Pankratz, V. Shane; Peterlongo, Paolo; Manoukian, Siranoush; Peissel, Bernard; Zaffaroni, Daniela; Bonanni, Bernardo; Bernard, Loris; Dolcetti, Riccardo; Papi, Laura; Ottini, Laura; Radice, Paolo; Greene, Mark H.; Mai, Phuong L.; Andrulis, Irene L.; Glendon, Gord; Ozcelik, Hilmi; Pharoah, Paul D.P.; Gayther, Simon A.; Simard, Jacques; Easton, Douglas F.; Couch, Fergus J.; Chenevix-Trench, Georgia
2012-01-01
Germline mutations in BRCA1 and BRCA2 are associated with increased risks of breast and ovarian cancer. A genome-wide association study (GWAS) identified six alleles associated with risk of ovarian cancer for women in the general population. We evaluated four of these loci as potential modifiers of ovarian cancer risk for BRCA1 and BRCA2 mutation carriers. Four single-nucleotide polymorphisms (SNPs), rs10088218 (at 8q24), rs2665390 (at 3q25), rs717852 (at 2q31), and rs9303542 (at 17q21), were genotyped in 12,599 BRCA1 and 7,132 BRCA2 carriers, including 2,678 ovarian cancer cases. Associations were evaluated within a retrospective cohort approach. All four loci were associated with ovarian cancer risk in BRCA2 carriers; rs10088218 per-allele hazard ratio (HR) = 0.81 (95% CI: 0.67–0.98) P-trend = 0.033, rs2665390 HR = 1.48 (95% CI: 1.21–1.83) P-trend = 1.8 × 10−4, rs717852 HR = 1.25 (95% CI: 1.10–1.42) P-trend = 6.6 × 10−4, rs9303542 HR = 1.16 (95% CI: 1.02–1.33) P-trend = 0.026. Two loci were associated with ovarian cancer risk in BRCA1 carriers; rs10088218 per-allele HR = 0.89 (95% CI: 0.81–0.99) P-trend = 0.029, rs2665390 HR = 1.25 (95% CI: 1.10–1.42) P-trend = 6.1 × 10−4. The HR estimates for the remaining loci were consistent with odds ratio estimates for the general population. The identification of multiple loci modifying ovarian cancer risk may be useful for counseling women with BRCA1 and BRCA2 mutations regarding their risk of ovarian cancer. PMID:22253144
MiR-34b is associated with clinical outcome in triple-negative breast cancer patients
Directory of Open Access Journals (Sweden)
Svoboda Marek
2012-03-01
Full Text Available Abstract Background Breast cancer is the most common malignancy with the highest incidence rates among women worldwide. Triple-negative breast cancer (TNBC represents the major phenotype of basal-like molecular subtype of breast cancer, characterized by higher incidence in young women and a very poor prognosis. MicroRNAs (miRNAs are small non-coding RNAs playing significant role in the pathogenesis of many cancers including breast cancer. Therefore, miRNAs are also potential prognostic and/or predictive biomarkers in triple-negative breast cancer patients. Methods Thirty-nine TNBC patients with available formalin-fixed paraffin-embedded (FFPE tissues were enrolled in the study. MiR-34a, miR-34b, and miR-34c were analyzed using qRT-PCR and correlated to clinico-pathological features of TNBC patients. Results Expression levels of miR-34b significantly correlate with disease free survival (DFS (p = 0.0020, log-rank test and overall survival (OS (p = 0.0008, log-rank test of TNBC patients. No other significant associations between miR-34a, miR-34b, and miR-34c with available clinical pathological data were observed. Conclusions MiR-34b expression negatively correlates with disease free survival and overall survival in TNBC patients. Thus, miR-34b may present a new promising prognostic biomarker in TNBC patients, but independent validations are necessary.
Mutation Clusters from Cancer Exome.
Kakushadze, Zura; Yu, Willie
2017-08-15
We apply our statistically deterministic machine learning/clustering algorithm *K-means (recently developed in https://ssrn.com/abstract=2908286) to 10,656 published exome samples for 32 cancer types. A majority of cancer types exhibit a mutation clustering structure. Our results are in-sample stable. They are also out-of-sample stable when applied to 1389 published genome samples across 14 cancer types. In contrast, we find in- and out-of-sample instabilities in cancer signatures extracted from exome samples via nonnegative matrix factorization (NMF), a computationally-costly and non-deterministic method. Extracting stable mutation structures from exome data could have important implications for speed and cost, which are critical for early-stage cancer diagnostics, such as novel blood-test methods currently in development.
Male breast cancer in BRCA1 and BRCA2 mutation carriers
DEFF Research Database (Denmark)
Silvestri, Valentina; Barrowdale, Daniel; Mulligan, Anna Marie
2016-01-01
BACKGROUND: BRCA1 and, more commonly, BRCA2 mutations are associated with increased risk of male breast cancer (MBC). However, only a paucity of data exists on the pathology of breast cancers (BCs) in men with BRCA1/2 mutations. Using the largest available dataset, we determined whether MBCs...... arising in BRCA1/2 mutation carriers display specific pathologic features and whether these features differ from those of BRCA1/2 female BCs (FBCs). METHODS: We characterised the pathologic features of 419 BRCA1/2 MBCs and, using logistic regression analysis, contrasted those with data from 9675 BRCA1...
Directory of Open Access Journals (Sweden)
Edwards Jeremy
2003-07-01
Full Text Available Abstract Background The identification of known mutations in a cell population is important for clinical applications and basic cancer research. In this work an immobilized form of the polymerase chain reaction, referred to as polony technology, was used to detect mutations as well as gene deletions, resulting in loss of heterozygosity (LOH, in cancer cell lines. Specifically, the mutational hotspots in p53, namely codons 175, 245, 248, 249, 273, and 282, and K-ras2, codons 12, 13 and 61, were genotyped in the pancreatic cell line, Panc-1. In addition LOH analysis was also performed for these same two genes in Panc-1 by quantifying the relative gene copy number of p53 and K-ras2. Results Using polony technology, Panc-1 was determined to possess only one copy of p53, which possessed a mutation in codon 273, and two copies of K-ras2, one wildtype and one with a mutation in codon 12. To further demonstrate the general approach of this method, polonies were also used to detect K-ras2 mutations in the pancreatic cell lines, AsPc-1 and CAPAN-1. Conclusions In conclusion, we have developed an assay that can detect mutations in hotspots of p53 and K-ras2 as well as diagnose LOH in these same genes.
Directory of Open Access Journals (Sweden)
Janiszewska Hanna
2006-01-01
Full Text Available Abstract The frameshift NOD2 gene mutation 3020insC is predominantly associated with Crohn's disease, but predisposes to many types of common cancers as well. We studied the frequency of this mutant NOD2 allele in 148 breast cancer women from the Bydgoszcz region in Poland. The NOD2 mutation was present in 8.8% of the patients. The mean age at breast cancer diagnosis of the mutation carriers was 43 years. We did not find any mutation in patients diagnosed with breast cancer after the age of 50 years. There was no association of the NOD2 mutation with a strong family history of breast cancer. On the contrary, the mutation frequency (11.4% was two times higher in women from families with a single case of breast cancer and with aggregation of other common types of cancer, especially digestive tract cancers. Low risk of breast cancer in the mutation carriers seems to be confirmed by finding the 3020insC mutation in three healthy parents of probands aged 73, 74 and 83 years, from three separate families.
Associations of MC1R Genotype and Patient Phenotypes with BRAF and NRAS Mutations in Melanoma.
Thomas, Nancy E; Edmiston, Sharon N; Kanetsky, Peter A; Busam, Klaus J; Kricker, Anne; Armstrong, Bruce K; Cust, Anne E; Anton-Culver, Hoda; Gruber, Stephen B; Luo, Li; Orlow, Irene; Reiner, Anne S; Gallagher, Richard P; Zanetti, Roberto; Rosso, Stefano; Sacchetto, Lidia; Dwyer, Terence; Parrish, Eloise A; Hao, Honglin; Gibbs, David C; Frank, Jill S; Ollila, David W; Begg, Colin B; Berwick, Marianne; Conway, Kathleen
2017-12-01
Associations of MC1R with BRAF mutations in melanoma have been inconsistent between studies. We sought to determine for 1,227 participants in the international population-based Genes, Environment, and Melanoma (GEM) study whether MC1R and phenotypes were associated with melanoma BRAF/NRAS subtypes. We used logistic regression adjusted by age, sex, and study design features and examined effect modifications. BRAF + were associated with younger age, blond/light brown hair, increased nevi, and less freckling, and NRAS + with older age relative to the wild type (BRAF - /NRAS - ) melanomas (all P < 0.05). Comparing specific BRAF subtypes to the wild type, BRAF V600E was associated with younger age, blond/light brown hair, and increased nevi and V600K with increased nevi and less freckling (all P < 0.05). MC1R was positively associated with BRAF V600E cases but only among individuals with darker phototypes or darker hair (P interaction < 0.05) but inversely associated with BRAF V600K (P trend = 0.006) with no significant effect modification by phenotypes. These results support distinct etiologies for BRAF V600E, BRAF V600K, NRAS + , and wild-type melanomas. MC1R's associations with BRAF V600E cases limited to individuals with darker phenotypes indicate that MC1R genotypes specifically provide information about BRAF V600E melanoma risk in those not considered high risk based on phenotype. Our results also suggest that melanin pathways deserve further study in BRAF V600E melanomagenesis. Copyright © 2017 The Authors. Published by Elsevier Inc. All rights reserved.
Identification of Germline Genetic Mutations in Pancreatic Cancer Patients
Salo-Mullen, Erin E.; O’Reilly, Eileen; Kelsen, David; Ashraf, Asad M.; Lowery, Maeve; Yu, Kenneth; Reidy, Diane; Epstein, Andrew S.; Lincoln, Anne; Saldia, Amethyst; Jacobs, Lauren M.; Rau-Murthy, Rohini; Zhang, Liying; Kurtz, Robert; Saltz, Leonard; Offit, Kenneth; Robson, Mark; Stadler, Zsofia K.
2016-01-01
Background Pancreatic adenocarcinoma (PAC) is part of several cancer predisposition syndromes; however, indications for genetic counseling/testing are not well-defined. We sought to determine mutation prevalence and characteristics that predict for inherited predisposition to PAC. Methods We identified 175 consecutive PAC patients who underwent clinical genetics assessment at Memorial Sloan Kettering between 2011–2014. Clinical data, family history, and germline results were evaluated. Results Among 159 PAC patients who pursued genetic testing, 24 pathogenic mutations were identified (15.1%; 95%CI, 9.5%–20.7%), including BRCA2(n=13), BRCA1(n=4), p16(n=2), PALB2(n=1), and Lynch syndrome(n=4). BRCA1/BRCA2 prevalence was 13.7% in Ashkenazi Jewish(AJ) (n=95) and 7.1% in non-AJ(n=56) patients. In AJ patients with strong, weak, or absent family history of BRCA-associated cancers, mutation prevalence was 16.7%, 15.8%, and 7.4%, respectively. Mean age at diagnosis in all mutation carriers was 58.5y(range 45–75y) compared to 64y(range 27–87y) in non-mutation carriers(P=0.02). Although BRCA2 was the most common mutation identified, no patients with early-onset PAC(≤50y) harbored a BRCA2 mutation and the mean age at diagnosis in BRCA2 carriers was equivalent to non-mutation carriers(P=0.34). Mutation prevalence in early-onset patients(n=21) was 28.6%, including BRCA1(n=2), p16(n=2), MSH2(n=1) and MLH1(n=1). Conclusion Mutations in BRCA2 account for over 50% of PAC patients with an identified susceptibility syndrome. AJ patients had high BRCA1/BRCA2 prevalence regardless of personal/family history, suggesting that ancestry alone indicates a need for genetic evaluation. With the exception of BRCA2-associated PAC, inherited predisposition to PAC is associated with earlier age at PAC diagnosis suggesting that this subset of patients may also represent a population warranting further evaluation. PMID:26440929
McGee, Jacob; Giannakeas, Vasily; Karlan, Beth; Lubinski, Jan; Gronwald, Jacek; Rosen, Barry; McLaughlin, John; Risch, Harvey; Sun, Ping; Foulkes, William D; Neuhausen, Susan L; Kotsopoulos, Joanne; Narod, Steven A
2017-05-01
Preventive breast surgery and MRI screening are offered to unaffected BRCA mutation carriers. The clinical benefit of these two modalities has not been evaluated among mutation carriers with a history of ovarian cancer. Thus, we sought to determine whether or not BRCA mutation carriers with ovarian cancer would benefit from preventive mastectomy or from MRI screening. First, the annual mortality rate for ovarian cancer patients was estimated for a cohort of 178 BRCA mutation carriers from Ontario, Canada. Next, the actuarial risk of developing breast cancer was estimated using an international registry of 509 BRCA mutation carriers with ovarian cancer. A series of simulations was conducted to evaluate the reduction in the probability of death (from all causes) associated with mastectomy and with MRI-based breast surveillance. Cox proportional hazards models were used to evaluate the impacts of mastectomy and MRI screening on breast cancer incidence as well as on all-cause mortality. Twenty (3.9%) of the 509 patients developed breast cancer within ten years following ovarian cancer diagnosis. The actuarial risk of developing breast cancer at ten years post-diagnosis, conditional on survival from ovarian cancer and other causes of mortality was 7.8%. Based on our simulation results, among all BRCA mutation-carrying patients diagnosed with stage III/IV ovarian cancer at age 50, the chance of dying before age 80 was reduced by less than 1% with MRI and by less than 2% with mastectomy. Greater improvements in survival with MRI or mastectomy were observed for women who had already survived 10years after ovarian cancer, and for women with stage I or II ovarian cancer. Among BRCA mutation-carrying ovarian cancer patients without a personal history of breast cancer, neither preventive mastectomy nor MRI screening is warranted, except for those who have survived ovarian cancer without recurrence for ten years and for those with early stage ovarian cancer. Copyright © 2017
Cardarella, Stephanie; Ogino, Atsuko; Nishino, Mizuki; Butaney, Mohit; Shen, Jeanne; Lydon, Christine; Yeap, Beow Y; Sholl, Lynette M; Johnson, Bruce E; Jänne, Pasi A
2013-08-15
BRAF mutations are found in a subset of non-small cell lung cancers (NSCLC). We examined the clinical characteristics and treatment outcomes of patients with NSCLC harboring BRAF mutations. Using DNA sequencing, we successfully screened 883 patients with NSCLC for BRAF mutations between July 1, 2009 and July 16, 2012. Baseline characteristics and treatment outcomes were compared between patients with and without BRAF mutations. Wild-type controls consisted of patients with NSCLC without a somatic alteration in BRAF, KRAS, EGFR, and ALK. In vitro studies assessed the biologic properties of selected non-V600E BRAF mutations identified from patients with NSCLC. Of 883 tumors screened, 36 (4%) harbored BRAF mutations (V600E, 18; non-V600E, 18) and 257 were wild-type for BRAF, EGFR, KRAS, and ALK negative. Twenty-nine of 36 patients with BRAF mutations were smokers. There were no distinguishing clinical features between BRAF-mutant and wild-type patients. Patients with advanced NSCLC with BRAF mutations and wild-type tumors showed similar response rates and progression-free survival (PFS) to platinum-based combination chemotherapy and no difference in overall survival. Within the BRAF cohort, patients with V600E-mutated tumors had a shorter PFS to platinum-based chemotherapy compared with those with non-V600E mutations, although this did not reach statistical significance (4.1 vs. 8.9 months; P = 0.297). We identified five BRAF mutations not previously reported in NSCLC; two of five were associated with increased BRAF kinase activity. BRAF mutations occur in 4% of NSCLCs and half are non-V600E. Prospective trials are ongoing to validate BRAF as a therapeutic target in NSCLC. ©2013 AACR.
A new experimental system for study on adaptive mutations
Institute of Scientific and Technical Information of China (English)
Lü; Zhong; (
2001-01-01
[1]Luria, S. E., Delbrück, M., Mutation of bacteria from virus sensitivity to virus resistance, Genetics, 1943, 28: 491.[2]Lederberg, J., Lederberg, E. M., Replica plating and indirect selection of bacteria mutants, J. Bacteriol., 1952, 63: 399.[3]Carins, J., Overbaugh, J., Miller, S., The origin of mutants, Nature, 1988, 355: 142.[4]Foster, P. L., Adaptive mutation: the uses of adversity, Annu. Rev. Microbiol., 1993, 47: 467.[5]Hall, B. G., Adaptive mutagenesis: a process that generates almost exclusively beneficient mutations, Genetica, 1998, 102/103: 109.[6]Kasak, L., Horak, R., Kivisaar, M., Promotor-creating mutations in Psuedmonas putida: A model system for the study of mutation in starving bacteria, PNAS, 1997, 94: 3134.[7]Steele, D. F., Jinks-Robertson, An examination of adaptive reversion in Saccharomyces cerevisiae, Genetics, 1992, 132: 9.[8]Davis, R. W., Botstein, Roth, J. R., Advanced Bacterial Genetics--A Manual for Genetic Engineering, New York: Cold Spring Harbor Laboratory Press, 1980, 13.[9]Miller, J. H., Experiments in Molecular Genetics, New York: Cold Spring Harbor Laboratory Press, 1972, 352.[10] Lea, D. E., Coulson, C. A., The distribution of the numbers of mutants in bacterial populations, J. Genetics, 1949, 49: 264.[11] Hughes, K. T., Roth, J. R., Transitory cis complementation: a method for provided transposition function to defective transposons, Genetics, 1988, 119: 9.[12] Sanderson, K. E., Roth J., Linkage map of Salmonella typhimurium, Microbiol. Rev., 1988, 52: 485.[13] He, B., Shiau, A., Choi, K. Y., Genes of the E. coli pur region are negatively controlled by a repressor-operator interaction, J. Bacteriol., 1990, 172: 4555.[14] Liu, B., Huang, Y., Wang, A. Q., Regulation of purine biosynthetic genes expression in Salmonella typhimurium (IV)--Oc mutation site of purG and its function analysis, Science in China, Ser. C, 1997, 40(3): 238.[15] Tang, H., Qin, J. C., Wang, A. Q
Fennell, Lochlan J; Clendenning, Mark; McKeone, Diane M; Jamieson, Saara H; Balachandran, Samanthy; Borowsky, Jennifer; Liu, John; Kawamata, Futoshi; Bond, Catherine E; Rosty, Christophe; Burge, Matthew E; Buchanan, Daniel D; Leggett, Barbara A; Whitehall, Vicki L J
2018-01-01
The WNT signaling pathway is commonly altered during colorectal cancer development. The E3 ubiquitin ligase, RNF43, negatively regulates the WNT signal through increased ubiquitination and subsequent degradation of the Frizzled receptor. RNF43 has recently been reported to harbor frequent truncating frameshift mutations in sporadic microsatellite unstable (MSI) colorectal cancers. This study assesses the relative frequency of RNF43 mutations in hereditary colorectal cancers arising in the setting of Lynch syndrome. The entire coding region of RNF43 was Sanger sequenced in 24 colorectal cancers from 23 patients who either (i) carried a germline mutation in one of the DNA mismatch repair genes (MLH1, MSH6, MSH2, PMS2), or (ii) showed immunohistochemical loss of expression of one or more of the DNA mismatch repair proteins, was BRAF wild type at V600E, were under 60 years of age at diagnosis, and demonstrated no promoter region methylation for MLH1 in tumor DNA. A validation cohort of 44 colorectal cancers from mismatch repair germline mutation carriers from the Australasian Colorectal Cancer Family Registry (ACCFR) were sequenced for the most common truncating mutation hotspots (X117 and X659). RNF43 mutations were found in 9 of 24 (37.5%) Lynch syndrome colorectal cancers. The majority of mutations were frameshift deletions in the G659 G7 repeat tract (29%); 2 cancers (2/24, 8%) from the one patient harbored frameshift mutations at codon R117 (C6 repeat tract) within exon 3. In the ACCFR validation cohort, RNF43 hotspot mutations were identified in 19/44 (43.2%) of samples, which was not significantly different to the initial series. The proportion of mutant RNF43 in Lynch syndrome related colorectal cancers is significantly lower than the previously reported mutation rate found in sporadic MSI colorectal cancers. These findings identify further genetic differences between sporadic and hereditary colorectal cancers. This may be because Lynch Syndrome cancers
Wang, Tso-Fu; Chu, Sung-Chao; Lee, Jen-Jyh; Yang, Gee-Gwo; Huang, Wei-Han; Chang, En-Ting; Low, Tissot; Wu, Yi-Feng; Kao, Ruey-Ho; Lin, Chih-Bin
2017-08-01
This study was conducted to evaluate the effect of clinical factors on the treatment outcomes of lung cancer patients with active epidermal growth factor receptor (EGFR) mutations treated by first-line tyrosine kinase inhibitors (TKIs). Patients of stage IIIb or IV lung adenocarcinoma harboring mutated EGFR were enrolled between March 2010 and June 2014 and followed up until December 2015. The effects of various clinical features, such as age, sex, smoking history, EGFR mutation types, TKIs used, presence of pleural effusion, metastatic sites on progression-free survival (PFS) and overall survival (OS), were analyzed retrospectively. A total of 104 patients were included in this study. Patients with pleural effusion at initial diagnosis had significantly shorter PFS and OS than those without pleural effusion (median PFS: 8.2 months vs 15.3 months, P = 0.0004; median OS: 16.3 months vs 28.2 months, P = 0.0003). Univariate analysis revealed that being male or a smoker was associated with short PFS, whereas smoking history, bony metastasis and malignant pleural effusion were associated with poor OS. Stepwise multivariate Cox regression analysis showed that the presence of pleural effusion and different TKI use were independent prognostic factors for PFS [hazard ratio [HR] = 2.50 (95% confidence interval [CI], 1.53-4.10), P = 0.0003 and HR = 0.55 (95% CI, 0.31-0.97), P = 0.0396, respectively], whereas the presence of pleural effusion and liver metastasis were associated with poor OS [HR = 2.79 (95% CI: 1.46-5.30), P = 0.0018 and HR = 2.12 (95% CI, 1.02-4.40), P = 0.0440, respectively]. The presence of pleural effusion predicts poor PFS and OS in lung adenocarcinoma patients receiving TKIs as the first-line treatment. Additional studies are warranted to elucidate the underlying mechanisms and determine novel strategies for improving the outcome of these patients. © 2017 John Wiley & Sons Australia, Ltd.
Finnish Fanconi anemia mutations and hereditary predisposition to breast and prostate cancer.
Mantere, T; Haanpää, M; Hanenberg, H; Schleutker, J; Kallioniemi, A; Kähkönen, M; Parto, K; Avela, K; Aittomäki, K; von Koskull, H; Hartikainen, J M; Kosma, V-M; Laasanen, S-L; Mannermaa, A; Pylkäs, K; Winqvist, R
2015-07-01
Mutations in downstream Fanconi anemia (FA) pathway genes, BRCA2, PALB2, BRIP1 and RAD51C, explain part of the hereditary breast cancer susceptibility, but the contribution of other FA genes has remained questionable. Due to FA's rarity, the finding of recurrent deleterious FA mutations among breast cancer families is challenging. The use of founder populations, such as the Finns, could provide some advantage in this. Here, we have resolved complementation groups and causative mutations of five FA patients, representing the first mutation confirmed FA cases in Finland. These patients belonged to complementation groups FA-A (n = 3), FA-G (n = 1) and FA-I (n = 1). The prevalence of the six FA causing mutations was then studied in breast (n = 1840) and prostate (n = 565) cancer cohorts, and in matched controls (n = 1176 females, n = 469 males). All mutations were recurrent, but no significant association with cancer susceptibility was observed for any: the prevalence of FANCI c.2957_2969del and c.3041G>A mutations was even highest in healthy males (1.7%). This strengthens the exclusive role of downstream genes in cancer predisposition. From a clinical point of view, current results provide fundamental information of the mutations to be tested first in all suspected FA cases in Finland. © 2014 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.
MRI Background Parenchymal Enhancement Is Not Associated with Breast Cancer.
Directory of Open Access Journals (Sweden)
Barbara Bennani-Baiti
Full Text Available Previously, a strong positive association between background parenchymal enhancement (BPE at magnetic resonance imaging (MRI and breast cancer was reported in high-risk populations. We sought to determine, whether this was also true for non-high-risk patients.540 consecutive patients underwent breast MRI for assessment of breast findings (BI-RADS 0-5, non-high-risk screening (no familial history of breast cancer, no known genetic mutation, no prior chest irradiation, or previous breast cancer diagnosis and subsequent histological work-up. For this IRB-approved study, BPE and fibroglandular tissue FGT were retrospectively assessed by two experienced radiologists according to the BI-RADS lexicon. Pearson correlation coefficients were calculated to explore associations between BPE, FGT, age and final diagnosis of breast cancer. Subsequently, multivariate logistic regression analysis, considering covariate colinearities, was performed, using final diagnosis as the target variable and BPE, FGT and age as covariates.Age showed a moderate negative correlation with FGT (r = -0.43, p<0.001 and a weak negative correlation with BPE (r = -0.28, p<0.001. FGT and BPE correlated moderately (r = 0.35, p<0.001. Final diagnosis of breast cancer displayed very weak negative correlations with FGT (r = -0.09, p = 0.046 and BPE (r = -0.156, p<0.001 and weak positive correlation with age (r = 0.353, p<0.001. On multivariate logistic regression analysis, the only independent covariate for prediction of breast cancer was age (OR 1.032, p<0.001.Based on our data, neither BPE nor FGT independently correlate with breast cancer risk in non-high-risk patients at MRI. Our model retained only age as an independent risk factor for breast cancer in this setting.
Directory of Open Access Journals (Sweden)
Kaori Shima
Full Text Available Mononucleotide tracts in the coding regions of the TGFBR2 and BAX genes are commonly mutated in microsatellite instability-high (MSI-high colon cancers. The receptor TGFBR2 plays an important role in the TGFB1 (transforming growth factor-β, TGF-β signaling pathway, and BAX plays a key role in apoptosis. However, a role of TGFBR2 or BAX mononucleotide mutation in colorectal cancer as a prognostic biomarker remains uncertain.We utilized a database of 1072 rectal and colon cancers in two prospective cohort studies (the Nurses' Health Study and the Health Professionals Follow-up Study. Cox proportional hazards model was used to compute mortality hazard ratio (HR, adjusted for clinical, pathological and molecular features including the CpG island methylator phenotype (CIMP, LINE-1 methylation, and KRAS, BRAF and PIK3CA mutations. MSI-high was observed in 15% (162/1072 of all colorectal cancers. TGFBR2 and BAX mononucleotide mutations were detected in 74% (117/159 and 30% (48/158 of MSI-high tumors, respectively. In Kaplan-Meier analysis as well as univariate and multivariate Cox regression analyses, compared to microsatellite stable (MSS/MSI-low cases, MSI-high cases were associated with superior colorectal cancer-specific survival [adjusted HR, 0.34; 95% confidence interval (CI, 0.20-0.57] regardless of TGFBR2 or BAX mutation status. Among MSI-high tumors, TGFBR2 mononucleotide mutation was associated with CIMP-high independent of other variables [multivariate odds ratio, 3.57; 95% CI, 1.66-7.66; p = 0.0011].TGFBR2 or BAX mononucleotide mutations are not associated with the patient survival outcome in MSI-high colorectal cancer. Our data do not support those mutations as prognostic biomarkers (beyond MSI in colorectal carcinoma.
Candidate genetic modifiers for breast and ovarian cancer risk in BRCA1 and BRCA2 mutation carriers.
Peterlongo, Paolo; Chang-Claude, Jenny; Moysich, Kirsten B; Rudolph, Anja; Schmutzler, Rita K; Simard, Jacques; Soucy, Penny; Eeles, Rosalind A; Easton, Douglas F; Hamann, Ute; Wilkening, Stefan; Chen, Bowang; Rookus, Matti A; Schmidt, Marjanka K; van der Baan, Frederieke H; Spurdle, Amanda B; Walker, Logan C; Lose, Felicity; Maia, Ana-Teresa; Montagna, Marco; Matricardi, Laura; Lubinski, Jan; Jakubowska, Anna; Gómez Garcia, Encarna B; Olopade, Olufunmilayo I; Nussbaum, Robert L; Nathanson, Katherine L; Domchek, Susan M; Rebbeck, Timothy R; Arun, Banu K; Karlan, Beth Y; Orsulic, Sandra; Lester, Jenny; Chung, Wendy K; Miron, Alex; Southey, Melissa C; Goldgar, David E; Buys, Saundra S; Janavicius, Ramunas; Dorfling, Cecilia M; van Rensburg, Elizabeth J; Ding, Yuan Chun; Neuhausen, Susan L; Hansen, Thomas V O; Gerdes, Anne-Marie; Ejlertsen, Bent; Jønson, Lars; Osorio, Ana; Martínez-Bouzas, Cristina; Benitez, Javier; Conway, Edye E; Blazer, Kathleen R; Weitzel, Jeffrey N; Manoukian, Siranoush; Peissel, Bernard; Zaffaroni, Daniela; Scuvera, Giulietta; Barile, Monica; Ficarazzi, Filomena; Mariette, Frederique; Fortuzzi, Stefano; Viel, Alessandra; Giannini, Giuseppe; Papi, Laura; Martayan, Aline; Tibiletti, Maria Grazia; Radice, Paolo; Vratimos, Athanassios; Fostira, Florentia; Garber, Judy E; Donaldson, Alan; Brewer, Carole; Foo, Claire; Evans, D Gareth R; Frost, Debra; Eccles, Diana; Brady, Angela; Cook, Jackie; Tischkowitz, Marc; Adlard, Julian; Barwell, Julian; Walker, Lisa; Izatt, Louise; Side, Lucy E; Kennedy, M John; Rogers, Mark T; Porteous, Mary E; Morrison, Patrick J; Platte, Radka; Davidson, Rosemarie; Hodgson, Shirley V; Ellis, Steve; Cole, Trevor; Godwin, Andrew K; Claes, Kathleen; Van Maerken, Tom; Meindl, Alfons; Gehrig, Andrea; Sutter, Christian; Engel, Christoph; Niederacher, Dieter; Steinemann, Doris; Plendl, Hansjoerg; Kast, Karin; Rhiem, Kerstin; Ditsch, Nina; Arnold, Norbert; Varon-Mateeva, Raymonda; Wappenschmidt, Barbara; Wang-Gohrke, Shan; Bressac-de Paillerets, Brigitte; Buecher, Bruno; Delnatte, Capucine; Houdayer, Claude; Stoppa-Lyonnet, Dominique; Damiola, Francesca; Coupier, Isabelle; Barjhoux, Laure; Venat-Bouvet, Laurence; Golmard, Lisa; Boutry-Kryza, Nadia; Sinilnikova, Olga M; Caron, Olivier; Pujol, Pascal; Mazoyer, Sylvie; Belotti, Muriel; Piedmonte, Marion; Friedlander, Michael L; Rodriguez, Gustavo C; Copeland, Larry J; de la Hoya, Miguel; Segura, Pedro Perez; Nevanlinna, Heli; Aittomäki, Kristiina; van Os, Theo A M; Meijers-Heijboer, Hanne E J; van der Hout, Annemarie H; Vreeswijk, Maaike P G; Hoogerbrugge, Nicoline; Ausems, Margreet G E M; van Doorn, Helena C; Collée, J Margriet; Olah, Edith; Diez, Orland; Blanco, Ignacio; Lazaro, Conxi; Brunet, Joan; Feliubadalo, Lidia; Cybulski, Cezary; Gronwald, Jacek; Durda, Katarzyna; Jaworska-Bieniek, Katarzyna; Sukiennicki, Grzegorz; Arason, Adalgeir; Chiquette, Jocelyne; Teixeira, Manuel R; Olswold, Curtis; Couch, Fergus J; Lindor, Noralane M; Wang, Xianshu; Szabo, Csilla I; Offit, Kenneth; Corines, Marina; Jacobs, Lauren; Robson, Mark E; Zhang, Liying; Joseph, Vijai; Berger, Andreas; Singer, Christian F; Rappaport, Christine; Kaulich, Daphne Geschwantler; Pfeiler, Georg; Tea, Muy-Kheng M; Phelan, Catherine M; Greene, Mark H; Mai, Phuong L; Rennert, Gad; Mulligan, Anna Marie; Glendon, Gord; Tchatchou, Sandrine; Andrulis, Irene L; Toland, Amanda Ewart; Bojesen, Anders; Pedersen, Inge Sokilde; Thomassen, Mads; Jensen, Uffe Birk; Laitman, Yael; Rantala, Johanna; von Wachenfeldt, Anna; Ehrencrona, Hans; Askmalm, Marie Stenmark; Borg, Åke; Kuchenbaecker, Karoline B; McGuffog, Lesley; Barrowdale, Daniel; Healey, Sue; Lee, Andrew; Pharoah, Paul D P; Chenevix-Trench, Georgia; Antoniou, Antonis C; Friedman, Eitan
2015-01-01
BRCA1 and BRCA2 mutation carriers are at substantially increased risk for developing breast and ovarian cancer. The incomplete penetrance coupled with the variable age at diagnosis in carriers of the same mutation suggests the existence of genetic and nongenetic modifying factors. In this study, we evaluated the putative role of variants in many candidate modifier genes. Genotyping data from 15,252 BRCA1 and 8,211 BRCA2 mutation carriers, for known variants (n = 3,248) located within or around 445 candidate genes, were available through the iCOGS custom-designed array. Breast and ovarian cancer association analysis was performed within a retrospective cohort approach. The observed P values of association ranged between 0.005 and 1.000. None of the variants was significantly associated with breast or ovarian cancer risk in either BRCA1 or BRCA2 mutation carriers, after multiple testing adjustments. There is little evidence that any of the evaluated candidate variants act as modifiers of breast and/or ovarian cancer risk in BRCA1 or BRCA2 mutation carriers. Genome-wide association studies have been more successful at identifying genetic modifiers of BRCA1/2 penetrance than candidate gene studies. ©2014 American Association for Cancer Research.
BRAF mutation-specific promoter methylation of FOX genes in colorectal cancer
E.H.J. van Roon (Eddy); A. Boot (Arnoud); A.A. Dihal (Ashwin); R.F. Ernst (Robert); T. van Wezel (Tom); H. Morreau (Hans); J.M. Boer (Judith)
2013-01-01
textabstractBackground: Cancer-specific hypermethylation of (promoter) CpG islands is common during the tumorigenesis of colon cancer. Although associations between certain genetic aberrations, such as BRAF mutation and microsatellite instability, and the CpG island methylator phenotype (CIMP), have
An experimental study of BIGH3 gene mutations in the patients with corneal dystrophies
International Nuclear Information System (INIS)
Jin Tao; Zou Liuhe; Yang Ling
2004-01-01
Objective: To evaluate BIGH3 gene mutations in Chinese patents with corneal dystrophies. Methods: 2ml peripheral venous blood was collected from 15 patients with granular corneal dystrophies and 5 normal subjects. Leucocytes DNA was extracted with standard method. With two pairs of oligonucleotide primers, exon 4 and exon 12 of the BIGH3 gene were amplified using the polymerase chain reaction. Amplified DNA fragments were purified and sequenced directly. Results: Mutations in BIGH3 gene were detected in all the patients with corneal dystrophies. BIGH3 gene mutations were not found in normal subjects. 12 patients with Avellino corneal dystrophy had the missense mutation R124H in the BIGH3 gene. 3 patients with granular corneal dystrophy had the missense mutation R555W in the BIGH3 gene. Conclusion: R124H and R555W mutations in BIGH3 gene were also found in the Chinese patients with Avellino and granular corneal dystrophies. In China, Avellino corneal dystrophy associated with the R124H mutation is the most common form in the corneal dystrophies resulted by BIGH3 gene mutions. Condon 124 and 555 are also the hot spots for the mutations in the BIGH3 gene in the Chinese patients with corneal dystrophies. Molecular genetic analysis may be repuired for proper diagnosis and subclassification of corneal dystrophies. (authors)
Directory of Open Access Journals (Sweden)
Santiago Rodriguez
2009-06-01
Full Text Available Filaggrin is a major protein in the epidermis. Several mutations in the filaggrin gene (FLG have been associated with a number of conditions. Filaggrin is expressed in the tympanic membrane and could alter its mechanical properties, but the relationship between genetic variation in FLG and hearing has not yet been tested.We examined whether loss-of function mutations R501X and 2282del4 in the FLG gene affected hearing in children. Twenty eight hearing variables representing five different aspects of hearing at age nine years in 5,377 children from the Avon Longitudinal Study of Parents and Children (ALSPAC cohort were tested for association with these mutations. No evidence of association was found between R501X or 2282del4 (or overall FLG mutation carrier status and any of the hearing phenotypes analysed.In conclusion, carrier status for common filaggrin mutations does not affect hearing in children.
Progression inference for somatic mutations in cancer
Directory of Open Access Journals (Sweden)
Leif E. Peterson
2017-04-01
Full Text Available Computational methods were employed to determine progression inference of genomic alterations in commonly occurring cancers. Using cross-sectional TCGA data, we computed evolutionary trajectories involving selectivity relationships among pairs of gene-specific genomic alterations such as somatic mutations, deletions, amplifications, downregulation, and upregulation among the top 20 driver genes associated with each cancer. Results indicate that the majority of hierarchies involved TP53, PIK3CA, ERBB2, APC, KRAS, EGFR, IDH1, VHL, etc. Research into the order and accumulation of genomic alterations among cancer driver genes will ever-increase as the costs of nextgen sequencing subside, and personalized/precision medicine incorporates whole-genome scans into the diagnosis and treatment of cancer. Keywords: Oncology, Cancer research, Genetics, Computational biology
Finding cancer driver mutations in the era of big data research.
Poulos, Rebecca C; Wong, Jason W H
2018-04-02
In the last decade, the costs of genome sequencing have decreased considerably. The commencement of large-scale cancer sequencing projects has enabled cancer genomics to join the big data revolution. One of the challenges still facing cancer genomics research is determining which are the driver mutations in an individual cancer, as these contribute only a small subset of the overall mutation profile of a tumour. Focusing primarily on somatic single nucleotide mutations in this review, we consider both coding and non-coding driver mutations, and discuss how such mutations might be identified from cancer sequencing datasets. We describe some of the tools and database that are available for the annotation of somatic variants and the identification of cancer driver genes. We also address the use of genome-wide variation in mutation load to establish background mutation rates from which to identify driver mutations under positive selection. Finally, we describe the ways in which mutational signatures can act as clues for the identification of cancer drivers, as these mutations may cause, or arise from, certain mutational processes. By defining the molecular changes responsible for driving cancer development, new cancer treatment strategies may be developed or novel preventative measures proposed.
Complex MSH2 and MSH6 mutations in hypermutated microsatellite unstable advanced prostate cancer.
Pritchard, Colin C; Morrissey, Colm; Kumar, Akash; Zhang, Xiaotun; Smith, Christina; Coleman, Ilsa; Salipante, Stephen J; Milbank, Jennifer; Yu, Ming; Grady, William M; Tait, Jonathan F; Corey, Eva; Vessella, Robert L; Walsh, Tom; Shendure, Jay; Nelson, Peter S
2014-09-25
A hypermutated subtype of advanced prostate cancer was recently described, but prevalence and mechanisms have not been well-characterized. Here we find that 12% (7 of 60) of advanced prostate cancers are hypermutated, and that all hypermutated cancers have mismatch repair gene mutations and microsatellite instability (MSI). Mutations are frequently complex MSH2 or MSH6 structural rearrangements rather than MLH1 epigenetic silencing. Our findings identify parallels and differences in the mechanisms of hypermutation in prostate cancer compared with other MSI-associated cancers.
Directory of Open Access Journals (Sweden)
Ewa Smoleń
2016-07-01
Department of Development in Nursing, Faculty of Health Sciences, Medical University, Lublin Słowa kluczowe: rak piersi, zapobieganie, ryzyko zachorowania, pielęgniarki. Key words: breast cancer, prevention, risk, nurses. Streszczenie Wstęp. Do najważniejszych czynników ryzyka zachorowania na raka piersi zalicza się: płeć żeńską, wiek powyżej 64 r.ż., mutacje genowe, rozpoznanie nowotworu piersi u dwóch lub więcej krewnych I stopnia, przebyty rak piersi oraz zmiany w piersi. W profilaktyce raka piersi ważne znaczenie obok badań przesiewowych ma podejmowanie prozdrowotnych zachowań zdrowotnych, zmniejszających ryzyko zachorowania. Cel pracy. Ocena zachowań zdrowotnych pielęgniarek w zakresie profilaktyki raka piersi oraz ryzyka rozwoju chorób nowotworowych w badanej grupie kobiet. Materiał i metody. Badania przeprowadzono metodą sondażu diagnostycznego w grupie 184 pielęgniarek województwa lubelskiego i podkarpackiego. Zastosowano kwestionariusz ankiety własnej konstrukcji. W analizie statystycznej posłużono się testem χ2 Pearsona. Wyniki. U ponad połowy respondentek w rodzinie notowano wystąpienie nowotworu, a u co dziesiątej był to nowotwór piersi. Jedna dziesiąta pielęgniarek deklarowała rozpoczęcie miesiączkowania w 12 r.ż. Większość pielęgniarek deklarowała karmienie naturalne w okresie macierzyństwa. Średnia wieku pierwszej wizyty u ginekologa to 20 lat. Ponad połowa badanych pielęgniarek deklarowała prawidłową masę ciała oraz podejmowanie aktywności fizycznej. Wykazano niewielkie różnice istotne statystycznie w poszczególnych zachowaniach w obu badanych grupach pielęgniarek. Wnioski. Zagrożenie wystąpieniem nowotworów piersi u badanych pielęgniarek związane było w głównej mierze z rodzinnym obciążeniem nowotworowym oraz wczesnym rozpoczęciem menstruacji, co zalicza się do czynników niepodlegających modyfikacji. Brak aktywności fizycznej oraz występowanie otyłości to czynniki
Lethal mutagenesis: targeting the mutator phenotype in cancer.
Fox, Edward J; Loeb, Lawrence A
2010-10-01
The evolution of cancer and RNA viruses share many similarities. Both exploit high levels of genotypic diversity to enable extensive phenotypic plasticity and thereby facilitate rapid adaptation. In order to accumulate large numbers of mutations, we have proposed that cancers express a mutator phenotype. Similar to cancer cells, many viral populations, by replicating their genomes with low fidelity, carry a substantial mutational load. As high levels of mutation are potentially deleterious, the viral mutation frequency is thresholded at a level below which viral populations equilibrate in a traditional mutation-selection balance, and above which the population is no longer viable, i.e., the population undergoes an error catastrophe. Because their mutation frequencies are fine-tuned just below this error threshold, viral populations are susceptible to further increases in mutational load and, recently this phenomenon has been exploited therapeutically by a concept that has been termed lethal mutagenesis. Here we review the application of lethal mutagenesis to the treatment of HIV and discuss how lethal mutagenesis may represent a novel therapeutic approach for the treatment of solid cancers. Copyright © 2010 Elsevier Ltd. All rights reserved.
Talseth-Palmer, Bente A; McPhillips, Mary; Groombridge, Claire; Spigelman, Allan; Scott, Rodney J
2010-05-21
Approximately 10% of Lynch syndrome families have a mutation in MSH6 and fewer families have a mutation in PMS2. It is assumed that the cancer incidence is the same in families with mutations in MSH6 as in families with mutations in MLH1/MSH2 but that the disease tends to occur later in life, little is known about families with PMS2 mutations. This study reports on our findings on mutation type, cancer risk and age of diagnosis in MSH6 and PMS2 families. A total of 78 participants (from 29 families) with a mutation in MSH6 and 7 participants (from 6 families) with a mutation in PMS2 were included in the current study. A database of de-identified patient information was analysed to extract all relevant information such as mutation type, cancer incidence, age of diagnosis and cancer type in this Lynch syndrome cohort. Cumulative lifetime risk was calculated utilising Kaplan-Meier survival analysis. MSH6 and PMS2 mutations represent 10.3% and 1.9%, respectively, of the pathogenic mutations in our Australian Lynch syndrome families. We identified 26 different MSH6 and 4 different PMS2 mutations in the 35 families studied. We report 15 novel MSH6 and 1 novel PMS2 mutations. The estimated cumulative risk of CRC at age 70 years was 61% (similar in males and females) and 65% for endometrial cancer in MSH6 mutation carriers. The risk of developing CRC is different between males and females at age 50 years, which is 34% for males and 21% for females. Novel MSH6 and PMS2 mutations are being reported and submitted to the current databases for identified Lynch syndrome mutations. Our data provides additional information to add to the genotype-phenotype spectrum for both MSH6 and PMS2 mutations.
Kim, Ju-Yeon; Moon, Hyeong-Gon; Kang, Young-Joon; Han, Wonshik; Noh, Woo-Chul; Jung, Yongsik; Moon, Byung-In; Kang, Eunyoung; Park, Sung-Shin; Lee, Min Hyuk; Park, Bo Young; Lee, Jong Won; Noh, Dong-Young
2017-09-01
Germline mutations in the BRCA1 and BRCA2 genes confer increased risks for breast cancers. However, the clinical presentation of breast cancer among women who are carriers of the BRCA1 or BRCA2 ( BRCA1/2 carriers) mutations is heterogenous. We aimed to identify the effects of the reproductive histories of women with the BRCA1/2 mutations on the clinical presentation of breast cancer. We retrospectively analyzed clinical data on women with proven BRCA1 and BRCA2 mutations who were recruited to the Korean Hereditary Breast Cancer study, from 2007 to 2014. Among the 736 women who were BRCA1/2 mutation carriers, a total of 483 women had breast cancers. Breast cancer diagnosis occurred at significantly younger ages in women who experienced menarche at ≤14 years of age, compared to those who experienced menarche at >14 years of age (37.38±7.60 and 43.30±10.11, respectively, p women with the BRCA2 mutation. The prevalence of advanced stages (stage II or III vs. stage I) of disease in parous women was higher than in nulliparous women (68.5% vs. 55.2%, p =0.043). This association was more pronounced in women with the BRCA2 mutation (hazard ratio, 2.67; p =0.014). Our results suggest that reproductive factors, such as the age of onset of menarche and the presence of parity, are associated with the clinical presentation patterns of breast cancer in BRCA1/2 mutation carriers.
Genetic Mutation and Exosome Signature of Human Papilloma Virus Associated Oropharyngeal Cancer
Kannan, Anbarasu; Hertweck, Kate L.; Philley, Julie V.; Wells, Robert B.; Dasgupta, Santanu
2017-01-01
Human papilloma virus-16 (HPV-16) associated oropharyngeal cancer (HPVOPC) is increasing alarmingly in the United States. We performed whole genome sequencing of a 44 year old, male HPVOPC subject diagnosed with moderately differentiated tonsillar carcinoma. We identified new somatic mutation in MUC16 (A.k.a. CA-125), MUC12, MUC4, MUC6, MUC2, SIRPA, HLA-DRB1, HLA-A and HLA-B molecules. Increased protein expression of MUC16, SIRPA and decreased expression of HLA-DRB1 was further demonstrated in this HPVOPC subject and an additional set of 15 HPVOPC cases. Copy number gain (3 copies) was also observed for MUC2, MUC4, MUC6 and SIRPA. Enhanced expression of MUC16, SIRPA and HPV-16-E7 protein was detectable in the circulating exosomes of numerous HPVOPC subjects. Treatment of non-tumorigenic mammary epithelial cells with exosomes derived from aggressive HPVOPC cells harboring MUC16, SIRPA and HPV-16-E7 proteins augmented invasion and induced epithelial to mesenchymal transition (EMT) accompanied by an increased expression ratio of the EMT markers Vimentin/E-cadherin. Exosome based screening of key HPVOPC associated molecules could be beneficial for early cancer diagnosis, monitoring and surveillance. PMID:28383029
HFE C282Y and H63D in adults with malignancies in a community medical oncology practice
International Nuclear Information System (INIS)
Barton, James C; Bertoli, Luigi F; Acton, Ronald T
2004-01-01
We sought to compare frequencies of HFE C282Y and H63D alleles and associated odds ratios (OR) in 100 consecutive unrelated white adults with malignancy to those in 318 controls. Data from patients with more than one malignancy were analyzed according to each primary malignancy. For the present study, OR ≥2.0 or ≤0.5 was defined to be increased or decreased, respectively. There were 110 primary malignancies (52 hematologic neoplasms, 58 carcinomas) in the 100 adult patients. Allele frequencies were similar in patients and controls (C282Y: 0.0850 vs. 0.0896, respectively (OR = 0.9); H63D: 0.1400 vs. 0.1447, respectively (OR = 0.9)). Two patients had hemochromatosis and C282Y homozygosity. With C282Y, increased OR occurred in non-Hodgkin lymphoma, myeloproliferative disorders, and adenocarcinoma of prostate (2.0, 2.8, and 3.4, respectively); OR was decreased in myelodysplasia (0.4). With H63D, increased OR occurred in myeloproliferative disorders and adenocarcinomas of breast and prostate (2.4, 2.0, and 2.0, respectively); OR was decreased in non-Hodgkin lymphoma and B-chronic lymphocytic leukemia (0.5 and 0.4, respectively). In 100 consecutive adults with malignancy evaluated in a community medical oncology practice, frequencies of HFE C282Y or H63D were similar to those in the general population. This suggests that C282Y or H63D is not associated with an overall increase in cancer risk. However, odds ratios computed in the present study suggest that increased (or decreased) risk for developing specific types of malignancy may be associated with the inheritance of HFE C282Y or H63D. Study of more patients with these specific types of malignancies is needed to determine if trends described herein would remain and yield significant differences
Patient and tumor characteristics and BRAF and KRAS mutations in colon cancer, NCCTG/Alliance N0147.
Gonsalves, Wilson I; Mahoney, Michelle R; Sargent, Daniel J; Nelson, Garth D; Alberts, Steven R; Sinicrope, Frank A; Goldberg, Richard M; Limburg, Paul J; Thibodeau, Stephen N; Grothey, Axel; Hubbard, Joleen M; Chan, Emily; Nair, Suresh; Berenberg, Jeffrey L; McWilliams, Robert R
2014-07-01
KRAS and BRAF (V600E) mutations are important predictive and prognostic markers, respectively, in colon cancer, but little is known about patient and clinical factors associated with them. Two thousand three hundred twenty-six of 3397 patients in the N0147 phase III adjuvant trial for stage III colon cancer completed a patient questionnaire. Primary tumors were assessed for KRAS and BRAF (V600E) mutations and defective mismatch repair (dMMR) status. Logistic regression models and categorical data analysis were used to identify associations of patient and tumor characteristics with mutation status. All statistical tests were two-sided. KRAS (35%) and BRAF (V600E) (14%) mutations were nearly mutually exclusive. KRAS mutations were more likely to be present in patients without a family history of colon cancer and never smokers. Tumors with KRAS mutations were less likely to have dMMR (odds ratio [OR] = 0.21; 95% confidence interval [CI] = 0.15 to 0.31; P characteristics are associated with KRAS and BRAF (V600E) mutations. © The Author 2014. Published by Oxford University Press. All rights reserved. For Permissions, please e-mail: journals.permissions@oup.com.
Mutations causative of familial hypercholesterolaemia
DEFF Research Database (Denmark)
Benn, Marianne; Watts, Gerald F; Tybjærg-Hansen, Anne
2016-01-01
causing mutations in 98 098 participants from the general population, the Copenhagen General Population Study. METHODS AND RESULTS: We genotyped for LDLR[W23X;W66G;W556S] and APOB[R3500Q] accounting for 38.7% of pathogenic FH mutations in Copenhagen. Clinical FH assessment excluded mutation information......-cholesterol concentration to discriminate between mutation carriers and non-carriers was 4.4 mmol/L. CONCLUSION: Familial hypercholesterolaemia-causing mutations are estimated to occur in 1:217 in the general population and are best identified by a definite or probable phenotypic diagnosis of FH based on the DLCN criteria....... The prevalence of the four FH mutations was 0.18% (1:565), suggesting a total prevalence of FH mutations of 0.46% (1:217). Using the Dutch Lipid Clinic Network (DLCN) criteria, odds ratios for an FH mutation were 439 (95% CI: 170-1 138) for definite FH, 90 (53-152) for probable FH, and 18 (13-25) for possible FH...
2012-01-01
Introduction Several common alleles have been shown to be associated with breast and/or ovarian cancer risk for BRCA1 and BRCA2 mutation carriers. Recent genome-wide association studies of breast cancer have identified eight additional breast cancer susceptibility loci: rs1011970 (9p21, CDKN2A/B), rs10995190 (ZNF365), rs704010 (ZMIZ1), rs2380205 (10p15), rs614367 (11q13), rs1292011 (12q24), rs10771399 (12p11 near PTHLH) and rs865686 (9q31.2). Methods To evaluate whether these single nucleotide polymorphisms (SNPs) are associated with breast cancer risk for BRCA1 and BRCA2 carriers, we genotyped these SNPs in 12,599 BRCA1 and 7,132 BRCA2 mutation carriers and analysed the associations with breast cancer risk within a retrospective likelihood framework. Results Only SNP rs10771399 near PTHLH was associated with breast cancer risk for BRCA1 mutation carriers (per-allele hazard ratio (HR) = 0.87, 95% CI: 0.81 to 0.94, P-trend = 3 × 10-4). The association was restricted to mutations proven or predicted to lead to absence of protein expression (HR = 0.82, 95% CI: 0.74 to 0.90, P-trend = 3.1 × 10-5, P-difference = 0.03). Four SNPs were associated with the risk of breast cancer for BRCA2 mutation carriers: rs10995190, P-trend = 0.015; rs1011970, P-trend = 0.048; rs865686, 2df-P = 0.007; rs1292011 2df-P = 0.03. rs10771399 (PTHLH) was predominantly associated with estrogen receptor (ER)-negative breast cancer for BRCA1 mutation carriers (HR = 0.81, 95% CI: 0.74 to 0.90, P-trend = 4 × 10-5) and there was marginal evidence of association with ER-negative breast cancer for BRCA2 mutation carriers (HR = 0.78, 95% CI: 0.62 to 1.00, P-trend = 0.049). Conclusions The present findings, in combination with previously identified modifiers of risk, will ultimately lead to more accurate risk prediction and an improved understanding of the disease etiology in BRCA1 and BRCA2 mutation carriers. PMID:22348646
Syahruddin, Elisna; Wulandari, Laksmi; Sri Muktiati, Nunuk; Rima, Ana; Soeroso, Noni; Ermayanti, Sabrina; Levi, Michael; Hidajat, Heriawaty; Widjajahakim, Grace; Utomo, Ahmad Rusdan Handoyo
2018-01-01
Purpose We aimed to evaluate the distribution of individual epidermal growth factor receptor (EGFR) mutation subtypes found in routine cytological specimens. Patients and methods A retrospective audit was performed on EGFR testing results of 1,874 consecutive cytological samples of newly diagnosed or treatment-naïve Indonesian lung cancer patients (years 2015–2016). Testing was performed by ISO15189 accredited central laboratory. Results Overall test failure rate was 5.1%, with the highest failure (7.1%) observed in pleural effusion and lowest (1.6%) in needle aspiration samples. EGFR mutation frequency was 44.4%. Tyrosine kinase inhibitor (TKI)-sensitive common EGFR mutations (ins/dels exon 19, L858R) and uncommon mutations (G719X, T790M, L861Q) contributed 57.1% and 29%, respectively. Approximately 13.9% of mutation-positive patients carried a mixture of common and uncommon mutations. Women had higher EGFR mutation rate (52.9%) vs men (39.1%; pcytological techniques yielded similar success rate to detect EGFR mutations. Uncommon EGFR mutations were frequent events in Indonesian lung cancer patients. PMID:29615847
Tummala, Hemanth; Walne, Amanda J; Williams, Mike; Bockett, Nicholas; Collopy, Laura; Cardoso, Shirleny; Ellison, Alicia; Wynn, Rob; Leblanc, Thierry; Fitzgibbon, Jude; Kelsell, David P; van Heel, David A; Payne, Elspeth; Plagnol, Vincent; Dokal, Inderjeet; Vulliamy, Tom
2016-07-07
A substantial number of individuals with bone marrow failure (BMF) present with one or more extra-hematopoietic abnormality. This suggests a constitutional or inherited basis, and yet many of them do not fit the diagnostic criteria of the known BMF syndromes. Through exome sequencing, we have now identified a subgroup of these individuals, defined by germline biallelic mutations in DNAJC21 (DNAJ homolog subfamily C member 21). They present with global BMF, and one individual developed a hematological cancer (acute myeloid leukemia) in childhood. We show that the encoded protein associates with rRNA and plays a highly conserved role in the maturation of the 60S ribosomal subunit. Lymphoblastoid cells obtained from an affected individual exhibit increased sensitivity to the transcriptional inhibitor actinomycin D and reduced amounts of rRNA. Characterization of mutations revealed impairment in interactions with cofactors (PA2G4, HSPA8, and ZNF622) involved in 60S maturation. DNAJC21 deficiency resulted in cytoplasmic accumulation of the 60S nuclear export factor PA2G4, aberrant ribosome profiles, and increased cell death. Collectively, these findings demonstrate that mutations in DNAJC21 cause a cancer-prone BMF syndrome due to corruption of early nuclear rRNA biogenesis and late cytoplasmic maturation of the 60S subunit. Copyright © 2016. Published by Elsevier Inc.
Hornemann, Thorsten; Penno, Anke; Richard, Stephane; Nicholson, Garth; van Dijk, Fleur S; Rotthier, Annelies; Timmerman, Vincent; von Eckardstein, Arnold
2009-04-01
Hereditary sensory neuropathy type 1 (HSAN I) is an autosomal dominant inherited neurodegenerative disorder of the peripheral nervous system associated with mutations in the SPTLC1 subunit of the serine palmitoyltransferase (SPT). Four missense mutations (C133W, C133Y, V144D and G387A) in SPTLC1 were reported to cause HSAN I. SPT catalyses the condensation of Serine and Palmitoyl-CoA, which is the first and rate-limiting step in the de novo synthesis of ceramides. Earlier studies showed that C133W and C133Y mutants have a reduced activity, whereas the impact of the V144D and G387A mutations on the human enzyme was not tested yet. In this paper, we show that none of the HSAN I mutations interferes with SPT complex formation. We demonstrate that also V144D has a reduced SPT activity, however to a lower extent than C133W and C133Y. In contrast, the G387A mutation showed no influence on SPT activity. Furthermore, the growth phenotype of LY-B cells--a SPTLC1 deficient CHO cell line--could be reversed by expressing either the wild-type SPTLC1 or the G387A mutant, but not the C133W mutant. This indicates that the G387A mutation is most likely not directly associated with HSAN I. These findings were genetically confirmed by the identification of a nuclear HSAN family which showed segregation of the G387A variant as a non-synonymous SNP.
Li, Yajuan; Lauriola, Mattia; Kim, Donghwa; Francesconi, Mirko; D'Uva, Gabriele; Shibata, Dave; Malafa, Mokenge P; Yeatman, Timothy J; Coppola, Domenico; Solmi, Rossella; Cheng, Jin Q
2016-09-01
Adenomatous polyposis coli (APC) mutation is the most common genetic change in sporadic colorectal cancer (CRC). Although deregulations of miRNAs have been frequently reported in this malignancy, APC-regulated miRNAs have not been extensively documented. Here, by using an APC-inducible cell line and array analysis, we identified a total of 26 deregulated miRNAs. Among them, members of miR-17-92 cluster were dramatically inhibited by APC and induced by enforced expression of β-catenin. Furthermore, we demonstrate that activated β-catenin resulted from APC loss binds to and activates the miR-17-92 promoter. Notably, enforced expression of miR-19a overrides APC tumor suppressor activity, and knockdown of miR-19a in cancer cells with compromised APC function reduced their aggressive features in vitro. Finally, we observed that expression of miR-19a significantly correlates with β-catenin levels in colorectal cancer specimens, and it is associated to the aggressive stage of tumor progression. Thus, our study reveals that miR-17-92 cluster is directly regulated by APC/β-catenin pathway and could be a potential therapeutic target in colon cancers with aberrant APC/β-catenin signaling.
Directory of Open Access Journals (Sweden)
Meng Yang
2017-05-01
Full Text Available Abstract Background Solid tumors residing in tissues and organs leave footprints in circulation through circulating tumor cells (CTCs and circulating tumor DNAs (ctDNA. Characterization of the ctDNA portraits and comparison with tumor DNA mutational portraits may reveal clinically actionable information on solid tumors that is traditionally achieved through more invasive approaches. Methods We isolated ctDNAs from plasma of patients of 103 lung cancer and 74 other solid tumors of different tissue origins. Deep sequencing using the Guardant360 test was performed to identify mutations in 73 clinically actionable genes, and the results were associated with clinical characteristics of the patient. The mutation profiles of 37 lung cancer cases with paired ctDNA and tumor genomic DNA sequencing were used to evaluate clonal representation of tumor in circulation. Five lung cancer cases with longitudinal ctDNA sampling were monitored for cancer progression or response to treatments. Results Mutations in TP53, EGFR, and KRAS genes are most prevalent in our cohort. Mutation rates of ctDNA are similar in early (I and II and late stage (III and IV cancers. Mutation in DNA repair genes BRCA1, BRCA2, and ATM are found in 18.1% (32/177 of cases. Patients with higher mutation rates had significantly higher mortality rates. Lung cancer of never smokers exhibited significantly higher ctDNA mutation rates as well as higher EGFR and ERBB2 mutations than ever smokers. Comparative analysis of ctDNA and tumor DNA mutation data from the same patients showed that key driver mutations could be detected in plasma even when they were present at a minor clonal population in the tumor. Mutations of key genes found in the tumor tissue could remain in circulation even after frontline radiotherapy and chemotherapy suggesting these mutations represented resistance mechanisms. Longitudinal sampling of five lung cancer cases showed distinct changes in ctDNA mutation portraits that
Chen, Dong; Huang, Jun-Fu; Liu, Kai; Zhang, Li-Qun; Yang, Zhao; Chuai, Zheng-Ran; Wang, Yun-Xia; Shi, Da-Chuan; Huang, Qing; Fu, Wei-Ling
2014-01-01
Colorectal cancer (CRC) is a heterogeneous disease with multiple underlying causative genetic mutations. The B-type Raf proto-oncogene (BRAF) plays an important role in the mitogen-activated protein kinase (MAPK) signaling cascade during CRC. The presence of BRAFV600E mutation can determine the response of a tumor to chemotherapy. However, the association between the BRAFV600E mutation and the clinicopathological features of CRC remains controversial. We performed a systematic review and meta-analysis to estimate the effect of BRAFV600E mutation on the clinicopathological characteristics of CRC. We identified studies that examined the effect of BRAFV600E mutation on CRC within the PubMed, ISI Science Citation Index, and Embase databases. The effect of BRAFV600E on outcome parameters was estimated by odds ratios (ORs) with 95% confidence intervals (CIs) for each study using a fixed effects or random effects model. 25 studies with a total of 11,955 CRC patients met inclusion criteria. The rate of BRAFV600 was 10.8% (1288/11955). The BRAFV600E mutation in CRC was associated with advanced TNM stage, poor differentiation, mucinous histology, microsatellite instability (MSI), CpG island methylator phenotype (CIMP). This mutation was also associated with female gender, older age, proximal colon, and mutL homolog 1 (MLH1) methylation. This meta-analysis demonstrated that BRAFV600E mutation was significantly correlated with adverse pathological features of CRC and distinct clinical characteristics. These data suggest that BRAFV600E mutation could be used to supplement standard clinical and pathological staging for the better management of individual CRC patients, and could be considered as a poor prognostic marker for CRC.
Alcohol Consumption and the Risk of Colorectal Cancer for Mismatch Repair Gene Mutation Carriers.
Dashti, S Ghazaleh; Buchanan, Daniel D; Jayasekara, Harindra; Ait Ouakrim, Driss; Clendenning, Mark; Rosty, Christophe; Winship, Ingrid M; Macrae, Finlay A; Giles, Graham G; Parry, Susan; Casey, Graham; Haile, Robert W; Gallinger, Steven; Le Marchand, Loïc; Thibodeau, Stephen N; Lindor, Noralane M; Newcomb, Polly A; Potter, John D; Baron, John A; Hopper, John L; Jenkins, Mark A; Win, Aung Ko
2017-03-01
Background: People with germline mutation in one of the DNA mismatch repair (MMR) genes have increased colorectal cancer risk. For these high-risk people, study findings of the relationship between alcohol consumption and colorectal cancer risk have been inconclusive. Methods: 1,925 MMR gene mutations carriers recruited into the Colon Cancer Family Registry who had completed a questionnaire on lifestyle factors were included. Weighted Cox proportional hazard regression models were used to estimate hazard ratios (HR) and 95% confidence intervals (CI) for the association between alcohol consumption and colorectal cancer. Results: Colorectal cancer was diagnosed in 769 carriers (40%) at a mean (SD) age of 42.6 (10.3) years. Compared with abstention, ethanol consumption from any alcoholic beverage up to 14 g/day and >28 g/day was associated with increased colorectal cancer risk (HR, 1.50; 95% CI, 1.09-2.07 and 1.69; 95% CI, 1.07-2.65, respectively; P trend = 0.05), and colon cancer risk (HR, 1.78; 95% CI, 1.27-2.49 and 1.94; 95% CI, 1.19-3.18, respectively; P trend = 0.02). However, there was no clear evidence for an association with rectal cancer risk. Also, there was no evidence for associations between consumption of individual alcoholic beverage types (beer, wine, spirits) and colorectal, colon, or rectal cancer risk. Conclusions: Our data suggest that alcohol consumption, particularly more than 28 g/day of ethanol (∼2 standard drinks of alcohol in the United States), is associated with increased colorectal cancer risk for MMR gene mutation carriers. Impact: Although these data suggested that alcohol consumption in MMR carriers was associated with increased colorectal cancer risk, there was no evidence of a dose-response, and not all types of alcohol consumption were associated with increased risk. Cancer Epidemiol Biomarkers Prev; 26(3); 366-75. ©2016 AACR . ©2016 American Association for Cancer Research.
Wimmer, Katharina; Beilken, Andreas; Nustede, Rainer; Ripperger, Tim; Lamottke, Britta; Ure, Benno; Steinmann, Diana; Reineke-Plaass, Tanja; Lehmann, Ulrich; Zschocke, Johannes; Valle, Laura; Fauth, Christine; Kratz, Christian P
2017-01-01
In a 14-year-old boy with polyposis and rectosigmoid carcinoma, we identified a novel POLE germline mutation, p.(Val411Leu), previously found as recurrent somatic mutation in 'ultramutated' sporadic cancers. This is the youngest reported cancer patient with polymerase proofreading-associated polyposis indicating that POLE mutation p.(Val411Leu) may confer a more severe phenotype than previously reported POLE and POLD1 germline mutations. The patient had multiple café-au-lait macules and a pilomatricoma mimicking the clinical phenotype of constitutional mismatch repair deficiency. We hypothesize that these skin features may be common to different types of constitutional DNA repair defects associated with polyposis and early-onset cancer.
DEFF Research Database (Denmark)
Milman, Nils; Koefoed, Pernille; Pedersen, Palle
2003-01-01
AIM: To assess the frequency of the C282Y and H63D mutations on the HFE gene in Danish patients with clinical hereditary haemochromatosis initially diagnosed by phenotypic methods. METHODS: In the period 1950-1985, an epidemiological survey in Denmark identified 179 patients with clinical...... diagnosis of clinical idiopathic haemochromatosis was made before blood samples were taken for HFE genotyping. The total series consisted of 58 patients (40 men and 18 women) with a median age of 60 yrs (range 18-74). HFE genotyping was performed by the polymerase chain reaction (PCR) technique. RESULTS...
Negahdar, Maria; Aukrust, Ingvild; Molnes, Janne; Solheim, Marie H; Johansson, Bente B; Sagen, Jørn V; Dahl-Jørgensen, Knut; Kulkarni, Rohit N; Søvik, Oddmund; Flatmark, Torgeir; Njølstad, Pål R; Bjørkhaug, Lise
2014-01-25
GCK-MODY, dominantly inherited mild hyperglycemia, is associated with more than 600 mutations in the glucokinase gene. Different molecular mechanisms have been shown to explain GCK-MODY. Here, we report a Pakistani family harboring the glucokinase mutation c.823C>T (p.R275C). The recombinant and in cellulo expressed mutant pancreatic enzyme revealed slightly increased enzyme activity (kcat) and normal affinity for α-D-glucose, and resistance to limited proteolysis by trypsin comparable with wild-type. When stably expressed in HEK293 cells and MIN6 β-cells (at different levels), the mutant protein appeared misfolded and unstable with a propensity to form dimers and aggregates. Its degradation rate was increased, involving the lysosomal and proteasomal quality control systems. On mutation, a hydrogen bond between the R275 side-chain and the carbonyl oxygen of D267 is broken, destabilizing the F260-L271 loop structure and the protein. This promotes the formation of dimers/aggregates and suggests that an increased cellular degradation is the molecular mechanism by which R275C causes GCK-MODY. Copyright © 2013 Elsevier Ireland Ltd. All rights reserved.
Identifying driver mutations in sequenced cancer genomes
DEFF Research Database (Denmark)
Raphael, Benjamin J; Dobson, Jason R; Oesper, Layla
2014-01-01
High-throughput DNA sequencing is revolutionizing the study of cancer and enabling the measurement of the somatic mutations that drive cancer development. However, the resulting sequencing datasets are large and complex, obscuring the clinically important mutations in a background of errors, nois...... patterns of mutual exclusivity. These techniques, coupled with advances in high-throughput DNA sequencing, are enabling precision medicine approaches to the diagnosis and treatment of cancer....
Directory of Open Access Journals (Sweden)
Talseth-Palmer Bente A
2010-05-01
Full Text Available Abstract Background Approximately 10% of Lynch syndrome families have a mutation in MSH6 and fewer families have a mutation in PMS2. It is assumed that the cancer incidence is the same in families with mutations in MSH6 as in families with mutations in MLH1/MSH2 but that the disease tends to occur later in life, little is known about families with PMS2 mutations. This study reports on our findings on mutation type, cancer risk and age of diagnosis in MSH6 and PMS2 families. Methods A total of 78 participants (from 29 families with a mutation in MSH6 and 7 participants (from 6 families with a mutation in PMS2 were included in the current study. A database of de-identified patient information was analysed to extract all relevant information such as mutation type, cancer incidence, age of diagnosis and cancer type in this Lynch syndrome cohort. Cumulative lifetime risk was calculated utilising Kaplan-Meier survival analysis. Results MSH6 and PMS2 mutations represent 10.3% and 1.9%, respectively, of the pathogenic mutations in our Australian Lynch syndrome families. We identified 26 different MSH6 and 4 different PMS2 mutations in the 35 families studied. We report 15 novel MSH6 and 1 novel PMS2 mutations. The estimated cumulative risk of CRC at age 70 years was 61% (similar in males and females and 65% for endometrial cancer in MSH6 mutation carriers. The risk of developing CRC is different between males and females at age 50 years, which is 34% for males and 21% for females. Conclusion Novel MSH6 and PMS2 mutations are being reported and submitted to the current databases for identified Lynch syndrome mutations. Our data provides additional information to add to the genotype-phenotype spectrum for both MSH6 and PMS2 mutations.
Mutations in MC1R Gene Determine Black Coat Color Phenotype in Chinese Sheep
Directory of Open Access Journals (Sweden)
Guang-Li Yang
2013-01-01
Full Text Available The melanocortin receptor 1 (MC1R plays a central role in regulation of animal coat color formation. In this study, we sequenced the complete coding region and parts of the 5′- and 3′-untranslated regions of the MC1R gene in Chinese sheep with completely white (Large-tailed Han sheep, black (Minxian Black-fur sheep, and brown coat colors (Kazakh Fat-Rumped sheep. The results showed five single nucleotide polymorphisms (SNPs: two non-synonymous mutations previously associated with coat color (c.218 T>A, p.73 Met>Lys. c.361 G>A, p.121 Asp>Asn and three synonymous mutations (c.429 C>T, p.143 Tyr>Tyr; c.600 T>G, p.200 Leu>Leu. c.735 C>T, p.245 Ile>Ile. Meanwhile, all mutations were detected in Minxian Black-fur sheep. However, the two nonsynonymous mutation sites were not in all studied breeds (Large-tailed Han, Small-tailed Han, Gansu Alpine Merino, and China Merino breeds, all of which are in white coat. A single haplotype AATGT (haplotype3 was uniquely associated with black coat color in Minxian Black-fur breed (P=9.72E-72, chi-square test. The first and second A alleles in this haplotype 3 represent location at 218 and 361 positions, respectively. Our results suggest that the mutations of MC1R gene are associated with black coat color phenotype in Chinese sheep.
K-ras mutations in sinonasal cancers in relation to wood dust exposure
International Nuclear Information System (INIS)
Bornholdt, Jette; Vogel, Ulla; Husgafvel-Pursiainen, Kirsti; Wallin, Håkan; Hansen, Johnni; Steiniche, Torben; Dictor, Michael; Antonsen, Annemarie; Wolff, Henrik; Schlünssen, Vivi; Holmila, Reetta; Luce, Danièle
2008-01-01
Cancer in the sinonasal tract is rare, but persons who have been occupationally exposed to wood dust have a substantially increased risk. It has been estimated that approximately 3.6 million workers are exposed to inhalable wood dust in EU. In previous small studies of this cancer, ras mutations were suggested to be related to wood dust exposure, but these studies were too limited to detect statistically significant associations. We examined 174 cases of sinonasal cancer diagnosed in Denmark in the period from 1991 to 2001. To ensure uniformity, all histological diagnoses were carefully reviewed pathologically before inclusion. Paraffin embedded tumour samples from 58 adenocarcinomas, 109 squamous cell carcinomas and 7 other carcinomas were analysed for K-ras codon 12, 13 and 61 point mutations by restriction fragment length polymorphisms and direct sequencing. Information on occupational exposure to wood dust and to potential confounders was obtained from telephone interviews and from registry data. Among the patients in this study, exposure to wood dust was associated with a 21-fold increased risk of having an adenocarcinoma than a squamous cell carcinoma compared to unexposed [OR = 21.0, CI = 8.0–55.0]. K-ras was mutated in 13% of the adenocarcinomas (seven patients) and in 1% of squamous cell carcinomas (one patient). Of these eight mutations, five mutations were located in the codon 12. The exact sequence change of remaining three could not be identified unambiguously. Among the five identified mutations, the G→A transition was the most common, and it was present in tumour tissue from two wood dust exposed adenocarcinoma patients and one patient with unknown exposure. Previously published studies of sinonasal cancer also identify the GGT → GAT transition as the most common and often related to wood dust exposure. Patients exposed to wood dust seemed more likely to develop adenocarcinoma compared to squamous cell carcinomas. K-ras mutations were detected
Directory of Open Access Journals (Sweden)
Giselly Encinas
2015-10-01
Full Text Available Summary Objective: our aim was to evaluate whether somatic mutations in five genes were associated with an early age at presentation of breast cancer (BC or serous ovarian cancer (SOC. Methods: COSMIC database was searched for the five most frequent somatic mutations in BC and SOC. A systematic review of PubMed was performed. Young age for BC and SOC patients was set at ≤35 and ≤40 years, respectively. Age groups were also classified in <30years and every 10 years thereafter. Results: twenty six (1,980 patients, 111 younger and 16 studies (598, 41 younger, were analyzed for BC and SOC, respectively. In BC, PIK3CA wild type tumor was associated with early onset, not confirmed in binary regression with estrogen receptor (ER status. In HER2-negative tumors, there was increased frequency of PIK3CA somatic mutation in older age groups; in ER-positive tumors, there was a trend towards an increased frequency of PIK3CA somatic mutation in older age groups. TP53 somatic mutation was described in 20% of tumors from both younger and older patients; PTEN, CDH1 and GATA3 somatic mutation was investigated only in 16 patients and PTEN mutation was detected in one of them. In SOC, TP53 somatic mutation was rather common, detected in more than 50% of tumors, however, more frequently in older patients. Conclusion: frequency of somatic mutations in specific genes was not associated with early-onset breast cancer. Although very common in patients with serous ovarian cancer diagnosed at all ages, TP53 mutation was more frequently detected in older women.
JORDI SALAS; NURIA LASO; SERGI MAS; M. JOSE LAFUENTE; XAVIER CASTERAD; MANUEL TRIAS; ANTONIO BALLESTA; RAFAEL MOLINA; CARLOS ASCASO; SHICHUN ZHENG; JOHN K. WIENCKE; AMALIA LAFUENTE
2004-01-01
Decrease in specific micronutrient intake in colorectal cancer patients with tumors presenting Ki-ras mutation BACKGROUND: The diversity of the Mediterranean diet and the heterogeneity of acquired genetic alterations in colorectal cancer (CRC) led us to examine the possible association between dietary factors and mutations, such as Ki-ras mutations, in genes implicated in the pathogenesis of these neoplasms. PATIENTS AND METHODS: The study was based on 246 cases and 296 controls. For th...
Coexistence of K-ras mutations and HPV infection in colon cancer
Directory of Open Access Journals (Sweden)
Tezol Ayda
2006-05-01
Full Text Available Abstract Background Activation of the ras genes or association with human papillomavirus infection have been extensively studied in colorectal cancer. However, the correlation between K-ras mutations and HPV in colorectal cancer has not been investigated yet. In this study we aimed to investigate the presence of K-ras mutations and their correlation with HPV infection in colon cancer. Methods K-ras mutations were analyzed by a mutagenic PCR assay and digestion with specific restriction enzymes to distinguish the wild-type and mutant codons. HPV infection was analyzed by PCR amplification and hybridization with specific probes by Southern blotting. Stattistical analyses were performed by the chi-square and Fisher's exact tests Results HPV gene fragments were detected in 43 tumors and 17 normal tissue samples. HPV 18 was the prevalent type in the tumor tissue. A mutation at codon 12 of the K-ras gene was present in 31 patients. 56% of the HPV-positive tumors also harbored a K-ras mutation. Codon 13 mutations were not observed. These data indicate that infection with high risk HPV types and mutational activation of the K-ras gene are frequent events in colorectal carcinogenesis. Conclusion Our findings suggest that mutational activation of the K-ras gene is a common event in colon carcinogenesis and that HPV infection may represent an important factor in the development of the premalignant lesions leading to the neoplastic phenotype.
Functional Analysis of Cancer-Associated DNA Polymerase ε Variants in Saccharomyces cerevisiae
Directory of Open Access Journals (Sweden)
Stephanie R. Barbari
2018-03-01
Full Text Available DNA replication fidelity relies on base selectivity of the replicative DNA polymerases, exonucleolytic proofreading, and postreplicative DNA mismatch repair (MMR. Ultramutated human cancers without MMR defects carry alterations in the exonuclease domain of DNA polymerase ε (Polε. They have been hypothesized to result from defective proofreading. However, modeling of the most common variant, Polε-P286R, in yeast produced an unexpectedly strong mutator effect that exceeded the effect of proofreading deficiency by two orders of magnitude and indicated the involvement of other infidelity factors. The in vivo consequences of many additional Polε mutations reported in cancers remain poorly understood. Here, we genetically characterized 13 cancer-associated Polε variants in the yeast system. Only variants directly altering the DNA binding cleft in the exonuclease domain elevated the mutation rate. Among these, frequently recurring variants were stronger mutators than rare variants, in agreement with the idea that mutator phenotype has a causative role in tumorigenesis. In nearly all cases, the mutator effects exceeded those of an exonuclease-null allele, suggesting that mechanisms distinct from loss of proofreading may drive the genome instability in most ultramutated tumors. All mutator alleles were semidominant, supporting the view that heterozygosity for the polymerase mutations is sufficient for tumor development. In contrast to the DNA binding cleft alterations, peripherally located variants, including a highly recurrent V411L, did not significantly elevate mutagenesis. Finally, the analysis of Polε variants found in MMR-deficient tumors suggested that the majority cause no mutator phenotype alone but some can synergize with MMR deficiency to increase the mutation rate.
JAK2 V617F, MPL W515L and JAK2 Exon 12 Mutations in Chinese Patients with Primary Myelofibrosis.
Xia, Jun; Lu, Mi-Ze; Jiang, Yuan-Qiang; Yang, Guo-Hua; Zhuang, Yun; Sun, Hong-Li; Shen, Yun-Feng
2012-03-01
JAK2 V617F, MPL W515L and JAK2 exon 12 mutations are novel acquired mutations that induce constitutive cytokine-independent activation of the JAK-STAT pathway in myeloproliferative disorders (MPD). The discovery of these mutations provides novel mechanism for activation of signal transduction in hematopoietic malignancies. This research was to investigate their prevalence in Chinese patients with primary myelofibrosis (PMF). We introduced allele-specific PCR (AS-PCR) combined with sequence analysis to simultaneously screen JAK2 V617F, MPL W515L and JAK2 exon 12 mutations in 30 patients with PMF. Fifteen PMF patients (50.0%) carried JAK2 V617F mutation, and only two JAK2 V617F-negative patients (6.7%) harbored MPL W515L mutation. None had JAK2 exon 12 mutations. Furthermore, these three mutations were not detected in 50 healthy controls. MPL W515L and JAK2 V617F mutations existed in PMF patients but JAK2 exon 12 mutations not. JAK2 V617F and MPL W515L and mutations might contribute to the primary molecular pathogenesis in patients with PMF.
Directory of Open Access Journals (Sweden)
Tea Skaaby
Full Text Available Filaggrin proteins are expressed in the skin, oral cavity, oesophagus, and cervical mucose. Loss-of-function mutations in the filaggrin gene (FLG reduce filaggrin expression and cause an impaired skin barrier function. We hypothesized that FLG mutation carriers would be more susceptible to human papillomavirus (HPV infection and thus a higher risk of HPV-related cancer and pre-cancer. We investigated the association of the FLG genotype with incidence of HPV-related cancer of cervix, vagina, vulva, penis, anus and head and neck, and pre-cancer of the cervix.We included 13,376 persons from four population-based studies conducted in the same background population in Copenhagen, Denmark. Participants were genotyped for the most common FLG mutations in Europeans. Information on cancer was obtained from The Danish Cancer Registry until 11 July 2011.There were 489 cases of prevalent and 97 cases of incident HPV-related cancer and pre-cancer (median follow-up 11.5 years. There was a statistically significant association between FLG genotype and incident HPV-related cancer and pre-cancer with a hazard ratio, HR = 2.1 (95% confidence intervals, CI: 1.2, 3.7 for FLG mutation carriers vs. wild types.FLG loss-of-function mutations were associated with higher incidence of HPV-related cancers and pre-cancers that are potentially screening and vaccine preventable.
Blein, Sophie; Bardel, Claire; Danjean, Vincent; McGuffog, Lesley; Healey, Sue; Barrowdale, Daniel; Lee, Andrew; Dennis, Joe; Kuchenbaecker, Karoline B; Soucy, Penny; Terry, Mary Beth; Chung, Wendy K; Goldgar, David E; Buys, Saundra S; Janavicius, Ramunas; Tihomirova, Laima; Tung, Nadine; Dorfling, Cecilia M; van Rensburg, Elizabeth J; Neuhausen, Susan L; Ding, Yuan Chun; Gerdes, Anne-Marie; Ejlertsen, Bent; Nielsen, Finn C; Hansen, Thomas Vo; Osorio, Ana; Benitez, Javier; Conejero, Raquel Andrés; Segota, Ena; Weitzel, Jeffrey N; Thelander, Margo; Peterlongo, Paolo; Radice, Paolo; Pensotti, Valeria; Dolcetti, Riccardo; Bonanni, Bernardo; Peissel, Bernard; Zaffaroni, Daniela; Scuvera, Giulietta; Manoukian, Siranoush; Varesco, Liliana; Capone, Gabriele L; Papi, Laura; Ottini, Laura; Yannoukakos, Drakoulis; Konstantopoulou, Irene; Garber, Judy; Hamann, Ute; Donaldson, Alan; Brady, Angela; Brewer, Carole; Foo, Claire; Evans, D Gareth; Frost, Debra; Eccles, Diana; Douglas, Fiona; Cook, Jackie; Adlard, Julian; Barwell, Julian; Walker, Lisa; Izatt, Louise; Side, Lucy E; Kennedy, M John; Tischkowitz, Marc; Rogers, Mark T; Porteous, Mary E; Morrison, Patrick J; Platte, Radka; Eeles, Ros; Davidson, Rosemarie; Hodgson, Shirley; Cole, Trevor; Godwin, Andrew K; Isaacs, Claudine; Claes, Kathleen; De Leeneer, Kim; Meindl, Alfons; Gehrig, Andrea; Wappenschmidt, Barbara; Sutter, Christian; Engel, Christoph; Niederacher, Dieter; Steinemann, Doris; Plendl, Hansjoerg; Kast, Karin; Rhiem, Kerstin; Ditsch, Nina; Arnold, Norbert; Varon-Mateeva, Raymonda; Schmutzler, Rita K; Preisler-Adams, Sabine; Markov, Nadja Bogdanova; Wang-Gohrke, Shan; de Pauw, Antoine; Lefol, Cédrick; Lasset, Christine; Leroux, Dominique; Rouleau, Etienne; Damiola, Francesca; Dreyfus, Hélène; Barjhoux, Laure; Golmard, Lisa; Uhrhammer, Nancy; Bonadona, Valérie; Sornin, Valérie; Bignon, Yves-Jean; Carter, Jonathan; Van Le, Linda; Piedmonte, Marion; DiSilvestro, Paul A; de la Hoya, Miguel; Caldes, Trinidad; Nevanlinna, Heli; Aittomäki, Kristiina; Jager, Agnes; van den Ouweland, Ans Mw; Kets, Carolien M; Aalfs, Cora M; van Leeuwen, Flora E; Hogervorst, Frans Bl; Meijers-Heijboer, Hanne Ej; Oosterwijk, Jan C; van Roozendaal, Kees Ep; Rookus, Matti A; Devilee, Peter; van der Luijt, Rob B; Olah, Edith; Diez, Orland; Teulé, Alex; Lazaro, Conxi; Blanco, Ignacio; Del Valle, Jesús; Jakubowska, Anna; Sukiennicki, Grzegorz; Gronwald, Jacek; Lubinski, Jan; Durda, Katarzyna; Jaworska-Bieniek, Katarzyna; Agnarsson, Bjarni A; Maugard, Christine; Amadori, Alberto; Montagna, Marco; Teixeira, Manuel R; Spurdle, Amanda B; Foulkes, William; Olswold, Curtis; Lindor, Noralane M; Pankratz, Vernon S; Szabo, Csilla I; Lincoln, Anne; Jacobs, Lauren; Corines, Marina; Robson, Mark; Vijai, Joseph; Berger, Andreas; Fink-Retter, Anneliese; Singer, Christian F; Rappaport, Christine; Kaulich, Daphne Geschwantler; Pfeiler, Georg; Tea, Muy-Kheng; Greene, Mark H; Mai, Phuong L; Rennert, Gad; Imyanitov, Evgeny N; Mulligan, Anna Marie; Glendon, Gord; Andrulis, Irene L; Tchatchou, Sandrine; Toland, Amanda Ewart; Pedersen, Inge Sokilde; Thomassen, Mads; Kruse, Torben A; Jensen, Uffe Birk; Caligo, Maria A; Friedman, Eitan; Zidan, Jamal; Laitman, Yael; Lindblom, Annika; Melin, Beatrice; Arver, Brita; Loman, Niklas; Rosenquist, Richard; Olopade, Olufunmilayo I; Nussbaum, Robert L; Ramus, Susan J; Nathanson, Katherine L; Domchek, Susan M; Rebbeck, Timothy R; Arun, Banu K; Mitchell, Gillian; Karlan, Beth Y; Lester, Jenny; Orsulic, Sandra; Stoppa-Lyonnet, Dominique; Thomas, Gilles; Simard, Jacques; Couch, Fergus J; Offit, Kenneth; Easton, Douglas F; Chenevix-Trench, Georgia; Antoniou, Antonis C; Mazoyer, Sylvie; Phelan, Catherine M; Sinilnikova, Olga M; Cox, David G
2015-04-25
Individuals carrying pathogenic mutations in the BRCA1 and BRCA2 genes have a high lifetime risk of breast cancer. BRCA1 and BRCA2 are involved in DNA double-strand break repair, DNA alterations that can be caused by exposure to reactive oxygen species, a main source of which are mitochondria. Mitochondrial genome variations affect electron transport chain efficiency and reactive oxygen species production. Individuals with different mitochondrial haplogroups differ in their metabolism and sensitivity to oxidative stress. Variability in mitochondrial genetic background can alter reactive oxygen species production, leading to cancer risk. In the present study, we tested the hypothesis that mitochondrial haplogroups modify breast cancer risk in BRCA1/2 mutation carriers. We genotyped 22,214 (11,421 affected, 10,793 unaffected) mutation carriers belonging to the Consortium of Investigators of Modifiers of BRCA1/2 for 129 mitochondrial polymorphisms using the iCOGS array. Haplogroup inference and association detection were performed using a phylogenetic approach. ALTree was applied to explore the reference mitochondrial evolutionary tree and detect subclades enriched in affected or unaffected individuals. We discovered that subclade T1a1 was depleted in affected BRCA2 mutation carriers compared with the rest of clade T (hazard ratio (HR) = 0.55; 95% confidence interval (CI), 0.34 to 0.88; P = 0.01). Compared with the most frequent haplogroup in the general population (that is, H and T clades), the T1a1 haplogroup has a HR of 0.62 (95% CI, 0.40 to 0.95; P = 0.03). We also identified three potential susceptibility loci, including G13708A/rs28359178, which has demonstrated an inverse association with familial breast cancer risk. This study illustrates how original approaches such as the phylogeny-based method we used can empower classical molecular epidemiological studies aimed at identifying association or risk modification effects.
Directory of Open Access Journals (Sweden)
Dong Chen
Full Text Available BACKGROUND: Colorectal cancer (CRC is a heterogeneous disease with multiple underlying causative genetic mutations. The B-type Raf proto-oncogene (BRAF plays an important role in the mitogen-activated protein kinase (MAPK signaling cascade during CRC. The presence of BRAFV600E mutation can determine the response of a tumor to chemotherapy. However, the association between the BRAFV600E mutation and the clinicopathological features of CRC remains controversial. We performed a systematic review and meta-analysis to estimate the effect of BRAFV600E mutation on the clinicopathological characteristics of CRC. METHODS: We identified studies that examined the effect of BRAFV600E mutation on CRC within the PubMed, ISI Science Citation Index, and Embase databases. The effect of BRAFV600E on outcome parameters was estimated by odds ratios (ORs with 95% confidence intervals (CIs for each study using a fixed effects or random effects model. RESULTS: 25 studies with a total of 11,955 CRC patients met inclusion criteria. The rate of BRAFV600 was 10.8% (1288/11955. The BRAFV600E mutation in CRC was associated with advanced TNM stage, poor differentiation, mucinous histology, microsatellite instability (MSI, CpG island methylator phenotype (CIMP. This mutation was also associated with female gender, older age, proximal colon, and mutL homolog 1 (MLH1 methylation. CONCLUSIONS: This meta-analysis demonstrated that BRAFV600E mutation was significantly correlated with adverse pathological features of CRC and distinct clinical characteristics. These data suggest that BRAFV600E mutation could be used to supplement standard clinical and pathological staging for the better management of individual CRC patients, and could be considered as a poor prognostic marker for CRC.
PIK3CA mutations frequently coexist with RAS and BRAF mutations in patients with advanced cancers.
Directory of Open Access Journals (Sweden)
Filip Janku
Full Text Available Oncogenic mutations of PIK3CA, RAS (KRAS, NRAS, and BRAF have been identified in various malignancies, and activate the PI3K/AKT/mTOR and RAS/RAF/MEK pathways, respectively. Both pathways are critical drivers of tumorigenesis.Tumor tissues from 504 patients with diverse cancers referred to the Clinical Center for Targeted Therapy at MD Anderson Cancer Center starting in October 2008 were analyzed for PIK3CA, RAS (KRAS, NRAS, and BRAF mutations using polymerase chain reaction-based DNA sequencing.PIK3CA mutations were found in 54 (11% of 504 patients tested; KRAS in 69 (19% of 367; NRAS in 19 (8% of 225; and BRAF in 31 (9% of 361 patients. PIK3CA mutations were most frequent in squamous cervical (5/14, 36%, uterine (7/28, 25%, breast (6/29, 21%, and colorectal cancers (18/105, 17%; KRAS in pancreatic (5/9, 56%, colorectal (49/97, 51%, and uterine cancers (3/20, 15%; NRAS in melanoma (12/40, 30%, and uterine cancer (2/11, 18%; BRAF in melanoma (23/52, 44%, and colorectal cancer (5/88, 6%. Regardless of histology, KRAS mutations were found in 38% of patients with PIK3CA mutations compared to 16% of patients with wild-type (wtPIK3CA (p = 0.001. In total, RAS (KRAS, NRAS or BRAF mutations were found in 47% of patients with PIK3CA mutations vs. 24% of patients wtPIK3CA (p = 0.001. PIK3CA mutations were found in 28% of patients with KRAS mutations compared to 10% with wtKRAS (p = 0.001 and in 20% of patients with RAS (KRAS, NRAS or BRAF mutations compared to 8% with wtRAS (KRAS, NRAS or wtBRAF (p = 0.001.PIK3CA, RAS (KRAS, NRAS, and BRAF mutations are frequent in diverse tumors. In a wide variety of tumors, PIK3CA mutations coexist with RAS (KRAS, NRAS and BRAF mutations.
A.M. Mulligan (Anna Marie); F.J. Couch (Fergus); D. Barrowdale (Daniel); S.M. Domchek (Susan); D. Eccles (Diana); H. Nevanlinna (Heli); S.J. Ramus (Susan); M. Robson (Mark); M.E. Sherman (Mark); A.B. Spurdle (Amanda); B. Wapenschmidt (Barbara); A. Lee (Andrew); L. McGuffog (Lesley); S. Healey (Sue); O. Sinilnikova (Olga); R. Janavicius (Ramunas); T.V.O. Hansen (Thomas); F.C. Nielsen (Finn); B. Ejlertsen (Bent); A. Osorio (Ana); I. Muñoz-Repeto (Iván); M. Durán (Mercedes); J. Godino (Javier); M. Pertesi (Maroulio); J. Benítez (Javier); P. Peterlongo (Paolo); S. Manoukian (Siranoush); B. Peissel (Bernard); D. Zaffaroni (D.); E. Cattaneo (Elisa); B. Bonnani (Bernardo); A. Viel (Alessandra); B. Pasini (Barbara); L. Papi (Laura); L. Ottini (Laura); A. Savarese (Antonella); L. Bernard (Loris); P. Radice (Paolo); U. Hamann (Ute); M. Verheus (Martijn); E.J. Meijers-Heijboer (Hanne); J.T. Wijnen (Juul); E.B. Gómez García (Encarna); M.R. Nelen (Marcel); C.M. Kets; C.M. Seynaeve (Caroline); M.M.A. Tilanus-Linthorst (Madeleine); R.B. van der Luijt (Rob); T.V. Os (Theo); M.A. Rookus (Matti); D. Frost (Debra); J.L. Jones (J Louise); D.G. Evans (Gareth); F. Lalloo (Fiona); R. Eeles (Rosalind); L. Izatt (Louise); J.W. Adlard (Julian); R. Davidson (Rosemarie); J. Cook (Jackie); A. Donaldson (Alan); H. Dorkins (Huw); H. Gregory (Helen); J. Eason (Jacqueline); C. Houghton (Catherine); J. Barwell (Julian); L. Side (Lucy); E. McCann (Emma); A. Murray (Alexandra); S. Peock (Susan); A.K. Godwin (Andrew); R.K. Schmutzler (Rita); K. Rhiem (Kerstin); C.W. Engel (Christoph); A. Meindl (Alfons); I. Ruehl (Ina); N. Arnold (Norbert); D. Niederacher (Dieter); C. Sutter (Christian); H. Deissler (Helmut); D. Gadzicki (Dorothea); K. Kast (Karin); S. Preisler-Adams (Sabine); R. Varon-Mateeva (Raymonda); I. Schoenbuchner (Ines); B. Fiebig (Britta); W. Heinritz (Wolfram); D. Schäfer (Dieter); H. Gevensleben (Heidrun); V. Caux-Moncoutier (Virginie); M. Fassy-Colcombet (Marion); F. Cornelis (Franco̧is); S. Mazoyer (Sylvie); M. Léone (Mélanie); N. Boutry-Kryza (N.); A. Hardouin (Agnès); P. Berthet (Pascaline); D.W. Muller (Danièle); J.P. Fricker (Jean Pierre); I. Mortemousque (Isabelle); P. Pujol (Pascal); I. Coupier (Isabelle); M. Lebrun (Marine); C. Kientz (Caroline); M. Longy (Michel); N. Sevenet (Nicolas); D. Stoppa-Lyonnet (Dominique); C. Isaacs (Claudine); T. Caldes (Trinidad); M. de La Hoya (Miguel); T. Heikinen (Tuomas); K. Aittomäki (Kristiina); I. Blanco (Ignacio); C. Lazaro (Conxi); R.B. Barkardottir (Rosa); P. Soucy (Penny); M. Dumont (Martine); J. Simard (Jacques); M. Montagna (Marco); S. Tognazzo (Silvia); E. D'Andrea (Emma); S.B. Fox (Stephen); M. Yan (Max); R. Rebbeck (Timothy); O.I. Olopade (Olofunmilayo); J.N. Weitzel (Jeffrey); H. Lynch (Henry); P.A. Ganz (Patricia); G. Tomlinson (Gail); X. Wang (Xing); Z. Fredericksen (Zachary); V.S. Pankratz (Shane); N.M. Lindor (Noralane); C. Szabo (Csilla); K. Offit (Kenneth); R. Sakr (Rita); M.M. Gaudet (Mia); K.P. Bhatia (Kailash); N. Kauff (Noah); C.F. Singer (Christian); M.-K. Tea; D. Gschwantler-Kaulich (Daphne); A. Fink-Retter (Anneliese); P.L. Mai (Phuong); M.H. Greene (Mark); E.N. Imyanitov (Evgeny); F.P. O'Malley (Frances); H. Ozcelik (Hilmi); G. Glendon (Gord); A.E. Toland (Amanda); A-M. Gerdes (Anne-Marie); M. Thomassen (Mads); T.A. Kruse (Torben); U.B. Jensen; A.-B. Skytte (Anne-Bine); M.A. Caligo (Maria); M. Soller (Maria); K. Henriksson (Karin); A. von Wachenfeldt (Anna); B. Arver (Brita Wasteson); M. Stenmark-Askmalm (M.); P. Karlsson (Per); Y.C. Ding (Yuan); S.L. Neuhausen (Susan); M.S. Beattie (Mary); P.D.P. Pharoah (Paul); K.B. Moysich (Kirsten); K.L. Nathanson (Katherine); B.Y. Karlan (Beth); J. Gross (Jenny); E.M. John (Esther); M.B. Daly (Mary); S.S. Buys (Saundra); M.C. Southey (Melissa); J.L. Hopper (John); M.-B. Terry (Mary-Beth); W. Chung (Wendy); A. Miron (Alexander); D. Goldgar (David); G. Chenevix-Trench (Georgia); D.F. Easton (Douglas); I.L. Andrulis (Irene); A.C. Antoniou (Antonis)
2011-01-01
textabstractIntroduction: Previous studies have demonstrated that common breast cancer susceptibility alleles are differentially associated with breast cancer risk for BRCA1 and/or BRCA2 mutation carriers. It is currently unknown how these alleles are associated with different breast cancer subtypes
Lecarpentier, Julie; Silvestri, Valentina; Kuchenbaecker, Karoline B; Barrowdale, Daniel; Dennis, Joe; McGuffog, Lesley; Soucy, Penny; Leslie, Goska; Rizzolo, Piera; Navazio, Anna Sara; Valentini, Virginia; Zelli, Veronica; Lee, Andrew; Amin Al Olama, Ali; Tyrer, Jonathan P; Southey, Melissa; John, Esther M; Conner, Thomas A; Goldgar, David E; Buys, Saundra S; Janavicius, Ramunas; Steele, Linda; Ding, Yuan Chun; Neuhausen, Susan L; Hansen, Thomas V O; Osorio, Ana; Weitzel, Jeffrey N; Toss, Angela; Medici, Veronica; Cortesi, Laura; Zanna, Ines; Palli, Domenico; Radice, Paolo; Manoukian, Siranoush; Peissel, Bernard; Azzollini, Jacopo; Viel, Alessandra; Cini, Giulia; Damante, Giuseppe; Tommasi, Stefania; Peterlongo, Paolo; Fostira, Florentia; Hamann, Ute; Evans, D Gareth; Henderson, Alex; Brewer, Carole; Eccles, Diana; Cook, Jackie; Ong, Kai-Ren; Walker, Lisa; Side, Lucy E; Porteous, Mary E; Davidson, Rosemarie; Hodgson, Shirley; Frost, Debra; Adlard, Julian; Izatt, Louise; Eeles, Ros; Ellis, Steve; Tischkowitz, Marc; Godwin, Andrew K; Meindl, Alfons; Gehrig, Andrea; Dworniczak, Bernd; Sutter, Christian; Engel, Christoph; Niederacher, Dieter; Steinemann, Doris; Hahnen, Eric; Hauke, Jan; Rhiem, Kerstin; Kast, Karin; Arnold, Norbert; Ditsch, Nina; Wang-Gohrke, Shan; Wappenschmidt, Barbara; Wand, Dorothea; Lasset, Christine; Stoppa-Lyonnet, Dominique; Belotti, Muriel; Damiola, Francesca; Barjhoux, Laure; Mazoyer, Sylvie; Van Heetvelde, Mattias; Poppe, Bruce; De Leeneer, Kim; Claes, Kathleen B M; de la Hoya, Miguel; Garcia-Barberan, Vanesa; Caldes, Trinidad; Perez Segura, Pedro; Kiiski, Johanna I; Aittomäki, Kristiina; Khan, Sofia; Nevanlinna, Heli; van Asperen, Christi J; Vaszko, Tibor; Kasler, Miklos; Olah, Edith; Balmaña, Judith; Gutiérrez-Enríquez, Sara; Diez, Orland; Teulé, Alex; Izquierdo, Angel; Darder, Esther; Brunet, Joan; Del Valle, Jesús; Feliubadalo, Lidia; Pujana, Miquel Angel; Lazaro, Conxi; Arason, Adalgeir; Agnarsson, Bjarni A; Johannsson, Oskar Th; Barkardottir, Rosa B; Alducci, Elisa; Tognazzo, Silvia; Montagna, Marco; Teixeira, Manuel R; Pinto, Pedro; Spurdle, Amanda B; Holland, Helene; Lee, Jong Won; Lee, Min Hyuk; Lee, Jihyoun; Kim, Sung-Won; Kang, Eunyoung; Kim, Zisun; Sharma, Priyanka; Rebbeck, Timothy R; Vijai, Joseph; Robson, Mark; Lincoln, Anne; Musinsky, Jacob; Gaddam, Pragna; Tan, Yen Y; Berger, Andreas; Singer, Christian F; Loud, Jennifer T; Greene, Mark H; Mulligan, Anna Marie; Glendon, Gord; Andrulis, Irene L; Toland, Amanda Ewart; Senter, Leigha; Bojesen, Anders; Nielsen, Henriette Roed; Skytte, Anne-Bine; Sunde, Lone; Jensen, Uffe Birk; Pedersen, Inge Sokilde; Krogh, Lotte; Kruse, Torben A; Caligo, Maria A; Yoon, Sook-Yee; Teo, Soo-Hwang; von Wachenfeldt, Anna; Huo, Dezheng; Nielsen, Sarah M; Olopade, Olufunmilayo I; Nathanson, Katherine L; Domchek, Susan M; Lorenchick, Christa; Jankowitz, Rachel C; Campbell, Ian; James, Paul; Mitchell, Gillian; Orr, Nick; Park, Sue Kyung; Thomassen, Mads; Offit, Kenneth; Couch, Fergus J; Simard, Jacques; Easton, Douglas F; Chenevix-Trench, Georgia; Schmutzler, Rita K; Antoniou, Antonis C; Ottini, Laura
2017-07-10
Purpose BRCA1/2 mutations increase the risk of breast and prostate cancer in men. Common genetic variants modify cancer risks for female carriers of BRCA1/2 mutations. We investigated-for the first time to our knowledge-associations of common genetic variants with breast and prostate cancer risks for male carriers of BRCA1/ 2 mutations and implications for cancer risk prediction. Materials and Methods We genotyped 1,802 male carriers of BRCA1/2 mutations from the Consortium of Investigators of Modifiers of BRCA1/2 by using the custom Illumina OncoArray. We investigated the combined effects of established breast and prostate cancer susceptibility variants on cancer risks for male carriers of BRCA1/2 mutations by constructing weighted polygenic risk scores (PRSs) using published effect estimates as weights. Results In male carriers of BRCA1/2 mutations, PRS that was based on 88 female breast cancer susceptibility variants was associated with breast cancer risk (odds ratio per standard deviation of PRS, 1.36; 95% CI, 1.19 to 1.56; P = 8.6 × 10 -6 ). Similarly, PRS that was based on 103 prostate cancer susceptibility variants was associated with prostate cancer risk (odds ratio per SD of PRS, 1.56; 95% CI, 1.35 to 1.81; P = 3.2 × 10 -9 ). Large differences in absolute cancer risks were observed at the extremes of the PRS distribution. For example, prostate cancer risk by age 80 years at the 5th and 95th percentiles of the PRS varies from 7% to 26% for carriers of BRCA1 mutations and from 19% to 61% for carriers of BRCA2 mutations, respectively. Conclusion PRSs may provide informative cancer risk stratification for male carriers of BRCA1/2 mutations that might enable these men and their physicians to make informed decisions on the type and timing of breast and prostate cancer risk management.
Li, Junyan; Jing, Ruilin; Wei, Hongyi; Wang, Minghao; Qi, Xiaowei; Liu, Haoxi; Liu, Jian; Ou, Jianghua; Jiang, Weihua; Tian, Fuguo; Sheng, Yuan; Li, Hengyu; Xu, Hong; Zhang, Ruishan; Guan, Aihua; Liu, Ke; Jiang, Hongchuan; Ren, Yu; He, Jianjun; Huang, Weiwei; Liao, Ning; Cai, Xiangjun; Ming, Jia; Ling, Rui; Xu, Yan; Hu, Chunyan; Zhang, Jianguo; Guo, Baoliang; Ouyang, Lizhi; Shuai, Ping; Liu, Zhenzhen; Zhong, Ling; Zeng, Zhen; Zhang, Ting; Xuan, Zhaoling; Tan, Xuanni; Liang, Junbin; Pan, Qinwen; Chen, Li; Zhang, Fan; Fan, Linjun; Zhang, Yi; Yang, Xinhua; Li, Jingbo; Chen, Chongjian; Jiang, Jun
2018-05-12
Multigene panel testing of breast cancer predisposition genes have been extensively conducted in Europe and America, which is relatively rare in Asia however. In this study, we assessed the frequency of germline mutations in 40 cancer predisposition genes, including BRCA1 and BRCA2, among a large cohort of Chinese patients with high hereditary risk of BC. From 2015 to 2016, consecutive BC patients from 26 centers of China with high hereditary risk were recruited (n=937). Clinical information was collected and next-generation sequencing (NGS) was performed using blood samples of participants to identify germline mutations. In total, we acquired 223 patients with putative germline mutations, including 159 in BRCA1/2, 61 in 15 other BC susceptibility genes and 3 in both BRCA1/2 and non-BRCA1/2 gene. Major mutant non-BRCA1/2 genes were TP53 (n=18), PALB2 (n=11), CHEK2 (n=6), ATM (n=6), and BARD1 (n=5). No factors predicted pathologic mutations in non-BRCA1/2 genes when treated as a whole. TP53 mutations were associated with HER-2 positive BC and younger age at diagnosis; and CHEK2 and PALB2 mutations were enriched in patients with luminal BC. Among high hereditary risk Chinese BC patients, 23.8% contained germline mutations, including 6.8% in non-BRCA1/2 genes. TP53 and PALB2 had a relatively high mutation rates (1.9% and 1.2%). Although no factors predicted for detrimental mutations in non-BRCA1/2 genes, some clinical features were associated with mutations of several particular genes. This article is protected by copyright. All rights reserved. © 2018 UICC.
Candidate genetic modifiers for breast and ovarian cancer risk in BRCA1 and BRCA2 mutation carriers
Peterlongo, Paolo; Chang-Claude, Jenny; Moysich, Kirsten B.; Rudolph, Anja; Schmutzler, Rita K.; Simard, Jacques; Soucy, Penny; Eeles, Rosalind A.; Easton, Douglas F.; Hamann, Ute; Wilkening, Stefan; Chen, Bowang; Rookus, Matti A.; Schmidt, Marjanka K; van der Baan, Frederieke H.; Spurdle, Amanda B.; Walker, Logan C.; Lose, Felicity; Maia, Ana-Teresa; Montagna, Marco; Matricardi, Laura; Lubinski, Jan; Jakubowska, Anna; Gómez Garcia, Encarna B.; Olopade, Olufunmilayo I.; Nussbaum, Robert L.; Nathanson, Katherine L.; Domchek, Susan M.; Rebbeck, Timothy R.; Arun, Banu K.; Karlan, Beth Y.; Orsulic, Sandra; Lester, Jenny; Chung, Wendy K.; Miron, Alex; Southey, Melissa C.; Goldgar, David E.; Buys, Saundra S.; Janavicius, Ramunas; Dorfling, Cecilia M.; van Rensburg, Elizabeth J.; Ding, Yuan Chun; Neuhausen, Susan L.; Hansen, Thomas V. O.; Gerdes, Anne-Marie; Ejlertsen, Bent; Jønson, Lars; Osorio, Ana; Martínez-Bouzas, Cristina; Benitez, Javier; Conway, Edye E.; Blazer, Kathleen R.; Weitzel, Jeffrey N.; Manoukian, Siranoush; Peissel, Bernard; Zaffaroni, Daniela; Scuvera, Giulietta; Barile, Monica; Ficarazzi, Filomena; Mariette, Frederique; Fortuzzi, Stefano; Viel, Alessandra; Giannini, Giuseppe; Papi, Laura; Martayan, Aline; Tibiletti, Maria Grazia; Radice, Paolo; Vratimos, Athanassios; Fostira, Florentia; Garber, Judy E.; Donaldson, Alan; Brewer, Carole; Foo, Claire; Evans, D. Gareth R.; Frost, Debra; Eccles, Diana; Brady, Angela; Cook, Jackie; Tischkowitz, Marc; Adlard, Julian; Barwell, Julian; Walker, Lisa; Izatt, Louise; Side, Lucy E.; Kennedy, M. John; Rogers, Mark T.; Porteous, Mary E.; Morrison, Patrick J.; Platte, Radka; Davidson, Rosemarie; Hodgson, Shirley V.; Ellis, Steve; Cole, Trevor; Godwin, Andrew K.; Claes, Kathleen; Van Maerken, Tom; Meindl, Alfons; Gehrig, Andrea; Sutter, Christian; Engel, Christoph; Niederacher, Dieter; Steinemann, Doris; Plendl, Hansjoerg; Kast, Karin; Rhiem, Kerstin; Ditsch, Nina; Arnold, Norbert; Varon-Mateeva, Raymonda; Wappenschmidt, Barbara; Wang-Gohrke, Shan; Bressac-de Paillerets, Brigitte; Buecher, Bruno; Delnatte, Capucine; Houdayer, Claude; Stoppa-Lyonnet, Dominique; Damiola, Francesca; Coupier, Isabelle; Barjhoux, Laure; Venat-Bouvet, Laurence; Golmard, Lisa; Boutry-Kryza, Nadia; Sinilnikova, Olga M.; Caron, Olivier; Pujol, Pascal; Mazoyer, Sylvie; Belotti, Muriel; Piedmonte, Marion; Friedlander, Michael L.; Rodriguez, Gustavo C.; Copeland, Larry J; de la Hoya, Miguel; Segura, Pedro Perez; Nevanlinna, Heli; Aittomäki, Kristiina; van Os, Theo A.M.; Meijers-Heijboer, Hanne E.J.; van der Hout, Annemarie H.; Vreeswijk, Maaike P.G.; Hoogerbrugge, Nicoline; Ausems, Margreet G.E.M.; van Doorn, Helena C.; Collée, J. Margriet; Olah, Edith; Diez, Orland; Blanco, Ignacio; Lazaro, Conxi; Brunet, Joan; Feliubadalo, Lidia; Cybulski, Cezary; Gronwald, Jacek; Durda, Katarzyna; Jaworska-Bieniek, Katarzyna; Sukiennicki, Grzegorz; Arason, Adalgeir; Chiquette, Jocelyne; Teixeira, Manuel R.; Olswold, Curtis; Couch, Fergus J.; Lindor, Noralane M.; Wang, Xianshu; Szabo, Csilla I.; Offit, Kenneth; Corines, Marina; Jacobs, Lauren; Robson, Mark E.; Zhang, Liying; Joseph, Vijai; Berger, Andreas; Singer, Christian F.; Rappaport, Christine; Kaulich, Daphne Geschwantler; Pfeiler, Georg; Tea, Muy-Kheng M.; Phelan, Catherine M.; Greene, Mark H.; Mai, Phuong L.; Rennert, Gad; Mulligan, Anna Marie; Glendon, Gord; Tchatchou, Sandrine; Andrulis, Irene L.; Toland, Amanda Ewart; Bojesen, Anders; Pedersen, Inge Sokilde; Thomassen, Mads; Jensen, Uffe Birk; Laitman, Yael; Rantala, Johanna; von Wachenfeldt, Anna; Ehrencrona, Hans; Askmalm, Marie Stenmark; Borg, Åke; Kuchenbaecker, Karoline B.; McGuffog, Lesley; Barrowdale, Daniel; Healey, Sue; Lee, Andrew; Pharoah, Paul D.P.; Chenevix-Trench, Georgia; Antoniou, Antonis C.; Friedman, Eitan
2014-01-01
Background BRCA1 and BRCA2 mutation carriers are at substantially increased risk for developing breast and ovarian cancer. The incomplete penetrance coupled with the variable age at diagnosis in carriers of the same mutation suggests the existence of genetic and non-genetic modifying factors. In this study we evaluated the putative role of variants in many candidate modifier genes. Methods Genotyping data from 15,252 BRCA1 and 8,211 BRCA2 mutation carriers, for known variants (n=3,248) located within or around 445 candidate genes, were available through the iCOGS custom-designed array. Breast and ovarian cancer association analysis was performed within a retrospective cohort approach. Results The observed p-values of association ranged between 0.005-1.000. None of the variants was significantly associated with breast or ovarian cancer risk in either BRCA1 or BRCA2 mutation carriers, after multiple testing adjustments. Conclusion There is little evidence that any of the evaluated candidate variants act as modifiers of breast and/or ovarian cancer risk in BRCA1 or BRCA2 mutation carriers. Impact Genome-wide association studies have been more successful at identifying genetic modifiers of BRCA1/2 penetrance than candidate gene studies. PMID:25336561
Stevens, Kristen N.; Wang, Xianshu; Fredericksen, Zachary; Pankratz, Vernon S.; Greene, Mark H.; Andrulis, Irene L.; Thomassen, Mads; Caligo, Maria; Nathanson, Katherine L.; Jakubowska, Anna; Osorio, Ana; Hamann, Ute; Godwin, Andrew K.; Stoppa-Lyonnet, Dominique; Southey, Melissa; Buys, Saundra S.; Singer, Christian F.; Hansen, Thomas V.O.; Arason, Adalgeir; Offit, Kenneth; Piedmonte, Marion; Montagna, Marco; Imyanitov, Evgeny; Tihomirova, Laima; Sucheston, Lara; Beattie, Mary; Neuhausen, Susan L.; Szabo, Csilla I.; Simard, Jacques; Spurdle, Amanda B.; Healey, Sue; Chen, Xiaoqing; Rebbeck, Timothy R.; Easton, Douglas F.; Chenevix-Trench, Georgia; Antoniou, Antonis C; Couch, Fergus J.
2012-01-01
Several common germline variants identified through genome-wide association studies of breast cancer risk in the general population have recently been shown to be associated with breast cancer risk for BRCA1 and/or BRCA2 mutation carriers. When combined, these variants can identify marked differences in the absolute risk of developing breast cancer for mutation carriers, suggesting that additional modifier loci may further enhance individual risk assessment for BRCA1 and BRCA2 mutation carriers. Recently, a common variant on 6p22 (rs9393597) was found to be associated with increased breast cancer risk for BRCA2 mutation carriers [Hazard ratio (HR)=1.55, 95% CI 1.25–1.92, p=6.0×10−5]. This observation was based on data from GWAS studies in which, despite statistical correction for multiple comparisons, the possibility of false discovery remains a concern. Here we report on an analysis of this variant in an additional 6,165 BRCA1 and 3,900 BRCA2 mutation carriers from the Consortium of Investigators of Modifiers of BRCA1/2 (CIMBA). In this replication analysis, rs9393597 was not associated with breast cancer risk for BRCA2 mutation carriers [HR=1.09, 95% CI 0.96–1.24, p=0.18]. No association with ovarian cancer risk for BRCA1 or BRCA2 mutation carriers or with breast cancer risk for BRCA1 mutation carriers was observed. This follow-up study suggests that, contrary to our initial report, this variant is not associated with breast cancer risk among individuals with germline BRCA2 mutations. PMID:23011509
Phuah, Sze Yee; Lee, Sheau Yee; Kang, Peter; Kang, In Nee; Yoon, Sook-Yee; Thong, Meow Keong; Hartman, Mikael; Sng, Jen-Hwei; Yip, Cheng Har; Taib, Nur Aishah Mohd; Teo, Soo-Hwang
2013-01-01
The partner and localizer of breast cancer 2 (PALB2) is responsible for facilitating BRCA2-mediated DNA repair by serving as a bridging molecule, acting as the physical and functional link between the breast cancer 1 (BRCA1) and breast cancer 2 (BRCA2) proteins. Truncating mutations in the PALB2 gene are rare but are thought to be associated with increased risks of developing breast cancer in various populations. We evaluated the contribution of PALB2 germline mutations in 122 Asian women with breast cancer, all of whom had significant family history of breast and other cancers. Further screening for nine PALB2 mutations was conducted in 874 Malaysian and 532 Singaporean breast cancer patients, and in 1342 unaffected Malaysian and 541 unaffected Singaporean women. By analyzing the entire coding region of PALB2, we found two novel truncating mutations and ten missense mutations in families tested negative for BRCA1/2-mutations. One additional novel truncating PALB2 mutation was identified in one patient through genotyping analysis. Our results indicate a low prevalence of deleterious PALB2 mutations and a specific mutation profile within the Malaysian and Singaporean populations.
Germline Mutations in Cancer Predisposition Genes are Frequent in Sporadic Sarcomas
Chan, Sock Hoai; Lim, Weng Khong; Ishak, Nur Diana Binte; Li, Shao-Tzu; Goh, Wei Lin; Tan, Gek San; Lim, Kiat Hon; Teo, Melissa; Young, Cedric Ng Chuan; Malik, Simeen; Tan, Mann Hong; Teh, Jonathan Yi Hui; Chin, Francis Kuok Choon; Kesavan, Sittampalam; Selvarajan, Sathiyamoorthy
2017-01-01
Associations of sarcoma with inherited cancer syndromes implicate genetic predisposition in sarcoma development. However, due to the apparently sporadic nature of sarcomas, little attention has been paid to the role genetic susceptibility in sporadic sarcoma. To address this, we performed targeted-genomic sequencing to investigate the prevalence of germline mutations in known cancer-associated genes within an Asian cohort of sporadic sarcoma patients younger than 50 years old. We observed 13....
Encinas, Giselly; Maistro, Simone; Pasini, Fatima Solange; Hirata Katayama, Maria Lucia; Brentani, Maria Mitzi; de Bock, Geertruida Hendrika; Azevedo Koike Folgueira, Maria Aparecida
2015-01-01
Objective: our aim was to evaluate whether somatic mutations in five genes were associated with an early age at presentation of breast cancer (BC) or serous ovarian cancer (SOC). Methods: COSMIC database was searched for the five most frequent somatic mutations in BC and SOC. A systematic review of
HFE MUTATIONS AND IRON OVERLOAD IN PATIENTS WITH ALCOHOLIC LIVER DISEASE
Directory of Open Access Journals (Sweden)
Luis COSTA-MATOS
2013-03-01
Full Text Available Context Alcoholic liver disease (ALD is generally associated with iron overload, which may contribute to its pathogenesis, through increased oxidative stress and cellular damage. There are conflicting reports in literature about hemochromatosis (HFE gene mutations and the severity of liver disease in alcoholic patients. Objectives To compare the prevalence of mutations in the hemochromatosis (HFE gene between patients with ALD and healthy controls; to assess the relation of HFE mutations with liver iron stores and liver disease severity. Methods Liver biopsy specimens were obtained from 63 ALD patients (during routine treatment and 52 healthy controls (during elective cholecystectomy. All individuals underwent routine liver function tests and HFE genotyping (to detect wild-type sequences and C282Y, H63D, S65C, E168Q, E168X, V59M, H63H, P160delC, Q127H, Q283P, V53M and W164X mutations. Associations between HFE mutations and risk of excessive liver iron stores, abnormal serum ferritin, liver fibrosis, or necroinflammatory activity were assessed by multivariate logistic regression analysis. Results ALD patients had significantly higher serum ferritin and transferrin saturation than controls (both P<0.05, but the distribution of HFE mutations was similar between the two groups. For ALD patients, the odds ratio for having at least one HFE mutation and excessive liver iron stores was 17.23 (95% confidence interval (CI: 2.09-142.34, P = 0.008. However, the presence of at least one HFE mutation was not associated with an increased risk of liver fibrosis or necroinflammatory activity. Active alcohol ingestion showed the strongest association to increased serum ferritin (OR = 8.87, 95% CI: 2.11-34.78, P = 0.003. Conclusions ALD patients do not present with a differential profile of HFE mutations from healthy controls. In ALD patients, however, the presence of at least one HFE mutation increases the risk of having excessive liver iron stores but has no
Hemochromatosis (HFE) gene mutations and response to chloroquine in porphyria cutanea tarda.
Stölzel, Ulrich; Köstler, Erich; Schuppan, Detlef; Richter, Matthias; Wollina, Uwe; Doss, Manfred O; Wittekind, Christian; Tannapfel, Andrea
2003-03-01
To examine the role of hemochromatosis (HFE) gene mutations, which are associated with porphyria cutanea tarda (PCT), in the therapeutic response to chloroquine. We retrospectively analyzed a database (Excel version 2001 [Microsoft Excel, Redmond, Wash]; date range of search, 1985-1999) of chloroquine-treated patients with PCT on whether HFE mutations (C282Y and H63D) might have influenced the clinical response, urinary porphyrin excretion, liver enzyme activities, and serum iron markers. Serum samples and corresponding complete sets of data before and after therapy were available in 62 of 207 patients with PCT who were treated exclusively with chloroquine. Academic teaching hospital. For treatment, low-dose chloroquine diphosphate, 125 to 250 mg twice weekly, was used during a median time of 16 months (range, 12-26 months). Of the 62 German patients with PCT, 37 (60%) carries HFE mutations. Chloroquine therapy was accompanied by clinical remission and reduced urinary porphyrin excretion (P<.001) in the 24 patients (39%) with HFE wild type as well as in 35 HFE heterozygous patients with PCT (56%). Decreases of serum iron markers following chloroquine therapy were limited to patients with PCT and HFE wild type. All patients homozygous for the C282Y mutation (3 [5%] of 62) had high serum iron, ferritin, and transferrin saturation and failed to respond to chloroquine treatment. The therapeutic response to chloroquine was not compromised by C282Y heterozygosity and compound heterozygosity of HFE mutations. Because HFE C282Y homozygotes (+/+) did not respond to chloroquine and a decrease in serum iron concentration was limited to patients with PCT and HFE wild type, phlebotomy should be first-line therapy in patients with PCT and HFE mutations.
Clinical significance of the BRAFV600E mutation in Asian patients with colorectal cancer.
Cheng, Hou-Hsuan; Lin, Jen-Kou; Chen, Wei-Shone; Jiang, Jeng-Kai; Yang, Shung-Haur; Chang, Shih-Ching
2018-06-04
To investigate the clinicopathological features and prognostic significance of the BRAFV600E mutation in Asian patients with colorectal cancer. We retrospectively reviewed the medical records of 1969 patients with colorectal cancer admitted to Taipei Veterans General Hospital for surgical treatment between 2000 and 2013. The measured endpoint was overall survival after surgery. The prognostic value of the BRAFV600E mutation was analyzed using the log-rank test and Cox regression analysis. The BRAFV600E mutation was detected in 106 (5.4%) patients and associated with female gender, abnormal cancer antigen (CA)19-9 at diagnosis, microsatellite status, right-sided primary tumors, mucinous histology, poor differentiation, and lymphovascular invasion. Metastatic patterns were more common in non-regional lymph node metastasis (20.8 vs. 7.4%, p = 0.06) and peritoneal seeding (41. vs. 21.2%, p = 0.04). Mutations were not prognostic in the overall survival of the entire study group but only in specific patients: age < 65, normal carcinoembryonic antigen at diagnosis, and stage IV disease. The BRAFV600E mutation was associated with distinct clinicopathological features and metastatic patterns. The overall survival rate was lower in selected colorectal patients with the BRAFV600E mutation.
Frequent POLE1 p.S297F mutation in Chinese patients with ovarian endometrioid carcinoma
International Nuclear Information System (INIS)
Zou, Yang; Liu, Fa-Ying; Liu, Huai; Wang, Feng; Li, Wei; Huang, Mei-Zhen; Huang, Yan; Yuan, Xiao-Qun; Xu, Xiao-Yun; Huang, Ou-Ping; He, Ming
2014-01-01
The catalytic subunit of DNA polymerase epsilon (POLE1) functions primarily in nuclear DNA replication and repair. Recently, POLE1 mutations were detected frequently in colorectal and endometrial carcinomas while with lower frequency in several other types of cancer, and the p.P286R and p.V411L mutations were the potential mutation hotspots in human cancers. Nevertheless, the mutation frequency of POLE1 in ovarian cancer still remains largely unknown. Here, we screened a total of 251 Chinese samples with distinct subtypes of ovarian carcinoma for the presence of POLE1 hotspot mutations by direct sequencing. A heterozygous somatic POLE1 mutation, p.S297F (c.890C>T), but not p.P286R and p.V411L hotspot mutations observed in other cancer types, was identified in 3 out of 37 (8.1%) patients with ovarian endometrioid carcinoma; this mutation was evolutionarily highly conserved from Homo sapiens to Schizosaccharomyces. Of note, the POLE1 mutation coexisted with mutation in the ovarian cancer-associated PPP2R1A (protein phosphatase 2, regulatory subunit A, α) gene in a 46-year-old patient, who was also diagnosed with ectopic endometriosis in the benign ovary. In addition, a 45-year-old POLE1-mutated ovarian endometrioid carcinoma patient was also diagnosed with uterine leiomyoma while the remaining 52-year-old POLE1-mutated patient showed no additional distinctive clinical manifestation. In contrast to high frequency of POLE1 mutations in ovarian endometrioid carcinoma, no POLE1 mutations were identified in patients with other subtypes of ovarian carcinoma. Our results showed for the first time that the POLE1 p.S297F mutation, but not p.P286R and p.V411L hotspot mutations observed in other cancer types, was frequent in Chinese ovarian endometrioid carcinoma, but absent in other subtypes of ovarian carcinoma. These results implicated that POLE1 p.S297F mutation might be actively involved in the pathogenesis of ovarian endometrioid carcinoma, but might not be actively
Frequent POLE1 p.S297F mutation in Chinese patients with ovarian endometrioid carcinoma
Energy Technology Data Exchange (ETDEWEB)
Zou, Yang; Liu, Fa-Ying; Liu, Huai; Wang, Feng [Key Laboratory of Women' s Reproductive Health of Jiangxi Province, Jiangxi Provincial Maternal and Child Health Hospital, Nanchang, Jiangxi 330006 (China); Central Laboratory, Jiangxi Provincial Maternal and Child Health Hospital, Nanchang, Jiangxi 330006 (China); Li, Wei [Key Laboratory of Women' s Reproductive Health of Jiangxi Province, Jiangxi Provincial Maternal and Child Health Hospital, Nanchang, Jiangxi 330006 (China); Central Laboratory, Jiangxi Provincial Maternal and Child Health Hospital, Nanchang, Jiangxi 330006 (China); Graduate School of Nanchang University, Nanchang, Jiangxi 330031 (China); Huang, Mei-Zhen [Graduate School of Nanchang University, Nanchang, Jiangxi 330031 (China); Jiangxi Provincial Cancer Institute, Jiangxi Provincial Cancer Hospital, Nanchang, Jiangxi 330029 (China); Huang, Yan; Yuan, Xiao-Qun [Key Laboratory of Women' s Reproductive Health of Jiangxi Province, Jiangxi Provincial Maternal and Child Health Hospital, Nanchang, Jiangxi 330006 (China); Central Laboratory, Jiangxi Provincial Maternal and Child Health Hospital, Nanchang, Jiangxi 330006 (China); Graduate School of Nanchang University, Nanchang, Jiangxi 330031 (China); Xu, Xiao-Yun [Graduate School of Nanchang University, Nanchang, Jiangxi 330031 (China); Jiangxi Provincial Cancer Institute, Jiangxi Provincial Cancer Hospital, Nanchang, Jiangxi 330029 (China); Huang, Ou-Ping, E-mail: huangouping@gmail.com [Jiangxi Provincial Cancer Institute, Jiangxi Provincial Cancer Hospital, Nanchang, Jiangxi 330029 (China); He, Ming, E-mail: jxhm56@hotmail.com [Department of Pharmacology and Molecular Therapeutics, Nanchang University School of Pharmaceutical Science, Nanchang 330006 (China)
2014-03-15
The catalytic subunit of DNA polymerase epsilon (POLE1) functions primarily in nuclear DNA replication and repair. Recently, POLE1 mutations were detected frequently in colorectal and endometrial carcinomas while with lower frequency in several other types of cancer, and the p.P286R and p.V411L mutations were the potential mutation hotspots in human cancers. Nevertheless, the mutation frequency of POLE1 in ovarian cancer still remains largely unknown. Here, we screened a total of 251 Chinese samples with distinct subtypes of ovarian carcinoma for the presence of POLE1 hotspot mutations by direct sequencing. A heterozygous somatic POLE1 mutation, p.S297F (c.890C>T), but not p.P286R and p.V411L hotspot mutations observed in other cancer types, was identified in 3 out of 37 (8.1%) patients with ovarian endometrioid carcinoma; this mutation was evolutionarily highly conserved from Homo sapiens to Schizosaccharomyces. Of note, the POLE1 mutation coexisted with mutation in the ovarian cancer-associated PPP2R1A (protein phosphatase 2, regulatory subunit A, α) gene in a 46-year-old patient, who was also diagnosed with ectopic endometriosis in the benign ovary. In addition, a 45-year-old POLE1-mutated ovarian endometrioid carcinoma patient was also diagnosed with uterine leiomyoma while the remaining 52-year-old POLE1-mutated patient showed no additional distinctive clinical manifestation. In contrast to high frequency of POLE1 mutations in ovarian endometrioid carcinoma, no POLE1 mutations were identified in patients with other subtypes of ovarian carcinoma. Our results showed for the first time that the POLE1 p.S297F mutation, but not p.P286R and p.V411L hotspot mutations observed in other cancer types, was frequent in Chinese ovarian endometrioid carcinoma, but absent in other subtypes of ovarian carcinoma. These results implicated that POLE1 p.S297F mutation might be actively involved in the pathogenesis of ovarian endometrioid carcinoma, but might not be actively
EGFR and KRAS mutation coexistence in lung adenocarcinomas
Directory of Open Access Journals (Sweden)
Vitor Manuel Leitão de Sousa
2015-04-01
Full Text Available Lung cancer is one of the most common causes of cancer deaths. The development of EGFR targeted therapies, including monoclonal antibodies and tyrosine kinase inhibitors have generated an interest in the molecular characterization of these tumours. KRAS mutations are associated with resistance to EGFR TKIs. EGFR and KRAS mutations have been considered as mutually exclusive. This paper presents three bronchial-pulmonary carcinomas, two adenocarcinomas and one pleomorphic sarcomatoid carcinoma, harboring EGFR and KRAS mutations. Case 1 corresponded to an adenocarcinoma with EGFR exon 21 mutation (L858R and KRAS codon 12 point mutation (G12V; case 2, a mucinous adenocarcinoma expressed coexistence of EGFR exon 21 mutation (L858R and KRAS codon 12 point mutation (G12V; and case 3 a sarcomatoid carcinoma with EGFR exon 19 deletion – del 9bp and KRAS codon 12 point mutation (G12C - cysteine. Based on our experience and on the literature, we conclude that EGFR and KRAS mutations can indeed coexist in the same bronchial-pulmonary carcinoma, either in the same histological type or in different patterns. The biological implications of this coexistence are still poorly understood mainly because these cases are not frequent or currently searched. It is therefore necessary to study larger series of cases with the two mutations to better understand the biological, clinical and therapeutic implications.
Chapman, Aaron M; Sun, Kathie Y; Ruestow, Peter; Cowan, Dallas M; Madl, Amy K
2016-12-01
Lung cancer is the leading cause of cancer-related mortality. While the majority of lung cancers are associated with tobacco smoke, approximately 10-15% of U.S. lung cancers occur in never smokers. Evidence suggests that lung cancer in never smokers appears to be a distinct disease caused by driver mutations which are different than the genetic pathways observed with lung cancer in smokers. A meta-analysis of human epidemiologic data was conducted to evaluate the profile of common or therapy-targetable mutations in lung cancers of never and ever smokers. Epidemiologic studies (N=167) representing over 63,000 lung cancer cases were identified and used to calculate summary odds ratios for lung cancer in never and ever smokers containing gene mutations: EGFR, chromosomal rearrangements and fusion of EML4 and ALK, and KRAS. This analysis also considered the effect of histopathology, smoking status, sex, and ethnicity. There were significantly increased odds of presenting the EGFR and ALK-EML4 mutations in 1) adenocarcinomas compared to non-small cell lung cancer and 2) never smokers compared to ever smokers. The prevalence of EGFR mutations was higher in Asian women as compared to women of Caucasian/Mixed ethnicity. As the smoking history increased, there was a decreased odds for exhibiting the EGFR mutation, particularly for cases >30 pack-years. Compared to ever smokers, never smokers had a decreased odds of KRAS mutations among those of Caucasian/Mixed ethnicity (OR=0.22, 95% CI: 0.17-0.29) and those of Asian ethnicity (OR=0.39, 95% CI: 0.30-0.50). Our findings show that key driver mutations and several patient features are highly prevalent in lung cancers of never smokers. These associations may be helpful as patient demographic models are developed to predict successful outcomes of targeted therapeutic interventions NSCLC. Copyright © 2016 Elsevier Ireland Ltd. All rights reserved.
Identification of coding and non-coding mutational hotspots in cancer genomes.
Piraino, Scott W; Furney, Simon J
2017-01-05
The identification of mutations that play a causal role in tumour development, so called "driver" mutations, is of critical importance for understanding how cancers form and how they might be treated. Several large cancer sequencing projects have identified genes that are recurrently mutated in cancer patients, suggesting a role in tumourigenesis. While the landscape of coding drivers has been extensively studied and many of the most prominent driver genes are well characterised, comparatively less is known about the role of mutations in the non-coding regions of the genome in cancer development. The continuing fall in genome sequencing costs has resulted in a concomitant increase in the number of cancer whole genome sequences being produced, facilitating systematic interrogation of both the coding and non-coding regions of cancer genomes. To examine the mutational landscapes of tumour genomes we have developed a novel method to identify mutational hotspots in tumour genomes using both mutational data and information on evolutionary conservation. We have applied our methodology to over 1300 whole cancer genomes and show that it identifies prominent coding and non-coding regions that are known or highly suspected to play a role in cancer. Importantly, we applied our method to the entire genome, rather than relying on predefined annotations (e.g. promoter regions) and we highlight recurrently mutated regions that may have resulted from increased exposure to mutational processes rather than selection, some of which have been identified previously as targets of selection. Finally, we implicate several pan-cancer and cancer-specific candidate non-coding regions, which could be involved in tumourigenesis. We have developed a framework to identify mutational hotspots in cancer genomes, which is applicable to the entire genome. This framework identifies known and novel coding and non-coding mutional hotspots and can be used to differentiate candidate driver regions from
Germinal and somatic mutations in cancer
International Nuclear Information System (INIS)
Knudson, A.G. Jr.
1977-01-01
The role of germinal and somatic mutations in carcinogenesis leads to the conclusion that environmental carcinogens probably exert their effects via somatic mutations. Susceptibility to this process may itself be genetically determined, so we may deduce that two groups, one genetic and one non-genetic, are included in the 'environmental' class. Other individuals seem to acquire cancer even in the absence of such environmental agents, and these too may be classified into a genetic and a non-genetic group. It has been estimated that in industrial countries, the environmental groups include 70-80% of all cancer cases, but we are only beginning to know how to separate the genetic and non-genetic subgroups. The genetic subgroup of the 'non-environmental' group is very small, probably of the order of magnitude of 1-2% for cancer as a whole. The remainder, about 25%, comprises a non-genetic, non-environmental subgroup that seems to arise as a consequence of 'spontaneous' somatic mutations. The incidence of these 'background' cancers is what we should combat with preventive and therapeutic measures
Association of type and location of BRCA1 and BRCA2 mutations with risk of breast and ovarian cancer
R. Rebbeck (Timothy); N. Mitra (Nandita); F. Wan (Fei); O. Sinilnikova (Olga); S. Healey (Sue); L. McGuffog (Lesley); G. Chenevix-Trench (Georgia); D.F. Easton (Douglas); A.C. Antoniou (Antonis C.); K.L. Nathanson (Katherine); Y. Laitman (Yael); A. Kushnir (Anya); S. Paluch-Shimon (Shani); R. Berger (Raanan); J. Zidan (Jamal); E. Friedman (Eitan); H. Ehrencrona (Hans); M. Stenmark-Askmalm (Marie); Z. Einbeigi (Zakaria); N. Loman (Niklas); K. Harbst (Katja); J. Rantala (Johanna); B. Melin (Beatrice); D. Huo (Dezheng); O.I. Olopade (Olofunmilayo); J.L. Seldon (Joyce); P.A. Ganz (Patricia); R.L. Nussbaum (Robert L.); S. Chan (Salina); K. Odunsi (Kunle); S.A. Gayther (Simon); S.M. Domchek (Susan); B.K. Arun (Banu); K.H. Lu (Karen); G. Mitchell (Gillian); B.Y. Karlan (Beth); C.S. Walsh (Christine); K.J. Lester (Kathryn); A.K. Godwin (Andrew); S.S. Pathak; E.B. Ross (Eric); M.J. Daly (Mark); A.S. Whittemore (Alice); E.M. John (Esther); A. Miron (Alexander); M.B. Terry (Mary Beth); W.K. Chung (Wendy K.); D. Goldgar (David); S.S. Buys (Saundra); R. Janavicius (Ramunas); L. Tihomirova (Laima); N. Tung (Nadine); C.M. Dorfling (Cecilia); E.J. van Rensburg (Elizabeth); L. Steele (Linda); S.L. Neuhausen (Susan); Y.C. Ding (Yuan); B. Ejlertsen (Bent); A-M. Gerdes (Anne-Marie); T.V.O. Hansen (Thomas); T. Ramon Y Cajal; A. Osorio (Ana); J. Benítez (Javier); J. Godino (Javier); M.I. Tejada; M. Duran (Mercedes); J.N. Weitzel (Jeffrey); K.A. Bobolis (Kristie A.); S.R. Sand (Sharon); A. Fontaine (Annette); A. Savarese (Antonella); B. Pasini (Barbara); B. Peissel (Bernard); B. Bonnani (Bernardo); D. Zaffaroni (Daniela); F. Vignolo-Lutati (Francesca); G. Scuvera (Giulietta); G. Giannini (Giuseppe); L. Bernard (Loris); M. Genuardi (Maurizio); P. Radice (Paolo); R. Dolcetti (Riccardo); S. Manoukian (Siranoush); V. Pensotti (Valeria); V. Gismondi (Viviana); D. Yannoukakos (Drakoulis); F. Fostira (Florentia); J. Garber (Judy); D. Torres (Diana); M.U. Rashid (Muhammad); U. Hamann (Ute); S. Peock (Susan); D. Frost (Debra); R. Platte (Radka); D.G. Evans (Gareth); R. Eeles (Rosalind); R. Davidson (Rosemarie); D. Eccles (Diana); T. Cole (Trevor); J. Cook (Jackie); C. Brewer (Carole); S. Hodgson (Shirley); P.J. Morrison (Patrick); L.J. Walker (Lisa); M.E. Porteous (Mary); M.J. Kennedy (John); L. Izatt (Louise); L. Adlard; A. Donaldson (Alan); S.D. Ellis (Steve); P. Sharma (Priyanka); R.K. Schmutzler (Rita); B. Wapenschmidt (Barbara); A. Becker (Alexandra); K. Rhiem (Kerstin); E. Hahnen (Eric); C.W. Engel (Christoph); A. Meindl (Alfons); S. Engert (Stefanie); N. Ditsch (Nina); N. Arnold (Norbert); H. Plendl (Hansjoerg); C. Mundhenke (Christoph); D. Niederacher (Dieter); M.C. Fleisch (Markus); C. Sutter (Christian); C.R. Bartram (Claus); N. Dikow (Nicola); S. Wang-Gohrke (Shan); D. Gadzicki (Dorothea); D. Steinemann (Doris); K. Kast (Karin); M. Beer (Marit); R. Varon-Mateeva (Raymonda); P.A. Gehrig (Paola A.); B.H.F. Weber (Bernhard); D. Stoppa-Lyonnet (Dominique); M. Belotti (Muriel); M. Gauthier-Villars (Marion); F. Damiola (Francesca); N. Boutry-Kryza (N.); C. Lasset (Christine); H. Sobol (Hagay); J.-P. Peyrat; D.W. Muller (Danièle); J.P. Fricker (Jean Pierre); M.-A. Collonge-Rame; I. Mortemousque (Isabelle); C. Nogues (Catherine); E. Rouleau (Etienne); C. Isaacs (Claudine); A. de Paepe (Anne); B. Poppe (Bruce); K. Claes (Kathleen); K. De Leeneer (Kim); M. Piedmonte (Marion); G. Rodriguez (Gustavo); K. Wakely (Katie); J.F. Boggess (John); S.V. Blank (Stephanie); J. Basil (Jack); M. Azodi (Masoud); K.-A. Phillips (Kelly-Anne); T. Caldes (Trinidad); M. de La Hoya (Miguel); A. Romero (Atocha); H. Nevanlinna (Heli); K. Aittomäki (Kristiina); A.H. van der Hout (Annemarie); F.B.L. Hogervorst (Frans); S. Verhoef; J.M. Collée (Margriet); C.M. Seynaeve (Caroline); J.C. Oosterwijk (Jan); J.J. Gille (Johan); J.T. Wijnen (Juul); E.B. Gómez García (Encarna); C.M. Kets; M.G.E.M. Ausems (Margreet); C.M. Aalfs (Cora); P. Devilee (Peter); A.R. Mensenkamp (Arjen); A. Kwong (Ava); E. Olah; J. Papp (Janos); O. Díez (Orland); C. Lazaro (Conxi); E. Darder (Esther); I. Blanco (Ignacio); M. Salinas; A. Jakubowska (Anna); J. Lubinski (Jan); J. Gronwald (Jacek); K. Jaworska-Bieniek (Katarzyna); K. Durda (Katarzyna); G. Sukiennicki (Grzegorz); T. Huzarski (Tomasz); T. Byrski (Tomasz); C. Cybulski (Cezary); A. Toloczko-Grabarek (Aleksandra); E. Złowocka-Perłowska (Elzbieta); J. Menkiszak (Janusz); A. Arason (Adalgeir); R.B. Barkardottir (Rosa); J. Simard (Jacques); R. Laframboise (Rachel); M. Montagna (Marco); S. Agata (Simona); E. Alducci (Elisa); A. Peixoto (Ana); P.J. Teixeira; A.B. Spurdle (Amanda); M.H. Lee (Min Hyuk); S.K. Park (Sue); S.-W. Kim (Sung-Won); M.O.W. Friebel (Mark ); F.J. Couch (Fergus); N.M. Lindor (Noralane); V.S. Pankratz (Shane); L. Guidugli (Lucia); X. Wang (Xianshu); M. Tischkowitz (Marc); L. Foretova (Lenka); J. Vijai (Joseph); K. Offit (Kenneth); M. Robson (Mark); R. Rau-Murthy (Rohini); N. Kauff (Noah); A. Fink-Retter (Anneliese); C.F. Singer (Christian); C. Rappaport (Christine); D. Gschwantler-Kaulich (Daphne); G. Pfeiler (Georg); M.-K. Tea; A. Berger (Andreas); M.H. Greene (Mark); P.L. Mai (Phuong); E.N. Imyanitov (Evgeny); A.E. Toland (Amanda); L. Senter (Leigha); A. Bojesen (Anders); I.S. Pedersen (Inge Sokilde); A.-B. Skytte (Anne-Bine); L. Sunde (Lone); M. Thomassen (Mads); S.T. Moeller (Sanne Traasdahl); T.A. Kruse (Torben); U.B. Jensen; M.A. Caligo (Maria); P. Aretini (Paolo); S.-H. Teo (Soo-Hwang); C.G. Selkirk (Christina); P.J. Hulick (Peter); I.L. Andrulis (Irene)
2015-01-01
textabstractImportance: Limited information about the relationship between specific mutations in BRCA1 or BRCA2 (BRCA1/2) and cancer risk exists. Objective: To identify mutation-specific cancer risks for carriers of BRCA1/2. Design, Setting, and Participants: Observational study ofwomen whowere
Musumeci, Rosario; Calaresu, Enrico; Gerosa, Jolanda; Oggioni, Davide; Bramati, Simone; Morelli, Patrizia; Mura, Ida; Piana, Andrea; Are, Bianca Maria; Cocuzza, Clementina Elvezia
2016-10-01
Linezolid is the main representative of the oxazolidinones, introduced in 2000 in clinical practice to treat severe Gram-positive infections. This compound inhibits protein synthesis by binding to the peptidyl transferase centre of the 50S bacterial ribosomal subunit. The aim of this study was to characterize 12 clinical strains of linezolid-resistant Staphylococcus spp. isolated in Northern Italy. All isolates of Staphylococcus spp. studied showed a multi-antibiotic resistance phenotype. In particular, all isolates showed the presence of the mecA gene associated with SSCmec types IVa, V or I. Mutations in domain V of 23S rRNA were shown to be the most prevalent mechanism of linezolid resistance: among these a new C2551T mutation was found in S. aureus, whilst the G2576T mutation was shown to be the most prevalent overall. Moreover, three S. epidermidis isolates were shown to have linezolid resistance associated only with alterations in both L3 and L4 ribosomal proteins. No strain was shown to harbor the previously described cfr gene. These results have shown how the clinical use of linezolid in Northern Italy has resulted in the selection of multiple antibiotic-resistant clinical isolates of Staphylococcus spp., with linezolid resistance in these strains being associated with mutations in 23S rRNA or ribosomal proteins L3 and L4.
DNA mutation motifs in the genes associated with inherited diseases.
Directory of Open Access Journals (Sweden)
Michal Růžička
Full Text Available Mutations in human genes can be responsible for inherited genetic disorders and cancer. Mutations can arise due to environmental factors or spontaneously. It has been shown that certain DNA sequences are more prone to mutate. These sites are termed hotspots and exhibit a higher mutation frequency than expected by chance. In contrast, DNA sequences with lower mutation frequencies than expected by chance are termed coldspots. Mutation hotspots are usually derived from a mutation spectrum, which reflects particular population where an effect of a common ancestor plays a role. To detect coldspots/hotspots unaffected by population bias, we analysed the presence of germline mutations obtained from HGMD database in the 5-nucleotide segments repeatedly occurring in genes associated with common inherited disorders, in particular, the PAH, LDLR, CFTR, F8, and F9 genes. Statistically significant sequences (mutational motifs rarely associated with mutations (coldspots and frequently associated with mutations (hotspots exhibited characteristic sequence patterns, e.g. coldspots contained purine tract while hotspots showed alternating purine-pyrimidine bases, often with the presence of CpG dinucleotide. Using molecular dynamics simulations and free energy calculations, we analysed the global bending properties of two selected coldspots and two hotspots with a G/T mismatch. We observed that the coldspots were inherently more flexible than the hotspots. We assume that this property might be critical for effective mismatch repair as DNA with a mutation recognized by MutSα protein is noticeably bent.
Directory of Open Access Journals (Sweden)
Shuyu D. Li
2017-10-01
Full Text Available Abstract Background Next-generation sequencing (NGS of cancer gene panels are widely applied to enable personalized cancer therapy and to identify novel oncogenic mutations. Methods We performed targeted NGS on 932 clinical cases of non-small-cell lung cancers (NSCLCs using the Ion AmpliSeq™ Cancer Hotspot panel v2 assay. Results Actionable mutations were identified in 65% of the cases with available targeted therapeutic options, including 26% of the patients with mutations in National Comprehensive Cancer Network (NCCN guideline genes. Most notably, we discovered JAK2 p.V617F somatic mutation, a hallmark of myeloproliferative neoplasms, in 1% (9/932 of the NSCLCs. Analysis of cancer cell line pharmacogenomic data showed that a high level of JAK2 expression in a panel of NSCLC cell lines is correlated with increased sensitivity to a selective JAK2 inhibitor. Further analysis of TCGA genomic data revealed JAK2 gain or loss due to genetic alterations in NSCLC clinical samples are associated with significantly elevated or reduced PD-L1 expression, suggesting that the activating JAK2 p.V617F mutation could confer sensitivity to both JAK inhibitors and anti-PD1 immunotherapy. We also detected JAK3 germline activating mutations in 6.7% (62/932 of the patients who may benefit from anti-PD1 treatment, in light of recent findings that JAK3 mutations upregulate PD-L1 expression. Conclusion Taken together, this study demonstrated the clinical utility of targeted NGS with a focused hotspot cancer gene panel in NSCLCs and identified activating mutations in JAK2 and JAK3 with clinical implications inferred through integrative analysis of cancer genetic, genomic, and pharmacogenomic data. The potential of JAK2 and JAK3 mutations as response markers for the targeted therapy against JAK kinases or anti-PD1 immunotherapy warrants further investigation.
Analysis of HFE gene mutations and HLA-A alleles in Brazilian patients with iron overload
Directory of Open Access Journals (Sweden)
Rodolfo Delfini Cançado
Full Text Available CONTEXT AND OBJECTIVE: Hemochromatosis is a common inherited disorder of iron metabolism and one of the most important causes of iron overload. The objective was to analyze the presence of C282Y, H63D and S65C mutations in the HFE gene and HLA-A alleles for a group of Brazilian patients with iron overload, and to correlate genotype with clinical and laboratory variables. DESIGN AND SETTING: Prospective study, in Discipline of Hematology and Oncology, Faculdade de Ciências Médicas da Santa Casa de Misericórdia de São Paulo. METHODS: We studied 35 patients with iron overload seen at our outpatient unit between January 2001 and December 2003. Fasting levels of serum iron and ferritin, and total iron-binding capacity, were assayed using standard techniques. Determinations of C282Y, H63D and S65C mutations in the HFE gene and of HLA-A alleles were performed by polymerase chain reaction (PCR. RESULTS: Twenty-six out of 35 patients (74% presented at least one of the HFE gene mutations analyzed. Among these, five (14% were C282Y/C282Y, four (11% C282Y/H63D, one (3% H63D/H63D, six (17% C282Y/WT and ten (29% H63D/WT. No patients had the S65C mutation and nine (25% did not present any of the three HFE mutations. Four out of five patients with C282Y/C282Y genotype (80% and three out of four patients with C282Y/H63D genotype (75% were HLA A*03. CONCLUSION: Analysis of HFE gene mutations constitutes an important procedure in identifying patients with hereditary hemochromatosis, particularly for patients with iron overload.
Colon Cancer Tumorigenesis Initiated by the H1047R Mutant PI3K.
Directory of Open Access Journals (Sweden)
Alexander E Yueh
Full Text Available The phosphoinositide 3-kinase (PI3K signaling pathway is critical for multiple important cellular functions, and is one of the most commonly altered pathways in human cancers. We previously developed a mouse model in which colon cancers were initiated by a dominant active PI3K p110-p85 fusion protein. In that model, well-differentiated mucinous adenocarcinomas developed within the colon and initiated through a non-canonical mechanism that is not dependent on WNT signaling. To assess the potential relevance of PI3K mutations in human cancers, we sought to determine if one of the common mutations in the human disease could also initiate similar colon cancers. Mice were generated expressing the Pik3caH1047R mutation, the analog of one of three human hotspot mutations in this gene. Mice expressing a constitutively active PI3K, as a result of this mutation, develop invasive adenocarcinomas strikingly similar to invasive adenocarcinomas found in human colon cancers. These tumors form without a polypoid intermediary and also lack nuclear CTNNB1 (β-catenin, indicating a non-canonical mechanism of tumor initiation mediated by the PI3K pathway. These cancers are sensitive to dual PI3K/mTOR inhibition indicating dependence on the PI3K pathway. The tumor tissue remaining after treatment demonstrated reduction in cellular proliferation and inhibition of PI3K signaling.
International Nuclear Information System (INIS)
Davies, Janine M; Trembath, Dimitri; Deal, Allison M; Funkhouser, William K; Calvo, Benjamin F; Finnegan, Timothy; Weck, Karen E; Tepper, Joel E; O'Neil, Bert H
2011-01-01
KRAS mutations may predict poor response to radiotherapy. Downstream events from KRAS, such as activation of BRAF, AKT and ERK, may also confer prognostic information but have not been tested in rectal cancer (RC). Our objective was to explore the relationships of KRAS and BRAF mutation status with p-AKT and p-ERK and outcomes in RC. Pre-radiotherapy RC tumor biopsies were evaluated. KRAS and BRAF mutations were assessed by pyrosequencing; p-AKT and p-ERK expression by immunohistochemistry. Of 70 patients, mean age was 58; 36% stage II, 56% stage III, and 9% stage IV. Responses to neoadjuvant chemoradiotherapy: 64% limited, 19% major, and 17% pathologic complete response. 64% were KRAS WT, 95% were BRAF WT. High p-ERK levels were associated with improved OS but not for p-AKT. High levels of p-AKT and p-ERK expression were associated with better responses. KRAS WT correlated with lower p-AKT expression but not p-ERK expression. No differences in OS, residual disease, or tumor downstaging were detected by KRAS status. KRAS mutation was not associated with lesser response to chemoradiotherapy or worse OS. High p-ERK expression was associated with better OS and response. Higher p-AKT expression was correlated with better response but not OS
Male breast cancer in BRCA1 and BRCA2 mutation carriers
DEFF Research Database (Denmark)
Silvestri, Valentina; Barrowdale, Daniel; Mulligan, Anna Marie
2016-01-01
BACKGROUND: BRCA1 and, more commonly, BRCA2 mutations are associated with increased risk of male breast cancer (MBC). However, only a paucity of data exists on the pathology of breast cancers (BCs) in men with BRCA1/2 mutations. Using the largest available dataset, we determined whether MBCs....../2 FBCs and with population-based data from 6351 MBCs in the Surveillance, Epidemiology, and End Results (SEER) database. RESULTS: Among BRCA2 MBCs, grade significantly decreased with increasing age at diagnosis (P = 0.005). Compared with BRCA2 FBCs, BRCA2 MBCs were of significantly higher stage (P...
Association of Type and Location of BRCA1 and BRCA2 Mutations With Risk of Breast and Ovarian Cancer
Rebbeck, Timothy R.; Mitra, Nandita; Wan, Fei; Sinilnikova, Olga M.; Healey, Sue; McGuffog, Lesley; Mazoyer, Sylvie; Chenevix-Trench, Georgia; Easton, Douglas F.; Antoniou, Antonis C.; Nathanson, Katherine L.; Laitman, Yael; Kushnir, Anya; Paluch-Shimon, Shani; Berger, Raanan; Zidan, Jamal; Friedman, Eitan; Ehrencrona, Hans; Stenmark-Askmalm, Marie; Einbeigi, Zakaria; Loman, Niklas; Harbst, Katja; Rantala, Johanna; Melin, Beatrice; Huo, Dezheng; Olopade, Olufunmilayo I.; Seldon, Joyce; Ganz, Patricia A.; Nussbaum, Robert L.; Chan, Salina B.; Odunsi, Kunle; Gayther, Simon A.; Domchek, Susan M.; Arun, Banu K.; Lu, Karen H.; Mitchell, Gillian; Karlan, Beth Y.; Walsh, Christine; Lester, Jenny; Godwin, Andrew K.; Pathak, Harsh; Ross, Eric; Daly, Mary B.; Whittemore, Alice S.; John, Esther M.; Miron, Alexander; Terry, Mary Beth; Chung, Wendy K.; Goldgar, David E.; Buys, Saundra S.; Janavicius, Ramunas; Tihomirova, Laima; Tung, Nadine; Dorfling, Cecilia M.; van Rensburg, Elizabeth J.; Steele, Linda; Neuhausen, Susan L.; Ding, Yuan Chun; Ejlertsen, Bent; Gerdes, Anne-Marie; Hansen, Thomas v O.; Ramón Y Cajal, Teresa; Osorio, Ana; Benitez, Javier; Godino, Javier; Tejada, Maria-Isabel; Duran, Mercedes; Weitzel, Jeffrey N.; Bobolis, Kristie A.; Sand, Sharon R.; Fontaine, Annette; Savarese, Antonella; Pasini, Barbara; Peissel, Bernard; Bonanni, Bernardo; Zaffaroni, Daniela; Vignolo-Lutati, Francesca; Scuvera, Giulietta; Giannini, Giuseppe; Bernard, Loris; Genuardi, Maurizio; Radice, Paolo; Dolcetti, Riccardo; Manoukian, Siranoush; Pensotti, Valeria; Gismondi, Viviana; Yannoukakos, Drakoulis; Fostira, Florentia; Garber, Judy; Torres, Diana; Rashid, Muhammad Usman; Hamann, Ute; Peock, Susan; Frost, Debra; Platte, Radka; Evans, D. Gareth; Eeles, Rosalind; Davidson, Rosemarie; Eccles, Diana; Cole, Trevor; Cook, Jackie; Brewer, Carole; Hodgson, Shirley; Morrison, Patrick J.; Walker, Lisa; Porteous, Mary E.; Kennedy, M. John; Izatt, Louise; Adlard, Julian; Donaldson, Alan; Ellis, Steve; Sharma, Priyanka; Schmutzler, Rita Katharina; Wappenschmidt, Barbara; Becker, Alexandra; Rhiem, Kerstin; Hahnen, Eric; Engel, Christoph; Meindl, Alfons; Engert, Stefanie; Ditsch, Nina; Arnold, Norbert; Plendl, Hans Jörg; Mundhenke, Christoph; Niederacher, Dieter; Fleisch, Markus; Sutter, Christian; Bartram, C. R.; Dikow, Nicola; Wang-Gohrke, Shan; Gadzicki, Dorothea; Steinemann, Doris; Kast, Karin; Beer, Marit; Varon-Mateeva, Raymonda; Gehrig, Andrea; Weber, Bernhard H.; Stoppa-Lyonnet, Dominique; Houdayer, Claude; Belotti, Muriel; Gauthier-Villars, Marion; Damiola, Francesca; Boutry-Kryza, Nadia; Lasset, Christine; Sobol, Hagay; Peyrat, Jean-Philippe; Muller, Danièle; Fricker, Jean-Pierre; Collonge-Rame, Marie-Agnès; Mortemousque, Isabelle; Nogues, Catherine; Rouleau, Etienne; Isaacs, Claudine; de Paepe, Anne; Poppe, Bruce; Claes, Kathleen; de Leeneer, Kim; Piedmonte, Marion; Rodriguez, Gustavo; Wakely, Katie; Boggess, John; Blank, Stephanie V.; Basil, Jack; Azodi, Masoud; Phillips, Kelly-Anne; Caldes, Trinidad; de la Hoya, Miguel; Romero, Atocha; Nevanlinna, Heli; Aittomäki, Kristiina; van der Hout, Annemarie H.; Hogervorst, Frans B. L.; Verhoef, Senno; Collée, J. Margriet; Seynaeve, Caroline; Oosterwijk, Jan C.; Gille, Johannes J. P.; Wijnen, Juul T.; Gómez Garcia, Encarna B.; Kets, Carolien M.; Ausems, Margreet G. E. M.; Aalfs, Cora M.; Devilee, Peter; Mensenkamp, Arjen R.; Kwong, Ava; Olah, Edith; Papp, Janos; Diez, Orland; Lazaro, Conxi; Darder, Esther; Blanco, Ignacio; Salinas, Mónica; Jakubowska, Anna; Lubinski, Jan; Gronwald, Jacek; Jaworska-Bieniek, Katarzyna; Durda, Katarzyna; Sukiennicki, Grzegorz; Huzarski, Tomasz; Byrski, Tomasz; Cybulski, Cezary; Toloczko-Grabarek, Aleksandra; Złowocka-Perłowska, Elżbieta; Menkiszak, Janusz; Arason, Adalgeir; Barkardottir, Rosa B.; Simard, Jacques; Laframboise, Rachel; Montagna, Marco; Agata, Simona; Alducci, Elisa; Peixoto, Ana; Teixeira, Manuel R.; Spurdle, Amanda B.; Lee, Min Hyuk; Park, Sue K.; Kim, Sung-Won; Friebel, Tara M.; Couch, Fergus J.; Lindor, Noralane M.; Pankratz, Vernon S.; Guidugli, Lucia; Wang, Xianshu; Tischkowitz, Marc; Foretova, Lenka; Vijai, Joseph; Offit, Kenneth; Robson, Mark; Rau-Murthy, Rohini; Kauff, Noah; Fink-Retter, Anneliese; Singer, Christian F.; Rappaport, Christine; Gschwantler-Kaulich, Daphne; Pfeiler, Georg; tea, Muy-Kheng; Berger, Andreas; Greene, Mark H.; Mai, Phuong L.; Imyanitov, Evgeny N.; Toland, Amanda Ewart; Senter, Leigha; Bojesen, Anders; Pedersen, Inge Sokilde; Skytte, Anne-Bine; Sunde, Lone; Thomassen, Mads; Moeller, Sanne Traasdahl; Kruse, Torben A.; Jensen, Uffe Birk; Caligo, Maria Adelaide; Aretini, Paolo; teo, Soo-Hwang; Selkirk, Christina G.; Hulick, Peter J.; Andrulis, Irene
2015-01-01
IMPORTANCE Limited information about the relationship between specific mutations in BRCA1 or BRCA2 (BRCA1/2) and cancer risk exists. OBJECTIVE To identify mutation-specific cancer risks for carriers of BRCA1/2. DESIGN, SETTING, AND PARTICIPANTS Observational study of women who were ascertained
Association of type and location of BRCA1 and BRCA2 mutations with risk of breast and ovarian cancer
Rebbeck, T.R.; Mitra, N.; Wan, F.; Sinilnikova, O.M.; Healey, S.; McGuffog, L.; Mazoyer, S.; Chenevix-Trench, G.; Easton, D.F.; Antoniou, A.C.; Nathanson, K.L.; Laitman, Y.; Kushnir, A.; Paluch-Shimon, S.; Berger, R.; Zidan, J.; Friedman, E.; Ehrencrona, H.; Stenmark-Askmalm, M.; Einbeigi, Z.; Loman, N.; Harbst, K.; Rantala, J.; Melin, B.; Huo, D.; Olopade, O.I.; Seldon, J.; Ganz, P.A.; Nussbaum, R.L.; Chan, S.B.; Odunsi, K.; Gayther, S.A.; Domchek, S.M.; Arun, B.K.; Lu, K.H.; Mitchell, G.; Karlan, B.Y.; Walsh, C.; Lester, J.; Godwin, A.K.; Pathak, H.; Ross, E.; Daly, M.B.; Whittemore, A.S.; John, E.M.; Miron, A.; Terry, M.B.; Chung, W.K.; Goldgar, D.E.; Buys, S.S.; Janavicius, R.; Tihomirova, L.; Tung, N.; Dorfling, C.M.; Rensburg, E.J. van; Steele, L.; Neuhausen, S.L.; Ding, Y.C.; Ejlertsen, B.; Gerdes, A.M.; Hansen, T.; Ramon Y Cajal, T.; Osorio, A.; Benitez, J.; Godino, J.; Tejada, M.I.; Duran, M.; Weitzel, J.N.; Bobolis, K.A.; Sand, S.R.; Fontaine, A.; Savarese, A.; Pasini, B.; Peissel, B.; Bonanni, B.; Zaffaroni, D.; Vignolo-Lutati, F.; Scuvera, G.; Giannini, G.; Bernard, L.; Genuardi, M.; Radice, P.; Dolcetti, R.; Manoukian, S.; Pensotti, V.; Gismondi, V.; Yannoukakos, D.; Fostira, F.; Garber, J.; Torres, D.; Rashid, M.U.; Hamann, U.; Peock, S.; Frost, D.; Platte, R.; Evans, D.G.; Eeles, R.; Davidson, R.; Eccles, D.; Cole, T.; Kets, M.; Mensenkamp, A.R.; et al.,
2015-01-01
IMPORTANCE: Limited information about the relationship between specific mutations in BRCA1 or BRCA2 (BRCA1/2) and cancer risk exists. OBJECTIVE: To identify mutation-specific cancer risks for carriers of BRCA1/2. DESIGN, SETTING, AND PARTICIPANTS: Observational study of women who were ascertained
Association of type and location of BRCA1 and BRCA2 mutations with risk of breast and ovarian cancer
DEFF Research Database (Denmark)
Rebbeck, Timothy R; Mitra, Nandita; Wan, Fei
2015-01-01
IMPORTANCE: Limited information about the relationship between specific mutations in BRCA1 or BRCA2 (BRCA1/2) and cancer risk exists. OBJECTIVE: To identify mutation-specific cancer risks for carriers of BRCA1/2. DESIGN, SETTING, AND PARTICIPANTS: Observational study of women who were ascertained...
Burns, Michael B; Montassier, Emmanuel; Abrahante, Juan; Priya, Sambhawa; Niccum, David E; Khoruts, Alexander; Starr, Timothy K; Knights, Dan; Blekhman, Ran
2018-06-20
Variation in the gut microbiome has been linked to colorectal cancer (CRC), as well as to host genetic variation. However, we do not know whether, in addition to baseline host genetics, somatic mutational profiles in CRC tumors interact with the surrounding tumor microbiome, and if so, whether these changes can be used to understand microbe-host interactions with potential functional biological relevance. Here, we characterized the association between CRC microbial communities and tumor mutations using microbiome profiling and whole-exome sequencing in 44 pairs of tumors and matched normal tissues. We found statistically significant associations between loss-of-function mutations in tumor genes and shifts in the abundances of specific sets of bacterial taxa, suggestive of potential functional interaction. This correlation allows us to statistically predict interactions between loss-of-function tumor mutations in cancer-related genes and pathways, including MAPK and Wnt signaling, solely based on the composition of the microbiome. In conclusion, our study shows that CRC microbiomes are correlated with tumor mutational profiles, pointing towards possible mechanisms of molecular interaction.
Mulligan, Anna Marie; Couch, Fergus J.; Barrowdale, Daniel; Domchek, Susan M.; Eccles, Diana; Nevanlinna, Heli; Ramus, Susan J.; Robson, Mark; Sherman, Mark; Spurdle, Amanda B.; Wappenschmidt, Barbara; Lee, Andrew; McGuffog, Lesley; Healey, Sue; Sinilnikova, Olga M.; Janavicius, Ramunas; Hansen, Thomas vO; Nielsen, Finn C.; Ejlertsen, Bent; Osorio, Ana; Muñoz-Repeto, Iván; Durán, Mercedes; Godino, Javier; Pertesi, Maroulio; Benítez, Javier; Peterlongo, Paolo; Manoukian, Siranoush; Peissel, Bernard; Zaffaroni, Daniela; Cattaneo, Elisa; Bonanni, Bernardo; Viel, Alessandra; Pasini, Barbara; Papi, Laura; Ottini, Laura; Savarese, Antonella; Bernard, Loris; Radice, Paolo; Hamann, Ute; Verheus, Martijn; Meijers-Heijboer, Hanne E. J.; Wijnen, Juul; Gómez García, Encarna B.; Nelen, Marcel R.; Kets, C. Marleen; Seynaeve, Caroline; Tilanus-Linthorst, Madeleine M. A.; van der Luijt, Rob B.; van Os, Theo; Rookus, Matti; Frost, Debra; Jones, J. Louise; Evans, D. Gareth; Lalloo, Fiona; Eeles, Ros; Izatt, Louise; Adlard, Julian; Davidson, Rosemarie; Cook, Jackie; Donaldson, Alan; Dorkins, Huw; Gregory, Helen; Eason, Jacqueline; Houghton, Catherine; Barwell, Julian; Side, Lucy E.; McCann, Emma; Murray, Alex; Peock, Susan; Godwin, Andrew K.; Schmutzler, Rita K.; Rhiem, Kerstin; Engel, Christoph; Meindl, Alfons; Ruehl, Ina; Arnold, Norbert; Niederacher, Dieter; Sutter, Christian; Deissler, Helmut; Gadzicki, Dorothea; Kast, Karin; Preisler-Adams, Sabine; Varon-Mateeva, Raymonda; Schoenbuchner, Ines; Fiebig, Britta; Heinritz, Wolfram; Schäfer, Dieter; Gevensleben, Heidrun; Caux-Moncoutier, Virginie; Fassy-Colcombet, Marion; Cornelis, François; Mazoyer, Sylvie; Léoné, Mélanie; Boutry-Kryza, Nadia; Hardouin, Agnès; Berthet, Pascaline; Muller, Danièle; Fricker, Jean-Pierre; Mortemousque, Isabelle; Pujol, Pascal; Coupier, Isabelle; Lebrun, Marine; Kientz, Caroline; Longy, Michel; Sevenet, Nicolas; Stoppa-Lyonnet, Dominique; Isaacs, Claudine; Caldes, Trinidad; de la Hoya, Miguel; Heikkinen, Tuomas; Aittomäki, Kristiina; Blanco, Ignacio; Lazaro, Conxi; Barkardottir, Rosa B.; Soucy, Penny; Dumont, Martine; Simard, Jacques; Montagna, Marco; Tognazzo, Silvia; D'Andrea, Emma; Fox, Stephen; Yan, Max; Rebbeck, Tim; Olopade, Olufunmilayo; Weitzel, Jeffrey N.; Lynch, Henry T.; Ganz, Patricia A.; Tomlinson, Gail E.; Wang, Xianshu; Fredericksen, Zachary; Pankratz, Vernon S.; Lindor, Noralane M.; Szabo, Csilla; Offit, Kenneth; Sakr, Rita; Gaudet, Mia; Bhatia, Jasmine; Kauff, Noah; Singer, Christian F.; tea, Muy-Kheng; Gschwantler-Kaulich, Daphne; Fink-Retter, Anneliese; Mai, Phuong L.; Greene, Mark H.; Imyanitov, Evgeny; O'Malley, Frances P.; Ozcelik, Hilmi; Glendon, Gordon; Toland, Amanda E.; Gerdes, Anne-Marie; Thomassen, Mads; Kruse, Torben A.; Jensen, Uffe Birk; Skytte, Anne-Bine; Caligo, Maria A.; Soller, Maria; Henriksson, Karin; Wachenfeldt, von Anna; Arver, Brita; Stenmark-Askmalm, Marie; Karlsson, Per; Ding, Yuan Chun; Neuhausen, Susan L.; Beattie, Mary; Pharoah, Paul D. P.; Moysich, Kirsten B.; Nathanson, Katherine L.; Karlan, Beth Y.; Gross, Jenny; John, Esther M.; Daly, Mary B.; Buys, Saundra M.; Southey, Melissa C.; Hopper, John L.; Terry, Mary Beth; Chung, Wendy; Miron, Alexander F.; Goldgar, David; Chenevix-Trench, Georgia; Easton, Douglas F.; Andrulis, Irene L.; Antoniou, Antonis C.; Ellis, Steve; Fineberg, Elena; Platte, Radka; Miedzybrodzka, Zosia; Morrison, Patrick; Jeffers, Lisa; Cole, Trevor; Ong, Kai-Ren; Hoffman, Jonathan; James, Margaret; Paterson, Joan; Downing, Sarah; Taylor, Amy; Rogers, T.; Kennedy, John M.; Barton, David; Porteous, Mary; Drummond, Sarah; Brewer, Carole; Kivuva, Emma; Searle, Anne; Goodman, Selina; Hill, Kathryn; Murday, Victoria; Bradshaw, Nicola; Snadden, Lesley; Longmuir, Mark; Watt, Catherine; Gibson, Sarah; Haque, Eshika; Tobias, Ed; Duncan, Alexis; Jacobs, Chris; Langman, Caroline; Whaite, Anna; Chu, Carol; Miller, Julie; Ellis, Ian; Taylor, Jane; Male, Alison; Berlin, Cheryl; Collier, Rebecca; Douglas, Fiona; Claber, Oonagh; Jobson, Irene; Walker, Lisa; McLeod, Diane; Halliday, Dorothy; Durell, Sarah; Stayner, Barbara; Shanley, Susan; Rahman, Nazneen; Houlston, Richard; Bancroft, Elizabeth; D'Mello, Lucia; Page, Elizabeth; Ardern-Jones, Audrey; Kohut, Kelly; Wiggins, Jennifer; Castro, Elena; Mitra, Anita; Robertson, Lisa; Quarrell, Oliver; Bardsley, Cathryn; Hodgson, Shirley; Goff, Sheila; Brice, Glen; Winchester, Lizzie; Eddy, Charlotte; Tripathi, Vishakha; Attard, Virginia; Lucassen, Anneke; Crawford, Gillian; McBride, Donna; Smalley, Sarah; Barjhoux, Laure; Verny-Pierre, Carole; Giraud, Sophie; Gauthier-Villars, Marion; Buecher, Bruno; Houdayer, Claude; Belotti, Muriel; Tirapo, Carole; de Pauw, Antoine; Roussy, Gustave; Bressac-de-Paillerets, Brigitte; Remenieras, Audrey; Byrde, Véronique; Caron, Olivier; Lenoir, Gilbert; Bignon, Yves-Jean; Uhrhammer, Nancy; Bérard, Léon; Lasset, Christine; Bonadona, Valérie; Baclesse, François; Sobol, Hagay; Bourdon, Violaine; Noguchi, Tetsuro; Eisinger, François; Coulet, Florence; Colas, Chrystelle; Soubrier, Florent; Peyrat, Jean-Philippe; Fournier, Joëlle; Révillion, Françoise; Vennin, Philippe; Adenis, Claude; Rouleau, Etienne; Lidereau, Rosette; Demange, Liliane; Nogues, Catherine; Barouk-Simonet, Emmanuelle; Bonnet, Françoise; Bubien, Virginie; Toulas, Christine; Guimbaud, Rosine; Gladieff, Laurence; Feillel, Viviane; Leroux, Dominique; Dreyfus, Hélène; Rebischung, Christine; Peysselon, Magalie; Coron, Fanny; Faivre, Laurence; Prieur, Fabienne; Ferrer, Sandra Fert; Lacassagne, Antoine; Frénay, Marc; Vénat-Bouvet, Laurence; Delnatte, Capucine; Snyder, Carrie L.; Hogervorst, F. B. L.; Verhoef, S.; Verheus, M.; van 't Veer, L. J.; van Leeuwen, F. E.; Collée, M.; van den Ouweland, A. M. W.; Jager, A.; Hooning, M. J.; van Asperen, C. J.; Wijnen, J. T.; Vreeswijk, M. P.; Tollenaar, R. A.; Devilee, P.; Ligtenberg, M. J.; Hoogerbrugge, N.; Ausems, M. G.; Aalfs, C. M.; Gille, J. J. P.; Waisfisz, Q.; Gomez-Garcia, E. B.; van Roozendaal, C. E.; Blok, Marinus J.; Caanen, B.; Oosterwijk, J. C.; van der Hout, A. H.; Mourits, M. J.; Vasen, H. F.; Nordling, Margareta; Bergman, Annika; Einbeigi, Zakaria; Liedgren, Sigrun; Borg, Åke; Loman, Niklas; Olsson, Håkan; Kristoffersson, Ulf; Jernström, Helena; Harbst, Katja; Lindblom, Annika; Liljegren, Annelie; Barbany-Bustinza, Gisela; Rantala, Johanna; Melin, Beatrice; Grönberg, Henrik; Stattin, Eva-Lena; Emanuelsson, Monica; Ehrencrona, Hans; Rosenquist, Richard; Dahl, Niklas
2011-01-01
Previous studies have demonstrated that common breast cancer susceptibility alleles are differentially associated with breast cancer risk for BRCA1 and/or BRCA2 mutation carriers. It is currently unknown how these alleles are associated with different breast cancer subtypes in BRCA1 and BRCA2
Abdikhakimov, Abdulla; Tukhtaboeva, Mukaddas; Adilov, Bakhtiyar; Turdikulova, Shahlo
2016-01-01
Breast cancer is the most common malignancy in women and affects approximately 1 out of 8 females in the US. Risk of developing breast cancer is strongly influenced by genetic factors. Germ-line mutations in BRCA1 and BRCA2 genes are associated with 5-10% of breast cancer incidence. To reduce the risk of developing cancer and to increase the likelihood of early detection, carriers of BRCA1 or BRCA2 mutations are offered surveillance programs and effective preventive medical interventions. Identification of founder mutations of BRCA1/2 in high risk communities can have a significant impact on the management of hereditary cancer at the level of the national healthcare systems, making genetic testing more affordable and cost-effective. BRCA1 and BRCA2 mutations in breast cancer patients have not been characterized in the Uzbek population. This pilot study aimed to investigate the contribution of BRCA1 and BRCA2 mutation to early onset and familial cases of breast cancer in Uzbekistan. A total of 67 patients with breast cancer and 103 age-matched disease free controls were included in this study. Utilizing SYBR Green based real-time allele-specific PCR, we have analyzed DNA samples of patients with breast cancer and disease free controls to identify the following BRCA1 and BRCA2 mutations: BRCA1 5382insC, BRCA1 4153delA, BRCA1 185delAG, BRCA1 300T>G, BRCA2 6174delT. Three unrelated samples (4.5%) were found to be positive for the heterozygous 5382insCBRCA1 mutation, representing a possible founder mutation in the Uzbek population, supporting the need for larger studies examining the contribution of this mutation to breast cancer incidence in Uzbekistan. We did not find BRCA1 4153delA, BRCA1 185delAG, BRCA1 300T>G, and BRCA2 6174delT mutations. This preliminary evidence suggests a potential contribution of BRCA1 5382insC mutation to breast cancer development in Uzbek population. Taking into account a high disease penetrance in carriers of BRCA1 mutation, it seems
A R54L mutation of CRYAA associated with autosomal dominant nuclear cataracts in a Chinese family.
Yang, Zhenfei; Su, Dongmei; Li, Qian; Ma, Zicheng; Yang, Fan; Zhu, Siquan; Ma, Xu
2013-12-01
To identify the genetic defect in a three-generation Chinese family with congenital cataracts. The phenotype of a three-generation Chinese family with congenital cataract was recruited. Detailed family history and clinical data of the family were recorded. Candidate genes sequencing was performed to screen out the disease-causing mutation. Bioinformatics analysis was performed to predict the function of mutant gene. The phenotype of the family was identified as nuclear cataract. Direct sequencing revealed a c.161 G > T transversion in exon 1 of crystallin alpha-A (CRYAA). This mutation co-segregated with all affected individuals in the family and was not found in unaffected family members nor in the 100 unrelated controls. Bioinformatics analysis indicated that the 54th amino acid position was highly conserved and the mutation R54L caused an increase of local hydrophobicity around the substitution site. This study identified a novel disease-causing mutation c.161 G > T (p.R54L) in CRYAA in a Chinese family with autosomal dominant nuclear cataracts, this is the first report relating a G > T mutation in CRYAA leading to congenital nuclear cataract.
Meroño, Tomás; Brites, Fernando; Dauteuille, Carolane; Lhomme, Marie; Menafra, Martín; Arteaga, Alejandra; Castro, Marcelo; Saez, María Soledad; Ballerga, Esteban González; Sorroche, Patricia; Rey, Jorge; Lesnik, Philippe; Sordá, Juan Andrés; Chapman, M John; Kontush, Anatol; Daruich, Jorge
2015-05-01
Iron overload (IO) has been associated with glucose metabolism alterations and increased risk of cardiovascular disease (CVD). Primary IO is associated with mutations in the HFE gene. To which extent HFE gene mutations and metabolic alterations contribute to the presence of atherogenic lipoprotein modifications in primary IO remains undetermined. The present study aimed to assess small, dense low-density lipoprotein (LDL) levels, chemical composition of LDL and high-density lipoprotein (HDL) particles, and HDL functionality in IO patients. Eighteen male patients with primary IO and 16 sex- and age-matched controls were recruited. HFE mutations (C282Y, H63D and S65C), measures of insulin sensitivity and secretion (calculated from the oral glucose tolerance test), chemical composition and distribution profile of LDL and HDL subfractions (isolated by gradient density ultracentrifugation) and HDL functionality (as cholesterol efflux and antioxidative activity) were studied. IO patients compared with controls exhibited insulin resistance (HOMA-IR (homoeostasis model assessment-estimated insulin resistance): +93%, PHFE genotypes. C282Y homozygotes (n=7) presented a reduced β-cell function and insulin secretion compared with non-C282Y patients (n=11) (-58% and -73%, respectively, PHFE gene mutations are involved in the presence of atherogenic lipoprotein modifications in primary IO. To what extent such alterations could account for an increase in CVD risk remains to be determined.
Population-based statistical inference for temporal sequence of somatic mutations in cancer genomes.
Rhee, Je-Keun; Kim, Tae-Min
2018-04-20
It is well recognized that accumulation of somatic mutations in cancer genomes plays a role in carcinogenesis; however, the temporal sequence and evolutionary relationship of somatic mutations remain largely unknown. In this study, we built a population-based statistical framework to infer the temporal sequence of acquisition of somatic mutations. Using the model, we analyzed the mutation profiles of 1954 tumor specimens across eight tumor types. As a result, we identified tumor type-specific directed networks composed of 2-15 cancer-related genes (nodes) and their mutational orders (edges). The most common ancestors identified in pairwise comparison of somatic mutations were TP53 mutations in breast, head/neck, and lung cancers. The known relationship of KRAS to TP53 mutations in colorectal cancers was identified, as well as potential ancestors of TP53 mutation such as NOTCH1, EGFR, and PTEN mutations in head/neck, lung and endometrial cancers, respectively. We also identified apoptosis-related genes enriched with ancestor mutations in lung cancers and a relationship between APC hotspot mutations and TP53 mutations in colorectal cancers. While evolutionary analysis of cancers has focused on clonal versus subclonal mutations identified in individual genomes, our analysis aims to further discriminate ancestor versus descendant mutations in population-scale mutation profiles that may help select cancer drivers with clinical relevance.
A. Osorio (Ana); R.L. Milne (Roger); K.B. Kuchenbaecker (Karoline); T. Vaclová (Tereza); G. Pita (Guillermo); R. Alonso (Rosario); P. Peterlongo (Paolo); I. Blanco (Ignacio); M. de La Hoya (Miguel); M. Durán (Mercedes); O. Díez (Orland); T. Ramon Y Cajal; I. Konstantopoulou (I.); C. Martínez-Bouzas (Cristina); R. Andrés Conejero (Raquel); P. Soucy (Penny); L. McGuffog (Lesley); D. Barrowdale (Daniel); A. Lee (Andrew); B. Arver (Brita Wasteson); J. Rantala (Johanna); N. Loman (Niklas); H. Ehrencrona (Hans); O.I. Olopade (Olofunmilayo); M.S. Beattie (Mary); S.M. Domchek (Susan); K.L. Nathanson (Katherine); R. Rebbeck (Timothy); B.K. Arun (Banu); B.Y. Karlan (Beth); C.S. Walsh (Christine); K.J. Lester (Kathryn); E.M. John (Esther); A.S. Whittemore (Alice); M.B. Daly (Mary); M.C. Southey (Melissa); J.L. Hopper (John); M.-B. Terry (Mary-Beth); S.S. Buys (Saundra); R. Janavicius (Ramunas); C.M. Dorfling (Cecilia); E.J. van Rensburg (Elizabeth); L. Steele (Linda); S.L. Neuhausen (Susan); Y.C. Ding (Yuan); T.V.O. Hansen (Thomas); L. Jønson (Lars); B. Ejlertsen (Bent); A-M. Gerdes (Anne-Marie); J. Infante (Jon); B. Herráez (Belén); L.T. Moreno (Leticia Thais); J.N. Weitzel (Jeffrey); J. Herzog (Josef); K. Weeman (Kisa); S. Manoukian (Siranoush); B. Peissel (Bernard); D. Zaffaroni (D.); G. Scuvera (Giulietta); B. Bonnani (Bernardo); F. Mariette (F.); S. Volorio (Sara); A. Viel (Alessandra); L. Varesco (Liliana); L. Papi (Laura); L. Ottini (Laura); M.G. Tibiletti (Maria Grazia); P. Radice (Paolo); D. Yannoukakos (Drakoulis); J. Garber; S.D. Ellis (Steve); D. Frost (Debra); R. Platte (Radka); E. Fineberg (Elena); D.G. Evans (Gareth); F. Lalloo (Fiona); L. Izatt (Louise); R. Eeles (Rosalind); J.W. Adlard (Julian); R. Davidson (Rosemarie); T.J. Cole (Trevor); D. Eccles (Diana); J. Cook (Jackie); S.V. Hodgson (Shirley); C. Brewer (Carole); M. Tischkowitz (Marc); F. Douglas (Fiona); M.E. Porteous (Mary); L. Side (Lucy); L.J. Walker (Lisa); P.J. Morrison (Patrick); A. Donaldson (Alan); J. Kennedy (John); C. Foo (Claire); A.K. Godwin (Andrew); R.K. Schmutzler (Rita); B. Wapenschmidt (Barbara); K. Rhiem (Kerstin); C.W. Engel (Christoph); A. Meindl (Alfons); N. Ditsch (Nina); N. Arnold (Norbert); H. Plendl (Hansjoerg); D. Niederacher (Dieter); C. Sutter (Christian); S. Wang-Gohrke (Shan); D. Steinemann (Doris); S. Preisler-Adams (Sabine); K. Kast (Karin); R. Varon-Mateeva (Raymonda); P.A. Gehrig (Paola A.); D. Stoppa-Lyonnet (Dominique); O. Sinilnikova (Olga); S. Mazoyer (Sylvie); F. Damiola (Francesca); B. Poppe (Bruce); K. Claes (Kathleen); M. Piedmonte (Marion); K. Tucker (Kathryn); F.J. Backes (Floor); P.M. Rodríguez; W. Brewster (Wendy); K. Wakeley (Katie); T. Rutherford (Thomas); T. Caldes (Trinidad); H. Nevanlinna (Heli); K. Aittomäki (Kristiina); M.A. Rookus (Matti); T.A.M. van Os (Theo); L. van der Kolk (Lizet); J.L. de Lange (J.); E.J. Meijers-Heijboer (Hanne); A.H. van der Hout (Annemarie); C.J. van Asperen (Christi); E.B. Gómez García (Encarna); N. Hoogerbrugge (Nicoline); J.M. Collée (Margriet); C.H.M. van Deurzen (Carolien); R.B. van der Luijt (Rob); P. Devilee (Peter); E. Olah (Edith); C. Lazaro (Conxi); A. Teulé (A.); M. Menéndez (Mireia); A. Jakubowska (Anna); C. Cybulski (Cezary); J. Gronwald (Jacek); J. Lubinski (Jan); K. Durda (Katarzyna); K. Jaworska-Bieniek (Katarzyna); O.T. Johannson (Oskar); C. Maugard; M. Montagna (Marco); S. Tognazzo (Silvia); P.J. Teixeira; S. Healey (Sue); C. Olswold (Curtis); L. Guidugli (Lucia); N.M. Lindor (Noralane); S. Slager (Susan); C. Szabo (Csilla); J. Vijai (Joseph); M. Robson (Mark); N. Kauff (Noah); L. Zhang (Lingling); R. Rau-Murthy (Rohini); A. Fink-Retter (Anneliese); C.F. Singer (Christian); C. Rappaport (Christine); D. Geschwantler Kaulich (Daphne); G. Pfeiler (Georg); M.-K. Tea; A. Berger (Annemarie); C. Phelan (Catherine); M.H. Greene (Mark); P.L. Mai (Phuong); F. Lejbkowicz (Flavio); I.L. Andrulis (Irene); A.M. Mulligan (Anna Marie); G. Glendon (Gord); A.E. Toland (Amanda); S.E. Bojesen (Stig); I.S. Pedersen (Inge Sokilde); L. Sunde (Lone); M. Thomassen (Mads); T.A. Kruse (Torben); U.B. Jensen; E. Friedman (Eitan); Y. Laitman (Yael); S.P. Shimon (Shani Paluch); J. Simard (Jacques); D.F. Easton (Douglas); K. Offit (Kenneth); F.J. Couch (Fergus); G. Chenevix-Trench (Georgia); A.C. Antoniou (Antonis); J. Benítez (Javier)
2014-01-01
textabstractSingle Nucleotide Polymorphisms (SNPs) in genes involved in the DNA Base Excision Repair (BER) pathway could be associated with cancer risk in carriers of mutations in the high-penetrance susceptibility genes BRCA1 and BRCA2, given the relation of synthetic lethality that exists between
Directory of Open Access Journals (Sweden)
Iwona Słowińska
2011-10-01
Full Text Available W pracy przedstawiono historię leczenia operacyjnego stawówśródręczno-paliczkowych ręki z użyciem endoprotez u chorych nareumatoidalne zapalenie stawów w Klinice Reumoortopedii InstytutuReumatologii w Warszawie (ryc. 1–4.
Directory of Open Access Journals (Sweden)
Navya Nair
2016-12-01
Full Text Available Endometrial cancer is the most common gynecologic malignancy, and its incidence and associated mortality are increasing. Despite the immediate need to detect these cancers at an earlier stage, there is no effective screening methodology or protocol for endometrial cancer. The comprehensive, genomics-based analysis of endometrial cancer by The Cancer Genome Atlas (TCGA revealed many of the molecular defects that define this cancer. Based on these cancer genome results, and in a prospective study, we hypothesized that the use of ultra-deep, targeted gene sequencing could detect somatic mutations in uterine lavage fluid obtained from women undergoing hysteroscopy as a means of molecular screening and diagnosis.Uterine lavage and paired blood samples were collected and analyzed from 107 consecutive patients who were undergoing hysteroscopy and curettage for diagnostic evaluation from this single-institution study. The lavage fluid was separated into cellular and acellular fractions by centrifugation. Cellular and cell-free DNA (cfDNA were isolated from each lavage. Two targeted next-generation sequencing (NGS gene panels, one composed of 56 genes and the other of 12 genes, were used for ultra-deep sequencing. To rule out potential NGS-based errors, orthogonal mutation validation was performed using digital PCR and Sanger sequencing. Seven patients were diagnosed with endometrial cancer based on classic histopathologic analysis. Six of these patients had stage IA cancer, and one of these cancers was only detectable as a microscopic focus within a polyp. All seven patients were found to have significant cancer-associated gene mutations in both cell pellet and cfDNA fractions. In the four patients in whom adequate tumor sample was available, all tumor mutations above a specific allele fraction were present in the uterine lavage DNA samples. Mutations originally only detected in lavage fluid fractions were later confirmed to be present in tumor but at
Genotyping of K-ras codons 12 and 13 mutations in colorectal cancer by capillary electrophoresis.
Chen, Yen-Ling; Chang, Ya-Sian; Chang, Jan-Gowth; Wu, Shou-Mei
2009-06-26
Point mutations of the K-ras gene located in codons 12 and 13 cause poor responses to the anti-epidermal growth factor receptor (anti-EGFR) therapy of colorectal cancer (CRC) patients. Besides, mutations of K-ras gene have also been proven to play an important role in human tumor progression. We established a simple and effective capillary electrophoresis (CE) method for simultaneous point mutation detection in codons 12 and 13 of K-ras gene. We combined one universal fluorescence-based nonhuman-sequence primer and two fragment-oriented primers in one tube, and performed this two-in-one polymerase chain reaction (PCR). PCR fragments included wild type and seven point mutations at codons 12 and 13 of K-ras gene. The amplicons were analyzed by single-strand conformation polymorphism (SSCP)-CE method. The CE analysis was performed by using a 1x Tris-borate-EDTA (TBE) buffer containing 1.5% (w/v) hydroxyethylcellulose (HEC) (MW 250,000) under reverse polarity with 15 degrees C and 30 degrees C. Ninety colorectal cancer patients were blindly genotyped using this developed method. The results showed good agreement with those of DNA sequencing method. The SSCP-CE was feasible for mutation screening of K-ras gene in populations.
Eto, Tsugio; Miyake, Keisuke; Nosho, Katsuhiko; Ohmuraya, Masaki; Imamura, Yu; Arima, Kota; Kanno, Shinichi; Fu, Lingfeng; Kiyozumi, Yuki; Izumi, Daisuke; Sugihara, Hidetaka; Hiyoshi, Yukiharu; Miyamoto, Yuji; Sawayama, Hiroshi; Iwatsuki, Masaaki; Baba, Yoshifumi; Yoshida, Naoya; Furukawa, Toru; Araki, Kimi; Baba, Hideo; Ishimoto, Takatsugu
2018-05-13
RNF43 mutations are frequently detected in colorectal cancer cells and lead to a loss of function of the ubiquitin E3 ligase. Here, we investigated the clinical significance of RNF43 mutations in a large Japanese cohort and the role of RNF43 at various stages of colorectal cancer development and progression. Mutation analysis of the RNF43 gene locus using pyrosequencing technology detected RNF43 hotspot mutations in 1 (0.88%) of 113 colorectal polyp cases and 30 (6.45%) of 465 colorectal cancer cases. Moreover, patients with colorectal cancer harboring mutated RNF43 experienced a higher recurrence rate than those harboring non-mutated RNF43. In addition, the growth of RNF43 wild-type colorectal cancer cell lines was significantly increased by RNF43 silencing. We generated Rnf43 knock-out mice in a C57BL/6N background using the CRISPR-Cas9 system. Although intestinal organoids from the Rnf43 knock-out mice did not show continuous growth compared with those from the wild-type mice in the absence of R-spondin, an azoxymethane (AOM)/dextran sodium sulfate (DSS) mouse model demonstrated that the tumors were markedly larger in the Rnf43 knock-out mice than in the wild-type mice. These findings provide evidence that Wnt signaling activation by RNF43 mutations during the tumorigenic stage enhances tumor growth and promotes a high recurrence rate in colorectal cancer patients. This article is protected by copyright. All rights reserved. This article is protected by copyright. All rights reserved.
2010-04-01
... 18 Conservation of Power and Water Resources 1 2010-04-01 2010-04-01 false Definitions. 284.282 Section 284.282 Conservation of Power and Water Resources FEDERAL ENERGY REGULATORY COMMISSION, DEPARTMENT... Blanket Certificates Authorizing Certain Natural Gas Sales by Interstate Pipelines § 284.282 Definitions...
Inherited Disease Genetics Improves the Identification of Cancer-Associated Genes.
Directory of Open Access Journals (Sweden)
Boyang Zhao
2016-06-01
Full Text Available The identification of biologically significant variants in cancer genomes is critical to therapeutic discovery, but it is limited by the statistical power needed to discern driver from passenger. Independent biological data can be used to filter cancer exomes and increase statistical power. Large genetic databases for inherited diseases are uniquely suited to this task because they contain specific amino acid alterations with known pathogenicity and molecular mechanisms. However, no rigorous method to overlay this information onto the cancer exome exists. Here, we present a computational methodology that overlays any variant database onto the somatic mutations in all cancer exomes. We validate the computation experimentally and identify novel associations in a re-analysis of 7362 cancer exomes. This analysis identified activating SOS1 mutations associated with Noonan syndrome as significantly altered in melanoma and the first kinase-activating mutations in ACVR1 associated with adult tumors. Beyond a filter, significant variants found in both rare cancers and rare inherited diseases increase the unmet medical need for therapeutics that target these variants and may bootstrap drug discovery efforts in orphan indications.
Polymorphic haplotypes on R408BW PKU and normal PAH chromosomes in Quebec and European populations
Energy Technology Data Exchange (ETDEWEB)
Byck, S.; Morgan, K.; Scriver, C.R. [McGill Univ., Montreal (Canada)] [and others
1994-09-01
The R408W mutation in the phenylalanine hydroxylase gene (PAH) is associated with haplotype 2.3 (RFLP haplotype 2, VNTR 3 of the HindIII system) in most European populations. Another chromosome, first observed in Quebec and then in northwest Europe, carries R408W on haplotype 1.8. The occurrence of the R408W mutation on two different PKU chromosomes could be the result of intragenic recombination, recurrent mutation or gene conversion. In this study, we analyzed both normal and R408W chromosomes carrying 1.8 and 2.3 haplotypes in Quebec and European populations; we used the TCTA{sub (n)} short tandem repeat sequence (STR) at the 5{prime} end of the PAH gene and the HindIII VNTR system at the 3{prime} end of the PAH gene to characterize chromosomes. Fourteen of sixteen R408W chromosomes from {open_quotes}Celtic{close_quotes} families in Quebec and the United Kingdom (UK) harbor a 244 bp STR allele; the remaining two chromosomes, carry a 240 bp or 248bp STR allele. Normal chromosomes (n=18) carry the 240 bp STR allele. R408W chromosomes are different from mutant H1.8 chromosomes; mutant H2.3 carries the 240 bp STR allele (14 of 16 chromosomes) or the 236 allele (2 of 16 chromosomes). The HindIII VNTR comprises variable numbers of 30 bp repeats (cassettes); the repeats also vary in nucleotide sequence. Variation clusters toward the 3{prime} end of cassettes and VNTRs. VNTR 3 alleles on normal H2 (n=9) and mutant R408W H2 (n=19) chromosomes were identical. VNTR 8 alleles on normal H1 chromosomes (n=9) and on R408W H1 chromosomes (n=15) differ by 1 bp substitution near the 3{prime} end of the 6th cassette. In summary, the mutant H1.8 chromosome harboring the R408W mutation has unique features at both the 5{prime} and 3{prime} end of the gene that distinguish it from the mutant H2.3 and normal H1.8 and H2.3 counterparts. The explanation for the occurrence of R408W on two different PAH haplotypes is recurrent mutation affecting the CpG dinucleotide in PAH codon 408.
Enein, Azza Aboul; El Dessouky, Nermine A; Mohamed, Khalda S; Botros, Shahira K A; Abd El Gawad, Mona F; Hamdy, Mona; Dyaa, Nehal
2016-06-15
This study aimed to detect the most common HFE gene mutations (C282Y, H63D, and S56C) in Egyptian beta thalassemia major patients and its relation to their iron status. The study included 50 beta thalassemia major patients and 30 age and sex matched healthy persons as a control group. Serum ferritin, serum iron and TIBC level were measured. Detection of the three HFE gene mutations (C282Y, H63D and S65C) was done by PCR-RFLP analysis. Confirmation of positive cases for the mutations was done by sequencing. Neither homozygote nor carrier status for the C282Y or S65C alleles was found. The H63D heterozygous state was detected in 5/50 (10%) thalassemic patients and in 1/30 (3.3%) controls with no statistically significant difference between patients and control groups (p = 0.22). Significantly higher levels of the serum ferritin and serum iron in patients with this mutation (p = 001). Our results suggest that there is an association between H63D mutation and the severity of iron overload in thalassemic patients.
Osorio, A.; Milne, R.L.; Kuchenbaecker, K.; Vaclova, T.; Pita, G.; Alonso, R.; Peterlongo, P.; Blanco, I.; Hoya, M. de la; Duran, M.; Diez, O.; Ramon, Y.C.T.; Konstantopoulou, I.; Martinez-Bouzas, C.; Conejero, R. Andres; Soucy, P.; McGuffog, L.; Barrowdale, D.; Lee, A.; Swe, B.; Arver, B.; Rantala, J.; Loman, N.; Ehrencrona, H.; Olopade, O.I.; Beattie, M.S.; Domchek, S.M.; Nathanson, K.; Rebbeck, T.R.; Arun, B.K.; Karlan, B.Y.; Walsh, C.; Lester, J.; John, E.M.; Whittemore, A.S.; Daly, M.B.; Southey, M.; Hopper, J.; Terry, M.B.; Buys, S.S.; Janavicius, R.; Dorfling, C.M.; Rensburg, E.J. van; Steele, L.; Neuhausen, S.L.; Ding, Y.C.; Hansen, T.V.; Jonson, L.; Ejlertsen, B.; Gerdes, A.M.; Infante, M.; Herraez, B.; Moreno, L.T.; Weitzel, J.N.; Herzog, J.; Weeman, K.; Manoukian, S.; Peissel, B.; Zaffaroni, D.; Scuvera, G.; Bonanni, B.; Mariette, F.; Volorio, S.; Viel, A.; Varesco, L.; Papi, L.; Ottini, L.; Tibiletti, M.G.; Radice, P.; Yannoukakos, D.; Garber, J.; Ellis, S.; Frost, D.; Platte, R.; Fineberg, E.; Evans, G.; Lalloo, F.; Izatt, L.; Eeles, R.; Adlard, J.; Davidson, R.; Cole, T.; Eccles, D.; Cook, J; Hodgson, S.; Brewer, C.; Tischkowitz, M.; Douglas, F.; Porteous, M.; Side, L.; Walker, L.; Morrison, P.; Donaldson, A.; Kennedy, J.; Foo, C.; Godwin, A.K.; Schmutzler, R.K.; Wappenschmidt, B.; Rhiem, K.; Engel, C.; Hoogerbrugge-van der Linden, N.; et al.,
2014-01-01
Single Nucleotide Polymorphisms (SNPs) in genes involved in the DNA Base Excision Repair (BER) pathway could be associated with cancer risk in carriers of mutations in the high-penetrance susceptibility genes BRCA1 and BRCA2, given the relation of synthetic lethality that exists between one of the
B-Raf mutation: a key player in molecular biology of cancer.
Rahman, M A; Salajegheh, A; Smith, R A; Lam, A K-Y
2013-12-01
B-Raf is one of the more commonly mutated proto-oncogenes implicated in the development of cancers. In this review, we consider the mechanisms and clinical impacts of B-Raf mutations in cancer and discuss the implications for the patient in melanoma, thyroid cancer and colorectal cancer, where B-Raf mutations are particularly common. © 2013.
Mutations and polymorphisms in TP53 gene--an overview on the role in colorectal cancer
Czech Academy of Sciences Publication Activity Database
Naccarati, Alessio; Poláková, Veronika; Pardini, Barbara; Vodičková, Ludmila; Hemminki, K.; Kumar, R.; Vodička, Pavel (ed.)
2012-01-01
Roč. 27, č. 2 (2012), s. 211-218 ISSN 0267-8357 R&D Projects: GA ČR GP305/09/P194; GA ČR GAP304/10/1286 Grant - others:GA UK(CZ) GA96908/B/2008 Institutional research plan: CEZ:AV0Z50390512 Keywords : TP53 mutations * TP53 polymorphisms * cancer risk Subject RIV: EB - Genetics ; Molecular Biology Impact factor: 3.500, year: 2012
Targeted cancer exome sequencing reveals recurrent mutations in myeloproliferative neoplasms
Tenedini, E; Bernardis, I; Artusi, V; Artuso, L; Roncaglia, E; Guglielmelli, P; Pieri, L; Bogani, C; Biamonte, F; Rotunno, G; Mannarelli, C; Bianchi, E; Pancrazzi, A; Fanelli, T; Malagoli Tagliazucchi, G; Ferrari, S; Manfredini, R; Vannucchi, A M; Tagliafico, E
2014-01-01
With the intent of dissecting the molecular complexity of Philadelphia-negative myeloproliferative neoplasms (MPN), we designed a target enrichment panel to explore, using next-generation sequencing (NGS), the mutational status of an extensive list of 2000 cancer-associated genes and microRNAs. The genomic DNA of granulocytes and in vitro-expanded CD3+T-lymphocytes, as a germline control, was target-enriched and sequenced in a learning cohort of 20 MPN patients using Roche 454 technology. We identified 141 genuine somatic mutations, most of which were not previously described. To test the frequency of the identified variants, a larger validation cohort of 189 MPN patients was additionally screened for these mutations using Ion Torrent AmpliSeq NGS. Excluding the genes already described in MPN, for 8 genes (SCRIB, MIR662, BARD1, TCF12, FAT4, DAP3, POLG and NRAS), we demonstrated a mutation frequency between 3 and 8%. We also found that mutations at codon 12 of NRAS (NRASG12V and NRASG12D) were significantly associated, for primary myelofibrosis (PMF), with highest dynamic international prognostic scoring system (DIPSS)-plus score categories. This association was then confirmed in 66 additional PMF patients composing a final dataset of 168 PMF showing a NRAS mutation frequency of 4.7%, which was associated with a worse outcome, as defined by the DIPSS plus score. PMID:24150215
Recurrently Mutated Genes Differ between Leptomeningeal and Solid Lung Cancer Brain Metastases.
Li, Yingmei; Liu, Boxiang; Connolly, Ian David; Kakusa, Bina Wasunga; Pan, Wenying; Nagpal, Seema; Montgomery, Stephen B; Hayden Gephart, Melanie
2018-03-29
When compared with solid brain metastases from NSCLC, leptomeningeal disease (LMD) has unique growth patterns and is rapidly fatal. Patients with LMD do not undergo surgical resection, limiting the tissue available for scientific research. In this study we performed whole exome sequencing on eight samples of LMD to identify somatic mutations and compared the results with those for 26 solid brain metastases. We found that taste 2 receptor member 31 gene (TAS2R31) and phosphodiesterase 4D interacting protein gene (PDE4DIP) were recurrently mutated among LMD samples, suggesting involvement in LMD progression. Together with a retrospective review of the charts of an additional 44 patients with NSCLC LMD, we discovered a surprisingly low number of KRAS mutations (n = 4 [7.7%]) but a high number of EGFR mutations (n = 33 [63.5%]). The median interval for development of LMD from NSCLC was shorter in patients with mutant EGFR (16.3 months) than in patients with wild-type EGFR (23.9 months) (p = 0.017). Targeted analysis of recurrent mutations thus presents a useful complement to the existing diagnostic tool kit, and correlations of EGFR in LMD and KRAS in solid metastases suggest that molecular distinctions or systemic treatment pressure underpin the differences in growth patterns within the brain. Copyright © 2018 International Association for the Study of Lung Cancer. Published by Elsevier Inc. All rights reserved.
Directory of Open Access Journals (Sweden)
Meagan B. Myers
2016-04-01
Full Text Available Mutant cancer subpopulations have the potential to derail durable patient responses to molecularly targeted cancer therapeutics, yet the prevalence and size of such subpopulations are largely unexplored. We employed the sensitive and quantitative Allele-specific Competitive Blocker PCR approach to characterize mutant cancer subpopulations in ductal carcinomas (DCs, examining five specific hotspot point mutations (PIK3CA H1047R, KRAS G12D, KRAS G12V, HRAS G12D, and BRAF V600E. As an approach to aid interpretation of the DC results, the mutations were also quantified in normal breast tissue. Overall, the mutations were prevalent in normal breast and DCs, with 9/9 DCs having measureable levels of at least three of the five mutations. HRAS G12D was significantly increased in DCs as compared to normal breast. The most frequent point mutation reported in DC by DNA sequencing, PIK3CA H1047R, was detected in all normal breast tissue and DC samples and was present at remarkably high levels (mutant fractions of 1.1 × 10−3 to 4.6 × 10−2 in 4/10 normal breast samples. In normal breast tissue samples, PIK3CA mutation levels were positively correlated with age. However, the PIK3CA H1047R mutant fraction distributions for normal breast tissues and DCs were similar. The results suggest PIK3CA H1047R mutant cells have a selective advantage in breast, contribute to breast cancer susceptibility, and drive tumor progression during breast carcinogenesis, even when present as only a subpopulation of tumor cells.
Directory of Open Access Journals (Sweden)
Ma B
2016-04-01
Full Text Available Ben Ma,1,2,* Rongliang Shi,1–3,* Shuwen Yang,1,2 Li Zhou,1,2 Ning Qu,1,2 Tian Liao,1,2 Yu Wang,1,2 Yulong Wang,1,2 Qinghai Ji1,2 1Department of Head and Neck Surgery, Fudan University Shanghai Cancer Center, 2Department of Oncology, Shanghai Medical College, 3Department of General Surgery, Fudan University, Minhang Hospital, Shanghai, People’s Republic of China *These authors contributed equally to this work Abstract: The study was performed to retrospectively analyze the correlation of dual specificity phosphatase 4 (DUSP4 expression with clinicopathological variables and BRAFV600E mutation to better characterize the potential role of DUSP4 as a biomarker in papillary thyroid cancer (PTC. Patients (n=120 who underwent surgery for PTC at Fudan University Shanghai Cancer Center (FUSCC were enrolled in this study, and a validation cohort from The Cancer Genome Atlas (TCGA database was identified to confirm the preliminary findings in our study. We investigated DUSP4 expression at the mRNA level in PTC tissues and adjacent normal tissues using real-time quantitative reverse transcription-polymerase chain reaction (qRT-PCR. BRAFV600E mutation analysis was also performed in PTC tissues using Sanger sequencing. Initially, we compared PTC tissues with paired normal tissues in DUSP4 expression using Student’s t-test, and then analyzed the correlation of DUSP4 with clinicopathological variables and BRAFV600E mutation in PTC using Mann–Whitney U, Kruskal–Wallis, χ2, and Fisher’s exact tests. Human-derived thyroid cell lines were also used to verify our findings. DUSP4 was significantly overexpressed in PTC tissues compared with the adjacent normal tissues (P<0.001. High DUSP4 expression showed a significant association with lymph node metastasis and extrathyroidal extension in both FUSCC and TCGA cohorts, and DUSP4 overexpression was an independent risk factor for lymph node metastasis in multivariate analysis. Additionally, DUSP4 expression
Replicative DNA polymerase mutations in cancer.
Heitzer, Ellen; Tomlinson, Ian
2014-02-01
Three DNA polymerases - Pol α, Pol δ and Pol ɛ - are essential for DNA replication. After initiation of DNA synthesis by Pol α, Pol δ or Pol ɛ take over on the lagging and leading strand respectively. Pol δ and Pol ɛ perform the bulk of replication with very high fidelity, which is ensured by Watson-Crick base pairing and 3'exonuclease (proofreading) activity. Yeast models have shown that mutations in the exonuclease domain of Pol δ and Pol ɛ homologues can cause a mutator phenotype. Recently, we identified germline exonuclease domain mutations (EDMs) in human POLD1 and POLE that predispose to 'polymerase proofreading associated polyposis' (PPAP), a disease characterised by multiple colorectal adenomas and carcinoma, with high penetrance and dominant inheritance. Moreover, somatic EDMs in POLE have also been found in sporadic colorectal and endometrial cancers. Tumors with EDMs are microsatellite stable and show an 'ultramutator' phenotype, with a dramatic increase in base substitutions. Copyright © 2014 The Authors. Published by Elsevier Ltd.. All rights reserved.
2010-07-01
... from such activity. Contingency Plan means a plan for action to be taken in emergency situations. Data... 30 Mineral Resources 2 2010-07-01 2010-07-01 false Definitions. 282.3 Section 282.3 Mineral... CONTINENTAL SHELF FOR MINERALS OTHER THAN OIL, GAS, AND SULPHUR General § 282.3 Definitions. When used in this...
Directory of Open Access Journals (Sweden)
Łukasz Kaczmarek
2015-03-01
Full Text Available Działalność przemysłowa wpływa bezpośrednio na środowisko. Przykładem tego jest wpływ ujęć wód podziemnych na warunki hydrogeologiczne. Kluczowym elementem tego zagadnienia jest wybór optymalnej lokalizacji projektowanego ujęcia. Przedstawiany artykuł opisuje wielokryterialną ocenę różnych wariantów lokalizacji ujęcia wód podziemnych. Woda z projektowanego ujęcia będzie dostarczana do oczyszczalni ścieków w Częstochowie do celów technologicznych. W celu zaprojektowania odpowiedniej studni głębinowej spełniającej określone wymagania przeprowadzono obliczenia analityczne m.in. promienia leja depresji i głębokości depresji, izochromy 25 lat oraz ustalono wytyczne dla projektu studni. Wykonano również wykres zwierciadła wód podziemnych podczas interakcji z ujęciem. Rezultatem wyżej wymienionych obliczeń było określenie zasięgu leja depresji oraz wybór wariantu budowy dwóch studni w ramach jednego ujęcia wód podziemnych. Dzięki wykonanej analizie zweryfikowano możliwości wspomagania procesu podejmowania szybkich i racjonalnych decyzji dla dużych obszarów, gdzie występuje wiele czynników wpływu na wydajność studni głębinowej.
Expression of estrogen receptor beta in the breast carcinoma of BRCA1 mutation carriers
International Nuclear Information System (INIS)
Litwiniuk, Maria M; Rożnowski, Krzysztof; Filas, Violetta; Godlewski, Dariusz D; Stawicka, Małgorzata; Kaleta, Remigiusz; Bręborowicz, Jan
2008-01-01
Breast cancers (BC) in women carrying mutations in BRCA1 gene are more frequently estrogen receptor negative than the nonhereditary BC. Nevertheless, tamoxifen has been found to have a protective effect in preventing contralateral tumors in BRCA1 mutation carriers. The identification of the second human estrogen receptor, ERβ, raised a question of its role in hereditary breast cancer. The aim of this study was to assess the frequency of ERα, ERβ, PgR (progesterone receptor) and HER-2 expression in breast cancer patients with mutated BRCA1 gene and in the control group. The study group consisted of 48 women with BRCA1 gene mutations confirmed by multiplex PCR assay. The patients were tested for three most common mutations of BRCA1 affecting the Polish population (5382insC, C61G, 4153delA). Immunostaining for ERα, ERβ and PgR (progesterone receptor) was performed using monoclonal antibodies against ERα, PgR (DakoCytomation), and polyclonal antibody against ERβ (Chemicon). The EnVision detection system was applied. The study population comprised a control group of 120 BC operated successively during the years 1998–99. The results of our investigation showed that BRCA1 mutation carriers were more likely to have ERα-negative breast cancer than those in the control group. Only 14.5% of BRCA1-related cancers were ERα-positive compared with 57.5% in the control group (P < 0.0001). On the contrary, the expression of ERβ protein was observed in 42% of BRCA1-related tumors and in 55% of the control group. An interesting finding was that most hereditary cancers (75% of the whole group) were triple-negative: ERα(-)/PgR(-)/HER-2(-) but almost half of this group (44.4%) showed the expression of ERβ. In the case of BRCA1-associated tumors the expression of ERβ was significantly higher than the expression of ERα. This may explain the effectiveness of tamoxifen in preventing contralateral breast cancer development in BRCA1 mutation carriers
Lifescience Database Archive (English)
Full Text Available SL (Link to library) SLH282 (Link to dictyBase) - - - Contig-U10985-1 | Contig-U15908-1 SLH2...82P (Link to Original site) SLH282F 506 SLH282Z 455 SLH282P 961 - - Show SLH282 Library SL (Link to library) Clone ID SLH2...85-1 | Contig-U15908-1 Original site URL http://dictycdb.biol.tsukuba.ac.jp/CSM/SL/SLH2-D/SLH2...82Q.Seq.d/ Representative seq. ID SLH282P (Link to Original site) Representative DNA sequence >SLH282 (SLH2...82Q) /CSM/SL/SLH2-D/SLH282Q.Seq.d/ GGTTTTTAAAACTATTGATACTGAAGAGAATGGAATTATATCAATAACACAATTAAGACA
Ancient genes establish stress-induced mutation as a hallmark of cancer.
Cisneros, Luis; Bussey, Kimberly J; Orr, Adam J; Miočević, Milica; Lineweaver, Charles H; Davies, Paul
2017-01-01
Cancer is sometimes depicted as a reversion to single cell behavior in cells adapted to live in a multicellular assembly. If this is the case, one would expect that mutation in cancer disrupts functional mechanisms that suppress cell-level traits detrimental to multicellularity. Such mechanisms should have evolved with or after the emergence of multicellularity. This leads to two related, but distinct hypotheses: 1) Somatic mutations in cancer will occur in genes that are younger than the emergence of multicellularity (1000 million years [MY]); and 2) genes that are frequently mutated in cancer and whose mutations are functionally important for the emergence of the cancer phenotype evolved within the past 1000 million years, and thus would exhibit an age distribution that is skewed to younger genes. In order to investigate these hypotheses we estimated the evolutionary ages of all human genes and then studied the probability of mutation and their biological function in relation to their age and genomic location for both normal germline and cancer contexts. We observed that under a model of uniform random mutation across the genome, controlled for gene size, genes less than 500 MY were more frequently mutated in both cases. Paradoxically, causal genes, defined in the COSMIC Cancer Gene Census, were depleted in this age group. When we used functional enrichment analysis to explain this unexpected result we discovered that COSMIC genes with recessive disease phenotypes were enriched for DNA repair and cell cycle control. The non-mutated genes in these pathways are orthologous to those underlying stress-induced mutation in bacteria, which results in the clustering of single nucleotide variations. COSMIC genes were less common in regions where the probability of observing mutational clusters is high, although they are approximately 2-fold more likely to harbor mutational clusters compared to other human genes. Our results suggest this ancient mutational response to
DEFF Research Database (Denmark)
Osorio, A.; Milne, R.L.; Pita, G.
2009-01-01
BACKGROUND: In this study we aimed to evaluate the role of a SNP in intron 1 of the ERCC4 gene (rs744154), previously reported to be associated with a reduced risk of breast cancer in the general population, as a breast cancer risk modifier in BRCA1 and BRCA2 mutation carriers. METHODS: We have...... genotyped rs744154 in 9408 BRCA1 and 5632 BRCA2 mutation carriers from the Consortium of Investigators of Modifiers of BRCA1/2 (CIMBA) and assessed its association with breast cancer risk using a retrospective weighted cohort approach. RESULTS: We found no evidence of association with breast cancer risk...... for BRCA1 (per-allele HR: 0.98, 95% CI: 0.93-1.04, P = 0.5) or BRCA2 (per-allele HR: 0.97, 95% CI: 0.89-1.06, P = 0.5) mutation carriers. CONCLUSION: This SNP is not a significant modifier of breast cancer risk for mutation carriers, though weak associations cannot be ruled out Udgivelsesdato: 2009/12/15...
Pre-45s rRNA promotes colon cancer and is associated with poor survival of CRC patients.
Tsoi, H; Lam, K C; Dong, Y; Zhang, X; Lee, C K; Zhang, J; Ng, S C; Ng, S S M; Zheng, S; Chen, Y; Fang, J; Yu, J
2017-11-02
One characteristic of cancer cells is the abnormally high rate of cell metabolism to sustain their enhanced proliferation. However, the behind mechanism of this phenomenon is still elusive. Here we find that enhanced precursor 45s ribosomal RNA (pre-45s rRNA) is one of the core mechanisms in promoting the pathogenesis of colorectal cancer (CRC). Pre-45s rRNA expression is significantly higher in primary CRC tumor tissues samples and cancer cell lines compared with the non-tumorous colon tissues, and is associated with tumor sizes. Knockdown of pre-45s rRNA inhibits G1/S cell-cycle transition by stabilizing p53 through inducing murine double minute 2 (MDM2) and ribosomal protein L11 (RpL11) interaction. In addition, we revealed that high rate of cancer cell metabolism triggers the passive release of calcium ion from endoplasmic reticulum to the cytoplasm. The elevated calcium ion in the cytoplasm activates the signaling cascade of calcium/calmodulin-dependent protein kinase II, ribosomal S6 kinase (S6K) and ribosomal S6K (CaMKII-S6K-UBF). The activated UBF promotes the transcription of rDNA, which therefore increases pre-45s rRNA. Disruption of CaMKII-S6K-UBF axis by either RNAi or pharmaceutical approaches leads to reduction of pre-45s rRNA expression, which subsequently suppresses cell proliferation in colon cancer cells by causing cell-cycle arrest. Knockdown of APC activates CaMKII-S6K-UBF cascade and thus enhances pre-45s rRNA expression. Moreover, the high expression level of pre-45s rRNA is associated with poor survival of CRC patients in two independent cohorts. Our study identifies a novel mechanism in CRC pathogenesis mediated by pre-45s rRNA and a prognostic factor of pre-45s rRNA in CRC patients.
Frequent alteration of MLL3 frameshift mutations in microsatellite deficient colorectal cancer.
Directory of Open Access Journals (Sweden)
Yoshiyuki Watanabe
Full Text Available MLL3 is a histone 3-lysine 4 methyltransferase with tumor-suppressor properties that belongs to a family of chromatin regulator genes potentially altered in neoplasia. Mutations in MLL3 were found in a whole genome analysis of colorectal cancer but have not been confirmed by a separate study.We analyzed mutations of coding region and promoter methylation in MLL3 using 126 cases of colorectal cancer. We found two isoforms of MLL3 and DNA sequencing revealed frameshift and other mutations affecting both isoforms of MLL3 in colorectal cancer cells and 19 of 134 (14% primary colorectal samples analyzed. Moreover, frameshift mutations were more common in cases with microsatellite instability (31% both in CRC cell lines and primary tumors. The largest isoform of MLL3 is transcribed from a CpG island-associated promoter that has highly homology with a pseudo-gene on chromosome 22 (psiTPTE22. Using an assay which measured both loci simultaneously we found prominent age related methylation in normal colon (from 21% in individuals less than 25 years old to 56% in individuals older than 70, R = 0.88, p<0.001 and frequent hypermethylation (83% in both CRC cell lines and primary tumors. We next studied the two loci separately and found that age and cancer related methylation was solely a property of the pseudogene CpG island and that the MLL3 loci was unmethylated.We found that frameshift mutations of MLL3 in both CRC cells and primary tumor that were more common in cases with microsatellite instability. Moreover, we have shown CpG island-associated promoter of MLL3 gene has no DNA methylation in CRC cells but also primary tumor and normal colon, and this region has a highly homologous of pseudo gene (psiTPTE22 that was age relate DNA methylation.
Hepp, Diego; Gonçalves, Gislene Lopes; de Freitas, Thales Renato Ochotorena
2015-01-01
The melanocortin 1 receptor (MC1R) is involved in the control of melanogenesis. Polymorphisms in this gene have been associated with variation in skin and hair color and with elevated risk for the development of melanoma. Here we used 11 computational tools based on different approaches to predict the damage-associated non-synonymous single nucleotide polymorphisms (nsSNPs) in the coding region of the human MC1R gene. Among the 92 nsSNPs arranged according to the predictions 62% were classified as damaging in more than five tools. The classification was significantly correlated with the scores of two consensus programs. Alleles associated with the red hair color (RHC) phenotype and with the risk of melanoma were examined. The R variants D84E, R142H, R151C, I155T, R160W and D294H were classified as damaging by the majority of the tools while the r variants V60L, V92M and R163Q have been predicted as neutral in most of the programs The combination of the prediction tools results in 14 nsSNPs indicated as the most damaging mutations in MC1R (L48P, R67W, H70Y, P72L, S83P, R151H, S172I, L206P, T242I, G255R, P256S, C273Y, C289R and R306H); C273Y showed to be highly damaging in SIFT, Polyphen-2, MutPred, PANTHER and PROVEAN scores. The computational analysis proved capable of identifying the potentially damaging nsSNPs in MC1R, which are candidates for further laboratory studies of the functional and pharmacological significance of the alterations in the receptor and the phenotypic outcomes.
Directory of Open Access Journals (Sweden)
Diego Hepp
Full Text Available The melanocortin 1 receptor (MC1R is involved in the control of melanogenesis. Polymorphisms in this gene have been associated with variation in skin and hair color and with elevated risk for the development of melanoma. Here we used 11 computational tools based on different approaches to predict the damage-associated non-synonymous single nucleotide polymorphisms (nsSNPs in the coding region of the human MC1R gene. Among the 92 nsSNPs arranged according to the predictions 62% were classified as damaging in more than five tools. The classification was significantly correlated with the scores of two consensus programs. Alleles associated with the red hair color (RHC phenotype and with the risk of melanoma were examined. The R variants D84E, R142H, R151C, I155T, R160W and D294H were classified as damaging by the majority of the tools while the r variants V60L, V92M and R163Q have been predicted as neutral in most of the programs The combination of the prediction tools results in 14 nsSNPs indicated as the most damaging mutations in MC1R (L48P, R67W, H70Y, P72L, S83P, R151H, S172I, L206P, T242I, G255R, P256S, C273Y, C289R and R306H; C273Y showed to be highly damaging in SIFT, Polyphen-2, MutPred, PANTHER and PROVEAN scores. The computational analysis proved capable of identifying the potentially damaging nsSNPs in MC1R, which are candidates for further laboratory studies of the functional and pharmacological significance of the alterations in the receptor and the phenotypic outcomes.
Novel genetic variants in miR-191 gene and familial ovarian cancer
International Nuclear Information System (INIS)
Shen, Jie; DiCioccio, Richard; Odunsi, Kunle; Lele, Shashikant B; Zhao, Hua
2010-01-01
Half of the familial aggregation of ovarian cancer can't be explained by any known risk genes, suggesting the existence of other genetic risk factors. Some of these unknown factors may not be traditional protein encoding genes. MicroRNA (miRNA) plays a critical role in tumorigenesis, but it is still unknown if variants in miRNA genes lead to predisposition to cancer. Considering the fact that miRNA regulates a number of tumor suppressor genes (TSGs) and oncogenes, genetic variations in miRNA genes could affect the levels of expression of TSGs or oncogenes and, thereby, cancer risk. To test this hypothesis in familial ovarian cancer, we screened for genetic variants in thirty selected miRNA genes, which are predicted to regulate key ovarian cancer genes and are reported to be misexpressed in ovarian tumor tissues, in eighty-three patients with familial ovarian cancer. All of the patients are non-carriers of any known BRCA1/2 or mismatch repair (MMR) gene mutations. Seven novel genetic variants were observed in four primary or precursor miRNA genes. Among them, three rare variants were found in the precursor or primary precursor of the miR-191 gene. In functional assays, the one variant located in the precursor of miR-191 resulted in conformational changes in the predicted secondary structures, and consequently altered the expression of mature miR-191. In further analysis, we found that this particular variant exists in five family members who had ovarian cancer. Our findings suggest that there are novel genetic variants in miRNA genes, and those certain genetic variants in miRNA genes can affect the expression of mature miRNAs and, consequently, might alter the regulation of TSGs or oncogenes. Additionally, the variant might be potentially associated with the development of familial ovarian cancer
DEFF Research Database (Denmark)
Blanco, Ignacio; Kuchenbaecker, Karoline; Cuadras, Daniel
2015-01-01
While interplay between BRCA1 and AURKA-RHAMM-TPX2-TUBG1 regulates mammary epithelial polarization, common genetic variation in HMMR (gene product RHAMM) may be associated with risk of breast cancer in BRCA1 mutation carriers. Following on these observations, we further assessed the link between ...
Akutsu, Yuko; Shirai, Kentaro; Takei, Akira; Goto, Yudai; Aoyama, Tomohiro; Watanabe, Akimitu; Imamura, Masatoshi; Enokizono, Takashi; Ohto, Tatsuyuki; Hori, Tetsuo; Suzuki, Keiko; Hayashi, Masaharu; Masumoto, Kouji; Inoue, Ken
2018-05-01
In this report, we present the case of a female infant with peripheral demyelinating neuropathy, central dysmyelinating leukodystrophy, Waardenburg syndrome, and Hirschsprung disease (PCWH) associated with a novel frameshift mutation (c.842dupT) in exon 5, the last exon of SOX10. She had severe hypoganglionosis in the small intestine and entire colon, and suffered from frequent enterocolitis. The persistence of ganglion cells made both the diagnosis and treatment difficult in the neonatal period. She also showed hypopigmentation of the irises, hair and skin, bilateral sensorineural deafness with hypoplastic inner year, severe demyelinating neuropathy with hypotonia, and diffuse brain hypomyelination. The p.Ser282GlnfsTer12 mutation presumably escapes from nonsense-mediated decay and may generate a dominant-negative effect. We suggest that hypoganglionosis can be a variant intestinal manifestation associated with PCWH and that hypoganglionosis and aganglionosis may share the same pathoetiological mechanism mediated by SOX10 mutations. © 2018 Wiley Periodicals, Inc.
DEFF Research Database (Denmark)
Jönsson, Mats; Ekstrand, Anna; Edekling, Thomas
2009-01-01
. METHODS: We used a real-time PCR based method to determine KRAS mutations in 136 colorectal cancers with mutations identified in 53 (39%) tumors. RESULTS: KRAS mutations were significantly more often found in rectal cancer (21/38, 55%) than in colon cancer (32/98, 33%) (P = 0.02). This finding...... was explained by marked differences mutation rates in female patients who showed mutations in 33% of the colon cancers and in 67% of the rectal cancers (P = 0.01). Concurrent KRAS mutations were identified in three tumors; two colorectal cancers harbored Gly12Asp/Gly13Asp and Gly12Cys/Gly13Asp and a third tumor...... carried Gly12Cys/Gly12Asp in an adenomatous component and additionally acquired Gly12Val in the invasive component. CONCLUSION: The demonstration of a particularly high KRAS mutation frequency among female rectal cancer patients suggests that this subset is the least likely to respond to anti...
Kohonen-Corish, Maija R J; Tseung, Jason; Chan, Charles; Currey, Nicola; Dent, Owen F; Clarke, Stephen; Bokey, Les; Chapuis, Pierre H
2014-06-15
Colonic and rectal cancers differ in their clinicopathologic features and treatment strategies. Molecular markers such as gene methylation, microsatellite instability and KRAS mutations, are becoming increasingly important in guiding treatment decisions in colorectal cancer. However, their association with clinicopathologic variables and utility in the management of rectal cancer is still poorly understood. We analyzed CDKN2A gene methylation, CpG island methylator phenotype (CIMP), microsatellite instability and KRAS/BRAF mutations in a cohort of 381 rectal cancers with extensive clinical follow-up data. BRAF mutations (2%), CIMP-high (4%) and microsatellite instability-high (2%) were rare, whereas KRAS mutations (39%), CDKN2A methylation (20%) and CIMP-low (25%) were more common. Only CDKN2A methylation and KRAS mutations showed an association with poor overall survival but these did not remain significant when analyzed with other clinicopathologic factors. In contrast, this prognostic effect was strengthened by the joint presence of CDKN2A methylation and KRAS mutations, which independently predicted recurrence of cancer and was associated with poor overall and cancer-specific survival. This study has identified a subgroup of more aggressive rectal cancers that may arise through the KRAS-p16 pathway. It has been previously shown that an interaction of p16 deficiency and oncogenic KRAS promotes carcinogenesis in the mouse and is characterized by loss of oncogene-induced senescence. These findings may provide avenues for the discovery of new treatments in rectal cancer. © 2013 UICC.
2018-04-25
EGFR Activating Mutation; EGFR Exon 19 Deletion Mutation; EGFR NP_005219.2:p.G719X; EGFR NP_005219.2:p.L858R; EGFR NP_005219.2:p.L861Q; EGFR T790M Mutation Negative; Recurrent Non-Small Cell Lung Carcinoma; Stage III Non-Small Cell Lung Cancer AJCC v7; Stage IIIA Non-Small Cell Lung Cancer AJCC v7; Stage IIIB Non-Small Cell Lung Cancer AJCC v7; Stage IV Non-Small Cell Lung Cancer AJCC v7
Warne, Charles D; Zaloumis, Sophie G; Bertalli, Nadine A; Delatycki, Martin B; Nicoll, Amanda J; McLaren, Christine E; Hopper, John L; Giles, Graham G; Anderson, Greg J; Olynyk, John K; Powell, Lawrie W; Allen, Katrina J; Gurrin, Lyle C
2017-04-01
Women who are homozygous for the p.C282Y mutation in the HFE gene are at much lower risk of iron overload-related disease than p.C282Y homozygous men, presumably because of the iron-depleting effects of menstruation and pregnancy. We used data from a population cohort study to model the impact of menstruation cessation at menopause on serum ferritin (SF) levels in female p.C282Y homozygotes, with p.C282Y/p.H63D simple or compound heterozygotes and those with neither p.C282Y nor p.H63D mutations (HFE wild types) as comparison groups. A sample of the Melbourne Collaborative Cohort Study was selected for the "HealthIron" study (n = 1438) including all HFE p.C282Y homozygotes plus a random sample stratified by HFE-genotype (p.C282Y and p.H63D). The relationship between the natural logarithm of SF and time since menopause was examined using linear mixed models incorporating spline smoothing. For p.C282Y homozygotes, SF increased by a factor of 3.6 (95% CI (1.8, 7.0), P HFE genotype groups increase more gradually and did not show a distinction between premenopausal and postmenopausal SF levels. Only p.C282Y homozygotes had predicted SF exceeding 200 μg/L postmenopause, but the projected SF did not increase the risk of iron overload-related disease. These data provide the first documented evidence that physiological blood loss is a major factor in determining the marked gender difference in expression of p.C282Y homozygosity. © 2016 Journal of Gastroenterology and Hepatology Foundation and John Wiley & Sons Australia, Ltd.
Statistical method on nonrandom clustering with application to somatic mutations in cancer
Directory of Open Access Journals (Sweden)
Rejto Paul A
2010-01-01
Full Text Available Abstract Background Human cancer is caused by the accumulation of tumor-specific mutations in oncogenes and tumor suppressors that confer a selective growth advantage to cells. As a consequence of genomic instability and high levels of proliferation, many passenger mutations that do not contribute to the cancer phenotype arise alongside mutations that drive oncogenesis. While several approaches have been developed to separate driver mutations from passengers, few approaches can specifically identify activating driver mutations in oncogenes, which are more amenable for pharmacological intervention. Results We propose a new statistical method for detecting activating mutations in cancer by identifying nonrandom clusters of amino acid mutations in protein sequences. A probability model is derived using order statistics assuming that the location of amino acid mutations on a protein follows a uniform distribution. Our statistical measure is the differences between pair-wise order statistics, which is equivalent to the size of an amino acid mutation cluster, and the probabilities are derived from exact and approximate distributions of the statistical measure. Using data in the Catalog of Somatic Mutations in Cancer (COSMIC database, we have demonstrated that our method detects well-known clusters of activating mutations in KRAS, BRAF, PI3K, and β-catenin. The method can also identify new cancer targets as well as gain-of-function mutations in tumor suppressors. Conclusions Our proposed method is useful to discover activating driver mutations in cancer by identifying nonrandom clusters of somatic amino acid mutations in protein sequences.
Structural, Dynamical, and Energetical Consequences of Rett Syndrome Mutation R133C in MeCP2
Directory of Open Access Journals (Sweden)
Tugba G. Kucukkal
2015-01-01
Full Text Available Rett Syndrome (RTT is a progressive neurodevelopmental disease affecting females. RTT is caused by mutations in the MECP2 gene and various amino acid substitutions have been identified clinically in different domains of the multifunctional MeCP2 protein encoded by this gene. The R133C variant in the methylated-CpG-binding domain (MBD of MeCP2 is the second most common disease-causing mutation in the MBD. Comparative molecular dynamics simulations of R133C mutant and wild-type MBD have been performed to understand the impact of the mutation on structure, dynamics, and interactions of the protein and subsequently understand the disease mechanism. Two salt bridges within the protein and two critical hydrogen bonds between the protein and DNA are lost upon the R133C mutation. The mutation was found to weaken the interaction with DNA and also cause loss of helicity within the 141-144 region. The structural, dynamical, and energetical consequences of R133C mutation were investigated in detail at the atomic resolution. Several important implications of this have been shown regarding protein stability and hydration dynamics as well as its interaction with DNA. The results are in agreement with previous experimental studies and further provide atomic level understanding of the molecular origin of RTT associated with R133C variant.
AURKA F31I Polymorphism and Breast Cancer Risk in BRCA1 and BRCA2 Mutation Carriers: A CIMBA study
Couch, Fergus J.; Sinilnikova, Olga; Vierkant, Robert A; Pankratz, V. Shane; Fredericksen, Zachary S.; Stoppa-Lyonnet, Dominique; Coupier, Isabelle; Hughes, David; Hardouin, Agnès; Berthet, Pascaline; Peock, Susan; Cook, Margaret; Baynes, Caroline; Hodgson, Shirley; Morrison, Patrick J.; Porteous, Mary E.; Jakubowska, Anna; Lubinski, Jan; Gronwald, Jacek; Spurdle, Amanda B.; Schmutzler, Rita; Versmold, Beatrix; Engel, Christoph; Meindl, Alfons; Sutter, Christian; Horst, Jurgen; Schaefer, Dieter; Offit, Kenneth; Kirchhoff, Tomas; Andrulis, Irene L.; Ilyushik, Eduard; Glendon, Gordon; Devilee, Peter; Vreeswijk, Maaike P.G.; Vasen, Hans F.A.; Borg, Ake; Backenhorn, Katja; Struewing, Jeffery P.; Greene, Mark H.; Neuhausen, Susan L.; Rebbeck, Timothy R.; Nathanson, Katherine; Domchek, Susan; Wagner, Theresa; Garber, Judy E.; Szabo, Csilla; Zikan, Michal; Foretova, Lenka; Olson, Janet E.; Sellers, Thomas A.; Lindor, Noralane; Nevanlinna, Heli; Tommiska, Johanna; Aittomaki, Kristiina; Hamann, Ute; Rashid, Muhammad U.; Torres, Diana; Simard, Jacques; Durocher, Francine; Guenard, Frederic; Lynch, Henry T.; Isaacs, Claudine; Weitzel, Jeffrey; Olopade, Olufunmilayo I.; Narod, Steven; Daly, Mary B.; Godwin, Andrew K.; Tomlinson, Gail; Easton, Douglas F.; Chenevix-Trench, Georgia; Antoniouon, Antonis C.
2009-01-01
The AURKA oncogene is associated with abnormal chromosome segregation and aneuploidy and predisposition to cancer. Amplification of AURKA has been detected at higher frequency in tumors from BRCA1 and BRCA2 mutation carriers than in sporadic breast tumors, suggesting that overexpression of AURKA and inactivation of BRCA1 and BRCA2 co-operate during tumor development and progression. The F31I polymorphism in AURKA has been associated with breast cancer risk in the homozygous state in prior studies. We evaluated whether the AURKA F31I polymorphism modifies breast cancer risk in BRCA1 and BRCA2 mutation carriers from the Consortium of Investigators of Modifiers of BRCA1/2 (CIMBA). CIMBA was established to provide sufficient statistical power through increased numbers of mutation carriers to identify polymorphisms that act as modifiers of cancer risk and can refine breast cancer risk estimates in BRCA1 and BRCA2 mutation carriers. A total of 4935 BRCA1 and 2241 BRCA2 mutation carriers and 11 individuals carrying both BRCA1 and BRCA2 mutations were genotyped for F31I. Overall, homozygosity for the 31I allele was not significantly associated with breast cancer risk in BRCA1 and BRCA2 carriers combined (HR = 0.91; 95% CI 0.77-1.06). Similarly, no significant association was seen in BRCA1 (HR = 0.90; 95% CI 0.75-1.08) or BRCA2 carriers (HR = 0.93; 95% CI 0.67-1.29) or when assessing the modifying effects of either bilateral prophylactic oophorectomy or menopausal status of BRCA1 and BRCA2 carriers. In summary, the F31I polymorphism in AURKA is not associated with a modified risk of breast cancer in BRCA1 and BRCA2 carriers. PMID:17627006
Vos, Janet R; Teixeira, Natalia; van der Kolk, Dorina M; Mourits, Marian J E; Rookus, Matti A; van Leeuwen, Flora E; Collée, Margriet; van Asperen, Christi J; Mensenkamp, Arjen R; Ausems, Margreet G E M; van Os, Theo A M; Meijers-Heijboer, Hanne E J; Gómez-Garcia, Encarna B; Vasen, Hans F; Brohet, Richard M; van der Hout, Annemarie H; Jansen, Liesbeth; Oosterwijk, Jan C; de Bock, Geertruida H
2014-11-01
We aimed to quantify previously observed relatively high cancer risks in BRCA2 mutation carriers (BRCA2 carriers) older than 60 in the Northern Netherlands, and to analyze whether these could be explained by mutation spectrum or population background risk. This consecutive cohort study included all known pathogenic BRCA1/2 carriers in the Northern Netherlands (N = 1,050). Carrier and general reference populations were: BRCA1/2 carriers in the rest of the Netherlands (N = 2,013) and the general population in both regions. Regional differences were assessed with HRs and ORs. HRs were adjusted for birth year and mutation spectrum. All BRCA1 carriers and BRCA2 carriers younger than 60 had a significantly lower breast cancer risk in the Northern Netherlands; HRs were 0.66 and 0.64, respectively. Above age 60, the breast cancer risk in BRCA2 carriers in the Northern Netherlands was higher than in the rest of the Netherlands [HR, 3.99; 95% confidence interval (CI), 1.11-14.35]. Adjustment for mutational spectrum changed the HRs for BRCA1, BRCA2 <60, and BRCA2 ≥60 years by -3%, +32%, and +11% to 0.75, 0.50, and 2.61, respectively. There was no difference in background breast cancer incidence between the two regions (OR, 1.03; 95% CI, 0.97-1.09). Differences in mutation spectrum only partly explain the regional differences in breast cancer risk in BRCA2 carriers, and for an even smaller part in BRCA1 carriers. The increased risk in BRCA2 carriers older than 60 may warrant extension of intensive breast screening beyond age 60. ©2014 American Association for Cancer Research.
DEFF Research Database (Denmark)
Lecarpentier, Julie; Silvestri, Valentina; Kuchenbaecker, Karoline B.
2017-01-01
Purpose BRCA1/2 mutations increase the risk of breast and prostate cancer in men. Common genetic variants modify cancer risks for female carriers of BRCA1/2 mutations. We investigated-for the first time to our knowledge-associations of common genetic variants with breast and prostate cancer risks...
Measurement of genome changes of greenable albino mutation line c.v. W25
International Nuclear Information System (INIS)
Wu Dianxing; Xia Yingwu; Shu Qingyao; Zhang Yaozhou; Liu Guifu
1997-01-01
W25 was a greenable albino mutation line, which was derived from a temperature-sensitive genic male sterile rice 2177s, with 300 Gy gamma rays irradiation. During the whole growth duration, the leaves of W25 showed the following characters: white, greenism, albinism and greenism again. 70 primers were used for the detection of polymorphism, one of them gave polymorphic products. RAPD analysis of W25 and 2177s with random primer H05 indicated that there were two DNA bands differences
Energy Technology Data Exchange (ETDEWEB)
Tanguay, R.M.; St-Louis, M.; Gibson, K. [Universite Laval, Ste-Foy (Canada)] [and others
1994-09-01
Hereditary tyrosinemia type I (HT I; McKusick 276700) is a severe inborn error of tyrosine catabolism pathway caused by a deficiency of fumarylacetoacetate hydrolase (FAH). The highest frequency reported is the one in Saguenay-Lac St-Jean (Quebec, Canada) where 1:1,846 births are affected. The FAH gene has been cloned and several mutations have been described. Allele specific oligonucleotide (ASO) hybridization was used to examine the frequency of a splice (IVS12-5G{r_arrow}A) mutation recently reported and RFLP analysis was done to identify haplotypes related to HT I. The splice mutation was found on 45/50 alleles (90%) in patients from SLSJ and 12/66 (18%) alleles from patients world-wide. All 25 patients from the SLSJ region were positive with 20 being homozygous, indicating that this mutation is the major cause of HT I in French Canada. Of these 25 patients, 96% were positive for one haplotype called no 6 which is these 25 patients, 96% were positive for one haplotype called no 6 which is identified by TaqI, RsaI, BglII, MspI and KpnI digestions. These data show a really strong association between the mutation (IVS12+5G{r_arrow}A) and haplotype 6. Among our patients from around the world, {approximately}52% were positive for haplotype 6 indicating its strong relation with HT I. These results provide the rationale for DNA-based carrier testing for HT I in the F-C population at risk as well as in HT I patients in general.
Li, Bei-Bei; Shen, Jian-Zhong; Cao, Xing-Yuan; Wang, Yang; Dai, Lei; Huang, Si-Yang; Wu, Cong-Ming
2010-07-01
Mycoplasma gallisepticum is a major etiological agent of chronic respiratory disease (CRD) in chickens and sinusitis in turkeys. The pleuromutilin antibiotics tiamulin and valnemulin are currently used in the treatment of M. gallisepticum infection. We studied the in vitro development of pleuromutilin resistance in M. gallisepticum and investigated the molecular mechanisms involved in this process. Pleuromutilin-resistant mutants were selected by serial passages of M. gallisepticum strains PG31 and S6 in broth medium containing subinhibitory concentrations of tiamulin or valnemulin. A portion of the gene encoding 23S rRNA gene (domain V) and the gene encoding ribosome protein L3 were amplified and sequenced. No mutation could be detected in ribosome protein L3. Mutations were found at nucleotide positions 2058, 2059, 2061, 2447 and 2503 of 23S rRNA gene (Escherichia coli numbering). Although a single mutation could cause elevation of tiamulin and valnemulin MICs, combinations of two or three mutations were necessary to produce high-level resistance. All the mutants were cross-resistant to lincomycin, chloramphenicol and florfenicol. Mutants with the A2058G or the A2059G mutation exhibited cross-resistance to macrolide antibiotics erythromycin, tilmicosin and tylosin.
Mon, Sann Y; Riedlinger, Gregory; Abbott, Collette E; Seethala, Raja; Ohori, N Paul; Nikiforova, Marina N; Nikiforov, Yuri E; Hodak, Steven P
2018-05-01
Thyroid-stimulating hormone receptor (TSHR) gene mutations play a critical role in thyroid cell proliferation and function. They are found in 20%-82% of hyperfunctioning nodules, hyperfunctioning follicular thyroid cancers (FTC), and papillary thyroid cancers (PTC). The diagnostic importance of TSHR mutation testing in fine needle aspiration (FNA) specimens remains unstudied. To examine the association of TSHR mutations with the functional status and surgical outcomes of thyroid nodules, we evaluated 703 consecutive thyroid FNA samples with indeterminate cytology for TSHR mutations using next-generation sequencing. Testing for EZH1 mutations was performed in selected cases. The molecular diagnostic testing was done as part of standard of care treatment, and did not require informed consent. TSHR mutations were detected in 31 (4.4%) nodules and were located in exons 281-640, with codon 486 being the most common. Allelic frequency ranged from 3% to 45%. Of 16 cases (12 benign, 3 FTC, 1 PTC) with surgical correlation, 15 had solitary TSHR mutations and 1 PTC had comutation with BRAF V600E. Hyperthyroidism was confirmed in all 3 FTC (2 overt, 1 subclinical). Of 5 nodules with solitary TSHR mutations detected at high allelic frequency, 3 (60%) were FTC. Those at low allelic frequency (3%-22%) were benign. EZH1 mutations were detected in 2 of 4 TSHR-mutant malignant nodules and neither of 2 benign nodules. We report that TSHR mutations occur in ∼5% thyroid nodules in a large consecutive series with indeterminate cytology. TSHR mutations may be associated with an increased cancer risk when present at high allelic frequency, even when the nodule is hyperfunctioning. Benign nodules were however most strongly correlated with TSHR mutations at low allelic frequency. © 2018 Wiley Periodicals, Inc.
International Nuclear Information System (INIS)
Li, Weina; He, Fei
2014-01-01
Highlights: • Expression of MMD is increased in lung cancer tissues. • Knockdown of MMD inhibits growth of A549 and LLC cells in vitro and in vivo. • MMD is a direct functional target of miR-140-5p. • MiR-140-5p/MMD axis regulates Erk1/2 signaling. - Abstract: Monocyte to macrophage differentiation-associated (MMD) is identified in macrophages as a gene associated with the differentiation from monocytes to macrophages. Recent microarray analysis for non-small cell lung cancer (NSCLC) suggests that MMD is an important signature associated with relapse and survival among patients with NSCLC. Therefore, we speculate that MMD likely plays a role in lung cancer. In this study, we found that the protein level of MMD was increased in lung cancer compared to benign lung tissues, and knockdown of MMD inhibited the growth of A549 and Lewis lung cancer cells (LLC) in vitro and in vivo. Integrated analysis demonstrated that MMD was a direct functional target of miR-140-5p. Furthermore, we found that miR-140-5p/MMD axis could affect the cell proliferation of lung cancer cells by regulating Erk signaling. Together, our results highlight the significance of miR-140-5p/MMD axis in lung cancer, and miR-140-5p/MMD axis could serve as new molecular targets for the therapy against lung cancer
Blanco, Ignacio; Kuchenbaecker, Karoline; Cuadras, Daniel; Wang, Xianshu; Barrowdale, Daniel; Ruiz de Garibay, Gorka; Librado, Pablo; Sanchez-Gracia, Alejandro; Rozas, Julio; Bonifaci, Nuria; McGuffog, Lesley; Pankratz, Vernon S.; Islam, Abul; Mateo, Francesca; Berenguer, Antoni; Petit, Anna; Catala, Isabel; Brunet, Joan; Feliubadalo, Lidia; Tornero, Eva; Benitez, Javier; Osorio, Ana; Cajal, Teresa Ramon Y.; Nevanlinna, Heli; Aittomaki, Kristiina; Arun, Banu K.; Toland, Amanda E.; Karlan, Beth Y.; Walsh, Christine; Lester, Jenny; Greene, Mark H.; Mai, Phuong L.; Nussbaum, Robert L.; Andrulis, Irene L.; Domchek, Susan M.; Nathanson, Katherine L.; Rebbeck, Timothy R.; Barkardottir, Rosa B.; Jakubowska, Anna; Lubinski, Jan; Durda, Katarzyna; Jaworska-Bieniek, Katarzyna; Claes, Kathleen; Van Maerken, Tom; Diez, Orland; Hansen, Thomas V.; Jonson, Lars; Gerdes, Anne-Marie; Ejlertsen, Bent; de la Hoya, Miguel; Caldes, Trinidad; Dunning, Alison M.; Oliver, Clare; Fineberg, Elena; Cook, Margaret; Peock, Susan; McCann, Emma; Murray, Alex; Jacobs, Chris; Pichert, Gabriella; Lalloo, Fiona; Chu, Carol; Dorkins, Huw; Paterson, Joan; Ong, Kai-Ren; Teixeira, Manuel R.; Teixeira, M.R.; Hogervorst, Frans B. L.; van der Hout, Annemarie H.; Seynaeve, Caroline; van der Luijt, Rob B.; Ligtenberg, Marjolijn J. L.; Devilee, Peter; Wijnen, Juul T.; Rookus, Matti A.; Meijers-Heijboer, Hanne E. J.; Blok, Marinus J.; van den Ouweland, Ans M. W.; Aalfs, Cora M.; Rodriguez, Gustavo C.; Phillips, Kelly-Anne A.; Piedmonte, Marion; Nerenstone, Stacy R.; Bae-Jump, Victoria L.; O'Malley, David M.; Ratner, Elena S.; Schmutzler, Rita K.; Wappenschmidt, Barbara; Rhiem, Kerstin; Engel, Christoph; Meindl, Alfons; Ditsch, Nina; Arnold, Norbert; Plendl, Hansjoerg J.; Niederacher, Dieter; Sutter, Christian; Wang-Gohrke, Shan; Steinemann, Doris; Preisler-Adams, Sabine; Kast, Karin; Varon-Mateeva, Raymonda; Gehrig, Andrea; Bojesen, Anders; Pedersen, Inge Sokilde; Sunde, Lone; Jensen, Uffe Birk; Thomassen, Mads; Kruse, Torben A.; Foretova, Lenka; Peterlongo, Paolo; Bernard, Loris; Peissel, Bernard; Scuvera, Giulietta; Manoukian, Siranoush; Radice, Paolo; Ottini, Laura; Montagna, Marco; Agata, Simona; Maugard, Christine; Simard, Jacques; Soucy, Penny; Berger, Andreas; Fink-Retter, Anneliese; Singer, Christian F.; Rappaport, Christine; Geschwantler-Kaulich, Daphne; Tea, Muy-Kheng; Pfeiler, Georg; John, Esther M.; Miron, Alex; Neuhausen, Susan L.; Terry, Mary Beth; Chung, Wendy K.; Daly, Mary B.; Goldgar, David E.; Janavicius, Ramunas; Dorfling, Cecilia M.; van Rensburg, Elisabeth J.; Fostira, Florentia; Konstantopoulou, Irene; Garber, Judy; Godwin, Andrew K.; Olah, Edith; Narod, Steven A.; Rennert, Gad; Paluch, Shani Shimon; Laitman, Yael; Friedman, Eitan; Liljegren, Annelie; Rantala, Johanna; Stenmark-Askmalm, Marie; Loman, Niklas; Imyanitov, Evgeny N.; Hamann, Ute; Spurdle, Amanda B.; Healey, Sue; Weitzel, Jeffrey N.; Herzog, Josef; Margileth, David; Gorrini, Chiara; Esteller, Manel; Gomez, Antonio; Sayols, Sergi; Vidal, Enrique; Heyn, Holger; Stoppa-Lyonnet, Dominique; Leone, Melanie; Barjhoux, Laure; Fassy-Colcombet, Marion; de Pauw, Antoine; Lasset, Christine; Ferrer, Sandra Fert; Castera, Laurent; Berthet, Pascaline; Cornelis, Francois; Bignon, Yves-Jean; Damiola, Francesca; Mazoyer, Sylvie; Sinilnikova, Olga M.; Maxwell, Christopher A.; Vijai, Joseph; Robson, Mark; Kauff, Noah; Corines, Marina J.; Villano, Danylko; Cunningham, Julie; Lee, Adam; Lindor, Noralane; Lazaro, Conxi; Easton, Douglas F.; Offit, Kenneth; Chenevix-Trench, Georgia; Couch, Fergus J.; Antoniou, Antonis C.; Angel Pujana, Miguel
2015-01-01
While interplay between BRCA1 and AURKA-RHAMM-TPX2-TUBG1 regulates mammary epithelial polarization, common genetic variation in HMMR (gene product RHAMM) may be associated with risk of breast cancer in BRCA1 mutation carriers. Following on these observations, we further assessed the link between the
An integrative genomic and proteomic analysis of PIK3CA, PTEN and AKT mutations in breast cancer
Energy Technology Data Exchange (ETDEWEB)
Stemke-Hale, Katherine; Gonzalez-Angulo, Ana Maria; Lluch, Ana; Neve, Richard M.; Kuo, Wen-Lin; Davies, Michael; Carey, Mark; Hu, Zhi; Guan, Yinghui; Sahin, Aysegul; Symmans, W. Fraser; Pusztai, Lajos; Nolden, Laura K.; Horlings, Hugo; Berns, Katrien; Hung, Mien-Chie; van de Vijver, Marc J.; Valero, Vicente; Gray, Joe W.; Bernards, Rene; Mills, Gordon B.; Hennessy, Bryan T.
2008-05-06
Phosphatidylinositol-3-kinase (PI3K)/AKT pathway aberrations are common in cancer. By applying mass spectroscopy-based sequencing and reverse phase protein arrays to 547 human breast cancers and 41 cell lines, we determined the subtype specificity and signaling effects of PIK3CA, AKT and PTEN mutations, and the effects of PIK3CA mutations on responsiveness to PI3K inhibition in-vitro and on outcome after adjuvant tamoxifen. PIK3CA mutations were more common in hormone receptor positive (33.8%) and HER2-positive (24.6%) than in basal-like tumors (8.3%). AKT1 (1.4%) and PTEN (2.3%) mutations were restricted to hormone receptor-positive cancers with PTEN protein levels also being significantly lower in hormone receptor-positive cancers. Unlike AKT1 mutations, PIK3CA (39%) and PTEN (20%) mutations were more common in cell lines than tumors, suggesting a selection for these but not AKT1 mutations during adaptation to culture. PIK3CA mutations did not have a significant impact on outcome in 166 hormone receptor-positive breast cancer patients after adjuvant tamoxifen. PIK3CA mutations, in comparison with PTEN loss and AKT1 mutations, were associated with significantly less and indeed inconsistent activation of AKT and of downstream PI3K/AKT signaling in tumors and cell lines, and PTEN loss and PIK3CA mutation were frequently concordant, suggesting different contributions to pathophysiology. PTEN loss but not PIK3CA mutations rendered cells sensitive to growth inhibition by the PI3K inhibitor LY294002. Thus, PI3K pathway aberrations likely play a distinct role in the pathogenesis of different breast cancer subtypes. The specific aberration may have implications for the selection of PI3K-targeted therapies in hormone receptor-positive breast cancer.
Ardin, Maude; Cahais, Vincent; Castells, Xavier; Bouaoun, Liacine; Byrnes, Graham; Herceg, Zdenko; Zavadil, Jiri; Olivier, Magali
2016-04-18
The nature of somatic mutations observed in human tumors at single gene or genome-wide levels can reveal information on past carcinogenic exposures and mutational processes contributing to tumor development. While large amounts of sequencing data are being generated, the associated analysis and interpretation of mutation patterns that may reveal clues about the natural history of cancer present complex and challenging tasks that require advanced bioinformatics skills. To make such analyses accessible to a wider community of researchers with no programming expertise, we have developed within the web-based user-friendly platform Galaxy a first-of-its-kind package called MutSpec. MutSpec includes a set of tools that perform variant annotation and use advanced statistics for the identification of mutation signatures present in cancer genomes and for comparing the obtained signatures with those published in the COSMIC database and other sources. MutSpec offers an accessible framework for building reproducible analysis pipelines, integrating existing methods and scripts developed in-house with publicly available R packages. MutSpec may be used to analyse data from whole-exome, whole-genome or targeted sequencing experiments performed on human or mouse genomes. Results are provided in various formats including rich graphical outputs. An example is presented to illustrate the package functionalities, the straightforward workflow analysis and the richness of the statistics and publication-grade graphics produced by the tool. MutSpec offers an easy-to-use graphical interface embedded in the popular Galaxy platform that can be used by researchers with limited programming or bioinformatics expertise to analyse mutation signatures present in cancer genomes. MutSpec can thus effectively assist in the discovery of complex mutational processes resulting from exogenous and endogenous carcinogenic insults.
International Nuclear Information System (INIS)
Schee, Kristina; Boye, Kjetil; Abrahamsen, Torveig Weum; Fodstad, Øystein; Flatmark, Kjersti
2012-01-01
MicroRNAs (miRNAs) regulate gene expression by binding to mRNA, and can function as oncogenes or tumor suppressors depending on the target. In this study, using qRT-PCR, we examined the expression of six miRNAs (miR-21, miR-31, miR-92a, miR-101, miR-106a and miR-145) in tumors from 193 prospectively recruited patients with colorectal cancer, and associations with clinicopathological parameters and patient outcome were analyzed. The miRNAs were chosen based on previous studies for their biomarker potential and suggested biological relevance in colorectal cancer. The miRNA expression was examined by qRT-PCR. Associations between miRNA expression and clinicopathological variables were explored using Mann–Whitney U and Kruskal-Wallis test while survival was estimated using the Kaplan-Meier method and compared using the log-rank test. MiR-101 was hardly expressed in the tumor samples, while for the other miRNAs, variable expression levels and expression ranges were observed, with miR-21 being most abundantly expressed relative to the reference (RNU44). In our study cohort, major clinical significance was demonstrated only for miR-31, as high expression was associated with advanced tumor stage and poor differentiation. No significant associations were found between expression of the investigated miRNAs and metastasis-free or overall survival. Investigating the expression of six miRNAs previously identified as candidate biomarkers in colorectal cancer, few clinically relevant associations were detected in our patient cohort. Our results emphasize the importance of validating potential tumor markers in independent patient cohorts, and indicate that the role of miRNAs as colorectal cancer biomarkers is still undetermined
Sakai, Kazuko; Ukita, Masayo; Schmidt, Jeanette; Wu, Longyang; De Velasco, Marco A; Roter, Alan; Jevons, Luis; Nishio, Kazuto; Mandai, Masaki
2017-10-01
Intratumoral heterogeneity of cancer cells remains largely unexplored. Here we investigated the composition of ovarian cancer and its biological relevance. A whole-genome single nucleotide polymorphism array was applied to detect the clonal composition of 24 formalin-fixed, paraffin-embedded samples of human ovarian cancer. Genome-wide segmentation data consisting of the log2 ratio (log2R) and B allele frequency (BAF) were used to calculate an estimate of the clonal composition number (CC number) for each tumor. Somatic mutation profiles of cancer-related genes were also determined for the same 24 samples by next-generation sequencing. The CC number was estimated successfully for 23 of the 24 cancer samples. The mean ± SD value for the CC number was 1.7 ± 1.1 (range of 0-4). A somatic mutation in at least one gene was identified in 22 of the 24 ovarian cancer samples, with the mutations including those in the oncogenes KRAS (29.2%), PIK3CA (12.5%), BRAF (8.3%), FGFR2 (4.2%), and JAK2 (4.2%) as well as those in the tumor suppressor genes TP53 (54.2%), FBXW7 (8.3%), PTEN (4.2%), and RB1 (4.2%). Tumors with one or more oncogenic mutations had a significantly lower CC number than did those without such a mutation (1.0 ± 0.8 versus 2.3 ± 0.9, P = 0.0027), suggesting that cancers with driver oncogene mutations are less heterogeneous than those with other mutations. Our results thus reveal a reciprocal relation between oncogenic mutation status and clonal composition in ovarian cancer using the established method for the estimation of the CC number. Copyright © 2017 The Author(s). Published by Elsevier B.V. All rights reserved.
Hereditary cancer genes are highly susceptible to splicing mutations
Soemedi, Rachel; Maguire, Samantha; Murray, Michael F.; Monaghan, Sean F.
2018-01-01
Substitutions that disrupt pre-mRNA splicing are a common cause of genetic disease. On average, 13.4% of all hereditary disease alleles are classified as splicing mutations mapping to the canonical 5′ and 3′ splice sites. However, splicing mutations present in exons and deeper intronic positions are vastly underreported. A recent re-analysis of coding mutations in exon 10 of the Lynch Syndrome gene, MLH1, revealed an extremely high rate (77%) of mutations that lead to defective splicing. This finding is confirmed by extending the sampling to five other exons in the MLH1 gene. Further analysis suggests a more general phenomenon of defective splicing driving Lynch Syndrome. Of the 36 mutations tested, 11 disrupted splicing. Furthermore, analyzing past reports suggest that MLH1 mutations in canonical splice sites also occupy a much higher fraction (36%) of total mutations than expected. When performing a comprehensive analysis of splicing mutations in human disease genes, we found that three main causal genes of Lynch Syndrome, MLH1, MSH2, and PMS2, belonged to a class of 86 disease genes which are enriched for splicing mutations. Other cancer genes were also enriched in the 86 susceptible genes. The enrichment of splicing mutations in hereditary cancers strongly argues for additional priority in interpreting clinical sequencing data in relation to cancer and splicing. PMID:29505604
Hereditary cancer genes are highly susceptible to splicing mutations.
Directory of Open Access Journals (Sweden)
Christy L Rhine
2018-03-01
Full Text Available Substitutions that disrupt pre-mRNA splicing are a common cause of genetic disease. On average, 13.4% of all hereditary disease alleles are classified as splicing mutations mapping to the canonical 5' and 3' splice sites. However, splicing mutations present in exons and deeper intronic positions are vastly underreported. A recent re-analysis of coding mutations in exon 10 of the Lynch Syndrome gene, MLH1, revealed an extremely high rate (77% of mutations that lead to defective splicing. This finding is confirmed by extending the sampling to five other exons in the MLH1 gene. Further analysis suggests a more general phenomenon of defective splicing driving Lynch Syndrome. Of the 36 mutations tested, 11 disrupted splicing. Furthermore, analyzing past reports suggest that MLH1 mutations in canonical splice sites also occupy a much higher fraction (36% of total mutations than expected. When performing a comprehensive analysis of splicing mutations in human disease genes, we found that three main causal genes of Lynch Syndrome, MLH1, MSH2, and PMS2, belonged to a class of 86 disease genes which are enriched for splicing mutations. Other cancer genes were also enriched in the 86 susceptible genes. The enrichment of splicing mutations in hereditary cancers strongly argues for additional priority in interpreting clinical sequencing data in relation to cancer and splicing.
Santolla, Maria Francesca; Lappano, Rosamaria; Cirillo, Francesca; Rigiracciolo, Damiano Cosimo; Sebastiani, Anna; Abonante, Sergio; Tassone, Pierfrancesco; Tagliaferri, Pierosandro; Di Martino, Maria Teresa; Maggiolini, Marcello; Vivacqua, Adele
2018-05-02
MicroRNA (miRNAs) are non-coding small RNA molecules that regulate gene expression by inhibiting the translation of target mRNAs. Among several dysregulated miRNAs in human cancer, the up-regulation of miR-221 has been associated with development of a variety of hematologic and solid malignancies. In this study, we investigated the involvement of miR-221 in breast cancer. TaqMan microRNA assay was used to detect the miR-221 levels in normal cells and in MDA-MB 231 and SkBr3 breast cancer cells as well as in main players of the tumor microenvironment, namely cancer-associated fibroblasts (CAFs). miR-221 mimic sequence and locked nucleic acid (LNA)-i-miR-221 construct were used to induce or inhibit, respectively, the miR-221 expression in cells used. Quantitative PCR and western blotting analysis were performed to evaluate the levels of the miR-221 target gene A20 (TNFAIP3), as well as the member of the NF-kB complex namely c-Rel and the connective tissue growth factor (CTGF). Chromatin immunoprecipitation (ChIP) assay was performed to ascertain the recruitment of c-Rel to the CTFG promoter. Finally, the cell growth and migration in the presence of LNA-i-miR-221 or silencing c-Rel and CTGF by specific short hairpin were assessed by cell count, colony formation and boyden chambers assays. Statistical analysis was performed by ANOVA. We first demonstrated that LNA-i-miR-221 inhibits both endogenous and ectopic expression of miR-221 in our experimental models. Next, we found that the A20 down-regulation, as well as the up-regulation of c-Rel induced by miR-221 were no longer evident using LNA-i-miR-221. Moreover, we established that the miR-221 dependent recruitment of c-Rel to the NF-kB binding site located within the CTGF promoter region is prevented by using LNA-i-miR-221. Furthermore, we determined that the up-regulation of CTGF mRNA and protein levels by miR-221 is no longer evident using LNA-i-miR221 and silencing c-Rel. Finally, we assessed that cell growth and
Mutation and Expression of the DCC Gene in Human Lung Cancer
Directory of Open Access Journals (Sweden)
Takashi Kohno
2000-07-01
Full Text Available Chromosome 18q is frequently deleted in lung cancers, a common region of 18q deletions was mapped to chromosome 18g21. Since the DCC candidate tumor suppressor gene has been mapped in this region, mutation and expression of the DCC gene were examined in 46 lung cancer cell lines, consisting of 14 small cell lung carcinomas (SCLCs and 32 non-small cell lung carcinomas (NSCLCs, to elucidate the pathogenetic significance of DCC alterations in human lung carcinogenesis. A heterozygous missense mutation was detected in a NSCLC cell line, Ma26, while homozygous deletion was not detected in any of the cell lines. The DCC gene was expressed in 11 (24% of the 46 cell lines, the incidence of DCC expression was significantly higher in SCLCs (7/14, 50% than in NSCLCs (4/32, 13% (P = .01, Fisher's exact test. Therefore, genetic alterations of DCC are infrequent; however, the levels of DCC expression vary among lung cancer cells, in particular, between SCLCs and NSCLCs. The present result does not implicate DCC as a specific mutational target of 18q deletions in human lung cancer; however, it suggests that DCC is a potential target of inactivation by genetic defects including intron or promoter mutations and/or epigenetic alterations. The present result also suggests that DCC expression is associated with some properties of SCLCs, such as a neuroendocrine (NE feature.
BRCA1/2 associated hereditary breast cancer
Institute of Scientific and Technical Information of China (English)
Li-song TENG; Yi ZHENG; Hao-hao WANG
2008-01-01
Breast cancer is one of the leading causes of death in women today. Some of the patients are hereditary, with a large proportion characterized by mutation in BRCA1 and/or BRCA2 genes. In this review, we provide an overview of these two genes,focusing on their relationship with hereditary breast cancers. BRCA1/2 associated hereditary breast cancers have unique features that differ from the general breast cancers, including alterations in cellular molecules, pathological bases, biological behavior, and a different prevention strategy. But the outcome of BRCA1/2 associated hereditary breast cancers still remains controversial;further studies are needed to elucidate the nature of BRCA1/2 associated hereditary breast cancers.
DEFF Research Database (Denmark)
Risom, Lotte; Christoffersen, Line Borck; Daugaard-Jensen, Jette
2013-01-01
Primary Failure of tooth Eruption (PFE) is a non-syndromic disorder which can be caused by mutations in the parathyroid hormone receptor 1 gene (PTH1R). Traditionally, the disorder has been identified clinically based on post-emergent failure of eruption of permanent molars. However, patients...... undergone surgical and/or orthodontic interventions, and identified novel PTH1R mutations in all. Four of the six mutations were predicted to abolish correct mRNA maturation either through introduction of premature stop codons (c.947C>A and c.1082G>A), or by altering correct mRNA splicing (c.544......-26_544-23del and c.989G>T). The latter was validated by transfection of minigenes. The six novel mutations expand the mutation spectrum for PFE from eight to 14 pathogenic mutations. Loss-of-function mutations in PTH1R are also associated with recessively inherited Blomstrand chondrodysplasia. We compiled all...
Directory of Open Access Journals (Sweden)
Jean-Yves Bleuyard
2017-11-01
Full Text Available Background: Germline mutations in the PALB2 gene are associated with the genetic disorder Fanconi anaemia and increased predisposition to cancer. Disease-associated variants are mainly protein-truncating mutations, whereas a few missense substitutions are reported to perturb its interaction with breast cancer susceptibility proteins BRCA1 and BRCA2, which play essential roles in homology-directed repair (HDR. More recently, PALB2 was shown to associate with active genes independently of BRCA1, and through this mechanism, safeguards these regions from DNA replicative stresses. However, it is unknown whether PALB2 tumour suppressor function requires its chromatin association. Methods: Mining the public database of cancer mutations, we identified four potentially deleterious cancer-associated missense mutations within the PALB2 chromatin association motif (ChAM. To assess the impact of these mutations on PALB2 function, we generated cell lines expressing PALB2 variants harbouring corresponding ChAM mutations, and evaluated PALB2 chromatin association properties and the cellular resistance to camptothecin (CPT. Additionally, we examined the accumulation of γH2A.X and the RAD51 recombinase as readouts of DNA damage signalling and HDR, respectively. Results: We demonstrate that a small-cell lung cancer (SCLC-associated T413S mutation in PALB2 impairs its chromatin association and confers reduced resistance to CPT, the only FDA-approved drug for relapsed SCLC. Unexpectedly, we found a less efficient γH2A.X nuclear foci formation in PALB2 T413S expressing cells, whereas a near-normal level of RAD51 nuclear foci was visible. Conclusions: These findings support the importance of PALB2 chromatin association in the suppression of tumours, including SCLC, an unusually aggressive type of cancer with poor prognosis. PALB2 T413S has little impact on RAD51 recruitment, likely due to its intact interaction with BRCA1 and BRCA2. However, this mutant shows
Directory of Open Access Journals (Sweden)
Jean-Yves Bleuyard
2018-01-01
Full Text Available Background: Germline mutations in the PALB2 gene are associated with the genetic disorder Fanconi anaemia and increased predisposition to cancer. Disease-associated variants are mainly protein-truncating mutations, whereas a few missense substitutions are reported to perturb its interaction with breast cancer susceptibility proteins BRCA1 and BRCA2, which play essential roles in homology-directed repair (HDR. More recently, PALB2 was shown to associate with active genes independently of BRCA1, and through this mechanism, safeguards these regions from DNA replicative stresses. However, it is unknown whether PALB2 tumour suppressor function requires its chromatin association. Methods: Mining the public database of cancer mutations, we identified four potentially deleterious cancer-associated missense mutations within the PALB2 chromatin association motif (ChAM. To assess the impact of these mutations on PALB2 function, we generated cell lines expressing PALB2 variants harbouring corresponding ChAM mutations, and evaluated PALB2 chromatin association properties and the cellular resistance to camptothecin (CPT. Additionally, we examined the accumulation of γH2A.X and the RAD51 recombinase as readouts of DNA damage signalling and HDR, respectively. Results: We demonstrate that a small-cell lung cancer (SCLC-associated T413S mutation in PALB2 impairs its chromatin association and confers reduced resistance to CPT, the only FDA-approved drug for relapsed SCLC. Unexpectedly, we found a less efficient γH2A.X nuclear foci formation in PALB2 T413S expressing cells, whereas a near-normal level of RAD51 nuclear foci was visible. Conclusions: These findings support the importance of PALB2 chromatin association in the suppression of tumours, including SCLC, an unusually aggressive type of cancer with poor prognosis. PALB2 T413S has little impact on RAD51 recruitment, likely due to its intact interaction with BRCA1 and BRCA2. However, this mutant shows
Directory of Open Access Journals (Sweden)
Xu Q
2015-06-01
Full Text Available Qing Xu,1,* Yazhen Zhu,2,* Yali Bai,1 Xiumin Wei,1 Xirun Zheng,2 Mao Mao,1 Guangjuan Zheng21Translational Bioscience and Diagnostics, WuXi AppTec, Shanghai, 2Department of Pathology, Guangdong Provincial Hospital of TCM, Guangzhou University of Chinese Medicine, Guangdong Provincial Academy of Chinese Medical Sciences, Guangzhou, People’s Republic of China*These authors contributed equally to this workBackground: Two types of epidermal growth factor receptor (EGFR mutations in exon 19 and exon 21 (ex19del and L858R are prevalent in lung cancer patients and sensitive to targeted EGFR inhibition. A resistance mutation in exon 20 (T790M has been found to accompany drug treatment when patients relapse. These three mutations are valuable companion diagnostic biomarkers for guiding personalized treatment. Quantitative polymerase chain reaction (qPCR-based methods have been widely used in the clinic by physicians to guide treatment decisions. The aim of this study was to evaluate the technical and clinical sensitivity and specificity of the droplet digital polymerase chain reaction (ddPCR method in detecting the three EGFR mutations in patients with lung cancer.Methods: Genomic DNA from H1975 and PC-9 cells, as well as 92 normal human blood specimens, was used to determine the technical sensitivity and specificity of the ddPCR assays. Genomic DNA of formalin-fixed, paraffin-embedded specimens from 78 Chinese patients with lung adenocarcinoma were assayed using both qPCR and ddPCR.Results: The three ddPCR assays had a limit of detection of 0.02% and a wide dynamic range from 1 to 20,000 copies measurement. The L858R and ex19del assays had a 0% background level in the technical and clinical settings. The T790M assay appeared to have a 0.03% technical background. The ddPCR assays were robust for correct determination of EGFR mutation status in patients, and the dynamic range appeared to be better than qPCR methods. The ddPCR assay for T790M could detect
International Nuclear Information System (INIS)
Spurdle, Amanda B; Hopper, John L; Chen, Xiaoqing; McCredie, Margaret RE; Giles, Graham G; Newman, Beth; Chenevix-Trench, Georgia; Khanna, KumKum
2002-01-01
There is evidence that certain mutations in the double-strand break repair pathway ataxia-telangiectasia mutated gene act in a dominant-negative manner to increase the risk of breast cancer. There are also some reports to suggest that the amino acid substitution variants T2119C Ser707Pro and C3161G Pro1054Arg may be associated with breast cancer risk. We investigate the breast cancer risk associated with these two nonconservative amino acid substitution variants using a large Australian population-based case–control study. The polymorphisms were genotyped in more than 1300 cases and 600 controls using 5' exonuclease assays. Case–control analyses and genotype distributions were compared by logistic regression. The 2119C variant was rare, occurring at frequencies of 1.4 and 1.3% in cases and controls, respectively (P = 0.8). There was no difference in genotype distribution between cases and controls (P = 0.8), and the TC genotype was not associated with increased risk of breast cancer (adjusted odds ratio = 1.08, 95% confidence interval = 0.59–1.97, P = 0.8). Similarly, the 3161G variant was no more common in cases than in controls (2.9% versus 2.2%, P = 0.2), there was no difference in genotype distribution between cases and controls (P = 0.1), and the CG genotype was not associated with an increased risk of breast cancer (adjusted odds ratio = 1.30, 95% confidence interval = 0.85–1.98, P = 0.2). This lack of evidence for an association persisted within groups defined by the family history of breast cancer or by age. The 2119C and 3161G amino acid substitution variants are not associated with moderate or high risks of breast cancer in Australian women
Alves, L N R; Santos, E V W; Stur, E; Silva Conforti, A M A; Louro, I D
2016-04-27
Hereditary hemochromatosis (HH) is an autosomal recessive disorder that leads to progressive iron accumulation and may cause cirrhosis, hepatocellular carcinoma, diabetes, and heart failure. Most cases of HH have been linked to mutations in genes associated with iron homeostasis. There have been three major variants in the high Fe (HFE) gene associated with the disease: C282Y, H63D and S65C. In this context, we aimed to evaluate the prevalence of the polymorphic variants (C282Y, H63D and S65C) of the HFE gene in the population of the Espírito Santo State (ES), Brazil by analyzing three different groups: general population (N = 120), Pomeranian descendants (N = 59), and patients with HH (N = 20). Using genomic DNA extracted from peripheral blood, polymorphic variant identification was performed by polymerase chain reaction-restriction fragment length polymorphism. Statistically significant differences were observed for genotype distribution of C282Y (P HFE gene allele frequencies for the general population, Pomeranian subpopulation, and patients with HH of ES, Brazil.
Directory of Open Access Journals (Sweden)
Paula Paulo
2018-04-01
Full Text Available Considering that mutations in known prostate cancer (PrCa predisposition genes, including those responsible for hereditary breast/ovarian cancer and Lynch syndromes, explain less than 5% of early-onset/familial PrCa, we have sequenced 94 genes associated with cancer predisposition using next generation sequencing (NGS in a series of 121 PrCa patients. We found monoallelic truncating/functionally deleterious mutations in seven genes, including ATM and CHEK2, which have previously been associated with PrCa predisposition, and five new candidate PrCa associated genes involved in cancer predisposing recessive disorders, namely RAD51C, FANCD2, FANCI, CEP57 and RECQL4. Furthermore, using in silico pathogenicity prediction of missense variants among 18 genes associated with breast/ovarian cancer and/or Lynch syndrome, followed by KASP genotyping in 710 healthy controls, we identified "likely pathogenic" missense variants in ATM, BRIP1, CHEK2 and TP53. In conclusion, this study has identified putative PrCa predisposing germline mutations in 14.9% of early-onset/familial PrCa patients. Further data will be necessary to confirm the genetic heterogeneity of inherited PrCa predisposition hinted in this study.
Risom, Lotte; Christoffersen, Line; Daugaard-Jensen, Jette; Hove, Hanne Dahlgaard; Andersen, Henriette Skovgaard; Andresen, Brage Storstein; Kreiborg, Sven; Duno, Morten
2013-01-01
Primary Failure of tooth Eruption (PFE) is a non-syndromic disorder which can be caused by mutations in the parathyroid hormone receptor 1 gene (PTH1R). Traditionally, the disorder has been identified clinically based on post-emergent failure of eruption of permanent molars. However, patients with PTH1R mutations will not benefit from surgical and/or orthodontic treatment and it is therefore clinically important to establish whether a given failure of tooth eruption is caused by a PTH1R defect or not. We analyzed the PTH1R gene in six patients clinically diagnosed with PFE, all of which had undergone surgical and/or orthodontic interventions, and identified novel PTH1R mutations in all. Four of the six mutations were predicted to abolish correct mRNA maturation either through introduction of premature stop codons (c.947C>A and c.1082G>A), or by altering correct mRNA splicing (c.544-26_544-23del and c.989G>T). The latter was validated by transfection of minigenes. The six novel mutations expand the mutation spectrum for PFE from eight to 14 pathogenic mutations. Loss-of-function mutations in PTH1R are also associated with recessively inherited Blomstrand chondrodysplasia. We compiled all published PTH1R mutations and identified a mutational overlap between Blomstrand chondrodysplasia and PFE. The results suggest that a genetic approach to preclinical diagnosis will have important implication for surgical and orthodontic treatment of patients with failure of tooth eruption.
Directory of Open Access Journals (Sweden)
Lotte Risom
Full Text Available Primary Failure of tooth Eruption (PFE is a non-syndromic disorder which can be caused by mutations in the parathyroid hormone receptor 1 gene (PTH1R. Traditionally, the disorder has been identified clinically based on post-emergent failure of eruption of permanent molars. However, patients with PTH1R mutations will not benefit from surgical and/or orthodontic treatment and it is therefore clinically important to establish whether a given failure of tooth eruption is caused by a PTH1R defect or not. We analyzed the PTH1R gene in six patients clinically diagnosed with PFE, all of which had undergone surgical and/or orthodontic interventions, and identified novel PTH1R mutations in all. Four of the six mutations were predicted to abolish correct mRNA maturation either through introduction of premature stop codons (c.947C>A and c.1082G>A, or by altering correct mRNA splicing (c.544-26_544-23del and c.989G>T. The latter was validated by transfection of minigenes. The six novel mutations expand the mutation spectrum for PFE from eight to 14 pathogenic mutations. Loss-of-function mutations in PTH1R are also associated with recessively inherited Blomstrand chondrodysplasia. We compiled all published PTH1R mutations and identified a mutational overlap between Blomstrand chondrodysplasia and PFE. The results suggest that a genetic approach to preclinical diagnosis will have important implication for surgical and orthodontic treatment of patients with failure of tooth eruption.
Novel BRCA1 splice-site mutation in ovarian cancer patients of Slavic origin.
Krivokuca, Ana; Dragos, Vita Setrajcic; Stamatovic, Ljiljana; Blatnik, Ana; Boljevic, Ivana; Stegel, Vida; Rakobradovic, Jelena; Skerl, Petra; Jovandic, Stevo; Krajc, Mateja; Magic, Mirjana Brankovic; Novakovic, Srdjan
2018-04-01
Mutations in breast cancer susceptibility gene 1 (BRCA1) lead to defects in a number of cellular pathways including DNA damage repair and transcriptional regulation, resulting in the elevated genome instability and predisposing to breast and ovarian cancers. We report a novel mutation LRG_292t1:c.4356delA,p.(Ala1453Glnfs*3) in the 12th exon of BRCA1, in the splice site region near the donor site of intron 12. It is a frameshift mutation with the termination codon generated on the third amino acid position from the site of deletion. Human Splice Finder 3.0 and MutationTaster have assessed this variation as disease causing, based on the alteration of splicing, creation of premature stop codon and other potential alterations initiated by nucleotide deletion. Among the most important alterations are frameshift and splice site changes (score of the newly created donor splice site: 0.82). c.4356delA was associated with two ovarian cancer cases in two families of Slavic origin. It was detected by next generation sequencing, and confirmed with Sanger sequencing in both cases. Because of the fact that it changes the reading frame of the protein, novel mutation c.4356delA p.(Ala1453Glnfs*3) in BRCA1 gene might be of clinical significance for hereditary ovarian cancer. Further functional as well as segregation analyses within the families are necessary for appropriate clinical classification of this variant. Since it has been detected in two ovarian cancer patients of Slavic origin, it is worth investigating founder effect of this mutation in Slavic populations.
The Landscape of Somatic Genetic Alterations in Breast Cancers From ATM Germline Mutation Carriers.
Weigelt, Britta; Bi, Rui; Kumar, Rahul; Blecua, Pedro; Mandelker, Diana L; Geyer, Felipe C; Pareja, Fresia; James, Paul A; Couch, Fergus J; Eccles, Diana M; Blows, Fiona; Pharoah, Paul; Li, Anqi; Selenica, Pier; Lim, Raymond S; Jayakumaran, Gowtham; Waddell, Nic; Shen, Ronglai; Norton, Larry; Wen, Hannah Y; Powell, Simon N; Riaz, Nadeem; Robson, Mark E; Reis-Filho, Jorge S; Chenevix-Trench, Georgia
2018-02-28
Pathogenic germline variants in ataxia-telangiectasia mutated (ATM), a gene that plays a role in DNA damage response and cell cycle checkpoints, confer an increased breast cancer (BC) risk. Here, we investigated the phenotypic characteristics and landscape of somatic genetic alterations in 24 BCs from ATM germline mutation carriers by whole-exome and targeted sequencing. ATM-associated BCs were consistently hormone receptor positive and largely displayed minimal immune infiltrate. Although 79.2% of these tumors exhibited loss of heterozygosity of the ATM wild-type allele, none displayed high activity of mutational signature 3 associated with defective homologous recombination DNA (HRD) repair. No TP53 mutations were found in the ATM-associated BCs. Analysis of an independent data set confirmed that germline ATM variants and TP53 somatic mutations are mutually exclusive. Our findings indicate that ATM-associated BCs often harbor bi-allelic inactivation of ATM, are phenotypically distinct from BRCA1/2-associated BCs, lack HRD-related mutational signatures, and that TP53 and ATM genetic alterations are likely epistatic.
Energy Technology Data Exchange (ETDEWEB)
Magracheva, Eugenia; Kozlov, Serguei; Stewart, Colin L.; Wlodawer, Alexander; Zdanov, Alexander; (NCI)
2009-08-07
Proteins of the A-type lamin family, which consists of two members, lamin A and lamin C, are the major components of a thin proteinaceous filamentous meshwork, the lamina, that underlies the inner nuclear membrane. A-type lamins have recently become the focus of extensive functional studies as a consequence of the linking of at least eight congenital diseases to mutations in the lamin A/C gene (LMNA). This spectrum of pathologies, which mostly manifest themselves as dominant traits, includes muscle dystrophies, dilated cardiomyopathies, the premature aging syndrome Hutchinson-Guilford progeria and familial partial lipodystrophy (FPLD). The crystal structure of the lamin A/C mutant R482W, a variant that causes FPLD, has been determined at 1.5 {angstrom} resolution. A completely novel aggregation state of the C-terminal globular domain and the position of the mutated amino-acid residue suggest means by which the mutation may affect lamin A/C-protein and protein-DNA interactions.
Directory of Open Access Journals (Sweden)
Elena Vigorito
Full Text Available Population-based genome wide association studies have identified a locus at 9p22.2 associated with ovarian cancer risk, which also modifies ovarian cancer risk in BRCA1 and BRCA2 mutation carriers. We conducted fine-scale mapping at 9p22.2 to identify potential causal variants in BRCA1 and BRCA2 mutation carriers. Genotype data were available for 15,252 (2,462 ovarian cancer cases BRCA1 and 8,211 (631 ovarian cancer cases BRCA2 mutation carriers. Following genotype imputation, ovarian cancer associations were assessed for 4,873 and 5,020 SNPs in BRCA1 and BRCA 2 mutation carriers respectively, within a retrospective cohort analytical framework. In BRCA1 mutation carriers one set of eight correlated candidate causal variants for ovarian cancer risk modification was identified (top SNP rs10124837, HR: 0.73, 95%CI: 0.68 to 0.79, p-value 2× 10-16. These variants were located up to 20 kb upstream of BNC2. In BRCA2 mutation carriers one region, up to 45 kb upstream of BNC2, and containing 100 correlated SNPs was identified as candidate causal (top SNP rs62543585, HR: 0.69, 95%CI: 0.59 to 0.80, p-value 1.0 × 10-6. The candidate causal in BRCA1 mutation carriers did not include the strongest associated variant at this locus in the general population. In sum, we identified a set of candidate causal variants in a region that encompasses the BNC2 transcription start site. The ovarian cancer association at 9p22.2 may be mediated by different variants in BRCA1 mutation carriers and in the general population. Thus, potentially different mechanisms may underlie ovarian cancer risk for mutation carriers and the general population.
International Nuclear Information System (INIS)
Yan Qingfeng; Bykhovskaya, Yelena; Li Ronghua; Mengesha, Emebet; Shohat, Mordechai; Estivill, Xavier; Fischel-Ghodsian, Nathan; Guan Minxin
2006-01-01
Nuclear modifier genes have been proposed to modulate the phenotypic manifestation of human mitochondrial 12S rRNA A1491G mutation associated with deafness in many families world-wide. Here we identified and characterized the putative nuclear modifier gene TRMU encoding a highly conserved mitochondrial protein related to tRNA modification. A 1937 bp TRMU cDNA has been isolated and the genomic organization of TRMU has been elucidated. The human TRMU gene containing 11 exons encodes a 421 residue protein with a strong homology to the TRMU-like proteins of bacteria and other homologs. TRMU is ubiquitously expressed in various tissues, but abundantly in tissues with high metabolic rates including heart, liver, kidney, and brain. Immunofluorescence analysis of human 143B cells expressing TRMU-GFP fusion protein demonstrated that the human Trmu localizes and functions in mitochondrion. Furthermore, we show that in families with the deafness-associated 12S rRNA A1491G mutation there is highly suggestive linkage and linkage disequilibrium between microsatellite markers adjacent to TRMU and the presence of deafness. These observations suggest that human TRMU may modulate the phenotypic manifestation of the deafness-associated mitochondrial 12S rRNA mutations
Nakasone, Shoko; Mimaki, Sachiyo; Ichikawa, Tomohiro; Aokage, Keiju; Miyoshi, Tomohiro; Sugano, Masato; Kojima, Motohiro; Fujii, Satoshi; Kuwata, Takeshi; Ochiai, Atsushi; Tsuboi, Masahiro; Goto, Koichi; Tsuchihara, Katsuya; Ishii, Genichiro
2018-05-01
Podoplanin-positive cancer-associated fibroblasts (CAFs) play an essential role in tumor progression. However, it is still unclear whether specific genomic alterations of cancer cells are required to recruit podoplanin-positive CAFs. The aim of this study was to investigate the relationship between the mutation status of lung adenocarcinoma cells and the presence of podoplanin-positive CAFs. Ninety-seven lung adenocarcinomas for which whole exome sequencing data were available were enrolled. First, we analyzed the clinicopathological features of the cases, and then, evaluated the relationship between genetic features of cancer cells (major driver mutations and the number of single nucleotide variants, SNVs) and the presence of podoplanin-positive CAFs. The presence of podoplanin-positive CAFs was associated with smoking history, solid predominant subtype, and lymph node metastasis. We could not find any significant correlations between major genetic mutations (EGFR, KRAS, TP53, MET, ERBB2, BRAF, and PIC3CA) in cancer cells and the presence of podoplanin-positive CAFs. However, cases with podoplanin-positive CAFs had a significantly higher number of SNVs in cancer cells than the podoplanin-negative CAFs cases (median 84 vs 37, respectively; p = 0.001). This was also detected in a non-smoker subgroup (p = 0.037). Multivariate analyses revealed that the number of SNVs in cancer cells was the only statistically significant independent predictor for the presence of podoplanin-positive CAFs (p = 0.044). In lung adenocarcinoma, the presence of podoplanin-positive CAFs was associated with higher numbers of SNVs in cancer cells, suggesting a relationship between accumulations of SNVs in cancer cells and the generation of a tumor-promoting microenvironment.
CYP2R1 mutations causing vitamin D-deficiency rickets.
Thacher, Tom D; Levine, Michael A
2017-10-01
CYP2R1 is the principal hepatic 25-hydroxylase responsible for the hydroxylation of parent vitamin D to 25-hydroxyvitamin D [25(OH)D]. Serum concentrations of 25(OH)D reflect vitamin D status, because 25(OH)D is the major circulating metabolite of vitamin D. The 1α-hydroxylation of 25(OH)D in the kidney by CYP27B1 generates the fully active vitamin D metabolite, 1,25-dihydroxyvitamin D (1,25(OH) 2 D). The human CYP2R1 gene, located at 11p15.2, has five exons, coding for an enzyme with 501 amino acids. In Cyp2r1-/- knockout mice, serum 25(OH)D levels were reduced by more than 50% compared wild-type mice. Genetic polymorphisms of CYP2R1 account for some of the individual variability of circulating 25(OH)D values in the population. We review the evidence that inactivating mutations in CYP2R1 can lead to a novel form of vitamin D-deficiency rickets resulting from impaired 25-hydroxylation of vitamin D. We sequenced the promoter, exons and intron-exon flanking regions of the CYP2R1 gene in members of 12 Nigerian families with rickets in more than one family member. We found missense mutations (L99P and K242N) in affected members of 2 of 12 families. The L99P mutation had previously been reported as a homozygous defect in an unrelated child of Nigerian origin with rickets. In silico analyses predicted impaired CYP2R1 folding or reduced interaction with substrate vitamin D by L99P and K242N mutations, respectively. In vitro studies of the mutant CYP2R1 proteins in HEK293 cells confirmed normal expression levels but completely absent or markedly reduced 25-hydroxylase activity by the L99P and K242N mutations, respectively. Heterozygous subjects had more moderate biochemical and clinical features of vitamin D deficiency than homozygous subjects. After an oral bolus dose of 50,000 IU of vitamin D 2 or vitamin D 3 , heterozygous subjects had lower increases in serum 25(OH)D than control subjects, and homozygous subjects had minimal increases, supporting a semidominant
Direct Transcriptional Consequences of Somatic Mutation in Breast Cancer
Directory of Open Access Journals (Sweden)
Adam Shlien
2016-08-01
Full Text Available Disordered transcriptomes of cancer encompass direct effects of somatic mutation on transcription, coordinated secondary pathway alterations, and increased transcriptional noise. To catalog the rules governing how somatic mutation exerts direct transcriptional effects, we developed an exhaustive pipeline for analyzing RNA sequencing data, which we integrated with whole genomes from 23 breast cancers. Using X-inactivation analyses, we found that cancer cells are more transcriptionally active than intermixed stromal cells. This is especially true in estrogen receptor (ER-negative tumors. Overall, 59% of substitutions were expressed. Nonsense mutations showed lower expression levels than expected, with patterns characteristic of nonsense-mediated decay. 14% of 4,234 rearrangements caused transcriptional abnormalities, including exon skips, exon reusage, fusions, and premature polyadenylation. We found productive, stable transcription from sense-to-antisense gene fusions and gene-to-intergenic rearrangements, suggesting that these mutation classes drive more transcriptional disruption than previously suspected. Systematic integration of transcriptome with genome data reveals the rules by which transcriptional machinery interprets somatic mutation.
Bu, Rong; Siraj, Abdul K; Al-Obaisi, Khadija A S; Beg, Shaham; Al Hazmi, Mohsen; Ajarim, Dahish; Tulbah, Asma; Al-Dayel, Fouad; Al-Kuraya, Khawla S
2016-09-01
Ethnic differences of breast cancer genomics have prompted us to investigate the spectra of BRCA1 and BRCA2 mutations in different populations. The prevalence and effect of BRCA 1 and BRCA 2 mutations in Middle Eastern population is not fully explored. To characterize the prevalence of BRCA mutations in Middle Eastern breast cancer patients, BRCA mutation screening was performed in 818 unselected breast cancer patients using Capture and/or Sanger sequencing. 19 short tandem repeat (STR) markers were used for founder mutation analysis. In our study, nine different types of deleterious mutation were identified in 28 (3.4%) cases, 25 (89.3%) cases in BRCA 1 and 3 (10.7%) cases in BRCA 2. Seven recurrent mutations identified accounted for 92.9% (26/28) of all the mutant cases. Haplotype analysis was performed to confirm c.1140 dupG and c.4136_4137delCT mutations as novel putative founder mutation, accounting for 46.4% (13/28) of all BRCA mutant cases and 1.6% (13/818) of all the breast cancer cases, respectively. Moreover, BRCA 1 mutation was significantly associated with BRCA 1 protein expression loss (p = 0.0005). Our finding revealed that a substantial number of BRCA mutations were identified in clinically high risk breast cancer from Middle East region. Identification of the mutation spectrum, prevalence and founder effect in Middle Eastern population facilitates genetic counseling, risk assessment and development of cost-effective screening strategy. © 2016 UICC.
de Cuba, E. M. V.; Snaebjornsson, P.; Heideman, D. A. M.; van Grieken, N. C. T.; Bosch, L. J. W.; Fijneman, R. J. A.; Belt, E.; Bril, H.; Stockmann, H. B. A. C.; Hooijberg, E.; Punt, C. J. A.; Koopman, M.; Nagtegaal, I. D.; Coupé, V. H. M.; Carvalho, B.; Meijer, G. A.
2016-01-01
Microsatellite instability (MSI) has been associated with favourable survival in early stage colorectal cancer (CRC) compared to microsatellite stable (MSS) CRC. The BRAF V600E mutation has been associated with worse survival in MSS CRC. This mutation occurs in 40% of MSI CRC and it is unclear
Directory of Open Access Journals (Sweden)
Huiyong Sun
2014-07-01
Full Text Available Tyrosine kinases are regarded as excellent targets for chemical drug therapy of carcinomas. However, under strong purifying selection, drug resistance usually occurs in the cancer cells within a short term. Many cases of drug resistance have been found to be associated with secondary mutations in drug target, which lead to the attenuated drug-target interactions. For example, recently, an acquired secondary mutation, G2032R, has been detected in the drug target, ROS1 tyrosine kinase, from a crizotinib-resistant patient, who responded poorly to crizotinib within a very short therapeutic term. It was supposed that the mutation was located at the solvent front and might hinder the drug binding. However, a different fact could be uncovered by the simulations reported in this study. Here, free energy surfaces were characterized by the drug-target distance and the phosphate-binding loop (P-loop conformational change of the crizotinib-ROS1 complex through advanced molecular dynamics techniques, and it was revealed that the more rigid P-loop region in the G2032R-mutated ROS1 was primarily responsible for the crizotinib resistance, which on one hand, impaired the binding of crizotinib directly, and on the other hand, shortened the residence time induced by the flattened free energy surface. Therefore, both of the binding affinity and the drug residence time should be emphasized in rational drug design to overcome the kinase resistance.
Directory of Open Access Journals (Sweden)
Caporale DA
2014-06-01
Full Text Available Diane A Caporale, Erica E SwensonDepartment of Biology, University of Wisconsin – Stevens Point, Stevens Point, WI, USAAbstract: Breast and lung cancer are two of the most common malignancies in the United States, causing approximately 40,000 and 160,000 deaths each year, respectively. Over 80% of hereditary breast cancer cases are due to mutations in two breast cancer predisposition genes, BRCA1 and BRCA2. These are tumor-suppressor genes associated with DNA repair. Since the discovery of these two genes in the mid-1990s, several other breast cancer predisposition genes have been identified, such as the CHEK2 gene encoding a regulator of BRCA1. Recently, studies have begun investigating the roles of BRCA1 and BRCA2 gene expression in lung cancer. We conducted a family-based case study that included a bloodline of Italian heritage with several cases of breast cancer and associated cancers (prostate and stomach through multiple generations and on a nonblood relative of Scottish/Irish descent who was consecutively diagnosed with breast and lung cancer. Cancer history and environmental risk factors were recorded for each family member. To investigate possible genetic risks, we screened for mutations in specific hypervariable regions of the BRCA1, BRCA2, and CHEK2 genes. DNA was extracted and isolated from the individuals' hair follicles and cheek cells. Polymerase chain reaction (PCR, allele-specific PCR, and DNA sequencing were performed to identify and verify the presence or absence of mutations in these regions. Genotypes of several family members were determined and carriers of mutations were identified. Here we report for the first time the occurrence of two different BRCA2 frameshift mutations within the same family. Specifically, three Italian family members were found to be carriers of the BRCA2-c.2808_2811delACAA (3036delACAA mutation, a 4-nucleotide deletion in exon 11, which is a truncated mutation that causes deleterious function of
CYBRD1 as a modifier gene that modulates iron phenotype in HFE p.C282Y homozygous patients.
Pelucchi, Sara; Mariani, Raffaella; Calza, Stefano; Fracanzani, Anna Ludovica; Modignani, Giulia Litta; Bertola, Francesca; Busti, Fabiana; Trombini, Paola; Fraquelli, Mirella; Forni, Gian Luca; Girelli, Domenico; Fargion, Silvia; Specchia, Claudia; Piperno, Alberto
2012-12-01
Most patients with hereditary hemochromatosis in the Caucasian population are homozygous for the p.C282Y mutation in the HFE gene. The penetrance and expression of hereditary hemochromatosis differ largely among cases of homozygous p.C282Y. Genetic factors might be involved in addition to environmental factors. In the present study, we analyzed 50 candidate genes involved in iron metabolism and evaluated the association between 214 single nucleotide polymorphisms in these genes and three phenotypic outcomes of iron overload (serum ferritin, iron removed and transferrin saturation) in a large group of 296 p.C282Y homozygous Italians. Polymorphisms were tested for genetic association with each single outcome using linear regression models adjusted for age, sex and alcohol consumption. We found a series of 17 genetic variants located in different genes with possible additive effects on the studied outcomes. In order to evaluate whether the selected polymorphisms could provide a predictive signature for adverse phenotype, we re-evaluated data by dividing patients in two extreme phenotype classes based on the three phenotypic outcomes. We found that only a small improvement in prediction could be achieved by adding genetic information to clinical data. Among the selected polymorphisms, a significant association was observed between rs3806562, located in the 5'UTR of CYBRD1, and transferrin saturation. This variant belongs to the same haplotype block that contains the CYBRD1 polymorphism rs884409, found to be associated with serum ferritin in another population of p.C282Y homozygotes, and able to modulate promoter activity. A luciferase assay indicated that rs3806562 does not have a significant functional role, suggesting that it is a genetic marker linked to the putative genetic modifier rs884409. While our results support the hypothesis that polymorphisms in genes regulating iron metabolism may modulate penetrance of HFE-hereditary hemochromatosis, with emphasis on
Haywood, Annika; Merner, Nancy D.; Hodgkinson, Kathy A.; Houston, Jim; Syrris, Petros; Booth, Valerie; Connors, Sean; Pantazis, Antonios; Quarta, Giovanni; Elliott, Perry; McKenna, William; Young, Terry Lynn
2012-01-01
AimsAutosomal dominant arrhythmogenic right ventricular cardiomyopathy/dysplasia (ARVC/D) (in the group of arrhythmogenic cardiomyopathies) is a common cause of sudden cardiac death in young adults. It is both clinically and genetically heterogeneous, with 12 loci (ARVC/D1-12) and eight genes identified, the majority of which encode structural proteins of cardiac desmosomes. The most recent gene identified, TMEM43, causes disease due to a missense mutation in a non-desmosomal gene (p.S358L) in 15 extended families from Newfoundland, Canada. To determine whether mutations in TMEM43 cause ARVC/D and arrhythmogenic cardiomyopathy in other populations, we fully re-sequenced TMEM43 on 143 ARVC/D probands (families) from the UK and 55 probands (from 55 families) from Newfoundland.Methods and resultsBidirectional sequencing of TMEM43 including intron-exon boundaries revealed 33 variants, the majority located in non-coding regions of TMEM43. For the purpose of validation, families of probands with rare, potentially deleterious coding variants were subjected to clinical and molecular follow-up. Three missense variants of uncertain significance (p.R28W, p.E142K, p.R312W) were located in highly conserved regions of the TMEM43 protein. One variant (p.R312W) also co-segregated with relatives showing clinical signs of disease. Genotyping and expansion of the disease-associated haplotype in subjects with the p.R312W variant from Newfoundland, Canada, and the UK suggest common ancestry.ConclusionAlthough the p.R312W variant was found in controls (3/378), identification of an ancestral disease p R312W haplotype suggests that the p.R312W variant is a pathogenic founder mutation. © 2012 The Author.
Haywood, Annika
2012-11-15
AimsAutosomal dominant arrhythmogenic right ventricular cardiomyopathy/dysplasia (ARVC/D) (in the group of arrhythmogenic cardiomyopathies) is a common cause of sudden cardiac death in young adults. It is both clinically and genetically heterogeneous, with 12 loci (ARVC/D1-12) and eight genes identified, the majority of which encode structural proteins of cardiac desmosomes. The most recent gene identified, TMEM43, causes disease due to a missense mutation in a non-desmosomal gene (p.S358L) in 15 extended families from Newfoundland, Canada. To determine whether mutations in TMEM43 cause ARVC/D and arrhythmogenic cardiomyopathy in other populations, we fully re-sequenced TMEM43 on 143 ARVC/D probands (families) from the UK and 55 probands (from 55 families) from Newfoundland.Methods and resultsBidirectional sequencing of TMEM43 including intron-exon boundaries revealed 33 variants, the majority located in non-coding regions of TMEM43. For the purpose of validation, families of probands with rare, potentially deleterious coding variants were subjected to clinical and molecular follow-up. Three missense variants of uncertain significance (p.R28W, p.E142K, p.R312W) were located in highly conserved regions of the TMEM43 protein. One variant (p.R312W) also co-segregated with relatives showing clinical signs of disease. Genotyping and expansion of the disease-associated haplotype in subjects with the p.R312W variant from Newfoundland, Canada, and the UK suggest common ancestry.ConclusionAlthough the p.R312W variant was found in controls (3/378), identification of an ancestral disease p R312W haplotype suggests that the p.R312W variant is a pathogenic founder mutation. © 2012 The Author.
miR-30a can inhibit DNA replication by targeting RPA1 thus slowing cancer cell proliferation.
Zou, Zhenyou; Ni, Mengjie; Zhang, Jing; Chen, Yongfeng; Ma, Hongyu; Qian, Shihan; Tang, Longhua; Tang, Jiamei; Yao, Hailun; Zhao, Chengbin; Lu, Xiongwen; Sun, Hongyang; Qian, Jue; Mao, Xiaoting; Lu, Xulin; Liu, Qun; Zen, Juping; Wu, Hanbing; Bao, Zhaosheng; Lin, Shudan; Sheng, Hongyu; Li, Yunlong; Liang, Yong; Chen, Zhiqiang; Zong, Dan
2016-07-15
Cell proliferation was inhibited following forced over-expression of miR-30a in the ovary cancer cell line A2780DX5 and the gastric cancer cell line SGC7901R. Interestingly, miR-30a targets the DNA replication protein RPA1, hinders the replication of DNA and induces DNA fragmentation. Furthermore, ataxia telangiectasia mutated (ATM) and checkpoint kinase 2 (CHK2) were phosphorylated after DNA damage, which induced p53 expression, thus triggering the S-phase checkpoint, arresting cell cycle progression and ultimately initiating cancer cell apoptosis. Therefore, forced miR-30a over-expression in cancer cells can be a potential way to inhibit tumour development. © 2016 The Author(s). published by Portland Press Limited on behalf of the Biochemical Society.
Identification of Constrained Cancer Driver Genes Based on Mutation Timing
Sakoparnig, Thomas; Fried, Patrick; Beerenwinkel, Niko
2015-01-01
Cancer drivers are genomic alterations that provide cells containing them with a selective advantage over their local competitors, whereas neutral passengers do not change the somatic fitness of cells. Cancer-driving mutations are usually discriminated from passenger mutations by their higher degree of recurrence in tumor samples. However, there is increasing evidence that many additional driver mutations may exist that occur at very low frequencies among tumors. This observation has prompted alternative methods for driver detection, including finding groups of mutually exclusive mutations and incorporating prior biological knowledge about gene function or network structure. Dependencies among drivers due to epistatic interactions can also result in low mutation frequencies, but this effect has been ignored in driver detection so far. Here, we present a new computational approach for identifying genomic alterations that occur at low frequencies because they depend on other events. Unlike passengers, these constrained mutations display punctuated patterns of occurrence in time. We test this driver–passenger discrimination approach based on mutation timing in extensive simulation studies, and we apply it to cross-sectional copy number alteration (CNA) data from ovarian cancer, CNA and single-nucleotide variant (SNV) data from breast tumors and SNV data from colorectal cancer. Among the top ranked predicted drivers, we find low-frequency genes that have already been shown to be involved in carcinogenesis, as well as many new candidate drivers. The mutation timing approach is orthogonal and complementary to existing driver prediction methods. It will help identifying from cancer genome data the alterations that drive tumor progression. PMID:25569148
Circulating miRNAs miR-34a and miR-150 associated with colorectal cancer progression
Czech Academy of Sciences Publication Activity Database
Aherne, S.T.; Madden, S.F.; Hughes, D. J.; Pardini, B.; Naccarati, A.; Levý, M.; Vodička, Pavel; Neary, P.; Dowling, P.; Clynes, M.
2015-01-01
Roč. 15, apr 30 (2015), s. 2-13 ISSN 1471-2407 R&D Projects: GA ČR GAP304/10/1286 Institutional support: RVO:68378041 Keywords : colorectal cancer * circulating miRNAs * miR-34a * miR-150 * miR-923 Subject RIV: EB - Genetics ; Molecular Biology Impact factor: 3.265, year: 2015
Directory of Open Access Journals (Sweden)
Yu S
2017-09-01
Full Text Available Su Yu,1,2 Yang Zhang,1 Yunjian Pan,1 Chao Cheng,1,3 Yihua Sun,1,3 Haiquan Chen1–4 1Department of Thoracic Surgery, Fudan University Shanghai Cancer Center, Shanghai, China; 2Cancer Research Center, Fudan University Shanghai Cancer Center, Shanghai, China; 3Department of Oncology, Shanghai Medical College, Fudan University, Shanghai, China; 4Institutes of Biomedical Sciences, Fudan University, Shanghai, China Purpose: To identify novel oncogenic mutations in non-small cell lung cancer patient specimens that lack mutations in known targetable genes (“pan-negative” patients.Methods: Comprehensive mutational analyses were performed on 1,356 lung adenocarcinoma specimens. In this cohort of patients, common lung cancer oncogenic driver mutations were detected in the epidermal growth factor receptor (EGFR kinase domain, the human epidermal growth factor receptor 2 kinase domain, as well as the KRAS, BRAF, ALK, ROS1 and RET genes. A sub-cohort of pan-negative patient specimens was assayed for mutations in the EGFR extracellular domain (ECD. Additionally, EGFR mutant NIH-3T3 stable cell lines were constructed and assessed for protein content, anchorage-independent growth, and tumor formation in xenograft models to identify oncogenic mutations. BaF3 lymphocytes were also used to test sensitivities of the mutations to tyrosine kinase inhibitors.Results: In pan-negative lung adenocarcinoma cases, a novel oncogenic EGFR ECD mutation was identified (M277E. EGFR M277E mutations encoded oncoproteins that transformed NIH-3T3 cells to grow in the absence of exogenous epidermal growth factor. Transformation was further evidenced by anchorage-independent growth and tumor formation in immunocompromised xenograft mouse models. Finally, as seen in the canonical EGFR L858R mutation, the M277E mutation conferred sensitivity to both erlotinib and cetuximab in BaF3 cell lines and to erlotinib in xenograft models.Conclusion: Here, a new EGFR driver mutation, M277E
BRCA2 Mutations in 154 Finnish Male Breast Cancer Patients
Directory of Open Access Journals (Sweden)
Kirsi Syrjäkoski
2004-09-01
Full Text Available The etiology and pathogenesis of male breast cancer (MBC are poorly known. This is due to the fact that the disease is rare, and large-scale genetic epidemiologic studies have been difficult to carry out. Here, we studied the frequency of eight recurrent Finnish BRCA2 founder mutations in a large cohort of 154 MBC patients (65% diagnosed in Finland from 1967 to 1996. Founder mutations were detected in 10 patients (6.5%, eight of whom carried the 9346(-2 A>G mutation. Two novel mutations (4075 delGT and 5808 del5 were discovered in a screening of the entire BRCA2 coding region in 34 samples. However, these mutations were not found in the rest of the 120 patients studied. Patients with positive family history of breast and/or ovarian cancer were often BRCA2 mutation carriers (44%, whereas those with no family history showed a low frequency of involvement (3.6%; P < .0001. Finally, we found only one Finnish MBC patient with 999 dell, the most common founder mutation in Finnish female breast cancer (FBC patients, and one that explains most of the hereditary FBC and MBC cases in Iceland. The variation in BRCA2 mutation spectrum between Finnish MBC patients and FBC patients in Finland and breast cancer patients in Iceland suggests that modifying genetic and environmental factors may significantly influence the penetrance of MBC and FBC in individuals carrying germline BRCA2 mutations in some populations.
Directory of Open Access Journals (Sweden)
Lixia Fan
Full Text Available Non-small cell lung cancer is one of the most common cancers and the leading cause of cancer death worldwide. Genetic variants in regulatory regions of some miRNAs might be involved in non-small cell lung cancer susceptibility and survival. rs12220909 (G/C genetic polymorphism in miR-4293 has been shown to be associated with decreased risk of esophageal squamous cell carcinoma. However, the influence of rs12220909 genetic variation on non-small cell lung cancer susceptibility has not been reported. In order to evaluate the potential association between miR-4293 rs12220909 and non-small cell lung cancer risk in a Chinese population, we performed a case-control study among 998 non-small cell lung cancer cases and 1471 controls. The data shows that miR-4293 rs12220909 was significantly associated with decreased susceptibility to non-small cell lung cancer (GC vs.GG: OR = 0.681, 95%CI = 0.555-0.835, P = 2.19E-4; GG vs. GC+CC: OR = 0.687, 95%CI = 0.564-0.837, P = 1.95E-4, which indicates that rs12220909 in miR-4293 may play a significant role in the development of non-small cell lung cancer.
Endocrine metabolic disorders in patients with breast cancer, carriers of BRCA1 gene mutations.
Berstein, L M; Boyarkina, M P; Vasilyev, D A; Poroshina, T E; Kovalenko, I G; Imyanitov, E N; Semiglazov, V F
2012-03-01
Two groups of breast cancer patients (53±2 years) in clinical remission receiving no specific therapy were examined: group 1, with BRCA1 gene mutations (N=11) and group 2, without mutations of this kind (N=11). The two groups did not differ by insulinemia and glycemia, insulin resistance index, blood levels of thyrotropic hormone, sex hormone-binding globulin, insulin-like growth factor-1, triglycerides, or lipoproteins. In group 1, blood estradiol level was higher. Intensive glucose-induced generation of reactive oxygen species in these patients was associated with a decrease of cholesterolemia, of the C-peptide/insulin proportion, and a trend to higher urinary excretion of 4-hydroxyestrone, one of the most genotoxic catecholestrogens. BRCA1 gene mutations in breast cancer patients were associated with signs of estrogenization and a pro-genotoxic shift in the estrogen and glucose system, which could modulate the disease course and requires correction.
2010-07-01
... 30 Mineral Resources 2 2010-07-01 2010-07-01 false Testing Plan. 282.23 Section 282.23 Mineral... § 282.23 Testing Plan. All testing activities shall be conducted in accordance with a Testing Plan... detailed Mining Plan than is obtainable under an approved Delineation Plan, to prepare feasibility studies...
30 CFR 282.22 - Delineation Plan.
2010-07-01
... 30 Mineral Resources 2 2010-07-01 2010-07-01 false Delineation Plan. 282.22 Section 282.22 Mineral... § 282.22 Delineation Plan. All exploration activities shall be conducted in accordance with a Delineation Plan submitted by the lessee and approved by the Director. The Delineation Plan shall describe the...
Frebourg, T; Kassel, J; Lam, K T; Gryka, M A; Barbier, N; Andersen, T I; Børresen, A L; Friend, S H
1992-07-15
Germ-line mutations in the p53 tumor suppressor gene have been observed in patients with Li-Fraumeni syndrome, brain tumors, second malignancies, and breast cancers. It is unclear whether all of these mutations have inactivated p53 and thereby provide an increased risk for cancer. Therefore, it is necessary to establish the biological significance of these germ-line mutations by the functional and structural analysis of the resulting mutant p53 proteins. We analyzed the ability of seven germ-line mutant proteins observed in patients with Li-Fraumeni syndrome, second primary neoplasms, or familial breast cancer to block the growth of malignant cells and compared the structural properties of the mutant proteins to that of the wild-type protein. Six of seven missense mutations disrupted the growth inhibitory properties and structure of the wild-type protein. One germ-line mutation retained the features of the wild-type p53. Genetic analysis of the breast cancer family in which this mutation was observed indicated that this germ-line mutation was not associated with the development of cancer. These results demonstrate that germ-line p53 mutations observed in patients with Li-Fraumeni syndrome and with second malignancies have inactivated the p53 tumor suppressor gene. The inability of the germ-line p53 mutants to block the growth of malignant cells can explain why patients with these germ-line mutations have an increased risk for cancer. The observation of a functionally silent germ-line mutation indicates that, before associating a germ-line tumor suppressor gene mutation with cancer risk, it is prudent to consider its functional significance.
Frebourg, T; Kassel, J; Lam, K T; Gryka, M A; Barbier, N; Andersen, T I; Børresen, A L; Friend, S H
1992-01-01
Germ-line mutations in the p53 tumor suppressor gene have been observed in patients with Li-Fraumeni syndrome, brain tumors, second malignancies, and breast cancers. It is unclear whether all of these mutations have inactivated p53 and thereby provide an increased risk for cancer. Therefore, it is necessary to establish the biological significance of these germ-line mutations by the functional and structural analysis of the resulting mutant p53 proteins. We analyzed the ability of seven germ-line mutant proteins observed in patients with Li-Fraumeni syndrome, second primary neoplasms, or familial breast cancer to block the growth of malignant cells and compared the structural properties of the mutant proteins to that of the wild-type protein. Six of seven missense mutations disrupted the growth inhibitory properties and structure of the wild-type protein. One germ-line mutation retained the features of the wild-type p53. Genetic analysis of the breast cancer family in which this mutation was observed indicated that this germ-line mutation was not associated with the development of cancer. These results demonstrate that germ-line p53 mutations observed in patients with Li-Fraumeni syndrome and with second malignancies have inactivated the p53 tumor suppressor gene. The inability of the germ-line p53 mutants to block the growth of malignant cells can explain why patients with these germ-line mutations have an increased risk for cancer. The observation of a functionally silent germ-line mutation indicates that, before associating a germ-line tumor suppressor gene mutation with cancer risk, it is prudent to consider its functional significance. Images PMID:1631137
DEFF Research Database (Denmark)
Muranen, Taru A; Blomqvist, Carl; Dörk, Thilo
2016-01-01
BACKGROUND: P.I157T is a CHEK2 missense mutation associated with a modest increase in breast cancer risk. Previously, another CHEK2 mutation, the protein truncating c.1100delC has been associated with poor prognosis of breast cancer patients. Here, we have investigated patient survival...... and characteristics of breast tumors of germ line p.I157T carriers. METHODS: We included in the analyses 26,801 European female breast cancer patients from 15 studies participating in the Breast Cancer Association Consortium. We analyzed the association between p.I157T and the clinico-pathological breast cancer...... characteristics by comparing the p.I157T carrier tumors to non-carrier and c.1100delC carrier tumors. Similarly, we investigated the p.I157T associated risk of early death, breast cancer-associated death, distant metastasis, locoregional relapse and second breast cancer using Cox proportional hazards models...
Pathophysiological consequences and benefits of HFE mutations: 20 years of research
Hollerer, Ina; Bachmann, André; Muckenthaler, Martina U.
2017-01-01
Mutations in the HFE (hemochromatosis) gene cause hereditary hemochromatosis, an iron overload disorder that is hallmarked by excessive accumulation of iron in parenchymal organs. The HFE mutation p.Cys282Tyr is pathologically most relevant and occurs in the Caucasian population with a carrier frequency of up to 1 in 8 in specific European regions. Despite this high prevalence, the mutation causes a clinically relevant phenotype only in a minority of cases. In this review, we summarize historical facts and recent research findings about hereditary hemochromatosis, and outline the pathological consequences of the associated gene defects. In addition, we discuss potential advantages of HFE mutations in asymptomatic carriers. PMID:28280078
Effect of tcdR Mutation on Sporulation in the Epidemic Clostridium difficile Strain R20291.
Girinathan, Brintha P; Monot, Marc; Boyle, Daniel; McAllister, Kathleen N; Sorg, Joseph A; Dupuy, Bruno; Govind, Revathi
2017-01-01
Clostridium difficile is an important nosocomial pathogen and the leading cause of hospital-acquired diarrhea. Antibiotic use is the primary risk factor for the development of C. difficile -associated disease because it disrupts normally protective gut flora and enables C. difficile to colonize the colon. C. difficile damages host tissue by secreting toxins and disseminates by forming spores. The toxin-encoding genes, tcdA and tcdB , are part of a pathogenicity locus, which also includes the tcdR gene that codes for TcdR, an alternate sigma factor that initiates transcription of tcdA and tcdB genes. We created a tcdR mutant in epidemic-type C. difficile strain R20291 in an attempt to identify the global role of tcdR . A site-directed mutation in tcdR affected both toxin production and sporulation in C. difficile R20291. Spores of the tcdR mutant were more heat sensitive than the wild type (WT). Nearly 3-fold more taurocholate was needed to germinate spores from the tcdR mutant than to germinate the spores prepared from the WT strain. Transmission electron microscopic analysis of the spores also revealed a weakly assembled exosporium on the tcdR mutant spores. Accordingly, comparative transcriptome analysis showed many differentially expressed sporulation genes in the tcdR mutant compared to the WT strain. These data suggest that regulatory networks of toxin production and sporulation in C. difficile strain R20291 a re linked with each other. IMPORTANCE C. difficile infects thousands of hospitalized patients every year, causing significant morbidity and mortality. C. difficile spores play a pivotal role in the transmission of the pathogen in the hospital environment. During infection, the spores germinate, and the vegetative bacterial cells produce toxins that damage host tissue. Thus, sporulation and toxin production are two important traits of C. difficile . In this study, we showed that a mutation in tcdR , the toxin gene regulator, affects both toxin
Vancauwenberghe, Eric; Noyer, Lucile; Derouiche, Sandra; Lemonnier, Loïc; Gosset, Pierre; Sadofsky, Laura R; Mariot, Pascal; Warnier, Marine; Bokhobza, Alexandre; Slomianny, Christian; Mauroy, Brigitte; Bonnal, Jean-Louis; Dewailly, Etienne; Delcourt, Philippe; Allart, Laurent; Desruelles, Emilie; Prevarskaya, Natalia; Roudbaraki, Morad
2017-08-01
Previous studies showed the effects of resveratrol (RES) on several cancer cells, including prostate cancer (PCa) cell apoptosis without taking into consideration the impact of the tumor microenvironment (TME). The TME is composed of cancer cells, endothelial cells, blood cells, and cancer-associated fibroblasts (CAF), the main source of growth factors. The latter cells might modify in the TME the impact of RES on tumor cells via secreted factors. Recent data clearly show the impact of CAF on cancer cells apoptosis resistance via secreted factors. However, the effects of RES on PCa CAF have not been studied so far. We have investigated here for the first time the effects of RES on the physiology of PCa CAF in the context of TME. Using a prostate cancer CAF cell line and primary cultures of CAF from prostate cancers, we show that RES activates the N-terminal mutated Transient Receptor Potential Ankyrin 1 (TRPA1) channel leading to an increase in intracellular calcium concentration and the expression and secretion of growth factors (HGF and VEGF) without inducing apoptosis in these cells. Interestingly, in the present work, we also show that when the prostate cancer cells were co-cultured with CAF, the RES-induced cancer cell apoptosis was reduced by 40%, an apoptosis reduction canceled in the presence of the TRPA1 channel inhibitors. The present work highlights CAF TRPA1 ion channels as a target for RES and the importance of the channel in the epithelial-stromal crosstalk in the TME leading to resistance to the RES-induced apoptosis. © 2017 Wiley Periodicals, Inc.
Xia, Jianjian; Xu, Huamin; Jiang, Hong; Xie, Junxia
2015-05-19
Impaired brain iron homeostasis has been considered as an important mechanism in Parkinson's diseases (PD). There are indications that C282Y and H63D polymorphisms of HFE genes involved in iron metabolism might contribute to the pathogenesis of PD in some cases. However, the investigation of the relationship between PD and the two polymorphisms had produced contradictory results. We performed a meta-analysis to assess the C282Y and H63D polymorphisms of HFE in PD susceptibility. PubMed, EMBASE and Web of Science were systematically searched to identify relevant researches. The strict selection criteria and exclusion standard were applied. Odds ratios (ORs) with 95% confidence intervals (CIs) were used to assess the strength of associations. A fixed-effect or random-effect model was selected, depending on the results of the heterogeneity test. Fifteen studies were included in the meta-analysis (eight studies with 1631 cases and 4548 controls for C282Y; seven studies with 1192 cases and 4065 controls for H63D). For the C282Y polymorphism, significant associations were observed in the Recessive model (YY vs CY+CC: OR=0.22, 95% CI=0.09-0.57, P=0.002). This indicated that the C282Y polymorphism in HFE might be a potential protective factor for PD. However, no significant associations were found for any genetic model for the H63D polymorphism, suggesting that the H63D polymorphism might not be associated with PD. Copyright © 2015 Elsevier Ireland Ltd. All rights reserved.
Niessen, RC; Sijmons, RH; Berends, MJW; Ou, J; Hofstra, RNW; Kleibeuker, JH
2004-01-01
Hereditary non-polyposis colorectal cancer (HNPCC), also referred to as Lynch syndrome, is an autosomal dominantly inherited disorder that is characterized by susceptibility to colorectal cancer and extracolonic malignancies, in particular endometrial cancer. HNPCC is caused by pathogenic mutations
Singh, Himanshu Narayan; Rajeswari, Moganty R
2016-01-01
Purine repeat sequences present in a gene are unique as they have high propensity to form unusual DNA-triple helix structures. Friedreich's ataxia is the only human disease that is well known to be associated with DNA-triplexes formed by purine repeats. The purpose of this study was to recognize the expanded purine repeats (EPRs) in human genome and find their correlation with cancer pathogenesis. We developed "PuRepeatFinder.pl" algorithm to identify non-overlapping EPRs without pyrimidine interruptions in the human genome and customized for searching repeat lengths, n ≥ 200. A total of 1158 EPRs were identified in the genome which followed Wakeby distribution. Two hundred and ninety-six EPRs were found in geneic regions of 282 genes (EPR-genes). Gene clustering of EPR-genes was done based on their cellular function and a large number of EPR-genes were found to be enzymes/enzyme modulators. Meta-analysis of 282 EPR-genes identified only 63 EPR-genes in association with cancer, mostly in breast, lung, and blood cancers. Protein-protein interaction network analysis of all 282 EPR-genes identified proteins including those in cadherins and VEGF. The two observations, that EPRs can induce mutations under malignant conditions and that identification of some EPR-gene products in vital cell signaling-mediated pathways, together suggest the crucial role of EPRs in carcinogenesis. The new link between EPR-genes and their functionally interacting proteins throws a new dimension in the present understanding of cancer pathogenesis and can help in planning therapeutic strategies. Validation of present results using techniques like NGS is required to establish the role of the EPR genes in cancer pathology.
Identification of ten variants associated with risk of estrogen-receptor-negative breast cancer
Milne, Roger L; Kuchenbaecker, Karoline B; Michailidou, Kyriaki; Beesley, Jonathan; Kar, Siddhartha; Lindström, Sara; Hui, Shirley; Lemaçon, Audrey; Soucy, Penny; Dennis, Joe; Jiang, Xia; Rostamianfar, Asha; Finucane, Hilary; Bolla, Manjeet K; McGuffog, Lesley; Wang, Qin; Aalfs, Cora M; Adams, Marcia; Adlard, Julian; Agata, Simona; Ahmed, Shahana; Ahsan, Habibul; Aittomäki, Kristiina; Al-Ejeh, Fares; Allen, Jamie; Ambrosone, Christine B; Amos, Christopher I; Andrulis, Irene L; Anton-Culver, Hoda; Antonenkova, Natalia N; Arndt, Volker; Arnold, Norbert; Aronson, Kristan J; Auber, Bernd; Auer, Paul L; Ausems, Margreet G E M; Azzollini, Jacopo; Bacot, François; Balmaña, Judith; Barile, Monica; Barjhoux, Laure; Barkardottir, Rosa B; Barrdahl, Myrto; Barnes, Daniel; Barrowdale, Daniel; Baynes, Caroline; Beckmann, Matthias W; Benitez, Javier; Bermisheva, Marina; Bernstein, Leslie; Bignon, Yves-Jean; Blazer, Kathleen R; Blok, Marinus J; Blomqvist, Carl; Blot, William; Bobolis, Kristie; Boeckx, Bram; Bogdanova, Natalia V; Bojesen, Anders; Bojesen, Stig E; Bonanni, Bernardo; Børresen-Dale, Anne-Lise; Bozsik, Aniko; Bradbury, Angela R; Brand, Judith S; Brauch, Hiltrud; Brenner, Hermann; Bressac-de Paillerets, Brigitte; Brewer, Carole; Brinton, Louise; Broberg, Per; Brooks-Wilson, Angela; Brunet, Joan; Brüning, Thomas; Burwinkel, Barbara; Buys, Saundra S; Byun, Jinyoung; Cai, Qiuyin; Caldés, Trinidad; Caligo, Maria A; Campbell, Ian; Canzian, Federico; Caron, Olivier; Carracedo, Angel; Carter, Brian D; Castelao, J Esteban; Castera, Laurent; Caux-Moncoutier, Virginie; Chan, Salina B; Chang-Claude, Jenny; Chanock, Stephen J; Chen, Xiaoqing; Cheng, Ting-Yuan David; Chiquette, Jocelyne; Christiansen, Hans; Claes, Kathleen B M; Clarke, Christine L; Conner, Thomas; Conroy, Don M; Cook, Jackie; Cordina-Duverger, Emilie; Cornelissen, Sten; Coupier, Isabelle; Cox, Angela; Cox, David G; Cross, Simon S; Cuk, Katarina; Cunningham, Julie M; Czene, Kamila; Daly, Mary B; Damiola, Francesca; Darabi, Hatef; Davidson, Rosemarie; De Leeneer, Kim; Devilee, Peter; Dicks, Ed; Diez, Orland; Ding, Yuan Chun; Ditsch, Nina; Doheny, Kimberly F; Domchek, Susan M; Dorfling, Cecilia M; Dörk, Thilo; dos-Santos-Silva, Isabel; Dubois, Stéphane; Dugué, Pierre-Antoine; Dumont, Martine; Dunning, Alison M; Durcan, Lorraine; Dwek, Miriam; Dworniczak, Bernd; Eccles, Diana; Eeles, Ros; Ehrencrona, Hans; Eilber, Ursula; Ejlertsen, Bent; Ekici, Arif B; Engel, Christoph; Eriksson, Mikael; Fachal, Laura; Faivre, Laurence; Fasching, Peter A; Faust, Ulrike; Figueroa, Jonine; Flesch-Janys, Dieter; Fletcher, Olivia; Flyger, Henrik; Foulkes, William D; Friedman, Eitan; Fritschi, Lin; Frost, Debra; Gabrielson, Marike; Gaddam, Pragna; Gammon, Marilie D; Ganz, Patricia A; Gapstur, Susan M; Garber, Judy; Garcia-Barberan, Vanesa; García-Sáenz, José A; Gaudet, Mia M; Gauthier-Villars, Marion; Gehrig, Andrea; Georgoulias, Vassilios; Gerdes, Anne-Marie; Giles, Graham G; Glendon, Gord; Godwin, Andrew K; Goldberg, Mark S; Goldgar, David E; González-Neira, Anna; Goodfellow, Paul; Greene, Mark H; Grip, Mervi; Gronwald, Jacek; Grundy, Anne; Gschwantler-Kaulich, Daphne; Guénel, Pascal; Guo, Qi; Haeberle, Lothar; Hahnen, Eric; Haiman, Christopher A; Håkansson, Niclas; Hallberg, Emily; Hamann, Ute; Hamel, Nathalie; Hankinson, Susan; Hansen, Thomas V O; Harrington, Patricia; Hart, Steven N; Hartikainen, Jaana M; Healey, Catherine S; Hein, Alexander; Helbig, Sonja; Henderson, Alex; Heyworth, Jane; Hicks, Belynda; Hillemanns, Peter; Hodgson, Shirley; Hogervorst, Frans B; Hollestelle, Antoinette; Hooning, Maartje J; Hoover, Bob; Hopper, John L; Hu, Chunling; Huang, Guanmengqian; Hulick, Peter J; Humphreys, Keith; Hunter, David J; Imyanitov, Evgeny N; Isaacs, Claudine; Iwasaki, Motoki; Izatt, Louise; Jakubowska, Anna; James, Paul; Janavicius, Ramunas; Janni, Wolfgang; Jensen, Uffe Birk; John, Esther M; Johnson, Nichola; Jones, Kristine; Jones, Michael; Jukkola-Vuorinen, Arja; Kaaks, Rudolf; Kabisch, Maria; Kaczmarek, Katarzyna; Kang, Daehee; Kast, Karin; Keeman, Renske; Kerin, Michael J; Kets, Carolien M; Keupers, Machteld; Khan, Sofia; Khusnutdinova, Elza; Kiiski, Johanna I; Kim, Sung-Won; Knight, Julia A; Konstantopoulou, Irene; Kosma, Veli-Matti; Kristensen, Vessela N; Kruse, Torben A; Kwong, Ava; Lænkholm, Anne-Vibeke; Laitman, Yael; Lalloo, Fiona; Lambrechts, Diether; Landsman, Keren; Lasset, Christine; Lazaro, Conxi; Le Marchand, Loic; Lecarpentier, Julie; Lee, Andrew; Lee, Eunjung; Lee, Jong Won; Lee, Min Hyuk; Lejbkowicz, Flavio; Lesueur, Fabienne; Li, Jingmei; Lilyquist, Jenna; Lincoln, Anne; Lindblom, Annika; Lissowska, Jolanta; Lo, Wing-Yee; Loibl, Sibylle; Long, Jirong; Loud, Jennifer T; Lubinski, Jan; Luccarini, Craig; Lush, Michael; MacInnis, Robert J; Maishman, Tom; Makalic, Enes; Kostovska, Ivana Maleva; Malone, Kathleen E; Manoukian, Siranoush; Manson, JoAnn E; Margolin, Sara; Martens, John W M; Martinez, Maria Elena; Matsuo, Keitaro; Mavroudis, Dimitrios; Mazoyer, Sylvie; McLean, Catriona; Meijers-Heijboer, Hanne; Menéndez, Primitiva; Meyer, Jeffery; Miao, Hui; Miller, Austin; Miller, Nicola; Mitchell, Gillian; Montagna, Marco; Muir, Kenneth; Mulligan, Anna Marie; Mulot, Claire; Nadesan, Sue; Nathanson, Katherine L; Neuhausen, Susan L; Nevanlinna, Heli; Nevelsteen, Ines; Niederacher, Dieter; Nielsen, Sune F; Nordestgaard, Børge G; Norman, Aaron; Nussbaum, Robert L; Olah, Edith; Olopade, Olufunmilayo I; Olson, Janet E; Olswold, Curtis; Ong, Kai-ren; Oosterwijk, Jan C; Orr, Nick; Osorio, Ana; Pankratz, V Shane; Papi, Laura; Park-Simon, Tjoung-Won; Paulsson-Karlsson, Ylva; Lloyd, Rachel; Pedersen, Inge Søkilde; Peissel, Bernard; Peixoto, Ana; Perez, Jose I A; Peterlongo, Paolo; Peto, Julian; Pfeiler, Georg; Phelan, Catherine M; Pinchev, Mila; Plaseska-Karanfilska, Dijana; Poppe, Bruce; Porteous, Mary E; Prentice, Ross; Presneau, Nadege; Prokofieva, Darya; Pugh, Elizabeth; Pujana, Miquel Angel; Pylkäs, Katri; Rack, Brigitte; Radice, Paolo; Rahman, Nazneen; Rantala, Johanna; Rappaport-Fuerhauser, Christine; Rennert, Gad; Rennert, Hedy S; Rhenius, Valerie; Rhiem, Kerstin; Richardson, Andrea; Rodriguez, Gustavo C; Romero, Atocha; Romm, Jane; Rookus, Matti A; Rudolph, Anja; Ruediger, Thomas; Saloustros, Emmanouil; Sanders, Joyce; Sandler, Dale P; Sangrajrang, Suleeporn; Sawyer, Elinor J; Schmidt, Daniel F; Schoemaker, Minouk J; Schumacher, Fredrick; Schürmann, Peter; Schwentner, Lukas; Scott, Christopher; Scott, Rodney J; Seal, Sheila; Senter, Leigha; Seynaeve, Caroline; Shah, Mitul; Sharma, Priyanka; Shen, Chen-Yang; Sheng, Xin; Shimelis, Hermela; Shrubsole, Martha J; Shu, Xiao-Ou; Side, Lucy E; Singer, Christian F; Sohn, Christof; Southey, Melissa C; Spinelli, John J; Spurdle, Amanda B; Stegmaier, Christa; Stoppa-Lyonnet, Dominique; Sukiennicki, Grzegorz; Surowy, Harald; Sutter, Christian; Swerdlow, Anthony; Szabo, Csilla I; Tamimi, Rulla M; Tan, Yen Y; Taylor, Jack A; Tejada, Maria-Isabel; Tengström, Maria; Teo, Soo H; Terry, Mary B; Tessier, Daniel C; Teulé, Alex; Thöne, Kathrin; Thull, Darcy L; Tibiletti, Maria Grazia; Tihomirova, Laima; Tischkowitz, Marc; Toland, Amanda E; Tollenaar, Rob A E M; Tomlinson, Ian; Tong, Ling; Torres, Diana; Tranchant, Martine; Truong, Thérèse; Tucker, Kathy; Tung, Nadine; Tyrer, Jonathan; Ulmer, Hans-Ulrich; Vachon, Celine; van Asperen, Christi J; Van Den Berg, David; van den Ouweland, Ans M W; van Rensburg, Elizabeth J; Varesco, Liliana; Varon-Mateeva, Raymonda; Vega, Ana; Viel, Alessandra; Vijai, Joseph; Vincent, Daniel; Vollenweider, Jason; Walker, Lisa; Wang, Zhaoming; Wang-Gohrke, Shan; Wappenschmidt, Barbara; Weinberg, Clarice R; Weitzel, Jeffrey N; Wendt, Camilla; Wesseling, Jelle; Whittemore, Alice S; Wijnen, Juul T; Willett, Walter; Winqvist, Robert; Wolk, Alicja; Wu, Anna H; Xia, Lucy; Yang, Xiaohong R; Yannoukakos, Drakoulis; Zaffaroni, Daniela; Zheng, Wei; Zhu, Bin; Ziogas, Argyrios; Ziv, Elad; Zorn, Kristin K; Gago-Dominguez, Manuela; Mannermaa, Arto; Olsson, Håkan; Teixeira, Manuel R; Stone, Jennifer; Offit, Kenneth; Ottini, Laura; Park, Sue K; Thomassen, Mads; Hall, Per; Meindl, Alfons; Schmutzler, Rita K; Droit, Arnaud; Bader, Gary D; Pharoah, Paul D P; Couch, Fergus J; Easton, Douglas F; Kraft, Peter; Chenevix-Trench, Georgia; García-Closas, Montserrat; Schmidt, Marjanka K; Antoniou, Antonis C; Simard, Jacques
2018-01-01
Most common breast cancer susceptibility variants have been identified through genome-wide association studies (GWAS) of predominantly estrogen receptor (ER)-positive disease1. We conducted a GWAS using 21,468 ER-negative cases and 100,594 controls combined with 18,908 BRCA1 mutation carriers (9,414 with breast cancer), all of European origin. We identified independent associations at P < 5 × 10−8 with ten variants at nine new loci. At P < 0.05, we replicated associations with 10 of 11 variants previously reported in ER-negative disease or BRCA1 mutation carrier GWAS and observed consistent associations with ER-negative disease for 105 susceptibility variants identified by other studies. These 125 variants explain approximately 14% of the familial risk of this breast cancer subtype. There was high genetic correlation (0.72) between risk of ER-negative breast cancer and breast cancer risk for BRCA1 mutation carriers. These findings may lead to improved risk prediction and inform further fine-mapping and functional work to better understand the biological basis of ER-negative breast cancer. PMID:29058716
2010-07-01
... 30 Mineral Resources 2 2010-07-01 2010-07-01 false Mining Plan. 282.24 Section 282.24 Mineral... § 282.24 Mining Plan. All OCS mineral development and production activities shall be conducted in accordance with a Mining Plan submitted by the lessee and approved by the Director. A Mining Plan shall...
DEFF Research Database (Denmark)
Vigorito, Elena; Kuchenbaecker, Karoline B; Beesley, Jonathan
2016-01-01
Population-based genome wide association studies have identified a locus at 9p22.2 associated with ovarian cancer risk, which also modifies ovarian cancer risk in BRCA1 and BRCA2 mutation carriers. We conducted fine-scale mapping at 9p22.2 to identify potential causal variants in BRCA1 and BRCA2...... mutation carriers. Genotype data were available for 15,252 (2,462 ovarian cancer cases) BRCA1 and 8,211 (631 ovarian cancer cases) BRCA2 mutation carriers. Following genotype imputation, ovarian cancer associations were assessed for 4,873 and 5,020 SNPs in BRCA1 and BRCA 2 mutation carriers respectively...... of BNC2. In BRCA2 mutation carriers one region, up to 45 kb upstream of BNC2, and containing 100 correlated SNPs was identified as candidate causal (top SNP rs62543585, HR: 0.69, 95%CI: 0.59 to 0.80, p-value 1.0 × 10-6). The candidate causal in BRCA1 mutation carriers did not include the strongest...
Chouaid, Christos; Luciani, Laura; LeLay, Katell; Do, Pascal; Bennouna, Jaafar; Perol, Maurice; Moro-Sibilot, Denis; Vergnenègre, Alain; de Pouvourville, Gérard
2017-10-01
The irreversible ErbB family blocker afatinib and the reversible EGFR tyrosine kinase inhibitor gefitinib were compared in the multicenter, international, randomized, head-to-head phase 2b LUX-Lung 7 trial for first-line treatment of advanced EGFR mutation-positive NSCLCs. Afatinib and gefitinib costs and patients' outcomes in France were assessed. A partitioned survival model was designed to assess the cost-effectiveness of afatinib versus gefitinib for EGFR mutation-positive NSCLCs. Outcomes and safety were taken primarily from the LUX-Lung 7 trial. Resource use and utilities were derived from that trial, an expert-panel questionnaire, and published literature, limiting expenditures to direct costs. Incremental cost-effectiveness ratios (ICERs) were calculated over a 10-year time horizon for the entire population, and EGFR exon 19 deletion or exon 21 L858R mutation (L858R) subgroups. Deterministic and probabilistic sensitivity analyses were conducted. For all EGFR mutation-positive NSCLCs, the afatinib-versus-gefitinib ICER of was €45,211 per quality-adjusted life-year (QALY) (0.170 QALY gain for an incremental cost of €7697). ICERs for EGFR exon 19 deletion and L858R populations were €38,970 and €52,518, respectively. Afatinib had 100% probability to be cost-effective at a willingness-to-pay threshold of €70,000/QALY for patients with common EGFR mutations. First-line afatinib appears cost-effective compared with gefitinib for patients with EGFR mutation-positive NSCLCs. Copyright © 2017 International Association for the Study of Lung Cancer. Published by Elsevier Inc. All rights reserved.
TP53 mutation spectrum in smokers and never smoking lung cancer patients
Directory of Open Access Journals (Sweden)
Ann Rita Halvorsen
2016-05-01
Full Text Available AbstractBackground: TP53 mutations are among the most common mutations found in lung cancers, identified as an independent prognostic factor in many types of cancers. The purpose of this study was to investigate the frequency and prognostic impact of TP53 mutations in never-smokers and in different histological subtypes of lung cancer.Methods: We analysed tumour tissue from 394 non-small cell carcinomas including adenocarcinomas (n=229, squamous cell carcinomas (n=112, large cell carcinomas (n=30 and others (n=23 for mutations in TP53 by the use of Sanger sequencing (n=394 and next generation sequencing (n=100. Results: TP53 mutations were identified in 47.2% of the samples, with the highest frequency (65% of mutations among squamous cell carcinomas. Among never-smokers, 36% carried a TP53 mutation, identified as a significant independent negative prognostic factor in this subgroup. For large cell carcinomas, a significantly prolonged progression free survival was found for those carrying a TP53 mutation. In addition, the frequency of frameshift mutations was doubled in squamous cell carcinomas (20.3% compared to adenocarcinomas (9.1%.Conclusion: TP53 mutation patterns differ between the histological subgroups of lung cancers, as also influenced by smoking history. This indicates that the histological subtypes in lung cancer are genetically different, and that smoking-induced TP53 mutations may have a different biological impact than TP53 mutations occurring in never-smokers.
30 CFR 282.26 - Contingency Plan.
2010-07-01
... 30 Mineral Resources 2 2010-07-01 2010-07-01 false Contingency Plan. 282.26 Section 282.26 Mineral... § 282.26 Contingency Plan. (a) When required by the Director, a lessee shall include a Contingency Plan as part of its request for approval of a Delineation, Testing, or Mining Plan. The Contingency Plan...
Common genetic variants and modification of penetrance of BRCA2-associated breast cancer
DEFF Research Database (Denmark)
Gaudet, Mia M; Kirchhoff, Tomas; Green, Todd
2010-01-01
The considerable uncertainty regarding cancer risks associated with inherited mutations of BRCA2 is due to unknown factors. To investigate whether common genetic variants modify penetrance for BRCA2 mutation carriers, we undertook a two-staged genome-wide association study in BRCA2 mutation carri...
Common genetic variants and modification of penetrance of BRCA2-associated breast cancer
DEFF Research Database (Denmark)
Gaudet, Mia M; Kirchhoff, Tomas; Green, Todd
2010-01-01
The considerable uncertainty regarding cancer risks associated with inherited mutations of BRCA2 is due to unknown factors. To investigate whether common genetic variants modify penetrance for BRCA2 mutation carriers, we undertook a two-staged genome-wide association study in BRCA2 mutation...
Yaeger, Rona; Shah, Manish A; Miller, Vincent A; Kelsen, Judith R; Wang, Kai; Heins, Zachary J; Ross, Jeffrey S; He, Yuting; Sanford, Eric; Yantiss, Rhonda K; Balasubramanian, Sohail; Stephens, Philip J; Schultz, Nikolaus; Oren, Moshe; Tang, Laura; Kelsen, David
2016-08-01
Patients with inflammatory bowel diseases, such as Crohn's disease (CD) and ulcerative colitis (UC), are at increased risk for small bowel or colorectal cancers (colitis-associated cancers [CACs]). We compared the spectrum of genomic alterations in CACs with those of sporadic colorectal cancers (CRCs) and investigated differences between CACs from patients with CD vs UC. We studied tumor tissues from patients with CACs treated at Memorial Sloan Kettering Cancer Center or Weill Cornell Medical College from 2003 through 2015. We performed hybrid capture-based next-generation sequencing analysis of >300 cancer-related genes to comprehensively characterize genomic alterations. We performed genomic analyses of 47 CACs (from 29 patients with UC and 18 with CD; 43 primary tumors and 4 metastases). Primary tumors developed in the ileum (n = 2), right colon (n = 18), left colon (n = 6), and rectosigmoid or rectum (n = 21). We found genomic alterations in TP53, IDH1, and MYC to be significantly more frequent, and mutations in APC to be significantly less frequent, than those reported in sporadic CRCs by The Cancer Genome Atlas or Foundation Medicine. We identified genomic alterations that might be targeted by a therapeutic agent in 17 of 47 (36%) CACs. These included the mutation encoding IDH1 R132; amplification of FGFR1, FGFR2, and ERBB2; and mutations encoding BRAF V600E and an EML4-ALK fusion protein. Alterations in IDH1 and APC were significantly more common in CACs from patients with CD than UC. In an analysis of CACs from 47 patients, we found significant differences in the spectrum of genomic alterations in CACs compared with sporadic CRCs. We observed a high frequency of IDH1 R132 mutations in patients with CD but not UC, as well as a high frequency of MYC amplification in CACs. Many genetic alterations observed in CACs could serve as therapeutic targets. Copyright © 2016 AGA Institute. Published by Elsevier Inc. All rights reserved.
Ghorbanoghli, Z; Nieuwenhuis, M H; Houwing-Duistermaat, J J; Jagmohan-Changur, S; Hes, F J; Tops, C M; Wagner, A; Aalfs, C M; Verhoef, S; Gómez García, E B; Sijmons, R H; Menko, F H; Letteboer, T G; Hoogerbrugge, N; van Wezel, T; Vasen, H F A; Wijnen, J T
2016-10-01
Familial adenomatous polyposis (FAP) is a dominantly inherited syndrome caused by germline mutations in the APC gene and characterized by the development of multiple colorectal adenomas and a high risk of developing colorectal cancer (CRC). The severity of polyposis is correlated with the site of the APC mutation. However, there is also phenotypic variability within families with the same underlying APC mutation, suggesting that additional factors influence the severity of polyposis. Genome-wide association studies identified several single nucleotide polymorphisms (SNPs) that are associated with CRC. We assessed whether these SNPs are associated with polyp multiplicity in proven APC mutation carriers. Sixteen CRC-associated SNPs were analysed in a cohort of 419 APC germline mutation carriers from 182 families. Clinical data were retrieved from the Dutch Polyposis Registry. Allele frequencies of the SNPs were compared for patients with APC genotype as a covariate. We found a trend of association of two of the tested SNPs with the ≥100 adenoma phenotype: the C alleles of rs16892766 at 8q23.3 (OR 1.71, 95 % CI 1.05-2.76, p = 0.03, dominant model) and rs3802842 at 11q23.1 (OR 1.51, 95 % CI 1.03-2.22, p = 0.04, dominant model). We identified two risk variants that are associated with a more severe phenotype in APC mutation carriers. These risk variants may partly explain the phenotypic variability in families with the same APC gene defect. Further studies with a larger sample size are recommended to evaluate and confirm the phenotypic effect of these SNPs in FAP.
Kishore, Ayush; Hall, Randy A
2017-06-09
Mutations to the adhesion G protein-coupled receptor ADGRG1 (G1; also known as GPR56) underlie the neurological disorder bilateral frontoparietal polymicrogyria. Disease-associated mutations in G1 studied to date are believed to induce complete loss of receptor function through disruption of either receptor trafficking or signaling activity. Given that N-terminal truncation of G1 and other adhesion G protein-coupled receptors has been shown to significantly increase the receptors' constitutive signaling, we examined two different bilateral frontoparietal polymicrogyria-inducing extracellular loop mutations (R565W and L640R) in the context of both full-length and N-terminally truncated (ΔNT) G1. Interestingly, we found that these mutations reduced surface expression of full-length G1 but not G1-ΔNT in HEK-293 cells. Moreover, the mutations ablated receptor-mediated activation of serum response factor luciferase, a classic measure of Gα 12/13 -mediated signaling, but had no effect on G1-mediated signaling to nuclear factor of activated T cells (NFAT) luciferase. Given these differential signaling results, we sought to further elucidate the pathway by which G1 can activate NFAT luciferase. We found no evidence that ΔNT activation of NFAT is dependent on Gα q/11 -mediated or β-arrestin-mediated signaling but rather involves liberation of Gβγ subunits and activation of calcium channels. These findings reveal that disease-associated mutations to the extracellular loops of G1 differentially alter receptor trafficking, depending on the presence of the N terminus, and differentially alter signaling to distinct downstream pathways. © 2017 by The American Society for Biochemistry and Molecular Biology, Inc.
RAD51C germline mutations in breast and ovarian cancer cases from high-risk families.
Directory of Open Access Journals (Sweden)
Jessica Clague
Full Text Available BRCA1 and BRCA2 are the most well-known breast cancer susceptibility genes. Additional genes involved in DNA repair have been identified as predisposing to breast cancer. One such gene, RAD51C, is essential for homologous recombination repair. Several likely pathogenic RAD51C mutations have been identified in BRCA1- and BRCA2-negative breast and ovarian cancer families. We performed complete sequencing of RAD51C in germline DNA of 286 female breast and/or ovarian cancer cases with a family history of breast and ovarian cancers, who had previously tested negative for mutations in BRCA1 and BRCA2. We screened 133 breast cancer cases, 119 ovarian cancer cases, and 34 with both breast and ovarian cancers. Fifteen DNA sequence variants were identified; including four intronic, one 5' UTR, one promoter, three synonymous, and six non-synonymous variants. None were truncating. The in-silico SIFT and Polyphen programs were used to predict possible pathogenicity of the six non-synonomous variants based on sequence conservation. G153D and T287A were predicted to be likely pathogenic. Two additional variants, A126T and R214C alter amino acids in important domains of the protein such that they could be pathogenic. Two-hybrid screening and immunoblot analyses were performed to assess the functionality of these four non-synonomous variants in yeast. The RAD51C-G153D protein displayed no detectable interaction with either XRCC3 or RAD51B, and RAD51C-R214C displayed significantly decreased interaction with both XRCC3 and RAD51B (p<0.001. Immunoblots of RAD51C-Gal4 activation domain fusion peptides showed protein levels of RAD51C-G153D and RAD51C-R214C that were 50% and 60% of the wild-type, respectively. Based on these data, the RAD51C-G153D variant is likely to be pathogenic, while the RAD51C- R214C variant is hypomorphic of uncertain pathogenicity. These results provide further support that RAD51C is a rare breast and ovarian cancer susceptibility gene.
The role of mutation in the new cancer paradigm
Directory of Open Access Journals (Sweden)
Prehn Richmond T
2005-04-01
Full Text Available Abstract The almost universal belief that cancer is caused by mutation may gradually be giving way to the belief that cancer begins as a cellular adaptation that involves the local epigenetic silencing of various genes. In my own interpretation of the new epigenetic paradigm, the genes epigenetically suppressed are genes that normally serve in post-embryonic life to suppress and keep suppressed those other genes upon which embryonic development depends. Those other genes, if not silenced or suppressed in the post-embryonic animal, become, I suggest, the oncogenes that are the basis of neoplasia. Mutations that occur in silenced genes supposedly go unrepaired and are, therefore, postulated to accumulate, but such mutations probably play little or no causative role in neoplasia because they occur in already epigenetically silenced genes. These mutations probably often serve to make the silencing, and therefore the cancer, epigenetically irreversible.
Fat and K-ras mutations in sporadic colorectal cancer in The Netherlands Cohort Study
Brink, M.; Weijenberg, M.P.; Goeij, A.F.P.M. de; Schouten, L.J.; Koedijk, F.D.H.; Roemen, G.M.J.M.; Lentjes, M.H.F.M.; Bruïne, A.P. de; Goldbohm, R.A.; Brandt, P.A. van den
2004-01-01
Associations between dietary intake of various fats and specific K-ras mutations in colorectal cancer (CRC) were investigated within the framework of The Netherlands Cohort Study on diet and cancer (NLCS). After 7.3 years of follow-up and with exclusion of the first 2.3 years, 448 colon and 160
A Novel MAPT Mutation, G55R, in a Frontotemporal Dementia Patient Leads to Altered Tau Function
Guzman, Elmer; Barczak, Anna; Chodakowska-Żebrowska, Małgorzata; Barcikowska, Maria; Feinstein, Stuart
2013-01-01
Over two dozen mutations in the gene encoding the microtubule associated protein tau cause a variety of neurodegenerative dementias known as tauopathies, including frontotemporal dementia (FTD), PSP, CBD and Pick's disease. The vast majority of these mutations map to the C-terminal region of tau possessing microtubule assembly and microtubule dynamics regulatory activities as well as the ability to promote pathological tau aggregation. Here, we describe a novel and non-conservative tau mutation (G55R) mapping to an alternatively spliced exon encoding part of the N-terminal region of the protein in a patient with the behavioral variant of FTD. Although less well understood than the C-terminal region of tau, the N-terminal region can influence both MT mediated effects as well as tau aggregation. The mutation changes an uncharged glycine to a basic arginine in the midst of a highly conserved and very acidic region. In vitro, 4-repeat G55R tau nucleates microtubule assembly more effectively than wild-type 4-repeat tau; surprisingly, this effect is tau isoform specific and is not observed in a 3-repeat G55R tau versus 3-repeat wild-type tau comparison. In contrast, the G55R mutation has no effect upon the abilities of tau to regulate MT growing and shortening dynamics or to aggregate. Additionally, the mutation has no effect upon kinesin translocation in a microtubule gliding assay. Together, (i) we have identified a novel tau mutation mapping to a mutation deficient region of the protein in a bvFTD patient, and (ii) the G55R mutation affects the ability of tau to nucleate microtubule assembly in vitro in a 4-repeat tau isoform specific manner. This altered capability could markedly affect in vivo microtubule function and neuronal cell biology. We consider G55R to be a candidate mutation for bvFTD since additional criteria required to establish causality are not yet available for assessment. PMID:24086739
Yap, Kai Lee; Kiyotani, Kazuma; Tamura, Kenji; Antic, Tatjana; Jang, Miran; Montoya, Magdeline; Campanile, Alexa; Yew, Poh Yin; Ganshert, Cory; Fujioka, Tomoaki; Steinberg, Gary D; O'Donnell, Peter H; Nakamura, Yusuke
2014-12-15
Because of suboptimal outcomes in muscle-invasive bladder cancer even with multimodality therapy, determination of potential genetic drivers offers the possibility of improving therapeutic approaches and discovering novel prognostic indicators. Using pTN staging, we case-matched 81 patients with resected ≥pT2 bladder cancers for whom perioperative chemotherapy use and disease recurrence status were known. Whole-exome sequencing was conducted in 43 cases to identify recurrent somatic mutations and targeted sequencing of 10 genes selected from the initial screening in an additional 38 cases was completed. Mutational profiles along with clinicopathologic information were correlated with recurrence-free survival (RFS) in the patients. We identified recurrent novel somatic mutations in the gene UNC5C (9.9%), in addition to TP53 (40.7%), KDM6A (21.0%), and TSC1 (12.3%). Patients who were carriers of somatic mutations in DNA repair genes (one or more of ATM, ERCC2, FANCD2, PALB2, BRCA1, or BRCA2) had a higher overall number of somatic mutations (P = 0.011). Importantly, after a median follow-up of 40.4 months, carriers of somatic mutations (n = 25) in any of these six DNA repair genes had significantly enhanced RFS compared with noncarriers [median, 32.4 vs. 14.8 months; hazard ratio of 0.46, 95% confidence interval (CI), 0.22-0.98; P = 0.0435], after adjustment for pathologic pTN staging and independent of adjuvant chemotherapy usage. Better prognostic outcomes of individuals carrying somatic mutations in DNA repair genes suggest these mutations as favorable prognostic events in muscle-invasive bladder cancer. Additional mechanistic investigation into the previously undiscovered role of UNC5C in bladder cancer is warranted. ©2014 American Association for Cancer Research.
Prostate cancer in a male with Holt-Oram syndrome: first clinical association of the TBX5 mutation.
LENUS (Irish Health Repository)
Aherne, Noel J
2013-08-05
Holt-Oram syndrome is an autosomal dominant disorder which is caused by mutations of TBX5 and is characterised by cardiac and skeletal abnormalities. TBX5 is part of the T-box gene family and is thought to upregulate tumour cell proliferation and metastasis when mutated. We report the first clinical case of prostate cancer in an individual with Holt Oram syndrome.
Yurgelun, Matthew B; Allen, Brian; Kaldate, Rajesh R; Bowles, Karla R; Judkins, Thaddeus; Kaushik, Praveen; Roa, Benjamin B; Wenstrup, Richard J; Hartman, Anne-Renee; Syngal, Sapna
2015-09-01
Multigene panels are commercially available tools for hereditary cancer risk assessment that allow for next-generation sequencing of numerous genes in parallel. However, it is not clear if these panels offer advantages over traditional genetic testing. We investigated the number of cancer predisposition gene mutations identified by parallel sequencing in individuals with suspected Lynch syndrome. We performed germline analysis with a 25-gene, next-generation sequencing panel using DNA from 1260 individuals who underwent clinical genetic testing for Lynch syndrome from 2012 through 2013. All patients had a history of Lynch syndrome-associated cancer and/or polyps. We classified all identified germline alterations for pathogenicity and calculated the frequencies of pathogenic mutations and variants of uncertain clinical significance (VUS). We also analyzed data on patients' personal and family history of cancer, including fulfillment of clinical guidelines for genetic testing. Of the 1260 patients, 1112 met National Comprehensive Cancer Network (NCCN) criteria for Lynch syndrome testing (88%; 95% confidence interval [CI], 86%-90%). Multigene panel testing identified 114 probands with Lynch syndrome mutations (9.0%; 95% CI, 7.6%-10.8%) and 71 with mutations in other cancer predisposition genes (5.6%; 95% CI, 4.4%-7.1%). Fifteen individuals had mutations in BRCA1 or BRCA2; 93% of these met the NCCN criteria for Lynch syndrome testing and 33% met NCCN criteria for BRCA1 and BRCA2 analysis (P = .0017). An additional 9 individuals carried mutations in other genes linked to high lifetime risks of cancer (5 had mutations in APC, 3 had bi-allelic mutations in MUTYH, and 1 had a mutation in STK11); all of these patients met NCCN criteria for Lynch syndrome testing. A total of 479 individuals had 1 or more VUS (38%; 95% CI, 35%-41%). In individuals with suspected Lynch syndrome, multigene panel testing identified high-penetrance mutations in cancer predisposition genes, many
Directory of Open Access Journals (Sweden)
Javier Martinez-Useros
2016-01-01
Full Text Available Pancreatic cancer is one of the deadliest cancers worldwide, and life expectancy after diagnosis is often short. Most pancreatic tumours appear sporadically and have been highly related to habits such as cigarette smoking, high alcohol intake, high carbohydrate, and sugar consumption. Other observational studies have suggested the association between pancreatic cancer and exposure to arsenic, lead, or cadmium. Aside from these factors, chronic pancreatitis and diabetes have also come to be considered as risk factors for these kinds of tumours. Studies have found that 10% of pancreatic cancer cases arise from an inherited syndrome related to some genetic alterations. One of these alterations includes mutation in BRCA2 gene. BRCA2 mutations impair DNA damage response and homologous recombination by direct regulation of RAD51. In light of these findings that link genetic factors to tumour development, DNA damage agents have been proposed as target therapies for pancreatic cancer patients carrying BRCA2 mutations. Some of these drugs include platinum-based agents and PARP inhibitors. However, the acquired resistance to PARP inhibitors has created a need for new chemotherapeutic strategies to target BRCA2. The present systematic review collects and analyses the role of BRCA2 alterations to be used in early diagnosis of an inherited syndrome associated with familiar cancer and as a prognostic and predictive biomarker for the management of pancreatic cancer patients.
Breast and Ovarian Cancer Risk and Risk Reduction in Jewish BRCA1/2 Mutation Carriers
Finkelman, Brian S.; Rubinstein, Wendy S.; Friedman, Sue; Friebel, Tara M.; Dubitsky, Shera; Schonberger, Niecee Singer; Shoretz, Rochelle; Singer, Christian F.; Blum, Joanne L.; Tung, Nadine; Olopade, Olufunmilayo I.; Weitzel, Jeffrey N.; Lynch, Henry T.; Snyder, Carrie; Garber, Judy E.; Schildkraut, Joellen; Daly, Mary B.; Isaacs, Claudine; Pichert, Gabrielle; Neuhausen, Susan L.; Couch, Fergus J.; van't Veer, Laura; Eeles, Rosalind; Bancroft, Elizabeth; Evans, D. Gareth; Ganz, Patricia A.; Tomlinson, Gail E.; Narod, Steven A.; Matloff, Ellen; Domchek, Susan; Rebbeck, Timothy R.
2012-01-01
Purpose Mutations in BRCA1/2 dramatically increase the risk of both breast and ovarian cancers. Three mutations in these genes (185delAG, 5382insC, and 6174delT) occur at high frequency in Ashkenazi Jews. We evaluated how these common Jewish mutations (CJMs) affect cancer risks and risk reduction. Methods Our cohort comprised 4,649 women with disease-associated BRCA1/2 mutations from 22 centers in the Prevention and Observation of Surgical End Points Consortium. Of these women, 969 were self-identified Jewish women. Cox proportional hazards models were used to estimate breast and ovarian cancer risks, as well as risk reduction from risk-reducing salpingo-oophorectomy (RRSO), by CJM and self-identified Jewish status. Results Ninety-one percent of Jewish BRCA1/2-positive women carried a CJM. Jewish women were significantly more likely to undergo RRSO than non-Jewish women (54% v 41%, respectively; odds ratio, 1.87; 95% CI, 1.44 to 2.42). Relative risks of cancer varied by CJM, with the relative risk of breast cancer being significantly lower in 6174delT mutation carriers than in non-CJM BRCA2 carriers (hazard ratio, 0.35; 95% CI, 0.18 to 0.69). No significant difference was seen in cancer risk reduction after RRSO among subgroups. Conclusion Consistent with previous results, risks for breast and ovarian cancer varied by CJM in BRCA1/2 carriers. In particular, 6174delT carriers had a lower risk of breast cancer. This finding requires additional confirmation in larger prospective and population-based cohort studies before being integrated into clinical care. PMID:22430266
Cancer risks for MLH1 and MSH2 mutation carriers
Dowty, James G.; Win, Aung K.; Buchanan, Daniel D.; Lindor, Noralane M.; Macrae, Finlay A.; Clendenning, Mark; Antill, Yoland C.; Thibodeau, Stephen N.; Casey, Graham; Gallinger, Steve; Le Marchand, Loic; Newcomb, Polly A.; Haile, Robert W.; Young, Graeme P.; James, Paul A.
2013-01-01
We studied 17,576 members of 166 MLH1 and 224 MSH2 mutation-carrying families from the Colon Cancer Family Registry. Average cumulative risks of colorectal cancer (CRC), endometrial cancer (EC) and other cancers for carriers were estimated using modified segregation analysis conditioned on ascertainment criteria. Heterogeneity in risks was investigated using a polygenic risk modifier. Average CRC cumulative risks to age 70 years (95% confidence intervals) for MLH1 and MSH2 mutation carriers, ...
LaConte, Leslie E W; Chavan, Vrushali; Elias, Abdallah F; Hudson, Cynthia; Schwanke, Corbin; Styren, Katie; Shoof, Jonathan; Kok, Fernando; Srivastava, Sarika; Mukherjee, Konark
2018-03-01
Deletion and truncation mutations in the X-linked gene CASK are associated with severe intellectual disability (ID), microcephaly and pontine and cerebellar hypoplasia in girls (MICPCH). The molecular origin of CASK-linked MICPCH is presumed to be due to disruption of the CASK-Tbr-1 interaction. This hypothesis, however, has not been directly tested. Missense variants in CASK are typically asymptomatic in girls. We report three severely affected girls with heterozygous CASK missense mutations (M519T (2), G659D (1)) who exhibit ID, microcephaly, and hindbrain hypoplasia. The mutation M519T results in the replacement of an evolutionarily invariant methionine located in the PDZ signaling domain known to be critical for the CASK-neurexin interaction. CASK M519T is incapable of binding to neurexin, suggesting a critically important role for the CASK-neurexin interaction. The mutation G659D is in the SH3 (Src homology 3) domain of CASK, replacing a semi-conserved glycine with aspartate. We demonstrate that the CASK G659D mutation affects the CASK protein in two independent ways: (1) it increases the protein's propensity to aggregate; and (2) it disrupts the interface between CASK's PDZ (PSD95, Dlg, ZO-1) and SH3 domains, inhibiting the CASK-neurexin interaction despite residing outside of the domain deemed critical for neurexin interaction. Since heterozygosity of other aggregation-inducing mutations (e.g., CASK W919R ) does not produce MICPCH, we suggest that the G659D mutation produces microcephaly by disrupting the CASK-neurexin interaction. Our results suggest that disruption of the CASK-neurexin interaction, not the CASK-Tbr-1 interaction, produces microcephaly and cerebellar hypoplasia. These findings underscore the importance of functional validation for variant classification.
Chaudhari, Aditi; Krumlinde, Daniel; Lundqvist, Annika; Akyürek, Levent M; Bandaru, Sashidhar; Skålén, Kristina; Ståhlman, Marcus; Borén, Jan; Wettergren, Yvonne; Ejeskär, Katarina; Rotter Sopasakis, Victoria
2015-10-01
The phosphatidylinositol-4,5-bisphosphate 3-kinase (PI3K) catalytic subunit p110α is the most frequently mutated kinase in human cancer, and the hot spot mutations E542K, E545K, and H1047R are the most common mutations in p110α. Very little is known about the metabolic consequences of the hot spot mutations of p110α in vivo. In this study, we used adenoviral gene transfer in mice to investigate the effects of the E545K and H1047R mutations on hepatic and whole-body glucose metabolism. We show that hepatic expression of these hot spot mutations results in rapid hepatic steatosis, paradoxically accompanied by increased glucose tolerance, and marked glycogen accumulation. In contrast, wild-type p110α expression does not lead to hepatic accumulation of lipids or glycogen despite similar degrees of upregulated glycolysis and expression of lipogenic genes. The reprogrammed metabolism of the E545K and H1047R p110α mutants was surprisingly not dependent on altered p110α lipid kinase activity. Copyright © 2015, American Society for Microbiology. All Rights Reserved.
Kobayashi, Yoshihisa; Togashi, Yosuke; Yatabe, Yasushi; Mizuuchi, Hiroshi; Jangchul, Park; Kondo, Chiaki; Shimoji, Masaki; Sato, Katsuaki; Suda, Kenichi; Tomizawa, Kenji; Takemoto, Toshiki; Hida, Toyoaki; Nishio, Kazuto; Mitsudomi, Tetsuya
2015-12-01
Lung cancers harboring common EGFR mutations respond to EGFR tyrosine kinase inhibitors (TKI), whereas exon 20 insertions (Ins20) are resistant to them. However, little is known about mutations in exon 18. Mutational status of lung cancers between 2001 and 2015 was reviewed. Three representative mutations in exon 18, G719A, E709K, and exon 18 deletion (Del18: delE709_T710insD) were retrovirally introduced into Ba/F3 and NIH/3T3 cells. The 90% inhibitory concentrations (IC90s) of first-generation (1G; gefitinib and erlotinib), second-generation (2G; afatinib, dacomitinib, and neratinib), and third-generation TKIs (3G; AZD9291 and CO1686) were determined. Among 1,402 EGFR mutations, Del19, L858R, and Ins20 were detected in 40%, 47%, and 4%, respectively. Exon 18 mutations, including G719X, E709X, and Del18, were present in 3.2%. Transfected Ba/F3 cells grew in the absence of IL3, and NIH/3T3 cells formed foci with marked pile-up, indicating their oncogenic abilities. IC90s of 1G and 3G TKIs in G719A, E709K, and Del18 were much higher than those in Del19 (by >11-50-fold), whereas IC90s of afatinib were only 3- to 7-fold greater than those for Del19. Notably, cells transfected with G719A and E709K exhibited higher sensitivity to neratinib (by 5-25-fold) than those expressing Del19. Patients with lung cancers harboring G719X exhibited higher response rate to afatinib or neratinib (∼ 80%) than to 1G TKIs (35%-56%) by compilation of data in the literature. Lung cancers harboring exon 18 mutations should not be overlooked in clinical practice. These cases can be best treated with afatinib or neratinib, although the currently available in vitro diagnostic kits cannot detect all exon 18 mutations. ©2015 American Association for Cancer Research.
TP53 Mutations in Nonsmall Cell Lung Cancer
Directory of Open Access Journals (Sweden)
Akira Mogi
2011-01-01
Full Text Available The tumor suppressor gene TP53 is frequently mutated in human cancers. Abnormality of the TP53 gene is one of the most significant events in lung cancers and plays an important role in the tumorigenesis of lung epithelial cells. Human lung cancers are classified into two major types, small cell lung cancer (SCLC and nonsmall cell lung cancer (NSCLC. The latter accounts for approximately 80% of all primary lung cancers, and the incidence of NSCLC is increasing yearly. Most clinical studies suggest that NSCLC with TP53 alterations carries a worse prognosis and may be relatively more resistant to chemotherapy and radiation. A deep understanding of the role of TP53 in lung carcinogenesis may lead to a more reasonably targeted clinical approach, which should be exploited to enhance the survival rates of patients with lung cancer. This paper will focus on the role of TP53 in the molecular pathogenesis, epidemiology, and therapeutic strategies of TP53 mutation in NSCLC.
Spectrum of K ras mutations in Pakistani colorectal cancer patients
International Nuclear Information System (INIS)
Murtaza, B.N.; Bibi, A.; Rashid, M.U.; Khan, Y.I.; Chaudri, M.S.; Shakoori, A.R.
2013-01-01
The incidence of colorectal cancer (CRC) is increasing daily worldwide. Although different aspects of CRC have been studied in other parts of the world, relatively little or almost no information is available in Pakistan about different aspects of this disease at the molecular level. The present study was aimed at determining the frequency and prevalence of K ras gene mutations in Pakistani CRC patients. Tissue and blood samples of 150 CRC patients (64% male and 36% female) were used for PCR amplification of K ras and detection of mutations by denaturing gradient gel electrophoresis, restriction fragment length polymorphism analysis, and nucleotide sequencing. The K ras mutation frequency was found to be 13%, and the most prevalent mutations were found at codons 12 and 13. A novel mutation was also found at codon 31. The dominant mutation observed was a G to A transition. Female patients were more susceptible to K ras mutations, and these mutations were predominant in patients with a nonmetastatic stage of CRC. No significant differences in the prevalence of K ras mutations were observed for patient age, gender, or tumor type. It can be inferred from this study that Pakistani CRC patients have a lower frequency of K ras mutations compared to those observed in other parts of the world, and that K ras mutations seemed to be significantly associated with female patients
Spectrum of K ras mutations in Pakistani colorectal cancer patients
Energy Technology Data Exchange (ETDEWEB)
Murtaza, B.N.; Bibi, A. [School of Biological Sciences, University of the Punjab, Quaid-i-Azam Campus, Lahore (Pakistan); Rashid, M.U.; Khan, Y.I. [Shaukat Khanum Memorial Cancer Hospital and Research Centre, Johar Town, Lahore (Pakistan); Chaudri, M.S. [Services Institute of Medical Sciences, Lahore (Pakistan); Shakoori, A.R. [School of Biological Sciences, University of the Punjab, Quaid-i-Azam Campus, Lahore (Pakistan)
2013-11-29
The incidence of colorectal cancer (CRC) is increasing daily worldwide. Although different aspects of CRC have been studied in other parts of the world, relatively little or almost no information is available in Pakistan about different aspects of this disease at the molecular level. The present study was aimed at determining the frequency and prevalence of K ras gene mutations in Pakistani CRC patients. Tissue and blood samples of 150 CRC patients (64% male and 36% female) were used for PCR amplification of K ras and detection of mutations by denaturing gradient gel electrophoresis, restriction fragment length polymorphism analysis, and nucleotide sequencing. The K ras mutation frequency was found to be 13%, and the most prevalent mutations were found at codons 12 and 13. A novel mutation was also found at codon 31. The dominant mutation observed was a G to A transition. Female patients were more susceptible to K ras mutations, and these mutations were predominant in patients with a nonmetastatic stage of CRC. No significant differences in the prevalence of K ras mutations were observed for patient age, gender, or tumor type. It can be inferred from this study that Pakistani CRC patients have a lower frequency of K ras mutations compared to those observed in other parts of the world, and that K ras mutations seemed to be significantly associated with female patients.
Directory of Open Access Journals (Sweden)
Yi-Hua Yao
2018-03-01
Full Text Available AIM: To identify the mutations of MYOC, OPTN, CYP1B1 and WDR36 in a large Chinese family affected by juvenile open angle glaucoma (JOAG. METHODS: Of 114 members of one family were recruited in this study. Blood samples from twelve members of this pedigree were collected for further research. As a control, 100 unrelated subjects were recruited from the same hospital. The exon and flanking intron sequences of candidate genes were amplified using the polymerase chain reaction and direct DNA sequencing. RESULTS: The proband (III:10 was a seventy-three years old woman with binocular JOAG at the age of 31. A recurrent heterozygous mutation (c.1099G>A of MYOC was identified in the three JOAG patients and another suspect. This transition was located in the first base pair of codon 367 (GGA>AGA in exon 3 of MYOC and was predicted to be a missense substitution of glycine to arginine (p.G367R in myocilin. Mutations in OPTN, CYP1B1 or WDR36 were not detected in this study. The G367R mutation was not present in unaffected family members or in 100 ethnically matched controls. Other variants of the coding regions of candidate genes were not detected in all participants. To date, this family was the largest to have been identified as carrying a certain MYOC mutation in China, further evidence of a founder effect for the G367R MYOC mutant was provided by our data. CONCLUSION: A MYOC c.1099G>A mutation in an autosomal dominant JOAG family is identified and the characteristic phenotypes among the patients are summarized. Genetic testing could be utilized in high-risk populations and be helpful not only for genetic counseling, but also for early diagnosis and treatment of affected patients or carriers of inherited JOAG.
Directory of Open Access Journals (Sweden)
Jun Yin
Full Text Available Esophageal cancer is the eighth most common cancer and sixth leading cause of cancer associated death worldwide. Besides environmental risk factors, genetic factors might play an important role in the esophageal cancer carcinogenesis. We conducted a hospital based case-control study to evaluate the genetic susceptibility of functional single nucleotide polymorphisms (SNPs in the microRNAs on the development of esophageal cancer. A total of 629 esophageal squamous cell carcinoma (ESCC cases and 686 controls were recruited for this study. The hsa-miR-34b/c rs4938723 T>C, pri-miR-124-1 rs531564 C>G, pre-miR-125a rs12975333 G>T and hsa-miR-423 rs6505162 C>A genotypes were determined using Ligation Detection Reaction (LDR method. Our results demonstrated that hsa-miR-34b/c rs4938723 CC genotype had a decreased risk of ESCC. The association was evident among patients who never drinking. Hsa-miR-423 rs6505162 C>A might associated with a significantly increased risk of ESCC in patients who smoking. These findings indicated that functional polymorphisms hsa-miR-34b/c rs4938723 T>C and hsa-miR-423 rs6505162 C>A might alter individual susceptibility to ESCC. However, our results were obtained with a limited sample size. Future larger studies with other ethnic populations are required to confirm current findings.
HFE mutations and hemochromatosis in Danish patients admitted for HFE genotyping
DEFF Research Database (Denmark)
Koefoed, P; Dalhoff, K; Dissing, J
2002-01-01
Analysis of the common C282Y and H63D mutations in the HFE gene is widely used to diagnose hereditary hemochromatosis (HH). The aim of this study was to evaluate the efficiency with which different hospitals and general practitioners select patients for HH genotype and to determine the distribution...... of HFE mutations in such patients. Nine hundred unrelated patients from Danish hospitals and general practitioners (group A) and 69 consecutive patients from a specialized liver unit (group B) were examined for HFE substitutions using multiplex real-time polymerase chain reaction. In group A we found 13...... in the H63D homozygotes or S65C heterozygotes. Moreover, 7 wild-type patients, 2 C282Y heterozygote patients and one H63D heterozygote patient fulfilled the criteria for HH. The significant enrichment of HH among associated genotype samples submitted for HFE testing indicates that the clinical selection...
Germ line p53 mutations in a familial syndrome of breast cancer, sarcomas, and other neoplasms.
Malkin, D; Li, F P; Strong, L C; Fraumeni, J F; Nelson, C E; Kim, D H; Kassel, J; Gryka, M A; Bischoff, F Z; Tainsky, M A
1990-11-30
Familial cancer syndromes have helped to define the role of tumor suppressor genes in the development of cancer. The dominantly inherited Li-Fraumeni syndrome (LFS) is of particular interest because of the diversity of childhood and adult tumors that occur in affected individuals. The rarity and high mortality of LFS precluded formal linkage analysis. The alternative approach was to select the most plausible candidate gene. The tumor suppressor gene, p53, was studied because of previous indications that this gene is inactivated in the sporadic (nonfamilial) forms of most cancers that are associated with LFS. Germ line p53 mutations have been detected in all five LFS families analyzed. These mutations do not produce amounts of mutant p53 protein expected to exert a trans-dominant loss of function effect on wild-type p53 protein. The frequency of germ line p53 mutations can now be examined in additional families with LFS, and in other cancer patients and families with clinical features that might be attributed to the mutation.
Directory of Open Access Journals (Sweden)
Novakovic Srdjan
2008-09-01
Full Text Available Abstract Background Both recurrent and population specific mutations have been found in different areas of the world and more specifically in ethnically defined or isolated populations. The population of Slovenia has over several centuries undergone limited mixing with surrounding populations. The current study was aimed at establishing the mutation spectrum of BRCA1/2 in the Slovenian breast/ovarian cancer families taking advantage of a complete cancer registration database. A second objective was to determine the cancer phenotype of these families. Methods The original population database was composed of cancer patients from the Institute of Oncology Ljubljana in Slovenia which also includes current follow-up status on these patients. The inclusion criteria for the BRCA1/2 screening were: (i probands with at least two first degree relatives with breast and ovarian cancer; (ii probands with only two first degree relatives of breast cancer where one must be diagnosed less than 50 years of age; and (iii individual patients with breast and ovarian cancer, bilateral breast cancer, breast cancer diagnosed before the age of 40 and male breast cancer without any other cancer in the family. Results Probands from 150 different families met the inclusion criteria for mutation analysis of which 145 consented to testing. A BRCA1/2 mutation was found in 56 (39%. Two novel large deletions covering consecutive exons of BRCA1 were found. Five highly recurrent specific mutations were identified (1806C>T, 300T>G, 300T>A, 5382insC in the BRCA1 gene and IVS16-2A>G in the BRCA2 gene. The IVS16-2A>G in the BRCA2 gene appears to be a unique founder mutation in the Slovenian population. A practical implication is that only 4 PCR fragments can be used in a first screen and reveal the cancer predisposing mutation in 67% of the BRCA1/2 positive families. We also observed an exceptionally high frequency of 4 different pathogenic missense mutations, all affecting one of
International Nuclear Information System (INIS)
Yashiro, Masakazu; Hirakawa, Kosei; Boland, C Richard
2010-01-01
Microsatellite instability (MSI) occurs in 15% of colorectal cancers (CRC). The genetic targets for mutation in the MSI phenotype include somatic mutations in the transforming growth factor beta receptor typeII (TGFbetaRII), BAX, hMSH3 and hMSH6. It is not clear how mutations of these genes mediate tumor progression in the MSI pathway, and the temporal sequence of these mutations remains uncertain. In this study, early stage CRCs were examined for frameshift mutations in these target genes, and compared with late stage tumors and CRC cell lines. We investigated 6 CRC cell lines and 71 sporadic CRCs, including 61 early stage cancers and 10 late stage cancers. Mutations of repetitive mononucleotide tracts in the coding regions of TGFbetaRII, BAX, hMSH3, hMSH6, IGFIIR and Fas antigen were identified by direct sequencing. Thirteen (18.3%) of 71 CRC, including 9/61 (14.7%) early stage cancers and 4/10 (40%) late stage cancers, were identified as MSI and analyzed for frameshift mutations. No mutation in the target genes was observed in any of the 9 early stage MSI CRCs. In contrast, frameshift mutations of TGFbetaRII, BAX, hMSH3 and hMSH6 were present in 3/4 late stage MSI tumors. There is a statistical association (p = 0.014) between mutation in any one gene and tumor stage. TGFbetaRII, BAX, hMSH3 and hMSH6 mutations are relatively late events in the genesis of MSI CRCs. The frameshift mutations in these target genes might mediate progression from early to late stage cancer, rather than mediating the adenoma to carcinoma transition
International Nuclear Information System (INIS)
Choi, Doo Ho; Jin, So Young; Lee, Dong Wha; Kim, Eun Seog; Kim, Yong Ho
2008-01-01
Women with breast cancer diagnosed at an age of 40 years or younger have a greater prevalence of germline BRCA1 and BRCA2 mutations than the prevalence of women with breast cancer diagnosed at older ages. Several immunohistochemical characteristics have been identified in breast cancers from studies of Caucasian women with BRCA1/2 mutations having familial or early-onset breast cancers. The aim of this study is to determine whether early-onset breast cancer in BRCA1 or BRCA2 mutation carriers, who were not selected from a family history, could be distinguished by the use of immunohistochemical methods and could be distinguished from breast cancer in women of a similar age without a germline BRCA1 or BRCA2 mutation. We also analyzed the prognostic difference between BRCA1/2 related and BRCA1/2 non-related patients by the use of univariate and multivariate analysis. Breast cancer tissue specimens from Korean women with early-onset breast cancers were studied using a tumor tissue microarray. Immunohistochemical staining of estrogen receptor (ER), progesterone receptor (PR) and HER-2, as well as the histology and grade of these specimens, were compared. The prognostic impact of immunohistochemical and histological factors as well as the BRCA1/2 mutation status was investigated separately. There were 14 cases and 16 deleterious BRCA1/2 mutations among 101 patients tested. A family history (4/14) and bilateral breast cancers (3/9) were high risk factors for BRCA1/2 mutations. BRCA1/2- associated cancers demonstrated more expression of ER-negative (19.4% versus 5.1%, p=0.038) and HER-2 negative than BRCA1/2 negative tumors, especially for tumors with BRCA1 tumors The BRCA1/2 mutation rate for patients with triple negative tumors (negative expression of ER, PR and HER-2) was 24.2%. Tumor size, nodal status, and HER-2 expression status were significantly associated with disease free survival, as determined by univariate and multivariate analysis, but the BRCA1/2 status was
DEFF Research Database (Denmark)
Ding, Yuan C; McGuffog, Lesley; Healey, Sue
2012-01-01
We previously reported significant associations between genetic variants in insulin receptor substrate 1 (IRS1) and breast cancer risk in women carrying BRCA1 mutations. The objectives of this study were to investigate whether the IRS1 variants modified ovarian cancer risk and were associated wit...
Kamal, Manal M; Youssef, Omar Z; Lotfy, Ahmed N; Elsaed, Eman T; Fawzy, May M T
2012-09-01
Understanding the role of environmental and molecular influences on the nature and rate of K-ras mutations in colorectal neoplasms is crucial. COX-2 polymorphisms -765G>C may play a role in carcinogenic processes in combination with specific life-style conditions or dependent on the racial composition of a particular population. If mutational events play an important role in colorectal carcinogenesis sequence, one can hypothesize that modification of these events by life-style or other factors would be a useful prevention strategy. To explore the association between K-ras mutation and potential variables known or suspected to be related to the risk of colorectal cancer (CRC) as well as determining the possible modulating effect of the COX-2 polymorphism, -765G>C. The study was conducted on 80 patients with colorectal cancer from Tropical Medicine and Gastrointestinal Tract endoscopy Departments and those attending clinic of the National Cancer Institute, Cairo University during the period extending from April 2009 to March 2010. Full history taking with emphasis on the risk factors of interest, namely age, sex, family history, smoking and dietary history. Serum CEA and CA19-9, RBCs folic acid and occult blood in stool were done to all samples. K-ras protooncogene mutation at codon 12 (exon 1) and cyclooxygenase 2 (COX-2) -765G>C polymorphism were determined by PCR-RFLP. The K-ras mutation was positive in 23 (28.7%) patients. COX-2 polymorphism revealed GG in 62.5%, GC in 26.2 % and CC genotype was found in 11.3 % of cases. The mean red blood cell folic acid level was lower in the K-ras positive group (100.96±51.3 ng/ml) than the negative group (216.6±166.4 ng/ml), (P<0.01). Higher folate levels were found in males than females (median=173 ng/ml and 85 ng/ml; respectively, P=0.002) with adjusted odds ratio (OR) of 0.984. Only, the RBCs folate (P=0.0018) followed by gender (P=0.036) contributed significantly in the discrimination between patients prone to develop K
International Nuclear Information System (INIS)
Kamal, M.M.; Youssef, O.Z.; Lotfy, A.N.; Elsaed, E.T.; Fawzy, M.M.T.
2012-01-01
Background: Understanding the role of environmental and molecular influences on the nature and rate of K-ras mutations in colorectal neoplasms is crucial. COX-2 polymorphisms -765G > C may play a role in carcinogenic processes in combination with specific life-style conditions or dependent on the racial composition of a particular population. If mutational events play an important role in colorectal carcinogenesis sequence, one can hypothesize that modification of these events by life-style or other factors would be a useful prevention strategy. Aim of work: To explore the association between K-ras mutation and potential variables known or suspected to be related to the risk of colorectal cancer (CRC) as well as determining the possible modulating effect of the COX-2 polymorphism, —765G > C. Subjects and methods: The study was conducted on 80 patients with colorectal cancer from Tropical Medicine and Gastrointestinal Tract endoscopy Departments and those attending clinic of the National Cancer Institute, Cairo University during the period extending from April 2009 to March 2010. Full history taking with emphasis on the risk factors of interest, namely age, sex, family history, smoking and dietary history. Serum CEA and CA19-9, RBCs folic acid and occult blood in stool were done to all samples. K-ras protooncogene mutation at codon 12 (exon 1) and cyclooxygenase 2 (COX-2) —765G > C polymorphism were determined by PCR-RFLP. Results: The K-ras mutation was positive in 23 (28.7%) patients. COX-2 polymorphism revealed GG in 62.5%, GC in 26.2 % and CC genotype was found in 11.3 % of cases. The mean red blood cell folic acid level was lower in the K-ras positive group (100.96 ± 51.3 ng/ml) than the negative group (216.6 ± 166.4 ng/ml), (P < 0.01). Higher folate levels were found in males than females (median = 173 ng/ml and 85 ng/ml; respectively, P = 0.002) with adjusted odds ratio (OR) of 0.984. Only, the RBCs folate (P = 0.0018) followed by gender (P = 0
Directory of Open Access Journals (Sweden)
Cheng Hu
2017-01-01
Full Text Available Background. Environmental factors and genetic mutations have been increasingly recognized as risk factors for chronic pancreatitis (CP. The PRSS1 p.R122H mutation was the first discovered to affect hereditary CP, with 80% penetrance. We performed here a systematic review and meta-analysis to evaluate the associations of PRSS1 p.R122H mutation with CP of diverse etiology. Methods. The PubMed, EMBASE, and MEDLINE database were reviewed. The pooled odds ratio (OR with 95% confidence intervals was used to evaluate the association of p.R122H mutation with CP. Initial analysis was conducted with all etiologies of CP, followed by a subgroup analysis for hereditary and nonhereditary CP, including alcoholic or idiopathic CP. Results. A total of eight case-control studies (1733 cases and 2415 controls were identified and included. Overall, PRSS1 p.R122H mutation was significantly associated with an increased risk of CP (OR = 4.78[1.13–20.20]. Further analysis showed p.R122H mutation strongly associated with the increased risk of hereditary CP (OR = 65.52[9.09–472.48] but not with nonhereditary CP, both alcoholic and idiopathic CP. Conclusions. Our study showing the differential role of p.R122H mutation in various etiologies of CP indicates that this complex disorder is likely influenced by multiple genetic factors as well as environmental factors.
Ito, Miki; Mitsuhashi, Kei; Igarashi, Hisayoshi; Nosho, Katsuhiko; Naito, Takafumi; Yoshii, Shinji; Takahashi, Hiroaki; Fujita, Masahiro; Sukawa, Yasutaka; Yamamoto, Eiichiro; Takahashi, Taiga; Adachi, Yasushi; Nojima, Masanori; Sasaki, Yasushi; Tokino, Takashi; Baba, Yoshifumi; Maruyama, Reo; Suzuki, Hiromu; Imai, Kohzoh; Yamamoto, Hiroyuki; Shinomura, Yasuhisa
2014-12-01
The CpG island methylator phenotype (CIMP) is a distinct form of epigenomic instability. Many CIMP-high colorectal cancers (CRCs) with BRAF mutation are considered to arise from serrated pathway. We recently reported that microRNA-31 (miR-31) is associated with BRAF mutation in colorectal tumors. Emerging new approaches have revealed gradual changes in BRAF mutation and CIMP-high throughout the colorectum in CRCs. Here, we attempted to identify a possible association between miR-31 and epigenetic features in serrated pathway, and hypothesized that miR-31 supports the "colorectal continuum" concept. We evaluated miR-31 expression, BRAF mutation and epigenetic features including CIMP status in 381 serrated lesions and 222 non-serrated adenomas and examined associations between them and tumor location (rectum; sigmoid, descending, transverse and ascending colon and cecum). A significant association was observed between high miR-31 expression and CIMP-high status in serrated lesions with BRAF mutation (p = 0.0001). In contrast, miR-31 was slightly but insignificantly associated with CIMP status in the cases with wild-type BRAF. miR-31 expression in sessile serrated adenomas (SSAs) with cytological dysplasia was higher than that in SSAs, whereas, no significant difference was observed between traditional serrated adenomas (TSAs) and TSAs with high-grade dysplasia. The frequency of miR-31, BRAF mutation CIMP-high and MLH1 methylation increased gradually from the rectum to cecum in serrated lesions. In conclusion, miR-31 expression was associated with CIMP-high status in serrated lesions with BRAF mutation. Our data also suggested that miR-31 plays an important role in SSA evolution and may be a molecule supporting the colorectal continuum. © 2014 UICC.
Prognostic significance of miR-205 in endometrial cancer.
Directory of Open Access Journals (Sweden)
Mihriban Karaayvaz
Full Text Available microRNAs have emerged as key regulators of gene expression, and their altered expression has been associated with tumorigenesis and tumor progression. Thus, microRNAs have potential as both cancer biomarkers and/or potential novel therapeutic targets. Although accumulating evidence suggests the role of aberrant microRNA expression in endometrial carcinogenesis, there are still limited data available about the prognostic significance of microRNAs in endometrial cancer. The goal of this study is to investigate the prognostic value of selected key microRNAs in endometrial cancer by the analysis of archival formalin-fixed paraffin-embedded tissues.Total RNAs were extracted from 48 paired normal and endometrial tumor specimens using Trizol based approach. The expression of miR-26a, let-7g, miR-21, miR-181b, miR-200c, miR-192, miR-215, miR-200c, and miR-205 were quantified by real time qRT-PCR expression analysis. Targets of the differentially expressed miRNAs were quantified using immunohistochemistry. Statistical analysis was performed by GraphPad Prism 5.0.The expression levels of miR-200c (P<0.0001 and miR-205 (P<0.0001 were significantly increased in endometrial tumors compared to normal tissues. Kaplan-Meier survival analysis revealed that high levels of miR-205 expression were associated with poor patient overall survival (hazard ratio, 0.377; Logrank test, P = 0.028. Furthermore, decreased expression of a miR-205 target PTEN was detected in endometrial cancer tissues compared to normal tissues.miR-205 holds a unique potential as a prognostic biomarker in endometrial cancer.
Do cosmological data rule out f (R ) with w ≠-1 ?
Battye, Richard A.; Bolliet, Boris; Pace, Francesco
2018-05-01
We review the equation of state (EoS) approach to dark sector perturbations and apply it to f (R ) gravity models of dark energy. We show that the EoS approach is numerically stable and use it to set observational constraints on designer models. Within the EoS approach we build an analytical understanding of the dynamics of cosmological perturbations for the designer class of f (R ) gravity models, characterized by the parameter B0 and the background equation of state of dark energy w . When we use the Planck cosmic microwave background temperature anisotropy, polarization, and lensing data as well as the baryonic acoustic oscillation data from SDSS and WiggleZ, we find B0<0.006 (95% C.L.) for the designer models with w =-1 . Furthermore, we find B0<0.0045 and |w +1 |<0.002 (95% C.L.) for the designer models with w ≠-1 . Previous analyses found similar results for designer and Hu-Sawicki f (R ) gravity models using the effective field theory approach [Raveri et al., Phys. Rev. D 90, 043513 (2014), 10.1103/PhysRevD.90.043513; Hu et al., Mon. Not. R. Astron. Soc. 459, 3880 (2016), 10.1093/mnras/stw775]; therefore this hints for the fact that generic f (R ) models with w ≠-1 can be tightly constrained by current cosmological data, complementary to solar system tests [Brax et al., Phys. Rev. D 78, 104021 (2008), 10.1103/PhysRevD.78.104021; Faulkner et al., Phys. Rev. D 76, 063505 (2007), 10.1103/PhysRevD.76.063505]. When compared to a w CDM fluid with the same sound speed, we find that the equation of state for f (R ) models is better constrained to be close to -1 by about an order of magnitude, due to the strong dependence of the perturbations on w .
Directory of Open Access Journals (Sweden)
Venkata Nagarjuna Maturu
2016-01-01
Full Text Available Background: There is limited Indian data on epidermal growth factor receptor (EGFR gene activating mutations (AMs prevalence and their clinicopathologic associations. The current study aimed to assess the relationship between EGFR AM and histologic subtypes and their impact on overall survival (OS in a North Indian cohort. Patients and Methods: Retrospective analysis of nonsmall cell lung cancer patients who underwent EGFR mutation testing (n = 186 over 3 years period (2012-2014. EGFR mutations were tested using polymerase chain reaction amplification and direct sequencing. Patients were classified as EGFR AM, EGFR wild type (WT or EGFR unknown (UKN. Histologically adenocarcinomas (ADC were further categorized as per the International Association for the Study of Lung Cancer/American Thoracic Society/European Respiratory Society-2011 classification. Results: Overall EGFR AM prevalence was 16.6%. The ratio of exon 19 deletions to exon 21 L858R mutations was 3.17:1. Female sex (P = 0.002, never smoking status (P = 0.002, metastatic disease (P = 0.032, and nonsolid subtype of ADC (P = 0.001 were associated with EGFR AM on univariate logistic regression analysis (LRA. On multivariate LRA, solid ADC was negatively associated with EGFR AM. Median OS was higher in patients with EGFR AM (750 days as compared to EGFR-WT (459 days or EGFR-UKN (291 days for the overall population and in patients with Stage IV disease (750 days vs. 278 days for EGFR-WT, P = 0.024. On univariate Cox proportional hazard (CPH analysis, smoking, poor performance status (Eastern Cooperative Oncology Group ≥ 2, EGFR-UKN status, and solid ADC were associated with worse OS while female sex and lepidic ADC had better OS. On multivariate CPH analysis, lepidic ADC (hazard ratio [HR] =0.12 and EGFR-WT/EGFR-UKN (HR = 2.39 and HR = 3.30 respectively were independently associated with OS in separate analyses. Conclusions: Histologic subtyping of ADC performed on small biopsies is
Ponti, G; Ponz de Leon, M; Maffei, S; Pedroni, M; Losi, L; Di Gregorio, C; Gismondi, V; Scarselli, A; Benatti, P; Roncari, B; Seidenari, S; Pellacani, G; Varotti, C; Prete, E; Varesco, L; Roncucci, L
2005-11-01
Attenuated familial adenomatous polyposis and Muir-Torre syndrome linked to compound biallelic constitutional MYH gene mutations.Peculiar dermatologic manifestations are present in several heritable gastrointestinal disorders. Muir-Torre syndrome (MTS) is a genodermatosis whose peculiar feature is the presence of sebaceous gland tumors associated with visceral malignancies. We describe one patient in whom multiple sebaceous gland tumors were associated with early onset colon and thyroid cancers and attenuated polyposis coli. Her family history was positive for colonic adenomas. She had a daughter presenting with yellow papules in the forehead region developed in the late infancy. Skin and visceral neoplasms were tested for microsatellite instability and immunohistochemical status of mismatch repair (MMR), APC and MYH proteins. The proband colon and skin tumors were microsatellite stable and showed normal expression of MMR proteins. Cytoplasmic expression of MYH protein was revealed in colonic cancer cells. Compound heterozygosity due to biallelic mutations in MYH, R168H and 379delC, was identified in the proband. The 11-year-old daughter was carrier of the monoallelic constitutional mutation 379delC in the MYH gene; in the sister, the R168H MYH gene mutation was detected. This report presents an interesting case of association between MYH-associated polyposis and sebaceous gland tumors. These findings suggest that patients with MTS phenotype that include colonic polyposis should be screened for MYH gene mutations.
International Nuclear Information System (INIS)
Tamimi, Rulla M; Hankinson, Susan E; Spiegelman, Donna; Kraft, Peter; Colditz, Graham A; Hunter, David J
2004-01-01
The ataxia telangiectasia mutated (ATM) gene is a tumor suppressor gene with functions in cell cycle arrest, apoptosis, and repair of DNA double-strand breaks. Based on family studies, women heterozygous for mutations in the ATM gene are reported to have a fourfold to fivefold increased risk of breast cancer compared with noncarriers of the mutations, although not all studies have confirmed this association. Haplotype analysis has been suggested as an efficient method for investigating the role of common variation in the ATM gene and breast cancer. Five biallelic haplotype tagging single nucleotide polymorphisms are estimated to capture 99% of the haplotype diversity in Caucasian populations. We conducted a nested case–control study of breast cancer within the Nurses' Health Study cohort to address the role of common ATM haplotypes and breast cancer. Cases and controls were genotyped for five haplotype tagging single nucleotide polymorphisms. Haplotypes were predicted for 1309 cases and 1761 controls for which genotype information was available. Six unique haplotypes were predicted in this study, five of which occur at a frequency of 5% or greater. The overall distribution of haplotypes was not significantly different between cases and controls (χ 2 = 3.43, five degrees of freedom, P = 0.63). There was no evidence that common haplotypes of ATM are associated with breast cancer risk. Extensive single nucleotide polymorphism detection using the entire genomic sequence of ATM will be necessary to rule out less common variation in ATM and sporadic breast cancer risk
Detection of genetic mutations associated with macrolide resistance of Mycoplasma pneumoniae
Directory of Open Access Journals (Sweden)
Chi Eun Oh
2010-02-01
Full Text Available Purpose : The aim of this study was to identify mutations associated with macrolide resistance in Mycoplasma pneumoniae (MP and to establish a cultural method to determine antimicrobial susceptibility. Methods : Nasopharyngeal aspirates (NPAs were collected from 62 children diagnosed with MP pneumonia by a serologic method or polymerase chain reaction. The 23S rRNA and L4 ribosomal protein genes of MP were amplified and sequenced. To identify mutations in these 2 genes, their nucleotide sequences were compared to those of the reference strain M129. MP cultivation was carried out for 32 (28 frozen and 5 refrigerated NPAs and M129 strain using Chanock’s glucose broth and agar plate in a 5% CO2 incubator at 37?#608;and examined at 2-3 day intervals for 6 weeks. Results : Among the 62 specimens, 17 had M144V mutations in ribosomal protein L4. The A2064G mutation was observed in 1 specimen; its 23S rRNA gene was successfully sequenced. Culture for MP was successful from the M129 strain and 2 of the 5 NPAs that were refrigerated for no longer than 3 days. However, MP did not grow from the 28 NPAs that were kept frozen at -80?#608;since 2003. Conclusion : We found the M144V mutation of L4 protein to be common and that of domain V of 23S rRNA gene was relatively rare among MP. Studies on the prevalence of macrolide-resistant MP and the relationship between the mutations of 23S rRNA gene and ribosomal protein L4 will aid in understanding the mechanism of macrolide resistance in MP.
Risk of colorectal cancer for people with a mutation in both a MUTYH and a DNA mismatch repair gene
Win, Aung Ko; Reece, Jeanette C.; Buchanan, Daniel D.; Clendenning, Mark; Young, Joanne P.; Cleary, Sean P.; Kim, Hyeja; Cotterchio, Michelle; Dowty, James G.; MacInnis, Robert J.; Tucker, Katherine M.; Winship, Ingrid M.; Macrae, Finlay A.; Burnett, Terrilea; Le Marchand, Loïc; Casey, Graham; Haile, Robert W.; Newcomb, Polly A.; Thibodeau, Stephen N.; Lindor, Noralane M.; Hopper, John L.; Gallinger, Steven; Jenkins, Mark A.
2015-01-01
The base excision repair protein, MUTYH, functionally interacts with the DNA mismatch repair (MMR) system. As genetic testing moves from testing one gene at a time, to gene panel and whole exome next generation sequencing approaches, understanding the risk associated with co-existence of germline mutations in these genes will be important for clinical interpretation and management. From the Colon Cancer Family Registry, we identified 10 carriers who had both a MUTYH mutation (6 with c.1187G>A p.(Gly396Asp), 3 with c.821G>A p.(Arg274Gln), and 1 with c.536A>G p.(Tyr179Cys)) and a MMR gene mutation (3 in MLH1, 6 in MSH2, and 1 in PMS2), 375 carriers of a single (monoallelic) MUTYH mutation alone, and 469 carriers of a MMR gene mutation alone. Of the 10 carriers of both gene mutations, 8 were diagnosed with colorectal cancer. Using a weighted cohort analysis, we estimated that risk of colorectal cancer for carriers of both a MUTYH and a MMR gene mutation was substantially higher than that for carriers of a MUTYH mutation alone [hazard ratio (HR) 21.5, 95 % confidence interval (CI) 9.19–50.1; p colorectal cancer for carriers of a MMR gene mutation alone. Our finding suggests MUTYH mutation testing in MMR gene mutation carriers is not clinically informative. PMID:26202870
Jia, Peilin; Zhao, Zhongming
2014-02-01
A major challenge in interpreting the large volume of mutation data identified by next-generation sequencing (NGS) is to distinguish driver mutations from neutral passenger mutations to facilitate the identification of targetable genes and new drugs. Current approaches are primarily based on mutation frequencies of single-genes, which lack the power to detect infrequently mutated driver genes and ignore functional interconnection and regulation among cancer genes. We propose a novel mutation network method, VarWalker, to prioritize driver genes in large scale cancer mutation data. VarWalker fits generalized additive models for each sample based on sample-specific mutation profiles and builds on the joint frequency of both mutation genes and their close interactors. These interactors are selected and optimized using the Random Walk with Restart algorithm in a protein-protein interaction network. We applied the method in >300 tumor genomes in two large-scale NGS benchmark datasets: 183 lung adenocarcinoma samples and 121 melanoma samples. In each cancer, we derived a consensus mutation subnetwork containing significantly enriched consensus cancer genes and cancer-related functional pathways. These cancer-specific mutation networks were then validated using independent datasets for each cancer. Importantly, VarWalker prioritizes well-known, infrequently mutated genes, which are shown to interact with highly recurrently mutated genes yet have been ignored by conventional single-gene-based approaches. Utilizing VarWalker, we demonstrated that network-assisted approaches can be effectively adapted to facilitate the detection of cancer driver genes in NGS data.
Chromosomal radiosensitivity in breast cancer patients and BRCA1 and 2 mutation carriers
International Nuclear Information System (INIS)
Vral, Anne
2004-01-01
Enhanced chromosomal radiosensitivity is observed in significant proportions of cancer patients. In breast cancer patients, this elevated sensitivity is confirmed in several independent studies with the G2 assay as well as with the GO micronucleus (MN) assay for peripheral blood lymphocytes (PBL). Enhanced chromosomal radiosensitivity is a common feature of sporadic breast cancer patients as well as breast cancer patients with a family history of the disease. Segregation analysis showed Mendelian heritability of chromosomal radiosensitivity. As mutations in the highly penetrant breast cancer predisposing genes, BRCA1 and 2, are only present in about 3-5 % of familial breast cancer patients, they cannot solely account for the high proportion of radiosensitive cases found among all breast cancer patients. A review on chromosomal radiosensitivity in BRCA1 and 2 mutation carriers shows that breast cancer patients with a BRCAl or 2 mutation are on the average more radiosensitive than healthy individuals, but not different from breast cancer patients without a BRCA mutation. The radiation response of healthy BRCA1/2 mutation carriers, on the contrary, is not significantly different from controls. Most studies performed on wild type and BRCA +/- EBV lymphoblastoid cell lines also could not demonstrate any differences in MN response between both groups. These findings suggest that mutations in BRCA 1 and 2 are not playing a major role in chromosomal radiosensitivity as measured by G2 and MN assay. The enhanced sensitivity observed in a substantial proportion of breast cancer patients, irrespective of a BRCA1/2 mutation or not, suggests that this feature may be related to the presence of other mutations in low penetrance breast cancer predisposing genes, which may be involved in the process of DNA damage. (author)
FAMILY ANAMNESIS OF CHILDREN WITH MUTATION OF THE INHERITED HEMOCHROMATOSIS
Directory of Open Access Journals (Sweden)
S.I. Polyakova
2010-01-01
Full Text Available The inherited burdened is studied on diseases, associated with an overload iron in 41 children with frequent mutations of the inherited hemochromatosis (IG of a 1 type (C282y, H63d, S65c. Control group was made by 27 children with undiscovered frequent mutations of NG. Frequencies of iron-associated diseases are compared for 560 members of families which have children with mutations of IG and 390 members of families which have children without IG mutations. Some features of medical-genealogical anamnesis, which can be conditioned of siderosis, are exposed, and indirectly specify in the presence of mutations in the gene of HFE. So, the high frequency of oncologic diseases, diabetes mellitus, hepatocirrhosis and deaths of relatives under the age of 50 years are the foundation for research of exchange of iron and holding of molecular-genetic research of the inherited hemochromatosis. Key words: inherited hemochromatosis, heredity, children. (Pediatric Pharmacology. – 2010; 7(3:52-56
Xue, Zhang Xiao; Wen, Wang Xiu; Zhuang, Yu; Hua, Zang Jian; Xia, Yang Ni
2016-09-01
Icotinib hydrochloride is a novel epidermal growth factor receptor (EGFR) tyrosine kinase inhibitor (TKI) with preclinical and clinical activity in non-small-cell lung cancer (NSCLC). Exon 19 deletion and L858R point mutation are the most commonly encountered EGFR mutations in NSCLC, and they predict improved clinical outcomes following treatment with icotinib. The objective of this study was to evaluate the differential clinical efficacy of icotinib in patients with exon 19 deletion or L858R point mutation of the EGFR gene. A total of 104 patients with advanced NSCLC, who harbored exon 19 deletion or L858R point mutation of EGFR and were treated with icotinib, were enrolled in this study. The tumor response and progression-free survival were evaluated. There were no significant differences between patients with EGFR exon 19 deletion and those with L858R point mutation who received treatment with icotinib.
Directory of Open Access Journals (Sweden)
Orestis Ioannidis
2012-03-01
Full Text Available Familial adenomatous polyposis (FAP is a rare syndrome characterized by the presence of hundreds to thousands of colorectal adenomas and is responsible for less than 1% of all colorectal cancers. The syndrome is also characterized by extra-colorectal features including amongst others upper gastrointestinal tract polyps and desmoid tumors. The syndrome is inherited by an autosomal dominant gene, the adenomatous polyposis coli (APC gene. We present the physical history, clinical presentation, diagnosis and treatment of a patient with a novel germline APC mutation, the W421X mutation, which resulted in FAP presenting with about a hundred colorectal polyps, gastric hyperplastic polyps and multiple aggressive intra-abdominal and extra-abdominal desmoid tumors.
Directory of Open Access Journals (Sweden)
Juan C. Gomez-Gelvez, MD
2016-03-01
Full Text Available Myeloproliferative neoplasms (MPNs are clonal hematopoietic stem cell disorders characterized by proliferation of one or more cell lineages in the bone marrow. At present, the main criterion in the 2008 World Health Organization classification of MPNs is the presence of an underlying genetic abnormality. These mutations are generally mutually exclusive except for rare reports in the literature. We report for the first time a detailed analysis of the clinical, histologic and cytogenetic/molecular features of a patient who initially presented with MPL W515L positive primary myelofibrosis and over the course of five years developed an MPN associated with both BCR-ABL1 and MPL W515L mutation. We discuss the diagnostic challenges and therapeutic implications of concomitant BCR-ABL1 translocation with MPL W515L mutation. Multiple genetic alterations may simultaneously coexist in patients exhibiting features of myeloproliferative disorders.
Concurrent mutation in exons 1 and 2 of the K-ras oncogene in colorectal cancer
Directory of Open Access Journals (Sweden)
Fiorella Guadagni
2012-01-01
Full Text Available The K-ras gene is frequently mutated in colorectal cancer and has been associated with tumor initiation and progression; approximately 90% of the activating mutations are found in codons 12 and 13 of exon 1 and just under 5% in codon 61 located in exon 2. These mutations determine single aminoacidic substitutions in the GTPase pocket leading to a block of the GTP hydrolytic activity of the K-ras p21 protein, and therefore to its constitutive activation. Point mutations in sites of the K-ras gene, other than codons 12, 13 and 61, and other types of genetic alterations, may occur in a minority of cases, such as in the less frequent cases of double mutations in the K-ras gene. However, all mutations in this gene, even those which occur in non-canonical sites or double mutations, are relevant oncogenic alterations in colorectal cancer and may underlie K-ras pathway hyperactivation. In the present study, we report the case of a patient with colorectal cancer presenting a concurrent point mutation in exons 1 and 2 of the K-ras gene, a GGT to TGT substitution (Glycine to Cysteine at codon 12, and a GAC to AAC substitution (Aspartic Acid to Asparagine at codon 57. In addition, we found in the same patient’s sample a silent polymorphism at codon 11 (Ala11Ala of exon 1. (Folia Histochemica et Cytobiologica 2011; Vol. 49, No. 4, pp. 729–733
Lopes, Gabriel Lima; Vattimo, Edoardo Filippo de Queiroz; Castro Junior, Gilberto de
2015-01-01
Lung cancer is the leading cause of cancer-related deaths worldwide. Promising new therapies have recently emerged from the development of molecular targeted drugs; particularly promising are those blocking the signal transduction machinery of cancer cells. One of the most widely studied cell signaling pathways is that of EGFR, which leads to uncontrolled cell proliferation, increased cell angiogenesis, and greater cell invasiveness. Activating mutations in the EGFR gene (deletions in exon 19 and mutation L858R in exon 21), first described in 2004, have been detected in approximately 10% of all non-squamous non-small cell lung cancer (NSCLC) patients in Western countries and are the most important predictors of a response to EGFR tyrosine-kinase inhibitors (EGFR-TKIs). Studies of the EGFR-TKIs gefitinib, erlotinib, and afatinib, in comparison with platinum-based regimens, as first-line treatments in chemotherapy-naïve patients have shown that the EGFR-TKIs produce gains in progression-free survival and overall response rates, although only in patients whose tumors harbor activating mutations in the EGFR gene. Clinical trials have also shown EGFR-TKIs to be effective as second- and third-line therapies in advanced NSCLC. Here, we review the main aspects of EGFR pathway activation in NSCLC, underscore the importance of correctly identifying activating mutations in the EGFR gene, and discuss the main outcomes of EGFR-TKI treatment in NSCLC.
Lopes, Gabriel Lima; Vattimo, Edoardo Filippo de Queiroz; de Castro, Gilberto
2015-01-01
Abstract Lung cancer is the leading cause of cancer-related deaths worldwide. Promising new therapies have recently emerged from the development of molecular targeted drugs; particularly promising are those blocking the signal transduction machinery of cancer cells. One of the most widely studied cell signaling pathways is that of EGFR, which leads to uncontrolled cell proliferation, increased cell angiogenesis, and greater cell invasiveness. Activating mutations in the EGFR gene (deletions in exon 19 and mutation L858R in exon 21), first described in 2004, have been detected in approximately 10% of all non-squamous non-small cell lung cancer (NSCLC) patients in Western countries and are the most important predictors of a response to EGFR tyrosine-kinase inhibitors (EGFR-TKIs). Studies of the EGFR-TKIs gefitinib, erlotinib, and afatinib, in comparison with platinum-based regimens, as first-line treatments in chemotherapy-naïve patients have shown that the EGFR-TKIs produce gains in progression-free survival and overall response rates, although only in patients whose tumors harbor activating mutations in the EGFR gene. Clinical trials have also shown EGFR-TKIs to be effective as second- and third-line therapies in advanced NSCLC. Here, we review the main aspects of EGFR pathway activation in NSCLC, underscore the importance of correctly identifying activating mutations in the EGFR gene, and discuss the main outcomes of EGFR-TKI treatment in NSCLC. PMID:26398757
Simple mathematical method to quantify p53 mutations in occupational lung cancer
International Nuclear Information System (INIS)
Helal, N.L.
2005-01-01
Radon-222, a decay product of uranium-238 and a source of high linear energy transfer (LET) alpha -particles, has been implicated in the increase risk of lung cancer in uranium miners as well as non-miners. The p53 gene mutational spectrum reveals evidence for a direct causal effect of radon inhalation in lung cancer. This mutation has been proposed as a marker of radon exposure. The development of such markers may ultimately be of benefit in the reduction of occupational morbidity and mortality from occupational cancer. One of the tasks in risk assessment of genotoxic occupational radiation exposure is to devise a simple numerical method. This method may be used to quantify the relationship between radiation dose and the effect on the genetic sequences. The tumor suppressor gene (TSG) p53 is an ideal bio marker addressing questions of exposure and risk. These proteins may be suitable for the design of more effective or less invasive cancer therapies. The clinical outcome of lung cancer patients may correlate with the normal regulation of these patients and, therefore, their identification may be used as a guideline for future therapy modalities. To investigate the association between radon exposure and p53 mutations in lung tumors, we have implied a mathematical method. This method has been developed from a 2-D graphical representational technique that enables easy visualization of base distributions. This is of special relevance to libraries of single nucleotide polymorphic (SNP) genes
Directory of Open Access Journals (Sweden)
Galina Lurie
2011-02-01
Full Text Available Overweight and obesity are strongly associated with endometrial cancer. Several independent genome-wide association studies recently identified two common polymorphisms, FTO rs9939609 and MC4R rs17782313, that are linked to increased body weight and obesity. We examined the association of FTO rs9939609 and MC4R rs17782313 with endometrial cancer risk in a pooled analysis of nine case-control studies within the Epidemiology of Endometrial Cancer Consortium (E2C2. This analysis included 3601 non-Hispanic white women with histologically-confirmed endometrial carcinoma and 5275 frequency-matched controls. Unconditional logistic regression models were used to assess the relation of FTO rs9939609 and MC4R rs17782313 genotypes to the risk of endometrial cancer. Among control women, both the FTO rs9939609 A and MC4R rs17782313 C alleles were associated with a 16% increased risk of being overweight (p = 0.001 and p = 0.004, respectively. In case-control analyses, carriers of the FTO rs9939609 AA genotype were at increased risk of endometrial carcinoma compared to women with the TT genotype [odds ratio (OR = 1.17; 95% confidence interval (CI: 1.03-1.32, p = 0.01]. However, this association was no longer apparent after adjusting for body mass index (BMI, suggesting mediation of the gene-disease effect through body weight. The MC4R rs17782313 polymorphism was not related to endometrial cancer risk (per allele OR = 0.98; 95% CI: 0.91-1.06; p = 0.68. FTO rs9939609 is a susceptibility marker for white non-Hispanic women at higher risk of endometrial cancer. Although FTO rs9939609 alone might have limited clinical or public health significance for identifying women at high risk for endometrial cancer beyond that of excess body weight, further investigation of obesity-related genetic markers might help to identify the pathways that influence endometrial carcinogenesis.
De Francesco, Vincenzo; Zullo, Angelo; Giorgio, Floriana; Saracino, Ilaria; Zaccaro, Cristina; Hassan, Cesare; Ierardi, Enzo; Di Leo, Alfredo; Fiorini, Giulia; Castelli, Valentina; Lo Re, Giovanna; Vaira, Dino
2014-03-01
Primary clarithromycin resistance is the main factor affecting the efficacy of Helicobacter pylori therapy. This study aimed: (i) to assess the concordance between phenotypic (culture) and genotypic (real-time PCR) tests in resistant strains; (ii) to search, in the case of disagreement between the methods, for point mutations other than those reported as the most frequent in Europe; and (iii) to compare the MICs associated with the single point mutations. In order to perform real-time PCR, we retrieved biopsies from patients in whom H. pylori infection was successful diagnosed by bacterial culture and clarithromycin resistance was assessed using the Etest. Only patients who had never been previously treated, and with H. pylori strains that were either resistant exclusively to clarithromycin or without any resistance, were included. Biopsies from 82 infected patients were analysed, including 42 strains that were clarithromycin resistant and 40 that were clarithromycin susceptible on culture. On genotypic analysis, at least one of the three most frequently reported point mutations (A2142C, A2142G and A2143G) was detected in only 23 cases (54.8%), with a concordance between the two methods of 0.67. Novel point mutations (A2115G, G2141A and A2144T) were detected in a further 14 out of 19 discordant cases, increasing the resistance detection rate of PCR to 88% (Presistance; and (iii) none of the tested point mutations is associated with significantly higher MIC values than the others.
CT radiogenomic characterization of EGFR, K-RAS, and ALK mutations in non-small cell lung cancer
Energy Technology Data Exchange (ETDEWEB)
Rizzo, Stefania; Rampinelli, Cristiano [European Institute of Oncology, Department of Radiology, Milan (Italy); Petrella, Francesco; Spaggiari, Lorenzo [European Institute of Oncology, Department of Thoracic Surgery, Milan (Italy); Buscarino, Valentina; De Maria, Federica [University of Milan, Department of Health Sciences, Milan (Italy); Raimondi, Sara [European Institute of Oncology, Department of Epidemiology and Biostatistics, Milan (Italy); Barberis, Massimo; Fumagalli, Caterina [European Institute of Oncology, Department of Pathology, Milan (Italy); Spitaleri, Gianluca; De Marinis, Filippo [European Institute of Oncology, Department of Thoracic Oncology, Milan (Italy); Bellomi, Massimo [European Institute of Oncology, Department of Radiology, Milan (Italy); University of Milan, Department of Health Sciences, Milan (Italy)
2016-01-15
To assess the association between CT features and EGFR, ALK, KRAS mutations in non-small cell lung cancer. Patients undergoing chest CT and testing for the above gene mutations were included. Qualitative evaluation of CTs included: lobe; lesion diameter; shape; margins; ground-glass opacity; density; cavitation; air bronchogram; pleural thickening; intratumoral necrosis; nodules in tumour lobe; nodules in non-tumour lobes; pleural retraction; location; calcifications; emphysema; fibrosis; pleural contact; pleural effusion. Statistical analysis was performed to assess association of features with each gene mutation. ROC curves for gene mutations were drawn; the corresponding area under the curve was calculated. P-values <0.05 were considered significant. Of 285 patients, 60/280 (21.43 %) were positive for EGFR mutation; 31/270 (11.48 %) for ALK rearrangement; 64/240 (26.67 %) for KRAS mutation. EGFR mutation was associated with air bronchogram, pleural retraction, females, non-smokers, small lesion size, and absence of fibrosis. ALK rearrangements were associated with age and pleural effusion. KRAS mutation was associated with round shape, nodules in non-tumour lobes, and smoking. This study disclosed associations between CT features and alterations of EGFR (air bronchogram, pleural retraction, small lesion size, absence of fibrosis), ALK (pleural effusion) and KRAS (round lesion shape, nodules in non-tumour lobes). (orig.)
Common genetic variants and modification of penetrance of BRCA2-associated breast cancer.
Directory of Open Access Journals (Sweden)
Mia M Gaudet
2010-10-01
Full Text Available The considerable uncertainty regarding cancer risks associated with inherited mutations of BRCA2 is due to unknown factors. To investigate whether common genetic variants modify penetrance for BRCA2 mutation carriers, we undertook a two-staged genome-wide association study in BRCA2 mutation carriers. In stage 1 using the Affymetrix 6.0 platform, 592,163 filtered SNPs genotyped were available on 899 young (<40 years affected and 804 unaffected carriers of European ancestry. Associations were evaluated using a survival-based score test adjusted for familial correlations and stratified by country of the study and BRCA2*6174delT mutation status. The genomic inflation factor (λ was 1.011. The stage 1 association analysis revealed multiple variants associated with breast cancer risk: 3 SNPs had p-values<10(-5 and 39 SNPs had p-values<10(-4. These variants included several previously associated with sporadic breast cancer risk and two novel loci on chromosome 20 (rs311499 and chromosome 10 (rs16917302. The chromosome 10 locus was in ZNF365, which contains another variant that has recently been associated with breast cancer in an independent study of unselected cases. In stage 2, the top 85 loci from stage 1 were genotyped in 1,264 cases and 1,222 controls. Hazard ratios (HR and 95% confidence intervals (CI for stage 1 and 2 were combined and estimated using a retrospective likelihood approach, stratified by country of residence and the most common mutation, BRCA2*6174delT. The combined per allele HR of the minor allele for the novel loci rs16917302 was 0.75 (95% CI 0.66-0.86, and for rs311499 was 0.72 (95% CI 0.61-0.85, . FGFR2 rs2981575 had the strongest association with breast cancer risk (per allele HR = 1.28, 95% CI 1.18-1.39, . These results indicate that SNPs that modify BRCA2 penetrance identified by an agnostic approach thus far are limited to variants that also modify risk of sporadic BRCA2 wild-type breast cancer.
DEFF Research Database (Denmark)
Gonzalez-Izarzugaza, Jose Maria; Vazquez, Miguel; del Pozo, Angela
2013-01-01
mutation remains a considerable challenge. Results The wKinMut web-server offers direct prediction of the potential pathogenicity of the mutations from a number of methods, including our recently developed prediction method based on the combination of information from a range of diverse sources, including...
Study of the R-(Zr,W)-(O,N) (R = Y, Nd, Sm, Gd, Yb) oxynitride system
Energy Technology Data Exchange (ETDEWEB)
Tessier, Franck, E-mail: Franck.Tessier@univ-rennes1.fr [UMR CNRS 6226 ' Sciences Chimiques de Rennes' , equipe ' Verres et Ceramiques' , Universite de Rennes 1, 35042 Rennes cedex (France); Maillard, Pascal [UMR CNRS 6226 ' Sciences Chimiques de Rennes' , equipe ' Verres et Ceramiques' , Universite de Rennes 1, 35042 Rennes cedex (France); Orhan, Emmanuelle [Laboratoire Science des Procedes Ceramiques et Traitements de Surface, UMR CNRS 6638, Universite de Limoges, 123 Avenue Albert Thomas, 87060 Limoges cedex (France); Chevire, Francois [UMR CNRS 6226 ' Sciences Chimiques de Rennes' , equipe ' Verres et Ceramiques' , Universite de Rennes 1, 35042 Rennes cedex (France)
2010-02-15
The replacement of tantalum by the couple Zr/W within the RTa-O-N systems (R = Y, Nd, Sm, Gd, Yb), enables the preparation of novel oxide and oxynitride phases in the R-Zr-W-O-N system. R{sub 2}Zr{sub 2-x}W{sub x}O{sub 7+x} oxides exhibit the fluorite-type (x < 0.9) and scheelite (x {approx} 1) structures. Corresponding oxynitride compositions are of the fluorite-type and show different colors, for example in the case of ytterbium: pale yellow (x = 0.2 or 0.25), green (x = 0.5-0.8) and brown for the tungsten-rich samples (x = 0.9, 1). Photocatalytic activity measurements have been performed to investigate the overall water splitting behavior of these colored phases.
Mandelker, Diana; Zhang, Liying; Kemel, Yelena; Stadler, Zsofia K; Joseph, Vijai; Zehir, Ahmet; Pradhan, Nisha; Arnold, Angela; Walsh, Michael F; Li, Yirong; Balakrishnan, Anoop R; Syed, Aijazuddin; Prasad, Meera; Nafa, Khedoudja; Carlo, Maria I; Cadoo, Karen A; Sheehan, Meg; Fleischut, Megan H; Salo-Mullen, Erin; Trottier, Magan; Lipkin, Steven M; Lincoln, Anne; Mukherjee, Semanti; Ravichandran, Vignesh; Cambria, Roy; Galle, Jesse; Abida, Wassim; Arcila, Marcia E; Benayed, Ryma; Shah, Ronak; Yu, Kenneth; Bajorin, Dean F; Coleman, Jonathan A; Leach, Steven D; Lowery, Maeve A; Garcia-Aguilar, Julio; Kantoff, Philip W; Sawyers, Charles L; Dickler, Maura N; Saltz, Leonard; Motzer, Robert J; O'Reilly, Eileen M; Scher, Howard I; Baselga, Jose; Klimstra, David S; Solit, David B; Hyman, David M; Berger, Michael F; Ladanyi, Marc; Robson, Mark E; Offit, Kenneth
2017-09-05
change to targeted therapy in 38 patients tested (3.7%) and predictive testing in the families of 13 individuals (1.3%), including 6 for whom genetic evaluation would not have been initiated by guideline-based testing. In this referral population with selected advanced cancers, universal sequencing of a broad panel of cancer-related genes in paired germline and tumor DNA samples was associated with increased detection of individuals with potentially clinically significant heritable mutations over the predicted yield of targeted germline testing based on current clinical guidelines. Knowledge of these additional mutations can help guide therapeutic and preventive interventions, but whether all of these interventions would improve outcomes for patients with cancer or their family members requires further study. clinicaltrials.gov Identifier: NCT01775072.
2010-04-01
... 27 Alcohol, Tobacco Products and Firearms 1 2010-04-01 2010-04-01 false Beer. 28.282 Section 28.282 Alcohol, Tobacco Products and Firearms ALCOHOL AND TOBACCO TAX AND TRADE BUREAU, DEPARTMENT OF THE... Beer. When beer has been laden on board the aircraft for use as supplies, the customs officer shall...
SEMA3A, a gene involved in axonal pathfinding, is mutated in patients with Kallmann syndrome.
Hanchate, Naresh Kumar; Giacobini, Paolo; Lhuillier, Pierre; Parkash, Jyoti; Espy, Cécile; Fouveaut, Corinne; Leroy, Chrystel; Baron, Stéphanie; Campagne, Céline; Vanacker, Charlotte; Collier, Francis; Cruaud, Corinne; Meyer, Vincent; García-Piñero, Alfons; Dewailly, Didier; Cortet-Rudelli, Christine; Gersak, Ksenija; Metz, Chantal; Chabrier, Gérard; Pugeat, Michel; Young, Jacques; Hardelin, Jean-Pierre; Prevot, Vincent; Dodé, Catherine
2012-08-01
Kallmann syndrome (KS) associates congenital hypogonadism due to gonadotropin-releasing hormone (GnRH) deficiency and anosmia. The genetics of KS involves various modes of transmission, including oligogenic inheritance. Here, we report that Nrp1(sema/sema) mutant mice that lack a functional semaphorin-binding domain in neuropilin-1, an obligatory coreceptor of semaphorin-3A, have a KS-like phenotype. Pathohistological analysis of these mice indeed showed abnormal development of the peripheral olfactory system and defective embryonic migration of the neuroendocrine GnRH cells to the basal forebrain, which results in increased mortality of newborn mice and reduced fertility in adults. We thus screened 386 KS patients for the presence of mutations in SEMA3A (by Sanger sequencing of all 17 coding exons and flanking splice sites) and identified nonsynonymous mutations in 24 patients, specifically, a frameshifting small deletion (D538fsX31) and seven different missense mutations (R66W, N153S, I400V, V435I, T688A, R730Q, R733H). All the mutations were found in heterozygous state. Seven mutations resulted in impaired secretion of semaphorin-3A by transfected COS-7 cells (D538fsX31, R66W, V435I) or reduced signaling activity of the secreted protein in the GN11 cell line derived from embryonic GnRH cells (N153S, I400V, T688A, R733H), which strongly suggests that these mutations have a pathogenic effect. Notably, mutations in other KS genes had already been identified, in heterozygous state, in five of these patients. Our findings indicate that semaphorin-3A signaling insufficiency contributes to the pathogenesis of KS and further substantiate the oligogenic pattern of inheritance in this developmental disorder.