WorldWideScience

Sample records for quantitative real-time rt-pcr

  1. Quantitative real-time RT-PCR and chromogenic in situ hybridization

    DEFF Research Database (Denmark)

    Rosa, Fabíola E; Silveira, Sara M; Silveira, Cássia G T

    2009-01-01

    . METHODS: To elucidate the molecular profile of HER-2 status, mRNA and protein expression in 75 invasive breast carcinomas were analyzed by real time quantitative RT-PCR (qRT-PCR) and IHC, respectively. Amplifications were evaluated in 43 of these cases by CISH and in 11 by FISH. RESULTS: The concordance...

  2. Gold nanoparticle-based RT-PCR and real-time quantitative RT-PCR assays for detection of Japanese encephalitis virus

    International Nuclear Information System (INIS)

    Huang, S-H; Tsai, M-H; Lin, C-W; Yang, T-C; Chuang, P-H; Tsai, I-S; Lu, H-C; Wan Lei; Lin, Y-J; Lai, C-H

    2008-01-01

    Virus isolation and antibody detection are routinely used for diagnosis of Japanese encephalitis virus (JEV) infection, but the low level of transient viremia in some JE patients makes JEV isolation from clinical and surveillance samples very difficult. We describe the use of gold nanoparticle-based RT-PCR and real-time quantitative RT-PCR assays for detection of JEV from its RNA genome. We tested the effect of gold nanoparticles on four different PCR systems, including conventional PCR, reverse-transcription PCR (RT-PCR), and SYBR green real-time PCR and RT-PCR assays for diagnosis in the acute phase of JEV infection. Gold nanoparticles increased the amplification yield of the PCR product and shortened the PCR time compared to the conventional reaction. In addition, nanogold-based real-time RT-PCR showed a linear relationship between Ct and template amount using ten-fold dilutions of JEV. The nanogold-based RT-PCR and real-time quantitative RT-PCR assays were able to detect low levels (1-10 000 copies) of the JEV RNA genomes extracted from culture medium or whole blood, providing early diagnostic tools for the detection of low-level viremia in the acute-phase infection. The assays described here were simple, sensitive, and rapid approaches for detection and quantitation of JEV in tissue cultured samples as well as clinical samples

  3. Selection of internal control genes for quantitative real-time RT-PCR studies during tomato development process

    Directory of Open Access Journals (Sweden)

    Borges-Pérez Andrés

    2008-12-01

    Full Text Available Abstract Background The elucidation of gene expression patterns leads to a better understanding of biological processes. Real-time quantitative RT-PCR has become the standard method for in-depth studies of gene expression. A biologically meaningful reporting of target mRNA quantities requires accurate and reliable normalization in order to identify real gene-specific variation. The purpose of normalization is to control several variables such as different amounts and quality of starting material, variable enzymatic efficiencies of retrotranscription from RNA to cDNA, or differences between tissues or cells in overall transcriptional activity. The validity of a housekeeping gene as endogenous control relies on the stability of its expression level across the sample panel being analysed. In the present report we describe the first systematic evaluation of potential internal controls during tomato development process to identify which are the most reliable for transcript quantification by real-time RT-PCR. Results In this study, we assess the expression stability of 7 traditional and 4 novel housekeeping genes in a set of 27 samples representing different tissues and organs of tomato plants at different developmental stages. First, we designed, tested and optimized amplification primers for real-time RT-PCR. Then, expression data from each candidate gene were evaluated with three complementary approaches based on different statistical procedures. Our analysis suggests that SGN-U314153 (CAC, SGN-U321250 (TIP41, SGN-U346908 ("Expressed" and SGN-U316474 (SAND genes provide superior transcript normalization in tomato development studies. We recommend different combinations of these exceptionally stable housekeeping genes for suited normalization of different developmental series, including the complete tomato development process. Conclusion This work constitutes the first effort for the selection of optimal endogenous controls for quantitative real-time

  4. Evaluation of candidate reference genes for gene expression normalization in Brassica juncea using real time quantitative RT-PCR.

    Directory of Open Access Journals (Sweden)

    Ruby Chandna

    Full Text Available The real time quantitative reverse transcription PCR (qRT-PCR is becoming increasingly important to gain insight into function of genes. Given the increased sensitivity, ease and reproducibility of qRT-PCR, the requirement of suitable reference genes for normalization has become important and stringent. It is now known that the expression of internal control genes in living organism vary considerably during developmental stages and under different experimental conditions. For economically important Brassica crops, only a couple of reference genes are reported till date. In this study, expression stability of 12 candidate reference genes including ACT2, ELFA, GAPDH, TUA, UBQ9 (traditional housekeeping genes, ACP, CAC, SNF, TIPS-41, TMD, TSB and ZNF (new candidate reference genes, in a diverse set of 49 tissue samples representing different developmental stages, stress and hormone treated conditions and cultivars of Brassica juncea has been validated. For the normalization of vegetative stages the ELFA, ACT2, CAC and TIPS-41 combination would be appropriate whereas TIPS-41 along with CAC would be suitable for normalization of reproductive stages. A combination of GAPDH, TUA, TIPS-41 and CAC were identified as the most suitable reference genes for total developmental stages. In various stress and hormone treated samples, UBQ9 and TIPS-41 had the most stable expression. Across five cultivars of B. juncea, the expression of CAC and TIPS-41 did not vary significantly and were identified as the most stably expressed reference genes. This study provides comprehensive information that the new reference genes selected herein performed better than the traditional housekeeping genes. The selection of most suitable reference genes depends on the experimental conditions, and is tissue and cultivar-specific. Further, to attain accuracy in the results more than one reference genes are necessary for normalization.

  5. Selection of reference genes for quantitative real time RT-PCR during dimorphism in the zygomycete Mucor circinelloides.

    Science.gov (United States)

    Valle-Maldonado, Marco I; Jácome-Galarza, Irvin E; Gutiérrez-Corona, Félix; Ramírez-Díaz, Martha I; Campos-García, Jesús; Meza-Carmen, Víctor

    2015-03-01

    Mucor circinelloides is a dimorphic fungal model for studying several biological processes including cell differentiation (yeast-mold transitions) as well as biodiesel and carotene production. The recent release of the first draft sequence of the M. circinelloides genome, combined with the availability of analytical methods to determine patterns of gene expression, such as quantitative Reverse transcription-Polymerase chain reaction (qRT-PCR), and the development of molecular genetic tools for the manipulation of the fungus, may help identify M. circinelloides gene products and analyze their relevance in different biological processes. However, no information is available on M. circinelloides genes of stable expression that could serve as internal references in qRT-PCR analyses. One approach to solve this problem consists in the use of housekeeping genes as internal references. However, validation of the usability of these reference genes is a fundamental step prior to initiating qRT-PCR assays. This work evaluates expression of several constitutive genes by qRT-PCR throughout the morphological differentiation stages of M. circinelloides; our results indicate that tfc-1 and ef-1 are the most stable genes for qRT-PCR assays during differentiation studies and they are proposed as reference genes to carry out gene expression studies in this fungus.

  6. Ex vivo screening for immunodominant viral epitopes by quantitative real time polymerase chain reaction (qRT-PCR

    Directory of Open Access Journals (Sweden)

    Nagorsen Dirk

    2003-12-01

    Full Text Available Abstract The identification and characterization of viral epitopes across the Human Leukocyte Antigen (HLA polymorphism is critical for the development of actives-specific or adoptive immunotherapy of virally-mediated diseases. This work investigates whether cytokine mRNA transcripts could be used to identify epitope-specific HLA-restricted memory T lymphocytes reactivity directly in fresh peripheral blood mononuclear cells (PBMCs from viral-seropositive individuals in response to ex vivo antigen recall. PBMCs from HLA-A*0201 healthy donors, seropositive for Cytomegalovirus (CMV and Influenza (Flu, were exposed for different periods and at different cell concentrations to the HLA-A*0201-restricted viral FluM158–66 and CMVpp65495–503 peptides. Quantitative real time PCR (qRT-PCR was employed to evaluate memory T lymphocyte immune reactivation by measuring the production of mRNA encoding four cytokines: Interferon-γ (IFN-γ, Interleukin-2 (IL-2, Interleukin-4 (IL-4, and Interleukin-10 (IL-10. We could characterize cytokine expression kinetics that illustrated how cytokine mRNA levels could be used as ex vivo indicators of T cell reactivity. Particularly, IFN-γ mRNA transcripts could be consistently detected within 3 to 12 hours of short-term stimulation in levels sufficient to screen for HLA-restricted viral immune responses in seropositive subjects. This strategy will enhance the efficiency of the identification of viral epitopes independently of the individual HLA phenotype and could be used to follow the intensity of immune responses during disease progression or in response to in vivo antigen-specific immunization.

  7. Ex vivo screening for immunodominant viral epitopes by quantitative real time polymerase chain reaction (qRT-PCR)

    Science.gov (United States)

    Provenzano, Maurizio; Mocellin, Simone; Bonginelli, Paola; Nagorsen, Dirk; Kwon, Seog-Woon; Stroncek, David

    2003-01-01

    The identification and characterization of viral epitopes across the Human Leukocyte Antigen (HLA) polymorphism is critical for the development of actives-specific or adoptive immunotherapy of virally-mediated diseases. This work investigates whether cytokine mRNA transcripts could be used to identify epitope-specific HLA-restricted memory T lymphocytes reactivity directly in fresh peripheral blood mononuclear cells (PBMCs) from viral-seropositive individuals in response to ex vivo antigen recall. PBMCs from HLA-A*0201 healthy donors, seropositive for Cytomegalovirus (CMV) and Influenza (Flu), were exposed for different periods and at different cell concentrations to the HLA-A*0201-restricted viral FluM158–66 and CMVpp65495–503 peptides. Quantitative real time PCR (qRT-PCR) was employed to evaluate memory T lymphocyte immune reactivation by measuring the production of mRNA encoding four cytokines: Interferon-γ (IFN-γ), Interleukin-2 (IL-2), Interleukin-4 (IL-4), and Interleukin-10 (IL-10). We could characterize cytokine expression kinetics that illustrated how cytokine mRNA levels could be used as ex vivo indicators of T cell reactivity. Particularly, IFN-γ mRNA transcripts could be consistently detected within 3 to 12 hours of short-term stimulation in levels sufficient to screen for HLA-restricted viral immune responses in seropositive subjects. This strategy will enhance the efficiency of the identification of viral epitopes independently of the individual HLA phenotype and could be used to follow the intensity of immune responses during disease progression or in response to in vivo antigen-specific immunization. PMID:14675481

  8. Quantitative real-time RT-PCR and chromogenic in situ hybridization: precise methods to detect HER-2 status in breast carcinoma

    Directory of Open Access Journals (Sweden)

    Soares Fernando A

    2009-03-01

    Full Text Available Abstract Background HER-2 gene testing has become an integral part of breast cancer patient diagnosis. The most commonly used assay in the clinical setting for evaluating HER-2 status is immunohistochemistry (IHC and fluorescence in situ hybridization (FISH. These procedures permit correlation between HER-2 expression and morphological features. However, FISH signals are labile and fade over time, making post-revision of the tumor difficult. CISH (chromogenic in situ hybridization is an alternative procedure, with certain advantages, although still limited as a diagnostic tool in breast carcinomas. Methods To elucidate the molecular profile of HER-2 status, mRNA and protein expression in 75 invasive breast carcinomas were analyzed by real time quantitative RT-PCR (qRT-PCR and IHC, respectively. Amplifications were evaluated in 43 of these cases by CISH and in 11 by FISH. Results The concordance rate between IHC and qRT-PCR results was 78.9%, and 94.6% for qRT-PCR and CISH. Intratumoral heterogeneity of HER-2 status was identified in three cases by CISH. The results of the three procedures were compared and showed a concordance rate of 83.8%; higher discordances were observed in 0 or 1+ immunostaining cases, which showed high-level amplification (15.4% and HER-2 transcript overexpression (20%. Moreover, 2+ immunostaining cases presented nonamplified status (50% by CISH and HER-2 downexpression (38.5% by qRT-PCR. In general, concordance occurred between qRT-PCR and CISH results. A high concordance was observed between CISH/qRT-PCR and FISH. Comparisons with clinicopathological data revealed a significant association between HER-2 downexpression and the involvement of less than four lymph nodes (P = 0.0350. Conclusion Based on these findings, qRT-PCR was more precise and reproducible than IHC. Furthermore, CISH was revealed as an alternative and useful procedure for investigating amplifications involving the HER-2 gene.

  9. Quantitative real-time RT-PCR and chromogenic in situ hybridization: precise methods to detect HER-2 status in breast carcinoma

    International Nuclear Information System (INIS)

    Rosa, Fabíola E; Silveira, Sara M; Silveira, Cássia GT; Bérgamo, Nádia A; Neto, Francisco A Moraes; Domingues, Maria AC; Soares, Fernando A; Caldeira, José RF; Rogatto, Silvia R

    2009-01-01

    HER-2 gene testing has become an integral part of breast cancer patient diagnosis. The most commonly used assay in the clinical setting for evaluating HER-2 status is immunohistochemistry (IHC) and fluorescence in situ hybridization (FISH). These procedures permit correlation between HER-2 expression and morphological features. However, FISH signals are labile and fade over time, making post-revision of the tumor difficult. CISH (chromogenic in situ hybridization) is an alternative procedure, with certain advantages, although still limited as a diagnostic tool in breast carcinomas. To elucidate the molecular profile of HER-2 status, mRNA and protein expression in 75 invasive breast carcinomas were analyzed by real time quantitative RT-PCR (qRT-PCR) and IHC, respectively. Amplifications were evaluated in 43 of these cases by CISH and in 11 by FISH. The concordance rate between IHC and qRT-PCR results was 78.9%, and 94.6% for qRT-PCR and CISH. Intratumoral heterogeneity of HER-2 status was identified in three cases by CISH. The results of the three procedures were compared and showed a concordance rate of 83.8%; higher discordances were observed in 0 or 1+ immunostaining cases, which showed high-level amplification (15.4%) and HER-2 transcript overexpression (20%). Moreover, 2+ immunostaining cases presented nonamplified status (50%) by CISH and HER-2 downexpression (38.5%) by qRT-PCR. In general, concordance occurred between qRT-PCR and CISH results. A high concordance was observed between CISH/qRT-PCR and FISH. Comparisons with clinicopathological data revealed a significant association between HER-2 downexpression and the involvement of less than four lymph nodes (P = 0.0350). Based on these findings, qRT-PCR was more precise and reproducible than IHC. Furthermore, CISH was revealed as an alternative and useful procedure for investigating amplifications involving the HER-2 gene

  10. Selection of reference genes for quantitative real-time RT-PCR studies in tomato fruit of the genotype MT-Rg1

    Directory of Open Access Journals (Sweden)

    Karla L. González-Aguilera

    2016-09-01

    Full Text Available Quantitative real-time RT-PCR (qRT-PCR has become one of the most widely used methods for accurate quantification of gene expression. Since there are no universal reference genes for normalization, the optimal strategy to normalize raw qRT-PCR data is to perform an initial comparison of a set of independent reference genes to assess the most stable ones in each biological model. Normalization of a qRT-PCR experiment helps to ensure that the results are both statistically significant and biologically meaningful. Tomato is the model of choice to study fleshy fruit development. The miniature tomato (Solanum lycopersicum L. cultivar Micro-Tom (MT is considered a model system for tomato genetics and functional genomics. A new genotype, containing the Rg1 allele, improves tomato in vitro regeneration. In this work, we evaluated the expression stability of four tomato reference genes, namely CAC, SAND, Expressed and ACTIN2. We showed that the genes CAC and Exp are the best reference genes of the four we tested during fruit development in the MT-Rg1 genotype. Furthermore, we validated the reference genes by showing that the expression profiles of the transcription factors FRUITFULL1 (FUL1 and APETALA2c (AP2c during fruit development are comparable to previous reports using other tomato cultivars.

  11. Detection, quantitation and identification of enteroviruses from surface waters and sponge tissue from the Florida Keys using real-time RT-PCR

    Science.gov (United States)

    Donaldson, K.A.; Griffin, Dale W.; Paul, J.H.

    2002-01-01

    A method was developed for the quantitative detection of pathogenic human enteroviruses from surface waters in the Florida Keys using Taqman (R) one-step Reverse transcription (RT)-PCR with the Model 7700 ABI Prism (R) Sequence Detection System. Viruses were directly extracted from unconcentrated grab samples of seawater, from seawater concentrated by vortex flow filtration using a 100kD filter and from sponge tissue. Total RNA was extracted from the samples, purified and concentrated using spin-column chromatography. A 192-196 base pair portion of the 5??? untranscribed region was amplified from these extracts. Enterovirus concentrations were estimated using real-time RT-PCR technology. Nine of 15 sample sites or 60% were positive for the presence of pathogenic human enteroviruses. Considering only near-shore sites, 69% were positive with viral concentrations ranging from 9.3viruses/ml to 83viruses/g of sponge tissue (uncorrected for extraction efficiency). Certain amplicons were selected for cloning and sequencing for identification. Three strains of waterborne enteroviruses were identified as Coxsackievirus A9, Coxsackievirus A16, and Poliovirus Sabin type 1. Time and cost efficiency of this one-step real-time RT-PCR methodology makes this an ideal technique to detect, quantitate and identify pathogenic enteroviruses in recreational waters. Copyright ?? 2002 Elsevier Science Ltd.

  12. Validation of Reference Genes for Quantitative Expression Analysis by Real-Time RT-PCR in Four Lepidopteran Insects

    OpenAIRE

    Teng, Xiaolu; Zhang, Zan; He, Guiling; Yang, Liwen; Li, Fei

    2012-01-01

    Quantitative real-time polymerase chain reaction (qPCR) is an efficient and widely used technique to monitor gene expression. Housekeeping genes (HKGs) are often empirically selected as the reference genes for data normalization. However, the suitability of HKGs used as the reference genes has been seldom validated. Here, six HKGs were chosen (actin A3, actin A1, GAPDH, G3PDH, E2F, rp49) in four lepidopteran insects Bombyx mori L. (Lepidoptera: Bombycidae), Plutella xylostella L. (Plutellidae...

  13. Intra-laboratory validation of chronic bee paralysis virus quantitation using an accredited standardised real-time quantitative RT-PCR method.

    Science.gov (United States)

    Blanchard, Philippe; Regnault, Julie; Schurr, Frank; Dubois, Eric; Ribière, Magali

    2012-03-01

    Chronic bee paralysis virus (CBPV) is responsible for chronic bee paralysis, an infectious and contagious disease in adult honey bees (Apis mellifera L.). A real-time RT-PCR assay to quantitate the CBPV load is now available. To propose this assay as a reference method, it was characterised further in an intra-laboratory study during which the reliability and the repeatability of results and the performance of the assay were confirmed. The qPCR assay alone and the whole quantitation method (from sample RNA extraction to analysis) were both assessed following the ISO/IEC 17025 standard and the recent XP U47-600 standard issued by the French Standards Institute. The performance of the qPCR assay and of the overall CBPV quantitation method were validated over a 6 log range from 10(2) to 10(8) with a detection limit of 50 and 100 CBPV RNA copies, respectively, and the protocol of the real-time RT-qPCR assay for CBPV quantitation was approved by the French Accreditation Committee. Copyright © 2011 Elsevier B.V. All rights reserved.

  14. Validation of reference genes for quantitative expression analysis by real-time rt-PCR in four lepidopteran insects.

    Science.gov (United States)

    Teng, Xiaolu; Zhang, Zan; He, Guiling; Yang, Liwen; Li, Fei

    2012-01-01

    Quantitative real-time polymerase chain reaction (qPCR) is an efficient and widely used technique to monitor gene expression. Housekeeping genes (HKGs) are often empirically selected as the reference genes for data normalization. However, the suitability of HKGs used as the reference genes has been seldom validated. Here, six HKGs were chosen (actin A3, actin A1, GAPDH, G3PDH, E2F, rp49) in four lepidopteran insects Bombyx mori L. (Lepidoptera: Bombycidae), Plutella xylostella L. (Plutellidae), Chilo suppressalis Walker (Crambidae), and Spodoptera exigua Hübner (Noctuidae) to study their expression stability. The algorithms of geNorm, NormFinder, stability index, and ΔCt analysis were used to evaluate these HKGs. Across different developmental stages, actin A1 was the most stable in P. xylostella and C. suppressalis, but it was the least stable in B. mori and S. exigua. Rp49 and GAPDH were the most stable in B. mori and S. exigua, respectively. In different tissues, GAPDH, E2F, and Rp49 were the most stable in B. mori, S. exigua, and C. suppressalis, respectively. The relative abundances of Siwi genes estimated by 2(-ΔΔCt) method were tested with different HKGs as the reference gene, proving the importance of internal controls in qPCR data analysis. The results not only presented a list of suitable reference genes in four lepidopteran insects, but also proved that the expression stabilities of HKGs were different among evolutionarily close species. There was no single universal reference gene that could be used in all situations. It is indispensable to validate the expression of HKGs before using them as the internal control in qPCR.

  15. Selection and validation of reference genes for gene expression analysis in switchgrass (Panicum virgatum using quantitative real-time RT-PCR.

    Directory of Open Access Journals (Sweden)

    Jacinta Gimeno

    Full Text Available Switchgrass (Panicum virgatum has received a lot of attention as a forage and bioenergy crop during the past few years. Gene expression studies are in progress to improve new traits and develop new cultivars. Quantitative real time PCR (qRT-PCR has emerged as an important technique to study gene expression analysis. For accurate and reliable results, normalization of data with reference genes is essential. In this work, we evaluate the stability of expression of genes to use as reference for qRT-PCR in the grass P. virgatum. Eleven candidate reference genes, including eEF-1α, UBQ6, ACT12, TUB6, eIF-4a, GAPDH, SAMDC, TUA6, CYP5, U2AF, and FTSH4, were validated for qRT-PCR normalization in different plant tissues and under different stress conditions. The expression stability of these genes was verified by the use of two distinct algorithms, geNorm and NormFinder. Differences were observed after comparison of the ranking of the candidate reference genes identified by both programs but eEF-1α, eIF-4a, CYP5 and U2AF are ranked as the most stable genes in the samples sets under study. Both programs discard the use of SAMDC and TUA6 for normalization. Validation of the reference genes proposed by geNorm and NormFinder were performed by normalization of transcript abundance of a group of target genes in different samples. Results show similar expression patterns when the best reference genes selected by both programs were used but differences were detected in the transcript abundance of the target genes. Based on the above research, we recommend the use of different statistical algorithms to identify the best reference genes for expression data normalization. The best genes selected in this study will help to improve the quality of gene expression data in a wide variety of samples in switchgrass.

  16. Identification of normalization factors for quantitative real-time RT-PCR analysis of gene expression in Pacific abalone Haliotis discus hannai

    Science.gov (United States)

    Qiu, Reng; Sun, Boguang; Fang, Shasha; Sun, Li; Liu, Xiao

    2013-03-01

    Quantitative real-time reverse transcription-polymerase chain reaction (qRT-PCR) is widely used in studies of gene expression. In most of these studies, housekeeping genes are used as internal references without validation. To identify appropriate reference genes for qRT-PCR in Pacific abalone Haliotis discus hannai, we examined the transcription stability of six housekeeping genes in abalone tissues in the presence and absence of bacterial infection. For this purpose, abalone were infected with the bacterial pathogen Vibrio anguillarum for 12 h and 48 h. The mRNA levels of the housekeeping genes in five tissues (digestive glands, foot muscle, gill, hemocyte, and mantle) were determined by qRT-PCR. The PCR data was subsequently analyzed with the geNorm and NormFinder algorithms. The results show that in the absence of bacterial infection, elongation factor-1-alpha and beta-actin were the most stably expressed genes in all tissues, and thus are suitable as cross-tissue type normalization factors. However, we did not identify any universal reference genes post infection because the most stable genes varied between tissue types. Furthermore, for most tissues, the optimal reference genes identified by both algorithms at 12 h and 48 h post-infection differed. These results indicate that bacterial infection induced significant changes in the expression of abalone housekeeping genes in a manner that is dependent on tissue type and duration of infection. As a result, different normalization factors must be used for different tissues at different infection points.

  17. Development of a real-time RT-PCR assay for the simultaneous identification, quantitation and differentiation of avian metapneumovirus subtypes A and B.

    Science.gov (United States)

    Cecchinato, Mattia; Lupini, Caterina; Munoz Pogoreltseva, Olga Svetlana; Listorti, Valeria; Mondin, Alessandra; Drigo, Michele; Catelli, Elena

    2013-01-01

    In recent years, special attention has been paid to real-time polymerase chain reaction (PCR) for avian metapneumovirus (AMPV) diagnosis, due to its numerous advantages over classical PCR. A new multiplex quantitative real-time reverse transcription-PCR (qRT-PCR) with molecular beacon probe assay, designed to target the SH gene, was developed. The test was evaluated in terms of specificity, sensitivity and repeatability, and compared with conventional RT nested-PCR based on the G gene. All of the AMPV subtype A and B strains tested were amplified and specifically detected while no amplification occurred with other non-target bird respiratory pathogens. The detection limit of the assay was 10(-0.41) median infectious dose/ml and 10(1.15) median infectious dose/ml when the AMPV-B strain IT/Ty/B/Vr240/87 and the AMPV-A strain IT/Ty/A/259-01/03 were used, respectively, as templates. In all cases, the amplification efficiency was approximately 2 and the error values were 0.9375) between crossing point values and virus quantities, making the assay herein designed reliable for quantification. When the newly developed qRT-PCR was compared with a conventional RT nested-PCR, it showed greater sensitivity with RNA extracted from both positive controls and from experimentally infected birds. This assay can be effectively used for the detection, identification, differentiation and quantitation of AMPV subtype A or subtype B to assist in disease diagnosis and to carry out rapid surveillance with high levels of sensitivity and specificity.

  18. Development of a novel quantitative real-time RT-PCR assay for the simultaneous detection of all serotypes of Foot-and-mouth disease virus

    DEFF Research Database (Denmark)

    Rasmussen, Thomas Bruun; Uttenthal, Åse; de Stricker, K.

    2003-01-01

    Foot-and-mouth disease virus (FMDV) spreads extremely fast and the need for rapid and robust diagnostic virus detection systems was obvious during the recent European epidemic. Using a novel real-time RT-PCR system based on primer-probe energy transfer (PriProET) we present here an assay targeting...

  19. A plastome primer set for comprehensive quantitative real time RT-PCR analysis of Zea mays: a starter primer set for other Poaceae species

    Directory of Open Access Journals (Sweden)

    Dunn Sade N

    2008-06-01

    Full Text Available Abstract Background Quantitative Real Time RT-PCR (q2(RTPCR is a maturing technique which gives researchers the ability to quantify and compare very small amounts of nucleic acids. Primer design and optimization is an essential yet time consuming aspect of using q2(RTPCR. In this paper we describe the design and empirical optimization of primers to amplify and quantify plastid RNAs from Zea mays that are robust enough to use with other closely related species. Results Primers were designed and successfully optimized for 57 of the 104 reported genes in the maize plastome plus two nuclear genes. All 59 primer pairs produced single amplicons after end-point reverse transcriptase polymerase chain reactions (RT-PCR as visualized on agarose gels and subsequently verified by q2(RTPCR. Primer pairs were divided into several categories based on the optimization requirements or the uniqueness of the target gene. An in silico test suggested the majority of the primer sets should work with other members of the Poaceae family. An in vitro test of the primer set on two unsequenced species (Panicum virgatum and Miscanthus sinensis supported this assumption by successfully producing single amplicons for each primer pair. Conclusion Due to the highly conserved chloroplast genome in plant families it is possible to utilize primer pairs designed against one genomic sequence to detect the presence and abundance of plastid genes or transcripts from genomes that have yet to be sequenced. Analysis of steady state transcription of vital system genes is a necessary requirement to comprehensively elucidate gene expression in any organism. The primer pairs reported in this paper were designed for q2(RTPCR of maize chloroplast genes but should be useful for other members of the Poaceae family. Both in silico and in vitro data are presented to support this assumption.

  20. [Detecting HB-1 Expression Level in Bone Marrow of Acute Leukemia Patients by Real-Time Fluorescence Quantitative RT-PCR].

    Science.gov (United States)

    Wang, Qing-Yun; Li, Yuan; Ji, Li; Liang, Ze-Yin; Liu, Wei; Ren, Han-Yun; Qiu, Zhi-Xiang

    2018-02-01

    To investigate the expression level of HB-1 gene in patients with acute lymphoblastic leukemia (ALL) and the significance of HB-1 gene in monitoring of minimal residual disease (MRD). The method of real-time fluorescence quantitative RT-PCR (Taqman probe) was established to detect the expression levels of HB-1 gene; then the sensitivity, specificity and repeatability of this assay were evaluated and verified. The HB-1 gene expression levels in bone marrow of 183 cases of ALL, 70 cases of acute myeloid leukemias (AML), 52 cases of non-malignant hematologic diseases and 24 healthy hematopoietic stem cell donors were detected. The correlation of HB-1 level with diagnosis and relapse was analyzed by detecting bone marrow samples of 33 B-ALL. The sensitivity of this assay reached the 10 -4 level. The coefficient of variation for inter-batch and inter-tube of HB-1 were 6.79% and 4.80%, respectively. It was found that HB-1 gene specifically expressed in acute B lymphoblastic leukemia. The median expression levels of HB-1 gene in newly diagnosed and relapsed B-ALL patients were statistically significantly higher than those in ALL in complete remission(CR), newly diagnosed T-ALL, newly diagnosed AML, non-malignant hematologic diseases, and healthy hematopoietic stem cell donors(33.0% vs 0.68%, 0.07%, 0.02%, 0.58% and 0, respectively) (P0.05). The expression level of HB-1 gene declined sharply when B-ALL patients reached complete remission (0-7.99%, with median level 0.68%), but increased when relapsed (7.69%, 8.08% and 484.0% in 3 relapsed samples), which was in accordance with results of flow cytometry. HB-1 gene specifically expressed in acute B lymphoblastic leukemia cells. The established real-time fluorescence quantitative RT-PCR assay shows good sensitivity, specificity and repeatability, thus, can be used as a biological marker in the clinical detection, monitoring MRD and predicting of early relapse for B-ALL patients.

  1. High-level expression of podoplanin in benign and malignant soft tissue tumors: immunohistochemical and quantitative real-time RT-PCR analysis.

    Science.gov (United States)

    Xu, Yongjun; Ogose, Akira; Kawashima, Hiroyuki; Hotta, Tetsuo; Ariizumi, Takashi; Li, Guidong; Umezu, Hajime; Endo, Naoto

    2011-03-01

    Podoplanin is a 38 kDa mucin-type transmembrane glycoprotein that was first identified in rat glomerular epithelial cells (podocytes). It is expressed in normal lymphatic endothelium, but is absent from vascular endothelial cells. D2-40 is a commercially available mouse monoclonal antibody which binds to an epitope on human podoplanin. D2-40 immunoreactivity is therefore highly sensitive and specific for lymphatic endothelium. Recent investigations have shown widespread applications of immunohistochemical staining with D2-40 in evaluating podoplanin expression as an immunohistochemical marker for diagnosis and prognosis in various tumors. To determine whether the podoplanin (D2-40) antibody may be useful for the diagnosis of soft tissue tumors, 125 cases, including 4 kinds of benign tumors, 15 kinds of malignant tumors and 3 kinds of tumor-like lesions were immunostained using the D2-40 antibody. Total RNA was extracted from frozen tumor tissue obtained from 41 corresponding soft tissue tumor patients and 12 kinds of soft tissue tumor cell lines. Quantitative real-time PCR reactions were performed. Immunohistochemical and quantitative real-time RT-PCR analyses demonstrated the expression of the podoplanin protein and mRNA in the majority of benign and malignant soft tissue tumors and tumor-like lesions examined, with the exception of alveolar soft part sarcoma, embryonal and alveolar rhabdomyosarcoma, extraskeletal Ewing's sarcoma/peripheral primitive neuro-ectodermal tumor and lipoma, which were completely negative for podoplanin. Since it is widely and highly expressed in nearly all kinds of soft tissue tumors, especially in spindle cell sarcoma, myxoid type soft tissue tumors and soft tissue tumors of the nervous system, podoplanin is considered to have little value in the differential diagnosis of soft tissue tumors.

  2. Quantitation of O6-methylguanine-DNA methyltransferase gene messenger RNA in gliomas by means of real-time RT-PCR and clinical response to nitrosoureas.

    Science.gov (United States)

    Tanaka, Satoshi; Oka, Hidehiro; Fujii, Kiyotaka; Watanabe, Kaoru; Nagao, Kumi; Kakimoto, Atsushi

    2005-09-01

    1. O6-methylguanine-DNA methyltransferase (MGMT) mRNA was measured in 50 malignant gliomas that had received 1-(4-amino-2-methyl-5-pyrimidynyl) methyl-3-(2-chloroethyl)-3-nitrosourea hydrochloride (ACNU) after the resection of the tumor by real-time reverse transcription-polymerase chain reaction (RT-PCR) using TaqMan probe. 2. The mean absolute value of MGMTmRNA normalized to the level of glyceraldehyde-3-phosphate dehydrogenase (GAPDH) for 50 tumors was 1.29 x 10(4)+/- 1.28 x 10(4) copy/microg RNA (mean +/- SD). The amount of MGMTmRNA less than 6 x 10(3) copy/microg RNA was the most significant factor in predicting the initial effect of treatment with ACNU by multi-variant regression analysis (p = 0.0157). 3. These results suggest that quantitation of MGMTmRNA is the excellent method for predicting for the effect of ACNU in glioma therapy.

  3. Validation of putative reference genes for gene expression studies in human hepatocellular carcinoma using real-time quantitative RT-PCR

    International Nuclear Information System (INIS)

    Cicinnati, Vito R; Shen, Qingli; Sotiropoulos, Georgios C; Radtke, Arnold; Gerken, Guido; Beckebaum, Susanne

    2008-01-01

    Reference genes, which are often referred to as housekeeping genes are frequently used to normalize mRNA levels between different samples in quantitative reverse transcription polymerase chain reaction (qRT-PCR). The selection of reference genes is critical for gene expression studies because the expression of these genes may vary among tissues or cells and may change under certain circumstances. Here, a systematic evaluation of six putative reference genes for gene expression studies in human hepatocellular carcinoma (HCC) is presented. Six genes, beta-2-microglobulin (B2M), glyceraldehyde-3-phosphate dehydrogenase (GAPDH), hydroxymethyl-bilane synthase (HMBS), hypoxanthine phosphoribosyl-transferase 1 (HPRT1), succinate dehydrogenase complex, subunit A (SDHA) and ubiquitin C (UBC), with distinct functional characteristics and expression patterns were evaluated by qRT-PCR. Inhibitory substances in RNA samples were quantitatively assessed and controlled using an external RNA control. The stability of selected reference genes was analyzed using both geNorm and NormFinder software. HMBS and GAPDH were identified as the optimal reference genes for normalizing gene expression data between paired tumoral and adjacent non-tumoral tissues derived from patients with HCC. HMBS, GAPDH and UBC were identified to be suitable for the normalization of gene expression data among tumor tissues; whereas the combination of HMBS, B2M, SDHA and GAPDH was suitable for normalizing gene expression data among five liver cancer cell lines, namely Hep3B, HepG2, HuH7, SK-HEP-1 and SNU-182. The determined gene stability was increased after exclusion of RNA samples containing relatively higher inhibitory substances. Of six genes studied, HMBS was found to be the single best reference gene for gene expression studies in HCC. The appropriate choice of combination of more than one reference gene to improve qRT-PCR accuracy depends on the kind of liver tissues or cells under investigation

  4. Validation of putative reference genes for gene expression studies in human hepatocellular carcinoma using real-time quantitative RT-PCR

    Directory of Open Access Journals (Sweden)

    Radtke Arnold

    2008-11-01

    Full Text Available Abstract Background Reference genes, which are often referred to as housekeeping genes are frequently used to normalize mRNA levels between different samples in quantitative reverse transcription polymerase chain reaction (qRT-PCR. The selection of reference genes is critical for gene expression studies because the expression of these genes may vary among tissues or cells and may change under certain circumstances. Here, a systematic evaluation of six putative reference genes for gene expression studies in human hepatocellular carcinoma (HCC is presented. Methods Six genes, beta-2-microglobulin (B2M, glyceraldehyde-3-phosphate dehydrogenase (GAPDH, hydroxymethyl-bilane synthase (HMBS, hypoxanthine phosphoribosyl-transferase 1 (HPRT1, succinate dehydrogenase complex, subunit A (SDHA and ubiquitin C (UBC, with distinct functional characteristics and expression patterns were evaluated by qRT-PCR. Inhibitory substances in RNA samples were quantitatively assessed and controlled using an external RNA control. The stability of selected reference genes was analyzed using both geNorm and NormFinder software. Results HMBS and GAPDH were identified as the optimal reference genes for normalizing gene expression data between paired tumoral and adjacent non-tumoral tissues derived from patients with HCC. HMBS, GAPDH and UBC were identified to be suitable for the normalization of gene expression data among tumor tissues; whereas the combination of HMBS, B2M, SDHA and GAPDH was suitable for normalizing gene expression data among five liver cancer cell lines, namely Hep3B, HepG2, HuH7, SK-HEP-1 and SNU-182. The determined gene stability was increased after exclusion of RNA samples containing relatively higher inhibitory substances. Conclusion Of six genes studied, HMBS was found to be the single best reference gene for gene expression studies in HCC. The appropriate choice of combination of more than one reference gene to improve qRT-PCR accuracy depends on the

  5. Validation of putative reference genes for gene expression studies in human hepatocellular carcinoma using real-time quantitative RT-PCR

    Science.gov (United States)

    Cicinnati, Vito R; Shen, Qingli; Sotiropoulos, Georgios C; Radtke, Arnold; Gerken, Guido; Beckebaum, Susanne

    2008-01-01

    Background Reference genes, which are often referred to as housekeeping genes are frequently used to normalize mRNA levels between different samples in quantitative reverse transcription polymerase chain reaction (qRT-PCR). The selection of reference genes is critical for gene expression studies because the expression of these genes may vary among tissues or cells and may change under certain circumstances. Here, a systematic evaluation of six putative reference genes for gene expression studies in human hepatocellular carcinoma (HCC) is presented. Methods Six genes, beta-2-microglobulin (B2M), glyceraldehyde-3-phosphate dehydrogenase (GAPDH), hydroxymethyl-bilane synthase (HMBS), hypoxanthine phosphoribosyl-transferase 1 (HPRT1), succinate dehydrogenase complex, subunit A (SDHA) and ubiquitin C (UBC), with distinct functional characteristics and expression patterns were evaluated by qRT-PCR. Inhibitory substances in RNA samples were quantitatively assessed and controlled using an external RNA control. The stability of selected reference genes was analyzed using both geNorm and NormFinder software. Results HMBS and GAPDH were identified as the optimal reference genes for normalizing gene expression data between paired tumoral and adjacent non-tumoral tissues derived from patients with HCC. HMBS, GAPDH and UBC were identified to be suitable for the normalization of gene expression data among tumor tissues; whereas the combination of HMBS, B2M, SDHA and GAPDH was suitable for normalizing gene expression data among five liver cancer cell lines, namely Hep3B, HepG2, HuH7, SK-HEP-1 and SNU-182. The determined gene stability was increased after exclusion of RNA samples containing relatively higher inhibitory substances. Conclusion Of six genes studied, HMBS was found to be the single best reference gene for gene expression studies in HCC. The appropriate choice of combination of more than one reference gene to improve qRT-PCR accuracy depends on the kind of liver tissues

  6. Validation of reference genes for gene expression analysis in olive (Olea europaea) mesocarp tissue by quantitative real-time RT-PCR

    Science.gov (United States)

    2014-01-01

    Background Gene expression analysis using quantitative reverse transcription PCR (qRT-PCR) is a robust method wherein the expression levels of target genes are normalised using internal control genes, known as reference genes, to derive changes in gene expression levels. Although reference genes have recently been suggested for olive tissues, combined/independent analysis on different cultivars has not yet been tested. Therefore, an assessment of reference genes was required to validate the recent findings and select stably expressed genes across different olive cultivars. Results A total of eight candidate reference genes [glyceraldehyde 3-phosphate dehydrogenase (GAPDH), serine/threonine-protein phosphatase catalytic subunit (PP2A), elongation factor 1 alpha (EF1-alpha), polyubiquitin (OUB2), aquaporin tonoplast intrinsic protein (TIP2), tubulin alpha (TUBA), 60S ribosomal protein L18-3 (60S RBP L18-3) and polypyrimidine tract-binding protein homolog 3 (PTB)] were chosen based on their stability in olive tissues as well as in other plants. Expression stability was examined by qRT-PCR across 12 biological samples, representing mesocarp tissues at various developmental stages in three different olive cultivars, Barnea, Frantoio and Picual, independently and together during the 2009 season with two software programs, GeNorm and BestKeeper. Both software packages identified GAPDH, EF1-alpha and PP2A as the three most stable reference genes across the three cultivars and in the cultivar, Barnea. GAPDH, EF1-alpha and 60S RBP L18-3 were found to be most stable reference genes in the cultivar Frantoio while 60S RBP L18-3, OUB2 and PP2A were found to be most stable reference genes in the cultivar Picual. Conclusions The analyses of expression stability of reference genes using qRT-PCR revealed that GAPDH, EF1-alpha, PP2A, 60S RBP L18-3 and OUB2 are suitable reference genes for expression analysis in developing Olea europaea mesocarp tissues, displaying the highest level

  7. Touch-down reverse transcriptase-PCR detection of IgV(H) rearrangement and Sybr-Green-based real-time RT-PCR quantitation of minimal residual disease in patients with chronic lymphocytic leukemia.

    Science.gov (United States)

    Peková, Sona; Marková, Jana; Pajer, Petr; Dvorák, Michal; Cetkovský, Petr; Schwarz, Jirí

    2005-01-01

    Patients with chronic lymphocytic leukemia (CLL) can relapse even after aggressive therapy and autografts. It is commonly assumed that to prevent relapse the level of minimal residual disease (MRD) should be as low as possible. To evaluate MRD, highly sensitive quantitative assays are needed. The aim of the study was to develop a robust and sensitive method for detection of the clonal immunoglobulin heavy-chain variable (IgV(H)) rearrangement in CLL and to introduce a highly sensitive and specific methodology for MRD monitoring in patients with CLL who undergo intensive treatment. As a prerequisite for MRD detection, touch-down reverse transcriptase (RT)-PCR using degenerate primers were used for the diagnostic identification of (H) gene rearrangement(s). For quantitative MRD detection in 18 patients, we employed a real-time RT-PCR assay (RQ-PCR) making use of patient-specific primers and the cost-saving Sybr-Green reporter dye (SG). For precise calibration of RQ-PCR, patient-specific IgV(H) sequences were cloned. Touch-down RT-PCR with degenerate primers allowed the successful detection of IgV(H) clonal rearrangement(s) in 252 of 257 (98.1%) diagnostic samples. Biallelic rearrangements were found in 27 of 252 (10.7%) cases. Degenerate primers used for the identification of clonal expansion at diagnosis were not sensitive enough for MRD detection. In contrast, our RQ-PCR assay using patient-specific primers and SG reached the sensitivity of 10(-)(6). We demonstrated MRD in each patient tested, including four of four patients in complete remission following autologous hematopoietic stem cell transplantation (HSCT) and three of three following allogeneic 'mini'-HSCT. Increments in MRD might herald relapse; aggressive chemotherapy could induce molecular remission. Our touch-down RT-PCR has higher efficiency to detect clonal IgV(H) rearrangements including the biallelic ones. MRD quantitation of IgV(H) expression using SG-based RQ-PCR represents a highly specific

  8. Improvement of a real-time RT-PCR assay for the detection of enterovirus RNA

    Directory of Open Access Journals (Sweden)

    Bruynseels Peggy

    2009-07-01

    Full Text Available Abstract We describe an improvement of an earlier reported real-time RT-PCR assay for the detection of enterovirus RNA, based on the 5' exonuclease digestion of a dual-labeled fluorogenic probe by Taq DNA polymerase. A different extraction method, real-time RT-PCR instrument and primer set were evaluated. Our data show that the optimized assay yields a higher sensitivity and reproducibility and resulted in a significant reduced hands-on time per sample.

  9. Use of quantitative real-time RT-PCR to investigate the correlation between viremia and viral shedding of canine distemper virus, and infection outcomes in experimentally infected dogs.

    Science.gov (United States)

    Sehata, Go; Sato, Hiroaki; Ito, Toshihiro; Imaizumi, Yoshitaka; Noro, Taichi; Oishi, Eiji

    2015-07-01

    We used real-time RT-PCR and virus titration to examine canine distemper virus (CDV) kinetics in peripheral blood and rectal and nasal secretions from 12 experimentally infected dogs. Real-time RT-PCR proved extremely sensitive, and the correlation between the two methods for rectal and nasal (r=0.78, 0.80) samples on the peak day of viral RNA was good. Although the dogs showed diverse symptoms, viral RNA kinetics were similar; the peak of viral RNA in the symptomatic dogs was consistent with the onset of symptoms. These results indicate that real-time RT-PCR is sufficiently sensitive to monitor CDV replication in experimentally infected dogs regardless of the degree of clinical manifestation and suggest that the peak of viral RNA reflects active CDV replication.

  10. Identification and evaluation of new reference genes in Gossypium hirsutum for accurate normalization of real-time quantitative RT-PCR data

    Directory of Open Access Journals (Sweden)

    Alves-Ferreira Marcio

    2010-03-01

    Full Text Available Abstract Background Normalizing through reference genes, or housekeeping genes, can make more accurate and reliable results from reverse transcription real-time quantitative polymerase chain reaction (qPCR. Recent studies have shown that no single housekeeping gene is universal for all experiments. Thus, suitable reference genes should be the first step of any qPCR analysis. Only a few studies on the identification of housekeeping gene have been carried on plants. Therefore qPCR studies on important crops such as cotton has been hampered by the lack of suitable reference genes. Results By the use of two distinct algorithms, implemented by geNorm and NormFinder, we have assessed the gene expression of nine candidate reference genes in cotton: GhACT4, GhEF1α5, GhFBX6, GhPP2A1, GhMZA, GhPTB, GhGAPC2, GhβTUB3 and GhUBQ14. The candidate reference genes were evaluated in 23 experimental samples consisting of six distinct plant organs, eight stages of flower development, four stages of fruit development and in flower verticils. The expression of GhPP2A1 and GhUBQ14 genes were the most stable across all samples and also when distinct plants organs are examined. GhACT4 and GhUBQ14 present more stable expression during flower development, GhACT4 and GhFBX6 in the floral verticils and GhMZA and GhPTB during fruit development. Our analysis provided the most suitable combination of reference genes for each experimental set tested as internal control for reliable qPCR data normalization. In addition, to illustrate the use of cotton reference genes we checked the expression of two cotton MADS-box genes in distinct plant and floral organs and also during flower development. Conclusion We have tested the expression stabilities of nine candidate genes in a set of 23 tissue samples from cotton plants divided into five different experimental sets. As a result of this evaluation, we recommend the use of GhUBQ14 and GhPP2A1 housekeeping genes as superior references

  11. Identification and evaluation of new reference genes in Gossypium hirsutum for accurate normalization of real-time quantitative RT-PCR data.

    Science.gov (United States)

    Artico, Sinara; Nardeli, Sarah M; Brilhante, Osmundo; Grossi-de-Sa, Maria Fátima; Alves-Ferreira, Marcio

    2010-03-21

    Normalizing through reference genes, or housekeeping genes, can make more accurate and reliable results from reverse transcription real-time quantitative polymerase chain reaction (qPCR). Recent studies have shown that no single housekeeping gene is universal for all experiments. Thus, suitable reference genes should be the first step of any qPCR analysis. Only a few studies on the identification of housekeeping gene have been carried on plants. Therefore qPCR studies on important crops such as cotton has been hampered by the lack of suitable reference genes. By the use of two distinct algorithms, implemented by geNorm and NormFinder, we have assessed the gene expression of nine candidate reference genes in cotton: GhACT4, GhEF1alpha5, GhFBX6, GhPP2A1, GhMZA, GhPTB, GhGAPC2, GhbetaTUB3 and GhUBQ14. The candidate reference genes were evaluated in 23 experimental samples consisting of six distinct plant organs, eight stages of flower development, four stages of fruit development and in flower verticils. The expression of GhPP2A1 and GhUBQ14 genes were the most stable across all samples and also when distinct plants organs are examined. GhACT4 and GhUBQ14 present more stable expression during flower development, GhACT4 and GhFBX6 in the floral verticils and GhMZA and GhPTB during fruit development. Our analysis provided the most suitable combination of reference genes for each experimental set tested as internal control for reliable qPCR data normalization. In addition, to illustrate the use of cotton reference genes we checked the expression of two cotton MADS-box genes in distinct plant and floral organs and also during flower development. We have tested the expression stabilities of nine candidate genes in a set of 23 tissue samples from cotton plants divided into five different experimental sets. As a result of this evaluation, we recommend the use of GhUBQ14 and GhPP2A1 housekeeping genes as superior references for normalization of gene expression measures in

  12. Detection of Tomato black ring virus by real-time one-step RT-PCR.

    Science.gov (United States)

    Harper, Scott J; Delmiglio, Catia; Ward, Lisa I; Clover, Gerard R G

    2011-01-01

    A TaqMan-based real-time one-step RT-PCR assay was developed for the rapid detection of Tomato black ring virus (TBRV), a significant plant pathogen which infects a wide range of economically important crops. Primers and a probe were designed against existing genomic sequences to amplify a 72 bp fragment from RNA-2. The assay amplified all isolates of TBRV tested, but no amplification was observed from the RNA of other nepovirus species or healthy host plants. The detection limit of the assay was estimated to be around nine copies of the TBRV target region in total RNA. A comparison with conventional RT-PCR and ELISA, indicated that ELISA, the current standard test method, lacked specificity and reacted to all nepovirus species tested, while conventional RT-PCR was approximately ten-fold less sensitive than the real-time RT-PCR assay. Finally, the real-time RT-PCR assay was tested using five different RT-PCR reagent kits and was found to be robust and reliable, with no significant differences in sensitivity being found. The development of this rapid assay should aid in quarantine and post-border surveys for regulatory agencies. Copyright © 2010 Elsevier B.V. All rights reserved.

  13. Comparative evaluation of conventional RT-PCR and real-time RT-PCR (RRT-PCR) for detection of avian metapneumovirus subtype A

    OpenAIRE

    Ferreira, HL; Spilki, FR; dos Santos, MMAB; de Almeida, RS; Arns, CW

    2009-01-01

    Avian metapneumovirus (AMPV) belongs to Metapneumovirus genus of Paramyxoviridae family. Virus isolation, serology, and detection of genomic RNA are used as diagnostic methods for AMPV. The aim of the present study was to compare the detection of six subgroup A AMPV isolates (AMPV/A) viral RNA by using different conventional and real time RT-PCR methods. Two new RT-PCR tests and two real time RT-PCR tests, both detecting fusion (F) gene and nucleocapsid (N) gene were compared with an establis...

  14. Identification of genes for normalization of real-time RT-PCR data in breast carcinomas

    DEFF Research Database (Denmark)

    Lyng, Maria B; Laenkholm, Anne-Vibeke; Pallisgaard, Niels

    2008-01-01

    BACKGROUND: Quantitative real-time RT-PCR (RT-qPCR) has become a valuable molecular technique in basic and translational biomedical research, and is emerging as an equally valuable clinical tool. Correlation of inter-sample values requires data normalization, which can be accomplished by various...... means, the most common of which is normalization to internal, stably expressed, reference genes. Recently, such traditionally utilized reference genes as GAPDH and B2M have been found to be regulated in various circumstances in different tissues, emphasizing the need to identify genes independent...... of factors influencing the tissue, and that are stably expressed within the experimental milieu. In this study, we identified genes for normalization of RT-qPCR data for invasive breast cancer (IBC), with special emphasis on estrogen receptor positive (ER+) IBC, but also examined their applicability to ER...

  15. Detection of ROS1 Gene Rearrangement in Lung Adenocarcinoma: Comparison of IHC, FISH and Real-Time RT-PCR

    OpenAIRE

    Shan, Ling; Lian, Fang; Guo, Lei; Qiu, Tian; Ling, Yun; Ying, Jianming; Lin, Dongmei

    2015-01-01

    Aims To compare fluorescence in situ hybridization (FISH), immunohistochemistry (IHC) and quantitative real-time reverse transcription-PCR (qRT-PCR) assays for detection of ROS1 fusion in a large number of ROS1-positive lung adenocatcinoma (ADC) patients. Methods Using IHC analysis, sixty lung ADCs including 16 cases with ROS1 protein expression and 44 cases without ROS1 expression were selected for this study. The ROS1 fusion status was examined by FISH and qRT-PCR assay. Results Among 60 ca...

  16. Real-Time RT-PCR for the Detection of Lyssavirus Species

    Directory of Open Access Journals (Sweden)

    A. Deubelbeiss

    2014-01-01

    Full Text Available The causative agents of rabies are single-stranded, negative-sense RNA viruses in the genus Lyssavirus of Rhabdoviridae, consisting of twelve classified and three as yet unclassified species including classical rabies virus (RABV. Highly neurotropic RABV causes rapidly progressive encephalomyelitis with nearly invariable fatal outcome. Rapid and reliable diagnosis of rabies is highly relevant for public and veterinary health. Due to growing variety of the genus Lyssavirus observed, the development of suitable molecular assays for diagnosis and differentiation is challenging. This work focused on the establishment of a suitable real-time RT-PCR technique for rabies diagnosis as a complement to fluorescent antibody test and rabies tissue culture infection test as gold standard for diagnosis and confirmation. The real-time RT-PCR was adapted with the goal to detect the whole spectrum of lyssavirus species, for nine of which synthesized DNA fragments were used. For the detection of species, seven probes were developed. Serial dilutions of the rabies virus strain CVS-11 showed a 100-fold higher sensitivity of real-time PCR compared to heminested RT-PCR. Using a panel of thirty-one lyssaviruses representing four species, the suitability of the protocol could be shown. Phylogenetic analysis of the sequences obtained by heminested PCR allowed correct classification of all viruses used.

  17. Real time RT-PCR assay for detection of different serotypes of FMDV in Egypt

    Directory of Open Access Journals (Sweden)

    Laila El-Shehawy

    Full Text Available Aim: The present study indicated that rRT-PCR could be provided for the detection of FMDV in infected, contact and carrier cattle and also provide a rapid sensitive tool aiming to aid in rapid disease detection and control. Foot and Mouth disease virus serotypes O and A still existing in Egypt. In January 2012, sever outbreaks struck the animal population in most Egyptian 1 governorates. The causative virus was identified as FMDV SAT2. Material and Methods: Five samples of tongue epithelium (ET and five oesophageal-pharyngeal (OP fluid samples were collected from FMD suspected cattle in infected farm at El-Fayoum and 20 OP samples from in-contact cattle at the same farm in addition to 30 OP samples from apparently healthy cattle at three different localities in El-Fayoum governorate (12 from Fayoum; 9 from Sinoras and 9 from Edsa in order to detect carrier cattle. All of these samples were collected during November and December 2011 and January 2012. Results: All the ET and OP samples were inoculated on BHK cell culture and baby mice. The obtained results were identified using complement fixation test in addition to real-time reverse transcriptase polymerase chain reaction (rRT-PCR. In the infected farm at El-Fayoum FMDV type SAT2 was detected in cattle which are considered as the first introduction of this type while FMDV type O and SAT2 were detected in the in-contact cattle in the same farm. The sensitivity of rRT-PCR was cleared in the in-contact cattle as 13 out of 20 OP samples were positive to FMDV by rRT-PCR while 11 out of 20 OP samples were positive to FMDV by CFT. The OP samples collected from apparently healthy cattle from Fayoum, Sinoras and Edsa localities in Fayoum governorate demonstrate the circulation of the FMDV type A, O and the recent SAT2 in carrier cattle which threaten cattle population in Fayoum governorate. Also the sensitivity of real time RT-PCR over the CFT in detection of FMDV carrier cattle was clearly noticed in

  18. Ring trial 2016 for Bluetongue virus detection by real-time RT-PCR in France.

    Science.gov (United States)

    Sailleau, Corinne; Viarouge, Cyril; Breard, Emmanuel; Vitour, Damien; Zientara, Stephan

    2017-05-01

    Since the unexpected emergence of BTV-8 in Northern Europe and the incursion of BTV-8 and 1 in France in 2006-2007, molecular diagnosis has considerably evolved. Several real-time RT-PCR (rtRT-PCR) methods have been developed and published, and are currently being used in many countries across Europe for BTV detection and typing. In France, the national reference laboratory (NRL) for orbiviruses develops and validates 'ready-to-use' kits with private companies for viral RNA detection. The regional laboratories network that was set up to deal with a heavy demand for analyses has used these available kits. From 2007, ring tests were organized to monitor the performance of the French laboratories. This study presents the results of 63 regional laboratories in the ring trial organized in 2016. Blood samples were sent to the laboratories. Participants were asked to use the rtRT-PCR methods in place in their laboratory, for detection of all BTV serotypes and specifically BTV-8. The French regional laboratories are able to detect and genotype BTV in affected animals. Despite the use of several methods (i.e. RNA extraction and different commercial rtRT-PCRs), the network is homogeneous. The ring trial demonstrated that the French regional veterinary laboratories have reliable and robust BTV diagnostic tools for BTV genome detection.

  19. Detection panel for identification of twelve hemorrhagic viruses using real-time RT-PCR.

    Science.gov (United States)

    Fajfr, M; Neubauerová, V; Pajer, P; Kubíčková, P; Růžek, D

    2014-09-01

    Viral hemorrhagic fevers are caused by viruses from four viral families and develop diseases with high fatality rates. However, no commercial diagnostic assay for these pathogens is available. We developed real-time RT-PCR assays for viruses Ebola, Marburg, Lassa, Guanarito, Machupo, Junin, Sabiá, Seoul, Puumala, Hantaan, Crimean-Congo hemorrhagic fever virus and Rift Valley fever virus. The assays were optimized for identical reaction conditions and can be performed using several types of real-time PCR instruments, both capillary and plate, including a portable Ruggedized Advanced Pathogen Identification Device (R.A.P.I.D.) (Idaho Technology, Inc.). In combination with primers and probes from previously published studies, we present a simple system for rapid identification of hemorrhagic filoviruses, arenaviruses and bunyaviruses with sufficient sensitivity for first contact laboratory and diagnosis under field conditions.

  20. Real-time RT-PCR, a necessary tool to support the diagnosis and surveillance of rotavirus in Mexico.

    Science.gov (United States)

    De La Cruz Hernández, Sergio Isaac; Anaya Molina, Yazmin; Gómez Santiago, Fabián; Terán Vega, Heidi Lizbeth; Monroy Leyva, Elda; Méndez Pérez, Héctor; García Lozano, Herlinda

    2018-04-01

    Rotavirus produces diarrhea in children under 5 years old. Most of those conventional methods such as polyacrylamide gel electrophoresis (PAGE) and reverse transcription-polymerase chain reaction (RT-PCR) have been used for rotavirus detection. However, these techniques need a multi-step process to get the results. In comparison with conventional methods, the real-time RT-PCR is a highly sensitive method, which allows getting the results in only one day. In this study a real-time RT-PCR assay was tested using a panel of 440 samples from patients with acute gastroenteritis, and characterized by PAGE and RT-PCR. The results show that the real-time RT-PCR detected rotavirus from 73% of rotavirus-negative samples analyzed by PAGE and RT-PCR; thus, the percentage of rotavirus-positive samples increased to 81%. The results indicate that this real-time RT-PCR should be part of a routine analysis, and as a support of the diagnosis of rotavirus in Mexico. Copyright © 2017 Elsevier Inc. All rights reserved.

  1. Single reaction, real time RT-PCR detection of all known avian and human metapneumoviruses.

    Science.gov (United States)

    Lemaitre, E; Allée, C; Vabret, A; Eterradossi, N; Brown, P A

    2018-01-01

    Current molecular methods for the detection of avian and human metapneumovirus (AMPV, HMPV) are specifically targeted towards each virus species or individual subgroups of these. Here a broad range SYBR Green I real time RT-PCR was developed which amplified a highly conserved fragment of sequence in the N open reading frame. This method was sufficiently efficient and specific in detecting all MPVs. Its validation according to the NF U47-600 norm for the four AMPV subgroups estimated low limits of detection between 1000 and 10copies/μL, similar with detection levels described previously for real time RT-PCRs targeting specific subgroups. RNA viruses present a challenge for the design of durable molecular diagnostic test due to the rate of change in their genome sequences which can vary substantially in different areas and over time. The fact that the regions of sequence for primer hybridization in the described method have remained sufficiently conserved since the AMPV and HMPV diverged, should give the best chance of continued detection of current subgroups and of potential unknown or future emerging MPV strains. Copyright © 2017 Elsevier B.V. All rights reserved.

  2. The development and application of the two real-time RT-PCR assays to detect the pathogen of HFMD.

    Directory of Open Access Journals (Sweden)

    Aili Cui

    Full Text Available Large-scale Hand, Foot, and Mouth Disease (HFMD outbreaks have frequently occurred in China since 2008, affecting more than one million children and causing several hundred children deaths every year. The pathogens of HFMD are mainly human enteroviruses (HEVs. Among them, human enterovirus 71 (HEV71 and coxsackievirus A16 (CVA16 are the most common pathogens of HFMD. However, other HEVs could also cause HFMD. To rapidly detect HEV71 and CVA16, and ensure detection of all HEVs causing HFMD, two real-time hybridization probe-based RT-PCR assays were developed in this study. One is a multiplex real-time RT-PCR assay, which was developed to detect and differentiate HEV71 specifically from CVA16 directly from clinical specimens within 1-2 h, and the other is a broad-spectrum real-time RT-PCR assay, which targeted almost all HEVs. The experiments confirmed that the two assays have high sensitivity and specificity, and the sensitivity was up to 0.1 TCID50/ml for detection of HEVs, HEV71, and CVA16, respectively. A total of 213 clinical specimens were simultaneously detected by three kinds of assays, including the two real-time RT-PCR assays, direct conventional RT-PCR assay, and virus isolation assay on human rhabdomyosarcoma cells (RD cells. The total positive rate of both HEV71 and CVA16 was 69.48% with real-time RT-PCR assay, 47.42% with RT-PCR assay, and 34.58% with virus isolation assay. One HFMD clinical specimen was positive for HEV, but negative for HEV71 or CVA16, which was identified as Echovirus 11 (Echo11 by virus isolation, RT-PCR, and sequencing for the VP1 gene. The two real-time RT-PCR assays had been applied in 31 provincial HFMD labs to detect the pathogens of HFMD, which has contributed to the rapid identification of the pathogens in the early stages of HFMD outbreaks, and helped to clarify the etiologic agents of HFMD in China.

  3. Comparative Evaluation Of Conventional Rt-pcr And Real-time Rt-pcr (rrt-pcr) For Detection Of Avian Metapneumovirus Subtype A [comparação Entre As Técnicas De Rt-pcr Convencional E Rt-pcr Em Tempo Real Para A Detecção Do Metapneumovírus Aviários Subtipo A

    OpenAIRE

    Ferreira H.L.; Spilki F.R.; dos Santos M.M.A.B.; de Almeida R.S.; Arns C.W.

    2009-01-01

    Avian metapneumovirus (AMPV) belongs to Metapneumovirus genus of Paramyxoviridae family. Virus isolation, serology, and detection of genomic RNA are used as diagnostic methods for AMPV. The aim of the present study was to compare the detection of six subgroup A AMPV isolates (AMPV/A) viral RNA by using different conventional and real time RT-PCR methods. Two new RT-PCR tests and two real time RT-PCR tests, both detecting fusion (F) gene and nucleocapsid (N) gene were compared with an establis...

  4. Development and validation of sensitive real-time RT-PCR assay for broad detection of rabies virus.

    Science.gov (United States)

    Faye, Martin; Dacheux, Laurent; Weidmann, Manfred; Diop, Sylvie Audrey; Loucoubar, Cheikh; Bourhy, Hervé; Sall, Amadou Alpha; Faye, Ousmane

    2017-05-01

    Rabies virus (RABV) remains one of the most important global zoonotic pathogens. RABV causes rabies, an acute encephalomyelitis associated with a high rate of mortality in humans and animals and affecting different parts of the world, particularly in Asia and Africa. Confirmation of rabies diagnosis relies on laboratory diagnosis, in which molecular techniques such as detection of viral RNA by reverse transcription polymerase chain reaction (RT-PCR) are increasingly being used. In this study, two real-time quantitative RT-PCR assays were developed for large-spectrum detection of RABV, with a focus on African isolates. The primer and probe sets were targeted highly conserved regions of the nucleoprotein (N) and polymerase (L) genes. The results indicated the absence of non-specific amplification and cross-reaction with a range of other viruses belonging to the same taxonomic family, i.e. Rhabdoviridae, as well as negative brain tissues from various host species. Analytical sensitivity ranged between 100 to 10 standard RNA copies detected per reaction for N-gene and L-gene assays, respectively. Effective detection and high sensitivity of these assays on African isolates showed that they can be successfully applied in general research and used in diagnostic process and epizootic surveillance in Africa using a double-check strategy. Copyright © 2017 Elsevier B.V. All rights reserved.

  5. Microdroplet sandwich real-time rt-PCR for detection of pandemic and seasonal influenza subtypes.

    Directory of Open Access Journals (Sweden)

    Stephanie L Angione

    Full Text Available As demonstrated by the recent 2012/2013 flu epidemic, the continual emergence of new viral strains highlights the need for accurate medical diagnostics in multiple community settings. If rapid, robust, and sensitive diagnostics for influenza subtyping were available, it would help identify epidemics, facilitate appropriate antiviral usage, decrease inappropriate antibiotic usage, and eliminate the extra cost of unnecessary laboratory testing and treatment. Here, we describe a droplet sandwich platform that can detect influenza subtypes using real-time reverse-transcription polymerase chain reaction (rtRT-PCR. Using clinical samples collected during the 2010/11 season, we effectively differentiate between H1N1p (swine pandemic, H1N1s (seasonal, and H3N2 with an overall assay sensitivity was 96%, with 100% specificity for each subtype. Additionally, we demonstrate the ability to detect viral loads as low as 10(4 copies/mL, which is two orders of magnitude lower than viral loads in typical infected patients. This platform performs diagnostics in a miniaturized format without sacrificing any sensitivity, and can thus be easily developed into devices which are ideal for small clinics and pharmacies.

  6. Development and Characterization of Probe-Based Real Time Quantitative RT-PCR Assays for Detection and Serotyping of Foot-And-Mouth Disease Viruses Circulating in West Eurasia

    DEFF Research Database (Denmark)

    Jamal, Syed M.; Belsham, Graham

    2015-01-01

    Asia,A-Iran05 and Asia-1 (Group-II and Group-VII (Sindh-08)). In addition, field samples from Iran and Bulgaria, containing FMDVs belonging to the O-PanAsiaANT-10 subline-agewere also tested. Each of the three primer/probe sets was designed to be specific for just one of the serotypes O, A and Asia-1 of FMDV....... Due to the heterogeneity of FMD viruses (FMDVs) in different parts of the world, region specific diagnostic tests are required. In this study, hydrolysableprobe-based real time reverse transcription quantitative polymerase chain reaction (RTqPCR) assays were developed for specific detection...... and serotyping of the FMDVs currently circulating in West Eurasia. These assays were evaluated, in parallel with pan-FMDV diagnosticassays and earlier serotype-specific assays, using field samples originating from Pakistan and Afghanistan containing FMD viruses belonging to different sublineages of OPan...

  7. Absolute estimation of initial concentrations of amplicon in a real-time RT-PCR process

    Directory of Open Access Journals (Sweden)

    Kohn Michael

    2007-10-01

    Full Text Available Abstract Background Since real time PCR was first developed, several approaches to estimating the initial quantity of template in an RT-PCR reaction have been tried. While initially only the early thermal cycles corresponding to exponential duplication were used, lately there has been an effort to use all of the cycles in a PCR. The efforts have included both fitting empirical sigmoid curves and more elaborate mechanistic models that explore the chemical reactions taking place during each cycle. The more elaborate mechanistic models require many more parameters than can be fit from a single amplification, while the empirical models provide little insight and are difficult to tailor to specific reactants. Results We directly estimate the initial amount of amplicon using a simplified mechanistic model based on chemical reactions in the annealing step of the PCR. The basic model includes the duplication of DNA with the digestion of Taqman probe and the re-annealing between previously synthesized DNA strands of opposite orientation. By modelling the amount of Taqman probe digested and matching that with the observed fluorescence, the conversion factor between the number of fluorescing dye molecules and observed fluorescent emission can be estimated, along with the absolute initial amount of amplicon and the rate parameter for re-annealing. The model is applied to several PCR reactions with known amounts of amplicon and is shown to work reasonably well. An expanded version of the model allows duplication of amplicon without release of fluorescent dye, by adding 1 more parameter to the model. The additional process is helpful in most cases where the initial primer concentration exceeds the initial probe concentration. Software for applying the algorithm to data may be downloaded at http://www.niehs.nih.gov/research/resources/software/pcranalyzer/ Conclusion We present proof of the principle that a mechanistically based model can be fit to observations

  8. Table 1. Primer sequences used for real-time qRT-PCR analysis of ...

    Indian Academy of Sciences (India)

    User

    TGTCCCAGTAAACCGCTC. GAATCCAGCACGATACCAGT. Figure 1. Expression analysis of candidate CsActin and CsFbox genes by qRT-PCR in response to 4°C treatment. The y-axis indicates Cq values, and error bars represent standard deviations of the mean values of four replicates. Rt, roots; St, stems; Le, leaves; Fl ...

  9. A novel and highly sensitive real-time nested RT-PCR assay in a single closed tube for detection of enterovirus.

    Science.gov (United States)

    Shen, Xin-Xin; Qiu, Fang-Zhou; Zhao, Huai-Long; Yang, Meng-Jie; Hong, Liu; Xu, Song-Tao; Zhou, Shuai-Feng; Li, Gui-Xia; Feng, Zhi-Shan; Ma, Xue-Jun

    2018-03-01

    The sensitivity of qRT-PCR assay is not adequate for the detection of the samples with lower viral load, particularly in the cerebrospinal fluid (CSF) of patients. Here, we present the development of a highly sensitive real-time nested RT-PCR (RTN RT-PCR) assay in a single closed tube for detection of human enterovirus (HEV). The clinical performance of both RTN RT-PCR and qRT-PCR was also tested and compared using 140 CSF and fecal specimens. The sensitivities of RTN RT-PCR assay for EV71, Coxsackievirus A (CVA)16, CVA6 and CVA10 achieved 10 -8 dilution with a corresponding Ct value of 38.20, 36.45, 36.75, and 36.45, respectively, which is equal to traditional two-step nested RT-PCR assay and approximately 2-10-fold lower than that of qRT-PCR assay. The specificity of RTN RT-PCR assay was extensively analyzed insilico and subsequently verified using the reference isolates and clinical samples. Sixteen qRT-PCR-negative samples were detected by RTN RT-PCR and a variety of enterovirus serotypes was identified by sequencing of inner PCR products. We conclude RTN RT-PCR is more sensitive than qRT-PCR for the detection of HEV in clinical samples. Copyright © 2017 Elsevier Inc. All rights reserved.

  10. Development and Characterization of Probe-Based Real Time Quantitative RT-PCR Assays for Detection and Serotyping of Foot-And-Mouth Disease Viruses Circulating in West Eurasia.

    Science.gov (United States)

    Jamal, Syed M; Belsham, Graham J

    2015-01-01

    Rapid and accurate diagnosis of foot-and-mouth disease (FMD) and virus serotyping are of paramount importance for control of this disease in endemic areas where vaccination is practiced. Ideally this virus characterization should be achieved without the need for virus amplification in cell culture. Due to the heterogeneity of FMD viruses (FMDVs) in different parts of the world, region specific diagnostic tests are required. In this study, hydrolysable probe-based real time reverse transcription quantitative polymerase chain reaction (RT-qPCR) assays were developed for specific detection and serotyping of the FMDVs currently circulating in West Eurasia. These assays were evaluated, in parallel with pan-FMDV diagnostic assays and earlier serotype-specific assays, using field samples originating from Pakistan and Afghanistan containing FMD viruses belonging to different sublineages of O-PanAsia, A-Iran05 and Asia-1 (Group-II and Group-VII (Sindh-08)). In addition, field samples from Iran and Bulgaria, containing FMDVs belonging to the O-PanAsiaANT-10 sublineage were also tested. Each of the three primer/probe sets was designed to be specific for just one of the serotypes O, A and Asia-1 of FMDV and detected the RNA from the target viruses with cycle threshold (CT) values comparable with those obtained with the serotype-independent pan-FMDV diagnostic assays. No cross-reactivity was observed in these assays between the heterotypic viruses circulating in the region. The assays reported here have higher diagnostic sensitivity (100% each for serotypes O and Asia-1, and 92% [95% CI = 81.4-100%] for serotype A positive samples) and specificity (100% each for serotypes O, A and Asia-1 positive samples) for the viruses currently circulating in West Eurasia compared to the serotyping assays reported earlier. Comparisons of the sequences of the primers and probes used in these assays and the corresponding regions of the circulating viruses provided explanations for the poor

  11. Development and Characterization of Probe-Based Real Time Quantitative RT-PCR Assays for Detection and Serotyping of Foot-And-Mouth Disease Viruses Circulating in West Eurasia.

    Directory of Open Access Journals (Sweden)

    Syed M Jamal

    Full Text Available Rapid and accurate diagnosis of foot-and-mouth disease (FMD and virus serotyping are of paramount importance for control of this disease in endemic areas where vaccination is practiced. Ideally this virus characterization should be achieved without the need for virus amplification in cell culture. Due to the heterogeneity of FMD viruses (FMDVs in different parts of the world, region specific diagnostic tests are required. In this study, hydrolysable probe-based real time reverse transcription quantitative polymerase chain reaction (RT-qPCR assays were developed for specific detection and serotyping of the FMDVs currently circulating in West Eurasia. These assays were evaluated, in parallel with pan-FMDV diagnostic assays and earlier serotype-specific assays, using field samples originating from Pakistan and Afghanistan containing FMD viruses belonging to different sublineages of O-PanAsia, A-Iran05 and Asia-1 (Group-II and Group-VII (Sindh-08. In addition, field samples from Iran and Bulgaria, containing FMDVs belonging to the O-PanAsiaANT-10 sublineage were also tested. Each of the three primer/probe sets was designed to be specific for just one of the serotypes O, A and Asia-1 of FMDV and detected the RNA from the target viruses with cycle threshold (CT values comparable with those obtained with the serotype-independent pan-FMDV diagnostic assays. No cross-reactivity was observed in these assays between the heterotypic viruses circulating in the region. The assays reported here have higher diagnostic sensitivity (100% each for serotypes O and Asia-1, and 92% [95% CI = 81.4-100%] for serotype A positive samples and specificity (100% each for serotypes O, A and Asia-1 positive samples for the viruses currently circulating in West Eurasia compared to the serotyping assays reported earlier. Comparisons of the sequences of the primers and probes used in these assays and the corresponding regions of the circulating viruses provided explanations for

  12. Field evaluation of an open and polyvalent universal HIV-1/SIVcpz/SIVgor quantitative RT-PCR assay for HIV-1 viral load monitoring in comparison to Abbott RealTime HIV-1 in Cameroon.

    Science.gov (United States)

    Guichet, Emilande; Aghokeng, Avelin; Eymard-Duvernay, Sabrina; Vidal, Nicole; Ayouba, Ahidjo; Mpoudi Ngole, Eitel; Delaporte, Eric; Ciaffi, Laura; Peeters, Martine

    2016-11-01

    With the increasing demand of HIV viral load (VL) tests in resource-limited countries (RLCs) there is a need for assays at affordable cost and able to quantify all known HIV-1 variants. VLs obtained with a recently developed open and polyvalent universal HIV-1/SIVcpz/SIVgor RT-qPCR were compared to Abbott RealTime HIV-1 assay in Cameroon. On 474 plasma samples, characterized by a wide range of VLs and a broad HIV-1 group M genetic diversity, 97.5% concordance was observed when using the lower detection limit of each assay. When using the threshold of 3.00 log 10 copies/mL, according to WHO guidelines to define virological failure (VF) in RLCs, the concordance was 94.7%, 360/474 versus 339/474 patients were identified with VF with the new assay and Abbott RealTime HIV-1, respectively. Higher VLs were measured with the new assay, +0.47 log 10 copies/mL (95% CI; 0.42-0.52) as shown with Bland-Altman analysis. Eleven samples from patients on VF with drug resistance were not detected by Abbott RealTime HIV-1 versus two only with the new assay. Overall, our study showed that the new assay can be easily implemented in a laboratory in RLCs with VL experience and showed good performance on a wide diversity of HIV-1 group M variants. Copyright © 2016 Elsevier B.V. All rights reserved.

  13. Development and implementation of the quality control panel of RT-PCR and real-time RT-PCR for avian influenza A (H5N1 surveillance network in mainland China

    Directory of Open Access Journals (Sweden)

    Wang Wei

    2011-03-01

    Full Text Available Abstract Background Reverse transcription PCR (RT-PCR and real time RT-PCR (rRT-PCR have been indispensable methods for influenza surveillance, especially for determination of avian influenza. The movement of testing beyond reference lab introduced the need of quality control, including the implementation of an evaluation system for validating personal training and sample proficiency testing. Methods We developed a panel with lysates of seasonal influenza virus (H1N1, H3N2 and B, serials of diluted H5N1 virus lysates, and in-vitro transcribed H5 hemaglutinin (HA and an artificial gene RNAs for RT-PCR and rRT-PCR quality control assessment. The validations of stability and reproducibility were performed on the panel. Additionally, the panel was implemented to assess the detection capability of Chinese human avian influenza networks. Results The panel has relatively high stability and good reproducibility demonstrated by kappa's tests. In the implementation of panel on Chinese human avian influenza networks, the results suggested that there were a relatively low number of discrepancies for both concise and reproducibility in Chinese avian influenza virus net works. Conclusions A quality control panel of RT-PCR and real-time RT-PCR for avian influenza A (H5N1 surveillance network was developed. An availably statistical data, which are used to assess the detection capability of networks on avian influenza virus (H5N1, can be obtained relatively easily through implementation of the panel on networks.

  14. Comparison of multiplex RT-PCR and real-time HybProbe assay for serotyping of dengue virus using reference strains and clinical samples from India

    Directory of Open Access Journals (Sweden)

    Anita Chakravarti

    2016-01-01

    Full Text Available Background: Dengue virus serotyping is crucial from clinical management and epidemiological point of view. Aims: To compare efficacy of two molecular detection and typing methods, namely, multiplex reverse transcription polymerase chain reaction (RT-PCR and real-time Hybprobe assay using a panel of known dilution of four reference Dengue virus strains and a panel of sera collected from clinically suspected dengue patients. Settings: This study was conducted at a tertiary-care teaching hospital in Delhi, India. Materials and Methods: Dengue serotype specific virus strains were used as prototypes for serotyping assays. Viral load was quantified by quantitative real time reverse transcription polymerase chain reaction (qRT-PCR. Acute phase serum samples were collected from 79 patients with clinically suspected Dengue fever on their first day of presentation during September-October 2012. Viral RNA from serum and cell culture supernatant was extracted. Reverse transcription was carried out. Quantitative detection of DENV RNA from reference strain culture supernatants and each of the 79 patient samples by real-time PCR was performed using light cycler Taqman master mix kit. Serotyping was done by multiplex RT-PCR assay and Hybprobe assay. Results: The multiplex RT-PCR assay, though found to be 100% specific, couldn't serotype either patient or reference strains with viral load less than 1000 RNA copies/ml. The Hybprobe assay was found to have 100% specificity and had a lower limit of serotype detection of merely 3.54 RNA copies/ml. Conclusions: HybProbe assay has an important role especially in situations where serotyping is to be performed in clinical samples with low viral load.

  15. Selection of Housekeeping Genes for Transgene Expression Analysis in Eucommia ulmoides Oliver Using Real-Time RT-PCR

    Directory of Open Access Journals (Sweden)

    Ren Chen

    2010-01-01

    Full Text Available In order to select appropriate housekeeping genes for accurate calibration of experimental variations in real-time (RT- PCR results in transgene expression analysis, particularly with respect to the influence of transgene on stability of endogenous housekeeping gene expression in transgenic plants, we outline a reliable strategy to identify the optimal housekeeping genes from a set of candidates by combining statistical analyses of their (RT- PCR amplification efficiency, gene expression stability, and transgene influences. We used the strategy to select two genes, ACTα and EF1α, from 10 candidate housekeeping genes, as the optimal housekeeping genes to evaluate transgenic Eucommia ulmoides Oliver root lines overexpressing IPPI or FPPS1 genes, which are involved in isoprenoid biosynthesis.

  16. Real-time RT-PCR high-resolution melting curve analysis and multiplex RT-PCR to detect and differentiate grapevine leafroll-associated associated virus 3 variant groups I, II, III and VI

    Directory of Open Access Journals (Sweden)

    Bester Rachelle

    2012-09-01

    Full Text Available Abstract Background Grapevine leafroll-associated virus 3 (GLRaV-3 is the main contributing agent of leafroll disease worldwide. Four of the six GLRaV-3 variant groups known have been found in South Africa, but their individual contribution to leafroll disease is unknown. In order to study the pathogenesis of leafroll disease, a sensitive and accurate diagnostic assay is required that can detect different variant groups of GLRaV-3. Methods In this study, a one-step real-time RT-PCR, followed by high-resolution melting (HRM curve analysis for the simultaneous detection and identification of GLRaV-3 variants of groups I, II, III and VI, was developed. A melting point confidence interval for each variant group was calculated to include at least 90% of all melting points observed. A multiplex RT-PCR protocol was developed to these four variant groups in order to assess the efficacy of the real-time RT-PCR HRM assay. Results A universal primer set for GLRaV-3 targeting the heat shock protein 70 homologue (Hsp70h gene of GLRaV-3 was designed that is able to detect GLRaV-3 variant groups I, II, III and VI and differentiate between them with high-resolution melting curve analysis. The real-time RT-PCR HRM and the multiplex RT-PCR were optimized using 121 GLRaV-3 positive samples. Due to a considerable variation in melting profile observed within each GLRaV-3 group, a confidence interval of above 90% was calculated for each variant group, based on the range and distribution of melting points. The intervals of groups I and II could not be distinguished and a 95% joint confidence interval was calculated for simultaneous detection of group I and II variants. An additional primer pair targeting GLRaV-3 ORF1a was developed that can be used in a subsequent real-time RT-PCR HRM to differentiate between variants of groups I and II. Additionally, the multiplex RT-PCR successfully validated 94.64% of the infections detected with the real-time RT-PCR HRM

  17. Lineage-Specific Real-Time RT-PCR for Yellow Fever Virus Outbreak Surveillance, Brazil.

    Science.gov (United States)

    Fischer, Carlo; Torres, Maria C; Patel, Pranav; Moreira-Soto, Andres; Gould, Ernest A; Charrel, Rémi N; de Lamballerie, Xavier; Nogueira, Rita Maria Ribeiro; Sequeira, Patricia C; Rodrigues, Cintia D S; Kümmerer, Beate M; Drosten, Christian; Landt, Olfert; Bispo de Filippis, Ana Maria; Drexler, Jan Felix

    2017-11-01

    The current yellow fever outbreak in Brazil prompted widespread yellow fever virus (YFV) vaccination campaigns, imposing a responsibility to distinguish between vaccine- and wild-type YFV-associated disease. We developed novel multiplex real-time reverse transcription PCRs that differentiate between vaccine and American wild-type YFV. We validated these highly specific and sensitive assays in an outbreak setting.

  18. Lineage-Specific Real-Time RT-PCR for Yellow Fever Virus Outbreak Surveillance, Brazil

    OpenAIRE

    Fischer, Carlo; Torres, Maria C.; Patel, Pranav; Moreira-Soto, Andres; Gould, Ernest A.; Charrel, Rémi N.; de Lamballerie, Xavier; Nogueira, Rita Maria Ribeiro; Sequeira, Patricia C.; Rodrigues, Cintia D.S.; Kümmerer, Beate M.; Drosten, Christian; Landt, Olfert; Bispo de Filippis, Ana Maria; Drexler, Jan Felix

    2017-01-01

    The current yellow fever outbreak in Brazil prompted widespread yellow fever virus (YFV) vaccination campaigns, imposing a responsibility to distinguish between vaccine- and wild-type YFV-associated disease. We developed novel multiplex real-time reverse transcription PCRs that differentiate between vaccine and American wild-type YFV. We validated these highly specific and sensitive assays in an outbreak setting.

  19. Development of a duplex real-time RT-PCR for the simultaneous detection and differentiation of Theiler's murine encephalomyelitis virus and rat theilovirus.

    Science.gov (United States)

    Yuan, Wen; Wang, Jing; Xu, Fengjiao; Huang, Bihong; Lian, Yuexiao; Rao, Dan; Yin, Xueqin; Wu, Miaoli; Zhu, Yujun; Zhang, Yu; Huang, Ren; Guo, Pengju

    2016-10-01

    Theiler's murine encephalomyelitis virus (TMEV) and rat theilovirus (RTV), the member of the genus Cardiovirus, are widespread in laboratory mice and rats, and are potential contaminants of biological materials. Cardioviruses infection may cause serious complications in biomedical research. To improve the efficiency of routine screening for Cardioviruses infection, a duplex real-time reverse transcriptase polymerase chain reaction (RT-PCR) assay was developed for simultaneous detection and differentiation of TMEV and RTV. The duplex assay was specific for reference strains of TMEV and RTV, and no cross-reaction was found with seven other rodent viruses. The limits of detection of both TMEV and RTV were 4×10(1) copies RNA/reaction. Reproducibility was estimated using standard dilutions, with coefficients of variation duplex real-time RT-PCR and conventional RT-PCR. For 439 clinical samples,95 samples were positive for TMEV and 72 samples were positive for RTV using duplex real-time RT-PCR approach, whereas only 77 samples were positive for TMEV and 66 samples were positive for RTV when conventional RT-PCR was applied. Mixed infections were found in 20 samples when analyzed by conventional RT-PCR whereas 30 samples were found to be mixed infection when duplex real-time RT-PCR was applied. This duplex assay provides a useful tool for routine health monitoring and screening of contaminated biological materials of these two viruses. Copyright © 2016 Elsevier B.V. All rights reserved.

  20. Correlation of immune activation with HIV-1 RNA levels assayed by real-time RT-PCR in HIV-1 Subtype C infected patients in Northern India

    Science.gov (United States)

    Agarwal, Atima; Sankaran, Sumathi; Vajpayee, Madhu; Sreenivas, V; Seth, Pradeep; Dandekar, Satya

    2014-01-01

    Background Assays with specificity and cost effectiveness are needed for the measurement of HIV-1 burden to monitor disease progression or response to anti-retroviral therapy (ART) in HIV-1 subtype C infected patients. Objectives The objective of this study was to develop and validate an affordable; one step Real-Time RT-PCR assay with high specificity and sensitivity to measure plasma HIV-1 loads in HIV-1 subtype C infected patients. Results We developed an RT-PCR assay to detect and quantitate plasma HIV-1 levels in HIV-1 subtype C infected patients. An inverse correlation between plasma viral loads (PVL) and CD4+ T-cell numbers was detected at all CDC stages. Significant correlations were found between CD8+ T-cell activation and PVL, as well as with the clinical and immunological status of the patients. Conclusions The RT-PCR assay provides a sensitive method to measure PVL in HIV-1 subtype C infected patients. Viral loads correlated with immune activation and can be used to monitor HIV care in India. PMID:17962068

  1. Quantitative RT-PCR analysis of estrogen receptor gene expression in laser microdissected prostate cancer tissue.

    Science.gov (United States)

    Walton, Thomas J; Li, Geng; McCulloch, Thomas A; Seth, Rashmi; Powe, Desmond G; Bishop, Michael C; Rees, Robert C

    2009-06-01

    Real-time quantitative RT-PCR analysis of laser microdissected tissue is considered the most accurate technique for determining tissue gene expression. The discovery of estrogen receptor beta (ERbeta) has focussed renewed interest on the role of estrogen receptors in prostate cancer, yet few studies have utilized the technique to analyze estrogen receptor gene expression in prostate cancer. Fresh tissue was obtained from 11 radical prostatectomy specimens and from 6 patients with benign prostate hyperplasia. Pure populations of benign and malignant prostate epithelium were laser microdissected, followed by RNA isolation and electrophoresis. Quantitative RT-PCR was performed using primers for androgen receptor (AR), estrogen receptor beta (ERbeta), estrogen receptor alpha (ERalpha), progesterone receptor (PGR) and prostate specific antigen (PSA), with normalization to two housekeeping genes. Differences in gene expression were analyzed using the Mann-Whitney U-test. Correlation coefficients were analyzed using Spearman's test. Significant positive correlations were seen when AR and AR-dependent PSA, and ERalpha and ERalpha-dependent PGR were compared, indicating a representative population of RNA transcripts. ERbeta gene expression was significantly over-expressed in the cancer group compared with benign controls (P cancer group (P prostate cancer specimens. In concert with recent studies the findings suggest differential production of ERbeta splice variants, which may play important roles in the genesis of prostate cancer. (c) 2009 Wiley-Liss, Inc.

  2. Development of duplex real-time RT-PCR based on Taqman technology for detecting simultaneously the genome of pan-enterovirus and enterovirus 71.

    Science.gov (United States)

    Hwang, Seoyeon; Kang, Byunghak; Hong, Jiyoung; Kim, Ahyoun; Kim, Hyejin; Kim, Kisang; Cheon, Doo-Sung

    2013-07-01

    Human enterovirus (EV) 71 is the main etiological agent of hand, foot, and mouth disease (HFMD). It is associated with neurological complications, and caused fatalities during recent outbreaks in the Asia-Pacific region. Infections caused by EV71 could lead to many complications, ranging from brainstem encephalitis to pulmonary oedema, resulting in high mortality. In this study, a duplex real-time RT-PCR assay was developed in order to simultaneously detect pan-EV and EV71. EV71-specific primers and probes were designed based on the highly conserved VP1 region of EV71. Five EV71 strains were detected as positive, and no positive fluorescence signal was observed in the duplex real-time RT-PCR for other viral RNA, which showed 100% specificity for the selected panel, and no cross-reactions were observed in this duplex real-time RT-PCR. The EV71-specific duplex real-time RT-PCR was more sensitive than conventional RT-PCR, and detected viral titers that were 10-fold lower than those measured by the latter. Of the 381 HFMD clinical specimens, 196 (51.4%) cases were pan-EV-positive, of which 170 (86.7%) were EV71-positive when tested by pan-EV and EV71-specific duplex real-time RT-PCR. EV71-specific duplex real-time RT-PCR offers a rapid and sensitive method to detect EV71 from clinical specimens, and will allow quarantine measures to be taken more effectively during outbreaks. Copyright © 2013 Wiley Periodicals, Inc.

  3. A duplex real-time RT-PCR assay for detecting H5N1 avian influenza virus and pandemic H1N1 influenza virus

    Directory of Open Access Journals (Sweden)

    Qin E-de

    2010-06-01

    Full Text Available Abstract A duplex real-time reverse transcriptase polymerase chain reaction (RT-PCR assay was improved for simultaneous detection of highly pathogenic H5N1 avian influenza virus and pandemic H1N1 (2009 influenza virus, which is suitable for early diagnosis of influenza-like patients and for epidemiological surveillance. The sensitivity of this duplex real-time RT-PCR assay was 0.02 TCID50 (50% tissue culture infective dose for H5N1 and 0.2 TCID50 for the pandemic H1N1, which was the same as that of each single-target RT-PCR for pandemic H1N1 and even more sensitive for H5N1 with the same primers and probes. No cross reactivity of detecting other subtype influenza viruses or respiratory tract viruses was observed. Two hundred and thirty-six clinical specimens were tested by comparing with single real-time RT-PCR and result from the duplex assay was 100% consistent with the results of single real-time RT-PCR and sequence analysis.

  4. A novel method of multiple nucleic acid detection: Real-time RT-PCR coupled with probe-melting curve analysis.

    Science.gov (United States)

    Han, Yang; Hou, Shao-Yang; Ji, Shang-Zhi; Cheng, Juan; Zhang, Meng-Yue; He, Li-Juan; Ye, Xiang-Zhong; Li, Yi-Min; Zhang, Yi-Xuan

    2017-11-15

    A novel method, real-time reverse transcription PCR (real-time RT-PCR) coupled with probe-melting curve analysis, has been established to detect two kinds of samples within one fluorescence channel. Besides a conventional TaqMan probe, this method employs another specially designed melting-probe with a 5' terminus modification which meets the same label with the same fluorescent group. By using an asymmetric PCR method, the melting-probe is able to detect an extra sample in the melting stage effectively while it almost has little influence on the amplification detection. Thus, this method allows the availability of united employment of both amplification stage and melting stage for detecting samples in one reaction. The further demonstration by simultaneous detection of human immunodeficiency virus (HIV) and hepatitis C virus (HCV) in one channel as a model system is presented in this essay. The sensitivity of detection by real-time RT-PCR coupled with probe-melting analysis was proved to be equal to that detected by conventional real-time RT-PCR. Because real-time RT-PCR coupled with probe-melting analysis can double the detection throughputs within one fluorescence channel, it is expected to be a good solution for the problem of low-throughput in current real-time PCR. Copyright © 2017 Elsevier Inc. All rights reserved.

  5. A duplex real-time RT-PCR assay for detecting H5N1 avian influenza virus and pandemic H1N1 influenza virus

    OpenAIRE

    Kang, Xiao-ping; Jiang, Tao; Li, Yong-qiang; Lin, Fang; Liu, Hong; Chang, Guo-hui; Zhu, Qing-yu; Qin, E-de; Qin, Cheng-feng; Yang, Yin-hui

    2010-01-01

    Abstract A duplex real-time reverse transcriptase polymerase chain reaction (RT-PCR) assay was improved for simultaneous detection of highly pathogenic H5N1 avian influenza virus and pandemic H1N1 (2009) influenza virus, which is suitable for early diagnosis of influenza-like patients and for epidemiological surveillance. The sensitivity of this duplex real-time RT-PCR assay was 0.02 TCID50 (50% tissue culture infective dose) for H5N1 and 0.2 TCID50 for the pandemic H1N1, which was the same a...

  6. A real time Taqman RT-PCR for the detection of rabbit hemorrhagic disease virus 2 (RHDV2).

    Science.gov (United States)

    Duarte, Margarida Dias; Carvalho, Carina L; Barros, Silvia C; Henriques, Ana M; Ramos, Fernanda; Fagulha, Teresa; Luís, Tiago; Duarte, Elsa L; Fevereiro, Miguel

    2015-07-01

    A specific real time RT-PCR for the detection of RHDV2 was developed and validated using RHDV and RHDV2 RNA preparations from positive field samples. The system was designed to amplify a 127 nucleotide-long RNA region located within the vp60 gene, based on the alignment of six sequences originated in Portugal, obtained in our laboratory, and 11 sequences from France and Italy. The primers and probe target sequences are highly conserved in the vast majority of the RHDV2 sequences presently known. In the sequences showing variability, only one mismatch is found per strain, usually outlying the 3' end of the primer or probe hybridization sequences. The specificity of the method was demonstrated in vitro with a panel of common rabbit pathogens. Standardization was performed with RNA transcripts obtained from a recombinant plasmid harboring the target sequence. The method was able to detected nine RNA molecules with an efficiency of 99.4% and a R(2) value of 1. Repeatability and reproducibility of the method were very high, with coefficients of variation lower than 2.40%. The assay was proven a valuable tool to diagnose most of RDVH2 circulating strains, and may be also useful to monitor viral loads, and consequently, disease progression and vaccination efficacy. Copyright © 2015 Elsevier B.V. All rights reserved.

  7. Identification of Dobrava, Hantaan, Seoul, and Puumala viruses by one-step real-time RT-PCR.

    Science.gov (United States)

    Aitichou, Mohamed; Saleh, Sharron S; McElroy, Anita K; Schmaljohn, C; Ibrahim, M Sofi

    2005-03-01

    We developed four assays for specifically identifying Dobrava (DOB), Hantaan (HTN), Puumala (PUU), and Seoul (SEO) viruses. The assays are based on the real-time one-step reverse transcriptase polymerase chain reaction (RT-PCR) with the small segment used as the target sequence. The detection limits of DOB, HTN, PUU, and SEO assays were 25, 25, 25, and 12.5 plaque-forming units, respectively. The assays were evaluated in blinded experiments, each with 100 samples that contained Andes, Black Creek Canal, Crimean-Congo hemorrhagic fever, Rift Valley fever and Sin Nombre viruses in addition to DOB, HTN, PUU and SEO viruses. The sensitivity levels of the DOB, HTN, PUU, and SEO assays were 98%, 96%, 92% and 94%, respectively. The specificity of DOB, HTN and SEO assays was 100% and the specificity of the PUU assay was 98%. Because of the high levels of sensitivity, specificity, and reproducibility, we believe that these assays can be useful for diagnosing and differentiating these four Old-World hantaviruses.

  8. Comparison of ELISA and dual stage real time RT-PCR to differentiate Sabin like and non-Sabin like poliovirus isolates.

    Science.gov (United States)

    Kaundal, Nirmal; Sarkate, Purva; Prakash, Charu; Rishi, Narayan

    2017-06-01

    Environmental surveillance of polioviruses has been used as an important tool in monitoring circulation of wild polioviruses and/or Vaccine derived polioviruses in sewage samples. It is important to distinguish Sabin like isolates from non-Sabin like; ELISA & dual stage real time RT-PCR have been used for the same. Current study was carried out on sewage isolates to compare ELISA & RT-PCR with sequencing to distinguish Sabin like from non-Sabin like. Out of 468 sewage specimens, 91 (19.44%) were non-polio enteroviruses positive and 377 (80.56%) were polio positive by virus isolation method. A total of 488 polio virus isolates were detected by L20B and RD route which were further subjected to ELISA and RT-PCR. The results were compared with sequencing. On comparison, the specificity of ELISA was only 66.67% in spite of very low sensitivity (3.43%). The sensitivity of RT-PCR was 97.71% which makes it a good primary screening test for detection of non-Sabin like viruses. However, the specificity was only 33.33%. RT-PCR appears to be a sensitive tool for detecting non-Sabin like viruses however; the isolates which are non-Sabin like by RT-PCR may not necessarily be mutated viruses. ELISA cannot be used for differentiation of Sabin likes from non-Sabin likes due to low sensitivity.

  9. Evaluation of RIDA®GENE norovirus GI/GII real time RT-PCR using stool specimens collected from children and adults with acute gastroenteritis.

    Science.gov (United States)

    Kanwar, N; Hassan, F; Barclay, L; Langley, C; Vinjé, J; Bryant, P W; George, K St; Mosher, L; Matthews-Greer, J M; Rocha, M A; Beenhouwer, D O; Harrison, C J; Moffatt, M; Shastri, N; Selvarangan, R

    2018-04-10

    Norovirus is the leading cause of epidemic and sporadic acute gastroenteritis (AGE) in the United States. Widespread prevalence necessitates implementation of accurate norovirus detection assays in clinical diagnostic laboratories. To evaluate RIDA ® GENE norovirus GI/GII real-time RT-PCR assay (RGN RT-PCR) using stool samples from patients with sporadic AGE. Patients between 14 days to 101 years of age with symptoms of AGE were enrolled prospectively at four sites across the United States during 2014-2015. Stool specimens were screened for the presence of norovirus RNA by the RGN RT-PCR assay. Results were compared with a reference method that included conventional RT-PCR and sequencing of a partial region of the 5'end of the norovirus ORF2 gene. A total of 259 (36.0%) of 719 specimens tested positive for norovirus by the reference method. The RGN RT-PCR assay detected norovirus in 244 (94%) of these 259 norovirus positive specimens. The sensitivity and specificity (95% confidence interval) of the RGN RT-PCR assay for detecting norovirus genogroup (G) I was 82.8% (63.5-93.5) and 99.1% (98.0-99.6) and for GII was 94.8% (90.8-97.2) and 98.6% (96.9-99.4), respectively. Seven specimens tested positive by the RGN-RT PCR that were negative by the reference method. The fifteen false negative samples were typed as GII.4 Sydney, GII.13, GI.3, GI.5, GI.2, GII.1, and GII.3 in the reference method. The RGN RT-PCR assay had a high sensitivity and specificity for the detection of norovirus in stool specimens from patients with sporadic AGE. Copyright © 2018. Published by Elsevier B.V.

  10. Real-time onestep RT-PCR for the detection and differentiation of European and North American types of PRRSV in boar semen

    DEFF Research Database (Denmark)

    Hjulsager, Charlotte Kristiane; Larsen, Lars Erik

    and safe diagnostic procedure, since cDNA synthesis and PCR is performed sequentially without inbetween opening of the PCR-tubes, thus eliminating a substantial contamination risk. The aim of the present study was to validate a real-time OneStep RT-PCR assay for the simultaneous detection...

  11. Development of a real-time RT-PCR assay based on primer-probe energy transfer for the detection of all serotypes of bluetongue virus

    DEFF Research Database (Denmark)

    Leblanc, N; Rasmussen, Thomas Bruun; Fernandez, J

    2010-01-01

    A real-time RT-PCR assay based on the primer–probe energy transfer (PriProET) was developed to detect all 24 serotypes of bluetongue virus (BTV). BTV causes serious disease, primarily in sheep, but in other ruminants as well. A distinguishing characteristic of the assay is its tolerance toward...

  12. Rapid detection of Enterovirus and Coxsackievirus A10 by a TaqMan based duplex one-step real time RT-PCR assay.

    Science.gov (United States)

    Chen, Jingfang; Zhang, Rusheng; Ou, Xinhua; Yao, Dong; Huang, Zheng; Li, Linzhi; Sun, Biancheng

    2017-06-01

    A TaqMan based duplex one-step real time RT-PCR (rRT-PCR) assay was developed for the rapid detection of Coxsackievirus A10 (CV-A10) and other enterovirus (EVs) in clinical samples. The assay was fully evaluated and found to be specific and sensitive. When applied in 115 clinical samples, a 100% diagnostic sensitivity in CV-A10 detection and 97.4% diagnostic sensitivity in other EVs were found. Copyright © 2017 Elsevier Ltd. All rights reserved.

  13. Quantitative RT-PCR for titration of replication-defective recombinant Semliki Forest virus.

    Science.gov (United States)

    Puglia, Ana L P; Rezende, Alexandre G; Jorge, Soraia A C; Wagner, Renaud; Pereira, Carlos A; Astray, Renato M

    2013-11-01

    Virus titration may constitute a drawback in the development and use of replication-defective viral vectors like Semliki Forest virus (SFV). The standardization and validation of a reverse transcription quantitative PCR (qRT-PCR) method for SFV titration is presented here. The qRT-PCR target is located within the nsp1 gene of the non-structural polyprotein SFV region (SFV RNA), which allows the strategy to be used for several different recombinant SFV constructs. Titer determinations were carried out by performing virus titration and infection assays with SFVs containing an RNA coding region for the rabies virus glycoprotein (RVGP) or green fluorescent protein (GFP). Results showed that the standardized qRT-PCR is applicable for different SFV constructs, and showed good reproducibility. To evaluate the correlation between the amount of functional SFV RNA in a virus lot and its infectivity in BHK-21 cell cultures, a temperature mediated titer decrease was performed and successfully quantitated by qRT-PCR. When used for cell infection at the same multiplicity of infection (MOI), the temperature treated SFV-RVGP samples induced the same levels of RVGP expression. Similarly, when different SFV-GFP lots with different virus titers, as accessed by qRT-PCR, were used for cell infection at the same MOI, the cultures showed comparable amounts of fluorescent cells. The data demonstrate a good correlation between the amount of virus used for infection, as measured by its SFV RNA, and the protein synthesis in the cells. In conclusion, the qRT-PCR method developed here is accurate and enables the titration of replication-defective SFV vectors, an essential aid for viral vector development as well as for establishment of production bioprocesses. Copyright © 2013 Elsevier B.V. All rights reserved.

  14. Development and evaluation of tailored specific real-time RT-PCR assays for detection of foot-and-mouth disease virus serotypes circulating in East Africa

    DEFF Research Database (Denmark)

    Bachanek-Bankowska, Katarzyna; Mero, Herieth R.; Wadsworth, Jemma

    2016-01-01

    Rapid, reliable and accurate diagnostic methods provide essential support to programmes that monitor and control foot-and-mouth disease (FMD). While pan-specific molecular tests for FMD virus (FMDV) detection are well established and widely used in endemic and FMD-free countries, current serotyping...... methods mainly rely either on antigen detection ELISAs or nucleotide sequencing approaches. This report describes the development of a panel of serotype-specific real-time RT-PCR assays (rRT-PCR) tailored to detect FMDV lineages currently circulating in East Africa. These assays target sequences within...... sequencing. Samples (n = 71) representing serotype A (topotype AFRICA, lineage G-I), serotype O (topotypes EA-2 and EA-4), serotype SAT 1 (topotype I (NWZ)) and serotype SAT2 (topotype IV) were correctly identified with these rRT-PCR assays. Furthermore, FMDV RNA from samples that did not contain infectious...

  15. Analytical and clinical performance of the CDC real time RT-PCR assay for detection and typing of dengue virus.

    Directory of Open Access Journals (Sweden)

    Gilberto A Santiago

    Full Text Available Dengue is an acute illness caused by the positive-strand RNA dengue virus (DENV. There are four genetically distinct DENVs (DENV-1-4 that cause disease in tropical and subtropical countries. Most patients are viremic when they present with symptoms; therefore, RT-PCR has been increasingly used in dengue diagnosis. The CDC DENV-1-4 RT-PCR Assay has been developed as an in-vitro diagnostic platform and was recently approved by the US Food and Drug Administration (FDA for detection of dengue in patients with signs or symptoms of mild or severe dengue. The primers and probes of this test have been designed to detect currently circulating strains of DENV-1-4 from around the world at comparable sensitivity. In a retrospective study with 102 dengue cases confirmed by IgM anti-DENV seroconversion in the convalescent sample, the RT-PCR Assay detected DENV RNA in 98.04% of the paired acute samples. Using sequencing as a positive indicator, the RT-PCR Assay had a 97.92% positive agreement in 86 suspected dengue patients with a single acute serum sample. After extensive validations, the RT-PCR Assay performance was highly reproducible when evaluated across three independent testing sites, did not produce false positive results for etiologic agents of other febrile illnesses, and was not affected by pathological levels of potentially interfering biomolecules. These results indicate that the CDC DENV-1-4 RT-PCR Assay provides a reliable diagnostic platform capable for confirming dengue in suspected cases.

  16. Analytical and clinical performance of the CDC real time RT-PCR assay for detection and typing of dengue virus.

    Science.gov (United States)

    Santiago, Gilberto A; Vergne, Edgardo; Quiles, Yashira; Cosme, Joan; Vazquez, Jesus; Medina, Juan F; Medina, Freddy; Colón, Candimar; Margolis, Harold; Muñoz-Jordán, Jorge L

    2013-01-01

    Dengue is an acute illness caused by the positive-strand RNA dengue virus (DENV). There are four genetically distinct DENVs (DENV-1-4) that cause disease in tropical and subtropical countries. Most patients are viremic when they present with symptoms; therefore, RT-PCR has been increasingly used in dengue diagnosis. The CDC DENV-1-4 RT-PCR Assay has been developed as an in-vitro diagnostic platform and was recently approved by the US Food and Drug Administration (FDA) for detection of dengue in patients with signs or symptoms of mild or severe dengue. The primers and probes of this test have been designed to detect currently circulating strains of DENV-1-4 from around the world at comparable sensitivity. In a retrospective study with 102 dengue cases confirmed by IgM anti-DENV seroconversion in the convalescent sample, the RT-PCR Assay detected DENV RNA in 98.04% of the paired acute samples. Using sequencing as a positive indicator, the RT-PCR Assay had a 97.92% positive agreement in 86 suspected dengue patients with a single acute serum sample. After extensive validations, the RT-PCR Assay performance was highly reproducible when evaluated across three independent testing sites, did not produce false positive results for etiologic agents of other febrile illnesses, and was not affected by pathological levels of potentially interfering biomolecules. These results indicate that the CDC DENV-1-4 RT-PCR Assay provides a reliable diagnostic platform capable for confirming dengue in suspected cases.

  17. Selection of reference genes for quantitative RT-PCR studies in striped dolphin (Stenella coeruleoalba skin biopsies

    Directory of Open Access Journals (Sweden)

    Casini Silvia

    2006-09-01

    Full Text Available Abstract Background Odontocete cetaceans occupy the top position of the marine food-web and are particularly sensitive to the bioaccumulation of lipophilic contaminants. The effects of environmental pollution on these species are highly debated and various ecotoxicological studies have addressed the impact of xenobiotic compounds on marine mammals, raising conservational concerns. Despite its sensitivity, quantitative real-time PCR (qRT-PCR has never been used to quantify gene induction caused by exposure of cetaceans to contaminants. A limitation for the application of qRT-PCR is the need for appropriate reference genes which allow the correct quantification of gene expression. A systematic evaluation of potential reference genes in cetacean skin biopsies is presented, in order to validate future qRT-PCR studies aiming at using the expression of selected genes as non-lethal biomarkers. Results Ten commonly used housekeeping genes (HKGs were partially sequenced in the striped dolphin (Stenella coeruleoalba and, for each gene, PCR primer pairs were specifically designed and tested in qRT-PCR assays. The expression of these potential control genes was examined in 30 striped dolphin skin biopsy samples, obtained from specimens sampled in the north-western Mediterranean Sea. The stability of selected control genes was determined using three different specific VBA applets (geNorm, NormFinder and BestKeeper which produce highly comparable results. Glyceraldehyde-3P-dehydrogenase (GAPDH and tyrosine 3-monooxygenase (YWHAZ always rank as the two most stably expressed HKGs according to the analysis with geNorm and Normfinder, and are defined as optimal control genes by BestKepeer. Ribosomal protein L4 (RPL4 and S18 (RPS18 also exhibit a remarkable stability of their expression levels. On the other hand, transferrin receptor (TFRC, phosphoglycerate kinase 1 (PGK1, hypoxanthine ribosyltransferase (HPRT1 and β-2-microglobin (B2M show variable expression

  18. A Pan-Lyssavirus Taqman Real-Time RT-PCR Assay for the Detection of Highly Variable Rabies virus and Other Lyssaviruses.

    Science.gov (United States)

    Wadhwa, Ashutosh; Wilkins, Kimberly; Gao, Jinxin; Condori Condori, Rene Edgar; Gigante, Crystal M; Zhao, Hui; Ma, Xiaoyue; Ellison, James A; Greenberg, Lauren; Velasco-Villa, Andres; Orciari, Lillian; Li, Yu

    2017-01-01

    Rabies, resulting from infection by Rabies virus (RABV) and related lyssaviruses, is one of the most deadly zoonotic diseases and is responsible for up to 70,000 estimated human deaths worldwide each year. Rapid and accurate laboratory diagnosis of rabies is essential for timely administration of post-exposure prophylaxis in humans and control of the disease in animals. Currently, only the direct fluorescent antibody (DFA) test is recommended for routine rabies diagnosis. Reverse-transcription polymerase chain reaction (RT-PCR) based diagnostic methods have been widely adapted for the diagnosis of other viral pathogens, but there is currently no widely accepted rapid real-time RT-PCR assay for the detection of all lyssaviruses. In this study, we demonstrate the validation of a newly developed multiplex real-time RT-PCR assay named LN34, which uses a combination of degenerate primers and probes along with probe modifications to achieve superior coverage of the Lyssavirus genus while maintaining sensitivity and specificity. The primers and probes of the LN34 assay target the highly conserved non-coding leader region and part of the nucleoprotein (N) coding sequence of the Lyssavirus genome to maintain assay robustness. The probes were further modified by locked nucleotides to increase their melting temperature to meet the requirements for an optimal real-time RT-PCR assay. The LN34 assay was able to detect all RABV variants and other lyssaviruses in a validation panel that included representative RABV isolates from most regions of the world as well as representatives of 13 additional Lyssavirus species. The LN34 assay was successfully used for both ante-mortem and post-mortem diagnosis of over 200 clinical samples as well as field derived surveillance samples. This assay represents a major improvement over previously published rabies specific RT-PCR and real-time RT-PCR assays because of its ability to universally detect RABV and other lyssaviruses, its high

  19. A Pan-Lyssavirus Taqman Real-Time RT-PCR Assay for the Detection of Highly Variable Rabies virus and Other Lyssaviruses.

    Directory of Open Access Journals (Sweden)

    Ashutosh Wadhwa

    2017-01-01

    Full Text Available Rabies, resulting from infection by Rabies virus (RABV and related lyssaviruses, is one of the most deadly zoonotic diseases and is responsible for up to 70,000 estimated human deaths worldwide each year. Rapid and accurate laboratory diagnosis of rabies is essential for timely administration of post-exposure prophylaxis in humans and control of the disease in animals. Currently, only the direct fluorescent antibody (DFA test is recommended for routine rabies diagnosis. Reverse-transcription polymerase chain reaction (RT-PCR based diagnostic methods have been widely adapted for the diagnosis of other viral pathogens, but there is currently no widely accepted rapid real-time RT-PCR assay for the detection of all lyssaviruses. In this study, we demonstrate the validation of a newly developed multiplex real-time RT-PCR assay named LN34, which uses a combination of degenerate primers and probes along with probe modifications to achieve superior coverage of the Lyssavirus genus while maintaining sensitivity and specificity. The primers and probes of the LN34 assay target the highly conserved non-coding leader region and part of the nucleoprotein (N coding sequence of the Lyssavirus genome to maintain assay robustness. The probes were further modified by locked nucleotides to increase their melting temperature to meet the requirements for an optimal real-time RT-PCR assay. The LN34 assay was able to detect all RABV variants and other lyssaviruses in a validation panel that included representative RABV isolates from most regions of the world as well as representatives of 13 additional Lyssavirus species. The LN34 assay was successfully used for both ante-mortem and post-mortem diagnosis of over 200 clinical samples as well as field derived surveillance samples. This assay represents a major improvement over previously published rabies specific RT-PCR and real-time RT-PCR assays because of its ability to universally detect RABV and other lyssaviruses

  20. Evaluation of FTA cards as a laboratory and field sampling device for the detection of foot-and-mouth disease virus and serotyping by RT-PCR and real-time RT-PCR.

    Science.gov (United States)

    Muthukrishnan, Madhanmohan; Singanallur, Nagendrakumar B; Ralla, Kumar; Villuppanoor, Srinivasan A

    2008-08-01

    Foot-and-mouth disease virus (FMDV) samples transported to the laboratory from far and inaccessible areas for serodiagnosis pose a major problem in a tropical country like India, where there is maximum temperature fluctuation. Inadequate storage methods lead to spoilage of FMDV samples collected from clinically positive animals in the field. Such samples are declared as non-typeable by the typing laboratories with the consequent loss of valuable epidemiological data. The present study evaluated the usefulness of FTA Classic Cards for the collection, shipment, storage and identification of the FMDV genome by RT-PCR and real-time RT-PCR. The stability of the viral RNA, the absence of infectivity and ease of processing the sample for molecular methods make the FTA cards a useful option for transport of FMDV genome for identification and serotyping. The method can be used routinely for FMDV research as it is economical and the cards can be transported easily in envelopes by regular document transport methods. Live virus cannot be isolated from samples collected in FTA cards, which is a limitation. This property can be viewed as an advantage as it limits the risk of transmission of live virus.

  1. Development of a novel real-time RT-PCR assay to detect Seneca Valley virus-1 associated with emerging cases of vesicular disease in pigs.

    Science.gov (United States)

    Fowler, Veronica L; Ransburgh, Russell H; Poulsen, Elizabeth G; Wadsworth, Jemma; King, Donald P; Mioulet, Valerie; Knowles, Nick J; Williamson, Susanna; Liu, Xuming; Anderson, Gary A; Fang, Ying; Bai, Jianfa

    2017-01-01

    Seneca Valley virus 1 (SVV-1) can cause vesicular disease that is clinically indistinguishable from foot-and-mouth disease, vesicular stomatitis and swine vesicular disease. SVV-1-associated disease has been identified in pigs in several countries, namely USA, Canada, Brazil and China. Diagnostic tests are required to reliably detect this emerging virus, and this report describes the development and evaluation of a novel real-time (r) reverse-transcription (RT) PCR assay (rRT-PCR), targeting the viral polymerase gene (3D) of SVV-1. This new assay detected all historical and contemporary SVV-1 isolates examined (n=8), while no cross-reactivity was observed with nucleic acid templates prepared from other vesicular disease viruses or common swine pathogens. The analytical sensitivity of the rRT-PCR was 0.79 TCID 50 /ml and the limit of detection was equivalent using two different rRT-PCR master-mixes. The performance of the test was further evaluated using pig nasal (n=25) and rectal swab samples (n=25), where concordant results compared to virus sequencing were generated for 43/50 samples. The availability of this assay, will enable laboratories to rapidly detect SVV-1 in cases of vesicular disease in pigs, negated for notifiable diseases, and could enable existing knowledge gaps to be investigated surrounding the natural epidemiology of SVV-1. Copyright © 2016 Elsevier B.V. All rights reserved.

  2. Comparative evaluation of conventional RT-PCR and real-time RT-PCR (RRT-PCR for detection of avian metapneumovirus subtype A Comparação entre as técnicas de RT-PCR convencional e RT-PCR em tempo real para a detecção do metapneumovírus aviários subtipo A

    Directory of Open Access Journals (Sweden)

    Helena Lage Ferreira

    2009-08-01

    Full Text Available Avian metapneumovirus (AMPV belongs to Metapneumovirus genus of Paramyxoviridae family. Virus isolation, serology, and detection of genomic RNA are used as diagnostic methods for AMPV. The aim of the present study was to compare the detection of six subgroup A AMPV isolates (AMPV/A viral RNA by using different conventional and real time RT-PCR methods. Two new RT-PCR tests and two real time RT-PCR tests, both detecting fusion (F gene and nucleocapsid (N gene were compared with an established test for the attachment (G gene. All the RT-PCR tested assays were able to detect the AMPV/A. The lower detection limits were observed using the N-, F- based RRT-PCR and F-based conventional RT-PCR (10(0.3 to 10¹ TCID50 mL-1. The present study suggests that the conventional F-based RT-PCR presented similar detection limit when compared to N- and F-based RRT-PCR and they can be successfully used for AMPV/A detection.O metapneumovírus aviário (AMPV pertence ao gênero Metapneumovirus, família Paramyxoviridae. Isolamento viral, sorologia e detecção do RNA genômico são atualmente as técnicas utilizadas para o diagnóstico desse agente. O objetivo do presente estudo foi comparar a detecção de RNA viral de seis isolados de AMPV, subtipo A (AMPV/A, utilizando diferentes métodos de RT-PCR convencional e real time RT-PCR (RRT-PCR. Duas novas técnicas de RT-PCR convencional e duas técnicas de RRT-PCR, ambas para a detecção dos genes da nucleoproteína (N e da proteína de fusão (F, foram comparadas com um RT-PCR previamente estabelecido para a detecção do AMPV (gene da glicoproteína -G. Todos esses métodos foram capazes de detectar os isolados AMPV/A. As técnicas RRT-PCR (genes F e N mostraram os menores limites de detecção (10(0.3 to 10¹ TCID50 mL-1. Os resultados sugerem que as técnicas RT-PCR convencional (gene F e as técnicas de RRT-PCR (gene F e N desenvolvidas no presente estudo podem ser utilizadas com sucesso para a detecção do

  3. Conventional and real time RT-PCR assays for the detection and differentiation of variant rabbit hemorrhagic disease virus (RHDVb) and its recombinants.

    Science.gov (United States)

    Dalton, K P; Arnal, J L; Benito, A A; Chacón, G; Martín Alonso, J M; Parra, F

    2018-01-01

    Since its emergence, variant RHDV (RHDVb/RHDV2) has spread throughout the Iberian Peninsula aided by the apparent lack of cross protection provided by classic (genogroup 1; G1) strain derived vaccines. In addition to RHDVb, full-length genome sequencing of RHDV strains has recently revealed the circulation of recombinant viruses on the Iberian Peninsula. These recombinant viruses contain the RHDVb structural protein encoding sequences and the non-structural coding regions of either pathogenic RHDV-G1 strains or non-pathogenic (np) rabbit caliciviruses. The aim of the work was twofold: firstly to validate a diagnostic real time RT-PCR developed in 2012 for the detection of RHDVb strains and secondly, to design a conventional RT-PCR for the differentiation of RHDVb strains from RHDVb recombinants by subsequent sequencing of the amplicon. Copyright © 2017 Elsevier B.V. All rights reserved.

  4. Development and evaluation of tailored specific real-time RT-PCR assays for detection of foot-and-mouth disease virus serotypes circulating in East Africa.

    Science.gov (United States)

    Bachanek-Bankowska, Katarzyna; Mero, Herieth R; Wadsworth, Jemma; Mioulet, Valerie; Sallu, Raphael; Belsham, Graham J; Kasanga, Christopher J; Knowles, Nick J; King, Donald P

    2016-11-01

    Rapid, reliable and accurate diagnostic methods provide essential support to programmes that monitor and control foot-and-mouth disease (FMD). While pan-specific molecular tests for FMD virus (FMDV) detection are well established and widely used in endemic and FMD-free countries, current serotyping methods mainly rely either on antigen detection ELISAs or nucleotide sequencing approaches. This report describes the development of a panel of serotype-specific real-time RT-PCR assays (rRT-PCR) tailored to detect FMDV lineages currently circulating in East Africa. These assays target sequences within the VP1-coding region that share high intra-lineage identity, but do not cross-react with FMD viruses from other serotypes that circulate in the region. These serotype-specific assays operate with the same thermal profile as the pan-diagnostic tests making it possible to run them in parallel to produce C T values comparable to the pan-diagnostic test detecting the 3D-coding region. These assays were evaluated alongside the established pan-specific molecular test using field samples and virus isolates collected from Tanzania, Kenya and Ethiopia that had been previously characterised by nucleotide sequencing. Samples (n=71) representing serotype A (topotype AFRICA, lineage G-I), serotype O (topotypes EA-2 and EA-4), serotype SAT 1 (topotype I (NWZ)) and serotype SAT2 (topotype IV) were correctly identified with these rRT-PCR assays. Furthermore, FMDV RNA from samples that did not contain infectious virus could still be serotyped using these assays. These serotype-specific real-time RT-PCR assays can detect and characterise FMDVs currently circulating in East Africa and hence improve disease control in this region. Copyright © 2016 The Authors. Published by Elsevier B.V. All rights reserved.

  5. Evaluation of reference genes for gene expression analysis using quantitative RT-PCR in Azospirillum brasilense.

    Science.gov (United States)

    McMillan, Mary; Pereg, Lily

    2014-01-01

    Azospirillum brasilense is a nitrogen fixing bacterium that has been shown to have various beneficial effects on plant growth and yield. Under normal conditions A. brasilense exists in a motile flagellated form, which, under starvation or stress conditions, can undergo differentiation into an encapsulated, cyst-like form. Quantitative RT-PCR can be used to analyse changes in gene expression during this differentiation process. The accuracy of quantification of mRNA levels by qRT-PCR relies on the normalisation of data against stably expressed reference genes. No suitable set of reference genes has yet been described for A. brasilense. Here we evaluated the expression of ten candidate reference genes (16S rRNA, gapB, glyA, gyrA, proC, pykA, recA, recF, rpoD, and tpiA) in wild-type and mutant A. brasilense strains under different culture conditions, including conditions that induce differentiation. Analysis with the software programs BestKeeper, NormFinder and GeNorm indicated that gyrA, glyA and recA are the most stably expressed reference genes in A. brasilense. The results also suggested that the use of two reference genes (gyrA and glyA) is sufficient for effective normalisation of qRT-PCR data.

  6. Evaluation of reference genes for gene expression analysis using quantitative RT-PCR in Azospirillum brasilense.

    Directory of Open Access Journals (Sweden)

    Mary McMillan

    Full Text Available Azospirillum brasilense is a nitrogen fixing bacterium that has been shown to have various beneficial effects on plant growth and yield. Under normal conditions A. brasilense exists in a motile flagellated form, which, under starvation or stress conditions, can undergo differentiation into an encapsulated, cyst-like form. Quantitative RT-PCR can be used to analyse changes in gene expression during this differentiation process. The accuracy of quantification of mRNA levels by qRT-PCR relies on the normalisation of data against stably expressed reference genes. No suitable set of reference genes has yet been described for A. brasilense. Here we evaluated the expression of ten candidate reference genes (16S rRNA, gapB, glyA, gyrA, proC, pykA, recA, recF, rpoD, and tpiA in wild-type and mutant A. brasilense strains under different culture conditions, including conditions that induce differentiation. Analysis with the software programs BestKeeper, NormFinder and GeNorm indicated that gyrA, glyA and recA are the most stably expressed reference genes in A. brasilense. The results also suggested that the use of two reference genes (gyrA and glyA is sufficient for effective normalisation of qRT-PCR data.

  7. Early diagnosis of dengue in travelers: comparison of a novel real-time RT-PCR, NS1 antigen detection and serology.

    Science.gov (United States)

    Huhtamo, Eili; Hasu, Essi; Uzcátegui, Nathalie Y; Erra, Elina; Nikkari, Simo; Kantele, Anu; Vapalahti, Olli; Piiparinen, Heli

    2010-01-01

    The increased traveling to dengue endemic regions and the numerous epidemics have led to a rise in imported dengue. The laboratory diagnosis of acute dengue requires several types of tests and often paired samples are needed for obtaining reliable results. Although several diagnostic methods are available, proper comparative data on their performance are lacking. To compare the performance of novel methods including a novel pan-DENV real-time RT-PCR and a commercially available NS1 capture-EIA in regard to IgM detection for optimizing the early diagnosis of DENV in travelers. A panel of 99 selected early phase serum samples of dengue patients was studied by real-time RT-PCR, NS1 antigen ELISA, IgM-EIA, IgG-IFA and cell culture virus isolation. The novel real-time RT-PCR was shown specific and sensitive for detection of DENV-1-4 RNA and suitable for diagnostic use. The diagnostic rate using combination of RNA and IgM detection was 99% and using NS1 and IgM detection 95.9%. The results of RNA and NS1 antigen detection disagreed in 15.5% of samples that had only RNA or NS1 antigen detected. The diagnostic rates of early samples are higher when either RNA or NS1 antigen detection is combined with IgM detection. Besides the differences in the RNA and NS1 detection assays, the observed discrepancy of results could suggest individual variation or differences in timing of these markers in patient serum. Copyright (c) 2009 Elsevier B.V. All rights reserved.

  8. Development of a real-time RT-PCR and Reverse Line probe Hybridisation assay for the routine detection and genotyping of Noroviruses in Ireland.

    LENUS (Irish Health Repository)

    Menton, John F

    2007-01-01

    BACKGROUND: Noroviruses are the most common cause of non-bacterial gastroenteritis. Improved detection methods have seen a large increase in the number of human NoV genotypes in the last ten years. The objective of this study was to develop a fast method to detect, quantify and genotype positive NoV samples from Irish hospitals. RESULTS: A real-time RT-PCR assay and a Reverse Line Blot Hybridisation assay were developed based on the ORF1-ORF2 region. The sensitivity and reactivity of the two assays used was validated using a reference stool panel containing 14 NoV genotypes. The assays were then used to investigate two outbreaks of gastroenteritis in two Irish hospitals. 56 samples were screened for NoV using a real-time RT-PCR assay and 26 samples were found to be positive. Genotyping of these positive samples found that all positives belonged to the GII\\/4 variant of NoV. CONCLUSION: The combination of the Real-time assay and the reverse line blot hybridisation assay provided a fast and accurate method to investigate a NoV associated outbreak. It was concluded that the predominant genotype circulating in these Irish hospitals was GII\\/4 which has been associated with the majority of NoV outbreaks worldwide. The assays developed in this study are useful tools for investigating NoV infection.

  9. Novel Molecular Beacon Probe-Based Real-Time RT-PCR Assay for Diagnosis of Crimean-Congo Hemorrhagic Fever Encountered in India

    Directory of Open Access Journals (Sweden)

    Aman Kamboj

    2014-01-01

    Full Text Available Crimean-Congo hemorrhagic fever (CCHF is an emerging zoonotic disease in India and requires immediate detection of infection both for preventing further transmission and for controlling the infection. The present study describes development, optimization, and evaluation of a novel molecular beacon-based real-time RT-PCR assay for rapid, sensitive, and specific diagnosis of Crimean-Congo hemorrhagic fever virus (CCHFV. The developed assay was found to be a better alternative to the reported TaqMan assay for routine diagnosis of CCHF.

  10. Gene expression analysis of the rat testis after treatment with di(2-ethylhexyl) phthalate using cDNA microarray and real-time RT-PCR

    International Nuclear Information System (INIS)

    Kijima, Kazuyasu; Toyosawa, Kaoru; Yasuba, Masashi; Matsuoka, Nobuo; Adachi, Tetsuya; Komiyama, Masatoshi; Mori, Chisato

    2004-01-01

    To investigate the effects of di(2-ethylhexyl) phthalate (DEHP) on gene expression in rat testis, 6-week-old male Sprague-Dawley rats were given a single oral dose of 20 or 2000 mg/kg and euthanized 3, 6, 24, or 72 h thereafter. Terminal deoxynucleotidyl transferase-mediated dUTP nick-end labeling (TUNEL)-positive cells were significantly increased in the testis at 24 and 72 h after the exposure to 2000 mg/kg of DEHP. On cDNA microarray analysis, in addition to apoptosis-related genes, genes associated with atrophy, APEX nuclease, MutS homologue (E. coli), testosterone-repressed-prostatic-message-2 (TRPM-2), connective tissue growth factor, collagen alpha 2 type V, and cell adhesion kinase were differentially expressed. To investigate the relationship between histopathological alteration and gene expression, we selected genes associated with apoptosis and analyzed their expression by real-time quantitative reverse transcription-polymerase chain reaction (RT-PCR). With 20 mg/kg of DEHP treatment, bcl-2, key gene related to apoptosis, was increased. Up-regulation of bcl-2, inhibitor of Apaf-1/caspase-9/caspase-2 cascade of apoptosis, may be related to the fact that no morphological apoptotic change was induced after dosing of 20 mg/kg DEHP. With 2000 mg/kg of DEHP treatment, the apoptotic activator cascade, Fas/FasL, FADD/caspase-8/caspase-3 cascade, and Apaf-1/caspase-9/caspase-2 cascade were increased and bcl-2 was decreased. Thus, these gene regulations might lead the cells into apoptosis in the case of high exposure to DEHP. In contrast, FADD/caspase-10/caspase-6 cascade and caspase-11/caspase-3 cascade were not increased. These results indicate that the cascades of FADD/caspase-10/caspase-6 and caspase-11/caspase-3 are not related to apoptosis with DEHP treatment

  11. Evaluation of 793/B-like and Mass-like vaccine strain kinetics in experimental and field conditions by real-time RT-PCR quantification.

    Science.gov (United States)

    Tucciarone, C M; Franzo, G; Berto, G; Drigo, M; Ramon, G; Koutoulis, K C; Catelli, E; Cecchinato, M

    2018-01-01

    Infectious bronchitis virus (IBV) is a great economic burden both for productive losses and costs of the control strategies. Many different vaccination protocols are applied in the same region and even in consecutive cycles on the same farm in order to find the perfect balance between costs and benefits. In Northern Italy, the usual second vaccination is more and more often moved up to the chick's first d of life. The second strain administration together with the common Mass priming by spray at the hatchery allows saving money and time and reducing animal stress. The present work compared the different vaccine strains (Mass-like or B48, and 1/96) kinetics both in field conditions and in a 21-day-long experimental trial in broilers, monitoring the viral replication by upper respiratory tract swabbing and vaccine specific real time reverse transcription PCR (RT-PCR) quantification. In both field and experimental conditions, titers for all the vaccines showed an increasing trend in the first 2 wk and then a decrease, though still remaining detectable during the whole monitored period. IBV field strain and avian Metapneumovirus (aMPV) presence also was also investigated by RT-PCR and sequencing, and by multiplex real-time RT-PCR, respectively, revealing a consistency in the pathogen introduction timing at around 30 d, in correspondence with the vaccine titer's main decrease. These findings suggest the need for an accurate knowledge of live vaccine kinetics, whose replication can compete with the other pathogen one, providing additional protection to be added to what is conferred by the adaptive immune response. © 2017 Poultry Science Association Inc.

  12. Multiplex real-time RT-PCR assay for bovine viral diarrhea virus type 1, type 2 and HoBi-like pestivirus.

    Science.gov (United States)

    Mari, Viviana; Losurdo, Michele; Lucente, Maria Stella; Lorusso, Eleonora; Elia, Gabriella; Martella, Vito; Patruno, Giovanni; Buonavoglia, Domenico; Decaro, Nicola

    2016-03-01

    HoBi-like pestiviruses are emerging pestiviruses that infect cattle causing clinical forms overlapping to those induced by bovine viral diarrhea virus (BVDV) 1 and 2. As a consequence of their widespread distribution reported in recent years, molecular tools for rapid discrimination among pestiviruses infecting cattle are needed. The aim of the present study was to develop a multiplex real-time RT-PCR assay, based on the TaqMan technology, for the rapid and unambiguous characterisation of all bovine pestiviruses, including the emerging HoBi-like strains. The assay was found to be sensitive, specific and repeatable, ensuring detection of as few as 10(0)-10(1) viral RNA copies. No cross-reactions between different pestiviral species were observed even in samples artificially contaminated with more than one pestivirus. Analysis of field samples tested positive for BVDV-1, BVDV-2 or HoBi-like virus by a nested PCR protocol revealed that the developed TaqMan assay had equal or higher sensitivity and was able to discriminate correctly the viral species in all tested samples, whereas a real-time RT-PCR assay previously developed for HoBi-like pestivirus detection showed cross-reactivity with few high-titre BVDV-2 samples. Copyright © 2015 Elsevier B.V. All rights reserved.

  13. Cross-platform evaluation of commercial real-time SYBR green RT-PCR kits for sensitive and rapid detection of European bat Lyssavirus type 1.

    Science.gov (United States)

    Picard-Meyer, Evelyne; Peytavin de Garam, Carine; Schereffer, Jean Luc; Marchal, Clotilde; Robardet, Emmanuelle; Cliquet, Florence

    2015-01-01

    This study evaluates the performance of five two-step SYBR Green RT-qPCR kits and five one-step SYBR Green qRT-PCR kits using real-time PCR assays. Two real-time thermocyclers showing different throughput capacities were used. The analysed performance evaluation criteria included the generation of standard curve, reaction efficiency, analytical sensitivity, intra- and interassay repeatability as well as the costs and the practicability of kits, and thermocycling times. We found that the optimised one-step PCR assays had a higher detection sensitivity than the optimised two-step assays regardless of the machine used, while no difference was detected in reaction efficiency, R (2) values, and intra- and interreproducibility between the two methods. The limit of detection at the 95% confidence level varied between 15 to 981 copies/µL and 41 to 171 for one-step kits and two-step kits, respectively. Of the ten kits tested, the most efficient kit was the Quantitect SYBR Green qRT-PCR with a limit of detection at 95% of confidence of 20 and 22 copies/µL on the thermocyclers Rotor gene Q MDx and MX3005P, respectively. The study demonstrated the pivotal influence of the thermocycler on PCR performance for the detection of rabies RNA, as well as that of the master mixes.

  14. Cross-Platform Evaluation of Commercial Real-Time SYBR Green RT-PCR Kits for Sensitive and Rapid Detection of European Bat Lyssavirus Type 1

    Directory of Open Access Journals (Sweden)

    Evelyne Picard-Meyer

    2015-01-01

    Full Text Available This study evaluates the performance of five two-step SYBR Green RT-qPCR kits and five one-step SYBR Green qRT-PCR kits using real-time PCR assays. Two real-time thermocyclers showing different throughput capacities were used. The analysed performance evaluation criteria included the generation of standard curve, reaction efficiency, analytical sensitivity, intra- and interassay repeatability as well as the costs and the practicability of kits, and thermocycling times. We found that the optimised one-step PCR assays had a higher detection sensitivity than the optimised two-step assays regardless of the machine used, while no difference was detected in reaction efficiency, R2 values, and intra- and interreproducibility between the two methods. The limit of detection at the 95% confidence level varied between 15 to 981 copies/µL and 41 to 171 for one-step kits and two-step kits, respectively. Of the ten kits tested, the most efficient kit was the Quantitect SYBR Green qRT-PCR with a limit of detection at 95% of confidence of 20 and 22 copies/µL on the thermocyclers Rotor gene Q MDx and MX3005P, respectively. The study demonstrated the pivotal influence of the thermocycler on PCR performance for the detection of rabies RNA, as well as that of the master mixes.

  15. Diagnosis of Barmah Forest Virus Infection by a Nested Real-Time SYBR Green RT-PCR Assay

    OpenAIRE

    Hueston, Linda; Toi, Cheryl S.; Jeoffreys, Neisha; Sorrell, Tania; Gilbert, Gwendolyn

    2013-01-01

    Barmah Forest virus (BFV) is a mosquito borne (+) ssRNA alphavirus found only in Australia. It causes rash, myalgia and arthralgia in humans and is usually diagnosed serologically. We developed a real-time PCR assay to detect BFV in an effort to improve diagnosis early in the course of infection. The limit of detection was 16 genome equivalents with a specificity of 100%. Fifty five serum samples from BFV-infected patients were tested by the PCR. 52 of 53 antibody-positive samples were PCR ne...

  16. Development of a highly sensitive real-time nested RT-PCR assay in a single closed tube for detection of enterovirus 71 in hand, foot, and mouth disease.

    Science.gov (United States)

    Niu, Peihua; Qi, Shunxiang; Yu, Benzhang; Zhang, Chen; Wang, Ji; Li, Qi; Ma, Xuejun

    2016-11-01

    Enterovirus 71 (EV71) is one of the major causative agents of outbreaks of hand, foot, and mouth disease (HFMD). A commercial TaqMan probe-based real-time PCR assay has been widely used for the differential detection of EV71 despite its relatively high cost and failure to detect samples with a low viral load (Ct value > 35). In this study, a highly sensitive real-time nested RT-PCR (RTN RT-PCR) assay in a single closed tube for detection of EV71 in HFMD was developed. The sensitivity and specificity of this assay were evaluated using a reference EV71 stock and a panel of controls consisting of coxsackievirus A16 (CVA16) and common respiratory viruses, respectively. The clinical performance of this assay was evaluated and compared with those of a commercial TaqMan probe-based real-time PCR (qRT-PCR) assay and a traditional two-step nested RT-PCR assay. The limit of detection for the RTN RT-PCR assay was 0.01 TCID50/ml, with a Ct value of 38.3, which was the same as that of the traditional two-step nested RT-PCR assay and approximately tenfold lower than that of the qRT-PCR assay. When testing the reference strain EV71, this assay showed favorable detection reproducibility and no obvious cross-reactivity. The testing results of 100 clinical throat swabs from HFMD-suspected patients revealed that 41 samples were positive for EV71 by both RTN RT-PCR and traditional two-step nested RT-PCR assays, whereas only 29 were EV71 positive by qRT-PCR assay.

  17. Pandemic preparedness in Hawaii: a multicenter verification of real-time RT-PCR for the direct detection of influenza virus types A and B.

    Science.gov (United States)

    Whelen, A Christian; Bankowski, Matthew J; Furuya, Glenn; Honda, Stacey; Ueki, Robert; Chan, Amelia; Higa, Karen; Kumashiro, Diane; Moore, Nathaniel; Lee, Roland; Koyamatsu, Terrie; Effler, Paul V

    2010-01-01

    We integrated multicenter, real-time (RTi) reverse transcription polymerase chain reaction (RT-PCR) screening into a statewide laboratory algorithm for influenza surveillance and response. Each of three sites developed its own testing strategy and was challenged with one randomized and blinded panel of 50 specimens previously tested for respiratory viruses. Following testing, each participating laboratory reported its results to the Hawaii State Department of Health, State Laboratories Division for evaluation and possible discrepant analysis. Two of three laboratories reported a 100% sensitivity and specificity, resulting in a 100% positive predictive value and a 100% negative predictive value (NPV) for influenza type A. The third laboratory showed a 71% sensitivity for influenza type A (83% NPV) with 100% specificity. All three laboratories were 100% sensitive and specific for the detection of influenza type B. Discrepant analysis indicated that the lack of sensitivity experienced by the third laboratory may have been due to the analyte-specific reagent probe used by that laboratory. Use of a newer version of the product with a secondary panel of 20 specimens resulted in a sensitivity and specificity of 100%. All three laboratories successfully verified their ability to conduct clinical testing for influenza using diverse nucleic acid extraction and RTi RT-PCR platforms. Successful completion of the verification by all collaborating laboratories paved the way for the integration of those facilities into a statewide laboratory algorithm for influenza surveillance and response.

  18. Diagnosis of Barmah Forest virus infection by a nested real-time SYBR green RT-PCR assay.

    Directory of Open Access Journals (Sweden)

    Linda Hueston

    Full Text Available Barmah Forest virus (BFV is a mosquito borne (+ ssRNA alphavirus found only in Australia. It causes rash, myalgia and arthralgia in humans and is usually diagnosed serologically. We developed a real-time PCR assay to detect BFV in an effort to improve diagnosis early in the course of infection. The limit of detection was 16 genome equivalents with a specificity of 100%. Fifty five serum samples from BFV-infected patients were tested by the PCR. 52 of 53 antibody-positive samples were PCR negative. Two culture-positive (neutralizing antibody negative samples were positive on first round PCR, while one sample (IgM and neutralizing antibody strongly positive, IgG negative was positive on second round PCR, suggesting that viral RNA is detectable and transiently present in early infection. PCR can provide results faster than culture, is capable of high throughput and by sequencing the PCR product strain variants can be characterized.

  19. Detection and typing of highly pathogenic porcine reproductive and respiratory syndrome virus by multiplex real-time rt-PCR.

    Directory of Open Access Journals (Sweden)

    Kerstin Wernike

    Full Text Available Porcine reproductive and respiratory syndrome (PRRS causes economic losses in the pig industry worldwide, and PRRS viruses (PRRSV are classified into the two distinct genotypes "North American (NA, type 2" and "European (EU, type 1". In 2006, a highly pathogenic NA strain of PRRSV (HP-PRRSV, characterized by high fever as well as high morbidity and mortality, emerged in swine farms in China. Therefore, a real-time reverse transcription polymerase chain reaction (RT-qPCR assay specific for HP-PRRSV was developed and combined with type 1- and type 2-specific RT-qPCR systems. Furthermore, an internal control, based on a heterologous RNA, was successfully introduced. This final multiplex PRRSV RT-qPCR, detecting and typing PRRSV, had an analytical sensitivity of less than 200 copies per µl for the type 1-assay and 20 copies per µl for the type 2- and HP assays and a high diagnostic sensitivity. A panel of reference strains and field isolates was reliably detected and samples from an animal trial with a Chinese HP-PRRS strain were used for test validation. The new multiplex PRRSV RT-qPCR system allows for the first time the highly sensitive detection and rapid differentiation of PRRSV of both genotypes as well as the direct detection of HP-PRRSV.

  20. Simultaneous detection of Zika, Chikungunya and Dengue viruses by a multiplex real-time RT-PCR assay.

    Science.gov (United States)

    Pabbaraju, Kanti; Wong, Sallene; Gill, Kara; Fonseca, Kevin; Tipples, Graham A; Tellier, Raymond

    2016-10-01

    In the recent past, arboviruses such as Chikungunya (CHIKV) and Zika (ZIKV) have increased their area of endemicity and presented as an emerging global public health threat. To design an assay for the simultaneous detection of ZIKV, CHIKV and Dengue (DENV) 1-4 from patients with symptoms of arboviral infection. This would be advantageous because of the similar clinical presentation typically encountered with these viruses and their co-circulation in endemic areas. In this study we have developed and validated a triplex real time reverse transcription PCR assay using hydrolysis probes targeting the non-structural 5 (NS5) region of ZIKV, non-structural protein 4 (nsP4) from CHIKV and 3' untranslated region (3'UTR) of DENV 1-4. The 95% LOD by the triplex assay was 15 copies/reaction for DENV-1 and less than 10 copies/reaction for all other viruses. The triplex assay was 100% specific and did not amplify any of the other viruses tested. The assay was reproducible and adaptable to testing different specimen types including serum, plasma, urine, placental tissue, brain tissue and amniotic fluid. This assay can be easily implemented for diagnostic testing of patient samples, even in a high throughput laboratory. Copyright © 2016 Elsevier B.V. All rights reserved.

  1. The effect of various disinfectants on detection of avian influenza virus by real time RT-PCR.

    Science.gov (United States)

    Suarez, D L; Spackman, E; Senne, D A; Bulaga, L; Welsch, A C; Froberg, K

    2003-01-01

    An avian influenza (AI) real time reverse transcriptase-polymerase chain reaction (RRT-PCR) test was previously shown to be a rapid and sensitive method to identify AI virus-infected birds in live-bird markets (LBMs). The test can also be used to identify avian influenza virus (AIV) from environmental samples. Consequently, the use of RRT-PCR was being considered as a component of the influenza eradication program in the LBMs to assure that each market was properly cleaned and disinfected before allowing the markets to be restocked. However, the RRT-PCR test cannot differentiate between live and inactivated virus, particularly in environmental samples where the RRT-PCR test potentially could amplify virus that had been inactivated by commonly used disinfectants, resulting in a false positive test result. To determine whether this is a valid concern, a study was conducted in three New Jersey LBMs that were previously shown to be positive for the H7N2 AIV. Environmental samples were collected from all three markets following thorough cleaning and disinfection with a phenolic disinfectant. Influenza virus RNA was detected in at least one environmental sample from two of the three markets when tested by RRT-PCR; however, all samples were negative by virus isolation using the standard egg inoculation procedure. As a result of these findings, laboratory experiments were designed to evaluate several commonly used disinfectants for their ability to inactivate influenza as well as disrupt the RNA so that it could not be detected by the RRT-PCR test. Five disinfectants were tested: phenolic disinfectants (Tek-trol and one-stroke environ), a quaternary ammonia compound (Lysol no-rinse sanitizer), a peroxygen compound (Virkon-S), and sodium hypochlorite (household bleach). All five disinfectants were effective at inactivating AIV at the recommended concentrations, but AIV RNA in samples inactivated with phenolic and quaternary ammonia compounds could still be detected by RRT

  2. One-step multiplex real-time RT-PCR assay for detecting and genotyping wild-type group A rotavirus strains and vaccine strains (Rotarix® and RotaTeq®) in stool samples

    Science.gov (United States)

    Mijatovic-Rustempasic, Slavica; Esona, Mathew D.; Tam, Ka Ian; Quaye, Osbourne; Bowen, Michael D.

    2016-01-01

    Background. Group A rotavirus (RVA) infection is the major cause of acute gastroenteritis (AGE) in young children worldwide. Introduction of two live-attenuated rotavirus vaccines, RotaTeq® and Rotarix®, has dramatically reduced RVA associated AGE and mortality in developed as well as in many developing countries. High-throughput methods are needed to genotype rotavirus wild-type strains and to identify vaccine strains in stool samples. Quantitative RT-PCR assays (qRT-PCR) offer several advantages including increased sensitivity, higher throughput, and faster turnaround time. Methods. In this study, a one-step multiplex qRT-PCR assay was developed to detect and genotype wild-type strains and vaccine (Rotarix® and RotaTeq®) rotavirus strains along with an internal processing control (Xeno or MS2 RNA). Real-time RT-PCR assays were designed for VP7 (G1, G2, G3, G4, G9, G12) and VP4 (P[4], P[6] and P[8]) genotypes. The multiplex qRT-PCR assay also included previously published NSP3 qRT-PCR for rotavirus detection and Rotarix® NSP2 and RotaTeq® VP6 qRT-PCRs for detection of Rotarix® and RotaTeq® vaccine strains respectively. The multiplex qRT-PCR assay was validated using 853 sequence confirmed stool samples and 24 lab cultured strains of different rotavirus genotypes. By using thermostable rTth polymerase enzyme, dsRNA denaturation, reverse transcription (RT) and amplification (PCR) steps were performed in single tube by uninterrupted thermocycling profile to reduce chances of sample cross contamination and for rapid generation of results. For quantification, standard curves were generated using dsRNA transcripts derived from RVA gene segments. Results. The VP7 qRT-PCRs exhibited 98.8–100% sensitivity, 99.7–100% specificity, 85–95% efficiency and a limit of detection of 4–60 copies per singleplex reaction. The VP7 qRT-PCRs exhibited 81–92% efficiency and limit of detection of 150–600 copies in multiplex reactions. The VP4 qRT-PCRs exhibited 98.8

  3. Comparison of real-time SYBR green dengue assay with real-time taqman RT-PCR dengue assay and the conventional nested PCR for diagnosis of primary and secondary dengue infection

    Science.gov (United States)

    Paudel, Damodar; Jarman, Richard; Limkittikul, Kriengsak; Klungthong, Chonticha; Chamnanchanunt, Supat; Nisalak, Ananda; Gibbons, Robert; Chokejindachai, Watcharee

    2011-01-01

    Background: Dengue fever and dengue hemorrhagic fever are caused by dengue virus. Dengue infection remains a burning problem of many countries. To diagnose acute dengue in the early phase we improve the low cost, rapid SYBR green real time assay and compared the sensitivity and specificity with real time Taqman® assay and conventional nested PCR assay. Aims: To develop low cost, rapid and reliable real time SYBR green diagnostic dengue assay and compare with Taqman real-time assay and conventional nested PCR (modified Lanciotti). Materials and Methods: Eight cultured virus strains were diluted in tenth dilution down to undetectable level by the PCR to optimize the primer, temperature (annealing, and extension and to detect the limit of detection of the assay. Hundred and ninety three ELISA and PCR proved dengue clinical samples were tested with real time SYBR® Green assay, real time Taqman® assay to compare the sensitivity and specificity. Results: Sensitivity and specificity of real time SYBR® green dengue assay (84% and 66%, respectively) was almost comparable to those (81% and 74%) of Taqman real time PCR dengue assay. Real time SYBR® green RT-PCR was equally sensitive in primary and secondary infection while real time Taqman was less sensitive in the secondary infection. Sensitivity of real time Taqman on DENV3 (87%) was equal to SYBR green real time PCR dengue assay. Conclusion: We developed low cost rapid diagnostic SYBR green dengue assay. Further study is needed to make duplex primer assay for the serotyping of dengue virus. PMID:22363089

  4. Characterization of human coronavirus etiology in Chinese adults with acute upper respiratory tract infection by real-time RT-PCR assays.

    Directory of Open Access Journals (Sweden)

    Roujian Lu

    Full Text Available BACKGROUND: In addition to SARS associated coronaviruses, 4 non-SARS related human coronaviruses (HCoVs are recognized as common respiratory pathogens. The etiology and clinical impact of HCoVs in Chinese adults with acute upper respiratory tract infection (URTI needs to be characterized systematically by molecular detection with excellent sensitivity. METHODOLOGY/PRINCIPAL FINDINGS: In this study, we detected 4 non-SARS related HCoV species by real-time RT-PCR in 981 nasopharyngeal swabs collected from March 2009 to February 2011. All specimens were also tested for the presence of other common respiratory viruses and newly identified viruses, human metapneumovirus (hMPV and human bocavirus (HBoV. 157 of the 981 (16.0% nasopharyngeal swabs were positive for HCoVs. The species detected were 229E (96 cases, 9.8%, OC43 (42 cases, 4.3%, HKU1 (16 cases, 1.6% and NL63 (11 cases, 1.1%. HCoV-229E was circulated in 21 of the 24 months of surveillance. The detection rates for both OC43 and NL63 were showed significantly year-to-year variation between 2009/10 and 2010/11, respectively (P<0.001 and P = 0.003, and there was a higher detection frequency of HKU1 in patients aged over 60 years (P = 0.03. 48 of 157(30.57% HCoV positive patients were co-infected. Undifferentiated human rhinoviruses and influenza (Flu A were the most common viruses detected (more than 35% in HCoV co-infections. Respiratory syncytial virus (RSV, human parainfluenza virus (PIV and HBoV were detected in very low rate (less than 1% among adult patients with URTI. CONCLUSIONS/SIGNIFICANCE: All 4 non-SARS-associated HCoVs were more frequently detected by real-time RT-PCR assay in adults with URTI in Beijing and HCoV-229E led to the most prevalent infection. Our study also suggested that all non-SARS-associated HCoVs contribute significantly to URTI in adult patients in China.

  5. Laboratory validation of two real-time RT-PCR methods with 5'-tailed primers for an enhanced detection of foot-and-mouth disease virus.

    Science.gov (United States)

    Vandenbussche, Frank; Lefebvre, David J; De Leeuw, Ilse; Van Borm, Steven; De Clercq, Kris

    2017-08-01

    The 3D and 5UTR real-time RT-PCR assays (RT-qPCR) from Callahan et al. (2002) and Reid et al. (2002) are commonly used reference methods for the detection of foot-and-mouth disease virus (FMDV). For an optimal detection of FMDV in clinical samples, it is advised to use both assays simultaneously (King et al., 2006). Recently, Vandenbussche et al. (2016) showed that the addition of 5'-tails to the FMDV-specific primers enhances the detection of FMDV in both the 3D and the 5UTR RT-qPCR assay. To validate the 3D and 5UTR RT-qPCR assays with 5'-tailed primers for diagnostic purposes, both assays were run in parallel in a triplex one-step RT-qPCR protocol with beta-actin as an internal control and synthetic RNA as an external control. We obtained low limits of detection and high linearity's, high repeatability and reproducibility, near 100% analytical specificity and >99% diagnostic accuracy for both assays. It was concluded that the 3D and 5UTR RT-qPCR assays with 5'-tailed primers are particularly suited for the detection of FMDV as well as to exclude the presence of FMDV. Copyright © 2017 Elsevier B.V. All rights reserved.

  6. Detection and characterization of Newcastle disease virus in clinical samples using real time RT-PCR and melting curve analysis based on matrix and fusion genes amplification

    Directory of Open Access Journals (Sweden)

    Saad Sharawi

    2013-10-01

    Full Text Available Aim: Newcastle disease is still one of the major threats for poultry industry allover the world. Therefore, attempt was made in this study to use the SYBR Green I real-time PCR with melting curves analysis as for detection and differentiation of NDV strains in suspected infected birds. Materials and Methods: Two sets of primers were used to amplify matrix and fusion genes in samples collected from suspectly infected birds (chickens and pigeons. Melting curve analysis in conjunction with real time PCR was conducted for identifying different pathotypes of the isolated NDVs. Clinical samples were propagated on specific pathogen free ECE and tested for MDT and ICIP. Results: The velogenic NDVs isolated from chickens and pigeons were distinguished with mean T 85.03±0.341 and m 83.78±0.237 respectively for M-gene amplification and for F-gene amplification the mean T were 84.04±0.037 and m 84.53±0.223. On the other hand the lentogenic NDV isolates including the vaccinal strains (HB1 and LaSota have a higher mean T (86.99±0.021 for M-gene amplification and 86.50±0.063 for F-gene amplification. The test showed no reaction with m unrelated RNA samples. In addition, the results were in good agreement with both virus isolation and biological pathotyping (MDT and ICIP. The assay offers an attractive alternative method for the diagnosis of NDV that can be easily applied in laboratory diagnosis as a screening test for the detection and differentiation of NDV infections. Conclusion: As was shown by the successful rapid detection and pathotyping of 15 NDV strains in clinical samples representing velogenic and lentogenic NDV strains, and the agreement with the results of virus isolation , biological pathotyping and pathogenicity indices. The results of this report suggests that the described SybrGreen I real-time RT-PCR assay in conjunction with Melting curve analysis used as a rapid, specific and simple diagnostic tools for detection and pathotyping of

  7. A comparative kinetic RT/-PCR strategy for the quantitation of mRNAs in microdissected human renal biopsy specimens.

    Science.gov (United States)

    Del Prete, D; Forino, M; Gambaro, G; D'Angelo, A; Baggio, B; Anglani, F

    1998-01-01

    Molecular biology techniques, to be applicable to a diagnostic renal biopsy specimen, should (1) be highly sensitive to be performed on a very small quantity of tissue; (2) be quantitative because they have to analyze genes normally expressed in the tissue and (3) allow the analysis of as large a number of genes as possible. Among different methods, only the reverse-transcriptase polymerase chain reaction (RT/-PCR) might comply with previous requisites, but the few RT/-PCR examples on renal biopsies in the literature do not allow starting RNA quantification and quality control; furthermore they have the drawback of analyzing only few genes. In an ongoing study to assess the expression of a number of genes in glomeruli and in tubulointerstitium of patients with different nephropathies, we developed a comparative RT/-PCR kinetic strategy based on the purification and quantification of total glomerular and tubulointerstitial RNA and on the use of an internal standard, the housekeeping gene G3PDH. We demonstrate that in microdissected diagnostic renal biopsies (1) glomerular and interstitial starting RNA can be quantified; (2) the G3PDH gene may be used both as an internal standard and as an indirect marker of RNA integrity; (3) as low as 28 ng of total RNA is sufficient to obtain PCR products of eight genes, and (4) it is worth to operate on microdissected biopsy specimens because of the different expression of genes in the two renal compartments.

  8. A community resource for high-throughput quantitative RT-PCR analysis of transcription factor gene expression in Medicago truncatula

    Directory of Open Access Journals (Sweden)

    Redman Julia C

    2008-07-01

    Full Text Available Abstract Background Medicago truncatula is a model legume species that is currently the focus of an international genome sequencing effort. Although several different oligonucleotide and cDNA arrays have been produced for genome-wide transcript analysis of this species, intrinsic limitations in the sensitivity of hybridization-based technologies mean that transcripts of genes expressed at low-levels cannot be measured accurately with these tools. Amongst such genes are many encoding transcription factors (TFs, which are arguably the most important class of regulatory proteins. Quantitative reverse transcription-polymerase chain reaction (qRT-PCR is the most sensitive method currently available for transcript quantification, and one that can be scaled up to analyze transcripts of thousands of genes in parallel. Thus, qRT-PCR is an ideal method to tackle the problem of TF transcript quantification in Medicago and other plants. Results We established a bioinformatics pipeline to identify putative TF genes in Medicago truncatula and to design gene-specific oligonucleotide primers for qRT-PCR analysis of TF transcripts. We validated the efficacy and gene-specificity of over 1000 TF primer pairs and utilized these to identify sets of organ-enhanced TF genes that may play important roles in organ development or differentiation in this species. This community resource will be developed further as more genome sequence becomes available, with the ultimate goal of producing validated, gene-specific primers for all Medicago TF genes. Conclusion High-throughput qRT-PCR using a 384-well plate format enables rapid, flexible, and sensitive quantification of all predicted Medicago transcription factor mRNAs. This resource has been utilized recently by several groups in Europe, Australia, and the USA, and we expect that it will become the 'gold-standard' for TF transcript profiling in Medicago truncatula.

  9. Quantitative (real-time) PCR

    International Nuclear Information System (INIS)

    Denman, S.E.; McSweeney, C.S.

    2005-01-01

    Many nucleic acid-based probe and PCR assays have been developed for the detection tracking of specific microbes within the rumen ecosystem. Conventional PCR assays detect PCR products at the end stage of each PCR reaction, where exponential amplification is no longer being achieved. This approach can result in different end product (amplicon) quantities being generated. In contrast, using quantitative, or real-time PCR, quantification of the amplicon is performed not at the end of the reaction, but rather during exponential amplification, where theoretically each cycle will result in a doubling of product being created. For real-time PCR, the cycle at which fluorescence is deemed to be detectable above the background during the exponential phase is termed the cycle threshold (Ct). The Ct values obtained are then used for quantitation, which will be discussed later

  10. Construction of an adult barnacle (Balanus amphitrite cDNA library and selection of reference genes for quantitative RT-PCR studies

    Directory of Open Access Journals (Sweden)

    Burgess J Grant

    2009-06-01

    Full Text Available Abstract Background Balanus amphitrite is a barnacle commonly used in biofouling research. Although many aspects of its biology have been elucidated, the lack of genetic information is impeding a molecular understanding of its life cycle. As part of a wider multidisciplinary approach to reveal the biogenic cues influencing barnacle settlement and metamorphosis, we have sequenced and annotated the first cDNA library for B. amphitrite. We also present a systematic validation of potential reference genes for normalization of quantitative real-time PCR (qRT-PCR data obtained from different developmental stages of this animal. Results We generated a cDNA library containing expressed sequence tags (ESTs from adult B. amphitrite. A total of 609 unique sequences (comprising 79 assembled clusters and 530 singlets were derived from 905 reliable unidirectionally sequenced ESTs. Bioinformatics tools such as BLAST, HMMer and InterPro were employed to allow functional annotation of the ESTs. Based on these analyses, we selected 11 genes to study their ability to normalize qRT-PCR data. Total RNA extracted from 7 developmental stages was reverse transcribed and the expression stability of the selected genes was compared using geNorm, BestKeeper and NormFinder. These software programs produced highly comparable results, with the most stable gene being mt-cyb, while tuba, tubb and cp1 were clearly unsuitable for data normalization. Conclusion The collection of B. amphitrite ESTs and their annotation has been made publically available representing an important resource for both basic and applied research on this species. We developed a qRT-PCR assay to determine the most reliable reference genes. Transcripts encoding cytochrome b and NADH dehydrogenase subunit 1 were expressed most stably, although other genes also performed well and could prove useful to normalize gene expression studies.

  11. Identification and validation of reference genes for quantitative RT-PCR normalization in wheat

    Directory of Open Access Journals (Sweden)

    Porceddu Enrico

    2009-02-01

    Full Text Available Abstract Background Usually the reference genes used in gene expression analysis have been chosen for their known or suspected housekeeping roles, however the variation observed in most of them hinders their effective use. The assessed lack of validated reference genes emphasizes the importance of a systematic study for their identification. For selecting candidate reference genes we have developed a simple in silico method based on the data publicly available in the wheat databases Unigene and TIGR. Results The expression stability of 32 genes was assessed by qRT-PCR using a set of cDNAs from 24 different plant samples, which included different tissues, developmental stages and temperature stresses. The selected sequences included 12 well-known HKGs representing different functional classes and 20 genes novel with reference to the normalization issue. The expression stability of the 32 candidate genes was tested by the computer programs geNorm and NormFinder using five different data-sets. Some discrepancies were detected in the ranking of the candidate reference genes, but there was substantial agreement between the groups of genes with the most and least stable expression. Three new identified reference genes appear more effective than the well-known and frequently used HKGs to normalize gene expression in wheat. Finally, the expression study of a gene encoding a PDI-like protein showed that its correct evaluation relies on the adoption of suitable normalization genes and can be negatively affected by the use of traditional HKGs with unstable expression, such as actin and α-tubulin. Conclusion The present research represents the first wide screening aimed to the identification of reference genes and of the corresponding primer pairs specifically designed for gene expression studies in wheat, in particular for qRT-PCR analyses. Several of the new identified reference genes outperformed the traditional HKGs in terms of expression stability

  12. Reference gene identification for reliable normalisation of quantitative RT-PCR data in Setaria viridis.

    Science.gov (United States)

    Nguyen, Duc Quan; Eamens, Andrew L; Grof, Christopher P L

    2018-01-01

    Quantitative real-time polymerase chain reaction (RT-qPCR) is the key platform for the quantitative analysis of gene expression in a wide range of experimental systems and conditions. However, the accuracy and reproducibility of gene expression quantification via RT-qPCR is entirely dependent on the identification of reliable reference genes for data normalisation. Green foxtail ( Setaria viridis ) has recently been proposed as a potential experimental model for the study of C 4 photosynthesis and is closely related to many economically important crop species of the Panicoideae subfamily of grasses, including Zea mays (maize), Sorghum bicolor (sorghum) and Sacchurum officinarum (sugarcane). Setaria viridis (Accession 10) possesses a number of key traits as an experimental model, namely; (i) a small sized, sequenced and well annotated genome; (ii) short stature and generation time; (iii) prolific seed production, and; (iv) is amendable to Agrobacterium tumefaciens -mediated transformation. There is currently however, a lack of reference gene expression information for Setaria viridis ( S. viridis ). We therefore aimed to identify a cohort of suitable S. viridis reference genes for accurate and reliable normalisation of S. viridis RT-qPCR expression data. Eleven putative candidate reference genes were identified and examined across thirteen different S. viridis tissues. Of these, the geNorm and NormFinder analysis software identified SERINE / THERONINE - PROTEIN PHOSPHATASE 2A ( PP2A ), 5 '- ADENYLYLSULFATE REDUCTASE 6 ( ASPR6 ) and DUAL SPECIFICITY PHOSPHATASE ( DUSP ) as the most suitable combination of reference genes for the accurate and reliable normalisation of S. viridis RT-qPCR expression data. To demonstrate the suitability of the three selected reference genes, PP2A , ASPR6 and DUSP , were used to normalise the expression of CINNAMYL ALCOHOL DEHYDROGENASE ( CAD ) genes across the same tissues. This approach readily demonstrated the suitably of the three

  13. Development of single-step multiplex real-time RT-PCR assays for rapid diagnosis of enterovirus 71, coxsackievirus A6, and A16 in patients with hand, foot, and mouth disease.

    Science.gov (United States)

    Puenpa, Jiratchaya; Suwannakarn, Kamol; Chansaenroj, Jira; Vongpunsawad, Sompong; Poovorawan, Yong

    2017-10-01

    Real-time reverse-transcription polymerase chain reaction (rRT-PCR) to detect enterovirus 71 (EV-A71) and coxsackievirus A16 (CV-A16) has facilitated the rapid and accurate identification of the two most common etiological agents underlying hand, foot, and mouth disease (HFMD). However, the worldwide emergence of CV-A6 infection in HFMD necessitates development of an improved multiplex rRT-PCR method. To rapidly determine the etiology of HFMD, two rRT-PCR assays using TaqMan probes were developed to differentiate among three selected common enteroviruses (EV-A71, CV-A16 and CV-A6) and to enable broad detection of enteroviruses (pan-enterovirus assay). No cross-reactions were observed with other RNA viruses examined. The detection limits of both assays were 10 copies per microliter for EV-A71, CV-A6 and CV-A16, and pan-enterovirus. The methods showed high accuracy (EV-A71, 90.6%; CV-A6, 92.0%; CV-A16, 100%), sensitivity (EV-A71, 96.5%; CV-A6, 95.8%; CV-A16, 99.0%), and specificity (EV-A71, 100%; CV-A6, 99.9%; CV-A16, 99.9%) in testing clinical specimens (n=1049) during 2014-2016, superior to those of conventional RT-PCR. Overall, the multiplex rRT-PCR assays enabled highly sensitive detection and rapid simultaneous typing of EV-A71, CV-A6 and CV-A16, and enteroviruses, rendering them feasible and attractive methods for large-scale surveillance of enteroviruses associated with HFMD outbreaks. Copyright © 2017 Elsevier B.V. All rights reserved.

  14. Quantitation of TGF-beta1 mRNA in porcine mesangial cells by comparative kinetic RT/PCR: comparison with ribonuclease protection assay and in situ hybridization.

    Science.gov (United States)

    Ceol, M; Forino, M; Gambaro, G; Sauer, U; Schleicher, E D; D'Angelo, A; Anglani, F

    2001-01-01

    Gene expression can be examined with different techniques including ribonuclease protection assay (RPA), in situ hybridisation (ISH), and quantitative reverse transcription-polymerase chain reaction (RT/PCR). These methods differ considerably in their sensitivity and precision in detecting and quantifying low abundance mRNA. Although there is evidence that RT/PCR can be performed in a quantitative manner, the quantitative capacity of this method is generally underestimated. To demonstrate that the comparative kinetic RT/PCR strategy-which uses a housekeeping gene as internal standard-is a quantitative method to detect significant differences in mRNA levels between different samples, the inhibitory effect of heparin on phorbol 12-myristate 13-acetate (PMA)-induced-TGF-beta1 mRNA expression was evaluated by RT/PCR and RPA, the standard method of mRNA quantification, and the results were compared. The reproducibility of RT/PCR amplification was calculated by comparing the quantity of G3PDH and TGF-beta1 PCR products, generated during the exponential phases, estimated from two different RT/PCR (G3PDH, r = 0.968, P = 0.0000; TGF-beta1, r = 0.966, P = 0.0000). The quantitative capacity of comparative kinetic RT/PCR was demonstrated by comparing the results obtained from RPA and RT/PCR using linear regression analysis. Starting from the same RNA extraction, but using only 1% of the RNA for the RT/PCR compared to RPA, significant correlation was observed (r = 0.984, P = 0.0004). Moreover the morphometric analysis of ISH signal was applied for the semi-quantitative evaluation of the expression and localisation of TGF-beta1 mRNA in the entire cell population. Our results demonstrate the close similarity of the RT/PCR and RPA methods in giving quantitative information on mRNA expression and indicate the possibility to adopt the comparative kinetic RT/PCR as reliable quantitative method of mRNA analysis. Copyright 2001 Wiley-Liss, Inc.

  15. Comparison of the genexpert enterovirus assay (GXEA) with real-time one step RT-PCR for the detection of enteroviral RNA in the cerebrospinal fluid of patients with meningitis.

    Science.gov (United States)

    Hong, JiYoung; Kim, Ahyoun; Hwang, Seoyeon; Cheon, Doo-Sung; Kim, Jong-Hyen; Lee, June-Woo; Park, Jae-Hak; Kang, Byunghak

    2015-02-13

    Enteroviruses (EVs) are the leading cause of aseptic meningitis worldwide. Detection of enteroviral RNA in clinical specimens has been demonstrated to improve the management of patient care, especially that of neonates and young children. To establish a sensitive and reliable assay for routine laboratory diagnosis, we compared the sensitivity and specificity of the GeneXpert Enterovirus Assay (GXEA) with that of the reverse transcription polymerase chain reaction (RT-PCR) based assay referred to as real-time one step RT-PCR (RTo-PCR). The sensitivity/specificity produced by GXEA and RTo-PCR were 100%/100% and 65%/100%, respectively. Both methods evaluated in this article can be used for detection of enterovirus in clinical specimens and these nucleic acid amplification methods are useful assays for the diagnosis of enteroviral infection.

  16. Performance of a commercial assay for the diagnosis of influenza A (H1N1 infection in comparison to the Centers for Disease Control and Prevention protocol of real time RT-PCR

    Directory of Open Access Journals (Sweden)

    María G Barbás

    2012-03-01

    Full Text Available At the time of influenza A (H1N1 emergency, the WHO responded with remarkable speed by releasing guidelines and a protocol for a real-time RT-PCR assay (rRT-PCR. The aim of the present study was to evalúate the performance of the "Real Time Ready Influenza A/H1N1 Detection Set" (June 2009-Roche kit in comparison to the CDC reference rRT-PCR protocol. The overall sensitivity of the Roche assay for detection of the Inf A gene in the presence or absence of the H1 gene was 74.5 %. The sensitivity for detecting samples that were only positive for the Inf A gene (absence of the H1 gene was 53.3 % whereas the sensitivity for H1N1-positive samples (presence of the Inf A gene and any other swine gene was 76.4 %. The specificity of the assay was 97.1 %. A new version of the kit (November 2009 is now available, and a recent evaluation of its performance showed good sensitivity to detect pandemic H1N1 compared to other molecular assays.Durante la pandemia de influenza A (H1N1, la OMS recomendó algoritmos y protocolos de detección del virus mediante RT-PCR en tiempo real. El objetivo del presente estudio fue evaluar el desempeño del equipo que comercializa la empresa Roche, Real Time Ready Influenza A/H1N1 Detection Set (junio de 2009, en comparación con el protocolo de RT-PCR en tiempo real de los CDC. La sensibilidad global del ensayo de Roche para la detección del gen Inf A en presencia o ausencia del gen H1 fue 74,5 %. La sensibilidad para la detección de muestras positivas solo para el gen Inf A (ausencia del gen H1 fue 53,3 % y la sensibilidad para la detección de muestras positivas para H1N1 (presencia del gen Inf A y cualquier otro gen porcino fue 76,4 %. La especificidad fue 97,1 %. Existe una nueva versión del equipo (noviembre 2009 que, según se ha descrito, presenta buena sensibilidad en comparación con otros ensayos moleculares para detectar H1N1 pandémica.

  17. Development and evaluation of a real-time one step Reverse-Transcriptase PCR for quantitation of Chandipura Virus

    Directory of Open Access Journals (Sweden)

    Tandale Babasaheb V

    2008-12-01

    Full Text Available Abstract Background Chandipura virus (CHPV, a member of family Rhabdoviridae was attributed to an explosive outbreak of acute encephalitis in children in Andhra Pradesh, India in 2003 and a small outbreak among tribal children from Gujarat, Western India in 2004. The case-fatality rate ranged from 55–75%. Considering the rapid progression of the disease and high mortality, a highly sensitive method for quantifying CHPV RNA by real-time one step reverse transcriptase PCR (real-time one step RT-PCR using TaqMan technology was developed for rapid diagnosis. Methods Primers and probe for P gene were designed and used to standardize real-time one step RT-PCR assay for CHPV RNA quantitation. Standard RNA was prepared by PCR amplification, TA cloning and run off transcription. The optimized real-time one step RT-PCR assay was compared with the diagnostic nested RT-PCR and different virus isolation systems [in vivo (mice in ovo (eggs, in vitro (Vero E6, PS, RD and Sand fly cell line] for the detection of CHPV. Sensitivity and specificity of real-time one step RT-PCR assay was evaluated with diagnostic nested RT-PCR, which is considered as a gold standard. Results Real-time one step RT-PCR was optimized using in vitro transcribed (IVT RNA. Standard curve showed linear relationship for wide range of 102-1010 (r2 = 0.99 with maximum Coefficient of variation (CV = 5.91% for IVT RNA. The newly developed real-time RT-PCR was at par with nested RT-PCR in sensitivity and superior to cell lines and other living systems (embryonated eggs and infant mice used for the isolation of the virus. Detection limit of real-time one step RT-PCR and nested RT-PCR was found to be 1.2 × 100 PFU/ml. RD cells, sand fly cells, infant mice, and embryonated eggs showed almost equal sensitivity (1.2 × 102 PFU/ml. Vero and PS cell-lines (1.2 × 103 PFU/ml were least sensitive to CHPV infection. Specificity of the assay was found to be 100% when RNA from other viruses or healthy

  18. Real-time RT-PCR analysis of mRNA decay: half-life of Beta-actin mRNA in human leukemia CCRF-CEM and Nalm-6 cell lines

    Directory of Open Access Journals (Sweden)

    Barredo Julio C

    2002-03-01

    Full Text Available Abstract Background We describe an alternative method to determine mRNA half-life (t1/2 based on the Real-Time RT-PCR procedure. This approach was evaluated by using the β-actin gene as a reference molecule for measuring of mRNA stability. Results Human leukemia Nalm-6 and CCRF-CEM cells were treated with various concentrations of Actinomycin D to block transcription and aliquots were removed periodically. Total RNA was isolated and quantified using the RiboGreen® fluorescent dye with the VersaFluor Fluorometer System. One μg of total RNA was reverse transcribed and used as template for the amplification of a region of the β-actin gene (231 bp. To generate the standard curve, serial ten-fold dilutions of the pBactin-231 vector containing the cDNA amplified fragment were employed, β-actin mRNAs were quantified by Real-Time RT-PCR using the SYBR® Green I fluorogenic dye and data analyzed using the iCycle iQ system software. Using this method, the β-actin mRNA exhibited a half-life of 6.6 h and 13.5 h in Nalm-6 and CCRF-CEM cells, respectively. The t1/2 value obtained for Nalm-6 is comparable to those estimated from Northern blot studies, using normal human leukocytes (5.5 h. Conclusions We have developed a rapid, sensitive, and reliable method based on Real-Time RT-PCR for measuring mRNA half-life. Our results confirm that β-actin mRNA half-life can be affected by the cellular growth rate.

  19. Estudio comparativo entre una prueba rápida y RT-PCR tiempo real en el diagnóstico de influenza AH1N1 2009 Comparative study of a rapid testing with real time RT-PCR for diagnosis of influenza AH1N1 2009

    Directory of Open Access Journals (Sweden)

    Luz Araceli Castro-Cárdenas

    2011-08-01

    Full Text Available OBJETIVO: Comparar la prueba QuickVue Influenza A+B empleando como estándar la RT-PCR tiempo real para influenza AH1N1 2009. MATERIAL Y MÉTODOS: Estudio retrospectivo-comparativo de 135 muestras de vías respiratorias de individuos sintomáticos para influenza procesadas de mayo 2009 a octubre 2010.Las pruebas citadas se realizaron simultáneamente. Se utilizó el software Confidence Interval Analysis 2000. RESULTADOS: Sensibilidad 62.96; especificidad 94.44; valor predictivo negativo 62.9; valor predictivo positivo 94.44; razón de probabilidad positiva 11.33 y razón de probabilidad negativa 0.39. Se calcularon intervalos de confianza a 95. DISCUSIÓN: Los valores obtenidos concuerdan con otros estudios donde la sensibilidad fluctúa de 50 a 70 y especificidad entre 90 y 95 por ciento. La prueba QuickVue Influenza A+B es rápida, simple y de menor costo que el RT-PCR tiempo real, útil para identificar el tipo de virus en brotes de influenza de una población determinadaOBJECTIVE: Compare QuickVue Influenza A+B test with real-time RT-PCR for the diagnosis of influenza AH1N1 2009. MATERIAL AND METHODS: Retrospective-comparative study of 135 respiratory specimens from individuals with symptoms of influenza processed from May 2009 to October 2010.The above mentioned tests were performed simultaneously. For statistic analysisthe softwareof Confidence IntervalAnalysis 2000 was used. RESULTS: The parameters obtained were: sensitivity 62.96; specificity 94.44; negative predictive value 62.9; positive predictive value 94.44; positive likelihood ratio 11.33; negative likelihood ratio 0.39. Confidence intervals to 95,were calculated to all of the above data. DISCUSSION: The test QuickVue InfluenzaA+B is a rapid,simple test,with lower cost than real-time RT-PCR useful for identifying the type of virus outbreaks of influenza in a given population.It correlates well with more specific test and similar reports.

  20. Development of tailored real-time RT-PCR assays for the detection and differentiation of serotype O, A and Asia-1 foot-and-mouth disease virus lineages circulating in the Middle East.

    Science.gov (United States)

    Reid, Scott M; Mioulet, Valerie; Knowles, Nick J; Shirazi, Nazeem; Belsham, Graham J; King, Donald P

    2014-10-01

    Rapid and accurate diagnosis is essential for effective control of foot-and-mouth disease (FMD). In countries where FMD is endemic, identification of the serotypes of the causative virus strains is important for vaccine selection and tracing the source of outbreaks. In this study, real-time reverse transcription polymerase chain reaction (rRT-PCR) assays using primer/probe sets designed from the VP1 coding region of the virus genomes were developed for the specific detection of serotype O, A and Asia-1 FMD viruses (FMDVs) circulating in the Middle East. These assays were evaluated using representative field samples of serotype O strains belonging exclusively to the PanAsia-2 lineage, serotype A strains of the Iran-05 lineage and serotype Asia-1 viruses from three relevant sub-groups. When RNA extracted from archival and contemporary field strains was tested using one- or two-step rRT-PCR assays, all three primer/probe sets detected the RNA from homotypic viruses and no cross-reactivity was observed with heterotypic viruses. Similar results were obtained using both single- and multiplex assay formats. Using plasmid standards, the minimum detection level of these tests was found to be lower than two copies. The results illustrate the potential of tailored rRT-PCR tools for the detection and categorization of viruses circulating in the Middle East belonging to distinct subgroups of serotypes O, A and Asia-1. These assays can also overcome the problem of serotyping samples which are found positive by the generic rRT-PCR diagnostic assays but negative by virus isolation and antigen-detection ELISA which would otherwise have to be serotyped by nucleotide sequencing. A similar approach could be used to develop serotyping assays for FMDV strains circulating in other regions of the world. Copyright © 2014 The Authors. Published by Elsevier B.V. All rights reserved.

  1. Real Time RT-PCR with a Newly Designed Set of Promers Confirmed the Presence of 2b and 2x/d Myosim Heavy Chain mRNAs in the Rat Slow Soleus Muscle

    Czech Academy of Sciences Publication Activity Database

    Žurmanová, Jitka; Půta, F.; Stopková, R.; Soukup, Tomáš

    2008-01-01

    Roč. 57, č. 6 (2008), s. 973-978 ISSN 0862-8408 R&D Projects: GA MŠk(CZ) LC554; GA ČR(CZ) GA305/06/1115; GA ČR(CZ) GA304/08/0256 Grant - others:EC(XE) LSH-CT-2004-511978 Institutional research plan: CEZ:AV0Z50110509 Keywords : rat slow soleus muscle * myosin heavy chain isoforms * real time RT-PCR Subject RIV: ED - Physiology Impact factor: 1.653, year: 2008

  2. Selection of reference genes for normalisation of real-time RT-PCR in brain-stem death injury in Ovis aries

    Directory of Open Access Journals (Sweden)

    Fraser John F

    2009-07-01

    Full Text Available Abstract Background Heart and lung transplantation is frequently the only therapeutic option for patients with end stage cardio respiratory disease. Organ donation post brain stem death (BSD is a pre-requisite, yet BSD itself causes such severe damage that many organs offered for donation are unusable, with lung being the organ most affected by BSD. In Australia and New Zealand, less than 50% of lungs offered for donation post BSD are suitable for transplantation, as compared with over 90% of kidneys, resulting in patients dying for lack of suitable lungs. Our group has developed a novel 24 h sheep BSD model to mimic the physiological milieu of the typical human organ donor. Characterisation of the gene expression changes associated with BSD is critical and will assist in determining the aetiology of lung damage post BSD. Real-time PCR is a highly sensitive method involving multiple steps from extraction to processing RNA so the choice of housekeeping genes is important in obtaining reliable results. Little information however, is available on the expression stability of reference genes in the sheep pulmonary artery and lung. We aimed to establish a set of stably expressed reference genes for use as a standard for analysis of gene expression changes in BSD. Results We evaluated the expression stability of 6 candidate normalisation genes (ACTB, GAPDH, HGPRT, PGK1, PPIA and RPLP0 using real time quantitative PCR. There was a wide range of Ct-values within each tissue for pulmonary artery (15–24 and lung (16–25 but the expression pattern for each gene was similar across the two tissues. After geNorm analysis, ACTB and PPIA were shown to be the most stably expressed in the pulmonary artery and ACTB and PGK1 in the lung tissue of BSD sheep. Conclusion Accurate normalisation is critical in obtaining reliable and reproducible results in gene expression studies. This study demonstrates tissue associated variability in the selection of these

  3. Validation of reference genes for quantitative RT-PCR normalization in Suaeda aralocaspica, an annual halophyte with heteromorphism and C4 pathway without Kranz anatomy

    Directory of Open Access Journals (Sweden)

    Jing Cao

    2016-02-01

    Full Text Available Reverse transcription quantitative real-time polymerase chain reaction (qRT-PCR is a powerful analytical technique for the measurement of gene expression, which depends on the stability of the reference gene used for data normalization. Suaeda aralocaspica, an annual halophyte with heteromorphic seeds and possessing C4 photosynthesis pathway without Kranz anatomy, is an ideal plant species to identify stress tolerance-related genes and compare relative expression at transcriptional level. So far, no molecular information is available for this species. In the present study, six traditionally used reference genes were selected and their expression stability in two types of seeds of S. aralocaspica under different experimental conditions was evaluated. Three analytical programs, geNorm, NormFinder and BestKeeper, were used to assess and rank the stability of reference gene expression. Results revealed that although some reference genes may display different transcriptional profiles between the two types of seeds, β-TUB and GAPDH appeared to be the most suitable references under different developmental stages and tissues. GAPDH was the appropriate reference gene under different germination time points and salt stress conditions, and ACTIN was suitable for various abiotic stress treatments for the two types of seeds. For all the sample pools, β-TUB served as the most stable reference gene, whereas 18S rRNA and 28S rRNA performed poorly and presented as the least stable genes in our study. UBQ seemed to be unsuitable as internal control under different salt treatments. In addition, the expression of a photosynthesis-related gene (PPDK of C4 pathway and a salt tolerance-related gene (SAT of S. aralocaspica were used to validate the best performance reference genes. This is the first systematic comparison of reference gene selection for qRT-PCR work in S. aralocaspica and these data will facilitate further studies on gene expression in this species

  4. Circadian transitions in radiation dose-dependent augmentation of mRNA levels for DNA damage-induced genes elicited by accurate real-time RT-PCR quantification

    International Nuclear Information System (INIS)

    Ishihara, Hiroshi; Tanaka, Izumi; Yakumaru, Haruko

    2010-01-01

    Molecular mechanisms of intracellular response after DNA-damage by exposure to ionizing radiation have been studied. In the case of cells isolated from living body of human and experimental animals, alteration of the responsiveness by physiological oscillation such as circadian rhythm must be considered. To examine the circadian variation in the response of p53-responsible genes p21, mdm2, bax, and puma, we established a method to quantitate their mRNA levels with high reproducibility and accuracy based on real-time reverse transcription polymerase chain reaction (RT-PCR) and compared the levels of responsiveness in mouse hemocytes after diurnal irradiation to that after nocturnal irradiation. Augmentations of p21 and mdm2 mRNA levels with growth-arrest and of puma mRNA before apoptosis were confirmed by time-course experiment in RAW264.7, and dose-dependent increases in the peak levels of all the RNA were shown. Similarly, the relative RNA levels of p21, mdm2, bax, and puma per glyceraldehyde-3-phosphate dehydrogenase (GAPDH) also increased dose-dependently in peripheral blood and bone marrow cells isolated from whole-body-irradiated mice. Induction levels of all messages reduced by half after nighttime irradiation as compared with daytime irradiation in blood cells. In marrow cells, nighttime irradiation enhanced the p21 and mdm2 mRNA levels than daytime irradiation. No significant difference in bax or puma mRNA levels was observed between nighttime and daytime irradiation in marrow cells. This suggests that early-stage cellular responsiveness in DNA damage-induced genes is modulated between diurnal and nocturnal irradiation. (author)

  5. Exploring Valid Reference Genes for Quantitative Real-Time PCR Analysis in Sesamia inferens (Lepidoptera: Noctuidae)

    OpenAIRE

    Sun, Meng; Lu, Ming-Xing; Tang, Xiao-Tian; Du, Yu-Zhou

    2015-01-01

    The pink stem borer, Sesamia inferens, which is endemic in China and other parts of Asia, is a major pest of rice and causes significant yield loss in this host plant. Very few studies have addressed gene expression in S. inferens. Quantitative real-time PCR (qRT-PCR) is currently the most accurate and sensitive method for gene expression analysis. In qRT-PCR, data are normalized using reference genes, which help control for internal differences and reduce error between samples. In this study...

  6. Specific and sensitive quantitative RT-PCR of miRNAs with DNA primers

    DEFF Research Database (Denmark)

    Balcells, Ingrid; Cirera Salicio, Susanna; Busk, Peter K.

    2011-01-01

    BACKGROUND: MicroRNAs are important regulators of gene expression at the post-transcriptional level and play an important role in many biological processes. Due to the important biological role it is of great interest to quantitatively determine their expression level in different biological...... be designed with a success rate of 94%. The method was able to quantify synthetic templates over eight orders of magnitude and readily discriminated between microRNAs with single nucleotide differences. Importantly, PCR with DNA primers yielded significantly higher amplification efficiencies of biological...... samples than a similar method based on locked nucleic acids-spiked primers, which is in agreement with the observation that locked nucleic acid interferes with efficient amplification of short templates. The higher amplification efficiency of DNA primers translates into higher sensitivity and precision...

  7. Selection of housekeeping genes for normalization by real-time RT-PCR: analysis of Or-MYB1 gene expression in Orobanche ramosa development.

    Science.gov (United States)

    González-Verdejo, C I; Die, J V; Nadal, S; Jiménez-Marín, A; Moreno, M T; Román, B

    2008-08-15

    Real-time PCR has become the method of choice for accurate and in-depth expression studies of candidate genes. To avoid bias, real-time PCR is referred to one or several internal control genes that should not fluctuate among treatments. A need for reference genes in the parasitic plant Orobanche ramosa has emerged, and the studies in this area have not yet been evaluated. In this study, the genes 18S rRNA, Or-act1, Or-tub1, and Or-ubq1 were compared in terms of expression stability using the BestKeeper software program. Among the four common endogenous control genes, Or-act1 and Or-ubq1 were the most stable in O. ramosa samples. In parallel, a study was carried out studying the expression of the transcription factor Or-MYB1 that seemed to be implicated during preinfection stages. The normalization strategy presented here is a prerequisite to accurate real-time PCR expression profiling that, among other things, opens up the possibility of studying messenger RNA levels of low-copy-number-like transcription factors.

  8. Validation of reference genes for quantitative RT-PCR studies of gene expression in perennial ryegrass (Lolium perenne L.

    Directory of Open Access Journals (Sweden)

    Thrush Anthony

    2010-01-01

    Full Text Available Abstract Background Perennial ryegrass (Lolium perenne L. is an important pasture and turf crop. Biotechniques such as gene expression studies are being employed to improve traits in this temperate grass. Quantitative reverse transcription-polymerase chain reaction (qRT-PCR is among the best methods available for determining changes in gene expression. Before analysis of target gene expression, it is essential to select an appropriate normalisation strategy to control for non-specific variation between samples. Reference genes that have stable expression at different biological and physiological states can be effectively used for normalisation; however, their expression stability must be validated before use. Results Existing Serial Analysis of Gene Expression data were queried to identify six moderately expressed genes that had relatively stable gene expression throughout the year. These six candidate reference genes (eukaryotic elongation factor 1 alpha, eEF1A; TAT-binding protein homolog 1, TBP-1; eukaryotic translation initiation factor 4 alpha, eIF4A; YT521-B-like protein family protein, YT521-B; histone 3, H3; ubiquitin-conjugating enzyme, E2 were validated for qRT-PCR normalisation in 442 diverse perennial ryegrass (Lolium perenne L. samples sourced from field- and laboratory-grown plants under a wide range of experimental conditions. Eukaryotic EF1A is encoded by members of a multigene family exhibiting differential expression and necessitated the expression analysis of different eEF1A encoding genes; a highly expressed eEF1A (h, a moderately, but stably expressed eEF1A (s, and combined expression of multigene eEF1A (m. NormFinder identified eEF1A (s and YT521-B as the best combination of two genes for normalisation of gene expression data in perennial ryegrass following different defoliation management in the field. Conclusions This study is unique in the magnitude of samples tested with the inclusion of numerous field-grown samples

  9. Combined Metabonomic and Quantitative RT-PCR Analyses Revealed Metabolic Reprogramming Associated with Fusarium graminearum Resistance in Transgenic Arabidopsis thaliana

    Directory of Open Access Journals (Sweden)

    Fangfang Chen

    2018-01-01

    Full Text Available Fusarium head blight disease resulting from Fusarium graminearum (FG infection causes huge losses in global production of cereals and development of FG-resistant plants is urgently needed. To understand biochemistry mechanisms for FG resistance, here, we have systematically investigated the plant metabolomic phenotypes associated with FG resistance for transgenic Arabidopsis thaliana expressing a class-I chitinase (Chi, a Fusarium-specific recombinant antibody gene (CWP2 and fused Chi-CWP2. Plant disease indices, mycotoxin levels, metabonomic characteristics, and expression levels of several key genes were measured together with their correlations. We found that A. thaliana expressing Chi-CWP2 showed higher FG resistance with much lower disease indices and mycotoxin levels than the wild-type and the plants expressing Chi or CWP2 alone. The combined metabonomic and quantitative RT-PCR analyses revealed that such FG-resistance was closely associated with the promoted biosynthesis of secondary metabolites (phenylpropanoids, alkanoids and organic osmolytes (proline, betaine, glucose, myo-inositol together with enhanced TCA cycle and GABA shunt. These suggest that the concurrently enhanced biosyntheses of the shikimate-mediated secondary metabolites and organic osmolytes be an important strategy for A. thaliana to develop and improve FG resistance. These findings provide essential biochemical information related to FG resistance which is important for developing FG-resistant cereals.

  10. Housekeeping gene expression during fetal brain development in the rat-validation by semi-quantitative RT-PCR.

    Science.gov (United States)

    Al-Bader, Maie Dawoud; Al-Sarraf, Hameed Ali

    2005-04-21

    Mammalian gene expression is usually carried out at the level of mRNA where the amount of mRNA of interest is measured under different conditions such as growth and development. It is therefore important to use a "housekeeping gene", that does not change in relative abundance during the experimental conditions, as a standard or internal control. However, recent data suggest that expression of some housekeeping genes may vary with the extent of cell proliferation, differentiation and under various experimental conditions. In this study, the expression of various housekeeping genes (18S rRNA [18S], glyceraldehydes-3-phosphate dehydrogenase [G3PDH], beta-glucuronidase [BGLU], histone H4 [HH4], ribosomal protein L19 [RPL19] and cyclophilin [CY]) was investigated during fetal rat brain development using semi-quantitative RT-PCR at 16, 19 and 21 days gestation. It was found that all genes studied, with exception to G3PDH, did not show any change in their expression levels during development. G3PDH, on the other hand, showed increased expression with development. These results suggest that the choice of a housekeeping gene is critical to the interpretation of experimental results and should be modified according to the nature of the study.

  11. Real-time RT-PCR systems for CTC detection from blood samples of breast cancer and gynaecological tumour patients (Review).

    Science.gov (United States)

    Andergassen, Ulrich; Kölbl, Alexandra C; Mahner, Sven; Jeschke, Udo

    2016-04-01

    Cells, which detach from a primary epithelial tumour and migrate through lymphatic vessels and blood stream are called 'circulating tumour cells'. These cells are considered to be the main root of remote metastasis and are correlated to a worse prognosis concerning progression-free and overall survival of the patients. Therefore, the detection of the minimal residual disease is of great importance regarding therapeutic decisions. Many different detection strategies are already available, but only one method, the CellSearch® system, reached FDA approval. The present review focusses on the detection of circulating tumour cells by means of real-time PCR, a highly sensitive method based on differences in gene expression between normal and malignant cells. Strategies for an enrichment of tumour cells are mentioned, as well as a large panel of potential marker genes. Drawbacks and advantages of the technique are elucidated, whereas, the greatest advantage might be, that by selection of appropriate marker genes, also tumour cells, which have already undergone epithelial to mesenchymal transition can be detected. Finally, the application of real-time PCR in different gynaecological malignancies is described, with breast cancer being the most studied cancer entity.

  12. Evaluation of the Xpert Flu test and comparison with in-house real-time RT-PCR assays for detection of influenza virus from 2008 to 2011 in Marseille, France.

    Science.gov (United States)

    Salez, N; Ninove, L; Thirion, L; Gazin, C; Zandotti, C; de Lamballerie, X; Charrel, R N

    2012-04-01

    Rapid documentation of respiratory specimens can have an impact on the management of patients and their relatives in terms of preventive and curative measures. We compared the results of the Xpert(®) Flu assay (Cepheid) with three real-time RT-PCR assays using 127 nasopharyngeal samples, of which 75 were positive for influenza A (with 52 identified as A/H1N1-2009) and 52 were positive for influenza B. The Xpert(®) Flu assay presented a quasi-absence of non-interpretable tests, and showed sensitivity and specificity of 100% and 100% for Flu A, 98.4% and 100% for A/H1N1-2009, and 80.7% and 100% for Flu B. © 2012 The Authors. Clinical Microbiology and Infection © 2012 European Society of Clinical Microbiology and Infectious Diseases.

  13. [Validation of a real time RT-PCR assay to detect foot-and-mouth disease virus and assessment of its performance in acute infection].

    Science.gov (United States)

    Fondevila, Norberto; Compaired, Diego; Maradei, Eduardo; Duffy, Sergio

    2014-01-01

    A specific real time reverse transcription polymerase chain reaction (RT-PCRrt) for the detection of foot-and-mouth disease virus was validated using the LightCycler thermocycler 2.0 and its reagents as recommended by the World Organization for Animal Health and was assessed for the detection of the virus in acute infection of cattle experimentally vaccinated and challenged with virus A Argentina/2001 or A24 Cruzeiro. The technique proved to be robust, showing coefficients of variation lower than 4% for different ARN extractions, days or repetitions and was able to detect up to 0,4 TCID 50%, and/or up to 100 RNA molecules. In probang samples, diagnostic sensitivity was 93.1 (95% CI 86.5-96.6) and diagnostic specificity 100 (95% CI 96.3-100). The results of the challenge in vaccinated or multivaccinated bovines showed that although there were high levels of clinical protection in the vaccinated group, FMDV could be detected in all challenged groups. However, detection was 100 times lower in immunized animals. Copyright © 2014 Asociación Argentina de Microbiología. Publicado por Elsevier España. All rights reserved.

  14. Validation of a norovirus multiplex real-time RT-PCR assay for the detection of norovirus GI and GII from faeces samples.

    LENUS (Irish Health Repository)

    Jones, S

    2011-01-01

    Norovirus is a leading cause of infectious non-bacterial gastroenteritis. The virus is highly contagious and has multiple modes of transmission, presenting a growing challenge to hospital-based healthcare. In this study, a total of 120 stool samples are tested for the presence of norovirus GI and GII by the Roche two-step Lightcycler 2.0 assay incorporating primers and probes produced by TIB Molbiol, and the results are compared with results from the National Virus Reference Laboratory. The Roche\\/TIB Molbiol assay produced 51 positive results and 69 negative results. Discrepancy analysis was performed for six conflicting results using a second real-time polymerase chain reaction (PCR) assay (Roche\\/TIB Molbiol) and this confirmed that four of the five discrepant positive results were true positives. A single discrepant negative result generated by the Roche assay remained negative using the second assay. Sensitivity, specificity, positive predictive value (PPV) and negative predictive value (NPV) were calculated to be 98%, 98.6%, 98.0% and 98.6%, respectively. Melting curve analysis was used to differentiate genogroups I and II and this showed that 92% of strains belonged to genogroup II.

  15. A one-step, triplex, real-time RT-PCR assay for the simultaneous detection of enterovirus 71, coxsackie A16 and pan-enterovirus in a single tube.

    Directory of Open Access Journals (Sweden)

    Shiyin Zhang

    Full Text Available The recent, ongoing epidemic of hand, foot, and mouth disease (HFMD, which is caused by enterovirus infection, has affected millions of children and resulted in thousands of deaths in China. Enterovirus 71 (EV71 and coxsackie A16 (CA16 are the two major distinct pathogens for HFMD. However, EV71 is more commonly associated with neurologic complications and even fatalities. Therefore, simultaneously detecting and differentiating EV71 and CA16 specifically from other enteroviruses for diagnosing HFMD is important. Here, we developed a one-step, triplex, real-time RT-PCR assay for the simultaneous detection of EV71, CA16, and pan-enterovirus (EVs in a single tube with an internal amplification control. The detection results for the serially diluted viruses indicate that the lower limit of detection for this assay is 0.001-0.04 TCID50/ml, 0.02 TCID50/ml, and 0.001 TCID50/ml for EVs, EV71, and CA16, respectively. After evaluating known HFMD virus stocks of 17 strains of 16 different serotypes, this assay showed a favorable detection spectrum and no obvious cross-reactivity. The results for 141 clinical throat swabs from HFMD-suspected patients demonstrated sensitivities of 98.4%, 98.7%, and 100% for EVs, EV71, and CA16, respectively, and 100% specificity for each virus. The application of this one-step, triplex, real-time RT-PCR assay in clinical units will contribute to HFMD surveillance and help to identify causative pathogen in patients with suspected HFMD.

  16. A one-step, triplex, real-time RT-PCR assay for the simultaneous detection of enterovirus 71, coxsackie A16 and pan-enterovirus in a single tube.

    Science.gov (United States)

    Zhang, Shiyin; Wang, Jin; Yan, Qiang; He, Shuizhen; Zhou, Wenbin; Ge, Shengxiang; Xia, Ningshao

    2014-01-01

    The recent, ongoing epidemic of hand, foot, and mouth disease (HFMD), which is caused by enterovirus infection, has affected millions of children and resulted in thousands of deaths in China. Enterovirus 71 (EV71) and coxsackie A16 (CA16) are the two major distinct pathogens for HFMD. However, EV71 is more commonly associated with neurologic complications and even fatalities. Therefore, simultaneously detecting and differentiating EV71 and CA16 specifically from other enteroviruses for diagnosing HFMD is important. Here, we developed a one-step, triplex, real-time RT-PCR assay for the simultaneous detection of EV71, CA16, and pan-enterovirus (EVs) in a single tube with an internal amplification control. The detection results for the serially diluted viruses indicate that the lower limit of detection for this assay is 0.001-0.04 TCID50/ml, 0.02 TCID50/ml, and 0.001 TCID50/ml for EVs, EV71, and CA16, respectively. After evaluating known HFMD virus stocks of 17 strains of 16 different serotypes, this assay showed a favorable detection spectrum and no obvious cross-reactivity. The results for 141 clinical throat swabs from HFMD-suspected patients demonstrated sensitivities of 98.4%, 98.7%, and 100% for EVs, EV71, and CA16, respectively, and 100% specificity for each virus. The application of this one-step, triplex, real-time RT-PCR assay in clinical units will contribute to HFMD surveillance and help to identify causative pathogen in patients with suspected HFMD.

  17. Evaluation of candidate reference genes for normalization of quantitative RT-PCR in soybean tissues under various abiotic stress conditions.

    Directory of Open Access Journals (Sweden)

    Dung Tien Le

    Full Text Available Quantitative RT-PCR can be a very sensitive and powerful technique for measuring differential gene expression. Changes in gene expression induced by abiotic stresses are complex and multifaceted, which make determining stably expressed genes for data normalization difficult. To identify the most suitable reference genes for abiotic stress studies in soybean, 13 candidate genes collected from literature were evaluated for stability of expression under dehydration, high salinity, cold and ABA (abscisic acid treatments using delta CT and geNorm approaches. Validation of reference genes indicated that the best reference genes are tissue- and stress-dependent. With respect to dehydration treatment, the Fbox/ABC, Fbox/60s gene pairs were found to have the highest expression stability in the root and shoot tissues of soybean seedlings, respectively. Fbox and 60s genes are the most suitable reference genes across dehydrated root and shoot tissues. Under salt stress the ELF1b/IDE and Fbox/ELF1b are the most stably expressed gene pairs in roots and shoots, respectively, while 60s/Fbox is the best gene pair in both tissues. For studying cold stress in roots or shoots, IDE/60s and Fbox/Act27 are good reference gene pairs, respectively. With regard to gene expression analysis under ABA treatment in either roots, shoots or across these tissues, 60s/ELF1b, ELF1b/Fbox and 60s/ELF1b are the most suitable reference genes, respectively. The expression of ELF1b/60s, 60s/Fbox and 60s/Fbox genes was most stable in roots, shoots and both tissues, respectively, under various stresses studied. Among the genes tested, 60s was found to be the best reference gene in different tissues and under various stress conditions. The highly ranked reference genes identified from this study were proved to be capable of detecting subtle differences in expression rates that otherwise would be missed if a less stable reference gene was used.

  18. A quantitative method to evaluate mesenchymal stem cell lipofection using real-time PCR.

    Science.gov (United States)

    Ribeiro, S C; Mendes, R; Madeira, C; Monteiro, G A; da Silva, C L; Cabral, J M S

    2010-01-01

    Genetic modification of human mesenchymal stem cells (MSC) is a powerful tool to improve the therapeutic utility of these cells and to increase the knowledge on their regulation mechanisms. In this context, strong efforts have been made recently to develop efficient nonviral gene delivery systems. Although several studies addressed this question most of them use the end product of a reporter gene instead of the DNA uptake quantification to test the transfection efficiency. In this study, we established a method based on quantitative real-time PCR (RT-PCR) to determine the intracellular plasmid DNA copy number in human MSC after lipofection. The procedure requires neither specific cell lysis nor DNA purification. The influence of cell number on the RT-PCR sensitivity was evaluated. The method showed good reproducibility, high sensitivity, and a wide linear range of 75-2.5 x 10⁶ plasmid DNA copies per cell. RT-PCR results were then compared with the percentage of transfected cells assessed by flow cytometry analysis, which showed that flow cytometry-based results are not always proportional to plasmid cellular uptake determined by RT-PCR. This work contributed for the establishment of a rapid quantitative assay to determine intracellular plasmid DNA in stem cells, which will be extremely beneficial for the optimization of gene delivery strategies. © 2010 American Institute of Chemical Engineers

  19. Quantitative RT-PCR based platform for rapid quantification of the transcripts of highly homologous multigene families and their members during grain development

    DEFF Research Database (Denmark)

    Kaczmarczyk, Agnieszka Ewa; Bowra, Steve; Elek, Zoltan

    2012-01-01

    expression combined with genetic variation in large multigene families with high homology among the alleles is very challenging. Results We designed a rapid qRT-PCR system with the aim of characterising the variation in the expression of hordein genes families. All the known D-, C-, B-, and gamma......-hordein sequences coding full length open reading frames were collected from commonly available databases. Phylogenetic analysis was performed and the members of the different hordein families were classified into subfamilies. Primer sets were designed to discriminate the gene expression level of whole families...... and its subgroups. More over the results indicate the genotypic specific gene expression. Conclusions Quantitative RT-PCR with SYBR Green labelling can be a useful technique to follow gene expression levels of large gene families with highly homologues members. We showed variation in the temporal...

  20. Selection and Validation of Reference Genes for qRT-PCR Expression Analysis of Candidate Genes Involved in Olfactory Communication in the Butterfly Bicyclus anynana

    OpenAIRE

    Arun, Alok; Bauml?, V?ronique; Amelot, Ga?l; Nieberding, Caroline M.

    2015-01-01

    Real-time quantitative reverse transcription PCR (qRT-PCR) is a technique widely used to quantify the transcriptional expression level of candidate genes. qRT-PCR requires the selection of one or several suitable reference genes, whose expression profiles remain stable across conditions, to normalize the qRT-PCR expression profiles of candidate genes. Although several butterfly species (Lepidoptera) have become important models in molecular evolutionary ecology, so far no study aimed at ident...

  1. Real-time RT-PCR expression analysis of chitinase and endoglucanase genes in the three-way interaction between the biocontrol strain Clonostachys rosea IK726, Botrytis cinera and strawberry

    DEFF Research Database (Denmark)

    Mamarabadi, Mojtaba; Jensen, Birgit; Jensen, Søren Dan Funck

    2008-01-01

    Clonostachys rosea is a well-known biocontrol agent against Botrytis cinerea, the causal agent of gray mold in strawberry. The activity of cell wall-degrading enzymes might play a significant role for successful biocontrol by C. rosea. The expression pattern of four chitinases, and two endoglucan......Clonostachys rosea is a well-known biocontrol agent against Botrytis cinerea, the causal agent of gray mold in strawberry. The activity of cell wall-degrading enzymes might play a significant role for successful biocontrol by C. rosea. The expression pattern of four chitinases, and two...... endoglucanase genes from C. rosea strain IK726 was analyzed using real-time RT-PCR in vitro and in strawberry leaves during interaction with B. cinerea. Specific primers were designed for ß-tubulin genes from C. rosea and B. cinerea, respectively, and a gene encoding a DNA-binding protein (DBP) from strawberry......, allowing in situ activity assessment of each fungus in vitro and during their interaction on strawberry leaves. Growth of B. cinerea was inhibited in all pathogen-antagonist interactions while the activity of IK726 was slightly increased. In all in vitro interactions, four of the six genes were upregulated...

  2. One-step multiplex quantitative RT-PCR for the simultaneous detection of viroids and phytoplasmas of pome fruit trees.

    Science.gov (United States)

    Malandraki, Ioanna; Varveri, Christina; Olmos, Antonio; Vassilakos, Nikon

    2015-03-01

    A one-step multiplex real-time quantitative reverse transcription polymerase chain reaction (RT-qPCR) based on TaqMan chemistry was developed for the simultaneous detection of Pear blister canker viroid and Apple scar skin viroid along with universal detection of phytoplasmas, in pome trees. Total nucleic acids (TNAs) extraction was performed according to a modified CTAB protocol. Primers and TaqMan MGB probes for specific detection of the two viroids were designed in this study, whereas for phytoplasma detection published universal primers and probe were used, with the difference that the later was modified to carry a MGB quencher. The pathogens were detected simultaneously in 10-fold serial dilutions of TNAs from infected plant material into TNAs of healthy plant up to dilutions 10(-5) for viroids and 10(-4) for phytoplasmas. The multiplex real-time assay was at least 10 times more sensitive than conventional protocols for viroid and phytoplasma detection. Simultaneous detection of the three targets was achieved in composite samples at least up to a ratio of 1:100 triple-infected to healthy tissue, demonstrating that the developed assay has the potential to be used for rapid and massive screening of viroids and phytoplasmas of pome fruit trees in the frame of certification schemes and surveys. Copyright © 2014 Elsevier B.V. All rights reserved.

  3. Comparative evaluation of the CerTest VIASURE flu A, B & RSV real time RT-PCR detection kit on the BD MAX system versus a routine in-house assay for detection of influenza A and B virus during the 2016/17 influenza season

    DEFF Research Database (Denmark)

    Sydenham, Thomas Vognbjerg; Bek-Thomsen, Malene; Andersen, Signe Dalsgaard

    2018-01-01

    laboratory technician "hands on" time but also the laboratory turnaround time is of interest. OBJECTIVES: We evaluated the performance of the VIASURE Flu A, B & RSV Real Time RT-PCR Detection Kit (CerTest Biotec) for detecting Influenza A and B viruses. STUDY DESIGN: During the 2016/17 influenza season 532...

  4. Selection of reference genes for quantitative RT-PCR (RT-qPCR) analysis of rat tissues under physiological and toxicological conditions

    DEFF Research Database (Denmark)

    Svingen, Terje; Letting, Heidi; Hadrup, Niels

    2015-01-01

    In biological research the analysis of gene expression levels in cells and tissues can be a powerful tool to gain insights into biological processes. For this, quantitative RT-PCR (RT-qPCR) is a popular method that often involve the use of constitutively expressed endogenous reference (or...... ‘housekeeping’) gene for normalization of data. Thus, it is essential to use reference genes that have been verified to be stably expressed within the specific experimental setting. Here, we have analysed the expression stability of 12 commonly used reference genes (Actb, B2m, Gapdh, Hprt, Pgk1, Rn18s, Rpl13a...

  5. Genome-Wide Identification and Evaluation of Reference Genes for Quantitative RT-PCR Analysis during Tomato Fruit Development.

    Science.gov (United States)

    Cheng, Yuan; Bian, Wuying; Pang, Xin; Yu, Jiahong; Ahammed, Golam J; Zhou, Guozhi; Wang, Rongqing; Ruan, Meiying; Li, Zhimiao; Ye, Qingjing; Yao, Zhuping; Yang, Yuejian; Wan, Hongjian

    2017-01-01

    Gene expression analysis in tomato fruit has drawn increasing attention nowadays. Quantitative real-time PCR (qPCR) is a routine technique for gene expression analysis. In qPCR operation, reliability of results largely depends on the choice of appropriate reference genes (RGs). Although tomato is a model for fruit biology study, few RGs for qPCR analysis in tomato fruit had yet been developed. In this study, we initially identified 38 most stably expressed genes based on tomato transcriptome data set, and their expression stabilities were further determined in a set of tomato fruit samples of four different fruit developmental stages (Immature, mature green, breaker, mature red) using qPCR analysis. Two statistical algorithms, geNorm and Normfinder, concordantly determined the superiority of these identified putative RGs. Notably, SlFRG05 (Solyc01g104170), SlFRG12 (Solyc04g009770), SlFRG16 (Solyc10g081190), SlFRG27 (Solyc06g007510), and SlFRG37 (Solyc11g005330) were proved to be suitable RGs for tomato fruit development study. Further analysis using geNorm indicate that the combined use of SlFRG03 (Solyc02g063070) and SlFRG27 would provide more reliable normalization results in qPCR experiments. The identified RGs in this study will be beneficial for future qPCR analysis of tomato fruit developmental study, as well as for the potential identification of optimal normalization controls in other plant species.

  6. Genome-Wide Identification and Evaluation of Reference Genes for Quantitative RT-PCR Analysis during Tomato Fruit Development

    Directory of Open Access Journals (Sweden)

    Yuan Cheng

    2017-08-01

    Full Text Available Gene expression analysis in tomato fruit has drawn increasing attention nowadays. Quantitative real-time PCR (qPCR is a routine technique for gene expression analysis. In qPCR operation, reliability of results largely depends on the choice of appropriate reference genes (RGs. Although tomato is a model for fruit biology study, few RGs for qPCR analysis in tomato fruit had yet been developed. In this study, we initially identified 38 most stably expressed genes based on tomato transcriptome data set, and their expression stabilities were further determined in a set of tomato fruit samples of four different fruit developmental stages (Immature, mature green, breaker, mature red using qPCR analysis. Two statistical algorithms, geNorm and Normfinder, concordantly determined the superiority of these identified putative RGs. Notably, SlFRG05 (Solyc01g104170, SlFRG12 (Solyc04g009770, SlFRG16 (Solyc10g081190, SlFRG27 (Solyc06g007510, and SlFRG37 (Solyc11g005330 were proved to be suitable RGs for tomato fruit development study. Further analysis using geNorm indicate that the combined use of SlFRG03 (Solyc02g063070 and SlFRG27 would provide more reliable normalization results in qPCR experiments. The identified RGs in this study will be beneficial for future qPCR analysis of tomato fruit developmental study, as well as for the potential identification of optimal normalization controls in other plant species.

  7. Evaluation of the suitability of six host genes as internal control in real-time RT-PCR assays in chicken embryo cell cultures infected with infectious bursal disease virus

    DEFF Research Database (Denmark)

    Li, Yiping; Bang, Dang Duong; Handberg, Kurt

    2005-01-01

    following a 7-day IBDV infection. The CE cells were inoculated with various multiplicity of infection (MOI) of IBDV vaccine strain Bursine-2, the expression of genes was measured by quantitative real-time PCR-based on cDNA synthesized from either normalized (100 ng) or non-normalized (10 mu l) total RNA...

  8. Development of tailored real-time RT-PCR assays for the detection and differentiation of serotype O, A and Asia-1 foot-and-mouth disease virus lineages circulating in the Middle East

    DEFF Research Database (Denmark)

    Reid, Scott M.; Mioulet, Valerie; Knowles, Nick J.

    2014-01-01

    transcription polymerase chain reaction (rRT-PCR) assays using primer/probe sets designed from the VP1 coding region of the virus genomes were developed for the specific detection of serotype O, A and Asia-1 FMD viruses (FMDVs) circulating in the Middle East. These assays were evaluated using representative...... by the generic rRT-PCR diagnostic assays but negative by virus isolation and antigen-detection ELISA which would otherwise have to be serotyped by nucleotide sequencing. A similar approach could be used to develop serotyping assays for FMDV strains circulating in other regions of the world....

  9. Selection and Verification of Candidate Reference Genes for Mature MicroRNA Expression by Quantitative RT-PCR in the Tea Plant (Camellia sinensis

    Directory of Open Access Journals (Sweden)

    Hui Song

    2016-05-01

    Full Text Available Quantitative reverse transcription-polymerase chain reaction (qRT-PCR is a rapid and sensitive method for analyzing microRNA (miRNA expression. However, accurate qRT-PCR results depend on the selection of reliable reference genes as internal positive controls. To date, few studies have identified reliable reference genes for differential expression analysis of miRNAs among tissues, and among experimental conditions in plants. In this study, three miRNAs and four non-coding small RNAs (ncRNA were selected as reference candidates, and the stability of their expression was evaluated among different tissues and under different experimental conditions in the tea plant (Camellia sinensis using the geNorm and NormFinder programs. It was shown that miR159a was the best single reference gene in the bud to the fifth leaf, 5S rRNA was the most suitable gene in different organs, miR6149 was the most stable gene when the leaves were attacked by Ectropis oblique and U4, miR5368n and miR159a were the best genes when the leaves were treated by methyl jasmonate (MeJA, salicylic acid (SA and abscisic acid (ABA, respectively. Our results provide suitable reference genes for future investigations on miRNA functions in tea plants.

  10. Accuracy of rapid influenza diagnostic test and immunofluorescence assay compared to real time RT-PCR in children with influenza A(H1N1pdm09 infection 

    Directory of Open Access Journals (Sweden)

    Aneta Nitsch-Osuch

    2012-10-01

    Full Text Available  Introduction:The influenza burden among children is underestimated. The aim of our study was to estimate the accuracy of the rapid influenza detection test (RIDT BD Directigen™ EZ Flu A B® and direct immunofluorescence assay (DFA used among children with influenza-like illness (ILI consulted in the ambulatory care clinic.Material/Methods:A total of 150 patients were enrolled in the study. Inclusion criteria were: age less than 59 months, presentation of ILI according to the CDC (Centers for Disease Control and Prevention definition (fever >37.8°C, cough and/or sore throat in the absence of another known cause of illness, duration of symptoms shorter than 96 hours. Two nasal swabs and one pharyngeal swab were obtained from patients and tested by RIDT, DFA and real time RT-PCR as the reference method.Results:For influenza A (H1N1pdm09 virus sensitivity of RIDT was 62.2�0(95�0CI 46.5–76.2� specificity 97.1�0(95�0CI 91.8–99.4� PPV 90.3�0(95�0CI 74.3–98� NPV 85.7�0(95�0CI 78.1–91.5� for DFA sensitivity was 60�0(95�0CI 51.9–63.2� specificity 96�0(95�0CI 88.7–98.8� PPV 93.1�0(95�0CI 80.5–98� NPV 72.7�0(95�0CI 67.2–74.9� Analysis of logistic regression revealed that the chance of receiving a true positive result of RIDT was twice as high when the test was conducted during the first 48 hours of symptoms (OR 0.40 vs OR 0.22.Conclusions:The accuracy of RIDT is comparable with DFA and both methods are very specific but moderately sensitive in diagnosis of influenza in young children. Both methods may be recommended for screening for influenza among children.

  11. Identification and evaluation of reliable reference genes for quantitative real-time PCR analysis in tea plant (Camellia sinensis (L.) O. Kuntze)

    Science.gov (United States)

    Quantitative real-time polymerase chain reaction (qRT-PCR) is a commonly used technique for measuring gene expression levels due to its simplicity, specificity, and sensitivity. Reliable reference selection for the accurate quantification of gene expression under various experimental conditions is a...

  12. Simultaneous detection of three pome fruit tree viruses by one-step multiplex quantitative RT-PCR.

    Science.gov (United States)

    Malandraki, Ioanna; Beris, Despoina; Isaioglou, Ioannis; Olmos, Antonio; Varveri, Christina; Vassilakos, Nikon

    2017-01-01

    A one-step multiplex real-time reverse transcription polymerase chain reaction (RT-qPCR) based on TaqMan probes was developed for the simultaneous detection of Apple mosaic virus (ApMV), Apple stem pitting virus (ASPV) and Apple stem grooving virus (ASGV) in total RNA of pome trees extracted with a CTAB method. The sensitivity of the method was established using in vitro synthesized viral transcripts serially diluted in RNA from healthy, virus-tested (negative) pome trees. The three viruses were simultaneously detected up to a 10-4 dilution of total RNA from a naturally triple-infected apple tree prepared in total RNA of healthy apple tissue. The newly developed RT-qPCR assay was at least one hundred times more sensitive than conventional single RT-PCRs. The assay was validated with 36 field samples for which nine triple and 11 double infections were detected. All viruses were detected simultaneously in composite samples at least up to the ratio of 1:150 triple-infected to healthy pear tissue, suggesting the assay has the capacity to examine rapidly a large number of samples in pome tree certification programs and surveys for virus presence.

  13. Reference gene selection for real-time quantitative PCR analysis of the mouse uterus in the peri-implantation period.

    Directory of Open Access Journals (Sweden)

    Pengfei Lin

    Full Text Available The study of uterine gene expression patterns is valuable for understanding the biological and molecular mechanisms that occur during embryo implantation. Real-time quantitative RT-PCR (qRT-PCR is an extremely sensitive technique that allows for the precise quantification of mRNA abundance; however, selecting stable reference genes suitable for the normalization of qRT-PCR data is required to avoid the misinterpretation of experimental results and erroneous analyses. This study employs several mouse models, including an early pregnancy, a pseudopregnancy, a delayed implantation and activation, an artificial decidualization and a hormonal treatment model; ten candidate reference genes (PPIA, RPLP0, HPRT1, GAPDH, ACTB, TBP, B2M, 18S, UBC and TUBA that are found in uterine tissues were assessed for their suitability as internal controls for relative qRT-PCR quantification. GeNorm(PLUS, NormFinder, and BestKeeper were used to evaluate these candidate reference genes, and all of these methods identified RPLP0 and GAPDH as the most stable candidates and B2M and 18S as the least stable candidates. However, when the different models were analyzed separately, the reference genes exhibited some variation in their expression levels.

  14. On-Orbit Quantitative Real-Time Gene Expression Analysis Using the Wetlab-2 System

    Science.gov (United States)

    Parra, Macarena; Jung, Jimmy; Almeida, Eduardo; Boone, Travis; Tran, Luan; Schonfeld, Julie

    2015-01-01

    NASA Ames Research Center's WetLab-2 Project enables on-orbit quantitative Reverse Transcriptase PCR (qRT-PCR) analysis without the need for sample return. The WetLab-2 system is capable of processing sample types ranging from microbial cultures to animal tissues dissected on-orbit. The project developed a RNA preparation module that can lyse cells and extract RNA of sufficient quality and quantity for use as templates in qRT-PCR reactions. Our protocol has the advantage of using non-toxic chemicals and does not require alcohols or other organics. The resulting RNA is dispensed into reaction tubes that contain all lyophilized reagents needed to perform qRT-PCR reactions. System operations require simple and limited crew actions including syringe pushes, valve turns and pipette dispenses. The project selected the Cepheid SmartCycler (TradeMark), a Commercial-Off-The-Shelf (COTS) qRT-PCR unit, because of its advantages including rugged modular design, low power consumption, rapid thermal ramp times and four-color multiplex detection. Single tube multiplex assays can be used to normalize for RNA concentration and integrity, and to study multiple genes of interest in each module. The WetLab-2 system can downlink data from the ISS to the ground after a completed run and uplink new thermal cycling programs. The ability to conduct qRT-PCR and generate results on-orbit is an important step towards utilizing the ISS as a National Laboratory facility. Specifically, the ability to get on-orbit data will provide investigators with the opportunity to adjust experimental parameters in real time without the need for sample return and re-flight. On orbit gene expression analysis can also eliminate the confounding effects on gene expression of reentry stresses and shock acting on live cells and organisms or the concern of RNA degradation of fixed samples and provide on-orbit gene expression benchmarking prior to sample return. Finally, the system can also be used for analysis of

  15. Relative quantification of PIK3CA gene expression level in fine-needle aspiration biopsy thyroid specimens collected from patients with papillary thyroid carcinoma and non-toxic goitre by real-time RT-PCR

    Directory of Open Access Journals (Sweden)

    Wojciechowska-Durczyńska Katarzyna

    2010-08-01

    Full Text Available Abstract Background Recent studies have shown that the phosphatidylinositol 3-kinase (PI3K signaling pathway is important regulator of many cellular events, including apoptosis, proliferation and motility. PI3K pathway alterations (PIK3CA gene mutations and/or amplification have been observed in various human tumours. In the majority of diagnosed cases, mutations are localized in one of the three "hot spots" in the gene, responsible for coding catalytic subunit α of class I PI3K (PIK3CA. Mutations and amplification of PIK3CA gene are characteristic for thyroid cancer, as well. Methods The aim of our study was to examine a gene expression level of PIK3CA in fine-needle aspiration biopsy (FNAB thyroid specimens in two types of thyroid lesions, papillary thyroid carcinoma (PTC and non-toxic goitre (NTG. Following conventional cytological examination, 42 thyroid FNAB specimens, received from patients with PTC (n = 20 and NTG (n = 22, were quantitatively evaluated regarding PIK3CA expression level by real-time PCR in the ABI PRISM® 7500 Sequence Detection System. Results Significantly higher expression level (RQ of PIK3CA in PTC group has been noted in comparison with NTG group (p Conclusion These observations may suggest role of PIK3CA alterations in PTC carcinogenesis.

  16. Evaluation of Housekeeping Genes for Quantitative Real-Time PCR Analysis of Bradysia odoriphaga (Diptera: Sciaridae

    Directory of Open Access Journals (Sweden)

    Caihua Shi

    2016-07-01

    Full Text Available The soil insect Bradysia odoriphaga (Diptera: Sciaridae causes substantial damage to Chinese chive. Suitable reference genes in B. odoriphaga (Bradysia odoriphaga have yet to be identified for normalizing target gene expression among samples by quantitative real-time PCR (qRT-PCR. This study was focused on identifying the expression stability of 12 candidate housekeeping genes in B. odoriphaga under various experiment conditions. The final stability ranking of 12 housekeeping genes was obtained with RefFinder, and the most suitable number of reference genes was analyzed by GeNorm. The results revealed that the most appropriate sets of internal controls were RPS15, RPL18, and RPS18 across developmental phases; RPS15, RPL28, and GAPDH across temperatures; RPS15 and RPL18 across pesticide treatments; RSP5, RPS18, and SDHA across photoperiods; ACTb, RPS18, and RPS15 across diets; RPS13 and RPL28 across populations; and RPS15, ACTb, and RPS18 across all samples. The use of the most suitable reference genes versus an arbitrarily selected reference gene resulted in significant differences in the analysis of a target gene expression. HSP23 in B. odoriphaga was found to be up-regulated under low temperatures. These results will contribute to the standardization of qRT-PCR and will also be valuable for further research on gene function in B. odoriphaga.

  17. Selection of Suitable Reference Genes for Quantitative Real-time PCR in Sapium sebiferum

    Directory of Open Access Journals (Sweden)

    Xue Chen

    2017-05-01

    Full Text Available Chinese tallow (Sapium sebiferum L. is a promising landscape and bioenergy plant. Measuring gene expression by quantitative real-time polymerase chain reaction (qRT-PCR can provide valuable information on gene function. Stably expressed reference genes for normalization are a prerequisite for ensuring the accuracy of the target gene expression level among different samples. However, the reference genes in Chinese tallow have not been systematically validated. In this study, 12 candidate reference genes (18S, GAPDH, UBQ, RPS15, SAND, TIP41, 60S, ACT7, PDF2, APT, TBP, and TUB were investigated with qRT-PCR in 18 samples, including those from different tissues, from plants treated with sucrose and cold stresses. The data were calculated with four common algorithms, geNorm, BestKeeper, NormFinder, and the delta cycle threshold (ΔCt. TIP41 and GAPDH were the most stable for the tissue-specific experiment, GAPDH and 60S for cold treatment, and GAPDH and UBQ for sucrose stresses, while the least stable genes were 60S, TIP41, and 18S respectively. The comprehensive results showed APT, GAPDH, and UBQ to be the top-ranked stable genes across all the samples. The stability of 60S was the lowest during all experiments. These selected reference genes were further validated by comparing the expression profiles of the chalcone synthase gene in Chinese tallow in different samples. The results will help to improve the accuracy of gene expression studies in Chinese tallow.

  18. Identification of circulating miRNA biomarkers based on global quantitative real-time PCR profiling

    Directory of Open Access Journals (Sweden)

    Kang Kang

    2012-02-01

    Full Text Available Abstract MicroRNAs (miRNAs are small noncoding RNAs (18-25 nucleotides that regulate gene expression at the post-transcriptional level. Recent studies have demonstrated the presence of miRNAs in the blood circulation. Deregulation of miRNAs in serum or plasma has been associated with many diseases including cancers and cardiovascular diseases, suggesting the possible use of miRNAs as diagnostic biomarkers. However, the detection of the small amount of miRNAs found in serum or plasma requires a method with high sensitivity and accuracy. Therefore, the current study describes polymerase chain reaction (PCR-based methods for measuring circulating miRNAs. Briefly, the procedure involves four major steps: (1 sample collection and preparation; (2 global miRNAs profiling using quantitative real-time PCR (qRT-PCR; (3 data normalization and analysis; and (4 selection and validation of miRNA biomarkers. In conclusion, qRT-PCR is a promising method for profiling of circulating miRNAs as biomarkers.

  19. Exploring Valid Reference Genes for Quantitative Real-time PCR Analysis in Plutella xylostella (Lepidoptera: Plutellidae)

    Science.gov (United States)

    Fu, Wei; Xie, Wen; Zhang, Zhuo; Wang, Shaoli; Wu, Qingjun; Liu, Yong; Zhou, Xiaomao; Zhou, Xuguo; Zhang, Youjun

    2013-01-01

    Abstract: Quantitative real-time PCR (qRT-PCR), a primary tool in gene expression analysis, requires an appropriate normalization strategy to control for variation among samples. The best option is to compare the mRNA level of a target gene with that of reference gene(s) whose expression level is stable across various experimental conditions. In this study, expression profiles of eight candidate reference genes from the diamondback moth, Plutella xylostella, were evaluated under diverse experimental conditions. RefFinder, a web-based analysis tool, integrates four major computational programs including geNorm, Normfinder, BestKeeper, and the comparative ΔCt method to comprehensively rank the tested candidate genes. Elongation factor 1 (EF1) was the most suited reference gene for the biotic factors (development stage, tissue, and strain). In contrast, although appropriate reference gene(s) do exist for several abiotic factors (temperature, photoperiod, insecticide, and mechanical injury), we were not able to identify a single universal reference gene. Nevertheless, a suite of candidate reference genes were specifically recommended for selected experimental conditions. Our finding is the first step toward establishing a standardized qRT-PCR analysis of this agriculturally important insect pest. PMID:23983612

  20. Evaluation of changes in periodontal bacteria in healthy dogs over 6 months using quantitative real-time PCR.

    Science.gov (United States)

    Maruyama, N; Mori, A; Shono, S; Oda, H; Sako, T

    2018-03-01

    Porphyromonas gulae, Tannerella forsythia and Campylobacter rectus are considered dominant periodontal pathogens in dogs. Recently, quantitative real-time PCR (qRT-PCR) methods have been used for absolute quantitative determination of oral bacterial counts. The purpose of the present study was to establish a standardized qRT-PCR procedure to quantify bacterial counts of the three target periodontal bacteria (P. gulae, T. forsythia and C. rectus). Copy numbers of the three target periodontal bacteria were evaluated in 26 healthy dogs. Then, changes in bacterial counts of the three target periodontal bacteria were evaluated for 24 weeks in 7 healthy dogs after periodontal scaling. Analytical evaluation of each self-designed primer indicated acceptable analytical imprecision. All 26 healthy dogs were found to be positive for P. gulae, T. forsythia and C. rectus. Median total bacterial counts (copies/ng) of each target genes were 385.612 for P. gulae, 25.109 for T. forsythia and 5.771 for C. rectus. Significant differences were observed between the copy numbers of the three target periodontal bacteria. Periodontal scaling reduced median copy numbers of the three target periodontal bacteria in 7 healthy dogs. However, after periodontal scaling, copy numbers of all three periodontal bacteria significantly increased over time (pperiodontal bacteria in dogs. Furthermore, the present study has revealed that qRT-PCR method can be considered as a new objective evaluation system for canine periodontal disease. Copyright© by the Polish Academy of Sciences.

  1. Identification and validation of reference genes for quantitative real-time PCR in Drosophila suzukii (Diptera: Drosophilidae.

    Directory of Open Access Journals (Sweden)

    Yifan Zhai

    Full Text Available To accurately evaluate gene expression levels and obtain more accurate quantitative real-time RT-PCR (qRT-PCR data, normalization relative to reliable reference gene(s is required. Drosophila suzukii, is an invasive fruit pest native to East Asia, and recently invaded Europe and North America, the stability of its reference genes have not been previously investigated. In this study, ten candidate reference genes (RPL18, RPS3, AK, EF-1β, TBP, NADH, HSP22, GAPDH, Actin, α-Tubulin, were evaluated for their suitability as normalization genes under different biotic (developmental stage, tissue and population, and abiotic (photoperiod, temperature conditions. The three statistical approaches (geNorm, NormFinder and BestKeeper and one web-based comprehensive tool (RefFinder were used to normalize analysis of the ten candidate reference genes identified α-Tubulin, TBP and AK as the most stable candidates, while HSP22 and Actin showed the lowest expression stability. We used three most stable genes (α-Tubulin, TBP and AK and one unstably expressed gene to analyze the expression of P-glycoprotein in abamectin-resistant and sensitive strains, and the results were similar to reference genes α-Tubulin, TBP and AK, which show good stability, while the result of HSP22 has a certain bias. The three validated reference genes can be widely used for quantification of target gene expression with qRT-PCR technology in D.suzukii.

  2. Quantitative Real-time Polymerase Chain Reaction for Enteropathogenic Escherichia coli: A Tool for Investigation of Asymptomatic Versus Symptomatic Infections

    Science.gov (United States)

    Barletta, Francesca; Mercado, Erik; Ruiz, Joaquim; Ecker, Lucie; Lopez, Giovanni; Mispireta, Monica; Gil, Ana I.; Lanata, Claudio F.; Cleary, Thomas G.

    2011-01-01

    Background. Enteropathogenic Escherichia coli (EPEC) strains are pediatric pathogens commonly isolated from both healthy and sick children with diarrhea in areas of endemicity. The aim of this study was to compare the bacterial load of EPEC isolated from stool samples from children with and without diarrhea to determine whether bacterial load might be a useful tool for further study of this phenomenon. Methods. EPEC was detected by polymerase chain reaction (PCR) of colonies isolated on MacConkey plates from 53 diarrheal and 90 healthy children aged <2 years. DNA was isolated from stool samples by cetyltrimethylammonium bromide extraction. To standardize quantification by quantitative real-time PCR (qRT-PCR), the correlation between fluorescence threshold cycle and copy number of the intimin gene of EPEC E2348/69 was determined. Results. The detection limit of qRT-PCR was 5 bacteria/mg stool. The geometric mean load in diarrhea was 299 bacteria/mg (95% confidence interval [CI], 77–1164 bacteria/mg), compared with 29 bacteria/mg (95% CI, 10–87 bacteria/mg) in control subjects (P = .016). Bacterial load was significantly higher in children with diarrhea than in control subjects among children <12 months of age (178 vs 5 bacteria/mg; P = .006) and among children with EPEC as the sole pathogen (463 vs 24 bacteria/mg; P = .006). Conclusions. EPEC load measured by qRT-PCR is higher in diarrheal than in healthy children. qRT-PCR may be useful to study the relationship between disease and colonization in settings of endemicity. PMID:22028433

  3. Development and evaluation of a real-time RT-PCR assay for the detection of Ebola virus (Zaire) during an Ebola outbreak in Guinea in 2014-2015.

    Science.gov (United States)

    Dedkov, V G; Magassouba, N' F; Safonova, M V; Deviatkin, A A; Dolgova, A S; Pyankov, O V; Sergeev, A A; Utkin, D V; Odinokov, G N; Safronov, V A; Agafonov, A P; Maleev, V V; Shipulin, G A

    2016-02-01

    In early February 2014, an outbreak of the Ebola virus disease caused by Zaire ebolavirus (EBOV) occurred in Guinea; cases were also recorded in other West African countries with a combined population of approximately 25 million. A rapid, sensitive and inexpensive method for detecting EBOV is needed to effectively control such outbreak. Here, we report a real-time reverse-transcription PCR assay for Z. ebolavirus detection used by the Specialized Anti-epidemic Team of the Russian Federation during the Ebola virus disease prevention mission in the Republic of Guinea. The analytical sensitivity of the assay is 5 × 10(2) viral particles per ml, and high specificity is demonstrated using representative sampling of viral, bacterial and human nucleic acids. This assay can be applied successfully for detecting the West African strains of Z. ebolavirus as well as on strains isolated in the Democratic Republic of the Congo in 2014. Copyright © 2015 Elsevier B.V. All rights reserved.

  4. Detection of 22 common leukemic fusion genes using a single-step multiplex qRT-PCR-based assay.

    Science.gov (United States)

    Lyu, Xiaodong; Wang, Xianwei; Zhang, Lina; Chen, Zhenzhu; Zhao, Yu; Hu, Jieying; Fan, Ruihua; Song, Yongping

    2017-07-25

    Fusion genes generated from chromosomal translocation play an important role in hematological malignancies. Detection of fusion genes currently employ use of either conventional RT-PCR methods or fluorescent in situ hybridization (FISH), where both methods involve tedious methodologies and require prior characterization of chromosomal translocation events as determined by cytogenetic analysis. In this study, we describe a real-time quantitative reverse transcription PCR (qRT-PCR)-based multi-fusion gene screening method with the capacity to detect 22 fusion genes commonly found in leukemia. This method does not require pre-characterization of gene translocation events, thereby facilitating immediate diagnosis and therapeutic management. We performed fluorescent qRT-PCR (F-qRT-PCR) using a commercially-available multi-fusion gene detection kit on a patient cohort of 345 individuals comprising 108 cases diagnosed with acute myeloid leukemia (AML) for initial evaluation; remaining patients within the cohort were assayed for confirmatory diagnosis. Results obtained by F-qRT-PCR were compared alongside patient analysis by cytogenetic characterization. Gene translocations detected by F-qRT-PCR in AML cases were diagnosed in 69.4% of the patient cohort, which was comparatively similar to 68.5% as diagnosed by cytogenetic analysis, thereby demonstrating 99.1% concordance. Overall gene fusion was detected in 53.7% of the overall patient population by F-qRT-PCR, 52.9% by cytogenetic prediction in leukemia, and 9.1% in non-leukemia patients by both methods. The overall concordance rate was calculated to be 99.0%. Fusion genes were detected by F-qRT-PCR in 97.3% of patients with CML, followed by 69.4% with AML, 33.3% with acute lymphoblastic leukemia (ALL), 9.1% with myelodysplastic syndromes (MDS), and 0% with chronic lymphocytic leukemia (CLL). We describe the use of a F-qRT-PCR-based multi-fusion gene screening method as an efficient one-step diagnostic procedure as an

  5. Exploring valid reference genes for quantitative real-time PCR analysis in Sesamia inferens (Lepidoptera: Noctuidae.

    Directory of Open Access Journals (Sweden)

    Meng Sun

    Full Text Available The pink stem borer, Sesamia inferens, which is endemic in China and other parts of Asia, is a major pest of rice and causes significant yield loss in this host plant. Very few studies have addressed gene expression in S. inferens. Quantitative real-time PCR (qRT-PCR is currently the most accurate and sensitive method for gene expression analysis. In qRT-PCR, data are normalized using reference genes, which help control for internal differences and reduce error between samples. In this study, seven candidate reference genes, 18S ribosomal RNA (18S rRNA, elongation factor 1 (EF1, glyceraldehyde-3-phosphate dehydrogenase (GAPDH, ribosomal protein S13 (RPS13, ribosomal protein S20 (RPS20, tubulin (TUB, and β-actin (ACTB were evaluated for their suitability in normalizing gene expression under different experimental conditions. The results indicated that three genes (RPS13, RPS20, and EF1 were optimal for normalizing gene expression in different insect tissues (head, epidermis, fat body, foregut, midgut, hindgut, Malpighian tubules, haemocytes, and salivary glands. 18S rRNA, EF1, and GAPDH were best for normalizing expression with respect to developmental stages and sex (egg masses; first, second, third, fourth, fifth, and sixth instar larvae; male and female pupae; and one-day-old male and female adults. 18S rRNA, RPS20, and TUB were optimal for fifth instars exposed to different temperatures (-8, -6, -4, -2, 0, and 27°C. To validate this recommendation, the expression profile of a target gene heat shock protein 83 gene (hsp83 was investigated, and results showed the selection was necessary and effective. In conclusion, this study describes reference gene sets that can be used to accurately measure gene expression in S. inferens.

  6. Exploring valid reference genes for quantitative real-time PCR analysis in Sesamia inferens (Lepidoptera: Noctuidae).

    Science.gov (United States)

    Sun, Meng; Lu, Ming-Xing; Tang, Xiao-Tian; Du, Yu-Zhou

    2015-01-01

    The pink stem borer, Sesamia inferens, which is endemic in China and other parts of Asia, is a major pest of rice and causes significant yield loss in this host plant. Very few studies have addressed gene expression in S. inferens. Quantitative real-time PCR (qRT-PCR) is currently the most accurate and sensitive method for gene expression analysis. In qRT-PCR, data are normalized using reference genes, which help control for internal differences and reduce error between samples. In this study, seven candidate reference genes, 18S ribosomal RNA (18S rRNA), elongation factor 1 (EF1), glyceraldehyde-3-phosphate dehydrogenase (GAPDH), ribosomal protein S13 (RPS13), ribosomal protein S20 (RPS20), tubulin (TUB), and β-actin (ACTB) were evaluated for their suitability in normalizing gene expression under different experimental conditions. The results indicated that three genes (RPS13, RPS20, and EF1) were optimal for normalizing gene expression in different insect tissues (head, epidermis, fat body, foregut, midgut, hindgut, Malpighian tubules, haemocytes, and salivary glands). 18S rRNA, EF1, and GAPDH were best for normalizing expression with respect to developmental stages and sex (egg masses; first, second, third, fourth, fifth, and sixth instar larvae; male and female pupae; and one-day-old male and female adults). 18S rRNA, RPS20, and TUB were optimal for fifth instars exposed to different temperatures (-8, -6, -4, -2, 0, and 27°C). To validate this recommendation, the expression profile of a target gene heat shock protein 83 gene (hsp83) was investigated, and results showed the selection was necessary and effective. In conclusion, this study describes reference gene sets that can be used to accurately measure gene expression in S. inferens.

  7. Diagnosis of aerobic vaginitis by quantitative real-time PCR

    OpenAIRE

    Rumyantseva, T. A.; Bellen, G.; Savochkina, Y. A.; Guschin, A. E.; Donders, G.G.G.

    2016-01-01

    Abstract: Purpose To evaluate a real-time PCR-based technique to quantify bacteria associated with aerobic vaginitis (AV) as a potential test. Methods Vaginal samples from 100 women were tested by wet-mount microscopy, gram stain and quantitative real-time PCR targeting Enterobacteriacea, Staphylococcus spp., Streptococcus spp., Enterococcus spp., Escherichia coli, Streptococcus agalactiae, S. aureus; Lactobacillus spp. AV diagnosis obtained by wet-mount microscopy was used as reference. Resu...

  8. Development of single step RT-PCR for detection of Kyasanur forest disease virus from clinical samples

    Directory of Open Access Journals (Sweden)

    Gouri Chaubal

    2018-02-01

    Discussion and conclusion: The previously published sensitive real time RT-PCR assay requires higher cost in terms of reagents and machine setup and technical expertise has been the primary reason for development of this assay. A single step RT-PCR is relatively easy to perform and more cost effective than real time RT-PCR in smaller setups in the absence of Biosafety Level-3 facility. This study reports the development and optimization of single step RT-PCR assay which is more sensitive and less time-consuming than nested RT-PCR and cost effective for rapid diagnosis of KFD viral RNA.

  9. Detection of infectious bronchitis virus with the use of real-time quantitative reverse transcriptase-PCR and correlation with virus detection in embryonated eggs.

    Science.gov (United States)

    Roh, Ha-Jung; Hilt, Deborah A; Jackwood, Mark W

    2014-09-01

    Real-time quantitative reverse transcriptase-polymerase chain reaction (qRT-PCR) assays have been used to detect the presence of challenge virus when the efficacy of infectious bronchitis virus (IBV) vaccine against field viruses is being experimentally evaluated. However, federal guidelines for licensing IBV vaccines indicate that challenge-virus detection following vaccination is to be conducted in embryonated eggs. In this study, we examined qRT-PCR data with the use of universal and type-specific primers and probe sets for IBV detection and compared those data with challenge-virus detection in embryonated eggs to determine if the two methods of evaluating vaccine efficacy are comparable. In addition, we tested the qRT-PCR assays on thermocyclers from two different manufacturers. We found the universal IBV primers and probe set to be comparable to challenge-virus detection in embryonated eggs. However, for some IBV types (Mass41 and Conn on the SmartCycler II and Ark, Mass41, Conn, and GA98 on the ABI 7500) the qRT-PCR assay was more sensitive than virus detection in embryonated eggs. This may simply be due to the universal IBV qRT-PCR assay being more sensitive than virus detection in eggs or to the assay detecting nucleic acid from nonviable virus. This finding is important and needs to be considered when evaluating challenge-virus detection for vaccination and challenge studies, because qRT-PCR could potentially identify positive birds that would otherwise be negative by virus detection in embryonated eggs; thus it could lead to a more stringent measure of vaccine efficacy. We also found that the IBV type-specific primers and probe sets designed in this study were in general less sensitive than the universal IBV primers and probe set. Only the Ark-DPI-spedcific assay on the SmartCycler II and the Ark-DPI-, Mass41-, and DE072/GA98- (for detection of GA98 virus only) specific assays on the ABI 7500 were comparable in sensitivity to virus detection in eggs. We

  10. Selection and validation of a set of reliable reference genes for quantitative RT-PCR studies in the brain of the Cephalopod Mollusc Octopus vulgaris

    Directory of Open Access Journals (Sweden)

    Biffali Elio

    2009-07-01

    Full Text Available Abstract Background Quantitative real-time polymerase chain reaction (RT-qPCR is valuable for studying the molecular events underlying physiological and behavioral phenomena. Normalization of real-time PCR data is critical for a reliable mRNA quantification. Here we identify reference genes to be utilized in RT-qPCR experiments to normalize and monitor the expression of target genes in the brain of the cephalopod mollusc Octopus vulgaris, an invertebrate. Such an approach is novel for this taxon and of advantage in future experiments given the complexity of the behavioral repertoire of this species when compared with its relatively simple neural organization. Results We chose 16S, and 18S rRNA, actB, EEF1A, tubA and ubi as candidate reference genes (housekeeping genes, HKG. The expression of 16S and 18S was highly variable and did not meet the requirements of candidate HKG. The expression of the other genes was almost stable and uniform among samples. We analyzed the expression of HKG into two different set of animals using tissues taken from the central nervous system (brain parts and mantle (here considered as control tissue by BestKeeper, geNorm and NormFinder. We found that HKG expressions differed considerably with respect to brain area and octopus samples in an HKG-specific manner. However, when the mantle is treated as control tissue and the entire central nervous system is considered, NormFinder revealed tubA and ubi as the most suitable HKG pair. These two genes were utilized to evaluate the relative expression of the genes FoxP, creb, dat and TH in O. vulgaris. Conclusion We analyzed the expression profiles of some genes here identified for O. vulgaris by applying RT-qPCR analysis for the first time in cephalopods. We validated candidate reference genes and found the expression of ubi and tubA to be the most appropriate to evaluate the expression of target genes in the brain of different octopuses. Our results also underline the

  11. Human fecal source identification with real-time quantitative PCR

    Science.gov (United States)

    Waterborne diseases represent a significant public health risk worldwide, and can originate from contact with water contaminated with human fecal material. We describe a real-time quantitative PCR (qPCR) method that targets a Bacteroides dori human-associated genetic marker for...

  12. Evaluation of Energy Balance on Human Telomerase Reverse Transcriptase (hTERT) Alternative Splicing by Semi-quantitative RT-PCR in Human Umbilical Vein Endothelial Cells.

    Science.gov (United States)

    Behjati, Mohaddeseh; Hashemi, Mohammad; Kazemi, Mohammad; Salehi, Mansoor; Javanmard, Shaghayegh Haghjooy

    2017-01-01

    Decreased high-energy phosphate level is involved in endothelial cell injury and dysfunction. Reduced telomerase activity in endothelial cells in parallel with reduced energy levels might be due to altered direction of alternative splicing machine as a complication of depleted energy during the process of atherosclerosis. Isolated human umbilical vein endothelial cells (HUVECs) were treated for 24 hours by oligomycine (OM) and 2-deoxy glucose (2-DG). After 24 hours, the effect of energy depletion on telomerase splicing pattern was evaluated using RT-PCR. Indeed, in both treated and untargeted cells, nitric oxide (NO) and von Willebrand factor (vWF) were measured. ATP was depleted in treated cells by 43.9% compared with control group. We observed a slight decrease in NO levels ( P = 0.09) and vWF ( P = 0.395) in the setting of 49.36% ATP depletion. In both groups, no telomerase gene expression was seen. Telomerase and housekeeping gene expression were found in positive control group (colon cancer tissue) and sample tissue. The absence of telomerase gene expression in HUVECs might be due to the mortality of these cells or the low level of telomerase gene expression in these cells under normal circumstances.

  13. WetLab-2: Tools for Conducting On-Orbit Quantitative Real-Time Gene Expression Analysis on ISS

    Science.gov (United States)

    Parra, Macarena; Almeida, Eduardo; Boone, Travis; Jung, Jimmy; Schonfeld, Julie

    2014-01-01

    The objective of NASA Ames Research Centers WetLab-2 Project is to place on the ISS a research platform capable of conducting gene expression analysis via quantitative real-time PCR (qRT-PCR) of biological specimens sampled or cultured on orbit. The project has selected a Commercial-Off-The-Shelf (COTS) qRT-PCR system, the Cepheid SmartCycler and will fly it in its COTS configuration. The SmartCycler has a number of advantages including modular design (16 independent PCR modules), low power consumption, rapid ramp times and the ability to detect up to four separate fluorescent channels at one time enabling multiplex assays that can be used for normalization and to study multiple genes of interest in each module. The team is currently working with Cepheid to enable the downlink of data from the ISS to the ground and provide uplink capabilities for programming, commanding, monitoring, and instrument maintenance. The project has adapted commercial technology to design a module that can lyse cells and extract RNA of sufficient quality and quantity for use in qRT-PCR reactions while using a housekeeping gene to normalize RNA concentration and integrity. The WetLab-2 system is capable of processing multiple sample types ranging from microbial cultures to animal tissues dissected on-orbit. The ability to conduct qRT-PCR on-orbit eliminates the confounding effects on gene expression of reentry stresses and shock acting on live cells and organisms or the concern of RNA degradation of fixed samples. The system can be used to validate terrestrial analyses of samples returned from ISS by providing on-orbit gene expression benchmarking prior to sample return. The ability to get on orbit data will provide investigators with the opportunity to adjust experiment parameters for subsequent trials based on the real-time data analysis without need for sample return and re-flight. Researchers will also be able to sample multigenerational changes in organisms. Finally, the system can be

  14. A quantitative real time polymerase chain reaction approach for estimating processed animal proteins in feed: preliminary data

    Directory of Open Access Journals (Sweden)

    Maria Cesarina Abete

    2013-04-01

    Full Text Available Lifting of the ban on the use of processed animal proteins (PAPs from non-ruminants in non-ruminant feed is in the wind, avoiding intraspecies recycling. Discrimination of species will be performed through polymerase chain reaction (PCR, which is at a moment a merely qualitative method. Nevertheless, quantification of PAPs in feed is needed. The aim of this study was to approach the quantitative determination of PAPs in feed through Real Time (RT-PCR technique; three different protocols picked up from the literature were tested. Three different kind of matrices were examined: pure animal meals (bovine, chicken and pork; one feed sample certified by the European reference laboratory on animal proteins (EURL AP in feed spiked with 0.1% bovine meal; and genomic DNAs from bovine, chicken and pork muscles. The limit of detection (LOD of the three protocols was set up. All the results obtained from the three protocols considered failed in the quantification process, most likely due to the uncertain copy numbers of the analytical targets chosen. This preliminary study will allow us to address further investigations, with the purpose of developing a RT-PCR quantitative method.

  15. When can real-time quantitative RT-PCR effectively define molecular relapse in acute promyelocytic leukemia patients? (Results of the French Belgian Swiss APL Group).

    Science.gov (United States)

    Cassinat, Bruno; de Botton, Stéphane; Kelaidi, Charikleia; Ades, Lionel; Zassadowski, Fabien; Guillemot, Isabelle; Schlageter, Marie-Helene; Raffoux, Emmanuel; Harousseau, Jean-Luc; Legrand, Olivier; Escoffre-Barbe, Martine; Reman, Oumedaly; Gardembas, Martine; Himberlin, Chantal; Cahn, Jean Yves; Guyotat, Denis; Bouscary, Didier; Parry, Anne; Rousselot, Philippe; Baruchel, Andre; Dombret, Hervé; Chevret, Sylvie; Fenaux, Pierre; Chomienne, Christine

    2009-09-01

    10-20% of APL patients relapse and the challenge remains to early identify these patients to improve survival rate. We report PML-RARalpha transcript detection by RQ-PCR in 260 consecutive APL patients (n = 970 samples). 223 patients with samples of sufficient RNA quality to demonstrate they reached molecular remission were monitored for MRD. During follow-up, 38 of these patients were tested positive for PML-RARalpha mRNA. 13 out of the 38 patients (34%) effectively developed hematological relapse. In the first positive sample, specific PML-RARalpha NCN thresholds over which, or under which, patients could effectively be predicted to relapse or not, were identified and subsequently validated in a second cohort.

  16. Relationship Between Ebola Virus Real-Time Quantitative Polymerase Chain Reaction-Based Threshold Cycle Value and Virus Isolation From Human Plasma.

    Science.gov (United States)

    Spengler, Jessica R; McElroy, Anita K; Harmon, Jessica R; Ströher, Ute; Nichol, Stuart T; Spiropoulou, Christina F

    2015-10-01

    We performed a longitudinal analysis of plasma samples obtained from 4 patients with Ebola virus (EBOV) disease (EVD) to determine the relationship between the real-time quantitative reverse transcriptase polymerase chain reaction (qRT-PCR)-based threshold cycle (Ct) value and the presence of infectious EBOV. EBOV was not isolated from plasma samples with a Ct value of >35.5 or >12 days after onset of symptoms. EBOV was not isolated from plasma samples in which anti-EBOV nucleoprotein immunoglobulin G was detected. These data demonstrate the utility of interpreting qRT-PCR results in the context of the course of EBOV infection and associated serological responses for patient-management decisions. Published by Oxford University Press on behalf of the Infectious Diseases Society of America 2015. This work is written by (a) US Government employee(s) and is in the public domain in the US.

  17. Selecting and validating reference genes for quantitative real-time PCR in Plutella xylostella (L.).

    Science.gov (United States)

    You, Yanchun; Xie, Miao; Vasseur, Liette; You, Minsheng

    2018-05-01

    Gene expression analysis provides important clues regarding gene functions, and quantitative real-time PCR (qRT-PCR) is a widely used method in gene expression studies. Reference genes are essential for normalizing and accurately assessing gene expression. In the present study, 16 candidate reference genes (ACTB, CyPA, EF1-α, GAPDH, HSP90, NDPk, RPL13a, RPL18, RPL19, RPL32, RPL4, RPL8, RPS13, RPS4, α-TUB, and β-TUB) from Plutella xylostella were selected to evaluate gene expression stability across different experimental conditions using five statistical algorithms (geNorm, NormFinder, Delta Ct, BestKeeper, and RefFinder). The results suggest that different reference genes or combinations of reference genes are suitable for normalization in gene expression studies of P. xylostella according to the different developmental stages, strains, tissues, and insecticide treatments. Based on the given experimental sets, the most stable reference genes were RPS4 across different developmental stages, RPL8 across different strains and tissues, and EF1-α across different insecticide treatments. A comprehensive and systematic assessment of potential reference genes for gene expression normalization is essential for post-genomic functional research in P. xylostella, a notorious pest with worldwide distribution and a high capacity to adapt and develop resistance to insecticides.

  18. Performance of a RT-PCR Assay in Comparison to FISH and Immunohistochemistry for the Detection of ALK in Non-Small Cell Lung Cancer.

    Science.gov (United States)

    Hout, David R; Schweitzer, Brock L; Lawrence, Kasey; Morris, Stephan W; Tucker, Tracy; Mazzola, Rosetta; Skelton, Rachel; McMahon, Frank; Handshoe, John; Lesperance, Mary; Karsan, Aly; Saltman, David L

    2017-08-01

    Patients with lung cancers harboring an activating anaplastic lymphoma kinase ( ALK ) rearrangement respond favorably to ALK inhibitor therapy. Fluorescence in situ hybridization (FISH) and immunohistochemistry (IHC) are validated and widely used screening tests for ALK rearrangements but both methods have limitations. The ALK RGQ RT-PCR Kit (RT-PCR) is a single tube quantitative real-time PCR assay for high throughput and automated interpretation of ALK expression. In this study, we performed a direct comparison of formalin-fixed paraffin-embedded (FFPE) lung cancer specimens using all three ALK detection methods. The RT-PCR test (diagnostic cut-off Δ C t of ≤8) was shown to be highly sensitive (100%) when compared to FISH and IHC. Sequencing of RNA detected full-length ALK transcripts or EML4-ALK and KIF5B-ALK fusion variants in discordant cases in which ALK expression was detected by the ALK RT-PCR test but negative by FISH and IHC. The overall specificity of the RT-PCR test for the detection of ALK in cases without full-length ALK expression was 94% in comparison to FISH and sequencing. These data support the ALK RT-PCR test as a highly efficient and reliable diagnostic screening approach to identify patients with non-small cell lung cancer whose tumors are driven by oncogenic ALK.

  19. Validation of reference genes for quantitative real-time PCR in Périgord black truffle (Tuber melanosporum) developmental stages.

    Science.gov (United States)

    Zarivi, Osvaldo; Cesare, Patrizia; Ragnelli, Anna Maria; Aimola, Pierpaolo; Leonardi, Marco; Bonfigli, Antonella; Colafarina, Sabrina; Poma, Anna Maria; Miranda, Michele; Pacioni, Giovanni

    2015-08-01

    The symbiotic fungus Tuber melanosporum Vittad. (Périgord black truffle) belongs to the Ascomycota and forms mutualistic symbiosis with tree and shrub roots. This truffle has a high value in a global market and is cultivated in many countries of both hemispheres. The publication of the T. melanosporum genome has given researchers unique opportunities to learn more about the biology of the fungus. Real-time quantitative PCR (qRT-PCR) is a definitive technique for quantitating differences in transcriptional gene expression levels between samples. To facilitate gene expression studies and obtain more accurate qRT-PCR data, normalization relative to stable housekeeping genes is required. These housekeeping genes must show stable expression under given experimental conditions for the qRT-PCR results to be accurate. Unfortunately, there are no studies on the stability of housekeeping genes used in T. melanosporum development. In this study, we present a morphological and microscopical classification of the developmental stages of T. melanosporum fruit body, and investigate the expression levels of 12 candidate reference genes (18S rRNA; 5.8S rRNA; Elongation factor 1-alpha; Elongation factor 1-beta; α-tubulin; 60S ribosomal protein L29; β-tubulin; 40S ribosomal protein S1; 40S ribosomal protein S3; Glucose-6-phosphate dehydrogenase; β-actin; Ubiquitin-conjugating enzyme). To evaluate the suitability of these genes as endogenous controls, five software-based approaches and one web-based comprehensive tool (RefFinder) were used to analyze and rank the tested genes. We demonstrate here that the 18S rRNA gene shows the most stable expression during T. melanosporum development and that a set of three genes, 18S rRNA, Elongation factor 1-alpha and 40S ribosomal protein S3, is the most suitable to normalize qRT-PCR data from all the analyzed developmental stages; conversely, 18S rRNA, Glucose-6-phosphate dehydrogenase and Elongation factor 1-alpha are the most suitable

  20. Identification and validation of quantitative real-time reverse transcription PCR reference genes for gene expression analysis in teak (Tectona grandis L.f.).

    Science.gov (United States)

    Galeano, Esteban; Vasconcelos, Tarcísio Sales; Ramiro, Daniel Alves; De Martin, Valentina de Fátima; Carrer, Helaine

    2014-07-22

    Teak (Tectona grandis L.f.) is currently the preferred choice of the timber trade for fabrication of woody products due to its extraordinary qualities and is widely grown around the world. Gene expression studies are essential to explore wood formation of vascular plants, and quantitative real-time reverse transcription PCR (qRT-PCR) is a sensitive technique employed for quantifying gene expression levels. One or more appropriate reference genes are crucial to accurately compare mRNA transcripts through different tissues/organs and experimental conditions. Despite being the focus of some genetic studies, a lack of molecular information has hindered genetic exploration of teak. To date, qRT-PCR reference genes have not been identified and validated for teak. Identification and cloning of nine commonly used qRT-PCR reference genes from teak, including ribosomal protein 60s (rp60s), clathrin adaptor complexes medium subunit family (Cac), actin (Act), histone 3 (His3), sand family (Sand), β-Tubulin (Β-Tub), ubiquitin (Ubq), elongation factor 1-α (Ef-1α), and glyceraldehyde-3-phosphate dehydrogenase (GAPDH). Expression profiles of these genes were evaluated by qRT-PCR in six tissue and organ samples (leaf, flower, seedling, root, stem and branch secondary xylem) of teak. Appropriate gene cloning and sequencing, primer specificity and amplification efficiency was verified for each gene. Their stability as reference genes was validated by NormFinder, BestKeeper, geNorm and Delta Ct programs. Results obtained from all programs showed that TgUbq and TgEf-1α are the most stable genes to use as qRT-PCR reference genes and TgAct is the most unstable gene in teak. The relative expression of the teak cinnamyl alcohol dehydrogenase (TgCAD) gene in lignified tissues at different ages was assessed by qRT-PCR, using TgUbq and TgEf-1α as internal controls. These analyses exposed a consistent expression pattern with both reference genes. This study proposes a first broad

  1. Quantitative analysis of real-time radiographic systems

    International Nuclear Information System (INIS)

    Barker, M.D.; Condon, P.E.; Barry, R.C.; Betz, R.A.; Klynn, L.M.

    1988-01-01

    A method was developed which yields quantitative information on the spatial resolution, contrast sensitivity, image noise, and focal spot size from real time radiographic images. The method uses simple image quality indicators and computer programs which make it possible to readily obtain quantitative performance measurements of single or multiple radiographic systems. It was used for x-ray and optical images to determine which component of the system was not operating up to standard. Focal spot size was monitored by imaging a bar pattern. This paper constitutes the second progress report on the development of the camera and radiation image quality indicators

  2. Quantitative real-time polymerase chain reaction for Streptococcus mutans and Streptococcus sobrinus in dental plaque samples and its association with early childhood caries.

    Science.gov (United States)

    Choi, Eun-Jung; Lee, Sung-Hoon; Kim, Young-Jae

    2009-03-01

    Streptococcus mutans and Streptococcus sobrinus are closely associated with the development of early childhood caries (ECC). Recently, quantitative real-time polymerase chain reaction (qRT-PCR) has been used for rapid and accurate quantification of these bacterial species. This study aims to detect quantitatively the levels of S. mutans and S. sobrinus in plaque samples by qRT-PCR, and to assess their association with the prevalence of ECC in Korean preschool children. One hundred and five children (71 months old or younger) were examined and classified into three groups (caries-free, ECC, severe ECC). Dental plaque samples were collected and qRT-PCR was conducted using oligonucleotide primers specific for glucosyltransferase gene (S. mutans-gtfB, S. sobrinus-gtfU) and universal primer. Pearson's correlation test was conducted to evaluate the relationship between the dmfs (decayed, missing, or filled surfaces primary teeth) scores and the microbiological findings. There was a significant difference between the levels of S. mutans and S. sobrinus in the plaque samples of the three groups (P plaque samples. The children with higher ratio of S. sobrinus to S. mutans in their dental plaque showed higher incidence of ECC.

  3. Assessing reference genes for accurate transcript normalization using quantitative real-time PCR in pearl millet [Pennisetum glaucum (L. R. Br].

    Directory of Open Access Journals (Sweden)

    Prasenjit Saha

    Full Text Available Pearl millet [Pennisetum glaucum (L. R.Br.], a close relative of Panicoideae food crops and bioenergy grasses, offers an ideal system to perform functional genomics studies related to C4 photosynthesis and abiotic stress tolerance. Quantitative real-time reverse transcription polymerase chain reaction (qRT-PCR provides a sensitive platform to conduct such gene expression analyses. However, the lack of suitable internal control reference genes for accurate transcript normalization during qRT-PCR analysis in pearl millet is the major limitation. Here, we conducted a comprehensive assessment of 18 reference genes on 234 samples which included an array of different developmental tissues, hormone treatments and abiotic stress conditions from three genotypes to determine appropriate reference genes for accurate normalization of qRT-PCR data. Analyses of Ct values using Stability Index, BestKeeper, ΔCt, Normfinder, geNorm and RefFinder programs ranked PP2A, TIP41, UBC2, UBQ5 and ACT as the most reliable reference genes for accurate transcript normalization under different experimental conditions. Furthermore, we validated the specificity of these genes for precise quantification of relative gene expression and provided evidence that a combination of the best reference genes are required to obtain optimal expression patterns for both endogeneous genes as well as transgenes in pearl millet.

  4. Diagnosis of aerobic vaginitis by quantitative real-time PCR.

    Science.gov (United States)

    Rumyantseva, T A; Bellen, G; Savochkina, Y A; Guschin, A E; Donders, G G G

    2016-07-01

    To evaluate a real-time PCR-based technique to quantify bacteria associated with aerobic vaginitis (AV) as a potential test. Vaginal samples from 100 women were tested by wet-mount microscopy, gram stain and quantitative real-time PCR targeting Enterobacteriacea, Staphylococcus spp., Streptococcus spp., Enterococcus spp., Escherichia coli, Streptococcus agalactiae, S. aureus; Lactobacillus spp. AV diagnosis obtained by wet-mount microscopy was used as reference. Some level of AV was diagnosed in 23 (23.7 %) cases. Various concentrations of Enterobacteriacea, Staphylococcus spp., Streptococcus spp. were detected an all patients. Enterococcus spp. were detected in 76 (78.3 %) cases. Summarized concentrations of aerobes were tenfold higher in AV-positive compared to AV-negative cases [7.30lg vs 6.06lg (p = 0.02)]. Concentrations of aerobes in severe, moderate and light AV cases did not vary significantly (p = 0.14). Concentration of lactobacilli was 1000-fold lower in AV-positive cases compared to normal cases (5.3lg vs 8.3lg, p AV-positive cases [19/22 (86.4 %) samples]. The relation of high loads of aerobes to the low numbers of Lactobacilli are a reliable marker for the presence of AV and could substitute microscopy as a test. PCR may be a good standardized substitution for AV diagnosis in settings where well-trained microscopists are lacking.

  5. Exploring valid reference genes for quantitative real - time rt - pce studies of hydrogenperoxide signaling in arabidopsis

    International Nuclear Information System (INIS)

    Zhou, H.; Han, B.; Xie, Y.; Zhang, J.; Shen, W.

    2015-01-01

    Hydrogen peroxide (H/sub 2/O/sub 2/ ) acts as a signaling molecule modulating the expression of various genes in plants. However, the reference gene(s) used for gene expression analysis of H/sub 2/O/sub 2/ signaling is still arbitrary. A reliable result obtained by quantitative real-time RT-PCR (RT-qPCR) highly depends on accurate transcript normalization using stably expressed reference genes, whereas the inaccurate normalization could easily lead to the false conclusions. In this report, by using geNorm and NormFinder algorithms, 12 candidate reference genes were evaluated and compared in root and shoot tissues of Arabidopsis upon different doses of H/sub 2/O/sub 2/. The results revealed that, in our experimental conditions, three novel reference genes (TIP41-like, UKN, and UBC21) were identified and validated as suitable reference genes for RT-qPCR normalization in both root and shoot tissues under oxidative stress. This conclusion was further confirmed by publicly available microarray data of methyl viologen and drought stress. In comparison with a single reference gene (EF-1a), the expression pattern of ZAT12 modulated by H/sub 2/O/sub 2/, when using TIP41-like, UKN, and UBC21 as multiple reference gene(s), was similar with the previous reports by using northern blotting. Thus, we proposed that these three reference genes might be good candidates for other researchers to include in their reference gene validation in gene expression studies under H/sub 2/O/sub 2/ related oxidative stress. (author)

  6. TaqMan MGB probe fluorescence real-time quantitative PCR for rapid detection of Chinese Sacbrood virus.

    Directory of Open Access Journals (Sweden)

    Ma Mingxiao

    Full Text Available Sacbrood virus (SBV is a picorna-like virus that affects honey bees (Apis mellifera and results in the death of the larvae. Several procedures are available to detect Chinese SBV (CSBV in clinical samples, but not to estimate the level of CSBV infection. The aim of this study was develop an assay for rapid detection and quantification of this virus. Primers and probes were designed that were specific for CSBV structural protein genes. A TaqMan minor groove binder (MGB probe-based, fluorescence real-time quantitative PCR was established. The specificity, sensitivity and stability of the assay were assessed; specificity was high and there were no cross-reactivity with healthy larvae or other bee viruses. The assay was applied to detect CSBV in 37 clinical samples and its efficiency was compared with clinical diagnosis, electron microscopy observation, and conventional RT-PCR. The TaqMan MGB-based probe fluorescence real-time quantitative PCR for CSBV was more sensitive than other methods tested. This assay was a reliable, fast, and sensitive method that was used successfully to detect CSBV in clinical samples. The technology can provide a useful tool for rapid detection of CSBV. This study has established a useful protocol for CSBV testing, epidemiological investigation, and development of animal models.

  7. Detection and identification of Rift Valley fever virus in mosquito vectors by quantitative real-time PCR.

    Science.gov (United States)

    Mwaengo, D; Lorenzo, G; Iglesias, J; Warigia, M; Sang, R; Bishop, R P; Brun, A

    2012-10-01

    Diagnostic methods allowing for rapid identification of pathogens are crucial for controlling and preventing dissemination after disease outbreaks as well as for use in surveillance programs. For arboviruses, detection of the presence of virus in their arthropod hosts is important for monitoring of viral activity and quantitative information is useful for modeling of transmission dynamics. In this study, molecular detection of Rift Valley fever virus (RVFV) in mosquito samples from the 2006 to 2007 East African outbreaks was performed using quantitative real-time PCR assay (qRT-PCR). Specific RVFV sequence-based primer/fluorogenic (TaqMan) probe sets were derived from the L and S RNA segments of the virus. Both primer-probe L and S segment-based combinations detected genomic RVFV sequences, with generally comparable levels of sensitivity. Viral loads from three mosquito species, Aedes mcintoshi, Aedes ochraceus and Mansonia uniformis were estimated and significant differences of between 5- and 1000-fold were detected between Ae. mcintoshi and M. uniformis using both the L and S primer-probe-based assays. The genetic relationships of the viral sequences in mosquito samples were established by partial M segment sequencing and assigned to the two previously described viral lineages defined by analysis of livestock isolates obtained during the 2006-2007 outbreak, confirming that similar viruses were present in both the vector and mammalian host. The data confirms the utility of qRT-PCR for identification and initial quantification of virus in mosquito samples during RVFV outbreaks. Copyright © 2012 Elsevier B.V. All rights reserved.

  8. Comparison of real-time and quantitative polymerase chain reaction assays in detection of cytomegalovirus DNA in clinical specimens

    International Nuclear Information System (INIS)

    Gokahmetoglu, S.; Deniz, E.

    2007-01-01

    To compare the real-time (RT) and qualitative (Q) polymerase chain reaction (PCR) assays for detection of Cytomegalovirus (CMV) DNA. The study took place in the Department of Microbiology, Erciyes University, Kayseri and in Iontek Laboratory, Istanbul, Turkey, from August to December 2006. One hundred and seven clinical specimens from 67 patients were included in the study. Cytomegalovirus DNA was investigated using RT-PCR kit (Fluorion Iontek, Turkey) and Q-PCR kit (Fluorion Iontek, Turkey). Deoxyribonucleic acid sequencing was applied to the samples that yielded discrepant results in both assays. Mac Nema's Chi Square test was used for statistical analysis. Of the specimens, 27 were found positive with both assays: 9 with only RT-PCR, and 11 with only Q-PCR assay. Both assays were found negative in 60 of the specimens. There was a good agreement between the 2 assays in 87(81.3%) of the specimens. There was no statistical significant difference between the assays (p>0.05). Two of the 11 samples that RT-PCR negative Q-PCR positive, and 3 of 9 samples that RT-PCR positive Q-PCR negative were found to be CMV DNA positive by DNA sequencing. A good level of concordance between RT-PCR and Q-PCR assays for CMV DNA detection has been found. (author)

  9. Selecting a set of housekeeping genes for quantitative real-time PCR in normal and tetraploid haemocytes of soft-shell clams, Mya arenaria.

    Science.gov (United States)

    Siah, A; Dohoo, C; McKenna, P; Delaporte, M; Berthe, F C J

    2008-09-01

    The transcripts involved in the molecular mechanisms of haemic neoplasia in relation to the haemocyte ploidy status of the soft-shell clam, Mya arenaria, have yet to be identified. For this purpose, real-time quantitative RT-PCR constitutes a sensitive and efficient technique, which can help determine the gene expression involved in haemocyte tetraploid status in clams affected by haemic neoplasia. One of the critical steps in comparing transcription profiles is the stability of selected housekeeping genes, as well as an accurate normalization. In this study, we selected five reference genes, S18, L37, EF1, EF2 and actin, generally used as single control genes. Their expression was analyzed by real-time quantitative RT-PCR at different levels of haemocyte ploidy status in order to select the most stable genes. Using the geNorm software, our results showed that L37, EF1 and S18 represent the most stable gene expressions related to various ploidy status ranging from 0 to 78% of tetraploid haemocytes in clams sampled in North River (Prince Edward Island, Canada). However, actin gene expression appeared to be highly regulated. Hence, using it as a housekeeping gene in tetraploid haemocytes can result in inaccurate data. To compare gene expression levels related to haemocyte ploidy status in Mya arenaria, using L37, EF1 and S18 as housekeeping genes for accurate normalization is therefore recommended.

  10. Mathematical analysis of the real time array PCR (RTA PCR) process

    NARCIS (Netherlands)

    Dijksman, Johan Frederik; Pierik, A.

    2012-01-01

    Real time array PCR (RTA PCR) is a recently developed biochemical technique that measures amplification curves (like with quantitative real time Polymerase Chain Reaction (qRT PCR)) of a multitude of different templates in a sample. It combines two different methods in order to profit from the

  11. Statistical aspects of quantitative real-time PCR experiment design.

    Science.gov (United States)

    Kitchen, Robert R; Kubista, Mikael; Tichopad, Ales

    2010-04-01

    Experiments using quantitative real-time PCR to test hypotheses are limited by technical and biological variability; we seek to minimise sources of confounding variability through optimum use of biological and technical replicates. The quality of an experiment design is commonly assessed by calculating its prospective power. Such calculations rely on knowledge of the expected variances of the measurements of each group of samples and the magnitude of the treatment effect; the estimation of which is often uninformed and unreliable. Here we introduce a method that exploits a small pilot study to estimate the biological and technical variances in order to improve the design of a subsequent large experiment. We measure the variance contributions at several 'levels' of the experiment design and provide a means of using this information to predict both the total variance and the prospective power of the assay. A validation of the method is provided through a variance analysis of representative genes in several bovine tissue-types. We also discuss the effect of normalisation to a reference gene in terms of the measured variance components of the gene of interest. Finally, we describe a software implementation of these methods, powerNest, that gives the user the opportunity to input data from a pilot study and interactively modify the design of the assay. The software automatically calculates expected variances, statistical power, and optimal design of the larger experiment. powerNest enables the researcher to minimise the total confounding variance and maximise prospective power for a specified maximum cost for the large study. Copyright 2010 Elsevier Inc. All rights reserved.

  12. Development Status of the WetLab-2 Project: New Tools for On-orbit Real-time Quantitative Gene Expression.

    Science.gov (United States)

    Jung, Jimmy; Parra, Macarena P.; Almeida, Eduardo; Boone, Travis; Chinn, Tori; Ricco, Antonio; Souza, Kenneth; Hyde, Liz; Rukhsana, Yousuf; Richey, C. Scott

    2013-01-01

    The primary objective of NASA Ames Research Centers WetLab-2 Project is to place on the ISS a research platform to facilitate gene expression analysis via quantitative real-time PCR (qRT-PCR) of biological specimens grown or cultured on orbit. The WetLab-2 equipment will be capable of processing multiple sample types ranging from microbial cultures to animal tissues dissected on-orbit. In addition to the logistical benefits of in-situ sample processing and analysis, conducting qRT-PCR on-orbit eliminates the confounding effects on gene expression of reentry stresses and shock acting on live cells and organisms. The system can also validate terrestrial analyses of samples returned from ISS by providing quantitative on-orbit gene expression benchmarking prior to sample return. The ability to get on orbit data will provide investigators with the opportunity to adjust experimental parameters for subsequent trials based on the real-time data analysis without need for sample return and re-flight. Finally, WetLab-2 can be used for analysis of air, surface, water, and clinical samples to monitor environmental contaminants and crew health. The verification flight of the instrument is scheduled to launch on SpaceX-5 in Aug. 2014.Progress to date: The WetLab-2 project completed a thorough study of commercially available qRT-PCR systems and performed a downselect based on both scientific and engineering requirements. The selected instrument, the Cepheid SmartCycler, has advantages including modular design (16 independent PCR modules), low power consumption, and rapid ramp times. The SmartCycler has multiplex capabilities, assaying up to four genes of interest in each of the 16 modules. The WetLab-2 team is currently working with Cepheid to modify the unit for housing within an EXPRESS rack locker on the ISS. This will enable the downlink of data to the ground and provide uplink capabilities for programming, commanding, monitoring, and instrument maintenance. The project is

  13. Design and analysis of Q-RT-PCR assays for haematological malignancies using mixed effects models

    DEFF Research Database (Denmark)

    Bøgsted, Martin; Mandrup, Charlotte; Petersen, Anders

    2009-01-01

    research use and needs qualit control for accuracy and precision. Especially the identification of experimental variations and statistical analysis has recently created discussions. The standard analytical technique is to use the Delta-Delta-Ct method. Although this method accounts for sample specific...... developed based on a linear mixed effects model for factorial designs. The model consists of an analysis of variance where the variation of each fixed effect of interest and identified experimental and biological nuisance variations are split. Hereby it accounts for varying efficiency, inhomogeneous......The recent WHO classification of haematological malignancies includes detection of genetic abnormalities with rognostic significance. Consequently, an increasing number of specific real-time quantitative reverse transcription polymerase chain reaction (Q-RT-PCR) based assays are in clinical...

  14. Application of reverse transcription-PCR and real-time PCR in nanotoxicity research.

    Science.gov (United States)

    Mo, Yiqun; Wan, Rong; Zhang, Qunwei

    2012-01-01

    Reverse transcription-polymerase chain reaction (RT-PCR) is a relatively simple and inexpensive technique to determine the expression level of target genes and is widely used in biomedical science research including nanotoxicology studies for semiquantitative analysis. Real-time PCR allows for the detection of PCR amplification in the exponential growth phase of the reaction and is much more quantitative than traditional RT-PCR. Although a number of kits and reagents for RT-PCR and real-time PCR are commercially available, the basic principles are the same. Here, we describe the procedures for total RNA isolation by using TRI Reagent, for reverse transcription (RT) by M-MLV reverse transcriptase, and for PCR by GoTaq(®) DNA Polymerase. And real-time PCR will be performed on an iQ5 multicolor real-time PCR detection system by using iQ™ SYBR Green Supermix.

  15. Statistical aspects of quantitative real-time PCR experiment design

    Czech Academy of Sciences Publication Activity Database

    Kitchen, R.R.; Kubista, Mikael; Tichopád, Aleš

    2010-01-01

    Roč. 50, č. 4 (2010), s. 231-236 ISSN 1046-2023 R&D Projects: GA AV ČR IAA500520809 Institutional research plan: CEZ:AV0Z50520701 Keywords : Real-time PCR * Experiment design * Nested analysis of variance Subject RIV: EB - Genetics ; Molecular Biology Impact factor: 4.527, year: 2010

  16. Monitoring and improving the sensitivity of dengue nested RT-PCR used in longitudinal surveillance in Thailand.

    Science.gov (United States)

    Klungthong, Chonticha; Manasatienkij, Wudtichai; Phonpakobsin, Thipwipha; Chinnawirotpisan, Piyawan; Rodpradit, Prinyada; Hussem, Kittinun; Thaisomboonsuk, Butsaya; Ong-ajchaowlerd, Prapapun; Nisalak, Ananda; Kalayanarooj, Siripen; Buddhari, Darunee; Gibbons, Robert V; Jarman, Richard G; Yoon, In-Kyu; Fernandez, Stefan

    2015-02-01

    AFRIMS longitudinal dengue surveillance in Thailand depends on the nested RT-PCR and the dengue IgM/IgG ELISA. To examine and improve the sensitivity of the nested RT-PCR using a panel of archived samples collected during dengue surveillance. A retrospective analysis of 16,454 dengue IgM/IgG ELISA positive cases collected between 2000 and 2013 was done to investigate the sensitivity of the nested RT-PCR. From these cases, 318 acute serum specimens or extracted RNA, previously found to be negative by the nested RT-PCR, were tested using TaqMan real-time RT-PCR (TaqMan rRT-PCR). To improve the sensitivity of nested RT-PCR, we designed a new primer based on nucleotide sequences from contemporary strains found to be positive by the TaqMan rRT-PCR. Sensitivity of the new nested PCR was calculated using a panel of 87 samples collected during 2011-2013. The percentage of dengue IgM/IgG ELISA positive cases that were negative by the nested RT-PCR varied from 17% to 42% for all serotypes depending on the year. Using TaqMan rRT-PCR, dengue RNA was detected in 194 (61%) of the 318 acute sera or extracted RNA previously found to be negative by the nested RT-PCR. The newly designed DENV-1 specific primer increased the sensitivity of DENV-1 detection by the nested RT-PCR from 48% to 88%, and of all 4 serotypes from 73% to 87%. These findings demonstrate the impact of genetic diversity and signal erosion on the sensitivity of PCR-based methods. Published by Elsevier B.V.

  17. Differential expression analysis of boron transporters and some stress-related genes in response to 24-epibrassinolide and boron by semi-quantitative RT-PCR in Arabidopsis thaliana (L. Heynh

    Directory of Open Access Journals (Sweden)

    Surgun Yonca

    2016-01-01

    Full Text Available Plant steroidal hormones, brassinosteroids (BRs, promote plant developmental processes and enhance tolerance to several abiotic stresses including high boron (B stress. To examine the possible role of BR in high B-induced stress at the transcriptional level, we investigated the response of B transporter genes (BOR1-4, high B-induced genes (MATE, Hsp-like, BR-induced genes (Hsp70-4, Hsp90-1 and other stress-related genes (LTI/COR78, LEA4-5 upon exogenous treatments of 24-epibrassinolide (EBL on Arabidopsis thaliana (L. Heynh exposed to high concentrations of boric acid (BA using semi-quantitative RT-PCR. BA treatments led to down regulation of BOR1 and BOR3 genes in leaf and root tissues and higher concentration of EBL further decreased expression of these genes in roots. The expression of high B-induced genes was observed to be upregulated by 1 μM EBL treatment under high B stress in both tissues of the seedlings. The upregulation of BR-induced genes were clearly evident in root tissues co-treated with 1 μM EBL and BA as compared to BA alone. Higher concentration of EBL was found to be more effective in increasing expression of LTI/COR78 gene in root and LEA4-5 gene in shoot tissues. To our knowledge, this is the first report how exogenous application of EBL modulates high B stress responses at molecular level in model plant Arabidopsis thaliana.

  18. Real time quantitative amplification detection on a microarray: towards high multiplex quantitative PCR.

    NARCIS (Netherlands)

    Pierik, A.; Moamfa, M; van Zelst, M.; Clout, D.; Stapert, H.; Dijksman, Johan Frederik; Broer, D.; Wimberger-Friedl, R.

    2012-01-01

    Quantitative real-time polymerase chain reaction (qrtPCR) is widely used as a research and diagnostic tool. Notwithstanding its many powerful features, the method is limited in the degree of multiplexing to about 6 due to spectral overlap of the available fluorophores. A new method is presented that

  19. Real time quantitative amplification detection on a microarray : towards high multiplex quantitative PCR

    NARCIS (Netherlands)

    Pierik, Anke; Boamfa, M.; Zelst, van M.; Clout, D.; Stapert, H.R.; Dijksman, J.F.; Broer, D.J.; Wimberger-Friedl, R.

    2012-01-01

    Quantitative real-time polymerase chain reaction (qrtPCR) is widely used as a research and diagnostic tool. Notwithstanding its many powerful features, the method is limited in the degree of multiplexing to about 6 due to spectral overlap of the available fluorophores. A new method is presented that

  20. Combined metabonomic and quantitative real-time PCR analyses reveal systems metabolic changes in Jurkat T-cells treated with HIV-1 Tat protein.

    Science.gov (United States)

    Liao, Wenting; Tan, Guangguo; Zhu, Zhenyu; Chen, Qiuli; Lou, Ziyang; Dong, Xin; Zhang, Wei; Pan, Wei; Chai, Yifeng

    2012-11-02

    HIV-1 Tat protein is released by infected cells and can affect bystander uninfected T cells and induce numerous biological responses which contribute to its pathogenesis. To elucidate the complex pathogenic mechanism, we conducted a comprehensive investigation on Tat protein-related extracellular and intracellular metabolic changes in Jurkat T-cells using combined gas chromatography-mass spectrometry (GC-MS), reversed-phase liquid chromatography-mass spectrometry (RPLC-MS) and a hydrophilic interaction liquid chromatography-mass spectrometry (HILIC-MS)-based metabonomics approach. Quantitative real-time PCR (qRT-PCR) analyses were further employed to measure expressions of several relevant enzymes together with perturbed metabolic pathways. Combined metabonomic and qRT-PCR analyses revealed that HIV-1 Tat caused significant and comprehensive metabolic changes, as represented by significant changes of 37 metabolites and 10 relevant enzymes in HIV-1 Tat-treated cells. Using MetaboAnalyst 2.0, it was found that 11 pathways (Impact-value >0.10) among the regulated pathways were acutely perturbed, including sphingolipid metabolism, glycine, serine and threonine metabolism, pyruvate metabolism, inositol phosphate metabolism, arginine and proline metabolism, citrate cycle, phenylalanine metabolism, tryptophan metabolism, pentose phosphate pathway, glycerophospholipid metabolism, glycolysis or gluconeogenesis. These results provide metabolic evidence of the complex pathogenic mechanism of HIV-1 Tat protein as a "viral toxin", and would help obligate Tat protein as "an important target" for therapeutic intervention and vaccine development.

  1. Galactomannan enzyme immunoassay and quantitative Real Time PCR as tools to evaluate the exposure and response in a rat model of aspergillosis after posaconazole prophylaxis.

    Science.gov (United States)

    Cendejas-Bueno, Emilio; Forastiero, Agustina; Ruiz, Isabel; Mellado, Emilia; Buitrago, María José; Gavaldà, Joan; Gomez-Lopez, Alicia

    2016-11-01

    A steroid-immunosuppressed rat model of invasive pulmonary aspergillosis was use to examine the usefulness of galactomannan enzyme immunoassay (GM) and quantitative real time PCR (RT-PCR) in evaluating the association between response and exposure after a high dose of prophylactic posaconazole. Two different strains of Aspergillus fumigatus with different in vitro posaconazole susceptibility were used. Serum concentrations demonstrated similar posaconazole exposure for all treated animals. However, response to posaconazole relied on the in vitro susceptibility of the infecting strain. After prophylaxis, galactomannan index and fungal burden only decreased in those animals infected with the most susceptible strain. This study demonstrated that both biomarkers may be useful tools for predicting efficacy of antifungal compounds in prophylaxis. Copyright © 2015 Elsevier España, S.L.U. and Sociedad Española de Enfermedades Infecciosas y Microbiología Clínica. All rights reserved.

  2. A Quantitative Approach to the Formal Verification of Real-Time Systems.

    Science.gov (United States)

    1996-09-01

    Computer Science A Quantitative Approach to the Formal Verification of Real - Time Systems Sergio Vale Aguiar Campos September 1996 CMU-CS-96-199...ptisiic raieaiSI v Diambimos Lboiamtad _^ A Quantitative Approach to the Formal Verification of Real - Time Systems Sergio Vale Aguiar Campos...implied, of NSF, the Semiconduc- tor Research Corporation, ARPA or the U.S. government. Keywords: real - time systems , formal verification, symbolic

  3. Selection of appropriate reference genes for the detection of rhythmic gene expression via quantitative real-time PCR in Tibetan hulless barley.

    Directory of Open Access Journals (Sweden)

    Jing Cai

    Full Text Available Hulless barley (Hordeum vulgare L. var. nudum. hook. f. has been cultivated as a major crop in the Qinghai-Tibet plateau of China for thousands of years. Compared to other cereal crops, the Tibetan hulless barley has developed stronger endogenous resistances to survive in the severe environment of its habitat. To understand the unique resistant mechanisms of this plant, detailed genetic studies need to be performed. The quantitative real-time reverse transcription-polymerase chain reaction (qRT-PCR is the most commonly used method in detecting gene expression. However, the selection of stable reference genes under limited experimental conditions was considered to be an essential step for obtaining accurate results in qRT-PCR. In this study, 10 candidate reference genes-ACT (Actin, E2 (Ubiquitin conjugating enzyme 2, TUBα (Alpha-tubulin, TUBβ6 (Beta-tubulin 6, GAPDH (Glyceraldehyde 3-phosphate dehydrogenase, EF-1α (Elongation factor 1-alpha, SAMDC (S-adenosylmethionine decarboxylase, PKABA1 (Gene for protein kinase HvPKABA1, PGK (Phosphoglycerate kinase, and HSP90 (Heat shock protein 90-were selected from the NCBI gene database of barley. Following qRT-PCR amplifications of all candidate reference genes in Tibetan hulless barley seedlings under various stressed conditions, the stabilities of these candidates were analyzed by three individual software packages including geNorm, NormFinder, and BestKeeper. The results demonstrated that TUBβ6, E2, TUBα, and HSP90 were generally the most suitable sets under all tested conditions; similarly, TUBα and HSP90 showed peak stability under salt stress, TUBα and EF-1α were the most suitable reference genes under cold stress, and ACT and E2 were the most stable under drought stress. Finally, a known circadian gene CCA1 was used to verify the service ability of chosen reference genes. The results confirmed that all recommended reference genes by the three software were suitable for gene expression

  4. Selection of appropriate reference genes for the detection of rhythmic gene expression via quantitative real-time PCR in Tibetan hulless barley.

    Science.gov (United States)

    Cai, Jing; Li, Pengfei; Luo, Xiao; Chang, Tianliang; Li, Jiaxing; Zhao, Yuwei; Xu, Yao

    2018-01-01

    Hulless barley (Hordeum vulgare L. var. nudum. hook. f.) has been cultivated as a major crop in the Qinghai-Tibet plateau of China for thousands of years. Compared to other cereal crops, the Tibetan hulless barley has developed stronger endogenous resistances to survive in the severe environment of its habitat. To understand the unique resistant mechanisms of this plant, detailed genetic studies need to be performed. The quantitative real-time reverse transcription-polymerase chain reaction (qRT-PCR) is the most commonly used method in detecting gene expression. However, the selection of stable reference genes under limited experimental conditions was considered to be an essential step for obtaining accurate results in qRT-PCR. In this study, 10 candidate reference genes-ACT (Actin), E2 (Ubiquitin conjugating enzyme 2), TUBα (Alpha-tubulin), TUBβ6 (Beta-tubulin 6), GAPDH (Glyceraldehyde 3-phosphate dehydrogenase), EF-1α (Elongation factor 1-alpha), SAMDC (S-adenosylmethionine decarboxylase), PKABA1 (Gene for protein kinase HvPKABA1), PGK (Phosphoglycerate kinase), and HSP90 (Heat shock protein 90)-were selected from the NCBI gene database of barley. Following qRT-PCR amplifications of all candidate reference genes in Tibetan hulless barley seedlings under various stressed conditions, the stabilities of these candidates were analyzed by three individual software packages including geNorm, NormFinder, and BestKeeper. The results demonstrated that TUBβ6, E2, TUBα, and HSP90 were generally the most suitable sets under all tested conditions; similarly, TUBα and HSP90 showed peak stability under salt stress, TUBα and EF-1α were the most suitable reference genes under cold stress, and ACT and E2 were the most stable under drought stress. Finally, a known circadian gene CCA1 was used to verify the service ability of chosen reference genes. The results confirmed that all recommended reference genes by the three software were suitable for gene expression analysis

  5. Performance Evaluation of the Bioneer AccuPower® HIV-1 Quantitative RT-PCR kit: Comparison with the Roche COBAS® AmpliPrep/COBAS TaqMan® HIV-1 Test Ver.2.0 for Quantification of HIV-1 Viral Load in Indonesia.

    Science.gov (United States)

    Kosasih, Agus Susanto; Sugiarto, Christine; Hayuanta, Hubertus Hosti; Juhaendi, Runingsih; Setiawan, Lyana

    2017-08-08

    Measurement of viral load in human immunodeficiency virus type 1 (HIV-1) infected patients is essential for the establishment of a therapeutic strategy. Several assays based on qPCR are available for the measurement of viral load; they differ in sample volume, technology applied, target gene, sensitivity and dynamic range. The Bioneer AccuPower® HIV-1 Quantitative RT-PCR is a novel commercial kit that has not been evaluated for its performance. This study aimed to evaluate the performance of the Bioneer AccuPower® HIV-1 Quantitative RT-PCR kit. In total, 288 EDTA plasma samples from the Dharmais Cancer Hospital were analyzed with the Bioneer AccuPower® HIV-1 Quantitative RT-PCR kit and the Roche COBAS? AmpliPrep/COBAS® TaqMan® HIV-1 version 2.0 (CAP/CTM v2.0). The performance of the Bioneer assay was then evaluated against the Roche CAP/CTM v2.0. Overall, there was good agreement between the two assays. The Bioneer assay showed significant linear correlation with CAP/CTM v2.0 (R2=0.963, plaboratories.

  6. Evaluation of methods for oligonucleotide array data via quantitative real-time PCR.

    Science.gov (United States)

    Qin, Li-Xuan; Beyer, Richard P; Hudson, Francesca N; Linford, Nancy J; Morris, Daryl E; Kerr, Kathleen F

    2006-01-17

    There are currently many different methods for processing and summarizing probe-level data from Affymetrix oligonucleotide arrays. It is of great interest to validate these methods and identify those that are most effective. There is no single best way to do this validation, and a variety of approaches is needed. Moreover, gene expression data are collected to answer a variety of scientific questions, and the same method may not be best for all questions. Only a handful of validation studies have been done so far, most of which rely on spike-in datasets and focus on the question of detecting differential expression. Here we seek methods that excel at estimating relative expression. We evaluate methods by identifying those that give the strongest linear association between expression measurements by array and the "gold-standard" assay. Quantitative reverse-transcription polymerase chain reaction (qRT-PCR) is generally considered the "gold-standard" assay for measuring gene expression by biologists and is often used to confirm findings from microarray data. Here we use qRT-PCR measurements to validate methods for the components of processing oligo array data: background adjustment, normalization, mismatch adjustment, and probeset summary. An advantage of our approach over spike-in studies is that methods are validated on a real dataset that was collected to address a scientific question. We initially identify three of six popular methods that consistently produced the best agreement between oligo array and RT-PCR data for medium- and high-intensity genes. The three methods are generally known as MAS5, gcRMA, and the dChip mismatch mode. For medium- and high-intensity genes, we identified use of data from mismatch probes (as in MAS5 and dChip mismatch) and a sequence-based method of background adjustment (as in gcRMA) as the most important factors in methods' performances. However, we found poor reliability for methods using mismatch probes for low-intensity genes

  7. Evaluation of methods for oligonucleotide array data via quantitative real-time PCR

    Directory of Open Access Journals (Sweden)

    Morris Daryl E

    2006-01-01

    Full Text Available Abstract Background There are currently many different methods for processing and summarizing probe-level data from Affymetrix oligonucleotide arrays. It is of great interest to validate these methods and identify those that are most effective. There is no single best way to do this validation, and a variety of approaches is needed. Moreover, gene expression data are collected to answer a variety of scientific questions, and the same method may not be best for all questions. Only a handful of validation studies have been done so far, most of which rely on spike-in datasets and focus on the question of detecting differential expression. Here we seek methods that excel at estimating relative expression. We evaluate methods by identifying those that give the strongest linear association between expression measurements by array and the "gold-standard" assay. Quantitative reverse-transcription polymerase chain reaction (qRT-PCR is generally considered the "gold-standard" assay for measuring gene expression by biologists and is often used to confirm findings from microarray data. Here we use qRT-PCR measurements to validate methods for the components of processing oligo array data: background adjustment, normalization, mismatch adjustment, and probeset summary. An advantage of our approach over spike-in studies is that methods are validated on a real dataset that was collected to address a scientific question. Results We initially identify three of six popular methods that consistently produced the best agreement between oligo array and RT-PCR data for medium- and high-intensity genes. The three methods are generally known as MAS5, gcRMA, and the dChip mismatch mode. For medium- and high-intensity genes, we identified use of data from mismatch probes (as in MAS5 and dChip mismatch and a sequence-based method of background adjustment (as in gcRMA as the most important factors in methods' performances. However, we found poor reliability for methods

  8. Quantitative Real-Time PCR Fecal Source Identification in the ...

    Science.gov (United States)

    Rivers in the Tillamook Basin play a vital role in supporting a thriving dairy and cheese-making industry, as well as providing a safe water resource for local human and wildlife populations. Historical concentrations of fecal bacteria in these waters are at times too high to allow for safe use leading to economic loss, endangerment of local wildlife, and poor conditions for recreational use. In this study, we employ host-associated qPCR methods for human (HF183/BacR287 and HumM2), ruminant (Rum2Bac), cattle (CowM2 and CowM3), canine (DG3 and DG37), and avian (GFD) fecal pollution combined with high-resolution geographic information system (GIS) land use data and general indicator bacteria measurements to elucidatewater quality spatial and temporal trends. Water samples (n=584) were collected over a 1-year period at 29 sites along the Trask, Kilchis, and Tillamook rivers and tributaries (Tillamook Basin, OR). A total of 16.6% of samples (n=97) yielded E. coli levels considered impaired based on Oregon Department of Environmental Quality bacteria criteria (406 MPN/100mL). Hostassociated genetic indicators were detected at frequencies of 39.2% (HF183/BacR287), 16.3% (HumM2), 74.6% (Rum2Bac), 13.0% (CowM2), 26.7% (CowM3), 19.8% (DG3), 3.2% (DG37), and 53.4% (GFD) across all water samples (n=584). Seasonal trends in avian, cattle, and human fecal pollution sources were evident over the study area. On a sample site basis, quantitative fecal source identification and

  9. Selection and validation of appropriate reference genes for quantitative real-time PCR analysis in Salvia hispanica.

    Directory of Open Access Journals (Sweden)

    Rahul Gopalam

    Full Text Available Quantitative real-time polymerase chain reaction (qRT-PCR has become the most popular choice for gene expression studies. For accurate expression analysis, it is pertinent to select a stable reference gene to normalize the data. It is now known that the expression of internal reference genes varies considerably during developmental stages and under different experimental conditions. For Salvia hispanica, an economically important oilseed crop, there are no reports of stable reference genes till date. In this study, we chose 13 candidate reference genes viz. Actin11 (ACT, Elongation factor 1-alpha (EF1-α, Eukaryotic translation initiation factor 3E (ETIF3E, alpha tubulin (α-TUB, beta tubulin (β-TUB, Glyceraldehyde 3-phosphate dehydrogenase (GAPDH, Cyclophilin (CYP, Clathrin adaptor complex (CAC, Serine/threonine-protein phosphatase 2A (PP2A, FtsH protease (FtsH, 18S ribosomal RNA (18S rRNA, S-adenosyl methionine decarboxylase (SAMDC and Rubisco activase (RCA and the expression levels of these genes were assessed in a diverse set of tissue samples representing vegetative stages, reproductive stages and various abiotic stress treatments. Two of the widely used softwares, geNorm and Normfinder were used to evaluate the expression stabilities of these 13 candidate reference genes under different conditions. Results showed that GAPDH and CYP expression remain stable throughout in the different abiotic stress treatments, CAC and PP2A expression were relatively stable under reproductive stages and α-TUB, PP2A and ETIF3E were found to be stably expressed in vegetative stages. Further, the expression levels of Diacylglycerol acyltransferase (DGAT1, a key enzyme in triacylglycerol synthesis was analyzed to confirm the validity of reference genes identified in the study. This is the first systematic study of selection of reference genes in S. hispanica, and will benefit future expression studies in this crop.

  10. Real-Time PCR (qPCR) Primer Design Using Free Online Software

    Science.gov (United States)

    Thornton, Brenda; Basu, Chhandak

    2011-01-01

    Real-time PCR (quantitative PCR or qPCR) has become the preferred method for validating results obtained from assays which measure gene expression profiles. The process uses reverse transcription polymerase chain reaction (RT-PCR), coupled with fluorescent chemistry, to measure variations in transcriptome levels between samples. The four most…

  11. Selection of Reference Genes for qRT-PCR Analysis of Gene Expression in Stipa grandis during Environmental Stresses.

    Directory of Open Access Journals (Sweden)

    Dongli Wan

    Full Text Available Stipa grandis P. Smirn. is a dominant plant species in the typical steppe of the Xilingole Plateau of Inner Mongolia. Selection of suitable reference genes for the quantitative real-time reverse transcription polymerase chain reaction (qRT-PCR is important for gene expression analysis and research into the molecular mechanisms underlying the stress responses of S. grandis. In the present study, 15 candidate reference genes (EF1 beta, ACT, GAPDH, SamDC, CUL4, CAP, SNF2, SKIP1, SKIP5, SKIP11, UBC2, UBC15, UBC17, UCH, and HERC2 were evaluated for their stability as potential reference genes for qRT-PCR under different stresses. Four algorithms were used: GeNorm, NormFinder, BestKeeper, and RefFinder. The results showed that the most stable reference genes were different under different stress conditions: EF1beta and UBC15 during drought and salt stresses; ACT and GAPDH under heat stress; SKIP5 and UBC17 under cold stress; UBC15 and HERC2 under high pH stress; UBC2 and UBC15 under wounding stress; EF1beta and UBC17 under jasmonic acid treatment; UBC15 and CUL4 under abscisic acid treatment; and HERC2 and UBC17 under salicylic acid treatment. EF1beta and HERC2 were the most suitable genes for the global analysis of all samples. Furthermore, six target genes, SgPOD, SgPAL, SgLEA, SgLOX, SgHSP90 and SgPR1, were selected to validate the most and least stable reference genes under different treatments. Our results provide guidelines for reference gene selection for more accurate qRT-PCR quantification and will promote studies of gene expression in S. grandis subjected to environmental stress.

  12. Outcome on EPIZONE Extension on VER/ VNN: Diagnostics, proficiency test and qRT-PCR validation

    DEFF Research Database (Denmark)

    Bigarré, Laurent; Panzarin, Valentina; Baud, Marine

    2012-01-01

    1 is to bring valuable genetic information on the second genome component of a given isolate. ANSES has developed new DNA probes targeting RNA1 with the goal of detecting all genotypes of nodaviruses. The aim of the project is thus: - To organize, conduct and report an inter-laboratory proficiency...... test for detection of aquatic nodaviruses by real time RT-PCR targeting RNA1 and RNA2, respectively. - To test a newly developed real-time RT-PCR targeting RNA1: sensitivity, specificity, range of detection and genetic information provided by sequencing the PCR product. Materials & methods Primers...... to be extracted by each partner. In the meantime, ANSES produced and distributed RNA extracted from healthy or infected fish (2 genogroups), or cell culture; one sample from cell culture had to be serially diluted to test the sensitivity of each method in partners’ hands. Samples were tested in duplicates...

  13. Enteroviruses in blood of patients with type 1 diabetes detected by integrated cell culture and reverse transcription quantitative real-time PCR.

    Science.gov (United States)

    Alidjinou, Enagnon Kazali; Sane, Famara; Lefevre, Christine; Baras, Agathe; Moumna, Ilham; Engelmann, Ilka; Vantyghem, Marie-Christine; Hober, Didier

    2017-11-01

    Enteroviruses (EV) have been associated with type 1 diabetes (T1D), but EV RNA detection has been reported in only a small proportion of T1D patients. We studied whether integrated cell culture and reverse transcription real-time PCR could improve EV detection in blood samples from patients with T1D. Blood was collected from 13 patients with T1D. The presence of EV RNA in blood was investigated by using real-time RT-PCR. In addition, plasma and white blood cells (WBC) were inoculated to BGM and Vero cell line cultures. Culture supernatants and cells collected on day 7 and day 14 were tested for EV RNA by real-time RT-PCR. Enterovirus identification was performed through sequencing of the VP4/VP2 region. Enterovirus RNA was detected in blood by using real-time RT-PCR in only one out of 13 patients. The detection of EV RNA in cultures inoculated with clinical samples (plasma and/or WBC) gave positive results in five other patients. The viral loads were low, ranging from 45 to 4420 copies/ng of total RNA. One isolate was successfully identified as coxsackievirus B1. Integrated cell culture and reverse transcription real-time PCR can improve the detection rate of EV in blood samples of patients with T1D and can be useful to investigate further the relationship between EV and the disease.

  14. Selection of reference genes for qRT-PCR analysis of gene expression in sea cucumber Apostichopus japonicus during aestivation

    Science.gov (United States)

    Zhao, Ye; Chen, Muyan; Wang, Tianming; Sun, Lina; Xu, Dongxue; Yang, Hongsheng

    2014-11-01

    Quantitative real-time reverse transcription-polymerase chain reaction (qRT-PCR) is a technique that is widely used for gene expression analysis, and its accuracy depends on the expression stability of the internal reference genes used as normalization factors. However, many applications of qRT-PCR used housekeeping genes as internal controls without validation. In this study, the expression stability of eight candidate reference genes in three tissues (intestine, respiratory tree, and muscle) of the sea cucumber Apostichopus japonicus was assessed during normal growth and aestivation using the geNorm, NormFinder, delta CT, and RefFinder algorithms. The results indicate that the reference genes exhibited significantly different expression patterns among the three tissues during aestivation. In general, the β-tubulin (TUBB) gene was relatively stable in the intestine and respiratory tree tissues. The optimal reference gene combination for intestine was 40S ribosomal protein S18 (RPS18), TUBB, and NADH dehydrogenase (NADH); for respiratory tree, it was β-actin (ACTB), TUBB, and succinate dehydrogenase cytochrome B small subunit (SDHC); and for muscle it was α-tubulin (TUBA) and NADH dehydrogenase [ubiquinone] 1 α subcomplex subunit 13 (NDUFA13). These combinations of internal control genes should be considered for use in further studies of gene expression in A. japonicus during aestivation.

  15. Modeling qRT-PCR dynamics with application to cancer biomarker quantification.

    Science.gov (United States)

    Chervoneva, Inna; Freydin, Boris; Hyslop, Terry; Waldman, Scott A

    2017-01-01

    Quantitative reverse transcription polymerase chain reaction (qRT-PCR) is widely used for molecular diagnostics and evaluating prognosis in cancer. The utility of mRNA expression biomarkers relies heavily on the accuracy and precision of quantification, which is still challenging for low abundance transcripts. The critical step for quantification is accurate estimation of efficiency needed for computing a relative qRT-PCR expression. We propose a new approach to estimating qRT-PCR efficiency based on modeling dynamics of polymerase chain reaction amplification. In contrast, only models for fluorescence intensity as a function of polymerase chain reaction cycle have been used so far for quantification. The dynamics of qRT-PCR efficiency is modeled using an ordinary differential equation model, and the fitted ordinary differential equation model is used to obtain effective polymerase chain reaction efficiency estimates needed for efficiency-adjusted quantification. The proposed new qRT-PCR efficiency estimates were used to quantify GUCY2C (Guanylate Cyclase 2C) mRNA expression in the blood of colorectal cancer patients. Time to recurrence and GUCY2C expression ratios were analyzed in a joint model for survival and longitudinal outcomes. The joint model with GUCY2C quantified using the proposed polymerase chain reaction efficiency estimates provided clinically meaningful results for association between time to recurrence and longitudinal trends in GUCY2C expression.

  16. Trends and advances in food analysis by real-time polymerase chain reaction.

    Science.gov (United States)

    Salihah, Nur Thaqifah; Hossain, Mohammad Mosharraf; Lubis, Hamadah; Ahmed, Minhaz Uddin

    2016-05-01

    Analyses to ensure food safety and quality are more relevant now because of rapid changes in the quantity, diversity and mobility of food. Food-contamination must be determined to maintain health and up-hold laws, as well as for ethical and cultural concerns. Real-time polymerase chain reaction (RT-PCR), a rapid and inexpensive quantitative method to detect the presence of targeted DNA-segments in samples, helps in determining both accidental and intentional adulterations of foods by biological contaminants. This review presents recent developments in theory, techniques, and applications of RT-PCR in food analyses, RT-PCR addresses the limitations of traditional food analyses in terms of sensitivity, range of analytes, multiplexing ability, cost, time, and point-of-care applications. A range of targets, including species of plants or animals which are used as food ingredients, food-borne bacteria or viruses, genetically modified organisms, and allergens, even in highly processed foods can be identified by RT-PCR, even at very low concentrations. Microfluidic RT-PCR eliminates the separate sample-processing step to create opportunities for point-of-care analyses. We also cover the challenges related to using RT-PCR for food analyses, such as the need to further improve sample handling.

  17. Laboratory evaluation of a quantitative real-time reverse transcription PCR assay for the detection and identification of the four subgroups of avian metapneumovirus.

    Science.gov (United States)

    Guionie, O; Toquin, D; Sellal, E; Bouley, S; Zwingelstein, F; Allée, C; Bougeard, S; Lemière, S; Eterradossi, N

    2007-02-01

    Avian metapneumovirus (AMPV) is an important pathogen causing respiratory diseases and egg drops in several avian species. Four AMPV subgroups have been identified. The laboratory diagnosis of AMPV infections relies on serological methods, on labour-intensive virus isolation procedures, and on recently developed subgroup specific reverse transcription PCR (RT-PCR) protocols. In the present study, both the specificity and sensitivity of a commercial real-time reverse transcription PCR (RRT-PCR) for the detection and identification of the four AMPV subgroups were evaluated. Fifteen non-AMPV avian viruses belonging to 7 genera and 32 AMPV belonging to the 4 subgroups were tested. No non-AMPV virus was detected, whereas all AMPV viruses were identified in agreement with their previous molecular and antigenic subgroup assignment. The sensitivity and quantitating ability of the RRT-PCR assay were determined using serial dilutions of RNA derived either from AMPV virus stocks or from runoff transcripts. In all cases, linear dose/responses were observed. The detection limits of the different subgroups ranged from 500 to 5000 RNA copies and from 0.03 to 3.16TCID50/ml. The results were reproducible under laboratory conditions, thus showing that quantitative RRT-PCR is a new and powerful tool for the rapid and sensitive detection, identification and quantitation of AMPVs.

  18. Real-time quantitative PCR of microdissected paraffin-embedded breast carcinoma

    DEFF Research Database (Denmark)

    Gjerdrum, Lise Mette; Sorensen, Boe Sandahl; Kjeldsen, Eigil

    2004-01-01

    We studied the feasibility of using real-time quantitative PCR to determine HER-2 DNA amplification and mRNA expression in microdissected formalin-fixed, paraffin-embedded breast tumors and compared this with standard immunohistochemistry (IHC) and fluorescent in situ hybridization (FISH) methods...... tumors as being amplified. Interestingly, all these scored 2+ with the HercepTest, but were negative using FISH. We believe that real-time quantitative PCR analysis of HER-2 DNA amplification following microdissection represents a useful supplementary or perhaps even an alternative technique...

  19. Performance of nested RT-PCR on CSF for tuberculous meningitis diagnosis in HIV-infected patients.

    Science.gov (United States)

    Gualberto, F A S; Gonçalves, M G; Fukasawa, L O; Santos, A M Ramos Dos; Sacchi, C T; Harrison, L H; Boulware, D R; Vidal, J E

    2017-10-01

    Timely diagnosis of tuberculous meningitis (TBM) in patients with human immunodeficiency virus (HIV) infection remains a challenge. Despite the current scale-up of the Xpert® MTB/RIF assay, other molecular diagnostic tools are necessary, particularly in referral centres in low- and middle-income countries without Xpert testing. To determine the diagnostic performance of nested real-time polymerase chain reaction (nRT-PCR) in HIV-infected TBM patients categorised according to standardised clinical case definitions. Based on clinical, laboratory and imaging data, HIV-infected patients with suspected TBM were prospectively categorised as 'definite TBM', 'probable TBM', 'possible TBM' or 'not TBM'. We evaluated nRT-PCR sensitivity and specificity in diagnosing TBM among definite TBM cases, and among definite + probable TBM cases. Ninety-two participants were enrolled in the study. nRT-PCR sensitivity for definite TBM (n = 8) was 100% (95%CI 67-100) and 86% (95%CI 60-96) for both definite and probable TBM (n = 6). Assuming that 'not TBM' patients (n = 74) were true-negatives, nRT-PCR specificity was 100% (95%CI 95-100). The possible TBM group (n = 4) had no nRT-PCR positives. The nRT-PCR is a useful rule-in test for HIV-infected patients with TBM according to international consensus case definitions. As nRT-PCR cannot exclude TBM, studies comparing and combining nRT-PCR with other assays are necessary for a rule-out test.

  20. Diagnosis of intestinal parasites in a rural community of Venezuela : Advantages and disadvantages of using microscopy or RT-PCR

    NARCIS (Netherlands)

    Incani, Renzo Nino; Ferrer, Elizabeth; Hoek, Denise; Ramak, Robbert; Roelfsema, Jeroen; Mughini-Gras, Lapo; Kortbeek, Titia M.; Pinelli, Elena

    2017-01-01

    A cross-sectional study was carried out to determine the prevalence and diagnostic performance of microscopy and real time PCR (RT-PCR) for 14 intestinal parasites in a Venezuelan rural community with a long history of persistent intestinal parasitic infections despite the implementation of regular

  1. Real-time quantitative PCR of microdissected paraffin-embedded breast carcinoma

    DEFF Research Database (Denmark)

    Gjerdrum, Lise Mette; Sorensen, Boe Sandahl; Kjeldsen, Eigil

    2004-01-01

    We studied the feasibility of using real-time quantitative PCR to determine HER-2 DNA amplification and mRNA expression in microdissected formalin-fixed, paraffin-embedded breast tumors and compared this with standard immunohistochemistry (IHC) and fluorescent in situ hybridization (FISH) methods...

  2. Periodontal pathogens: a quantitative comparison of anaerobic culture and real-time PCR

    NARCIS (Netherlands)

    Boutaga, Khalil; van Winkelhoff, Arie Jan; Vandenbroucke-Grauls, Christina M. J. E.; Savelkoul, Paul H. M.

    2005-01-01

    Periodontitis is a multi-factorial chronic inflammatory and destructive disease of the tooth-supporting tissues. Quantitative anaerobic culture techniques have been used for microbial diagnosis of the different forms of the disease. The aim of this study was to compare real-time PCR with

  3. Real-time quantitative PCR of Staphylococcus aureus and application in restaurant meals.

    Science.gov (United States)

    Berrada, H; Soriano, J M; Mañes, J; Picó, Y

    2006-01-01

    Staphylococcus aureus is considered the second most common pathogen to cause outbreaks of food poisoning, exceeded only by Campylobacter. Consumption of foods containing this microorganism is often identified as the cause of illness. In this study, a rapid, reliable, and sensitive real-time quantitative PCR was developed and compared with conventional culture methods. Real-time quantitative PCR was carried out by purifying DNA extracts of S. aureus with a Staphylococcus sample preparation kit and quantifying it in the LightCycler system with hybridization probes. The assay was linear from a range of 10 to 10(6) S. aureus cells (r2 > 0.997). The PCR reaction presented an efficiency of >85%. Accuracy of the PCR-based assay, expressed as percent bias, was around 13%, and the precision, expressed as a percentage of the coefficient of variation, was 7 to 10%. Intraday and interday variability were studied at 10(2) CFU/g and was 12 and 14%, respectively. The proposed method was applied to the analysis of 77 samples of restaurant meals in Valencia (Spain). In 11.6% of samples S. aureus was detected by real-time quantitative PCR, as well as by the conventional microbiological method. An excellent correspondence between real-time quantitative PCR and microbiological numbers (CFU/g) was observed with deviations of < 28%.

  4. Validation of putative reference genes for normalization of Q-RT-PCR data from paraffin-embedded lymphoid tissue

    DEFF Research Database (Denmark)

    Green, Tina Marie; de Stricker, Karin; Møller, Michael Boe

    2009-01-01

    Normalization of quantitative reverse transcription-PCR (Q-RT-PCR) data to appropriate tissue-specific reference genes is an essential part of interpreting the results. This study aimed to determine the most appropriate reference genes for normalizing gene expressions in lymphatic tissue...... was 0.93 (Pnormalization with the appropriate reference genes. Thus, we show that formalin-fixed, paraffin-embedded lymphoid samples are suitable for Q-RT-PCR when using thoroughly validated reference genes....

  5. Touch-down reverse transcriptase-PCR detection of IgV(H) rearrangement and Sybr-Green-based real-time RT-PCR quantitation of minimal residual disease in patients with chronic lymphocytic leukemia

    Czech Academy of Sciences Publication Activity Database

    Peková, Soňa; Marková, J.; Pajer, Petr; Dvořák, Michal; Cetkovský, P.; Schwarz, J.

    2005-01-01

    Roč. 9, č. 1 (2005), s. 23-34 ISSN 1084-8592 Institutional research plan: CEZ:AV0Z50520514 Keywords : minimal residual disease * chronic lymphocytic leukaemia * IgV (H) rearrangement Subject RIV: EB - Genetics ; Molecular Biology Impact factor: 2.562, year: 2003

  6. Diagnostic evaluation of a multiplexed RT-PCR microsphere array assay for the detection of foot-and-mouth disease virus and look-alike disease viruses

    Energy Technology Data Exchange (ETDEWEB)

    Hindson, B J; Reid, S M; Baker, B R; Ebert, K; Ferris, N P; Bentley Tammero, L F; Lenhoff, R J; Naraghi-Arani, P; Vitalis, E A; Slezak, T R; Hullinger, P J; King, D P

    2007-07-26

    A high-throughput multiplexed assay was developed for the differential laboratory diagnosis of foot-and-mouth disease virus (FMDV) from viruses which cause clinically similar diseases of livestock. This assay simultaneously screens for five RNA and two DNA viruses using multiplexed reverse transcription PCR (mRT-PCR) amplification coupled with a microsphere hybridization array and flow-cytometric detection. Two of the seventeen primer-probe sets included in this multiplex assay were adopted from previously characterized real-time RT-PCR (rRT-PCR) assays for FMDV. The diagnostic accuracy of the mRT-PCR was evaluated using 287 field samples, including 248 (true positive n= 213, true negative n=34) from suspect cases of foot-and-mouth disease collected from 65 countries between 1965 and 2006 and 39 true negative samples collected from healthy animals. The mRT-PCR assay results were compared with two singleplex rRT-PCR assays, using virus isolation with antigen-ELISA as the reference method. The diagnostic sensitivity of the mRT-PCR assay for FMDV was 93.9% [95% C.I. 89.8-96.4%], compared to 98.1% [95% C.I. 95.3-99.3%] for the two singleplex rRT-PCR assays used in combination. In addition, the assay could reliably differentiate between FMDV and other vesicular viruses such as swine vesicular disease virus and vesicular exanthema of swine virus. Interestingly, the mRT-PCR detected parapoxvirus (n=2) and bovine viral diarrhea virus (n=2) in clinical samples, demonstrating the screening potential of this mRT-PCR assay to identify viruses in FMDV-negative material not previously recognized using focused single-target rRT-PCR assays.

  7. Quantitative density measurements from a real-time neutron radiography system

    International Nuclear Information System (INIS)

    McRae, D.D.; Jenkins, R.W. Jr.; Brenizer, J.S.; Tobin, K.W.; Hosticka, B.; Sulcoski, M.F.

    1986-01-01

    An advanced video system has been assembled from commercially available equipment to support the real-time neutron radiography facility established jointly by the University of Virginia Department of Nuclear Engineering and Engineering Physics, and the Philip Morris Research Center. A schematic diagram of the equipment used for real-time neutron radiography is presented. To obtain quantitative density measurements with this system, several modifications of both hardware and image processing software were required. After implementation of these changes, the system was capable of determining material densities by measuring the degree of neutron attenuation

  8. Validation of endogenous reference genes for qRT-PCR analysis of human visceral adipose samples.

    Science.gov (United States)

    Mehta, Rohini; Birerdinc, Aybike; Hossain, Noreen; Afendy, Arian; Chandhoke, Vikas; Younossi, Zobair; Baranova, Ancha

    2010-05-21

    Given the epidemic proportions of obesity worldwide and the concurrent prevalence of metabolic syndrome, there is an urgent need for better understanding the underlying mechanisms of metabolic syndrome, in particular, the gene expression differences which may participate in obesity, insulin resistance and the associated series of chronic liver conditions. Real-time PCR (qRT-PCR) is the standard method for studying changes in relative gene expression in different tissues and experimental conditions. However, variations in amount of starting material, enzymatic efficiency and presence of inhibitors can lead to quantification errors. Hence the need for accurate data normalization is vital. Among several known strategies for data normalization, the use of reference genes as an internal control is the most common approach. Recent studies have shown that both obesity and presence of insulin resistance influence an expression of commonly used reference genes in omental fat. In this study we validated candidate reference genes suitable for qRT-PCR profiling experiments using visceral adipose samples from obese and lean individuals. Cross-validation of expression stability of eight selected reference genes using three popular algorithms, GeNorm, NormFinder and BestKeeper found ACTB and RPII as most stable reference genes. We recommend ACTB and RPII as stable reference genes most suitable for gene expression studies of human visceral adipose tissue. The use of these genes as a reference pair may further enhance the robustness of qRT-PCR in this model system.

  9. Validation of endogenous reference genes for qRT-PCR analysis of human visceral adipose samples

    Directory of Open Access Journals (Sweden)

    Afendy Arian

    2010-05-01

    Full Text Available Abstract Background Given the epidemic proportions of obesity worldwide and the concurrent prevalence of metabolic syndrome, there is an urgent need for better understanding the underlying mechanisms of metabolic syndrome, in particular, the gene expression differences which may participate in obesity, insulin resistance and the associated series of chronic liver conditions. Real-time PCR (qRT-PCR is the standard method for studying changes in relative gene expression in different tissues and experimental conditions. However, variations in amount of starting material, enzymatic efficiency and presence of inhibitors can lead to quantification errors. Hence the need for accurate data normalization is vital. Among several known strategies for data normalization, the use of reference genes as an internal control is the most common approach. Recent studies have shown that both obesity and presence of insulin resistance influence an expression of commonly used reference genes in omental fat. In this study we validated candidate reference genes suitable for qRT-PCR profiling experiments using visceral adipose samples from obese and lean individuals. Results Cross-validation of expression stability of eight selected reference genes using three popular algorithms, GeNorm, NormFinder and BestKeeper found ACTB and RPII as most stable reference genes. Conclusions We recommend ACTB and RPII as stable reference genes most suitable for gene expression studies of human visceral adipose tissue. The use of these genes as a reference pair may further enhance the robustness of qRT-PCR in this model system.

  10. Validation of tumor markers in central nervous system germ cell tumors by real-time reverse transcriptase polymerase chain reaction using formalin-fixed paraffin-embedded tissues.

    Science.gov (United States)

    Kim, Dowhan; Lee, Da Hye; Choi, Junjeong; Shim, Kyu Won; Kim, Se Hoon

    2013-01-01

    The therapeutic protocols for treatment of germinomas and non-germinomatous germ cell tumors (NGGCTs) are completely different, so it is important to distinguish pure germinomas from NGGCTs. As it can be difficult to diagnose by morphology alone, immunohisto-chemistry (IHC) has been widely used as an ancillary test to improve diagnostic accuracy. However, IHC has limitations due to the misinterpretation of results or the aberrant loss of immunoreactivity. However, real-time RT-PCR has certain advantages over IHC, including its quantitative nature. The aim of our study was to evaluate the usefulness of real-time RT-PCR on formalin-fixed paraffin-embedded (FFPE) tissue blocks for the diagnosis of germ cell tumors of the central nervous system. We selected eight markers of germ cell tumors using a literature search, and validated them using real-time RT-PCR. Among them, POU5F1, NANOG and TGFB2 were statistically significant (P=0.05) in multiple comparisons (MANOVA) of three groups (pure germinomas, mature teratomas and malignant germ cell tumors). Two-group (pure germinomas and NGGCTs) discriminant analysis achieved a 70.0% success rate in cross-validation. We concluded that real-time RT-PCR using FFPE tissue has adequate validating power comparable to IHC in the diagnosis of central nervous system germ cell tumors; therefore, when IHC is not available, not conclusive or not informative, RT-PCR is a potential alternative to a repeat biopsy.

  11. RT-PCR Detection of HIV in Republic of Macedonia

    Directory of Open Access Journals (Sweden)

    Golubinka Bosevska

    2008-11-01

    Full Text Available The aim of the study was to detect HIV RNA in seropositive patients using RT-PCR method and thus, to establish PCR methodology in the routine laboratory works.The total of 33 examined persons were divided in two groups: 1 13 persons seropositive for HIV; and 2 20 healthy persons - randomly selected blood donors that made the case control group. The subjects age was between 25 and 52 years (average 38,5.ELFA test for combined detection of HIV p24 antigen and anti HIV-1 + 2 IgG and ELISA test for detection of antibodies against HIV-1 and HIV-2, were performed for each examined person. RNA from the whole blood was extracted using a commercial kit based on salt precipitation. Detection of HIV RNA was performed using RT-PCR kit. Following nested PCR, the product was separated by electrophoresis in 1,5 % agarose gel. The result was scored positive if the band of 210bp was visible regardless of intensity Measures of precaution were taken during all the steps of the work and HIV infected materials were disposed of accordingly.In the group of blood donors ELFA, ELISA and RT-PCR were negative. Assuming that prevalence of HIV infection is zero, the clinical specificity of RT-PCR is 100 %. The analytical specificity of RT-PCR method was tested against Hepatitis C and B, Human Papiloma Virus, Cytomegalovirus, Herpes Simplex Virus, Rubella Virus, Mycobacterium tuberculosis, Chlamydia trachomatis. None of these templates yielded amplicon. In the group of 13 seropositive persons, 33 samples were analyzed. HIV RNA was detected in 15 samples. ELISA and ELFA test were positive in all samples. Different aliquots of the samples were tested independently and showed the same results. After different periods of storing the RNA samples at -70°C, RT-PCR reaction was identical to the one performed initially. The obtained amplicons were maintained frozen at -20°C for a week and the subsequently performed electrophoresis was identical to the previous one. The reaction is

  12. Development of real-time PCR for detection and quantitation of Streptococcus parauberis.

    Science.gov (United States)

    Nguyen, T L; Lim, Y J; Kim, D-H; Austin, B

    2016-01-01

    Streptococcus parauberis is an increasing threat to aquaculture of olive flounder, Paralichthys olivaceus Temminck & Schlegel, in South Korea. We developed a real-time polymerase chain reaction (PCR) method using the TaqMan probe assay to detect and quantify S. parauberis by targeting the gyrB gene sequences, which are effective for molecular analysis of the genus Streptococcus. Our real-time PCR assay is capable of detecting 10 fg of genomic DNA per reaction. The intra- and interassay coefficient of variation (CV) values ranged from 0.42-1.95%, demonstrating that the assay has good reproducibility. There was not any cross-reactivity to Streptococcus iniae or to other streptococcal/lactococcal fish pathogens, such as S. agalactiae and Lactococcus garvieae, indicating that the assay is highly specific to S. parauberis. The results of the real-time PCR assay corresponded well to those of conventional culture assays for S. parauberis from inoculated tissue homogenates (r = 0.957; P < 0.05). Hence, this sensitive and specific real-time PCR is a valuable tool for diagnostic quantitation of S. parauberis in clinical samples. © 2014 John Wiley & Sons Ltd.

  13. Embryonation of Ostertagia ostertagi eggs affects the outcome of real-time quantitative PCR

    DEFF Research Database (Denmark)

    Drag, Markus; Höglund, Johan; Nejsum, Peter

    prior to detection and quantification by real-time quantitative polymerase chain reaction (qPCR). Fresh O. ostertagi eggs were isolated from cattle faeces and stored at 4°C or 25°C under aerobic or anaerobic conditions. Embryonation was monitored by microscopy and the ITS2 copies were determined by q...... the outcome of qPCR analysis for the quantitative determination of O. ostertagi eggs in cattle faeces. Cold storage at 4°C for up to 3 days or anaerobicvacuum packing at 25°C for up to 336 h will entail no undesirable effects on ITS2 copies....

  14. Embryonation of Ostertagia ostertagi eggs affects the outcome of real-time quantitative PCR

    DEFF Research Database (Denmark)

    Drag, Markus; Höglund, Johan; Nejsum, Peter

    prior to detection and quantification by real-time quantitative polymerase chain reaction (qPCR) . Fresh O. ostertagi eggs were isolated from cattle faeces and stored at 4°C or 25°C under aerobic or anaerobic conditions. Embryonation was monitored by microscopy and the ITS2 copies were determined by q...... the outcome of qPCR analysis for the quantitative determination of O. ostertagi eggs in cattle faeces. Cold storage at 4°C for up to 3 days or anaerobic vacuum packing at 25°C for up to 336 h will entail no undesirable effects on ITS2 copies....

  15. Legionellosis and Lung Abscesses: Contribution of Legionella Quantitative Real-Time PCR to an Adapted Followup

    Directory of Open Access Journals (Sweden)

    G. Descours

    2013-01-01

    Full Text Available We report a case of severe Legionnaires' disease (LD complicated by a lung abscess in an immunocompetent patient who required ECMO therapy and thoracic surgery. The results of repeated Legionella quantitative real-time PCR performed on both sera and respiratory samples correlated with the LD severity and the poor clinical outcome. Moreover, the PCR allowed for the detection of Legionella DNA in the lung abscess specimen, which was negative when cultured for Legionella. This case report provides a logical basis for further investigations to examine whether the Legionella quantitative PCR could improve the assessment of LD severity and constitute a prognostic marker.

  16. Detection and Analysis of Circular RNAs by RT-PCR.

    Science.gov (United States)

    Panda, Amaresh C; Gorospe, Myriam

    2018-03-20

    Gene expression in eukaryotic cells is tightly regulated at the transcriptional and posttranscriptional levels. Posttranscriptional processes, including pre-mRNA splicing, mRNA export, mRNA turnover, and mRNA translation, are controlled by RNA-binding proteins (RBPs) and noncoding (nc)RNAs. The vast family of ncRNAs comprises diverse regulatory RNAs, such as microRNAs and long noncoding (lnc)RNAs, but also the poorly explored class of circular (circ)RNAs. Although first discovered more than three decades ago by electron microscopy, only the advent of high-throughput RNA-sequencing (RNA-seq) and the development of innovative bioinformatic pipelines have begun to allow the systematic identification of circRNAs (Szabo and Salzman, 2016; Panda et al ., 2017b; Panda et al ., 2017c). However, the validation of true circRNAs identified by RNA sequencing requires other molecular biology techniques including reverse transcription (RT) followed by conventional or quantitative (q) polymerase chain reaction (PCR), and Northern blot analysis (Jeck and Sharpless, 2014). RT-qPCR analysis of circular RNAs using divergent primers has been widely used for the detection, validation, and sometimes quantification of circRNAs (Abdelmohsen et al ., 2015 and 2017; Panda et al ., 2017b). As detailed here, divergent primers designed to span the circRNA backsplice junction sequence can specifically amplify the circRNAs and not the counterpart linear RNA. In sum, RT-PCR analysis using divergent primers allows direct detection and quantification of circRNAs.

  17. Selection and validation of endogenous reference genes for qRT-PCR analysis in leafy spurge (Euphorbia esula.

    Directory of Open Access Journals (Sweden)

    Wun S Chao

    Full Text Available Quantitative real-time polymerase chain reaction (qRT-PCR is the most important tool in measuring levels of gene expression due to its accuracy, specificity, and sensitivity. However, the accuracy of qRT-PCR analysis strongly depends on transcript normalization using stably expressed reference genes. The aim of this study was to find internal reference genes for qRT-PCR analysis in various experimental conditions for seed, adventitious underground bud, and other organs of leafy spurge. Eleven candidate reference genes (BAM4, PU1, TRP-like, FRO1, ORE9, BAM1, SEU, ARF2, KAPP, ZTL, and MPK4 were selected from among 171 genes based on expression stabilities during seed germination and bud growth. The other ten candidate reference genes were selected from three different sources: (1 3 stably expressed leafy spurge genes (60S, bZIP21, and MD-100 identified from the analyses of leafy spurge microarray data; (2 3 orthologs of Arabidopsis "general purpose" traditional reference genes (GAPDH_1, GAPDH_2, and UBC; and (3 4 orthologs of Arabidopsis stably expressed genes (UBC9, SAND, PTB, and F-box identified from Affymetrix ATH1 whole-genome GeneChip studies. The expression stabilities of these 21 genes were ranked based on the C(T values of 72 samples using four different computation programs including geNorm, Normfinder, BestKeeper, and the comparative ΔC(T method. Our analyses revealed SAND, PTB, ORE9, and ARF2 to be the most appropriate reference genes for accurate normalization of gene expression data. Since SAND and PTB were obtained from 4 orthologs of Arabidopsis, while ORE9 and ARF2 were selected from 171 leafy spurge genes, it was more efficient to identify good reference genes from the orthologs of other plant species that were known to be stably expressed than that of randomly testing endogenous genes. Nevertheless, the two newly identified leafy spurge genes, ORE9 and ARF2, can serve as orthologous candidates in the search for reference genes

  18. Identification of suitable reference genes for gene expression normalization in qRT-PCR analysis in watermelon.

    Directory of Open Access Journals (Sweden)

    Qiusheng Kong

    Full Text Available Watermelon is one of the major Cucurbitaceae crops and the recent availability of genome sequence greatly facilitates the fundamental researches on it. Quantitative real-time reverse transcriptase PCR (qRT-PCR is the preferred method for gene expression analyses, and using validated reference genes for normalization is crucial to ensure the accuracy of this method. However, a systematic validation of reference genes has not been conducted on watermelon. In this study, transcripts of 15 candidate reference genes were quantified in watermelon using qRT-PCR, and the stability of these genes was compared using geNorm and NormFinder. geNorm identified ClTUA and ClACT, ClEF1α and ClACT, and ClCAC and ClTUA as the best pairs of reference genes in watermelon organs and tissues under normal growth conditions, abiotic stress, and biotic stress, respectively. NormFinder identified ClYLS8, ClUBCP, and ClCAC as the best single reference genes under the above experimental conditions, respectively. ClYLS8 and ClPP2A were identified as the best reference genes across all samples. Two to nine reference genes were required for more reliable normalization depending on the experimental conditions. The widely used watermelon reference gene 18SrRNA was less stable than the other reference genes under the experimental conditions. Catalase family genes were identified in watermelon genome, and used to validate the reliability of the identified reference genes. ClCAT1and ClCAT2 were induced and upregulated in the first 24 h, whereas ClCAT3 was downregulated in the leaves under low temperature stress. However, the expression levels of these genes were significantly overestimated and misinterpreted when 18SrRNA was used as a reference gene. These results provide a good starting point for reference gene selection in qRT-PCR analyses involving watermelon.

  19. Quantitative real-time monitoring of dryer effluent using fiber optic near-infrared spectroscopy.

    Science.gov (United States)

    Harris, S C; Walker, D S

    2000-09-01

    This paper describes a method for real-time quantitation of the solvents evaporating from a dryer. The vapor stream in the vacuum line of a dryer was monitored in real time using a fiber optic-coupled acousto-optic tunable filter near-infrared (AOTF-NIR) spectrometer. A balance was placed in the dryer, and mass readings were recorded for every scan of the AOTF-NIR. A partial least-squares (PLS) calibration was subsequently built based on change in mass over change in time for solvents typically used in a chemical manufacturing plant. Controlling software for the AOTF-NIR was developed. The software collects spectra, builds the PLS calibration model, and continuously fits subsequently collected spectra to the calibration, allowing the operator to follow the mass loss of solvent from the dryer. The results indicate that solvent loss can be monitored and quantitated in real time using NIR for the optimization of drying times. These time-based mass loss values have also been used to calculate "dynamic" vapor density values for the solvents. The values calculated are in agreement with values determined from the ideal gas law and could prove valuable as tools to measure temperature or pressure indirectly.

  20. Development of a real time polymerase chain reaction for quantitation of Schistosoma mansoni DNA

    Directory of Open Access Journals (Sweden)

    Ana Lisa do Vale Gomes

    2006-10-01

    Full Text Available This report describes the development of a SYBR Green I based real time polymerase chain reaction (PCR protocol for detection on the ABI Prism 7000 instrument. Primers targeting the gene encoding the SSU rRNA were designed to amplify with high specificity DNA from Schistosoma mansoni, in a real time quantitative PCR system. The limit of detection of parasite DNA for the system was 10 fg of purified genomic DNA, that means less than the equivalent to one parasite cell (genome ~580 fg DNA. The efficiency was 0.99 and the correlation coefficient (R² was 0.97. When different copy numbers of the target amplicon were used as standards, the assay could detect at least 10 copies of the specific target. The primers used were designed to amplify a 106 bp DNA fragment (Tm 83ºC. The assay was highly specific for S. mansoni, and did not recognize DNA from closely related non-schistosome trematodes. The real time PCR allowed for accurate quantification of S. mansoni DNA and no time-consuming post-PCR detection of amplification products by gel electrophoresis was required. The assay is potentially able to quantify S. mansoni DNA (and indirectly parasite burden in a number of samples, such as snail tissue, serum and feces from patients, and cercaria infested water. Thus, these PCR protocols have potential to be used as tools for monitoring of schistosome transmission and quantitative diagnosis of human infection.

  1. Real-time quantitative phase reconstruction in off-axis digital holography using multiplexing.

    Science.gov (United States)

    Girshovitz, Pinhas; Shaked, Natan T

    2014-04-15

    We present a new approach for obtaining significant speedup in the digital processing of extracting unwrapped phase profiles from off-axis digital holograms. The new technique digitally multiplexes two orthogonal off-axis holograms, where the digital reconstruction, including spatial filtering and two-dimensional phase unwrapping on a decreased number of pixels, can be performed on both holograms together, without redundant operations. Using this technique, we were able to reconstruct, for the first time to our knowledge, unwrapped phase profiles from off-axis holograms with 1 megapixel in more than 30 frames per second using a standard single-core personal computer on a MATLAB platform, without using graphic-processing-unit programming or parallel computing. This new technique is important for real-time quantitative visualization and measurements of highly dynamic samples and is applicable for a wide range of applications, including rapid biological cell imaging and real-time nondestructive testing. After comparing the speedups obtained by the new technique for holograms of various sizes, we present experimental results of real-time quantitative phase visualization of cells flowing rapidly through a microchannel.

  2. RT-PCR Protocols - Methods in Molecular Biology

    Directory of Open Access Journals (Sweden)

    Manuela Monti

    2011-03-01

    Full Text Available “The first record I have of it, is when I made a computer file which I usually did whenever I had an idea, that would have been on the Monday when I got back, and I called it Chain Reaction.POL, meaning polymerase. That was the identifier for it and later I called the thing the Polymerase Chain Reaction, which a lot of people thought was a dumb name for it, but it stuck, and it became PCR”. With these words the Nobel prize winner, Kary Mullis, explains how he named the PCR: one of the most important techniques ever invented and currently used in molecular biology. This book “RT-PCR Protocols” covers a wide range of aspects important for the setting of a PCR experiment for both beginners and advanced users. In my opinion the book is very well structured in three different sections. The first one describes the different technologies now available, like competitive RT-PCR, nested RT-PCR or RT-PCR for cloning. An important part regards the usage of PCR in single cell mouse embryos, stressing how important...........

  3. Table 1. Real-time qRT-PCR verification of eight DEGs. Gene ...

    Indian Academy of Sciences (India)

    (TCA)8. GGGTCCGAGTGCCTTAATTT. TGTGGGATGTGTTGTGTGTG 60.32 59.88. HAAS VR 415 BMK.5319. (T)13. GATTCACGTGTGCCATCATC TGGACAATTCATTCAAAAAGAAAA 59.93 59.87 372. HAAS_VR_417 BMK.5329. (AG)6. ATCCCGGGGTGAAAAATAAA AGAAATGGTGCAATGGGTTC 60.36 59.80 157. (GAC)5 ...

  4. Detection of medically important Candida species by absolute quantitation real-time polymerase chain reaction.

    Science.gov (United States)

    Than, Leslie Thian Lung; Chong, Pei Pei; Ng, Kee Peng; Seow, Heng Fong

    2015-01-01

    The number of invasive candidiasis cases has risen especially with an increase in the number of immunosuppressed and immunocom promised patients. The early detection of Candida species which is specific and sensitive is important in determining the correct administration of antifungal drugs to patients. This study aims to develop a method for the detection, identification and quantitation of medically important Candida species through quantitative polymerase chain reaction (qPCR). The isocitrate lyase (ICL) gene which is not found in mammals was chosen as the target gene of real-time PCR. Absolute quantitation of the gene copy number was achieved by constructing the plasmid containing the ICL gene which is used to generate standard curve. Twenty fungal species, two bacterial species and human DNA were tested to check the specificity of the detection method. All eight Candida species were successfully detected, identified and quantitated based on the ICL gene. A seven-log range of the gene copy number and a minimum detection limit of 10(3) copies were achieved. A one-tube absolute quantification real-time PCR that differentiates medically important Candida species via individual unique melting temperature was achieved. Analytical sensitivity and specificity were not compromised.

  5. Rapid quantitative detection of Lactobacillus sakei in meat and fermented sausages by real-time PCR.

    Science.gov (United States)

    Martín, Belén; Jofré, Anna; Garriga, Margarita; Pla, Maria; Aymerich, Teresa

    2006-09-01

    A quick and simple method for quantitative detection of Lactobacillus sakei in fermented sausages was successfully developed. It is based on Chelex-100-based DNA purification and real-time PCR enumeration using a TaqMan fluorescence probe. Primers and probes were designed in the L. sakei 16S-23S rRNA intergenic transcribed spacer region, and the assay was evaluated using L. sakei genomic DNA and an artificially inoculated sausage model. The detection limit of this technique was approximately 3 cells per reaction mixture using both purified DNA and the inoculated sausage model. The quantification limit was established at 30 cells per reaction mixture in both models. The assay was then applied to enumerate L. sakei in real samples, and the results were compared to the MRS agar count method followed by confirmation of the percentage of L. sakei colonies. The results obtained by real-time PCR were not statistically significantly different than those obtained by plate count on MRS agar (P > 0.05), showing a satisfactory agreement between both methods. Therefore, the real-time PCR assay developed can be considered a promising rapid alternative method for the quantification of L. sakei and evaluation of the implantation of starter strains of L. sakei in fermented sausages.

  6. Real-Time Polymerase Chain Reaction: Applications in Diagnostic Microbiology

    Directory of Open Access Journals (Sweden)

    Kordo B. A. Saeed

    2013-11-01

    Full Text Available The polymerase chain reaction (PCR has revolutionized the detection of DNA and RNA. Real-Time PCR (RT-PCR is becoming the gold standard test for accurate, sensitive and fast diagnosis for a large range of infectious agents. Benefits of this procedure over conventional methods for measuring RNA include its sensitivity, high throughout and quantification. RT-PCR assays have advanced the diagnostic abilities of clinical laboratories particularly microbiology and infectious diseases. In this review we would like to briefly discuss RT-PCR in diagnostic microbiology laboratory, beginning with a general introduction to RT-PCR and its principles, setting up an RT PCR, including multiplex systems and the avoidance and remediation of contamination issues. A segment of the review would be devoted to the application of RT-PCR in clinical practice concentrating on its role in the diagnosis and treatment of infectious diseases.

  7. Selection of reference genes for quantitative real-time PCR in bovine preimplantation embryos

    Directory of Open Access Journals (Sweden)

    Van Zeveren Alex

    2005-12-01

    Full Text Available Abstract Background Real-time quantitative PCR is a sensitive and very efficient technique to examine gene transcription patterns in preimplantation embryos, in order to gain information about embryo development and to optimize assisted reproductive technologies. Critical to the succesful application of real-time PCR is careful assay design, reaction optimization and validation to maximize sensitivity and accuracy. In most of the studies published GAPD, ACTB or 18S rRNA have been used as a single reference gene without prior verification of their expression stability. Normalization of the data using unstable controls can result in erroneous conclusions, especially when only one reference gene is used. Results In this study the transcription levels of 8 commonly used reference genes (ACTB, GAPD, Histone H2A, TBP, HPRT1, SDHA, YWHAZ and 18S rRNA were determined at different preimplantation stages (2-cell, 8-cell, blastocyst and hatched blastocyst in order to select the most stable genes to normalize quantitative data within different preimplantation embryo stages. Conclusion Using the geNorm application YWHAZ, GAPD and SDHA were found to be the most stable genes across the examined embryonic stages, while the commonly used ACTB was shown to be highly regulated. We recommend the use of the geometric mean of those 3 reference genes as an accurate normalization factor, which allows small expression differences to be reliably measured.

  8. Molecular quantification of lactic acid bacteria in fermented milk products using real-time quantitative PCR.

    Science.gov (United States)

    Furet, Jean-Pierre; Quénée, Pascal; Tailliez, Patrick

    2004-12-15

    Real-time quantitative PCR assays were developed for the absolute quantification of lactic acid bacteria (LAB) (Streptococcus thermophilus, Lactobacillus delbrueckii, L. casei, L. paracasei, L. rhamnosus, L. acidophilus and L. johnsonii) in fermented milk products. The results of molecular quantification and classic bacterial enumeration did not differ significantly with respect to S. thermophilus and the species of the L. casei group which were detected in the six commercial fermented products tested, thus showing that DNA extraction was efficient and that genomic DNA solutions were free of PCR inhibitors. For L. delbrueckii, the results of bacterial enumeration were generally lower by a factor 10 to 100 than those of PCR quantification, suggesting a loss of viability during storage of the dairy products at 1-8 degrees C for most of the strains in this species. Real-time quantitative assays enabled identification of the species of lactic acid bacterial strains initially present in commercial fermented milk products and their accurate quantification with a detection threshold of 10(3) cells per ml of product.

  9. Quantification bias caused by plasmid DNA conformation in quantitative real-time PCR assay.

    Science.gov (United States)

    Lin, Chih-Hui; Chen, Yu-Chieh; Pan, Tzu-Ming

    2011-01-01

    Quantitative real-time PCR (qPCR) is the gold standard for the quantification of specific nucleic acid sequences. However, a serious concern has been revealed in a recent report: supercoiled plasmid standards cause significant over-estimation in qPCR quantification. In this study, we investigated the effect of plasmid DNA conformation on the quantification of DNA and the efficiency of qPCR. Our results suggest that plasmid DNA conformation has significant impact on the accuracy of absolute quantification by qPCR. DNA standard curves shifted significantly among plasmid standards with different DNA conformations. Moreover, the choice of DNA measurement method and plasmid DNA conformation may also contribute to the measurement error of DNA standard curves. Due to the multiple effects of plasmid DNA conformation on the accuracy of qPCR, efforts should be made to assure the highest consistency of plasmid standards for qPCR. Thus, we suggest that the conformation, preparation, quantification, purification, handling, and storage of standard plasmid DNA should be described and defined in the Minimum Information for Publication of Quantitative Real-Time PCR Experiments (MIQE) to assure the reproducibility and accuracy of qPCR absolute quantification.

  10. The hsp 16 Gene of the Probiotic Lactobacillus acidophilus Is Differently Regulated by Salt, High Temperature and Acidic Stresses, as Revealed by Reverse Transcription Quantitative PCR (qRT-PCR Analysis

    Directory of Open Access Journals (Sweden)

    Daniela Fiocco

    2011-08-01

    Full Text Available Small heat shock proteins (sHsps are ubiquitous conserved chaperone-like proteins involved in cellular proteins protection under stressful conditions. In this study, a reverse transcription quantitative PCR (RT-qPCR procedure was developed and used to quantify the transcript level of a small heat shock gene (shs in the probiotic bacterium Lactobacillus acidophilus NCFM, under stress conditions such as heat (45 °C and 53 °C, bile (0.3% w/v, hyperosmosis (1 M and 2.5 M NaCl, and low pH value (pH 4. The shs gene of L. acidophilus NCFM was induced by salt, high temperature and acidic stress, while repression was observed upon bile stress. Analysis of the 5' noncoding region of the hsp16 gene reveals the presence of an inverted repeat (IR sequence (TTAGCACTC-N9-GAGTGCTAA homologue to the controlling IR of chaperone expression (CIRCE elements found in the upstream regulatory region of Gram-positive heat shock operons, suggesting that the hsp16 gene of L. acidophilus might be transcriptionally controlled by HrcA. In addition, the alignment of several small heat shock proteins identified so far in lactic acid bacteria, reveals that the Hsp16 of L. acidophilus exhibits a strong evolutionary relationship with members of the Lactobacillus acidophilus group.

  11. Complementary techniques: validation of gene expression data by quantitative real time PCR.

    Science.gov (United States)

    Provenzano, Maurizio; Mocellin, Simone

    2007-01-01

    Microarray technology can be considered the most powerful tool for screening gene expression profiles of biological samples. After data mining, results need to be validated with highly reliable biotechniques allowing for precise quantitation of transcriptional abundance of identified genes. Quantitative real time PCR (qrt-PCR) technology has recently reached a level of sensitivity, accuracy and practical ease that support its use as a routine bioinstrumentation for gene level measurement. Currently, qrt-PCR is considered by most experts the most appropriate method to confirm or confute microarray-generated data. The knowledge of the biochemical principles underlying qrt-PCR as well as some related technical issues must be beard in mind when using this biotechnology.

  12. Variation in Bluetongue virus real-time reverse transcription polymerase chain reaction assay results in blood samples of sheep, cattle, and alpaca.

    Science.gov (United States)

    Brito, Barbara P; Gardner, Ian A; Hietala, Sharon K; Crossley, Beate M

    2011-07-01

    Bluetongue is a vector-borne viral disease that affects domestic and wild ruminants. The epidemiology of this disease has recently changed, with occurrence in new geographic areas. Various real-time quantitative reverse transcription polymerase chain reaction (real-time qRT-PCR) assays are used to detect Bluetongue virus (BTV); however, the impact of biologic differences between New World camelids and domestic ruminant samples on PCR efficiency, for which the BTV real-time qRT-PCR was initially validated are unknown. New world camelids are known to have important biologic differences in whole blood composition, including hemoglobin concentration, which can alter PCR performance. In the present study, sheep, cattle, and alpaca blood were spiked with BTV serotypes 10, 11, 13, and 17 and analyzed in 10-fold dilutions by real-time qRT-PCR to determine if species affected nucleic acid recovery and assay performance. A separate experiment was performed using spiked alpaca blood subsequently diluted in 10-fold series in sheep blood to assess the influence of alpaca blood on performance efficiency of the BTV real-time qRT-PCR assay. Results showed that BTV-specific nucleic acid detection from alpaca blood was consistently 1-2 logs lower than from sheep and cattle blood, and results were similar for each of the 4 BTV serotypes analyzed.

  13. Real time quantitative phase microscopy based on single-shot transport of intensity equation (ssTIE) method

    Science.gov (United States)

    Yu, Wei; Tian, Xiaolin; He, Xiaoliang; Song, Xiaojun; Xue, Liang; Liu, Cheng; Wang, Shouyu

    2016-08-01

    Microscopy based on transport of intensity equation provides quantitative phase distributions which opens another perspective for cellular observations. However, it requires multi-focal image capturing while mechanical and electrical scanning limits its real time capacity in sample detections. Here, in order to break through this restriction, real time quantitative phase microscopy based on single-shot transport of the intensity equation method is proposed. A programmed phase mask is designed to realize simultaneous multi-focal image recording without any scanning; thus, phase distributions can be quantitatively retrieved in real time. It is believed the proposed method can be potentially applied in various biological and medical applications, especially for live cell imaging.

  14. Simple, specific molecular typing of dengue virus isolates using one-step RT-PCR and restriction fragment length polymorphism.

    Science.gov (United States)

    Ortiz, Alma; Capitan, Zeuz; Mendoza, Yaxelis; Cisneros, Julio; Moreno, Brechla; Zaldivar, Yamitzel; Garcia, Mariana; Smith, Rebecca E; Motta, Jorge; Pascale, Juan Miguel

    2012-10-01

    A one-step RT-PCR and one-enzyme RFLP was used to detect and distinguish among flaviviruses, including the four serotypes of dengue and the St. Louis Encephalitis, West Nile and Yellow Fever viruses in cultured virus samples or acute-phase human serum. Using a previously described RT-PCR, but novel RFLP procedure, results are obtained in 24 h with basic PCR and electrophoresis equipment. There is 95% agreement between RT-PCR/RFLP results and those achieved by indirect immunofluorescence assays, and 100% agreement between RT-PCR/RFLP results and gene sequencing. This method is more rapid than tests of cytopathic effect based on virus isolation in tissue culture, and simpler than real-time PCR. It does not require specialized equipment, radioisotopes or computer analysis and is a method that can be applied widely in the developing world. It allows for prompt determination of whether a flavivirus is the cause of illness in a febrile patient, rapid identification of dengue serotypes in circulation, and improved patient management in cases where prior dengue exposure make dengue hemorrhagic fever or dengue shock syndrome a risk. Copyright © 2012 Elsevier B.V. All rights reserved.

  15. Quantitative detection of Campylobacter jejuni on fresh chicken carcasses by real-time PCR.

    Science.gov (United States)

    Rönner, Anna-Clara; Lindmark, Hans

    2007-06-01

    Campylobacter jejuni infection is a significant cause of foodborne gastroenteritis worldwide. Consumption and handling of poultry products is believed to be the primary risk factor for campylobacteriosis. Risk assessments require quantitative data, and C. jejuni is enumerated usually by direct plating, which sometimes allows growth of non-Campylobacter bacteria. The objective of the present study was to develop a quantitative real-time PCR method (q-PCR) for enumerating C. jejuni in chicken rinse without a culturing step. The procedure to obtain the template for the PCR assay involved (i) filtration of 10 ml of chicken rinse, (ii) centrifugation of the sample, and (iii) total DNA extraction from the pellet obtained using a commercial DNA extraction kit. The detection limit of the method was comparable to that for plating 100 microl of chicken rinse on modified charcoal cefoperazone deoxycholate agar, and the detection limit could be further improved 10-fold by concentrating the DNA eluate by ethanol precipitation. A close correlation for spiked chicken rinse was obtained for the results of the quantitative real-time PCR method and direct plating (r = 0.99). The coefficient of correlation for the methods was 0.87 when samples from chicken carcasses on the slaughter line were analyzed, whereas a lower correlation (r = 0.76) was obtained when samples from retail carcasses were analyzed. Greater variation in the proportion of dead and/or viable but not culturable Campylobacter types in the retail samples may explain the decreased correlation between the methods. Overall, the new method is simple and fast and the results obtained are closely correlated with those for direct plating for samples containing a low proportion of dead Campylobacter cells.

  16. Identification and validation of reference genes for quantification of target gene expression with quantitative real-time PCR for tall fescue under four abiotic stresses.

    Directory of Open Access Journals (Sweden)

    Zhimin Yang

    Full Text Available Tall fescue (Festuca arundinacea Schreb. is widely utilized as a major forage and turfgrass species in the temperate regions of the world and is a valuable plant material for studying molecular mechanisms of grass stress tolerance due to its superior drought and heat tolerance among cool-season species. Selection of suitable reference genes for quantification of target gene expression is important for the discovery of molecular mechanisms underlying improved growth traits and stress tolerance. The stability of nine potential reference genes (ACT, TUB, EF1a, GAPDH, SAND, CACS, F-box, PEPKR1 and TIP41 was evaluated using four programs, GeNorm, NormFinder, BestKeeper, and RefFinder. The combinations of SAND and TUB or TIP41 and TUB were most stably expressed in salt-treated roots or leaves. The combinations of GAPDH with TIP41 or TUB were stable in roots and leaves under drought stress. TIP41 and PEPKR1 exhibited stable expression in cold-treated roots, and the combination of F-box, TIP41 and TUB was also stable in cold-treated leaves. CACS and TUB were the two most stable reference genes in heat-stressed roots. TIP41 combined with TUB and ACT was stably expressed in heat-stressed leaves. Finally, quantitative real-time polymerase chain reaction (qRT-PCR assays of the target gene FaWRKY1 using the identified most stable reference genes confirmed the reliability of selected reference genes. The selection of suitable reference genes in tall fescue will allow for more accurate identification of stress-tolerance genes and molecular mechanisms conferring stress tolerance in this stress-tolerant species.

  17. Selection and validation of reference genes for qRT-PCR expression analysis of candidate genes involved in olfactory communication in the butterfly Bicyclus anynana.

    Directory of Open Access Journals (Sweden)

    Alok Arun

    Full Text Available Real-time quantitative reverse transcription PCR (qRT-PCR is a technique widely used to quantify the transcriptional expression level of candidate genes. qRT-PCR requires the selection of one or several suitable reference genes, whose expression profiles remain stable across conditions, to normalize the qRT-PCR expression profiles of candidate genes. Although several butterfly species (Lepidoptera have become important models in molecular evolutionary ecology, so far no study aimed at identifying reference genes for accurate data normalization for any butterfly is available. The African bush brown butterfly Bicyclus anynana has drawn considerable attention owing to its suitability as a model for evolutionary ecology, and we here provide a maiden extensive study to identify suitable reference gene in this species. We monitored the expression profile of twelve reference genes: eEF-1α, FK506, UBQL40, RpS8, RpS18, HSP, GAPDH, VATPase, ACT3, TBP, eIF2 and G6PD. We tested the stability of their expression profiles in three different tissues (wings, brains, antennae, two developmental stages (pupal and adult and two sexes (male and female, all of which were subjected to two food treatments (food stress and control feeding ad libitum. The expression stability and ranking of twelve reference genes was assessed using two algorithm-based methods, NormFinder and geNorm. Both methods identified RpS8 as the best suitable reference gene for expression data normalization. We also showed that the use of two reference genes is sufficient to effectively normalize the qRT-PCR data under varying tissues and experimental conditions that we used in B. anynana. Finally, we tested the effect of choosing reference genes with different stability on the normalization of the transcript abundance of a candidate gene involved in olfactory communication in B. anynana, the Fatty Acyl Reductase 2, and we confirmed that using an unstable reference gene can drastically alter the

  18. Selection and validation of reference genes for qRT-PCR expression analysis of candidate genes involved in olfactory communication in the butterfly Bicyclus anynana.

    Science.gov (United States)

    Arun, Alok; Baumlé, Véronique; Amelot, Gaël; Nieberding, Caroline M

    2015-01-01

    Real-time quantitative reverse transcription PCR (qRT-PCR) is a technique widely used to quantify the transcriptional expression level of candidate genes. qRT-PCR requires the selection of one or several suitable reference genes, whose expression profiles remain stable across conditions, to normalize the qRT-PCR expression profiles of candidate genes. Although several butterfly species (Lepidoptera) have become important models in molecular evolutionary ecology, so far no study aimed at identifying reference genes for accurate data normalization for any butterfly is available. The African bush brown butterfly Bicyclus anynana has drawn considerable attention owing to its suitability as a model for evolutionary ecology, and we here provide a maiden extensive study to identify suitable reference gene in this species. We monitored the expression profile of twelve reference genes: eEF-1α, FK506, UBQL40, RpS8, RpS18, HSP, GAPDH, VATPase, ACT3, TBP, eIF2 and G6PD. We tested the stability of their expression profiles in three different tissues (wings, brains, antennae), two developmental stages (pupal and adult) and two sexes (male and female), all of which were subjected to two food treatments (food stress and control feeding ad libitum). The expression stability and ranking of twelve reference genes was assessed using two algorithm-based methods, NormFinder and geNorm. Both methods identified RpS8 as the best suitable reference gene for expression data normalization. We also showed that the use of two reference genes is sufficient to effectively normalize the qRT-PCR data under varying tissues and experimental conditions that we used in B. anynana. Finally, we tested the effect of choosing reference genes with different stability on the normalization of the transcript abundance of a candidate gene involved in olfactory communication in B. anynana, the Fatty Acyl Reductase 2, and we confirmed that using an unstable reference gene can drastically alter the expression

  19. Reference gene selection for qRT-PCR assays in Stellera chamaejasme subjected to abiotic stresses and hormone treatments based on transcriptome datasets.

    Science.gov (United States)

    Liu, Xin; Guan, Huirui; Song, Min; Fu, Yanping; Han, Xiaomin; Lei, Meng; Ren, Jingyu; Guo, Bin; He, Wei; Wei, Yahui

    2018-01-01

    Stellera chamaejasme Linn, an important poisonous plant of the China grassland, is toxic to humans and livestock. The rapid expansion of S. chamaejasme has greatly damaged the grassland ecology and, consequently, seriously endangered the development of animal husbandry. To draft efficient prevention and control measures, it has become more urgent to carry out research on its adaptive and expansion mechanisms in different unfavorable habitats at the genetic level. Quantitative real-time polymerase chain reaction (qRT-PCR) is a widely used technique for studying gene expression at the transcript level; however, qRT-PCR requires reference genes (RGs) as endogenous controls for data normalization and only through appropriate RG selection and qRT-PCR can we guarantee the reliability and robustness of expression studies and RNA-seq data analysis. Unfortunately, little research on the selection of RGs for gene expression data normalization in S. chamaejasme has been reported. In this study, 10 candidate RGs namely, 18S , 60S , CYP , GAPCP1 , GAPDH2 , EF1B , MDH , SAND , TUA1 , and TUA6 , were singled out from the transcriptome database of S. chamaejasme , and their expression stability under three abiotic stresses (drought, cold, and salt) and three hormone treatments (abscisic acid, ABA; gibberellin, GA; ethephon, ETH) were estimated with the programs geNorm, NormFinder, and BestKeeper. Our results showed that GAPCP1 and EF1B were the best combination for the three abiotic stresses, whereas TUA6 and SAND , TUA1 and CYP , GAPDH2 and 60S were the best choices for ABA, GA, and ETH treatment, respectively. Moreover, GAPCP1 and 60S were assessed to be the best combination for all samples, and 18S was the least stable RG for use as an internal control in all of the experimental subsets. The expression patterns of two target genes ( P5CS2 and GI ) further verified that the RGs that we selected were suitable for gene expression normalization. This work is the first attempt to

  20. Reference gene selection for qRT-PCR assays in Stellera chamaejasme subjected to abiotic stresses and hormone treatments based on transcriptome datasets

    Directory of Open Access Journals (Sweden)

    Xin Liu

    2018-04-01

    Full Text Available Background Stellera chamaejasme Linn, an important poisonous plant of the China grassland, is toxic to humans and livestock. The rapid expansion of S. chamaejasme has greatly damaged the grassland ecology and, consequently, seriously endangered the development of animal husbandry. To draft efficient prevention and control measures, it has become more urgent to carry out research on its adaptive and expansion mechanisms in different unfavorable habitats at the genetic level. Quantitative real-time polymerase chain reaction (qRT-PCR is a widely used technique for studying gene expression at the transcript level; however, qRT-PCR requires reference genes (RGs as endogenous controls for data normalization and only through appropriate RG selection and qRT-PCR can we guarantee the reliability and robustness of expression studies and RNA-seq data analysis. Unfortunately, little research on the selection of RGs for gene expression data normalization in S. chamaejasme has been reported. Method In this study, 10 candidate RGs namely, 18S, 60S, CYP, GAPCP1, GAPDH2, EF1B, MDH, SAND, TUA1, and TUA6, were singled out from the transcriptome database of S. chamaejasme, and their expression stability under three abiotic stresses (drought, cold, and salt and three hormone treatments (abscisic acid, ABA; gibberellin, GA; ethephon, ETH were estimated with the programs geNorm, NormFinder, and BestKeeper. Result Our results showed that GAPCP1 and EF1B were the best combination for the three abiotic stresses, whereas TUA6 and SAND, TUA1 and CYP, GAPDH2 and 60S were the best choices for ABA, GA, and ETH treatment, respectively. Moreover, GAPCP1 and 60S were assessed to be the best combination for all samples, and 18S was the least stable RG for use as an internal control in all of the experimental subsets. The expression patterns of two target genes (P5CS2 and GI further verified that the RGs that we selected were suitable for gene expression normalization. Discussion

  1. Investigations on abundance and activity of microbial sponge symbionts using quantitative real - time PCR

    DEFF Research Database (Denmark)

    Kumala, Lars; Hentschel, Ute; Bayer, Kristina

    Marine sponges are hosts to dense and diverse microbial consortia that are likely to play a key role in the metabolic processes of the host sponge due to their enormous abundance. Common symbioses between nitrogen transforming microorganisms and sponges indicate complex nitrogen cycling within...... the host. Of particular interest is determining the community structure and function of microbial symbionts in order to gain deeper insight into host-symbiont interactions. We investigated the abundance and activity of microbial symbionts in two Mediterranean sponge species using quantitative real-time PCR....... An absolute quantification of functional genes and transcripts in archaeal and bacterial symbionts was conducted to determine their involvement in nitrification and denitrification, comparing the low microbial abundance (LMA) sponge Dysidea avara with the high microbial abundance (HMA) representative Aplysina...

  2. Comparison of high and low virulence serotypes of Actinobacillus pleuropneumoniae by quantitative real-time PCR

    DEFF Research Database (Denmark)

    Schou, Kirstine Klitgaard; Angen, Øystein; Boye, Mette

    PCR data. Preliminary results showed that in both serotype 2 and serotype 6, the toxin producing gene apxIV was the most highly expressed of the investigated genes. The major difference observed between the two serotypes was that apfA, involved in type IV vili production, was significantly upregulated...... of high virulence while serotype 6 strains are normally found to be less pathogenic. To gain an understanding of the differential virulence of serotype 2 and 6, the expression of a panel of Ap genes during infection of porcine epithelial lung cells (SJPL) were examined by quantitative real-time PCR (q...... to be important for early establishment of the bacteria in the host were examined by qPCR. The genes examined were apfA, coding for a subunit of Type IV pili, kdsB coding for a gene involved in lippopolysacceride biosynthesis, and pgaB which is involved in biofilm formation, all three believed to be important...

  3. Fast real-time polymerase chain reaction for quantitative detection of Lactobacillus delbrueckii bacteriophages in milk.

    Science.gov (United States)

    Martín, Maria Cruz; del Rio, Beatriz; Martínez, Noelia; Magadán, Alfonso H; Alvarez, Miguel A

    2008-12-01

    One of the main microbiological problems of the dairy industry is the susceptibility of starter bacteria to virus infections. Lactobacillus delbrueckii, a component of thermophilic starter cultures used in the manufacture of several fermented dairy products, including yogurt, is also sensitive to bacteriophage attacks. To avoid the problems associated with these viruses, quick and sensitive detection methods are necessary. In the present study, a fast real-time quantitative polymerase chain reaction assay for the direct detection and quantification of L. delbrueckii phages in milk was developed. A set of primers and a TaqMan MGB probe was designed, based on the lysin gene sequence of different L. delbrueckii phages. The results show the proposed method to be a rapid (total processing time 30 min), specific and highly sensitive technique for detecting L. delbrueckii phages in milk.

  4. Real-time and quantitative isotropic spatial resolution susceptibility imaging for magnetic nanoparticles

    Science.gov (United States)

    Pi, Shiqiang; Liu, Wenzhong; Jiang, Tao

    2018-03-01

    The magnetic transparency of biological tissue allows the magnetic nanoparticle (MNP) to be a promising functional sensor and contrast agent. The complex susceptibility of MNPs, strongly influenced by particle concentration, excitation magnetic field and their surrounding microenvironment, provides significant implications for biomedical applications. Therefore, magnetic susceptibility imaging of high spatial resolution will give more detailed information during the process of MNP-aided diagnosis and therapy. In this study, we present a novel spatial magnetic susceptibility extraction method for MNPs under a gradient magnetic field, a low-frequency drive magnetic field, and a weak strength high-frequency magnetic field. Based on this novel method, a magnetic particle susceptibility imaging (MPSI) of millimeter-level spatial resolution (<3 mm) was achieved using our homemade imaging system. Corroborated by the experimental results, the MPSI shows real-time (1 s per frame acquisition) and quantitative abilities, and isotropic high resolution.

  5. Quantitative analysis of the dystrophin gene by real-time PCR

    Directory of Open Access Journals (Sweden)

    Maksimovic Nela

    2012-01-01

    Full Text Available Duchenne and Becker muscular dystrophy (DMD/BMD are severe X-linked neuromuscular disorders caused by mutations in the dystrophin gene. Our aim was to optimize a quantitative real-time PCR method based on SYBR® Green I chemistry for routine diagnostics of DMD/BMD deletion carriers. Twenty female relatives of DMD/BMD patients with previously detected partial gene deletions were studied. The relative quantity of the target exons was calculated by a comparative threshold cycle method (ΔΔCt. The carrier status of all subjects was successfully determined. The gene dosage ratio for non-carriers was 1.07±0.20, and for carriers 0.56±0.11. This assay proved to be simple, rapid, reliable and cost-effective.

  6. Biomarker discovery for colon cancer using a 761 gene RT-PCR assay

    Directory of Open Access Journals (Sweden)

    Hackett James R

    2007-08-01

    Full Text Available Abstract Background Reverse transcription PCR (RT-PCR is widely recognized to be the gold standard method for quantifying gene expression. Studies using RT-PCR technology as a discovery tool have historically been limited to relatively small gene sets compared to other gene expression platforms such as microarrays. We have recently shown that TaqMan® RT-PCR can be scaled up to profile expression for 192 genes in fixed paraffin-embedded (FPE clinical study tumor specimens. This technology has also been used to develop and commercialize a widely used clinical test for breast cancer prognosis and prediction, the Onco typeDX™ assay. A similar need exists in colon cancer for a test that provides information on the likelihood of disease recurrence in colon cancer (prognosis and the likelihood of tumor response to standard chemotherapy regimens (prediction. We have now scaled our RT-PCR assay to efficiently screen 761 biomarkers across hundreds of patient samples and applied this process to biomarker discovery in colon cancer. This screening strategy remains attractive due to the inherent advantages of maintaining platform consistency from discovery through clinical application. Results RNA was extracted from formalin fixed paraffin embedded (FPE tissue, as old as 28 years, from 354 patients enrolled in NSABP C-01 and C-02 colon cancer studies. Multiplexed reverse transcription reactions were performed using a gene specific primer pool containing 761 unique primers. PCR was performed as independent TaqMan® reactions for each candidate gene. Hierarchal clustering demonstrates that genes expected to co-express form obvious, distinct and in certain cases very tightly correlated clusters, validating the reliability of this technical approach to biomarker discovery. Conclusion We have developed a high throughput, quantitatively precise multi-analyte gene expression platform for biomarker discovery that approaches low density DNA arrays in numbers of

  7. Study of the Efficacy of Real Time-PCR Method for Amikacin Determination Using Microbial Assay

    Directory of Open Access Journals (Sweden)

    Farzaneh Lotfipour

    2015-06-01

    Full Text Available Purpose: Microbial assay is used to determine the potency of antibiotics and vitamins. In spite of its advantages like simplicity and easiness, and to reveal the slight changes in the molecules, the microbial assay suffers from significant limitations; these methods are of lower specificity, accuracy and sensitivity. The objective of the present study is to evaluate the efficacy of real time-PCR technique in comparison with turbidimetric method for microbial assay of amikacin. Methods: Microbial determination of amikacin by turbidimetric method was performed according to USP. Also amikacin concentrations were determined by microbial assay using taq-man quantitative PCR method. Standard curves in different concentration for both methods were plotted and method validation parameters of linearity, precision and accuracy were calculated using statistical procedures. Results: The RT-PCR method was linear in the wider concentration range (5.12 – 38.08 for RT-PCR versus 8.00 – 30.47 for turbidimetric method with a better correlation coefficient (0.976 for RT-PCR versus 0.958 for turbidimetric method. RT-PCR method with LOQ of 5.12 ng/ml was more sensitive than turbidimetric method with LOQ of 8.00 ng/ml and the former could detect and quantify low concentrations of amikacin. The results of accuracy and precision evaluation showed that the RT-PCR method was accurate and precise in all of the tested concentration. Conclusion: The RT-PCR method described here provided an accurate and precise technique for measurement of amikacin potency and it can be a candidate for microbial determination of the antibiotics with the same test organism.

  8. A Multiplex RT-PCR Assay for S. aureus, L. monocytogenes, and Salmonella spp. Detection in Raw Milk with Pre-enrichment

    Directory of Open Access Journals (Sweden)

    Tian Ding

    2017-05-01

    Full Text Available This study firstly developed a multiplex real-time PCR (RT-PCR technique combined with a pre-enrichment step to simultaneously detect Staphylococcus aureus (S. aureus, Listeria monocytogenes (L. monocytogenes and Salmonella spp. in raw milk and the dairy farm environment (feces, soil, feed, water in one reaction. Brain heart infusion (BHI broth was selected for the enrichment step to increase the density of the target bacteria by using an incubation of 4 h before multiplex RT-PCR. The results showed that the detection limit of the multiplex real-time assay was approximately 102 CFU/mL for pure cultures and artificially contaminated milk without enrichment, while 12, 14, and 10 CFU/25 mL, respectively, for S. aureus, L. monocytogenes, and Salmonella spp. after pre-enrichment. The newly developed multiplex RT-PCR assay was applied to 46 dairy farm environmental samples and raw milk samples covering a wide variety of sample types. The results demonstrated that the multiplex RT-PCR assay coupled with the BHI enrichment broth was suitable for the simultaneous screening of S. aureus, L. monocytogenes, and Salmonella spp. in the pasture environment and in raw milk. The multiplex RT-PCR assay clearly and successfully shortened the total detection time and reduced labor compared to conventional culture-based methods for testing natural samples.

  9. Verus: A Tool for Quantitative Analysis of Finite-State Real-Time Systems.

    Science.gov (United States)

    1996-08-12

    Symbolic model checking is a technique for verifying finite-state concurrent systems that has been extended to handle real - time systems . Models with...up to 10(exp 30) states can often be verified in minutes. In this paper, we present a new tool to analyze real - time systems , based on this technique...We have designed a language, called Verus, for the description of real - time systems . Such a description is compiled into a state-transition graph and

  10. Oxidative stress provokes distinct transcriptional responses in the stress-tolerant atr7 and stress-sensitive loh2 Arabidopsis thaliana mutants as revealed by multi-parallel quantitative real-time PCR analysis of ROS marker and antioxidant genes.

    Science.gov (United States)

    Mehterov, Nikolay; Balazadeh, Salma; Hille, Jacques; Toneva, Valentina; Mueller-Roeber, Bernd; Gechev, Tsanko

    2012-10-01

    The Arabidopsis thaliana atr7 mutant is tolerant to oxidative stress induced by paraquat (PQ) or the catalase inhibitor aminotriazole (AT), while its original background loh2 and wild-type plants are sensitive. Both, AT and PQ, which stimulate the intracellular formation of H₂O₂ or superoxide anions, respectively, trigger cell death in loh2 but do not lead to visible damage in atr7. To study gene expression during oxidative stress and ROS-induced programmed cell death, two platforms for multi-parallel quantitative real-time PCR (qRT-PCR) analysis of 217 antioxidant and 180 ROS marker genes were employed. The qRT-PCR analyses revealed AT- and PQ-induced expression of many ROS-responsive genes mainly in loh2, confirming that an oxidative burst plays a role in the activation of the cell death in this mutant. Some of the genes were specifically regulated by either AT or PQ, serving as markers for particular types of ROS. Genes significantly induced by both AT and PQ in loh2 included transcription factors (ANAC042/JUB1, ANAC102, DREB19, HSFA2, RRTF1, ZAT10, ZAT12, ethylene-responsive factors), signaling compounds, ferritins, alternative oxidases, and antioxidant enzymes. Many of these genes were upregulated in atr7 compared to loh2 under non-stress conditions at the first time point, indicating that higher basal levels of ROS and higher antioxidant capacity in atr7 are responsible for the enhanced tolerance to oxidative stress and suggesting a possible tolerance against multiple stresses of this mutant. Copyright © 2012 Elsevier Masson SAS. All rights reserved.

  11. Expression patterns of WRKY genes in di-haploid Populus simonii × P. nigra in response to salinity stress revealed by quantitative real-time PCR and RNA sequencing.

    Science.gov (United States)

    Wang, Shengji; Wang, Jiying; Yao, Wenjing; Zhou, Boru; Li, Renhua; Jiang, Tingbo

    2014-10-01

    Spatio-temporal expression patterns of 13 out of 119 poplar WRKY genes indicated dynamic and tissue-specific roles of WRKY family proteins in salinity stress tolerance. To understand the expression patterns of poplar WRKY genes under salinity stress, 51 of the 119 WRKY genes were selected from di-haploid Populus simonii × P. nigra by quantitative real-time PCR (qRT-PCR). We used qRT-PCR to profile the expression of the top 13 genes under salinity stress across seven time points, and employed RNA-Seq platforms to cross-validate it. Results demonstrated that all the 13 WRKY genes were expressed in root, stem, and leaf tissues, but their expression levels and overall patterns varied notably in these tissues. Regarding overall gene expression in roots, the 13 genes were significantly highly expressed at all six time points after the treatment, reaching the plateau of expression at hour 9. In leaves, the 13 genes were similarly up-regulated from 3 to 12 h in response to NaCl treatment. In stems, however, expression levels of the 13 genes did not show significant changes after the NaCl treatment. Regarding individual gene expression across the time points and the three tissues, the 13 genes can be classified into three clusters: the lowly expressed Cluster 1 containing PthWRKY28, 45 and 105; intermediately expressed Clusters 2 including PthWRKY56, 88 and 116; and highly expressed Cluster 3 consisting of PthWRKY41, 44, 51, 61, 62, 75 and 106. In general, genes in Cluster 2 and 3 displayed a dynamic pattern of "induced amplification-recovering", suggesting that these WRKY genes and corresponding pathways may play a critical role in mediating salt response and tolerance in a dynamic and tissue-specific manner.

  12. Real-time elastography with a novel quantitative technology for assessment of liver fibrosis in chronic hepatitis B

    International Nuclear Information System (INIS)

    Wang Juan; Guo Long; Shi Xiuying; Pan Wenqian; Bai Yunfei; Ai Hong

    2012-01-01

    Background: The accurate evaluation of liver fibrosis stage is important in determining the treatment strategy. The limitations of percutaneous liver biopsy as the gold standard are obvious for invasion. Real-time elastography with conventional ultrasound probes and a new quantitative technology for diffuse histological lesion is a novel approach for staging of liver fibrosis. Purpose: This study aimed to evaluate the value of real-time tissue elastography with a new quantitative technology for the assessment of liver fibrosis stage. Materials and methods: Real-time elastography was performed in 55 patients with liver fibrosis and chronic hepatitis B and in 20 healthy volunteers. Eleven parameters for every patient in colorcode image obtained from the real-time elastography were analyzed with principal components analysis. We analyzed the correlation between elasticity index and liver fibrosis stage and the accuracy of real-time elastography for liver fibrosis staging. Additionally, aspartate transaminase-to-platelet ratio index was also included in the analysis. Results: The Spearman's correlation coefficient between the elasticity index and the histologic fibrosis stage was 0.81, which is highly significant (p 0.05), respectively. Conclusions: Real-time elastography with a new quantitative technology for diffuse histological lesion is a new and promising sonography-based noninvasive method for the assessment of liver fibrosis in patients with chronic hepatitis B.

  13. Semi-Nested Real-Time Reverse Transcription Polymerase Chain Reaction Methods for the Successful Quantitation of Cytokeratin mRNA Expression Levels for the Subtyping of Non-Small-Cell Lung Carcinoma Using Paraffin-Embedded and Microdissected Lung Biopsy Specimens

    International Nuclear Information System (INIS)

    Nakanishi, Yoko; Shimizu, Tetsuo; Tsujino, Ichiro; Obana, Yukari; Seki, Toshimi; Fuchinoue, Fumi; Ohni, Sumie; Oinuma, Toshinori; Kusumi, Yoshiaki; Yamada, Tsutomu; Takahashi, Noriaki; Hashimoto, Shu; Nemoto, Norimichi

    2013-01-01

    In patients with inoperable advanced non-small cell lung carcinomas (NSCLCs), histological subtyping using small-mount biopsy specimens was often required to decide the indications for drug treatment. The aim of this study was to assess the utility of highly sensitive mRNA quantitation for the subtyping of advanced NSCLC using small formalin fixing and paraffin embedding (FFPE) biopsy samples. Cytokeratin (CK) 6, CK7, CK14, CK18, and thyroid transcription factor (TTF)-1 mRNA expression levels were measured using semi-nested real-time quantitative (snq) reverse-transcribed polymerase chain reaction (RT-PCR) in microdissected tumor cells collected from 52 lung biopsies. Our results using the present snqRT-PCR method showed an improvement in mRNA quantitation from small FFPE samples, and the mRNA expression level using snqRT-PCR was correlated with the immunohistochemical protein expression level. CK7, CK18, and TTF-1 mRNA were expressed at significantly higher levels (P<0.05) in adenocarcinoma (AD) than in squamous cell carcinoma (SQ), while CK6 and CK14 mRNA expression was significantly higher (P<0.05) in SQ than in AD. Each histology-specific CK, particularly CK18 in AD and CK6 in SQ, were shown to be correlated with a poor prognosis (P=0.02, 0.02, respectively). Our results demonstrated that a quantitative CK subtype mRNA analysis from lung biopsy samples can be useful for predicting the histology subtype and prognosis of advanced NSCLC

  14. Detection of Ophiocordyceps sinensis in soil by quantitative real-time PCR.

    Science.gov (United States)

    Peng, Qingyun; Zhong, Xin; Lei, Wei; Zhang, Guren; Liu, Xin

    2013-03-01

    Ophiocordyceps sinensis, one of the best known entomopathogenic fungi in traditional Chinese medicine, parasitizes larvae of the moth genus Thitarodes, which lives in soil tunnels. However, little is known about the spatial distribution of O. sinensis in the soil. We established a protocol for DNA extraction, purification, and quantification of O. sinensis in soil with quantitative real-time PCR targeting the internal transcribed spacer region. The method was assessed using 34 soil samples from Tibet. No inhibitory effects in purified soil DNA extracts were detected. The standard curve method for absolute DNA quantification generated crossing point values that were strongly and linearly correlated to the log10 of the initial amount of O. sinensis genomic DNA (r(2) = 0.999) over 7 orders of magnitude (4 × 10(1) to 4 × 10(7) fg). The amplification efficiency and y-intercept value of the standard curve were 1.953 and 37.70, respectively. The amount of O. sinensis genomic DNA decreased with increasing soil depth and horizontal distance from a sclerotium (P protocol is rapid, specific, sensitive, and provides a powerful tool for quantification of O. sinensis from soil.

  15. Expression analysis of fusarium wilt resistance gene in melon by real-time quantitative pcr

    International Nuclear Information System (INIS)

    Wang, X.; Xu, B.; Zhao, L.; Gao, P.; Luan, F.

    2014-01-01

    Melon Actin gene was used as a reference gene, to explore the gene expression profiles of the Fom-2 gene in roots, stems, and leaves of melon MR-1 under induction by Fusarium oxysporum f. sp. melonis. Monitoring using real-time quantitative PCR showed similar accumulation patterns of Fom-2 in roots, stems, and leaves over the observation period of 1 to 11 days; the expression level in stems was the highest. The expression of the Fom-2 gene was strengthened by the prolongation of induction time. In stems, the expression of Fom-2 was 5.737 times higher than in the control at three days; in roots, expression of Fom-2 was 5.617 times higher than in the control at five days. Similarly, the expression of Fom-2 in leaves obviously increased. It was 4.441 times higher than in the control at 5 days. The expression of Fom-2 was non-tissue specific, up-regulated under induction by Fusarium, and related to early resistance to Fusarium wilt. (author)

  16. Quantitative Real-Time PCR using the Thermo Scientific Solaris qPCR Assay

    Science.gov (United States)

    Ogrean, Christy; Jackson, Ben; Covino, James

    2010-01-01

    The Solaris qPCR Gene Expression Assay is a novel type of primer/probe set, designed to simplify the qPCR process while maintaining the sensitivity and accuracy of the assay. These primer/probe sets are pre-designed to >98% of the human and mouse genomes and feature significant improvements from previously available technologies. These improvements were made possible by virtue of a novel design algorithm, developed by Thermo Scientific bioinformatics experts. Several convenient features have been incorporated into the Solaris qPCR Assay to streamline the process of performing quantitative real-time PCR. First, the protocol is similar to commonly employed alternatives, so the methods used during qPCR are likely to be familiar. Second, the master mix is blue, which makes setting the qPCR reactions easier to track. Third, the thermal cycling conditions are the same for all assays (genes), making it possible to run many samples at a time and reducing the potential for error. Finally, the probe and primer sequence information are provided, simplifying the publication process. Here, we demonstrate how to obtain the appropriate Solaris reagents using the GENEius product search feature found on the ordering web site (www.thermo.com/solaris) and how to use the Solaris reagents for performing qPCR using the standard curve method. PMID:20567213

  17. Species identification of Cannabis sativa using real-time quantitative PCR (qPCR).

    Science.gov (United States)

    Johnson, Christopher E; Premasuthan, Amritha; Satkoski Trask, Jessica; Kanthaswamy, Sree

    2013-03-01

    Most narcotics-related cases in the United States involve Cannabis sativa. Material is typically identified based on the cystolithic hairs on the leaves and with chemical tests to identify of the presence of cannabinoids. Suspect seeds are germinated into a viable plant so that morphological and chemical tests can be conducted. Seed germination, however, causes undue analytical delays. DNA analyses that involve the chloroplast and nuclear genomes have been developed for identification of C. sativa materials, but they require several nanograms of template DNA. Using the trnL 3' exon-trnF intragenic spacer regions within the C. sativa chloroplast, we have developed a real-time quantitative PCR assay that is capable of identifying picogram amounts of chloroplast DNA for species determination of suspected C. sativa material. This assay provides forensic science laboratories with a quick and reliable method to identify an unknown sample as C. sativa. © 2013 American Academy of Forensic Sciences.

  18. Identification of Reference Genes for Normalizing Quantitative Real-Time PCR in Urechis unicinctus

    Science.gov (United States)

    Bai, Yajiao; Zhou, Di; Wei, Maokai; Xie, Yueyang; Gao, Beibei; Qin, Zhenkui; Zhang, Zhifeng

    2018-06-01

    The reverse transcription quantitative real-time PCR (RT-qPCR) has become one of the most important techniques of studying gene expression. A set of valid reference genes are essential for the accurate normalization of data. In this study, five candidate genes were analyzed with geNorm, NormFinder, BestKeeper and ΔCt methods to identify the genes stably expressed in echiuran Urechis unicinctus, an important commercial marine benthic worm, under abiotic (sulfide stress) and normal (adult tissues, embryos and larvae at different development stages) conditions. The comprehensive results indicated that the expression of TBP was the most stable at sulfide stress and in developmental process, while the expression of EF- 1- α was the most stable at sulfide stress and in various tissues. TBP and EF- 1- α were recommended as a suitable reference gene combination to accurately normalize the expression of target genes at sulfide stress; and EF- 1- α, TBP and TUB were considered as a potential reference gene combination for normalizing the expression of target genes in different tissues. No suitable gene combination was obtained among these five candidate genes for normalizing the expression of target genes for developmental process of U. unicinctus. Our results provided a valuable support for quantifying gene expression using RT-qPCR in U. unicinctus.

  19. Identification of four squid species by quantitative real-time polymerase chain reaction.

    Science.gov (United States)

    Ye, Jian; Feng, Junli; Liu, Shasha; Zhang, Yanping; Jiang, Xiaona; Dai, Zhiyuan

    2016-02-01

    Squids are distributed worldwide, including many species of commercial importance, and they are often made into varieties of flavor foods. The rapid identification methods for squid species especially their processed products, however, have not been well developed. In this study, quantitative real-time PCR (qPCR) systems based on specific primers and TaqMan probes have been established for rapid and accurate identification of four common squid species (Ommastrephes bartramii, Dosidicus gigas, Illex argentinus, Todarodes pacificus) in Chinese domestic market. After analyzing mitochondrial genes reported in GenBank, the mitochondrial cytochrome b (Cytb) gene was selected for O. bartramii detection, cytochrome c oxidase subunit I (COI) gene for D. gigas and T. Pacificus detection, ATPase subunit 6 (ATPase 6) gene for I. Argentinus detection, and 12S ribosomal RNA (12S rDNA) gene for designing Ommastrephidae-specific primers and probe. As a result, all the TaqMan systems are of good performance, and efficiency of each reaction was calculated by making standard curves. This method could detect target species either in single or mixed squid specimen, and it was applied to identify 12 squid processed products successfully. Thus, it would play an important role in fulfilling labeling regulations and squid fishery control. Copyright © 2016 Elsevier Ltd. All rights reserved.

  20. A real-time, quantitative PCR protocol for assessing the relative parasitemia of Leucocytozoon in waterfowl

    Science.gov (United States)

    Smith, Matthew M.; Schmutz, Joel A.; Apelgren, Chloe; Ramey, Andy M.

    2015-01-01

    Microscopic examination of blood smears can be effective at diagnosing and quantifying hematozoa infections. However, this method requires highly trained observers, is time consuming, and may be inaccurate for detection of infections at low levels of parasitemia. To develop a molecular methodology for identifying and quantifying Leucocytozoon parasite infection in wild waterfowl (Anseriformes), we designed a real-time, quantitative PCR protocol to amplify Leucocytozoon mitochondrial DNA using TaqMan fluorogenic probes and validated our methodology using blood samples collected from waterfowl in interior Alaska during late summer and autumn (n = 105). By comparing our qPCR results to those derived from a widely used nested PCR protocol, we determined that our assay showed high levels of sensitivity (91%) and specificity (100%) in detecting Leucocytozoon DNA from host blood samples. Additionally, results of a linear regression revealed significant correlation between the raw measure of parasitemia produced by our qPCR assay (Ct values) and numbers of parasites observed on blood smears (R2 = 0.694, P = 0.003), indicating that our assay can reliably determine the relative parasitemia levels among samples. This methodology provides a powerful new tool for studies assessing effects of haemosporidian infection in wild avian species.

  1. GETPrime: a gene- or transcript-specific primer database for quantitative real-time PCR.

    Science.gov (United States)

    Gubelmann, Carine; Gattiker, Alexandre; Massouras, Andreas; Hens, Korneel; David, Fabrice; Decouttere, Frederik; Rougemont, Jacques; Deplancke, Bart

    2011-01-01

    The vast majority of genes in humans and other organisms undergo alternative splicing, yet the biological function of splice variants is still very poorly understood in large part because of the lack of simple tools that can map the expression profiles and patterns of these variants with high sensitivity. High-throughput quantitative real-time polymerase chain reaction (qPCR) is an ideal technique to accurately quantify nucleic acid sequences including splice variants. However, currently available primer design programs do not distinguish between splice variants and also differ substantially in overall quality, functionality or throughput mode. Here, we present GETPrime, a primer database supported by a novel platform that uniquely combines and automates several features critical for optimal qPCR primer design. These include the consideration of all gene splice variants to enable either gene-specific (covering the majority of splice variants) or transcript-specific (covering one splice variant) expression profiling, primer specificity validation, automated best primer pair selection according to strict criteria and graphical visualization of the latter primer pairs within their genomic context. GETPrime primers have been extensively validated experimentally, demonstrating high transcript specificity in complex samples. Thus, the free-access, user-friendly GETPrime database allows fast primer retrieval and visualization for genes or groups of genes of most common model organisms, and is available at http://updepla1srv1.epfl.ch/getprime/. Database URL: http://deplanckelab.epfl.ch.

  2. [Quantitative fluorogenic real-time PCR assay for respiratory syncytial virus detection].

    Science.gov (United States)

    Zhang, Qi-wei; You, Shang-you; Sun, Ji-min; Wu, Qi; Yu, Chun-hua; Zhang, Chu-yu

    2005-07-01

    To Establish a rapid and objective quantitative fluorogenic real-time PCR assay for early detection of human respiratory syncytial virus (hRSV). Two pairs of primers and one TaqMan Fluorogenic probe that are specific for the recognition of the most conservative N gene of hRSV for virus detection with LighCycler PCR in 93 nasopharyngeal secretion specimens collected from infants and young children. The assay was compared with virus isolation, routine PCR, nested PCR, and enzyme-linked immunosorbent assay (ELISA). This TaqMan assay had a sensitivity of 1 x 10(2) cDNA copies/microl with a dynamic range between 1 x 10(2) and 1 x 10(7) cDNA copies/microl, which was the same as that of nested PCR, but 10 times more sensitive than routine PCR. The specificity of the assay was evaluated by comparing hRSV with polivirus type 1, coxsackie virus type 2, influenza A, influenza B and adenovirus type 7. A PCR product of the expected size (195 bp) was produced and fluorescence signal detected for hRSV, but not for any of the other viruses. The results in LightCycler and Rotor-Gene instrument were consistent. Forty-four specimens (43.9%) were hRSV-positive with this assay and 4 (4/93,4.3%) were hRSV-positive with ELISA, showing rather low correlation between the two methods. No visible relation was found between the concentration of hRSV RNA and severity of the disease. This assay is rapid, sensitive, specific and quantitative, and has the potential of wide application for early diagnosis of hRSV infection and evaluation of the therapeutic effect.

  3. A method for accurate detection of genomic microdeletions using real-time quantitative PCR

    Directory of Open Access Journals (Sweden)

    Bassett Anne S

    2005-12-01

    Full Text Available Abstract Background Quantitative Polymerase Chain Reaction (qPCR is a well-established method for quantifying levels of gene expression, but has not been routinely applied to the detection of constitutional copy number alterations of human genomic DNA. Microdeletions or microduplications of the human genome are associated with a variety of genetic disorders. Although, clinical laboratories routinely use fluorescence in situ hybridization (FISH to identify such cryptic genomic alterations, there remains a significant number of individuals in which constitutional genomic imbalance is suspected, based on clinical parameters, but cannot be readily detected using current cytogenetic techniques. Results In this study, a novel application for real-time qPCR is presented that can be used to reproducibly detect chromosomal microdeletions and microduplications. This approach was applied to DNA from a series of patient samples and controls to validate genomic copy number alteration at cytoband 22q11. The study group comprised 12 patients with clinical symptoms of chromosome 22q11 deletion syndrome (22q11DS, 1 patient trisomic for 22q11 and 4 normal controls. 6 of the patients (group 1 had known hemizygous deletions, as detected by standard diagnostic FISH, whilst the remaining 6 patients (group 2 were classified as 22q11DS negative using the clinical FISH assay. Screening of the patients and controls with a set of 10 real time qPCR primers, spanning the 22q11.2-deleted region and flanking sequence, confirmed the FISH assay results for all patients with 100% concordance. Moreover, this qPCR enabled a refinement of the region of deletion at 22q11. Analysis of DNA from chromosome 22 trisomic sample demonstrated genomic duplication within 22q11. Conclusion In this paper we present a qPCR approach for the detection of chromosomal microdeletions and microduplications. The strategic use of in silico modelling for qPCR primer design to avoid regions of repetitive

  4. Clinical utility of RT-PCR in assessing HER 2 gene expression versus traditional IHC and FISH in breast cancer patients.

    Science.gov (United States)

    Suryavanshi, Moushumi; Mehta, Anurag; Jaipuria, Jiten; Kumar, Dushyant; Vishwakarma, Gayatri; Panigrahi, Manoj Kumar; Verma, Haristuti; Saifi, Mumtaz; Sharma, Sanjeev; Tandon, Simran; Doval, D C; Das, Bhudev C

    2018-02-09

    IHC and FISH are used for categorizing HER 2 status in breast cancer at the protein and DNA level, respectively. HER 2 expression at the RNA level is quantitative, cheaper, easier to standardize and free from interobserver variation. 115 consecutive patients were tested by IHC, FISH and RT-PCR (test cohort). Assuming FISH result to be the response variable, ROC curves for RT-PCR ratio were analyzed to label HER 2 negative, equivocal and positive cases as RT-PCR score 1, 2 and 3, respectively. Inter-relationships between RT-PCR, IHC and FISH were defined. 'Clinical benefit' of a test was defined as proportion of patients labeled unequivocally as HER 2 positive or negative. Population for 1 year was simulated constraint to previous reports of HER 2 positivity and IHC category distribution by a meta-analysis of previous studies that evaluated concordance between IHC and FISH to determine HER 2 status (simulation cohort). Four diagnostic pathways in the simulation cohort were defined-(1) initial IHC, followed by FISH (conventional pathway); (2) initial RT-PCR, followed by FISH; (3) initial IHC, followed by RT-PCR and then by FISH; (4) initial RT-PCR, followed by IHC and then by FISH. The clinical benefit of IHC and RT-PCR in the four pathways was analyzed and sensitivity analysis for incremental cost-effectiveness ratio and cost-benefit comapring RT-PCR against IHC, both as first-line tests and among those with IHC score 2 as a reflex second-line test was performed by the Monte Carlo technique. 115 patients comprised the study population. While none with IHC score of 0 or 1 was FISH positive for HER 2, all cases with IHC score of 3 were FISH positive. 43 cases were assigned IHC score of 2. Thus, 72 patients benefited from the initial IHC testing [clinical benefit 62.6%], with the overall concordance between IHC and FISH being 100% for those with IHC score of 0, 1 and 3 (conclusive IHC categories). For RT-PCR with 100% concordance, 15.7% (115-97 = 18) patients

  5. Ultrasensitive quantitation of human papillomavirus type 16 E6 oncogene sequences by nested real time PCR

    Directory of Open Access Journals (Sweden)

    López-Revilla Rubén

    2010-05-01

    Full Text Available Abstract Background We have developed an ultrasensitive method based on conventional PCR preamplification followed by nested amplification through real time PCR (qPCR in the presence of the DNA intercalating agent EvaGreen. Results Amplification mixtures calibrated with a known number of pHV101 copies carrying a 645 base pair (bp-long insert of the human papillomavirus type 16 (HPV16 E6 oncogene were used to generate the E6-1 amplicon of 645 bp by conventional PCR and then the E6-2 amplicon of 237 bp by nested qPCR. Direct and nested qPCR mixtures for E6-2 amplification corresponding to 2.5 × 102-2.5 × 106 initial pHV101 copies had threshold cycle (Ct values in the ranges of 18.7-29.0 and 10.0-25.0, respectively. The Ct of qPCR mixtures prepared with 1/50 volumes of preamplified mixtures containing 50 ng of DNA of the SiHa cell line (derived from an invasive cervical cancer with one HPV16 genome per cell was 19.9. Thermal fluorescence extinction profiles of E6-2 amplicons generated from pHV101 and SiHa DNA were identical, with a peak at 85.5°C. Conclusions Our method based on conventional preamplification for 15 cycles increased 10,750 times the sensitivity of nested qPCR for the quantitation of the E6 viral oncogene and confirmed that the SiHa cell line contains one E6-HPV16 copy per cell.

  6. The quantification of spermatozoa by real-time quantitative PCR, spectrophotometry, and spermatophore cap size.

    Science.gov (United States)

    Doyle, Jacqueline M; McCormick, Cory R; DeWoody, J Andrew

    2011-01-01

    Many animals, such as crustaceans, insects, and salamanders, package their sperm into spermatophores, and the number of spermatozoa contained in a spermatophore is relevant to studies of sexual selection and sperm competition. We used two molecular methods, real-time quantitative polymerase chain reaction (RT-qPCR) and spectrophotometry, to estimate sperm numbers from spermatophores. First, we designed gene-specific primers that produced a single amplicon in four species of ambystomatid salamanders. A standard curve generated from cloned amplicons revealed a strong positive relationship between template DNA quantity and cycle threshold, suggesting that RT-qPCR could be used to quantify sperm in a given sample. We then extracted DNA from multiple Ambystoma maculatum spermatophores, performed RT-qPCR on each sample, and estimated template copy numbers (i.e. sperm number) using the standard curve. Second, we used spectrophotometry to determine the number of sperm per spermatophore by measuring DNA concentration relative to the genome size. We documented a significant positive relationship between the estimates of sperm number based on RT-qPCR and those based on spectrophotometry. When these molecular estimates were compared to spermatophore cap size, which in principle could predict the number of sperm contained in the spermatophore, we also found a significant positive relationship between sperm number and spermatophore cap size. This linear model allows estimates of sperm number strictly from cap size, an approach which could greatly simplify the estimation of sperm number in future studies. These methods may help explain variation in fertilization success where sperm competition is mediated by sperm quantity. © 2010 Blackwell Publishing Ltd.

  7. An integrated real-time diagnostic concept using expert systems, qualitative reasoning and quantitative analysis

    International Nuclear Information System (INIS)

    Edwards, R.M.; Lee, K.Y.; Kumara, S.; Levine, S.H.

    1989-01-01

    An approach for an integrated real-time diagnostic system is being developed for inclusion as an integral part of a power plant automatic control system. In order to participate in control decisions and automatic closed loop operation, the diagnostic system must operate in real-time. Thus far, an expert system with real-time capabilities has been developed and installed on a subsystem at the Experimental Breeder Reactor (EBR-II) in Idaho, USA. Real-time simulation testing of advanced power plant concepts at the Pennsylvania State University has been developed and was used to support the expert system development and installation at EBR-II. Recently, the US National Science Foundation (NSF) and the US Department of Energy (DOE) have funded a Penn State research program to further enhance application of real-time diagnostic systems by pursuing implementation in a distributed power plant computer system including microprocessor based controllers. This paper summarizes past, current, planned, and possible future approaches to power plant diagnostic systems research at Penn State. 34 refs., 9 figs

  8. Evaluation of Rice Resistance to Southern Rice Black-Streaked Dwarf Virus and Rice Ragged Stunt Virus through Combined Field Tests, Quantitative Real-Time PCR, and Proteome Analysis.

    Science.gov (United States)

    Wang, Zhenchao; Yu, Lu; Jin, Linhong; Wang, Wenli; Zhao, Qi; Ran, Longlu; Li, Xiangyang; Chen, Zhuo; Guo, Rong; Wei, Yongtian; Yang, Zhongcheng; Liu, Enlong; Hu, Deyu; Song, Baoan

    2017-02-22

    Diseases caused by southern rice black-streaked dwarf virus (SRBSDV) and rice ragged stunt virus (RRSV) considerably decrease grain yield. Therefore, determining rice cultivars with high resistance to SRBSDV and RRSV is necessary. In this study, rice cultivars with high resistance to SRBSDV and RRSV were evaluated through field trials in Shidian and Mangshi county, Yunnan province, China. SYBR Green I-based quantitative real-time polymerase chain reaction (qRT-PCR) analysis was used to quantitatively detect virus gene expression levels in different rice varieties. The following parameters were applied to evaluate rice resistance: acre yield (A.Y.), incidence of infected plants (I.I.P.), virus load (V.L.), disease index (D.I.), and insect quantity (I.Q.) per 100 clusters. Zhongzheyou1 (Z1) and Liangyou2186 (L2186) were considered the most suitable varieties with integrated higher A.Y., lower I.I.P., V.L., D.I. and I.Q. In order to investigate the mechanism of rice resistance, comparative label-free shotgun liquid chromatography tandem-mass spectrometry (LC-MS/MS) proteomic approaches were applied to comprehensively describe the proteomics of rice varieties' SRBSDV tolerance. Systemic acquired resistance (SAR)-related proteins in Z1 and L2186 may result in the superior resistance of these varieties compared with Fengyouxiangzhan (FYXZ).

  9. A human fecal contamination index for ranking impaired recreational watersusing the HF183 quantitative real-time PCR method

    Science.gov (United States)

    Human fecal pollution of surface water remains a public health concern worldwide. As a result, there is a growing interest in the application of human-associated fecal source identification quantitative real-time PCR (qPCR) technologies for recreational water quality risk managem...

  10. Data Acceptance Criteria for Standardized Human-Associated Fecal Source Identification Quantitative Real-Time PCR Methods

    Science.gov (United States)

    There is a growing interest in the application of human-associated fecal sourceidentification quantitative real-time PCR (qPCR) technologies for water quality management. The transition from a research tool to a standardized protocol requires a high degree of confidence in data q...

  11. Quantitation of RHD by real-time polymerase chain reaction for determination of RHD zygosity and RHD mosaicism/chimerism

    DEFF Research Database (Denmark)

    Krog, Grethe Risum; Clausen, Frederik Banch; Dziegiel, Morten Hanefeld

    2007-01-01

    Determination of RHD zygosity of the spouse is crucial in preconception counseling of families with history of hemolytic disease of the fetus and newborn caused by anti-D. RHD zygosity can be determined by quantitative real-time polymerase chain reaction (PCR) basically by determining RHD dosage,......, and this feature is relevant in investigating RHD mosaicism and chimerism....

  12. Development of a non invasion real-time PCR assay for the quantitation of chicken parvovirus in fecal swabs

    Science.gov (United States)

    The present study describes the development of a real time Taqman polymerase chain reaction (PCR) assay using a fluorescent labeled probe for the detection and quantitation of chicken parvovirus (ChPV) in feces. The primers and probes were designed based on the nucleotide sequence of the non struct...

  13. EVALUATION OF A RAPID, QUANTITATIVE REAL-TIME PCR METHOD FOR ENUMERATION OF PATHOGENIC CANDIDA CELLS IN WATER

    Science.gov (United States)

    Quantitative Real-Time PCR (QRT-PCR) technology, incorporating fluorigenic 5' nuclease (TaqMan?) chemistry, was developed for the specific detection and quantification of six pathogenic species of Candida (C. albicans, C. tropicalis, C. krusei, C. parapsilosis, C. glabrata and C....

  14. Decay Of Bacterial Pathogens, Fecal Indicators, And Real-Time Quantitative PCR Genetic Markers In Manure-Amended Soils

    Science.gov (United States)

    This study examined persistence and decay of bacterial pathogens, fecal indicator bacteria (FIB), and emerging real-time quantitative PCR (qPCR) genetic markers for rapid detection of fecal pollution in manure-amended agricultural soils. Known concentrations of transformed green...

  15. Decay Of Bacterial Pathogen, Fecal Indicators, And Real-Time Quantitative PCR Genetic Markers In Manure Amended Soils

    Science.gov (United States)

    This study examined persistence and decay of bacterial pathogens, fecal indicator bacteria, and emerging real-time quantitative PCR (qPCR) genetic markers for rapid detection of fecal pollution in manre-amended agricultural soils. Known concentrations of transformed green fluore...

  16. Strategy for the maximization of clinically relevant information from hepatitis C virus, RT-PCR quantification.

    LENUS (Irish Health Repository)

    Levis, J

    2012-02-03

    BACKGROUND: The increasing clinical application of viral load assays for monitoring viral infections has been an incentive for the development of standardized tests for the hepatitis C virus. OBJECTIVE: To develop a simple model for the prediction of baseline viral load in individuals infected with the hepatitis C virus. METHODOLOGY: Viral load quantification of each patient\\'s first sample was assessed by RT-PCR-ELISA using the Roche MONITOR assay in triplicate. Genotype of the infecting virus was identified by reverse line probe hybridization, using amplicons resulting from the qualitative HCV Roche AMPLICOR assay. RESULTS: Retrospective evaluation of first quantitative values suggested that 82.4% (n=168\\/204) of individuals had a viral load between 4.3 and 6.7 log(10) viral copies per ml. A few patients (3.4%; n=7\\/204) have a serum viremia less than the lower limit of the linear range of the RT-PCR assay. Subsequent, prospective evaluation of hepatitis C viral load of all new patients using a model based on the dynamic range of viral load in the retrospective group correctly predicted the dynamic range in 75.9% (n=33\\/54). CONCLUSION: The dynamic range of hepatitis C viremia extends beyond the linear range of the Roche MONITOR assay. Accurate determination of serum viremia is substantially improved by dilution of specimens prior to quantification.

  17. Real-time quantitative PCR for retrovirus-like particle quantification in CHO cell culture.

    Science.gov (United States)

    de Wit, C; Fautz, C; Xu, Y

    2000-09-01

    Chinese hamster ovary (CHO) cells have been widely used to manufacture recombinant proteins intended for human therapeutic uses. Retrovirus-like particles, which are apparently defective and non-infectious, have been detected in all CHO cells by electron microscopy (EM). To assure viral safety of CHO cell-derived biologicals, quantification of retrovirus-like particles in production cell culture and demonstration of sufficient elimination of such retrovirus-like particles by the down-stream purification process are required for product market registration worldwide. EM, with a detection limit of 1x10(6) particles/ml, is the standard retrovirus-like particle quantification method. The whole process, which requires a large amount of sample (3-6 litres), is labour intensive, time consuming, expensive, and subject to significant assay variability. In this paper, a novel real-time quantitative PCR assay (TaqMan assay) has been developed for the quantification of retrovirus-like particles. Each retrovirus particle contains two copies of the viral genomic particle RNA (pRNA) molecule. Therefore, quantification of retrovirus particles can be achieved by quantifying the pRNA copy number, i.e. every two copies of retroviral pRNA is equivalent to one retrovirus-like particle. The TaqMan assay takes advantage of the 5'-->3' exonuclease activity of Taq DNA polymerase and utilizes the PRISM 7700 Sequence Detection System of PE Applied Biosystems (Foster City, CA, U.S.A.) for automated pRNA quantification through a dual-labelled fluorogenic probe. The TaqMan quantification technique is highly comparable to the EM analysis. In addition, it offers significant advantages over the EM analysis, such as a higher sensitivity of less than 600 particles/ml, greater accuracy and reliability, higher sample throughput, more flexibility and lower cost. Therefore, the TaqMan assay should be used as a substitute for EM analysis for retrovirus-like particle quantification in CHO cell

  18. Cloning and evaluation of reference genes for quantitative real-time PCR analysis in Amorphophallus

    Directory of Open Access Journals (Sweden)

    Kai Wang

    2017-04-01

    Full Text Available Quantitative real-time reverse transcription PCR (RT-qPCR has been widely used in the detection and quantification of gene expression levels because of its high accuracy, sensitivity, and reproducibility as well as its large dynamic range. However, the reliability and accuracy of RT-qPCR depends on accurate transcript normalization using stably expressed reference genes. Amorphophallus is a perennial plant with a high content of konjac glucomannan (KGM in its corm. This crop has been used as a food source and as a traditional medicine for thousands of years. Without adequate knowledge of gene expression profiles, there has been no report of validated reference genes in Amorphophallus. In this study, nine genes that are usually used as reference genes in other crops were selected as candidate reference genes. These putative sequences of these genes Amorphophallus were cloned by the use of degenerate primers. The expression stability of each gene was assessed in different tissues and under two abiotic stresses (heat and waterlogging in A. albus and A. konjac. Three distinct algorithms were used to evaluate the expression stability of the candidate reference genes. The results demonstrated that EF1-a, EIF4A, H3 and UBQ were the best reference genes under heat stress in Amorphophallus. Furthermore, EF1-a, EIF4A, TUB, and RP were the best reference genes in waterlogged conditions. By comparing different tissues from all samples, we determined that EF1-α, EIF4A, and CYP were stable in these sets. In addition, the suitability of these reference genes was confirmed by validating the expression of a gene encoding the small heat shock protein SHSP, which is related to heat stress in Amorphophallus. In sum, EF1-α and EIF4A were the two best reference genes for normalizing mRNA levels in different tissues and under various stress treatments, and we suggest using one of these genes in combination with 1 or 2 reference genes associated with different

  19. Assumption-free analysis of quantitative real-time polymerase chain reaction (PCR) data

    NARCIS (Netherlands)

    Ramakers, Christian; Ruijter, Jan M.; Deprez, Ronald H. Lekanne; Moorman, Antoon F. M.

    2003-01-01

    Quantification of mRNAs using real-time polymerase chain reaction (PCR) by monitoring the product formation with the fluorescent dye SYBR Green I is being extensively used in neurosciences, developmental biology, and medical diagnostics. Most PCR data analysis procedures assume that the PCR

  20. Estimating marginal properties of quantitative real-time PCR data using nonlinear mixed models

    DEFF Research Database (Denmark)

    Gerhard, Daniel; Bremer, Melanie; Ritz, Christian

    2014-01-01

    A unified modeling framework based on a set of nonlinear mixed models is proposed for flexible modeling of gene expression in real-time PCR experiments. Focus is on estimating the marginal or population-based derived parameters: cycle thresholds and ΔΔc(t), but retaining the conditional mixed mod...

  1. Development of a real-time quantitative assay for detection of Epstein-Barr virus

    NARCIS (Netherlands)

    Niesters, H. G.; van Esser, J.; Fries, E.; Wolthers, K. C.; Cornelissen, J.; Osterhaus, A. D.

    2000-01-01

    With the use of real-time PCR, we developed and evaluated a rapid, sensitive, specific, and reproducible method for the detection of Epstein-Barr virus (EBV) DNA in plasma samples. This method allowed us to screen plasma and serum samples over a range between 100 and 10(7) copies of DNA per ml using

  2. Development of a real-time quantitative assay for detection of Epstein-Barr virus

    NARCIS (Netherlands)

    H.G.M. Niesters (Bert); E. Fries; K.C. Wolthers (Katja); A.D.M.E. Osterhaus (Albert); J.J. Cornelissen (Jan); J.W.J. van Esser (Joost)

    2000-01-01

    textabstractWith the use of real-time PCR, we developed and evaluated a rapid, sensitive, specific, and reproducible method for the detection of Epstein-Barr virus (EBV) DNA in plasma samples. This method allowed us to screen plasma and serum samples over a range between 100 and

  3. Comparison of Hybrid Capture 2 Assay with Real-time-PCR for Detection and Quantitation of Hepatitis B Virus DNA.

    Science.gov (United States)

    Majid, Farjana; Jahan, Munira; Lutful Moben, Ahmed; Tabassum, Shahina

    2014-01-01

    Both real-time-polymerase chain reaction (PCR) and hybrid capture 2 (HC2) assay can detect and quantify hepatitis B virus (HBV) DNA. However, real-time-PCR can detect a wide range of HBV DNA, while HC2 assay could not detect lower levels of viremia. The present study was designed to detect and quantify HBV DNA by real-time-PCR and HC2 assay and compare the quantitative data of these two assays. A cross-sectional study was conducted in between July 2010 and June 2011. A total of 66 serologically diagnosed chronic hepatitis B (CHB) patients were selected for the study. Real-time-PCR and HC2 assay was done to detect HBV DNA. Data were analyzed by statistical Package for the social sciences (SPSS). Among 66 serologically diagnosed chronic hepatitis B patients 40 (60.61%) patients had detectable and 26 (39.39%) had undetectable HBV DNA by HC2 assay. Concordant results were obtained for 40 (60.61%) out of these 66 patients by real-time-PCR and HC2 assay with mean viral load of 7.06 ± 1.13 log 10 copies/ml and 6.95 ± 1.08 log 10 copies/ml, respectively. In the remaining 26 patients, HBV DNA was detectable by real-time-PCR in 20 patients (mean HBV DNA level was 3.67 ± 0.72 log 10 copies/ml. However, HBV DNA could not be detectable in six cases by the both assays. The study showed strong correlation (r = 0.915) between real-time-PCR and HC2 assay for the detection and quantification of HBV DNA. HC2 assay may be used as an alternative to real-time-PCR for CHB patients. How to cite this article: Majid F, Jahan M, Moben AL, Tabassum S. Comparison of Hybrid Capture 2 Assay with Real-time-PCR for Detection and Quantitation of Hepatitis B Virus DNA. Euroasian J Hepato-Gastroenterol 2014;4(1):31-35.

  4. Comparison of the performance in detection of HPV infections between the high-risk HPV genotyping real time PCR and the PCR-reverse dot blot assays.

    Science.gov (United States)

    Zhang, Lahong; Dai, Yibei; Chen, Jiahuan; Hong, Liquan; Liu, Yuhua; Ke, Qiang; Chen, Yiwen; Cai, Chengsong; Liu, Xia; Chen, Zhaojun

    2018-01-01

    A new multiplex real-time PCR assay, the high-risk HPV genotyping real time PCR assay (HR HPV RT-PCR), has been developed to detect 15 high-risk HPV types with respective viral loads. In this report, a total of 684 cervical specimens from women diagnosed with vaginitis were assessed by the HR HPV RT-PCR and the PCR reaction and reverse dot blot (PCR-RDB) assays, using a PCR-sequencing method as a reference standard. A total coincidence of 97.7% between the HR HPV RT PCR and the PCR-RDB assays was determined with a Kappa value of 0.953. The HR HPV RT PCR assay had sensitivity, specificity, and concordance rates (accuracy) of 99.7%, 99.7%, and 99.7%, respectively, as confirmed by PCR-sequencing, while the PCR-RDB assay had respective rates of 98.8%, 97.1%, and 98.0%. The overall rate of HPV infection, determined by PCR-sequencing, in women diagnosed with vaginitis was 49.85%, including 36.26% of single infection and 13.6% of multiple infections. The most common infections among the 15 high-risk HPV types in women diagnosed with vaginitis were HPV-52, HPV-16, and HPV-58, with a total detection rate of 10.23%, 7.75%, and 5.85%, respectively. We conclude that the HR HPV RT PCR assay exhibits better clinical performance than the PCR-RDB assay, and is an ideal alternative method for HPV genotyping. In addition, the HR HPV RT PCR assay provides HPV DNA viral loads, and could serve as a quantitative marker in the diagnosis and treatment of single and multiple HPV infections. © 2017 Wiley Periodicals, Inc.

  5. Establishment of realtime RT-PCR assay to detect polio virus in the Acute Flaccid Paralysis laboratory surveillance

    Directory of Open Access Journals (Sweden)

    Nike Susanti

    2016-07-01

    Full Text Available AbstrakLatar belakang: Virus polio indigenous terakhir ditemukan di Indonesia tahun 1995 tetapi ancaman viruspolio impor dan mutasi virus dari Oral Polio Vaccine (OPV menjadi Vaccine Derived Poliovirus (VDPVmasih berlanjut. Tahun 1991 WHO mengembangkan Surveilans Acute Flaccid Paralysis (AFP dan tahun2014, identifikasi virus polio dengan real-time reverse transcriptase Polymerase Chain Reaction (rRTPCRmulai digunakan di Laboratorium Nasional Polio Pusat Biomedis dan Teknologi Dasar Kesehatan.Tujuan dari penggunaan rRT-PCR untuk mendapatkan metode yang cepat dan lebih baik dalam memantausirkulasi dan mutasi virus polio.Metode: Isolat polio positif diidentifikasi menggunakanan rRT PCR dengan kombinasi primer dan probeyang ditetapkan WHO. RNA virus di konversi ke cDNA menggunakan reverse transcriptase lalu diamplifikasimenggunakan taq polymerase. Produk PCR di deteksi dan diidentifikasi dengan hibridisasi menggunakanprobe spesifik. Sintesis cDNA dan reaksi PCR menggunakan primer yang dilekatkan di probe. Kombinasiprimer dan probe menghasilkan identifikasi serotipe dan intratypic differentiation (ITD dari isolat virus.Hasil: Selama tahun 2014, NPL Jakarta menerima 604 kasus AFP dari surveilans dan lima kasusterdeteksi positif mengandung virus polio. Semua spesimen positif mengandung virus polio yang berasaldari vaksin. Dua kasus positif virus polio tipe P2 (40%, satu kasus jenis virus polio P1 (20%, 1 kasusjenis virus polio P3 (20% dan satu kasus virus polio campuran jenis P1 + P2 (20%.Kesimpulan: Real-time PCR dapat digunakan di Laboratorium Polio Jakarta untuk membantu identifikasivirus Polio secara cepat. Tes ini dapat digunakan untuk memantau sirkulasi virus polio pada populasiyang rutin diimunisasi dengan OPV. (Health Science Journal of Indonesia 2016;7:27-31Kata kunci: ITD, Poliovirus, Identification, rRT-PCR AbstractBackground: The last indigenous polio was detected in 1995 but the threat of wild type polio viruses and themutation of Oral

  6. Detection of bacterial species involved in perimplantitis concerned with cultural and RT-PCR

    Directory of Open Access Journals (Sweden)

    Marcello Gatti

    2010-06-01

    Full Text Available Dental implants offer new treatment options for edentulous either partially or completely, now represent a viable alternative to conventional fixed protheses. Dental implants are colonized by a flora dominated by Gram-positive facultative aerobic, while in patients with bone loss and formation of pockets peri-implant diseases was found a significant difference in the composition of microflora, bacteria, Gram-negative anaerobes in particular Fusobacterium spp., Treponema denticola (Spirochetes, Tannerella forsythensis, Aggregatibacter actinomycetemcomitans, Prevotella intermedia as interim black-pigmented bacteria, Porphyromonas gingivalis, often in high concentrations. Aims. The purpose of this study was to identify those at risk of perimplantitis using 2 techniques: RT-PCR examination of trade and culture. The results were compared taking into consideration the advantages and disadvantages of both methods. Materials and methods.We studied 24 patients (14 women and 10 men, aged, women between 43 and 76 years, with an average of 63.8 + / - 10.9 years, men between 45 and 88 years with a average of 64.3 years + / - 12.5 years. Was performed a double levy of sub-gingival plaque at multiple sites that had an implant CAL (clinical attachment level> 4mm in order to assess the microbiological identification with the two techniques: Examining culture and Real-Time PCR of Commerce ( Gum-Sunstar that identifies 4 bacterial species: A. actinomycetemcomitans (A.a., P.gingivalis (P.g., T.forsythensis (T.f., and T.denticola (T.d.. Results. All patients studied were positive to both tests with charger high: the consideration of tenure, with CFU / ml > 105, was positive in 66.6% of samples by:T.f., and P.g., in 12.5% for A.a., while T.d. not been sought by examining culture, the RT-PCR was positive, with high loads, in 95.8% of samples for T.f., in 79.1% for P.g., in 12.5% for A.a. and 20.8% for T.d.The test crop showed the presence of even P.intermedia in 91

  7. Quantitative Real-time PCR detection of putrescine-producing Gram-negative bacteria

    Directory of Open Access Journals (Sweden)

    Kristýna Maršálková

    2017-01-01

    Full Text Available Biogenic amines are indispensable components of living cells; nevertheless these compounds could be toxic for human health in higher concentrations. Putrescine is supposed to be the major biogenic amine associated with microbial food spoilage. Development of reliable, fast and culture-independent molecular methods to detect bacteria producing biogenic amines deserves the attention, especially of the food industry in purpose to protect health. The objective of this study was to verify the newly designed primer sets for detection of two inducible genes adiA and speF together in Salmonella enterica and Escherichia coli genome by Real-time PCR. These forenamed genes encode enzymes in the metabolic pathway which leads to production of putrescine in Gram-negative bacteria. Moreover, relative expression of these genes was studied in E. coli CCM 3954 strain using Real-time PCR. In this study, sets of new primers for the detection two inducible genes (speF and adiA in Salmonella enterica and E. coli by Real-time PCR were designed and tested. Amplification efficiency of a Real-time PCR was calculated from the slope of the standard curves (adiA, speF, gapA. An efficiency in a range from 95 to 105 % for all tested reactions was achieved. The gene expression (R of adiA and speF genes in E. coli was varied depending on culture conditions. The highest gene expression of adiA and speF was observed at 6, 24 and 36 h (RadiA ~ 3, 5, 9; RspeF ~11, 10, 9; respectively after initiation of growth of this bacteria in nutrient broth medium enchired with amino acids. The results show that these primers could be used for relative quantification analysis of E. coli.

  8. Development of quantitative real-time PCR for detection and enumeration of Enterobacteriaceae.

    Science.gov (United States)

    Takahashi, Hajime; Saito, Rumi; Miya, Satoko; Tanaka, Yuichiro; Miyamura, Natsumi; Kuda, Takashi; Kimura, Bon

    2017-04-04

    The family Enterobacteriaceae, members of which are widely distributed in the environment, includes many important human pathogens. In this study, a rapid real-time PCR method targeting rplP, coding for L16 protein, a component of the ribosome large subunit, was developed for enumerating Enterobacteriaceae strains, and its efficiency was evaluated using naturally contaminated food products. The rplP-targeted real-time PCR amplified Enterobacteriaceae species with Ct values of 14.0-22.8, whereas the Ct values for non-Enterobacteriaceae species were >30, indicating the specificity of this method for the Enterobacteriaceae. Using a calibration curve of Ct=-3.025 (log CFU/g)+37.35, which was calculated from individual plots of the cell numbers in different concentrations of 5 Enterobacteriaceae species, the rplP-targeted real-time PCR was applied to 51 food samples. A Enterobacteriaceae species in foods rapidly and accurately, and therefore, it can be used for the microbiological risk analysis of foods. Copyright © 2017 Elsevier B.V. All rights reserved.

  9. Comparison of Abbott and Da-an real-time PCR for quantitating serum HBV DNA.

    Science.gov (United States)

    Qiu, Ning; Li, Rui; Yu, Jian-Guo; Yang, Wen; Zhang, Wei; An, Yong; Li, Tong; Liu, Xue-En; Zhuang, Hui

    2014-09-07

    To compare the performance of the Da-an real-time hepatitis B virus (HBV) DNA assay and Abbott RealTime HBV assay. HBV DNA standards as well as a total of 180 clinical serum samples from patients with chronic hepatitis B were measured using the Abbott and Da-an real-time polymerase chain reaction (PCR) assays. Correlation and Bland-Altman plot analysis was used to compare the performance of the Abbott and Da-an assays. The HBV DNA levels were logarithmically transformed for analysis. All statistical analyses were performed using SPSS for Windows version 18.0. The correlation between the two assays was analyzed by Pearson's correlation and linear regression. The Bland-Altman plots were used for the analysis of agreement between the two assays. A P value of Da-an assay were significantly correlated with the expected values of HBV DNA standards (r = 0.999, for Abbott; r = 0.987, for Da-an, P Da-an assay. Moreover, HBV DNA levels measured by the Abbott assay were significantly higher than those of the Da-an assay (6.23 ± 1.76 log IU/mL vs 5.46 ± 1.55 log IU/mL, P Da-an assay presented lower sensitivity and a narrower linear range as compared to the Abbott assay, suggesting the need to be improved.

  10. Comparison of RT-PCR-Dot blot hybridization based on radioisotope 32P with conventional RT-PCR and commercial ELISA Assays for blood screening of HIV-1

    International Nuclear Information System (INIS)

    Maria Lina R; Andi Yasmon

    2011-01-01

    There are many commercial ELISA and rapid test kits that have been used for blood screening; however, the kits can give false positive and negative results. Therefore, RT-PCR (Reverse Transcription Polymerase Chain Reaction) - Dot Blot Hybridization based on radioisotope 32 P (RDBR) method was developed in this research, to compare the method with the conventional RT-PCR and commercial ELISA Enzyme-Linked lmmunosorbent Assay) kit. This method is efficient for screening of large blood specimens and surveillance study. Eighty seven samples were used and serum of the samples were tested by ELISA to detect HIV-1. The HIV-l RNA genome was extracted from plasma samples and tested using the RT-PCR and RDBR methods. Of 87 samples that were tested, the rates of positive testing of the RT-PCR, the RDBR, and the ELISA were 71.26%, 74.71%, and 80.46%, respectively. The RDBR (a combination of RTPCR and dot blot hybridization) was more sensitive than conventional RT-PCR by showing 3.45% in increase number of positive specimens. The results showed that of 9 samples (10.34%) were negative RDBR and positive ELISA, while 4 samples (4.60%) were negative ELISA and positive RDBR. The two methods showed slightly difference in the results but further validation is still needed. However, RDBR has high potential as an alternative method for screening of blood in large quantities when compared to method of conventional RT-PCR and ELISA. (author)

  11. Quantitative analysis of diet structure by real-time PCR, reveals different feeding patterns by two dominant grasshopper species

    Science.gov (United States)

    Huang, Xunbing; Wu, Huihui; McNeill, Mark Richard; Qin, Xinghu; Ma, Jingchuan; Tu, Xiongbing; Cao, Guangchun; Wang, Guangjun; Nong, Xiangqun; Zhang, Zehua

    2016-01-01

    Studies on grasshopper diets have historically employed a range of methodologies, each with certain advantages and disadvantages. For example, some methodologies are qualitative instead of quantitative. Others require long experimental periods or examine population-level effects, only. In this study, we used real-time PCR to examine diets of individual grasshoppers. The method has the advantage of being both fast and quantitative. Using two grasshopper species, Oedaleus asiaticus and Dasyhippus barbipes, we designed ITS primer sequences for their three main host plants, Stipa krylovii, Leymus chinensis and Cleistogenes squarrosa and used real-time PCR method to test diet structure both qualitatively and quantitatively. The lowest detection efficiency of the three grass species was ~80% with a strong correlation between actual and PCR-measured food intake. We found that Oedaleus asiaticus maintained an unchanged diet structure across grasslands with different grass communities. By comparison, Dasyhippus barbipes changed its diet structure. These results revealed why O. asiaticus distribution is mainly confined to Stipa-dominated grassland, and D. barbipes is more widely distributed across Inner Mongolia. Overall, real-time PCR was shown to be a useful tool for investigating grasshopper diets, which in turn offers some insight into grasshopper distributions and improved pest management. PMID:27562455

  12. Real-time reverse transcription polymerase chain reaction method for detection of Canine distemper virus modified live vaccine shedding for differentiation from infection with wild-type strains.

    Science.gov (United States)

    Wilkes, Rebecca P; Sanchez, Elena; Riley, Matthew C; Kennedy, Melissa A

    2014-01-01

    Canine distemper virus (CDV) remains a common cause of infectious disease in dogs, particularly in high-density housing situations such as shelters. Vaccination of all dogs against CDV is recommended at the time of admission to animal shelters and many use a modified live virus (MLV) vaccine. From a diagnostic standpoint for dogs with suspected CDV infection, this is problematic because highly sensitive diagnostic real-time reverse transcription polymerase chain reaction (RT-PCR) tests are able to detect MLV virus in clinical samples. Real-time PCR can be used to quantitate amount of virus shedding and can differentiate vaccine strains from wild-type strains when shedding is high. However, differentiation by quantitation is not possible in vaccinated animals during acute infection, when shedding is low and could be mistaken for low level vaccine virus shedding. While there are gel-based RT-PCR assays for differentiation of vaccine strains from field strains based on sequence differences, the sensitivity of these assays is unable to match that of the real-time RT-PCR assay currently used in the authors' laboratory. Therefore, a real-time RT-PCR assay was developed that detects CDV MLV vaccine strains and distinguishes them from wild-type strains based on nucleotide sequence differences, rather than the amount of viral RNA in the sample. The test is highly sensitive, with detection of as few as 5 virus genomic copies (corresponding to 10(-1) TCID(50)). Sequencing of the DNA real-time products also allows phylogenetic differentiation of the wild-type strains. This test will aid diagnosis during outbreaks of CDV in recently vaccinated animals.

  13. Effect of ionizing radiation on the quantitative detection of Salmonella using real-time PCR

    Energy Technology Data Exchange (ETDEWEB)

    Lim, Sangyong; Jung, Jinwoo [Radiation Research Center for Biotechnology, Korea Atomic Energy Research Institute, Jeongeup 580-185 (Korea, Republic of); Kim, Minjeong; Ryu, Sangryeol [Department of Food and Animal Biotechnology, School of Agricultural Biotechnology, Center for Agricultural Biomaterials, Seoul National University, Seoul 151-921 (Korea, Republic of); Kim, Dongho [Radiation Research Center for Biotechnology, Korea Atomic Energy Research Institute, Jeongeup 580-185 (Korea, Republic of)], E-mail: fungikim@kaeri.re.kr

    2008-09-15

    Food irradiation is an economically viable technology for inactivating foodborne pathogens, but irradiation can mask pathogens in unhygienically prepared food. The aim of this study was to investigate the effect of irradiation treatment on the detection of Salmonella using real-time PCR. Three commercially available kits were tested, of which the InstaGene Matrix procedure was most effective in preparing template DNA from Salmonella exposed to radiation in broth culture. The minimum level of detection by real-time PCR combined with InstaGene Matrix was 3 log units of Salmonella per milliliter. However, when pure cultures of Salmonella were irradiated at 3 and 5 kGy, the cycle threshold (C{sub T}) increased 1-1.5-fold compared to irradiation at 0 and 1 kGy. This indicated that irradiation treatment may result in an underestimation of bacterial counts due to radiation-induced DNA lesions. We also compared C{sub T} values in inoculated chicken homogenates before and after irradiation, which in this model caused a 1.3-3.3-fold underestimation of bacterial counts with respect to irradiation dose.

  14. Design and Validation of Real-Time PCR: Quantitative Diagnosis of Common Leishmania Species in Iran.

    Science.gov (United States)

    Fekri Soofi Abadi, Maryam; Dabiri, Shahriar; Fotouhi Ardakani, Reza; Fani Malaki, Lina; Amirpoor Rostami, Sahar; Ziasistani, Mahsa; Dabiri, Donya

    2016-07-01

    Design and validation of Real-time PCR on the protected gene region ITS2 to quantify the parasite load in common leishmania (L) species. Probe and primer were designed from the ITS2 region between the rRNA genes with minimum gene variation in three common leishmania species followed by a Real-time PCR using the Taq man probe method in the form of absolute quantification. A series of different concentrations of leishmania were analyzed. After the purified PCR product was successfully placed in a PTG19-T plasmid vector, specialized ITS2 region was cloned in this plasmid. In the last phase, the cloned gene was transferred to the Ecoli.Top10F bacteria. The standard plasmid was provided in 10(7) to 10(1) copies/rxn concentrations. The specification and clinical sensitivity of the data was analyzed using inter and intra scales. The probe and primer were designed using three species, including L. infantum, L. major, and L.tropica. Seven concentrations of purified parasite in culture media showed that the selected region for quantifying the parasite is suitable. Clinical and analytical specificity and sensitivity were both 100%, respectively. The Taq man method for the ITS2 region in leishmania is one the most sensitive diagnostic test for identifying the parasite load and is suggested as a tool for fast identification and quantification of species.

  15. No control genes required: Bayesian analysis of qRT-PCR data.

    Directory of Open Access Journals (Sweden)

    Mikhail V Matz

    Full Text Available Model-based analysis of data from quantitative reverse-transcription PCR (qRT-PCR is potentially more powerful and versatile than traditional methods. Yet existing model-based approaches cannot properly deal with the higher sampling variances associated with low-abundant targets, nor do they provide a natural way to incorporate assumptions about the stability of control genes directly into the model-fitting process.In our method, raw qPCR data are represented as molecule counts, and described using generalized linear mixed models under Poisson-lognormal error. A Markov Chain Monte Carlo (MCMC algorithm is used to sample from the joint posterior distribution over all model parameters, thereby estimating the effects of all experimental factors on the expression of every gene. The Poisson-based model allows for the correct specification of the mean-variance relationship of the PCR amplification process, and can also glean information from instances of no amplification (zero counts. Our method is very flexible with respect to control genes: any prior knowledge about the expected degree of their stability can be directly incorporated into the model. Yet the method provides sensible answers without such assumptions, or even in the complete absence of control genes. We also present a natural Bayesian analogue of the "classic" analysis, which uses standard data pre-processing steps (logarithmic transformation and multi-gene normalization but estimates all gene expression changes jointly within a single model. The new methods are considerably more flexible and powerful than the standard delta-delta Ct analysis based on pairwise t-tests.Our methodology expands the applicability of the relative-quantification analysis protocol all the way to the lowest-abundance targets, and provides a novel opportunity to analyze qRT-PCR data without making any assumptions concerning target stability. These procedures have been implemented as the MCMC.qpcr package in R.

  16. No control genes required: Bayesian analysis of qRT-PCR data.

    Science.gov (United States)

    Matz, Mikhail V; Wright, Rachel M; Scott, James G

    2013-01-01

    Model-based analysis of data from quantitative reverse-transcription PCR (qRT-PCR) is potentially more powerful and versatile than traditional methods. Yet existing model-based approaches cannot properly deal with the higher sampling variances associated with low-abundant targets, nor do they provide a natural way to incorporate assumptions about the stability of control genes directly into the model-fitting process. In our method, raw qPCR data are represented as molecule counts, and described using generalized linear mixed models under Poisson-lognormal error. A Markov Chain Monte Carlo (MCMC) algorithm is used to sample from the joint posterior distribution over all model parameters, thereby estimating the effects of all experimental factors on the expression of every gene. The Poisson-based model allows for the correct specification of the mean-variance relationship of the PCR amplification process, and can also glean information from instances of no amplification (zero counts). Our method is very flexible with respect to control genes: any prior knowledge about the expected degree of their stability can be directly incorporated into the model. Yet the method provides sensible answers without such assumptions, or even in the complete absence of control genes. We also present a natural Bayesian analogue of the "classic" analysis, which uses standard data pre-processing steps (logarithmic transformation and multi-gene normalization) but estimates all gene expression changes jointly within a single model. The new methods are considerably more flexible and powerful than the standard delta-delta Ct analysis based on pairwise t-tests. Our methodology expands the applicability of the relative-quantification analysis protocol all the way to the lowest-abundance targets, and provides a novel opportunity to analyze qRT-PCR data without making any assumptions concerning target stability. These procedures have been implemented as the MCMC.qpcr package in R.

  17. Simultaneous detection of three lily viruses using Triplex IC-RT-PCR.

    Science.gov (United States)

    Zhang, Yubao; Wang, Yajun; Xie, Zhongkui; Yang, Guo; Guo, Zhihong; Wang, Le

    2017-11-01

    Viruses commonly infecting lily (Lilium spp.) include: Lily symptomless virus (LSV), Cucumber mosaic virus (CMV) and Lily mottle virus (LMoV). These viruses usually co-infect lilies causing severe economic losses in terms of quantity and quality of flower and bulb production around the world. Reliable and precise detection systems need to be developed for virus identification. We describe the development of a triplex immunocapture (IC) reverse transcription (RT) polymerase chain reaction (PCR) assay for the simultaneous detection of LSV, CMV and LMoV. The triplex IC-RT-PCR was compared with a quadruplex RT-PCR assay. Relative to the quadruplex RT-PCR, the specificity of the triplex IC-RT-PCR system for LSV, CMV and LMoV was 100% for field samples. The sensitivity of the triplex IC-RT-PCR system was 99.4%, 81.4% and 98.7% for LSV, CMV and LMoV, respectively. Agreement (κ) between the results obtained from the two tests was 0.968, 0.844 and 0.984 for LSV, CMV and LMoV, respectively. This is the first report of the simultaneous detection of LSV, CMV and LMoV in a triplex IC-RT-PCR assay. In particular we believe this convenient and reliable triplex IC-RT-PCR method could be used routinely for large-scale field surveys or crop health monitoring of lily. Copyright © 2017. Published by Elsevier B.V.

  18. Development and validation of a real-time quantitative PCR assay to detect Xanthomonas axonopodis pv. allii from onion seed.

    Science.gov (United States)

    Robène, Isabelle; Perret, Marion; Jouen, Emmanuel; Escalon, Aline; Maillot, Marie-Véronique; Chabirand, Aude; Moreau, Aurélie; Laurent, Annie; Chiroleu, Frédéric; Pruvost, Olivier

    2015-07-01

    Bacterial blight of onion is an emerging disease threatening world onion production. The causal agent Xanthomonas axonopodis pv. allii is seed transmitted and a reliable and sensitive tool is needed to monitor seed exchanges. A triplex quantitative real-time PCR assay was developed targeting two X. axonopodis pv. allii-specific markers and an internal control chosen in 5.8S rRNA gene from Alliaceae. Amplification of at least one marker indicates the presence of the bacterium in seed extracts. This real-time PCR assay detected all the 79 X. axonopodis pv. allii strains tested and excluded 85.2% of the 135 non-target strains and particularly all 39 saprophytic and pathogenic bacteria associated with onion. Cross-reactions were mainly obtained for strains assigned to nine phylogenetically related X. axonopodis pathovars. The cycle cut-off was estimated statistically at 36.3 considering a risk of false positive of 1%. The limit of detection obtained in at least 95% of the time (LOD 95%) was 5×10(3) CFU/g (colony forming unit/g). The sensitivity threshold was found to be 1 infected seed in 32,790 seeds. This real-time PCR assay should be useful for preventing the long-distance spread of X. axonopodis pv. allii via contaminated seed lots and determining the epidemiology of the bacterium. Copyright © 2015 Elsevier B.V. All rights reserved.

  19. Real-time PCR assays for the quantitation of rDNA from apricot and other plant species in marzipan.

    Science.gov (United States)

    Haase, Ilka; Brüning, Philipp; Matissek, Reinhard; Fischer, Markus

    2013-04-10

    Marzipan or marzipan raw paste is a typical German sweet which is consumed directly or is used as an ingredient in the bakery industry/confectionery (e.g., in stollen) and as filling for chocolate candies. Almonds (blanched and pealed) and sugar are the only ingredients for marzipan production according to German food guidelines. Especially for the confectionery industry, the use of persipan, which contains apricot or peach kernels instead of almonds, is preferred due to its stronger aroma. In most of the companies, both raw pastes are produced, in most cases on the same production line, running the risk of an unintended cross contamination. Additionally, due to high almond market values, dilutions of marzipan with cheaper seeds may occur. Especially in the case of apricot and almond, the close relationship of both species is a challenge for the analysis. DNA based methods for the qualitative detection of apricot, peach, pea, bean, lupine, soy, cashew, pistachio, and chickpea in marzipan have recently been published. In this study, different quantitation strategies on the basis of real-time PCR have been evaluated and a relative quantitation method with a reference amplification product was shown to give the best results. As the real-time PCR is based on the high copy rDNA-cluster, even contaminations <1% can be reliably quantitated.

  20. Chemisorption of iodine-125 to gold nanoparticles allows for real-time quantitation and potential use in nanomedicine

    Energy Technology Data Exchange (ETDEWEB)

    Walsh, Adrian A, E-mail: a.walsh@nanobiosols.com [Liverpool Science Park, Nano Biosols Ltd (United Kingdom)

    2017-04-15

    Gold nanoparticles have been available for many years as a research tool in the life sciences due to their electron density and optical properties. New applications are continually being developed, particularly in nanomedicine. One drawback is the need for an easy, real-time quantitation method for gold nanoparticles so that the effects observed in in vitro cell toxicity assays and cell uptake studies can be interpreted quantitatively in terms of nanoparticle loading. One potential method of quantifying gold nanoparticles in real time is by chemisorption of iodine-125, a gamma emitter, to the nanoparticles. This paper revisits the labelling of gold nanoparticles with iodine-125, first described 30 years ago and never fully exploited since. We explore the chemical properties and usefulness in quantifying bio-functionalised gold nanoparticle binding in a quick and simple manner. The gold particles were labelled specifically and quantitatively simply by mixing the two items. The nature of the labelling is chemisorption and is robust, remaining bound over several weeks in a variety of cell culture media. Chemisorption was confirmed as potassium iodide can remove the label whereas sodium chloride and many other buffers had no effect. Particles precoated in polymers or proteins can be labelled just as efficiently allowing for post-labelling experiments in situ rather than using radioactive gold atoms in the production process. We also demonstrate that interparticle exchange of I-125 between different size particles does not appear to take place confirming the affinity of the binding.

  1. Chemisorption of iodine-125 to gold nanoparticles allows for real-time quantitation and potential use in nanomedicine

    Science.gov (United States)

    Walsh, Adrian A.

    2017-04-01

    Gold nanoparticles have been available for many years as a research tool in the life sciences due to their electron density and optical properties. New applications are continually being developed, particularly in nanomedicine. One drawback is the need for an easy, real-time quantitation method for gold nanoparticles so that the effects observed in in vitro cell toxicity assays and cell uptake studies can be interpreted quantitatively in terms of nanoparticle loading. One potential method of quantifying gold nanoparticles in real time is by chemisorption of iodine-125, a gamma emitter, to the nanoparticles. This paper revisits the labelling of gold nanoparticles with iodine-125, first described 30 years ago and never fully exploited since. We explore the chemical properties and usefulness in quantifying bio-functionalised gold nanoparticle binding in a quick and simple manner. The gold particles were labelled specifically and quantitatively simply by mixing the two items. The nature of the labelling is chemisorption and is robust, remaining bound over several weeks in a variety of cell culture media. Chemisorption was confirmed as potassium iodide can remove the label whereas sodium chloride and many other buffers had no effect. Particles precoated in polymers or proteins can be labelled just as efficiently allowing for post-labelling experiments in situ rather than using radioactive gold atoms in the production process. We also demonstrate that interparticle exchange of I-125 between different size particles does not appear to take place confirming the affinity of the binding.

  2. Chemisorption of iodine-125 to gold nanoparticles allows for real-time quantitation and potential use in nanomedicine

    International Nuclear Information System (INIS)

    Walsh, Adrian A

    2017-01-01

    Gold nanoparticles have been available for many years as a research tool in the life sciences due to their electron density and optical properties. New applications are continually being developed, particularly in nanomedicine. One drawback is the need for an easy, real-time quantitation method for gold nanoparticles so that the effects observed in in vitro cell toxicity assays and cell uptake studies can be interpreted quantitatively in terms of nanoparticle loading. One potential method of quantifying gold nanoparticles in real time is by chemisorption of iodine-125, a gamma emitter, to the nanoparticles. This paper revisits the labelling of gold nanoparticles with iodine-125, first described 30 years ago and never fully exploited since. We explore the chemical properties and usefulness in quantifying bio-functionalised gold nanoparticle binding in a quick and simple manner. The gold particles were labelled specifically and quantitatively simply by mixing the two items. The nature of the labelling is chemisorption and is robust, remaining bound over several weeks in a variety of cell culture media. Chemisorption was confirmed as potassium iodide can remove the label whereas sodium chloride and many other buffers had no effect. Particles precoated in polymers or proteins can be labelled just as efficiently allowing for post-labelling experiments in situ rather than using radioactive gold atoms in the production process. We also demonstrate that interparticle exchange of I-125 between different size particles does not appear to take place confirming the affinity of the binding.

  3. RT-PCR-ELISA as a tool for diagnosis of low-pathogenicity avian influenza

    DEFF Research Database (Denmark)

    Dybkaer, Karen; Munch, Mette; Handberg, Kurt Jensen

    2003-01-01

    A one-tube reverse transcriptase/polymerase chain reaction coupled with an enzyme-linked immunosorbent assay (RT-PCR-ELISA) was developed for the rapid detection of avian influenza virus (AIV) in clinical specimens. A total of 419 swab pools were analyzed from chickens experimentally infected wit...... of the twenty-three VI-positive specimens were negative when tested by RT-PCR-ELISA. The diagnostic sensitivity and specificity of the RT-PCR-ELISA was 91% and 97%, respectively, using VI in SPF eggs as the gold reference standard....

  4. Visualisation and quantitative analysis of the rodent malaria liver stage by real time imaging.

    NARCIS (Netherlands)

    Ploemen, I.H.J.; Prudencio, M.; Douradinha, B.G.; Ramesar, J.; Fonager, J.; Gemert, G.J.A. van; Luty, A.J.F.; Hermsen, C.C.; Sauerwein, R.W.; Baptista, F.G.; Mota, M.M.; Waters, A.P.; Que, I.; Lowik, C.W.G.M.; Khan, S.M.; Janse, C.J.; Franke-Fayard, B.

    2009-01-01

    The quantitative analysis of Plasmodium development in the liver in laboratory animals in cultured cells is hampered by low parasite infection rates and the complicated methods required to monitor intracellular development. As a consequence, this important phase of the parasite's life cycle has been

  5. Dengue Virus NS1 Protein as a Diagnostic Marker: Commercially Available ELISA and Comparison to qRT-PCR and Serological Diagnostic Assays Currently Used by the State of Florida

    Directory of Open Access Journals (Sweden)

    Jason H. Ambrose

    2017-01-01

    Full Text Available Background. The proper management of patients infected with dengue virus requires early detection. Here, real-time molecular assays have proven useful but have limitations, whereas ELISAs that detect antibodies are still favored but results are obtained too late to be of clinical value. The production of DENV NS1 peaks early during infection and its detection can combine the advantages of both diagnostic approaches. Methods. This study compared assays currently used for detecting DENV infection at the Florida Department of Health including anti-DENV IgM and IgG ELISAs as well as qRT-PCR, against a commercially available DENV NS1 ELISA. These comparisons were made among a group of 21 human sera. Results. Nine of 14 (64.3% DENV qRT-PCR+ samples were also DENV NS1+. Interestingly, the 5 NS1− samples that were qRT-PCR+ were additionally IgM− and IgG+ suggesting a nonprimary infection. Compared to qRT-PCR, the NS1 assay had a sensitivity of 64.3%, specificity 100%, PPV of 100%, and NPV of 58.3%. Conclusions. The NS1 ELISA performed as expected in known DENV qRT-PCR+ samples; however negative NS1 results for qRT-PCR+ and IgG+ sera seemingly reduced the usefulness of the NS1 ELISA for nonprimary cases. We therefore conclude that diagnosis obtained via DENV NS1 ELISA deserves further investigation.

  6. Reference Gene Selection for qRT-PCR Normalization Analysis in kenaf (Hibiscus cannabinus L. under Abiotic Stress and Hormonal Stimuli

    Directory of Open Access Journals (Sweden)

    Xiaoping Niu

    2017-05-01

    Full Text Available Kenaf (Hibiscus cannabinus L., an environmental friendly and economic fiber crop, has a certain tolerance to abiotic stresses. Identification of reliable reference genes for transcript normalization of stress responsive genes expression by quantitative real-time PCR (qRT-PCR is important for exploring the molecular mechanisms of plants response to abiotic stresses. In this study, nine candidate reference genes were cloned, and their expression stabilities were assessed in 132 abiotic stress and hormonal stimuli samples of kenaf using geNorm, NormFinder, and BestKeeper algorithms. Results revealed that HcPP2A (Protein phosphatase 2A and HcACT7 (Actin 7 were the optimum reference genes across all samples; HcUBC (Ubiquitin-conjugating enzyme like protein was the worst reference gene for transcript normalization. The reliability of the selected reference genes was further confirmed by evaluating the expression profile of HcWRKY28 gene at different stress durations. This work will benefit future studies on discovery of stress-tolerance genes and stress-signaling pathways in this important fiber crop.

  7. Comparison between quantitative nucleic acid sequence-based amplification, real-time reverse transcriptase PCR, and real-time PCR for quantification of Leishmania parasites

    NARCIS (Netherlands)

    van der Meide, Wendy; Guerra, Jorge; Schoone, Gerard; Farenhorst, Marit; Coelho, Leila; Faber, William; Peekel, Inge; Schallig, Henk

    2008-01-01

    DNA or RNA amplification methods for detection of Leishmania parasites have advantages regarding sensitivity and potential quantitative characteristics in comparison with conventional diagnostic methods but are often still not routinely applied. However, the use and application of molecular assays

  8. Interlaboratory validation of quantitative duplex real-time PCR method for screening analysis of genetically modified maize.

    Science.gov (United States)

    Takabatake, Reona; Koiwa, Tomohiro; Kasahara, Masaki; Takashima, Kaori; Futo, Satoshi; Minegishi, Yasutaka; Akiyama, Hiroshi; Teshima, Reiko; Oguchi, Taichi; Mano, Junichi; Furui, Satoshi; Kitta, Kazumi

    2011-01-01

    To reduce the cost and time required to routinely perform the genetically modified organism (GMO) test, we developed a duplex quantitative real-time PCR method for a screening analysis simultaneously targeting an event-specific segment for GA21 and Cauliflower Mosaic Virus 35S promoter (P35S) segment [Oguchi et al., J. Food Hyg. Soc. Japan, 50, 117-125 (2009)]. To confirm the validity of the method, an interlaboratory collaborative study was conducted. In the collaborative study, conversion factors (Cfs), which are required to calculate the GMO amount (%), were first determined for two real-time PCR instruments, the ABI PRISM 7900HT and the ABI PRISM 7500. A blind test was then conducted. The limit of quantitation for both GA21 and P35S was estimated to be 0.5% or less. The trueness and precision were evaluated as the bias and reproducibility of the relative standard deviation (RSD(R)). The determined bias and RSD(R) were each less than 25%. We believe the developed method would be useful for the practical screening analysis of GM maize.

  9. Detecting Newcastle disease virus in combination of RT-PCR with red blood cell absorption

    Directory of Open Access Journals (Sweden)

    Liu Chengqian

    2011-05-01

    Full Text Available Abstract Reverse transcription-polymerase chain reaction (RT-PCR has limited sensitivity when treating complicated samples, such as feces, waste-water in farms, and nucleic acids, protein rich tissue samples, all the factors may interfere with the sensitivity of PCR test or generate false results. In this study, we developed a sensitive RT-PCR, combination of red blood cell adsorption, for detecting Newcastle disease virus (NDV. One pair of primers which was highly homologous to three NDV pathotypes was designed according to the consensus nucleocapsid protein (NP gene sequence. To eliminate the interfere of microbes and toxic substances, we concentrated and purified NDV from varied samples utilizing the ability of NDV binding red blood cells (RBCs. The RT-PCR coupled with red blood cell adsorption was much more sensitive in comparison with regular RT-PCR. The approach could also be used to detect other viruses with the property of hemagglutination, such as influenza viruses.

  10. Simultaneous detection of enteropathogenic viruses in buffalos faeces using multiplex reverse transcription-polymerase chain reaction (mRT-PCR

    Directory of Open Access Journals (Sweden)

    U. Pagnini

    2010-02-01

    Full Text Available A multiplex reverse transcription- polymerase chain reaction (mRT-PCR assay that detects Bovine Viral Diarrhoea Virus, Bovine Coronavirus, and Group A Rotaviruses in infected cell-culture fluids and clinical faecal samples is described. One hundred twenty faecal samples from buffalo calves with acute gastroenteritis were tested. The mRT-PCR was validated against simplex RT-PCR with published primers for Pestivirus, Coronavirus and Rotavirus. The multiplex RT-PCR was equally sensitive and specific in detecting viral infections compared with simplex RT-PCR. The mRT-PCR readily identified viruses by discriminating the size of their amplified gene products. This mRT-PCR may be a sensitive and rapid assay for surveillance of buffalo enteric viruses in field specimens. This novel multiplex RT-PCR is an attractive technique for the rapid, specific, and cost-effective laboratory diagnosis of acute gastroenteritis.

  11. RT-PCR and real-time PCR analysis of E2A-PBX1, TEL-AML1 ...

    Indian Academy of Sciences (India)

    Department of Molecular Oncology, Cancer Institute (WIA) 38, Sardar Patel Road, Chennai 600 036, India; Department of Biotechnology, Dr M. G. R. Educational and Research Institute, Dr M. G. R. University, Maduravoyal, Chennai 600 095, India; Department of Hemato Immunology, Cancer Institute (WIA) 38, Sardar Patel ...

  12. Molecular Properties of Poliovirus Isolates: Nucleotide Sequence Analysis, Typing by PCR and Real-Time RT-PCR.

    Science.gov (United States)

    Burns, Cara C; Kilpatrick, David R; Iber, Jane C; Chen, Qi; Kew, Olen M

    2016-01-01

    Virologic surveillance is essential to the success of the World Health Organization initiative to eradicate poliomyelitis. Molecular methods have been used to detect polioviruses in tissue culture isolates derived from stool samples obtained through surveillance for acute flaccid paralysis. This chapter describes the use of realtime PCR assays to identify and serotype polioviruses. In particular, a degenerate, inosine-containing, panpoliovirus (panPV) PCR primer set is used to distinguish polioviruses from NPEVs. The high degree of nucleotide sequence diversity among polioviruses presents a challenge to the systematic design of nucleic acid-based reagents. To accommodate the wide variability and rapid evolution of poliovirus genomes, degenerate codon positions on the template were matched to mixed-base or deoxyinosine residues on both the primers and the TaqMan™ probes. Additional assays distinguish between Sabin vaccine strains and non-Sabin strains. This chapter also describes the use of generic poliovirus specific primers, along with degenerate and inosine-containing primers, for routine VP1 sequencing of poliovirus isolates. These primers, along with nondegenerate serotype-specific Sabin primers, can also be used to sequence individual polioviruses in mixtures.

  13. Sequence Optimized Real-Time RT-PCR Assay for Detection of Crimean-Congo Hemorrhagic Fever Virus

    Science.gov (United States)

    2017-03-21

    on the linear range of the curve 129 using a nonlinear regression analysis. A two-way ANOVA with Sidak’s multiple comparisons test was 130 done to...currently fielded CCHFV assay. 31 TR-17-094 DISTRIBUTION STATEMENT A: Approved for public release; distribution is unlimited. 2 Introduction 32...analyses were performed using GraphPrism 6 (GraphPad Software, San Diego, CA). 128 Assay linearity based on the preliminary LOD was determined based

  14. Norovirus Real Time RT-PCR Detection Technology Transition to the Joint Biological Identification and Diagnosis System (JBAIDS)

    Science.gov (United States)

    2012-09-21

    virus and Southampton virus, and II (GII), which includes Bristol virus, Lordsdale virus, Toronto virus, Mexico virus, Hawaii virus and Snow Mountain...Shigella flexneriATCC12022 1 Negative Shigella sonnei ATCC25931 1 Negative Vibrio cholera (NAG) (Culture) 2 Negative Vibrio cholera (Ogawa...Culture) 1 Negative Vibrio cholera (Inaga) (Culture) 1 Negative Sapovivus (Known specimen extract) 2 Negative Rotavirus (Known specimen extract) 2

  15. VEGF system expression by immunohistochemistry and real-time RT-PCR study on collared peccary placenta

    DEFF Research Database (Denmark)

    Santos, Tatiana C.; Oliveira, Moacir F.; Papa, Paula C.

    2014-01-01

    Vascular endothelial growth factor (VEGF) is known to induce endothelial cell proliferation, to promote cell migration, and to inhibit apoptosis, thus playing a central role in angiogenesis and in the regulation of vasculogenesis. The expression of the VEGF-ligand receptor system was studied in t...

  16. RT-PCR and real-time PCR analysis of E2A-PBX1, TEL-AML1 ...

    Indian Academy of Sciences (India)

    2011-08-19

    Aug 19, 2011 ... group of 1–25 years (50 pediatric and 14 young adults). Diagnosis of ... 3% agarose gel to visualize the amplified products of fusion gene transcripts. .... translocation in 13.4% (177/1321, range 9–23%) of child- hood ALL in Far ... to apoptosis, growth factor interactions and alters cell–cell and cell–matrix ...

  17. A real-time RT-PCR method to detect viable Giardia lamblia cysts in environmental waters.

    Science.gov (United States)

    Baque, Robert H; Gilliam, Amy O; Robles, Liza D; Jakubowski, Walter; Slifko, Theresa R

    2011-05-01

    Currently, USEPA Method 1623 is the standard assay used for simultaneous detection of Giardia cysts and Cryptosporidium oocysts in various water matrices. However, the method is unable to distinguish between species, genotype, or to assess viability. Therefore, the objective of the present study was to address the shortcomings of USEPA Method 1623 by developing a novel molecular-based method that can assess viability of Giardia cysts in environmental waters and identify genotypes that pose a human health threat (assemblage groups A and B). Primers and TaqMan(®) probes were designed to target the beta-giardin gene in order to discriminate among species and assemblages. Viability was determined by detection of de-novo mRNA synthesis after heat induction. The beta-giardin primer/probe sets were able to detect and differentiate between Giardia lamblia assemblages A and B, and did not detect Giardia muris (mouse species) or G. lamblia assemblages C, D, E and F (non-human), with the exception of Probe A which did detect G. lamblia assemblage F DNA. Additionally, DNA or cDNA of other waterborne organisms were not detected, suggesting that the method is specific to Giardia assemblages. Assay applicability was demonstrated by detection of viable G. lamblia cysts in spiked (assemblage B) and unspiked (assemblage A and B) reclaimed water samples. Copyright © 2011 Elsevier Ltd. All rights reserved.

  18. Field Evaluation of a Deployable RT-PCR Assay System for Real-Time Identification of Dengue Virus

    National Research Council Canada - National Science Library

    McAvin, James C; Blow, Jamie A; Putnam, John L; Swaby, James A

    2004-01-01

    Dengue fever and the more severe form of the disease, dengue hemorrhagic fever, occurs in tropical and subtropical regions globally through infection by one or more of four viral serotypes, DEN-1, DEN-2, DEN-3 and DEN-4...

  19. Real-time quantitative Schlieren imaging by fast Fourier demodulation of a checkered backdrop

    Science.gov (United States)

    Wildeman, Sander

    2018-06-01

    A quantitative synthetic Schlieren imaging (SSI) method based on fast Fourier demodulation is presented. Instead of a random dot pattern (as usually employed in SSI), a 2D periodic pattern (such as a checkerboard) is used as a backdrop to the refractive object of interest. The range of validity and accuracy of this "Fast Checkerboard Demodulation" (FCD) method are assessed using both synthetic data and experimental recordings of patterns optically distorted by small waves on a water surface. It is found that the FCD method is at least as accurate as sophisticated, multi-stage, digital image correlation (DIC) or optical flow (OF) techniques used with random dot patterns, and it is significantly faster. Efficient, fully vectorized, implementations of both the FCD and DIC/OF schemes developed for this study are made available as open source Matlab scripts.

  20. Optimisation of the RT-PCR detection of immunomagnetically enriched carcinoma cells

    International Nuclear Information System (INIS)

    Raynor, Michael; Stephenson, Sally-Anne; Walsh, David CA; Pittman, Kenneth B; Dobrovic, Alexander

    2002-01-01

    Immunomagnetic enrichment followed by RT-PCR (immunobead RT-PCR) is an efficient methodology to identify disseminated carcinoma cells in the blood and bone marrow. The RT-PCR assays must be both specific for the tumor cells and sufficiently sensitive to enable detection of single tumor cells. We have developed a method to test RT-PCR assays for any cancer. This has been investigated using a panel of RT-PCR markers suitable for the detection of breast cancer cells. In the assay, a single cell line-derived tumor cell is added to 100 peripheral blood mononuclear cells (PBMNCs) after which mRNA is isolated and reverse transcribed for RT-PCR analysis. PBMNCs without added tumor cells are used as specificity controls. The previously studied markers epidermal growth factor receptor (EGFR), mammaglobin 1 (MGB1), epithelial cell adhesion molecule (EpCAM/TACSTD1), mucin 1 (MUC1), carcinoembryonic antigen (CEA) were tested. Two new epithelial-specific markers ELF3 and EphB4 were also tested. MUC1 was unsuitable as strong amplification was detected in 100 cell PBMNC controls. Expression of ELF3, EphB4, EpCAM, EGFR, CEA and MGB1 was found to be both specific for the tumor cell, as demonstrated by the absence of a signal in most 100 cell PBMNC controls, and sensitive enough to detect a single tumor cell in 100 PBMNCs using a single round of RT-PCR. ELF3, EphB4, EpCAM, EGFR, CEA and MGB1 are appropriate RT-PCR markers for use in a marker panel to detect disseminated breast cancer cells after immunomagnetic enrichment

  1. Red blood cells in cerebrospinal fluid as possible inhibitory factor for enterovirus RT-PCR

    Directory of Open Access Journals (Sweden)

    Sérgio Monteiro de Almeida

    Full Text Available ABSTRACT The presence of hemoglobin in samples are considered an important inhibitory factor for polymerase chain reaction (PCR. The aim of this study was to examine the influence of red blood cells (RBCs in cerebrospinal fluid (CSF as an inhibitory factor to reverse transcription polymerase chain reaction (RT-PCR for enteroviruses (EV. Forty-four CSF samples from patients showing characteristics of viral meningitis were assessed for EV by RT-PCR. Viral RNA extracted with guanidine isothyocianate buffer and virus detection was performed by in-house nested PCR. Positivity for EV RT-PCR was higher in CSF samples without RBCs than in samples with RBCs: 13(26% and 36(9.2%, p = 0.001. In the group with positive EV RT-PCR, the mean + SD CSF RBC was 37 ± 183 cell/mm3; the group with negative results had 580 + 2,890 cell/mm3 (p = 0.007. The acceptable upper limit for CSF RBCs that could not influence RT-PCR was 108 cells/mm3. CSF samples with negative results for EV RT-PCR have more erythrocytes.

  2. Evaluation and optimization of SYBR Green real-time reverse transcription polymerase chain reaction as a tool for diagnosis of the Flavivirus genus in Brazil

    Directory of Open Access Journals (Sweden)

    Marilia Farignoli Romeiro

    2016-06-01

    Full Text Available Abstract: INTRODUCTION: The genus Flavivirus includes several pathogenic species that cause severe illness in humans. Therefore, a rapid and accurate molecular method for diagnosis and surveillance of these viruses would be of great importance. Here, we evaluate and optimize a quantitative real-time reverse transcription polymerase chain reaction (RT-PCR method for the diagnosis of the Flavivirus genus. METHODS: We evaluated different commercial kits that use the SYBR Green system for real-time RT-PCR with a primer set that amplifies a fragment of the NS5 flavivirus gene. The specificity and sensitivity of the assay were tested using twelve flaviviruses and ribonucleic acid (RNA transcribed from the yellow fever virus. Additionally, this assay was evaluated using the sera of 410 patients from different regions of Brazil with acute febrile illness and a negative diagnosis for the dengue virus. RESULTS: The real-time RT-PCR amplified all flaviviruses tested at a melting temperature of 79.92 to 83.49°C. A detection limit of 100 copies per ml was determined for this assay. Surprisingly, we detected dengue virus in 4.1% (17/410 of samples from patients with febrile illness and a supposedly negative dengue infection diagnosis. The viral load in patients ranged from 2.1×107to 3.4×103copies per ml. CONCLUSIONS: The real-time RT-PCR method may be very useful for preliminary diagnoses in screenings, outbreaks, and other surveillance studies. Moreover, this assay can be easily applied to monitor viral activity and to measure viral load in pathogenesis studies.

  3. Detection and quantification of Renibacterium salmoninarum DNA in salmonid tissues by real-time quantitative polymerase chain reaction analysis

    Science.gov (United States)

    Chase, D.M.; Elliott, D.G.; Pascho, R.J.

    2006-01-01

    Renibacterium salmoninarum is an important salmonid pathogen that is difficult to culture. We developed and assessed a real-time, quantitative, polymerase chain reaction (qPCR) assay for the detection and enumeration of R. salmoninarum. The qPCR is based on TaqMan technology and amplifies a 69-base pair (bp) region of the gene encoding the major soluble antigen (MSA) of R. salmoninarum. The qPCR assay consistently detected as few as 5 R. salmoninarum cells per reaction in kidney tissue. The specificity of the qPCR was confirmed by testing the DNA extracts from a panel of microorganisms that were either common fish pathogens or reported to cause false-positive reactions in the enzyme-linked immunosorbent assay (ELISA). Kidney samples from 38 juvenile Chinook salmon (Oncorhynchus tshawytscha) in a naturally infected population were examined by real-time qPCR, a nested PCR, and ELISA, and prevalences of R. salmoninarum detected were 71, 66, and 71%, respectively. The qPCR should be a valuable tool for evaluating the R. salmoninarum infection status of salmonids.

  4. Detection of Haemophilus influenzae in respiratory secretions from pneumonia patients by quantitative real-time polymerase chain reaction.

    Science.gov (United States)

    Abdeldaim, Guma M K; Strålin, Kristoffer; Kirsebom, Leif A; Olcén, Per; Blomberg, Jonas; Herrmann, Björn

    2009-08-01

    A quantitative real-time polymerase chain reaction (PCR) based on the omp P6 gene was developed to detect Haemophilus influenzae. Its specificity was determined by analysis of 29 strains of 11 different Haemophilus spp. and was compared with PCR assays having other target genes: rnpB, 16S rRNA, and bexA. The method was evaluated on nasopharyngeal aspirates from 166 adult patients with community-acquired pneumonia. When 10(4) DNA copies/mL was used as cutoff limit for the method, P6 PCR had a sensitivity of 97.5% and a specificity of 96.0% compared with the culture. Of 20 culture-negative but P6 PCR-positive cases, 18 were confirmed by fucK PCR as H. influenzae. Five (5.9%) of 84 nasopharyngeal aspirates from adult controls tested PCR positive. We conclude that the P6 real-time PCR is both sensitive and specific for identification of H. influenzae in respiratory secretions. Quantification facilitates discrimination between disease-causing H. influenzae strains and commensal colonization.

  5. Real-Time PCR-Based Quantitation Method for the Genetically Modified Soybean Line GTS 40-3-2.

    Science.gov (United States)

    Kitta, Kazumi; Takabatake, Reona; Mano, Junichi

    2016-01-01

    This chapter describes a real-time PCR-based method for quantitation of the relative amount of genetically modified (GM) soybean line GTS 40-3-2 [Roundup Ready(®) soybean (RRS)] contained in a batch. The method targets a taxon-specific soybean gene (lectin gene, Le1) and the specific DNA construct junction region between the Petunia hybrida chloroplast transit peptide sequence and the Agrobacterium 5-enolpyruvylshikimate-3-phosphate synthase gene (epsps) sequence present in GTS 40-3-2. The method employs plasmid pMulSL2 as a reference material in order to quantify the relative amount of GTS 40-3-2 in soybean samples using a conversion factor (Cf) equal to the ratio of the RRS-specific DNA to the taxon-specific DNA in representative genuine GTS 40-3-2 seeds.

  6. Species-specific detection and quantification of common barnacle larvae from the Japanese coast using quantitative real-time PCR.

    Science.gov (United States)

    Endo, Noriyuki; Sato, Kana; Matsumura, Kiyotaka; Yoshimura, Erina; Odaka, Yukiko; Nogata, Yasuyuki

    2010-11-01

    Species-specific detection and quantification methods for barnacle larvae using quantitative real-time polymerase chain reaction (qPCR) were developed. Species-specific primers for qPCR were designed for 13 barnacle species in the mitochondrial 12S ribosomal RNA gene region. Primer specificity was examined by PCR using template DNA extracted from each of the 13 barnacle species, other unidentified barnacle species, and field collected zooplankton samples. The resulting PCR products comprised single bands following agarose gel electrophoresis when the templates corresponded to primers. The amplifications were highly species-specific even for the field plankton samples. The field plankton samples were subjected to qPCR assay. The calculated DNA contents for each barnacle species were closely correlated with the number of larvae measured by microscopic examination. The method could be applied to quantify barnacle larvae in natural plankton samples.

  7. A triplex quantitative real-time PCR assay for differential detection of human adenovirus serotypes 2, 3 and 7.

    Science.gov (United States)

    Qiu, Fang-Zhou; Shen, Xin-Xin; Zhao, Meng-Chuan; Zhao, Li; Duan, Su-Xia; Chen, Chen; Qi, Ju-Ju; Li, Gui-Xia; Wang, Le; Feng, Zhi-Shan; Ma, Xue-Jun

    2018-05-02

    Human adenovirus (HAdV) serotypes 2, 3 and 7 are more prevalent than other serotypes and have been associated with severe pneumonia in pediatric children. Molecular typing of HAdV is not routinely performed in clinical diagnostic laboratories as it is time-consuming and labor-intensive. In the present study, we developed a triplex quantitative real-time PCR assay (tq-PCR) in a single closed tube for differential detection and quantitative analysis of HAdV serotypes 2, 3 and 7. The sensitivity, specificity, reproducibility and clinical performance of tq-PCR were evaluated. The analytical sensitivity of the tq-PCR was 100 copies/reaction for each of HAdV serotypes 2, 3 and 7, and no cross-reaction with other common respiratory viruses or HAdV serotypes 1,4,5,6,31,55 and 57 was observed. The coefficients of variation (CV) of intra-assay and inter-assay were between 0.6% to 3.6%. Of 138 previously-defined HAdV-positive nasopharyngeal aspirates samples tested, the detection agreement between tq-PCR and nested PCR was 96.38% (133/138). The proposed tq-PCR assay is a sensitive, specific and reproducible method and has the potential for clinical use in the rapid and differential detection and quantitation of HAdV serotypes 2, 3 and 7.

  8. Use of quantitative real-time PCR for direct detection of serratia marcescens in marine and other aquatic environments.

    Science.gov (United States)

    Joyner, Jessica; Wanless, David; Sinigalliano, Christopher D; Lipp, Erin K

    2014-03-01

    Serratia marcescens is the etiological agent of acroporid serratiosis, a distinct form of white pox disease in the threatened coral Acropora palmata. The pathogen is commonly found in untreated human waste in the Florida Keys, which may contaminate both nearshore and offshore waters. Currently there is no direct method for detection of this bacterium in the aquatic or reef environment, and culture-based techniques may underestimate its abundance in marine waters. A quantitative real-time PCR assay was developed to detect S. marcescens directly from environmental samples, including marine water, coral mucus, sponge tissue, and wastewater. The assay targeted the luxS gene and was able to distinguish S. marcescens from other Serratia species with a reliable quantitative limit of detection of 10 cell equivalents (CE) per reaction. The method could routinely discern the presence of S. marcescens for as few as 3 CE per reaction, but it could not be reliably quantified at this level. The assay detected environmental S. marcescens in complex sewage influent samples at up to 761 CE ml(-1) and in septic system-impacted residential canals in the Florida Keys at up to 4.1 CE ml(-1). This detection assay provided rapid quantitative abilities and good sensitivity and specificity, which should offer an important tool for monitoring this ubiquitous pathogen that can potentially impact both human health and coral health.

  9. Comparison between culture and a multiplex quantitative real-time polymerase chain reaction assay detecting Ureaplasma urealyticum and U. parvum.

    Science.gov (United States)

    Frølund, Maria; Björnelius, Eva; Lidbrink, Peter; Ahrens, Peter; Jensen, Jørgen Skov

    2014-01-01

    A novel multiplex quantitative real-time polymerase chain reaction (qPCR) for simultaneous detection of U. urealyticum and U. parvum was developed and compared with quantitative culture in Shepard's 10 C medium for ureaplasmas in urethral swabs from 129 men and 66 women, and cervical swabs from 61 women. Using culture as the gold standard, the sensitivity of the qPCR was 96% and 95% for female urethral and cervical swabs, respectively. In male urethral swabs the sensitivity was 89%. The corresponding specificities were 100%, 87% and 99%. The qPCR showed a linear increasing DNA copy number with increasing colour-changing units. Although slightly less sensitive than culture, this multiplex qPCR assay detecting U. urealyticum and U. parvum constitutes a simple and fast alternative to the traditional methods for identification of ureaplasmas and allows simultaneous species differentiation and quantitation in clinical samples. Furthermore, specimens overgrown by other bacteria using the culture method can be evaluated in the qPCR.

  10. Comparison between culture and a multiplex quantitative real-time polymerase chain reaction assay detecting Ureaplasma urealyticum and U. parvum.

    Directory of Open Access Journals (Sweden)

    Maria Frølund

    Full Text Available A novel multiplex quantitative real-time polymerase chain reaction (qPCR for simultaneous detection of U. urealyticum and U. parvum was developed and compared with quantitative culture in Shepard's 10 C medium for ureaplasmas in urethral swabs from 129 men and 66 women, and cervical swabs from 61 women. Using culture as the gold standard, the sensitivity of the qPCR was 96% and 95% for female urethral and cervical swabs, respectively. In male urethral swabs the sensitivity was 89%. The corresponding specificities were 100%, 87% and 99%. The qPCR showed a linear increasing DNA copy number with increasing colour-changing units. Although slightly less sensitive than culture, this multiplex qPCR assay detecting U. urealyticum and U. parvum constitutes a simple and fast alternative to the traditional methods for identification of ureaplasmas and allows simultaneous species differentiation and quantitation in clinical samples. Furthermore, specimens overgrown by other bacteria using the culture method can be evaluated in the qPCR.

  11. TaqMan探针荧光定量PCR检测花生油中掺入棕榈油的研究%Determination of palm oil adulterated in peanut oil with the TaqMan probe -based RT- PCR method

    Institute of Scientific and Technical Information of China (English)

    周慧; 梁宇斌; 吴苏喜; 李晓明; 裴伟; 杨涛

    2011-01-01

    The method of Real - time fluorescence quantitative polymerase chain reaction ( RT - PCR) with TaqMan fluorescent probe was chosen to fast detect the amount of palm oil mixed in peanut oil. MT3 - B gene of palm was selected as target gene to detect palm oil from peanut oil. The primers of MT3 - B and TaqMan probe were designed, MT3 - B gene reconstructed plasmid was built as absolute quantitative criteria for quantitative RT - PCR to establish standard curve. Peanut oil blended with 1% -40% concentration gradient palm oil was extracted DNA to test palm content by RT - PCR. The result showed that the correlation coefficient (R1) of standard curve with logarithmic linear regression analysis was 0.996. When the adulteration of palm oil in peanut oil reached 5% volume, MT3 - B gene of 17.431 copies per milli-liter of mixed oil could be detected . The method showed good sensitivity, specificity and repeatability.%根据棕榈内源基因MT3 -B设计引物和TaqMan探针,采用基因重组技术构建用于检测棕榈基因MT3 -B的重组质粒作为绝对定量标准品,建立标准曲线,对花生油中掺入棕榈油1% ~40%梯度混合油品提取DNA进行棕榈成分定量检测.结果表明,重组质粒标准品荧光定量标准曲线对数线性回归分析相关系数(R2)为0.996;花生油中掺入棕榈油达到5%时,可检出每亳升混合油品中棕榈MT3 -B基因17.431 copies,检测的重复性和特异性好.

  12. Molecular analysis of dolphin morbillivirus: A new sensitive detection method based on nested RT-PCR.

    Science.gov (United States)

    Centelleghe, Cinzia; Beffagna, Giorgia; Zanetti, Rossella; Zappulli, Valentina; Di Guardo, Giovanni; Mazzariol, Sandro

    2016-09-01

    Cetacean Morbillivirus (CeMV) has been identified as the most pathogenic virus for cetaceans. Over the past three decades, this RNA virus has caused several outbreaks of lethal disease in odontocetes and mysticetes worldwide. Isolation and identification of CeMV RNA is very challenging in whales because of the poor preservation status frequently shown by tissues from stranded animals. Nested reverse transcription polymerase chain reaction (nested RT-PCR) is used instead of conventional RT-PCR when it is necessary to increase the sensitivity and the specificity of the reaction. This study describes a new nested RT-PCR technique useful to amplify small amounts of the cDNA copy of Cetacean morbillivirus (CeMV) when it is present in scant quantity in whales' biological specimens. This technique was used to analyze different tissues (lung, brain, spleen and other lymphoid tissues) from one under human care seal and seven cetaceans stranded along the Italian coastline between October 2011 and September 2015. A well-characterized, 200 base pair (bp) fragment of the dolphin Morbillivirus (DMV) haemagglutinin (H) gene, obtained by nested RT-PCR, was sequenced and used to confirm DMV positivity in all the eight marine mammals under study. In conclusion, this nested RT-PCR protocol can represent a sensitive detection method to identify CeMV-positive, poorly preserved tissue samples. Furthermore, this is also a rather inexpensive molecular technique, relatively easy to apply. Copyright © 2016 Elsevier B.V. All rights reserved.

  13. Direct recovery of infectious Pestivirus from a full-length RT-PCR amplicon

    DEFF Research Database (Denmark)

    Rasmussen, Thomas Bruun; Reimann, Ilona; Hoffmann, Bernd

    2008-01-01

    This study describes the use of a novel and rapid long reverse transcription (RT)-PCR for the generation of infectious full-length cDNA of pestiviruses. To produce rescued viruses, full-length RT-PCR amplicons of 12.3 kb, including a T7-promotor, were transcribed directly in vitro, and the result......This study describes the use of a novel and rapid long reverse transcription (RT)-PCR for the generation of infectious full-length cDNA of pestiviruses. To produce rescued viruses, full-length RT-PCR amplicons of 12.3 kb, including a T7-promotor, were transcribed directly in vitro......, and the resulting RNA transcripts were electroporated into ovine cells. Infectious virus was obtained after one cell culture passage. The rescued viruses had a phenotype similar to the parental Border Disease virus strain. Therefore, direct generation of infectious pestiviruses from full-length RT-PCR cDNA products...

  14. Using quantitative real-time PCR to detect chimeras in transgenic tobacco and apricot and to monitor their dissociation

    Directory of Open Access Journals (Sweden)

    Burgos Lorenzo

    2010-07-01

    Full Text Available Abstract Background The routine generation of transgenic plants involves analysis of transgene integration into the host genome by means of Southern blotting. However, this technique cannot distinguish between uniformly transformed tissues and the presence of a mixture of transgenic and non-transgenic cells in the same tissue. On the other hand, the use of reporter genes often fails to accurately detect chimerical tissues because their expression can be affected by several factors, including gene silencing and plant development. So, new approaches based on the quantification of the amount of the transgene are needed urgently. Results We show here that chimeras are a very frequent phenomenon observed after regenerating transgenic plants. Spatial and temporal analyses of transformed tobacco and apricot plants with a quantitative, real-time PCR amplification of the neomycin phosphotransferase (nptII transgene as well as of an internal control (β-actin, used to normalise the amount of target DNA at each reaction, allowed detection of chimeras at unexpected rates. The amount of the nptII transgene differed greatly along with the sub-cultivation period of these plants and was dependent on the localisation of the analysed leaves; being higher in roots and basal leaves, while in the apical leaves it remained at lower levels. These data demonstrate that, unlike the use of the gus marker gene, real-time PCR is a powerful tool for detection of chimeras. Although some authors have proposed a consistent, positive Southern analysis as an alternative methodology for monitoring the dissociation of chimeras, our data show that it does not provide enough proof of uniform transformation. In this work, however, real-time PCR was applied successfully to monitor the dissociation of chimeras in tobacco plants and apricot callus. Conclusions We have developed a rapid and reliable method to detect and estimate the level of chimeras in transgenic tobacco and apricot

  15. Quantitative Determination of Plasmodium vivax Gametocytes by Real-Time Quantitative Nucleic Acid Sequence-Based Amplification in Clinical Samples

    NARCIS (Netherlands)

    Beurskens, Martijn; Mens, Pètra; Schallig, Henk; Syafruddin, Din; Asih, Puji Budi Setia; Hermsen, Rob; Sauerwein, Robert

    2009-01-01

    Microscopic detection of Plasmodium vivax gametocytes, the sexual life stage of this malaria parasite, is insensitive because P vivax parasitaemia is low. To detect and quantity gametocytes a more sensitive, quantitative realtime Pvs25-QT-NASBA based oil Pvs25 mRNA was developed and tested in two

  16. Applying real-time quantitative PCR to diagnosis of freemartin in Holstein cattle by quantifying SRY gene: a comparison experiment

    Directory of Open Access Journals (Sweden)

    Qinghua Qiu

    2018-04-01

    Full Text Available Background Freemartinism generally occurs in female offspring of dizygotic twins in a mixed-sex pregnancy. Most bovine heterosexual twin females are freemartins. However, about 10% of bovine heterosexual twin females are fertile. Farmers mostly cull bovine fertile heterosexual twin females due to the lack of a practical diagnostic approach. Culling of such animals results in economic and genetic-material losses both for dairy and beef industry. Methods In this study, a comparative test, including qualitative detection of SRY gene by polymerase chain reaction (PCR, quantitative detection of relative content of SRY by real-time quantitative polymerase chain reaction (qPCR, and quantitative detection of H-Y antigen, was performed to establish the most accurate diagnosis for freemartin. Twelve Holstein heterosexual twin females were used in this study, while three normal Holstein bulls and three normal Holstein cows were used as a positive and negative control, respectively. Results Polymerase chain reaction results revealed that SRY gene were absent in three heterosexual twin females and only two of them were verified as fertile in later age. The qPCR results showed that relative content of SRY was more than 14.2% in freemartins and below 0.41% in fertile heterosexual twin females. The H-Y antigen test showed no significant numerical difference between freemartin and fertile heterosexual twin female. Discussion Our results show that relative content of SRY quantified by qPCR is a better detection method for diagnosis of freemartin in Holstein cattle as compare to qualitative detection of SRY gene by PCR or quantitative detection of H-Y antigen. To the authors’ knowledge, this is the first time we applied qPCR to diagnosing freemartin by quantifying SRY gene and got relative SRY content of each freemartin and fertile heterosexual twin female. We concluded that low-level of SRY would not influence fertility of bovine heterosexual twin female.

  17. A two-step real-time PCR assay for quantitation and genotyping of human parvovirus 4.

    Science.gov (United States)

    Väisänen, E; Lahtinen, A; Eis-Hübinger, A M; Lappalainen, M; Hedman, K; Söderlund-Venermo, M

    2014-01-01

    Human parvovirus 4 (PARV4) of the family Parvoviridae was discovered in a plasma sample of a patient with an undiagnosed acute infection in 2005. Currently, three PARV4 genotypes have been identified, however, with an unknown clinical significance. Interestingly, these genotypes seem to differ in epidemiology. In Northern Europe, USA and Asia, genotypes 1 and 2 have been found to occur mainly in persons with a history of injecting drug use or other parenteral exposure. In contrast, genotype 3 appears to be endemic in sub-Saharan Africa, where it infects children and adults without such risk behaviour. In this study, a novel straightforward and cost-efficient molecular assay for both quantitation and genotyping of PARV4 DNA was developed. The two-step method first applies a single-probe pan-PARV4 qPCR for screening and quantitation of this relatively rare virus, and subsequently, only the positive samples undergo a real-time PCR-based multi-probe genotyping. The new qPCR-GT method is highly sensitive and specific regardless of the genotype, and thus being suitable for studying the clinical impact and occurrence of the different PARV4 genotypes. Copyright © 2013 Elsevier B.V. All rights reserved.

  18. A multiplex calibrated real-time PCR assay for quantitation of DNA of EBV-1 and 2.

    Science.gov (United States)

    Gatto, Francesca; Cassina, Giulia; Broccolo, Francesco; Morreale, Giuseppe; Lanino, Edoardo; Di Marco, Eddi; Vardas, Efthiya; Bernasconi, Daniela; Buttò, Stefano; Principi, Nicola; Esposito, Susanna; Scarlatti, Gabriella; Lusso, Paolo; Malnati, Mauro S

    2011-12-01

    Accurate and highly sensitive tests for the diagnosis of active Epstein-Barr virus (EBV) infection are essential for the clinical management of individuals infected with EBV. A calibrated quantitative real-time PCR assay for the measurement of EBV DNA of both EBV-1 and 2 subtypes was developed, combining the detection of the EBV DNA and a synthetic DNA calibrator in a multiplex PCR format. The assay displays a wide dynamic range and a high degree of accuracy even in the presence of 1μg of human genomic DNA. This assay measures with the same efficiency EBV DNA from strains prevalent in different geographic areas. The clinical sensitivity and specificity of the system were evaluated by testing 181 peripheral blood mononuclear cell (PBMCs) and plasma specimens obtained from 21 patients subjected to bone marrow transplantation, 70 HIV-seropositive subjects and 23 healthy controls. Patients affected by EBV-associated post-transplant lymphoprolipherative disorders had the highest frequency of EBV detection and the highest viral load. Persons infected with HIV had higher levels of EBV DNA load in PBMCs and a higher frequency of EBV plasma viremia compared to healthy controls. In conclusion, this new assay provides a reliable high-throughput method for the quantitation of EBV DNA in clinical samples. Copyright © 2011 Elsevier B.V. All rights reserved.

  19. Quantitative real-time PCR approaches for microbial community studies in wastewater treatment systems: applications and considerations.

    Science.gov (United States)

    Kim, Jaai; Lim, Juntaek; Lee, Changsoo

    2013-12-01

    Quantitative real-time PCR (qPCR) has been widely used in recent environmental microbial ecology studies as a tool for detecting and quantifying microorganisms of interest, which aids in better understandings of the complexity of wastewater microbial communities. Although qPCR can be used to provide more specific and accurate quantification than other molecular techniques, it does have limitations that must be considered when applying it in practice. This article reviews the principle of qPCR quantification and its applications to microbial ecology studies in various wastewater treatment environments. Here we also address several limitations of qPCR-based approaches that can affect the validity of quantification data: template nucleic acid quality, nucleic acid extraction efficiency, specificity of group-specific primers and probes, amplification of nonviable DNA, gene copy number variation, and limited number of sequences in the database. Even with such limitations, qPCR is reportedly among the best methods for quantitatively investigating environmental microbial communities. The application of qPCR is and will continue to be increasingly common in studies of wastewater treatment systems. To obtain reliable analyses, however, the limitations that have often been overlooked must be carefully considered when interpreting the results. Copyright © 2013 Elsevier Inc. All rights reserved.

  20. [Comparison of two quantitative methods of endobronchial ultrasound real-time elastography for evaluating intrathoracic lymph nodes].

    Science.gov (United States)

    Mao, X W; Yang, J Y; Zheng, X X; Wang, L; Zhu, L; Li, Y; Xiong, H K; Sun, J Y

    2017-06-12

    Objective: To compare the clinical value of two quantitative methods in analyzing endobronchial ultrasound real-time elastography (EBUS-RTE) images for evaluating intrathoracic lymph nodes. Methods: From January 2014 to April 2014, EBUS-RTE examination was performed in patients who received EBUS-TBNA examination in Shanghai Chest Hospital. Each intrathoracic lymph node had a selected EBUS-RTE image. Stiff area ratio and mean hue value of region of interest (ROI) in each image were calculated respectively. The final diagnosis of lymph node was based on the pathologic/microbiologic results of EBUS-TBNA, pathologic/microbiologic results of other examinations and clinical following-up. The sensitivity, specificity, positive predictive value, negative predictive value and accuracy were evaluated for distinguishing malignant and benign lesions. Results: Fifty-six patients and 68 lymph nodes were enrolled in this study, of which 35 lymph nodes were malignant and 33 lymph nodes were benign. The stiff area ratio and mean hue value of benign and malignant lesions were 0.32±0.29, 0.62±0.20 and 109.99±28.13, 141.62±17.52, respectively, and statistical differences were found in both of those two methods ( t =-5.14, P methods can be used for analyzing EBUS-RTE images quantitatively, having the value of differentiating benign and malignant intrathoracic lymph nodes, and the stiff area ratio is better than the mean hue value between the two methods.

  1. Development and application of an oligonucleotide microarray and real-time quantitative PCR for detection of wastewater bacterial pathogens

    Energy Technology Data Exchange (ETDEWEB)

    Lee, Dae-Young [National Water Research Institute, Environment Canada, 867 Lakeshore Road, Burlington, Ontario, L7R 4A6 (Canada)], E-mail: daeyoung.lee@ec.gc.ca; Lauder, Heather; Cruwys, Heather; Falletta, Patricia [National Water Research Institute, Environment Canada, 867 Lakeshore Road, Burlington, Ontario, L7R 4A6 (Canada); Beaudette, Lee A. [Environmental Science and Technology Centre, Environment Canada, 335 River Road South, Ottawa, Ontario, K1A 0H3 (Canada)], E-mail: lee.beaudette@ec.gc.ca

    2008-07-15

    Conventional microbial water quality test methods are well known for their technical limitations, such as lack of direct pathogen detection capacity and low throughput capability. The microarray assay has recently emerged as a promising alternative for environmental pathogen monitoring. In this study, bacterial pathogens were detected in municipal wastewater using a microarray equipped with short oligonucleotide probes targeting 16S rRNA sequences. To date, 62 probes have been designed against 38 species, 4 genera, and 1 family of pathogens. The detection sensitivity of the microarray for a waterborne pathogen Aeromonas hydrophila was determined to be approximately 1.0% of the total DNA, or approximately 10{sup 3}A. hydrophila cells per sample. The efficacy of the DNA microarray was verified in a parallel study where pathogen genes and E. coli cells were enumerated using real-time quantitative PCR (qPCR) and standard membrane filter techniques, respectively. The microarray and qPCR successfully detected multiple wastewater pathogen species at different stages of the disinfection process (i.e. secondary effluents vs. disinfected final effluents) and at two treatment plants employing different disinfection methods (i.e. chlorination vs. UV irradiation). This result demonstrates the effectiveness of the DNA microarray as a semi-quantitative, high throughput pathogen monitoring tool for municipal wastewater.

  2. Sequential processing of quantitative phase images for the study of cell behaviour in real-time digital holographic microscopy.

    Science.gov (United States)

    Zikmund, T; Kvasnica, L; Týč, M; Křížová, A; Colláková, J; Chmelík, R

    2014-11-01

    Transmitted light holographic microscopy is particularly used for quantitative phase imaging of transparent microscopic objects such as living cells. The study of the cell is based on extraction of the dynamic data on cell behaviour from the time-lapse sequence of the phase images. However, the phase images are affected by the phase aberrations that make the analysis particularly difficult. This is because the phase deformation is prone to change during long-term experiments. Here, we present a novel algorithm for sequential processing of living cells phase images in a time-lapse sequence. The algorithm compensates for the deformation of a phase image using weighted least-squares surface fitting. Moreover, it identifies and segments the individual cells in the phase image. All these procedures are performed automatically and applied immediately after obtaining every single phase image. This property of the algorithm is important for real-time cell quantitative phase imaging and instantaneous control of the course of the experiment by playback of the recorded sequence up to actual time. Such operator's intervention is a forerunner of process automation derived from image analysis. The efficiency of the propounded algorithm is demonstrated on images of rat fibrosarcoma cells using an off-axis holographic microscope. © 2014 The Authors Journal of Microscopy © 2014 Royal Microscopical Society.

  3. Recombinant plasmid-based quantitative Real-Time PCR analysis of Salmonella enterica serotypes and its application to milk samples.

    Science.gov (United States)

    Gokduman, Kurtulus; Avsaroglu, M Dilek; Cakiris, Aris; Ustek, Duran; Gurakan, G Candan

    2016-03-01

    The aim of the current study was to develop, a new, rapid, sensitive and quantitative Salmonella detection method using a Real-Time PCR technique based on an inexpensive, easy to produce, convenient and standardized recombinant plasmid positive control. To achieve this, two recombinant plasmids were constructed as reference molecules by cloning the two most commonly used Salmonella-specific target gene regions, invA and ttrRSBC. The more rapid detection enabled by the developed method (21 h) compared to the traditional culture method (90 h) allows the quantitative evaluation of Salmonella (quantification limits of 10(1)CFU/ml and 10(0)CFU/ml for the invA target and the ttrRSBC target, respectively), as illustrated using milk samples. Three advantages illustrated by the current study demonstrate the potential of the newly developed method to be used in routine analyses in the medical, veterinary, food and water/environmental sectors: I--The method provides fast analyses including the simultaneous detection and determination of correct pathogen counts; II--The method is applicable to challenging samples, such as milk; III--The method's positive controls (recombinant plasmids) are reproducible in large quantities without the need to construct new calibration curves. Copyright © 2016 Elsevier B.V. All rights reserved.

  4. Quantitative assessment of hematopoietic chimerism by quantitative real-time polymerase chain reaction of sequence polymorphism systems after hematopoietic stem cell transplantation.

    Science.gov (United States)

    Qin, Xiao-ying; Li, Guo-xuan; Qin, Ya-zhen; Wang, Yu; Wang, Feng-rong; Liu, Dai-hong; Xu, Lan-ping; Chen, Huan; Han, Wei; Wang, Jing-zhi; Zhang, Xiao-hui; Li, Jin-lan; Li, Ling-di; Liu, Kai-yan; Huang, Xiao-jun

    2011-08-01

    Analysis of changes in recipient and donor hematopoietic cell origin is extremely useful to monitor the effect of hematopoietic stem cell transplantation (HSCT) and sequential adoptive immunotherapy by donor lymphocyte infusions. We developed a sensitive, reliable and rapid real-time PCR method based on sequence polymorphism systems to quantitatively assess the hematopoietic chimerism after HSCT. A panel of 29 selected sequence polymorphism (SP) markers was screened by real-time PCR in 101 HSCT patients with leukemia and other hematological diseases. The chimerism kinetics of bone marrow samples of 8 HSCT patients in remission and relapse situations were followed longitudinally. Recipient genotype discrimination was possible in 97.0% (98 of 101) with a mean number of 2.5 (1-7) informative markers per recipient/donor pair. Using serial dilutions of plasmids containing specific SP markers, the linear correlation (r) of 0.99, the slope between -3.2 and -3.7 and the sensitivity of 0.1% were proved reproducible. By this method, it was possible to very accurately detect autologous signals in the range from 0.1% to 30%. The accuracy of the method in the very important range of autologous signals below 5% was extraordinarily high (standard deviation real-time PCR method over short tandem repeat PCR chimerism assays is the absence of PCR competition and plateau biases, with demonstrated greater sensitivity and linearity. Finally, we prospectively analyzed bone marrow samples of 8 patients who received allografts and presented the chimerism kinetics of remission and relapse situations that illustrated the sensitivity level and the promising clinical application of this method. This SP-based real-time PCR assay provides a rapid, sensitive, and accurate quantitative assessment of mixed chimerism that can be useful in predicting graft rejection and early relapse.

  5. Diagnosis of intestinal parasites in a rural community of Venezuela: Advantages and disadvantages of using microscopy or RT-PCR.

    Science.gov (United States)

    Incani, Renzo Nino; Ferrer, Elizabeth; Hoek, Denise; Ramak, Robbert; Roelfsema, Jeroen; Mughini-Gras, Lapo; Kortbeek, Titia; Pinelli, Elena

    2017-03-01

    A cross-sectional study was carried out to determine the prevalence and diagnostic performance of microscopy and real time PCR (RT-PCR) for 14 intestinal parasites in a Venezuelan rural community with a long history of persistent intestinal parasitic infections despite the implementation of regular anthelminthic treatments. A total of 228 participants were included in this study. A multiplex RT-PCR was used for the detection of Dientamoeba fragilis, Giardia intestinalis, Cryptosporidium sp. and a monoplex RT-PCR for Entamoeba histolytica. Furthermore, a multiplex PCR was performed for detection of Ascaris lumbricoides, Strongyloides stercoralis, Necator americanus and Ancylostoma duodenale. Combined microscopy-PCR revealed prevalences of 49.3% for A. lumbricoides, 10.1% for N. americanus (no A. duodenale was detected), 2.0% for S. stercoralis, 40.4% for D. fragilis, 35.1% for G. intestinalis, and 7.9% for E. histolytica/dispar. Significant increases in prevalence at PCR vs. microscopy were found for A. lumbricoides, G. intestinalis and D. fragilis. Other parasites detected by microscopy alone were Trichuris trichiura (25.7%), Enterobius vermicularis (3.4%), Blastocystis sp. (65.8%), and the non-pathogenic Entamoeba coli (28.9%), Entamoeba hartmanni (12.3%), Endolimax nana (19.7%) and Iodamoeba bütschlii (7.5%). Age- but no gender-related differences in prevalences were found for A. lumbricoides, T. trichiura, G. intestinalis, and E. histolytica/dispar. The persistently high prevalences of intestinal helminths are probably related to the high faecal pollution as also evidenced by the high prevalences of non-pathogenic intestinal protozoans. These results highlight the importance of using sensitive diagnostic techniques in combination with microscopy to better estimate the prevalence of intestinal parasites, especially in the case of D. fragilis trophozoites, which deteriorate very rapidly and would be missed by microscopy. In addition, the differentiation between

  6. Detection of respiratory bacterial pathogens causing atypical pneumonia by multiplex Lightmix® RT-PCR.

    Science.gov (United States)

    Wagner, Karoline; Springer, Burkard; Imkamp, Frank; Opota, Onya; Greub, Gilbert; Keller, Peter M

    2018-04-01

    Pneumonia is a severe infectious disease. In addition to common viruses and bacterial pathogens (e.g. Streptococcus pneumoniae), fastidious respiratory pathogens like Chlamydia pneumoniae, Mycoplasma pneumoniae and Legionella spp. can cause severe atypical pneumonia. They do not respond to penicillin derivatives, which may cause failure of antibiotic empirical therapy. The same applies for infections with B. pertussis and B. parapertussis, the cause of pertussis disease, that may present atypically and need to be treated with macrolides. Moreover, these fastidious bacteria are difficult to identify by culture or serology, and therefore often remain undetected. Thus, rapid and accurate identification of bacterial pathogens causing atypical pneumonia is crucial. We performed a retrospective method evaluation study to evaluate the diagnostic performance of the new, commercially available Lightmix ® multiplex RT-PCR assay that detects these fastidious bacterial pathogens causing atypical pneumonia. In this retrospective study, 368 clinical respiratory specimens, obtained from patients suffering from atypical pneumonia that have been tested negative for the presence of common agents of pneumonia by culture and viral PCR, were investigated. These clinical specimens have been previously characterized by singleplex RT-PCR assays in our diagnostic laboratory and were used to evaluate the diagnostic performance of the respiratory multiplex Lightmix ® RT-PCR. The multiplex RT-PCR displayed a limit of detection between 5 and 10 DNA copies for different in-panel organisms and showed identical performance characteristics with respect to specificity and sensitivity as in-house singleplex RT-PCRs for pathogen detection. The Lightmix ® multiplex RT-PCR assay represents a low-cost, time-saving and accurate diagnostic tool with high throughput potential. The time-to-result using an automated DNA extraction device for respiratory specimens followed by multiplex RT-PCR detection was

  7. A novel universal real-time PCR system using the attached universal duplex probes for quantitative analysis of nucleic acids

    Directory of Open Access Journals (Sweden)

    Wilson Zoe A

    2008-06-01

    Full Text Available Abstract Background Real-time PCR techniques are being widely used for nucleic acids analysis, but one limitation of current frequently employed real-time PCR is the high cost of the labeled probe for each target molecule. Results We describe a real-time PCR technique employing attached universal duplex probes (AUDP, which has the advantage of generating fluorescence by probe hydrolysis and strand displacement over current real-time PCR methods. AUDP involves one set of universal duplex probes in which the 5' end of the fluorescent probe (FP and a complementary quenching probe (QP lie in close proximity so that fluorescence can be quenched. The PCR primer pair with attached universal template (UT and the FP are identical to the UT sequence. We have shown that the AUDP technique can be used for detecting multiple target DNA sequences in both simplex and duplex real-time PCR assays for gene expression analysis, genotype identification, and genetically modified organism (GMO quantification with comparable sensitivity, reproducibility, and repeatability with other real-time PCR methods. Conclusion The results from GMO quantification, gene expression analysis, genotype identification, and GMO quantification using AUDP real-time PCR assays indicate that the AUDP real-time PCR technique has been successfully applied in nucleic acids analysis, and the developed AUDP real-time PCR technique will offer an alternative way for nucleic acid analysis with high efficiency, reliability, and flexibility at low cost.

  8. The incidence and distribution characteristics of MLL rearrangements in Chinese acute myeloid leukemia patients by multiplex nested RT-PCR.

    Science.gov (United States)

    Yang, Hua; Cao, Tingting; Gao, Li; Wang, Lili; Zhu, Chengying; Xu, Yuanyuan; Jing, Yu; Zhu, Haiyan; Lv, Na; Yu, Li

    2017-07-20

    Occurrence of MLL (Mixed Lineage Leukemia) gene rearrangements indicates poor prognosis in acute myeloid leukemia (AML) patients. This is the first study to report the positive rate and distribution characteristics of MLL rearrangements in AML patients in north China. We used multiplex nested real time PCR (RT-PCR) to screen for incidence of 11 MLL rearrangements in 433 AML patients. Eleven MLL rearrangements included (MLL-PTD, MLL-AF9, MLL-ELL, MLL-AF10, MLL-AF17, MLL-AF6, MLL-ENL, MLL-AF1Q, MLL-CBP, MLL-AF1P, MLL-AFX1). There were 68 AML patients with MLL rearrangements, and the positive rate was 15.7%. MLL-PTD (4.84%) was detected in 21 patients, MLL-AF9 in 15, (3.46%), MLL-ELL in 10 (2.31%), MLL-AF10 in 8 (1.85%), MLL-AF1Q in 2 (0.46%), 3 cases each of MLL-AF17, MLL-AF6, MLL-ENL (0.69% each), a and single case each of MLL-CBP, MLL-AF1P, and MLL-AFX1 (0.23% each). The highest rate of MLL rearrangements was found in 24 patients with M5 subtype AML, occurring in 24 cases (35.3%). MLL rearrangements occurred in 21 patients with M2 subtype AML (30.9%), and in 10 patients with M4 subtype AML (14.7%). Screening fusion genes by multiplex nested RT-PCR is a convenient, fast, economical, and accurate method for diagnosis and predicting prognosis of AML.

  9. Application of droplet digital PCR for quantitative detection of Spiroplasma citri in comparison with real time PCR.

    Directory of Open Access Journals (Sweden)

    Yogita Maheshwari

    Full Text Available Droplet digital polymerase chain reaction (ddPCR is a method for performing digital PCR that is based on water-oil emulsion droplet technology. It is a unique approach to measure the absolute copy number of nucleic acid targets without the need of external standards. This study evaluated the applicability of ddPCR as a quantitative detection tool for the Spiroplasma citri, causal agent of citrus stubborn disease (CSD in citrus. Two sets of primers, SP1, based on the spiral in housekeeping gene, and a multicopy prophage gene, SpV1 ORF1, were used to evaluate ddPCR in comparison with real time (quantitative PCR (qPCR for S. citri detection in citrus tissues. Standard curve analyses on tenfold dilution series showed that both ddPCR and qPCR exhibited good linearity and efficiency. However, ddPCR had a tenfold greater sensitivity than qPCR and accurately quantified up to one copy of spiralin gene. Receiver operating characteristic analysis indicated that the ddPCR methodology was more robust for diagnosis of CSD and the area under the curve was significantly broader compared to qPCR. Field samples were used to validate ddPCR efficacy and demonstrated that it was equal or better than qPCR to detect S. citri infection in fruit columella due to a higher pathogen titer. The ddPCR assay detected both the S. citri spiralin and the SpV1 ORF1 targets quantitatively with high precision and accuracy compared to qPCR assay. The ddPCR was highly reproducible and repeatable for both the targets and showed higher resilience to PCR inhibitors in citrus tissue extract for the quantification of S. citri compare to qPCR.

  10. Real-time label-free quantitative fluorescence microscopy-based detection of ATP using a tunable fluorescent nano-aptasensor platform.

    Science.gov (United States)

    Shrivastava, Sajal; Sohn, Il-Yung; Son, Young-Min; Lee, Won-Il; Lee, Nae-Eung

    2015-12-14

    Although real-time label-free fluorescent aptasensors based on nanomaterials are increasingly recognized as a useful strategy for the detection of target biomolecules with high fidelity, the lack of an imaging-based quantitative measurement platform limits their implementation with biological samples. Here we introduce an ensemble strategy for a real-time label-free fluorescent graphene (Gr) aptasensor platform. This platform employs aptamer length-dependent tunability, thus enabling the reagentless quantitative detection of biomolecules through computational processing coupled with real-time fluorescence imaging data. We demonstrate that this strategy effectively delivers dose-dependent quantitative readouts of adenosine triphosphate (ATP) concentration on chemical vapor deposited (CVD) Gr and reduced graphene oxide (rGO) surfaces, thereby providing cytotoxicity assessment. Compared with conventional fluorescence spectrometry methods, our highly efficient, universally applicable, and rational approach will facilitate broader implementation of imaging-based biosensing platforms for the quantitative evaluation of a range of target molecules.

  11. A simplified strategy for sensitive detection of Rose rosette virus compatible with three RT-PCR chemistries.

    Science.gov (United States)

    Dobhal, Shefali; Olson, Jennifer D; Arif, Mohammad; Garcia Suarez, Johnny A; Ochoa-Corona, Francisco M

    2016-06-01

    Rose rosette disease is a disorder associated with infection by Rose rosette virus (RRV), a pathogen of roses that causes devastating effects on most garden cultivated varieties, and the wild invasive rose especially Rosa multiflora. Reliable and sensitive detection of this disease in early phases is needed to implement proper control measures. This study assesses a single primer-set based detection method for RRV and demonstrates its application in three different chemistries: Endpoint RT-PCR, TaqMan-quantitative RT-PCR (RT-qPCR) and SYBR Green RT-qPCR with High Resolution Melting analyses. A primer set (RRV2F/2R) was designed from consensus sequences of the nucleocapsid protein gene p3 located in the RNA 3 region of RRV. The specificity of primer set RRV2F/2R was validated in silico against published GenBank sequences and in-vitro against infected plant samples and an exclusivity panel of near-neighbor and other viruses that commonly infect Rosa spp. The developed assay is sensitive with a detection limit of 1fg from infected plant tissue. Thirty rose samples from 8 different states of the United States were tested using the developed methods. The developed methods are sensitive and reliable, and can be used by diagnostic laboratories for routine testing and disease management decisions. Copyright © 2016 Elsevier B.V. All rights reserved.

  12. Rapid detection of Van genes in rectal swabs by real time PCR in Southern Brazil

    Directory of Open Access Journals (Sweden)

    Vlademir Cantarelli

    2011-10-01

    Full Text Available INTRODUCTION: Laboratory-based surveillance is an important component in the control of vancomycin resistant enterococci (VRE. METHODS: The study aimed to evaluate real-time polymerase chain reaction (RT-PCR (genes vanA-vanB for VRE detection on 115 swabs from patients included in a surveillance program. RESULTS: Sensitivity of RT-PCR was similar to primary culture (75% and 79.5%, respectively when compared to broth enriched culture, whereas specificity was 83.1%. CONCLUSIONS: RT-PCR provides same day results, however it showed low sensitivity for VRE detection.

  13. Real-time label-free quantitative fluorescence microscopy-based detection of ATP using a tunable fluorescent nano-aptasensor platform

    Science.gov (United States)

    Shrivastava, Sajal; Sohn, Il-Yung; Son, Young-Min; Lee, Won-Il; Lee, Nae-Eung

    2015-11-01

    Although real-time label-free fluorescent aptasensors based on nanomaterials are increasingly recognized as a useful strategy for the detection of target biomolecules with high fidelity, the lack of an imaging-based quantitative measurement platform limits their implementation with biological samples. Here we introduce an ensemble strategy for a real-time label-free fluorescent graphene (Gr) aptasensor platform. This platform employs aptamer length-dependent tunability, thus enabling the reagentless quantitative detection of biomolecules through computational processing coupled with real-time fluorescence imaging data. We demonstrate that this strategy effectively delivers dose-dependent quantitative readouts of adenosine triphosphate (ATP) concentration on chemical vapor deposited (CVD) Gr and reduced graphene oxide (rGO) surfaces, thereby providing cytotoxicity assessment. Compared with conventional fluorescence spectrometry methods, our highly efficient, universally applicable, and rational approach will facilitate broader implementation of imaging-based biosensing platforms for the quantitative evaluation of a range of target molecules.Although real-time label-free fluorescent aptasensors based on nanomaterials are increasingly recognized as a useful strategy for the detection of target biomolecules with high fidelity, the lack of an imaging-based quantitative measurement platform limits their implementation with biological samples. Here we introduce an ensemble strategy for a real-time label-free fluorescent graphene (Gr) aptasensor platform. This platform employs aptamer length-dependent tunability, thus enabling the reagentless quantitative detection of biomolecules through computational processing coupled with real-time fluorescence imaging data. We demonstrate that this strategy effectively delivers dose-dependent quantitative readouts of adenosine triphosphate (ATP) concentration on chemical vapor deposited (CVD) Gr and reduced graphene oxide (r

  14. SYBR green-based one step quantitative real-time polymerase chain reaction assay for the detection of Zika virus in field-caught mosquitoes.

    Science.gov (United States)

    Tien, Wei-Ping; Lim, Gareth; Yeo, Gladys; Chiang, Suzanna Nicole; Chong, Chee-Seng; Ng, Lee-Ching; Hapuarachchi, Hapuarachchige Chanditha

    2017-09-19

    The monitoring of vectors is one of the key surveillance measures to assess the risk of arbovirus transmission and the success of control strategies in endemic regions. The recent re-emergence of Zika virus (ZIKV) in the tropics, including Singapore, emphasizes the need to develop cost-effective, rapid and accurate assays to monitor the virus spread by mosquitoes. As ZIKV infections largely remain asymptomatic, early detection of ZIKV in the field-caught mosquitoes enables timely implementation of appropriate mosquito control measures. We developed a rapid, sensitive and specific real-time reverse transcription polymerase chain reaction (rRT-PCR) assay for the detection of ZIKV in field-caught mosquitoes. The primers and PCR cycling conditions were optimized to minimize non-specific amplification due to cross-reactivity with the genomic material of Aedes aegypti, Aedes albopictus, Culex quinquefasciatus, Culex tritaeniorhynchus, Culex sitiens and Anopheles sinensis, as well as accompanying microbiota. The performance of the assay was further evaluated with a panel of flaviviruses and alphaviruses as well as in field-caught Ae. aegypti mosquitoes confirmed to be positive for ZIKV. As compared to a probe-based assay, the newly developed assay demonstrated 100% specificity and comparable detection sensitivity for ZIKV in mosquitoes. Being a SYBR Green-based method, the newly-developed assay is cost-effective and easy to adapt, thus is applicable to large-scale vector surveillance activities in endemic countries, including those with limited resources and expertise. The amplicon size (119 bp) also allows sequencing to confirm the virus type. The primers flank relatively conserved regions of ZIKV genome, so that, the assay is able to detect genetically diverse ZIKV strains. Our findings, therefore, testify the potential use of the newly-developed assay in vector surveillance programmes for ZIKV in endemic regions.

  15. Real-time ed end-point Polymerase Chain Reaction per la quantizzazione del DNA di Citomegalovirus: confronto tra metodi e con il test per l’antigene pp65

    Directory of Open Access Journals (Sweden)

    Tiziano Allice

    2006-03-01

    Full Text Available Quantitave Polymerase Chain Reaction (PCR for Cytomegalovirus (CMV DNA provides highly sensitive and specific data for detecting CMV as well as monitoring the infection and determining the appropriate antiviral strategy.To determine the clinical application of a recently introduced real-time (RT PCR assay for CMV DNA quantitation in peripheral blood leukocytes (PBLs and defining its correlation with the commercial quantitative end-point (EP PCR method COBAS AMPLICOR CMV Monitor and pp65 antigen test. Sequential PBL samples (n=158 from 32 liver transplanted patients with CMV asymptomatic infection and positive for CMV DNA by EP-PCR were retrospectively analysed with RT-PCR and studied according to pp65 antigen levels. A good correlation was found between RT-PCR and pp65 antigen test (r=0.691 and between the two PCR assays (r=0.761. RT-PCR data were significantly higher in pre-emptive treated patients (those with >20 pp65+positive cells, median value: 3.8 log10 copies/500,000 PBLs than in not-treated ones (2.9 logs.According to pp65 levels of 0, 1-10, 11-20, 21-50, 51-100 and >100 positive cells/200,000 PBLs, median CMV DNA load by RT-PCR was 2.6, 3.0, 3.6, 4.0. 4.2 and 4.8, log10 copies/ 500,000 PBLs, respectively (EP-PCR CMV DNA levels: 2. 8, 2.9, 3.8, 3.7, 3.9 and 4.0 logs. For samples with >20 pp65+cells, that is above the level at which pre-emptive therapy was started, RT-PCR values were significantly higher than in groups with less than 20 pp65+cells, whereas EP-PCR values did not significantly differ and showed a slower progression rate. Dilutions of DNA from CMV AD169 strain were used to probe RT-PCR reproducibility (between and intra-assay variability < 2% and sensitivity (100% detection rate at 10 copies/reaction, 28.5% with EP-PCR. A significant improvement is coming from the introduction of RT-PCR to the study of CMV DNA dynamics in differently CMV infected patients due to a more reliable quantitation of CMV DNA for moderate and high

  16. Comparison of commercial DNA preparation kits for the detection of Brucellae in tissue using quantitative real-time PCR

    Directory of Open Access Journals (Sweden)

    Straube Eberhard

    2010-04-01

    Full Text Available Abstract Background The detection of Brucellae in tissue specimens using PCR assays is difficult because the amount of bacteria is usually low. Therefore, optimised DNA extraction methods are critical. The aim of this study was to assess the performance of commercial kits for the extraction of Brucella DNA. Methods Five kits were evaluated using clinical specimens: QIAamp™ DNA Mini Kit (QIAGEN, peqGold™ Tissue DNA Mini Kit (PeqLab, UltraClean™ Tissue and Cells DNA Isolation Kit (MoBio, DNA Isolation Kit for Cells and Tissues (Roche, and NucleoSpin™ Tissue (Macherey-Nagel. DNA yield was determined using a quantitative real-time PCR assay targeting IS711 that included an internal amplification control. Results Kits of QIAGEN and Roche provided the highest amount of DNA, Macherey-Nagel and Peqlab products were intermediate whereas MoBio yielded the lowest amount of DNA. Differences were significant (p Conclusions We observed differences in DNA yield as high as two orders of magnitude for some samples between the best and the worst DNA extraction kits and inhibition was observed occasionally. This indicates that DNA purification may be more relevant than expected when the amount of DNA in tissue is very low.

  17. Effectiveness of quantitative real time PCR in long-term follow-up of chronic myeloid leukemia patients

    International Nuclear Information System (INIS)

    Savasoglu, K.; Berber, B.

    2015-01-01

    To determine the use of the Quantitative Real Time PCR (RQ-PCR) assay follow-up with Chronic Myeloid Leukemia (CML) patients. Study Design: Cross-sectional observational. Place and Duration of Study: Izmir Ataturk Education and Research Hospital, Izmir, Turkey, from 2009 to 2013. Methodology: Cytogenetic, FISH, RQ-PCR test results from 177 CML patients materials selected between 2009 - 2013 years was set up for comparison analysis. Statistical analysis was performed to compare between FISH, karyotype and RQ-PCR results of the patients. Karyotyping and FISH specificity and sensitivity rates determined by ROC analysis compared with RQ-PCR results. Chi-square test was used to compare test failure rates. Results:Sensitivity and specificity values were determined for karyotyping 17.6 - 98% (p=0.118, p > 0.05) and for FISH 22.5 - 96% (p=0.064, p > 0.05) respectively. FISH sensitivity was slightly higher than karyotyping but there was calculated a strong correlation between them (p < 0.001). RQ-PCR test failure rate did not correlate with other two tests (p > 0.05); however, karyotyping and FISH test failure rate was statistically significant (p < 0.001). Conclusion: Besides, the situation needed for karyotype analysis, RQ-PCR assay can be used alone in the follow-up of CML disease. (author)

  18. Quantitative real-time PCR technique for the identification of E. coli residual DNA in streptokinase recombinant product.

    Science.gov (United States)

    Fazelahi, Mansoureh; Kia, Vahid; Kaghazian, Hooman; Paryan, Mahdi

    2017-11-26

    Recombinant streptokinase is a biopharmaceutical which is usually produced in E. coli. Residual DNA as a contamination and risk factor may remain in the product. It is necessary to control the production procedure to exclude any possible contamination. The aim of the present study was to develop a highly specific and sensitive quantitative real-time PCR-based method to determine the amount of E. coli DNA in recombinant streptokinase. A specific primers and a probe was designed to detect all strains of E. coli. To determine the specificity, in addition to using NCBI BLASTn, 28 samples including human, bacterial, and viral genomes were used. The results confirmed that the assay detects no genomic DNA but E. coli's and the specificity was determined to be 100%. To determine the sensitivity and limit of detection of the assay, a 10-fold serial dilution (10 1 to 10 7 copies/µL) was tested in triplicate. The sensitivity of the test was determined to be 101 copies/µL or 35 fg/µL. Inter-assay and intra-assay were determined to be 0.86 and 1.69%, respectively. Based on the results, this assay can be used as an accurate method to evaluate the contamination of recombinant streptokinase in E. coli.

  19. Identification of reference genes for expression analysis by real-time quantitative PCR in drought-stressed soybean

    Directory of Open Access Journals (Sweden)

    Renata Stolf-Moreira

    2011-01-01

    Full Text Available The objective of this work was to validate, by quantitative PCR in real time (RT-qPCR, genes to be used as reference in studies of gene expression in soybean in drought-stressed trials. Four genes commonly used in soybean were evaluated: Gmβ-actin, GmGAPDH, GmLectin and GmRNAr18S. Total RNA was extracted from six samples: three from roots in a hydroponic system with different drought intensities (0, 25, 50, 75 and 100 minutes of water stress, and three from leaves of plants grown in sand with different soil moistures (15, 5 and 2.5% gravimetric humidity. The raw cycle threshold (Ct data were analyzed, and the efficiency of each primer was calculated for an overall analysis of the Ct range among the different samples. The GeNorm application was used to evaluate the best reference gene, according to its stability. The GmGAPDH was the least stable gene, with the highest mean values of expression stability (M, and the most stable genes, with the lowest M values, were the Gmβ-actin and GmRNAr18S, when both root and leaves samples were tested. These genes can be used in RT-qPCR as reference gene for expression analysis.

  20. Effectiveness of Quantitative Real Time PCR in Long-Term Follow-up of Chronic Myeloid Leukemia Patients.

    Science.gov (United States)

    Savasoglu, Kaan; Payzin, Kadriye Bahriye; Ozdemirkiran, Fusun; Berber, Belgin

    2015-08-01

    To determine the use of the Quantitative Real Time PCR (RQ-PCR) assay follow-up with Chronic Myeloid Leukemia (CML) patients. Cross-sectional observational. Izmir Ataturk Education and Research Hospital, Izmir, Turkey, from 2009 to 2013. Cytogenetic, FISH, RQ-PCR test results from 177 CMLpatients' materials selected between 2009 - 2013 years was set up for comparison analysis. Statistical analysis was performed to compare between FISH, karyotype and RQ-PCR results of the patients. Karyotyping and FISH specificity and sensitivity rates determined by ROC analysis compared with RQ-PCR results. Chi-square test was used to compare test failure rates. Sensitivity and specificity values were determined for karyotyping 17.6 - 98% (p=0.118, p > 0.05) and for FISH 22.5 - 96% (p=0.064, p > 0.05) respectively. FISH sensitivity was slightly higher than karyotyping but there was calculated a strong correlation between them (p 0.05); however, karyotyping and FISH test failure rate was statistically significant (p < 0.001). Besides, the situation needed for karyotype analysis, RQ-PCR assay can be used alone in the follow-up of CMLdisease.

  1. Development of real-time quantitative polymerase chain reaction assays to track treatment response in retinoid resistant acute promyelocytic leukemia

    Directory of Open Access Journals (Sweden)

    Jelena V Jovanovic

    2011-10-01

    Full Text Available Molecular detection of minimal residual disease (MRD has become established to assess remission status and guide therapy in patients with PML-RARA+ acute promyelocytic leukemia (APL. However, there are few data on tracking disease response in patients with rarer retinoid resistant subtypes of APL, characterized by PLZF-RARA and STAT5b-RARA. Despite their relative rarity (<1% of APL we identified 6 cases (PLZF-RARA, n=5; STAT5b-RARA, n=1, established the respective breakpoint junction regions and designed real-time quantitative polymerase chain reaction (RQ-PCR assays to detect leukemic transcripts. The relative level of fusion gene expression in diagnostic samples was comparable to that observed in t(15;17-associated APL, affording assay sensitivities of ~1 in 104-105. Serial samples were available from 2 PLZF-RARA APL patients. One showed persistent PCR positivity, predicting subsequent relapse, and remains in CR2, ~11 years post-autograft. The other, achieved molecular remission (CRm with combination chemotherapy, remaining in CR1 at 6 years. The STAT5b-RARA patient failed to achieve CRm following frontline combination chemotherapy and ultimately proceeded to allogeneic transplant on the basis of a steadily rising fusion transcript level. These data highlight the potential of RQ-PCR detection of MRD to facilitate development of more individualized approaches to the management of rarer molecularly-defined subsets of acute leukemia.

  2. Accurate, Fast and Cost-Effective Diagnostic Test for Monosomy 1p36 Using Real-Time Quantitative PCR

    Directory of Open Access Journals (Sweden)

    Pricila da Silva Cunha

    2014-01-01

    Full Text Available Monosomy 1p36 is considered the most common subtelomeric deletion syndrome in humans and it accounts for 0.5–0.7% of all the cases of idiopathic intellectual disability. The molecular diagnosis is often made by microarray-based comparative genomic hybridization (aCGH, which has the drawback of being a high-cost technique. However, patients with classic monosomy 1p36 share some typical clinical characteristics that, together with its common prevalence, justify the development of a less expensive, targeted diagnostic method. In this study, we developed a simple, rapid, and inexpensive real-time quantitative PCR (qPCR assay for targeted diagnosis of monosomy 1p36, easily accessible for low-budget laboratories in developing countries. For this, we have chosen two target genes which are deleted in the majority of patients with monosomy 1p36: PRKCZ and SKI. In total, 39 patients previously diagnosed with monosomy 1p36 by aCGH, fluorescent in situ hybridization (FISH, and/or multiplex ligation-dependent probe amplification (MLPA all tested positive on our qPCR assay. By simultaneously using these two genes we have been able to detect 1p36 deletions with 100% sensitivity and 100% specificity. We conclude that qPCR of PRKCZ and SKI is a fast and accurate diagnostic test for monosomy 1p36, costing less than 10 US dollars in reagent costs.

  3. Detection of exogenous gene doping of IGF-I by a real-time quantitative PCR assay.

    Science.gov (United States)

    Zhang, Jin-Ju; Xu, Jing-Feng; Shen, Yong-Wei; Ma, Shi-Jiao; Zhang, Ting-Ting; Meng, Qing-Lin; Lan, Wen-Jun; Zhang, Chun; Liu, Xiao-Mei

    2017-07-01

    Gene doping can be easily concealed since its product is similar to endogenous protein, making its effective detection very challenging. In this study, we selected insulin-like growth factor I (IGF-I) exogenous gene for gene doping detection. First, the synthetic IGF-I gene was subcloned to recombinant adeno-associated virus (rAAV) plasmid to produce recombinant rAAV2/IGF-I-GFP vectors. Second, in an animal model, rAAV2/IGF-I-GFP vectors were injected into the thigh muscle tissue of mice, and then muscle and blood specimens were sampled at different time points for total DNA isolation. Finally, real-time quantitative PCR was employed to detect the exogenous gene doping of IGF-I. In view of the characteristics of endogenous IGF-I gene sequences, a TaqMan probe was designed at the junction of exons 2 and 3 of IGF-I gene to distinguish it from the exogenous IGF-I gene. In addition, an internal reference control plasmid and its probe were used in PCR to rule out false-positive results through comparison of their threshold cycle (Ct) values. Thus, an accurate exogenous IGF-I gene detection approach was developed in this study. © 2016 International Union of Biochemistry and Molecular Biology, Inc.

  4. Identification of Reference Genes for Quantitative Real Time PCR Assays in Aortic Tissue of Syrian Hamsters with Bicuspid Aortic Valve.

    Science.gov (United States)

    Rueda-Martínez, Carmen; Fernández, M Carmen; Soto-Navarrete, María Teresa; Jiménez-Navarro, Manuel; Durán, Ana Carmen; Fernández, Borja

    2016-01-01

    Bicuspid aortic valve (BAV) is the most frequent congenital cardiac malformation in humans, and appears frequently associated with dilatation of the ascending aorta. This association is likely the result of a common aetiology. Currently, a Syrian hamster strain with a relatively high (∼40%) incidence of BAV constitutes the only spontaneous animal model of BAV disease. The characterization of molecular alterations in the aorta of hamsters with BAV may serve to identify pathophysiological mechanisms and molecular markers of disease in humans. In this report, we evaluate the expression of ten candidate reference genes in aortic tissue of hamsters in order to identify housekeeping genes for normalization using quantitative real time PCR (RT-qPCR) assays. A total of 51 adult (180-240 days old) and 56 old (300-440 days old) animals were used. They belonged to a control strain of hamsters with normal, tricuspid aortic valve (TAV; n = 30), or to the affected strain of hamsters with TAV (n = 45) or BAV (n = 32). The expression stability of the candidate reference genes was determined by RT-qPCR using three statistical algorithms, GeNorm, NormFinder and Bestkeeper. The expression analyses showed that the most stable reference genes for the three algorithms employed were Cdkn1β, G3pdh and Polr2a. We propose the use of Cdkn1β, or both Cdkn1β and G3pdh as reference genes for mRNA expression analyses in Syrian hamster aorta.

  5. Identification of Reference Genes for Quantitative Real Time PCR Assays in Aortic Tissue of Syrian Hamsters with Bicuspid Aortic Valve.

    Directory of Open Access Journals (Sweden)

    Carmen Rueda-Martínez

    Full Text Available Bicuspid aortic valve (BAV is the most frequent congenital cardiac malformation in humans, and appears frequently associated with dilatation of the ascending aorta. This association is likely the result of a common aetiology. Currently, a Syrian hamster strain with a relatively high (∼40% incidence of BAV constitutes the only spontaneous animal model of BAV disease. The characterization of molecular alterations in the aorta of hamsters with BAV may serve to identify pathophysiological mechanisms and molecular markers of disease in humans. In this report, we evaluate the expression of ten candidate reference genes in aortic tissue of hamsters in order to identify housekeeping genes for normalization using quantitative real time PCR (RT-qPCR assays. A total of 51 adult (180-240 days old and 56 old (300-440 days old animals were used. They belonged to a control strain of hamsters with normal, tricuspid aortic valve (TAV; n = 30, or to the affected strain of hamsters with TAV (n = 45 or BAV (n = 32. The expression stability of the candidate reference genes was determined by RT-qPCR using three statistical algorithms, GeNorm, NormFinder and Bestkeeper. The expression analyses showed that the most stable reference genes for the three algorithms employed were Cdkn1β, G3pdh and Polr2a. We propose the use of Cdkn1β, or both Cdkn1β and G3pdh as reference genes for mRNA expression analyses in Syrian hamster aorta.

  6. Standardisation and evaluation of a quantitative multiplex real-time PCR assay for the rapid identification of Streptococcus pneumoniae

    Directory of Open Access Journals (Sweden)

    Feroze Ahmed Ganaie

    2015-01-01

    Full Text Available Rapid diagnosis of Streptococcus pneumoniae can play a significant role in decreasing morbidity and mortality of infection. The accurate diagnosis of pneumococcal disease is hampered by the difficulties in growing the isolates from clinical specimens and also by misidentification. Molecular methods have gained popularity as they offer improvement in the detection of causative pathogens with speed and ease. The present study aims at validating and standardising the use of 4 oligonucleotide primer-probe sets (pneumolysin [ply], autolysin [lytA], pneumococcal surface adhesion A [psaA] and Spn9802 [DNA fragment] in a single-reaction mixture for the detection and discrimination of S. pneumoniae. Here, we validate a quantitative multiplex real-time PCR (qmPCR assay with a panel consisting of 43 S. pneumoniae and 29 non-pneumococcal isolates, 20 culture positive, 26 culture negative and 30 spiked serum samples. A standard curve was obtained using S. pneumoniae ATCC 49619 strain and glyceraldehyde 3-phosphate dehydrogenase (GAPDH gene was used as an endogenous internal control. The experiment showed high sensitivity with lower limit of detection equivalent to 4 genome copies/µl. The efficiency of the reaction was 100% for ply, lytA, Spn9802 and 97% for psaA. The test showed sensitivity and specificity of 100% with culture isolates and serum specimens. This study demonstrates that qmPCR analysis of sera using 4 oligonucleotide primers appears to be an appropriate method for the genotypic identification of S. pneumoniae infection.

  7. Selection of reliable reference genes for quantitative real-time PCR in human T cells and neutrophils

    Directory of Open Access Journals (Sweden)

    Ledderose Carola

    2011-10-01

    Full Text Available Abstract Background The choice of reliable reference genes is a prerequisite for valid results when analyzing gene expression with real-time quantitative PCR (qPCR. This method is frequently applied to study gene expression patterns in immune cells, yet a thorough validation of potential reference genes is still lacking for most leukocyte subtypes and most models of their in vitro stimulation. In the current study, we evaluated the expression stability of common reference genes in two widely used cell culture models-anti-CD3/CD28 activated T cells and lipopolysaccharide stimulated neutrophils-as well as in unselected untreated leukocytes. Results The mRNA expression of 17 (T cells, 7 (neutrophils or 8 (unselected leukocytes potential reference genes was quantified by reverse transcription qPCR, and a ranking of the preselected candidate genes according to their expression stability was calculated using the programs NormFinder, geNorm and BestKeeper. IPO8, RPL13A, TBP and SDHA were identified as suitable reference genes in T cells. TBP, ACTB and SDHA were stably expressed in neutrophils. TBP and SDHA were also the most stable genes in untreated total blood leukocytes. The critical impact of reference gene selection on the estimated target gene expression is demonstrated for IL-2 and FIH expression in T cells. Conclusions The study provides a shortlist of suitable reference genes for normalization of gene expression data in unstimulated and stimulated T cells, unstimulated and stimulated neutrophils and in unselected leukocytes.

  8. Development of Real-Time Quantitative Polymerase Chain Reaction Assays to Track Treatment Response in Retinoid Resistant Acute Promyelocytic Leukemia

    Energy Technology Data Exchange (ETDEWEB)

    Jovanovic, Jelena V. [Cancer Genetics Laboratory, Department of Medical and Molecular Genetics, King’s College London School of Medicine, London (United Kingdom); Rennie, Kristian [GSTS Pathology, Guy’s Hospital, London (United Kingdom); Culligan, Dominic [Department of Haematology, Aberdeen Royal Infirmary, Aberdeen (United Kingdom); Peniket, Andrew [Department of Haematology, John Radcliffe Hospital, Oxford (United Kingdom); Lennard, Anne [Department of Haematology, Royal Victoria Infirmary, Newcastle (United Kingdom); Harrison, Justin [Department of Haematology, Hemel Hempstead Hospital, Hemel Hempstead (United Kingdom); Vyas, Paresh [Medical Research Council Molecular Haematology Unit, Weatherall Institute of Molecular Medicine, Oxford (United Kingdom); Grimwade, David, E-mail: david.grimwade@genetics.kcl.ac.uk [Cancer Genetics Laboratory, Department of Medical and Molecular Genetics, King’s College London School of Medicine, London (United Kingdom)

    2011-10-25

    Molecular detection of minimal residual disease (MRD) has become established to assess remission status and guide therapy in patients with ProMyelocytic Leukemia–RARA+ acute promyelocytic leukemia (APL). However, there are few data on tracking disease response in patients with rarer retinoid resistant subtypes of APL, characterized by PLZF–RARA and STAT5b–RARA. Despite their rarity (<1% of APL) we identified 6 cases (PLZF–RARA, n = 5; STAT5b–RARA, n = 1), established the respective breakpoint junction regions and designed reverse transcription-quantitative real-time polymerase chain reaction (RT-qPCR) assays to detect leukemic transcripts. The relative level of fusion gene expression in diagnostic samples was comparable to that observed in t(15;17) – associated APL, affording assay sensitivities of ∼1 in 10{sup 4}−10{sup 5}. Serial samples were available from two PLZF–RARA APL patients. One showed persistent polymerase chain reaction positivity, predicting subsequent relapse, and remains in CR2, ∼11 years post-autograft. The other, achieved molecular remission (CRm) with combination chemotherapy, remaining in CR1 at 6 years. The STAT5b–RARA patient failed to achieve CRm following frontline combination chemotherapy and ultimately proceeded to allogeneic transplant on the basis of a steadily rising fusion transcript level. These data highlight the potential of RT-qPCR detection of MRD to facilitate development of more individualized approaches to the management of rarer molecularly defined subsets of acute leukemia.

  9. Development of Real-Time Quantitative Polymerase Chain Reaction Assays to Track Treatment Response in Retinoid Resistant Acute Promyelocytic Leukemia

    International Nuclear Information System (INIS)

    Jovanovic, Jelena V.; Rennie, Kristian; Culligan, Dominic; Peniket, Andrew; Lennard, Anne; Harrison, Justin; Vyas, Paresh; Grimwade, David

    2011-01-01

    Molecular detection of minimal residual disease (MRD) has become established to assess remission status and guide therapy in patients with ProMyelocytic Leukemia–RARA+ acute promyelocytic leukemia (APL). However, there are few data on tracking disease response in patients with rarer retinoid resistant subtypes of APL, characterized by PLZF–RARA and STAT5b–RARA. Despite their rarity (<1% of APL) we identified 6 cases (PLZF–RARA, n = 5; STAT5b–RARA, n = 1), established the respective breakpoint junction regions and designed reverse transcription-quantitative real-time polymerase chain reaction (RT-qPCR) assays to detect leukemic transcripts. The relative level of fusion gene expression in diagnostic samples was comparable to that observed in t(15;17) – associated APL, affording assay sensitivities of ∼1 in 10 4 −10 5 . Serial samples were available from two PLZF–RARA APL patients. One showed persistent polymerase chain reaction positivity, predicting subsequent relapse, and remains in CR2, ∼11 years post-autograft. The other, achieved molecular remission (CRm) with combination chemotherapy, remaining in CR1 at 6 years. The STAT5b–RARA patient failed to achieve CRm following frontline combination chemotherapy and ultimately proceeded to allogeneic transplant on the basis of a steadily rising fusion transcript level. These data highlight the potential of RT-qPCR detection of MRD to facilitate development of more individualized approaches to the management of rarer molecularly defined subsets of acute leukemia.

  10. Sensitive detection of novel Indian isolate of BTV 21 using ns1 gene based real-time PCR assay

    Directory of Open Access Journals (Sweden)

    Gaya Prasad

    2013-06-01

    Full Text Available Aim: The study was conducted to develop ns1 gene based sensitive real-time RT-PCR assay for diagnosis of India isolates of bluetongue virus (BTV. Materials and Methods: The BTV serotype 21 isolate (KMNO7 was isolated from Andhra Pradesh and propagated in BHK-21 cell line in our laboratory. The Nucleic acid (dsRNA of virus was extracted using Trizol method and cDNA was prepared using a standard protocol. The cDNA was allowed to ns1 gene based group specific PCR to confirm the isolate as BTV. The viral RNA was diluted 10 folds and the detection limit of ns1 gene based RT-PCR was determined. Finally the tenfold diluted viral RNA was subjected to real-time RT-PCR using ns1 gene primer and Taq man probe to standardized the reaction and determine the detection limit. Results: The ns1 gene based group specific PCR showed a single 366bp amplicon in agarose gel electrophoresis confirmed the sample as BTV. The ns1 gene RT-PCR using tenfold diluted viral RNA showed the detection limit of 70.0 fg in 1%agarose gel electrophoresis. The ns1 gene based real time RT-PCR was successfully standardized and the detection limit was found to be 7.0 fg. Conclusion: The ns1 gene based real-time RT-PCR was successfully standardized and it was found to be 10 times more sensitive than conventional RT-PCR. Key words: bluetongue, BTV21, RT-PCR, Real time RT-PCR, ns1 gene [Vet World 2013; 6(8.000: 554-557

  11. Detecting the Presence of Nora Virus in "Drosophila" Utilizing Single Fly RT-PCR

    Science.gov (United States)

    Munn, Bethany; Ericson, Brad; Carlson, Darby J.; Carlson, Kimberly A.

    2015-01-01

    A single fly RT-PCR protocol has recently been developed to detect the presence of the persistent, horizontally transmitted Nora virus in "Drosophila." Wild-caught flies from Ohio were tested for the presence of the virus, with nearly one-fifth testing positive. The investigation presented can serve as an ideal project for biology…

  12. RT-PCR for detection of all seven genotypes of Lyssavirus genus.

    Science.gov (United States)

    Vázquez-Morón, S; Avellón, A; Echevarría, J E

    2006-08-01

    The Lyssavirus genus includes seven species or genotypes named 1-7. Rabies genotypes correlate with geographical distribution and specific hosts. Co-circulation of different lyssaviruses, imported cases, and the presence of unknown viruses, such as Aravan, Khujand, Irkut and West Caucasian Bat Virus, make it necessary to use generic methods able to detect all lyssaviruses. Primer sequences were chosen from conserved regions in all genotypes in order to optimise a generic RT-PCR. Serial dilutions of 12 RNA extracts from all seven Lyssavirus genotypes were examined to compare the sensitivity of the RT-PCR standardised in this study with a published RT-PCR optimised for EBLV1 detection and capable of amplifying RNA from all seven lyssaviruses. All seven genotypes were detected by both RT-PCRs, however, the sensitivity was higher with the new version of the test. Twenty samples submitted for rabies diagnosis were tested by the new RT-PCR. Eight out of 20 samples from six dogs, one horse and one bat were found positive, in agreement with immunofluorescence results. Seven samples from terrestrial mammals were genotype 1 and one from a bat was genotype 5. In conclusion, this method can be used to complement immunofluorescence for the diagnosis of rabies, enabling the detection of unexpected lyssaviruses during rabies surveillance.

  13. RT-PCR-ELISA as a tool for diagnosis of low-pathogenicity avian influenza

    DEFF Research Database (Denmark)

    Dybkaer, Karen; Munch, Mette; Handberg, Kurt Jensen

    2003-01-01

    A one-tube reverse transcriptase/polymerase chain reaction coupled with an enzyme-linked immunosorbent assay (RT-PCR-ELISA) was developed for the rapid detection of avian influenza virus (AIV) in clinical specimens. A total of 419 swab pools were analyzed from chickens experimentally infected...

  14. Identification and characterization of a novel tospovirus species using a new RT-PCR approach

    NARCIS (Netherlands)

    Cortez, I.; Saaijer, J.; Wonjkaew, K.S.; Pereira, A.M.; Goldbach, R.W.; Peters, D.; Kormelink, R.

    2001-01-01

    Summary. A novel tospovirus serologically distinct from all established tospo- virus species was found in Thailand in Physalis minima L. The S RNA of this virus was cloned by a new RT-PCR approach revealing a nucleotide sequence of 3257 nucleotides. The ambisense RNA segment encoded a nonstructural

  15. [REAL TIME POLYMERASE CHAIN REACTION IN TULAREMIA LABORATORY DIAGNOSTICS].

    Science.gov (United States)

    Kormilitsyna, M I; Mescheryakova, I S; Mikhailova, T V; Dobrovolsky, A A

    2015-01-01

    Enhancement of tularemia laboratory diagnostics by F. tularensis DNA determination in blood sera of patients using real time polymerase chain reaction (RT-PCR). 39 blood sera of patients obtained during transmissive epidemic outbreak of tularemia in Khanty-Mansiysk in 2013 were studied in agglutination reaction, passive hemagglutination, RT-PCR. Specific primers and fluorescent probes were used: ISFTu2F/R+ISFTu2P, Tu14GF/R+tul4-PR2. Advantages of using RT-PCR for early diagnostics of tularemia, when specific antibodies are not detected using traditional immunologic methods, were established. Use of a combination of primers and ISFTu2F/R+ISFTu2P probe allowed to detect F. tularensis DNA in 100% of sera, whereas Tul4G F/R+tul4-PR2 combination--92% of sera. The data were obtained when DNA was isolated from sera using "Proba Rapid" express method. Clinical-epidemiologic diagnosis oftularemia was confirmed by both immune-serologic and RT-PCR methods when sera were studied 3-4 weeks after the onset of the disease. RT-PCR with ISFTu2F/R primers and fluorescent probe ISFTu2P, having high sensitivity and specificity, allows to determine F. tularensis DNA in blood sera of patients at both the early stage and 3-4 weeks after the onset of the disease.

  16. A sensitive, reproducible, and economic real-time reverse transcription PCR detecting avian metapneumovirus subtypes A and B.

    Science.gov (United States)

    Franzo, G; Drigo, M; Lupini, C; Catelli, E; Laconi, A; Listorti, V; Bonci, M; Naylor, C J; Martini, M; Cecchinato, M

    2014-06-01

    Use of real-time PCR is increasing in the diagnosis of infectious disease due to its sensitivity, specificity, and speed of detection. These characteristics make it particularly suited for the diagnosis of viral infections, like avian metapneumovirus (AMPV), for which effective control benefits from continuously updated knowledge of the epidemiological situation. Other real-time reverse transcription (RT)-PCRs have been published based on highly specific fluorescent dye-labeled probes, but they have high initial cost, complex validation, and a marked susceptibility to the genetic variability of their target sequence. With this in mind, we developed and validated a SYBR Green I-based quantitative RT-PCR for the detection of the two most prevalent AMPV subtypes (i.e., subtypes A and B). The assay demonstrated an analytical sensitivity comparable with that of a previously published real-time RT-PCR and the ability to detect RNA equivalent to approximately 0.5 infectious doses for both A and B subtypes. The high efficiency and linearity between viral titer and crossing point displayed for both subtypes make it suited for viral quantification. Optimization of reaction conditions and the implementation of melting curve analysis guaranteed the high specificity of the assay. The stable melting temperature difference between the two subtypes indicated the possibility of subtyping through melting temperature analysis. These characteristics make our assay a sensitive, specific, and rapid tool, enabling contemporaneous detection, quantification, and discrimination of AMPV subtype A and B.

  17. Screening and Validation of Housekeeping Genes of the Root and Cotyledon of Cunninghamia lanceolata under Abiotic Stresses by Using Quantitative Real-Time PCR

    Directory of Open Access Journals (Sweden)

    Wenlong Bao

    2016-07-01

    Full Text Available Cunninghamia lanceolata (Chinese fir is a fast-growing and commercially important conifer of the Cupressaceae family. Due to the unavailability of complete genome sequences and relatively poor genetic background information of the Chinese fir, it is necessary to identify and analyze the expression levels of suitable housekeeping genes (HKGs as internal reference for precise analysis. Based on the results of database analysis and transcriptome sequencing, we have chosen five candidate HKGs (Actin, GAPDH, EF1a, 18S rRNA, and UBQ with conservative sequences in the Chinese fir and related species for quantitative analysis. The expression levels of these HKGs in roots and cotyledons under five different abiotic stresses in different time intervals were measured by qRT-PCR. The data were statistically analyzed using the following algorithms: NormFinder, BestKeeper, and geNorm. Finally, RankAggreg was applied to merge the sequences generated from three programs and rank these according to consensus sequences. The expression levels of these HKGs showed variable stabilities under different abiotic stresses. Among these, Actin was the most stable internal control in root, and GAPDH was the most stable housekeeping gene in cotyledon. We have also described an experimental procedure for selecting HKGs based on the de novo sequencing database of other non-model plants.

  18. Quantitative real-time PCR analysis of Anopheles dirus TEP1 and NOS during Plasmodium berghei infection, using three reference genes

    Directory of Open Access Journals (Sweden)

    Jonathan W.K. Liew

    2017-07-01

    Full Text Available Quantitative reverse transcription PCR (qRT-PCR has been an integral part of characterizing the immunity of Anopheles mosquitoes towards Plasmodium invasion. Two anti-Plasmodium factors of Anopheles, thioester-containing protein 1 (TEP1 and nitric oxide synthase (NOS, play a role in the refractoriness of Anopheles towards Plasmodium infection and are generally expressed during infection. However, these are less studied in Anopheles dirus, a dominant malaria vector in Southeast Asia. Furthermore, most studies used a single reference gene for normalization during gene expression analysis without proper validation. This may lead to erroneous quantification of expression levels. Therefore, the present study characterized and investigated the expression profiles of TEP1 and NOS of Anopheles dirus during P. berghei infection. Prior to that, the elongation factor 1-alpha (EF1, actin 1 (Act and ribosomal protein S7 (S7 genes were validated for their suitability as a set of reference genes. TEP1 and NOS expressions in An. dirus were found to be significantly induced after P. berghei infection.

  19. Outbreak of hepatitis E virus infection in Darfur, Sudan: effectiveness of real-time reverse transcription-PCR analysis of dried blood spots.

    Science.gov (United States)

    Mérens, Audrey; Guérin, Philippe Jean; Guthmann, Jean-Paul; Nicand, Elisabeth

    2009-06-01

    Biological samples collected in refugee camps during an outbreak of hepatitis E were used to compare the accuracy of hepatitis E virus RNA amplification by real-time reverse transcription-PCR (RT-PCR) for sera and dried blood spots (concordance of 90.6%). Biological profiles (RT-PCR and serology) of asymptomatic individuals were also analyzed.

  20. SNPs and real-time quantitative PCR method for constitutional allelic copy number determination, the VPREB1 marker case

    Directory of Open Access Journals (Sweden)

    Costa Elena

    2011-05-01

    Full Text Available Abstract Background 22q11.2 microdeletion is responsible for the DiGeorge Syndrome, characterized by heart defects, psychiatric disorders, endocrine and immune alterations and a 1 in 4000 live birth prevalence. Real-time quantitative PCR (qPCR approaches for allelic copy number determination have recently been investigated in 22q11.2 microdeletions detection. The qPCR method was performed for 22q11.2 microdeletions detection as a first-level screening approach in a genetically unknown series of patients with congenital heart defects. A technical issue related to the VPREB1 qPCR marker was pointed out. Methods A set of 100 unrelated Italian patients with congenital heart defects were tested for 22q11.2 microdeletions by a qPCR method using six different markers. Fluorescence In Situ Hybridization technique (FISH was used for confirmation. Results qPCR identified six patients harbouring the 22q11.2 microdeletion, confirmed by FISH. The VPREB1 gene marker presented with a pattern consistent with hemideletion in one 3 Mb deleted patient, suggestive for a long distal deletion, and in additional five non-deleted patients. The long distal 22q11.2 deletion was not confirmed by Comparative Genomic Hybridization. Indeed, the VPREB1 gene marker generated false positive results in association with the rs1320 G/A SNP, a polymorphism localized within the VPREB1 marker reverse primer sequence. Patients heterozygous for rs1320 SNP, showed a qPCR profile consistent with the presence of a hemideletion. Conclusions Though the qPCR technique showed advantages as a screening approach in terms of cost and time, the VPREB1 marker case revealed that single nucleotide polymorphisms can interfere with qPCR data generating erroneous allelic copy number interpretations.

  1. Application of propidium monoazide quantitative real-time PCR to quantify the viability of Lactobacillus delbrueckii ssp. bulgaricus.

    Science.gov (United States)

    Shao, Yuyu; Wang, Zhaoxia; Bao, Qiuhua; Zhang, Heping

    2016-12-01

    In this study, a combination of propidium monoazide (PMA) and quantitative real-time PCR (qPCR) was used to develop a method to determine the viability of cells of Lactobacillus delbrueckii ssp. bulgaricus ND02 (L. bulgaricus) that may have entered into a viable but nonculturable state. This can happen due to its susceptibility to cold shock during lyophilization and storage. Propidium monoazide concentration, PMA incubation time, and light exposure time were optimized to fully exploit the PMA-qPCR approach to accurately assess the total number of living L. bulgaricus ND02. Although PMA has little influence on living cells, when concentrations of PMA were higher than 30μg/mL the number of PCR-positive living bacteria decreased from 10 6 to 10 5 cfu/mL in comparison with qPCR enumeration. Mixtures of living and dead cells were used as method verification samples for enumeration by PMA-qPCR, demonstrating that this method was feasible and effective for distinguishing living cells of L. bulgaricus when mixed with a known number of dead cells. We suggest that several conditions need to be studied further before PMA-qPCR methods can be accurately used to distinguish living from dead cells for enumeration under more realistic sampling situations. However, this research provides a rapid way to enumerate living cells of L. bulgaricus and could be used to optimize selection of cryoprotectants in the lyophilization process and develop technologies for high cell density cultivation and optimal freeze-drying processes. Copyright © 2016 American Dairy Science Association. Published by Elsevier Inc. All rights reserved.

  2. Evaluation and validation of candidate endogenous control genes for real-time quantitative PCR studies of breast cancer

    Directory of Open Access Journals (Sweden)

    Miller Nicola

    2007-11-01

    Full Text Available Abstract Background Real-time quantitative PCR (RQ-PCR forms the basis of many breast cancer biomarker studies and novel prognostic assays, paving the way towards personalised cancer treatments. Normalisation of relative RQ-PCR data is required to control for non-biological variation introduced during sample preparation. Endogenous control (EC genes, used in this context, should ideally be expressed constitutively and uniformly across treatments in all test samples. Despite widespread recognition that the accuracy of the normalised data is largely dependent on the reliability of the EC, there are no reports of the systematic validation of genes commonly used for this purpose in the analysis of gene expression by RQ-PCR in primary breast cancer tissues. The aim of this study was to identify the most suitable endogenous control genes for RQ-PCR analysis of primary breast tissue from a panel of eleven candidates in current use. Oestrogen receptor alpha (ESR1 was used a target gene to compare the effect of choice of EC on the estimate of gene quantity. Results The expression and validity of candidate ECs (GAPDH, TFRC, ABL, PPIA, HPRT1, RPLP0, B2M, GUSB, MRPL19, PUM1 and PSMC4 was determined in 6 benign and 21 malignant primary breast cancer tissues. Gene expression data was analysed using two different statistical models. MRPL19 and PPIA were identified as the most stable and reliable EC genes, while GUSB, RPLP0 and ABL were least stable. There was a highly significant difference in variance between ECs. ESR1 expression was appreciably higher in malignant compared to benign tissues and there was a significant effect of EC on the magnitude of the error associated with the relative quantity of ESR1. Conclusion We have validated two endogenous control genes, MRPL19 and PPIA, for RQ-PCR analysis of gene expression in primary breast tissue. Of the genes in current use in this field, the above combination offers increased accuracy and resolution in the

  3. Analysis of gene expression in small numbers of purified hemopoietic progenitor cells by RT-PCR.

    Science.gov (United States)

    Ziegler, B L; Lamping, C P; Thoma, S J; Fliedner, T M

    1995-05-01

    Primitive hemopoietic stem cells represent the most probable targets for genetic alterations due to exposure to ionizing irradiation or chemical carcinogens. We have applied a two-step protocol for the purification of CD34+HLA-DR-/low hemopoietic progenitor cells from cord blood (CB). CD34+ cells were isolated by monoclonal antibody (mAb) against CD34 (My10) and immunomagnetic beads. Beads were cleaved off the CD34+ cells by enzymatic treatment with chymopapain. Due to chymopapain-resistance of epitopes recognized by the used mAbs purity control of CD34+ cells and separation into CD34+HLA-DR-/low and CD34+HLA-DR+ subsets could be performed by using flow cytometry. Two miniaturized procedures were applied to isolate poly(A)+ mRNA for the reverse transcription polymerase chain reaction (RT-PCR) from small numbers of CD34+HLA-DR-/low cells. In five experiments, the mean purity of immunomagnetically isolated CD34+ cells was 93.8% +/- 3.9. Flow cytometry sorting of CD34+ cells resulted in pure CD34+HLA-DR-/low populations (purity > 98.8%; range 98.8% to 99.9%; viability > 96%) with an average yield of 2600 +/- 800 cells/5 x 10(7) low density CB cells. By RT-PCR using both poly(A)+ mRNA isolation procedures, sequences corresponding to CD34 and beta 2-microglobulin were amplified from as few as 20 cells. Furthermore, a sequence-independent RT-PCR (SIP-RT-PCR) was applied to amplify the cDNA derived from five erythroblasts isolated from a burst-forming unit-erythroid (BFU-E). Upon hybridization, full-length c-fos message was detected in the SIP-RT-PCR amplified material. Our data demonstrate that gene expression can be detected at the transcriptional level in small numbers of hemopoietic progenitor cells. In addition, the SIP-RT-PCR may allow the amplification of unique mRNA species when subtractive hybridization procedures are performed. The presented data should be useful to analyze gene expression in rare subsets of radiation-exposed immature hemopoietic stem

  4. Quantitative real-time monitoring of multi-elements in airborne particulates by direct introduction into an inductively coupled plasma mass spectrometer

    International Nuclear Information System (INIS)

    Suzuki, Yoshinari; Sato, Hikaru; Hiyoshi, Katsuhiro; Furuta, Naoki

    2012-01-01

    A new calibration system for real-time determination of trace elements in airborne particulates was developed. Airborne particulates were directly introduced into an inductively coupled plasma mass spectrometer, and the concentrations of 15 trace elements were determined by means of an external calibration method. External standard solutions were nebulized by an ultrasonic nebulizer (USN) coupled with a desolvation system, and the resulting aerosol was introduced into the plasma. The efficiency of sample introduction via the USN was calculated by two methods: (1) the introduction of a Cr standard solution via the USN was compared with introduction of a Cr(CO) 6 standard gas via a standard gas generator and (2) the aerosol generated by the USN was trapped on filters and then analyzed. The Cr introduction efficiencies obtained by the two methods were the same, and the introduction efficiencies of the other elements were equal to the introduction efficiency of Cr. Our results indicated that our calibration method for introduction efficiency worked well for the 15 elements (Ti, V, Cr, Mn, Co, Ni, Cu, Zn, As, Mo, Sn, Sb, Ba, Tl and Pb). The real-time data and the filter-collection data agreed well for elements with low-melting oxides (V, Co, As, Mo, Sb, Tl, and Pb). In contrast, the real-time data were smaller than the filter-collection data for elements with high-melting oxides (Ti, Cr, Mn, Ni, Cu, Zn, Sn, and Ba). This result implies that the oxides of these 8 elements were not completely fused, vaporized, atomized, and ionized in the initial radiation zone of the inductively coupled plasma. However, quantitative real-time monitoring can be realized after correction for the element recoveries which can be calculated from the ratio of real-time data/filter-collection data. - Highlights: ► APs were directly introduced into ICP-MS and real-time analysis was performed. ► The real-time data were calibrated by a multi-element standard solution from USN. ► During real-time

  5. Strategy for Extracting DNA from Clay Soil and Detecting a Specific Target Sequence via Selective Enrichment and Real-Time (Quantitative) PCR Amplification ▿

    Science.gov (United States)

    Yankson, Kweku K.; Steck, Todd R.

    2009-01-01

    We present a simple strategy for isolating and accurately enumerating target DNA from high-clay-content soils: desorption with buffers, an optional magnetic capture hybridization step, and quantitation via real-time PCR. With the developed technique, μg quantities of DNA were extracted from mg samples of pure kaolinite and a field clay soil. PMID:19633108

  6. MIQE précis: Practical implementation of minimum standard guidelines for fluorescence-based quantitative real-time PCR experiments

    NARCIS (Netherlands)

    Bustin, S.A.; Beaulieu, J.F.; Huggett, J.; Jaggi, R.; Kibenge, F.S.; Olsvik, P.A.; Penning, L.C.; Toegel, S.

    2010-01-01

    MIQE précis: Practical implementation of minimum standard guidelines for fluorescence-based quantitative real-time PCR experiments Stephen A Bustin1 , Jean-François Beaulieu2 , Jim Huggett3 , Rolf Jaggi4 , Frederick SB Kibenge5 , Pål A Olsvik6 , Louis C Penning7 and Stefan Toegel8 1 Centre for

  7. A Human Fecal Contamination Score for Ranking Recreational Sites using the HF183/BacR287 Quantitative Real-Time PCR Method

    Science.gov (United States)

    Human fecal pollution of recreational waters remains a public health concern worldwide. As a result, there is a growing interest in the application of human-associated fecal source identification quantitative real-time PCR (qPCR) technologies for water quality research and manag...

  8. QUANTITATION OF INTRACELLULAR NAD(P)H IN LIVING CELLS CAN MONITOR AN IMBALANCE OF DNA SINGLE STRAND BREAK REPAIR IN REAL TIME

    Science.gov (United States)

    Quantitation of intracellular NAD(P)H in living cells can monitor an imbalance of DNA single strand break repair in real time.ABSTRACTDNA single strand breaks (SSBs) are one of the most frequent DNA lesions in genomic DNA generated either by oxidative stress or du...

  9. Quantitative Real Time PCR approach to study gene expression profile during prenatal growth of skeletal muscle in pig of Duroc and Pietrain breeds

    Directory of Open Access Journals (Sweden)

    M. Cagnazzo

    2010-01-01

    Full Text Available The quantitative real time-PCR (QRT-PCR is a very sensitive method used to quantify mRNA level in gene expression analysis. Combining amplification, detection and quantification in a single step, allows a more accurate measurement compared to the traditional PCR end point analysis (Pfaffl, 2001; Bustin, 2002.

  10. Investigations for a multi-marker RT-PCR to improve sensitivity of disseminated tumor cell detection.

    NARCIS (Netherlands)

    Vlems, F.A.; Diepstra, J.H.S.; Cornelissen, I.M.; Ligtenberg, M.J.L.; Wobbes, Th.; Punt, C.J.A.; Krieken, J.H.J.M. van; Ruers, T.J.M.; Muijen, G.N.P. van

    2003-01-01

    BACKGROUND: In order to develop a multi-marker RT-PCR, which as such may be more sensitive than a single marker assay for the detection of disseminated tumor cells, we evaluated six RT-PCR markers: cytokeratin 20 (CK20), carcinoembryonic antigen (CEA), guanylyl cyclase C (GCC), epidermal growth

  11. Investigations for a multi-marker RT-PCR to improve sensitivity of disseminated tumor cell detection

    NARCIS (Netherlands)

    Vlems, F. A.; Diepstra, J. H. S.; Cornelissen, I. M. H. A.; Ligtenberg, M. J. L.; Wobbes, Th; Punt, C. J. A.; van Krieken, J. H. J. M.; Ruers, T. J. M.; van Muijen, G. N. P.

    2003-01-01

    In order to develop a multi-marker RT-PCR, which as such may be more sensitive than a single marker assay for the detection of disseminated tumor cells, we evaluated six RT-PCR markers: cytokeratin 20 (CK20), carcinoembryonic antigen (CEA), guanylyl cyclase C (GCC), epidermal growth factor receptor

  12. Comparison of lung cancer cell lines representing four histopathological subtypes with gene expression profiling using quantitative real-time PCR

    Directory of Open Access Journals (Sweden)

    Kawaguchi Makoto

    2010-01-01

    Full Text Available Abstract Background Lung cancers are the most common type of human malignancy and are intractable. Lung cancers are generally classified into four histopathological subtypes: adenocarcinoma (AD, squamous cell carcinoma (SQ, large cell carcinoma (LC, and small cell carcinoma (SC. Molecular biological characterization of these subtypes has been performed mainly using DNA microarrays. In this study, we compared the gene expression profiles of these four subtypes using twelve human lung cancer cell lines and the more reliable quantitative real-time PCR (qPCR. Results We selected 100 genes from public DNA microarray data and examined them by DNA microarray analysis in eight test cell lines (A549, ABC-1, EBC-1, LK-2, LU65, LU99, STC 1, RERF-LC-MA and a normal control lung cell line (MRC-9. From this, we extracted 19 candidate genes. We quantified the expression of the 19 genes and a housekeeping gene, GAPDH, with qPCR, using the same eight cell lines plus four additional validation lung cancer cell lines (RERF-LC-MS, LC-1/sq, 86-2, and MS-1-L. Finally, we characterized the four subtypes of lung cancer cell lines using principal component analysis (PCA of gene expression profiling for 12 of the 19 genes (AMY2A, CDH1, FOXG1, IGSF3, ISL1, MALL, PLAU, RAB25, S100P, SLCO4A1, STMN1, and TGM2. The combined PCA and gene pathway analyses suggested that these genes were related to cell adhesion, growth, and invasion. S100P in AD cells and CDH1 in AD and SQ cells were identified as candidate markers of these lung cancer subtypes based on their upregulation and the results of PCA analysis. Immunohistochemistry for S100P and RAB25 was closely correlated to gene expression. Conclusions These results show that the four subtypes, represented by 12 lung cancer cell lines, were well characterized using qPCR and PCA for the 12 genes examined. Certain genes, in particular S100P and CDH1, may be especially important for distinguishing the different subtypes. Our results

  13. O-5S quantitative real-time PCR: a new diagnostic tool for laboratory confirmation of human onchocerciasis.

    Science.gov (United States)

    Mekonnen, Solomon A; Beissner, Marcus; Saar, Malkin; Ali, Solomon; Zeynudin, Ahmed; Tesfaye, Kassahun; Adbaru, Mulatu G; Battke, Florian; Poppert, Sven; Hoelscher, Michael; Löscher, Thomas; Bretzel, Gisela; Herbinger, Karl-Heinz

    2017-10-02

    Onchocerciasis is a parasitic disease caused by the filarial nematode Onchocerca volvulus. In endemic areas, the diagnosis is commonly confirmed by microscopic examination of skin snip samples, though this technique is considered to have low sensitivity. The available melting-curve based quantitative real-time PCR (qPCR) using degenerated primers targeting the O-150 repeat of O. volvulus was considered insufficient for confirming the individual diagnosis, especially in elimination studies. This study aimed to improve detection of O. volvulus DNA in clinical samples through the development of a highly sensitive qPCR assay. A novel hydrolysis probe based qPCR assay was designed targeting the specific sequence of the O. volvulus O-5S rRNA gene. A total of 200 clinically suspected onchocerciasis cases were included from Goma district in South-west Ethiopia, from October 2012 through May 2013. Skin snip samples were collected and subjected to microscopy, O-150 qPCR, and the novel O-5S qPCR. Among the 200 individuals, 133 patients tested positive (positivity rate of 66.5%) and 67 negative by O-5S qPCR, 74 tested positive by microscopy (37.0%) and 78 tested positive by O-150 qPCR (39.0%). Among the 133 O-5S qPCR positive individuals, microscopy and O-150 qPCR detected 55.6 and 59.4% patients, respectively, implying a higher sensitivity of O-5S qPCR than microscopy and O-150 qPCR. None of the 67 individuals who tested negative by O-5S qPCR tested positive by microscopy or O-150 qPCR, implying 100% specificity of the newly designed O-5S qPCR assay. The novel O-5S qPCR assay is more sensitive than both microscopic examination and the existing O-150 qPCR for the detection of O. volvulus from skin snip samples. The newly designed assay is an important step towards appropriate individual diagnosis and control of onchocerciasis.

  14. Evaluation of reference genes for quantitative real-time PCR in oil palm elite planting materials propagated by tissue culture.

    Directory of Open Access Journals (Sweden)

    Pek-Lan Chan

    Full Text Available BACKGROUND: The somatic embryogenesis tissue culture process has been utilized to propagate high yielding oil palm. Due to the low callogenesis and embryogenesis rates, molecular studies were initiated to identify genes regulating the process, and their expression levels are usually quantified using reverse transcription quantitative real-time PCR (RT-qPCR. With the recent release of oil palm genome sequences, it is crucial to establish a proper strategy for gene analysis using RT-qPCR. Selection of the most suitable reference genes should be performed for accurate quantification of gene expression levels. RESULTS: In this study, eight candidate reference genes selected from cDNA microarray study and literature review were evaluated comprehensively across 26 tissue culture samples using RT-qPCR. These samples were collected from two tissue culture lines and media treatments, which consisted of leaf explants cultures, callus and embryoids from consecutive developmental stages. Three statistical algorithms (geNorm, NormFinder and BestKeeper confirmed that the expression stability of novel reference genes (pOP-EA01332, PD00380 and PD00569 outperformed classical housekeeping genes (GAPDH, NAD5, TUBULIN, UBIQUITIN and ACTIN. PD00380 and PD00569 were identified as the most stably expressed genes in total samples, MA2 and MA8 tissue culture lines. Their applicability to validate the expression profiles of a putative ethylene-responsive transcription factor 3-like gene demonstrated the importance of using the geometric mean of two genes for normalization. CONCLUSIONS: Systematic selection of the most stably expressed reference genes for RT-qPCR was established in oil palm tissue culture samples. PD00380 and PD00569 were selected for accurate and reliable normalization of gene expression data from RT-qPCR. These data will be valuable to the research associated with the tissue culture process. Also, the method described here will facilitate the selection

  15. Evaluation of reference genes for real-time quantitative PCR studies in Candida glabrata following azole treatment

    Directory of Open Access Journals (Sweden)

    Li Qingdi

    2012-06-01

    Full Text Available Abstract Background The selection of stable and suitable reference genes for real-time quantitative PCR (RT-qPCR is a crucial prerequisite for reliable gene expression analysis under different experimental conditions. The present study aimed to identify reference genes as internal controls for gene expression studies by RT-qPCR in azole-stimulated Candida glabrata. Results The expression stability of 16 reference genes under fluconazole stress was evaluated using fold change and standard deviation computations with the hkgFinder tool. Our data revealed that the mRNA expression levels of three ribosomal RNAs (RDN5.8, RDN18, and RDN25 remained stable in response to fluconazole, while PGK1, UBC7, and UBC13 mRNAs showed only approximately 2.9-, 3.0-, and 2.5-fold induction by azole, respectively. By contrast, mRNA levels of the other 10 reference genes (ACT1, EF1α, GAPDH, PPIA, RPL2A, RPL10, RPL13A, SDHA, TUB1, and UBC4 were dramatically increased in C. glabrata following antifungal treatment, exhibiting changes ranging from 4.5- to 32.7-fold. We also assessed the expression stability of these reference genes using the 2-ΔΔCT method and three other software packages. The stability rankings of the reference genes by geNorm and the 2-ΔΔCT method were identical to those by hkgFinder, whereas the stability rankings by BestKeeper and NormFinder were notably different. We then validated the suitability of six candidate reference genes (ACT1, PGK1, RDN5.8, RDN18, UBC7, and UBC13 as internal controls for ten target genes in this system using the comparative CT method. Our validation experiments passed for all six reference genes analyzed except RDN18, where the amplification efficiency of RDN18 was different from that of the ten target genes. Finally, we demonstrated that the relative quantification of target gene expression varied according to the endogenous control used, highlighting the importance of the choice of internal controls in such

  16. Evaluation of Reference Genes for Quantitative Real-Time PCR in Oil Palm Elite Planting Materials Propagated by Tissue Culture

    Science.gov (United States)

    Chan, Pek-Lan; Rose, Ray J.; Abdul Murad, Abdul Munir; Zainal, Zamri; Leslie Low, Eng-Ti; Ooi, Leslie Cheng-Li; Ooi, Siew-Eng; Yahya, Suzaini; Singh, Rajinder

    2014-01-01

    Background The somatic embryogenesis tissue culture process has been utilized to propagate high yielding oil palm. Due to the low callogenesis and embryogenesis rates, molecular studies were initiated to identify genes regulating the process, and their expression levels are usually quantified using reverse transcription quantitative real-time PCR (RT-qPCR). With the recent release of oil palm genome sequences, it is crucial to establish a proper strategy for gene analysis using RT-qPCR. Selection of the most suitable reference genes should be performed for accurate quantification of gene expression levels. Results In this study, eight candidate reference genes selected from cDNA microarray study and literature review were evaluated comprehensively across 26 tissue culture samples using RT-qPCR. These samples were collected from two tissue culture lines and media treatments, which consisted of leaf explants cultures, callus and embryoids from consecutive developmental stages. Three statistical algorithms (geNorm, NormFinder and BestKeeper) confirmed that the expression stability of novel reference genes (pOP-EA01332, PD00380 and PD00569) outperformed classical housekeeping genes (GAPDH, NAD5, TUBULIN, UBIQUITIN and ACTIN). PD00380 and PD00569 were identified as the most stably expressed genes in total samples, MA2 and MA8 tissue culture lines. Their applicability to validate the expression profiles of a putative ethylene-responsive transcription factor 3-like gene demonstrated the importance of using the geometric mean of two genes for normalization. Conclusions Systematic selection of the most stably expressed reference genes for RT-qPCR was established in oil palm tissue culture samples. PD00380 and PD00569 were selected for accurate and reliable normalization of gene expression data from RT-qPCR. These data will be valuable to the research associated with the tissue culture process. Also, the method described here will facilitate the selection of appropriate

  17. Screening suitable reference genes for normalization in reverse transcription quantitative real-time PCR analysis in melon.

    Directory of Open Access Journals (Sweden)

    Qiusheng Kong

    Full Text Available Melon (Cucumis melo. L is not only an economically important cucurbitaceous crop but also an attractive model for studying many biological characteristics. Screening appropriate reference genes is essential to reverse transcription quantitative real-time PCR (RT-qPCR, which is key to many studies involving gene expression analysis. In this study, 14 candidate reference genes were selected, and the variations in their expression in roots and leaves of plants subjected to biotic stress, abiotic stress, and plant growth regulator treatment were assessed by RT-qPCR. The stability of the expression of the selected genes was determined and ranked using geNorm and NormFinder. geNorm identified the two most stable genes for each set of conditions: CmADP and CmUBIep across all samples, CmUBIep and CmRPL in roots, CmRAN and CmACT in leaves, CmADP and CmRPL under abiotic stress conditions, CmTUA and CmACT under biotic stress conditions, and CmRAN and CmACT under plant growth regulator treatments. NormFinder determined CmRPL to be the best reference gene in roots and under biotic stress conditions and CmADP under the other experimental conditions. CmUBC2 and CmPP2A were not found to be suitable under many experimental conditions. The catalase family genes CmCAT1, CmCAT2, and CmCAT3 were identified in melon genome and used as target genes to validate the reliability of identified reference genes. The catalase family genes showed the most upregulation 3 days after inoculation with Fusarium wilt in roots, after which they were downregulated. Their levels of expression were significantly overestimated when the unsuitable reference gene was used for normalization. These results not only provide guidelines for the selection of reference genes for gene expression analyses in melons but may also provide valuable information for studying the functions of catalase family genes in stress responses.

  18. Development of duplex RT-PCR-ELISA for the simultaneous detection of hepatitis A virus and hepatitis E virus.

    Science.gov (United States)

    Tahk, Hongmin; Lee, Min Hwa; Lee, Kang Bum; Cheon, Doo-Sung; Choi, Changsun

    2011-07-01

    This study aimed to develop a specific and sensitive duplex reverse transcription polymerase chain reaction enzyme-linked immunosorbent assay (duplex RT-PCR-ELISA) for hepatitis A virus (HAV) and hepatitis E virus (HEV). Duplex RT-PCR-ELISA could detect and differentiate HAV and HEV with specific probes. When ELISA technique was used to detect probe-bound RT-PCR products, duplex RT-PCR-ELISA could detect as little as 0.1 ng/μL HAV and HEV from clinical samples. Human norovirus, enterovirus, poliovirus, murine norovirus and feline calicivirus were used for the specificity test; all were negative. Therefore duplex RT-PCR-ELISA can be used for the simultaneous detection of HAV and HEV in contaminated fecal samples. Copyright © 2011 Elsevier B.V. All rights reserved.

  19. Detection of enteroviruses and hepatitis a virus in water by consensus primer multiplex RT-PCR

    Science.gov (United States)

    Li, Jun-Wen; Wang, Xin-Wei; Yuan, Chang-Qing; Zheng, Jin-Lai; Jin, Min; Song, Nong; Shi, Xiu-Quan; Chao, Fu-Huan

    2002-01-01

    AIM: To develop a rapid detection method of enteroviruses and Hepatitis A virus (HAV). METHODS: A one-step, single-tube consensus primers multiplex RT-PCR was developed to simultaneously detect Poliovirus, Coxsackie virus, Echovirus and HAV. A general upstream primer and a HAV primer and four different sets of primers (5 primers) specific for Poliovirus, Coxsacki evirus, Echovirus and HAV cDNA were mixed in the PCR mixture to reverse transcript and amplify the target DNA. Four distinct amplified DNA segments representing Poliovirus, Coxsackie virus, Echovirus and HAV were identified by gel electrophoresis as 589-, 671-, 1084-, and 1128 bp sequences, respectively. Semi-nested PCR was used to confirm the amplified products for each enterovirus and HAV. RESULTS: All four kinds of viral genome RNA were detected, and producing four bands which could be differentiated by the band size on the gel. To confirm the specificity of the multiplex PCR products, semi-nested PCR was performed. For all the four strains tested gave positive results. The detection sensitivity of multiplex PCR was similar to that of monoplex RT-PCR which was 24 PFU for Poliovrus, 21 PFU for Coxsackie virus, 60 PFU for Echovirus and 105 TCID50 for HAV. The minimum amount of enteric viral RNA detected by semi-nested PCR was equivalent to 2.4 PFU for Poliovrus, 2.1 PFU for Coxsackie virus, 6.0 PFU for Echovirus and 10.5 TCID50 for HAV. CONCLUSION: The consensus primers multiplex RT-PCR has more advantages over monoplex RT-PCR for enteric viruses detection, namely, the rapid turnaround time and cost effectiveness. PMID:12174381

  20. A novel method to compensate for different amplification efficiencies between patient DNA samples in quantitative real-time PCR

    NARCIS (Netherlands)

    J.P.P. Meijerink (Jules); C. Mandigers; L. van de Locht; E. Tonnissen; F. Goodsaid; J. Raemaekers (John)

    2001-01-01

    textabstractQuantification of residual disease by real-time polymerase chain reaction (PCR) will become a pivotal tool in the development of patient-directed therapy. In recent years, various protocols to quantify minimal residual disease in leukemia or lymphoma patients have been

  1. A novel method to compensate for different amplification efficiencies between patient DNA samples in quantitative real-time PCR.

    NARCIS (Netherlands)

    Meijerink, J.P.P.; Mandigers, C.M.P.W.; Locht, A.T.F. van de; Tonnissen, E.L.R.T.M.; Goodsaid, F.; Raemaekers, J.M.M.

    2001-01-01

    Quantification of residual disease by real-time polymerase chain reaction (PCR) will become a pivotal tool in the development of patient-directed therapy. In recent years, various protocols to quantify minimal residual disease in leukemia or lymphoma patients have been developed. These assays assume

  2. Partial validation of a TaqMan real-time quantitative PCR for the detection of ranaviruses

    DEFF Research Database (Denmark)

    Stilwell, Natalie K.; Whittington, Richard J.; Hick, Paul M.

    2018-01-01

    Ranaviruses are globally emerging pathogens negatively impacting wild and cultured fish, amphibians, and reptiles. Although conventional and diagnostic real-time PCR (qPCR) assays have been developed to detect ranaviruses, these assays often have not been tested against the known diversity of ran...

  3. Simultaneous quantitative assessment of circulating cell-free mitochondrial and nuclear DNA by multiplex real-time PCR

    Directory of Open Access Journals (Sweden)

    Peng Xia

    2009-01-01

    Full Text Available Quantification of circulating nucleic acids in plasma and serum could be used as a non-invasive diagnostic tool for monitoring a wide variety of diseases and conditions. We describe here a rapid, simple and accurate multiplex real-time PCR method for direct synchronized analysis of circulating cell-free (ccf mitochondrial (mtDNA and nuclear (nDNA DNA in plasma and serum samples. The method is based on one-step multiplex real-time PCR using a FAM-labeled MGB probe and primers to amplify the mtDNA sequence of the ATP 8 gene, and a VIC-labeled MGB probe and primers to amplify the nDNA sequence of the glycerinaldehyde-3-phosphate-dehydrogenase (GAPDH gene, in plasma and serum samples simultaneously. The efficiencies of the multiplex assays were measured in serial dilutions. Based on the simulation of the PCR reaction kinetics, the relative quantities of ccf mtDNA were calculated using a very simple equation. Using our optimised real-time PCR conditions, close to 100% efficiency was obtained from the two assays. The two assays performed in the dilution series showed very good and reproducible correlation to each other. This optimised multiplex real-time PCR protocol can be widely used for synchronized quantification of mtDNA and nDNA in different samples, with a very high rate of efficiency.

  4. User satisfaction with a real-time automated feedback system for general practitioners: a quantitative and qualitative study

    NARCIS (Netherlands)

    Bindels, Rianne; Hasman, Arie; Derickx, Mieke; van Wersch, Jan W. J.; Winkens, Ron A. G.

    2003-01-01

    OBJECTIVE: The GRIF automated feedback system produces real-time comments on the appropriateness of diagnostic tests ordered by general practitioners (GPs) based on recommendations from accepted national and regional practice guidelines. We investigated the experiences of GPs with this system and,

  5. Quantitative analysis of the improvement in high zoom maritime tracking due to real-time image enhancement

    CSIR Research Space (South Africa)

    Bachoo, AK

    2011-04-01

    Full Text Available This work aims to evaluate the improvement in the performance of tracking small maritime targets due to real-time enhancement of the video streams from high zoom cameras on pan-tilt pedestal. Due to atmospheric conditions these images can frequently...

  6. Two quantitative real-time PCR assays for the detection of penaeid shrimp and blue crab, crustacean shellfish allergens.

    Science.gov (United States)

    Eischeid, Anne C; Kim, Bang-hyun; Kasko, Sasha M

    2013-06-19

    Food allergen detection methods must be able to specifically detect minute quantities of an allergenic food in a complex food matrix. One technique that can be used is real-time PCR. For the work described here, real-time PCR assays were developed to detect penaeid shrimp and blue crab, crustacean shellfish allergens. The method was tested using shrimp meat and crab meat spiked into several types of foods, including canned soups, deli foods, meat, seafood, and prepared seafood products. Foods were spiked with either shrimp or crab at levels ranging from 0.1 to 10⁶ parts per million (ppm) and analyzed either raw or cooked by a variety of methods. Real-time PCR data were used to generate linear standard curves, and assays were evaluated with respect to linear range and reaction efficiency. Results indicate that both assays performed well in a variety of food types. High reaction efficiencies were achieved across a linear range of 6-8 orders of magnitude. Limits of detection were generally between 0.1 and 1 ppm. Cooking methods used to simulate thermal processing of foods had little effect on assay performance. This work demonstrates that real-time PCR can be a valuable tool in the detection of crustacean shellfish.

  7. Detection of avian metapneumovirus subtypes in turkeys using RT-PCR.

    Science.gov (United States)

    Ongor, H; Karahan, M; Kalin, R; Bulut, H; Cetinkaya, B

    2010-03-20

    This study investigated the prevalence of avian metapneumovirus (aMPV) and the detection of molecular subtypes of field strains of the virus using RT-PCR in clinically healthy turkeys and those showing signs of respiratory disease. In the RT-PCR examination of 624 tracheal tissue samples collected from a local turkey abattoir, 2.9 per cent (18/624) of samples tested positive. In the examination of tracheal swab samples collected from flocks with respiratory problems, 18 of 20 samples tested positive. When the results were assessed at flock level, aMPV infection was detected in only one of the 23 clinically healthy turkey flocks, whereas all four flocks with respiratory problems were infected. Molecular typing using primers specific to the attachment glycoprotein (G) gene showed that all 36 positive samples belonged to subtype B. Partial sequence analysis of DNA samples showed 95 per cent homology between the field types and the reference strain aMPV subtype B. Whereas clinically healthy turkeys had been vaccinated with a subtype A virus vaccine, the flocks with respiratory problems had been vaccinated with a subtype B virus vaccine. Despite four blind passages of RT-PCR-positive samples on Vero and chicken embryo fibroblast cells, no cytopathic effect was detected by microscopic examination.

  8. Identification of Suitable Endogenous Normalizers for qRT- PCR Analysis of Plasma microRNA Expression in Essential Hypertension

    Science.gov (United States)

    Solayman, Mohamed Hassan M.; Langaee, Taimour; Patel, Archanakumari; El-Wakeel, Lamia; El-Hamamsy, Manal; Badary, Osama; Johnson, Julie A.

    2016-01-01

    Circulating microRNAs (miRNAs) are promising biomarkers for many diseases. Quantitative reverse transcription polymerase chain reaction (qRT-PCR) is a gold standard for miRNA expression profiling that requires proper data normalization. Since there is no universal normalizer, it is recommended to evaluate normalizers under every experimental condition. This study describes the identification of suitable endogenous normalizer(s) (ENs) for plasma miRNA expression in essential hypertension. Expression levels of 5 candidate ENs and 2 plasma quality markers were determined by qRT-PCR in plasma samples from 18 hypertensive patients and 10 healthy controls. NormFinder, GeNorm, and DataAssist software programs were used to select the best EN(s). Expression levels of the 5 candidate ENs were also analyzed in urine samples from hypertensive patients and compared to the plasma samples of the hypertensive patients. Among the analyzed candidates, hsa-miR-92a-3p was identified as the best EN, and hsa-miR-21-5p and hsa-miR-16-5p as next best. Moreover, hsa-miR-92a-3p showed the most consistent expression between plasma and urine In conclusion, this study showed that hsa-miR-92a-3p, hsa-miR-21-5p, and hsa-miR-16-5p may be used as normalizers for plasma miRNA expression data in essential hypertension studies. PMID:26798072

  9. Real-time systems

    OpenAIRE

    Badr, Salah M.; Bruztman, Donald P.; Nelson, Michael L.; Byrnes, Ronald Benton

    1992-01-01

    This paper presents an introduction to the basic issues involved in real-time systems. Both real-time operating sys and real-time programming languages are explored. Concurrent programming and process synchronization and communication are also discussed. The real-time requirements of the Naval Postgraduate School Autonomous Under Vehicle (AUV) are then examined. Autonomous underwater vehicle (AUV), hard real-time system, real-time operating system, real-time programming language, real-time sy...

  10. Determinazione quantitativa di HCV-RNA: valutazione comparativa dei saggi Abbott Real-Time e Versant bDNA v.3

    Directory of Open Access Journals (Sweden)

    Aldo Manzin

    2007-06-01

    Full Text Available Hepatitis C virus (HCV RNA measurement before, during and after antiviral therapy has become an essential tool in the management of interferon-based treatment of HCV-related infections. Conventional Polymerase Chain Reaction (PCR has been largely used to obtain quantitative data, but laborious, time-consuming post-PCR handling steps are required to gain valuable results. Real time (RT PCR now provides advantages over end-point (EP PCR due to its improved rapidity, sensitivity, reproducibility and the reduced risk of carry-over contamination, and has now proven itself to be valuable for the more precise monitoring of viral load kinetics and assessing antiviral response.The Abbott Real-Time HCV-RNA is a recently introduced assay for the automated processing of clinical samples and HCV-RNA quantitation: its basic technology relies on use of fluorescent linear probes (dynamic range using 0.5 ml as input target= 12-108 IU/mL and a hybridization/detection step at low temperature (35°C, which allows target mismatches to be tolerated. To determine the clinical application of the Abbott Real-Time assay and defining its correlation with the Bayer Versant bDNA v.3 assay, 68 consecutive samples from unselected HCV-infected patients were retrospectively analysed with RT and the results obtained using the two tests compared.A good correlation was found between RT-PCR and bDNA: 97% of samples tested had a result within a 0.5 log HCV IU/mL difference (bias=0.15 log, whereas 6 samples negative with bDNA gave positive results with Abbott RT (range, 1.89-3.07 log IU/mL and “in-house” qualitative RT-PCR assays.

  11. Application of quantitative real-time PCR compared to filtration methods for the enumeration of Escherichia coli in surface waters within Vietnam.

    Science.gov (United States)

    Vital, Pierangeli G; Van Ha, Nguyen Thi; Tuyet, Le Thi Hong; Widmer, Kenneth W

    2017-02-01

    Surface water samples in Vietnam were collected from the Saigon River, rural and suburban canals, and urban runoff canals in Ho Chi Minh City, Vietnam, and were processed to enumerate Escherichia coli. Quantification was done through membrane filtration and quantitative real-time polymerase chain reaction (PCR). Mean log colony-forming unit (CFU)/100 ml E. coli counts in the dry season for river/suburban canals and urban canals were log 2.8 and 3.7, respectively, using a membrane filtration method, while using Taqman quantitative real-time PCR they were log 2.4 and 2.8 for river/suburban canals and urban canals, respectively. For the wet season, data determined by the membrane filtration method in river/suburban canals and urban canals samples had mean counts of log 3.7 and 4.1, respectively. While mean log CFU/100 ml counts in the wet season using quantitative PCR were log 3 and 2, respectively. Additionally, the urban canal samples were significantly lower than those determined by conventional culture methods for the wet season. These results show that while quantitative real-time PCR can be used to determine levels of fecal indicator bacteria in surface waters, there are some limitations to its application and it may be impacted by sources of runoff based on surveyed samples.

  12. A one-step multiplex RT-PCR assay for simultaneous detection of four viruses that infect peach.

    Science.gov (United States)

    Yu, Y; Zhao, Z; Jiang, D; Wu, Z; Li, S

    2013-10-01

    A multiplex reverse transcription polymerase chain reaction (mRT-PCR) assay was developed to enable the simultaneous detection and differentiation of four viruses that infect peach, namely Apple chlorotic leaf spot virus (ACLSV), Cherry green ring mottle virus (CGRMV), Prunus necrotic ringspot virus (PNRSV) and Apricot pseudo-chlorotic leaf spot virus (APCLSV). In this study, four pairs of primers, one specific for each virus, were designed; the corresponding PCR products were 632, 439, 346 and 282 bp in length for ACLSV, CGRMV, PNRSV and APCLSV, respectively, and the fragments could be distinguished clearly by agarose gel electrophoresis. The sensitivity and specificity of the method were tested using individual RT-PCR and enzyme-linked immunosorbent assay (ELISA), and the identity of the RT-PCR amplification products was also confirmed by DNA sequencing. The results of RT-PCR and ELISA, along with batch detection using samples collected from peach orchards, revealed that this rapid and simple technique is an effective way to identify the four viruses simultaneously. The mRT-PCR assay described in this study was developed for the simultaneous detection of four peach viruses from infected peach samples is reliable and sensitive. In contrast to conventional uniplex RT-PCR, mRT-PCR is more efficient, reducing costs, time and handling when testing large numbers of samples. This rapid and simple method is useful for large-scale surveys of viruses that infect peach. © 2013 The Society for Applied Microbiology.

  13. Investigation of Legionella Contamination in Bath Water Samples by Culture, Amoebic Co-Culture, and Real-Time Quantitative PCR Methods.

    Science.gov (United States)

    Edagawa, Akiko; Kimura, Akio; Kawabuchi-Kurata, Takako; Adachi, Shinichi; Furuhata, Katsunori; Miyamoto, Hiroshi

    2015-10-19

    We investigated Legionella contamination in bath water samples, collected from 68 bathing facilities in Japan, by culture, culture with amoebic co-culture, real-time quantitative PCR (qPCR), and real-time qPCR with amoebic co-culture. Using the conventional culture method, Legionella pneumophila was detected in 11 samples (11/68, 16.2%). Contrary to our expectation, the culture method with the amoebic co-culture technique did not increase the detection rate of Legionella (4/68, 5.9%). In contrast, a combination of the amoebic co-culture technique followed by qPCR successfully increased the detection rate (57/68, 83.8%) compared with real-time qPCR alone (46/68, 67.6%). Using real-time qPCR after culture with amoebic co-culture, more than 10-fold higher bacterial numbers were observed in 30 samples (30/68, 44.1%) compared with the same samples without co-culture. On the other hand, higher bacterial numbers were not observed after propagation by amoebae in 32 samples (32/68, 47.1%). Legionella was not detected in the remaining six samples (6/68, 8.8%), irrespective of the method. These results suggest that application of the amoebic co-culture technique prior to real-time qPCR may be useful for the sensitive detection of Legionella from bath water samples. Furthermore, a combination of amoebic co-culture and real-time qPCR might be useful to detect viable and virulent Legionella because their ability to invade and multiply within free-living amoebae is considered to correlate with their pathogenicity for humans. This is the first report evaluating the efficacy of the amoebic co-culture technique for detecting Legionella in bath water samples.

  14. Investigation of Legionella Contamination in Bath Water Samples by Culture, Amoebic Co-Culture, and Real-Time Quantitative PCR Methods

    Directory of Open Access Journals (Sweden)

    Akiko Edagawa

    2015-10-01

    Full Text Available We investigated Legionella contamination in bath water samples, collected from 68 bathing facilities in Japan, by culture, culture with amoebic co-culture, real-time quantitative PCR (qPCR, and real-time qPCR with amoebic co-culture. Using the conventional culture method, Legionella pneumophila was detected in 11 samples (11/68, 16.2%. Contrary to our expectation, the culture method with the amoebic co-culture technique did not increase the detection rate of Legionella (4/68, 5.9%. In contrast, a combination of the amoebic co-culture technique followed by qPCR successfully increased the detection rate (57/68, 83.8% compared with real-time qPCR alone (46/68, 67.6%. Using real-time qPCR after culture with amoebic co-culture, more than 10-fold higher bacterial numbers were observed in 30 samples (30/68, 44.1% compared with the same samples without co-culture. On the other hand, higher bacterial numbers were not observed after propagation by amoebae in 32 samples (32/68, 47.1%. Legionella was not detected in the remaining six samples (6/68, 8.8%, irrespective of the method. These results suggest that application of the amoebic co-culture technique prior to real-time qPCR may be useful for the sensitive detection of Legionella from bath water samples. Furthermore, a combination of amoebic co-culture and real-time qPCR might be useful to detect viable and virulent Legionella because their ability to invade and multiply within free-living amoebae is considered to correlate with their pathogenicity for humans. This is the first report evaluating the efficacy of the amoebic co-culture technique for detecting Legionella in bath water samples.

  15. Response of a diuron-degrading community to diuron exposure assessed by real-time quantitative PCR monitoring of phenylurea hydrolase A and B encoding genes

    OpenAIRE

    Pesce , S.; Beguet , J.; Rouard , N.; Devers Lamrani , M.; Martin Laurent , F.

    2013-01-01

    A real-time quantitative PCR method was developed to detect and quantify phenlylurea hydrolase genes' (puhA and puhB) sequences from environmental DNA samples to assess diuron-degrading genetic potential in some soil and sediment microbial communities. In the soil communities, mineralization rates (determined with [ring-14C]-labeled diuron) were linked to diuron-degrading genetic potentials estimated from puhB number copies, which increased following repeated diuron treatments. In the sedimen...

  16. Evaluation of Reference Genes for Real-Time Quantitative PCR Analysis in Larvae of Spodoptera litura Exposed to Azadirachtin Stress Conditions

    OpenAIRE

    Benshui Shu; Jingjing Zhang; Gaofeng Cui; Ranran Sun; Veeran Sethuraman; Xin Yi; Guohua Zhong

    2018-01-01

    Azadirachtin is an efficient and broad-spectrum botanical insecticide against more than 150 kinds of agricultural pests with the effects of mortality, antifeedant and growth regulation. Real-time quantitative polymerase chain reaction (RT-qPCR) could be one of the powerful tools to analyze the gene expression level and investigate the mechanism of azadirachtin at transcriptional level, however, the ideal reference genes are needed to normalize the expression profiling of target genes. In this...

  17. RT-PCR for confirmation of echovirus 30 isolated in Belém, Brazil

    Directory of Open Access Journals (Sweden)

    Maria de Lourdes C. Gomes

    Full Text Available Echovirus (Echo 30 or human enterovirus B is the most frequent enterovirus associated with meningitis cases. Epidemics and outbreaks of this disease caused by Echo 30 have occurred in several countries. In Brazil, Echo 30 has been isolated from sporadic cases and outbreaks that occurred mainly in the south and southeast regions. We used RT-PCR to examine Echo 30 isolates from meningitis cases detected from March 2002 to December 2003 in Belém, state of Pará, in northern Brazil. The patients were attended in a Basic Health Unit (State Health Secretary of Pará, where cerebrospinal fluid (CSF was collected and stored in liquid nitrogen. Weekly visits were made by technicians from Evandro Chagas Institute to the health unit and samples were stored at -70ºC in the laboratory until use. HEp-2 and RD cell lines were used for viral isolation and neutralization with specific antisera for viral identification. RNA extraction was made using Trizol reagent. The RT-PCR was made in one step, and the total mixture (50 µL was composed of: RNA, reaction buffer, dNTP, primers, Rnase inhibitor, reverse transcriptase, Taq polymerase and water. The products were visualized in agarose gel stained with ethidium bromide, visualized under UV light. Among the 279 CSF samples examined, 30 (10.7% were EV positive, 29 being Echo 30 and one was Cox B. Nineteen Echo 30 were examined with RT-PCR; 18 tested positive (762 and 494 base pairs. The use of this technique permitted viral identification in less time than usual, which benefits the patient and is of importance for public-health interventions.

  18. Soil Baiting, Rapid PCR Assay and Quantitative Real Time PCR to Diagnose Late Blight of Potato in Quarantine Programs

    Directory of Open Access Journals (Sweden)

    Touseef Hussain

    2018-05-01

    Full Text Available Phytophthora infestans (mont de Bary is a pathogen of great concern across the globe, and accurate detection is an important component in responding to the outbreaks of potential disease. Although the molecular diagnostic protocol used in regulatory programs has been evaluated but till date methods implying direct comparison has rarely used. In this study, a known area soil samples from potato fields where light blight appear every year (both A1 and A2 mating type was assayed by soil bait method, PCR assay detection and quantification of the inoculums. Suspected disease symptoms appeared on bait tubers were further confirmed by rapid PCR, inoculums were quantified through Real Time PCR, which confirms presence of P. infestans. These diagnostic methods can be highly correlated with one another. Potato tuber baiting increased the sensitivity of the assay compared with direct extraction of DNA from tuber and soil samples. Our study determines diagnostic sensitivity and specificity of the assays to determine the performance of each method. Overall, molecular techniques based on different types of PCR amplification and Real-time PCR can lead to high throughput, faster and more accurate detection method which can be used in quarantine programmes in potato industry and diagnostic laboratory.

  19. DETECTION OF CLASSICAL SWINE FEVER VIRUS BY RT-PCR IN WEST BENGAL, INDIA

    Directory of Open Access Journals (Sweden)

    Sumit Chowdhury

    2016-12-01

    Full Text Available Classical swine fever is a deadly disease of swine, caused by a RNA virus. The present study has identified presence of the classical swine fever virus (CSFV in pigs of West Bengal by one step reverse transcriptase PCR (RT-PCR performed using 5’ NTR specific primers. Internal organs from clinically affected pigs were examined from three districts of West Bengal. RT-PCT has identified presence of CSFV in all the tissues examined confirming presence of CSFV in different parts of the state.

  20. Sensitive real-time PCR detection of pathogenic Leptospira spp. and a comparison of nucleic acid amplification methods for the diagnosis of leptospirosis.

    Science.gov (United States)

    Waggoner, Jesse J; Balassiano, Ilana; Abeynayake, Janaki; Sahoo, Malaya K; Mohamed-Hadley, Alisha; Liu, Yuanyuan; Vital-Brazil, Juliana Magalhães; Pinsky, Benjamin A

    2014-01-01

    Bacteria of the genus Leptospira, the causative agents of leptospirosis, are categorized into pathogenic and non-pathogenic species. However, the benefit of using a clinical diagnostic that is specific for pathogenic species remains unclear. In this study, we present the development of a real-time PCR (rtPCR) for the detection of pathogenic Leptospira (the pathogenic rtPCR), and we perform a comparison of the pathogenic rtPCR with a published assay that detects all Leptospira species [the undifferentiated febrile illness (UFI) assay] and a reference 16S Leptospira rtPCR, which was originally designed to detect pathogenic species. For the pathogenic rtPCR, a new hydrolysis probe was designed for use with primers from the UFI assay, which targets the 16S gene. The pathogenic rtPCR detected Leptospira DNA in 37/37 cultured isolates from 5 pathogenic and one intermediate species. Two strains of the non-pathogenic L. biflexa produced no signal. Clinical samples from 65 patients with suspected leptospirosis were then tested using the pathogenic rtPCR and a reference Leptospira 16S rtPCR. All 65 samples had tested positive for Leptospira using the UFI assay; 62 (95.4%) samples tested positive using the pathogenic rtPCR (p = 0.24). Only 24 (36.9%) samples tested positive in the reference 16S rtPCR (pLeptospira species in 49/50 cases, including 3 cases that were only detected using the UFI assay. The pathogenic rtPCR displayed similar sensitivity to the UFI assay when testing clinical specimens with no difference in specificity. Both assays proved significantly more sensitive than a real-time molecular test used for comparison. Future studies are needed to investigate the clinical and epidemiologic significance of more sensitive Leptospira detection using these tests.

  1. Quantitation of hepatitis B virus DNA in plasma using a sensitive cost-effective "in-house" real-time PCR assay

    Directory of Open Access Journals (Sweden)

    Daniel Hubert Darius

    2009-01-01

    Full Text Available Background: Sensitive nucleic acid testing for the detection and accurate quantitation of hepatitis B virus (HBV is necessary to reduce transmission through blood and blood products and for monitoring patients on antiviral therapy. The aim of this study is to standardize an "in-house" real-time HBV polymerase chain reaction (PCR for accurate quantitation and screening of HBV. Materials and Methods: The "in-house" real-time assay was compared with a commercial assay using 30 chronically infected individuals and 70 blood donors who are negative for hepatitis B surface antigen, hepatitis C virus (HCV antibody and human immunodeficiency virus (HIV antibody. Further, 30 HBV-genotyped samples were tested to evaluate the "in-house" assay′s capacity to detect genotypes prevalent among individuals attending this tertiary care hospital. Results: The lower limit of detection of this "in-house" HBV real-time PCR was assessed against the WHO international standard and found to be 50 IU/mL. The interassay and intra-assay coefficient of variation (CV of this "in-house" assay ranged from 1.4% to 9.4% and 0.0% to 2.3%, respectively. Virus loads as estimated with this "in-house" HBV real-time assay correlated well with the commercial artus HBV RG PCR assay ( r = 0.95, P < 0.0001. Conclusion: This assay can be used for the detection and accurate quantitation of HBV viral loads in plasma samples. This assay can be employed for the screening of blood donations and can potentially be adapted to a multiplex format for simultaneous detection of HBV, HIV and HCV to reduce the cost of testing in blood banks.

  2. A simple RT-PCR-based strategy for screening connexin identity

    Directory of Open Access Journals (Sweden)

    M. Urban

    1999-08-01

    Full Text Available Vertebrate gap junctions are aggregates of transmembrane channels which are composed of connexin (Cx proteins encoded by at least fourteen distinct genes in mammals. Since the same Cx type can be expressed in different tissues and more than one Cx type can be expressed by the same cell, the thorough identification of which connexin is in which cell type and how connexin expression changes after experimental manipulation has become quite laborious. Here we describe an efficient, rapid and simple method by which connexin type(s can be identified in mammalian tissue and cultured cells using endonuclease cleavage of RT-PCR products generated from "multi primers" (sense primer, degenerate oligonucleotide corresponding to a region of the first extracellular domain; antisense primer, degenerate oligonucleotide complementary to the second extracellular domain that amplify the cytoplasmic loop regions of all known connexins except Cx36. In addition, we provide sequence information on RT-PCR primers used in our laboratory to screen individual connexins and predictions of extension of the "multi primer" method to several human connexins.

  3. Evaluation of gamma-sterilization (60Co) by RT-PCR by DHFR expression detection

    International Nuclear Information System (INIS)

    Converso, Ana Paula G.; Andrade Junior, Heitor F. de; Vieira, Daniel P.

    2007-01-01

    The improvement of techniques to detect pathogen agents in blood had reduced significantly the contamination mechanisms by hemocomponents in blood transfusion procedures. Ionizing radiation is a method that has presented several applications on medicine and in currently days has been showing special attention on blood banks which has been applied to avoid TA-GVHD development. DHFR is an enzyme constitutive in Plasmodium protozoa and has an important role in folate metabolism on these parasites. Detecting the expression of RNAm coder for this enzyme is possible to evaluate the viability of this parasite in blood samples. Plasmodium chabaudi AJ is a parasite that induces lethal malaria in rodents similar to human malaria In this work, the objective was to detect the presence of plasmodium protozoa in irradiated blood samples, infected experimentally, through the application of a RT-PCR using primers for the coder sequence of DHFR's mRNA. We studied doses of ionizing radiation between 0 and 75 Gy. The irradiation procedures were accomplished in Center of Radiation Technology of IPEN-CNEN in a 60 Co panoramic source. Our results had demonstrated that RT-PCR is a sensible method to evaluate the viability of plasmodium in blood samples because the technique could detect low parasite burden in all tested samples. (author)

  4. Evaluation of gamma-sterilization ({sup 60}Co) by RT-PCR by DHFR expression detection

    Energy Technology Data Exchange (ETDEWEB)

    Converso, Ana Paula G.; Andrade Junior, Heitor F. de [Instituto de Medicina Tropical de Sao Paulo, Sao Paulo, SP (Brazil)]. E-mail: anapaulagconverso@gmail.com; hfandrad@usp.br; Vieira, Daniel P. [Instituto de Pesquisas Energeticas e Nucleares (IPEN/CNEN-SP), Sao Paulo, SP (Brazil); Instituto de Medicina Tropical de Sao Paulo, Sao Paulo, SP (Brazil); E-mail: dperezv@usp.br

    2007-07-01

    The improvement of techniques to detect pathogen agents in blood had reduced significantly the contamination mechanisms by hemocomponents in blood transfusion procedures. Ionizing radiation is a method that has presented several applications on medicine and in currently days has been showing special attention on blood banks which has been applied to avoid TA-GVHD development. DHFR is an enzyme constitutive in Plasmodium protozoa and has an important role in folate metabolism on these parasites. Detecting the expression of RNAm coder for this enzyme is possible to evaluate the viability of this parasite in blood samples. Plasmodium chabaudi AJ is a parasite that induces lethal malaria in rodents similar to human malaria In this work, the objective was to detect the presence of plasmodium protozoa in irradiated blood samples, infected experimentally, through the application of a RT-PCR using primers for the coder sequence of DHFR's mRNA. We studied doses of ionizing radiation between 0 and 75 Gy. The irradiation procedures were accomplished in Center of Radiation Technology of IPEN-CNEN in a {sup 60}Co panoramic source. Our results had demonstrated that RT-PCR is a sensible method to evaluate the viability of plasmodium in blood samples because the technique could detect low parasite burden in all tested samples. (author)

  5. Highly Specific Detection of Five Exotic Quarantine Plant Viruses using RT-PCR

    Directory of Open Access Journals (Sweden)

    Hoseong Choi

    2013-03-01

    Full Text Available To detect five plant viruses (Beet black scorch virus, Beet necrotic yellow vein virus, Eggplant mottled dwarf virus, Pelargonium zonate spot virus, and Rice yellow mottle virus for quarantine purposes, we designed 15 RT-PCR primer sets. Primer design was based on the nucleotide sequence of the coat protein gene, which is highly conserved within species. All but one primer set successfully amplified the targets, and gradient PCRs indicated that the optimal temperature for the 14 useful primer sets was 51.9°C. Some primer sets worked well regardless of annealing temperature while others required a very specific annealing temperature. A primer specificity test using plant total RNAs and cDNAs of other plant virus-infected samples demonstrated that the designed primer sets were highly specific and generated reproducible results. The newly developed RT-PCR primer sets would be useful for quarantine inspections aimed at preventing the entry of exotic plant viruses into Korea.

  6. Detection of canine distemper virus nucleoprotein gene by RT-PCR in urine of dogs with distemper clinical signs

    International Nuclear Information System (INIS)

    Gebara, C.M.S.; Wosiachi, S.R.; Negrao, F.J.; Oliveira, D.B. de; Beloni, S.N.E.; Alfieri, A.A.; Alfieri, A.F.

    2004-01-01

    The urine of 87 dogs with clinical signs suggestive of canine distemper was analyzed by RT-PCR for detection of canine distemper virus (CDV) nucleoprotein gene. The samples were allotted to the following groups: group A- with 41 dogs with systemic symptoms, group B- with 37 dogs with neurological signs, and group C- with 9 dogs with simultaneous systemic and neurological clinical signs. Group D (control) included 20 assymptomatic dogs. A c2 was used to test RT-PCR results according to clinical form and hematological characteristics. The RT-PCR was positive for CDV in 47% (41/87) of the urine samples from dogs with clinical signs. All samples from assymptomatic dogs were RT-PCR negatives. Positive samples were found in all groups of dogs with distemper symptoms according to the following propositions: 51.2% (21/41), 29% (11/37) and 100% (9/9) for groups A, B and C, respectively. In all clinical forms (groups A, B and C) leucocytosis was the most frequent observed hematological alteration. No relationship between RT-PCR results and hematological changes was observed. The results showed that independently of the clinical stage of the illness the RT-PCR based on urine sample can be applied for ante mortem diagnosis of CDV

  7. Unequal distribution of RT-PCR artifacts along the E1-E2 region of Hepatitis C virus.

    Science.gov (United States)

    Domingo-Calap, Pilar; Sentandreu, Vicente; Bracho, Maria Alma; González-Candelas, Fernando; Moya, Andrés; Sanjuán, Rafael

    2009-10-01

    Although viral variability studies have focused traditionally on consensus sequences, the relevance of molecular clone sequences for studying viral evolution at the intra-host level is being increasingly recognized. However, for this approach to be reliable, RT-PCR artifacts do not have to contribute excessively to the observed variability. Molecular clone sequences were obtained from an in vitro transcript to estimate the maximum error rate associated to RT-PCR for the Hepatitis C virus (HCV) E1-E2 region. On average, the frequency of RT-PCR errors was one order of magnitude lower than the level of intra-host genetic variability observed in samples from an HCV outbreak. However, RT-PCR errors were not distributed evenly along the E1-E2 region and were concentrated heavily in the hypervariable region 2 (HVR 2). Although it is concluded that RT-PCR molecular clone sequences are reliable, these results warn against extrapolation of RT-PCR error rates to different genome regions. The data suggest that the RNA sequence context or secondary structure can determine the fidelity of in vitro transcription or reverse transcription. Potentially, these factors might also modify the fidelity of the viral polymerase.

  8. Epidemiological, clinical and laboratory profile of scrub typhus cases detected by serology and RT-PCR in Kumaon, Uttarakhand: a hospital-based study.

    Science.gov (United States)

    Rawat, Vinita; Singh, Rajesh Kumar; Kumar, Ashok; Saxena, Sandip R; Varshney, Umesh; Kumar, Mukesh

    2018-04-01

    We analysed the epidemiology, clinical and laboratory data of the 168 scrub typhus cases confirmed by a combination of any one of the following: real time polymerase chain reaction (RT-PCR) and/or immunofluorescence assay (IFA) (IgM and/or IgG). The peak season for scrub typhus was from July to October. By multivariate binary logistic regression analysis, the risk of scrub typhus was about four times in those working in occupation related to forest work. Major clinical manifestations were fever (100%), myalgia (65%), cough (51%) and vomiting (46%); major complications were meningitis/meningoencephatilitis (12.5%) and multi-organ failure (MOF) and pneumonia (5.3% each). Laboratory investigations revealed raised aminotranferase levels and thrombocytopenia in most confirmed cases. We conclude that scrub typhus is an important cause of febrile illness in the Kumaon hills of Uttarakhand where this disease had not previously been considered to exist.

  9. Análise de citocinas pela RT-PCR em pacientes com rinite alérgica RT-PCR cytokine study in patients with allergic rhinitis

    Directory of Open Access Journals (Sweden)

    Tarcimara Moreira da Silva

    2009-02-01

    Full Text Available Rinite alérgica é uma doença que decorre de um processo inflamatório da mucosa nasal conseqüente à reação de hipersensibilidade a alérgenos inalatórios e, eventualmente, alimentares. É mediada por IgE, envolvendo diferentes células, mediadores e citocinas. OBJETIVO: Avaliar as transcrições para as seguintes citocinas: IL-4, IL-5, IL-8 e IFN-gama, particularmente importantes no processo alérgico nasal, principalmente IL-4 e IL-5. Neste estudo, optou-se por avaliar os pacientes atópicos fora das crises alérgicas, com a finalidade de se conhecer as expressões das citocinas neste período. MATERIAL E MÉTODO: Realizou-se um estudo transversal e prospectivo, selecionando-se 30 pacientes, sendo 13 pacientes portadores de rinite alérgica paucissintomáticos e 17 pacientes não-atópicos. Os grupos foram selecionados através da história, do exame clínico otorrinolaringológico e do teste alérgico cutâneo - Prick Test. O perfil das citocinas foi pesquisado nos fragmentos de mucosa nasal, através da RT-PCR semiquantitativa, escolhida por apresentar boa reprodutibilidade e especificidade, utilizando-se como referência o gene da Beta-actina. RESULTADOS: Os valores de IL-5, IL-8, IFN-gama mantiveram-se homogêneos em relação ao grupo controle. A IL-4 apresentou diferença com significância estatística. CONCLUSÃO: Os pacientes alérgicos paucissintomáticos apresentaram normalização da expressão das citocinas na mucosa nasal à exceção de IL-4.Allergic rhinitis is an inflammatory reaction of the nasal mucosa, in consequence of an IgE mediated hypersensitive reaction to inhaling allergens, involving different mediators and cytokine cells. AIM: The purpose of this study was to evaluate the transcriptions for IL-4, IL-5, IL-8 and IFN-gama, particularly important in the nasal allergy process, especially IL-4 and IL-5. For this study we decided to evaluate atopic patients who were free from allergic crises, with the purpose of

  10. Identification and Evaluation of Reliable Reference Genes for Quantitative Real-Time PCR Analysis in Tea Plant (Camellia sinensis (L.) O. Kuntze)

    Science.gov (United States)

    Hao, Xinyuan; Horvath, David P.; Chao, Wun S.; Yang, Yajun; Wang, Xinchao; Xiao, Bin

    2014-01-01

    Reliable reference selection for the accurate quantification of gene expression under various experimental conditions is a crucial step in qRT-PCR normalization. To date, only a few housekeeping genes have been identified and used as reference genes in tea plant. The validity of those reference genes are not clear since their expression stabilities have not been rigorously examined. To identify more appropriate reference genes for qRT-PCR studies on tea plant, we examined the expression stability of 11 candidate reference genes from three different sources: the orthologs of Arabidopsis traditional reference genes and stably expressed genes identified from whole-genome GeneChip studies, together with three housekeeping gene commonly used in tea plant research. We evaluated the transcript levels of these genes in 94 experimental samples. The expression stabilities of these 11 genes were ranked using four different computation programs including geNorm, Normfinder, BestKeeper, and the comparative ∆CT method. Results showed that the three commonly used housekeeping genes of CsTUBULIN1, CsACINT1 and Cs18S rRNA1 together with CsUBQ1 were the most unstable genes in all sample ranking order. However, CsPTB1, CsEF1, CsSAND1, CsCLATHRIN1 and CsUBC1 were the top five appropriate reference genes for qRT-PCR analysis in complex experimental conditions. PMID:25474086

  11. Evaluation of different enrichment methods for pathogenic Yersinia species detection by real time PCR

    Science.gov (United States)

    2014-01-01

    Background Yersiniosis is a zoonotic disease reported worldwide. Culture and PCR based protocols are the most common used methods for detection of pathogenic Yersinia species in animal samples. PCR sensitivity could be increased by an initial enrichment step. This step is particularly useful in surveillance programs, where PCR is applied to samples from asymptomatic animals. The aim of this study was to evaluate the improvement in pathogenic Yersinia species detection using a suitable enrichment method prior to the real time PCR (rtPCR). Nine different enrichment protocols were evaluated including six different broth mediums (CASO, ITC, PSB, PBS, PBSMSB and PBSSSB). Results The analysis of variance showed significant differences in Yersinia detection by rtPCR according to the enrichment protocol used. These differences were higher for Y. pseudotuberculosis than for Y. enterocolitica. In general, samples incubated at lower temperatures yielded the highest detection rates. The best results were obtained with PBSMSB and PBS2. Application of PBSMSB protocol to free-ranging wild board samples improved the detection of Y. enterocolitica by 21.2% when compared with direct rtPCR. Y. pseudotuberculosis detection was improved by 10.6% when results obtained by direct rtPCR and by PBSMSB enrichment before rtPCR were analyzed in combination. Conclusions The data obtained in the present study indicate a difference in Yersinia detection by rtPCR related to the enrichment protocol used, being PBSMSB enrichment during 15 days at 4°C and PBS during 7 days at 4°C the most efficient. The use of direct rtPCR in combination with PBSMSB enrichment prior to rtPCR resulted in an improvement in the detection rates of pathogenic Yersinia in wild boar and could be useful for application in other animal samples. PMID:25168886

  12. Isothermal microcalorimetry - A quantitative method to monitor Trypanosoma congolense growth and growth inhibition by trypanocidal drugs in real time.

    Science.gov (United States)

    Gysin, M; Braissant, O; Gillingwater, K; Brun, R; Mäser, P; Wenzler, T

    2018-03-16

    Trypanosoma congolense is a protozoan parasite that is transmitted by tsetse flies, causing African Animal Trypanosomiasis, also known as Nagana, in sub-Saharan Africa. Nagana is a fatal disease of livestock that causes severe economic losses. Two drugs are available, diminazene and isometamidium, yet successful treatment is jeopardized by drug resistant T. congolense. Isothermal microcalorimetry is a highly sensitive tool that can be used to study growth of the extracellular T. congolense parasites or to study parasite growth inhibition after the addition of antitrypanosomal drugs. Time of drug action and time to kill can be quantified in a simple way by real time heat flow measurements. We established a robust protocol for the microcalorimetric studies of T. congolense and developed mathematical computations in R to calculate different parameters related to growth and the kinetics of drug action. We demonstrate the feasibility and benefit of the method exemplary with the two standard drugs, diminazene aceturate and isometamidium chloride. The method and the mathematical approach can be translated to study other pathogenic or non-pathogenic cells if they are metabolically active and grow under axenic conditions. Copyright © 2018 The Authors. Published by Elsevier Ltd.. All rights reserved.

  13. Quantitative evaluation of alternatively spliced mRNA isoforms by label-free real-time plasmonic sensing.

    Science.gov (United States)

    Huertas, César S; Carrascosa, L G; Bonnal, S; Valcárcel, J; Lechuga, L M

    2016-04-15

    Alternative splicing of mRNA precursors enables cells to generate different protein outputs from the same gene depending on their developmental or homeostatic status. Its deregulation is strongly linked to disease onset and progression. Current methodologies for monitoring alternative splicing demand elaborate procedures and often present difficulties in discerning between closely related isoforms, e.g. due to cross-hybridization during their detection. Herein, we report a general methodology using a Surface Plasmon Resonance (SPR) biosensor for label-free monitoring of alternative splicing events in real-time, without any cDNA synthesis or PCR amplification requirements. We applied this methodology to RNA isolated from HeLa cells for the quantification of alternatively spliced isoforms of the Fas gene, involved in cancer progression through regulation of programmed cell death. We demonstrate that our methodology is isoform-specific, with virtually no cross-hybridization, achieving limits of detection (LODs) in the picoMolar (pM) range. Similar results were obtained for the detection of the BCL-X gene mRNA isoforms. The results were independently validated by RT-qPCR, with excellent concordance in the determination of isoform ratios. The simplicity and robustness of this biosensor technology can greatly facilitate the exploration of alternative splicing biomarkers in disease diagnosis and therapy. Copyright © 2015 Elsevier B.V. All rights reserved.

  14. A novel approach for evaluating the performance of real time quantitative loop-mediated isothermal amplification-based methods.

    Science.gov (United States)

    Nixon, Gavin J; Svenstrup, Helle F; Donald, Carol E; Carder, Caroline; Stephenson, Judith M; Morris-Jones, Stephen; Huggett, Jim F; Foy, Carole A

    2014-12-01

    Molecular diagnostic measurements are currently underpinned by the polymerase chain reaction (PCR). There are also a number of alternative nucleic acid amplification technologies, which unlike PCR, work at a single temperature. These 'isothermal' methods, reportedly offer potential advantages over PCR such as simplicity, speed and resistance to inhibitors and could also be used for quantitative molecular analysis. However there are currently limited mechanisms to evaluate their quantitative performance, which would assist assay development and study comparisons. This study uses a sexually transmitted infection diagnostic model in combination with an adapted metric termed isothermal doubling time (IDT), akin to PCR efficiency, to compare quantitative PCR and quantitative loop-mediated isothermal amplification (qLAMP) assays, and to quantify the impact of matrix interference. The performance metric described here facilitates the comparison of qLAMP assays that could assist assay development and validation activities.

  15. A novel approach for evaluating the performance of real time quantitative loop-mediated isothermal amplification-based methods

    Directory of Open Access Journals (Sweden)

    Gavin J. Nixon

    2014-12-01

    Full Text Available Molecular diagnostic measurements are currently underpinned by the polymerase chain reaction (PCR. There are also a number of alternative nucleic acid amplification technologies, which unlike PCR, work at a single temperature. These ‘isothermal’ methods, reportedly offer potential advantages over PCR such as simplicity, speed and resistance to inhibitors and could also be used for quantitative molecular analysis. However there are currently limited mechanisms to evaluate their quantitative performance, which would assist assay development and study comparisons. This study uses a sexually transmitted infection diagnostic model in combination with an adapted metric termed isothermal doubling time (IDT, akin to PCR efficiency, to compare quantitative PCR and quantitative loop-mediated isothermal amplification (qLAMP assays, and to quantify the impact of matrix interference. The performance metric described here facilitates the comparison of qLAMP assays that could assist assay development and validation activities.

  16. Comparative Evaluation of Four Real-Time PCR Methods for the Quantitative Detection of Epstein-Barr Virus from Whole Blood Specimens.

    Science.gov (United States)

    Buelow, Daelynn; Sun, Yilun; Tang, Li; Gu, Zhengming; Pounds, Stanley; Hayden, Randall

    2016-07-01

    Monitoring of Epstein-Barr virus (EBV) load in immunocompromised patients has become integral to their care. An increasing number of reagents are available for quantitative detection of EBV; however, there are little published comparative data. Four real-time PCR systems (one using laboratory-developed reagents and three using analyte-specific reagents) were compared with one another for detection of EBV from whole blood. Whole blood specimens seeded with EBV were used to determine quantitative linearity, analytical measurement range, lower limit of detection, and CV for each assay. Retrospective testing of 198 clinical samples was performed in parallel with all methods; results were compared to determine relative quantitative and qualitative performance. All assays showed similar performance. No significant difference was found in limit of detection (3.12-3.49 log10 copies/mL; P = 0.37). A strong qualitative correlation was seen with all assays that used clinical samples (positive detection rates of 89.5%-95.8%). Quantitative correlation of clinical samples across assays was also seen in pairwise regression analysis, with R(2) ranging from 0.83 to 0.95. Normalizing clinical sample results to IU/mL did not alter the quantitative correlation between assays. Quantitative EBV detection by real-time PCR can be performed over a wide linear dynamic range, using three different commercially available reagents and laboratory-developed methods. EBV was detected with comparable sensitivity and quantitative correlation for all assays. Copyright © 2016 American Society for Investigative Pathology and the Association for Molecular Pathology. Published by Elsevier Inc. All rights reserved.

  17. Galectin-3 and Beclin1/Atg6 genes in human cancers: using cDNA tissue panel, qRT-PCR, and logistic regression model to identify cancer cell biomarkers.

    Directory of Open Access Journals (Sweden)

    Halliday A Idikio

    Full Text Available Cancer biomarkers are sought to support cancer diagnosis, predict cancer patient response to treatment and survival. Identifying reliable biomarkers for predicting cancer treatment response needs understanding of all aspects of cancer cell death and survival. Galectin-3 and Beclin1 are involved in two coordinated pathways of programmed cell death, apoptosis and autophagy and are linked to necroptosis/necrosis. The aim of the study was to quantify galectin-3 and Beclin1 mRNA in human cancer tissue cDNA panels and determine their utility as biomarkers of cancer cell survival.A panel of 96 cDNAs from eight (8 different normal and cancer tissue types were used for quantitative real-time polymerase chain reaction (qRT-PCR using ABI7900HT. Miner2.0, a web-based 4- and 3-parameter logistic regression software was used to derive individual well polymerase chain reaction efficiencies (E and cycle threshold (Ct values. Miner software derived formula was used to calculate mRNA levels and then fold changes. The ratios of cancer to normal tissue levels of galectin-3 and Beclin1 were calculated (using the mean for each tissue type. Relative mRNA expressions for galectin-3 were higher than for Beclin1 in all tissue (normal and cancer types. In cancer tissues, breast, kidney, thyroid and prostate had the highest galectin-3 mRNA levels compared to normal tissues. High levels of Beclin1 mRNA levels were in liver and prostate cancers when compared to normal tissues. Breast, kidney and thyroid cancers had high galectin-3 levels and low Beclin1 levels.Galectin-3 expression patterns in normal and cancer tissues support its reported roles in human cancer. Beclin1 expression pattern supports its roles in cancer cell survival and in treatment response. qRT-PCR analysis method used may enable high throughput studies to generate molecular biomarker sets for diagnosis and predicting cancer treatment response.

  18. Free cancer cell detection in peritoneal cavity in gastric cancer patients by RT-PCR for CEA

    International Nuclear Information System (INIS)

    Lee, Jong Inn; Moon, Nan Mo; Paik, Nam Sun; Choi, Dong Wook; Bang, Ho Yun; Hong, Seok Il

    1997-12-01

    Authors applied RT-PCR assay to detecting CEA expressing free cancer cells in peritoneal cavity of 114 gastric cancer patients to find an indication for prophylactic treatment to prevent peritoneal recurrence. Sixty-three of 114 cases were positive for RT-PCR, of which 16 cases were positive for cytologic examination and 47 cases were negative. Forty-nine of 51 cases who were negative for RT-PCR were negative for cytologic examination. Positivity for RT-PCR according to the depth of invasion were as follows : two (28.6 %) of seven cases whose cancer invaded mucosal or submucosal layer were positive. Ten (45.5 %) of 22 cases whose cancer invaded muscular or subserosal layer were positive. Forty-one (57.7 %) of 71 serosa involved cases were positive. Eleven (78.6 %) of cases who had grossly perioneal seedings were positive (p=0.026). However, all of 7 EGC cases, 19 of 22 cases whose cancer invaded to muscle layer or to subserosa were negative for cytologic examination, and eight of 13 cases who had had peritoneal seedings were positive. Positivity for RT-PCR according to cell differentiation were as follows: forty-two (61.8 %) of 68 cases who cancer were poorly differentiated type were positive. (p=0.163) Serum level of CEA of RT-PCR positive group and that of negative group were not statistically different. It was revealed that RT-PCR was more sensitive than cytologic examination in detecting free tumor cells, especially in pm, ss and serosa positive cancers, so if further study with more cases and longer follow-up is performed, its role as prognostic factor and an indication of prophylactic therapy will be clarified. (author). 22 refs., 5 tabs

  19. Free cancer cell detection in peritoneal cavity in gastric cancer patients by RT-PCR for CEA

    Energy Technology Data Exchange (ETDEWEB)

    Lee, Jong Inn; Moon, Nan Mo; Paik, Nam Sun; Choi, Dong Wook; Bang, Ho Yun; Hong, Seok Il [Korea Cancer Center Hospital, Seoul (Korea, Republic of)

    1997-12-01

    Authors applied RT-PCR assay to detecting CEA expressing free cancer cells in peritoneal cavity of 114 gastric cancer patients to find an indication for prophylactic treatment to prevent peritoneal recurrence. Sixty-three of 114 cases were positive for RT-PCR, of which 16 cases were positive for cytologic examination and 47 cases were negative. Forty-nine of 51 cases who were negative for RT-PCR were negative for cytologic examination. Positivity for RT-PCR according to the depth of invasion were as follows : two (28.6 %) of seven cases whose cancer invaded mucosal or submucosal layer were positive. Ten (45.5 %) of 22 cases whose cancer invaded muscular or subserosal layer were positive. Forty-one (57.7 %) of 71 serosa involved cases were positive. Eleven (78.6 %) of cases who had grossly perioneal seedings were positive (p=0.026). However, all of 7 EGC cases, 19 of 22 cases whose cancer invaded to muscle layer or to subserosa were negative for cytologic examination, and eight of 13 cases who had had peritoneal seedings were positive. Positivity for RT-PCR according to cell differentiation were as follows: forty-two (61.8 %) of 68 cases who cancer were poorly differentiated type were positive. (p=0.163) Serum level of CEA of RT-PCR positive group and that of negative group were not statistically different. It was revealed that RT-PCR was more sensitive than cytologic examination in detecting free tumor cells, especially in pm, ss and serosa positive cancers, so if further study with more cases and longer follow-up is performed, its role as prognostic factor and an indication of prophylactic therapy will be clarified. (author). 22 refs., 5 tabs.

  20. Selection of suitable reference genes for normalization of genes of interest in canine soft tissue sarcomas using quantitative real-time polymerase chain reaction

    DEFF Research Database (Denmark)

    Zornhagen, K. W.; Kristensen, A. T.; Hansen, Anders Elias

    2015-01-01

    Quantitative real-time reverse transcription polymerase chain reaction (RT-qPCR) is a sensitive technique for quantifying gene expression. Stably expressed reference genes are necessary for normalization of RT-qPCR data. Only a few articles have been published on reference genes in canine tumours....... The objective of this study was to demonstrate how to identify suitable reference genes for normalization of genes of interest in canine soft tissue sarcomas using RT-qPCR. Primer pairs for 17 potential reference genes were designed and tested in archival tumour biopsies from six dogs. The geNorm algorithm...

  1. Progesterone receptor isoform analysis by quantitative real-time polymerase chain reaction in formalin-fixed, paraffin-embedded canine mammary dysplasias and tumors

    DEFF Research Database (Denmark)

    Guil-Luna, S.; Stenvang, Jan; Brünner, Nils

    2014-01-01

    and its isoforms in formalin-fixed, paraffin-embedded tissue samples from canine mammary lesions (4 dysplasias, 10 benign tumors, and 46 carcinomas) using 1-step SYBR Green quantitative real-time polymerase chain reaction (RT-qPCR). Progesterone receptor was expressed in 75% of dysplasias, all benign...... in the expression of isoform A versus B. Analysis of progesterone receptor mRNA isoforms by RT-qPCR was successful in routinely formalin-fixed, paraffin-embedded tissue samples and enabled the distribution of isoforms A and B to be identified for the first time in dysplasias, benign tumors, and malignant tumors...

  2. Relative quantitative RT-PCR to study the expression of plant nutrient transporters in arbuscular mycorrhizas

    DEFF Research Database (Denmark)

    Burleigh, S.H.

    2001-01-01

    had high reproducibility and reflected trends in gene expression as observed by Northern blotting. Using this technique, it was demonstrated that both the high-affinity phosphate transporter MtPt2 and a putative nitrate transporter from Medicago truncatula were down-regulated in roots when colonized...

  3. Optimization of the elution buffer and concentration method for detecting hepatitis E virus in swine liver using a nested reverse transcription-polymerase chain reaction and real-time reverse transcription-polymerase chain reaction.

    Science.gov (United States)

    Son, Na Ry; Seo, Dong Joo; Lee, Min Hwa; Seo, Sheungwoo; Wang, Xiaoyu; Lee, Bog-Hieu; Lee, Jeong-Su; Joo, In-Sun; Hwang, In-Gyun; Choi, Changsun

    2014-09-01

    The aim of this study was to develop an optimal technique for detecting hepatitis E virus (HEV) in swine livers. Here, three elution buffers and two concentration methods were compared with respect to enhancing recovery of HEV from swine liver samples. Real-time reverse transcription-polymerase chain reaction (RT-PCR) and nested RT-PCR were performed to detect HEV RNA. When phosphate-buffered saline (PBS, pH 7.4) was used to concentrate HEV in swine liver samples using ultrafiltration, real-time RT-PCR detected HEV in 6 of the 26 samples. When threonine buffer was used to concentrate HEV using polyethylene glycol (PEG) precipitation and ultrafiltration, real-time RT-PCR detected HEV in 1 and 3 of the 26 samples, respectively. When glycine buffer was used to concentrate HEV using ultrafiltration and PEG precipitation, real-time RT-PCR detected HEV in 1 and 3 samples of the 26 samples, respectively. When nested RT-PCR was used to detect HEV, all samples tested negative regardless of the type of elution buffer or concentration method used. Therefore, the combination of real-time RT-PCR and ultrafiltration with PBS buffer was the most sensitive and reliable method for detecting HEV in swine livers. Copyright © 2014 Elsevier B.V. All rights reserved.

  4. Identification of rat genes by TWINSCAN gene prediction, RT-PCR, and direct sequencing

    DEFF Research Database (Denmark)

    Wu, Jia Qian; Shteynberg, David; Arumugam, Manimozhiyan

    2004-01-01

    an alternative approach: reverse transcription-polymerase chain reaction (RT-PCR) and direct sequencing based on dual-genome de novo predictions from TWINSCAN. We tested 444 TWINSCAN-predicted rat genes that showed significant homology to known human genes implicated in disease but that were partially...... in the single-intron experiment. Spliced sequences were amplified in 46 cases (34%). We conclude that this procedure for elucidating gene structures with native cDNA sequences is cost-effective and will become even more so as it is further optimized.......The publication of a draft sequence of a third mammalian genome--that of the rat--suggests a need to rethink genome annotation. New mammalian sequences will not receive the kind of labor-intensive annotation efforts that are currently being devoted to human. In this paper, we demonstrate...

  5. Emulating a crowded intracellular environment in vitro dramatically improves RT-PCR performance

    International Nuclear Information System (INIS)

    Lareu, Ricky R.; Harve, Karthik S.; Raghunath, Michael

    2007-01-01

    The polymerase chain reaction's (PCR) phenomenal success in advancing fields as diverse as Medicine, Agriculture, Conservation, or Paleontology is based on the ability of using isolated prokaryotic thermostable DNA polymerases in vitro to copy DNA irrespective of origin. This process occurs intracellularly and has evolved to function efficiently under crowded conditions, namely in an environment packed with macromolecules. However, current in vitro practice ignores this important biophysical parameter of life. In order to more closely emulate conditions of intracellular biochemistry in vitro we added inert macromolecules into reverse transcription (RT) and PCR. We show dramatic improvements in all parameters of RT-PCR including 8- to 10-fold greater sensitivity, enhanced polymerase processivity, higher specific amplicon yield, greater primer annealing and specificity, and enhanced DNA polymerase thermal stability. The faster and more efficient reaction kinetics was a consequence of the cumulative molecular and thermodynamic effects of the excluded volume effect created by macromolecular crowding

  6. Quantitative Real-Time Fluoroscopy Analysis on Measurement of the Hepatic Arterial Flow During Transcatheter Arterial Chemoembolization of Hepatocellular Carcinoma: Comparison with Quantitative Digital Subtraction Angiography Analysis

    Energy Technology Data Exchange (ETDEWEB)

    Lin, Yi-Yang; Lee, Rheun-Chuan, E-mail: rclee@vghtpe.gov.tw; Guo, Wan-Yuo, E-mail: wyguo@vghtpe.gov.tw; Chu, Wei-Fa [Taipei Veterans General Hospital, Department of Radiology (China); Wu, Frank Chun-Hsien [Siemens Healthcare Ltd. (China); Gehrisch, Sonja [Siemens Healthcare GmbH (Germany)

    2016-11-15

    PurposeTo quantify the arterial flow change during transcatheter arterial chemoembolization (TACE) for hepatocellular carcinoma (HCC) using digital subtraction angiography, quantitative color-coding analysis (d-QCA), and real-time subtraction fluoroscopy QCA (f-QCA).Materials and MethodsThis prospective study enrolled 20 consecutive patients with HCC who had undergone TACE via a subsegmental approach between February 2014 and April 2015. The TACE endpoint was a sluggish antegrade tumor-feeding arterial flow. d-QCA and f-QCA were used for determining the relative maximal density time (rT{sub max}) of the selected arteries. The rT{sub max} of the selected arteries was analyzed in d-QCA and f-QCA before and after TACE, and its correlation in both analyses was evaluated.ResultsThe pre- and post-TACE rT{sub max} of the embolized segmental artery in d-QCA and f-QCA were 1.59 ± 0.81 and 2.97 ± 1.80 s (P < 0.001) and 1.44 ± 0.52 and 2.28 ± 1.02 s (P < 0.01), respectively. The rT{sub max} of the proximal hepatic artery did not significantly change during TACE in d-QCA and f-QCA. The Spearman correlation coefficients of the pre- and post-TACE rT{sub max} of the embolized segmental artery between d-QCA and f-QCA were 0.46 (P < 0.05) and 0.80 (P < 0.001). Radiation doses in one series of d-QCA and f-QCA were 140.7 ± 51.5 milligray (mGy) and 2.5 ± 0.7 mGy, respectively.Conclusionsf-QCA can quantify arterial flow changes with a higher temporal resolution and lower radiation dose. Flow quantification of the embolized segmental artery using f-QCA and d-QCA is highly correlated.

  7. Quantitative Real-Time Fluoroscopy Analysis on Measurement of the Hepatic Arterial Flow During Transcatheter Arterial Chemoembolization of Hepatocellular Carcinoma: Comparison with Quantitative Digital Subtraction Angiography Analysis

    International Nuclear Information System (INIS)

    Lin, Yi-Yang; Lee, Rheun-Chuan; Guo, Wan-Yuo; Chu, Wei-Fa; Wu, Frank Chun-Hsien; Gehrisch, Sonja

    2016-01-01

    PurposeTo quantify the arterial flow change during transcatheter arterial chemoembolization (TACE) for hepatocellular carcinoma (HCC) using digital subtraction angiography, quantitative color-coding analysis (d-QCA), and real-time subtraction fluoroscopy QCA (f-QCA).Materials and MethodsThis prospective study enrolled 20 consecutive patients with HCC who had undergone TACE via a subsegmental approach between February 2014 and April 2015. The TACE endpoint was a sluggish antegrade tumor-feeding arterial flow. d-QCA and f-QCA were used for determining the relative maximal density time (rT_m_a_x) of the selected arteries. The rT_m_a_x of the selected arteries was analyzed in d-QCA and f-QCA before and after TACE, and its correlation in both analyses was evaluated.ResultsThe pre- and post-TACE rT_m_a_x of the embolized segmental artery in d-QCA and f-QCA were 1.59 ± 0.81 and 2.97 ± 1.80 s (P < 0.001) and 1.44 ± 0.52 and 2.28 ± 1.02 s (P < 0.01), respectively. The rT_m_a_x of the proximal hepatic artery did not significantly change during TACE in d-QCA and f-QCA. The Spearman correlation coefficients of the pre- and post-TACE rT_m_a_x of the embolized segmental artery between d-QCA and f-QCA were 0.46 (P < 0.05) and 0.80 (P < 0.001). Radiation doses in one series of d-QCA and f-QCA were 140.7 ± 51.5 milligray (mGy) and 2.5 ± 0.7 mGy, respectively.Conclusionsf-QCA can quantify arterial flow changes with a higher temporal resolution and lower radiation dose. Flow quantification of the embolized segmental artery using f-QCA and d-QCA is highly correlated.

  8. Development of a Rapid Real-Time PCR Assay for Quantitation of Pneumocystis carinii f. sp. Carinii

    DEFF Research Database (Denmark)

    Larsen, Hans Henrik; Kovacs, Joseph A; Stock, Frida

    2002-01-01

    A method for reliable quantification of Pneumocystis carinii in research models of P. carinii pneumonia (PCP) that is more convenient and reproducible than microscopic enumeration of organisms would greatly facilitate investigations of this organism. We developed a rapid quantitative touchdown (QTD......) PCR assay for detecting P. carinii f. sp. carinii, the subspecies of P. carinii commonly used in research models of PCP. The assay was based on the single-copy dihydrofolate reductase gene and was able to detect ... 6 log values for standards containing > or =5 copies/tube. Application of the assay to a series of 10-fold dilutions of P. carinii organisms isolated from rat lung demonstrated that it was reproducibly quantitative over 5 log values (r = 0.99). The assay was applied to a recently reported in vitro...

  9. Development of a Rapid Real-Time PCR Assay for Quantitation of Pneumocystis carinii f. sp. Carinii

    DEFF Research Database (Denmark)

    Larsen, Hans Henrik; Kovacs, Joseph A; Stock, Frida

    2002-01-01

    6 log values for standards containing > or =5 copies/tube. Application of the assay to a series of 10-fold dilutions of P. cari