WorldWideScience

Sample records for quantitative polymerase chain

  1. Quantitative polymerase chain reaction analysis by deconvolution of internal standard.

    Science.gov (United States)

    Hirakawa, Yasuko; Medh, Rheem D; Metzenberg, Stan

    2010-04-29

    Quantitative Polymerase Chain Reaction (qPCR) is a collection of methods for estimating the number of copies of a specific DNA template in a sample, but one that is not universally accepted because it can lead to highly inaccurate (albeit precise) results. The fundamental problem is that qPCR methods use mathematical models that explicitly or implicitly apply an estimate of amplification efficiency, the error of which is compounded in the analysis to unacceptable levels. We present a new method of qPCR analysis that is efficiency-independent and yields accurate and precise results in controlled experiments. The method depends on a computer-assisted deconvolution that finds the point of concordant amplification behavior between the "unknown" template and an admixed amplicon standard. We apply the method to demonstrate dexamethasone-induced changes in gene expression in lymphoblastic leukemia cell lines. This method of qPCR analysis does not use any explicit or implicit measure of efficiency, and may therefore be immune to problems inherent in other qPCR approaches. It yields an estimate of absolute initial copy number of template, and controlled tests show it generates accurate results.

  2. Quantitative polymerase chain reaction analysis by deconvolution of internal standard

    Directory of Open Access Journals (Sweden)

    Metzenberg Stan

    2010-04-01

    Full Text Available Abstract Background Quantitative Polymerase Chain Reaction (qPCR is a collection of methods for estimating the number of copies of a specific DNA template in a sample, but one that is not universally accepted because it can lead to highly inaccurate (albeit precise results. The fundamental problem is that qPCR methods use mathematical models that explicitly or implicitly apply an estimate of amplification efficiency, the error of which is compounded in the analysis to unacceptable levels. Results We present a new method of qPCR analysis that is efficiency-independent and yields accurate and precise results in controlled experiments. The method depends on a computer-assisted deconvolution that finds the point of concordant amplification behavior between the "unknown" template and an admixed amplicon standard. We apply the method to demonstrate dexamethasone-induced changes in gene expression in lymphoblastic leukemia cell lines. Conclusions This method of qPCR analysis does not use any explicit or implicit measure of efficiency, and may therefore be immune to problems inherent in other qPCR approaches. It yields an estimate of absolute initial copy number of template, and controlled tests show it generates accurate results.

  3. Reverse transcriptase-quantitative polymerase chain reaction (RT ...

    African Journals Online (AJOL)

    zino

    2014-02-05

    Feb 5, 2014 ... polymerase chain reaction (PCR) method that allows one to detect very low transcription levels of functional ... If one can see or know where microbes in soil live, what roles in soil .... extraction buffer allowed both soil DNA and total soil RNA ... genomic DNA contamination in the RNA sample is trouble-.

  4. Analysis of liver connexin expression using reverse transcription quantitative real-time polymerase chain reaction

    Science.gov (United States)

    Maes, Michaël; Willebrords, Joost; Crespo Yanguas, Sara; Cogliati, Bruno; Vinken, Mathieu

    2016-01-01

    Summary Although connexin production is mainly regulated at the protein level, altered connexin gene expression has been identified as the underlying mechanism of several pathologies. When studying the latter, appropriate methods to quantify connexin mRNA levels are required. The present chapter describes a well-established reverse transcription quantitative real-time polymerase chain reaction procedure optimized for analysis of hepatic connexins. The method includes RNA extraction and subsequent quantification, generation of complementary DNA, quantitative real-time polymerase chain reaction and data analysis. PMID:27207283

  5. [Software and hardware design for the temperature control system of quantitative polymerase chain reaction].

    Science.gov (United States)

    Qiu, Xian-bo; Yuan, Jing-qi; Li, Qi

    2005-07-01

    A temperature control system for quantitive polymerase chain reaction (PCR) is presented in the paper with both software and hardware configuration. The performance of the control system has been improved by optimizing the software and hardware design according to the system's properties. The control system has been proven to have a good repeatability and reliability as well as high control precision.

  6. Stepwise kinetic equilibrium models of quantitative polymerase chain reaction

    Directory of Open Access Journals (Sweden)

    Cobbs Gary

    2012-08-01

    Full Text Available Abstract Background Numerous models for use in interpreting quantitative PCR (qPCR data are present in recent literature. The most commonly used models assume the amplification in qPCR is exponential and fit an exponential model with a constant rate of increase to a select part of the curve. Kinetic theory may be used to model the annealing phase and does not assume constant efficiency of amplification. Mechanistic models describing the annealing phase with kinetic theory offer the most potential for accurate interpretation of qPCR data. Even so, they have not been thoroughly investigated and are rarely used for interpretation of qPCR data. New results for kinetic modeling of qPCR are presented. Results Two models are presented in which the efficiency of amplification is based on equilibrium solutions for the annealing phase of the qPCR process. Model 1 assumes annealing of complementary targets strands and annealing of target and primers are both reversible reactions and reach a dynamic equilibrium. Model 2 assumes all annealing reactions are nonreversible and equilibrium is static. Both models include the effect of primer concentration during the annealing phase. Analytic formulae are given for the equilibrium values of all single and double stranded molecules at the end of the annealing step. The equilibrium values are then used in a stepwise method to describe the whole qPCR process. Rate constants of kinetic models are the same for solutions that are identical except for possibly having different initial target concentrations. Analysis of qPCR curves from such solutions are thus analyzed by simultaneous non-linear curve fitting with the same rate constant values applying to all curves and each curve having a unique value for initial target concentration. The models were fit to two data sets for which the true initial target concentrations are known. Both models give better fit to observed qPCR data than other kinetic models present in the

  7. Comparison of proteases in DNA extraction via quantitative polymerase chain reaction.

    Science.gov (United States)

    Eychner, Alison M; Lebo, Roberta J; Elkins, Kelly M

    2015-06-01

    We compared four proteases in the QIAamp DNA Investigator Kit (Qiagen) to extract DNA for use in multiplex polymerase chain reaction (PCR) assays. The aim was to evaluate alternate proteases for improved DNA recovery as compared with proteinase K for forensic, biochemical research, genetic paternity and immigration, and molecular diagnostic purposes. The Quantifiler Kit TaqMan quantitative PCR assay was used to measure the recovery of DNA from human blood, semen, buccal cells, breastmilk, and earwax in addition to low-template samples, including diluted samples, computer keyboard swabs, chewing gum, and cigarette butts. All methods yielded amplifiable DNA from all samples.

  8. Analysis of hepcidin expression: in situ hybridization and quantitative polymerase chain reaction from paraffin sections.

    Science.gov (United States)

    Sakuraoka, Yuhki; Sawada, Tokihiko; Shiraki, Takayuki; Park, Kyunghwa; Sakurai, Yuhichiro; Tomosugi, Naohisa; Kubota, Keiichi

    2012-07-28

    To establish methods for quantitative polymerase chain reaction (PCR) for hepcidin using RNAs isolated from paraffin-embedded sections and in situ hybridization of hepatocellular carcinoma (HCC). Total RNA from paraffin-embedded sections was isolated from 68 paraffin-embedded samples of HCC. Samples came from 54 male and 14 female patients with a mean age of 66.8 ± 7.8 years. Quantitative PCR was performed. Immunohistochemistry and in situ hybridization for hepcidin were also performed. Quantitative PCR for hepcidin using RNAs isolated from paraffin-embedded sections of HCC was performed successfully. The expression level of hepcidin mRNA in cancer tissues was significantly higher than that in non-cancer tissues. A method of in situ hybridization for hepcidin was established successfully, and this demonstrated that hepcidin mRNA was expressed in non-cancerous tissue but absent in cancerous tissue. We have established novel methods for quantitative PCR for hepcidin using RNAs isolated from paraffin-embedded sections and in situ hybridization of HCC.

  9. Analysis of hepcidin expression: In situ hybridization and quantitative polymerase chain reaction from paraffin sections

    Institute of Scientific and Technical Information of China (English)

    Yuhki Sakuraoka; Tokihiko Sawada; Takayuki Shiraki; Kyunghwa Park; Yuhichiro Sakurai; Naohisa Tomosugi; Keiichi Kubota

    2012-01-01

    AIM:TO establish methods for quantitative polymerase chain reaction (PCR) for hepcidin using RNAs isolated from paraffin-embedded sections and in situ hybridization of hepatocellular carcinoma (HCC).METHODS:Total RNA from paraffin-embedded sections was isolated from 68 paraffin-embedded samples of HCC.Samples came from 54 male and 14 female patients with a mean age of 66.8 ± 7.8 years.Quantitative PCR was performed.Immunohistochemistry and in situ hybridization for hepcidin were also performed.RESULTS:Quantitative PCR for hepcidin using RNAs isolated from paraffin-embedded sections of HCC was performed successfully.The expression level of hepcidin mRNA in cancer tissues was significantly higher than that in non-cancer tissues.A method of in situ hybridization for hepcidin was established successfully,and this demonstrated that hepcidin mRNA was expressed in non-cancerous tissue but absent in cancerous tissue.CONCLUSION:We have established novel methods for quantitative PCR for hepcidin using RNAs isolated from paraffin-embedded sections and in situ hybridization of HCC.

  10. Quantitative polymerase chain reaction (PCR) for detection of aquatic animal pathogens in a diagnostic laboratory setting

    Science.gov (United States)

    Purcell, Maureen K.; Getchell, Rodman G.; McClure, Carol A.; Weber, S.E.; Garver, Kyle A.

    2011-01-01

    Real-time, or quantitative, polymerase chain reaction (qPCR) is quickly supplanting other molecular methods for detecting the nucleic acids of human and other animal pathogens owing to the speed and robustness of the technology. As the aquatic animal health community moves toward implementing national diagnostic testing schemes, it will need to evaluate how qPCR technology should be employed. This review outlines the basic principles of qPCR technology, considerations for assay development, standards and controls, assay performance, diagnostic validation, implementation in the diagnostic laboratory, and quality assurance and control measures. These factors are fundamental for ensuring the validity of qPCR assay results obtained in the diagnostic laboratory setting.

  11. Quantitative Analysis of Periodontal Pathogens Using Real-Time Polymerase Chain Reaction (PCR).

    Science.gov (United States)

    Marin, Mª José; Figuero, Elena; Herrera, David; Sanz, Mariano

    2017-01-01

    The quantitative polymerase chain reaction (qPCR) is a variant of PCR aimed to detect and quantify a targeted DNA molecule through the addition of probes labeled with fluorescent molecules that emit fluorescence within each amplification cycle, what results in fluorescence values proportional to the amount of accumulated PCR product. This chapter presents the detailed procedures for quantification of different periodontal pathogens (Porphyromonas gingivalis, Aggregatibacter actinomycetemcomitans, Tannerella forsythia, Campylobacter rectus, and Fusobacterium spp.) using qPCR. It also includes the description of the most frequent problems encountered and how to solve them. In addition, a detailed protocol for multiplex qPCR to detect and quantify P. gingivalis and A. actinomycetemcomitans is included.

  12. Comparison of analytic methods for quantitative real-time polymerase chain reaction data.

    Science.gov (United States)

    Chen, Ping; Huang, Xuelin

    2015-11-01

    Polymerase chain reaction (PCR) is a laboratory procedure to amplify and simultaneously quantify targeted DNA molecules, and then detect the product of the reaction at the end of all the amplification cycles. A more modern technique, real-time PCR, also known as quantitative PCR (qPCR), detects the product after each cycle of the progressing reaction by applying a specific fluorescence technique. The quantitative methods currently used to analyze qPCR data result in varying levels of estimation quality. This study compares the accuracy and precision of the estimation achieved by eight different models when applied to the same qPCR dataset. Also, the study evaluates a newly introduced data preprocessing approach, the taking-the-difference approach, and compares it to the currently used approach of subtracting the background fluorescence. The taking-the-difference method subtracts the fluorescence in the former cycle from that in the latter cycle to avoid estimating the background fluorescence. The results obtained from the eight models show that taking-the-difference is a better way to preprocess qPCR data compared to the original approach because of a reduction in the background estimation error. The results also show that weighted models are better than non-weighted models, and that the precision of the estimation achieved by the mixed models is slightly better than that achieved by the linear regression models.

  13. Detecting and resolving position-dependent temperature effects in real-time quantitative polymerase chain reaction.

    Science.gov (United States)

    von Kanel, Thomas; Gerber, Dominik; Wittwer, Carl T; Hermann, Mark; Gallati, Sabina

    2011-12-15

    Real-time quantitative polymerase chain reaction (qPCR) depends on precise temperature control of the sample during cycling. In the current study, we investigated how temperature variation in plate-based qPCR instruments influences qPCR results. Temperature variation was measured by amplicon melting analysis as a convenient means to assess well-to-well differences. Multiple technical replicates of several SYBR Green I-based qPCR assays allowed correlation of relative well temperature to quantification cycle. We found that inadequate template denaturation results in an inverse correlation and requires increasing the denaturation temperature, adding a DNA destabilizing agent, or pretreating with a restriction enzyme. In contrast, inadequate primer annealing results in a direct correlation and requires lowering the annealing temperature. Significant correlations were found in 18 of 25 assays. The critical nature of temperature-dependent effects was shown in a blinded study of 29 patients for the diagnosis of Prader-Willy and Angelman syndromes, where eight diagnoses were incorrect unless temperature-dependent effects were controlled. A method to detect temperature-dependent effects by pairwise comparisons of replicates in routine experiments is presented and applied. Systematic temperature errors in qPCR instruments can be recognized and their effects eliminated when high precision is required in quantitative genetic diagnostics and critical complementary DNA analyses. Copyright © 2011 Elsevier Inc. All rights reserved.

  14. Quantitative and selective polymerase chain reaction analysis of highly similar human alpha-class glutathione transferases.

    Science.gov (United States)

    Larsson, Emilia; Mannervik, Bengt; Raffalli-Mathieu, Françoise

    2011-05-01

    Alpha-class glutathione transferases (GSTs) found expressed in human tissues constitute a family of four homologous enzymes with contrasting enzyme activities. In particular, GST A3-3 has been shown to contribute to the biosynthesis of steroid hormones in human cells and is selectively expressed in steroidogenic tissues. The more ubiquitous GST A1-1, GST A2-2, and GST A4-4 appear to be primarily involved in detoxification processes and are expressed at higher levels than GST A3-3. We are interested in studying the cell and tissue expression of the GST A3-3 gene, yet the existence of highly expressed sequence-similar homologs and of several splice variants is a serious challenge for the specific detection of unique transcript species. We found that published polymerase chain reaction (PCR) primers for GST A3-3 lack the specificity required for reliable quantitative analysis. Therefore, we designed quantitative PCR (qPCR) primers with greatly increased discrimination power for the human GSTA3 full-length transcript. The improved primers allow accurate discrimination between GST A3-3 and the other alpha-class GSTs and so are of great value to studies of the expression of the GSTA3 gene. The novel primers were used to quantify GSTA3 transcripts in human embryonic liver and steroidogenic cell lines.

  15. Development of a real time polymerase chain reaction for quantitation of Schistosoma mansoni DNA

    Directory of Open Access Journals (Sweden)

    Ana Lisa do Vale Gomes

    2006-10-01

    Full Text Available This report describes the development of a SYBR Green I based real time polymerase chain reaction (PCR protocol for detection on the ABI Prism 7000 instrument. Primers targeting the gene encoding the SSU rRNA were designed to amplify with high specificity DNA from Schistosoma mansoni, in a real time quantitative PCR system. The limit of detection of parasite DNA for the system was 10 fg of purified genomic DNA, that means less than the equivalent to one parasite cell (genome ~580 fg DNA. The efficiency was 0.99 and the correlation coefficient (R² was 0.97. When different copy numbers of the target amplicon were used as standards, the assay could detect at least 10 copies of the specific target. The primers used were designed to amplify a 106 bp DNA fragment (Tm 83ºC. The assay was highly specific for S. mansoni, and did not recognize DNA from closely related non-schistosome trematodes. The real time PCR allowed for accurate quantification of S. mansoni DNA and no time-consuming post-PCR detection of amplification products by gel electrophoresis was required. The assay is potentially able to quantify S. mansoni DNA (and indirectly parasite burden in a number of samples, such as snail tissue, serum and feces from patients, and cercaria infested water. Thus, these PCR protocols have potential to be used as tools for monitoring of schistosome transmission and quantitative diagnosis of human infection.

  16. Quantitation of RHD by real-time polymerase chain reaction for determination of RHD zygosity and RHD mosaicism/chimerism

    DEFF Research Database (Denmark)

    Krog, Grethe Risum; Clausen, Frederik Banch; Dziegiel, Morten Hanefeld

    2007-01-01

    Determination of RHD zygosity of the spouse is crucial in preconception counseling of families with history of hemolytic disease of the fetus and newborn caused by anti-D. RHD zygosity can be determined by quantitative real-time polymerase chain reaction (PCR) basically by determining RHD dosage...

  17. Quantitation of Genital Herpes Virus DNA by Polymerase Chain Reaction and ELISA

    Institute of Scientific and Technical Information of China (English)

    CHENG Peihua(程培华)

    2002-01-01

    Objective:To detect and quantitate genital herpes simplex virus (HSV) DNA in specimens from 100 patients clinically diagnosed with genital herpes.Methods: Polymerase Chain Reaction (PCR) and enzyme-linked immunosorbent assay (ELISA) were used with a standard curve of DNA copies of HSV as quantitative contrast.Results: Ninety-three cases were confirmed HSV positive and 7 cases were found to be negative. There were 58 cases of HSV-2 (62.4%) and 35 cases of HSV-1 (37.6%) among the 93 positive cases. The number of DNA plasmids ranged from 115 to 1.1×105 per 250μL among the 93 positive samples (mean =7.1×104/250μL). The number of HSV DNA plasmids ranged from 136 to 1.1×105 copies per 250μL (mean =7.6×104) among those with HSV-2, and 115 to 9.4×104 per 250μL (mean =6.3×104) among those with HSV-1. Meanwhile 10μL of extracted and dissolved DNA randomly taken from 8 each of HSV-2 and HSV-1 samples were tested. The number of HSV-2 DNA plasmids ranged from 35 copies to 2.7×104 (Mean =1.8×104) and the number of HSV-1 DNA ranged from 29 to 2.5×104 (Mean = 1.6×104). In the 7 negative cases, the quantity of HSV plasmids was zero.Conclusion: The sensitivity of ELISA quantitation (93%) is equal to that of Southern blot. The sensitivity of PCR for diagnosis is 91%, and 88% for PCR typing.

  18. A new method for quantitative real-time polymerase chain reaction data analysis.

    Science.gov (United States)

    Rao, Xiayu; Lai, Dejian; Huang, Xuelin

    2013-09-01

    Quantitative real-time polymerase chain reaction (qPCR) is a sensitive gene quantification method that has been extensively used in biological and biomedical fields. The currently used methods for PCR data analysis, including the threshold cycle method and linear and nonlinear model-fitting methods, all require subtracting background fluorescence. However, the removal of background fluorescence can hardly be accurate and therefore can distort results. We propose a new method, the taking-difference linear regression method, to overcome this limitation. Briefly, for each two consecutive PCR cycles, we subtract the fluorescence in the former cycle from that in the latter cycle, transforming the n cycle raw data into n-1 cycle data. Then, linear regression is applied to the natural logarithm of the transformed data. Finally, PCR amplification efficiencies and the initial DNA molecular numbers are calculated for each reaction. This taking-difference method avoids the error in subtracting an unknown background, and thus it is more accurate and reliable. This method is easy to perform, and this strategy can be extended to all current methods for PCR data analysis.

  19. Epstein-Barr virus (EBV) load determination using real-time quantitative polymerase chain reaction.

    Science.gov (United States)

    Fan, Hongxin; Robetorye, Ryan S

    2013-01-01

    Epstein-Barr virus (EBV) infects virtually the entire human population and infection persists throughout the lifetime of its host. EBV has been associated with the development of a wide variety of neoplasms, including lymphoma, carcinoma, and sarcoma. In addition, EBV-associated lymphoproliferative disorders are particularly prevalent in immunosuppressed individuals, including AIDS patients, transplant recipients, and patients with congenital immunodeficiencies. In recent years, EBV viral load assessment has been extensively implemented in clinical practice for the diagnosis and monitoring of EBV-associated malignancies and lymphoproliferative disorders. The real-time quantitative polymerase chain reaction (RQ-PCR) has become the method of choice for quantification of specific EBV nucleic acid sequences. This method is fast, extremely sensitive, and accurate, requires only very small amounts of input nucleic acid, and is relatively simple to perform. These characteristics have made it the method of choice for EBV viral load determination. This chapter describes the use of a laboratory-developed RQ-PCR EBV viral load assay for the detection of EBV DNA in cell-free plasma and cerebrospinal fluid samples.

  20. Salmonellae in fish feces analyzed by in situ hybridization and quantitative polymerase chain reaction.

    Science.gov (United States)

    Sha, Qiong; Forstner, Michael R J; Bonner, Timothy H; Hahn, Dittmar

    2013-09-01

    The potential of fish to transfer salmonellae from heterogeneous aquatic biofilms into feces was assessed in controlled aquarium studies with Suckermouth Catfish Hypostomus plecostomus and with biofilms inoculated with salmonellae. Neither the presence of catfish nor inoculation with salmonellae had detectable effects on the abundance of the microbial community. Densities of the microbial community were about 10(5) cells/mL in the water during a 1-week period, whereas densities of the microbial community increased 10-fold (10(6) to 10(7) cells/mg) in catfish feces during the same period. Salmonellae were detected by both quantitative polymerase chain reaction (qPCR) and situ hybridization in water samples immediately after inoculation, in numbers of about 10(4) cells/mL, representing up to 20% of the cells of the microbial community. Numbers decreased by three orders of magnitude within the first 3 d of the study, which represented only 0.01% of the community, and became undetectable after day 5. In catfish feces, numbers of Salmonella initially increased to up to 6% of the cells of the community but then declined. These results suggest that Salmonella are not biomagnified during gut passage, and thus, fish only provide a means for the translocation of this pathogen.

  1. A comprehensive collection of experimentally validated primers for Polymerase Chain Reaction quantitation of murine transcript abundance

    Directory of Open Access Journals (Sweden)

    Wang Xiaowei

    2008-12-01

    Full Text Available Abstract Background Quantitative polymerase chain reaction (QPCR is a widely applied analytical method for the accurate determination of transcript abundance. Primers for QPCR have been designed on a genomic scale but non-specific amplification of non-target genes has frequently been a problem. Although several online databases have been created for the storage and retrieval of experimentally validated primers, only a few thousand primer pairs are currently present in existing databases and the primers are not designed for use under a common PCR thermal profile. Results We previously reported the implementation of an algorithm to predict PCR primers for most known human and mouse genes. We now report the use of that resource to identify 17483 pairs of primers that have been experimentally verified to amplify unique sequences corresponding to distinct murine transcripts. The primer pairs have been validated by gel electrophoresis, DNA sequence analysis and thermal denaturation profile. In addition to the validation studies, we have determined the uniformity of amplification using the primers and the technical reproducibility of the QPCR reaction using the popular and inexpensive SYBR Green I detection method. Conclusion We have identified an experimentally validated collection of murine primer pairs for PCR and QPCR which can be used under a common PCR thermal profile, allowing the evaluation of transcript abundance of a large number of genes in parallel. This feature is increasingly attractive for confirming and/or making more precise data trends observed from experiments performed with DNA microarrays.

  2. FUNGAL SPECIATION USING QUANTITATIVE POLYMERASE CHAIN REACTION (QPCR) IN PATIENTS WITH AND WITHOUT CHRONIC RHINOSINUSITIS

    Science.gov (United States)

    Objectives/Hypothesis: 1. to determine the mycology of the middle meatus using an endoscopically guided brush sampling technique and polymerase chain reaction laboratory processing of nasal mucous. 2. To compare the mycology of the middle meatus in patients with sinus disease to...

  3. Use of Quantitative Polymerase Chain Reaction for Determining Copy Numbers of Transgenes in Lesquerella fendleri

    Directory of Open Access Journals (Sweden)

    Grace Q. Chen

    2010-01-01

    Full Text Available Problem statement: In transgenic plants, the number of transgene copies could greatly influence the level of expression and genetic stability of the target gene, thus it is important to develop an efficient method for accurate estimation of transgene copies. The quantitative Polymerase Chain Reaction (qPCR technique is becoming more efficient nowadays to determine copy numbers of transgenes in transgenic plants, being used here, for the first time in quantifying copy numbers of transgenes in Lesquerella fendleri. Approach: The system utilized a known one copy gene, LfKCS4/5, from L. fendleri as an endogenous calibrator and the threshold Crossing point (Ct measured by Applied Biosystem 7500 system to calculate the copy numbers of transgenes in primary transgenic lines (T0 generation. Results: The qPCR condition was optimized and each primer set had a PCR efficiency of 0.99 or 1.01. Our data demonstrated unambiguous 2-fold discrimination of the copy number of β-glucuronidase gene (gusA and hygromycine phosphotransferase II (hptII genes in 12 T0 lines. Most of the lines contained one or two copies of each gene. Eight out of 12 samples (66.7% showed more copies of gusA gene than that of hptII gene, suggesting rearrangements of the Transferred (T-DNA. Possible modifications of the T-DNA cassette in L. fendleri are discussed based on main models of T-DNA integration in the plant genome. Conclusion: The qPCR described in this study is an efficient method and it is particularly useful in identification and selection of transgenic plants with desirable copy numbers at early stage.

  4. Antiadenoviral effects of N-chlorotaurine in vitro confirmed by quantitative polymerase chain reaction methods

    Directory of Open Access Journals (Sweden)

    Eiichi Uchio

    2010-11-01

    Full Text Available Eiichi Uchio1, Hirotoshi Inoue1, Kazuaki Kadonosono21Department of Ophthalmology, Fukuoka University School of Medicine, Fukuoka, Japan; 2Department of Ophthalmology, Yokohama City University Medical Center, Yokohama, JapanPurpose: Adenoviral keratoconjunctivitis is recognized as one of the major pathogens of ophthalmological nosocomial infection worldwide. N-Chlorotaurine (Cl–HN–CH2–CH2–SO3H, NCT is the N-chloro derivative of the amino acid taurine, which is an oxidant produced by human granulocytes and monocytes during inflammatory reactions. Using conventional viral plaque assay, it was previously shown that NCT causes inactivation of several human adenovirus (HAdV serotypes. In this study, we evaluated the antiadenoviral effect of NCT by quantitative polymerase chain reaction (PCR methods.Methods: A549 cells were used for viral cell culture, and HAdV serotypes 3, 4, 8, 19, and 37 were used. After calculating 50% cytotoxic concentration (CC50 of NCT by MTS (3-(4,5-dimethylthiazol-2-yl-5-(3-carboxymethoxyphenyl-2-(4-sulfophenyl-2H-tetrazolium method, HAdV was cultured with NCT for 7 days, and extracted adenoviral DNA was quantitatively measured by real-time PCR.Results: A statistically significant (P < 0.05 dose-dependent inhibition was indicated for all serotypes except HAdV type 4 (HAdV4, which was maximally inhibited by only ~50%. Among the serotypes, NCT was particularly effective against HAdV8, HAdV19a, and HAdV37. The 50% effective concentration (EC50 obtained by real-time PCR of NCT ranged between 49 and 256 µM. EC50 of NCT against HAdV3 was slightly higher than that against serotypes of species D. The selective index (CC50/EC50 ranged between 41 and 60 except for HAdV4 (11.5.Conclusions: These results show that NCT has an antiviral effect against most serotypes of human HAdV inducing keratoconjunctivitis, indicating its possible therapeutic use.Keywords: adenovirus, N-chlorotaurine, epidemic keratoconjunctivitis, antiviral

  5. A multiplex quantitative real-time polymerase chain reaction panel for detecting neurologic pathogens in dogs with meningoencephalitis

    OpenAIRE

    Han, Jae-Ik; Chang, Dong-Woo; Na, Ki-Jeong

    2015-01-01

    Meningoencephalitis (ME) is a common inflammatory disorder of the central nervous system in dogs. Clinically, ME has both infectious and non-infectious causes. In the present study, a multiplex quantitative real-time polymerase chain reaction (mqPCR) panel was optimized for the detection of eight canine neurologic pathogens (Blastomyces dermatitidis, Cryptococcus spp., Neospora caninum, Borrelia burgdorferi, Bartonella spp., Toxoplasma gondii, Ehrlichia canis, and canine distemper virus [CDV]...

  6. Early detection of Brucella canis via quantitative polymerase chain reaction analysis.

    Science.gov (United States)

    Kauffman, L K; Bjork, J K; Gallup, J M; Boggiatto, P M; Bellaire, B H; Petersen, C A

    2014-02-01

    Canine brucellosis is a reportable zoonotic disease that can lead to canine reproductive losses and human infection through contact with infected urine or other genitourinary secretions. Although many locations require testing and euthanasia of positive dogs, current diagnosis is limited by the time required for seroconversion, for example, presence of B. canis-specific antibodies. The goal of this study was to determine the diagnostic ability of Brucella canis-specific quantitative polymerase chain reaction (qPCR) assay to detect B. canis in field samples prior to serological positivity for faster diagnosis and prevention of transmission within kennels or in households. Two kennels, one of which was located in the owner's home, were sampled following observation of suggestive clinical signs and positive serology of at least one dog. Specimens obtained were comparatively analysed via serology and qPCR analysis. 107 dogs were analysed for B. canis infection via qPCR: 105 via whole-blood samples, 65 via vaginal swab, six via urine and seven via genitourinary tract tissue taken at necropsy. Forty-five dogs were found to be infected with canine brucellosis via qPCR, of which 22 (48.89%) were seropositive. A statistically significant number (P = 0.0228) of qPCR-positive dogs, 5/25 (20.00%), seroconverted within a 30-day interval after initial serologic testing. As compared to serology, qPCR analysis of DNA from vaginal swabs had a sensitivity of 92.31% and specificity of 51.92%, and qPCR analysis of DNA from whole-blood samples had a sensitivity of 16.67% and specificity of 100%. B. canis outer membrane protein 25 DNA qPCR from non-invasive vaginal swab and urine samples provided early detection of B. canis infection in dogs prior to detection of antibodies. This assay provides a critical tool to decrease zoonotic spread of canine brucellosis, its associated clinical presentation(s), and emotional and economic repercussions.

  7. Rapid diagnosis of invasive pulmonary aspergillosis by quantitative polymerase chain reaction using bronchial lavage fluid.

    Science.gov (United States)

    Kawazu, Masahito; Kanda, Yoshinobu; Goyama, Susumu; Takeshita, Masataka; Nannya, Yasuhito; Niino, Miyuki; Komeno, Yukiko; Nakamoto, Tetsuya; Kurokawa, Mineo; Tsujino, Shiho; Ogawa, Seishi; Aoki, Katsunori; Chiba, Shigeru; Motokura, Toru; Ohishi, Nobuya; Hirai, Hisamaru

    2003-01-01

    Polymerase chain reaction (PCR) is a sensitive method for detection of Aspergillus DNA in bronchoalveolar lavage fluid, but it has not yet been able to distinguish infection from contamination. We have established a technique to quantify Aspergillus DNA using a real-time PCR method to resolve this problem, and we report herein a successful application of real-time PCR to diagnose invasive pulmonary aspergillosis by comparing the amount of Aspergillus DNA in bronchial lavage fluid from an affected area to that from an unaffected area. This novel tool will provide rapid, sensitive, and specific diagnosis of pulmonary aspergillosis.

  8. RAPID MONITORING BY QUANTITATIVE POLYMERASE CHAIN REACTION FOR PATHOGENIC ASPERGILLUS DURING CARPET REMOVAL FROM A HOSPITAL

    Science.gov (United States)

    Monitoring for pathogenic Aspergillus species using a rapid, highly sensitive, quantitative polumerase chain reaction technique during carpet removal in a burn unit provided data which allowed the patients to be safely returned to the re-floored area sooner than if only conventio...

  9. An integrated one-chip-sensor system for microRNA quantitative analysis based on digital droplet polymerase chain reaction

    Science.gov (United States)

    Tsukuda, Masahiko; Wiederkehr, Rodrigo Sergio; Cai, Qing; Majeed, Bivragh; Fiorini, Paolo; Stakenborg, Tim; Matsuno, Toshinobu

    2016-04-01

    A silicon microfluidic chip was developed for microRNA (miRNA) quantitative analysis. It performs sequentially reverse transcription and polymerase chain reaction in a digital droplet format. Individual processes take place on different cavities, and reagent and sample mixing is carried out on a chip, prior to entering each compartment. The droplets are generated on a T-junction channel before the polymerase chain reaction step. Also, a miniaturized fluorescence detector was developed, based on an optical pick-up head of digital versatile disc (DVD) and a micro-photomultiplier tube. The chip integrated in the detection system was tested using synthetic miRNA with known concentrations, ranging from 300 to 3,000 templates/µL. Results proved the functionality of the system.

  10. Comparison of two real-time quantitative polymerase chain reaction strategies for minimal residual disease evaluation in lymphoproliferative disorders: correlation between immunoglobulin gene mutation load and real-time quantitative polymerase chain reaction performance.

    Science.gov (United States)

    Della Starza, Irene; Cavalli, Marzia; Del Giudice, Ilaria; Barbero, Daniela; Mantoan, Barbara; Genuardi, Elisa; Urbano, Marina; Mannu, Claudia; Gazzola, Anna; Ciabatti, Elena; Guarini, Anna; Foà, Robin; Galimberti, Sara; Piccaluga, Pierpaolo; Gaidano, Gianluca; Ladetto, Marco; Monitillo, Luigia

    2014-09-01

    We compared two strategies for minimal residual disease evaluation of B-cell lymphoproliferative disorders characterized by a variable immunoglobulin heavy chain (IGH) genes mutation load. Twenty-five samples from chronic lymphocytic leukaemia (n = 18) or mantle cell lymphoma (n = 7) patients were analyzed. Based on IGH variable region genes, 22/25 samples carried > 2% mutations, 20/25 > 5%. In the IGH joining region genes, 23/25 samples carried > 2% mutations, 18/25 > 5%. Real-time quantitative polymerase chain reaction was performed on IGH genes using two strategies: method A utilizes two patient-specific primers, whereas method B employs one patient-specific and one germline primer, with different positions on the variable, diversity and joining regions. Twenty-three samples (92%) resulted evaluable using method A, only six (24%) by method B. Method B poor performance was specifically evident among mutated IGH variable/joining region cases, although no specific mutation load above, which the real-time quantitative polymerase chain reaction failed was found. The molecular strategies for minimal residual disease evaluation should be adapted to the B-cell receptor features of the disease investigated.

  11. Quantitative polymerase chain reaction: another tool to evaluate viable virus content in live attenuated orf vaccine

    Directory of Open Access Journals (Sweden)

    Durlav Prasad Bora

    2012-12-01

    Full Text Available A probe-based real-time polymerase chain reaction (PCR assay based on the highly conserved DNA polymerase gene of orf virus (ORFV for the quality control of attenuated orf vaccine is reported. Primary lamb testis (PLT cells were infected with orf vaccine virus and harvested at a critical time point to obtain maximum viable virus content as determined by real-time PCR. DNA extracted from these harvests was subjected to real-time PCR. A critical time point for the harvesting of PLT cells infected with various log10 dilutions of vaccine virus was found to be 42 h (highest slope of 3.335, which was obtained by comparing the slopes of standard curves of different time intervals. The assay was employed to evaluate viable virus content in different batches of orf vaccine. The titres estimated by real-time PCR and conventional TCID50 were comparable with a correlation of 0.8169. Thus, the real-time PCR assay could provide an alternative method or supplementary tool to estimate live ORFV particles in attenuated orf vaccine.

  12. A simple modification to improve the accuracy of methylation-sensitive restriction enzyme quantitative polymerase chain reaction.

    Science.gov (United States)

    Krygier, Magdalena; Podolak-Popinigis, Justyna; Limon, Janusz; Sachadyn, Paweł; Stanisławska-Sachadyn, Anna

    2016-05-01

    DNA digestion with endonucleases sensitive to CpG methylation such as HpaII followed by polymerase chain reaction (PCR) quantitation is commonly used in molecular studies as a simple and inexpensive solution for assessment of region-specific DNA methylation. We observed that the results of such analyses were highly overestimated if mock-digested samples were applied as the reference. We determined DNA methylation levels in several promoter regions in two setups implementing different references: mock-digested and treated with a restriction enzyme that has no recognition sites within examined amplicons. Fragmentation of reference templates allowed removing the overestimation effect, thereby improving measurement accuracy.

  13. Diagnosis of ocular toxoplasmosis by two polymerase chain reaction (PCR) examinations: qualitative multiplex and quantitative real-time.

    Science.gov (United States)

    Sugita, Sunao; Ogawa, Manabu; Inoue, Shizu; Shimizu, Norio; Mochizuki, Manabu

    2011-09-01

    To establish a two-step polymerase chain reaction (PCR) diagnostic system for ocular toxoplasmosis. A total of 13 ocular fluid samples (11 aqueous humor and 2 vitreous fluid) were collected from 13 patients with clinically suspected ocular toxoplasmosis. Ten ocular samples from other uveitis patients and 20 samples from subjects without ocular inflammation were used as controls. Two polymerase chain reaction (PCR) methods, i.e., qualitative multiplex PCR and quantitative real-time PCR, were used to measure the toxoplasma genome (T. gondii B1 gene). Qualitative multiplex PCR detected T. gondii B1 gene in the ocular fluids of 11 out of 13 patients with clinically suspected ocular toxoplasmosis. In real-time PCR, we detected high copy numbers of T. gondii DNA (5.1 × 10(2)-2.1 × 10(6) copies/mL) in a total of 10 patients (10/13, 77%). Only ocular toxoplasmosis scar lesions were observed in the three real-time PCR-negative patients. PCR assay results for the samples from the two control groups were all negative. The two-step PCR examination to detect toxoplasma DNA is a useful tool for diagnosing ocular toxoplasmosis.

  14. Detection of Legionella by quantitative-polymerase chain reaction (qPCR) for monitoring and risk assessment

    DEFF Research Database (Denmark)

    Krøjgaard, Louise H.; Krogfelt, Karen A.; Albrechtsen, Hans-Jorgen

    2011-01-01

    Background: Culture and quantitative polymerase chain reaction (qPCR) assays for the detection of Legionella were compared on samples from a residential area before and after two interventions. A total of 84 samples were collected from shower hoses and taps as first flush samples and at constant...... temperature. Samples were grouped according to the origin of the sample, a) circulation water b) water from empty apartments c) water from shower hoses. The aims were to investigate the usefulness of qPCR compared to culture for monitoring remedial actions for elimination of Legionella bacteria and as a tool...... for risk assessment. Results: In water collected from the apartments Legionella spp were detected by qPCR in the concentration range from LOQ to 9.6* 10(5)GU/L while L. pneumophila were detected in a range from LOQ to 6.8*10(5) GU/L. By culturing, the legionellae were detected in the range from below...

  15. Quantitation of mule duck in goose foie gras using TaqMan real-time Polymerase Chain Reaction.

    Science.gov (United States)

    Rodríguez, Miguel A; García, Teresa; González, Isabel; Asensio, Luis; Hernández, Pablo E; Martín, Rosario

    2004-03-24

    A real-time quantitative Polymerase Chain Reaction (PCR) method has been developed for the quantitation of mule duck (Anas platyrhynchos x Cairina moschata) in binary duck/goose foie gras mixtures. The method combines the use of real-time PCR with duck-specific and endogenous control "duck + goose" primers to measure duck content and total foie gras content, respectively. Both PCR systems (duck-specific and duck + goose) were designed on the mitochondrial 12S ribosomal RNA gene (rRNA). The duck-specific system amplifies a 96 bp fragment from duck DNA, whereas the duck + goose system amplifies a 120 bp fragment from duck and goose DNA. The method measures PCR product accumulation through a FAM-labeled fluorogenic probe (TaqMan). The C(t) (threshold cycle) values obtained from the duck + goose system are used to normalize the ones obtained from the duck-specific system. Analysis of experimental duck/goose foie gras binary mixtures demonstrated the suitability of the assay for the detection and quantitation of duck in the range of 1-25%. This genetic marker can be very useful to avoid mislabeling or fraudulent species substitution of goose by duck in foie gras.

  16. Semi-quantitative digital analysis of polymerase chain reactionelectrophoresis gel: Potential applications in low-income veterinary laboratories

    Directory of Open Access Journals (Sweden)

    John F. Antiabong

    2016-09-01

    Full Text Available Aim: The interpretation of conventional polymerase chain reaction (PCR assay results is often limited to either positive or negative (non-detectable. The more robust quantitative PCR (qPCR method is mostly reserved for quantitation studies and not a readily accessible technology in laboratories across developing nations. The aim of this study was to evaluate a semi-quantitative method for conventional PCR amplicons using digital image analysis of electrophoretic gel. The potential applications are also discussed. Materials and Methods: This study describes standard conditions for the digital image analysis of PCR amplicons using the freely available ImageJ software and confirmed using the qPCR assay. Results and Conclusion: Comparison of ImageJ analysis of PCR-electrophoresis gel and qPCR methods showed similar trends in the Fusobacterium necrophorum DNA concentration associated with healthy and periodontal disease infected wallabies (p≤0.03. Based on these empirical data, this study adds descriptive attributes (“more” or “less” to the interpretation of conventional PCR results. The potential applications in low-income veterinary laboratories are suggested, and guidelines for the adoption of the method are also highlighted.

  17. New Performance Metrics for Quantitative Polymerase Chain Reaction-Based Microbial Source Tracking Methods

    Science.gov (United States)

    Binary sensitivity and specificity metrics are not adequate to describe the performance of quantitative microbial source tracking methods because the estimates depend on the amount of material tested and limit of detection. We introduce a new framework to compare the performance ...

  18. A quantitative polymerase chain reaction assay for the enumeration of brown tide algae Aureococcusanophagefferens in coastal waters of Qinhuangdao

    Institute of Scientific and Technical Information of China (English)

    GUO Hao; LIU Yongjian; ZHANG Qi; YUAN Xiutang; ZHANG Weiwei; ZHANG Zhifeng

    2015-01-01

    Aureococcus anophagefferens, a small pelagophyte algae, has caused brown tide blooms in coastal waters of Qinhua-ngdao in recent years, presenting significant negative impacts on the shellfish mariculture industry. Under standard light microscopy, it is visually indistinguishable from other small algae in field samples due to its extremely small size. In this study, quantitative polymerase chain reaction (qPCR) based on 18S rDNA sequences was developed and used to detect and enumerate A. anophagefferens. A linear regression (R2=0.91) was generated based on cycle thr-esholds value (Ct) versus known concentrations of A. anophagefferens. Twenty-two field samples collected in coastal waters of Qinhuangdao were subjected to DNA extraction and then analyzed using qPCR. Results showed that A. anophagefferens had a wide distribution in coastal waters along Qinhuangdao. Elevated A. anophagefferens abun-dance, category 3 brown tide blooms (>200 000 cells/mL) occurred at Dongshan Beach and Tiger-stone Beach in August in 2013. In shellfish mariculture areas along coastal waters of Qinhuangdao, 4 stations had category 3 blooms, and 6 stations had category 2 blooms (35 000–200 000 cells/mL) in August and all stations had category 1 blooms (>0 to ≤35 000 cells/mL) in October. Quantitative PCR allows for detection of A. anophagefferens cells at low levels in filed samples, which is essential to effective management and prediction of brown tide blooms.

  19. A quantitative real time polymerase chain reaction approach for estimating processed animal proteins in feed: preliminary data

    Directory of Open Access Journals (Sweden)

    Maria Cesarina Abete

    2013-04-01

    Full Text Available Lifting of the ban on the use of processed animal proteins (PAPs from non-ruminants in non-ruminant feed is in the wind, avoiding intraspecies recycling. Discrimination of species will be performed through polymerase chain reaction (PCR, which is at a moment a merely qualitative method. Nevertheless, quantification of PAPs in feed is needed. The aim of this study was to approach the quantitative determination of PAPs in feed through Real Time (RT-PCR technique; three different protocols picked up from the literature were tested. Three different kind of matrices were examined: pure animal meals (bovine, chicken and pork; one feed sample certified by the European reference laboratory on animal proteins (EURL AP in feed spiked with 0.1% bovine meal; and genomic DNAs from bovine, chicken and pork muscles. The limit of detection (LOD of the three protocols was set up. All the results obtained from the three protocols considered failed in the quantification process, most likely due to the uncertain copy numbers of the analytical targets chosen. This preliminary study will allow us to address further investigations, with the purpose of developing a RT-PCR quantitative method.

  20. Development of a quantitative polymerase chain reaction assay for detection of Kudoa septempunctata in olive flounder (Paralichthys olivaceus).

    Science.gov (United States)

    Harada, Tetsuya; Kawai, Takao; Sato, Hiroshi; Yokoyama, Hiroshi; Kumeda, Yuko

    2012-05-15

    Kudoa septempunctata is a newly identified myxosporean parasite that infects the trunk muscles of olive flounder (Paralichthys olivaceus) and a causative agent of the increasing number of foodborne gastroenteritis outbreaks with unknown etiology which have occurred in Japan over the last few years. Here, we developed a quantitative polymerase chain reaction (QPCR) assay for the detection of K. septempunctata 18S rDNA in olive flounder muscle tissue samples. Additionally, we compared the relative efficacy of four DNA extraction methods, including two commercial kits, and assessed intrafish variability in the distribution of K. septempunctata spores in flounder using this QPCR method in order to establish a more accurate quantitative measurement. Our QPCR assay displayed high sensitivity, specificity, and reproducibility, and had good correlation with a microscopic detection method. Our data also indicated that the DNeasy® Blood & Tissue Kit was more efficient method for the extraction of K. septempunctata DNA than the three other methods (heating, alkaline lysis, and FastDNA® SPIN Kit method). We believe that our method would be useful for investigating foodborne outbreaks caused by K. septempunctata and for the monitoring and quantification of this parasite in retail or aquacultured olive flounders to prevent such outbreaks. Copyright © 2012 Elsevier B.V. All rights reserved.

  1. Candidate gene biodosimeters of mice and human exposure to ionizing radiation by quantitative reverse transcription polymerase chain reaction

    Directory of Open Access Journals (Sweden)

    Hamed Rezaeejam

    2015-01-01

    Full Text Available Understanding of cellular responses to ionizing radiation (IR is essential for the development of predictive markers useful for assessing human exposure. Biological markers of exposure to IR in human populations are of great interest for assessing normal tissue injury in radiation oncology and for biodosimetry in nuclear incidents and accidental radiation exposures. Traditional radiation exposure biomarkers based on cytogenetic assays (biodosimetry, are time-consuming and do not provide results fast enough and requires highly trained personnel for scoring. Hence, the development of rapid biodosimetry methods is one of the highest priorities. Exposure of cells to IR activates multiple signal transduction pathways, which result in complex alterations in gene-expression. Real-time quantitative reverse transcription-polymerase chain reaction (RT-qPCR has become the benchmark for the detection and quantification of RNA targets and is being utilized increasingly in monitoring the specific genes with more accurately and sensitively. This review evaluates the RT-qPCR as a biodosimetry method and we investigated the papers from 2000 up to now, which identified the genes-expression related the DNA repair, cell cycle checkpoint, and apoptosis induced by ionization radiation in peripheral blood and determined as biodosimeters. In conclusion, it could be say that RT-qPCR technique for determining the specific genes as biodosimeters could be a fully quantitative reliable and sensitive method. Furthermore, the results of the current review will help the researchers to recognize the most expressed genes induced by ionization radiation.

  2. A novel quantitative real-time polymerase chain reaction method for detecting toxigenic Pasteurella multocida in nasal swabs from swine.

    Science.gov (United States)

    Scherrer, Simone; Frei, Daniel; Wittenbrink, Max Michael

    2016-12-01

    Progressive atrophic rhinitis (PAR) in pigs is caused by toxigenic Pasteurella multocida. In Switzerland, PAR is monitored by selective culture of nasal swabs and subsequent polymerase chain reaction (PCR) screening of bacterial colonies for the P. multocida toxA gene. A panel of 203 nasal swabs from a recent PAR outbreak were used to evaluate a novel quantitative real-time PCR for toxigenic P. multocida in porcine nasal swabs. In comparison to the conventional PCR with a limit of detection of 100 genome equivalents per PCR reaction, the real-time PCR had a limit of detection of 10 genome equivalents. The real-time PCR detected toxA-positive P. multocida in 101 samples (49.8%), whereas the conventional PCR was less sensitive with 90 toxA-positive samples (44.3%). In comparison to the real-time PCR, 5.4% of the toxA-positive samples revealed unevaluable results by conventional PCR. The approach of culture-coupled toxA PCR for the monitoring of PAR in pigs is substantially improved by a novel quantitative real-time PCR.

  3. Nested real-time quantitative polymerase chain reaction assay for detection of hepatitis B virus covalently closed circular DNA

    Institute of Scientific and Technical Information of China (English)

    XU Chun-hai; LI Zhao-shen; DAI Jun-ying; ZHU Hai-yang; YU Jian-wu; L(U) Shu-Ian

    2011-01-01

    peripheral blood mononuclear cells; marrow mononuclear cells Background Successful treatment of hepatitis B can be achieved only if the template for hepatitis B virus (HBV) DNA replication, the covalently closed circular HBV DNA (cccDNA) can be completely cleared. To date, detecting cccDNA remains clinically challenging. The purpose of this study was to develop a nested real-time quantitative polymerase chain reaction (PCR) assay for detecting HBV cccDNA in peripheral blood mononuclear cells (PBMCs) and bone marrow mononuclear cells (MMNCs).Methods Based on the structural differences between HBV cccDNA and HBV relaxed circular DNA (rcDNA), two pairs of primers were synthesized as well as a downstream TaqMan probe. Blood and bone marrow samples were collected from hepatitis B patients and healthy controls. To remove rcDNA, samples were incubated with mung bean nuclease and the resultant purified HBV cccDNA was then amplified by nested real-time fluorescence quantitative PCR. The cccDNA levels were calculated using a positive standard.Results The nested real-time fluorescence quantitative PCR method for HBV cccDNA was successful, with a linear range of 3.0x102 copies/ml to 3.9x108 copies/ml. Of the 25 PBMC samples and 7 MMNC samples obtained from chronic hepatitis B or liver cirrhosis patients, 3 MMNC samples and 9 PBMC samples were positive for HBV cccDNA, while all of the 21 PBMC samples from healthy controls were negative.Conclusion The nested real-time fluorescence quantitative PCR may be used as an important tool for detecting cccDNA in hepatitis B patients.

  4. Development and validation of quantitative polymerase chain reaction protocols targeting the ‘L’, ‘M’, and ‘S’ ribonucleic acid of Soybean vein necrosis virus

    Science.gov (United States)

    Soybean vein necrosis virus (SVNV) was first reported in Wisconsin in 2012. SVNV is a new member of the Tospovirus family and is becoming more frequent in occurrence in the north central region USA. New real-time reverse transcriptase quantitative polymerase chain reaction (RT-qPCR) protocols were d...

  5. Diagnostic performance of fecal quantitative real-time polymerase chain reaction for detection of Lawsonia intracellularis–associated proliferative enteropathy in nursery pigs

    DEFF Research Database (Denmark)

    Pedersen, Ken Steen; Stege, Helle; Jensen, Tim Kåre;

    2013-01-01

    Quantitative polymerase chain reaction (qPCR) tests for detection and quantification of Lawsonia intracellularis in feces from pigs have been developed. The objective of the current study was to evaluate the diagnostic performance of a fecal qPCR test for detection of nursery pigs with L...

  6. Comparison of Enterococcus quantitative polymerase chain reaction analysis results from midwest U.S. river samples using EPA Method 1611 and Method 1609 PCR reagents

    Science.gov (United States)

    The U.S. Environmental Protection Agency (EPA) has provided recommended beach advisory values in its 2012 recreational water quality criteria (RWQC) for states wishing to use quantitative polymerase chain reaction (qPCR) for the monitoring of Enterococcus fecal indicator bacteria...

  7. Selection of suitable reference genes for normalization of genes of interest in canine soft tissue sarcomas using quantitative real-time polymerase chain reaction

    DEFF Research Database (Denmark)

    Zornhagen, K. W.; Kristensen, A. T.; Hansen, Anders Elias;

    2015-01-01

    Quantitative real-time reverse transcription polymerase chain reaction (RT-qPCR) is a sensitive technique for quantifying gene expression. Stably expressed reference genes are necessary for normalization of RT-qPCR data. Only a few articles have been published on reference genes in canine tumours...

  8. Progesterone receptor isoform analysis by quantitative real-time polymerase chain reaction in formalin-fixed, paraffin-embedded canine mammary dysplasias and tumors

    DEFF Research Database (Denmark)

    Guil-Luna, S.; Stenvang, Jan; Brünner, Nils;

    2014-01-01

    and its isoforms in formalin-fixed, paraffin-embedded tissue samples from canine mammary lesions (4 dysplasias, 10 benign tumors, and 46 carcinomas) using 1-step SYBR Green quantitative real-time polymerase chain reaction (RT-qPCR). Progesterone receptor was expressed in 75% of dysplasias, all benign...

  9. Comparison of Enterococcus quantitative polymerase chain reaction analysis results from midwest U.S. river samples using EPA Method 1611 and Method 1609 PCR reagents

    Science.gov (United States)

    The U.S. Environmental Protection Agency (EPA) has provided recommended beach advisory values in its 2012 recreational water quality criteria (RWQC) for states wishing to use quantitative polymerase chain reaction (qPCR) for the monitoring of Enterococcus fecal indicator bacteria...

  10. Method for detection of Stachybotrys chartarum in pure culture and field samples using quantitative polymerase chain reaction

    Energy Technology Data Exchange (ETDEWEB)

    Cruz-Perez, Patricia; Buttner, Mark P.

    2004-05-11

    A method for detecting the fungus Stachybotrys chartarum includes isolating DNA from a sample suspected of containing the fungus Stachybotrys chartarum. The method further includes subjecting the DNA to polymerase chain reaction amplification utilizing at least one of several primers, the several primers each including one of the base sequences 5'GTTGCTTCGGCGGGAAC3', 5'TTTGCGTTTGCCACTCAGAG3', 5'ACCTATCGTTGCTTCGGCG3', and 5'GCGTTTGCCACTCAGAGAATACT3'. The method additionally includes detecting the fungus Stachybotrys chartarum by visualizing the product of the polymerase chain reaction.

  11. New Developments in Quantitative Real-time Polymerase Chain Reaction Technology.

    Science.gov (United States)

    Gadkar, Vija yJ; Filion, Martin

    2014-01-01

    Real time-quantitative PCR (RT-qPCR) technology has revolutionized the detection landscape in every area of molecular biology. The fundamental basis of this technology has remained unchanged since its inception, however various modifications have enhanced the overall performance of this highly versatile technology. These improvements have ranged from changes in the individual components of the enzymatic reaction cocktail (polymerizing enzymes, reaction buffers, probes, etc.) to the detection system itself (instrumentation, software, etc.). The RT-qPCR technology currently available to researchers is more sensitive, faster and affordable than when this technology was first introduced. In this article, we summarize the developments of the last few years in RT-qPCR technology and nucleic acid amplification.

  12. Detection of human herpesvirus 8 by quantitative polymerase chain reaction: development and standardisation of methods

    Directory of Open Access Journals (Sweden)

    Speicher David J

    2012-09-01

    Full Text Available Abstract Background Human herpesvirus 8 (HHV-8, the aetiological agent of Kaposi’s sarcoma (KS, multicentric Castleman’s disease (MCD, and primary effusion lymphoma (PEL is rare in Australia, but endemic in Sub-Saharan Africa, parts of South-east Asia and Oceania. While the treatment of external KS lesions can be monitored by clinical observation, the internal lesions of KS, MCD and PEL require extensive and expensive internal imaging, or autopsy. In patients with MCD and PEL, if HHV-8 viraemia is not reduced quickly, ~50% die within 24 months. HHV-8 qPCR is a valuable tool for monitoring HHV-8 viraemia, but is not available in many parts of the world, including those with high prevalence of KS and HHV-8. Methods A new molecular facility with stringent three-phase workflow was established, adhering to NPAAC and CLSI guidelines. Three fully validated quantitative assays were developed: two for detection and quantification of HHV-8; one for GAPDH, necessary for normalisation of viral loads in tissue and peripheral blood. Results The HHV-8 ORF73 and ORF26 qPCR assays were 100% specific. All qPCR assays, displayed a broad dynamic range (102 to 1010 copies/μL TE Buffer with a limit of detection of 4.85x103, 5.61x102, and 2.59x102 copies/μL TE Buffer and a limit of quantification of 4.85x103, 3.01x102, and 1.38x102 copies/μL TE Buffer for HHV-8 ORF73, HHV-8 ORF26, and GAPDH respectively. The assays were tested on a panel of 35 KS biopsies from Queensland. All were HHV-8 qPCR positive with average viral load of 2.96x105 HHV-8 copies/μL DNA extract (range: 4.37x103 to 1.47x106 copies/μL DNA extract: When normalised these equate to an average viral load of 2.44x104 HHV-8 copies/103 cells (range: 2.20x102 to 7.38x105 HHV-8 copies/103 cells. Conclusions These are the first fully optimised, validated and MIQE compliant HHV-8 qPCR assays established in Australia. They worked well for qualitative detection of HHV-8 in archival tissue, and are well

  13. Quantitative Polymerase Chain Reaction for Microbial Growth Kinetics of Mixed Culture System.

    Science.gov (United States)

    Cotto, Ada; Looper, Jessica K; Mota, Linda C; Son, Ahjeong

    2015-11-01

    Microbial growth kinetics is often used to optimize environmental processes owing to its relation to the breakdown of substrate (contaminants). However, the quantification of bacterial populations in the environment is difficult owing to the challenges of monitoring a specific bacterial population within a diverse microbial community. Conventional methods are unable to detect and quantify the growth of individual strains separately in the mixed culture reactor. This work describes a novel quantitative PCR (qPCR)-based genomic approach to quantify each species in mixed culture and interpret its growth kinetics in the mixed system. Batch experiments were performed for both single and dual cultures of Pseudomonas putida and Escherichia coli K12 to obtain Monod kinetic parameters (μmax and Ks). The growth curves and kinetics obtained by conventional methods (i.e., dry weight measurement and absorbance reading) were compared with that obtained by qPCR assay. We anticipate that the adoption of this qPCR-based genomic assay can contribute significantly to traditional microbial kinetics, modeling practice, and the operation of bioreactors, where handling of complex mixed cultures is required.

  14. Identification of four squid species by quantitative real-time polymerase chain reaction.

    Science.gov (United States)

    Ye, Jian; Feng, Junli; Liu, Shasha; Zhang, Yanping; Jiang, Xiaona; Dai, Zhiyuan

    2016-02-01

    Squids are distributed worldwide, including many species of commercial importance, and they are often made into varieties of flavor foods. The rapid identification methods for squid species especially their processed products, however, have not been well developed. In this study, quantitative real-time PCR (qPCR) systems based on specific primers and TaqMan probes have been established for rapid and accurate identification of four common squid species (Ommastrephes bartramii, Dosidicus gigas, Illex argentinus, Todarodes pacificus) in Chinese domestic market. After analyzing mitochondrial genes reported in GenBank, the mitochondrial cytochrome b (Cytb) gene was selected for O. bartramii detection, cytochrome c oxidase subunit I (COI) gene for D. gigas and T. Pacificus detection, ATPase subunit 6 (ATPase 6) gene for I. Argentinus detection, and 12S ribosomal RNA (12S rDNA) gene for designing Ommastrephidae-specific primers and probe. As a result, all the TaqMan systems are of good performance, and efficiency of each reaction was calculated by making standard curves. This method could detect target species either in single or mixed squid specimen, and it was applied to identify 12 squid processed products successfully. Thus, it would play an important role in fulfilling labeling regulations and squid fishery control.

  15. Detection of Nanophyetus salmincola in water, snails, and fish tissues by quantitative polymerase chain reaction

    Science.gov (United States)

    Purcell, Maureen K.; Powers, Rachel L.; Besijn, Bonnie; Hershberger, Paul K.

    2017-01-01

    We report the development and validation of two quantitative PCR (qPCR) assays to detect Nanophyetus salmincola DNA in water samples and in fish and snail tissues. Analytical and diagnostic validation demonstrated good sensitivity, specificity, and repeatability of both qPCR assays. The N. salmincola DNA copy number in kidney tissue was significantly correlated with metacercaria counts based on microscopy. Extraction methods were optimized for the sensitive qPCR detection of N. salmincola DNA in settled water samples. Artificially spiked samples suggested that the 1-cercaria/L threshold corresponded to an estimated log10 copies per liter ≥ 6.0. Significant correlation of DNA copy number per liter and microscopic counts indicated that the estimated qPCR copy number was a good predictor of the number of waterborne cercariae. However, the detection of real-world samples below the estimated 1-cercaria/L threshold suggests that the assays may also detect other N. salmincola life stages, nonintact cercariae, or free DNA that settles with the debris. In summary, the qPCR assays reported here are suitable for identifying and quantifying all life stages of N. salmincola that occur in fish tissues, snail tissues, and water.

  16. Growth factor expression after supraspinatus tear: a quantitative polymerase chain reaction (PCR) study in rats.

    Science.gov (United States)

    Díaz Heredia, Jorge; Ruiz Iban, M A; Martínez-Botas, J; Valencia Mora, M; Cuéllar Ayestaran, A; Moros Marco, S; Ruiz Díaz, R

    2016-11-01

    The objective of this study was to evaluate the temporal expression pattern of three different growth factors (VEGF, IL-1β, and TGF-1β) in a supraspinatus tendon lesion in an animal model. The hypothesis of this study is that there are variations in the expression of these factors in the first 8 weeks after injury. A full thickness defect was made in the supraspinatus tendon of 40 rat shoulders. The animal were sacrificed at 0, 3, 7, 14 and 56 days after injury and three tissue samples were obtained: bone from the tendon footprint; the supraspinatus tendon stump, and a fragment of the myotendinous junction. After mRNA extraction, quantitative PCR analysis was performed, and the expression of three different growth factors were evaluated in each zone. There was an increased expression of IL-1β during the first week after injury at all levels evaluated with a clear peak in the first day after injury. There was also a significant increase in TGF-1β expression levels all along the first week in the three zones. There were no variations in VEGF expression in the three zones along the 8 weeks. IL-1β was expressed predominantly in the initial stages after injury; TGF initiated its expression after the initial phase since day three, whereas VEGF remained basically unchanged during the entire process.

  17. New buffers to improve the quantitative real-time polymerase chain reaction.

    Science.gov (United States)

    Ahmad, Ashraf; Ghasemi, Jahan

    2007-08-01

    Real-time PCR is a potent technique for nucleic acid quantification for research and diagnostic purposes, the wide dynamic range being one of the advantages over other techniques like the microarray. Several additives and enhancers have been studied to expand the PCR dynamic range in order to be more efficient in quantifying low quantities of nucleic acids, increase the yield and improve reaction efficiency. Shown here is that a combination of new buffers with the regularly used Tris buffer makes it possible to expand the real-time PCR dynamic range and to improve the efficiency and correlation coefficient. Mixing HEPES, TEA or MOPS with Tris was more efficient than Tris alone. It was also found that, if the pH value of the Tris buffer was calibrated with phosphoric acid instead of hydrochloric acid, then the dynamic range was significantly improved and low quantities could be detected and quantified more efficiently. Mixing more than one compound with the Tris buffer was also effective for expanding the dynamic range and increasing the efficiency and correlation coefficient in quantitative real-time PCR.

  18. Development of a SYBR Green quantitative polymerase chain reaction assay for rapid detection and quantification of infectious laryngotracheitis virus.

    Science.gov (United States)

    Mahmoudian, Alireza; Kirkpatrick, Naomi C; Coppo, Mauricio; Lee, Sang-Won; Devlin, Joanne M; Markham, Philip F; Browning, Glenn F; Noormohammadi, Amir H

    2011-06-01

    Infectious laryngotracheitis is an acute viral respiratory disease of chickens with a worldwide distribution. Sensitive detection of the causative herpesvirus is particularly important because it can persist in the host at a very low copy number and be transmitted to other birds. Quantification of viral genome copy number is also useful for clinical investigations and experimental studies. In the study presented here, a quantitative polymerase chain reaction (qPCR) assay was developed using SYBR Green chemistry and the viral gene UL15a to detect and quantify infectious laryngotracheitis virus (ILTV) in ILTV-inoculated chicken embryos or naturally infected birds. The specificity of the assay was confirmed using a panel of viral and bacterial pathogens of poultry. The sensitivity of the assay was compared with two conventional PCR assays, virus titration and an antigen-detecting enzyme-linked immunosorbent assay. The qPCR developed in this study was highly sensitive and specific, and has potential for quantification of ILTV in tissues from naturally and experimentally infected birds and embryos.

  19. A multiplex quantitative real-time polymerase chain reaction panel for detecting neurologic pathogens in dogs with meningoencephalitis.

    Science.gov (United States)

    Han, Jae-Ik; Chang, Dong-Woo; Na, Ki-Jeong

    2015-01-01

    Meningoencephalitis (ME) is a common inflammatory disorder of the central nervous system in dogs. Clinically, ME has both infectious and non-infectious causes. In the present study, a multiplex quantitative real-time polymerase chain reaction (mqPCR) panel was optimized for the detection of eight canine neurologic pathogens (Blastomyces dermatitidis, Cryptococcus spp., Neospora caninum, Borrelia burgdorferi, Bartonella spp., Toxoplasma gondii, Ehrlichia canis, and canine distemper virus [CDV]). The mqPCR panel was subsequently applied to 53 cerebrospinal fluid (CSF) samples collected from dogs with ME. The analytic sensitivity (i.e., limit of detection, expressed as molecules per 1 mL of recombinant vector) was 3.8 for CDV, 3.7 for Ehrlichia canis, 3.7 for Bartonella spp., 3.8 for Borrelia burgdorferi, 3.7 for Blastomyces dermatitidis, 3.7 for Cryptococcus spp., 38 for Neospora caninum, and 3.7 for Toxoplasma gondii. Among the tested CSF samples, seven (15%) were positive for the following pathogens in decreasing order of frequency: Cryptococcus spp. (3/7), Blastomyces dermatitidis (2/7), and Borrelia burgdorferi (2/7). In summary, use of an mqPCR panel with high analytic sensitivity as an initial screen for infectious agents in dogs with ME could facilitate the selection of early treatment strategies and improve outcomes.

  20. Analysis of plasma viral RNA levels during acute dengue virus infection using quantitative competitor reverse transcription-polymerase chain reaction.

    Science.gov (United States)

    Sudiro, T M; Zivny, J; Ishiko, H; Green, S; Vaughn, D W; Kalayanarooj, S; Nisalak, A; Norman, J E; Ennis, F A; Rothman, A L

    2001-01-01

    There is increasing recognition of the potential importance of viral burden in the pathogenesis of dengue hemorrhagic fever (DHF). There is little data available, however, describing the kinetics of viral replication in humans with natural dengue virus (DV) infection. Standard procedures for measuring titers of infectious virus in clinical specimens are either laborious or insensitive. We developed a method for measurement of DV RNA in plasma samples based on reverse transcription-polymerase chain reaction (RT-PCR) using a mutant RNA target as a competitor. This technique was reproducible and accurate for samples containing any of the four DV serotypes, and could be applied to samples containing as few as 250 copies of RNA per reaction. We examined plasma viral RNA levels in 80 children with acute DV infection; sequential plasma samples were tested in 34 of these children. Plasma viral RNA levels ranged as high as 10(9) RNA copies/ml, and correlated with titers of infectious virus measured in mosquitoes (r= 0.69). Plasma viral RNA levels fell rapidly during the last several days of the febrile period. We did not find a significant difference in maximal plasma viral RNA levels between children with DHF and children with dengue fever, but peak viral RNA levels were identified in only 16 subjects. We conclude that this quantitative RT-PCR method will be valuable for further studies of natural DV infections.

  1. High-throughput multiplex quantitative polymerase chain reaction method for Giardia lamblia and Cryptosporidium species detection in stool samples.

    Science.gov (United States)

    Nurminen, Noora; Juuti, Rosa; Oikarinen, Sami; Fan, Yue-Mei; Lehto, Kirsi-Maarit; Mangani, Charles; Maleta, Kenneth; Ashorn, Per; Hyöty, Heikki

    2015-06-01

    Giardia lamblia and Cryptosporidium species belong to a complex group of pathogens that cause diseases hampering development and socioeconomic improvements in the developing countries. Both pathogens are recognized as significant causes of diarrhea and nutritional disorders. However, further studies are needed to clarify the role of parasitic infections, especially asymptomatic infections in malnutrition and stunting. We developed a high-throughput multiplex quantitative polymerase chain reaction (qPCR) method for G. lamblia and Cryptosporidium spp. detection in stool samples. The sensitivity and specificity of the method were ensured by analyzing confirmed positive samples acquired from diagnostics laboratories and participating in an external quality control round. Its capability to detect asymptomatic G. lamblia and Cryptosporidium spp. infections was confirmed by analyzing stool samples collected from 44 asymptomatic 6-month-old infants living in an endemic region in Malawi. Of these, five samples were found to be positive for G. lamblia and two for Cryptosporidium spp. In conclusion, the developed method is suitable for large-scale studies evaluating the occurrence of G. lamblia and Cryptosporidium spp. in endemic regions and for clinical diagnostics of these infections.

  2. An integrated CMOS quantitative-polymerase-chain-reaction lab-on-chip for point-of-care diagnostics.

    Science.gov (United States)

    Norian, Haig; Field, Ryan M; Kymissis, Ioannis; Shepard, Kenneth L

    2014-10-21

    Considerable effort has recently been directed toward the miniaturization of quantitative-polymerase-chain-reaction (qPCR) instrumentation in an effort to reduce both cost and form factor for point-of-care applications. Considerable gains have been made in shrinking the required volumes of PCR reagents, but resultant prototypes retain their bench-top form factor either due to heavy heating plates or cumbersome optical sensing instrumentation. In this paper, we describe the use of complementary-metal-oxide semiconductor (CMOS) integrated circuit (IC) technology to produce a fully integrated qPCR lab-on-chip. Exploiting a 0.35 μm high-voltage CMOS process, the IC contains all of the key components for performing qPCR. Integrated resistive heaters and temperature sensors regulate the surface temperature of the chip to an accuracy of 0.45 °C. Electrowetting-on-dielectric microfluidics are actively driven from the chip surface, allowing for droplet generation and transport down to volumes less than 1.2 nanoliter. Integrated single-photon avalanche diodes (SPADs) are used for fluorescent monitoring of the reaction, allowing for the quantification of target DNA with more than four-orders-of-magnitude of dynamic range and sensitivities down to a single copy per droplet. Using this device, reliable and sensitive real-time proof-of-concept detection of Staphylococcus aureus (S. aureus) is demonstrated.

  3. Use of Fluorescence Quantitative Polymerase Chain Reaction (PCR) for the Detection of Escherichia coli Adhesion to Pig Intestinal Epithelial Cells.

    Science.gov (United States)

    Dai, C H; Gan, L N; Qin, W U; Zi, C; Zhu, G Q; Wu, S L; Bao, W B

    2016-09-01

    An efficient and accurate method to test Escherichia coli (E. coli) adhesion to intestinal epithelial cells will contribute to the study of bacterial pathogenesis and the function of genes that encode receptors related to adhesion. This study used the quantitative real-time polymerase chain reaction (qPCR) method. qPCR primers were designed from the PILIN gene of E. coli F18ab, F18ac, and K88ac, and the pig β-ACTIN gene. Total deoxyribonucleic acid (DNA) from E. coli and intestinal epithelial cells (IPEC-J2 cells) were used as templates for qPCR. The 2-ΔΔCt formula was used to calculate the relative number of bacteria in cultures of different areas. We found that the relative numbers of F18ab, F18ac, and K88ac that adhered to IPEC-J2 cells did not differ significantly in 6-, 12-, and 24-well culture plates. This finding indicated that there was no relationship between the relative adhesion number of E. coli and the area of cells, so the method of qPCR could accurately test the relative number of E. coli. This study provided a convenient and reliable testing method for experiments involving E. coli adhesion, and also provided innovative ideas for similar detection methods.

  4. Influences of bracket bonding on mutans streptococcus in plaque detected by real time fluorescence-quantitative polymerase chain reaction

    Institute of Scientific and Technical Information of China (English)

    AI Hong; LU Hong-fei; LIANG Huan-you; WU Jian; LI Ruo-lan; LIU Guo-ping; XI Yun

    2005-01-01

    Background Enamel demineralization occurs frequently during orthodontic treatment. In this study, we evaluated the changes of the density of mutans streptococcus (MS) in plaque after bracket bonding and using fluoride adhesive on maxillary incisors by real time fluorescence-quantitative polymerase chain reaction (RT-FQ PCR).Methods The study was designed as a self-paired test. Brackets were bonded with fluoride adhesive on the left side, while non-fluoride adhesive on the right side for each patient. Plaque samples were taken from the surfaces around the brackets of four maxillary incisors before brackets bonding and after the bonding 4 weeks later. The amount of MS was measured by RT-FQ PCR. The data obtained were analyzed statistically using the SPSS 11.5 version and the alpha level was set at 0.05 (2-tailed).Results The amount of MS in plaque increased significantly after bracket bonding (P0.05), and among the incisors using and not using fluoride adhesive (P>0.05).Conclusions The increase of the density of MS in plaque after bracket bonding is one of the etiological factors for enamel demineralization in orthodontic patients. The result of this study did not support what we observed clinically that the incidence of enamel demineralization for lateral incisors was higher than that for central incisors. Using fluoride adhesive for bonding did not affect the amount of MS in plaque in our study. Further study is needed.

  5. Identification and validation of reference genes for quantitative real-time polymerase chain reaction in Cimex lectularius.

    Science.gov (United States)

    Mamidala, Praveen; Rajarapu, Swapna P; Jones, Susan C; Mittapalli, Omprakash

    2011-07-01

    Quantitative real-time polymerase chain reaction (qRT-PCR) has emerged as robust methodology for gene expression studies, but reference genes are crucial for accurate normalization. Commonly used reference genes are housekeeping genes that are thought to be nonregulated; however, their expression can be unstable across different experimental conditions. We report the identification and validation of suitable reference genes in the bed bug, Cimex lectularius, by using qRT-PCR. The expression stability of eight reference genes in different tissues (abdominal cuticle, midgut, Malpighian tubules, and ovary) and developmental stages (early instar nymphs, late instar nymphs, and adults) of pesticide-susceptible and pesticide-exposed C. lectularius were analyzed using geNorm, NormFinder, and BestKeeper. Overall expression analysis of the eight reference genes revealed significant variation among samples, indicating the necessity of validating suitable reference genes for accurate quantification of mRNA transcripts. Ribosomal protein (RPL18) exhibited the most stable gene expression across all the tissue and developmental-stage samples; a-tubulin revealed the least stability across all of the samples examined. Thus, we recommend RPL18 as a suitable reference gene for normalization in gene expression studies of C. lectularius.

  6. Reference genes for quantitative real-time polymerase chain reaction studies in soybean plants under hypoxic conditions.

    Science.gov (United States)

    Nakayama, T J; Rodrigues, F A; Neumaier, N; Marcelino-Guimarães, F C; Farias, J R B; de Oliveira, M C N; Borém, A; de Oliveira, A C B; Emygdio, B M; Nepomuceno, A L

    2014-02-13

    Quantitative real-time polymerase chain reaction (RT-qPCR) is a powerful tool used to measure gene expression. However, because of its high sensitivity, the method is strongly influenced by the quality and concentration of the template cDNA and by the amplification efficiency. Relative quantification is an effective strategy for correcting random and systematic errors by using the expression level of reference gene(s) to normalize the expression level of the genes of interest. To identify soybean reference genes for use in studies of flooding stress, we compared 5 candidate reference genes (CRGs) with the NormFinder and GeNorm programs to select the best internal control. The expression stability of the CRGs was evaluated in root tissues from soybean plants subjected to hypoxic conditions. Elongation factor 1-beta and actin-11 were identified as the most appropriate genes for RT-qPCR normalization by both the NormFinder and GeNorm analyses. The expression profiles of the genes for alcohol dehydrogenase 1, sucrose synthase 4, and ascorbate peroxidase 2 were analyzed by comparing different normalizing combinations (including no normalization) of the selected reference genes. Here, we have identified potential genes for use as references for RT-qPCR normalization in experiments with soybean roots growing in O2-depleted environments, such as flooding-stressed plants.

  7. Development of real-time quantitative polymerase chain reaction assays to track treatment response in retinoid resistant acute promyelocytic leukemia

    Directory of Open Access Journals (Sweden)

    Jelena V Jovanovic

    2011-10-01

    Full Text Available Molecular detection of minimal residual disease (MRD has become established to assess remission status and guide therapy in patients with PML-RARA+ acute promyelocytic leukemia (APL. However, there are few data on tracking disease response in patients with rarer retinoid resistant subtypes of APL, characterized by PLZF-RARA and STAT5b-RARA. Despite their relative rarity (<1% of APL we identified 6 cases (PLZF-RARA, n=5; STAT5b-RARA, n=1, established the respective breakpoint junction regions and designed real-time quantitative polymerase chain reaction (RQ-PCR assays to detect leukemic transcripts. The relative level of fusion gene expression in diagnostic samples was comparable to that observed in t(15;17-associated APL, affording assay sensitivities of ~1 in 104-105. Serial samples were available from 2 PLZF-RARA APL patients. One showed persistent PCR positivity, predicting subsequent relapse, and remains in CR2, ~11 years post-autograft. The other, achieved molecular remission (CRm with combination chemotherapy, remaining in CR1 at 6 years. The STAT5b-RARA patient failed to achieve CRm following frontline combination chemotherapy and ultimately proceeded to allogeneic transplant on the basis of a steadily rising fusion transcript level. These data highlight the potential of RQ-PCR detection of MRD to facilitate development of more individualized approaches to the management of rarer molecularly-defined subsets of acute leukemia.

  8. Quantitative Polymerase Chain Reaction to Assess Response to Treatment of Bacterial Vaginosis and Risk of Preterm Birth.

    Science.gov (United States)

    Abramovici, Adi; Lobashevsky, Elena; Cliver, Suzanne P; Edwards, Rodney K; Hauth, John C; Biggio, Joseph R

    2015-10-01

    The aim of this study was to determine whether quantitative polymerase chain reaction (qPCR) bacterial load measurement is a valid method to assess response to treatment of bacterial vaginosis and risk of preterm birth in pregnant women. Secondary analysis by utilizing stored vaginal samples obtained during a previous randomized controlled trial studying the effect of antibiotics on preterm birth (PTB). All women had risk factors for PTB: (1) positive fetal fibronectin (n=146), (2) bacterial vaginosis (BV) and a prior PTB (n=43), or (3) BV and a prepregnancy weightbacterial loads were correlated with Nugent score and each of its specific bacterial components (all pbacterial load did not differ by treatment group (p=0.87). Posttreatment total bacterial load was significantly lower in the antibiotics group than the placebo group (pbacterial load decreased significantly posttreatment in the antibiotics group (pbacterial loads were not statistically significant. qPCR correlates with Nugent score and demonstrates decreased bacterial load after antibiotic treatment. Therefore, it is a valid method of vaginal flora assessment in pregnant women who are at high risk for PTB. Thieme Medical Publishers 333 Seventh Avenue, New York, NY 10001, USA.

  9. Detection of nonauthorized genetically modified organisms using differential quantitative polymerase chain reaction: application to 35S in maize.

    Science.gov (United States)

    Cankar, Katarina; Chauvensy-Ancel, Valérie; Fortabat, Marie-Noelle; Gruden, Kristina; Kobilinsky, André; Zel, Jana; Bertheau, Yves

    2008-05-15

    Detection of nonauthorized genetically modified organisms (GMOs) has always presented an analytical challenge because the complete sequence data needed to detect them are generally unavailable although sequence similarity to known GMOs can be expected. A new approach, differential quantitative polymerase chain reaction (PCR), for detection of nonauthorized GMOs is presented here. This method is based on the presence of several common elements (e.g., promoter, genes of interest) in different GMOs. A statistical model was developed to study the difference between the number of molecules of such a common sequence and the number of molecules identifying the approved GMO (as determined by border-fragment-based PCR) and the donor organism of the common sequence. When this difference differs statistically from zero, the presence of a nonauthorized GMO can be inferred. The interest and scope of such an approach were tested on a case study of different proportions of genetically modified maize events, with the P35S promoter as the Cauliflower Mosaic Virus common sequence. The presence of a nonauthorized GMO was successfully detected in the mixtures analyzed and in the presence of (donor organism of P35S promoter). This method could be easily transposed to other common GMO sequences and other species and is applicable to other detection areas such as microbiology.

  10. Quantitative polymerase chain reaction (PCR) assays for a bacterial thiaminase I gene and the thiaminase-producing bacterium Paenibacillus thiaminolyticus.

    Science.gov (United States)

    Richter, C.A.; Wright-Osment, Maureen K.; Zajicek, J.L.; Honeyfield, D.C.; Tillitt, D.E.

    2009-01-01

    The thiaminase I enzyme produced by the gram-positive bacterium Paenibacillus thiaminolyticus isolated from the viscera of Lake Michigan alewives Alosa pseudoharengus is currently the only defined source of the thiaminase activity linked to thiamine (vitamin B1) deficiency in early mortality syndrome (EMS) in the larvae of Great Lakes salmonines. Diets of alewife or isolated strains of P. thiaminolyticus mixed in a semipurified diet and fed to lake trout Salvelinus namaycush have been shown to produce EMS in fry. We utilized quantitative polymerase chain reaction (Q-PCR) to aid in studies of the sources of P. thiaminolyticus and thiaminase I. Quantitative PCR assays were established to detect the thiaminase I gene of P. thiaminolyticus, the 16S rRNA gene from most species of bacteria, and the 16S rRNA gene specifically from P. thiaminolyticus and a few closely related taxa. The Q-PCR assays are linear over at least six orders of magnitude and can detect the thiaminase I gene of P. thiaminolyticus from as few as 1,000 P. thiaminolyticus cells/g of sample or the Paenibacillus 16S rRNA gene from as few as 100 P. thiaminolyticus cells/g of sample. The initial results from alewife viscera samples with high thiaminase activity yielded unexpectedly low densities of P. thiaminolyticus cells; Paenibacillus thiaminolyticus was detectable in 2 of 6 alewife viscera tested at densities on the order of 100 cells/g out of 100,000,000 total bacterial cells/g. The low numbers of P. thiaminolyticus detected suggest that alewives contain additional non-P. thiaminolyticus sources of thiaminase activity.

  11. Multiplex time-reducing quantitative polymerase chain reaction assay for determination of telomere length in blood and tissue DNA.

    Science.gov (United States)

    Jiao, Jingjing; Kang, Jing X; Tan, Rui; Wang, Jingdong; Zhang, Yu

    2012-04-01

    In this paper we describe a multiplex time-reducing quantitative polymerase chain reaction (qPCR) method for determination of telomere length. This multiplex qPCR assay enables two pairs of primers to simultaneously amplify telomere and single copy gene (albumin) templates, thus reducing analysis time and labor compared with the previously established singleplex assay. The chemical composition of the master mix and primers for the telomere and albumin were systematically optimized. The thermal cycling program was designed to ensure complete separation of the melting processes of the telomere and albumin. Semi-log standard curves of DNA concentration versus cycle threshold (C (t)) were established, with a linear relationship over an 81-fold DNA concentration range. The well-performed intra-assay (RSD range 2.4-4.7%) and inter-assay (RSD range: 3.1-5.0%) reproducibility were demonstrated to ensure measurement stability. Using wild-type, Lewis lung carcinoma and H22 liver carcinoma C57BL/6 mouse models, significantly different telomere lengths among different DNA samples were not observed in wild-type mice. However, the relative telomere lengths of the tumor DNA in the two strains of tumor-bearing mice were significantly shorter than the lengths in the surrounding non-tumor DNA of tumor-bearing mice and the tissue DNA of wild-type mice. These results suggest that the shortening of telomere lengths may be regarded as an important indicator for cancer control and prevention. Quantification of telomere lengths was further confirmed by the traditional Southern blotting method. This method could be successfully used to reduce the time needed for rapid, precise measurement of telomere lengths in biological samples.

  12. Gastrointestinal tract distribution of Salmonella enteritidis in orally infected mice with a species-specific fluorescent quantitative polymerase chain reaction

    Institute of Scientific and Technical Information of China (English)

    2007-01-01

    AIM: To identify and understand the regular distribution pattern and primary penetration site for Salmonella enteritidis (S. enteritidis) in the gastrointestinal tract.METHODS: Based on the species-specific DNA sequence of S. enteritidis from GenBank, a species-specific real-time, fluorescence-based quantitative polymerase chain reaction (FQ-PCR) was developed for the detection of S.enteritidis. We used this assay to detect genomic DNA of S. enteritidis in the gastrointestinal tract, including duodenum, jejunum, ileum, cecum, colon, rectum,esophagus and stomach, from mice after oral infection.RESULTS: S. enteritidis was consistently detected in all segments of the gastrointestinal tract. The jejunum and ileum were positive at 8 h post inoculation, and the final organ to show a positive result was the stomach at 18 h post inoculation. The copy number of S. enteritidis DNA in each tissue reached a peak at 24-36 h post inoculation,with the jejunum, ileum and cecum containing high concentrations of S. enteritidis, whereas the duodenum,colon, rectum, stomach and esophagus had low concentrations. S. enteritidis began to decrease and vanished at 2 d post inoculation, but it was still present up to 5 d post inoculation in the jejunum, ileum and cecum, without causing apparent symptoms. By 5 d post inoculation, the cecum had significantly higher numbers of S. enteritidis than any of the other areas (P < 0.01),and this appeared to reflect its function as a repository for S. enteritidis.CONCLUSION: The results provided significant data for clarifying the pathogenic mechanism of S. enteritidis in the gastrointestinal tract, and showed that the jejunum,ileum and cecum are the primary sites of invasion in normal mice after oral infection. This study will help to further understanding of the mechanisms of action of S.enteritidis.

  13. In vitro evaluation of five different herbal extracts as an antimicrobial endodontic irrigant using real time quantitative polymerase chain reaction

    Directory of Open Access Journals (Sweden)

    Thilla S Vinothkumar

    2013-01-01

    Full Text Available Context: Sodium hypochlorite is the most commonly used irrigant but it has disadvantage like high cytotoxicity. So there is a need to find an alternative to 5.25% Sodium hypochlorite against microorganism Enterococcus faecalis and Candida albicans. Literature has shown that these 5 extracts namely Terminalia chebula, Myristica frangrans, Aloe barbadensis, Curcuma longa and Azadaricta indica has good properties which can be used as a potential endodontic irrigant. Aims: To evaluate the antimicrobial efficacy of various herbal extracts namely Curcuma longa (CL, Azadiracta indica (AI, Aloe barbadensis (AV, Myristica fragrans (MF and Terminalia chebula (TC as endodontic irrigant against Enterococcus faecalis and Candida albicans using real-time quantitative polymerase chain reaction (qPCR. Materials and Methods: Eighty-four teeth were extracted and suspended with Enterococcus faecalis and Candida albicans. A preliminary study was first performed to determine the minimum inhibitory concentration of extracts. The irrigating groups were divided into five herbal groups and 2 control groups. After irrigating the teeth the remaining microbial load was determined using qPCR. Statistical Analysis Used: Statistical analysis was performed using Oneway Anova/Kruskal-Wallis test with post-hoc Tukey′s HSD and was statistically significant ( P < 0.05. Results: It was shown that Neem was highly efficient to 5.25% NaOCl in reducing Enterococcus faecalis and Candida albicans within the root canals when compared with other extracts. Conclusions: Neem leaf extract has a significant antimicrobial efficacy against Enterococcus faecalis and Candida albicans compared to 5.25% sodium hypochlorite.

  14. Quantitative Real-time Polymerase Chain Reaction for Enteropathogenic Escherichia coli: A Tool for Investigation of Asymptomatic Versus Symptomatic Infections

    Science.gov (United States)

    Barletta, Francesca; Mercado, Erik; Ruiz, Joaquim; Ecker, Lucie; Lopez, Giovanni; Mispireta, Monica; Gil, Ana I.; Lanata, Claudio F.; Cleary, Thomas G.

    2011-01-01

    Background. Enteropathogenic Escherichia coli (EPEC) strains are pediatric pathogens commonly isolated from both healthy and sick children with diarrhea in areas of endemicity. The aim of this study was to compare the bacterial load of EPEC isolated from stool samples from children with and without diarrhea to determine whether bacterial load might be a useful tool for further study of this phenomenon. Methods. EPEC was detected by polymerase chain reaction (PCR) of colonies isolated on MacConkey plates from 53 diarrheal and 90 healthy children aged <2 years. DNA was isolated from stool samples by cetyltrimethylammonium bromide extraction. To standardize quantification by quantitative real-time PCR (qRT-PCR), the correlation between fluorescence threshold cycle and copy number of the intimin gene of EPEC E2348/69 was determined. Results. The detection limit of qRT-PCR was 5 bacteria/mg stool. The geometric mean load in diarrhea was 299 bacteria/mg (95% confidence interval [CI], 77–1164 bacteria/mg), compared with 29 bacteria/mg (95% CI, 10–87 bacteria/mg) in control subjects (P = .016). Bacterial load was significantly higher in children with diarrhea than in control subjects among children <12 months of age (178 vs 5 bacteria/mg; P = .006) and among children with EPEC as the sole pathogen (463 vs 24 bacteria/mg; P = .006). Conclusions. EPEC load measured by qRT-PCR is higher in diarrheal than in healthy children. qRT-PCR may be useful to study the relationship between disease and colonization in settings of endemicity. PMID:22028433

  15. Selection of reference genes for quantitative reverse-transcription polymerase chain reaction normalization in Brassica napus under various stress conditions.

    Science.gov (United States)

    Wang, Zheng; Chen, Yu; Fang, Hedi; Shi, Haifeng; Chen, Keping; Zhang, Zhiyan; Tan, Xiaoli

    2014-10-01

    Data normalization is essential for reliable output of quantitative real-time reverse-transcription polymerase chain reaction (qRT-PCR) assays, as the unsuitable choice of reference gene(s), whose expression might be influenced by exogenous treatments in plant tissues, could cause misinterpretation of results. To date, no systematic studies on reference genes have been performed in stressed Brassica napus. In this study, we investigated the expression variations of nine candidate reference genes in 40 samples of B. napus leaves subjected to various exogenous treatments. Parallel analyses by geNorm and NormFinder revealed that optimal reference genes differed across the different sets of samples. The best-ranked reference genes were PP2A and TIP41 for salt stress, TIP41 and ACT7 for heavy metal (Cr(6+)) stress, PP2A and UBC21 for drought stress, F-box and SAND for cold stress, F-box and ZNF for salicylic acid stress, TIP41, ACT7, and PP2A for methyl jasmonate stress, TIP41 and ACT7 for abscisic acid stress, and TIP41, UBC21, and PP2A for Sclerotinia sclerotiorum stress. Two newly employed reference genes, TIP41 and PP2A, showed better performances, suggesting their suitability in multiple conditions. To further validate the suitability of the reference genes, the expression patterns of BnWRKY40 and BnMKS1 were studied in parallel. This study is the first systematic analysis of reference gene selection for qRT-PCR normalization in B. napus, an agriculturally important crop, under different stress conditions. The results will contribute toward more accurate and widespread use of qRT-PCR in gene analysis of the genus Brassica.

  16. Novel X-linked genes revealed by quantitative polymerase chain reaction in the green anole, Anolis carolinensis.

    Science.gov (United States)

    Rovatsos, Michail; Altmanová, Marie; Pokorná, Martina Johnson; Kratochvíl, Lukáš

    2014-08-28

    The green anole, Anolis carolinensis (ACA), is the model reptile for a vast array of biological disciplines. It was the first nonavian reptile to have its genome fully sequenced. During the genome project, the XX/XY system of sex chromosomes homologous to chicken chromosome 15 (GGA15) was revealed, and 106 X-linked genes were identified. We selected 38 genes located on eight scaffolds in ACA and having orthologs located on GGA15, then tested their linkage to ACA X chromosome by using comparative quantitative fluorescent real-time polymerase chain reaction applied to male and female genomic DNA. All tested genes appeared to be X-specific and not present on the Y chromosome. Assuming that all genes located on these scaffolds should be localized to the ACA X chromosome, we more than doubled the number of known X-linked genes in ACA, from 106 to 250. While demonstrating that the gene content of chromosome X in ACA and GGA15 is largely conserved, we nevertheless showed that numerous interchromosomal rearrangements had occurred since the splitting of the chicken and anole evolutionary lineages. The presence of many ACA X-specific genes localized to distinct contigs indicates that the ACA Y chromosome should be highly degenerated, having lost a large amount of its original gene content during evolution. The identification of novel genes linked to the X chromosome and absent on the Y chromosome in the model lizard species contributes to ongoing research as to the evolution of sex determination in reptiles and provides important information for future comparative and functional genomics.

  17. Feline coronavirus quantitative reverse transcriptase polymerase chain reaction on effusion samples in cats with and without feline infectious peritonitis.

    Science.gov (United States)

    Longstaff, Louise; Porter, Emily; Crossley, Victoria J; Hayhow, Sophie E; Helps, Christopher R; Tasker, Séverine

    2017-02-01

    Objectives The aim of the study was to determine whether feline coronavirus (FCoV) RNA in effusion samples can be used as a diagnostic marker of feline infectious peritonitis (FIP); and in FCoV RNA-positive samples to examine amino acid codons in the FCoV spike protein at positions 1058 and 1060 where leucine and alanine, respectively, have been associated with systemic or virulent (FIP) FCoV infection. Methods Total RNA was extracted from effusion samples from 20 cats with confirmed FIP and 23 cats with other diseases. Feline coronavirus RNA was detected using a reverse transcriptase quantitative polymerase chain reaction assay (qRT-PCR), and positive samples underwent pyrosequencing of position 1058 with or without Sanger sequencing of position 1060 in the FCoV spike protein. Results Seventeen (85%) of the effusion samples from 20 cats with FIP were positive for FCoV RNA, whereas none of the 23 cats with other diseases were positive. Pyrosequencing of the 17 FCoV-positive samples showed that 11 (65%) of the cats had leucine and two (12%) had methionine at position 1058. Of the latter two samples with methionine, one had alanine at position 1060. Conclusions and relevance A positive FCoV qRT-PCR result on effusions appears specific for FIP and may be a useful diagnostic marker for FIP in cats with effusions. The majority of FCoVs contained amino acid changes previously associated with systemic spread or virulence (FIP) of the virus.

  18. Detection of Salmonella spp. by Conventional Bacteriology and by Quantitative Polymerase-Chain Reaction in Commercial Egg Structures

    Directory of Open Access Journals (Sweden)

    DMC Moraes

    2016-03-01

    Full Text Available Abstract Conventional bacteriology techniques and quantitative polymerase-chain reaction (qPCR were applied to the eggshell, albumen, and yolk of washed and unwashed commercial white and brown eggs, to detect Salmonella spp. Pooled samples of eggshells, albumen, and yolk of white and brown eggs were collected at the poultry house and at the egg-storage room. Salmonella spp. was detected by conventional bacteriology in 5.4% (21/387 of analyzed samples and in 16% (68/387 by qPCR. In the 114 unwashed white eggs samples of eggshell, albumen and yolk, the bacterium was identified in 2.6% of the eggs (3/114 by conventional bacteriology and in 13.2% (15/114 by qPCR. In the 90 samples of washed eggs, 6.7% (6/90 were contaminated as detected by conventional bacteriology and 10.0% (9/90 by qPCR. In the 81 samples of unwashed brown eggs, Salmonella spp. was detected in 6.1% of the eggs (5/81 by conventional bacteriology and 27.2% (22/81 by qPCR. In the 102 samples of brown washed eggs, 6.9% (7/102 where positive by conventional bacteriology and 35.3% (16/102 by qPCR. All samples detected as positive by conventional bacteriology were also positive by qPCR. Salmonella Agona represented 18.2% (4/22 of identified serovars, Salmonella enterica subs. enterica O: 4.5 18.2% (4/22, Salmonella Schwarzengrund 18.2% (4/22, Salmonella Cerro 13.6% (3/22, Salmonella Anatum 13.6% (3/22, Salmonella Enteritidis 9.1% (2/22, Salmonella Johannesburg 4.5% (1/22, and Salmonella Corvallis 4.5% (1/22. The qPCR method provided better detection of Salmonella spp. in commercial eggs than conventional bacteriology. The conventional egg washing and disinfection procedures are not efficient to eliminate Salmonella.

  19. [The validation of kit of reagents for quantitative detection of DNA of human cytomegalovirus in biological material using polymerase chain reaction technique in real time operation mode].

    Science.gov (United States)

    Sil'veĭstrova, O Iu; Domonova, É A; Shipulina, O Iu

    2014-04-01

    The validation of kit of reagents destined to detection and quantitative evaluation of DNA of human cytomegalovirus in biological material using polymerase chain reaction technique in real time operation mode was implemented. The comparison was made against international WHO standard--The first WHO international standard for human cytomegalovirus to implement measures the kit of reagents "AmpliSens CMV-screen/monitor-FL" and standard sample of enterprise DNA HCMV (The central research institute of epidemiology of Rospotrebnadzor) was applied. The fivefold dilution of international WHO standard and standard sample of enterprise were carried out in concentrations of DNA HCMV from 106 to 102. The arrangement of polymerase chain reaction and analysis of results were implemented using programed amplifier with system of detection of fluorescent signal in real-time mode "Rotor-Gene Q" ("Qiagen", Germany). In the total of three series of experiments, all stages of polymerase chain reaction study included, the coefficient of translation of quantitative evaluation of DNA HCMV from copy/ml to ME/ml equal to 0.6 was introduced for this kit of reagents.

  20. Development of plasmids for quantitative detection of integrated lentiviral vectors and evaluation of culture time to perform vector titer by real-time quantitative polymerase chain reaction assay

    Directory of Open Access Journals (Sweden)

    Elena Baiamonte

    2014-09-01

    Full Text Available The accurate assessment of provirus copy number per cell (VCN/cell is a fundamental issue in transgenesis as well as in gene therapy studies based on stably integrated vectors. To this end, real-time quantitative polymerase chain reaction (qPCR is a powerful method but it is sensible to differences in quality or concentration of the two-plasmid preparations used for the construction of the standard curves. In order to minimize technical errors we included genome specific sequences (mouse or human and vector specific sequences in the same plasmid. We evaluated the specificity and sensitivity of these bivalent plasmids by qPCR analysis on mouse and human genomic DNA containing a known number of a reporter lentiviral vector and we found that the system is reliable to measure up to 0.1 VCN/cell. Here we have applied this assay to measure vector titer of virus stock preparations and to determine the optimal cell passages at which viral titration effectively reflects the number of integrated vectors.

  1. Evaluation of reference genes for quantitative polymerase chain reaction across life cycle stages and tissue types of Tribolium castaneum.

    Science.gov (United States)

    Toutges, Michelle J; Hartzer, Kris; Lord, Jeffrey; Oppert, Brenda

    2010-08-25

    The genome of the genetic model for coleopteran insects, Tribolium castaneum, is now available for downstream applications. To facilitate gene expression studies in T. castaneum, genes were evaluated for suitability as normalizers in comparisons across tissues and/or developmental stages. In less diverse samples, such as comparisons within developmental stages or tissue only, normalizers for mRNA were more stable and consistent. Overall, the genes for ribosomal proteins rps6, rpl13a, rps3, and rps18 were the most stable normalizers for broad scale gene expression analysis in T. castaneum. However, their stability ranking was dependent upon the instrument as well as the analysis program. These data emphasize the need to optimize normalizers used in all real-time polymerase chain reaction experiments specifically for the experimental conditions and thermocycler and to carefully evaluate data generated by computational algorithms.

  2. Quantitative assessment of Wilms tumor 1 expression by real-time quantitative polymerase chain reaction in patients with acute myeloblastic leukemia

    Directory of Open Access Journals (Sweden)

    Hossein Ayatollahi

    2017-01-01

    Full Text Available Background: The Wilms tumor 1 (WT1 gene is originally defined as a tumor suppressor gene and a transcription factor that overexpressed in leukemic cells. It is highly expressed in more than 80% of acute myeloid leukemia (AML patients, both in bone marrow (BM and in peripheral blood (PB, and it is used as a powerful and independent marker of minimal residual disease (MRD; we have determined the expression levels of the WT1 by real-time quantitative polymerase chain reaction (RQ-PCR in PB and BM in 126 newly diagnosed AML patients. Materials and Methods: This study was done in molecular pathology and cancer research center from April 2014 to June 2015, RQ-PCR method was used to determine the WT1 gene expression in BM and/or PB samples from 126 patients of AML, we cloned both WT1 and ABL genes for creating a standard curve, and we calculate copy number of WT1 genes in patients. Results: A total of 126 AML patients consist of 70 males (55.6% and 56 females (44.4%, with a median age of 26 years; 104 (81% patients out of 126 show overexpression of WT1 gene. We also concomitant monitoring of fusion transcripts (PML RARa, AML1-ETO, MLL-MLL, CBFb-MYH11, or DEK-CAN in our patients, the AML1-ETO group showing remarkably low levels of WT1 compared with other fusion transcript and the CBFB-MYH11 showing high levels of WT1. Conclusion: We conclude that WT1 expression by RQ-PCR in AML patients may be employed as an independent tool to detect MRD in the majority of normal karyotype AML patients.

  3. Establishment and Application of a TaqMan Real-Time Quantitative Reverse Transcription-Polymerase Chain Reaction Assay for Rubella Virus RNA

    Institute of Scientific and Technical Information of China (English)

    Li-Hong ZHAO; Yu-Yan MA; Hong WANG; Shu-Ping ZHAO; Wei-Ming ZHAO; Hua LI; Lei-Yi WANG

    2006-01-01

    The aim of this study was to establish and apply a real-time quantitative reverse transcription polymerase chain reaction (RT-PCR) for rubella virus (RV) RNA. First, the primer and TaqMan probe concentrations, as well as reaction temperatures were optimized to establish an efficient real-time quantitative RT-PCR assay for RV RNA. Next, an RV-specific PCR amplicon was made as an external standard to estimate the linearity, amplification efficiency, analytical sensitivity and reproducibility of the real time quantitative assay. Finally, the assay was applied to quantify RVRNA in clinical samples for rubella diagnosis.The RV-specific PCR amplicon was prepared for evaluation of the assay at 503 bp, and its original concentration was 2.75×109 copies/μl. The real time quantitative assay was shown to have good linearity (R2=0.9920), high amplification efficiency (E=1.91), high sensitivity (275 copies/ml), and high reproducibility (variation coefficient range, from 1.25% to 3.58%). Compared with the gold standard, the specificity and sensitivity of the assay in clinical samples was 96.4% and 86.4%, respectively. Therefore, the established quantitative RT-PCR method is a simple, rapid, less-labored, quantitative, highly specific and sensitive assay for RV RNA.

  4. Quantitative Detection of Interleukin 8 Gene Expression in Lung Cancer by Real-time Polymerase Chain Reaction

    Institute of Scientific and Technical Information of China (English)

    JianzhongSu; QianggangDong; JinsuHuang; GuoliangBao

    2004-01-01

    OBJECTIVE To develop a method for absolute quantification of interleukin 8 (IL-8) mRNA by using real-time polymerase chain reaction (PCR). METHODS The IL-8 mRNA and protein expression in 2 human lung cancer cell lines, H460 and A549, were evaluated by real-time PCR and ELISA. The IL-8 mRNA expression in 9 cases of normal lung tissue and 44 cases of non-small cell lung cancer (NSCLC) were examined. RESULTS The IL-8 mRNA copy number in a given sample can be measured by real-time PCR. The gene expression of IL-8 is correlated with its protein secretion. The normalized value of IL-8 expression was 4.87+1.69 (copies/104 GAPDH copies) in normal lung tissue and 17.04±23.96 in NSCLC, respectively. The difference between these two groups is statistically significant (P=0.002). Using 9.74 and 19.48 as cut-off points for positive expression and overexpression of IL-8, 52.3%(23/44cases) of NSCLC were found to express an increased level of IL-8, among which 29.5% (13/44cases) were defined as positive expression and 22.7% (10/44cases) as overexpression. Statistical analysis indicated that IL-8 overexpression was significantly increased in female cancers, squamous carcinoma, and in late stages of disease (P<0.05). CONCLUSION The IL-8 gene expression can be determined by a real-time PCR technique. IL-8 overexpression is correlated with gender, histopathology and stages of the disease.

  5. Detection of somatic quantitative genetic alterations by multiplex polymerase chain reaction for the prediction of outcome in diffuse large B-cell lymphomas.

    Science.gov (United States)

    Jardin, Fabrice; Ruminy, Philippe; Kerckaert, Jean-Pierre; Parmentier, Françoise; Picquenot, Jean-Michel; Quief, Sabine; Villenet, Céline; Buchonnet, Gérard; Tosi, Mario; Frebourg, Thierry; Bastard, Christian; Tilly, Hervé

    2008-04-01

    Genomic gains and losses play a crucial role in the development of diffuse large B-cell lymphomas. High resolution array comparative genomic hybridization provides a comprehensive view of these genomic imbalances but is not routinely applicable. We developed a polymerase chain reaction assay to provide information regarding gains or losses of relevant genes and prognosis in diffuse large B-cell lymphomas. Two polymerase chain reaction assays (multiplex polymerase chain reaction of short fluorescent fragments, QMPSF) were designed to detect gains or losses of c-REL, BCL6, SIM1, PTPRK, MYC, CDKN2A, MDM2, CDKN1B, TP53 and BCL2. Array comparative genomic hybridization was simultaneously performed to evaluate the sensitivity and predictive value of the QMPSF assay. The biological and clinical relevance of this assay were assessed. The predictive value of the QMPSF assay for detecting abnormal DNA copy numbers ranged between 88-97%, giving an overall concordance rate of 92% with comparative genomic hybridization results. In 77 cases of diffuse large B-cell lymphomas, gains of MYC, CDKN1B, c-REL and BCL2 were detected in 12%, 40%, 27% and 29%, respectively. TP53 and CDKN2A deletions were observed in 22% and 36% respectively. BCL2 and CDKN2A allelic status correlated with protein expression. TP53 mutations were associated with allelic deletions in 45% of cases. The prognostic value of a single QMPSF assay including TP53, MYC, CDKN2A, SIM1 and CDKN1B was predictive of the outcome independently of the germinal center B-cell like/non-germinal center B-cell like subtype or the International Prognostic Index. QMPSF is a reliable and flexible method for detecting somatic quantitative genetic alterations in diffuse large B-cell lymphomas and could be integrated in future prognostic predictive models.

  6. QUANTITATION OF DNA TOPOISOMERASE-II-ALPHA MESSENGER-RIBONUCLEIC-ACID LEVELS IN A SMALL-CELL LUNG-CANCER CELL-LINE AND 2 DRUG-RESISTANT SUBLINES USING A POLYMERASE CHAIN REACTION-AIDED TRANSCRIPT TITRATION ASSAY

    NARCIS (Netherlands)

    WITHOFF, S; SMIT, EF; MEERSMA, GJ; van den Berg, Anke; TIMMERBOSSCHA, H; KOK, K; POSTMUS, PE; MULDER, NH; DEVRIES, EGE; BUYS, CHCM

    1994-01-01

    BACKGROUND: We have modified a polymerase chain reaction (PCR)-aided transcript titration assay (1) in order to allow quantitation of low amounts of DNA topoisomerase II alpha mRNA in small RNA samples. EXPERIMENTAL DESIGN: The titration assay was used to quantitate the amount of DNA topoisomerase I

  7. How to develop an in-house real-time quantitative cytomegalovirus polymerase chain reaction: Insights from a cancer centre in Eastern India

    Directory of Open Access Journals (Sweden)

    Anusha Harishankar

    2015-01-01

    Full Text Available Development of a reliable, cost-effective cytomegalovirus quantitative polymerase chain reaction (QPCR is a priority for developing countries. Manufactured kits are expensive, and availability can be inconsistent. Development of an in-house QPCR kit that is reliable and quality assured requires significant effort and initial investment. However, the rewards of such an enterprise are manifold and include an in-depth understanding of molecular reactions, and expertise in the development of further low-cost molecular kits. The experience of an oncology centre in Eastern India has been shared. Hopefully, this would provide a brief roadmap for such an initiative. Staff with adequate understanding of molecular processes are essential along with vital infrastructure for molecular research and development.

  8. International ring trial for the validation of an event-specific Golden Rice 2 quantitative real-time polymerase chain reaction method.

    Science.gov (United States)

    Jacchia, Sara; Nardini, Elena; Bassani, Niccolò; Savini, Christian; Shim, Jung-Hyun; Trijatmiko, Kurniawan; Kreysa, Joachim; Mazzara, Marco

    2015-05-27

    This article describes the international validation of the quantitative real-time polymerase chain reaction (PCR) detection method for Golden Rice 2. The method consists of a taxon-specific assay amplifying a fragment of rice Phospholipase D α2 gene, and an event-specific assay designed on the 3' junction between transgenic insert and plant DNA. We validated the two assays independently, with absolute quantification, and in combination, with relative quantification, on DNA samples prepared in haploid genome equivalents. We assessed trueness, precision, efficiency, and linearity of the two assays, and the results demonstrate that both the assays independently assessed and the entire method fulfill European and international requirements for methods for genetically modified organism (GMO) testing, within the dynamic range tested. The homogeneity of the results of the collaborative trial between Europe and Asia is a good indicator of the robustness of the method.

  9. Apparent Polyploidization after Gamma Irradiation: Pitfalls in the Use of Quantitative Polymerase Chain Reaction (qPCR) for the Estimation of Mitochondrial and Nuclear DNA Gene Copy Numbers

    Science.gov (United States)

    Kam, Winnie W. Y.; Lake, Vanessa; Banos, Connie; Davies, Justin; Banati, Richard

    2013-01-01

    Quantitative polymerase chain reaction (qPCR) has been widely used to quantify changes in gene copy numbers after radiation exposure. Here, we show that gamma irradiation ranging from 10 to 100 Gy of cells and cell-free DNA samples significantly affects the measured qPCR yield, due to radiation-induced fragmentation of the DNA template and, therefore, introduces errors into the estimation of gene copy numbers. The radiation-induced DNA fragmentation and, thus, measured qPCR yield varies with temperature not only in living cells, but also in isolated DNA irradiated under cell-free conditions. In summary, the variability in measured qPCR yield from irradiated samples introduces a significant error into the estimation of both mitochondrial and nuclear gene copy numbers and may give spurious evidence for polyploidization. PMID:23722662

  10. Four-hour quantitative real-time polymerase chain reaction-based comprehensive chromosome screening and accumulating evidence of accuracy, safety, predictive value, and clinical efficacy.

    Science.gov (United States)

    Treff, Nathan R; Scott, Richard T

    2013-03-15

    Embryonic comprehensive chromosomal euploidy may represent a powerful biomarker to improve the success of IVF. However, there are a number of aneuploidy screening strategies to consider, including different technologic platforms with which to interrogate the embryonic DNA, and different embryonic developmental stages from which DNA can be analyzed. Although there are advantages and disadvantages associated with each strategy, a series of experiments producing evidence of accuracy, safety, clinical predictive value, and clinical efficacy indicate that trophectoderm biopsy and quantitative real-time polymerase chain reaction (qPCR)-based comprehensive chromosome screening (CCS) may represent a useful strategy to improve the success of IVF. This Biomarkers in Reproductive Medicine special issue review summarizes the accumulated experience with the development and clinical application of a 4-hour blastocyst qPCR-based CCS technology. Copyright © 2013 American Society for Reproductive Medicine. Published by Elsevier Inc. All rights reserved.

  11. Relationship Between Ebola Virus Real-Time Quantitative Polymerase Chain Reaction-Based Threshold Cycle Value and Virus Isolation From Human Plasma.

    Science.gov (United States)

    Spengler, Jessica R; McElroy, Anita K; Harmon, Jessica R; Ströher, Ute; Nichol, Stuart T; Spiropoulou, Christina F

    2015-10-01

    We performed a longitudinal analysis of plasma samples obtained from 4 patients with Ebola virus (EBOV) disease (EVD) to determine the relationship between the real-time quantitative reverse transcriptase polymerase chain reaction (qRT-PCR)-based threshold cycle (Ct) value and the presence of infectious EBOV. EBOV was not isolated from plasma samples with a Ct value of >35.5 or >12 days after onset of symptoms. EBOV was not isolated from plasma samples in which anti-EBOV nucleoprotein immunoglobulin G was detected. These data demonstrate the utility of interpreting qRT-PCR results in the context of the course of EBOV infection and associated serological responses for patient-management decisions. Published by Oxford University Press on behalf of the Infectious Diseases Society of America 2015. This work is written by (a) US Government employee(s) and is in the public domain in the US.

  12. Development of an event-specific hydrolysis probe quantitative real-time polymerase chain reaction assay for Embrapa 5.1 genetically modified common bean (Phaseolus vulgaris).

    Science.gov (United States)

    Treml, Diana; Venturelli, Gustavo L; Brod, Fábio C A; Faria, Josias C; Arisi, Ana C M

    2014-12-10

    A genetically modified (GM) common bean event, namely Embrapa 5.1, resistant to the bean golden mosaic virus (BGMV), was approved for commercialization in Brazil. Brazilian regulation for genetically modified organism (GMO) labeling requires that any food containing more than 1% GMO be labeled. The event-specific polymerase chain reaction (PCR) method has been the primary trend for GMO identification and quantitation because of its high specificity based on the flanking sequence. This work reports the development of an event-specific assay, named FGM, for Embrapa 5.1 detection and quantitation by use of SYBR Green or hydrolysis probe. The FGM assay specificity was tested for Embrapa 2.3 event (a noncommercial GM common bean also resistant to BGMV), 46 non-GM common bean varieties, and other crop species including maize, GM maize, soybean, and GM soybean. The FGM assay showed high specificity to detect the Embrapa 5.1 event. Standard curves for the FGM assay presented a mean efficiency of 95% and a limit of detection (LOD) of 100 genome copies in the presence of background DNA. The primers and probe developed are suitable for the detection and quantitation of Embrapa 5.1.

  13. Development and Application of Real-Time Quantitative Polymerase Chain Reaction Technique Using SYBR Green I in the Diagnosis of Down Syndrome

    Directory of Open Access Journals (Sweden)

    Shirin Shahbazi

    2010-01-01

    Full Text Available Objective: Rapid diagnosis of Trisomy 21 Syndrome (Down Syndrome patients usingReal-Time quantitative Polymerase Chain Reaction (Real-Time qPCR in order to establisha novel method for prenatal diagnosis in the future.Materials and Methods: A total of 5 ml of peripheral blood was obtained from eachpatient and normal controls (NR. Then, genomic DNA from lymphocytes was extractedusing the salting out procedure. Gene dosage levels of DSCAM and (PMP22, DSCAM inDown Syndrome and NR were analyzed using real-time quantitative PCR. The DSCAM/PMP22 ratio was calculated according to the 2-ΔΔCt formula for all samples.Results: Real-time PCR showed a DSCAM/PMP22 ratio of 1.48 ± 0.18 and 1.01 ± 0.10(p<0.001 in Down Syndrome and normal samples, respectively, demonstrating threecopies of the target (DSCAM gene in Trisomy 21 Syndrome.Conclusion: DSCAM/PMP22 ratio is increased significantly in Down Syndrome patientsthan NR (1.5 times. Therefore, the real-time quantitative PCR technique can be used asa sensitive, accurate and reliable technique for rapid and prenatal diagnosis of Trisomy21 Syndrome.

  14. Quantitative polymerase chain reaction analysis with allele-specific oligonucleotide primers for individual IgH VDJ regions to evaluate tumor burden in myeloma patients.

    Science.gov (United States)

    Sata, Hiroshi; Shibayama, Hirohiko; Maeda, Ikuhiro; Habuchi, Yoko; Nakatani, Eiji; Fukushima, Kentaro; Fujita, Jiro; Ezoe, Sachiko; Tadokoro, Seiji; Maeda, Tetsuo; Mizuki, Masao; Kosugi, Satoru; Nakagawa, Masashi; Ueda, Shuji; Iida, Masato; Tokumine, Yukihiro; Azenishi, Yasuhiko; Mitsui, Hideki; Oritani, Kenji; Kanakura, Yuzuru

    2015-05-01

    Quantitative polymerase chain reaction (PCR) with patient-specific, allele-specific oligonucleotide (ASO) primers for individual immunoglobulin H VDJ region (ASO-PCR) amplification was performed using several sources of clinical material, including mRNA from peripheral blood cells (PBMNCs), whole bone marrow cells (BMMNCs), and the CD20+ CD38- B-cell population in bone marrow, as well as cell-free DNA from the sera of patients with multiple myeloma (MM). We designed the ASO primers and produced sufficient PCR fragments to evaluate tumor burden in 20 of 30 bone marrow samples at diagnosis. Polymerase chain reaction amplification efficiency depended on primer sequences because the production of ASO-PCR fragments did not correlate with serum M-protein levels. However, the ASO-PCR levels in BMMNCs showed statistically significant correlations with those in PBMNCs and CD20+ CD38- B-cells. The good association between the BMMNC and PBMNC data indicated that PBMNCs could be a suitable source for monitoring minimal residual disease (MRD). In the case of cell-free DNA, ASO-PCR levels showed a unique pattern and remained high even after treatment. Because the sequence information for each ASO-PCR product was identical to the original, the cell-free DNA might also be useful for evaluating MRD. Moreover, the ASO-PCR products were clearly detected in 17 of 22 mRNA samples from CD20+ CD38- populations, suggesting that MM clones might exist in relatively earlier stages of B cells than in plasma cells. Thus, ASO-PCR analysis using various clinical materials is useful for detecting MRD in MM patients as well as for clarifying MM pathogenesis. Copyright © 2015 ISEH - International Society for Experimental Hematology. Published by Elsevier Inc. All rights reserved.

  15. Quantitation of 35S promoter in maize DNA extracts from genetically modified organisms using real-time polymerase chain reaction, part 2: interlaboratory study.

    Science.gov (United States)

    Feinberg, Max; Fernandez, Sophie; Cassard, Sylvanie; Bertheau, Yves

    2005-01-01

    The European Committee for Standardization (CEN) and the European Network of GMO Working Laboratories have proposed development of a modular strategy for stepwise validation of complex analytical techniques. When applied to the quantitation of genetically modified organisms (GMOs) in food products, the instrumental quantitation step of the technique is separately validated from the DNA extraction step to better control the sources of uncertainty and facilitate the validation of GMO-specific polymerase chain reaction (PCR) tests. This paper presents the results of an interlaboratory study on the quantitation step of the method standardized by CEN for the detection of a regulatory element commonly inserted in GMO maize-based foods. This is focused on the quantitation of P35S promoter through using the quantitative real-time PCR (QRT-PCR). Fifteen French laboratories participated in the interlaboratory study of the P35S quantitation operating procedure on DNA extract samples using either the thermal cycler ABI Prism 7700 (Applied Biosystems, Foster City, CA) or Light Cycler (Roche Diagnostics, Indianapolis, IN). Attention was focused on DNA extract samples used to calibrate the method and unknown extract samples. Data were processed according to the recommendations of ISO 5725 standard. Performance criteria, obtained using the robust algorithm, were compared to the classic data processing after rejection of outliers by the Cochran and Grubbs tests. Two laboratories were detected as outliers by the Grubbs test. The robust precision criteria gave values between the classical values estimated before and after rejection of the outliers. Using the robust method, the relative expanded uncertainty by the quantitation method is about 20% for a 1% Bt176 content, whereas it can reach 40% for a 0.1% Bt176. The performances of the quantitation assay are relevant to the application of the European regulation, which has an accepted tolerance interval of about +/-50%. These data

  16. Comparison of SYBR Green and TaqMan methods in quantitative real-time polymerase chain reaction analysis of four adenosine receptor subtypes

    Directory of Open Access Journals (Sweden)

    Mohamadhasan Tajadini

    2014-01-01

    Full Text Available Background: Real-time polymerase chain reaction (PCR is based on the revolutionary method of PCR. This technique is the result of PCR enormous sensitivity and real-time monitoring combination. In quantitative gene expression analysis, two methods have more popularity, SYBR Green and TaqMan, SYBR Green is relatively cost benefit and easy to use and technically based on binding the fluorescent dye to double-stranded deoxyribonucleic acid (dsDNA where TaqMan method has more expensive and based on dual labeled oligonucleotide and exonuclease activity of Taq polymerase enzyme. Specificity is the most important concern with the usage of any non-specific dsDNA-binding Dyes such as SYBR Green whiles more specificity showed by labeled oligonucleotide method such as TaqMan. In this study, we compared two common RT PCR methods, TaqMan and SYBR Green in measurement gene expression profile of adenosine receptors. Materials and Methods: Gene expression profiles of A1, A2A, A2B and A3 Adenosine receptors were analyzed by optimized TaqMan and SYBR Green quantitative RT PCR in breast cancer tissues. Primary expression data was normalizing by B. actin reference gene. Results: Efficiencies were calculated more than 95% for TaqMan and SYBR Green methods in all genes. The correlations between means of normalized data of each gene in two methods were positive and significant (P < 0.05. Conclusion: Data analysis showed that with the use of high performance primer and by use proper protocols and material we can make precise data by SYBR Green as TaqMan method. In other word by optimization of SYBR Green method, its performance and quality could be comparable to TaqMan method.

  17. Myosin proteins identified from masseter muscle using quantitative reverse transcriptase-polymerase chain reaction--a pilot study of the relevance to orthodontics.

    Science.gov (United States)

    Suchak, Archna; Hunt, Nigel P; Shah, Rishma; Sinanan, Andrea C M; Lloyd, Tim; Lewis, Mark P

    2009-04-01

    There is a clearly established relationship between masticatory muscle structure and facial form. Human studies in this area, however, have been limited, especially in consideration of the myosin heavy chain (MyHC) family of contractile proteins. The aim of this pilot study was to assess if differences were detectable between genotype with respect to MyHC isoforms and the vertical facial phenotype in a sample of nine Caucasian female patients, age range 18-49 years, using a novel rapid technique. Masseter muscle biopsies were taken from patients with a range of vertical facial form. The levels of expression of the MyHC isoform genes MYH 1, 2, 3, 6, 7, and 8 were compared with the expression in a female calibrator patient aged 23 years with normal vertical facial form, using quantitative reverse transcriptase-polymerase chain reaction (RT-PCR) analysis. Statistical analysis was undertaken using Pearson correlation coefficient. The results showed that there were distinct differences in gene expression between patients with a wide range of variation although changes in MYH1 were consistent with one cephalometric variable, the maxillo-mandibular angle. The full procedure, from start to finish, can be completed within half a day. Rapid genotyping of patients in this way could reveal important information of relevance to treatment. This technology has potential as a diagnostic and prognostic aid when considering correction of certain malocclusions.

  18. COMPARISON OF ENTEROCOCCUS MEASUREMENTS IN FRESHWATER AT TWO RECREATIONAL BEACHES BY QUANTITATIVE POLYMERASE CHAIN REACTION AND MEMBRANE FILER CULTURE ANALYSIS

    Science.gov (United States)

    Cell densities of the fecal pollution indicator genus, Enterococcus, were determined by a rapid (2-3 hr) quantitative PCR (QPCR) analysis based method in 100 ml water samples collected from recreational beaches on Lake Michigan and Lake Erie during the summer of 2003. Enumeration...

  19. A duplex real-time reverse transcription polymerase chain reaction for the detection and quantitation of avian leukosis virus subgroups A and B.

    Science.gov (United States)

    Zhou, Gang; Cai, Wenbo; Liu, Xiaolei; Niu, Chengming; Gao, Caixia; Si, Changde; Zhang, Wei; Qu, Liandong; Han, Lingxia

    2011-05-01

    Avian leukosis is a disease that is spreading widely in the world causing large economic losses to the poultry industry. In this study, a duplex quantitative real-time reverse transcription polymerase chain reaction (qRT-PCR) assay was developed to detect and quantify avian leukosis virus subgroups A and B (ALVA/B). The assay was optimised to measure viral gp85 and chicken housekeeping (β-actin) genes. The result showed that the assay was specific for reference strains of ALVA/B subtype and no cross-reaction was detected with ALV subtypes E and J or with four other non-ALV viruses. The assay detected as few as 56 gp85 cDNA copies and was 100-fold more sensitive than a conventional RT-PCR. Seventy clinical blood samples were evaluated by both the qRT-PCR and the conventional RT-PCR assay, and the results show that 65 samples were positive by the qRT-PCR compared with 43 by the conventional RT-PCR. When this assay was used to quantify the viral load in ALV-inoculated embryos from three congenic chicken lines, the embryos from the B21 line showed the highest viral load, whereas the lowest load was found in the B5 line. This assay provides a powerful tool for quantitative detection of the ALVA/B and for the study of host genetic resistance to avian leukosis.

  20. Detection of Legionella by cultivation and quantitative real-time polymerase chain reaction in biological waste water treatment plants in Norway.

    Science.gov (United States)

    Lund, Vidar; Fonahn, Wenche; Pettersen, Jens Erik; Caugant, Dominique A; Ask, Eirik; Nysaeter, Ase

    2014-09-01

    Cases of Legionnaires' disease associated with biological treatment plants (BTPs) have been reported in six countries between 1997 and 2010. However, knowledge about the occurrence of Legionella in BTPs is scarce. Hence, we undertook a qualitative and quantitative screening for Legionella in BTPs treating waste water from municipalities and industries in Norway, to assess the transmission potential of Legionella from these installations. Thirty-three plants from different industries were sampled four times within 1 year. By cultivation, 21 (16%) of 130 analyses were positive for Legionella species and 12 (9%) of 130 analyses were positive for Legionella pneumophila. By quantitative real-time polymerase chain reaction (PCR), 433 (99%) of 437 analyses were positive for Legionella species and 218 (46%) of 470 analyses were positive for L. pneumophila. This survey indicates that PCR could be the preferable method for detection of Legionella in samples from BTPs. Sequence types of L. pneumophila associated with outbreaks in Norway were not identified from the BTPs. We showed that a waste water treatment plant with an aeration basin can produce high concentrations of Legionella. Therefore, these plants should be considered as a possible source of community-acquired Legionella infections.

  1. Quantitative duplex TaqMan real-time polymerase chain reaction for the assessment of the etiologic agent of epizootic bovine abortion.

    Science.gov (United States)

    Brooks, Roxann S; Blanchard, Myra T; Anderson, Mark L; Hall, Mark R; Stott, Jeffery L

    2011-11-01

    Epizootic bovine abortion (EBA), also commonly known as "foothill abortion," is a late-term abortion primarily in beef cattle with significant economic impacts in California, Nevada, and Oregon. The causative agent is a novel deltaproteobacterium (aoEBA) closely related to the order Myxococcales and vectored by the soft-shelled tick Ornithodoros coriaceus. Historically, diagnosis has relied upon the pathologic examination of the fetus and the presence of elevated fetal serum immunoglobulins. Identification of the etiologic agent, a unique deltaproteobacterium, permitted the development of a quantitative duplex real-time polymerase chain reaction (qPCR) using a unique 90-bp sequence of aoEBA 16S ribosomal RNA gene in conjunction with an 88-bp sequence of the bovine β-actin gene. Reaction efficiencies were 100.9% for the 16S aoEBA gene and 93.1% for the bovine β-actin gene. Application of the duplex TaqMan to a set of aoEBA-infected fetal bovine necropsy tissues demonstrated the assay to be robust in quantitatively identifying the aoEBA bacteria and establishing host-tissue pathogen load. Consistent with previously reported immunohistochemical data, organized lymphoid tissue generally carried the heaviest bacterial load as compared to non-lymphoid tissue. The newly developed duplex TaqMan assay will facilitate diagnosis in difficult cases and provide an invaluable tool for delineating the pathogenesis of EBA.

  2. Real-time polymerase chain reaction approach for quantitation of ruminant-specific DNA to indicate a correlation between DNA amount and meat and bone meal heat treatments.

    Science.gov (United States)

    Chiappini, Barbara; Brambilla, Gianfranco; Agrimi, Umberto; Vaccari, Gabriele; Aarts, Henk J M; Berben, Gilbert; Frezza, Domenico; Giambra, Vincenzo

    2005-01-01

    The use of ruminant-derived proteins in ruminant feeds has been banned in both the European Union and the United States to prevent further spread of bovine spongiform encephalopathy. Enforcement of these regulations relies on the ability to identify the presence of prohibited proteins in feed. We developed a quantitative real-time polymerase chain reaction assay for the quantification of ruminant-specific DNA as index of protein content. The assay is based on the amplification of a 117 base pair mitochondrial 16S rRNA DNA gene fragment and an internal positive control (IPC). The use of an IPC permits compensation for differences in DNA extraction efficiency and avoids the occurrence of false-negative results. We demonstrated a decrease in target DNA amount with a difference of 2 logs between meat and bone meal (MBM) treated at 133 degrees and 145 degrees C. Such a difference indicates that bias could occur when DNA-based methods are used for quantitation purposes. Risk management could benefit from future efforts concerning validation of the method for MBM detection in feedstuff and safety evaluation of the use of animal-derived proteins in animal nutrition.

  3. Rapid Prenatal Diagnosis of Trisomy 21 by Real-time Quantitative Polymerase Chain Reaction with Amplification of Small Tandem Repeats and S100B in Chromosome 21

    Science.gov (United States)

    Nam, Mi Suk; Yang, Eun Suk

    2005-01-01

    Trisomy 21 (Down syndrome) is the most common congenital anomaly, and it occurs in one out of 700-1000 births. Current techniques such as amniocentesis and chorionic villi sampling (CVS) require lengthy laboratory culture procedures and high costs. This study was undertaken to establish a rapid prenatal diagnosis of trisomy 21 using real-time quantitative polymerase chain reaction (PCR) of fetal DNA from amniotic fluid. Real-time quantitative PCR was performed with DNA templates obtained from 14 normal blood samples, 10 normal amniotic fluid samples, 14 Down syndrome blood samples, and 7 Down syndrome amniotic fluid samples. Primers for D21S167 and S100B of chromosome 21 were used. Primers that direct the amplification of the 165-bp fragment of the insulin-like growth factor (IGF)-1 gene on chromosome 12 using a PCR primer were included to generate an internal standard for quantitation. The relative levels of D21S167 and S100B were 2.6 and 2.4 times higher in the blood of Down syndrome patients than those in the control group. The differences between these two groups were statistically significant (p-values were 0.0012 and 0.0016, respectively). The relative levels of D21S167 and S100B were 2.1 and 2.7 times higher in the amniotic fluid of Down syndrome fetuses than those in the control group. The difference between these two groups was statistically significant (p-values were 0.0379 and 0.0379, respectively). Prenatal diagnosis of trisomy 21 by real-time quantitative PCR using STR (small tandem repeats) amplification of D21S167 and S100B is a useful, accurate and rapid diagnostic method. Furthermore, it may also be useful for prenatal diagnosis with fetal DNA from maternal blood, and for preimplantation genetic diagnosis and prenatal counseling. PMID:15861490

  4. Effect of Genital Sampling Site on the Detection and Quantification of Ureaplasma Species with Quantitative Polymerase Chain Reaction during Pregnancy

    Science.gov (United States)

    Vancutsem, Ellen; Buyl, Ronald; Gucciardo, Leonardo; Foulon, Walter

    2017-01-01

    Objective. This study aimed to compare the qualitative and quantitative reproducibility of quantitative PCR (qPCR) for Ureaplasma species (Ureaplasma spp.) throughout pregnancy and according to the genital sampling site. Study Design. Between 5 and 14 weeks of gestation (T1), vaginal, fornix, and two cervical samples were taken. Sampling was repeated during the 2nd (T2) and 3rd (T3) trimester in randomly selected T1 positive and negative women. Qualitative and quantitative reproducibility were evaluated using, respectively, Cohen's kappa (κ) and interclass correlation coefficients (ICC) and repeated measures ANOVA on the log-transformed mean number of DNA copies for each sampling site. Results. During T1, 51/127 women were positive for U. parvum and 8 for U. urealyticum (4 patients for both). Sampling was repeated for 44/55 women at T2 and/or T3; 43 (97.7%) remained positive at the three timepoints. κ ranged between 0.83 and 0.95 and the ICC for cervical samples was 0.86. Conclusions. Colonization by Ureaplasma spp. seems to be very constant during pregnancy and vaginal samples have the highest detection rate.

  5. Detection and quantitative characterization of artificial extra peaks following polymerase chain reaction amplification of 14 short tandem repeat systems used in forensic investigations

    DEFF Research Database (Denmark)

    Meldgaard, Michael; Morling, N

    1997-01-01

    Detection on automated DNA sequencers of polymerase chain reaction (PCR) products of tetra- and penta-nucleotide short tandem repeat (STR) loci frequently reveals one or more extra peaks along with the true, major allele peak. The most frequent extra peak pattern is a single smaller peak which......, while Hum-TH01, HumCD4, and D12S391 were virtually unaffected by low-stringency conditions. Replacement of the Taq DNA polymerase with DNA polymerases with lower processivity resulted in higher levels of extra peaks. Our results support the hypothesis that extra peaks are produced due to slipped...

  6. Effects of Holding Time, Storage, and the Preservation of Samples on Sample Integrity for the Detection of Fecal Indicator Bacteria by Quantitative Polymerase Chain Reaction (qPCR)-based assays.

    Science.gov (United States)

    The purpose of this project was to answer questions related to storage of samples to be analyzed by the quantitative polymerase chain reaction (qPCR)-based assays for fecal indicator bacteria. The project was divided into two parts. The first part was to determine if filters th...

  7. Strand-Specific Quantitative Reverse Transcription-Polymerase Chain Reaction Assay for Measurement of Arenavirus Genomic and Antigenomic RNAs.

    Directory of Open Access Journals (Sweden)

    Kelsey Haist

    Full Text Available Arenaviruses are bi-segmented, single-stranded RNA viruses that cause significant human disease. The manner in which they regulate the replication of their genome is not well-understood. This is partly due to the absence of a highly sensitive assay to measure individual species of arenavirus replicative RNAs. To overcome this obstacle, we designed a quantitative reverse transcription (RT-PCR assay for selective quantitation of each of the lymphocytic choriomeningitis virus (LCMV genomic or antigenomic RNAs. During the course of assay design, we identified a nonspecific priming phenomenon whereby, in the absence of an RT primer, cDNAs complementary to each of the LCMV replicative RNA species are generated during RT. We successfully circumvented this nonspecific priming event through the use of biotinylated primers in the RT reaction, which permitted affinity purification of primer-specific cDNAs using streptavidin-coated magnetic beads. As proof of principle, we used the assay to map the dynamics of LCMV replication at acute and persistent time points and to determine the quantities of genomic and antigenomic RNAs that are incorporated into LCMV particles. This assay can be adapted to measure total S or L segment-derived viral RNAs and therefore represents a highly sensitive diagnostic platform to screen for LCMV infection in rodent and human tissue samples and can also be used to quantify virus-cell attachment.

  8. Quantitative reverse transcriptase-polymerase chain reaction measured expression of MDR1 and MRP in primary breast carcinoma.

    Science.gov (United States)

    Dexter, D W; Reddy, R K; Geles, K G; Bansal, S; Myint, M A; Rogakto, A; Leighton, J C; Goldstein, L J

    1998-06-01

    To evaluate the clinical significance of drug resistance mechanisms in breast cancer, we examined the expression of MDR1 and MRP in primary breast carcinoma and normal adjacent tissue using a highly quantitative and reproducible reverse transcription-PCR assay. Expression of both genes was observed in all specimens examined, both tumor (n = 74) and normal adjacent tissue (n = 55). The expression of MDR1, however, was low, with the level of expression being 25 times less than the drug-resistant control cell line KB 8-5. Immunohistochemical analysis of P-glycoprotein corroborated the PCR results; only 6% (2 of 31) were positive for JSB1 staining, and 0 of 32 were positive for for UIC2. MRP expression did not exceed control cell line levels, and immunohistochemistry detected moderate levels of expression. MDR1 expression was independent of grade, stage, tumor size, nodal status, metastasis, and estrogen receptor and progesterone receptor status. There was, however, a significant correlation of MDR1 expression with age and histology. Approximately twice the expression of MDR1 was observed in the 50 age group, and lobular carcinoma had 4 times the expression of MDR1 of other histological types. MRP expression was independent of all other clinical parameters. Thus, these results show that although MDR1 expression is detectable in primary breast carcinoma by PCR, this expression as measured by quantitative reverse transcriptase-PCR is extremely low. The significance of these low levels is yet to be determined. MDR1 expression was higher in < 50 age group and lobular carcinoma, which may contribute to poor prognosis associated with young age and lobular histology.

  9. Quantitation of Bt-176 maize genomic sequences by surface plasmon resonance-based biospecific interaction analysis of multiplex polymerase chain reaction (PCR).

    Science.gov (United States)

    Feriotto, Giordana; Gardenghi, Sara; Bianchi, Nicoletta; Gambari, Roberto

    2003-07-30

    Surface plasmon resonance (SPR) based biosensors have been described for the identification of genetically modified organisms (GMO) by biospecific interaction analysis (BIA). This paper describes the design and testing of an SPR-based BIA protocol for quantitative determinations of GMOs. Biotinylated multiplex Polymerase Chain Reaction (PCR) products from nontransgenic maize as well as maize powders containing 0.5 and 2% genetically modified Bt-176 sequences were immobilized on different flow cells of a sensor chip. After immobilization, different oligonucleotide probes recognizing maize zein and Bt-176 sequences were injected. The results obtained were compared with Southern blot analysis and with quantitative real-time PCR assays. It was demonstrated that sequential injections of Bt-176 and zein probes to sensor chip flow cells containing multiplex PCR products allow discrimination between PCR performed using maize genomic DNA containing 0.5% Bt-176 sequences and that performed using maize genomic DNA containing 2% Bt-176 sequences. The efficiency of SPR-based BIA in discriminating material containing different amounts of Bt-176 maize is comparable to real-time quantitative PCR and much more reliable than Southern blotting, which in the past has been used for semiquantitative purposes. Furthermore, the approach allows the BIA assay to be repeated several times on the same multiplex PCR product immobilized on the sensor chip, after washing and regeneration of the flow cell. Finally, it is emphasized that the presented strategy to quantify GMOs could be proposed for all of the SPR-based, commercially available biosensors. Some of these optical SPR-based biosensors use, instead of flow-based sensor chips, stirred microcuvettes, reducing the costs of the experimentation.

  10. Prognostic value of ZAP-70 expression in chronic lymphocytic leukemia as assessed by quantitative polymerase chain reaction and flow cytometry.

    Science.gov (United States)

    Adams, Rebecca L C; Cheung, Catherine; Banh, Raymond; Saal, Russell; Cross, Donna; Gill, Devinder; Self, Marlene; Klein, Kerenaftali; Mollee, Peter

    2014-03-01

    Chronic lymphocytic leukemia (CLL) is a disorder in which the tempo of disease progression is highly variable, and prognostic markers that can be utilized at diagnosis are regarded as clinically important. Currently, there are several prognostic factors, such as immunoglobulin heavy chain (IgVH) mutational status, and ZAP-70 protein expression in neoplastic B-cells, that have demonstrated significant discriminative power in the prognostication of CLL. They are, however, largely unavailable in the routine diagnostic laboratory setting. In this study, we characterized the IgVH status and ZAP-70 expression by molecular techniques in a cohort of 108 patients with CLL, and correlated these results with three different methods of ZAP-70 expression by flow cytometry. We then assessed the results of these methods in terms of prognostic power as characterized by time to first treatment (TTFT). By comparing three different flow cytometry methods using receiver–operator curve (ROC) analysis, we identified that by utilizing a corrected mean fluorescence intensity (CorrMFI) algorithm for assessing ZAP-70 expression, there was good correlation with both IgVH mutational status, and ZAP-70 expression as assessed by qPCR. We were also able to show that ZAP-70 expression, as assessed by both qPCR and the CorrMFI method, was prognostic of TTFT. While confirmation in a larger patient cohort, with longer follow-up is required, we believe that the CorrMFI represents the most promising method currently available in a routine diagnostic setting for the assessment of ZAP-70 expression in CLL patients. © 2013 International Clinical Cytometry Society.

  11. Quantitation of viable Coxiella burnetii in milk using an integrated cell culture-polymerase chain reaction (ICC-PCR) assay.

    Science.gov (United States)

    Stewart, Diana; Shieh, Y-Carol; Tortorello, Mary; Kukreja, Ankush; Shazer, Arlette; Schlesser, Joseph

    2015-11-01

    The obligate intracellular pathogen Coxiella burnetii has long been considered the most heat resistant pathogen in raw milk, making it the reference pathogen for determining pasteurisation conditions for milk products. New milk formulations and novel non-thermal processes require validation of effectiveness which requires a more practical method for analysis than using the currently used animal model for assessing Coxiella survival. Also, there is an interest in better characterising thermal inactivation of Coxiella in various milk formulations. To avoid the use of the guinea pig model for evaluating Coxiella survival, an Integrated Cell Culture-PCR (ICC-PCR) method was developed for determining Coxiella viability in milk. Vero cell cultures were directly infected from Coxiella-contaminated milk in duplicate 24-well plates. Viability of the Coxiella in milk was shown by a ≥ 0.5 log genome equivalent (ge)/ml increase in the quantity of IS111a gene from the baseline post-infection (day 0) level after 9-11 d propagation. Coxiella in skim, 2%, and whole milk, and half and half successfully infected Vero cells and increased in number by at least 2 logs using a 48-h infection period followed by 9-d propagation time. As few as 125 Coxiella ge/ml in whole milk was shown to infect and propagate at least 2 logs in the optimised ICC-PCR assay, though variable confirmation of propagation was shown for as low as 25 Coxiella ge/ml. Applicability of the ICC-PCR method was further proven in an MPN format to quantitate the number of viable Coxiella remaining in whole milk after 60 °C thermal treatment at 0, 20, 40, 60 and 90 min.

  12. A Quantitative Polymerase Chain Reaction Assay for the Detection and Quantification of Epizootic Epitheliotropic Disease Virus (EEDV; Salmonid Herpesvirus 3).

    Science.gov (United States)

    Glenney, Gavin W; Barbash, Patricia A; Coll, John A

    2016-03-01

    Epizootic epitheliotropic disease virus (EEDV; salmonid herpesvirus [SalHV3]; family Alloherpesviridae) causes a systemic disease of juvenile and yearling Lake Trout Salvelinus namaycush. No cell lines are currently available for the culture and propagation of EEDV, so primary diagnosis is limited to PCR and electron microscopy. To better understand the pervasiveness of EEDV (carrier or latent state of infection) in domesticated and wild Lake Trout populations, we developed a sensitive TaqMan quantitative PCR (qPCR) assay to detect the presence of the EEDV terminase gene in Lake Trout tissues. This assay was able to detect a linear standard curve over nine logs of plasmid dilution and was sensitive enough to detect single-digit copies of EEDV. The efficiency of the PCR assay was 99.4 ± 0.06% (mean ± SD), with a 95% confidence limit of 0.0296 (R(2) = 0.994). Methods were successfully applied to collect preliminary data from a number of species and water bodies in the states of Pennsylvania, New York, and Vermont, indicating that EEDV is more common in wild fish than previously known. In addition, through the development of this qPCR assay, we detected EEDV in a new salmonid species, the Cisco Coregonus artedi. The qPCR assay was unexpectedly able to detect two additional herpesviruses, the Atlantic Salmon papillomatosis virus (ASPV; SalHV4) and the Namaycush herpesvirus (NamHV; SalHV5), which both share high sequence identity with the EEDV terminase gene. With these unexpected findings, we subsequently designed three primer sets to confirm initial TaqMan qPCR assay positives and to differentiate among EEDV, ASPV, and NamHV by detecting the glycoprotein genes via SYBR Green qPCR. Received April 20, 2015; accepted November 10, 2015.

  13. Identification of suitable reference genes for gene expression studies using quantitative polymerase chain reaction in lung cancer in vitro.

    Science.gov (United States)

    Ali, Hassan; Du, Zhenwu; Li, Xiuying; Yang, Qiwei; Zhang, Yu Cheng; Wu, Mei; Li, Yi; Zhang, Guizhen

    2015-05-01

    The present study aimed to examine 10 housekeeping genes (HKGs), including 18s ribosomal RNA (18S), glyceraldehyde‑3‑phosphate dehydrogenase (GAPDH), ribosomal protein large P0 (RPLP0), β‑actin (ACTB), peptidylprolyl isomerase A (PPIA), phosphoglycerate kinase‑1 (PGK1), β‑2‑microglobulin (B2M), ribosomal protein LI3a (RPL13A), hypoxanthine phosphoribosyl transferase‑1 (HPRT1) and TATA box binding protein (TBP) in order to identify the most stable and suitable reference genes for use in expression studies in non‑small cell lung cancer. The mRNA expression encoding the panel of the 10 HKGs was determined using reverse transcription‑quantitative PCR (RT‑qPCR) in human lung cancer cell lines. Three software programs, BestKeeper, NormFinder and geNorm, were used to ascertain the most suitable reference genes to normalize the RNA input. The present study examined three lung cancer cell lines (A549, NCI‑H446 and NCI‑H460). The analysis of the experimental data using BestKeeper software revealed that all 10 HKGs were stable, with GADPH, followed by 18S being the most stable genes and PPIA and HPRT1 being the least stable genes. The NormFinder software results demonstrated that PPIA followed by ACTB were the most stable and B2M and RPLP0 were the least stable. The geNorm software results revealed that ACTB and PGK1, followed by PPIA were the most stable genes and B2M and RPLP0 were identified as the least stable genes. Due to discrepancies in the ranking orders of the reference genes obtained by different analyzing software programs, it was not possible to determine a single universal reference gene. The suitability of selected reference genes requires unconditional validation prior to each study. Based on the three analyzing programs, ACTB, PPIA and PGK1 were the most stable reference genes in lung cancer cell lines.

  14. Development of a Quantitative Polymerase Chain Reaction Detection Protocol for Cercospora kikuchii in Soybean Leaves and Its Use for Documenting Latent Infection as Affected by Fungicide Applications.

    Science.gov (United States)

    Chanda, A K; Ward, N A; Robertson, C L; Chen, Z-Y; Schneider, R W

    2014-10-01

    Cercospora leaf blight (CLB) of soybean, caused by Cercospora kikuchii, is a serious disease in the southern United States. A sensitive TaqMan probe-based real-time quantitative polymerase chain reaction (qPCR) assay was developed to specifically detect and quantify C. kikuchii in naturally infected soybean plants. The sensitivity was 1 pg of genomic DNA, which was equivalent to about 34 copies of genome of C. kikuchii. Using this qPCR assay, we documented a very long latent infection period for C. kikuchii in soybean leaves beginning at the V3 growth stage (as early as 22 days after planting). The levels of biomass of C. kikuchii remained low until R1, and a rapid increase was detected from the R2/R3 to R4/R5 growth stages shortly before the appearance of symptoms at R6. The efficacy of various fungicide regimens under field conditions also was evaluated over a 3-year period using this qPCR method. Our results showed that multiple fungicide applications beginning at R1 until late reproductive stages suppressed the development of C. kikuchii in leaves and delayed symptom expression. Different fungicide chemistries also had differential effects on the amount of latent infection and symptom expression during late reproductive growth stages.

  15. Application of a qualitative and quantitative real-time polymerase chain reaction method for detecting genetically modified papaya line 55-1 in papaya products.

    Science.gov (United States)

    Nakamura, Kosuke; Akiyama, Hiroshi; Takahashi, Yuki; Kobayashi, Tomoko; Noguchi, Akio; Ohmori, Kiyomi; Kasahara, Masaki; Kitta, Kazumi; Nakazawa, Hiroyuki; Kondo, Kazunari; Teshima, Reiko

    2013-01-15

    Genetically modified (GM) papaya (Carica papaya L.) line 55-1 (55-1), which is resistant to papaya ringspot virus infection, has been marketed internationally. Many countries have mandatory labeling regulations for GM foods, and there is a need for specific methods for detecting 55-1. Here, an event- and construct-specific real-time polymerase chain reaction (PCR) method was developed for detecting 55-1 in papaya products. Quantitative detection was possible for fresh papaya fruit up to dilutions of 0.001% and 0.01% (weight per weight [w/w]) for homozygous SunUp and heterozygous Rainbow cultivars, respectively, in non-GM papaya. The limit of detection and quantification was as low as 250 copies of the haploid genome according to a standard reference plasmid. The method was applicable to qualitative detection of 55-1 in eight types of processed products (canned papaya, pickled papaya, dried fruit, papaya-leaf tea, jam, puree, juice, and frozen dessert) containing papaya as a main ingredient. Copyright © 2012 Elsevier Ltd. All rights reserved.

  16. In planta and soil quantification of Fusarium oxysporum f. sp. ciceris and evaluation of Fusarium wilt resistance in chickpea with a newly developed quantitative polymerase chain reaction assay.

    Science.gov (United States)

    Jiménez-Fernández, Daniel; Montes-Borrego, Miguel; Jiménez-Díaz, Rafael M; Navas-Cortés, Juan A; Landa, Blanca B

    2011-02-01

    Fusarium wilt of chickpea caused by Fusarium oxysporum f. sp. ciceris can be managed by risk assessment and use of resistant cultivars. A reliable method for the detection and quantification of F. oxysporum f. sp. ciceris in soil and chickpea tissues would contribute much to implementation of those disease management strategies. In this study, we developed a real-time quantitative polymerase chain reaction (q-PCR) protocol that allows quantifying F. oxysporum f. sp. ciceris DNA down to 1 pg in soil, as well as in the plant root and stem. Use of the q-PCR protocol allowed quantifying as low as 45 colony forming units of F. oxysporum f. sp. ciceris per gram of dry soil from a field plot infested with several races of the pathogen. Moreover, the q-PCR protocol clearly differentiated susceptible from resistant chickpea reactions to the pathogen at 15 days after sowing in artificially infested soil, as well as the degree of virulence between two F. oxysporum f. sp. ciceris races. Also, the protocol detected early asymptomatic root infections and distinguished significant differences in the level of resistance of 12 chickpea cultivars that grew in that same field plot infested with several races of the pathogen. Use of this protocol for fast, reliable, and cost-effective quantification of F. oxysporum f. sp. ciceris in asymptomatic chickpea tissues at early stages of the infection process can be of great value for chickpea breeders and for epidemiological studies in growth chambers, greenhouses and field-scale plots.

  17. Comparison of optical microscopy and quantitative polymerase chain reaction for estimating parasitaemia in patients with kala-azar and modelling infectiousness to the vector Lutzomyia longipalpis

    Science.gov (United States)

    Silva, Jailthon C; Zacarias, Danielle A; Silva, Vladimir C; Rolão, Nuno; Costa, Dorcas L; Costa, Carlos HN

    2016-01-01

    Currently, the only method for identifying infective hosts with Leishmania infantum to the vector Lutzomyia longipalpis is xenodiagnosis. More recently, quantitative polymerase chain reaction (qPCR) has been used to model human reservoir competence by assuming that detection of parasite DNA indicates the presence of viable parasites for infecting vectors. Since this assumption has not been proven, this study aimed to verify this hypothesis. The concentration of amastigotes in the peripheral blood of 30 patients with kala-azar was microscopically verified by leukoconcentration and was compared to qPCR estimates. Parasites were identified in 4.8 mL of peripheral blood from 67% of the patients, at a very low concentration (average 0.3 parasites/mL). However, qPCR showed 93% sensitivity and the estimated parasitaemia was over a thousand times greater, both in blood and plasma, with higher levels in plasma than in blood. Furthermore, the microscopic count of circulating parasites and the qPCR parasitaemia estimates were not mathematically compatible with the published proportions of infected sandflies in xenodiagnostic studies. These findings suggest that qPCR does not measure the concentration of circulating parasites, but rather measures DNA from other sites, and that blood might not be the main source of infection for vectors. PMID:27439033

  18. Quantitative real-time polymerase chain reaction is an alternative method for the detection of HER-2 amplification in formalin-fixed paraffin-embedded breast cancer samples.

    Science.gov (United States)

    Pu, Tianjie; Guo, Peng; Qiu, Yan; Chen, Shinan; Yang, Libo; Sun, Linyong; Ye, Feng; Bu, Hong

    2015-01-01

    Fluorescent in situ hybridization (FISH) and immunohistochemistry (IHC) are the most common methods that are used to quantify HER-2 gene and protein levels, respectively, in human breast cancer. However, due to bad sample quality, some samples are unable to be subjected to a FISH assay. We evaluated 71 formalin-fixed paraffin-embedded (FFPE) breast carcinoma specimens by quantitative real-time polymerase chain reaction (qPCR), IHC, and FISH. We also performed qPCR and FISH assays on delayed formalin-fixed (DDF) samples. The qPCR results were in complete concordance with the results of IHC and FISH. In regards to the DDF samples, the HER-2 fluorescent signal seemed decayed compared with that of the DDF samples after 1 h. However, the qPCR method still works well up to 12 hours. Our results indicated that qPCR was obviously superior to FISH in cases that were not fixed in a reasonable amount of time. However, qPCR can be an alternative method by which to perform HER2 amplification assays in breast cancer.

  19. Selection of relatively exact reference genes for gene expression studies in flixweed (Descurainia sophia) by quantitative real-time polymerase chain reaction.

    Science.gov (United States)

    Xu, Xian; Liu, Xiaomin; Chen, Silong; Li, Binghua; Wang, Xiaoyun; Fan, Cuiqin; Wang, Guiqi; Ni, Hanwen

    2016-02-01

    The reliable gene expression analysis of a reverse transcription quantitative polymerase chain reaction (qRT-PCR) mainly depends on selecting suitable reference genes that can express stably under different experimental conditions. Thus far, no reference genes have been identified in flixweed. In this paper, 7 supposed reference genes were selected to evaluate their expression stabilities by qRT-PCR in flixweed under three conditions including different sampling times after tribenuron treatment, different organs, and different growth stages using geNorm, NormFinder, and BestKeeper statistical algorithms. The results showed that ACT7, UBC and 18SrRNA were the stable reference genes in all of the tested samples. ACT7 and UBC showed high stability in different sampling times after the tribenuron treatment. UBC and 18SrRNA were the most suitable genes for different organs and growth stages. This work confirmed the suitable reference genes of flixweed for a relatively accurate gene expression analysis under different experimental conditions.

  20. Comparison of quantitative real-time polymerase chain reaction with NanoString® methodology using adipose and liver tissues from rats fed seaweed.

    Science.gov (United States)

    Bentley-Hewitt, Kerry L; Hedderley, Duncan I; Monro, John; Martell, Sheridan; Smith, Hannah; Mishra, Suman

    2016-05-25

    Experimental methods are constantly being improved by new technology. Recently a new technology, NanoString®, has been introduced to the market for the analysis of gene expression. Our experiments used adipose and liver samples collected from a rat feeding trial to explore gene expression changes resulting from a diet of 7.5% seaweed. Both quantitative real-time polymerase chain reaction (qPCR) and NanoString methods were employed to look at expression of genes related to fat and glucose metabolism and this paper compares results from both methods. We conclude that NanoString offers a valuable alternative to qPCR and our data suggest that results are more accurate because of the reduced sample handling and direct quantification of gene copy number without the need for enzymatic amplification. However, we have highlighted a potential challenge for both methods, which needs to be addressed when designing primers or probes. We suggest a literature search for known splice variants of a particular gene to be completed so that primers or probes can be designed that do not span exons which may be affected by alternative gene sequences.

  1. Identification of mRNA for endocannabinoid biosynthetic enzymes within hippocampal pyramidal cells and CA1 stratum radiatum interneuron subtypes using quantitative real-time polymerase chain reaction.

    Science.gov (United States)

    Merrill, C B; McNeil, M; Williamson, R C; Poole, B R; Nelson, B; Sudweeks, S; Edwards, J G

    2012-08-30

    The hippocampus is required for short-term memory and contains both excitatory pyramidal cells and inhibitory interneurons. These cells exhibit various forms of synaptic plasticity, the mechanism underlying learning and memory. More recently, endocannabinoids were identified to be involved in synaptic plasticity. Our goal was to describe the distribution of endocannabinoid biosynthetic enzymes within CA1 stratum radiatum interneurons and CA3/CA1 pyramidal cells. We extracted mRNA from single interneurons and pyramidal cells and used real-time quantitative polymerase chain reaction (RT-PCR) to detect the presence of 12-lipoxygenase, N-acyl-phosphatidylethanolamine-specific phospholipase D, diacylglycerol lipase α, and type I metabotropic glutamate receptors, all known to be involved in endocannabinoid production and plasticity. We observed that the expression of endocannabinoid biosynthetic enzyme mRNA does occur within interneurons and that it is coexpressed with type I metabotropic glutamate receptors, suggesting interneurons have the potential to produce endocannabinoids. We also identified that CA3 and CA1 pyramidal cells express endocannabinoid biosynthetic enzyme mRNA. Our data provide the first molecular biological evidence for putative endocannabinoid production in interneurons, suggesting their potential ability to regulate endocannabinoid-mediated processes, such as synaptic plasticity.

  2. Molecular diagnosis of Anaplasma marginale in cattle: quantitative evaluation of a real-time PCR (Polymerase Chain Reaction based on msp5 gene

    Directory of Open Access Journals (Sweden)

    Gisele M. Bacanelli

    2014-01-01

    Full Text Available The rickettsia Anaplasma marginale is considered the main agent of bovine anaplasmosis. Due the nonspecific clinical signs of the anaplasmosis, the diagnosis of infection depends of laboratory confirmation. In recent years, molecular diagnostic methods have been used to detect A. marginale in cattle. However, the existence of a large number of assays of different sensitivity and cost makes the choice of an appropriate test difficult. In the present study, a real-time Polymerase Chain Reaction (PCR based on the msp5 target gene was quantitatively assessed and compared to an end point PCR. Both reactions were subjected to sensitivity and specificity evaluation using plasmid DNA and samples from cattle experimentally infected with A. marginale. A comparative field trial of the tests was carried out using samples of cattle from a stable enzootic area for A. marginale. The real-time PCR showed a higher sensitivity than the end point PCR. This reaction (i.e. real-time PCR was able to detect one copy of the msp5 gene in 100 ηg of plasmidial DNA, and more than 80% of its results were positive among experimentally infected animals seven days after infection. In addition, based on in silico analysis, the real-time PCR evaluated in the present study appears to be useful for the detection of A. ovis.

  3. Quantitative real-time polymerase chain reaction improves conventional microbiological diagnosis in an outbreak of brucellosis due to ingestion of unpasteurized goat cheese.

    Science.gov (United States)

    Colmenero, Juan D; Clavijo, Encarnación; Morata, Pilar; Bravo, María J; Queipo-Ortuño, María I

    2011-11-01

    Rapid diagnosis of individuals involved in brucellosis outbreaks can sometimes be difficult with conventional microbiological techniques. We analyzed, for the first time, the diagnostic yield of a real-time polymerase chain reaction (PCR) assay in a family outbreak of brucellosis due to consumption of unpasteurized goat cheese. PCR correctly identified all symptomatic cases.

  4. Quantitative 16S rDNA-targeted polymerase chain reaction and oligonucleotide hybridization for the detection of Paenibacillus azotofixans in soil and the wheat rhizosphere

    NARCIS (Netherlands)

    Rosado, A.S.; Seldin, L.; Wolters, A.; Elsas, van J.D.

    1996-01-01

    A molecular method for the detection of Paenibacillus azotofixans in soil and the wheat rhizosphere was developed. The system consisted of polymerase chain reaction (PCR) amplification of part of the variable V1 to V4 regions of the 16S ribosomal RNA gene, followed by hybridization with a specific o

  5. Comparative quantitative analysis of BCR-ABL transcripts with the T315I mutant clone by polymerase chain reaction (PCR)-Invader method.

    Science.gov (United States)

    Tadokoro, Kenichi; Ishikawa, Maho; Suzuki, Makoto; Saito, Tomoyoshi; Suzuki, Yoshie; Yamaguchi, Toshikazu; Yagasaki, Fumiharu

    2011-09-01

    Drug resistance is a serious complication in the treatment of chronic myeloid leukemia (CML). The most common and best-characterized mechanism of secondary imatinib resistance in CML is the development of kinase domain mutations in the BCR-ABL gene. Second-generation tyrosine kinase inhibitors, such as dasatinib or nilotinib, overcome most of these mutations, but they are not effective against the T315I mutant. To determine whether these mutations contribute to clinical resistance, it is necessary to monitor the ratio of the mutant and wild-type forms. Here, we developed a polymerase chain reaction (PCR)-Invader assay for comparative quantitative analysis (qPI assay) of BCR-ABL transcripts with the T315I mutant clone. T315I ratios were calculated for the wild-type and mutant fold-over-zero (FOZ) values. In examination with 2 kinds of plasmids containing wild-type or T315I mutant PCR amplicons, mutant FOZ values were detected down to 1% of the total. The results of 12 serial samples from 2 patients (case A: Philadelphia-positive acute lymphoblastic leukemia and case B: CML) with the T315I mutant clone were compared with those of direct sequencing or 2 kinds of allele-specific oligonucleotide (ASO)-PCR. All samples showed the T315I mutation by qPI assay and ASO-PCR, and 10 samples showed it by direct sequencing. Significant correlation (correlation coefficient; r2 = 0.951) was noted between the qPI assay and quantitative ASO-PCR to analyze T315I mutant ratios. Thus, the qPI assay is a useful method for evaluating the T315I mutant clone in BCR-ABL transcripts.

  6. A sensitive and quantitative polymerase chain reaction-based cell free in vitro non-homologous end joining assay for hematopoietic stem cells.

    Directory of Open Access Journals (Sweden)

    Lijian Shao

    Full Text Available Hematopoietic stem cells (HSCs are responsible for sustaining hematopoietic homeostasis and regeneration after injury for the entire lifespan of an organism. Maintenance of genomic stability is crucial for the preservation of HSCs, which depends on their efficient repair of DNA damage, particularly DNA double strand breaks (DSBs. Because of the paucity of HSCs and lack of sensitive assays, directly measuring the ability of HSCs to repair DSBs has been difficult. Therefore, we developed a sensitive and quantitative cell free in vitro non-homologous end joining (NHEJ assay using linearized plasmids as the substrates and quantitative polymerase chain reaction (qPCR technique. This assay can sensitively detect DSB repair via NHEJ in less than 1 µg 293T cell nuclear proteins or nuclear extracts from about 5,000 to 10,000 human BM CD34(+ hematopoietic cells. Using this assay, we confirmed that human bone marrow HSCs (CD34(+CD38(- cells are less proficient in the repair of DSBs by NHEJ than HPCs (CD34(+CD38(+ cells. In contrast, mouse quiescent HSCs (Pyronin-Y(low LKS(+ cells and cycling HSCs (Pyronin-Y(hi LKS(+ cells repaired the damage more efficiently than HPCs (LKS(- cells. The difference in the abilities of human and mouse HSCs and HPCs to repair DSBs through NHEJ is likely attributed to their differential expression of key NHEJ DNA damage repair genes such as LIG4. These findings suggest that the qPCR-based cell free in vitro NHEJ assay can be used to sensitively measure the ability of human and mouse HSCs to repair DSBs.

  7. Comparative Diagnosis of Human Bocavirus 1 Respiratory Infection With Messenger RNA Reverse-Transcription Polymerase Chain Reaction (PCR), DNA Quantitative PCR, and Serology.

    Science.gov (United States)

    Xu, Man; Arku, Benedict; Jartti, Tuomas; Koskinen, Janne; Peltola, Ville; Hedman, Klaus; Söderlund-Venermo, Maria

    2017-05-15

    Human bocavirus (HBoV) 1 can cause life-threatening respiratory tract infection in children. Diagnosing acute HBoV1 infection is challenging owing to long-term airway persistence. We assessed whether messenger RNA (mRNA) detection would correlate better than DNA detection with acute HBoV1 infection. Paired serum samples from 121 children with acute wheezing were analyzed by means of serology. Quantitative polymerase chain reaction (PCR) and reverse-transcription (RT) PCR were applied to nasopharyngeal swab (NPS) samples from all acutely HBoV1-infected children and from controls with nonacute infection. By serology, 16 of 121 children (13.2%) had acute HBoV1 infection, all of whom had HBoV1 DNA in NPS samples, and 12 of 16 (75%) had HBoV1 mRNA. Among 25 children with nondiagnostic results, 6 had HBoV1 DNA in NPS samples, and 1 had mRNA. All 13 mRNA-positive samples exhibited high DNA loads (≥106 copies/mL). No mRNA persisted for 2 weeks, whereas HBoV1 DNA persisted for 2 months in 4 children; 1 year later all 15 samples were DNA negative. Compared with serology, DNA PCR had high clinical sensitivity (100%) but, because of viral persistence, low specificity (76%). In contrast, mRNA RT-PCR had low clinical sensitivity (75%) but high specificity (96%). A combination of HBoV1 serology and nasopharyngeal DNA quantitative PCR and mRNA RT-PCR should be used for accurate diagnosis of HBoV1 infection.

  8. Evaluation of the effects of acyclovir and/or human amniotic membrane on herpes virus culture and quantitative virus inactivity by real-time polymerase chain reaction

    Directory of Open Access Journals (Sweden)

    Feride Aylin Kantarci

    2014-08-01

    Full Text Available AIM: To investigate the permeability of amniotic membrane in herpes virus cell culture to acyclovir with real time polymerase chain reaction (RT-PCR.METHODS: Madin-Darby Bovine Kidney (MDBK cell culture and Bovine Herpes Virus (BHV1 type 1 were used in the study. Cell cultures were grouped into two on the basis of herpes virus inoculation. Each group was sub-grouped into three. Amniotic membrane (V-HAM, acyclovir (V-A, and amniotic membrane and acyclovir (V-HAM-A were applied to these subgroup cultures, respectively. After the application of the membrane and the drug, the cultures were evaluated at 24 and 48h for cytopathic effect positive (CPE+ with a tissue culture microscope. In the CPE (+ samples, the DNA was extracted for viral DNA analysis by RT-PCR.RESULTS: In control cultures without herpes virus CPE was not detected. Besides, amniotic membrane and acyclovir did not have cytotoxic effect on cell cultures. CPE were detected in Bovine Herpesvirus type-1 inoculated cell cultures after amniotic membrane and/or acyclovir application. DNA analysis with RT-PCR indicated that Cycle threshold (Ct values were lower in the BHV1 and membrane applied group (amniotic membrane group< acyclovir group< membrane and acyclovir group. This showed that membrane did not have antiviral effect. The membrane and acyclovir cell culture groups with high Ct values indicated that membrane was permeable and had a low barrier effect to drug,CONCLUSION: In our in-vitro study, we found that amniotic membrane, which can be used in the treatment of corneal diseases, did not have antiviral effect. Besides, we detected that amniotic membrane was permeable to acyclovir in BHV-1 inoculated MDBK cell culture. However, more studies are necessary to investigate the quantitative effects of amniotic membrane and acyclovir.

  9. Real-time quantitative reverse transcription-polymerase chain reaction to detect propionibacterial ribosomal RNA in the lymph nodes of Chinese patients with sarcoidosis.

    Science.gov (United States)

    Zhou, Y; Wei, Y-R; Zhang, Y; Du, S-S; Baughman, R P; Li, H-P

    2015-09-01

    The aim of this study was to investigate the diagnostic value of using the copy number of propionibacterial rRNA as a biomarker for sarcoidosis. Ribosomal RNA of Propionibacterium acnes and P. granulosum was measured by real-time quantitative reverse transcription-polymerase chain reaction (RT-PCR) using formalin-fixed and paraffin-embedded tissue of lymph node biopsy from 65 Chinese patients with sarcoidosis, 45 with tuberculosis and 50 controls with other diseases (23 with non-specific lymphadenitis and 27 with mediastinal lymph node metastasis from lung cancer). The receiver operating characteristic (ROC) curve was analysed to determine an optimal cut-off value for diagnosis, and the diagnostic accuracy of the cut-off value was evaluated in additional tissue samples [24 patients with sarcoidosis and 22 with tuberculosis (TB)]. P. acnes or P. granulosum rRNA was detected in 48 of the 65 sarcoidosis samples but only in four of the 45 TB samples and three of the 50 control samples. Analysis of the ROC curve revealed that an optimal cut-off value of the copy number of propionibacterial rRNA for diagnosis of sarcoidosis was 50·5 copies/ml with a sensitivity and specificity of 73·8 and 92·6%, respectively. Based on the cut-off value, 19 of the 24 additional sarcoidosis samples exhibited positive P. acnes or P. granulosum, whereas only one of the 22 additional TB samples was positive, resulting in a sensitivity and specificity of 79·2 and 95·5%, respectively. These findings suggest that propionibacteria might be associated with sarcoidosis granulomatous inflammation. Detection of propionibacterial rRNA by RT-PCR might possibly distinguish sarcoidosis from TB.

  10. Analytical validation of a quantitative reverse transcriptase polymerase chain reaction assay for evaluation of T-cell targeted immunosuppressive therapy in the dog.

    Science.gov (United States)

    Riggs, C; Archer, T; Fellman, C; Figueiredo, A S; Follows, J; Stokes, J; Wills, R; Mackin, A; Bulla, C

    2013-12-15

    Cyclosporine is an immunosuppressive agent that inhibits T-cell function by decreasing production of cytokines such as interleukin-2 (IL-2) and interferon-γ(IFN-γ). In dogs, there is currently no reliable analytical method for determining effective cyclosporine dosages in individual patients. Our laboratory has developed a quantitative reverse transcriptase polymerase chain reaction (RT-qPCR) assay that measures IL-2 and IFN-γ gene expression, with the goal of quantifying immunosuppression in dogs treated with cyclosporine. This study focuses on analytical validation of our assay, and on the effects of sample storage conditions on cyclosporine-exposed samples. Heparinized whole blood collected from healthy adult dogs was exposed to a typical post-treatment blood concentration for cyclosporine(500 ng/mL) for 1 h, and then stored for 0, 24, and 48 h at both room temperature and 4 ◦C.The study was then repeated using a cyclosporine concentration of 75 ng/mL, with sample storage for 0, 24, and 48 h at 4 ◦C. Cytokine gene expression was measured using RT-qPCR,and assay efficiency and inter- and intra-assay variability were determined. Storage for upto 24 h at room temperature, and up to 48 h at 4 ◦C, did not significantly alter results compared to samples that were processed immediately. Validation studies showed our assay to be highly efficient and reproducible and robust enough to be feasible under standard practice submission conditions. © 2013 Elsevier B.V. All rights reserved.

  11. The use of quantitative real time polymerase chain reaction to quantify some rumen bacterial strains in an in vitro rumen system

    Directory of Open Access Journals (Sweden)

    Lucy Onime

    2013-08-01

    Full Text Available The aim of this work was to quantify four rumen bacterial strains (Butyrivibrio fibrisolvens, Ruminococcus albus, Streptococcus bovis, Megasphaera elsdenii in an in vitro batch rumen fermentative system by quantitative real time polymerase chain reaction (qPCR. The experiment was a 2×2 factorial arrangement with two types of liquid rumen, collected from dairy cows (DC and fattening bulls (FB and two types of fermentation substrate (forage:concentrate ratios, 75:25 and 25:75 and was replicated in two fermentation runs. Fermentation fluids from FB compared to those from DC had lower pH, higher total VFA concentrations (averages of 0 and 24 h samplings, 6.70 vs 7.04 and 72.6 vs 42.7 mmol/l P<0.001 and contained less acetic (P=0.014 and more propionic (P<0.01 and butyric (P=0.029 acids. The two types of substrates incubated produced very small differences in the end fermentation products. B. fibrosolvens concentrations were higher (P<0.001 in the DC fermentation fluids compared to that from bulls (averages of 0 and 24 h sampling times, 3.47 vs 1.38 x109 copies /mL, while M. elsdenii was detected only in FB fermentation fluids. R. albus and S. bovis concentrations were not different between the two types of rumen liquid. With the only exception for B. fibrosolvens, bacteria strains considered in this study increased their concentrations in the fermentation fluid during the 24 h of in vitro incubation.

  12. Combination of differential growth at two different temperatures with a quantitative real-time polymerase chain reaction to determine temperature-sensitive phenotype of Mycoplasma synoviae.

    Science.gov (United States)

    Shahid, Muhammad A; Ghorashi, Seyed A; Agnew-Crumpton, Rebecca; Markham, Philip F; Marenda, Marc S; Noormohammadi, Amir H

    2013-04-01

    Mycoplasma synoviae infections result in significant economic losses in the chicken and turkey industries. A commercially available live temperature-sensitive (ts (+)) vaccine strain MS-H has been found to be effective in controlling M. synoviae infections in commercial layer and broiler breeder farms in various countries, including Australia. Detection and differentiation of MS-H from field strains (ts (-)) and from ts (-) MS-H reisolates in vaccinated flocks is vital in routine flock status monitoring. At present microtitration is the only available technique to determine the ts phenotype of M. synoviae. This technique is time consuming and not amenable to automation. In the present study, a quantitative real-time polymerase chain reaction (Q-PCR) was combined with simultaneous culturing of M. synoviae at two different temperatures (33°C and 39.5°C) to determine the ts phenotype of 22 Australian M. synoviae strains/isolates. The M. synoviae type strain WVU-1853 was also included for comparison. A ratio of the copy numbers of the variable lipoprotein haemagglutinin (vlhA) gene at the two temperatures was calculated and a cut-off value was determined and used to delineate the ts phenotype. In all M. synoviae strains/isolates tested in this study, the ts phenotype determined using Q-PCR was in agreement with that determined using conventional microtitration. Combination of Q-PCR with differential growth at two different temperatures is a rapid, reliable and accurate technique that could be used as an effective tool in laboratories actively involved in ts phenotyping of M. synoviae strains/isolates.

  13. Optimizing a Method for the Quantification by Quantitative Real-Time Polymerase Chain Reaction of Host Cell DNA in Plasmid Vector Batches Used in Human Gene Therapy.

    Science.gov (United States)

    Ferro, Serge; Fabre, Isabelle; Chenivesse, Xavier

    2016-08-01

    Gene therapy products are very complex advanced therapy medicinal products produced using different processes that require many chemical and biological reagents and production intermediates, such as producing cells. The quantification of residual impurities in gene therapy vectors is a major quality control step when these vectors are used for therapeutic purposes, whether or not they are derived from viruses. Indeed, in nonviral gene therapy products, particularly plasmid vectors used to transfer genetic material, the presence of host-cell DNA (HCDNA) from the bacterial cells used for the vector production is an important concern because of the risk of immunogenicity and insertional mutagenesis. Several methods have been developed to quantify residual HCDNA, but real-time quantitative polymerase chain reaction (qPCR) seems to be most suitable because it allows detecting traces of "contaminating" DNA. The French National Agency for Medicines and Health Products Safety (ANSM) ensures the quality and safety of gene transfer medicinal products and must be able to quantify, in its own laboratories, the amount of HCDNA present in plasmid vector batches. Therefore, we developed and validated a qPCR method to quantify at the femtogram level the presence of Escherichia coli residual DNA in plasmid vectors. This approach uses the capillary-based LightCycler 1.5 System (Roche) with SYBR Green I, a primer pair against the E. coli 23S ribosomal RNA gene and different concentrations of a linearized plasmid that contains the 23S target sequence, as standard. This qPCR method is linear on an 8-decade logarithmic scale, accurate, reproducible, and sensitive (quantification of up to 10 copies of 23S target sequence per reaction, or 1.4 E. coli genome, or 7 fg of bacterial DNA). This technique allows ensuring that batches of plasmid vectors to be used in clinical trials comply with the specifications on HCDNA content.

  14. Evaluation of the effects of acyclovir and/or human amniotic membrane on herpes virus culture and quantitative virus inactivity by real-time polymerase chain reaction

    Institute of Scientific and Technical Information of China (English)

    Feride; Aylin; Kantarci; Ali; Reza; Faraji; Aykut; Ozkul; Fikret; Akata

    2014-01-01

    ·AIM: To investigate the permeability of amniotic membrane in herpes virus cell culture to acyclovir with real time polymerase chain reaction(RT-PCR).·METHODS: Madin-Darby Bovine Kidney(MDBK) cell culture and Bovine Herpes Virus(BHV1) type 1 were used in the study. Cell cultures were grouped into two on the basis of herpes virus inoculation. Each group was sub-grouped into three. Amniotic membrane(V-HAM),acyclovir(V-A), and amniotic membrane and acyclovir(V-HAM-A) were applied to these subgroup cultures,respectively. After the application of the membrane and the drug, the cultures were evaluated at 24 and 48 h for cytopathic effect positive(CPE +) with a tissue culture microscope. In the CPE(+) samples, the DNA was extracted for viral DNA analysis by RT-PCR.·RESULTS: In control cultures without herpes virus CPE was not detected. Besides, amniotic membrane and acyclovir did not have cytotoxic effect on cell cultures.CPE were detected in Bovine Herpesvirus type-1inoculated cell cultures after amniotic membrane and/or acyclovir application. DNA analysis with RT-PCR indicated that Cycle threshold(Ct) values were lower in the BHV1 and membrane applied group(amniotic membrane group < acyclovir group < membrane and acyclovir group). This showed that membrane did not have antiviral effect. The membrane and acyclovir cell culture groups with high Ct values indicated thatmembrane was permeable and had a low barrier effect to drug.·CONCLUSION: In our in-vitro study, we found that amniotic membrane, which can be used in the treatment of corneal diseases, did not have antiviral effect. Besides,we detected that amniotic membrane was permeable to acyclovir in BHV-1 inoculated MDBK cell culture.However, more studies are necessary to investigate the quantitative effects of amniotic membrane and acyclovir.

  15. Interlaboratory comparison of three microbial source tracking quantitative polymerase chain reaction (qPCR) assays from fecal-source and environmental samples

    Science.gov (United States)

    Stelzer, Erin A.; Strickler, Kriston M.; Schill, William B.

    2012-01-01

    During summer and early fall 2010, 15 river samples and 6 fecal-source samples were collected in West Virginia. These samples were analyzed by three laboratories for three microbial source tracking (MST) markers: AllBac, a general fecal indicator; BacHum, a human-associated fecal indicator; and BoBac, a ruminant-associated fecal indicator. MST markers were analyzed by means of the quantitative polymerase chain reaction (qPCR) method. The aim was to assess interlaboratory precision when the three laboratories used the same MST marker and shared deoxyribonucleic acid (DNA) extracts of the samples, but different equipment, reagents, and analyst experience levels. The term assay refers to both the markers and the procedure differences listed above. Interlaboratory precision was best for all three MST assays when using the geometric mean absolute relative percent difference (ARPD) and Friedman's statistical test as a measure of interlaboratory precision. Adjustment factors (one for each MST assay) were calculated using results from fecal-source samples analyzed by all three laboratories and applied retrospectively to sample concentrations to account for differences in qPCR results among labs using different standards and procedures. Following the application of adjustment factors to qPCR results, ARPDs were lower; however, statistically significant differences between labs were still observed for the BacHum and BoBac assays. This was a small study and two of the MST assays had 52 percent of samples with concentrations at or below the limit of accurate quantification; hence, more testing could be done to determine if the adjustment factors would work better if the majority of sample concentrations were above the quantification limit.

  16. The use of epifluorescent microscopy and quantitative polymerase chain reaction to determine the presence/absence and identification of microorganisms associated with domestic and foreign wallboard samples

    Science.gov (United States)

    Griffin, Dale W.

    2011-01-01

    Epifluorescent microscopy and quantitative polymerase chain reaction (qPCR) were utilized to determine the presence, concentration and identification of bacteria, and more specifically sulfate reducing bacteria (SRB) in subsamples of Chinese and North American wallboard, and wallboard-mine rock. Bacteria were visible in most subsamples, which included wallboard-lining paper from each side of the wallboard, wallboard filler, wallboard tape and fragments of mined wallboard rock via microscopy. Observed bacteria occurred as single or small clusters of cells and no mass aggregates indicating colonization were noted. Universal 16S qPCR was utilized to directly examine samples and detected bacteria at concentrations ranging from 1.4 x 103 to 6.4 x 104 genomic equivalents per mm2 of paper or per gram of wallboard filler or mined rock, in 12 of 41 subsamples. Subsamples were incubated in sulfate reducing broth for ~30 to 60 days (enrichment assay) and then analyzed by universal 16S and SRB qPCR. Enrichment universal 16S qPCR detected bacteria in 32 of 41 subsamples at concentrations ranging from 1.5 x 104 to 4.2 x 107 genomic equivalents per ml of culture broth. Evaluation of enriched subsamples by SRB qPCR demonstrated that SRB were not detectable in most of the samples and if they were detected, detection was not reproducible (an indication of low concentrations, if present). Enrichment universal 16S and SRB qPCR demonstrated that viable bacteria were present in subsamples (as expected given exposure of the samples following manufacture, transport and use) but that SRB were either not present or present at very low numbers. Further, no differences in trends were noted between the various Chinese and North American wallboard samples. In all, the microscopy and qPCR data indicated that the suspected ‘sulfur emissions’ emanating from suspect wallboard samples is not due to microbial activity.

  17. Evaluation of Real-Time Quantitative Polymerase Chain Reaction (qPCR) to Determine Escherichia coli Concentrations at Two Lake Erie Beaches

    Science.gov (United States)

    Kephart, Christopher M.; Bushon, Rebecca N.

    2009-01-01

    During the recreational seasons of 2006 and 2007, the quantitative polymerase chain reaction (qPCR) method was used to determine Escherichia coli (E. coli) concentrations in samples from two Lake Erie beaches. Results from the qPCR method were compared to those obtained by traditional culturing on modified mTEC agar. Regression analysis showed strong, statistically significant correlations between results from the two methods for both years. Correlation coefficients at Edgewater and Villa Angela Beaches were 0.626 and 0.789 for 2006 and 0.667 and 0.829 for 2007, respectively. Linear regression analyses were done to determine how well E. coli concentrations could have been predicted from qPCR results. These hypothetical predictions were compared to the current practice of determining recreational water quality from E. coli concentrations determined for samples collected on the previous day. The qPCR method resulted in a greater percentage of correct predictions of water-quality exceedances than the current method for both beaches and both years. However, because regression equations differed somewhat between both sites and both years, the study did not result in any single relation reliable enough to use for actual real-time prediction of water-quality exceedances for either beach; therefore, a posterior analysis of data was done. Additional years of data may be needed to develop such a relation. Results from this study support the continued development and testing of a qPCR method for providing rapid and accurate estimates of E. coli concentrations for monitoring recreational water quality.

  18. Detection of the Pandemic H1N1/2009 Influenza A Virus by a Highly Sensitive Quantitative Real-time Reverse-transcription Polymerase Chain Reaction Assay

    Institute of Scientific and Technical Information of China (English)

    Zhu Yang; Guoliang Mao; Yujun Liu; Yuan-Chuan Chen; Chengjing Liu; Jun Luo; Xihan Li

    2013-01-01

    A quantitative real time reverse-transcription polymerase chain reaction (qRT-PCR) assay with specific primers recommended by the World Health Organization (WHO) has been widely used successfully for detection and monitoring of the pandemic H1N 1/2009 influenza A virus.In this study,we report the design and characterization of a novel set of primers to be used in a qRT-PCR assay for detecting the pandemic H1N1/2009 virus.The newly designed primers target three regions that are highly conserved among the hemagglutinin (HA) genes of the pandemic H1N1/2009 viruses and are different from those targeted by the WHO-recommended primers.The qRT-PCR assays with the newly designed primers are highly specific,and as specific as the WHO-recommended primers for detecting pandemic H1N1/2009 viruses and other influenza viruses including influenza B viruses and influenza A viruses of human,swine,and raccoon dog origin.Furthermore,the qRT-PCR assays with the newly designed primers appeared to be at least 10-fold more sensitive than those with the WHO-recommended primers as the detection limits of the assays with our primers and the WHO-recommended primers were 2.5 and 25 copies of target RNA per reaction,respectively.When tested with 83 clinical samples,32 were detected to be positive using the qRT-PCR assays with our designed primers,while only 25 were positive by the assays with the WHO-recommended primers.These results suggest that the qRT-PCR system with the newly designed primers represent a highly sensitive assay for diagnosis of the pandemic H1N1/2009 virus infection.

  19. Detection of Viral Hemorrhagic Septicemia Virus by Quantitative Reverse Transcription Polymerase Chain Reaction from Two Fish Species at Two Sites in Lake Superior

    Science.gov (United States)

    Cornwell, Emily R.; Eckerlin, Geofrey E.; Getchell, Rodman G.; Groocock, Geoffrey H.; Thompson, Tarin M.; Batts, William N.; Casey, Rufina N.; Kurath, Gael; Winton, James R.; Bowser, Paul R.; Bain, Mark B.; Casey, James W.

    2011-01-01

    Viral hemorrhagic septicemia virus (VHSV) was first detected in the Laurentian Great Lakes in 2005 during a mortality event in the Bay of Quinte, Lake Ontario. Subsequent analysis of archived samples determined that the first known isolation of VHSV in the Laurentian Great Lakes was from a muskellunge Esox masquinongy collected in Lake St. Clair in 2003. By the end of 2008, mortality events and viral isolations had occurred in all of the Laurentian Great Lakes except Lake Superior. In 2009, a focused disease surveillance program was designed to determine whether VHSV was also present in Lake Superior. In this survey, 874 fish from 7 sites along the U.S. shoreline of Lake Superior were collected during June 2009. Collections were focused on nearshore species known to be susceptible to VHSV. All fish were dissected individually by using aseptic techniques and were tested for the presence of VHSV genetic material by use of a quantitative reverse transcription (qRT) polymerase chain reaction (PCR) targeting the viral nucleoprotein gene. Seventeen fish from two host species at two different sites tested positive at low levels for VHSV. All attempts to isolate virus in cell culture were unsuccessful. However, the presence of viral RNA was confirmed independently in five fish by using a nested PCR that targeted the glycoprotein (G) gene. Partial G gene sequences obtained from three fish were identical to the corresponding sequence from the original 2003 VHSV isolate (MI03) from muskellunge. These detections represent the earliest evidence for the presence of VHSV in Lake Superior and illustrate the utility of the highly sensitive qRT-PCR assay for disease surveillance in aquatic animals.

  20. Endonuclease restriction-mediated real-time polymerase chain reaction: a novel technique for rapid, sensitive and quantitative detection of nucleic-acid sequence

    Directory of Open Access Journals (Sweden)

    Yi Wang

    2016-07-01

    Full Text Available The article reported a novel methodology for real-time PCR analysis of nucleic acids, termed endonuclease restriction-mediated real-time polymerase chain reaction (ET-PCR. Just like PCR, ET-PCR only required one pair of primers. A short sequence (Ss, which was recognized by restriction enzyme BstUI, was attached to the 5’ end of the forward (F or reverse (R PCR primer, and the new F or R primer was named EF or ER. EF/ER was labeled at the 5’ end with a reporter dye and in the middle with a quenching dye. BstUI cleaves the newly synthesized double-stranded terminal sequences (5’ end recognition sequences and their complementary sequences during the extension phase, which separates the reporter molecule from the quenching dye, leading to a gain of fluorescence signal. This process is repeated in each amplification cycle and unaffected the exponential synthesis of the PCR amplification. ET-PCR allowed real-time analysis of single or multiple targets in a single vessel, and provided the reproducible quantitation of nucleic acids. positive results were generated in a relatively short period. The analytical sensitivity and specificity of ETR-PCR were successfully evaluated, detecting down to 250 fg of genomic DNA per tube of target pathogen DNA examined, and the positive results were generated in a relatively short period. Moreover, the practical application of ET-PCR for simultaneous detection of multiple target pathogens was also demonstrated in artificially contaminated blood samples. In conclusion, due to the technique’s simplicity of design, reproducible data and low contamination risk, ET-PCR assay is an appealing alternative to conventional approaches currently used for real-time nucleic acid analysis.

  1. Value of Tropheryma whipplei quantitative polymerase chain reaction assay for the diagnosis of Whipple disease: usefulness of saliva and stool specimens for first-line screening.

    Science.gov (United States)

    Fenollar, Florence; Laouira, Sonia; Lepidi, Hubert; Rolain, Jean-Marc; Raoult, Didier

    2008-09-01

    Whipple disease (WD) is a chronic infectious disease caused by Tropheryma whipplei. WD DNA has been found in stool and saliva specimens from patients and asymptomatic carriers. A total of 4418 samples that were sent to our center for determination of WD were tested by a T. whipplei-specific quantitative polymerase chain reaction (PCR) based on repetitive sequences. Definite WD was diagnosed in 71 patients, including 55 patients with classic WD (defined by positive results of periodic acid-Schiff staining and/or specific immunohistochemistry of small-bowel biopsy specimens) and 16 patients with localized WD (including patients with endocarditis, neurologic infection, and uveitis). Of the persons without WD, 2.3% had stool specimens positive for T. whipplei by PCR and 0.2% had saliva specimens positive for T. whipplei by PCR. Diagnosis of WD was likely in patients with positive results of both PCR of saliva specimens and PCR of stool specimens (positive predictive value, 95.2%). When the bacterial load was >10(4) colony-forming units per g of stool, the positive predictive value was 100%. A negative result of PCR of a saliva or stool specimen had a negative predictive value of 99.2% for classic WD. For localized WD, positive results of both PCR of saliva specimens and PCR of stool specimens had a sensitivity of 58% (compared with 94% for classic WD). The positive predictive value of testing of blood, cerebrospinal fluid, and urine specimens was 100% for each, and the positive predictive value for testing of duodenal biopsy specimens was 97.5%. T. whipplei-specific quantitative PCR of saliva and stool specimens should be performed as first-line noninvasive screening for WD. When the results for both types of specimens are positive, diagnosis of classic WD should be highly suspected, especially if a high bacterial load is detected. Because PCR of saliva and stool specimens lacks sensitivity for determination of localized WD, invasive samples should be tested on the

  2. Bordetella pertussis diagnosed by polymerase chain reaction

    DEFF Research Database (Denmark)

    Birkebaek, N H; Heron, I; Skjødt, K

    1994-01-01

    The object of this work was to test the polymerase chain reaction (PCR) for demonstration of Bordetella pertussis (BP) in nasopharyngeal secretions. The method was applied to patients with recently diagnosed pertussis, as verified by BP culture. In order to test the sensitivity and specificity of...

  3. Determining Annealing Temperatures for Polymerase Chain Reaction

    Science.gov (United States)

    Porta, Angela R.; Enners, Edward

    2012-01-01

    The polymerase chain reaction (PCR) is a common technique used in high school and undergraduate science teaching. Students often do not fully comprehend the underlying principles of the technique and how optimization of the protocol affects the outcome and analysis. In this molecular biology laboratory, students learn the steps of PCR with an…

  4. Polymerase Chain Reaction for Educational Settings.

    Science.gov (United States)

    Garrison, Stephen J.; dePamphillis, Claude

    1994-01-01

    Suggests the incorporation of the Polymerase Chain Reaction (PCR) technique into high school and college biology laboratories. Discusses the following sections: (1) current PCR applications; (2) PCR technique; (3) Manual and Machine PCR; (4) Manual PCR Preparations and Procedure; (5) Materials, Supplies, and Recipes; (6) Primer Selection; and (7)…

  5. Designing primers and evaluation of the efficiency of propidium monoazide – Quantitative polymerase chain reaction for counting the viable cells of Lactobacillus gasseri and Lactobacillus salivarius

    Directory of Open Access Journals (Sweden)

    Chieh-Hsien Lai

    2017-07-01

    Full Text Available The purpose of this study is to evaluate the efficiency of using propidium monoazide (PMA real-time quantitative polymerase chain reaction (qPCR to count the viable cells of Lactobacillus gasseri and Lactobacillus salivarius in probiotic products. Based on the internal transcription spacer and 23S rRNA genes, two primer sets specific for these two Lactobacillus species were designed. For a probiotic product, the total deMan Rogosa Sharpe plate count was 8.65±0.69 log CFU/g, while for qPCR, the cell counts of L. gasseri and L. salivarius were 8.39±0.14 log CFU/g and 8.57±0.24 log CFU/g, respectively. Under the same conditions, for its heat-killed product, qPCR counts for L. gasseri and L. salivarius were 6.70±0.16 log cells/g and 7.67±0.20 log cells/g, while PMA-qPCR counts were 5.33±0.18 log cells/g and 5.05±0.23 log cells/g, respectively. For cell dilutions with a viable cell count of 8.5 log CFU/mL for L. gasseri and L. salivarius, after heat killing, the PMA-qPCR count for both Lactobacillus species was near 5.5 log cells/mL. When the PMA-qPCR counts of these cell dilutions were compared before and after heat killing, although some DNA might be lost during the heat killing, significant qPCR signals from dead cells, i.e., about 4–5 log cells/mL, could not be reduced by PMA treatment. Increasing PMA concentrations from 100 μM to 200 μM or light exposure time from 5 minutes to 15 minutes had no or, if any, only minor effect on the reduction of qPCR signals from their dead cells. Thus, to differentiate viable lactic acid bacterial cells from dead cells using the PMA-qPCR method, the efficiency of PMA to reduce the qPCR signals from dead cells should be notable.

  6. Quantitative studies of the regular distribution pattern for Salmonella enteritidis in the internal organs of mice after oral challenge by a specific real-time polymerase chain reaction

    Institute of Scientific and Technical Information of China (English)

    Shu-Xuan Deng; An-Chun Cheng; Ming-Shu Wang; Ping Cao; Bin Yan; Nian-Chun Yin; Sheng-Yan Cao; Zhen-Hua Zhang

    2008-01-01

    AIM:To identify and understand the regular distribution pattern for Salmonella enteritidis (S.enteritidis) in the internal organs of mice after an oral challenge over a 3 wk period.METHODS:Assays based on the serovar-specific DNA sequence of S.enteritidis from GenBank,and a serovar-specific real-time,fluorescence-based quantitative polymerase chain reaction (FQ-PCR) were developed for the detection of S.enteritidis.We used this assay to detect genomic DNA of S.enteritidis in the blood and the internal organs,including heart,liver,spleen,kidney,pancreas,and gallbladder,from mice after oral challenge at different time points respectively.RESULTS:The results showed that the spleen was positive at 12 h post inoculation (PI),and the blood was at 14 h PI.The organism was detected in the liver and heart at 16 h PI,the pancreas was positive at 20 h PI,and the final organs to show positive results were the kidney and gallbladder at 22 h PI.The copy number of S.enteritidis DNA in each tissue reached a peak at 24-36 h PI,with the liver and spleen containing high concentrations of S.enteritidis,whereas the blood,heart,kidney,pancreas,and gallbladder had low concentrations.S.enteritidis populations began to decrease and were not detectable at 3 d PI,but were still present up to 12 d PI in the gallbladder,2 wk for the liver,and 3 wk for the spleen without causing apparent symptoms.CONCLUSION:The results provided significant data for understanding the life cycle of S.enteritidis in the internal organs,and showed that the liver and spleen may be the primary sites for setting itself up as a commensa over a long time after oral challenge.Interestingly,it may be the first time reported that the gallbladder is a site of carriage for S.enteritidis over a 12 d period.This study will help to understand the mechanisms of action of S.enteritidis infection in vivo.

  7. Reference gene selection for quantitative reverse transcription-polymerase chain reaction normalization during in vitro adventitious rooting in Eucalyptus globulus Labill

    Directory of Open Access Journals (Sweden)

    Pasquali Giancarlo

    2010-09-01

    Full Text Available Abstract Background Eucalyptus globulus and its hybrids are very important for the cellulose and paper industry mainly due to their low lignin content and frost resistance. However, rooting of cuttings of this species is recalcitrant and exogenous auxin application is often necessary for good root development. To date one of the most accurate methods available for gene expression analysis is quantitative reverse transcription-polymerase chain reaction (qPCR; however, reliable use of this technique requires reference genes for normalization. There is no single reference gene that can be regarded as universal for all experiments and biological materials. Thus, the identification of reliable reference genes must be done for every species and experimental approach. The present study aimed at identifying suitable control genes for normalization of gene expression associated with adventitious rooting in E. globulus microcuttings. Results By the use of two distinct algorithms, geNorm and NormFinder, we have assessed gene expression stability of eleven candidate reference genes in E. globulus: 18S, ACT2, EF2, EUC12, H2B, IDH, SAND, TIP41, TUA, UBI and 33380. The candidate reference genes were evaluated in microccuttings rooted in vitro, in presence or absence of auxin, along six time-points spanning the process of adventitious rooting. Overall, the stability profiles of these genes determined with each one of the algorithms were very similar. Slight differences were observed in the most stable pair of genes indicated by each program: IDH and SAND for geNorm, and H2B and TUA for NormFinder. Both programs indentified UBI and 18S as the most variable genes. To validate these results and select the most suitable reference genes, the expression profile of the ARGONAUTE1 gene was evaluated in relation to the most stable candidate genes indicated by each algorithm. Conclusion Our study showed that expression stability varied between putative reference genes

  8. Quantitative assessment of hematopoietic chimerism by quantitative real-time polymerase chain reaction of sequence polymorphism systems after hematopoietic stem cell transplantation

    Institute of Scientific and Technical Information of China (English)

    QIN Xiao-ying; WANG Jing-zhi; ZHANG Xiao-hui; LI Jin-lan; LI Ling-di; LIU Kai-yan; HUANG Xiao-jun; LI Guo-xuan; QIN Ya-zhen; WANG Yu; WANG Feng-rong; LIU Dai-hong; XU Lan-ping; CHEN Huan; HAN Wei

    2011-01-01

    Background Analysis of changes in recipient and donor hematopoietic cell origin is extremely useful to monitor the effect of hematopoietic stem cell transplantation (HSCT) and sequential adoptive immunotherapy by donor lymphocyte infusions. We developed a sensitive, reliable and rapid real-time PCR method based on sequence polymorphism systems to quantitatively assess the hematopoietic chimerism after HSCT. Methods A panel of 29 selected sequence polymorphism (SP) markers was screened by real-time PCR in 101 HSCT patients with leukemia and other hematological diseases. The chimerism kinetics of bone marrow samples of 8 HSCT patients in remission and relapse situations were followed longitudinally. Results Recipient genotype discrimination was possible in 97.0% (98 of 101) with a mean number of 2.5 (1-7)informative markers per recipient/donor pair. Using serial dilutions of plasmids containing specific SP markers, the linear correlation (r) of 0.99, the slope between -3.2 and -3.7 and the sensitivity of 0.1% were proved reproducible. By this method, it was possible to very accurately detect autologous signals in the range from 0.1% to 30%. The accuracy of the method in the very important range of autologous signals below 5% was extraordinarily high (standard deviation <1.85%),which might significantly improve detection accuracy of changes in autologous signals early in the post-transplantation course of follow-up. The main advantage of the real-time PCR method over short tandem repeat PCR chimerism assays is the absence of PCR competition and plateau biases, with demonstrated greater sensitivity and linearity. Finally, we prospectively analyzed bone marrow samples of 8 patients who received allografts and presented the chimerism kinetics of remission and relapse situations that illustrated the sensitivity level and the promising clinical application of this method. Conclusion This SP-based real-time PCR assay provides a rapid, sensitive, and accurate quantitative

  9. The polymerase chain reaction (PCR): general methods.

    Science.gov (United States)

    Waters, Daniel L E; Shapter, Frances M

    2014-01-01

    The polymerase chain reaction (PCR) converts very low quantities of DNA into very high quantities and is the foundation of many specialized techniques of molecular biology. PCR utilizes components of the cellular machinery of mitotic cell division in vitro which respond predictably to user inputs. This chapter introduces the principles of PCR and discusses practical considerations from target sequence definition through to optimization and application.

  10. Differential regulation of transforming growth factor beta and interleukin 2 genes in human T cells: demonstration by usage of novel competitor DNA constructs in the quantitative polymerase chain reaction

    OpenAIRE

    1991-01-01

    The regulation of mRNA encoding transforming growth factor beta (TGF- beta) and interleukin 2 (IL-2) in normal human T cells was explored using novel competitor DNA constructs in the quantitative polymerase chain reaction and accessory cell-independent T cell activation models. Our experimental design revealed the following: (a) TGF-beta mRNA and IL-2 mRNA are regulated differentially in normal human T cells, quiescent or signaled with the synergistic combinations of: sn-1,2- dioctanoylglycer...

  11. Polymerase chain reaction assay for avian polyomavirus.

    OpenAIRE

    Phalen, D.N.; Wilson, V G; Graham, D L

    1991-01-01

    A polymerase chain reaction assay was developed for detection of budgerigar fledgling disease virus (BFDV). The assay used a single set of primers complementary to sequences located in the putative coding region for the BFDV VP1 gene. The observed amplification product had the expected size of 550 bp and was confirmed to derive from BFDV DNA by its restriction digestion pattern. This assay was specific for BFDV and highly sensitive, being able to detect as few as 20 copies of the virus. By us...

  12. Polymerase chain reaction assay for avian polyomavirus.

    Science.gov (United States)

    Phalen, D N; Wilson, V G; Graham, D L

    1991-05-01

    A polymerase chain reaction assay was developed for detection of budgerigar fledgling disease virus (BFDV). The assay used a single set of primers complementary to sequences located in the putative coding region for the BFDV VP1 gene. The observed amplification product had the expected size of 550 bp and was confirmed to derive from BFDV DNA by its restriction digestion pattern. This assay was specific for BFDV and highly sensitive, being able to detect as few as 20 copies of the virus. By using the polymerase chain reaction, BFDV was detected in adult, nestling, and embryo budgerigar (Melopsitticus undulatus) tissue DNAs and in sera from adult and nestling budgerigars. These results suggest the possibility of persistent infections in adult birds and lend further support to previously described evidence of possible in ovo transmission. BFDV was also detected in chicken embryo fibroblast cell cultures and chicken eggs inoculated with the virus. A 550-bp product with identical restriction enzyme sites was amplified from a suspected polyomavirus isolated from a peach-faced lovebird (Agapornis pesonata) and from tissue DNA from a Hahn's macaw (Ara nobilis) and a sun conure (Aratinga solstitialis) with histological lesions suggestive of polyomavirus infection. These fragments also hybridized with a BFDV-derived probe, proving that they were derived from a polyomavirus very similar, if not identical, to BFDV.

  13. Fluorescent antibody test, quantitative polymerase chain reaction pattern and clinical aspects of rabies virus strains isolated from main reservoirs in Brazil

    Directory of Open Access Journals (Sweden)

    Camila Appolinário

    2015-10-01

    Full Text Available ABSTRACTRabies virus (RABV isolated from different mammals seems to have unique characteristics that influence the outcome of infection. RABV circulates in nature and is maintained by reservoirs that are responsible for the persistence of the disease for almost 4000 years. Considering the different pattern of pathogenicity of RABV strains in naturally and experimentally infected animals, the aim of this study was to analyze the characteristics of RABV variants isolated from the main Brazilian reservoirs, being related to a dog (variant 2,Desmodus rotundus (variant 3, crab eating fox, marmoset, and Myotis spp. Viral replication in brain tissue of experimentally infected mouse was evaluated by two laboratory techniques and the results were compared to clinical evolution from five RABV variants. The presence of the RABV was investigated in brain samples by fluorescent antibody test (FAT and real time polymerase chain reaction (qRT-PCR for quantification of rabies virus nucleoprotein gene (N gene. Virus replication is not correlated with clinical signs and evolution. The pattern of FAT is associated with RABV replication levels. Virus isolates from crab eating fox and marmoset had a longer evolution period and higher survival rate suggesting that the evolution period may contribute to the outcome. RABV virus variants had independent characteristics that determine the clinical evolution and survival of the infected mice.

  14. Fluorescent antibody test, quantitative polymerase chain reaction pattern and clinical aspects of rabies virus strains isolated from main reservoirs in Brazil.

    Science.gov (United States)

    Appolinário, Camila; Allendorf, Susan Dora; Vicente, Acácia Ferreira; Ribeiro, Bruna Devidé; Fonseca, Clóvis Reinaldo da; Antunes, João Marcelo; Peres, Marina Gea; Kotait, Ivanete; Carrieri, Maria Luiza; Megid, Jane

    2015-01-01

    Rabies virus (RABV) isolated from different mammals seems to have unique characteristics that influence the outcome of infection. RABV circulates in nature and is maintained by reservoirs that are responsible for the persistence of the disease for almost 4000 years. Considering the different pattern of pathogenicity of RABV strains in naturally and experimentally infected animals, the aim of this study was to analyze the characteristics of RABV variants isolated from the main Brazilian reservoirs, being related to a dog (variant 2), Desmodus rotundus (variant 3), crab eating fox, marmoset, and Myotis spp. Viral replication in brain tissue of experimentally infected mouse was evaluated by two laboratory techniques and the results were compared to clinical evolution from five RABV variants. The presence of the RABV was investigated in brain samples by fluorescent antibody test (FAT) and real time polymerase chain reaction (qRT-PCR) for quantification of rabies virus nucleoprotein gene (N gene). Virus replication is not correlated with clinical signs and evolution. The pattern of FAT is associated with RABV replication levels. Virus isolates from crab eating fox and marmoset had a longer evolution period and higher survival rate suggesting that the evolution period may contribute to the outcome. RABV virus variants had independent characteristics that determine the clinical evolution and survival of the infected mice.

  15. Short communication: prospective comparison of qualitative versus quantitative polymerase chain reaction for monitoring virologic treatment failure in HIV-infected patients.

    Science.gov (United States)

    Jeong, Su Jin; Kim, Min Hyung; Song, Je Eun; Ahn, Jin Young; Kim, Sun Bean; Ann, Hea Won; Kim, Jae Kyung; Choi, Heun; Ku, Nam Su; Han, Sang Hoon; Kim, June Myung; Smith, Davey M; Kim, Hyon-Suk; Choi, Jun Yong

    2014-08-01

    Less costly but still accurate methods for monitoring HIV treatment response are needed. We prospectively evaluated if a qualitative polymerase chain reaction (PCR) amplification assay for virologic monitoring could maintain accuracy while reducing costs in Seoul, South Korea. We conducted the first prospective study comparing a qualitative PCR amplification of HIV-1 reverse transcriptase (RT) versus a commercial real time PCR assay (i.e., viral load) for virologic monitoring of 150 patients receiving antiretroviral therapy (ART) between November 2011 and August 2012 at an urban hospital in Seoul, South Korea. A total of 215 blood plasma samples from 150 patients receiving ART for more than 6 months were evaluated. Using the individual viral load assay, 12 of 215 (5.6%) plasma samples had more than 500 HIV RNA copies/ml. The qualitative PCR amplification assay detected individual samples with ≥500 HIV RNA copies/ml with 100% sensitivity. The specificities of the qualitative PCR amplification of the HIV-1 RT assay were 94.1%, 93.6%, and 93.2% compared to the real time PCR at 500, 1,000, and 5,000 threshold of HIV RNA copies/ml, respectively, and $24,940 USD would have been saved for 150 patients during 10 months. The qualitative PCR amplification of the HIV-1 RT assay might be a useful approach to effectively monitor patients receiving ART and save resources.

  16. Detection of CAPN10 copy number variation in Thai patients with type 2 diabetes by denaturing high performance liquid chromatography and real-time quantitative polymerase chain reaction

    Science.gov (United States)

    Plengvidhya, Nattachet; Chanprasert, Kanjana; Tangjittipokin, Watip; Thongnoppakhun, Wanna; Yenchitsomanus, Pa-thai

    2015-01-01

    Aims/Introduction A combination of multiple genetic and environmental factors contribute to the pathogenesis of type 2 diabetes. Copy number variations (CNVs) are associated with complex human diseases. However, CNVs can cause genotype deviation from the Hardy–Weinberg equilibrium (HWE). A genetic case–control association study in 216 Thai diabetic patients and 192 non-diabetic controls found that, after excluding genotyping errors, genotype distribution of calpain 10 (CAPN10) SNP44 (rs2975760) deviated from HWE. Here, we aimed to detect CNV within the CAPN10 SNP44 region. Materials and Methods CNV within the CAPN10 SNP44 region was detected using denaturing high-performance liquid chromatography, and the results confirmed by real-time quantitative polymerase chain reaction with SYBR Green I. Results Both methods successfully identified CNV in the CAPN10 SNP44 region, obtaining concordant results. Correction of genotype calling based on the status of identified CNVs showed that the CAPN10 SNP44 genotype is in good agreement with HWE (P > 0.05). However, no association between CNV genotypes and risk of type 2 diabetes was observed. Conclusions Identified CNVs for CAPN10 SNP44 genotypes lead to deviation from HWE. Furthermore, both denaturing high-performance liquid chromatography and real-time quantitative polymerase chain reaction are useful for detecting CNVs. PMID:26543536

  17. Development, Evaluation, and Integration of a Quantitative Reverse-Transcription Polymerase Chain Reaction Diagnostic Test for Ebola Virus on a Molecular Diagnostics Platform.

    Science.gov (United States)

    Cnops, Lieselotte; Van den Eede, Peter; Pettitt, James; Heyndrickx, Leo; De Smet, Birgit; Coppens, Sandra; Andries, Ilse; Pattery, Theresa; Van Hove, Luc; Meersseman, Geert; Van Den Herrewegen, Sari; Vergauwe, Nicolas; Thijs, Rein; Jahrling, Peter B; Nauwelaers, David; Ariën, Kevin K

    2016-10-15

     The 2013-2016 Ebola epidemic in West Africa resulted in accelerated development of rapid diagnostic tests for emergency outbreak preparedness. We describe the development and evaluation of the Idylla™ prototype Ebola virus test, a fully automated sample-to-result molecular diagnostic test for rapid detection of Zaire ebolavirus (EBOV) and Sudan ebolavirus (SUDV).  The Idylla™ prototype Ebola virus test can simultaneously detect EBOV and SUDV in 200 µL of whole blood. The sample is directly added to a disposable cartridge containing all reagents for sample preparation, RNA extraction, and amplification by reverse-transcription polymerase chain reaction analysis. The performance was evaluated with a variety of sample types, including synthetic constructs and whole blood samples from healthy volunteers spiked with viral RNA, inactivated virus, and infectious virus.  The 95% limits of detection for EBOV and SUDV were 465 plaque-forming units (PFU)/mL (1010 copies/mL) and 324 PFU/mL (8204 copies/mL), respectively. In silico and in vitro analyses demonstrated 100% correct reactivity for EBOV and SUDV and no cross-reactivity with relevant pathogens. The diagnostic sensitivity was 97.4% (for EBOV) and 91.7% (for SUDV), the specificity was 100%, and the diagnostic accuracy was 95.9%.  The Idylla™ prototype Ebola virus test is a fast, safe, easy-to-use, and near-patient test that meets the performance criteria to detect EBOV in patients with suspected Ebola. © The Author 2016. Published by Oxford University Press for the Infectious Diseases Society of America. All rights reserved. For permissions, e-mail journals.permissions@oup.com.

  18. Polymerase Chain Reaction on a Viral Nanoparticle.

    Science.gov (United States)

    Carr-Smith, James; Pacheco-Gómez, Raúl; Little, Haydn A; Hicks, Matthew R; Sandhu, Sandeep; Steinke, Nadja; Smith, David J; Rodger, Alison; Goodchild, Sarah A; Lukaszewski, Roman A; Tucker, James H R; Dafforn, Timothy R

    2015-12-18

    The field of synthetic biology includes studies that aim to develop new materials and devices from biomolecules. In recent years, much work has been carried out using a range of biomolecular chassis including α-helical coiled coils, β-sheet amyloids and even viral particles. In this work, we show how hybrid bionanoparticles can be produced from a viral M13 bacteriophage scaffold through conjugation with DNA primers that can template a polymerase chain reaction (PCR). This unprecedented example of a PCR on a virus particle has been studied by flow aligned linear dichroism spectroscopy, which gives information on the structure of the product as well as a new protototype methodology for DNA detection. We propose that this demonstration of PCR on the surface of a bionanoparticle is a useful addition to ways in which hybrid assemblies may be constructed using synthetic biology.

  19. Polymerase chain reaction with nearby primers.

    Science.gov (United States)

    Garafutdinov, Ravil R; Galimova, Aizilya A; Sakhabutdinova, Assol R

    2017-02-01

    DNA analysis of biological specimens containing degraded nucleic acids such as mortal remains, archaeological artefacts, forensic samples etc. has gained more attention in recent years. DNA extracted from these samples is often inapplicable for conventional polymerase chain reaction (PCR), so for its amplification the nearby primers are commonly used. Here we report the data that clarify the features of PCR with nearby and abutting primers. We have shown that the proximity of primers leads to significant reduction of the reaction time and ensures the successful performance of DNA amplification even in the presence of PCR inhibitors. The PCR with abutting primers is usually characterized by the absence of nonspecific amplification products that causes extreme sensitivity with limit of detection on single copy level. The feasibility of PCR with abutting primers was demonstrated on species identification of 100 years old rotten wood. Copyright © 2016 Elsevier Inc. All rights reserved.

  20. Bordetella pertussis diagnosed by polymerase chain reaction

    DEFF Research Database (Denmark)

    Birkebaek, N H; Heron, I; Skjødt, K

    1994-01-01

    The object of this work was to test the polymerase chain reaction (PCR) for demonstration of Bordetella pertussis (BP) in nasopharyngeal secretions. The method was applied to patients with recently diagnosed pertussis, as verified by BP culture. In order to test the sensitivity and specificity...... in 25 patients in whose nasopharyngeal secretions BP had been demonstrated after 4-7 days of culture. The detection limit of PCR in aqueous solution was 1-2 BP bacteria per reaction tube. PCR was 100% specific for BP, showing no response with other Bordetella species or other bacteria known to colonize...... of PCR for the diagnosis of BP, we used known concentrations of BP, Bordetella parapertussis and Bordetella bronchiseptica in aqueous solutions. PCR was furthermore carried out on species of bacteria that might be isolated from the nasopharynx. The applicability of PCR to patient specimens was tested...

  1. [Polymerase chain reaction and its application].

    Science.gov (United States)

    Sárosi, I; Gerald, E; Girish, V N

    1992-07-01

    The polymerase chain reaction (PCR) is one of the most important new methods in molecular biology. It is widely used in genetic and anthropologic basic research, in oncology and virology, in all those fields, where molecular biologic methods can give answers to the questions raised. The procedure enables one to multiply with extreme precision targeted pieces of amounts as little as one target molecule of DNA or RNA by five to six logs, making them easy to be handled and examined by routine molecular biological methods. The method is presented through one possible application field, that is of great importance in the study of hepatocarcinogenesis. Sensitivity of PCR in detection of hepatitis B virus DNA is greater by four logs than animal inoculation, the last most sensitive method known.

  2. Towards quantitative mRNA analysis in paraffin-embedded tissues using real-time reverse transcriptase-polymerase chain reaction: a methodological study on lymph nodes from melanoma patients.

    Science.gov (United States)

    Abrahamsen, Helene Nortvig; Steiniche, Torben; Nexo, Ebba; Hamilton-Dutoit, Stephen J; Sorensen, Boe Sandahl

    2003-02-01

    Improved extraction techniques combined with sensitive real-time reverse transcriptase-polymerase chain reaction may allow detection of mRNA in formalin-fixed, paraffin-embedded (FFPE) materials, but the factors affecting mRNA quantification in clinical material using these methods have not been systematically analyzed. We designed analyses using real-time reverse transcriptase-polymerase chain reaction for quantification of MART-1, beta-actin, and beta(2)-microglobulin mRNAs. The analytical intra- and interassay imprecision (coefficient of variation) was in the range 10 to 20% for all three genes studied. Using these protocols, we studied the influence of tissue autolysis and length of formalin-fixation on mRNA detection in metastatic melanoma. Delay in freezing reduced detectable mRNA, although this was less than predicted and mostly occurred early in autolysis. MART-1, beta-actin, and beta(2)-microglobulin mRNAs were consistently detected in FFPE metastatic melanoma even after fixation for up to 3 weeks, although the total mRNA detected was markedly reduced in fixed compared with fresh tissues (up to 99%). Quantification of MART-1 was, however, possible if this was expressed relative to a housekeeping gene. The polymerase chain reaction product from FFPE tissues could be increased up to 100-fold amplifying short (tissue processing and in fixation length seem to be less important sources of imprecision than previously assumed. Our findings suggest that quantitative analysis of mRNA in archive and routine diagnostic tissues may be possible.

  3. The polymerase chain reaction: current and future clinical applications.

    OpenAIRE

    Lynch, J R; Brown, J. M.

    1990-01-01

    The polymerase chain reaction has undergone rapid improvement since its initial development, such that the technique currently permits rapid, accurate, predictive tests to be made in the field of prenatal diagnosis and has greatly aided forensic medicine. It is anticipated that the polymerase chain reaction will also facilitate advances in other fields, in particular preimplantation diagnosis, virology, bacteriology, and cancer therapy.

  4. A Practical Polymerase Chain Reaction Laboratory for Introductory Biology Classes.

    Science.gov (United States)

    Bowlus, R. David; Grether, Susan C.

    1996-01-01

    Presents a polymerase chain reaction (PCR) laboratory exercise that can be performed by introductory biology students in 1 45- to 55-minute class period. Includes a general description of the polymerase chain reaction, materials needed, procedure, and details of interest to teachers. (JRH)

  5. Actinobaculum suis Detection Using Polymerase Chain Reaction

    Directory of Open Access Journals (Sweden)

    Cristina Román Amigo

    2012-01-01

    Full Text Available Actinobaculum suis is an important agent related to urinary infection in swine females. Due to its fastidious growth characteristics, the isolation of this anaerobic bacterium is difficult, thus impairing the estimation of its prevalence. The purpose of this study was to develop and test a polymerase chain reaction (PCR for the detection and identification of A. suis and then compare these results with traditional isolation methods. Bacterial isolation and PCR were performed on one hundred and ninety-two urine samples from sows and forty-five preputial swabs from boars. The results indicate that this PCR was specific for A. suis, presenting a detection limit between 1.0×101 CFU/mL and 1.0×102 CFU/mL. A. suis frequencies, as measured by PCR, were 8.9% (17/192 in sow urine samples and 82.2% (37/45 in preputial swabs. Assessed using conventional culturing techniques, none of the urine samples were positive for A. suis; however, A. suis was detected in 31.1% (14/45 of the swabs. This PCR technique was shown to be an efficient method for the detection of A. suis in urine and preputial swabs.

  6. A kinetic-based sigmoidal model for the polymerase chain reaction and its application to high-capacity absolute quantitative real-time PCR

    Directory of Open Access Journals (Sweden)

    Stewart Don

    2008-05-01

    Full Text Available Abstract Background Based upon defining a common reference point, current real-time quantitative PCR technologies compare relative differences in amplification profile position. As such, absolute quantification requires construction of target-specific standard curves that are highly resource intensive and prone to introducing quantitative errors. Sigmoidal modeling using nonlinear regression has previously demonstrated that absolute quantification can be accomplished without standard curves; however, quantitative errors caused by distortions within the plateau phase have impeded effective implementation of this alternative approach. Results Recognition that amplification rate is linearly correlated to amplicon quantity led to the derivation of two sigmoid functions that allow target quantification via linear regression analysis. In addition to circumventing quantitative errors produced by plateau distortions, this approach allows the amplification efficiency within individual amplification reactions to be determined. Absolute quantification is accomplished by first converting individual fluorescence readings into target quantity expressed in fluorescence units, followed by conversion into the number of target molecules via optical calibration. Founded upon expressing reaction fluorescence in relation to amplicon DNA mass, a seminal element of this study was to implement optical calibration using lambda gDNA as a universal quantitative standard. Not only does this eliminate the need to prepare target-specific quantitative standards, it relegates establishment of quantitative scale to a single, highly defined entity. The quantitative competency of this approach was assessed by exploiting "limiting dilution assay" for absolute quantification, which provided an independent gold standard from which to verify quantitative accuracy. This yielded substantive corroborating evidence that absolute accuracies of ± 25% can be routinely achieved. Comparison

  7. Quantitative shearing linear amplification polymerase chain reaction: an improved method for quantifying lentiviral vector insertion sites in transplanted hematopoietic cell systems.

    Science.gov (United States)

    Zhou, Sheng; Bonner, Melissa A; Wang, Yong-Dong; Rapp, Samuel; De Ravin, Suk See; Malech, Harry L; Sorrentino, Brian P

    2015-02-01

    In gene therapy trials targeting blood disorders, it is important to detect dominance of transduced hematopoietic stem cell (HSC) clones arising from vector insertion site (VIS) effects. Current methods for VIS analysis often do not have defined levels of quantitative accuracy and therefore can fail to detect early clonal dominance. We have developed a rapid and inexpensive method for measuring clone size based on random shearing of genomic DNA, minimal exponential PCR amplification, and shear site counts as a quantitative endpoint. This quantitative shearing linear amplification PCR (qsLAM PCR) assay utilizes an internal control sample containing 19 lentiviral insertion sites per cell that is mixed with polyclonal samples derived from transduced human CD34+ cells. Samples were analyzed from transplanted pigtail macaques and from a participant in our X-linked severe combined immunodeficiency (XSCID) lentiviral vector trial and yielded controlled and quantitative results in all cases. One case of early clonal dominance was detected in a monkey transplanted with limiting numbers of transduced HSCs, while the clinical samples from the XSCID trial participant showed highly diverse clonal representation. These studies demonstrate that qsLAM PCR is a facile and quantitative assay for measuring clonal repertoires in subjects enrolled in human gene therapy trials using lentiviral-transduced HSCs.

  8. an overview on the application of polymerase chain reaction (pcr)

    African Journals Online (AJOL)

    DR. AMINU

    Bayero Journal of Pure and Applied Sciences, 2(1): 109 - 114 ... Keywords: Polymerase chain reaction, Diagnosis, Bacteria, Infections .... A brain abscess is a localized pyogenic bacterial ... as encephalitis and skin rash. ... Streptococcus.

  9. Problem-Solving Test: Real-Time Polymerase Chain Reaction

    Science.gov (United States)

    Szeberenyi, Jozsef

    2009-01-01

    Terms to be familiar with before you start to solve the test: polymerase chain reaction, DNA amplification, electrophoresis, breast cancer, "HER2" gene, genomic DNA, "in vitro" DNA synthesis, template, primer, Taq polymerase, 5[prime][right arrow]3[prime] elongation activity, 5[prime][right arrow]3[prime] exonuclease activity, deoxyribonucleoside…

  10. [Usefulness of a real-time quantitative polymerase-chain reaction (PCR) assay for the diagnosis of congenital and postnatal cytomegalovirus infection].

    Science.gov (United States)

    Reina, J; Weber, I; Riera, E; Busquets, M; Morales, C

    2014-05-01

    Cytomegalovirus (CMV) is the main virus causing congenital and postnatal infections in the pediatric population. The aim of this study is to evaluate the usefulness of a quantitative real-time PCR in the diagnosis of these infections using urine as a single sample. We studied all the urine samples of newborns (PCR (PCRc), and quantitative real-time PCR (PCRq). We analyzed 332 urine samples (270 to rule out congenital infection and 62 postnatal infections). Of the first, 22 were positive in the PCRq, 19 in the PCRc, and 17 in the culture. PCRq had a sensitivity of 100%, on comparing the culture with the rest of the techniques. Using the PCRq as a reference method, culture had a sensitivity of 77.2%, and PCRc 86.3%. In cases of postnatal infection, PCRq detected 16 positive urines, the PCRq 12, and the cell culture 10. The urines showed viral loads ranging from 2,178 to 116,641 copies/ml. The genomic amplification technique PCRq in real time was more sensitive than the other techniques evaluated. This technique should be considered as a reference (gold standard), leaving the cell culture as a second diagnostic level. The low cost and the automation of PCRq would enable the screening for CMV infection in large neonatal and postnatal populations. Copyright © 2013 Asociación Española de Pediatría. Published by Elsevier Espana. All rights reserved.

  11. Development of Quantitative Real-time Polymerase Chain Reaction for the Detection of Vibrio vulnificus Based on Hemolysin (vvhA) Coding System

    Institute of Scientific and Technical Information of China (English)

    ZENG-HUI WU; YONG-LIANG LOU; YI-YU LU; JIE YAN

    2008-01-01

    To establish a TaqMan real-time fluorescent quantitative PCR to detect Vibrio vulnificus based on the hemolysin gene (vvhA) coding cytolysin. Methods Primers and probes in the conserved region of the vvhA gene sequence were designed for the TaqMan real-time PCR to detect 100 bp amplicon from V. vulnificus DNA. Recombinant plasmid pMD19-vvhA100 was constructed and used as a positive control during the detection. Minimal amplification cycles (Ct value) and fluorescence intensity enhancement (△Rn value) were used as observing indexes to optimize the reaction conditions of TaqMan real-time PCR. The TaqMan assay for the detection of Vbirio vulnificus was evaluated in pure culture, mice tissue which artificially contaminated Vibrio vulnificus and clinical samples. Results The established TaqMan real-time PCR showed positive results only for Vibrio vulnificus DNA and pMD19-vvhA100. The standard curve was plotted and the minimum level of the vvhA target from the recombinant plasmid DNA was 10 copies with a Ct value of 37.94±0.19, as the equivalent of 0.01 ng purified genomic DNA of Vibrio vulnificus. The results detected by TaqMan PCR were positive for the 16 clinical samples and all the specimens of peripheral blood and subcutaneous tissue of mice which were infected with Vibrio vulnificus. Conclusion TaqMan real-time PCR is a rapid, effective, and quantitative tool to detect Vibro vulnificus, and can be used in clinical laboratory diagnosis of septicemia and wound infection caused by Vibrio vulnificus.

  12. Single-Step RNA Extraction from Different Hydrogel-Embedded Mesenchymal Stem Cells for Quantitative Reverse Transcription-Polymerase Chain Reaction Analysis.

    Science.gov (United States)

    Köster, Natascha; Schmiermund, Alexandra; Grubelnig, Stefan; Leber, Jasmin; Ehlicke, Franziska; Czermak, Peter; Salzig, Denise

    2016-06-01

    For many tissue engineering applications, cells such as human mesenchymal stem cells (hMSCs) must be embedded in hydrogels. The analysis of embedded hMSCs requires RNA extraction, but common extraction procedures often produce low yields and/or poor quality RNA. We systematically investigated four homogenization methods combined with eight RNA extraction protocols for hMSCs embedded in three common hydrogel types (alginate, agarose, and gelatin). We found for all three hydrogel types that using liquid nitrogen or a rotor-stator produced low RNA yields, whereas using a microhomogenizer or enzymatic/chemical hydrogel digestion achieved better yields regardless of which extraction protocol was subsequently applied. The hot phenol extraction protocol generally achieved the highest A260 values (representing up to 40.8 μg RNA per 10(6) cells), but the cetyltrimethylammonium bromide (CTAB) method produced RNA of better quality, with A260/A280 and A260/A230 ratios and UV spectra similar to the pure RNA control. The RNA produced by this method was also suitable as a template for endpoint and quantitative reverse transcription-PCR (qRT-PCR), achieving low Ct values of ∼20. The prudent choice of hydrogel homogenization and RNA extraction methods can ensure the preparation of high-quality RNA that generates reliable endpoint and quantitative RT-PCR data. We therefore propose a universal method that is suitable for the extraction of RNA from cells embedded in all three hydrogel types commonly used for tissue engineering.

  13. Evaluation of RNA extraction methods and identification of putative reference genes for real-time quantitative polymerase chain reaction expression studies on olive (Olea europaea L.) fruits.

    Science.gov (United States)

    Nonis, Alberto; Vezzaro, Alice; Ruperti, Benedetto

    2012-07-11

    Genome wide transcriptomic surveys together with targeted molecular studies are uncovering an ever increasing number of differentially expressed genes in relation to agriculturally relevant processes in olive (Olea europaea L). These data need to be supported by quantitative approaches enabling the precise estimation of transcript abundance. qPCR being the most widely adopted technique for mRNA quantification, preliminary work needs to be done to set up robust methods for extraction of fully functional RNA and for the identification of the best reference genes to obtain reliable quantification of transcripts. In this work, we have assessed different methods for their suitability for RNA extraction from olive fruits and leaves and we have evaluated thirteen potential candidate reference genes on 21 RNA samples belonging to fruit developmental/ripening series and to leaves subjected to wounding. By using two different algorithms, GAPDH2 and PP2A1 were identified as the best reference genes for olive fruit development and ripening, and their effectiveness for normalization of expression of two ripening marker genes was demonstrated.

  14. Comparison of real-time polymerase chain reaction with the COBAS Amplicor test for quantitation of hepatitis B virus DNA in serum samples

    Institute of Scientific and Technical Information of China (English)

    Ming Shi; Yong Zhang; Ying-Hua Zhu; Jing Zhang; Wei-Jia Xu

    2008-01-01

    AIM: To compare the clinical performance of a real-time PCR assay with the COBAS Amplicor Hepatitis B Virus (HBV) Monitor test for quantitation of HBV DNA in serum samples. METHODS: The reference sera of the Chinese National Institute for the Control of Pharmaceutical and Biological Products and the National Center for Clinical Laboratories of China, and 158 clinical serum samples were used in this study. The linearity, accuracy, reproducibility, assay time, and costs of the real-time PCR were evaluated and compared with those of the Cobas Amplicor test. RESULTS: The intra-assay and inter-assay variations of the real-time PCR ranged from 0.3% to 3.8% and 1.4% to 8.1%, respectively. The HBV DNA levels measured by the real-time PCR correlated very well with those obtained with the COBAS Amplicor test (r = 0.948). The real-time PCR HBV DNA kit was much cheaper and had a wider dynamic range. CONCLUSION: The real-time PCR assay is an excellent tool for monitoring of HBV DNA levels in patients with chronic hepatitis B.

  15. Rapid detection and quantification of Ebola Zaire virus by one-step real-time quantitative reverse transcription-polymerase chain reaction.

    Science.gov (United States)

    Ro, Young-Tae; Ticer, Anysha; Carrion, Ricardo; Patterson, Jean L

    2017-04-01

    Given that Ebola virus causes severe hemorrhagic fever in humans with mortality rates as high as 90%, rapid and accurate detection of this virus is essential both for controlling infection and preventing further transmission. Here, a one-step qRT-PCR assay for rapid and quantitative detection of an Ebola Zaire strain using GP, VP24 or VP40 genes as a target is introduced. Routine assay conditions for hydrolysis probe detection were established from the manufacturer's protocol used in the assays. The analytical specificity and sensitivity of each assay was evaluated using in vitro synthesized viral RNA transcripts. The assays were highly specific for the RNA transcripts, no cross-reactivity being observed among them. The limits of detection of the assays ranged from 10(2) to 10(3) copies per reaction. The assays were also evaluated using viral RNAs extracted from cell culture-propagated viruses (Ebola Zaire, Sudan and Reston strains), confirming that they are gene- and strain-specific. The RT-PCR assays detected viral RNAs in blood samples from virus-infected animal, suggesting that they can be also a useful method for identifying Ebola virus in clinical samples. © 2017 The Societies and John Wiley & Sons Australia, Ltd.

  16. Development of a quantitative real-time polymerase chain reaction assay to target a novel group of ammonia-producing bacteria found in poultry litter.

    Science.gov (United States)

    Rothrock, M J; Cook, K L; Lovanh, N; Warren, J G; Sistani, K

    2008-06-01

    Ammonia production in poultry houses has serious implications for flock health and performance, nutrient value of poultry litter, and energy costs for running poultry operations. In poultry litter, the conversion of organic N (uric acid and urea) to NH(4)-N is a microbially mediated process. The urease enzyme is responsible for the final step in the conversion of urea to NH(4)-N. Cloning and analysis of 168 urease sequences from extracted genomic DNA from poultry litter samples revealed the presence of a novel, dominant group of ureolytic microbes (representing 90% of the urease clone library). Specific primers and a probe were designed to target this novel poultry litter urease producer (PLUP) group, and a new quantitative real-time PCR assay was developed. The assay allowed for the detection of 10(2) copies of target urease sequences per PCR reaction (approximately 1 x 10(4) cells per gram of poultry litter), and the reaction was linear over 8 orders of magnitude. Our PLUP group was present only in poultry litter and was not present in environmental samples from diverse agricultural settings. This novel PLUP group represented between 0.1 to 3.1% of the total microbial populations (6.0 x 10(6) to 2.4 x 10(8) PLUP cells per gram of litter) from diverse poultry litter types. The PLUP cell concentrations were directly correlated to the total cell concentrations in the poultry litter and were found to be influenced by the physical parameters of the litters (bedding material, moisture content, pH), as well as the NH(4)-N content of the litters, based on principal component analysis. Chemical parameters (organic N, total N, total C) were not found to be influential in the concentrations of our PLUP group in the diverse poultry litters Future applications of this assay could include determining the efficacy of current NH(4)-N-reducing litter amendments or in designing more efficient treatment protocols.

  17. Detection and quantitation of infectious pancreatic necrosis virus by real-time reverse transcriptase-polymerase chain reaction using lethal and non-lethal tissue sampling.

    Science.gov (United States)

    Bowers, Robert M; Lapatra, Scott E; Dhar, Arun K

    2008-02-01

    Infectious pancreatic necrosis virus (IPNV) is a bisegmented double-stranded RNA virus belonging to the family Birnaviridae, genus Aquabirnavirus, which is a major viral pathogen of salmonid fish. The virus infects wild and cultured salmonids, causing high mortality in juvenile trout and salmon. A highly sensitive and specific real-time RT-PCR assay using the fluorogenic dye SYBR((R)) Green I was developed for the detection and quantitation of IPNV in rainbow trout (Oncorhynchus mykiss). Rainbow trout were infected experimentally with IPNV in the laboratory by injection or immersion and then pectoral fin, spleen, and head kidney samples were collected for analysis. The corresponding cDNA was synthesized using DNase I-treated total RNA and then real-time RT-PCR was performed using primers based on the IPNV non-structural protein gene, designated as either NS or VP4. Rainbow trout beta-actin and elongation factor 1alpha (EF-1alpha) genes were used as internal controls. Using real-time RT-PCR, the virus was successfully detected in pectoral fin, spleen, and head kidney tissue samples. The dissociation curves for each amplicon showed a single melting peak at 83, 81.5, and 84 degrees C for IPNV NS, trout beta-actin, and EF-1alpha genes, respectively. The amplicon size and nucleotide sequence was used to confirm the specificity of the products. Using a dilution series of in vitro transcribed RNA, IPNV was reliably detected down to 10 RNA copies and had a dynamic range up to 10(7) RNA copies. A time course assay, using immersion challenged samples, revealed that the virus could be detected in pectoral fin, spleen, and head kidney as early as 24h post-challenge. The average viral load in all three tissues increased over time, reaching its highest level at 21 days post-challenge, which was followed by a slight decrease at 28 days post-challenge. IPNV load in pectoral fin tissue was comparable to the viral load in spleen and head kidney tissues, indicating that pectoral fin

  18. Temperature inactivation of Feline calicivirus vaccine strain FCV F-9 in comparison with human noroviruses using an RNA exposure assay and reverse transcribed quantitative real-time polymerase chain reaction-A novel method for predicting virus infectivity.

    Science.gov (United States)

    Topping, J R; Schnerr, H; Haines, J; Scott, M; Carter, M J; Willcocks, M M; Bellamy, K; Brown, D W; Gray, J J; Gallimore, C I; Knight, A I

    2009-03-01

    A one-step reverse transcription quantitative real-time polymerase chain reaction (RT-QPCR) method in combination with RNase treatment and low copy number samples was developed in order to examine the effect of temperature on the ability of virus capsids to protect their RNA content. The method was applied to a non-cultivable virus (GII.4 norovirus) and Feline calicivirus vaccine strain F-9 (FCV) which is often used as a norovirus surrogate. Results demonstrated that FCV RNA is exposed maximally after 2min at 63.3 degrees C and this correlated with a greater than 4.5log reduction in infectivity as assessed by plaque assay. In contrast human GII.4 norovirus RNA present in diluted clinical specimens was not exposed maximally until 76.6 degrees C, at least 13.3 degrees C greater than that for FCV. These data suggest that norovirus possesses greater thermostability than this commonly used surrogate. Further, these studies indicate that current food processing regimes for pasteurisation are insufficient to achieve inactivation of GII.4 NoVs. The method provides a novel molecular method for predicting virus infectivity.

  19. Association of clinical status of follicular lymphoma patients after autologous stem cell transplant and quantitative assessment of lymphoma in blood and bone marrow as measured by SYBR Green I polymerase chain reaction.

    Science.gov (United States)

    Pennell, Nancy; Woods, Anthony; Reis, Marciano; Buckstein, Rena; Spaner, David; Imrie, Kevin; Hewitt, Karen; Boudreau, Angela; Seth, Arun; Berinstein, Neil L

    2006-02-01

    Molecular remission in the autograft and bone marrow after transplant are predictive of durable clinical remission in relapsed follicular lymphoma. Thus, a simple reliable method to quantify minimal residual disease (MRD) would improve prognostication in these patients. Fluorescent hybridization probes have been used in real-time quantitative polymerase chain reaction (RQ-PCR) to monitor MRD with a reproducible sensitivity of 0.01%; however, these techniques are expensive and require additional experiments to examine clonality. We describe a SYBR Green I detection method that is more universal, checks clonal identity, yields the same sensitivity for monitoring MRD, and is more economically attractive. Using this method to follow 14 follicular lymphoma patients treated with autologous stem cell transplantation, molecular markers were successfully defined for 12 patients. Median contamination of stem-cell grafts was 0.1% (range, 0 to 13%). Six patients with measurable graft contamination became PCR-negative in blood and bone marrow within 12 months after autologous stem cell transplantation. Three patients free of disease progression (median follow-up of 75 months) are in molecular remission. Increasing fractions of RQ-PCR-positive blood and bone marrow cells reliably predicted morphological and clinical relapse. In one case, both clinical relapse and spontaneous regression were reflected by changes in MRD levels. Thus, our RQ-PCR method reproducibly distinguishes different levels of MRD.

  20. Accuracy of marker analysis, quantitative real-time polymerase chain reaction, and multiple ligation-dependent probe amplification to determine SMN2 copy number in patients with spinal muscular atrophy.

    Science.gov (United States)

    Alías, Laura; Bernal, Sara; Barceló, Maria J; Also-Rallo, Eva; Martínez-Hernández, Rebeca; Rodríguez-Alvarez, Francisco J; Hernández-Chico, Concepción; Baiget, Montserrat; Tizzano, Eduardo F

    2011-09-01

    Spinal muscular atrophy (SMA) is an autosomal recessive neuromuscular disorder caused by absence of or mutations in the survival motor neuron1 gene (SMN1). All SMA patients have a highly homologous copy of SMN1, the SMN2 gene. Severe (type I) SMA patients present one or two SMN2 copies, whereas milder chronic forms (type II-III) usually have three or four SMN2 copies. SMN2 dosage is important to stratify patients for motor function tests and clinical trials. Our aim was to compare three methods, marker analysis, real-time quantitative polymerase chain reaction using the LightCycler instrument, and multiple ligation-dependent probe amplification (MLPA), to characterize their accuracy in quantifying SMN2 genes. We studied a group of 62 genetically confirmed SMA patients, 54 with homozygous absence of exons 7 and 8 of SMN1 and 8 with SMN2-SMN1 hybrid genes. A complete correlation using the three methods was observed in 32 patients (51.6%). In the remaining 30 patients, discordances between the three methods were found, including under or overestimation of SMN2 copies by marker analysis with respect to the quantitative methods (LightCycler and MLPA) because of lack of informativeness of markers, 3' deletions of SMN genes, and breakpoints in SMN2-SMN1 hybrid genes. The technical limitations and advantages and disadvantages of these methods are discussed. We conclude that the three methods complement each other in estimating the SMN2 copy number in most cases. However, MLPA offers additional information to characterize SMA cases with particular rearrangements such as partial deletions and hybrid genes.

  1. Detection of specific polymerase chain reaction product by utilizing the 5'----3' exonuclease activity of Thermus aquaticus DNA polymerase.

    OpenAIRE

    1991-01-01

    The 5'----3' exonuclease activity of the thermostable enzyme Thermus aquaticus DNA polymerase may be employed in a polymerase chain reaction product detection system to generate a specific detectable signal concomitantly with amplification. An oligonucleotide probe, nonextendable at the 3' end, labeled at the 5' end, and designed to hybridize within the target sequence, is introduced into the polymerase chain reaction assay. Annealing of probe to one of the polymerase chain reaction product s...

  2. A novel method for the quantification of adeno-associated virus vectors for RNA interference applications using quantitative polymerase chain reaction and purified genomic adeno-associated virus DNA as a standard.

    Science.gov (United States)

    Wagner, Anke; Röhrs, Viola; Kedzierski, Radoslaw; Fechner, Henry; Kurreck, Jens

    2013-12-01

    Recombinant adeno-associated virus (rAAV) vectors are promising tools in gene therapy, but accurate quantification of the vector dose remains a critical issue for their successful application. We therefore aimed at the precise determination of the titer of self-complementary AAV (scAAV) vectors to improve the reliability of RNA interference (RNAi)-mediated knockdown approaches. Vector titers were initially determined by quantitative polymerase chain reaction (qPCR) using four primer sets targeting different regions within the AAV vector genome (VG) and either coiled or linearized plasmid standards. Despite very low variability between replicates in each assay, these quantification experiments revealed up to 20-fold variation in vector titers. Therefore, we developed a novel approach for the reproducible determination of titers of scAAV vectors based on the use of purified genomic vector DNA as a standard (scAAVStd). Consistent results were obtained in qPCR assays using the four primer sets mentioned above. RNAi-mediated silencing of human cyclophilin B (hCycB) by short hairpin RNA-expressing scAAV vectors was investigated in HeLa cells using two independent vector preparations. We found that the required vector titers for efficient knockdown differed by a factor of 3.5 between both preparations. Hence, we also investigated the number of internalized scAAV vectors, termed transduction units (TUs). TUs were determined by qPCR applying the scAAVStd. Very similar values for 80% hCycB knockdown were obtained for the two AAV vector preparations. Thus, only the determination of TUs, rather than vector concentration, allows for reproducible results in functional analyses using AAV vectors.

  3. Detection of Echinoderm Microtubule Associated Protein Like 4-Anaplastic Lymphoma Kinase Fusion Genes in Non-small Cell Lung Cancer Clinical Samples by a Real-time Quantitative Reverse Transcription Polymerase Chain Reaction Method.

    Science.gov (United States)

    Zhao, Jing; Zhao, Jin-Yin; Chen, Zhi-Xia; Zhong, Wei; Li, Long-Yun; Liu, Li-Cheng; Hu, Xiao-Xu; Chen, Wei-Jun; Wang, Meng-Zhao

    2016-12-20

    Objective To establish a real-time quantitative reverse transcription polymerase chain reaction assay (qRT-PCR) for the rapid, sensitive, and specific detection of echinoderm microtubule associated protein like 4-anaplastic lymphoma kinase (EML4-ALK) fusion genes in non-small cell lung cancer. Methods The specific primers for the four variants of EML4-ALK fusion genes (V1, V2, V3a, and V3b) and Taqman fluorescence probes for the detection of the target sequences were carefully designed by the Primer Premier 5.0 software. Then, using pseudovirus containing EML4-ALK fusion genes variants (V1, V2, V3a, and V3b) as the study objects, we further analyzed the lower limit, sensitivity, and specificity of this method. Finally, 50 clinical samples, including 3 ALK-fluorescence in situ hybridization (FISH) positive specimens, were collected and used to detect EML4-ALK fusion genes using this method. Results The lower limit of this method for the detection of EML4-ALK fusion genes was 10 copies/μl if no interference of background RNA existed. Regarding the method's sensitivity, the detection resolution was as high as 1% and 0.5% in the background of 500 and 5000 copies/μl wild-type ALK gene, respectively. Regarding the method's specificity, no non-specific amplification was found when it was used to detect EML4-ALK fusion genes in leukocyte and plasma RNA samples from healthy volunteers. Among the 50 clinical samples, 47 ALK-FISH negative samples were also negative. Among 3 ALK-FISH positive samples, 2 cases were detected positive using this method, but another was not detected because of the failure of RNA extraction. Conclusion The proposed qRT-PCR assay for the detection of EML4-ALK fusion genes is rapid, simple, sensitive, and specific, which is deserved to be validated and widely used in clinical settings.

  4. Development and validation of a real time quantitative reverse transcription-polymerase chain reaction (qRT-PCR) assay for investigation of wild poliovirus type 1-South Asian (SOAS) strain reintroduced into Israel, 2013 to 2014.

    Science.gov (United States)

    Hindiyeh, M Y; Moran-Gilad, J; Manor, Y; Ram, D; Shulman, L M; Sofer, D; Mendelson, E

    2014-02-20

    In February 2013, wild poliovirus type 1 (WPV1) was reintroduced into southern Israel and resulted in continuous silent circulation in the highly immune population. As a part of the public health emergency response, a novel real time quantitative reverse transcription-polymerase chain reaction (qRT-PCR) assay was developed, to allow for the sensitive and specific detection of the circulatingWPV1-South Asian (SOAS) strain. Specific primers and probes derived from the VP-1 region were designed, based on sequenced sewage isolates, and used to simultaneously amplify this WPV1-SOAS sequence together with bacteriophage MS-2 as internal control. High titre WPV1-SOAS stock virus was used for assay optimisation and 50 processed sewage samples collected from southern Israel and tested by reference culture based methods were used for analytical validation of the assay’s performance. The limit of detection of the multiplex qRT-PCR (SOAS/MS-2) assay was 0.1 plaque-forming unit (pfu)/reaction (20 pfu/mL) for WPV1-SOAS RNA with 100% sensitivity, specificity, positive and negative predictive values when compared to the culture based method. The turnaround time was rapid, providing results for environmental samples within 24 to 48 hours from completion of sewage processing, instead of five to seven days by culture-based analysis. Direct sewage testing by qRT-PCR assay proved to be a useful tool for rapid detection and environmental surveillance of WPV1-SOAS circulating strain during emergency response. Application of the approach for detection of WPV1-SOAS in stool samples obtained during acute flaccid paralysis (AFP) surveillance or field surveys should be further evaluated.

  5. Pooling of cultured samples and comparison of multistate laboratory workflows with the MagMAX sample preparation system and VetMAX quantitative polymerase chain reaction reagents for detection of Tritrichomonas foetus-colonized bulls.

    Science.gov (United States)

    Effinger, Lee; Peddireddi, Lalitha; Simunich, Marilyn; Oberst, Richard; O'Connell, Catherine; Leyva-Baca, Ivan

    2014-01-01

    The objectives of the current study were 1) to compare sample preparation workflows and quantitative real-time polymerase chain reaction assays (qPCR) as currently used in veterinary diagnostic laboratories with a study protocol utilizing commercially available reagents for individual Tritrichomonas foetus testing, 2) to assess the accuracy of pooling cultured smegma samples followed by extraction and qPCR testing as used in the study laboratory, and 3) to assess the specificity of the currently used primers and probes by sequencing all positive and presumptive positive samples identified in the study laboratory in an attempt to capture any nucleotide variability between T. foetus isolates and to rule out false-positive results possibly due to Simplicimonas moskowitzi. Eight hundred three cultured smegma samples were collected from different regions of the United States with the collaboration of 5 veterinary testing laboratories. The samples were processed individually by the respective laboratories, and then sent to the study laboratory and retested using the study protocol. Comparison testing showed an overall agreement of 95.89% between the veterinary testing laboratories and the study laboratory. One hundred seventy-six positive or presumptive positive samples plus 625 negative qPCR samples were combined and retested using a pooling protocol. Pools consisted of 1 positive sample and 4 negative samples (1/5). These pools were processed using the same study laboratory protocols, and 96% of the positive samples were detected in these pools. Nested PCR followed by sequencing confirmed 175 of the 178 samples classified as positive or presumptive positive in the study laboratory as containing T. foetus-specific DNA.

  6. Real-Time Reverse-Transcription Quantitative Polymerase Chain Reaction Assay Is a Feasible Method for the Relative Quantification of Heregulin Expression in Non–Small Cell Lung Cancer Tissue

    Directory of Open Access Journals (Sweden)

    Jessica Kristof

    2017-03-01

    Full Text Available In preclinical studies, heregulin ( HRG expression was shown to be the most relevant predictive biomarker for response to patritumab, a fully human anti–epidermal growth factor receptor 3 monoclonal antibody. In support of a phase 2 study of erlotinib ± patritumab in non–small cell lung cancer (NSCLC, a reverse-transcription quantitative polymerase chain reaction (RT-qPCR assay for relative quantification of HRG expression from formalin-fixed paraffin-embedded (FFPE NSCLC tissue samples was developed and validated and described herein. Test specimens included matched FFPE normal lung and NSCLC and frozen NSCLC tissue, and HRG -positive and HRG -negative cell lines. Formalin-fixed paraffin-embedded tissue was examined for functional performance. Heregulin distribution was also analyzed across 200 NSCLC commercial samples. Applied Biosystems TaqMan Gene Expression Assays were run on the Bio-Rad CFX96 real-time PCR platform. Heregulin RT-qPCR assay specificity, PCR efficiency, PCR linearity, and reproducibility were demonstrated. The final assay parameters included the Qiagen FFPE RNA Extraction Kit for RNA extraction from FFPE NSCLC tissue, 50 ng of RNA input, and 3 reference (housekeeping genes ( HMBS, IPO8 , and EIF2B1 , which had expression levels similar to HRG expression levels and were stable among FFPE NSCLC samples. Using the validated assay, unimodal HRG distribution was confirmed across 185 evaluable FFPE NSCLC commercial samples. Feasibility of an RT-qPCR assay for the quantification of HRG expression in FFPE NSCLC specimens was demonstrated.

  7. The Future of Digital Polymerase Chain Reaction in Virology.

    Science.gov (United States)

    Vynck, Matthijs; Trypsteen, Wim; Thas, Olivier; Vandekerckhove, Linos; De Spiegelaere, Ward

    2016-10-01

    Driven by its potential benefits over currently available methods, and the recent development of commercial platforms, digital polymerase chain reaction (dPCR) has received increasing attention in virology research and diagnostics as a tool for the quantification of nucleic acids. The current technologies are more precise and accurate, but may not be much more sensitive, compared with quantitative PCR (qPCR) applications. The most promising applications with the current technology are the analysis of mutated sequences, such as emerging drug-resistant mutations. Guided by the recent literature, this review focuses on three aspects that demonstrate the potential of dPCR for virology researchers and clinicians: the applications of dPCR within both virology research and clinical virology, the benefits of the technique over the currently used real-time qPCR, and the importance and availability of specific data analysis approaches for dPCR. Comments are provided on current drawbacks and often overlooked pitfalls that need further attention to allow widespread implementation of dPCR as an accurate and precise tool within the field of virology.

  8. Quantitative analysis of waterfowl parvoviruses in geese and Muscovy ducks by real-time polymerase chain reaction: correlation between age, clinical symptoms and DNA copy number of waterfowl parvoviruses

    Directory of Open Access Journals (Sweden)

    Woźniakowski Grzegorz

    2012-03-01

    Full Text Available Abstract Background Waterfowl parvoviruses cause serious loss in geese and ducks production. Goose parvovirus (GPV is infectious for geese and ducks while Muscovy duck parvovirus (MDPV infects Muscovy ducks only. So far, for these viruses' sensitive detection polymerase chain reaction (PCR and loop-mediated isothermal amplification (LAMP were applied. However, there was no molecular biology method for both waterfowl parvoviruses detection and quantification which could unify the laboratory procedures. The level of GPV and MDPV replication and distribution plays a significant role in the parvoviral infection progress and is strictly correlated to clinical symptoms. Meanwhile, experiments conducted previously on GPV distribution in geese, performed as animal trial, did not involve epidemiological data from the disease field cases. The study on the correlation between age, clinical symptoms and viral DNA copy number may be benefitable in understanding the GPV and MDPV infection. Such data may also aid in determination of the stage and severity of the infection with parvoviruses. Therefore the aim of this study was to develop quantitative real-time PCR for parallel detection of GPV and MDPV in geese and Muscovy ducks and to determine the correlation between the age of the infected birds, clinical symptoms and DNA copy number for the estimation of the disease stage or severity. Results In order to develop quantitative real-time PCR the viral material was collected from 13 farms of geese and 3 farms of Muscovy ducks. The designed primers and Taqman probe for real-time PCR were complementary to GPV and MDPV inverted terminal repeats region. The pITR plasmid was constructed, purified and used to prepare dilutions for standard curve preparation and DNA quantification. The applied method detected both GPV and MDPV in all the examined samples extracted from the heart and liver of the infected birds. The conducted correlation tests have shown relationship

  9. Quantitative analysis of waterfowl parvoviruses in geese and Muscovy ducks by real-time polymerase chain reaction: correlation between age, clinical symptoms and DNA copy number of waterfowl parvoviruses.

    Science.gov (United States)

    Woźniakowski, Grzegorz; Samorek-Salamonowicz, Elżbieta; Kozdruń, Wojciech

    2012-03-15

    Waterfowl parvoviruses cause serious loss in geese and ducks production. Goose parvovirus (GPV) is infectious for geese and ducks while Muscovy duck parvovirus (MDPV) infects Muscovy ducks only. So far, for these viruses' sensitive detection polymerase chain reaction (PCR) and loop-mediated isothermal amplification (LAMP) were applied. However, there was no molecular biology method for both waterfowl parvoviruses detection and quantification which could unify the laboratory procedures. The level of GPV and MDPV replication and distribution plays a significant role in the parvoviral infection progress and is strictly correlated to clinical symptoms. Meanwhile, experiments conducted previously on GPV distribution in geese, performed as animal trial, did not involve epidemiological data from the disease field cases. The study on the correlation between age, clinical symptoms and viral DNA copy number may be benefitable in understanding the GPV and MDPV infection. Such data may also aid in determination of the stage and severity of the infection with parvoviruses. Therefore the aim of this study was to develop quantitative real-time PCR for parallel detection of GPV and MDPV in geese and Muscovy ducks and to determine the correlation between the age of the infected birds, clinical symptoms and DNA copy number for the estimation of the disease stage or severity. In order to develop quantitative real-time PCR the viral material was collected from 13 farms of geese and 3 farms of Muscovy ducks. The designed primers and Taqman probe for real-time PCR were complementary to GPV and MDPV inverted terminal repeats region. The pITR plasmid was constructed, purified and used to prepare dilutions for standard curve preparation and DNA quantification. The applied method detected both GPV and MDPV in all the examined samples extracted from the heart and liver of the infected birds. The conducted correlation tests have shown relationship between age, clinical symptoms during

  10. Determination of gender in cetaceans by the polymerase chain reaction

    NARCIS (Netherlands)

    Palsboll, PJ; Vader, A; Bakke, P; El-Gewely, MR

    1992-01-01

    We determined the gender of a variety of cet can species, including both ondotocetes and mysticetes, using the polymerase chain reaction for amplification of the sex chromosome specific regions ZFY/ZFX and SRY. This quick and simple method requires extremely small amounts of tissue, and therefore al

  11. Robust regression methods for real-time polymerase chain reaction

    NARCIS (Netherlands)

    Trypsteen, Wim; De Neve, Jan; Bosman, Kobus; Nijhuis, Monique; Thas, Olivier; Vandekerckhove, Linos; De Spiegelaere, Ward

    2015-01-01

    Current real-time polymerase chain reaction (PCR) data analysis methods implement linear least squares regression methods for primer efficiency estimation based on standard curve dilution series. This method is sensitive to outliers that distort the outcome and are often ignored or removed by the en

  12. A noncontact temperature measurement method in polymerase chain reaction reactors

    Science.gov (United States)

    Sochivko, D. G.; Varlamov, D. A.; Fedorov, A. A.; Kurochkin, V. E.

    2016-04-01

    A new noncontact method for measuring temperatures of liquids, which is based on the fluorescent probes, is proposed. The method is intended for measuring temperatures of reaction media in reactors of devices for polymerase chain reactions in real time and can be used for determining dynamic temperature parameters.

  13. [The contamination under polymerase chain reaction studies: problems and solutions].

    Science.gov (United States)

    Titov, V N; Ameliushkina, V A; Rozhkova, T A

    2015-01-01

    The study was carried out to determine risk factors of false positive and false negative results under polymerase chain reaction-analysis of clinical material. The samples with high viral load can be the source of false positive results. The contamination with nucleic acids can occur at any section of polymerase chain reaction analysis. The study data permitted to establish that the most sensitive stage is isolation and purification of nucleic acids especially under manual mode of operation. The detection of positive signal in most samples of one setting indicates total contamination. The cases when only several samples are polluted are special challenge. The presence of sample with high concentration of viral nucleic acid and several samples with low concentration in one setting means necessity of repeated analysis beginning with stage of isolation of nucleic acid. The analysis of curves of accumulation of products of amplification, their forms and positioning on chart is the obligatory stage of polymerase chain reaction study in real time regimen. These actions permit to exclude the readouts of false negative testing results to departments. The study conclusions are equipotent for polymerase chain reaction testing of any nucleic acid targets.

  14. Use of polymerase chain reaction for detection of Chlamydia trachomatis

    DEFF Research Database (Denmark)

    Østergaard, Lars; Birkelund, Svend; Christiansen, Gunna

    1990-01-01

    A polymerase chain reaction (PCR) assay was developed for detection of Chlamydia trachomatis DNA. From the published sequence of the common C. trachomatis plasmid, two primer sets were selected. Detection of amplified sequences was done by agarose gel electrophoresis of cleaved or uncleaved...

  15. Robust regression methods for real-time polymerase chain reaction

    NARCIS (Netherlands)

    Trypsteen, Wim; De Neve, Jan; Bosman, Kobus; Nijhuis, Monique; Thas, Olivier; Vandekerckhove, Linos; De Spiegelaere, Ward

    2015-01-01

    Current real-time polymerase chain reaction (PCR) data analysis methods implement linear least squares regression methods for primer efficiency estimation based on standard curve dilution series. This method is sensitive to outliers that distort the outcome and are often ignored or removed by the

  16. Robust regression methods for real-time polymerase chain reaction

    NARCIS (Netherlands)

    Trypsteen, Wim; De Neve, Jan; Bosman, Kobus; Nijhuis, Monique|info:eu-repo/dai/nl/176957529; Thas, Olivier; Vandekerckhove, Linos; De Spiegelaere, Ward

    2015-01-01

    Current real-time polymerase chain reaction (PCR) data analysis methods implement linear least squares regression methods for primer efficiency estimation based on standard curve dilution series. This method is sensitive to outliers that distort the outcome and are often ignored or removed by the en

  17. Mathematics analysis of polymerase chain reaction kinetic curves.

    Science.gov (United States)

    Sochivko, D G; Fedorov, A A; Varlamov, D A; Kurochkin, V E; Petrov, R V

    2016-01-01

    The paper reviews different approaches to the mathematical analysis of polymerase chain reaction (PCR) kinetic curves. The basic principles of PCR mathematical analysis are presented. Approximation of PCR kinetic curves and PCR efficiency curves by various functions is described. Several PCR models based on chemical kinetics equations are suggested. Decision criteria for an optimal function to describe PCR efficiency are proposed.

  18. Accuracy of replication in the polymerase chain reaction. Comparison between Thermotoga maritima DNA polymerase and Thermus aquaticus DNA polymerase

    Directory of Open Access Journals (Sweden)

    R.S. Diaz

    1998-10-01

    Full Text Available For certain applications of the polymerase chain reaction (PCR, it may be necessary to consider the accuracy of replication. The breakthrough that made PCR user friendly was the commercialization of Thermus aquaticus (Taq DNA polymerase, an enzyme that would survive the high temperatures needed for DNA denaturation. The development of enzymes with an inherent 3' to 5' exonuclease proofreading activity, lacking in Taq polymerase, would be an improvement when higher fidelity is needed. We used the forward mutation assay to compare the fidelity of Taq polymerase and Thermotoga maritima (ULTMA™ DNA polymerase, an enzyme that does have proofreading activity. We did not find significant differences in the fidelity of either enzyme, even when using optimal buffer conditions, thermal cycling parameters, and number of cycles (0.2% and 0.13% error rates for ULTMA™ and Taq, respectively, after reading about 3,000 bases each. We conclude that for sequencing purposes there is no difference in using a DNA polymerase that contains an inherent 3' to 5' exonuclease activity for DNA amplification. Perhaps the specificity and fidelity of PCR are complex issues influenced by the nature of the target sequence, as well as by each PCR component.

  19. Clinical value of miR-452-5p expression in lung adenocarcinoma: A retrospective quantitative real-time polymerase chain reaction study and verification based on The Cancer Genome Atlas and Gene Expression Omnibus databases.

    Science.gov (United States)

    Gan, Xiao-Ning; Luo, Jie; Tang, Rui-Xue; Wang, Han-Lin; Zhou, Hong; Qin, Hui; Gan, Ting-Qing; Chen, Gang

    2017-05-01

    The role and mechanism of miR-452-5p in lung adenocarcinoma remain unclear. In this study, we performed a systematic study to investigate the clinical value of miR-452-5p expression in lung adenocarcinoma. The expression of miR-452-5p in 101 lung adenocarcinoma patients was detected by quantitative real-time polymerase chain reaction. The Cancer Genome Atlas and Gene Expression Omnibus databases were joined to verify the expression level of miR-452-5p in lung adenocarcinoma. Via several online prediction databases and bioinformatics software, pathway and network analyses of miR-452-5p target genes were performed to explore its prospective molecular mechanism. The expression of miR-452-5p in lung adenocarcinoma in house was significantly lower than that in adjacent tissues (p < 0.001). Additionally, the expression level of miR-452-5p was negatively correlated with several clinicopathological parameters including the tumor size (p = 0.014), lymph node metastasis (p = 0.032), and tumor-node-metastasis stage (p = 0.036). Data from The Cancer Genome Atlas also confirmed the low expression of miR-452 in lung adenocarcinoma (p < 0.001). Furthermore, reduced expression of miR-452-5p in lung adenocarcinoma (standard mean deviations = -0.393, 95% confidence interval: -0.774 to -0.011, p = 0.044) was validated by a meta-analysis. Five hub genes targeted by miR-452-5p, including SMAD family member 4, SMAD family member 2, cyclin-dependent kinase inhibitor 1B, tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein epsilon, and tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein beta, were significantly enriched in the cell-cycle pathway. In conclusion, low expression of miR-452-5p tends to play an essential role in lung adenocarcinoma. Bioinformatics analysis might be beneficial to reveal the potential mechanism of miR-452-5p in lung adenocarcinoma.

  20. 用荧光定量PCR方法检测转染细胞中外源基因的拷贝数%Detection of the Copy Numbers of Exogenous Gene of Transfected Cells by Fluorescent Quantitative Polymerase Chain Reaction

    Institute of Scientific and Technical Information of China (English)

    李影; 何蕴韶; 程刚; 李虎

    2001-01-01

    【Objective】 To detect the copy numbers of brain-deriv ed neurotrophic factor (BDNF) gene in BDNF transfected PcDNA3.1(+)/BDNF/CHO cel ls with fluorescent quantitative polymerase chain reaction (FQ-PCR). 【Methods 】 BDNF DNA were amplified by GeneAmp 5700 Sequence Detection System with eq ual quantitative genomic DNA of PcDNA3.1(+)/BDNF/CHO, PcDNA3.1(+)/CHO and CHO cells as tamplates respectively. The process was repeated 30 times for every sam ples. The results were analyzed using q test. 【Results】 The copy numbers o f BDNF of PcDNA3.1(+)/BDNF/CHO cells and PcDNA 3.1(+)/CHO and CHO cells were 9 5 164±12, 31 622±10, 31 622±11 respectively. The copy numb ers of BDNF of PcDNA3.1(+)/BDNF/CHO cells were as three times as those of the P cDNA3.1(+)/CHO and CHO cells. The copy numbers of the two latters were the same . 【Conclusion】 The results clearly show that the PcDNA3.1(+)/BDNF/CHO cells h arbor two BDNF DNA copies.%【目的】 探讨采用荧光定量PCR技术检测脑源性神经营养因 子(BDNF)基因转染细胞(PcDNA3.1(+)/BDNF/CHO)中BDNF的拷贝数。【方法】 分别以同等质 量的PcDNA3.1(+)/BDNF/CHO,PcDNA3.1(+)/CHO(空载体转染细胞)及CHO细胞的DNA为模板 ,在PE5700PCR仪上进行荧光定量PCR分析。每个样本共检测30次,结果采用q检验分析 。【结果】 PcDNA3.1(+)/BDNF/CHO细胞、PcDNA3.1(+)/CHO和CHO细胞株中BDNF的拷贝数 分别为95 164±12,31 622±10,31 622±11。q检验结果显示前者与后两者之间 有统计学意义,P0.05。PcDNA 3.1(+)/ BDNF/CHO细胞株中BDNF的拷贝数是后二者的3倍,而后两者的拷贝数相同。【结论】 BDNF转 染细胞株中外源BDNF基因是以2个拷贝的比例整合到宿主细胞基因组中去的。

  1. qPCR (quantitative polymerase chain reaction) for the quantification of bacteriophages in stream water samples to investigate hydrological processes: a proof-of-concept study in the Huewelerbach experimental catchment (Luxembourg)

    Science.gov (United States)

    Antonelli, Marta; Narayanan Balasubramanian, Mukundh; Ogorzaly, Leslie; Pfister, Laurent

    2016-04-01

    Albeit recent technological developments (e.g. field deployable instruments operating at high temporal frequencies), experimental hydrology is a discipline that remains measurement limited. From this perspective, trans-disciplinary approaches may create valuable opportunities to enlarge the amount of tools available for investigating hydrological processes. Bacteriophages have been widely used in hydrology as biological tracer for investigating colloid transport and contamination of ground water systems. However, there are only a few studies focusing on the employability of bacteriophages as surface water tracers (i.e. phage transport, system functioning). Here, we present a proof-of-concept study carried out in the Huewelerbach catchment in Luxembourg in December 2015. The aim of this study was to investigate how viral particles can be used to detect hydrological connectivity between the riparian zone/river bank and the stream during rainfall events. Moreover, this study is one of the first attempts for applying the qPCR (quantitative polymerase chain reaction) technique for the quantification of bacteriophages in stream water samples to investigate hydrological processes. This technique is very sensitive and has a large dynamic range - enhancing ease and speed of phage detection. We used two different male-specific coliphages (GA phage, genogroup II and SP phage, genogroup IV). Two litres of GA phage were injected directly in the stream as a slug injection and two litres of SP phage were poured next to the river bank (alluvial deposition) close to the injection point. We also added NaCl (200 g) to both phage suspensions. We collected stream water samples 100 m and 500 m downstream (i.e. catchment outlet) of the injection point for one week. Phages were concentrated through ultracentrifugation of 100 ml of water sample followed by quantification via qPCR. Conductivity in stream water was monitored for the entire duration of the experiment. Discharge was monitored

  2. POSSIBILITIES OF THE POLYMERASE CHAIN REACTION IN THE HUMAN IDENTIFICATION

    Directory of Open Access Journals (Sweden)

    Zoran Budimlija

    2001-05-01

    Full Text Available Biological traces can be found in various forms. The basic question to deal withduring the biological traces' analysis is the one about their origin, that is, the questionof identity of the person to whom such samples belong. Up to now the most precisemethod of the DNA is the PCR of Polymerase Chain Reaction.The generalassumptions about applying the method for the purpose of human identification aredescribed, namely, the one that is used in the Institute for Forensic Medicine in NoviSad.

  3. Automated polymerase chain reaction in capillary tubes with hot air.

    Science.gov (United States)

    Wittwer, C T; Fillmore, G C; Hillyard, D R

    1989-06-12

    We describe a simple, compact, inexpensive thermal cycler that can be used for the polymerase chain reaction. Based on heat transfer with air to samples in sealed capillary tubes, the apparatus resembles a recirculating hair dryer. The temperature is regulated via thermocouple input to a programmable set-point process controller that provides proportional output to a solid state relay controlling a heating coil. For efficient cooling after the denaturation step, the controller activates a solenoid that opens a door to vent hot air and allows cool air to enter. Temperature-time profiles and amplification results approximate those obtained using water baths and microfuge tubes.

  4. HLA-B27 Determination by Polymerase Chain Reaction

    Directory of Open Access Journals (Sweden)

    D. C. Kilpatrick

    1996-01-01

    Full Text Available A method for determining the presence or absence of HLA-827 by selective amplification of a region in the third exon of the HLA-B27 gene common to B*270 I to B*2705 inclusive, was evaluated. This polymerase chain reaction/sequence specific primer (PCR-SSP method gave perfect correlation with serological typing on 40 individuals of previously determined HLA type and on 50 further clinical samples elaluated blind. It was concluded that HLA-B27 determination by PCR-SSP is simple, reliable. cost-effectile and convient for laboratory staff.

  5. HLA-B27 Determination by Polymerase Chain Reaction

    OpenAIRE

    Kilpatrick, D C

    1996-01-01

    A method for determining the presence or absence of HLA-827 by selective amplification of a region in the third exon of the HLA-B27 gene common to B*270 I to B*2705 inclusive, was evaluated. This polymerase chain reaction/sequence specific primer (PCR-SSP) method gave perfect correlation with serological typing on 40 individuals of previously determined HLA type and on 50 further clinical samples elaluated blind. It was concluded that HLA-B27 determination by PCR-SSP is simple, reliable. cost...

  6. Detection of Trypanosoma cruzi by Polymerase Chain Reaction.

    Science.gov (United States)

    Márquez, María Elizabeth; Concepción, Juan Luis; González-Marcano, Eglys; Mondolfi, Alberto Paniz

    2016-01-01

    American Trypanosomiasis (Chagas disease) is an infectious disease caused by the hemoflagellate parasite Trypanosoma cruzi which is transmitted by reduviid bugs. T. cruzi infection occurs in a broad spectrum of reservoir animals throughout North, Central, and South America and usually evolves into an asymptomatic chronic clinical stage of the disease in which diagnosis is often challenging. This chapter describes the application of polymerase chain reaction (PCR) for the detection of Trypanosoma cruzi DNA including protocols for sample preparation, DNA extraction, and target amplification methods.

  7. Effects of Superparamagnetic Nanoparticle Clusters on the Polymerase Chain Reaction

    Directory of Open Access Journals (Sweden)

    Toshiaki Higashi

    2012-04-01

    Full Text Available The polymerase chain reaction (PCR method is widely used for the reproduction and amplification of specific DNA segments, and a novel PCR method using nanomaterials such as gold nanoparticles has recently been reported. This paper reports on the effects of superparamagnetic nanoparticles on PCR amplification without an external magnetic field, and clarifies the mechanism behind the effects of superparamagnetic particle clusters on PCR efficiency by estimating the structures of such clusters in PCR. It was found that superparamagnetic nanoparticles tend to inhibit PCR amplification depending on the structure of the magnetic nanoparticle clusters. The paper also clarifies that Taq polymerase is captured in the spaces formed among magnetic nanoparticle clusters, and that it is captured more efficiently as a result of their motion from heat treatment in PCR thermal cycles. Consequently, Taq polymerase that should be used in PCR is reduced in the PCR solution. These outcomes will be applied to novel PCR techniques using magnetic particles in an external magnetic field.

  8. Pooling of porcine fecal samples for quantification of Lawsonia intracellularis by real-time polymerase chain reaction

    DEFF Research Database (Denmark)

    Pedersen, Ken Steen; Johansen, Markku; Jorsal, Sven Erik Lind;

    2014-01-01

    obtained by averaging test results from individual fecal samples in relation to a quantitative polymerase chain reaction (qPCR) test for Lawsonia intracellularis. Ten diarrheic and 10 normal fecal samples were submitted from each of 43 Danish swine herds (n = 860 fecal samples). Pools (n = 43), each...

  9. Real-Time Polymerase Chain Reaction: Applications in Diagnostic Microbiology

    Directory of Open Access Journals (Sweden)

    Kordo B. A. Saeed

    2013-11-01

    Full Text Available The polymerase chain reaction (PCR has revolutionized the detection of DNA and RNA. Real-Time PCR (RT-PCR is becoming the gold standard test for accurate, sensitive and fast diagnosis for a large range of infectious agents. Benefits of this procedure over conventional methods for measuring RNA include its sensitivity, high throughout and quantification. RT-PCR assays have advanced the diagnostic abilities of clinical laboratories particularly microbiology and infectious diseases. In this review we would like to briefly discuss RT-PCR in diagnostic microbiology laboratory, beginning with a general introduction to RT-PCR and its principles, setting up an RT PCR, including multiplex systems and the avoidance and remediation of contamination issues. A segment of the review would be devoted to the application of RT-PCR in clinical practice concentrating on its role in the diagnosis and treatment of infectious diseases.

  10. Automated microdroplet platform for sample manipulation and polymerase chain reaction.

    Science.gov (United States)

    Chabert, Max; Dorfman, Kevin D; de Cremoux, Patricia; Roeraade, Johan; Viovy, Jean-Louis

    2006-11-15

    We present a fully automated system performing continuous sampling, reagent mixing, and polymerase chain reaction (PCR) in microdroplets transported in immiscible oil. Sample preparation and analysis are totally automated, using an original injection method from a modified 96-well plate layered with three superimposed liquid layers and in-capillary laser-induced fluorescence endpoint detection. The process is continuous, allowing sample droplets to be carried uninterruptedly into the reaction zone while new drops are aspirated from the sample plate. Reproducible amplification, negligible cross-contamination, and detection of low sample concentrations were demonstrated on numerous consecutive sample drops. The system, which opens the route to strong reagents and labor savings in high-throughput applications, was validated on the clinically relevant quantification of progesterone receptor gene expression in human breast cancer cell lines.

  11. Modelling of Serpentine Continuous Flow Polymerase Chain Reaction Microfluidics

    Directory of Open Access Journals (Sweden)

    Abubakar Mohammed

    2012-03-01

    Full Text Available The continuous flow Polymerase Chain Reaction (PCR microfluidics DNA amplification device is a recent discovery aimed at eliminating the cyclic hold experienced while using the alternative stationary device.The Application of Computational Fluid Dynamics is increasingly growing and can help achieve optimal designs before actual fabrication. This paper presents a CFD modelling of a continuous flow serpentine PCR device with narrow and wider channels. There are two temperature regions at 950C and 600C for denaturation and annealing respectively. Extension is achieved along the middle of the channel at 720C owing to temperature gradient. The model require a pressure of 42.6KPa for a 30 cycle amplification.

  12. Nested methylation-specific polymerase chain reaction cancer detection method

    Science.gov (United States)

    Belinsky, Steven A.; Palmisano, William A.

    2007-05-08

    A molecular marker-based method for monitoring and detecting cancer in humans. Aberrant methylation of gene promoters is a marker for cancer risk in humans. A two-stage, or "nested" polymerase chain reaction method is disclosed for detecting methylated DNA sequences at sufficiently high levels of sensitivity to permit cancer screening in biological fluid samples, such as sputum, obtained non-invasively. The method is for detecting the aberrant methylation of the p16 gene, O 6-methylguanine-DNA methyltransferase gene, Death-associated protein kinase gene, RAS-associated family 1 gene, or other gene promoters. The method offers a potentially powerful approach to population-based screening for the detection of lung and other cancers.

  13. Polymerase chain reaction: A molecular diagnostic tool in periodontology.

    Science.gov (United States)

    Maheaswari, Rajendran; Kshirsagar, Jaishree Tukaram; Lavanya, Nallasivam

    2016-01-01

    This review discusses the principles of polymerase chain reaction (PCR) and its application as a diagnostic tool in periodontology. The relevant MEDLINE and PubMed indexed journals were searched manually and electronically by typing PCR, applications of PCR, PCR in periodontics, polymorphism studies in periodontitis, and molecular techniques in periodontology. The searches were limited to articles in English language and the articles describing PCR process and its relation to periodontology were collected and used to prepare a concise review. PCR has now become a standard diagnostic and research tool in periodontology. Various studies reveal that its sensitivity and specificity allow it as a rapid, efficient method of detecting, identifying, and quantifying organism. Different immune and inflammatory markers can be identified at the mRNA expression level, and also the determination of genetic polymorphisms, thus providing the deeper insight into the mechanisms underlying the periodontal disease.

  14. Polymerase chain reaction of Au nanoparticle-bound primers

    Institute of Scientific and Technical Information of China (English)

    SHEN Hebai; HU Min; YANG Zhongnan; WANG Chen; ZHU Longzhang

    2005-01-01

    Polymerase chain reaction (PCR) is a useful technique for in vitro amplification of a DNA fragment. In this paper, a PCR procedure using Au nanoparticle (AuNP) -bound primers was systemically studied. The 5′-SH- (CH2)6-modified primers were covalently attached to the AuNP surface via Au-S bonds, and plasmid pBluescript SK was used as a template. The effects of the concentration of AuNP-bound primers, annealing temperature and PCR cycles were evaluated, respectively. The results indicate that PCR can proceed successfully under optimized condition, with either forward or reverse primers bound to the AuNP surface or with both the two primers bound to the AuNP surface. Development of PCR procedure based on AuNPs not only makes the isolation of PCR products very convenient, but also provides novel methods to prepare AuNP-bound ssDNA and nanostructured material.

  15. APPLICATION OF POLYMERASE CHAIN REACTION FOR DIAGNOSING AMEBIC LIVER ABSCESS

    Institute of Scientific and Technical Information of China (English)

    郭增柱; 王正仪; 安亦军; 祝宏

    1996-01-01

    Polymerase chain reaction (PCR) has been applied in diagnosing amebic liver infection by detecting pathogenic Entamoeba histolytica DNA in liver aspirates. Oligonucleotide primers found to he specific for the gene encoding the 30 kDa molecule of this pathogenic ameba were used in the test. Liver aspirates obtained from 23 patients with amebic liver abscess substantiated by typical clinical rnanifastation or with very high titres of anti-E histtolytica antibodies by ELISA were found to he positive by PCR. Fourteen controlsamples (3 cases of bacterial liver abscess, I of liver cancer and 10 of other abscess) were all found to be negative to this reaction. The results suggested PCR to he a specific and sensitive tool for diagnosing amebic liver abscess infections.

  16. Polymerase chain reaction-based gene removal from plasmids

    Directory of Open Access Journals (Sweden)

    Vishnu Vardhan Krishnamurthy

    2015-09-01

    Full Text Available This data article contains supplementary figures and methods to the research article entitled, “Multiplex gene removal by two-step polymerase chain reactions” (Krishnamurthy et al., Anal. Biochem., 2015, doi:http://dx.doi.org/10.1016/j.ab.2015.03.033, which presents a restriction-enzyme free method to remove multiple DNA segments from plasmids. Restriction-free cloning methods have dramatically improved the flexibility and speed of genetic manipulation compared to conventional assays based on restriction enzyme digestion (Lale and Valla, 2014. DNA Cloning and Assembly Methods, vol. 1116. Here, we show the basic scheme and characterize the success rate for single and multiplex gene removal from plasmids. In addition, we optimize experimental conditions, including the amount of template, multiple primers mixing, and buffers for DpnI treatment, used in the one-pot reaction for multiplex gene removal.

  17. Use of polymerase chain reaction for detection of Chlamydia trachomatis

    DEFF Research Database (Denmark)

    Østergaard, Lars; Birkelund, Svend; Christiansen, Gunna

    1990-01-01

    A polymerase chain reaction (PCR) assay was developed for detection of Chlamydia trachomatis DNA. From the published sequence of the common C. trachomatis plasmid, two primer sets were selected. Detection of amplified sequences was done by agarose gel electrophoresis of cleaved or uncleaved...... amplified sequences, Southern hybridization, or dot blot analysis. The PCR assay was optimized and, after 40 cycles of amplification with primer set II, demonstrated a sensitivity of 10(-17) g of DNA, which corresponds to the detection of one copy of the plasmid. Because of the high sensitivity, we...... developed a closed system in which airborne contamination was minimized. Analysis of 228 clinical samples tested by cell culture, IDEIA enzyme immunosorbent assay (Medico-Nobel, Boots-Celltech Ltd., Berkshire, United Kingdom), and PCR showed a sensitivity of 100%, a specificity of 93% when PCR was compared...

  18. Aqueous humor polymerase chain reaction in uveitis - utility and safety.

    Science.gov (United States)

    Chronopoulos, Argyrios; Roquelaure, Daniel; Souteyrand, Georges; Seebach, Jörg Dieter; Schutz, James Scott; Thumann, Gabriele

    2016-10-28

    To study the value and safety of aqueous humor polymerase chain reaction (PCR) analysis for Herpes simplex, varicella zoster, cytomegalovirus, Epstein-Barr virus and Toxoplasma gondii in patients with uveitis. Records of 45 consecutive patients with anterior and posterior uveitis who underwent AC paracentesis with PCR were reviewed. The main outcome measure was frequency of PCR positivity. Secondary outcomes were alteration of treatment, safety of paracentesis, and correlation of keratitic precipitates with PCR positivity, RESULTS: The overall PCR positivity was 48.9 % (22/45). Therapy was changed because of the PCR results in 14/45 patients (37.7 %). One patient experienced a paracentesis related complication (1/45, 2.2 %) without long-term sequelae. Aqueous PCR altered the diagnosis and treatment in over a third of our patients and was relatively safe. Aqueous PCR should be considered for uveitis of atypical clinical appearance, recurrent severe uveitis of uncertain etiology, and therapy refractory cases.

  19. Toxoplasma polymerase chain reaction on experimental blood samples.

    Science.gov (United States)

    Joss, A W; Chatterton, J M; Evans, R; Ho-Yen, D O

    1993-01-01

    A two-stage polymerase chain reaction (PCR) assay employing oligonucleotide primers from the B1 gene of Toxoplasma gondii was developed and assessed for sensitivity and specificity. It was able to detect T. gondii DNA from as little as one parasite/sample in mock-infected rat or mouse leucocyte preparations. Parasitaemia was also identified in animals at five stages between 16 and 66 h after infection with the virulent RH strain, and at 12 stages between 2 and 38 days after infection with the cyst-forming Beverley strain. In the latter case, PCR was more sensitive than animal culture. No cross-reactions were observed in samples containing various opportunist pathogens which may also be found in the blood of immunocompromised patients.

  20. Rapid electrochemiluminescence assays of polymerase chain reaction products.

    Science.gov (United States)

    Kenten, J H; Casadei, J; Link, J; Lupold, S; Willey, J; Powell, M; Rees, A; Massey, R

    1991-09-01

    We demonstrate the first use of an electrochemiluminescent (ECL) label, [4-(N-succimidyloxycarbonylpropyl)-4'-methyl-2,2'- bipyridine]ruthenium(II) dihexafluorophosphate (Origen label; IGEN Inc.), in DNA probe assays. This label allows rapid (less than 25 min) quantification and detection of polymerase chain reaction (PCR)-amplified products from oncogenes, viruses, and cloned genes. For the PCR, we used labeled oligonucleotide primers complementary to human papiloma virus and the Ha-ras oncogene. These samples were followed by ECL analysis or hybridization with specific, Origen-labeled oligonucleotide probes. These studies demonstrate the speed, specificity, and effectiveness of the new ECL labels, compared with 32P, for nucleic acid probe applications. We describe formats involving conventional methodologies and a new format that requires no wash step, allowing simple and rapid sample analysis. These rapid assays also reduce PCR contamination, by requiring less sample handling. Improvements in ECL detectability are currently under investigation for use in DNA probe assays without amplification.

  1. Diagnostic challenges of tuberculous lymphadenitis using polymerase chain reaction analysis: a case study.

    Science.gov (United States)

    Taniguchi, Hirokazu; Nakamura, Masahiko; Shimokawa, Kazuki; Kamiseki, Fumi; Ishizawa, Shin; Abo, Hitoshi; Furuse, Hideaki; Tsuda, Takeshi; Masaki, Yasuaki; Suzuki, Kensuke

    2015-01-01

    This report presents a case of tuberculous lymphadenitis that was difficult to diagnose using polymerase chain reaction analysis. An 80-year-old Japanese female was hospitalized due to swollen cervical lymph nodes. Her lymph node tests revealed paradoxical polymerase chain reaction results. Polymerase chain reaction analysis of two biopsy tissues using the Cobas TaqMan revealed a positive result for Mycobacterium avium and a negative result for Mycobacterium tuberculosis. However, polymerase chain reaction analysis of a cultured colony of acid-fast bacteria from biopsy tissue using the Cobas TaqMan and an alternative polymerase chain reaction analysis of biopsy tissue yielded discordant results. The patient was diagnosed as having tuberculous lymphadenitis. She was treated with antitubercular drugs and subsequently had a reduction in cervical lymph node swelling. Polymerase chain reaction analysis is not 100% accurate; hence, its use as a diagnostic tool for mycobacterial infection requires increased attention.

  2. Effects of upconversion nanoparticles on polymerase chain reaction.

    Directory of Open Access Journals (Sweden)

    Sang-Hyun Hwang

    Full Text Available Nanoparticles (NPs are attractive materials owing to their physical and electrochemical properties, which make them extremely useful in diagnostic applications. Photon upconversion is the phenomenon where high-energy photons are emitted upon excitation of low-energy photons. Nucleic acids detection based on upconversion nanoparticles (UCNPs, which display a high signal-to-noise ratio and no photobleaching, has been widely applied. We evaluated whether UCNPs can improve polymerase chain reaction (PCR specificity and affect PCR amplification. The effects of UCNPs with a diameter size of 40, 70, and 250 nm were evaluated using 3 PCR kits (AccuPower PCR PreMix, AmpliTaq Gold 360 Master Mix, and HotStarTaq Plus Master Mix and 3 real-time PCR kits (AccuPower GreenStar qPCR PreMix, SYBR Green PCR Master Mix, and QuantiTect SYBR Green PCR Kit. Quantum dots were used for comparison with the UCNPs. In the presence of an appropriate concentration of UCNPs, PCR specificity was optimized. UCNPs of 40-nm size improved PCR specificity more effectively than did UCNPs sized 70 or 250 nm. As the size and concentrations of the UCNPs were increased, PCR amplification was more severely inhibited. At lower annealing temperatures (25°C-45°C, addition of the 40 nm UCNP (1 µg/µL to the PCR reagent produced specific PCR products without nonspecific sequence amplification. Therefore, UCNPs of different sizes, with different DNA polymerases used in the commercial kits, showed different inhibitory effects on PCR amplification. These results demonstrate that optimization of UCNPs, added to reaction mixtures at appropriate concentrations, can improve PCR specificity. However, the mechanism underlining UCNPs effect on PCR remains unclear and will require further investigation.

  3. Polymerase chain reaction: basic protocol plus troubleshooting and optimization strategies.

    Science.gov (United States)

    Lorenz, Todd C

    2012-05-22

    In the biological sciences there have been technological advances that catapult the discipline into golden ages of discovery. For example, the field of microbiology was transformed with the advent of Anton van Leeuwenhoek's microscope, which allowed scientists to visualize prokaryotes for the first time. The development of the polymerase chain reaction (PCR) is one of those innovations that changed the course of molecular science with its impact spanning countless subdisciplines in biology. The theoretical process was outlined by Keppe and coworkers in 1971; however, it was another 14 years until the complete PCR procedure was described and experimentally applied by Kary Mullis while at Cetus Corporation in 1985. Automation and refinement of this technique progressed with the introduction of a thermal stable DNA polymerase from the bacterium Thermus aquaticus, consequently the name Taq DNA polymerase. PCR is a powerful amplification technique that can generate an ample supply of a specific segment of DNA (i.e., an amplicon) from only a small amount of starting material (i.e., DNA template or target sequence). While straightforward and generally trouble-free, there are pitfalls that complicate the reaction producing spurious results. When PCR fails it can lead to many non-specific DNA products of varying sizes that appear as a ladder or smear of bands on agarose gels. Sometimes no products form at all. Another potential problem occurs when mutations are unintentionally introduced in the amplicons, resulting in a heterogeneous population of PCR products. PCR failures can become frustrating unless patience and careful troubleshooting are employed to sort out and solve the problem(s). This protocol outlines the basic principles of PCR, provides a methodology that will result in amplification of most target sequences, and presents strategies for optimizing a reaction. By following this PCR guide, students should be able to: • Set up reactions and thermal cycling

  4. Development of an on-site rapid real-time polymerase chain reaction system and the characterization of suitable DNA polymerases for TaqMan probe technology.

    Science.gov (United States)

    Furutani, Shunsuke; Naruishi, Nahoko; Hagihara, Yoshihisa; Nagai, Hidenori

    2016-08-01

    On-site quantitative analyses of microorganisms (including viruses) by the polymerase chain reaction (PCR) system are significantly influencing medical and biological research. We have developed a remarkably rapid and portable real-time PCR system that is based on microfluidic approaches. Real-time PCR using TaqMan probes consists of a complex reaction. Therefore, in a rapid real-time PCR, the optimum DNA polymerase must be estimated by using actual real-time PCR conditions. In this study, we compared the performance of three DNA polymerases in actual PCR conditions using our rapid real-time PCR system. Although KAPA2G Fast HS DNA Polymerase has the highest enzymatic activity among them, SpeedSTAR HS DNA Polymerase exhibited better performance to rapidly increase the fluorescence signal in an actual real-time PCR using TaqMan probes. Furthermore, we achieved rapid detection of Escherichia coli in 7 min by using SpeedSTAR HS DNA Polymerase with the same sensitivity as that of a conventional thermal cycler.

  5. Integrated polymerase chain reaction chips utilizing digital microfluidics.

    Science.gov (United States)

    Chang, Yi-Hsien; Lee, Gwo-Bin; Huang, Fu-Chun; Chen, Yi-Yu; Lin, Jr-Lung

    2006-09-01

    This study reports an integrated microfluidic chip for polymerase chain reaction (PCR) applications utilizing digital microfluidic chip (DMC) technology. Several crucial procedures including sample transportation, mixing, and DNA amplification were performed on the integrated chip using electro-wetting-on-dielectric (EWOD) effect. An innovative concept of hydrophobic/hydrophilic structure has been successfully demonstrated to integrate the DMC chip with the on-chip PCR device. Sample droplets were generated, transported and mixed by the EWOD-actuation. Then the mixture droplets were transported to a PCR chamber by utilizing the hydrophilic/hydrophobic interface to generate required surface tension gradient. A micro temperature sensor and two micro heaters inside the PCR chamber along with a controller were used to form a micro temperature control module, which could perform precise PCR thermal cycling for DNA amplification. In order to demonstrate the performance of the integrated DMC/PCR chips, a detection gene for Dengue II virus was successfully amplified and detected. The new integrated DMC/PCR chips only required an operation voltage of 12V(RMS) at a frequency of 3 KHz for digital microfluidic actuation and 9V(DC) for thermal cycling. When compared to its large-scale counterparts for DNA amplification, the developed system consumed less sample and reagent and could reduce the detection time. The developed chips successfully demonstrated the feasibility of Lab-On-a-Chip (LOC) by utilizing EWOD-based digital microfluidics.

  6. Taylor dispersion in polymerase chain reaction in a microchannel

    Science.gov (United States)

    Lee, Jinkee; Kulla, Elejdis; Chauhan, Anuj; Tripathi, Anubhav

    2008-09-01

    Polymerase chain reaction (PCR) is commonly used for a wide range of DNA applications such as disease detection, genetic fingerprinting, and paternity testing. The importance of PCR has led to an increased interest in performing PCR in a microfluidic platform with a high throughput while using very small DNA quantities. In this paper we solve convection-diffusion equations for the DNA and deoxynucleoside triphosphate (dNTP) under conditions suitable for PCR operation in a microchip. These include pressure driven flow accompanied by temporal temperature changes that lead to an amplification reaction, which is modeled as a first order reaction. The convection-diffusion-reaction equations are solved by using the method of multiple time scales to yield average equations that can be solved to obtain the long time evolution of the concentration profiles. The results obtained by solving the averaged equations agree well with full numerical solutions. The averaged equations are also solved to simulate the PCR to illustrate some interesting aspects of this operation in a microfluidic device. It is shown that insufficient nucleotide concentrations can lead to complete depletion of NTP at certain axial locations, which leads to termination of DNA amplification at these locations, resulting in formation of a plateau in DNA concentration.

  7. Nucleic acid amplification: Alternative methods of polymerase chain reaction.

    Science.gov (United States)

    Fakruddin, Md; Mannan, Khanjada Shahnewaj Bin; Chowdhury, Abhijit; Mazumdar, Reaz Mohammad; Hossain, Md Nur; Islam, Sumaiya; Chowdhury, Md Alimuddin

    2013-10-01

    Nucleic acid amplification is a valuable molecular tool not only in basic research but also in application oriented fields, such as clinical medicine development, infectious diseases diagnosis, gene cloning and industrial quality control. A comperehensive review of the literature on the principles, applications, challenges and prospects of different alternative methods of polymerase chain reaction (PCR) was performed. PCR was the first nucleic acid amplification method. With the advancement of research, a no of alternative nucleic acid amplification methods has been developed such as loop mediated isothermal amplification, nucleic acid sequence based amplification, strand displacement amplification, multiple displacement amplification. Most of the alternative methods are isothermal obviating the need for thermal cyclers. Though principles of most of the alternate methods are relatively complex than that of PCR, they offer better applicability and sensitivity in cases where PCR has limitations. Most of the alternate methods still have to prove themselves through extensive validation studies and are not available in commercial form; they pose the potentiality to be used as replacements of PCR. Continuous research is going on in different parts of the world to make these methods viable technically and economically.

  8. Nested polymerase chain reaction for early diagnosis of typhoid fever.

    Science.gov (United States)

    Sultana, S; Hossain, M A; Alam, M A; Paul, S K; Mahmud, C; Kabir, M R; Haque, N; Yesmin, T; Kayes, M T; Maruf, A A; Kobayashi, N

    2012-01-01

    Typhoid fever, caused by Salmonella typhi, is an important cause of morbidity and mortality in many developing countries. A rapid and sensitive method for the detection of S. typhi is essential for early diagnosis. This was a study to prospectively evaluate the sensitivity and specificity of nested polymerase chain reaction (PCR) to identify the S. typhi using flagellin gene related primers. The study was carried out in the department of Microbiology, Mymensingh Medical College, Mymensingh between July, 2010 and June, 2011, including 82 individuals of different age and sex. Of them, 62 were clinically suspected cases of typhoid fever and remaining 20 were apparently healthy controls. Cultures as well as PCR of blood specimens were performed for each of the cases. Among the 62 suspected typhoid fever cases, 8(12.9%) were blood culture positive and 55(88.7%) were PCR positive for S. typhi. All culture positive cases were positive by PCR and among 54 culture negative cases, 47(87%) were positive by PCR. Neither of the healthy controls was positive by PCR or blood culture. The sensitivity, specificity, positive predictive value and negative predictive value of PCR using blood culture as gold standard were 88.7%, 100%, 100% and 74% respectively for typhoid fever. In this study, the PCR appears highly specific, very sensitive and superior to blood culture for the early diagnosis of typhoid fever.

  9. Urine Nested Polymerase Chain Reaction in Neonatal Septicemia.

    Science.gov (United States)

    Das, B K; Suri, Shipra; Nath, Gopal; Prasad, Rajniti

    2015-08-01

    This cross-sectional study was done to evaluate diagnostic efficacy of urine nested polymerase chain reaction (PCR) using broad-range 16SrDNA PCR-based amplification, followed by restriction analysis and sequencing in neonatal septicemia. The study included 50 babies; 48% had vaginal delivery, 46% were preterm, 20% had a history of prolonged rupture of membranes and 56% were low birth weight (≤2500 g). Clinical presentations were lethargy (96%), respiratory distress (80%) and bleeding diathesis (16%). Absolute neutrophil count <1800/mm(3) was observed in 60%, and positive C-reactive protein in 46%. Thirty neonates had positive blood culture, and Klebsiella pneumoniae (22%) was the predominant organism. Nested urine PCR was positive in 38 (76%) and detected bacterial DNA in 8 neonates with negative blood cultures. The sensitivity, specificity, positive predictive value, negative predictive value and accuracy of nested PCR were 100, 60, 78.9, 100 and 84%, respectively, compared with blood culture. Nested PCR can detect most bacteria in single assay and identify unusual and unexpected causal agents.

  10. Fluorescence-based temperature control for polymerase chain reaction.

    Science.gov (United States)

    Sanford, Lindsay N; Wittwer, Carl T

    2014-03-01

    The ability to accurately monitor solution temperature is important for the polymerase chain reaction (PCR). Robust amplification during PCR is contingent on the solution reaching denaturation and annealing temperatures. By correlating temperature to the fluorescence of a passive dye, noninvasive monitoring of solution temperatures is possible. The temperature sensitivity of 22 fluorescent dyes was assessed. Emission spectra were monitored and the change in fluorescence between 45 and 95°C was quantified. Seven dyes decreased in intensity as the temperature increased, and 15 were variable depending on the excitation wavelength. Sulforhodamine B (monosodium salt) exhibited a fold change in fluorescence of 2.85. Faster PCR minimizes cycling times and improves turnaround time, throughput, and specificity. If temperature measurements are accurate, no holding period is required even at rapid speeds. A custom instrument using fluorescence-based temperature monitoring with dynamic feedback control for temperature cycling amplified a fragment surrounding rs917118 from genomic DNA in 3min and 45s using 35 cycles, allowing subsequent genotyping by high-resolution melting analysis. Gold-standard thermocouple readings and fluorescence-based temperature differences were 0.29±0.17 and 0.96±0.26°C at annealing and denaturation, respectively. This new method for temperature cycling may allow faster speeds for PCR than currently considered possible.

  11. Monitoring infection: from blood culture to polymerase chain reaction (PCR).

    Science.gov (United States)

    Book, Malte; Lehmann, Lutz Eric; Zhang, XiangHong; Stüber, Frank

    2013-06-01

    In patients with sepsis, diagnosis of blood stream infection (BSI) is a key concern to the therapist. Direct verification of pathogens in the blood stream executed by blood cultures (BC) still is regarded as the gold standard up to date. The quickest possible initiation of an appropriate antimicrobial therapy is a cornerstone of an effective therapy. Moreover, in this view BC can also serve to identify antimicrobial agents to target the pathogen. However, when employing BC the time needed until microbiological results are available ranges from 24 up to 72 h. Moreover, infections caused by multiple pathogens often remain undetected and concurrent antibiotic therapy may lower the overall sensitivity. Alternative pathogen characterization can be performed by polymerase chain reaction (PCR) based amplification methods. Results using PCR can be obtained within 6-8 h. Therefore, the time delay until an appropriate therapy can be reduced enormously. Moreover, these methods have the potential to enhance the sensitivity in the diagnosis of blood stream infections. Therefore, PCR based methods might be a valuable adjunct to present procedures of diagnosing bacteraemia.

  12. Marzipan: polymerase chain reaction-driven methods for authenticity control.

    Science.gov (United States)

    Brüning, Philipp; Haase, Ilka; Matissek, Reinhard; Fischer, Markus

    2011-11-23

    According to German food guidelines, almonds are the only oilseed ingredient allowed for the production of marzipan. Persipan is a marzipan surrogate in which the almonds are replaced by apricot or peach kernels. Cross-contamination of marzipan products with persipan may occur if both products are produced using the same production line. Adulterations or dilutions, respectively, of marzipan with other plant-derived products, for example, lupine or pea, have also been found. Almond and apricot plants are closely related. Consequently, classical analytical methods for the identification/differentiation often fail or are not sensitive enough to quantify apricot concentrations below 1%. Polymerase chain reaction (PCR)-based methods have been shown to enable the differentiation of closely related plant species in the past. These methods are characterized by high specificity and low detection limits. Isolation methods were developed and evaluated especially with respect to the matrix marzipan in terms of yield, purity, integrity, and amplificability of the isolated DNA. For the reliable detection of apricot, peach, pea, bean, lupine, soy, cashew, pistachio, and chickpea, qualitative standard and duplex PCR methods were developed and established. The applicability of these methods was tested by cross-reaction studies and analysis of spiked raw pastes. Contaminations at the level of 0.1% could be detected.

  13. Investigation on detection of Haemophilus ducreyi by Polymerase Chain Reaction

    Institute of Scientific and Technical Information of China (English)

    ZHANG Xibao(张锡宝); FEI Shi(费实); DENG Wenguo(邓文国); CAO wenlig(曹文苓); ZHU huilan(朱慧兰); MENG jinxiu(孟锦秀); YAN jinglan(颜景兰)

    2002-01-01

    Objective:To investigate the application of polymerase chain reaction (PCR) detection of Haemophilus ducreyi in clinical diagnosis of chancroid.Methods: Nucleotide sequences of 16srRNA gene specific for H. Dureyi were used to develop primer sets for amplification of two strains. The amplified products were tested via PCR and sequenced by electrophoresis in a 1.5 % gel.These products were compared with those of heterogeneous species or related bacteria to test the specificity of the PCR assay. PCR amplification with different concentrations of H.ducreyi was performed to test its sensitivity.Results: PCR amplification of two strains of H. Ducreyi produced a single band of expected 438bp length. The sequence was identified with genomic DNA. None of the other 19 reference species amplified under the same conditions gave this result. The highest sensitivity of PCR assay in the present test was 10ng/L.Conclusions: PCR assay for detection of H. Ducreyi is a rapid, specific, and sensitive detection method. If laboratory conditions are strictly controlled, PCR assay is a potentially useful laboratory test for H. Ducreyi infection diagnosis.

  14. Analysis of human cytomegalovirus using the polymerase chain reaction.

    Science.gov (United States)

    Mendelson, M

    2000-01-01

    As with numerous other branches of science, the study of human cytomegalovirus (HCMV) infection has been revolutionized by the polymerase chain reaction (PCR) method first devised by Mullis and Faloona (1). PCR allows the in vitro amplification of HCMV DNA sequences by the simultaneous primer extension of complementary DNA strands. Similarly, reverse transcription-PCR (RT-PCR) allows the study of targeted gene expression, by reverse transcription of RNA to complementary DNA (cDNA), followed by amplification of target DNA using predetermined primers. The PCR method is used in the clinical diagnosis of HCMV infection, particularly in the setting of transplantation medicine and in those patients infected with the human immunodeficiency virus (HIV). In addition, the advent of PCR and RT-PCR has transformed our understanding of the pathogenesis of HCMV infection, central to which is the definition of the sites of latency, the degree and type of gene expression within the latently infected cell, and the factors influencing both the maintenance of latency and reactivation of the virus during immunosuppression.

  15. Role of multiplex polymerase chain reaction in diagnosing tubercular meningitis

    Directory of Open Access Journals (Sweden)

    Anupam Berwal

    2017-01-01

    Full Text Available Tuberculous meningitis (TBM is one of the most serious manifestations of extrapulmonary tuberculosis. Timely and accurate diagnosis provides a favorable prognosis in patients with TBM. The study evaluated the use of multiplex polymerase chain reaction (PCR in the diagnosis of TBM. A study was conducted on 74 patients clinically suspected with TBM. The cerebrospinal fluid (CSF specimens were processed for smear microscopy, middle brook 7H9 culture, and multiplex PCR using primers directed against IS6110 gene and 38 kD protein for detection of Mycobacterium tuberculosis. The results were analyzed to assess the role of multiplex PCR in the diagnosis of TBM. A total of 26 (35.1% patients were diagnosed with TBM. Microscopy was negative in all while culture was positive in two cases only. Comparing with clinical diagnosis and CSF adenosine deaminase levels of ≥10 U/L, multiplex PCR showed sensitivity, specificity, positive predictive value, and negative predictive value of 71.4%, 89.6%, 83.3%, and 81.2%, respectively, in the diagnosis of TBM.

  16. Identifying of meat species using polymerase chain reaction (PCR)

    Science.gov (United States)

    Foong, Chow Ming; Sani, Norrakiah Abdullah

    2013-11-01

    Meat has been widely consumed as an important protein source in daily life of human. Furthermore, with busy and intense urban lifestyle, processed food is now one of the main protein sources of one's diet. Consumers rely on the food labeling to decide if the meat product purchased is safe and reliable. Therefore, it is important to ensure the food labeling is done in a correct manner to avoid consumer fraud. More consumers are now concern about the food quality and safety as compared to before. This study described the meat species identification and detection method using Polymerase Chain Reaction (PCR) in 8 types of meats (cattle, buffalo, goat, sheep, chicken, duck, pork and horse). The objective of this study is to decide on the specificity of oligonucleotide sequences obtained from previous study. There were 5 proposed oligonucleotide primer in this study. The main important finding in this work is the specificity of oligonucleotide primers to raw meats. It if found that the oligonucleotide primers proposed were not specific to the local raw meat species. Therefore, further study is needed to obtain a species-specific oligonucletide primers for PCR, in order to be applied in food product testing.

  17. Identifying of meat species using polymerase chain reaction (PCR)

    Energy Technology Data Exchange (ETDEWEB)

    Foong, Chow Ming; Sani, Norrakiah Abdullah [School of Chemical Sciences and Food Technology, Faculty of Science and Technology, Universiti Kebangsaan Malaysia, 43600, Bangi, Selangor (Malaysia)

    2013-11-27

    Meat has been widely consumed as an important protein source in daily life of human. Furthermore, with busy and intense urban lifestyle, processed food is now one of the main protein sources of one’s diet. Consumers rely on the food labeling to decide if the meat product purchased is safe and reliable. Therefore, it is important to ensure the food labeling is done in a correct manner to avoid consumer fraud. More consumers are now concern about the food quality and safety as compared to before. This study described the meat species identification and detection method using Polymerase Chain Reaction (PCR) in 8 types of meats (cattle, buffalo, goat, sheep, chicken, duck, pork and horse). The objective of this study is to decide on the specificity of oligonucleotide sequences obtained from previous study. There were 5 proposed oligonucleotide primer in this study. The main important finding in this work is the specificity of oligonucleotide primers to raw meats. It if found that the oligonucleotide primers proposed were not specific to the local raw meat species. Therefore, further study is needed to obtain a species-specific oligonucletide primers for PCR, in order to be applied in food product testing.

  18. Critical analysis: use of polymerase chain reaction to diagnose leprosy

    Directory of Open Access Journals (Sweden)

    Flaviane Granero Maltempe

    Full Text Available ABSTRACT Leprosy is a neglected tropical disease and an important public health problem, especially in developing countries. It is a chronic infectious disease that is caused by Mycobacterium leprae, which has a predilection for the skin and peripheral nerves. Although it has low sensitivity, slit-skin smear (SSS remains the conventional auxiliary laboratory technique for the clinical diagnosis of leprosy. Polymerase chain reaction (PCR is a molecular biology technique that holds promise as a simple and sensitive diagnostic tool. In the present study, the performance of two PCR methods, using different targets, PCR-LP and PCR-P, were compared with SSS with regard to leprosy diagnosis in a reference laboratory. M. leprae DNA was extracted from 106 lymph samples of 40 patients who had clinical suspicion of leprosy. The samples were subjected to both PCR techniques and SSS. Amplification of the human b-globin gene was used as PCR inhibitor control. The specificity of both PCR techniques was 100%, and sensitivity was 0.007 and 0.015 µg/ml for PCR-LP and PCR-P, respectively. No significant difference was found between either the PCR-LP or PCR-P results and SSS results (p > 0.05. Although PCR is not yet a replacement for SSS in the diagnosis of leprosy, this technique may be used as an efficient auxiliary tool for early detection of the disease, especially in endemic regions. This strategy may also be useful in cases in which SSS results are negative (e.g., in paucibacillary patients and cases in which skin biopsy cannot be performed.

  19. Brucella contamination in raw milk by polymerase chain reaction

    Directory of Open Access Journals (Sweden)

    Mohammad Khalili

    2016-10-01

    Full Text Available Background: Human brucellosis is a significant public health problem in many middle east countries including Iran. Brucella organisms, which are small aerobic, facultative intracellular coccobacilli, localize in the reproductive organs of host animals, causing abortions and sterility. They are shed in large numbers in the animal’s urine, milk, placental fluid, and other fluids. Dairy product from raw milk are a potential threat to public health in endemic developing countries. The gold standard for the diagnosis of brucellosis is isolation of Brucella species. However, isolation Brucella species is time consuming and needed to level 3 biocontainment facilities and highly skilled technical personnel to handle samples and live bacteria for eventual identification. Handling Brucella species increase risk of laboratory infection. Polymerase chain reaction (PCR with high sensitivity and specifity overcomed to these disadvantages. The aim of this study was to detect Brucella species in milk from dairy cattle farms in Kerman province, Iran by PCR technique. Methods: Forty and eight bulk tank milk (BTM were collected from October 2015 to March 2016 from 48 dairy cattle farm including 4200 cows. DNA of milk samples extracted by lysis buffer and proteinase K method. All milk samples were examined by PCR to detect Brucella-specific DNA targeting IS 711. Positive samples must be showed 317 bp amplified, corresponding to the expected size of the IS 711 genome region in all Brucella species. Results: Using IS711 primer were detected in 4 samples (8.3% Brucella spp. from 48 BTM samples in this area. Conclusion: The results indicate that brucellosis by Brucella species is endemic in the Kerman province dairy farms. Consumption of raw milk dairy products by individual farmers operating under poor hygienic conditions represents an high risk to public health. The need for implementing control measures and raising public awareness on zoonotic transmission of

  20. Buoyancy-Driven Polymerase Chain Reaction (PCR) Devices

    Energy Technology Data Exchange (ETDEWEB)

    Ness, K D; Wheeler, E K; Benett, W; Stratton, P; Christian, A; Chen, A; Ortega, J; Weisgraber, T H; Goodson, K E

    2004-09-28

    Polymerase chain reaction (PCR) facilitates DNA detection by significantly increasing the concentration of specific DNA segments. A new class of PCR instruments uses a buoyancy-driven re-circulating flow to thermally cycle the DNA sample and benefits from reduced cycle times, low sample volumes, a miniaturized format, and low power consumption. This paper analyzes a specific buoyancy PCR device in a micro-channel ''race-track'' geometry to determine key parameters about PCR cycle times and other figures of merit as functions of device dimensions. The 1-D model balances the buoyancy driving force with frictional losses. A hydrostatic pressure imbalance concept is used between the left and right sides of the fluid loop to calculate the buoyancy driving force. Velocity and temperature distributions within the channels are determined from two-dimensional analysis of the channel section, with developing region effects included empirically through scaled values of the local Nusselt number. Good agreement between four independent verification steps validate the 1-D simulation approach: (1) analytical expressions for the thermal entrance length are compared against, (2) comparison with a full 3-D finite element simulation, (3) comparison with an experimental flow field characterization, and (4) calculation of the minimum PCR runtime required to get a positive PCR signal from the buoyancy-driven PCR device. The 1-D approach closely models an actual buoyancy-driven PCR device and can further be used as a rapid design tool to simulate buoyancy PCR flows and perform detailed design optimizations studies.

  1. A diagnostic polymerase chain reaction assay for Zika virus.

    Science.gov (United States)

    Balm, Michelle N D; Lee, Chun Kiat; Lee, Hong Kai; Chiu, Lily; Koay, Evelyn S C; Tang, Julian W

    2012-09-01

    Zika virus (ZIKV) is a mosquito-borne flavivirus. Infection results in a dengue-like illness with fever, headache, malaise, and a maculopapular rash. Nearly all cases are mild and self-limiting but in 2007, a large outbreak of ZIKV was reported from the island of Yap (in Micronesia, northwest of Indonesia). Singapore is already endemic for dengue, and its impact on public health and economic burden is significant. Other dengue-like infections (e.g., Chikungunya virus) are present. Yet only 10% of reported dengue cases have laboratory confirmation. The identification and control of other dengue-like, mosquito-transmitted infections is thus important for the health of Singapore's population, as well as its economy. Given that ZIKV shares the same Aedes mosquito vector with both dengue and Chikungunya, it is possible that this virus is present in Singapore and causing some of the mild dengue-like illness. A specific and sensitive one-step, reverse transcription polymerase chain reaction (RT-PCR) with an internal control (IC) was designed and tested on 88 archived samples of dengue-negative, Chikungunya-negative sera from patients presenting to our hospital with a dengue-like illness, to determine the presence of ZIKV in Singapore. The assay was specific for detection of ZIKV and displayed a lower limit of detection (LoD) of 140 copies viral RNA/reaction when tested on synthetic RNA standards prepared using pooled negative patient plasma. Of the 88 samples tested, none were positive for ZIKV RNA, however, the vast majority of these were from patients admitted to hospital and further study may be warranted in community-based environments.

  2. Combination Primer Polymerase Chain Reaction for Multi-Site Mutagenesis of Close Proximity Sites

    OpenAIRE

    Jensen, Pia Hønnerup; Weilguny, Dietmar

    2005-01-01

    We describe a rapid and efficient polymerase chain reaction procedure for multi-site-directed mutagenesis for cases in which the sites to be mutated are in close proximity. The combination primer polymer chain reaction method is based on a multi-site directed mutagenesis protocol together with a splicing by overlapping extension polymerase chain reaction protocol. several different combinations of multiple mutations were successfully performed with this method and are reported in this study.

  3. Rapid quantification of semen hepatitis B virus DNA by real-time polymerase chain reaction

    Institute of Scientific and Technical Information of China (English)

    Wei-Ping Qian; Li-Ka Shing; Yue-Qiu Tan; Ying Chen; Ying Peng; Zhi Li; Guang-Xiu Lu; Marie C. Lin; Hsiang-Fu Kung; Ming-Ling He

    2005-01-01

    AIM: To examine the sensitivity and accuracy of real-time polymerase chain reaction (PCR) for the quantification of hepatitis B virus (HBV) DNA in semen.METHODS: Hepatitis B viral DNA was isolated from HBV carriers' semen and sera using phenol extraction method and QTAamp DNA blood mini kit (Qiagen, Germany). HBV DNA was detected by conventional PCR and quantified by TaqMan technology-based real-time PCR (quantitative polymerase chain reaction (qPCR)). The detection threshold was 200 copies of HBV DNA for conventional PCR and 10 copies of HBV DNA for real time PCR per reaction.RESULTS: Both methods of phenol extraction and QIAamp DNA blood mini kit were suitable for isolating HBV DNA from semen. The value of the detection thresholds was 500 copies of HBV DNA per mL in the semen. The viral loads were 7.5×107 and 1.67×107 copies of HBV DNA per mL in two HBV infected patients' sera, while 2.L4×105 and 3.02×105 copies of HBV DNA per mL in the semen.CONCLUSION: Real-time PCR is a more sensitive and accurate method to detect and quantify HBV DNA in the semen.

  4. Identification of duck plague virus by polymerase chain reaction

    Science.gov (United States)

    Hansen, W.R.; Brown, Sean E.; Nashold, S.W.; Knudson, D.L.

    1999-01-01

    A polymerase chain reaction (PCR) assay was developed for detecting duck plague virus. A 765-bp EcoRI fragment cloned from the genome of the duck plague vaccine (DP-VAC) virus was sequenced for PCR primer development. The fragment sequence was found by GenBank alignment searches to be similar to the 3a?? ends of an undefined open reading frame and the gene for DNA polymerase protein in other herpesviruses. Three of four primer sets were found to be specific for the DP-VAC virus and 100% (7/7) of field isolates but did not amplify DNA from inclusion body disease of cranes virus. The specificity of one primer set was tested with genome templates from other avian herpesviruses, including those from a golden eagle, bald eagle, great horned owl, snowy owl, peregrine falcon, prairie falcon, pigeon, psittacine, and chicken (infectious laryngotracheitis), but amplicons were not produced. Hence, this PCR test is highly specific for duck plague virus DNA. Two primer sets were able to detect 1 fg of DNA from the duck plague vaccine strain, equivalent to five genome copies. In addition, the ratio of tissue culture infectious doses to genome copies of duck plague vaccine virus from infected duck embryo cells was determined to be 1:100, making the PCR assay 20 times more sensitive than tissue culture for detecting duck plague virus. The speed, sensitivity, and specificity of this PCR provide a greatly improved diagnostic and research tool for studying the epizootiology of duck plague. /// Se desarroll?? una prueba de reacci??n en cadena por la polimerasa para detectar el virus de la peste del pato. Un fragmento EcoRI de 765 pares de bases clonado del genoma del virus vacunal de la peste del pato fue secuenciado para la obtenci??n de los iniciadores de la prueba de la reacci??n en cadena por la polimerasa. En investigaciones de alineaci??n en el banco de genes ('GenBank') se encontr?? que la secuencia del fragmento era similar a los extremos 3a?? de un marco de lectura abierto

  5. Real time polymerase chain reaction (rt-pcr for mycobacterium tuberculosis in serpiginous choroiditis- A study of 29 cases

    Directory of Open Access Journals (Sweden)

    RadhaAnnamalai, Jyotirmay Biswas, Sudharshan S, Gayathri R, Lily Therese, Viswanathan S, NamithaBhuvaneswari

    2014-07-01

    Full Text Available Purpose: A study of real time Polymerase Chain Reaction for Mycobacterium tuberculosis (M. tuberculosis DNA in 29 cases of active serpiginous choroiditis. Design: Case control study. Methods: DNA extraction from the aqueous humor was carried out using QIAMP DNA extraction kit. Real- time Polymerase Chain reaction (RT-PCR for MTB was carried out using Genosen’s Mtb complex quantitative Real time PCR kit. All patients were also subjected to complete blood count, venereal disease research laboratory test, chest radiograph, QuantiFERON TB Gold test on the blood and polymerase chain reaction on a sample of aqueous humor. Results: Aqueous aspirate showed copies of mycobacterium tuberculosis DNA in one out of twenty nine cases of serpiginous choroiditis. Direct smear and culture for mycobacteria was negative in all cases. Conclusion: RT-PCR identifies MTB DNA in suspected latent tuberculosis in serpiginous choroiditis with high specificity. Serpiginous choroiditis and multifocal choroiditis due to tuberculosis may resemble each other clinically but have distinct clinical features which can be confirmed by real time polymerase chain reaction performed on the aqueous humor The association between serpiginous choroiditis and tuberculosis would be a chance association or if present a rare association.

  6. Extended kinetic model of real-time polymerase chain reaction process

    Science.gov (United States)

    Fedorov, A. A.; Sochivko, D. G.; Varlamov, D. A.; Kurochkin, V. E.

    2016-11-01

    Real-time polymerase chain reaction (real-time PCR) is the main molecular genetic method used for qualitative and quantitative analysis of specific nucleic acid sequences in many areas of biomedical research. Theoretical study of pCr models allows to estimate the influence of various reaction components and parameters, and to determine the unknown parameter values by approximating the experimental real-time PCR curves. An extended kinetic model of real-time PCR is presented. The model takes into account the enzyme activity based on Michaelis-Menten kinetics, the hybridization of complementary DNA fragments, the presence of a fluorescent probe used for detection of the reaction products, and the temperature dependence of primers and probe hybridization.

  7. Tissue extraction of DNA and RNA and analysis by the polymerase chain reaction.

    Science.gov (United States)

    Jackson, D P; Lewis, F A; Taylor, G R; Boylston, A W; Quirke, P

    1990-06-01

    Several DNA extraction techniques were quantitatively and qualitatively compared using both fresh and paraffin wax embedded tissue and their suitability investigated for providing DNA and RNA for the polymerase chain reaction (PCR). A one hour incubation with proteinase K was the most efficient DNA extraction procedure for fresh tissue. For paraffin wax embedded tissue a five day incubation with proteinase K was required to produce good yields of DNA. Incubation with sodium dodecyl sulphate produced very poor yields, while boiling produced 20% as much DNA as long enzyme digestion. DNA extracted by these methods was suitable for the PCR amplification of a single copy gene. Proteinase K digestion also produced considerable amounts of RNA which has previously been shown to be suitable for PCR analysis. A delay before fixation had no effect on the amount of DNA obtained while fixation in Carnoy's reagent results in a much better preservation of DNA than formalin fixation, allowing greater yields to be extracted.

  8. Comparison of a quantitative real-time polymerase chain reaction (qPCR) with conventional PCR, bacterial culture and ELISA for detection of Mycobacterium avium subsp. paratuberculosis infection in sheep showing pathology of Johne's disease.

    Science.gov (United States)

    Sonawane, Ganesh G; Tripathi, Bhupendra N

    2013-12-01

    A quantitative real-time PCR (qPCR) assay employing IS900 gene specific primers of Mycobacterium avium subsp. parartuberculosis (MAP) was compared with conventional PCR, bacterial culture and enzyme-linked immunosorbent assay in 38 sheep showing granulomatous enteritis and lymphadenitis with and without demonstration of acid-fast bacilli (AFB). The lesions were classified as multibacillary (MB) (n = 23), which had diffuse granulomatous lesions with abundant AFB, and paucibacillary (PB) (n = 15), which had focal or multifocal granulomatous lesions with few or no AFB. In the multibacillary group (MB), IS900 PCR detected 19 (82.6%), and qPCR detected all 23 (100%) sheep positive for MAP in the intestine and lymph node tissues. In the paucibacillary group (PB), IS900 PCR detected 2 (13.3%), and qPCR detected all 15 (100%) sheep positive for MAP in tissues. When results of both groups were taken together, IS900 PCR detected 21(55.2%), and qPCR detected all 38 (100%) animals positive for MAP genome either in the intestine or lymph node tissues. On Herrold egg yolk medium, tissues of 14 (60.9%) MB and 5 (33.3%) PB sheep were found to be positive for MAP. Out of 27 sheep (PB = 8, MB = 19) tested by an ELISA, 21 (77.7%) were found to be positive for MAP antibody, of which 25% (2/8) and 100% (19/19) sheep were from PB and MB sheep, respectively. Based on the results of the present study, it was concluded that qPCR was a highly sensitive test in comparison to conventional PCR, ELISA and bacterial culture for the diagnosis of paratuberculosis on infected tissues especially from paucibacillary sheep.

  9. Copy number ratios determined by two digital polymerase chain reaction systems in genetically modified grains

    Science.gov (United States)

    Pérez Urquiza, M.; Acatzi Silva, A. I.

    2014-02-01

    Three certified reference materials produced from powdered seeds to measure the copy number ratio sequences of p35S/hmgA in maize containing MON 810 event, p35S/Le1 in soybeans containing GTS 40-3-2 event and DREB1A/acc1 in wheat were produced according to the ISO Guides 34 and 35. In this paper, we report digital polymerase chain reaction (dPCR) protocols, performance parameters and results of copy number ratio content of genetically modified organisms (GMOs) in these materials using two new dPCR systems to detect and quantify molecular deoxyribonucleic acid: the BioMark® (Fluidigm) and the OpenArray® (Life Technologies) systems. These technologies were implemented at the National Institute of Metrology in Mexico (CENAM) and in the Reference Center for GMO Detection from the Ministry of Agriculture (CNRDOGM), respectively. The main advantage of this technique against the more-used quantitative polymerase chain reaction (qPCR) is that it generates an absolute number of target molecules in the sample, without reference to standards or an endogenous control, which is very useful when not much information is available for new developments or there are no standard reference materials in the market as in the wheat case presented, or when it was not possible to test the purity of seeds as in the maize case presented here. Both systems reported enhanced productivity, increased reliability and reduced instrument footprint. In this paper, the performance parameters and uncertainty of measurement obtained with both systems are presented and compared.

  10. Highly Sensitive and Reliable Detection of EGFR Exon 19 Deletions by Droplet Digital Polymerase Chain Reaction.

    Science.gov (United States)

    Oskina, Natalya; Oscorbin, Igor; Khrapov, Evgeniy; Boyarskikh, Ulyana; Subbotin, Dmitriy; Demidova, Irina; Imyanitov, Evgeny; Filipenko, Maxim

    2017-06-06

    Analysis of EGFR mutations is becoming a routine clinical practice but the optimal EGFR mutation testing method is still to be determined. We determined the nucleotide sequence of deletions located in exon 19 of the EGFR gene in lung tumor samples of patients residing in different regions of Russia (153 tumor DNA specimens), using Sanger sequencing. We developed a droplet digital polymerase chain reaction assay capable of detecting all common EGFR deletions in exon 19. We also compared the therascreen amplification refractory mutation system assay with a droplet digital polymerase chain reaction assay for the detection of all the deletions in our study. The droplet digital polymerase chain reaction assay demonstrated 100% sensitivity against polymerase chain reaction fragment length analysis and detected all possible types of deletions revealed in our study (22 types). At the same time, the therascreen EGFR RGQ PCR Kit was not able to detect deletions c.2252-2276>A and c.2253-2276 and showed low performance for another long deletion. Thus, we can conclude that the extraordinary length of deletions and their atypical locations (shift at the 3'-region compared to known deletions) could be problematic for the therascreen EGFR RGQ PCR Kit and should be taken into account during targeted mutation test development. However, droplet digital polymerase chain reaction is a promising and reliable assay that can be used as a diagnostic tool to genotype formalin-fixed paraffin-embedded cancer samples for EGFR or another clinically relevant somatic mutation.

  11. A Novel, Essential Control for Clonality Analysis with Human Androgen Receptor Gene Polymerase Chain Reaction

    Science.gov (United States)

    van Dijk, Jeroen P.; Heuver, Leonie H.; van der Reijden, Bert A.; Raymakers, Reinier A.; de Witte, Theo; Jansen, Joop H.

    2002-01-01

    The most widely used technique for determining clonality based on X-chromosome inactivation is the human androgen receptor gene polymerase chain reaction (PCR). The reliability of this assay depends critically on the digestion of DNA before PCR with the methylation-sensitive restriction enzyme HpaII. We have developed a novel method for quantitatively monitoring the HpaII digestion in individual samples. Using real-time quantitative PCR we measured the efficiency of HpaII digestion by measuring the amplification of a gene that escapes X-chromosome inactivation (XE169) before and after digestion. This method was tested in blood samples from 30 individuals: 2 healthy donors and 28 patients with myelodysplastic syndrome. We found a lack of XE169 DNA reduction after digestion in the granulocytes of two myelodysplastic syndrome patients leading to a false polyclonal X-chromosome inactivation pattern. In all other samples a significant reduction of XE169 DNA was observed after HpaII digestion. The median reduction was 220-fold, ranging from a 9.0-fold to a 57,000-fold reduction. Also paraffin-embedded malignant tissue was investigated from two samples of patients with mantle cell lymphoma and two samples of patients with colon carcinoma. In three of these cases inefficient HpaII digestion led to inaccurate X-chromosome inactivation pattern ratios. We conclude that monitoring the efficiency of the HpaII digestion in a human androgen receptor gene PCR setting is both necessary and feasible. PMID:12213708

  12. A real time polymerase chain reaction assay for quantification of Edwardsiella ictaluri in catfish pond water and genetic homogeneity of diagnostic case isolates from Mississippi

    Science.gov (United States)

    A quantitative polymerase chain reaction (qPCR) assay was developed for the detection and quantification of Edwardsiella ictaluri in channel catfish Ictalurus punctatus pond water using modifications to a published E. ictaluri–specific qPCR assay and previously established protocols for the molecula...

  13. Random Mutagenesis by Error-Prone Polymerase Chain Reaction Using a Heavy Water Solvent.

    Science.gov (United States)

    Minamoto, Toshifumi

    2017-01-01

    Heavy water is a form of water that contains a heavier isotope of hydrogen ((2)H, also known as deuterium, D) or oxygen ((17)O or (18)O). When using heavy water as a solvent, error-prone polymerase chain reaction (epPCR) can induce random mutations independent of the polymerase used or the composition of the PCR reaction mixture. This relatively new method can easily be combined with the existing epPCR methods to increase the rate of mutations.

  14. Polymerase Chain Reaction/Rapid Methods Are Gaining a Foothold in Developing Countries.

    Science.gov (United States)

    Ragheb, Suzan Mohammed; Jimenez, Luis

    Detection of microbial contamination in pharmaceutical raw materials and finished products is a critical factor to guarantee their safety, stability, and potency. Rapid microbiological methods-such as polymerase chain reaction-have been widely applied to clinical and food quality control analysis. However, polymerase chain reaction applications to pharmaceutical quality control have been rather slow and sporadic. Successful implementation of these methods in pharmaceutical companies in developing countries requires important considerations to provide sensitive and robust assays that will comply with good manufacturing practices.

  15. Evaluation of IgG anti-toxoplasma avidity and polymerase chain reaction in the postnatal diagnosis of congenital toxoplasmosis.

    Science.gov (United States)

    Torres, Elizabeth; Rivera, Raul; Cardona, Nestor; Sanchez, Victor; Lora, Fabiana; Gómez-Marín, Jorge Enrique

    2013-06-01

    Confirmatory tests for congenital toxoplasmosis were evaluated in 23 infected and 31 uninfected newborns. Conventional polymerase chain reaction was better than real-time polymerase chain reaction, but did not identify additional cases. Avidity tests added 2 new cases that were not identified by other criteria. Overall sensitivity was 82.6%. Avidity assay, but not polymerase chain reaction, increased the sensitivity of confirmatory assays in congenital toxoplasmosis.

  16. Use of Existing Diagnostic Reverse-Transcription Polymerase Chain Reaction Assays for Detection of Ebola Virus RNA in Semen.

    Science.gov (United States)

    Pettitt, James; Higgs, Elizabeth S; Adams, Rick D; Jahrling, Peter B; Hensley, Lisa E

    2016-04-15

    Sexual transmission of Ebola virus in Liberia has now been documented and associated with new clusters in regions previously declared Ebola free. Assays that have Emergency Use Authorization (EUA) and are routinely used to detect Ebola virus RNA in whole blood and plasma specimens at the Liberian Institute for Biomedical Research were tested for their suitability in detecting the presence of Ebola virus RNA in semen. Qiagen AVL extraction protocols, as well as the Ebola Zaire Target 1 and major groove binder quantitative reverse-transcription polymerase chain reaction assays, were demonstrably suitable for this purpose and should facilitate epidemiologic investigations, including those involving long-term survivors of Ebola.

  17. Reverse transcription-polymerase chain reaction molecular testing of cytology specimens: Pre-analytic and analytic factors.

    Science.gov (United States)

    Bridge, Julia A

    2017-01-01

    The introduction of molecular testing into cytopathology laboratory practice has expanded the types of samples considered feasible for identifying genetic alterations that play an essential role in cancer diagnosis and treatment. Reverse transcription-polymerase chain reaction (RT-PCR), a sensitive and specific technical approach for amplifying a defined segment of RNA after it has been reverse-transcribed into its DNA complement, is commonly used in clinical practice for the identification of recurrent or tumor-specific fusion gene events. Real-time RT-PCR (quantitative RT-PCR), a technical variation, also permits the quantitation of products generated during each cycle of the polymerase chain reaction process. This review addresses qualitative and quantitative pre-analytic and analytic considerations of RT-PCR as they relate to various cytologic specimens. An understanding of these aspects of genetic testing is central to attaining optimal results in the face of the challenges that cytology specimens may present. Cancer Cytopathol 2017;125:11-19. © 2016 American Cancer Society.

  18. 多重定量荧光PCR在胎儿常见染色体非整倍体快速诊断中的应用%Application of multiple quantitative fluorescence polymerase chain reaction approach for rapid prenatal diagnosis of common chromosome aneuploidies

    Institute of Scientific and Technical Information of China (English)

    胡婷; 刘洪倩; 朱红梅; 王婧; 张海霞; 祝茜; 赖怡; 秦利; 王和

    2014-01-01

    目的 探讨多重定量荧光PCR(quantitative fluorescence polymerase chain reaction,QFPCR)技术在胎儿常见染色体非整倍体异常快速诊断中的应用.方法 用QF-PCR技术对我院4649名行羊膜腔穿刺术孕妇的4760份羊水样本21、18、13、X和Y染色体数目进行分析,并与染色体核型分析结果进行比较.结果 QF-PCR检测成功率为98.4%.QF-PCR检测出21、18、13、X及Y染色体非整倍体48例(2例核型为46,XY,rob(13∶21),+21;4例为双胎之一21三体),均与核型分析结果一致,5种常见染色体非整倍体异常分析敏感性和特异性均为100%;检出1例21三体嵌合体及4例性染色体异常的嵌合体(1例核型分析漏诊);QF-PCR漏诊4例性染色体嵌合体;染色体核型分析失败的64例样本,QF-PCR检测均得到结果.QF-PCR检测结果与核型分析符合率为98.3%.结论 QF-PCR技术可快速、准确的诊断21、18、13、X及Y染色体非整倍体,并能检出部分嵌合体,作为染色体核型分析的有效补充,在快速产前诊断中具有重要临床实用价值.%Objective To assess the value of multiple quantitative fluorescence polymerase chain reaction (QF-PCR) approach for rapid prenatal diagnosis of common chromosomal aneuploidies.Methods A total of 4760 amniotic samples from 4649 pregnant women were analyzed with QF-PCR for 21,18,13,X and Y aneuploidies,and the results were compared with those of karyotype analysis.Results The overall success rate for QF-PCR was 98.4%.All the 48 cases of 21,18,13,X and Y aneuploidies (including 2 case of 46,XY,rob(13 ∶ 21),+ 21; 4 trisomy 21 in 4 twins) were detected by QF-PCR,with the overall sensibility and specificity both reaching 100%.One mosaicism of trisomy 21 and 4 mosaicisms of sex chromosome (1 misdiagnosed by karyotype analysis) were also detected by QF-PCR.Four mosaicisms of sex chromosome were verified as missed diagnosis.All the 64 cases failed by karyotype analysis were successfully analyzed by the

  19. Use of neuropathological tissue for molecular genetic studies: parameters affecting DNA extraction and polymerase chain reaction.

    Science.gov (United States)

    Kösel, S; Graeber, M B

    1994-01-01

    Nuclear and mitochondrial DNA were extracted from gray matter of human cerebral cortex which had either been formalin-fixed and embedded into paraffin or stored in formalin for up to 26 years. Extraction conditions were optimized for proteinase K digestion, i.e., enzyme concentration, digestion temperature and incubation time. Using the polymerase chain reaction (PCR), DNA was successfully amplified from archival material and sequenced employing a direct nonradioactive cycle sequencing protocol. In general, tissue embedded into paraffin following brief fixation in formalin gave good quantitative results, i.e., up to 1 microgram DNA/mg tissue were extracted. This yield was at least one order of magnitude higher than that obtained with tissue stored in formalin. However, paraffin-embedded neuropathological material was found to contain an as-yet-unidentified PCR inhibitor, and a deleterious effect of long-term fixation in unbuffered low-grade formalin was clearly detectable. Importantly, both paraffin-embedded tissue blocks and human brain that had been stored in formalin for many years yielded DNA sufficient for qualitative analysis. The implications of these findings for the use of neuropathological material in molecular genetic studies are discussed.

  20. Mechanisms of Propidium Monoazide Inhibition of Polymerase Chain Reaction and implications for Propidium Monoazide Applications

    Science.gov (United States)

    Lee, C. M.; Darrach, H.; Ponce, A.; McFarland, E.; Laymon, C.; Fingland, N. K.

    2015-12-01

    PMA-qPCR is a laboratory technique that can be used to identify viable microbes by employing the use of propidium monoazide (PMA), a DNA-intercalating dye, and quantitative polymerase chain reaction (qPCR). The current model of PMA-qPCR operates under the assumption that PMA is only capable of entering membrane-compromised cells, where it irreversibly cross-links to DNA and makes it unavailable for amplification via qPCR. However, the exact mechanism behind PMA's entry into the cell and its interaction with genetic material is not well understood. To better understand PMA's capabilities, we have examined the effect PMA has on enzyme binding and processivity using endonucleases and exonucleases. Our results suggest that the current model behind PMA-qPCR inhibition is incomplete, in that rather than precipitating the entirety of the DNA, PMA also inhibits enzyme binding and/or processivity in soluble DNA. These results have important implications for studying the viable community of microorganisms in various applications, such as environmental monitoring, planetary protection and bioburden assessment, and biohazard detection.

  1. Diagnosis of whooping cough in Switzerland: differentiating Bordetella pertussis from Bordetella holmesii by polymerase chain reaction.

    Science.gov (United States)

    Pittet, Laure F; Emonet, Stéphane; François, Patrice; Bonetti, Eve-Julie; Schrenzel, Jacques; Hug, Melanie; Altwegg, Martin; Siegrist, Claire-Anne; Posfay-Barbe, Klara M

    2014-01-01

    Bordetella holmesii, an emerging pathogen, can be misidentified as Bordetella pertussis by routine polymerase chain reaction (PCR). In some reports, up to 29% of the patients diagnosed with pertussis have in fact B. holmesii infection and invasive, non-respiratory B. holmesii infections have been reported worldwide. This misdiagnosis undermines the knowledge of pertussis' epidemiology, and may lead to misconceptions on pertussis vaccine's efficacy. Recently, the number of whooping cough cases has increased significantly in several countries. The aim of this retrospective study was to determine whether B. holmesii was contributing to the increase in laboratory-confirmed cases of B. pertussis in Switzerland. A multiplex species-specific quantitative PCR assay was performed on 196 nasopharyngeal samples from Swiss patients with PCR-confirmed Bordetella infection (median age: 6 years-old, minimum 21 days-old, maximum 86 years-old), formerly diagnosed as Bordetella pertussis (IS481+). No B. holmesii (IS481+, IS1001-, hIS1001+) was identified. We discuss whether laboratories should implement specific PCR to recognize different Bordetella species. We conclude that in Switzerland B. holmesii seems to be circulating less than in neighboring countries and that specific diagnostic procedures are not necessary routinely. However, as the epidemiological situation may change rapidly, periodic reevaluation is suggested.

  2. Diagnosis of whooping cough in Switzerland: differentiating Bordetella pertussis from Bordetella holmesii by polymerase chain reaction.

    Directory of Open Access Journals (Sweden)

    Laure F Pittet

    Full Text Available Bordetella holmesii, an emerging pathogen, can be misidentified as Bordetella pertussis by routine polymerase chain reaction (PCR. In some reports, up to 29% of the patients diagnosed with pertussis have in fact B. holmesii infection and invasive, non-respiratory B. holmesii infections have been reported worldwide. This misdiagnosis undermines the knowledge of pertussis' epidemiology, and may lead to misconceptions on pertussis vaccine's efficacy. Recently, the number of whooping cough cases has increased significantly in several countries. The aim of this retrospective study was to determine whether B. holmesii was contributing to the increase in laboratory-confirmed cases of B. pertussis in Switzerland. A multiplex species-specific quantitative PCR assay was performed on 196 nasopharyngeal samples from Swiss patients with PCR-confirmed Bordetella infection (median age: 6 years-old, minimum 21 days-old, maximum 86 years-old, formerly diagnosed as Bordetella pertussis (IS481+. No B. holmesii (IS481+, IS1001-, hIS1001+ was identified. We discuss whether laboratories should implement specific PCR to recognize different Bordetella species. We conclude that in Switzerland B. holmesii seems to be circulating less than in neighboring countries and that specific diagnostic procedures are not necessary routinely. However, as the epidemiological situation may change rapidly, periodic reevaluation is suggested.

  3. A novel technique for measuring variations in DNA copy-number: competitive genomic polymerase chain reaction

    Directory of Open Access Journals (Sweden)

    Nakagawara Akira

    2007-07-01

    Full Text Available Background Changes in genomic copy number occur in many human diseases including cancer. Characterization of these changes is important for both basic understanding and diagnosis of these diseases. Microarrays have recently become the standard technique and are commercially available. However, it is useful to have an affordable technique to complement them. Results We describe a novel polymerase chain reaction (PCR-based technique, termed competitive genomic PCR (CGP. The main characteristic of CGP is that different adaptors are added to the sample and control genomic DNAs after appropriate restriction enzyme digestion. These adaptor-supplemented DNAs are subjected to competitive PCR using an adaptor-primer and a locus-specific primer. The amplified products are then separated according to size differences between the adaptors. CGP eliminates the tedious steps inherent in quantitative PCR and achieves moderate throughput. Assays with different X chromosome numbers showed that it can provide accurate quantification. High-resolution analysis of neuroblastoma cell lines around the MYCN locus revealed novel junctions for amplification, which were not detected by a commercial array. Conclusion CGP is a moderate throughput technique for analyzing changes in genomic copy numbers. Because CGP can measure any genomic locus using PCR primers, it is especially useful for detailed analysis of a genomic region of interest.

  4. Mucosal polymerase chain reaction for diagnosing Helicobacter pylori infection in patients with bleeding peptic ulcers

    Institute of Scientific and Technical Information of China (English)

    Hwai-Jeng Lin; Wen-Ching Lo; Chin-Lin Perng; Guan-Ying Tseng; Anna Fen-Yau Li; Yueh-Hsing Ou

    2005-01-01

    AIM: Helicobacter pylori(Hpylori) has been linked to chronic gastritis, peptic ulcers, gastric cancer and MALT-lymphoma.Conventional invasive tests are less sensitive than noninvasive tests in diagnosing H pylori infection in patients with bleeding peptic ulcers. Polymerase chain reaction is a sensitive and accurate method for diagnosing H pylori infection. The aim of this study was to evaluate the diagnostic role of mucosal polymerase chain reaction for H pylori infection in patients with bleeding peptic ulcers.METHODS: In patients with bleeding, non-bleeding peptic ulcers and chronic gastritis, we checked rapid urease test,histology, bacterial culture and mucosal polymerase chain reaction for detecting H pylori infection. Positive H pylori infection was defined as positive culture or both a positive histology and a positive rapid urease test. For mucosal polymerase chain reaction of Hpylori, we checked vacA (s1a, s1b, s1c, s2, m1, m1T, m2),iceA1,iceA2 and cag A.RESULTS: Between October 2000 and April 2002, 88 patients with bleeding peptic ulcers (males/females: 60/28, gastric ulcers/duodenal ulcers: 55/33), 81 patients with non-bleeding peptic ulcers (males/females: 54/27, gastric ulcers/duodenal ulcers: 45/36) and 37 patients with chronic gastritis (males/females: 24/13) were enrolled in this study. In patients with bleeding peptic ulcers, non-bleeding peptic ulcers and chronic gastritis, 45 patients (51%), 71 patients (88%)and 20 patients (54%) respectively were found to have positive H pylori infection (P<0.001). In patients with bleeding peptic ulcers, non-bleeding peptic ulcers and chronic gastritis, polymerase chain reaction for H pylori infection was positive in 54 patients (61%), 70 patients (86%) and 20 patients (54%) respectively (P<0.001). The sensitivity,positive predictive value and diagnostic accuracy of mucosal polymerase reaction for Hpylori infection were significantly lower in patients with bleeding peptic ulcers (84%, 79%and 81%) than in

  5. Total chemical synthesis of a thermostable enzyme capable of polymerase chain reaction.

    Science.gov (United States)

    Xu, Weiliang; Jiang, Wenjun; Wang, Jiaxing; Yu, Linping; Chen, Ji; Liu, Xianyu; Liu, Lei; Zhu, Ting F

    2017-01-01

    Polymerase chain reaction (PCR) has been a defining tool in modern biology. Towards realizing mirror-image PCR, we have designed and chemically synthesized a mutant version of the 352-residue thermostable Sulfolobus solfataricus P2 DNA polymerase IV with l-amino acids and tested its PCR activity biochemically. To the best of our knowledge, this enzyme is the largest chemically synthesized protein reported to date. We show that with optimization of PCR conditions, the fully synthetic polymerase is capable of amplifying template sequences of up to 1.5 kb. The establishment of this synthetic route for chemically synthesizing DNA polymerase IV is a stepping stone towards building a d-enzyme system for mirror-image PCR, which may open up an avenue for the creation of many mirror-image molecular tools such as mirror-image systematic evolution of ligands by exponential enrichment.

  6. Thermostable Mismatch-Recognizing Protein MutS Suppresses Nonspecific Amplification during Polymerase Chain Reaction (PCR)

    Science.gov (United States)

    Fukui, Kenji; Bessho, Yoshitaka; Shimada, Atsuhiro; Yokoyama, Shigeyuki; Kuramitsu, Seiki

    2013-01-01

    Polymerase chain reaction (PCR)-related technologies are hampered mainly by two types of error: nonspecific amplification and DNA polymerase-generated mutations. Here, we report that both errors can be suppressed by the addition of a DNA mismatch-recognizing protein, MutS, from a thermophilic bacterium. Although it had been expected that MutS has a potential to suppress polymerase-generated mutations, we unexpectedly found that it also reduced nonspecific amplification. On the basis of this finding, we propose that MutS binds a mismatched primer-template complex, thereby preventing the approach of DNA polymerase to the 3′ end of the primer. Our simple methodology improves the efficiency and accuracy of DNA amplification and should therefore benefit various PCR-based applications, ranging from basic biological research to applied medical science. PMID:23519109

  7. Haemophilus ducreyi detection by polymerase chain reaction in oesophageal lesions of HIV patients.

    Science.gov (United States)

    Borges, M C; Colares, J K B; Lima, D M; Fonseca, B A L

    2009-04-01

    HIV patients frequently have opportunistic oesophageal infections. We report Haemophilus ducreyi genetic material detected by polymerase chain reaction in biopsies of oesophageal lesions in three HIV-1-infected patients. This finding may be an indication of its aetiopathological role in oesophageal lesions of HIV patients.

  8. Detection of adenovirus hexon sequence in a cat by polymerase chain reaction(short communication)

    NARCIS (Netherlands)

    Horzinek, M.C.; Lakatos, B.; Farkas, J.; Egberink, H.F.; Vennema, H.; Benko, M.

    1999-01-01

    Adenoviral nucleic acid was detected by polymerase chain reaction (PCR) in pharyngeal and rectal swab samples of a cat seropositive for adenovirus and suffering from transient hepatic failure. The samples were taken at a one-year interval, and both faecal samples as well as the second pharyngeal

  9. POTATO RING ROT PATHOGEN DETECTION BY POLYMERASE CHAIN REACTION IN POTATO TUBERS

    Directory of Open Access Journals (Sweden)

    Shafikova T.N.

    2008-10-01

    Full Text Available Bacterial ring rot caused by Clavibacter michiganensis ssp. sepedonicus is a widespread disease of potato resulting in significant economic lost in agriculture and seed growing. A latent form of this infection makes difficulties for diagnostics and facilitates the quick disease propagation. Polymerase chain reaction is the best method for the disease control.

  10. Use of enrichment real time-Polymerase Chain Reaction to enumerate Salmonella on chicken parts

    Science.gov (United States)

    Salmonella that survive cooking and that cross-contaminate other food during meal preparation and serving represent primary routes of consumer exposure to this pathogen from chicken. Consequently, the present study was undertaken to use enrichment real time-polymerase chain reaction (RT-PCR) to enu...

  11. Polymerase chain reaction amplification of genomic fragments of bovine herpesvirus-1

    OpenAIRE

    Cândido AL; ED Bontempo; Resende M.

    2000-01-01

    Especial conditions were developed for the amplification of five DNA segments from US region of BHV-1 by polymerase chain reaction. In order to eliminate most nonspecific products it was found that addition of three cosolvents DMSO, glycerol and NP 40 was a simple method for increasing the specificity of amplification.

  12. Rapid and sensitive detection of Campylobacter spp. in chicken products by using the polymerase chain reaction

    NARCIS (Netherlands)

    Giesendorf, B A; Quint, W G; Henkens, M H; Stegeman, H; Huf, F A; Niesters, H G

    1992-01-01

    The polymerase chain reaction (PCR) after a short enrichment culture was used to detect Campylobacter spp. in chicken products. After the 16S rRNA gene sequence of Campylobacter jejuni was determined and compared with known sequences from other enterobacteria, a primer and probe combination was sele

  13. Direct detection of Streptococcus mutans in human dental plaque by polymerase chain reaction.

    Science.gov (United States)

    Igarashi, T; Yamamoto, A; Goto, N

    1996-10-01

    Streptococcus mutans is an etiological agent in human dental caries. A method for the detection of S. mutans directly from human dental plaque by polymerase chain reaction has been developed. Oligonucleotide primers specific for a portion of the dextranase gene (dexA) of S. mutans Ingbritt (serotype c) were designed to amplify a 1272-bp DNA fragment by polymerase chain reaction. The present method specifically detected S. mutans (serotypes c, e and f), but none of the other mutans streptococci: S. cricetus (serotype a), S. rattus (serotype b), S. sobrinus (serotypes d and g), and S. downei (serotype h), other gram-positive bacteria (16 strains of 12 species of cocci and 18 strains of 12 species of bacilli) nor gram-negative bacteria (1 strain of 1 species of cocci and 20 strains of 18 species of bacilli). The method was capable of detecting 1 pg of the chromosomal DNA purified from S. mutans Ingbritt and as few as 12 colony-forming units of S. mutans cells. The S. mutans cells in human dental plaque were also directly detected. Seventy clinical isolates of S. mutans isolated from the dental plaque of 8 patients were all positive by the polymerase chain reaction. These results suggest that the dexA polymerase chain reaction is suitable for the specific detection and identification of S. mutans.

  14. Designing Polymerase Chain Reaction (PCR) Primer Multiplexes in the Forensic Laboratory

    Science.gov (United States)

    Elkins, Kelly M.

    2011-01-01

    The polymerase chain reaction (PCR) is a common experiment in upper-level undergraduate biochemistry, molecular biology, and forensic laboratory courses as reagents and thermocyclers have become more affordable for institutions. Typically, instructors design PCR primers to amplify the region of interest and the students prepare their samples for…

  15. Detection of adenovirus hexon sequence in a cat by polymerase chain reaction(short communication)

    NARCIS (Netherlands)

    Horzinek, M.C.; Lakatos, B.; Farkas, J.; Egberink, H.F.; Vennema, H.; Benko, M.

    1999-01-01

    Adenoviral nucleic acid was detected by polymerase chain reaction (PCR) in pharyngeal and rectal swab samples of a cat seropositive for adenovirus and suffering from transient hepatic failure. The samples were taken at a one-year interval, and both faecal samples as well as the second pharyngeal sam

  16. Detection of adenovirus hexon sequence in a cat by polymerase chain reaction(short communication)

    NARCIS (Netherlands)

    Horzinek, M.C.; Lakatos, B.; Farkas, J.; Egberink, H.F.; Vennema, H.; Benko, M.

    1999-01-01

    Adenoviral nucleic acid was detected by polymerase chain reaction (PCR) in pharyngeal and rectal swab samples of a cat seropositive for adenovirus and suffering from transient hepatic failure. The samples were taken at a one-year interval, and both faecal samples as well as the second pharyngeal sam

  17. Polymerase chain reaction-mediated DNA fingerprinting for epidemiological studies on Campylobacter spp

    NARCIS (Netherlands)

    Giesendorf, B A; Goossens, H; Niesters, H G; Van Belkum, A; Koeken, A; Endtz, H P; Stegeman, H; Quint, W G

    1994-01-01

    The applicability of polymerase chain reaction (PCR)-mediated DNA typing, with primers complementary to dispersed repetitive DNA sequences and arbitrarily chosen DNA motifs, to study the epidemiology of campylobacter infection was evaluated. With a single PCR reaction and simple gel electrophoresis,

  18. HLA-DQA1 typing in Danes by two polymerase chain reaction (PCR) based methods

    DEFF Research Database (Denmark)

    Cowland, J B; Madsen, H O; Morling, N

    1995-01-01

    A total of 280 persons were HLA-DQA1 typed by two different polymerase chain reaction (PCR) based methods; (i) a reverse dot-blot (RDB) method, which can differentiate between six alleles, and (ii) a combined PCR-restriction fragment length polymorphism (PCR-RFLP) and allele-specific amplification...

  19. Designing Polymerase Chain Reaction (PCR) Primer Multiplexes in the Forensic Laboratory

    Science.gov (United States)

    Elkins, Kelly M.

    2011-01-01

    The polymerase chain reaction (PCR) is a common experiment in upper-level undergraduate biochemistry, molecular biology, and forensic laboratory courses as reagents and thermocyclers have become more affordable for institutions. Typically, instructors design PCR primers to amplify the region of interest and the students prepare their samples for…

  20. Pneumocystis carinii in bronchoalveolar lavage and induced sputum: detection with a nested polymerase chain reaction

    DEFF Research Database (Denmark)

    Skøt, J; Lerche, A G; Kolmos, H J;

    1995-01-01

    To evaluate polymerase chain reaction (PCR) for detection of Pneumocystis carinii, 117 bronchoalveolar lavage (BAL) specimens, from HIV-infected patients undergoing a diagnostic bronchoscopy, were processed and a nested PCR, followed by Southern blot and hybridization with a P32-labelled probe...

  1. On-Chip integration of sample pretreatment and Multiplex polymerase chain reaction (PCR) for DNA analysis

    DEFF Research Database (Denmark)

    Brivio, Monica; Snakenborg, Detlef; Søgaard, E.;

    2008-01-01

    In this paper we present a modular lab-on-a-chip system for integrated sample pre-treatment (PT) by magnetophoresis and DNA amplification by polymerase chain reaction (PCR). It consists of a polymer-based microfluidic chip mounted on a custom-made thermocycler (Figure 1) and includes a simple...

  2. Using the Polymerase Chain Reaction in an Undergraduate Laboratory to Produce "DNA Fingerprints."

    Science.gov (United States)

    Phelps, Tara L.; And Others

    1996-01-01

    Presents a laboratory exercise that demonstrates the sensitivity of the Polymerase Chain Reaction as well as its potential application to forensic analysis during a criminal investigation. Can also be used to introduce, review, and integrate population and molecular genetics topics such as genotypes, multiple alleles, allelic and genotypic…

  3. Detection of infections of the eye with Chlamydia trachomatis by the polymerase chain reaction

    NARCIS (Netherlands)

    J. Fan (Jun); W.Y. Zhang (Wen); Y.Y. Wu (Yu); X.Y. Jing (Xiou); E.C.J. Claas (Eric)

    1993-01-01

    textabstractThe aim of this study was to test the diagnostic feasibility of the polymerase chain reaction (PCR) for detection of infections with Chlamydia trachomatis in eye swabs from patients with conjunctivitis, and to establish the basic technique of the PCR for epidemiological survey. The resul

  4. Polymerase chain reaction-mediated DNA fingerprinting for epidemiological studies on Campylobacter spp

    NARCIS (Netherlands)

    Giesendorf, B A; Goossens, H; Niesters, H G; Van Belkum, A; Koeken, A; Endtz, H P; Stegeman, H; Quint, W G

    The applicability of polymerase chain reaction (PCR)-mediated DNA typing, with primers complementary to dispersed repetitive DNA sequences and arbitrarily chosen DNA motifs, to study the epidemiology of campylobacter infection was evaluated. With a single PCR reaction and simple gel electrophoresis,

  5. Sustaines high throughput polymerase chain reaction diagnostics during the European epidemic of Bluetongue serotype 8

    NARCIS (Netherlands)

    Rijn, van P.A.; Heutink, C.G.; Boonstra, J.; Kramps, J.A.; Gennip, van H.G.P.

    2012-01-01

    A real-time reverse transcription polymerase chain reaction assay (PCR test) based on genome segment 10 of Bluetongue virus (BTV) was developed. The PCR test consists of robotized viral RNA isolation from blood samples and an all-in-one method including initial denaturation of genomic

  6. Detection of infections of the eye with Chlamydia trachomatis by the polymerase chain reaction

    NARCIS (Netherlands)

    J. Fan (Jun); W.Y. Zhang (Wen); Y.Y. Wu (Yu); X.Y. Jing (Xiou); E.C.J. Claas (Eric)

    1993-01-01

    textabstractThe aim of this study was to test the diagnostic feasibility of the polymerase chain reaction (PCR) for detection of infections with Chlamydia trachomatis in eye swabs from patients with conjunctivitis, and to establish the basic technique of the PCR for epidemiological survey. The

  7. Rapid and sensitive detection of Campylobacter spp. in chicken products by using the polymerase chain reaction

    NARCIS (Netherlands)

    Giesendorf, B A; Quint, W G; Henkens, M H; Stegeman, H; Huf, F A; Niesters, H G

    1992-01-01

    The polymerase chain reaction (PCR) after a short enrichment culture was used to detect Campylobacter spp. in chicken products. After the 16S rRNA gene sequence of Campylobacter jejuni was determined and compared with known sequences from other enterobacteria, a primer and probe combination was

  8. [Application of the polymerase chain reaction for detecting respiratory syncytial virus].

    Science.gov (United States)

    Sarmiento, L; Chacón, D; Valdivia, A; Savón, C; Goyenechea, A

    1997-01-01

    The polymerase chain reaction (PCR) was developed in order to identify the respiratory syncytial virus by using the reference strain. The high sensitivity and specificity obtained show the PCR utility for detecting the RSV genoma and its application on the diagnosis.

  9. Principles and applications of polymerase chain reaction in medical diagnostic fields: a review

    OpenAIRE

    Marcela Agne Alves Valones; Rafael Lima Guimarães; Lucas André Cavalcanti Brandão; Paulo Roberto Eleutério de Souza; Alessandra Albuquerque Tavares de Carvalho; Sergio Crovela

    2009-01-01

    Recent developments in molecular methods have revolutionized the detection and characterization of microorganisms in a broad range of medical diagnostic fields, including virology, mycology, parasitology, microbiology and dentistry. Among these methods, Polymerase Chain Reaction (PCR) has generated great benefits and allowed scientific advancements. PCR is an excellent technique for the rapid detection of pathogens, including those difficult to culture. Along with conventional PCR techniques,...

  10. Specific Detection of Campylobacter Jejuni and Campylobacter Coli by Using Polymerase Chain Reaction

    Science.gov (United States)

    1992-10-01

    D2676 CDC C. cryaerophila ( Arcobacter cryoaerophilus) 1 D2792 (type strain) CDC C. hyoinestinilis 3 D2189 CDC D2411 (porcine) CDC D1932 (type...polymerase descriptions and proposal of Arcobacter gen. nov. Int. J. Syst. chain reaction for the detection of Mycobacterium leprae. 1. Bacteriol. 41:451-455

  11. Detection and analysis of polymerase chain reaction products by mass spectrometry

    Energy Technology Data Exchange (ETDEWEB)

    Hurst, G.B., Doktycz, M.J., Britt, P.F., Vass, A.A., Buchanan, M.V.

    1997-02-01

    This paper describes recent and ongoing efforts to overcome some of the obstacles to more routine and robust application of MALDI-TOF to analysis of polymerase chain reaction products and other information- bearing nucleic acid molecules. Methods for purifying nucleic acid samples are described, as is the application of delayed extraction TOF mass spectrometry to analysis of short oligonucleotides.

  12. 实时荧光定量聚合酶链反应检测结核分枝杆菌在结核性脑膜炎诊断中的价值%Diagnostic value of real time fluorescent quantitation polymerase chain reaction for detecting the mycobacterium tuberculosis in diagnosis of tuberculous meningitis

    Institute of Scientific and Technical Information of China (English)

    李向平; 胡淼; 韩磊; 郭春磊; 董玉倩; 李平法

    2013-01-01

    Objective To investigate the value of real time fluorescent quantitation polymerase chain reaction (PCR)which detected the mycobacterium tuberculosis in the diagnosis of tuberculous meningitis.Methods Smear and real time fluorescent quantitation PCR methods were used to detect cerebrospinal fluid samples of 181 patients who were clinically diagnosed tuberculous meningitis,suspected tuberculous meningitis as well as suffered non-tuberculous meningitis.Meanwhile,the results were analyzed.Results In the sample of 181 cerebrospinal fluid,the positive rate detected by cerebrospinal fluid smear method was 2.21% (4/181)and the positive rate detected by real time fluorescent quantitation PCR method was 12.15% (22/181).The cerebrospinal fluid specimens positive rates of 51 cases clinically definited tuberculous meningitis detected by smear and real time fluorescent quantitation PCR assay were 5.88% (3/51) and 25.49% (13/51) respectively.And in the 80 cases of suspected tuberculous meningitis patients,the positive rates were 1.25% (1/80)and 11.25% (9/80)respectively.The difference of the positive detection rate between the two methods was statistically significant (x2 =10.654,P < 0.05).Cerebrospinal fluid specimens of 50 cases with non-tuberculous meningitis detected by smear and real time fluorescent quantitation PCR methods were both negative.Conclusion Detection of mycobacterium tuberculosis with real time fluorescent quantitation PCR method has high clinical application value,and it can be used as one of effective methods of clinical tuberculosis detection and diagnosis.%目的 探讨实时荧光定量聚合酶链反应(PCR)法检测结核分枝杆菌在结核性脑膜炎诊断中的价值.方法 对181例临床确诊的结核性脑膜炎患者、可疑结核性脑膜炎患者和非结核性脑膜炎患者的脑脊液标本采用涂片、实时荧光定量PCR 2种方法进行检测,对其结果进行对比分析.结果 181例脑脊液标本中,脑脊

  13. Diversity of Enterococcus faecalis Genotypes from Multiple Oral Sites Associated with Endodontic Failure Using Repetitive Sequence-based Polymerase Chain Reaction and Arbitrarily Primed Polymerase Chain Reaction.

    Science.gov (United States)

    Delboni, Maraísa G; Gomes, Brenda P F A; Francisco, Priscila A; Teixeira, Fabrício B; Drake, David

    2017-03-01

    The aim of this study was to evaluate the diversity and similarity of Enterococcus faecalis genotype isolates from multiple oral sites using repetitive sequence-based polymerase chain reaction and arbitrarily primed polymerase chain reaction (AP-PCR). Forty-two endodontically treated teeth with apical periodontitis were selected. A total of 126 microbial samples were collected from 3 different sites (saliva, pulp chamber, and root canals, all n = 42) during the nonsurgical retreatment procedures. After growth on m-Enterococcus agar, the colonies were isolated, characterized as gram-positive catalase negative cocci, and identified using an API 20 Strep kit (bioMérieux, Marcy-l'Etoile, France). Seventy-four colonies from 10 patients were confirmed as E. faecalis by polymerase chain reaction (16S ribosomal RNA). Repetitive sequence-based polymerase chain reactions using ERIC and AP-PCR using RW3A primers were performed in all 74 colonies. Fingerprints were analyzed and separated into genotypic groups based on the Dice coefficient percentage of similarity (82% or greater) as determined by ERIC reproducibility assays involving E. faecalis controls. Seven different E. faecalis genotypes (GTs) (GT1 = 27%, GT2 = 17.6%, GT3 = 1.3%, GT4 = 18.9%, GT5 = 9.5%, GT6 = 14.9%, and GT7 = 10.8%) were observed in different subjects and oral sites associated with endodontic failure. Remarkably, in 4 of 5 patients, the same GTs present in the infected root canals were also isolated from either the pulp chamber or the saliva samples. In particular, GT6 was detected in all 3 oral sites of patient 37. E. faecalis GTs isolated from saliva, the pulp chamber, and the root canal were similar using the Rep-PCR and AP-PCR methods. These findings suggest that coronal microleakage is a conceivable cause of endodontic failure. Copyright © 2016 American Association of Endodontists. Published by Elsevier Inc. All rights reserved.

  14. Real-time polymerase chain reaction for diagnosing infectious mononucleosis in pediatric patients: A systematic review and meta-analysis.

    Science.gov (United States)

    Jiang, Sha-Yi; Yang, Jing-Wei; Shao, Jing-Bo; Liao, Xue-Lian; Lu, Zheng-Hua; Jiang, Hui

    2016-05-01

    In this meta-analysis, we evaluated the diagnostic role of Epstein-Barr virus deoxyribonucleic acid detection and quantitation in the serum of pediatric and young adult patients with infectious mononucleosis. The primary outcome of this meta-analysis was the sensitivity and specificity of Epstein-Barr virus (EBV) deoxyribonucleic acid (DNA) detection and quantitation using polymerase chain reaction (PCR). A systematic review and meta-analysis was performed by searching for articles that were published through September 24, 2014 in the following databases: Medline, Cochrane, EMBASE, and Google Scholar. The following keywords were used for the search: "Epstein-Barr virus," "infectious mononucleosis," "children/young adults/infant/pediatric," and "polymerase chain reaction or PCR." Three were included in this analysis. We found that for detection by PCR, the pooled sensitivity for detecting EBV DNA was 77% (95%CI, 66-86%) and the pooled specificity for was 98% (95%CI, 93-100%). Our findings indicate that this PCR-based assay has high specificity and good sensitivity for detecting of EBV DNA, indicating it may useful for identifying patients with infectious mononucleosis. This assay may also be helpful to identify young athletic patients or highly physically active pediatric patients who are at risk for a splenic rupture due to acute infectious mononucleosis.

  15. Qualitative and quantitative assessment of genetically modified soy in enteral nutrition formulas by polymerase chain reaction based methods Avaliação qualitativa e quantitativa de soja geneticamente modificada em fórmulas de nutrição enteral

    Directory of Open Access Journals (Sweden)

    Natália Eudes Fagundes de Barros

    2010-02-01

    Full Text Available OBJECTIVE: The aim of this work was to investigate the occurrence of Roundup Ready soybean in enteral nutrition formulas sold in Brazil. METHODS: A duplex Polymerase Chain Reaction based on the amplification of the lectin gene and the construction of the recombinant deoxyribonucleic acid of transgenic glyphosate-tolerant soybean (35S promoter and chloroplast transit peptide gene was performed in order to analyze the deoxyribonucleic acid obtained from nine soy protein isolate-containing formulas. RESULTS: Despite the highly processed nature of the food matrices, amplifiable deoxyribonucleic acid templates were obtained from all tested samples, as judged by the amplification of the lectin gene sequence. However, amplicons relative to the presence of Roundup Ready soybean were restricted to one of the nine enteral nutrition formulas analyzed as well as to the soybean reference powder, as expected. Quantitative analysis of the genetically modified formula by real-time Polymerase Chain Reaction showed a content of approximately 0.3% (w/w of recombinant deoxyribonucleic acid from the Roundup Ready soybean. CONCLUSION: The results show that one of the formulas contained genetically modified soy, pointing to the need of regulating the use of transgenic substances and of specific labeling in this product category.OBJETIVO: Investigar a ocorrência de soja transgênica em fórmulas de suporte nutricional comercializadas no Brasil. MÉTODOS: Foi desenvolvido o método da reação em cadeia da polimerase duplex, com base na amplificação do gene na lectina, e na construção do ácido desoxirribonucléico recombinante da soja transgênica tolerante a glifosato (promotor 35S e gene de peptídeo de trânsito de cloroplasto, a fim de avaliar o ácido desoxirribonucléico extraído a partir das nove fórmulas contendo isolado protéico de soja. RESULTADOS: Apesar do alto grau de processamento aos quais os produtos avaliados foram submetidos, foi poss

  16. Polymerase chain reaction and conventional DNA tests in detection of HPV DNA in cytologically normal and abnormal cervical scrapes

    DEFF Research Database (Denmark)

    Kalia, A.; Jalava, T.; Nieminen, P.

    1992-01-01

    Med.mikrobiologi, polymerase chain reaction, DNA tests, human papillomavirus (HPV), cervical smear, hybridisation, cytologi, affiProbe HPV test, ViraType test......Med.mikrobiologi, polymerase chain reaction, DNA tests, human papillomavirus (HPV), cervical smear, hybridisation, cytologi, affiProbe HPV test, ViraType test...

  17. 9 CFR 147.30 - Laboratory procedure recommended for the polymerase chain reaction (PCR) test for Mycoplasma...

    Science.gov (United States)

    2010-01-01

    ... the polymerase chain reaction (PCR) test for Mycoplasma gallisepticum and M. synoviae. 147.30 Section... Examination Procedures § 147.30 Laboratory procedure recommended for the polymerase chain reaction (PCR) test... sample (100 to 2000 ng/5 μl) with one of the following 45 μl PCR cocktails: (i) 5 μl 10x PCR buffer, 1...

  18. 9 CFR 147.31 - Laboratory procedures recommended for the real-time polymerase chain reaction test for Mycoplasma...

    Science.gov (United States)

    2010-01-01

    ... the real-time polymerase chain reaction test for Mycoplasma gallisepticum (MGLP ReTi). 147.31 Section... Examination Procedures § 147.31 Laboratory procedures recommended for the real-time polymerase chain reaction... lp gene. (c) MGLP ReTi. Primers and probe should be utilized in a 25 µl reaction containing 12.5...

  19. MULTI INFEKSI PADA UDANG Litopenaeus vannamei : DIAGNOSIS DENGAN POLYMERASE CHAIN REACTION (PCR DAN REVERSE TRANSCRIPTASE-POLYMERASE CHAIN REACTION (RT-PCR

    Directory of Open Access Journals (Sweden)

    Isti Koesharyani

    2012-04-01

    Full Text Available Penelitian ini dilakukan karena adanya masalah yang dihadapi seperti pertumbuhan udang yang tidak seragam (ukuran bervariasi, penampakan klinis yang abnormal dan organ yang tidak sempurna. Gejala tersebut akibat dari infeksi penyakit yang disebabkan oleh virus. Untuk mengetahui jenis virus yang menyerang udang tersebut, maka dilakukan analisis Polymerase Chain Reaction (PCR dan Reverse TranscriptasePolymerase Chain Reaction (RT-PCR menggunakan berbagai jenis spesifik primer WSSV, IHHNV, MBV, TSV, IMNV, dan PvNV. Sampel udang yang secara visual normal dan abnormal diambil lalu disimpan dalam larutan pengawet 90% Ethanol dan RNAlater kemudian dianalisis di laboratorium dengan metode yang sudah dikembangkan oleh Pusat Penelitian dan Pengembangan Perikanan Budidaya. Hasilnya menunjukkan bahwa udang yang tumbuh lambat dan mempunyai rostrum bengkok dan warna otot daging memutih ternyata tidak hanya diserang oleh satu virus namun dua virus IHHNV dan IMNV. Hasil penelitian ini juga mengindikasikan bahwa udang yang terserang IHHNV akan tumbuh lambat walaupun tidak mematikan, sedangkan udang yang diserang IMNV otot daging di tubuh memutih terutama pada bagian punggung dan dapat menimbulkan kematian.

  20. 沙门氏致病菌标准阳性模板的构建及实时荧光定量聚合酶链式反应检测%Construction of Standard Positive Template and Development of a Real-Time Fluorescence Quantitative Polymerase Chain Reaction (FQ-PCR) Assay for PathogenicSalmonella spp.

    Institute of Scientific and Technical Information of China (English)

    陈晨; 邵彪; 陈刚; 黄伟东

    2014-01-01

    Objective: To construct recombinant plasmids for use as standard positive template and establish a real-time fluorescent quantitative polymerase chain reaction (FQ-PCR) assay for determining pathogenicSalmonellaspp. in foods. Methods: Primers and Taqman probe were designed and synthesized with the specific fragment of InvA gene as the target sequence. Recombinant plasmids were constructed by inserting the target gene into PGM-T carriers. Real-time fluorescent quantitative PCR method was established and its sensitivity, specificity, repeatability and accuracy were investigated. Results: The recombinant plasmids constructed using the specific sequence of pathogenicSalmonella spp. could be used as a standard positive template for fluorescent quantitative PCR. The standard curve wasY=-3.151 lgX+42.86 (R2=0.999), and the sensitivity of the method was 80 copies per reaction. It was specific to detect Salmonellaspp. with good repeatability (the inter-batch and intra-batch coefficients of variation were both less than 5%). Conclusion: The FQ-PCR method allows qualitative and quantitative detection of pathogenicSalmonellaspp.%目的:构建重组质粒作为标准阳性模板,建立食品中沙门氏致病菌实时荧光定量聚合酶链式反应检测方法。方法:以致病性沙门氏菌invA基因上特异性片段为目标,设计并合成引物和TaqMan探针,将目标片段连接到PGM-T载体上构建重组质粒,建立实时荧光定量检测体系,并考察方法的灵敏性、特异性、重复性和准确性。结果:构建出致病性沙门氏菌特异性基因片段的重组质粒,能够作为实时荧光定量聚合酶链式反应检测方法的标准阳性模板,标准曲线方程为Y=-3.151 lgX+42.86(R2=0.999),灵敏度80拷贝反应体系,能特异区分沙门氏菌与类型的细菌,同时,批内和批间的变异系数均小于5%,具有良好的重复性。结论:本方法能够实现对食品

  1. Detection of Salmonella Typhi in blood with real time fluorescent quantitative reverse transcriptive polymerase chain reaction%利用实时荧光定量反转录-聚合酶链反应方法检测血液中伤寒沙门菌

    Institute of Scientific and Technical Information of China (English)

    樊粉霞; 娄静; 陈建才; 聂艳妮; 阚飙; 闫梅英

    2012-01-01

    Objective To establish an assay of real time fluorescent quantitative reverse transcriptive polymerase chain reaction (rRT-PCR) to detect Salmonella Typhi in blood. Methods Specific primers STY1631 gene of S. Typhi were designed and modified to establish rRT-PCR assay and the specificity and sensitivity of rRT-PCR with RNA as template were evaluated and verified by checking cultured Salmonella spp. in 51 serotypes, predominant non-salmonella enteric diarrheal pathogens and eight species of bacteria inducing bacteremia with fever as major symptom. The simulative blood specimens supplemented with S. Typhi were tested by the rRT-PCR assay. Results The established rRT-PCR assay successfully detected STY1631 gene of S. Typhi. Totally 48 S. Typhi isolates were amplified to be positive. Other isolates, including non-salmonella strains in 33 serotypes, predominant non-salmonella enteric diarrheal pathogens and eight species of bacteria causing bacteremia with fever, were amplified to be negative. For purified total RNA from pure cultured isolates, the detection limit of the assay was 1 pg per reaction, equal to 194 copies per reaction. The sensitivity achieved 1 × 102 cfu /ml with the purified nucleotide from simulative blood. Conclusion The rRT-PCR assay for detecting S. Typhi with high sensitivity and specificity was established, which would be suitable for the rapid diagnosis of S. Typhi infection and identification of other pathogens causing fever for the early warning, prevention and treatment of typhoid fever.%目的 建立实时荧光定量反转录-聚合酶链反应(real time fluorescent quantitative reverse transcriptionpolymerase chain reaction,rRT-PCR)方法检测伤寒沙门菌.方法 针对伤寒沙门菌STY1631基因设计特异性引物,通过优化反应条件,建立检测该靶基因的rRT-PCR方法,利用51个血清型的纯培养伤寒和非伤寒沙门菌菌株、常见非沙门致腹泻病原菌以及发热为主要症状的8种常见病原菌核糖

  2. Quantitative models for sustainable supply chain management

    DEFF Research Database (Denmark)

    Brandenburg, M.; Govindan, Kannan; Sarkis, J.

    2014-01-01

    Sustainability, the consideration of environmental factors and social aspects, in supply chain management (SCM) has become a highly relevant topic for researchers and practitioners. The application of operations research methods and related models, i.e. formal modeling, for closed-loop SCM...... and reverse logistics has been effectively reviewed in previously published research. This situation is in contrast to the understanding and review of mathematical models that focus on environmental or social factors in forward supply chains (SC), which has seen less investigation. To evaluate developments...

  3. Polymerase chain reaction-based molecular diagnosis of cutaneous infections in dermatopathology.

    Science.gov (United States)

    Swick, Brian L

    2012-12-01

    Conventional methods, including microscopy, culture, and serologic studies, are a mainstay in the diagnosis of cutaneous infection. However, owing to limitations associated with these techniques, such as low sensitivity for standard microscopy and in the case of culture delay in diagnosis, polymerase chain-reaction based molecular techniques have taken on an expanding role in the diagnosis of infectious processes in dermatopathology. In particular, these assays are a useful adjunct in the diagnosis of cutaneous tuberculosis, atypical mycobacterial infection, leprosy, Lyme disease, syphilis, rickettsioses, leishmaniasis, and some fungal and viral infections. Already in the case of tuberculosis and atypical mycobacterial infection, standardized polymerase chain-reaction assays are commonly used for diagnostic purposes. With time, additional molecular-based techniques will decrease in cost and gain increased standardization, thus delivering rapid diagnostic confirmation for many difficult-to-diagnose cutaneous infections from standard formalin-fixed paraffin-embedded tissue specimens.

  4. Studying the effect of graphene-ZnO nanocomposites on polymerase chain reaction

    Science.gov (United States)

    Sharma, Vinay; Rajaura, Rajveer; Sharma, Preetam Kumar; Srivastava, Rishabh Ronin; Sharma, Shyam Sundar; Agrawal, Kailash

    2016-05-01

    An emerging area of research is improving the efficiency of the polymerase chain reaction (PCR) by using nanoparticles. With graphene nano-flakes showing promising results, in this paper we report the effect of Graphene-ZnO nanocomposites on Polymerase Chain reaction (PCR) efficiency. G-ZnO nanocomposites were efficiently synthesized via in situ chemical method. Transmission electron microscopy (TEM) and scanning electron microscopy (SEM) image confirms the formation of nanocomposites. ZnO nanoparticles of size range ~20-30 nm are uniformly attached on the graphene sheets. No amplification during PCR indicates inhibitory activity of G-ZnO nanocomposites which points the fingers at ZnO moiety of the G-ZnO composite for no amplification during our PCR reaction. Further work should concentrate on finding out the main inhibitory mechanism involved in inhibition of PCR using G-ZnO composites.

  5. Studying the effect of graphene-ZnO nanocomposites on polymerase chain reaction

    Energy Technology Data Exchange (ETDEWEB)

    Sharma, Vinay, E-mail: winn201@gmail.com; Rajaura, Rajveer; Sharma, Preetam Kumar; Srivastava, Rishabh Ronin [Centre for Converging Technologies, University of Rajasthan, Jaipur 302004 (India); Sharma, Shyam Sundar [Govt. women Engineering College, Ajmer (India); Agrawal, Kailash [Centre for Converging Technologies, University of Rajasthan, Jaipur 302004 (India); Department of Botany, University of Rajasthan, Jaipur 302004 (India)

    2016-05-06

    An emerging area of research is improving the efficiency of the polymerase chain reaction (PCR) by using nanoparticles. With graphene nano-flakes showing promising results, in this paper we report the effect of Graphene-ZnO nanocomposites on Polymerase Chain reaction (PCR) efficiency. G-ZnO nanocomposites were efficiently synthesized via in situ chemical method. Transmission electron microscopy (TEM) and scanning electron microscopy (SEM) image confirms the formation of nanocomposites. ZnO nanoparticles of size range ~20-30 nm are uniformly attached on the graphene sheets. No amplification during PCR indicates inhibitory activity of G-ZnO nanocomposites which points the fingers at ZnO moiety of the G-ZnO composite for no amplification during our PCR reaction. Further work should concentrate on finding out the main inhibitory mechanism involved in inhibition of PCR using G-ZnO composites.

  6. Biosynthetic enhancement of the detection of bacteria by the polymerase chain reaction.

    Directory of Open Access Journals (Sweden)

    Julie S Do

    Full Text Available Molecular viability testing (MVT was previously reported to specifically detect viable bacterial cells in complex samples. In MVT, brief nutritional stimulation induces viable cells, but not non-viable cells, to produce abundant amounts of species-specific ribosomal RNA precursors (pre-rRNA. Quantitative polymerase chain reaction (qPCR is used to quantify specific pre-rRNAs in a stimulated aliquot relative to a non-stimulated control. In addition to excluding background signal from non-viable cells and from free DNA, we report here that MVT increases the analytical sensitivity of qPCR when detecting viable cells. Side-by-side limit-of-detection comparisons showed that MVT is 5-fold to >10-fold more sensitive than standard (static DNA-targeted qPCR when detecting diverse bacterial pathogens (Aeromonas hydrophila, Acinetobacter baumannii, Listeria monocytogenes, Mycobacterium avium, and Staphylococcus aureus in serum, milk, and tap water. Sensitivity enhancement may come from the elevated copy number of pre-rRNA relative to genomic DNA, and also from the ratiometric measurement which reduces ambiguity associated with weak or borderline signals. We also report that MVT eliminates false positive signals from bacteria that have been inactivated by moderately elevated temperatures (pasteurization, a condition that can confound widely-used cellular integrity tests that utilize membrane-impermeant compounds such as propidium iodide (PI or propidium monoazide (PMA to differentiate viable from inactivated bacteria. MVT enables the sensitive and specific detection of very small numbers of viable bacteria in complex matrices.

  7. Quantitative timed analysis of interactive Markov chains

    NARCIS (Netherlands)

    Guck, Dennis; Han, Tingting; Katoen, Joost-Pieter; Neuhausser, M.

    2012-01-01

    This paper presents new algorithms and accompanying tool support for analyzing interactive Markov chains (IMCs), a stochastic timed 1 1/2-player game in which delays are exponentially distributed. IMCs are compositional and act as semantic model for engineering formalisms such as AADL and dynamic fa

  8. The impact of meningococcal polymerase chain reaction testing on laboratory confirmation of invasive meningococcal disease.

    LENUS (Irish Health Repository)

    Drew, Richard J

    2012-03-01

    Laboratory methods of diagnosis were examined for 266 children with invasive meningococcal disease. Seventy-five (36%) of 207 cases with bloodstream infection had both positive blood culture and blood meningococcal polymerase chain reaction (PCR), 130 (63%) negative blood culture and positive blood PCR, and 2 (1%) had positive blood culture and negative blood PCR. Sixty-three percent of cases were diagnosed by PCR alone.

  9. Development of a polymerase chain reaction assay for the detection of pseudorabies virus in clinical samples

    OpenAIRE

    Lester J Pérez; Heidy Díaz de Arce

    2009-01-01

    Aujeszky's disease, also known as pseudorabies causes severe economic losses in swine industry and affects the pig husbandry all over the world. The conventional diagnostic procedure is time-consuming and false-negative results may occur in submissions from latently infected animals. The development, optimization and evaluation of a polymerase chain reaction (PCR) assay are presented for the diagnosis of pseudorabies infection. This assay was based on the amplification of a highly conserved v...

  10. High-speed droplet-allele-specific polymerase chain reaction for genotyping of single nucleotide polymorphisms.

    Science.gov (United States)

    Matsuda, Kazuyuki; Honda, Takayuki

    2015-01-01

    Single nucleotide alternations such as single nucleotide polymorphisms (SNPs) or single nucleotide mutations are useful genetic markers for molecular diagnosis, prognosis, drug response, and predisposition to diseases. Rapid identification of SNPs or mutations is clinically important, especially for determining drug responses and selection of molecular-targeted therapy. Here, we describe a rapid genotyping assay based on the allele-specific polymerase chain reaction (AS-PCR) by using our droplet-PCR machine (droplet-AS-PCR).

  11. Solar thermal polymerase chain reaction for smartphone-assisted molecular diagnostics

    OpenAIRE

    Li Jiang; Matthew Mancuso; Zhengda Lu; Gunkut Akar; Ethel Cesarman; David Erickson

    2014-01-01

    Nucleic acid-based diagnostic techniques such as polymerase chain reaction (PCR) are used extensively in medical diagnostics due to their high sensitivity, specificity and quantification capability. In settings with limited infrastructure and unreliable electricity, however, access to such devices is often limited due to the highly specialized and energy-intensive nature of the thermal cycling process required for nucleic acid amplification. Here we integrate solar heating with microfluidics ...

  12. Shortening Isolation of Patients With Suspected Tuberculosis by Using Polymerase Chain Reaction Analysis

    DEFF Research Database (Denmark)

    Fløe, Andreas; Hilberg, Ole; Thomsen, Vibeke Østergaard;

    2015-01-01

    Background. Isolation of patients suspected for pulmonary tuberculosis is guided by serial sputum smears. This can result in isolation for days for patients with noncontagious tuberculosis. To determine whether a single sample negative for Mycobacterium tuberculosis complex at polymerase chain...... reaction (PCR) can guide isolation. Methods. We retrospectively evaluated sputum samples analyzed for M. tuberculosis complex at the International Reference Laboratory of Mycobacteriology, Copenhagen, Denmark in 2002–2011. We selected culture-confirmed tuberculosis cases with ≥3 samples within 14 days...

  13. Differentiation of Giardia duodenalis from other Giardia spp. by using polymerase chain reaction and gene probes.

    OpenAIRE

    Mahbubani, M H; Bej, A K; Perlin, M H; Schaefer, F W; Jakubowski, W.; Atlas, R M

    1992-01-01

    Giardia spp. are waterborne organisms that are the most commonly identified pathogenic intestinal protozoans in the United States. Current detection techniques for Giardia species in water include microscopy and immunofluorescence techniques. Species of the genus Giardia are classified on the basis of taxonomic criteria, such as cell morphology, and on host specificity. We have developed a polymerase chain reaction- and gene probe-based detection system specific for Giardia spp., which can di...

  14. Determination of penicillin susceptibility of Streptococcus pneumoniae using the polymerase chain reaction.

    OpenAIRE

    Jalal, H; Organji, S.; Reynolds, J.; Bennett, D; O'Mason, E.; Millar, M R

    1997-01-01

    AIM: To develop a polymerase chain reaction (PCR) based method to detect penicillin susceptibility in isolates of Streptococcus pneumoniae (SP). METHOD: PCR primers were designed to amplify differential nucleotide sequences of the penicillin-binding protein (PBP) genes 2b, 2x, and 1a in penicillin susceptible and resistant strains of SP. Primers derived from the PBP 2x and 2b genes were designed to amplify products from penicillin susceptible S pneumoniae (PSSP), whereas primers derived from ...

  15. STUDY OF UROGENITAL TRACT MICROFLORA OF DNEPROPETROVSK FEMALES BY POLYMERASE CHAIN REACTION

    Directory of Open Access Journals (Sweden)

    Honcharova S.Y.

    2015-08-01

    Full Text Available We isolated and identified the pathogens from the urogenital tract in 100 women of 26-55 years in Diagnostic Center of Dnepropetrovsk Medical Academy by polymerase chain reaction. It was found that all investigated microflora was represented by HPV of high and low cancer risk - HSV type 1+2, Ureaplasma urealyticum, Chlamydia trachomatis, Trichomonas vaginalis, Mycoplasma hominis, and Candida yeast species. The most abundant pathogens from the urogenital tract were HPV, Ureaplasma urealyticum, and Chlamydia trachomatis.

  16. A reverse transcription-polymerase chain reaction assay for the detection of avian pneumovirus (Colorado strain).

    Science.gov (United States)

    Ali, A; Reynolds, D L

    1999-01-01

    A reverse transcription-polymerase chain reaction assay was developed for the detection of avian pneumovirus (Colorado strain) (APV-Col). The specific primers were designed from the published sequence of the matrix protein gene of APV-Col. The primers amplified a product of 631 nucleotides from APV-Col. The assay identified only APV-Col and did not react with Newcastle disease virus and infectious bronchitis virus.

  17. Prediction of insecticidal activity of Bacillus thuringiensis strains by polymerase chain reaction product profiles.

    OpenAIRE

    Carozzi, N B; Kramer, V C; Warren, G W; Evola, S; Koziel, M G

    1991-01-01

    A rapid analysis of Bacillus thuringiensis strains predictive of insecticidal activity was established by using polymerase chain reaction (PCR) technology. Primers specific to regions of high homology within genes encoding three major classes of B. thuringiensis crystal proteins were used to generate a PCR product profile characteristic of each insecticidal class. Predictions of insecticidal activity were made on the basis of the electrophoretic patterns of the PCR products. Included in the s...

  18. Performance of transport and selective media for swine Bordetella bronchiseptica recovery and it comparison to polymerase chain reaction detection

    Science.gov (United States)

    Coutinho, Tania Alen; Bernardi, Mari Lourdes; de Itapema Cardoso, Marisa Ribeiro; Borowski, Sandra Maria; Moreno, Andrea Micke; de Barcellos, David Emilio Santos Neves

    2009-01-01

    Three comparative assays were performed seeking to improve the sensitivity of the diagnosis of Bordetella bronchiseptica infection analyzing swine nasal swabs. An initial assay compared the recovery of B. bronchiseptica from swabs simultaneously inoculated with B. bronchiseptica and some interfering bacteria, immersed into three transport formulations (Amies with charcoal, trypticase soy broth and phosphate buffer according to Soerensen supplemented with 5% of bovine fetal serum) and submitted to different temperatures (10°C and 27°C) and periods of incubation (24, 72 and 120 hours). A subsequent assay compared three selective media (MacConkey agar, modified selective medium G20G and a ceftiofur medium) for their recovery capabilities from clinical specimens. One last assay compared the polymerase chain reaction to the three selective media. In the first assay, the recovery of B. bronchiseptica from transport systems was better at 27°C and the three formulations had good performances at this temperature, but the collection of qualitative and quantitative analysis indicated the advantage of Amies medium for nasal swabs transportation. The second assay indicated that MacConkey agar and modified G20G had similar results and were superior to the ceftiofur medium. In the final assay, polymerase chain reaction presented superior capability of B. bronchiseptica detection to culture procedures. PMID:24031390

  19. Evaluation of revised polymerase chain reaction primers for more inclusive quantification of ammonia-oxidizing archaea and bacteria.

    Science.gov (United States)

    Meinhardt, Kelley A; Bertagnolli, Anthony; Pannu, Manmeet W; Strand, Stuart E; Brown, Sally L; Stahl, David A

    2015-04-01

    Ammonia-oxidizing archaea (AOA) and bacteria (AOB) fill key roles in the nitrogen cycle. Thus, well-vetted methods for characterizing their distribution are essential for framing studies of their significance in natural and managed systems. Quantification of the gene coding for one subunit of the ammonia monooxygenase (amoA) by polymerase chain reaction is frequently employed to enumerate the two groups. However, variable amplification of sequence variants comprising this conserved genetic marker for ammonia oxidizers potentially compromises within- and between-system comparisons. We compared the performance of newly designed non-degenerate quantitative polymerase chain reaction primer sets to existing primer sets commonly used to quantify the amoA of AOA and AOB using a collection of plasmids and soil DNA samples. The new AOA primer set provided improved quantification of model mixtures of different amoA sequence variants and increased detection of amoA in DNA recovered from soils. Although both primer sets for the AOB provided similar results for many comparisons, the new primers demonstrated increased detection in environmental application. Thus, the new primer sets should provide a useful complement to primers now commonly used to characterize the environmental distribution of AOA and AOB.

  20. A Novel, Multi-Parallel, Real-Time Polymerase Chain Reaction Approach for Eight Gastrointestinal Parasites Provides Improved Diagnostic Capabilities to Resource-Limited At-Risk Populations

    OpenAIRE

    Mejia, Rojelio; Vicuña, Yosselin; Broncano, Nely; Sandoval, Carlos; Vaca, Maritza; Chico, Martha; Cooper, Philip J.; Nutman, Thomas B.

    2013-01-01

    Diagnosis of gastrointestinal parasites has traditionally relied on stool microscopy, which has low diagnostic sensitivity and specificity. We have developed a novel, rapid, high-throughput quantitative multi-parallel real-time polymerase chain reaction (qPCR) platform. Species-specific primers/probes were used for eight common gastrointestinal parasite pathogens: Ascaris lumbricoides, Necator americanus, Ancylostoma duodenale, Giardia lamblia, Cryptosporidium spp., Entamoeba histolytica, Tri...

  1. Sensitivitas dan Spesifisitas Nested Polymerase Chain Reaction untuk Mendeteksi DNA Coxiella burnetii (SENSITIVITY AND SPECIFICITY OF NESTED POLYMERASE CHAIN REACTION FOR DETECTION OF COXIELLA BURNETII DNA

    Directory of Open Access Journals (Sweden)

    Trioso Purnawarman

    2014-04-01

    Full Text Available Sensitivity and specificity of nested polymerase chain reaction (nested PCR to detect Coxiella burnetii(C. burnetii DNA were studied. The primer system which consists of external primers (OMP1 and OMP2and internal primers (OMP3 and OMP4, was designed from the nucleotide sequence of the com I geneencoding for 27 kDa outer membrane protein and used to specifically amplify a 501 bp and 438 bp fragment.This nested PCR assay was 50 fold more sensitive than that of using PCR external primer only. TheNested PCR has a detection limit as low as 300 pg/?l. Specificity studies showed that nested PCR onlydetected C. burnetii DNA and did not happened Brucella abortus, Escherichia coli, Pseudomonas aeruginosaand Campylobacter Jejuni DNA. Nested PCR has high senstively and specificaly diagnostic method of C.burnetii as agent of Q fever disease.

  2. Evaluation of urogenital Chlamydia trachomatis infections by cell culture and the polymerase chain reaction using a closed system

    DEFF Research Database (Denmark)

    Østergaard, Lars; Traulsen, J; Birkelund, Svend

    1993-01-01

    Two hundred and fifty-four specimens from males and females consulting a clinic for sexually transmitted diseases were analyzed for genital Chlamydia trachomatis infection. Each clinical sample was tested by the cell culture technique and the polymerase chain reaction using a closed system. When...... the two test systems were compared, the overall sensitivity of the polymerase chain reaction was 96% and the specificity 94% when compared to the cell culture technique. By use of a closed system for DNA extraction and sample transfer for the polymerase chain reaction, contamination of the samples...

  3. Evaluation of urogenital Chlamydia trachomatis infections by cell culture and the polymerase chain reaction using a closed system

    DEFF Research Database (Denmark)

    Østergaard, Lars; Traulsen, J; Birkelund, Svend

    1991-01-01

    Two hundred and fifty-four specimens from males and females consulting a clinic for sexually transmitted diseases were analyzed for genital Chlamydia trachomatis infection. Each clinical sample was tested by the cell culture technique and the polymerase chain reaction using a closed system. When...... the two test systems were compared, the overall sensitivity of the polymerase chain reaction was 96% and the specificity 94% when compared to the cell culture technique. By use of a closed system for DNA extraction and sample transfer for the polymerase chain reaction, contamination of the samples...

  4. Detection of epidermal growth factor receptor mutation in lung cancer by droplet digital polymerase chain reaction

    Directory of Open Access Journals (Sweden)

    Xu Q

    2015-06-01

    Full Text Available Qing Xu,1,* Yazhen Zhu,2,* Yali Bai,1 Xiumin Wei,1 Xirun Zheng,2 Mao Mao,1 Guangjuan Zheng21Translational Bioscience and Diagnostics, WuXi AppTec, Shanghai, 2Department of Pathology, Guangdong Provincial Hospital of TCM, Guangzhou University of Chinese Medicine, Guangdong Provincial Academy of Chinese Medical Sciences, Guangzhou, People’s Republic of China*These authors contributed equally to this workBackground: Two types of epidermal growth factor receptor (EGFR mutations in exon 19 and exon 21 (ex19del and L858R are prevalent in lung cancer patients and sensitive to targeted EGFR inhibition. A resistance mutation in exon 20 (T790M has been found to accompany drug treatment when patients relapse. These three mutations are valuable companion diagnostic biomarkers for guiding personalized treatment. Quantitative polymerase chain reaction (qPCR-based methods have been widely used in the clinic by physicians to guide treatment decisions. The aim of this study was to evaluate the technical and clinical sensitivity and specificity of the droplet digital polymerase chain reaction (ddPCR method in detecting the three EGFR mutations in patients with lung cancer.Methods: Genomic DNA from H1975 and PC-9 cells, as well as 92 normal human blood specimens, was used to determine the technical sensitivity and specificity of the ddPCR assays. Genomic DNA of formalin-fixed, paraffin-embedded specimens from 78 Chinese patients with lung adenocarcinoma were assayed using both qPCR and ddPCR.Results: The three ddPCR assays had a limit of detection of 0.02% and a wide dynamic range from 1 to 20,000 copies measurement. The L858R and ex19del assays had a 0% background level in the technical and clinical settings. The T790M assay appeared to have a 0.03% technical background. The ddPCR assays were robust for correct determination of EGFR mutation status in patients, and the dynamic range appeared to be better than qPCR methods. The ddPCR assay for T790M could detect

  5. Identification of spoilage yeasts in a food-production chain by microsatellite polymerase chain reaction fingerprinting

    NARCIS (Netherlands)

    Baleiras Couto, M.M.; Hartog, B.J.; Veld, J.H.J. Huis in 't; Hofstra, H.; Vossen, J.M.B.M. van der

    1996-01-01

    A survey of yeast strains present in the production chain of mayonnaise and salad dressings was carried out over a period of 14 months. Attempts were made to identify the isolated yeasts with the API system, but identification of all species involved was not possible. In the investigation the

  6. Extraction of DNA from exfoliative cytology specimens and its suitability for analysis by the polymerase chain reaction.

    Science.gov (United States)

    Jackson, D P; Payne, J; Bell, S; Lewis, F A; Taylor, G R; Peel, K R; Sutton, J; Quirke, P

    1990-01-01

    The extraction of DNA from archival exfoliative cytology samples would allow the molecular biological analysis of this readily available material using the polymerase chain reaction (PCR). We have quantitatively and qualitatively studied the extraction of DNA from a variety of cytological preparations. For both fresh and archival cervical smears, overnight incubation with proteinase K produces high yields of high molecular weight DNA, but simply boiling the samples produces DNA suitable for PCR amplification of a single copy gene. Increasing the proteinase K incubation to several days allows the extraction of DNA from fixed and stained archival cytology slides from a variety of sites. The extracted DNA was again suitable for PCR analysis. Fresh and archival cytological material can be utilized for molecular biological study of disease processes using PCR. Archival cytological material is probably the best source of DNA and RNA after stored frozen tissue.

  7. Detection of Zaire Ebola virus by real-time reverse transcription-polymerase chain reaction, Sierra Leone, 2014.

    Science.gov (United States)

    Liu, Licheng; Sun, Yang; Kargbo, Brima; Zhang, Chuntao; Feng, Huahua; Lu, Huijun; Liu, Wenseng; Wang, Chengyu; Hu, Yi; Deng, Yongqiang; Jiang, Jiafu; Kang, Xiaoping; Yang, Honglei; Jiang, Yongqiang; Yang, Yinhui; Kargbo, David; Qian, Jun; Chen, Weijun

    2015-09-15

    During the 2014 Ebola virus disease (EVD) outbreak, a real-time quantitative polymerase chain reaction was established to detect and identify the Zaire Ebola virus. We describe the use of this assay to screen 315 clinical samples from EVD suspected person in Sierra Leone. The detection rate in blood samples was 77.81% (207/266), and there were relatively higher detection rate (79.32% and 81.42%, respectively) during the first two weeks after onset of symptoms. In the two weeks that followed, the detection rate declined to 66.67% and 25.00%, respectively. There was the highest virus load at the first week and then decreased. The detection rate in swab samples was 89.79% (44/49). This may be benefit from the included patients. 46 of 49 swab samples were collected from died patients. Taken together, the results presented here indicate that the assay specifically and sensitively detects Zaire Ebola virus.

  8. PEMERIKSAAN BAKTERI LEPTOSPIRA PADA SAMPEL DARAH MANUSIA SUSPECT LEPTOSPIROSIS MENGGUNAKAN METODE PCR (POLYMERASE CHAIN REACTION

    Directory of Open Access Journals (Sweden)

    Sefrita Tri Utami

    2014-01-01

    Full Text Available ABSTRACTLeptospirosis is a zoonotic disease, which is caused by leptospira. Leptospirosis cases often show no specificclinical symptoms and is difficult to diagnose without testing samples in the laboratory. Testing using PCR(Polymerase Chain Reaction is considered more accurate than the other methods. Components required in theexamination Leptospira bacteria in human blood samples using PCR method is DNA template, DNA polymeraseenzyme, forward primer (PU1 and SU1 and reverse primer (Lep R1, nuclease free water, Mg 2 +, and dNTPs.Examination of Leptospira bacteria in human blood samples include sampling, DNA isolation, examination byPCR, and electrophoresis running.Key words: leptospirosis, Leptospira, PCR methodsABSTRAKLeptospirosis adalah penyakit zoonosis yang disebabkan oleh bakteri Leptospira. Kasus leptospirosis seringtidak menunjukkan gejala klinis yang spesifik dan sulit didiagnosis tanpa pengujian sampel di laboratorium.Pengujian dengan menggunakan metode PCR (Polymerase Chain Reaction dinilai lebih akurat dibandingkandengan metode yang lain. Komponen-komponen yang dibutuhkan dalam pemeriksaan bakteri Leptospira padasampel darah manusia menggunakan metode PCR adalah DNA template, enzim polymerase, Primer PU 1 danPrimer SU 1, Primer Lep R1, air, Mg2+ , dan dNTP. Pemeriksaan bakteri Leptospira pada sampel darah manusiameliputi pengambilan sampel, isolasi DNA, pemeriksaan dengan metode PCR, dan running elektroforesis.Kata kunci: leptospirosis, Leptospira, metode PCR

  9. 不同荧光定量聚合酶链反应法基因检测肺炎链球菌的比较研究%Comparison of different fluorescent quantitation polymerase chain reaction for genes detection of Streptococcus pneumonia

    Institute of Scientific and Technical Information of China (English)

    董佳波; 傅应裕

    2013-01-01

    Objective To compare the sensitivity and specificity of different fluorescent quantitation polymerase chain reaction(PCR) for genes detection of Streptococcus pneumonia.Methods By designing five sets of fluorescent quantitation PCR primers targeting different genes of Streptococcus pneumonia (lytA,ply,spn9802,psaA,cspA),the sensitivity and specificity of fluorescent quantitation PCR was determined through detecting 37 strains of Streptococcus pneumonia and 28 strains of non-Streptococcus pneumonia,as well as 80 sputum specimens from suspected pneumonia cases.Results These five primers had excellent sensitivity with 90% amplification efficiency through analysis of the standard curve.The change of Ct value was less than 0.5,indicating that these five primers have good stability.By detecting 37 strains of Streptococcus pneumonia and 28 strains of non-Streptococcus pneumonia,it showed that the specificity of lytA,ply and spn9802 was better than the other two primers (positive rate and negative rate was all 100%).But the detection limit of lytA,ply was one order of magnitude than spn9802 (101 CFU/ml vs.102 CFU/ml).The specificity of psaA and cspA was worse [negative rate of psaA was 89% (25/28),positive rate of cspA was 97% (36/37)].By detecting 80 sputum specimens from suspected pneumonia cases,it showed that the specificity of fluorescent quantitation PCR were better than the bacterial culture.The specificity of lytA and ply was the best two [positive rate:92.50%(74/80),90.00%(72/80)],and next was spn9802 [86.25%(69/80)],the specificity ofpsaA and cspA was the worst two for detection [76.25%(61/80) and 78.75%(63/80)].Conclusions The sensitivity and specificity of fluorescent quantitation PCR genes used in clinic for detecting Streptococcus pneumonia is different.LytA and ply are the best primers in specificity,next is spn9802,and psaA and cspA are the worst primers for in specificity detection.%目的 比较不同荧光定量聚合酶链反应法(PCR

  10. [Development of a real-time polymerase chain reaction method for the identification of Candida species].

    Science.gov (United States)

    Ağca, Harun; Dalyan Cilo, Burcu; Özmerdiven, Gülşah Ece; Sağlam, Sezcan; Ener, Beyza

    2015-01-01

    Candida species are one of the major causes of nosocomial infections and are the fourth most common agent involved in bloodstream infections. The impact of non-albicans Candida species is increasing, however C.albicans is still the most common species. Since the antifungal susceptibility pattern among Candida spp. may be different, rapid diagnosis and identification of non-albicans Candida spp. are important for the determination of antifungal agents that will be used for treatment. The aim of the study was to describe a real-time polymerase chain reaction (Rt-PCR) assay that rapidly detects, identifies and quantitates Candida species from blood culture samples. A total of 50 consecutive positive blood culture bottles (BACTEC, Beckton Dickinson, USA) identified at our laboratory between June-November 2013, were included in the study. Reference strains of Candida spp. (C.albicans ATCC 10231, C.glabrata ATCC 90030, C.tropicalis ATCC 1021, C.krusei ATCC 6258, C.parapsilosis ATCC 22019 and C. dubliniensis CD36) grown on Sabouraud dextrose agar were used for quality control. BACTEC bottles that were positive for Escherichia coli, Pseudomonas aeruginosa and Staphylococcus aureus were also studied to search the cross-reactivity. A commercial kit (Zymo Research, USA) was used for DNA extraction. Real-time PCR was performed on LightCycler 480 (Roche, Germany) with primers and probes specific for 18S rRNA of Candida species. Twenty microlitres of the reaction mix contained 2 μl of extracted DNA, 2 μl of LightCycler Fast Start DNA Master Probe (Roche Diagnostics, Germany), 2 μl of MgCl(2) (5 mmol), 2 μl of 10x PCR buffer (Roche Diagnostics, Germany), 0.5 μl of each primer (0.01 nmol/μl) and 1 μl of each probe (0.1 μmol/μl) (TibMolBiol, Germany). Amplification was performed using the following conditions; 95°C for 10 mins and 50 cycles of denaturation at 95°C for 10 secs, annealing at 62°C for 10 secs and polymerisation at 72°C for 20 secs. A melting curve was

  11. Development of species-specific DNA probes for Campylobacter jejuni, Campylobacter coli, and Campylobacter lari by polymerase chain reaction fingerprinting

    NARCIS (Netherlands)

    Giesendorf, B A; van Belkum, A; Koeken, A; Stegeman, H; Henkens, M H; van der Plas, J; Goossens, H; Niesters, H G; Quint, W G

    1993-01-01

    The application of polymerase chain reaction (PCR) fingerprinting assays enables discrimination between species and strains of microorganisms. PCR primers aiming at arbitrary sequences in combination with primers directed against the repetitive extragenic palindrome (REP) or enterobacterial repetiti

  12. Gynecological manifestations, histopathological findings, and schistosoma-specific polymerase chain reaction results among women with Schistosoma haematobium infection

    DEFF Research Database (Denmark)

    Randrianasolo, Bodo Sahondra; Jourdan, Peter Mark; Ravoniarimbinina, Pascaline;

    2015-01-01

    BACKGROUND: The pathophysiology of female genital schistosomiasis (FGS) is only partially understood. This study aims to describe the histopathological findings, polymerase chain reaction (PCR) results, and gynecological manifestations of FGS in women with different intensities of Schistosoma...

  13. Development of species-specific DNA probes for Campylobacter jejuni, Campylobacter coli, and Campylobacter lari by polymerase chain reaction fingerprinting

    NARCIS (Netherlands)

    Giesendorf, B A; van Belkum, A; Koeken, A; Stegeman, H; Henkens, M H; van der Plas, J; Goossens, H; Niesters, H G; Quint, W G

    The application of polymerase chain reaction (PCR) fingerprinting assays enables discrimination between species and strains of microorganisms. PCR primers aiming at arbitrary sequences in combination with primers directed against the repetitive extragenic palindrome (REP) or enterobacterial

  14. Enhanced Specificity of Multiplex Polymerase Chain Reaction via CdTe Quantum Dots

    Science.gov (United States)

    Liang, Gaofeng; Ma, Chao; Zhu, Yanliang; Li, Shuchun; Shao, Youhua; Wang, Yong; Xiao, Zhongdang

    2011-12-01

    Nanoparticles were recently reported to be able to improve both efficiency and specificity in polymerase chain reaction (PCR). Here, CdTe QDs were introduced into multi-PCR systems. It was found that an appropriate concentration of CdTe QDs could enhance the performance of multi-PCR by reducing the formation of nonspecific products in the complex system, but an excessive amount of CdTe QDs could suppress the PCR. The effects of QDs on PCR can be reversed by increasing the polymerase concentration or by adding bovine serum albumin (BSA). The mechanisms underlying these effects were also discussed. The results indicated that CdTe QDs could be used to optimize the amplification products of the PCR, especially in the multi-PCR system with different primers annealing temperatures, which is of great significance for molecular diagnosis.

  15. Use of Polymerase Chain Reaction To Detect the Take-All Fungus, Gaeumannomyces graminis, in Infected Wheat Plants

    OpenAIRE

    Schesser, Kurt; Luder, Andreas; Henson, Joan M.

    1991-01-01

    Gaeumannomyces graminis, the causative agent of take-all disease of wheat, barley, and oats, was detected in infected wheat seedlings by using the polymerase chain reaction to amplify Gaeumannomyces-specific DNA fragments. Nested primers and two rounds of amplification were used to amplify two fragments, approximately 287 and 188 bp in size, from G. graminis-infected wheat seedlings. The use of nested primers greatly decreased the number of nonspecific amplification products. Polymerase chain...

  16. Application of polymerase chain reaction (PCR) for diagnosis of equine herpes virus-1 (EHV-1).

    Science.gov (United States)

    Gupta, A K; Singh, B K; Yadav, M P

    1996-11-01

    Fifty aborted foetus samples were diagnosed for the presence of equine herpes virus-1 (EHV-1) by polymerase chain reaction (PCR) technique. Specific primer pair for amplification of a particular segment of EHV-1 DNA in gc region having 3 Hae III restriction endonuclease sites was used. A 409 base pair segment obtained as PCR amplification product in 9 samples was digested with Hae III to confirm the presence of EHV-1 as the infectious agent in aborted tissues. It was observed that PCR technique was more sensitive, specific and rapid than the conventional virological diagnostic methods.

  17. Toxocara polymerase chain reaction on ocular fluids in bilateral granulomatous chorioretinitis

    Directory of Open Access Journals (Sweden)

    Tian JX

    2015-05-01

    Full Text Available Jenny Xue Tian,1 Stephen O’Hagan2 1Ophthalmology Department, Cairns Base Hospital, Cairns, QLD, Australia; 2Ophthalmology, James Cook University, Cairns, QLD, Australia Abstract: To report a rare case of bilateral granulomatous chorioretinitis complicated by bilateral peripapillary choroidal neovascular membranes. This is the first reported case in Australia where intravitreal injections of anti-vascular endothelial growth factor ranibizumab were used to successfully treat choroidal neovascular membrane caused by granulomatous chorioretinitis. This is also the first reported case in Australia of Toxocara polymerase chain reaction being performed on intraocular fluids. Keywords: granulomatous chorioretinitis, ocular toxocariasis, neovascular membrane, anti-VEGF

  18. Low predictive value of polymerase chain reaction for diagnosis of cytomegalovirus disease in liver transplant recipients.

    Science.gov (United States)

    Delgado, R; Lumbreras, C; Alba, C; Pedraza, M A; Otero, J R; Gómez, R; Moreno, E; Noriega, A R; Payá, C V

    1992-07-01

    The polymerase chain reaction (PCR) and viral culture techniques were prospectively compared for the detection of cytomegalovirus (CMV) in blood samples from 24 liver transplant recipients. Nine patients had one or more episodes of viremia, seven of which were clinically symptomatic infections. All samples in which CMV was isolated by culture were positive by the PCR. However, the PCR result was also positive for one or more samples from 11 patients who never developed CMV-related symptoms. Although the PCR is a very sensitive technique for CMV detection in blood samples from liver transplant recipients, it is not useful as a marker of symptomatic CMV disease.

  19. [Detection of leptospirosis reservoirs in Madagascar using the polymerase chain reaction technique].

    Science.gov (United States)

    Ralaiarijaona, R L; Bellenger, E; Chanteau, S; Roger, F; Pérolat, P; Rasolofo Razanamparany, V

    2001-01-01

    A polymerase chain reaction (PCR) technique was used for detection of the Leptospira interrogans rrs gene in kidney tissue from 115 rats, 50 zebu cattles and 13 pigs in an attempt to identify a possible animal reservoir of leptospirosis in Madagascar. In addition, serological testing of 105 individuals in close contact with animals was carried out. The PCR analysis was negative for all the samples tested and only one person was found seropositive at a low titer. The findings suggest that leptospirosis, if prevalent in Madagascar, is likely rare.

  20. Pneumocystis carinii in bronchoalveolar lavage and induced sputum: detection with a nested polymerase chain reaction

    DEFF Research Database (Denmark)

    Skøt, J; Lerche, A G; Kolmos, H J;

    1995-01-01

    To evaluate polymerase chain reaction (PCR) for detection of Pneumocystis carinii, 117 bronchoalveolar lavage (BAL) specimens, from HIV-infected patients undergoing a diagnostic bronchoscopy, were processed and a nested PCR, followed by Southern blot and hybridization with a P32-labelled probe......, but sensitivity dropped markedly with this system. A further 33 patients had both induced sputum and bronchoalveolar lavage performed and the induced sputum was analysed using PCR and routine microbiological methods. The PCR sensitivity on induced sputum was equal to that of routine methods. At present...... the evaluated PCR cannot replace routine microbiological methods for detection of Pneumocystis carinii, on either BAL fluid or induced sputum....

  1. Multiplex polymerase chain reaction tests for detection of pathogens associated with gastroenteritis.

    Science.gov (United States)

    Zhang, Hongwei; Morrison, Scott; Tang, Yi-Wei

    2015-06-01

    A wide range of enteric pathogens can cause infectious gastroenteritis. Conventional diagnostic algorithms are time-consuming and often lack sensitivity and specificity. Advances in molecular technology have provided new clinical diagnostic tools. Multiplex polymerase chain reaction (PCR)-based testing has been used in gastroenterology diagnostics in recent years. This article presents a review of recent laboratory-developed multiplex PCR tests and current commercial multiplex gastrointestinal pathogen tests. It focuses on two commercial syndromic multiplex tests: Luminex xTAG Gastrointestinal Pathogen Panel and BioFire FilmArray gastrointestinal test. Multiplex PCR tests have shown superior sensitivity to conventional methods for detection of most pathogens.

  2. Preparative isolation of polymerase chain reaction products using mixed-mode chromatography.

    Science.gov (United States)

    Matos, T; Silva, G; Queiroz, J A; Bülow, L

    2015-11-15

    The polymerase chain reaction (PCR) has become one of the most useful techniques in molecular biology laboratories around the world. The purification of the target DNA product is often challenging, however, and most users are restricted to employing available commercial kits. The recent developments in mixed-mode chromatography have shown higher selectivity for a variety of nucleic acid-containing samples. Capto Adhere is a mixed-mode chromatography resin that offers a high-selectivity ligand and is here applied for the purification of amplified DNAs from PCR mixtures in a 10-min single step, with yields above 95%, high linearity, and high precision for different concentrations.

  3. DNA from oral bacteria by sodium hydroxide-paper method suitable for polymerase chain reaction.

    Science.gov (United States)

    Lefimil, Claudia; Lozano, Carla; Morales-Bozo, Irene; Plaza, Anita; Maturana, Cristian; Urzúa, Blanca

    2013-02-15

    In the oral cavity, we can find a complex mixture of microorganisms, commensals, and pathogens. The studies of normal oral microbiota, as well as the studies of much oral pathology (e.g., caries, periodontitis), involve the isolation and cultivation of these microorganisms and their molecular analysis. The aim of this study was to validate a quick, easy, efficient, and inexpensive DNA extraction method for the recovery of genomic DNA from gram-positive and gram-negative oral bacteria to be used in polymerase chain reaction amplification. This method worked great with all samples analyzed, providing an approach to extract DNA for different microorganisms. Copyright © 2012 Elsevier Inc. All rights reserved.

  4. [Identification of the causative agents of glanders and melioidosis by polymerase chain reaction].

    Science.gov (United States)

    Tkachenko, G A; Antonov, V A; Zamaraev, V S; Iliukhin, V I

    2003-01-01

    Burkholderia mallei and B. pseudomallei are causative agents of glanders and melioidosis, respectively, i.e. severe and fatal infection diseases of man and animal. The computer-based analysis of the 23S rRNA gene sites was used for selecting the primers. Two pairs of primers were chosen for the identification of B. mallei and Bpseudomallei. DNAs from 48 B. pseudomallei and 15 strains of B. mallei, unlike from other geterological bacteria, were positively amplified. Therefore, the method of polymerase chain reaction can be used in laboratory diagnosis of glanders and melioidosis.

  5. Sex Identification of Red-crowned Crane by the Polymerase Chain Reaction

    Institute of Scientific and Technical Information of China (English)

    LI Jian-hong; LI Shu-ling; BAO Jun; BAI Xiu-juan

    2004-01-01

    Sex determining gene primers of Oriental White Stork were used to amplify sex-linked gene of the Red-crowned Crane's W chromosome-specific by PCR for sex identification. The sexes of 7 couples of grown Red-crowned Cranes and 15 youngs were identified. Through DNA sequence analysis, the identity is 94.77% between Red-crowned Crane and Oriental White Stork. The results of this study suggest that the application of the polymerase chain reaction technique is practicable for determining sex in the Red-crowned Crane.

  6. On-Chip integration of sample pretreatment and Multiplex polymerase chain reaction (PCR) for DNA analysis

    DEFF Research Database (Denmark)

    Brivio, Monica; Snakenborg, Detlef; Søgaard, E.

    2008-01-01

    In this paper we present a modular lab-on-a-chip system for integrated sample pre-treatment (PT) by magnetophoresis and DNA amplification by polymerase chain reaction (PCR). It consists of a polymer-based microfluidic chip mounted on a custom-made thermocycler (Figure 1) and includes a simple...... and efficient method for switching the liquid flow between the PT and PCR chamber. Purification of human genomic DNA from EDTA-treated blood and multiplex PCR were successfully carried out on-chip using the developed lab-on-a-chip system....

  7. Pneumocystis carinii in bronchoalveolar lavage and induced sputum: detection with a nested polymerase chain reaction

    DEFF Research Database (Denmark)

    Skøt, J; Lerche, A G; Kolmos, H J

    1995-01-01

    To evaluate polymerase chain reaction (PCR) for detection of Pneumocystis carinii, 117 bronchoalveolar lavage (BAL) specimens, from HIV-infected patients undergoing a diagnostic bronchoscopy, were processed and a nested PCR, followed by Southern blot and hybridization with a P32-labelled probe......, but sensitivity dropped markedly with this system. A further 33 patients had both induced sputum and bronchoalveolar lavage performed and the induced sputum was analysed using PCR and routine microbiological methods. The PCR sensitivity on induced sputum was equal to that of routine methods. At present...... the evaluated PCR cannot replace routine microbiological methods for detection of Pneumocystis carinii, on either BAL fluid or induced sputum....

  8. Diagnostic value of polymerase chain reaction analysis of skin biopsies in purpura fulminans.

    Science.gov (United States)

    Beau, Caroline; Vlassova, Natalia; Sarlangue, Jean; Brissaud, Olivier; Léauté-Labrèze, Christine; Boralevi, Franck

    2013-01-01

    Even though prompt diagnosis and treatment of purpura fulminans (PF) is essential to reduce mortality, early administration of antibiotics may preclude identification of the causative agent by standard bacterial cultures and thus render definitive diagnosis impossible. Here we present a case of an infant with PF and negative bacterial cultures for whom polymerase chain reaction (PCR) analysis of a cutaneous biopsy specimen obtained 4 days after initiation of antibiotics identified the genomic sequence of Neisseria meningitidis genogroup C. When bacterial cultures fail to provide useful information, PCR of skin biopsy specimens can be a valuable diagnostic tool in PF. © 2013 Wiley Periodicals, Inc.

  9. Development and validation of a Myxoma virus real-time polymerase chain reaction assay.

    Science.gov (United States)

    Albini, Sarah; Sigrist, Brigitte; Güttinger, Regula; Schelling, Claude; Hoop, Richard K; Vögtlin, Andrea

    2012-01-01

    To aid in the rapid diagnosis of myxomatosis in rabbits, a real-time polymerase chain reaction (PCR) for the specific detection of Myxoma virus is described. Primers and probe were designed to amplify a 147-bp fragment within the Serp2 gene. The assay was able to detect 23 copies of a synthesized oligo indicating a reliable sensitivity. In addition, the real-time PCR did not detect the Rabbit fibroma virus used in myxomatosis vaccines. The novel PCR was shown to be able to detect Myxoma virus in fresh and paraffin-embedded rabbit tissues originating from myxomatosis cases from various regions in Switzerland.

  10. Development and validation of a Myxoma virus real-time polymerase chain reaction assay

    OpenAIRE

    Albini, S; Sigrist, B; Guttinger, R; Schelling, C; Hoop, R K; Vogtlin, A

    2012-01-01

    To aid in the rapid diagnosis of myxomatosis in rabbits, a real-time polymerase chain reaction (PCR) for the specific detection of Myxoma virus is described. Primers and probe were designed to amplify a 147-bp fragment within the Serp2 gene. The assay was able to detect 23 copies of a synthesized oligo indicating a reliable sensitivity. In addition, the real-time PCR did not detect the Rabbit fibroma virus used in myxomatosis vaccines. The novel PCR was shown to be able to detect Myxoma virus...

  11. 实时荧光定量聚合酶链反应测定表皮生长因子Ⅲ突变体表达的方法构建及其应用%Construction of the method for quantitative detection of epidermal growth factor receptor variant Ⅲ by real-time polymerase chain reaction with Taq Man probe and its application

    Institute of Scientific and Technical Information of China (English)

    杨蓓蓓; 张行; 陈嘉; 曹江; 常惠玉

    2008-01-01

    目的 构建含有表皮生长因子受体Ⅲ型突变体(epidermal growth factor receptor variantⅢ,EGFRv Ⅲ)的重组质粒,建立实时荧光定量聚合酶链反应(PCR)技术测定EGFRv Ⅲ的标准曲线,以定量检测喉鳞癌组织中EGFRv Ⅲ的表达水平.方法以重叠延伸PCR法构建含EGFR第1外显子及第8至部分第9外显子的融合序列.再以融合序列为模板,以高特异性的引物扩增EGFRv Ⅲ的目的片段,构建含有EGFRv Ⅲ的重组质粒,进行测序鉴定.将此质粒作为标准品进行梯度稀释,以TaqMan探针实时荧光定量PCR进行检测,建立标准曲线.并以此技术对32例喉鳞癌组织中EGFRvⅢ mRNA表达水平进行测定.结果 经测序鉴定,含EGFRv Ⅲ的重组质粒标准品构建成功,以不同稀释水平的标准品质粒进行荧光定量PCR扩增所得的标准曲线,可用于EGFRv Ⅲ定量分析.32例喉鳞癌组织中共有5例检测到EGFRv Ⅲ的表达,阳性率为15.6%.除1例癌旁组织中存在极少量的EGFRv Ⅲ表达外,EGFRv Ⅲ均在肿瘤组织中表达.结论 用TaqMan探针实时荧光定量PCR技术定量研究EGFRv Ⅲ的方法已构建成功,在喉癌组织中的成功运用已证明该方法切实可行,并且较为准确可靠.EGFRv Ⅲ在喉癌组织中有表达,但是阳性率及含量不高,是否能成为喉癌生物治疗的特异性攻击靶点尚待进一步探索.%Objecfive To construct the recombinant plasmid and standard curve for detection of epidermal growth factor receptor variant Ⅲ (EGFRv Ⅲ) by real-time quantitive polymerase chain reaction (PCR) and establish the RT-PCR assay for accurate detection of EGFRv Ⅲ.Methods To amplify the DNA sequences of exon 1 and exon 8 to exon 9 of EGFR seperately and fuse the above sequences by overhang extension PCR.Then constructing the recombinant plasmid of EGFRv Ⅲ by highly specific primers with the fused sequence as its template.The recombinant plasmid of EGFRv Ⅲ was then sent for sequence analysis

  12. Metode Direct Polymerase Chain Reaction untuk Melacak Campylobacter sp. pada Daging Ayam (DIRECT POLYMERASE CHAIN REACTION METHOD FOR DETECTION CAMPYLOBACTER SP. OF POULTRY MEAT

    Directory of Open Access Journals (Sweden)

    Andriani .

    2013-08-01

    Full Text Available Campylobacter sp. is the most commonly reported as agent of foodborne zoonosis causing acutegastroenteritis in humans. Poultry meat is considered as a major source of C. jejuni infection in human.The conventional methods for detecting foodborne bacteria is time-consuming which rely on the of thebacteria in culture media, followed by biochemical identification. In this study polymerase chain reaction(PCR technique was used for rapid identification of the pathogenic Campylobacter sp. The samples usedwere 298 chicken carcass with sold in supermarkets and traditional markets, and were carried out inaccordance the isolation protocol ISO/ DIS 10272-1994. Identification was performed using biochemicalAPI Campy. The direct PCR (DPCR assay with two sets of primers was employed for isolation andidentification of C. jejuni and C. coli. The result of the isolation and identification both by conventional orPCR methods showed that chicken carcasses both from supermarket and traditional market werecontaminated with C. jejuni and or C. coli. Prevalence of Campylobacter sp. contamination in chicken meatwas higher by DPCR (62.6% than by conventional (19.8%, indicating that DPCR technique was moresensitive than conventional method with detection limit for C. jejuni was103 cfu/ml.

  13. Amplification refractory mutation system polymerase chain reaction versus optimized polymerase chain reaction restriction-fragment length polymorphism for apolipoprotein E genotyping of majorly depressed patients.

    Science.gov (United States)

    You, Hongmin; Chen, Jin; Zhou, Jingjing; Huang, Hua; Pan, Junxi; Wang, Ziye; Lv, Lin; Zhang, Lujun; Li, Juan; Qin, Bin; Yang, Yongtao; Xie, Peng

    2015-11-01

    Major depressive disorder (MDD) is a prevalent, debilitating mood disorder that has been associated with several genetic polymorphisms. One such polymorphism, namely that of apolipoprotein E (APOE), has three allelic forms (ε2, ε3 and ε4) that encode for six unique isoforms of the APOE protein. A growing number of techniques have been developed for APOE genotyping; however, not all polymerase chain reaction (PCR)‑based genotyping techniques are equally accurate or cost‑effective. In order to find a more accurate and cost‑effective APOE genotyping method for MDD screening in large populations, the present study comparatively evaluated two genotyping methods, amplification refractory mutation system PCR (ARMS‑PCR) and optimized PCR restriction‑fragment length polymorphism (PCR‑RFLP), in blood samples taken from a population of 708 MDD patients. Although either of the two methods were able to detect all six unique APOE genotypes, comparisons of the two methods with Sanger sequencing demonstrated that ARMS‑PCR (94%) was significantly more accurate than optimized PCR‑RFLP (82%). ARMS‑PCR should prove useful in quickly verifying ambiguous results obtained by other APOE genotyping methods and can be cost-effectively performed in the setting of a small laboratory or a population-based screening program.

  14. Comparison of Nested Polymerase Chain Reaction and Real-Time Polymerase Chain Reaction with Parasitological Methods for Detection of Strongyloides stercoralis in Human Fecal Samples.

    Science.gov (United States)

    Sharifdini, Meysam; Mirhendi, Hossein; Ashrafi, Keyhan; Hosseini, Mostafa; Mohebali, Mehdi; Khodadadi, Hossein; Kia, Eshrat Beigom

    2015-12-01

    This study was performed to evaluate nested polymerase chain reaction (PCR) and real-time PCR methods for detection of Strongyloides stercoralis in fecal samples compared with parasitological methods. A total of 466 stool samples were examined by conventional parasitological methods (formalin ether concentration [FEC] and agar plate culture [APC]). DNA was extracted using an in-house method, and mitochondrial cytochrome c oxidase subunit 1 and 18S ribosomal genes were amplified by nested PCR and real-time PCR, respectively. Among 466 samples, 12.7% and 18.2% were found infected with S. stercoralis by FEC and APC, respectively. DNA of S. stercoralis was detected in 18.9% and 25.1% of samples by real-time PCR and nested PCR, respectively. Considering parasitological methods as the diagnostic gold standard, the sensitivity and specificity of nested PCR were 100% and 91.6%, respectively, and that of real-time PCR were 84.7% and 95.8%, respectively. However, considering sequence analyzes of the selected nested PCR products, the specificity of nested PCR is increased. In general, molecular methods were superior to parasitological methods. They were more sensitive and more reliable in detection of S. stercoralis in comparison with parasitological methods. Between the two molecular methods, the sensitivity of nested PCR was higher than real-time PCR.

  15. Comparison of a conventional polymerase chain reaction with real-time polymerase chain reaction for the detection of neurotropic viruses in cerebrospinal fluid samples

    Directory of Open Access Journals (Sweden)

    M Ramamurthy

    2011-01-01

    Full Text Available Purpose : To compare a conventional polymerase chain reaction (PCR and real-time PCR for the detection of neurotropic DNA viruses. Materials and Methods : A total of 147 cerebrospinal fluid (CSF samples was collected from patients attending a tertiary care hospital in South India for a period from 2005 to 2008. All these samples were tested using a conventional multiplex/uniplex PCR and a real-time multiplex/uniplex PCR. This technique was used to detect a large number of herpes viruses responsible for central nervous system infections, including HSV-1, HSV-2, VZV, CMV and EBV and the polyoma virus JCV. Results : Overall, in the entire set of samples, the real-time PCR yielded 88 (59.9% positives and conventional PCR had six (4.1% positives. Conclusion : Our results suggest that the real-time PCR assay was more sensitive compared with the conventional PCR. The advantage of real-time PCR is that it can be performed much faster than conventional PCR. Real-time PCR is less time-consuming, less labour-intensive and also reduces the chance of contamination as there is no post-amplification procedure. In the entire study population, the major viruses detected using real-time PCR were EBV (34%, HSV-2 (10.8% and VZV (6.8%.

  16. Evaluation of Immunomagnetic Separation for the Detection of Salmonella in Surface Waters by Polymerase Chain Reaction

    Directory of Open Access Journals (Sweden)

    Chao-Yu Hsu

    2014-09-01

    Full Text Available Salmonella spp. is associated with fecal pollution and capable of surviving for long periods in aquatic environments. Instead of the traditional, time-consuming biochemical detection, polymerase chain reaction (PCR allows rapid identification of Salmonella directly concentrated from water samples. However, prevalence of Salmonella may be underestimated because of the vulnerability of PCR to various environmental chemicals like humic acid, compounded by the fact that various DNA polymerases have different susceptibility to humic acid. Because immunomagnetic separation (IMS theoretically could isolate Salmonella from other microbes and facilitate removal of aquatic PCR inhibitors of different sizes, this study aims to compare the efficiency of conventional PCR combined with immunomagnetic separation (IMS for Salmonella detection within a moderately polluted watershed. In our study, the positive rate was increased from 17.6% to 47% with nearly ten-fold improvement in the detection limit. These results suggest the sensitivity of Salmonella detection could be enhanced by IMS, particularly in low quality surface waters. Due to its effects on clearance of aquatic pollutants, IMS may be suitable for most DNA polymerases for Salmonella detection.

  17. Comparison of different polymerase chain reaction-based approaches for clonality assessment of immunoglobulin heavy-chain gene rearrangements in B-cell neoplasia

    NARCIS (Netherlands)

    Derksen, P W; Langerak, A W; Kerkhof, E; Wolvers-Tettero, I L; Boor, P P; Mulder, A H; Vrints, L W; Coebergh, J W; van Krieken, J H; Schuuring, E; Kluin, P M; van Dongen, J J

    1999-01-01

    Several frequently applied polymerase chain reaction strategies for analysis of immunoglobulin heavy-chain gene rearrangements were compared by analyzing 70 B-cell lymphoproliferative disorders and 24 reactive lymphoid lesions. Southern blot analysis was used as the "gold standard" for clonality ass

  18. An optimized polymerase chain reaction assay to identify avian virus vaccine contamination with Chicken anemia virus.

    Science.gov (United States)

    Amer, Haitham M; Elzahed, Hanan M; Elabiare, Elham A; Badawy, Ahmed A; Yousef, Ausama A

    2011-01-01

    The use of embryonating chicken eggs in preparation of avian virus vaccines is the principle cause for contamination with Chicken anemia virus (CAV). Identification of CAV in contaminated vaccines relies on the expensive, tedious, and time-consuming practice of virus isolation in lymphoblastoid cell lines. The experience of the last 2 decades indicates that polymerase chain reaction is extending to replace most of the classic methods for detection of infectious agents. In the present report, a simple, rapid, and accurate polymerase chain reaction method for detection of CAV in poultry vaccines is described. Oligonucleotide primers homologous to highly conserved sequences of the VP1 gene were used to amplify a fragment of 676 bp. The developed assay was specific for detecting CAV from different sources, with no cross reactivity with many avian viruses. No inter- and intra-assay variations were observed. The analytical sensitivity of the test was high enough to detect 5 TCID(50) (50% tissue culture infective dose) of the virus per reaction; however, different factors related to the vaccine matrix showed considerable effects on the detection limit. In conclusion, this method may represent a suitable alternative to virus isolation for identification of CAV contamination of poultry virus vaccines.

  19. Development of Capillary Loop Convective Polymerase Chain Reaction Platform with Real-Time Fluorescence Detection

    Directory of Open Access Journals (Sweden)

    Wen-Pin Chou

    2017-02-01

    Full Text Available Polymerase chain reaction (PCR has been one of the principal techniques of molecular biology and diagnosis for decades. Conventional PCR platforms, which work by rapidly heating and cooling the whole vessel, need complicated hardware designs, and cause energy waste and high cost. On the other hand, partial heating on the various locations of vessels to induce convective solution flows by buoyancy have been used for DNA amplification in recent years. In this research, we develop a new convective PCR platform, capillary loop convective polymerase chain reaction (clcPCR, which can generate one direction flow and make the PCR reaction more stable. The U-shaped loop capillaries with 1.6 mm inner diameter are designed as PCR reagent containers. The clcPCR platform utilizes one isothermal heater for heating the bottom of the loop capillary and a CCD device for detecting real-time amplifying fluorescence signals. The stable flow was generated in the U-shaped container and the amplification process could be finished in 25 min. Our experiments with different initial concentrations of DNA templates demonstrate that clcPCR can be applied for precise quantification. Multiple sample testing and real-time quantification will be achieved in future studies.

  20. Development of nested polymerase chain reaction-based diagnosis of duck enteritis virus and detection of DNA polymerase gene from non-descriptive duck breeds of West Bengal, India

    National Research Council Canada - National Science Library

    Partha Sarathi Mandal; Sunit Kumar Mukhopadhayay; Saktipada Pradhan; Samiran Mondal; Chandrakanta Jana; Nimai Chandra Patra; Rabindra Nath Hansda

    2017-01-01

    ...) infected eggs, and histopathological changes of chorioallantoic membrane (CAM) in non-descriptive ducks of West Bengal with special reference to standardize nested polymerase chain reaction (PCR...

  1. Comparison of histopathology and real-time polymerase chain reaction (RT-PCR) for detection of Mycobacterium tuberculosis in fistula-in-ano.

    Science.gov (United States)

    Garg, Pankaj

    2017-07-01

    Histopathology is commonly used to diagnose tuberculosis in fistula-in-ano. The aim was to compare the sensitivity of polymerase chain reaction and histopathology in detecting tuberculosis in fistula-in-ano. The histopathology and polymerase chain-reaction of tissue (fistula tract) was done in all the consecutive operated cases. When pus sample was also available, polymerase chain reaction-pus was also done RESULTS: Three hundred forty seven samples (179 patients) were tested over 2 years (median 6.5 months). The mean age was 38.8 ± 10.7 years, and male/female was 170/9. Histopathology and polymerase chain reaction of tissue (fistula tract) was done in 152 and 165 patients, respectively. Polymerase chain reaction (pus) could be done in 30 patients. Overall, tuberculosis was detected in 20/179 (11.2%) patients. Of these, tuberculosis was detected by histopathology (tissue) in 1/152 (0.7%) and by polymerase chain reaction (tissue) in 14/165 (8.5%) patients. In pus, polymerase chain reaction detected tuberculosis in 6/30 (20%) patients. Both polymerase chain reaction of tissue and pus were positive in one patient. Polymerase chain reaction (tissue) and polymerase chain reaction (pus) were significantly more sensitive than histopathology (tissue) for detecting tuberculosis [histopathology 1/152 vs. polymerase chain reaction (tissue) 14/165, p = 0.0009] [histopathology 1/152 vs. polymerase chain reaction (pus) 6/30, p Polymerase chain reaction was significantly more sensitive than histopathology in detecting tuberculosis in fistula-in-ano. Histopathology might be missing out tuberculosis in many patients leading to recurrence of the fistula.

  2. Validity of the polymerase chain reaction in the diagnosis of clinically suspected cases of American visceral leishmaniasis.

    Science.gov (United States)

    Pedrosa, Celia Maria Silva; Ximenes, Ricardo Arraes de Alencar; Almeida, Wendell Alexandre Pinheiro de; Rocha, Eliana Maria Mauricio da

    2013-01-01

    To test the validity of the polymerase chain reaction for diagnosing American visceral leishmaniasis, 88 suspected cases were studied. Diagnosis was confirmed in 47 (53.5%) and ruled out in 41 (46.5%) patients. Samples of bone marrow and peripheral blood were processed by polymerase chain reaction to evaluate the sensitivity and specificity of the test and its agreement beyond chance with microscopy examination. The polymerase chain reaction was positive in bone marrow of 100% of the patients with amastigotes seen with microscopy examination, and in 59.5% in those where no parasite were seen. Agreement beyond chance between visualization of the parasite in bone marrow aspirates and polymerase chain reaction was considered weak (Kappa=0.41). Concordance between polymerase chain reaction of bone marrow aspirates and of peripheral blood was considered excellent (Kappa=0.88). The test turned out positive in all bone marrow aspirates of those with the disease and whereas the positivity rate was 58.5% among those without the disease, with specificity rate of 41.5%.

  3. ISOLASI Campylobacter DARI KARKAS AYAM MENGGUNAKAN METODE KONVENSIONAL DAN POLYMERASE CHAIN REACTIONS [Isolation of Campylobacter from Poultry Carcasses using Conventional and Polymerase Chain Reaction Methods

    Directory of Open Access Journals (Sweden)

    Surachmi Setiyaningsih2

    2013-06-01

    Full Text Available Campylobacter jejuni and Campylobacter coli are two spesies of Campylobacter sp. frequently found as pathogenic bacteria causing human gastrointestinal infections. Contaminated chicken carcasses have been reported as the source of human campylobacteriosis. In this study, Campylobacter were isolated from chicken carcasses sold in traditional markets and supermarkets. In traditional markets, chicken carcasses are sold without proper packaging or in an open space and stored at room temperature (25-30°C for prolonged period allowing pathogenic bacteria to grow. While at supermarkets, chicken carcasses are openly displayed or enclosed in plastic wrappings and stored in a refrigerator (4-8°C. A total of 298 samples of chicken carcasses from traditional markets and supermarkets in the area of DKI Jakarta, West Java (Bogor and Sukabumi and Central Java (Kudus and Demak were collected. Isolation and identification using conventional and Polymerase Chain Reactions (PCR methods were done to determine the prevalence of C. jejuni and C. coli contamination in poultry. The results showed that chicken carcasses sold in the sampling area, both traditional markets and supermarkets, were contaminated with C. jejuni and C. coli. The contamination rate of Campylobacter sp. in chicken carcasses sold in supermarkets, were 14.1% by conventional methods and 29.5% by PCR. This was higher than those in traditional markets, i.e. 5.7 and 12.1%, respectively. It is also confirmed that the prevalence for contamination of C. jejuni was higher than C. coli in 298 samples, i.e. 16.1% and 3.7% by conventional method and 23.5% and 18.1% by PCR method respectively.

  4. Polymerase chain reaction-mediated characterization of molds belonging to the Aspergillus flavus group and detection of Aspergillus parasiticus in peanut kernels by a multiplex polymerase chain reaction.

    Science.gov (United States)

    Chen, Ruey-Shyang; Tsay, Jwu-Guh; Huang, Yu-Fen; Chiou, Robin Y Y

    2002-05-01

    The Aspergillus flavus group covers species of A. flavus and Aspergillus parasiticus as aflatoxin producers and Aspergillus oryzae and Aspergillus sojae as koji molds. Genetic similarity among these species is high, and aflatoxin production of a culture may be affected by cultivation conditions and substrate composition. Therefore, a polymerase chain reaction (PCR)-mediated method of detecting the aflatoxin-synthesizing genes to indicate the degree of risk a genotype has of being a phenotypic producer was demonstrated. In this study, 19 strains of the A. flavus group, including A. flavus, A. parasiticus, A. oryzae, A. sojae, and one Aspergillus niger, were subjected to PCR testing in an attempt to detect four genes, encoding for norsolorinic acid reductase (nor-1), versicolorin A dehydrogenase (ver-1), sterigmatocystin O-methyltransferase (omt-1), and a regulatory protein (apa-2), involved in aflatoxin biosynthesis. Concurrently, the strains were cultivated in yeast-malt (YM) broth for aflatoxin detection. Fifteen strains were shown to possess the four target DNA fragments. With regard to aflatoxigenicity, all seven aflatoxigenic strains possessed the four DNA fragments, and five strains bearing less than the four DNA fragments did not produce aflatoxin. When peanut kernels were artificially contaminated with A. parasiticus and A. niger for 7 days, the contaminant DNA was extractable from a piece of cotyledon (ca. 100 mg), and when subjected to multiplex PCR testing using the four pairs of primers coding for the above genes, they were successfully detected. The target DNA fragments were detected in the kernels infected with A. parasiticus, and none was detected in the sound (uninoculated) kernels or in the kernels infected with A. niger.

  5. α,β-D-constrained nucleic acids are strong terminators of thermostable DNA polymerases in polymerase chain reaction.

    Directory of Open Access Journals (Sweden)

    Olivier Martínez

    Full Text Available (S(C5', R(P α,β-D- Constrained Nucleic Acids (CNA are dinucleotide building blocks that can feature either B-type torsional angle values or non-canonical values, depending on their 5'C and P absolute stereochemistry. These CNA are modified neither on the nucleobase nor on the sugar structure and therefore represent a new class of nucleotide with specific chemical and structural characteristics. They promote marked bending in a single stranded DNA so as to preorganize it into a loop-like structure, and they have been shown to induce rigidity within oligonucleotides. Following their synthesis, studies performed on CNA have only focused on the constraints that this family of nucleotides introduced into DNA. On the assumption that bending in a DNA template may produce a terminator structure, we investigated whether CNA could be used as a new strong terminator of polymerization in PCR. We therefore assessed the efficiency of CNA as a terminator in PCR, using triethylene glycol phosphate units as a control. Analyses were performed by denaturing gel electrophoresis and several PCR products were further analysed by sequencing. The results showed that the incorporation of only one CNA was always skipped by the polymerases tested. On the other hand, two CNA units always stopped proofreading polymerases, such as Pfu DNA polymerase, as expected for a strong replication terminator. Non-proofreading enzymes, e.g. Taq DNA polymerase, did not recognize this modification as a strong terminator although it was predominantly stopped by this structure. In conclusion, this first functional use of CNA units shows that these modified nucleotides can be used as novel polymerization terminators of proofreading polymerases. Furthermore, our results lead us to propose that CNA and their derivatives could be useful tools for investigating the behaviour of different classes of polymerases.

  6. α,β-D-Constrained Nucleic Acids Are Strong Terminators of Thermostable DNA Polymerases in Polymerase Chain Reaction

    Science.gov (United States)

    Mahéo, Sabrina; Gross, Grégori; Bodin, Pierre; Teissié, Justin; Escudier, Jean-Marc; Paquereau, Laurent

    2011-01-01

    (SC5′, RP) α,β-D- Constrained Nucleic Acids (CNA) are dinucleotide building blocks that can feature either B-type torsional angle values or non-canonical values, depending on their 5′C and P absolute stereochemistry. These CNA are modified neither on the nucleobase nor on the sugar structure and therefore represent a new class of nucleotide with specific chemical and structural characteristics. They promote marked bending in a single stranded DNA so as to preorganize it into a loop-like structure, and they have been shown to induce rigidity within oligonucleotides. Following their synthesis, studies performed on CNA have only focused on the constraints that this family of nucleotides introduced into DNA. On the assumption that bending in a DNA template may produce a terminator structure, we investigated whether CNA could be used as a new strong terminator of polymerization in PCR. We therefore assessed the efficiency of CNA as a terminator in PCR, using triethylene glycol phosphate units as a control. Analyses were performed by denaturing gel electrophoresis and several PCR products were further analysed by sequencing. The results showed that the incorporation of only one CNA was always skipped by the polymerases tested. On the other hand, two CNA units always stopped proofreading polymerases, such as Pfu DNA polymerase, as expected for a strong replication terminator. Non-proofreading enzymes, e.g. Taq DNA polymerase, did not recognize this modification as a strong terminator although it was predominantly stopped by this structure. In conclusion, this first functional use of CNA units shows that these modified nucleotides can be used as novel polymerization terminators of proofreading polymerases. Furthermore, our results lead us to propose that CNA and their derivatives could be useful tools for investigating the behaviour of different classes of polymerases. PMID:21991314

  7. Rapid Detection of Salmonella in Food and Beverage Samples by Polymerase Chain Reaction

    Directory of Open Access Journals (Sweden)

    Radji, M.

    2010-01-01

    Full Text Available Polymerase chain reaction (PCR assay had been used to detect Salmonella in food and beverage samples using suitable primers which are based on specific invA gene of Salmonella. Twenty nine samples were collected from street food counters and some canteens in Margonda Street, Depok, West Java, Indonesia. It was found that five of twenty nine samples were detected to contain Salmonella and showed the presence of the amplified product of the size 244 bp. The method of PCR demonstrated the specificity of invA primers for detection of Salmonella as confirmed by biochemical and serological assay. The results of this study revealed that PCR was a rapid and useful tool for detection of Salmonella in food and beverage samples.

  8. Typing of Poultry Influenza Virus (H5 and H7 by Reverse Transcription- Polymerase Chain Reaction

    Directory of Open Access Journals (Sweden)

    Cesare Bonacina

    2010-01-01

    Full Text Available The ability of the influenza Orthomixovirus to undergo to continually antigenically changes that can affect its pathogenicity and its diffusion, explains the growing seriousness of this disease and the recent epizoozies in various parts of the world. There have been 15 HA and 9 NA type A sub-types of the influenza virus identified all of which are present in birds. Until now the very virulent avian influenza viruses identified were all included to the H5 and H7 sub-types. We here show that is possible to identify the H5 and H7 sub-types with reverse transcription-polymerase chain reaction (RT-PCR by using a set of specific primers for each HA sub-type. The RT-PCR is a quick and sensitive method of identifying the HA sub-types of the influenza virus directly from homogenised organs.

  9. Polymerase chain reaction detection of potentially pathogenic free-living amoebae in dental units.

    Science.gov (United States)

    Leduc, Annie; Gravel, Sabrina; Abikhzer, Jérémie; Roy, Stéphane; Barbeau, Jean

    2012-07-01

    Several genera of amoebae can be found in water from dental units and on the inner surface of waterlines. The presence of bacterial biofilms on these surfaces is thought to favor the proliferation of amoebae. Potentially pathogenic Acanthamoeba and Naegleria spp. may be an infection risk for patients through contact with open surgical sites or aerosolization. A polymerase chain reaction of DNA extracted from pelleted samples showed that Acanthamoeba spp. and Naegleria spp. were present in water from dental units, suction lines, and suction filters at the dental clinic of the Université de Montréal. Acanthamoeba spp. were detected in 24.2% of 66 samples and Naegleria spp. in 3.0%. We discuss the infection risk associated with these results.

  10. Specific and sensitive detection of Trichomonas tenax by the polymerase chain reaction.

    Science.gov (United States)

    Kikuta, N; Yamamoto, A; Fukura, K; Goto, N

    1997-03-01

    A polymerase chain reaction (PCR) protocol was developed for specific detection of Trichomonas tenax by using a pair of primers designed for its 18S rRNA gene. The detection was specific for T. tenax, since no amplification was detected with DNAs from Trichomonas vaginalis, which belongs to the same genus as T. tenax, in addition to various species of oral protists, fungi and bacteria, and human leukocytes. This method had a detection limit of 100 fg for T. tenax genomic DNA and could detect T. tenax cells in dental plaque at a concentration of as low as 5 cells per PCR mixture. Direct detection from clinical dental plaque samples was also possible; therefore, the present PCR procedure could provide a simple and rapid detection method of T. tenax in dental plaque.

  11. Genotypic study of verocytotoxic Escherichia coli isolates from deer by multiplex polymerase chain reaction

    Directory of Open Access Journals (Sweden)

    Raghavendra Prasad Mishra

    2016-08-01

    Full Text Available Aim: This study was planned to study the genotypes of verocytotoxigenic Escherichia coli (VTEC in fecal samples of deer due to its public health significance. Materials and Methods: A total of 160 fecal samples of deer were taken from Mathura district and Kanpur Zoo and screened for VTEC genes by polymerase chain reaction (PCR. Results: All fecal samples were positive for E. coli. All the E. coli isolates were screened by PCR to detect virulence genes stx1, stx2, eaeA, and hlyA. Of these, 15 isolates were found positive for VTEC having one or more genes in different combinations. Conclusion: Genes such as stx1, stx2, eaeA, and hlyA were prevalent in VTEC isolates from feces of deer. The presence of VTEC isolates having virulent genes may pose a threat to public health.

  12. Diagnosis of Leishmania infantum infection by Polymerase Chain Reaction in wild mammals

    Directory of Open Access Journals (Sweden)

    Mayara C. Lombardi

    2014-12-01

    Full Text Available Visceral leishmaniasis is a chronic infectious disease caused by Leishmania infantum (synonym: Leishmania chagasi and transmitted by the sandfly Lutzomyia longipalpis in Brazil. It is an endemic zoonosis in several regions of the country, including Belo Horizonte (State of Minas Gerais. In urban areas, the domestic dog is susceptible and considered the most important animal reservoir. However, L. infantum has been previously diagnosed in other species, including captive primates and canids. This study aimed to evaluate the presence of the agent DNA in captive animals as well as some free ranging animals from the Zoo-Botanical Foundation of Belo Horizonte by Polymerase Chain Reaction. Eighty one blood samples from primates, carnivores, ruminants, edentates, marsupial, and a monogastric herbivore were analyzed. Three primates Alouatta guariba (brown howler monkey, and two canids Speothos venaticus (bush dog were positive, demonstrating the importance of leishmaniasis control in endemic areas for preservation of wildlife species in captivity.

  13. Acanthamoeba can be differentiated by the polymerase chain reaction and simple plating assays.

    Science.gov (United States)

    Khan, N A; Jarroll, E L; Paget, T A

    2001-09-01

    Acanthamoeba are opportunistic pathogens with invasive and noninvasive species. For clinical purposes it is important to differentiate potentially pathogenic from nonpathogenic isolates. For the rapid and sensitive identification of Acanthamoeba at the genus level, we used a polymerase chain reaction (PCR)-based method which detected as few as five cells. Further, we tested nine isolates of Acanthamoeba for their ability to produce cytopathic effects (CPE) on corneal epithelial cells. On the basis of the results, Acanthamoeba were divided into pathogenic or nonpathogenic groups. However, because CPE assays are not available to every diagnostic laboratory, we developed a simple plating assay based on osmotolerance which correlated well with the CPE assays. Pathogenic Acanthamoeba showed growth on higher osmolarity (agar plates containing one molar mannitol), while growth of nonpathogens was inhibited on these plates. In conclusion, we have developed methods for the rapid identification and differentiation of Acanthamoeba.

  14. Treponema pallidum and Haemophilus ducreyi DNA detection by A Multi-Nested Polymerase Chain Reaction

    Institute of Scientific and Technical Information of China (English)

    郑和平; SylviaBruisten; 何玉山; 黄进梅; 吴兴中

    2004-01-01

    Objectives: To develop a multi-nested polymerase chain reaction in an assay to detect early Treponema pallidum and Haemophilus ducreyi DNA in the swabs of genital ulcers. Methods: Four pairs of outer and inner primers, specific to the basic membrane protein gene of Treponema pallidum and to the 16s rRNA gene of H ducreyi were synthesized. The multi-nested PCR was developed and applied to detect Treponema pallidum and Haemophilus dicreyi in clinical swabs. Result: The two samples of standard strains of Haemophilus ducreyi and one Treponema pallidum were amplified and showed 309-bp rRNA gene of Haemophilus ducreyi and 506-bp DNA of Treponema palidum, respectively. Out of 51 samples of genital ulcer detected, 29 showed Treponemapallidum positive product and noHaemophilus ducreyi DNA was found. Conclusion: The multi-nested PCR for Treponema pallidum and Haemophilus ducreyi could be useful for early detection and distinguishing diagnosis between syphilis and chancroid.

  15. Diagnosis of Progressive Spinal Muscular Atrophy by Using Polymerase Chain Reaction

    Institute of Scientific and Technical Information of China (English)

    姚娟; 丁新生; 陈克连; 程虹; 邓晓萱; 沈鸣九; 王颖

    2001-01-01

    Objective To understand the deletion in the survival motor neuron gene (SMN) of childhood-onset spinal muscular atrophy (SMA) in Chinese, and the value of diagnosis of SMA using polymerase chain reaction-restriction fragment length polymorphism (PCR-RFLP)method. Methods Deletions of SMN gene of exon 7 and 8 in 10 cases of presumed SMA, and 20 normal controls from 6 families and 30 unrelated controls were performed by PCR-RFLP analysis. Results Deletions of SMN gene detected in 9 of 10 (90%) cases of presumed SMA . No deletions of SMN in the telomere were found in the other members of families and controls.Conclusion PCR-RFLP is a sensitive, specific and simple method in diagnosis of SMA.

  16. Polymerase chain reaction-based assays for the diagnosis of human brucellosis.

    Science.gov (United States)

    Wang, Ying; Wang, Zhanli; Zhang, Yaxian; Bai, Liyun; Zhao, Yue; Liu, Chunfang; Ma, An; Yu, Hui

    2014-08-01

    Polymerase chain reaction (PCR) is an in vitro technique for the nucleic acid amplification, which is commonly used to diagnose infectious diseases. The use of PCR for pathogens detection, genotyping and quantification has some advantages, such as high sensitivity, high specificity, reproducibility and technical ease. Brucellosis is a common zoonosis caused by Brucella spp., which still remains as a major health problem in many developing countries around the world. The direct culture and immunohistochemistry can be used for detecting infection with Brucella spp. However, PCR has the potential to address limitations of these methods. PCR are now one of the most useful assays for the diagnosis in human brucellosis. The aim of this review was to summarize the main PCR techniques and their applications for diagnosis and follow-up of patients with brucellosis. Moreover, advantages or limitation of the different PCR methods as well as the evaluation of PCR results for treatment and follow-up of human brucellosis were also discussed.

  17. Validation study of HPV DNA detection from stained FNA smears by polymerase chain reaction

    DEFF Research Database (Denmark)

    Channir, Hani Ibrahim; Grønhøj Larsen, Christian; Ahlborn, Lise Barlebo;

    2016-01-01

    BACKGROUND: Human papillomavirus (HPV)-related oropharyngeal squamous cell carcinoma (OPSCC) often presents with cystic cervical metastasis and a small primary tumor localized in the palatine tonsils or base of the tongue, which is diagnostically challenging. Testing for HPV DNA in fine......-needle aspiration (FNA) smears from metastases may facilitate a targeted diagnostic workup for identifying the primary tumor. This study was designed to assess the ability to detect HPV DNA in FNA smears with polymerase chain reaction (PCR). METHODS: May-Grünvald-Giemsa (MGG)-stained FNA smears from metastases...... and corresponding surgical specimens were collected from 71 patients with known HPV-positive OPSCC, 12 patients with oral squamous cell carcinoma (OSCC), 20 patients with branchial cleft cysts, and 20 patients with Warthin tumors. Thirty-eight patients with OPSCC and 7 patients with OSCC had FNA smears available...

  18. The polymerase chain reaction and its application to clinical plastic surgery.

    LENUS (Irish Health Repository)

    Rea, S

    2012-02-03

    Molecular biology has become an essential component in many fields of modern medical research, including plastic surgery. Research into the molecular mechanisms underlying many disease processes offer increased understanding of the pathogenesis of disease and provide exciting therapeutic possibilities. Yet for many clinicians, the presentation of much research into molecular biological processes is couched in confusing terminology and based on scientific techniques, the basis of which are frequently difficult for the clinician to understand. The purpose of this review is to present an introduction to some of the molecular biological techniques currently in use, namely the polymerase chain reaction (PCR) and explore its applications to different aspects of plastic surgery. This review explores the role PCR now plays in all aspects of modern plastic surgery practise, with particular emphasis on normal and abnormal wound healing, the diagnosis of craniofacial anomalies, the diagnosis and treatment of cancer including melanoma and squamous cell carcinoma of the head and neck, and burns.

  19. Detection of Fasciola gigantica infection in snails by polymerase chain reaction.

    Science.gov (United States)

    Velusamy, R; Singh, B P; Raina, O K

    2004-02-26

    Polymerase chain reaction (PCR) was used to detect Fasciola gigantica infection in the snail intermediate host. Fasciola specific primers amplified a 124 bp fragment in PCR when the genomic DNA isolated from F. gigantica infected Lymnaea auricularia snails was used as template. In addition to the 124 bp amplicon, a ladder of DNA fragments representing amplification of the 124 bp repetitive sequences was observed. Genomic DNA of the parasite was used as a positive control, which also gave an amplification of the 124 bp fragment. DNA isolated from non-infected snails was used as a negative control and no amplification of this sequence was observed. This technique is highly specific and sensitive and possesses fairly good prospects of its utility as an epidemiological tool for ascertaining the infectivity status in ubiquitous snail populations.

  20. Simplified procedures for applying the polymerase chain reaction to routinely fixed paraffin wax sections.

    Science.gov (United States)

    Coates, P J; d'Ardenne, A J; Khan, G; Kangro, H O; Slavin, G

    1991-02-01

    The polymerase chain reaction was applied to the analysis of DNA contained in archival paraffin wax embedded material. DNA suitable for the reaction was obtained from these tissues by simple extraction methods, without previous dewaxing of tissue sections. When compared with unfixed material, the reaction efficiency was compromised, so that an increased number of amplification cycles were required to produce equivalent amounts of amplified product. This in turn led to an increase in amplification artefacts, which can be minimised by a simple modification of the standard reaction. Amplification of relatively large DNA fragments was not always successful, and it seems prudent to bear this in mind when designing oligonucleotide primers which are to be used for the amplification of archival material. The efficiency of the procedure can be improved by dividing the amplification cycles into two parts: this reduces the amount of reagent needed, is relatively simple and inexpensive, and can be performed in one working day.

  1. Deletion Analysis Of The Duchenne/Becker Muscular Dystrophy Gene Using Multiplex Polymerase Chain Reaction

    Directory of Open Access Journals (Sweden)

    Dastur P

    2004-01-01

    Full Text Available The diagnosis of Duchenna Muscular Dystrophy (DMD and Becker Muscular Dystorphy (BMD is mainly based on clinical profile, serum CPK values, muscle biopsy and immunostaining for dystrophin. This was done in 100 unrelated patients using 19 exons including the promoter region in two sets of multiplex polymerase chain reaction (PCR. These primers amplify most of the exons in the deletion prone ′hot spot′ regions allowing determinations of deletion end points. Intragenic deletions were detected in 74 patients indicating that the use of PCR- based assays will allow deletion detection help in prenatal diagnosis for most of the DMD/BMD patients. The frequency of deletions observed in the present study was 74%.

  2. Repetitive sequence based polymerase chain reaction to differentiate close bacteria strains in acidic sites

    Institute of Scientific and Technical Information of China (English)

    XIE Ming; YIN Hua-qun; LIU Yi; LIU Jie; LIU Xue-duan

    2008-01-01

    To study the diversity of bacteria strains newly isolated from several acid mine drainage(AMD) sites in China,repetitive sequence based polymerase chain reaction (rep-PCR),a well established technology for diversity analysis of closely related bacteria strains,was conducted on 30 strains of bacteria Leptospirillum ferriphilium,8 strains of bacteria Acidithiobacillus ferrooxidans,as well as the Acidithiobacillus ferrooxidans type strain ATCC (American Type Culture Collection) 23270.The results showed that,using ERIC and BOX primer sets,rep-PCR produced highly discriminatory banding patterns.Phylogenetic analysis based on ERIC-PCR banding types was made and the results indicated that rep-PCR could be used as a rapid and highly discriminatory screening technique in studying bacterial diversity,especially in differentiating bacteria within one species in AMD.

  3. Separation-Type Multiplex Polymerase Chain Reaction Chip for Detecting Male Infertility

    Science.gov (United States)

    Ha, Seung-Mo; Ju, Jin-Kyoung; Ahn, Yoomin; Hwang, Seung Young

    2008-06-01

    A novel polymerase chain reaction (PCR) biochip is presented in this paper. In this PCR chip, the glass substrate integrated with the microheater and microsensor is separable from the reaction chamber where the sample is injected, which now makes repeated reuse of the glass substrate possible. The heat transfer efficiency and target gene amplification of the proposed separable PCR chip was compared with that of the conventional united PCR chip. The results showed that the sex-determining Y chromosome (SRY) gene PCR for detecting male infertility was successfully performed in the separable chip. However, repeated multiplex PCR was successful for only two genes, SPGY1 and SRY, but not for gene SY586. Future work is needed for a multiplex PCR with more than three genes.

  4. Gene analysis of multiple oral bacteria by the polymerase chain reaction coupled with capillary polymer electrophoresis.

    Science.gov (United States)

    Liu, Chenchen; Yamaguchi, Yoshinori; Sekine, Shinichi; Ni, Yi; Li, Zhenqing; Zhu, Xifang; Dou, Xiaoming

    2016-03-01

    Capillary polymer electrophoresis is identified as a promising technology for the analysis of DNA from bacteria, virus and cell samples. In this paper, we propose an innovative capillary polymer electrophoresis protocol for the quantification of polymerase chain reaction products. The internal standard method was modified and applied to capillary polymer electrophoresis. The precision of our modified internal standard protocol was evaluated by measuring the relative standard deviation of intermediate capillary polymer electrophoresis experiments. Results showed that the relative standard deviation was reduced from 12.4-15.1 to 0.6-2.3%. Linear regression tests were also implemented to validate our protocol. The modified internal standard method showed good linearity and robust properties. Finally, the ease of our method was illustrated by analyzing a real clinical oral sample using a one-run capillary polymer electrophoresis experiment.

  5. Epidemiological Investigation of Salmonella Tilene by Pulsed-Field Gel Electrophoresis and Polymerase Chain Reaction

    Directory of Open Access Journals (Sweden)

    Chandar M Anand

    1997-01-01

    Full Text Available Pulsed-field gel electrophoresis (PFGE and DNA fingerprinting by the polymerase chain reaction (PCR were performed on 11 isolates of Salmonella tilene. Five strains were from a cluster of human patients, six from sugar gliders and pygmy hedgehogs kept as family pets or from local pet retailers, and one isolate from the first North American case of S tilene described in Washington State in 1994. The PFGE restriction patterns showed all isolates to be similar. However, PCR using primers to the 16S and 23S rRNA genes of Escherichia coli demonstrated that the Washington State isolate differed from the rest of the other isolates, which were all similar based upon their DNA fingerprint. This study indicates that reliance on one technique alone may be insufficient to show nuances between strains that are, in many respects, closely related.

  6. Rapid polymerase chain reaction diagnosis of white-nose syndrome in bats

    Science.gov (United States)

    Lorch, J.M.; Gargas, A.; Meteyer, C.U.; Berlowski-Zier, B. M.; Green, D.E.; Shearn-Bochsler, V.; Thomas, N.J.; Blehert, D.S.

    2010-01-01

    A newly developed polymerase chain reaction (PCR)-based method to rapidly and specifically detect Geomyces destructans on the wings of infected bats from small quantities (1-2 mg) of tissue is described in the current study (methods for culturing and isolating G. destructans from bat skin are also described). The lower limits of detection for PCR were 5 fg of purified fungal DNA or 100 conidia per 2 mg of wing tissue. By using histology as the standard, the PCR had a diagnostic specificity of 100% and a diagnostic sensitivity of 96%, whereas the diagnostic sensitivity of culture techniques was only 54%. The accuracy and fast turnaround time of PCR provides field biologists with valuable information on infection status more rapidly than traditional methods, and the small amount of tissue required for the test would allow diagnosis of white-nose syndrome in live animals.

  7. An improved electrochemiluminescence polymerase chain reaction method for the detection of Fusarium wilts

    Institute of Scientific and Technical Information of China (English)

    Jie Wei; Xiao Ming Zhou

    2008-01-01

    An improved electrochemiluminescence polymerase chain reaction (ECL-PCR) method was developed and applied to detect Fusarium wilt. Briefly, the internal transcribed spacer (ITS) sequence of Fusarium oxysporum f. sp Cubense (FOC) was amplified by PCR. Two universal fragments, which were complimentary to Ru(bpy)32+ (TBR) labeled probe and Biotin labeled probe, respectively, were connected to the tail of primers so that all the PCR products got universal sequences. Then biotin labeled probes and TBR labeled probes were hybridized with the PCR products at the same time. Through the specific interaction between biotin and streptavidin, the PCR products were captured by streptavidin coated magnetic bead and then detected by ECL assay. The experiment results showed that the healthy banana samples and infected ones can be discriminated by this ECL-PCR method. This improved ECL-PCR approach is useful in Fusarium wilt detection due to its high sensitivity, simplicity and stability.

  8. Use of polymerase chain reaction (PCR for detection of Chlamydia trachomatis infection in cervical swab samples

    Directory of Open Access Journals (Sweden)

    Mania-Pramanik Jayanti

    2001-09-01

    Full Text Available A polymerase chain reaction (PCR based method has been set up for detection of Chlamydia trachomatis (C. trachomatis infection in single cervical swab samples. A primer pair specific to the major outer membrane protein (MOMP gene common to all serotypes of C. trachomatis was used. This method was validated for its sensitivity as well as specificity. A minimum Ing of DNA could be used for detection of the infection. Specificity of the method was confirmed by carrying out a sample dilution curve. The cervical swab samples analysed in the present study were in coded form for validation of the PCR with an established commercial ELISA (Chlamydiazyme. Both the sensitivity and specificity of PCR was 100% when the ELISA results of these samples were decoded. Thus, this PCR technique could be used for better diagnosis of C. trachomatis infection in comparison to the commercially available ELISA technique.

  9. A Micro Polymerase Chain Reaction Module for Integrated and Portable DNA Analysis Systems

    Directory of Open Access Journals (Sweden)

    Elisa Morganti

    2011-01-01

    Full Text Available This work deals with the design, fabrication, and thermal characterization of a disposable miniaturized Polymerase Chain Reaction (PCR module that will be integrated in a portable and fast DNA analysis system. It is composed of two independent parts: a silicon substrate with embedded heater and thermometers and a PDMS (PolyDiMethylSiloxane chamber reactor as disposable element; the contact between the two parts is assured by a mechanical clamping obtained using a Plastic Leaded Chip Carrier (PLCC. This PLCC is also useful, avoid the PCR mix evaporation during the thermal cycles. Finite Element Analysis was used to evaluate the thermal requirements of the device. The thermal behaviour of the device was characterized revealing that the temperature can be controlled with a precision of ±0.5°C. Different concentrations of carbon nanopowder were mixed to the PDMS curing agent in order to increase the PDMS thermal conductivity and so the temperature control accuracy.

  10. Polymerase Chain Reaction Identification of a Hymenopteran Insect in the Cornea: a Case Report

    Directory of Open Access Journals (Sweden)

    Hsien-Chung Lin

    2006-03-01

    Full Text Available The type of corneal injuries associated with insect encounters is related to the composition of the foreign body. However, previous reports on corneal foreign bodies as insects were rarely based on scientific evidence. Here, we report on a 49-year-old male who was stung in his left eye by an unknown insect. Emergent keratotomy was performed to remove the embedded corneal foreign body. The removed foreign body was observed under light microscopy, and a fragment of insect was suspected. The sample was sent for molecular analysis. The polymerase chain reaction product was sequenced, subjected to a BLAST search, and identified as an ichneumonoid member of the insect order Hymenoptera.

  11. Monitoring Acidophilic Microbes with Real-Time Polymerase Chain Reaction (PCR) Assays

    Energy Technology Data Exchange (ETDEWEB)

    Frank F. Roberto

    2008-08-01

    Many techniques that are used to characterize and monitor microbial populations associated with sulfide mineral bioleaching require the cultivation of the organisms on solid or liquid media. Chemolithotrophic species, such as Acidithiobacillus ferrooxidans and Leptospirillum ferrooxidans, or thermophilic chemolithotrophs, such as Acidianus brierleyi and Sulfolobus solfataricus can grow quite slowly, requiring weeks to complete efforts to identify and quantify these microbes associated with bioleach samples. Real-time PCR (polymerase chain reaction) assays in which DNA targets are amplified in the presence of fluorescent oligonucleotide primers, allowing the monitoring and quantification of the amplification reactions as they progress, provide a means of rapidly detecting the presence of microbial species of interest, and their relative abundance in a sample. This presentation will describe the design and use of such assays to monitor acidophilic microbes in the environment and in bioleaching operations. These assays provide results within 2-3 hours, and can detect less than 100 individual microbial cells.

  12. Kinetic characteristics of continuous flow polymerase chain reaction chip: A numerical investigation

    Institute of Scientific and Technical Information of China (English)

    2010-01-01

    Continuous flow PCR (polymerase chain reaction) chip holds impressive advantages compared to micro chamber PCR chip. In order to have better understanding of kinetic characteristics of continuous flow PCR chip, a comprehensive mathematical model is presented in this paper, including melting, annealing and extension phases of a typical PCR process which has the essence of a convection-diffusion-reaction system. Using this model, we can simulate the PCR process in series of reaction cycles. Numerical results show that the average sample velocity plays a significant role in affecting the amplification efficiency. Also, appropriate combination of the PCR mixture is important for high-quality DNA amplification. Giving a large initial DNA concentration range, the continuous flow PCR scheme holds excellent real-time detection ability theoretically. The present numerical model bridges the temperature distribution to the real DNA amplification, and thereby is able to successfully predict continuous flow PCR properties which are important for the chip design.

  13. Single primer-mediated circular polymerase chain reaction for hairpin DNA cloning and plasmid editing.

    Science.gov (United States)

    Huang, Jiansheng; Khan, Inamullah; Liu, Rui; Yang, Yan; Zhu, Naishuo

    2016-05-01

    We developed and validated a universal polymerase chain reaction (PCR) method, single primer circular (SPC)-PCR, using single primer to simultaneously insert and amplify a short hairpin sequence into a vector with a high success rate. In this method, the hairpin structure is divided into two parts and fused into a vector by PCR. Then, a single primer is used to cyclize the chimera into a mature short hairpin RNA (shRNA) expression vector. It is not biased by loop length or palindromic structures. Six hairpin DNAs with short 4-nucleotide loops were successfully cloned. Moreover, SPC-PCR was also applied to plasmid editing within 3 h with a success rate higher than 95%.

  14. A simple multiplex polymerase chain reaction to determine ABO blood types of rhesus macaques (Macaca mulatta).

    Science.gov (United States)

    Premasuthan, A; Kanthaswamy, S; Satkoski, J; Smith, D G

    2011-06-01

    Rhesus macaques are the most common nonhuman primate model organism used in biomedical research. Their increasingly frequent use as subjects in studies involving transplantation requires that blood and other tissue antigens of donors and recipients be compatible. We report here an easy and rapid multiplex polymerase chain reaction (PCR) to determine the ABO blood group phenotypes of rhesus macaques that can be performed with only small amounts of DNA. We phenotyped 78 individuals and found this species to exhibit the A, B and AB phenotypes in frequencies that vary by geographic region. The probability of randomly pairing rhesus macaque donors and recipients that exhibit major ABO phenotype incompatibility is approximately 0.35 and 0.45 for Indian and Chinese rhesus macaques, respectively.

  15. Prevalence of Dirofilaria immitis infection in dogs from Celestun, Mexico, using polymerase chain reaction test.

    Science.gov (United States)

    Caro-Gonzalez, Johny Antonio; Bolio-Gonzalez, Manuel Emilio; Escobedo-Ortegón, Francisco Javier; Manrique-Saide, Pablo; Rodriguez-Vivas, Roger Ivan; Rodriguez-Buenfil, Jorge Carlos; Sauri-Arceo, Carlos Humberto

    2011-02-01

    The aim of this study was to determine the prevalence of Dirofilaria immitis in dogs and to analyze risk factors associated with infection at Celestun, a coastal locality in southeast Mexico. Blood samples were collected from 279 asymptomatic individuals between August 2007 and March 2008 and analyzed by polymerase chain reaction technique. The association between D. immitis infection and sex, age group, and distance of residence from a wetland of dogs was statistically analyzed. Prevalence of D. immitis infection was of 59.8%. Age of individuals (>2 years) was a risk factor for infection with D. immitis (odds ratio 2.49, confidence interval 1.47-4.23, p=0.001). In conclusion, Celestun can be considered a focus of D. immitis infection with high levels of transmission among the local dog population, as confirmed by the high prevalence reported and the association of age (dogs >2 years) as a risk associated with infection.

  16. Deletion Analysis Of The Duchenne/Becker Muscular Dystrophy Gene Using Multiplex Polymerase Chain Reaction

    Directory of Open Access Journals (Sweden)

    Dastur R

    2003-01-01

    Full Text Available The diagnosis of Duchenne Muscular Dystrophy (DMD and Becker Muscular Dystrophy (BMD is mainly based on clinical profile, serum CPK values, muscle biopsy and immunostaining for dystrophin. Most recent and accurate method for diagnosing DMD/BMD is by detection of mutations in the DMD gene. This was done in 100 unrelated patients using 19 exons including the promoter region in two sets of multiplex polymerase chain reaction (PCR. These primers amplify most of the exons in the deletion prone ′hotspot′ regions allowing determination of deletion end point. Intragenic deletions were detected in 74 patients indicating that the use of PCR-based assays will allow deletion detection help in prenatal diagnosis for most of the DMD/BMD patients. The frequency of deletions observed in the present study was 74%.

  17. Detection of Helicobactor pylori by polymerase chain reaction: A comparison in sample preparation

    Directory of Open Access Journals (Sweden)

    Murugesan R

    2005-01-01

    Full Text Available Gastric biopsy samples obtained from 14 patients with upper abdominal pain, clinically diagnosed as acid peptic disease, were analysed for the presence of Helicobacter pylori (H. pylori by Polymerase Chain Reaction (PCR using partially (template A and completely purified DNA (template B. Antigen specific primer was used to analyse the sample by PCR method. The presence of H. pylori in the samples was confirmed by running a positive control. The presence of H. pylori was also detected by urease method using standard protocol. Among the 14 samples studied, 8 showed the presence of H. pylori with both templates A and B. Among these 8 samples only 3 showed positive for the presence of H. pylori with urease method. The present work discusses the results obtained in the detection of H. pylori in template A and B by PCR method.

  18. Discrepancies between Antigen and Polymerase Chain Reaction Tests for the Detection of Rotavirus and Norovirus.

    Science.gov (United States)

    Kim, Hyun Soo; Kim, Jae-Seok

    2016-05-01

    We compared the results of an antigen test (ELISA) with those of polymerase chain reaction (PCR) for the detection of rotavirus and norovirus in stool specimens. Rotavirus and norovirus antigen-positive stool specimens were collected, and rotavirus and norovirus PCRs were performed on these specimens. Of the 325 rotavirus antigen-positive specimens, 200 were positive for both assays and 125 were PCR negative. Of 286 norovirus antigen-positive specimens, 51 were PCR negative. Comparison of the lower limit of detection showed that rotavirus PCR was 16 times more sensitive and norovirus PCR was over 4,000 times more sensitive than the ELISA. Discrepant results between ELISA and PCR were common, and the possibility of false-positive and false-negative results should be considered with rotavirus and norovirus assays.

  19. Detection of gonorrhea among HIV infected patients by polymerase chain reaction

    Directory of Open Access Journals (Sweden)

    Pragya Poudel

    2015-07-01

    Full Text Available Objective: To determine the burden of gonorrhea among HIV patients using PCR technique. Methods: A cross sectional study was carried out in a HIV clinic of Sparsha Nepal from January to March, 2011. Standard microbiological procedures were followed during collection and processing of urine samples. DNA amplification, isolation and detection were carried out. Gonorrhoea diagnosis was done by multiplex polymerase chain reaction. Results: Among the 119 HIV positive patients, 12 (10.08% were positive for N. gonorrheae. The cases were more among the males than in females. The age of patients ranged from 20- 45 years and the highest prevalence was among the age group 20-35 years. The distribution of gonorrhea infected patients according to marital status revealed that 8 cases were among the married patients. Conclusions: This study revealed that the incidence of gonorrhoea was higher in males and in married people. So, the control measures should be targeted to these groups of people.

  20. Polymerase chain reaction of Porphyromonas gingivalis, Treponema denticola, and Tannerella forsythia in primary endodontic infections.

    Science.gov (United States)

    Gomes, Brenda P F A; Montagner, Francisco; Jacinto, Rogério Castilho; Zaia, Alexandre A; Ferraz, Caio Cezar Randi; Souza-Filho, Francisco J

    2007-09-01

    The aim of this study was to investigate the correlation between endodontic clinical signs and symptoms and the presence of Porphyromonas gingivalis, Treponema denticola, and Tannerella forsythia or their association by nested polymerase chain reaction assay. Microbial samples were taken from 50 cases with necrotic pulp tissues in primary infections. DNA was extracted from the samples, which were analyzed for the presence of three endodontic pathogens by using species-specific primers. P gingivalis, T denticola, and T forsythia were detected in 46%, 38%, and 22% of the symptomatic cases, respectively. The bacterial complex composed by T forsythia, P gingivalis, and T denticola was found in 14% of the cases with spontaneous pain, tenderness to percussion, swelling, and pain on palpation. The high prevalence of P gingivalis, T denticola, and T forsythia in the samples examined suggests that these bacteria are related to the etiology of symptomatic periradicular diseases.

  1. DETECTION OF PATHOGENS CAUSING GENITAL ULCER DISEASE BY MULTIPLEX POLYMERASE CHAIN REACTION

    Institute of Scientific and Technical Information of China (English)

    Ai-ying Liu; Ming-jun Jiang; Yue-ping Yin; Jiang-fang Sun

    2005-01-01

    Objective To establish a multiplex polymerase chain reaction (M-PCR) assay for simultaneous detection of pathogens causing genital ulcer disease (GUD).Methods Based on the gene-specific region of the following pathogens: Chlamydia trachomatis ompl/ompb, herpes simplex virus (HSV) DNA polymerase, Treponema pallidum tpp47, Haemophilus ducreyi 16s rRNA, four sets of primers were designed and an M-PCR assay was developed to detect four pathogens in one test. The assay was evaluated with diagnostic result of golden standard for each pathogen.Results Of the 51 clinical samples, M-PCR showed slightly higher positive rate (47.1%) of HSV than cell culture (23.6%).Meanwhile, the positive rate of T. p allidum detected by M-PCR and dark-field microscopy was 19.6% ( 10/51) and 15.7% (8/51),respectively. Only one sample was positive for H. ducreyiand no sample was positive for C. trachomatis detected by both M-PCR assay and culture.Conclusion This primary study indicated that M-PCR assay can simultaneously and rapidly detect the four etiologic pathogens causing GUD.

  2. Effect of surface functionalisation on the interaction of iron oxide nanoparticles with polymerase chain reaction.

    Science.gov (United States)

    Aysan, Ayse Beyza; Knejzlík, Zdeněk; Ulbrich, Pavel; Šoltys, Marek; Zadražil, Aleš; Štěpánek, František

    2017-05-01

    The combination of nanoparticles with the polymerase chain reaction (PCR) can have benefits such as easier sample handling or higher sensitivity, but also drawbacks such as loss of colloidal stability or inhibition of the PCR. The present work systematically investigates the interaction of magnetic iron oxide nanoparticles (MIONs) with the PCR in terms of colloidal stability and potential PCR inhibition due to interaction between the PCR components and the nanoparticle surface. Several types of MIONs with and without surface functionalisation by sodium citrate, dextran and 3-aminopropyl-triethoxysilane (APTES) were prepared and characterised by Transmission Electron Microscopy (TEM), dynamic light scattering (DLS) and Fourier Transform Infrared (FT-IR) spectroscopy. Colloidal stability in the presence of the PCR components was investigated both at room temperature and under PCR thermo-cycling. Dextran-stabilized MIONs show the best colloidal stability in the PCR mix at both room and elevated temperatures. Citrate- and APTES-stabilised as well as uncoated MIONs show a comparable PCR inhibition near the concentration 0.1mgml(-1) while the inhibition of dextran stabilized MIONs became apparent near 0.5mgml(-1). It was demonstrated that the PCR could be effectively carried out even in the presence of elevated concentration of MIONs up to 2mgml(-1) by choosing the right coating approach and supplementing the reaction mix by critical components, Taq DNA polymerase and Mg(2+) ions. Copyright © 2017 Elsevier B.V. All rights reserved.

  3. Gene synthesis by integrated polymerase chain assembly and PCR amplification using a high-speed thermocycler

    Science.gov (United States)

    TerMaat, Joel R.; Pienaar, Elsje; Whitney, Scott E.; Mamedov, Tarlan G.; Subramanian, Anuradha

    2013-01-01

    Polymerase chain assembly (PCA) is a technique used to synthesize genes ranging from a few hundred base pairs to many kilobase pairs in length. In traditional PCA, equimolar concentrations of single stranded DNA oligonucleotides are repeatedly hybridized and extended by a polymerase enzyme into longer dsDNA constructs, with relatively few full-length sequences being assembled. Thus, traditional PCA is followed by a second primer-mediated PCR reaction to amplify the desired full-length sequence to useful, detectable quantities. Integration of assembly and primer-mediated amplification steps into a single reaction using a high-speed thermocycler is shown to produce similar results. For the integrated technique, the effects of oligo concentration, primer concentration, and number of oligonucleotides are explored. The technique is successfully demonstrated for the synthesis of two genes encoding EPCR-1 (653 bp) and pUC19 β-lactamase (929 bp) in under 20 min. However, rapid integrated PCA–PCR was found to be problematic when attempted with the TM-1 gene (1509 bp). Partial oligonucleotide sets of TM-1 could be assembled and amplified simultaneously, indicating that the technique may be limited to a maximum number of oligonucleotides due to competitive annealing and competition for primers. PMID:19799938

  4. Quantitative Model for Supply Chain Visibility: Process Capability Perspective

    Directory of Open Access Journals (Sweden)

    Youngsu Lee

    2016-01-01

    Full Text Available Currently, the intensity of enterprise competition has increased as a result of a greater diversity of customer needs as well as the persistence of a long-term recession. The results of competition are becoming severe enough to determine the survival of company. To survive global competition, each firm must focus on achieving innovation excellence and operational excellence as core competency for sustainable competitive advantage. Supply chain management is now regarded as one of the most effective innovation initiatives to achieve operational excellence, and its importance has become ever more apparent. However, few companies effectively manage their supply chains, and the greatest difficulty is in achieving supply chain visibility. Many companies still suffer from a lack of visibility, and in spite of extensive research and the availability of modern technologies, the concepts and quantification methods to increase supply chain visibility are still ambiguous. Based on the extant researches in supply chain visibility, this study proposes an extended visibility concept focusing on a process capability perspective and suggests a more quantitative model using Z score in Six Sigma methodology to evaluate and improve the level of supply chain visibility.

  5. Detection of PERV by polymerase chain reaction and its safety in bioartificial liver support system

    Institute of Scientific and Technical Information of China (English)

    Hai-Hui Wang; Ying-Jie Wang; Hong-Ling Liu; Jun Liu; Yan-Ping Huang; Hai-Tao Guo; Yu-Ming Wang

    2006-01-01

    AIM: To establish a method detecting porcine endogenous retrovirus (PERV) in China experimental minipigs and to evaluate the safety of PERV in three individuals treated with bioartificial liver support systems based on porcine hepatocytes.METHODS: Porcine hepatocytes were isolated with two-stage perfusion method, then cultured in the bioreactor, which is separated by a semipermeable membrane (0.2μm) from the lumen through which the patients' blood plasma was circulated. After post-hemoperfusion, patients' blood was obtained for screening. Additionally, samples of medium collected from both intraluminal and extraluminal compartments of the laboratory bioreactor and culture supernate in vitro was analyzed. The presence of viral sequences was estimated by polymerase chain reaction (PCR) and reverse transcriptase-polymerase chain reaction (RT-PCR). Finally, the infection of virus in the supernate of common culture was ascertained by exposure to the fetal liver cells.RESULTS: PERV-specific gag sequences were found in the porcine hepatocytes using RT-PCR. and were detected in all samples from the intraluminal,extraluminal samples and culture supernate. However,culture supernatant from primary porcine hepatocytes (cleared of cellular debris) failed to infect human fetal liver cells. Finally, RT-PCR detected no PERV infection was found in the blood samples obtained from three patients at various times post-hemoperfusion.CONCLUSION: The assays used are specific and sensitive, identified by second PCR. PERVs could be released from hepatocytes cultured in bioreactor without the stimulation of mitogen and could not be prevented by the hollow fiber semipermeable membrane, indicating the existence of PERV safety in extracorporeal bioartificial liver support system (EBLSS).

  6. Diagnosis of human herpes virus 1 and 2 (HHV-1 and HHV-2): use of a synthetic standard curve for absolute quantification by real time polymerase chain reaction.

    Science.gov (United States)

    Lima, Lyana Rodrigues Pinto; Silva, Amanda Perse da; Schmidt-Chanasit, Jonas; Paula, Vanessa Salete de

    2017-03-01

    The use of quantitative real time polymerase chain reaction (qPCR) for herpesvirus detection has improved the sensitivity and specificity of diagnosis, as it is able to detect shedding episodes in the absence of clinical lesions and diagnose clinical specimens that have low viral loads. With an aim to improve the detection and quantification of herpesvirus by qPCR, synthetic standard curves for human herpesvirus 1 and 2 (HHV-1 and HHV-2) targeting regions gD and gG, respectively, were designed and evaluated. The results show that synthetic curves can replace DNA standard curves in diagnostic herpes qPCR.

  7. Porcine reproductive and respiratory syndrome virus: Interlaboratory ring trial to evaluate real-time reverse transcription polymerase chain reaction detection methods

    DEFF Research Database (Denmark)

    Wernike, Kerstin; Bonilauri, Paolo; Dauber, Malte

    2012-01-01

    To compare the real-time reverse transcription quantitative polymerase chain reaction (RT-qPCR) assays used for the diagnosis of Porcine reproductive and respiratory syndrome virus (PRRSV), a Europe-wide interlaboratory ring trial was conducted. A variety of PRRSV strains including North American...... (NA) and European (EU) genotype isolates were analyzed by the participants. Great differences regarding qualitative diagnostics as well as analytical sensitivity were observed between the individual RT-qPCR systems, especially when investigating strains from the EU genotype. None of the assays...

  8. Diagnosis of human herpes virus 1 and 2 (HHV-1 and HHV-2): use of a synthetic standard curve for absolute quantification by real time polymerase chain reaction

    Science.gov (United States)

    Lima, Lyana Rodrigues Pinto; da Silva, Amanda Perse; Schmidt-Chanasit, Jonas; de Paula, Vanessa Salete

    2017-01-01

    The use of quantitative real time polymerase chain reaction (qPCR) for herpesvirus detection has improved the sensitivity and specificity of diagnosis, as it is able to detect shedding episodes in the absence of clinical lesions and diagnose clinical specimens that have low viral loads. With an aim to improve the detection and quantification of herpesvirus by qPCR, synthetic standard curves for human herpesvirus 1 and 2 (HHV-1 and HHV-2) targeting regions gD and gG, respectively, were designed and evaluated. The results show that synthetic curves can replace DNA standard curves in diagnostic herpes qPCR. PMID:28225902

  9. Polymerase chain reaction in diagnosis of Borrelia burgdorferi infections and studies on taxonomic classification

    DEFF Research Database (Denmark)

    Lebech, Anne-Mette

    2002-01-01

    not regarded as a suitable sample source for B. burgdorferi PCR. The reason may be the variable presence of Taq polymerase inhibitors. Based on a semi-quantitative detection system for amplicons, reflecting the input amount of specific DNA and thus the density of spirochetes in the clinical samples high...... a PCR assay for direct detection of B. burgdorferi DNA and to evaluate the diagnostic utility of PCR in clinical specimens from patients with Lyme borreliosis and (ii) to study the taxonomic classification of B. burgdorferi isolates and its implications for epidemiology and clinical presentation...... between ongoing and past infection. Due to the extreme paucity of spirochetes in clinical specimens neither in vitro culture nor antigen detection had yielded a sufficient diagnostic sensitivity. Thus the recently introduced highly sensitive PCR methodology could be a solution and was thus studied. Assays...

  10. 多重荧光定量PCR方法的建立及其在快速产前诊断中的应用%Establishment of multiple quantitative fluorescent polymerase chain reaction assay and its application in rapid prenatal diagnosis of common chromosome aneuploidies

    Institute of Scientific and Technical Information of China (English)

    徐爱群; 边旭明; 刘俊涛; 姚凤霞; 张为民; 郝娜; 周京

    2010-01-01

    术能成功用于常见非整倍体异常的快速产前诊断,检测结果准确,适合于规模较大的产前诊断中心进行大样本检测.%Objective To establish the multiple quantitative fluorescent polymerase chain reaction (QF-PCR)assay and evaluate its clinical application in prenatal diagnosis.Methods Totally 170 samples Were collected between May 2008 and July 2009 in prenatal center of Peking Union Medical College Hospital:123 of them were amniotic fluid,9 were chofionic villous samples,20 were fetal blood and 18 were villi from aborted fetuses.All samples were from women of Han nationality,with mean age of (34.1±4.6) years old,and with mean gestational age of(19.6±1.0)weeks.Cytogenetic cultures and karyotyping were made to every sample.Genomic DNA wag extracted from the samples.The sequences of twenty short tandem repeat (STR) markers were designed according to the GenBank and references,including 6 STR markers in chromosome 21.4 in chromosome 18.4 in chromosome 13,4 in chromosome X,1 in chromosome Y and 1 universal marker in both X and Y chromosome.Each sample was amplified by two sets of multiple QF-PCR,which included 4 STR markers in each of 21,18,13 and sex chromosomes. If the result was uninformative,the third set of anotherd 4 STR markers was added. Results ( 1 ) Karyotyping. Cytogenetic analysis were made for all the 170 samples, 151 (89%) of which were normal, and 19 (11% ) were abnormal (2)QF-PCR assay. 167(98% ) samples were detected by QF-PCR. The results were obtained within 2 -3 days after sampling. 134 samples were proved normal by QF-PCR, which was consistent with karyotyping. Among the 19 abnormal karyotype samples, 18 were detected as abnormal( eight were 21-trisomy, three were 18-trisomy)by QF-PCR. Among the 167 samples, 150(90% ) were detected using the first and second set of STR mixtures, and 3(2% ) were detected when the third set of STR was added. The remain 14(8% ) were uninformative. (3) The diagnostic efficiency of QF

  11. A study of Hodgkin/Reed-Sternberg cells using single cell polymerase chain reaction.

    Science.gov (United States)

    Deng, F; Liao, L; Lü, G; Li, G; Yang, G

    2000-01-01

    To investigate the characteristics of Hodgkin/Reed-Stemberg (H/R-S) cells found in patients with various types of Hodgkin's disease (HD). H/R-S cells were micropicked from frozen sections of tissues affected by HD. The DNA from these cells was amplified by polymerase chain reaction (PCR) using immunoglobulin heavy chain gene FR III a/JH primers and light chain gene family-specific primers. A total of 52/135 (35.8%) isolated cells showed the specific products in the reactions. IgH and V kappa 4 rearrangements were repeatedly found in many cells from a lymphocyte predominance type sample; repeated V kappa 4 and individual IgH/V kappa 2,4 rearrangements and individual IgH, V lambda 3/ V kappa 4 rearrangements were found in two different cases of the nodular sclerosis type; repeated IgH/ V lambda 3 and individual V lambda 2,4 rearrangements, repeated V kappa 2,4 rearrangements, repeated V kappa 4 and individual IgH/ V kappa 3 rearrangements, repeated IgH and individual V kappa 3/ V lambda 4 rearrangements were detected in 3 cases of the mixed cellularity type. Repeated and individual IgH rearrangements were found in other 2 cases. The H/R-S cells isolated from the lymphocyte predominance subtypes of HD have IgH and V lambda 4 gene rearrangements. This suggests that the lymphocyte predominance type is a proliferation of neoplastic B cells. The cells isolated from the mixed cellularity and nodular sclerosis types derive from B lineage cells at various stages of differentiation because of the presence of their IgH, kappa and/or lambda gene rearrangements. To our knowledge, this is the first time that the lambda gene rearrangement was detected in H/R-S cells.

  12. Single nucleotide polymorphisms in the ovine casein genes detected by polymerase chain reaction-single strand conformation polymorphism.

    Science.gov (United States)

    Ceriotti, G; Chessa, S; Bolla, P; Budelli, E; Bianchi, L; Duranti, E; Caroli, A

    2004-08-01

    Casein genetic polymorphisms are important and well known due to their effects on quantitative traits and technological properties of milk. At the DNA level, polymerase chain reaction (PCR)-single-strand conformation polymorphism (SSCP) allows for the simultaneous typing of several alleles at casein loci, as well as the detection of unknown polymorphisms. Here we describe the usefulness of the PCR-SSCP technique for casein typing in sheep. In particular, three single-nucleotide polymorphisms (SNP) are described at CSN1S1, CSN2, and CSN3, all resulting in amino acid exchanges. At CSN1S1, a transition T-->C was found, resulting in the deduced amino acid exchange Ile186-->Thr186. A transition A-->G resulting in the deduced amino acid exchange Met183-->Val183 was identified at CSN2. The 2 SNP showed a rather high frequency (ranging from 0.12 to 0.26) in 3 Italian breeds (Sarda, Comisana, Sopravissana). Another transition C-->T (Ser104-->Leu104) was found at CSN3 in one heterozygous animal.

  13. Early detection of Toxoplasma gondii by real-time polymerase chain reaction methods in patients with recurrent spontaneous abortions

    Directory of Open Access Journals (Sweden)

    Parviz Saleh

    2014-11-01

    Full Text Available Introduction: One of the causes of recurrent spontaneous abortions (RSA is an infection by the toxoplasmosis Protozoa. In comparison, we present detailed results using real-time polymerase chain reaction (PCR methods of detection. In this study, it was tried to detect Toxoplasma gondii (T. gondii by real-time PCR methods in patients with RSA. Methods: Amniotic fluid sampling was performed in the 16-20th weeks of gestation in 50 pregnant women with a history of RSA. The extracted deoxyribonucleic acid (DNA samples were analyzed using quantitative real-time PCR. Results: In all the cases, the detection of T. gondii was negative in the peripheral blood, and amniotic fluid samples by using the molecular methods (real-time PCR. Using the serological detection methods, 6% of patients were diagnosed as positive for the immunoglobulin M (IgM antibody. In addition, the IgG antibody was positive in 46% of the patients. Conclusion: It can be concluded that the serological methods lack specificity.

  14. Exogenous reference gene normalization for real-time reverse transcription-polymerase chain reaction analysis under dynamic endogenous transcription

    Institute of Scientific and Technical Information of China (English)

    Stephen Johnston; Zachary Gallaher; Krzysztof Czaja

    2012-01-01

    Quantitative real-time reverse transcription-polymerase chain reaction (qPCR) is widely used to investigate transcriptional changes following experimental manipulations to the nervous system. Despite the widespread utilization of qPCR, the interpretation of results is marred by the lack of a suitable reference gene due to the dynamic nature of endogenous transcription. To address this inherent deficiency, we investigated the use of an exogenous spike-in mRNA, luciferase, as an internal reference gene for the 2-ΔΔCt normalization method. To induce dynamic transcription, we systemically administered capsaicin, a neurotoxin selective for C-type sensory neurons expressing the TRPV-1 receptor, to adult male Sprague-Dawley rats. We later isolated nodose ganglia for qPCR analysis with the reference being either exogenous luciferase mRNA or the commonly used endogenous reference β-III tubulin. The exogenous luciferase mRNA reference clearly demonstrated the dynamic expression of the endogenous reference. Furthermore, variability of the endogenous reference would lead to misinterpretation of other genes of interest. In conclusion, traditional reference genes are often unstable under physiologically normal situations, and certainly unstable following the damage to the nervous system. The use of exogenous spike-in reference provides a consistent and easily implemented alternative for the analysis of qPCR data.

  15. [Adaptation of a sensitive DNA extraction method for detection of Entamoeba histolytica by real-time polymerase chain reaction].

    Science.gov (United States)

    Pınar, Ahmet; Akyön, Yakut; Alp, Alpaslan; Ergüven, Sibel

    2010-07-01

    This study was aimed to adapt a sensitive DNA extraction protocol in stool samples for real-time polymerase chain reaction (PCR) detection of Entamoeba histolytica which causes important morbidity and mortality worldwide. Stool extraction is a problematic step and has direct effects on PCR sensitivity. In order to improve the sensitivity of E.histolytica detection by real-time PCR, "QIAamp DNA stool minikit (Qiagen, Germany)" was modified by adding an overnight incubation step with proteinase K and sodium dodecyl sulfate (SDS) in this study. Three different extraction methods [(1) original method, (2) cetyltrimethyl-ammonium bromide (CTAB) method, (3) modified method] were evaluated for effects on sensitivity in real-time quantitative PCR (Artus RealArt TM E.histolytica RG PCR Kit, Qiagen Diagnostics, Germany). For this purpose, several concentrations of standard E.histolytica DNA were spiked in parasite-free stool samples and three different extraction protocols were performed. Detection sensitivities of "QIAamp DNA stool minikit" was found 5000 copies/ml and of CTAB method was found 500 copies/ml. Detection sensitivity of the extraction was improved to 5 copies/mL by modified "QIAamp DNA stool minikit" protocol. Since detection sensitivities of nucleic acid extraction protocols from stool samples directly affect the sensitivity of PCR amplification, different extraction protocols for different microorganisms should be evaluated.

  16. A Simple Reverse Transcription-Polymerase Chain Reaction for Dengue Type 2 Virus Identification

    Directory of Open Access Journals (Sweden)

    Figueiredo Luiz Tadeu M

    1997-01-01

    Full Text Available We show here a simplified reverse transcription-polymerase chain reaction (RT-PCR for identification of dengue type 2 virus. Three dengue type 2 virus strains, isolated from Brazilian patients, and yellow fever vaccine 17DD, as a negative control, were used in this study. C6/36 cells were infected with the virus, and tissue culture fluids were collected after 7 days of infection period. The RT-PCR, a combination of RT and PCR done after a single addition of reagents in a single reaction vessel was carried out following a digestion of virus with 1% Nonidet P-40. The 50ml assay reaction mixture included 50 pmol of a dengue type 2 specific primer pair amplifying a 210 base pair sequence of the envelope protein gene, 0.1 mM of the four deoxynucleoside triphosphates, 7.5U of reverse transcriptase, and 1U of thermostable Taq DNA polymerase. The reagent mixture was incubated for 15 min at 37oC for RT followed by a variable amount of cycles of two-step PCR amplification (92oC for 60 sec, 53oC for 60 sec with slow temperature increment. The PCR products were subjected to 1.7% agarose gel electrophoresis and visualized with UV light after gel incubation in ethidium bromide solution. DNA bands were observed after 25 and 30 cycles of PCR. Virus amount as low as 102.8 TCID50/ml was detected by RT-PCR. Specific DNA amplification was observed with the three dengue type 2 strains. This assay has advantages compared to other RT-PCRs: it avoids laborious extraction of virus RNA; the combination of RT and PCR reduces assay time, facilitates the performance and reduces risk of contamination; the two-step PCR cycle produces a clear DNA amplification, saves assay time and simplifies the technique

  17. Impact of Fungicide Residues on Polymerase Chain Reaction and on Yeast Metabolism

    Directory of Open Access Journals (Sweden)

    Gildo Almeida da Silva

    Full Text Available ABSTRACT The indiscriminate use of pesticides on grape crops is harmful for consumers´ healthin “in natura” consumption and in the ingestion of wine and grape juice. During winemaking, a rapid and efficient fermentation stage is critical to avoid proliferation of contaminating microorganisms and to guarantee the product´s quality. Polymerase chain reaction (PCR has the advantage of detecting these contaminants in the early stages of fermentation. However,this enzymatic reaction may also be susceptible to specific problems, reducing its efficiency. Agricultural practices, such as fungicide treatments, may be a source of PCR inhibiting factors and may also interfere in the normal course of fermentation.The action of the pesticides captan and folpet on PCR and on yeast metabolism was evaluated, once these phthalimide compounds are widely employed in Brazilian vineyards. DNA amplification was only observed at 75 and 37.5 µg/mL of captan concentrations, whereas with folpet, amplification was observed only in the two lowest concentrations tested (42.2 and 21.1µg/mL.Besides the strong inhibition on Taq polymerase activity, phthalimides also inhibited yeast metabolism at all concentrations analyzed.Grape must containing captan and folpet residues could not be transformed into wine due to stuck fermentation caused by the inhibition of yeast metabolism. Non-compliance with the waiting period for phthalimide fungicides may result in financial liabilities to the viticulture sector.The use of yeasts with high fungicide sensitivity should be selected for must fermentation as a strategy for sustainable wine production and to assure that products comply with health and food safety standards.

  18. National Department of Defense Surveillance for Invasive Streptococcus Pneumoniae: Antibiotic Resistance, Serotype Distribution, and Arbitrarily Primed Polymerase Chain Reaction Analyses

    Science.gov (United States)

    2008-02-15

    penicillin -susceptible and peni- cillin-resistant Streptococcnspneuttmoniae serotypes in Canada. J Infect Dis Streptococcus pneumoniae Surveillance Group...Gray for the Streptococcus pneumonia Surveillance Group Report No. 00-44 Approved for public release; distribution unlimited. NAVAL HEALTH RESEARCH...Defense Surveillance for Invasive Streptococcus pneumoniae : Antibiotic Resistance, Serotype Distribution, and Arbitrarily Primed Polymerase Chain

  19. Evaluation of Amplification Targets for the Specific Detection of Bordetella pertussis Using Real-Time Polymerase Chain Reaction

    Directory of Open Access Journals (Sweden)

    Mohammad Rubayet Hasan

    2014-01-01

    Full Text Available BACKGROUND: Bordetella pertussis infections continue to be a major public health challenge in Canada. Polymerase chain reaction (PCR assays to detect B pertussis are typically based on the multicopy insertion sequence IS481, which offers high sensitivity but lacks species specificity.

  20. Polymerase Chain Reaction (PCR)-based methods for detection and identification of mycotoxigenic Penicillium species using conserved genes

    Science.gov (United States)

    Polymerase chain reaction amplification of conserved genes and sequence analysis provides a very powerful tool for the identification of toxigenic as well as non-toxigenic Penicillium species. Sequences are obtained by amplification of the gene fragment, sequencing via capillary electrophoresis of d...

  1. Polymerase Chain Reaction in the Diagnosis of Visceral Leishmaniasis Recurrence in the Setting of Negative Splenic Smears.

    Science.gov (United States)

    Hasnain, Golam; Basher, Ariful; Nath, Proggananda; Ghosh, Prakash; Hossain, Faria; Hossain, Shakhawat; Mondal, Dinesh

    2016-01-01

    This report presents two cases of visceral leishmaniasis (VL) recurrence where the microscopy of the splenic smear failed in diagnosis. However, a strong clinical suspicion compelled further evaluation by polymerase chain reaction (PCR), which validated the etiology. This short report highlights the usefulness of PCR in diagnosing cases of suspected smear-negative VL recurrence.

  2. An In Vitro Model for Studying Neutrophil Activation During Cardiopulmonary Bypass by Using a Polymerase Chain Reaction Thermocycler

    NARCIS (Netherlands)

    Tang, Min; Zhao, Xiao-Gang; Gu, Y. John; Chen, Chang-Zhi

    2010-01-01

    The accurate temperature control of a polymerase chain reaction (PCR) thermocycler was exploited in developing an in vitro model to study neutrophil activation during cardiopulmonary bypass. Neutrophils from 12 volunteers underwent temperature changes in a PCR thermocycler (37 degrees C for 30 minut

  3. Diagnosis of ventricular drainage-related bacterial meningitis by broad-range real-time polymerase chain reaction

    DEFF Research Database (Denmark)

    Deutch, Susanna; Dahlberg, Daniel; Hedegaard, Jesper;

    2007-01-01

    OBJECTIVE: To compare a broad-range real-time polymerase chain reaction (PCR) diagnostic strategy with culture to evaluate additional effects on the etiological diagnosis and the quantification of the bacterial load during the course of ventricular drainage-related bacterial meningitis (VR...

  4. Detection of human immunodeficiency virus DNA in cultured human glial cells by means of the polymerase chain reaction

    DEFF Research Database (Denmark)

    Teglbjaerg, L L; Hansen, J E; Dalbøge, H;

    1991-01-01

    This report describes the use of the polymerase chain reaction (PCR) for the detection of viral genomic sequences in latently infected cells. Infection with human immunodeficiency virus in cultures of human glial cells was demonstrated, using nucleic acid amplification followed by dot blot...

  5. Polymerase chain reaction (PCR)-based typing analysis of atypical isolates of the fish pathogen Aeromonas salmonicida

    DEFF Research Database (Denmark)

    Høie, S.; Dalsgaard, Inger; Aase, I.L.;

    1999-01-01

    Two hundred and five isolates of atypical Aeromonas salmonicida, recovered from a wide range of hosts and countries were characterized by polymerase chain reaction (PCR) targeting four genes. The chosen genes were those encoding the extracellular A-layer protein (AP), the serine protease (Sprot...

  6. Amplification of Chloroplast DNA Using the Polymerase Chain Reaction (PCR): A Practical Activity for Secondary School Students

    Science.gov (United States)

    Hamilton, Kenny; Barfoot, Jan; Crawford, Kathleen E.; Simpson, Craig G.; Beaumont, Paul C.; Bownes, Mary

    2006-01-01

    We describe a polymerase chain reaction (PCR) protocol suitable for use in secondary schools and colleges. This PCR protocol can be used to investigate genetic variation between plants. The protocol makes use of primers which are complementary to sequences of nucleotides that are highly conserved across different plant genera. The regions of…

  7. [THE HIGHLY EFFECTIVE DETECTION OF DNA RICKETTSIA USING TECHNIQUE OF POLYMERASE CHAIN REACTION IN REAL-TIME].

    Science.gov (United States)

    Kartashov, M Yu; Mikryukova, T P; Ternovoi, V A; Moskvitina, N S; Loktev, V B

    2015-12-01

    The article considers development of highly effective technique of detection of genetic material of ricketsia based on polymerase chain reaction in real-time using original primers to the most conservative sites of gene of citrate synthase (gItA). The analytical sensitivity of the developed polymerase chain reaction in real-time test permits to detect from 80 genome equivalents in analyzed sample during three hours. The high specificity of test-system is substantiated by detection of nucleotide sequences of amplificated fragments of gene gltA. The approbation ofthe polymerase chain reaction in real-time test is carried out on collection of 310 ticks of species I. persulcatus, I. pavlovskyi, D. reticulatus. It is demonstrated that the developed alternate ofprimers and probe permits with high degree of sensitivity and specifcity to detect DNA of different species of ricketsia widespread on territory of Russia (R. sibirica, R. raoultii, R. helvetica, R. tarasevichiae). The proposed polymerase chain reaction in real-time test can be appliedfor isolation of fragment of gene gltA with purpose for detecting nucleotide sequence and subsequent genetic typing of ricketsia. The application ofthe proposed technique can facilitate task of monitoring hot spots of ricketsiosis.

  8. Development, validation, and standardization of polymerase chain reaction-based detection of E-coli O157

    DEFF Research Database (Denmark)

    Abdulmawjood, A.; Bulte, M.; Roth, S.

    2004-01-01

    A diagnostic polymerase chain reaction assay was developed for the detection of E. coli O157 as the first part of a multicenter validation and standardization project. The assay is based on amplification of sequences of the rfbE O157 gene and includes an internal amplification control. The select...

  9. An In Vitro Model for Studying Neutrophil Activation During Cardiopulmonary Bypass by Using a Polymerase Chain Reaction Thermocycler

    NARCIS (Netherlands)

    Tang, Min; Zhao, Xiao-Gang; Gu, Y. John; Chen, Chang-Zhi

    The accurate temperature control of a polymerase chain reaction (PCR) thermocycler was exploited in developing an in vitro model to study neutrophil activation during cardiopulmonary bypass. Neutrophils from 12 volunteers underwent temperature changes in a PCR thermocycler (37 degrees C for 30

  10. Amplification of Chloroplast DNA Using the Polymerase Chain Reaction (PCR): A Practical Activity for Secondary School Students

    Science.gov (United States)

    Hamilton, Kenny; Barfoot, Jan; Crawford, Kathleen E.; Simpson, Craig G.; Beaumont, Paul C.; Bownes, Mary

    2006-01-01

    We describe a polymerase chain reaction (PCR) protocol suitable for use in secondary schools and colleges. This PCR protocol can be used to investigate genetic variation between plants. The protocol makes use of primers which are complementary to sequences of nucleotides that are highly conserved across different plant genera. The regions of…

  11. Whole Blood Polymerase Chain Reaction in a Neonate with Disseminated Herpes Simplex Virus Infection and Liver Failure

    Directory of Open Access Journals (Sweden)

    Jennifer A. Scoble

    2013-10-01

    Full Text Available A late preterm neonate born by cesarean section with intact membranes presented at 9 days of life with shock and liver failure. Surface cultures were negative but whole blood polymerase chain reaction was positive for herpes simplex virus type 2, underscoring the value of this test in early diagnosis of perinatally acquired disseminated herpes simplex virus infection without skin lesions.

  12. A mutation specific polymerase chain reaction for detecting hepatitis B virus genome mutations at nt551

    Institute of Scientific and Technical Information of China (English)

    Chun-Ling Ma; De-Xing Fang; Hua-Biao Chen; Fa-Qing Li; Hui-Ying Jin; Su-Qin Li; Wei-Guo Tan

    2003-01-01

    AIM: The hepatitis B surface antigen (HBsAg) is considered to be one of the best markers for the diagnosis of acute and chronic HBV infection. But in some patients, this antigen cannot be detected by routine serological assays despite the presence of virus. One of the most important explanations for the lack of detectable HBsAg is that mutations which occur within the "a" determinant of HBV S gene can alter expression of HBsAg and lead to changes of antigenicity and immunogenicity of HBsAg accordingly. As a result, these mutants cannot be detected by diagnosis assays. Thus, it is essential to find out specific and sensitive methods to test the new mutants and further investigate their distribution. This study is to establish a method to investigate the distribution of the HBsAg mutant at nt551.METHODS: A mutation specific polymerase chain reaction (msPCR) was established for amplifying HBV DNA with a mutation at nt551. Four sets of primer pairs, P551A-PPS,P551G-PPS, P551C-PPS and P551T-PPS, with the same sequences except for one base at 3' terminus were designed and synthesized according to the known HBV genome sequences and the popular HBV subtypes, adr and adw, in China. At the basis of regular PCR method, we explored the specific conditions for amplifying HBV DNAs with a mutation at nt551 by regulating annealing temperature and the concentration of these primers. 126 serum samples from patients of hepatitis B were collected, among which 16 were positive for HBV S DNA in the nested PCR amplification. These 16 HBV S DNAs were detected by using the msPCR method.RESULTS: When the annealing temperature was raised to 71 °C, nt551A and nt551G were amplified specifically by P551A-PPS and P551G-PPS; At 72 °C and 5 pmole of the primers (each) in reaction of 25 μl volume, nt551C and nt551T were amplified specifically by P551C-PPS and P551TPPS. 16 of HBV S gene fragments were characterized by using this method. 14 of them were positive for nt551A, one was positive for nt

  13. Quantitative Methods in Supply Chain Management Models and Algorithms

    CERN Document Server

    Christou, Ioannis T

    2012-01-01

    Quantitative Methods in Supply Chain Management presents some of the most important methods and tools available for modeling and solving problems arising in the context of supply chain management. In the context of this book, “solving problems” usually means designing efficient algorithms for obtaining high-quality solutions. The first chapter is an extensive optimization review covering continuous unconstrained and constrained linear and nonlinear optimization algorithms, as well as dynamic programming and discrete optimization exact methods and heuristics. The second chapter presents time-series forecasting methods together with prediction market techniques for demand forecasting of new products and services. The third chapter details models and algorithms for planning and scheduling with an emphasis on production planning and personnel scheduling. The fourth chapter presents deterministic and stochastic models for inventory control with a detailed analysis on periodic review systems and algorithmic dev...

  14. Accuracy of the serological ELISA test compared with the polymerase chain reaction for the diagnosis of cytomegalovirus infection in pregnancy

    Directory of Open Access Journals (Sweden)

    Silvana Varella Parmigiani

    Full Text Available CONTEXT: The most frequently used methods for detecting antibodies are the indirect immunofluorescence test and the enzymatic immunoassay (ELISA. The polymerase chain reaction is a molecular biology technique in which the production of large amounts of specific DNA fragments is induced from very low concentrations of complex substrates aloowing the detection of very low amounts of viral particles. OBJECTIVE: To assess the accuracy of serological/ELISA tests in comparison with the polymerase chain reaction in maternal blood to diagnose cytomegalovirus infection. DESIGN: A descriptive study was performed. SETTING: High-risk outpatient clinic of Campinas University (Unicamp. PARTICIPANTS: We selected 243 pregnant women. All of them had been indicated for blood sampling because of suspicions of cytomegalovirus infection and also because of other infections. MAIN MEASUREMENTS: The group was tested for cytomegalovirus. Serological tests were run and compared to the polymerase chain reaction, which was considered to be the gold standard. Status analyses were done using Fisher's exact test, via the SAS software. RESULTS: The previous cytomegalovirus infection rate was 94.6%. The main reasons for inclusion in the study were fetal nervous system malformation (25.5%, maternal toxoplasmosis (25.5% and Rh isoimmunization (14.8%. Only two women were included because of positive serological immunoglobulin M test for cytomegalovirus. The sensitivity and specificity of the serological tests were 94% and 6% for immunoglobulin G. CONCLUSION: Serological tests had lower sensitivity in comparison with the polymerase chain reaction test when diagnosing cytomegalovirus infection. The consequences of positive polymerase chain reaction and negative immunoglobulin M in women remain unknown.

  15. Development of a Droplet Digital Polymerase Chain Reaction for Rapid and Simultaneous Identification of Common Foodborne Pathogens in Soft Cheese.

    Science.gov (United States)

    Cremonesi, Paola; Cortimiglia, Claudia; Picozzi, Claudia; Minozzi, Giulietta; Malvisi, Michela; Luini, Mario; Castiglioni, Bianca

    2016-01-01

    Dairy products can harbor various microorganisms (e.g., Campylobacter spp., Salmonella spp., Listeria monocytogenes, verocytotoxin-producing Escherichia coli) arising from animal reservoirs, and which can become important sources of foodborne illness. Therefore, early detection of food pathogens is crucial to prevent diseases. We wished to develop an accurate quantitative protocol based on a droplet digital polymerase chain reaction (ddPCR) involving eight individual TaqMan™ reactions to detect simultaneously, without selective enrichment, Listeria spp., L. monocytogenes, Salmonella spp., verocytotoxin-producing E. coli and Campylobacter spp. in cheese. ddPCR (a "third-generation PCR") provides absolute quantification of target DNAs without requirement of a standard curve, which simplifies experimentation and data comparability. The accuracy, specificity and sensitivity of the developed ddPCR system were assessed using purified DNA from 50 reference pathogenic and non-pathogenic strains from international or Italian collections and analyzing soft cheese samples artificially contaminated with serial dilutions (from 4 × 10(6) to 4 × 10(1) CFU/g) of pure cultures from the American Type Culture Collection. Finally, the performance of our ddPCR system was compared by parallel testing with quantitative PCR: it gave higher sensitivity (10(2) CFU/g for the Listeria spp. assay) without the necessity of a standard curve. In conclusion, this is the first ddPCR system developed for simultaneous detection of common foodborne pathogens in cheese using a single set of amplification conditions. As such, it could become a useful strategy for high-throughput screening of microorganisms to evaluate the quality and safety of food products.

  16. Development of a droplet digital polymerase chain reaction for rapid and simultaneous identification of common foodborne pathogens in soft cheese

    Directory of Open Access Journals (Sweden)

    Paola Cremonesi

    2016-10-01

    Full Text Available Dairy products can harbor various microorganisms (e.g., Campylobacter spp., Salmonella spp., Listeria monocytogenes, verocytotoxin-producing Escherichia coli arising from animal reservoirs, and which can become important sources of foodborne illness. Therefore, early detection of food pathogens is crucial to prevent diseases. We wished to develop an accurate quantitative protocol based on a droplet digital polymerase chain reaction (ddPCR involving eight individual TaqMan™ reactions to detect simultaneously, without selective enrichment, Listeria spp., L. monocytogenes, Salmonella spp., verocytotoxin-producing E. coli and Campylobacter spp. in cheese. ddPCR (a third-generation PCR provides absolute quantification of target DNAs without requirement of a standard curve, which simplifies experimentation and data comparability. The accuracy, specificity and sensitivity of the developed ddPCR system were assessed using purified DNA from 50 reference pathogenic and non-pathogenic strains from international or Italian collections and analyzing soft cheese samples artificially contaminated with serial dilutions (from 4×106 to 4×101 CFU/g of pure cultures from the American Type Culture Collection.Finally, the performance of our ddPCR system was compared by parallel testing with quantitative PCR: it gave higher sensitivity (102 CFU/g for the Listeria spp. assay without the necessity of a standard curve.In conclusion, this is the first ddPCR system developed for simultaneous detection of common foodborne pathogens in cheese using a single set of amplification conditions. As such, it could become a useful strategy for high-throughput screening of microorganisms to evaluate the quality and safety of food products.

  17. BORRELIA BURGDORFERI DNA IN BIOLOGICAL SAMPLES FROM PATIENTS WITH SARCOIDOSIS USING THE POLYMERASE CHAIN REACTION TECHNIQUE

    Institute of Scientific and Technical Information of China (English)

    连伟; 罗慰慈

    1995-01-01

    Polymerase chain reaction (PCR) was used to detect the presence of Borretia burgdoferi DNA in biological samples from patients with sarcoidcsis. The target DNA sequence was of chromosomal origin. The amplified DNA sequence was analyzed by agarose gel electrophoresis, PAGE with silver staining, and the identity of amplified DNA was confirmed by restriction enzyme cleavage and DNA-DNA hybridlzation with a 32P-labelled probe. The assay was sensitive to fewer than two copies of B. burgdor feri genome, even in the presence of a 104-fold excess of human eukaryotic DNA, and was also specific to different B. burgdorferl strains tested. Sera seroiogieally positive to B. burgdorferi (n=26), broncbemlveolar lavage fluid and supematant of BALF (n=26) and peripheral blood (n=9) from sarcoidosis patients were tested. The positive rate was low (4/26, 2/26, and 0/9, respectively). It was considered that DNA from B. bur gdor feri may be identified in a minority of patients with s,arcoidosis, and it may play a pathogenetic rote in such cases. More studies need to be done before advancing the hypothesis of an etiologic role of B. burgdorferi in sarcoidosis.

  18. Multiplex Polymerase Chain Reaction for Detection of Gastrointestinal Pathogens in Migrant Workers in Qatar.

    Science.gov (United States)

    Humphrey, John M; Ranbhise, Sanjay; Ibrahim, Emad; Al-Romaihi, Hamad E; Farag, Elmoubasher; Abu-Raddad, Laith J; Glesby, Marshall J

    2016-12-07

    The causes of infectious diarrhea among the migrant worker population in Qatar are not well understood. We conducted a prospective observational study to understand the demographic and clinical characteristics and infectious causes of diarrhea among migrant workers in Doha, Qatar. A total of 126 male workers presenting to the Qatar Red Crescent Worker's Health Center outpatient clinic or emergency department were studied over a 5-month period in 2015-2016. Epidemiologic surveys were administered to all subjects and the prevalence of 22 different stool pathogens was determined using multiplex polymerase chain reaction (PCR) (FilmArray(®) Gastrointestinal PCR). A target pathogen was identified in 62.7% of subjects. Enteropathogenic Escherichia coli was the most prevalent pathogen and was detected in 24.6% of subjects, followed by Salmonella (22.2%), enteroaggregative E. coli (15.1%), Giardia lamblia (9.5%), and enterotoxigenic E. coli (8.7%). Multiple pathogens were identified in 49.3% of positive stool samples. In a multivariable analysis, the presence of a heart rate ≥ 90 (adjusted odds ratio [OR] = 3.7, 95% confidence interval [CI] = 1.4-10.0) and > 5 fecal leukocytes/high-power field (adjusted OR = 2.8, 95% CI = 1.2-7.0) were significant predictors of detecting an acute inflammatory pathogen by PCR. Use of multiplex PCR enabled the detection of gastrointestinal pathogens in a high proportion of cases, illustrating the utility of this diagnostic tool in epidemiologic studies of infectious diarrhea.

  19. Polymerase chain reaction with lesion scrapping for the diagnosis of human American tegumentary leishmaniasis

    Directory of Open Access Journals (Sweden)

    Eneide Aparecida Sabaini Venazzi

    2006-06-01

    Full Text Available The objective of this work was to compare the polymerase chain reaction (PCR using lesion scrapping with other conventional techniques for the diagnosis of the American tegumentary leishmaniasis (ATL. For this, patients with cutaneous lesions suspected to be ATL were studied. The DNA was amplified with the MP1L/MP3H primers. From the 156 studied patients, 79 (50.6% presented positive parasite direct search (PD, 81 (51.9% had positive Montenegro skin test (MST, and 90 (57.7% presented PD and/or MST positive. The PCR was positive in all of the positive-PD patients (100% sensitivity, in 91.1% of the positive PD and/or MST patients, and in 27.3% of the patients that presented negative PD and positive MST. The PCR positivity was similar to the PD (P = 0.2482 and inferior to the MST (P = 0.0455, and to the PD/MST association (P = 0.0133. The high PCR sensitivity, and positivity in those cases where the PD was negative, highlights the importance of this technique as an auxiliary tool for the diagnosis of ATL.

  20. Polymerase chain reaction with lesion scrapping for the diagnosis of human American tegumentary leishmaniasis.

    Science.gov (United States)

    Venazzi, Eneide Aparecida Sabaini; Roberto, Andréa Claudia Bekner Silva; Barbosa-Tessmann, Ione Parra; Zanzarini, Paulo Donizeti; Lonardoni, Maria Valdrinez Campana; Silveira, Thaís Gomes Verzignassi

    2006-06-01

    The objective of this work was to compare the polymerase chain reaction (PCR) using lesion scrapping with other conventional techniques for the diagnosis of the American tegumentary leishmaniasis (ATL). For this, patients with cutaneous lesions suspected to be ATL were studied. The DNA was amplified with the MP1L/MP3H primers. From the 156 studied patients, 79 (50.6%) presented positive parasite direct search (PD), 81 (51.9%) had positive Montenegro skin test (MST), and 90 (57.7%) presented PD and/or MST positive. The PCR was positive in all of the positive-PD patients (100% sensitivity), in 91.1% of the positive PD and/or MST patients, and in 27.3% of the patients that presented negative PD and positive MST. The PCR positivity was similar to the PD (P = 0.2482) and inferior to the MST (P = 0.0455), and to the PD/MST association (P = 0.0133). The high PCR sensitivity, and positivity in those cases where the PD was negative, highlights the importance of this technique as an auxiliary tool for the diagnosis of ATL.

  1. Molecular detection of plant pathogenic bacteria using polymerase chain reaction single-strand conformation polymorphism.

    Science.gov (United States)

    Srinivasa, Chandrashekar; Sharanaiah, Umesha; Shivamallu, Chandan

    2012-03-01

    The application of polymerase chain reaction (PCR) technology to molecular diagnostics holds great promise for the early identification of agriculturally important plant pathogens. Ralstonia solanacearum, Xanthomoans axonopodis pv. vesicatoria, and Xanthomonas oryzae pv. oryzae are phytopathogenic bacteria, which can infect vegetables, cause severe yield loss. PCR-single-strand conformation polymorphism (PCR-SSCP) is a simple and powerful technique for identifying sequence changes in amplified DNA. The technique of PCR-SSCP is being exploited so far, only to detect and diagnose human bacterial pathogens in addition to plant pathogenic fungi. Selective media and serology are the commonly used methods for the detection of plant pathogens in infected plant materials. In this study, we developed PCR-SSCP technique to identify phytopathogenic bacteria. The PCR product was denatured and separated on a non-denaturing polyacrylamide gel. SSCP banding patterns were detected by silver staining of nucleic acids. We tested over 56 isolates of R. solanacearum, 44 isolates of X. axonopodis pv. vesicatoria, and 20 isolates of X. oryzae pv. oryzae. With the use of universal primer 16S rRNA, we could discriminate such species at the genus and species levels. Species-specific patterns were obtained for bacteria R. solanacearum, X. axonopodis pv. vesicatoria, and X. oryzae pv. oryzae. The potential use of PCR-SSCP technique for the detection and diagnosis of phytobacterial pathogens is discussed in the present paper.

  2. Molecular identification of Amazonian stingless bees using polymerase chain reaction single-strand conformation polymorphism.

    Science.gov (United States)

    Souza, M T; Carvalho-Zilse, G A

    2014-07-25

    In countries containing a mega diversity of wildlife, such as Brazil, identifying and characterizing biological diversity is a continuous process for the scientific community, even in face of technological and scientific advances. This activity demands initiatives for the taxonomic identification of highly diverse groups, such as stingless bees, including molecular analysis strategies. This type of bee is distributed in all of the Brazilian states, with the highest species diversity being found in the State of Amazônia. However, the estimated number of species diverges among taxonomists. These bees are considered the main pollinators in the Amazon rainforest, in which they obtain food and shelter; however, their persistence is constantly threatened by deforestation pressure. Hence, it is important to classify the number and abundance of bee specie, to measure their decline and implement meaningful, priority conservation strategies. This study aims to maximize the implementation of more direct, economic and successful techniques for the taxonomic identification of stingless bees. Specifically, the genes 16S rRNA and COI from mitochondrial DNA were used as molecular markers to differentiate 9 species of Amazonian stingless bees based on DNA polymorphism, using the polymerase chain reaction-single-strand conformation polymorphism technique. We registered different, exclusive SSCP haplotypes for both genes in all species analyzed. These results demonstrate that SSCP is a simple and cost-effective technique that is applicable to the molecular identification of stingless bee species.

  3. Molecular detection of plant pathogenic bacteria using polymerase chain reaction single-strand conformation polymorphism

    Institute of Scientific and Technical Information of China (English)

    Chandrashekar Srinivasa; Umesha Sharanaiah; Chandan Shivamallu

    2012-01-01

    The application of polymerase chain reaction (PCR) technology to molecular diagnostics holds great promise for the early identification of agriculturally important plant pathogens.Ralstonia solanacearum,Xanthomoans axonopodis pv.vesicatoria,and Xanthomonas oryzae pv.oryzae are phytopathogenic bacteria,which can infect vegetables,cause severe yield loss.PCR-single-strand conformation polymorphism (PCR-SSCP) is a simple and powerful technique for identifying sequence changes in amplified DNA.The technique of PCR-SSCP is being exploited so far,only to detect and diagnose human bacterial pathogens in addition to plant pathogenic fungi.Selective media and serology are the commonly used methods for the detection of plant pathogens in infected plant materials.In this study,we developed PCR-SSCP technique to identify phytopathogenic bacteria.The PCR product was denatured and separated on a non-denaturing polyacrylamide gel.SSCP banding patterns were detected by silver staining of nucleic acids.We tested over 56 isolates of R. solanacearum,44 isolates of X. axonopodis pv.vesicatoria,and 20 isolates of X.oryzae pv.oryzae.With the use of universal primer 16S rRNA,we could discriminate such species at the genus and species levels.Speciesspecific patterns were obtained for bacteria R.solanacearum,X.axonopodis pv.vesicatoria,and X.oryzae pv.oryzae.The potential use of PCR-SSCP technique for the detection and diagnosis of phytobacterial pathogens is discussed in the present paper.

  4. A disposable, continuous-flow polymerase chain reaction device: design, fabrication and evaluation.

    Science.gov (United States)

    Ragsdale, Victoria; Li, Huizhong; Sant, Himanshu; Ameel, Tim; Gale, Bruce K

    2016-08-01

    Polymerase Chain Reaction (PCR) is used to amplify a specific segment of DNA through a thermal cycling protocol. The PCR industry is shifting its focus away from macro-scale systems and towards micro-scale devices because: micro-scale sample sizes require less blood from patients, total reaction times are on the order of minutes opposed to hours, and there are cost advantages as many microfluidic devices are manufactured from inexpensive polymers. Some of the fastest PCR devices use continuous flow, but they have all been built of silicon or glass to allow sufficient heat transfer. This article presents a disposable polycarbonate (PC) device that is capable of achieving real-time, continuous flow PCR in a completely disposable polymer device in less than 13 minutes by thermally cycling the sample through an established temperature gradient in a serpentine channel. The desired temperature gradient was determined through simulations and validated by experiments which showed that PCR was achieved. Practical demonstration included amplification of foot-and-mouth disease virus (FMDV) derived cDNA.

  5. Detection of Salmonella invA gene in shrimp enrichment culture by polymerase chain reaction.

    Science.gov (United States)

    Upadhyay, Bishnu Prasad; Utrarachkij, Fuangfa; Thongshoob, Jarinee; Mahakunkijcharoen, Yuvadee; Wongchinda, Niracha; Suthienkul, Orasa; Khusmith, Srisin

    2010-03-01

    Contamination of seafood with salmonellae is a major public health concern. Detection of Salmonella by standard culture methods is time consuming. In this study, an enrichment culture step prior to polymerase chain reaction (PCR) was applied to detect 284 bp fragment of Salmonella invA in comparison with the conventional culture method in 100 shrimp samples collected from four different shrimp farms and fresh food markets around Bangkok. Samples were pre-enriched in non-selective lactose broth (LB) and selective tetrathionate broth (TTB). PCR detection limit was 10 pg and 10(4) cfu/ml of viable salmonellae with 100% specificity. PCR assay detected 19 different Salmonella serovars belonging to 8 serogroups (B, C1, C2-C3, D1, E1, E4 and K) commonly found in clinical and environmental samples in Thailand. The detection rate of PCR following TTB enrichment (24%) was higher than conventional culture method (19%). PCR following TTB, but not in LB enrichment allowed salmonella detection with 84% sensitivity, 90% specificity and 89% accuracy. Shrimp samples collected from fresh food markets had higher levels of contaminated salmonellae than those from shrimp farms. The results indicated that incorporation of an enrichment step prior to PCR has the potential to be applied for detection of naturally contaminated salmonellae in food, environment and clinical samples.

  6. Detection of Mycobacterium tuberculosis complex by nested polymerase chain reaction in pulmonary and extrapulmonary specimens

    Directory of Open Access Journals (Sweden)

    Adriana Antônia da Cruz Furini

    2013-12-01

    Full Text Available OBJECTIVE: To compare the performance of nested polymerase chain reaction (NPCR with that of cultures in the detection of the Mycobacterium tuberculosis complex in pulmonary and extrapulmonary specimens.METHODS: We analyzed 20 and 78 pulmonary and extrapulmonary specimens, respectively, of 67 hospitalized patients suspected of having tuberculosis. An automated microbial system was used for the identification of Mycobacterium spp. cultures, and M. tuberculosis IS6110 was used as the target sequence in the NPCR. The kappa statistic was used in order to assess the level of agreement among the results.RESULTS: Among the 67 patients, 6 and 5, respectively, were diagnosed with pulmonary and extrapulmonary tuberculosis, and the NPCR was positive in all of the cases. Among the 98 clinical specimens, smear microscopy, culture, and NPCR were positive in 6.00%, 8.16%, and 13.26%, respectively. Comparing the results of NPCR with those of cultures (the gold standard, we found that NPCR had a sensitivity and specificity of 100% and 83%, respectively, in pulmonary specimens, compared with 83% and 96%, respectively, in extrapulmonary specimens, with good concordance between the tests (kappa, 0.50 and 0.6867, respectively.CONCLUSIONS: Although NPCR proved to be a very useful tool for the detection of M. tuberculosis complex, clinical, epidemiological, and other laboratory data should also be considered in the diagnosis and treatment of pulmonary and extrapulmonary tuberculosis.

  7. Design, construction, and validation of a modular library of sequence diversity standards for polymerase chain reaction.

    Science.gov (United States)

    Baum, Paul D; Young, Jennifer J; Zhang, Qianjun; Kasakow, Zeljka; McCune, Joseph M

    2011-04-01

    Methods to measure the sequence diversity of polymerase chain reaction (PCR)-amplified DNA lack standards for use as assay calibrators and controls. Here we present a general and economical method for developing customizable DNA standards of known sequence diversity. Standards ranging from 1 to 25,000 sequences were generated by directional ligation of oligonucleotide "words" of standard length and GC content and then amplified by PCR. The sequence accuracy and diversity of the library were validated using AmpliCot analysis (DNA hybridization kinetics) and Illumina sequencing. The library has the following features: (i) pools containing tens of thousands of sequences can be generated from the ligation of relatively few commercially synthesized short oligonucleotides; (ii) each sequence differs from all others in the library at a minimum of three nucleotide positions, permitting discrimination between different sequences by either sequencing or hybridization; (iii) all sequences have identical length, GC content, and melting temperature; (iv) the identity of each standard can be verified by restriction digestion; and (v) once made, the ends of the library may be cleaved and replaced with sequences to match any PCR primer pair. These standards should greatly improve the accuracy and reproducibility of sequence diversity measurements.

  8. A rapid polymerase chain reaction-based test for screening Steinert′s disease (DM1

    Directory of Open Access Journals (Sweden)

    Hamzi Khalil

    2010-01-01

    Full Text Available Myotonic dystrophy (DM is a multisystemic neuromuscular disorder caused by a dynamic mutation of (CTG trinucleotide repeats in the 3′ untranslated region of the myotonic dystrophy protein kinase gene (DMPK. The aim of the present study was to establish the use of polymerase chain reaction (PCR-based simple and rapid method for initial sample screening. Only a minority of samples were tested positive with the above method and need to be detected by tri primer (TP-PCR and Southern blotting which is more time consuming and involves use of radioactive material. This study concerned 24 patients from nine families with a clinical diagnosis of the DM1. DNA extracted from the blood was used for amplification of the triplet repeat sequences at the DMPK loci. We obtained two bands for the normal subjects and one band for patients corresponding to normal DMPK allele, confirmed by the TP-PCR and the Southern blot. This rapid test for initial screening of samples for the presence of DMPK mutations is economical and reliable method. This method reduces the number of samples needing TP-PCR and Southern blotting.

  9. Toxin genotyping of Clostridium perfringens strains using a polymerase chain reaction protocol

    Directory of Open Access Journals (Sweden)

    Elisabetta Di Giannatale

    2010-03-01

    Full Text Available A polymerase chain reaction protocol consisting of a multiplex to identify the cpa, cpb1, cpetx, cpi genes and a duplex to identify the cpe and cpb2 genes encoding for a, b1, e, i, enterotoxin and b2 toxins, respectively, was applied to DNA extracted from two collections of Clostridium perfringens strains. The first collection involved 19 isolates from rabbits. The second collection of 41 isolates came from routine necropsies. The cpa gene alone, or in association with the cpb2 gene, was detected in all DNA samples examined. The cpa gene, together with cpb2 gene, were detected in seven of the rabbit C. perfringens strains (36.8% and in nine isolates from necropsies (21.9%. The cpa gene was found in 63.2% of rabbit strains and 76.9% of strains from other animal species. In rabbits, the pathological lesions associated with C. perfringens detection were predominantly forms of non-inflammatory enteropathies. In other species, C. perfringens was mainly associated with congestive-haemorrhagic enteropathy, but also with fatal traumatic lesions, degenerative diseases and organs with post-mortem autolysis. No clear correlation was observed between detection of b2 toxin gene and species-specific pathological features.

  10. Polymerase chain reaction-based discrimination of viable from non-viable Mycoplasma gallisepticum

    Directory of Open Access Journals (Sweden)

    Ching Giap Tan

    2014-02-01

    Full Text Available The present study was based on the reverse transcription polymerase chain reaction (RT-PCR of the 16S ribosomal nucleic acid (rRNA of Mycoplasma for detection of viable Mycoplasma gallisepticum. To determine the stability of M. gallisepticum 16S rRNA in vitro, three inactivation methods were used and the suspensions were stored at different temperatures. The 16S rRNA of M. gallisepticum was detected up to approximately 20–25 h at 37 °C, 22–25 h at 16 °C, and 23–27 h at 4 °C. The test, therefore, could detect viable or recently dead M. gallisepticum (< 20 h. The RT-PCR method was applied during an in vivo study of drug efficacy under experimental conditions, where commercial broiler-breeder eggs were inoculated with M. gallisepticum into the yolk. Hatched chicks that had been inoculated in ovo were treated with Macrolide 1. The method was then applied in a flock of day 0 chicks with naturally acquired vertical transmission of M. gallisepticum, treated with Macrolide 2. Swabs of the respiratory tract were obtained for PCR and RT-PCR evaluations to determine the viability of M. gallisepticum. This study proved that the combination of both PCR and RT-PCR enables detection and differentiation of viable from non-viable M. gallisepticum.

  11. Improved polymerase chain reaction conditions for quick diagnostics of Huntington disease.

    Science.gov (United States)

    Culjković, B; Ruzdijić, S; Rakić, L; Romac, S

    1997-12-01

    Huntington disease (HD) belongs to a growing list of neurodegenerative disorders (fragile X syndrome [6], myotonic dystrophy [1], spino-bulbar muscular atrophy [2] etc.) characterized by unstable expanded trinucleotide repeats (so-called 'dynamic mutations'). The dynamic mutation causing HD represents the expansion of CAG triplets in the first exon of a gene IT15 (chromosome 4) coding for huntington. This trinucleotide stretch is varying in the range of 11-34 in normal chromosomes and 39-121 in HD chromosomes. The most direct diagnostic approach is to amplify the proximal region of IT15 gene (from patients genomic DNA) by polymerase chain reaction (PCR) and estimate the number of CAG triplets. All protocols published to date are difficult to reproduce because amplification is inefficient giving additional non-specific products. The strategy of our experiment is shown in Fig. 1. We designed one new primer, primer No. 2 (another primer was primer No. 1) and novel PCR conditions. Primer No. 2 is located closer to CAG triplets and its extension is not including the GC rich region. PCR amplified products, using primer Nos. 1 and 2, thus do not include the GC rich region and, therefore, are much more efficiently amplified (compared to the products of amplification with primer Nos. 1 and 3).

  12. Use of the polymerase chain reaction for detection of Fusarium graminearum in bulgur wheat

    Directory of Open Access Journals (Sweden)

    Carla Bertechini Faria

    2012-03-01

    Full Text Available The detection of mycotoxigenic fungi in foodstuff is important because their presence may indicate the possible associated mycotoxin contamination. Fusarium graminearum is a wheat pathogen and a producer of micotoxins. The polymerase chain reaction (PCR has been employed for the specific identification of F. graminearum. However, this methodology has not been commonly used for detection of F. graminearum in food. Thus, the objective of the present study was to develop a molecular methodology to detect F. graminearum in commercial samples of bulgur wheat. Two methods were tested. In the first method, a sample of this cereal was contaminated with F. graminearum mycelia. The genomic DNA was extracted from this mixture and used in a F. graminearum specific PCR reaction. The F. graminearum species was detected only in samples that were heavily contaminated. In the second method, samples of bulgur wheat were inoculated on a solid medium, and isolates having F. graminearum culture characteristics were obtained. The DNA extracted from these isolates was tested in F. graminearum specific PCR reactions. An isolate obtained had its trichothecene genotype identified by PCR. The established methodology could be used in surveys of food contamination with F. graminearum.

  13. Genital infection caused by Entamoeba histolytica confirmed by polymerase chain reaction analyses.

    Science.gov (United States)

    Asano, Hiroshi; Kaneuchi, Masanori; Furuta, Itsuko; Yamaya, Yukie; Hatanaka, Kanako C; Takeda, Mahito; Matsuno, Yoshihiro; Sakuragi, Noriaki

    2014-05-01

    Entamoeba histolytica is estimated to infect approximately 1% of the global population. In Japan, the prevalence of amebic dysentery has been increasing, with more than 800 patients newly diagnosed annually. However, genital infection with E. histolytica is uncommon even in endemic areas. We present a case of vaginitis caused by E. histolytica. A 50-year-old Japanese woman without history of overseas travel presented to a nearby clinic with increased vaginal discharge. She had hemorrhagic erosion at the uterine cervix with yellowish vaginal discharge, and was referred to our hospital for exclusion of malignancy. Cervical cytology revealed periodic acid-Schiff-positive protozoa not aggregating around squamous cells, and thus amebic vaginitis was suspected. We performed polymerase chain reaction (PCR) analyses and identified E. histolytica. The vaginitis was treated with metronidazole, and the disappearance of amebic protozoa was confirmed by cytology and PCR. Therefore, it may be important to obtain early diagnosis by cervical cytology and PCR.

  14. Polymerase chain reaction-based screening for the ceftriaxone-resistant Neisseria gonorrhoeae F89 strain.

    Science.gov (United States)

    Goire, N; Lahra, M M; Ohnishi, M; Hogan, T; Liminios, A E; Nissen, M D; Sloots, T P; Whiley, D M

    2013-04-04

    Emergence and spread of Neisseria gonorrhoeae resistant to extended spectrum cephalosporins is a major problem threatening treatment of gonorrhoea and is further highlighted by the recent report of a second ceftriaxone-resistant N. gonorrhoeae strain (F89) in Europe, initially observed in France and subsequently identified in Spain. N. gonorrhoeae antimicrobial resistance (AMR) surveillance has acquired new importance and molecular tools have the potential to enhance bacterial culture-based methods. In this study, we established a polymerase chain reaction (PCR) protocol for direct detection of the F89 strain. A key component of this screening protocol was the development of a hybridisation probe-based melting curve analysis assay (mosaic501-hybPCR) to detect the presence of an A501P substitution on the N. gonorrhoeae mosaic penicillin binding protein 2 (PBP2) sequence, an important characteristic of the F89 strain. The mosaic501-hybPCR was evaluated using plasmid-derived positive controls (n=3) and characterised gonococcal (n=33) and non-gonococcal (n=58) isolates. The protocol was then applied to 159 clinical specimens from Sydney, Australia, collected during the first half of the year 2012 that were N. gonorrhoeae PCR-positive. Overall, the results indicate that the PCR-based protocol is suitable for direct detection of the N. gonorrhoeae F89 strain in non-cultured clinical samples. It therefore provides an additional tool to aid investigations into the potential spread of F89 strain throughout Europe and elsewhere.

  15. Analysis of polymorphism in the bovine casein genes by use of the polymerase chain reaction.

    Science.gov (United States)

    Pinder, S J; Perry, B N; Skidmore, C J; Savva, D

    1991-01-01

    Methods have been devised for detecting polymorphisms in the bovine beta- and kappa-casein genes using the polymerase chain reaction (PCR) followed either by restriction enzyme digestion (to reveal a restriction fragment length polymorphism (RFLP] or by hybridization of an allele-specific oligonucleotide. These methods, as well as being faster and more sensitive than traditional RFLP methods, are of more general applicability since they can detect any change in DNA sequence. They require only a small sample of blood or semen and are applicable to animals of any age or sex. These methods make possible large-scale screening and thus selection for alleles at these loci. Typing of blood DNA can give erroneous results when the animal concerned is a twin; however, this can be overcome by retesting using milk or semen. Analysis of the kappa-casein genotype of Holstein-Friesian bulls gives frequencies for the A and B alleles of 0.80 and 0.20 respectively. Selection in favour of the B allele, which is superior for cheese production, could thus have a large effect. The A3 and B alleles at the beta-casein locus have been shown to be rare in the Holstein-Friesian population. Linkage disequilibrium exists between beta-casein B and kappa-casein B.

  16. Clonality assessment of lymphoproliferative lesions using the polymerase chain reaction: An analysis of two methods

    Directory of Open Access Journals (Sweden)

    Nikhil Moorchung

    2011-01-01

    Full Text Available Background: Lymphoid malignancies are a heterogeneous group of disorders which may be difficult to differentiate from reactive proliferations even after immunohistochemistry. Polymerase chain reaction (PCR is believed to be a good adjunct tool for diagnosis. Materials and Methods: We examined 24 cases of neoplastic and non-neoplastic lymphoproliferative lesions in this study and evaluated the PCR as an additional tool in the confirmation of the diagnosis. Two different PCR methodologies were evaluated. Results: In the evaluation of the T-cell PCR, it was seen that the correlation using both the commercial kits and the custom-synthesized primers was highly significant at a P value of 0.05. Conclusions: Both the methods showed an excellent concordance for T-cell γ gene rearrangements, However, the same was not seen in the B-cell receptor rearrangements. This may be because of the small sample size or the inability of consensus V primers to recognize complementary DNA sequences in all of the V segments.

  17. Isolation and polymerase chain reaction-based identification of Riemerella anatipestifer from ducks in Kerala, India

    Directory of Open Access Journals (Sweden)

    Manju Soman

    2014-10-01

    Full Text Available Aim: The aim was to isolate and characterize Riemerella anatipestifer organisms from disease outbreaks in ducks in Kerala. Materials and Methods: Ducklings, suspected of Riemerella infection, were sacrificed and subjected to post-mortem examination. Heart blood smears and impression smears from liver and spleen were examined for the presence of pathogenic organisms. Heart blood, lung, liver, and spleen collected aseptically from the birds were subjected to isolation trials in brain heart infusion agar and 10% bovine blood agar. The isolates were characterized based on morphology, cultural characteristics and biochemical tests, and their identity were confirmed by polymerase chain reaction (PCR and the PCR amplified DNA was sequenced. The antibiotic sensitivity testing of the isolates were carried out using six antibiotics viz ciprofloxacin, chloramphenicol, enrofloxacin, amoxycillin, cotrimoxazole, and gentamicin. Results: Colonies suggestive of Riemerella organisms could be isolated on blood agar. Biochemical characterization and PCR confirmed the identity of isolates as R. anatipestifer. The nucleotide sequence of the PCR product showed 99% homology to the R. anatipestifer sequences in the NCBI. The antibiogram revealed that the organisms were sensitive to ciprofloxacin, enrofloxacin, and gentamicin. Conclusion: The present study suggests that the PCR assay can facilitate fast and proper identification of R. anatipestifer infection in ducks. The assay can also differentiate between R. anatipestifer and Pasteurella multocida and can replace the traditional methods of differentiation which are cumbersome and time-consuming.

  18. Low-Cost Temperature Logger for a Polymerase Chain Reaction Thermal Cycler

    Directory of Open Access Journals (Sweden)

    Chan-Young Park

    2016-10-01

    Full Text Available Polymerase chain reaction (PCR is a method of amplifying DNA which is normally carried out with a thermal cycler. To obtain more accurate and reliable PCR results, the temperature change within the chamber of the thermal cycler needs to be verified and calibrated regularly. Commercially available temperature loggers commonly used for temperature verification tests usually require a graphical user interface (GUI attached to the logger for convenience and straightforward understanding of the device. In this study, a host-local architecture for the temperature logger that significantly reduces the development time and cost is proposed. Employing standard computing devices as the host gives better development environment and user-friendly GUI. This paper presents the hardware and software design of the host-local temperature logger, and demonstrates the use of the local temperature logger connected to a personal computer with a Windows operating system. The probe design, thermistor resistance measurement, temperature filtering, and temperature calibration is described in detail. The thermistor self-heating problem was investigated in particular to determine the reference resistor that was serially connected to the thermistor. The temperature accuracy and temporal precision of the proposed system was 0.1 K.

  19. Detection of Salmonella sp. in Dermanyssus gallinae using an FTA filter-based polymerase chain reaction.

    Science.gov (United States)

    Moro, C Valiente; Desloire, S; Chauve, C; Zenner, L

    2007-06-01

    Salmonella spp. bacteria are responsible for some of the most important zoonoses worldwide. Because Dermanyssus gallinae (DeGeer) (Acari: Dermanyssidae) has been recently reported to be an experimental vector of Salmonella Enteritidis, it would be of benefit to evaluate the presence of this bacterium in mites. A molecular detection tool associating a simple filter-based DNA preparation with a specific 16S rDNA Salmonella sp. polymerase chain reaction (PCR) amplification was described. The limit of detection with this method was 2 x 10(4) bacteria per mite. To adapt this technique for large-scale studies, two sizes of mite pools were tested and a preliminary investigation was carried out on mites from 16 currently or previously contaminated farms. Mites sampled from one farm of each type were positive for Salmonella, suggesting that Dermanyssus could act as a reservoir between flocks. In further investigations, it will be necessary to carry out a large-scale study to assess the role of D. gallinae in the epidemiology of avian salmonellosis.

  20. Identification of aflatoxigenic fungi using polymerase chain reaction-based assay

    Directory of Open Access Journals (Sweden)

    Šošo Vladislava M.

    2014-01-01

    Full Text Available As the aflatoxins represent a health-risk for humans because of their proven carcinogenicity, food-borne fungi that produce them as secondary metabolites, mainly Aspergillus flavus and Aspergillus parasiticus, have to be isolated and identified. The best argument for identifying problem fungi is that it indicates control points within the food system as part of a hazard analysis critical control point (HACCP approach. This assumes there is a close link between fungus and toxin. Conventional methods for isolation and identification of fungi are time consuming and require admirably dedicated taxonomists. Hence, it is imperative to develop methodologies that are relatively rapid, highly specific and as an alternative to the existing methods. The polymerase chain reaction (PCR facilitates the in vitro amplification of the target sequence. The main advantages of PCR is that organisms need not be cultured, at least not for a long time, prior to their detection, target DNA can be detected even in a complex mixture, no radioactive probes are required, it is rapid, sensitive and highly versatile. The gene afl-2 has been isolated and shown to regulate aflatoxin biosynthesis in A. flavus. Also, the PCR reaction was targeted against aflatoxin synthesis regulatory gene (aflR1 since these genes are nearly identical in A. flavus and A. parasiticus in order to indicate the possibility of detection of both the species with the same PCR system (primers/reaction. [Projekat Ministarstva nauke Republike Srbije, br. III46009

  1. Ion-Mediated Polymerase Chain Reactions Performed with an Electronically Driven Microfluidic Device.

    Science.gov (United States)

    Zhang, Yi; Li, Qian; Guo, Linjie; Huang, Qing; Shi, Jiye; Yang, Yang; Liu, Dongsheng; Fan, Chunhai

    2016-09-26

    The polymerase chain reaction (PCR) is a powerful method for exponentially amplifying very low amounts of target DNA from genetic, clinical, and forensic samples. However, the heating and cooling steps in PCR largely hamper the miniaturization of thermocyclers for on-site detection of pathogens and point-of-care tests. Herein, we devise an ion-mediated PCR (IM-PCR) strategy by exploiting ion-induced DNA denaturation/renaturation cycles. DNA duplexes are effectively denatured in alkaline solutions; whereas, the denatured single-stranded DNA strands readily reform duplexes at neutral pH. By using an integrated microchip that can programmably control the solution pH simply switching the potential in a range of several hundred millivolts, we can trigger IM-PCR at a constant temperature. Analogously to thermal cycling, 30 cycles of pH-induced denaturation/renaturation were used to amplify protein DNA fragments as confirmed by DNA sequencing. We anticipate that this portable, low-cost, and scalable IM-PCR holds great promise for widespread biological, clinical, and environmental applications.

  2. Detection of horses infected naturally with equine infectious anemia virus by nested polymerase chain reaction.

    Science.gov (United States)

    Nagarajan, M M; Simard, C

    2001-05-01

    A nested polymerase chain reaction (PCR) amplifying a region of the gag gene of equine infectious anemia virus (EIAV) was developed for the rapid and direct detection of proviral DNA from the peripheral blood of naturally infected horses and was compared with the Coggins test. DNA prepared from white blood cells of 122 field horses from 15 stables with reported cases of EIAV and one seronegative stable were analysed. Amplifications of expected size fragments were obtained by nested PCR for 88 horses using two different sets of primers targeting the gag region. The specificity of the amplified products was confirmed by hybridization using a digoxigenin-labeled probe. Gag-nested PCR-restriction fragment length polymorphism analysis distinguished two different subtypes of gag gene, A and B. Subtype A was found to be the most prevalent among the infected horses that were tested. The PCR-gag amplified sequence of subtype A shared 84.6% nucleotide and 93% deduced amino acid sequence identities with the prototype Wyoming strain whereas subtype B sequence was almost 100% identical to the prototype. Sequence analysis of gag subtype A suggests the presence of a novel EIAV variant among infected horses in Canada. The nested PCR assay developed in the present study detected more EIAV positive animals and was found as specific as the agar gel immunodiffusion (Coggins) assay and offers great potential a diagnostic test for the detection of EIAV infections in field horses.

  3. Detection of herpesviral sequences in tissues of green turtles with fibropapilloma by polymerase chain reaction.

    Science.gov (United States)

    Lu, Y; Wang, Y; Yu, Q; Aguirre, A A; Balazs, G H; Nerurkar, V R; Yanagihara, R

    2000-01-01

    An alpha-herpesvirus has been associated recently with green turtle fibropapilloma (FP). To further clarify the role of this newfound green turtle herpesvirus (GTHV) in the pathogenesis of FP, various normal-appearing tissues and organs (including skin, eye, brain, heart, liver, spleen, intestine, lung, kidney, nerve, gonad, tongue, gall bladder, urinary bladder, thyroid and peripheral blood mononuclear cells (PBMC) from blood) and tumor tissues from 19 green turtles (Chelonia mydas) with FP, and tissues from three green turtles without FP, collected during 1997 to 1999 in the Hawaiian Islands, were tested for GTHV sequences by nested polymerase chain reaction (PCR), using GTHV-specific oligonuclotide primers. GTHV sequences were detected in all tumors (51/51) and most tissues (133/167) of tumored turtles. By contrast, such sequences were undetectable in tissues (0/28) of three non-tumored turtles. Analysis of GTHV sequences detected in different tissues and tumors revealed a low degree of genetic diversity (green turtles and its absence in tissues of non-tumored turtles, argues for an etiologic role in FP.

  4. Nanostructured biochip for label-free and real-time optical detection of polymerase chain reaction.

    Science.gov (United States)

    Hiep, Ha Minh; Kerman, Kagan; Endo, Tatsuro; Saito, Masato; Tamiya, Eiichi

    2010-02-19

    In this report, Au-coated nanostructured biochip with functionalized thiolated primers on its surface is developed for label-free and real-time optical detection of polymerase chain reaction (PCR). A PCR chamber of 150 microm in thickness containing Au-coated nanostructured substrate in the bottom layer was bordered with SU-8 100 walls. After immobilization of 5'-thiolated primers on the surface, simultaneous DNA amplification and detection were performed without any labeled molecules via the relative reflected intensity (RRI) of Au-coated nanostructured substrate. When human genomic DNA at several concentrations of 0.2, 0.5 and 1 ng microL(-1) was included in the initial DNA samples, the increases in the RRI peak values were clearly observed with the increasing PCR cycle numbers. We found that the starting point of the optical signal, which was divergent from the background in our PCR biochip, was around 3-4 cycles, much lower than that of the fluorescent real-time PCR analysis (around 23-25 cycles). Our proposed PCR device using Au-coated nanostructured substrate holds noteworthy promise for rapid, label-free and real-time DNA detection for point-of-care testing (POCT) applications.

  5. Real-time polymerase chain reaction for detection of Strongyloides stercoralis in stool.

    Science.gov (United States)

    Sultana, Yasmin; Jeoffreys, Neisha; Watts, Matthew R; Gilbert, Gwendolyn L; Lee, Rogan

    2013-06-01

    The use of real-time polymerase chain reaction (PCR) for detection of Strongyloides stercoralis in stool has recently been described. We compared five DNA extraction methods by using normal human stool spiked with Strongyloides ratti and tested by using a real-time PCR. The PowerSoil kit was found to be the best technique in terms of sensitivity and ease of use. The PCR detected DNA extracted from one spiked S. ratti larva diluted 10⁻². The PowerSoil kit was then used to extract DNA from 160 human survey samples. All culture positive specimens with a high and moderate larval load were identified by real-time PCR, but only 15% of specimens with low larval load were positive. Specificity was greater than 99%. The combination of the PowerSoil kit and real-time PCR reliably detected high to moderate larval numbers of S. stercoralis in stools but was less sensitive when the larval load was low.

  6. Prescription Surveillance and Polymerase Chain Reaction Testing to Identify Pathogens during Outbreaks of Infection

    Directory of Open Access Journals (Sweden)

    Hiroaki Sugiura

    2013-01-01

    Full Text Available Syndromic surveillance, including prescription surveillance, offers a rapid method for the early detection of agents of bioterrorism and emerging infectious diseases. However, it has the disadvantage of not considering definitive diagnoses. Here, we attempted to definitively diagnose pathogens using polymerase chain reaction (PCR immediately after the prescription surveillance system detected an outbreak. Specimens were collected from 50 patients with respiratory infections. PCR was used to identify the pathogens, which included 14 types of common respiratory viruses and Mycoplasma pneumoniae. Infectious agents including M. pneumoniae, respiratory syncytial virus (RSV, rhinovirus, enterovirus, and parainfluenza virus were detected in 54% of patients. For the rapid RSV diagnosis kit, sensitivity was 80% and specificity was 85%. For the rapid adenovirus diagnosis kit, no positive results were obtained; therefore, sensitivity could not be calculated and specificity was 100%. Many patients were found to be treated for upper respiratory tract infections without the diagnosis of a specific pathogen. In Japan, an outbreak of M. pneumoniae infection began in 2011, and our results suggested that this outbreak may have included false-positive cases. By combining syndromic surveillance and PCR, we were able to rapidly and accurately identify causative pathogens during a recent respiratory infection outbreak.

  7. Analysis of adult otitis media: polymerase chain reaction versus culture for bacteria and viruses.

    Science.gov (United States)

    Liederman, E M; Post, J C; Aul, J J; Sirko, D A; White, G J; Buchman, C A; Ehrlich, G D

    1998-01-01

    Recent studies using the polymerase chain reaction (PCR) have identified bacterial and viral genomic sequences in culture-negative pediatric middle ear effusions. To evaluate this technique in adults, 19 effusions were analyzed to compare bacterial and viral culture and PCR detection of Streptococcus pneumoniae, Haemophilus influenzae, Moraxella catarrhalis, and adenovirus. Effusions from 4 subjects positive for human immunodeficiency virus (HIV) were analyzed by PCR for HIV virus. Three of 19 effusions were culture-positive for bacteria, and 0 of 19 for viruses. Fifteen of 19 effusions were PCR-positive for bacterial genomic sequences, and 0 of 19 for adenovirus. Thirteen of 15 PCR-positive specimens demonstrated S pneumoniae, 5 of 15 H influenzae, and 0 of 13 M catarrhalis. All 4 effusions from HIV-positive subjects were PCR-positive for HIV. No effusion was culture-positive and PCR-negative. These results confirm that culture-negative middle ear effusions contain genomic sequences from bacterial pathogens. Finding of HIV RNA and DNA in effusion from HIV-positives suggests replicating virus in this fluid.

  8. Diagnosis of neonatal sepsis by broad-range 16S real-time polymerase chain reaction.

    Science.gov (United States)

    Ohlin, Andreas; Bäckman, Anders; Ewald, Uwe; Schollin, Jens; Björkqvist, Maria

    2012-01-01

    The standard diagnostic test (blood culture) for suspected neonatal sepsis has limitations in sensitivity and specificity, and 16S polymerase chain reaction (PCR) has been suggested as a new diagnostic tool for neonatal sepsis. To develop and evaluate a new real-time PCR method for detection of bacterial DNA in blood samples collected from infants with suspected neonatal sepsis. Immediately after blood culture, a study sample of 0.5-1.0 ml whole blood was collected and used for a novel 16S real-time PCR assay. All positive samples were sequenced. Detailed case studies were performed in all cases with conflicting results, to verify if PCR could detect pathogens in culture negative sepsis. 368 samples from 317 infants were included. When compared with blood culture, the assay yielded a sensitivity of 79%, a specificity of 90%, a positive predictive value of 59%, and a negative predictive value of 96%. Seven of the 31 samples with a positive PCR result and a negative blood culture had definite or suspected bacterial sepsis. In five samples, PCR (but not blood culture) could detect a pathogen that was present in a blood culture collected more than 24 h prior to the PCR sample. This study presents an evaluation of a new real-time PCR technique that can detect culture-positive sepsis, and suggests that PCR has the potential to detect bacteria in culture-negative samples even after the initiation of intravenous antibiotics. Copyright © 2011 S. Karger AG, Basel.

  9. DIFFERENTIATION OF PSEUDOCONDYLOMA OF VULVA AND CONDYLOMA ACUMINATA BY DOT BLOT HYBRIDIZATION AND POLYMERASE CHAIN REACTION

    Institute of Scientific and Technical Information of China (English)

    刘跃华; 王家璧; 司静懿

    1996-01-01

    This study differentiated pseudocondyloma of vulva from condyloma acunainata using dot blot hybridization and polymerase chain reaction (PCR). A total of 27 cases o{ pseudocondyloma of vulva and 65 cases of condyloma acuminata were selected for the sttldy. The genital lesions were examined clinically and were biopsled. Each biopsy v-as subjected to histological examination and HPV DNA analysis by dot blot hybridization and PCR. Dot blot analysis detected HPV DNA in 19(82.6%) out of 23 cases of condyloma acuminata and 2(25%) out of 8 cases pseudocondyloma of vulvae(P<0. 05). PCR detected HPV DNA in 51(92.7%) our of 55 cases of eondyloma acuminata, compared with none in 23 cases of pseudocondylorna(P<0. 001). HPV DNA was present in the majority of condyloma acuminata specimens, HPV 6 and 11 were the predominant types. Peudocondyloma is probably not associated with HPV. PCR was the most sensitive and useful techntque for HPV DNA detection.

  10. Fabrication of Polymerase Chain Reaction Plastic Lab-on-a-Chip Device for Rapid Molecular Diagnoses.

    Science.gov (United States)

    Trinh, Kieu The Loan; Zhang, Hainan; Kang, Dong-Jin; Kahng, Sung-Hyun; Tall, Ben D; Lee, Nae Yoon

    2016-05-01

    We aim to fabricate a thermoplastic poly(methylmethacrylate) (PMMA) Lab-on-a-Chip device to perform continuous- flow polymerase chain reactions (PCRs) for rapid molecular detection of foodborne pathogen bacteria. A miniaturized plastic device was fabricated by utilizing PMMA substrates mediated by poly(dimethylsiloxane) interfacial coating, enabling bonding under mild conditions, and thus avoiding the deformation or collapse of microchannels. Surface characterizations were carried out and bond strength was measured. The feasibility of the Lab-on-a-Chip device for performing on-chip PCR utilizing a lab-made, portable dual heater was evaluated. The results were compared with those obtained using a commercially available thermal cycler. A PMMA Lab-on-a-Chip device was designed and fabricated for conducting PCR using foodborne pathogens as sample targets. A robust bond was established between the PMMA substrates, which is essential for performing miniaturized PCR on plastic. The feasibility of on-chip PCR was evaluated using Escherichia coli O157:H7 and Cronobacter condimenti, two worldwide foodborne pathogens, and the target amplicons were successfully amplified within 25 minutes. In this study, we present a novel design of a low-cost and high-throughput thermoplastic PMMA Lab-on-a-Chip device for conducting microscale PCR, and we enable rapid molecular diagnoses of two important foodborne pathogens in minute resolution using this device. In this regard, the introduced highly portable system design has the potential to enable PCR investigations of many diseases quickly and accurately.

  11. A comparison of three DNA extractive procedures with Leptospira for polymerase chain reaction analysis

    Directory of Open Access Journals (Sweden)

    Veloso IF

    2000-01-01

    Full Text Available Three DNA extraction methods were evaluated in this study: proteinase K followed by phenol-chloroform; a plant proteinase (E6870 followed by phenol-chloroform; and boiling of leptospires in 0.1 mM Tris, pH 7.0 for 10 min at 100°C, with no phenol treatment. Every strain treated with proteinase K or E6870 afforded positive polymerase chain reaction (PCR reaction. On the other hand, from five strains extracted by the boiling method, three did not feature the 849 bp band characteristic in Leptospira. We also evaluated by RAPD-PCR, DNAs from serovars isolated with proteinase K and proteinase 6870 with primers B11/B12. Each of the DNA samples provided PCR profiles in agreement with previous data. Moreover, the results with E6870 showed less background non-specific amplification, suggesting that removal of nucleases was more efficient with E6870. The limit for detection by PCR using Lep13/Lep14 was determined to be 10(2 leptospira, using the silver stain procedure.

  12. Polymerase chain reaction based epidemiological investigation of canine parvoviral disease in dogs at Bareilly region

    Directory of Open Access Journals (Sweden)

    Jobin Thomas

    2014-11-01

    Full Text Available Aim: The aim of this study was to screen the suspected samples by polymerase chain reaction (PCR and epidemiological analysis of positive cases of canine parvovirus type2. Materials and Methods: Fecal samples were collected from dogs suspected for canine parvovirus type 2 (CPV-2 and viral DNA was extracted. Primers were designed, and PCR was done with all extracted DNA samples. Age, sex and breed wise distribution of positive cases were analyzed. Results: Out of a total 44 collected fecal samples, 23 were found to be positive for CPV-2 by developed PCR. The disease was found to be more common in Labrador male pups of 3-6 months of age. The percentage of positive cases in vaccinated dogs was found to be around 17.4%. Conclusion: Almost half (52.3% of total collected samples were found to be positive by PCR. However, number of field samples are needed to further validate this test and additionally sequence analysis needs to be done to ensure the prevalent field strain of CPV-2.

  13. Molecular typing of canine parvovirus variants by polymerase chain reaction and restriction enzyme analysis.

    Science.gov (United States)

    Kumar, M; Nandi, S

    2010-12-01

    Canine parvovirus type 2 (CPV-2) is a pathogen of dogs, which causes acute gastroenteritis and lymphopenia mostly in young pups. This paper reports the incidence of CPV-2 infection in diarrhoeic dogs with an aim to define the involvement of various variants of canine parvovirus circulating in India. CPV-2a, a variant of CPV-2 was differentiated from CPV-2b by polymerase chain reaction (PCR). The samples positive for CPV-2b were further analysed by PCR and restriction endonuclease (RE) analysis using Mbo II to detect the CPV-2c variant. Of 129 faecal samples studied, 78 were found positive for canine parvovirus by PCR. Among the 78 samples, 27 were of CPV-2a, 39 of CPV-2b and 12 of CPV-2c type, respectively. This study also showed that CPV-2c, anew variant, is circulating in India. The CPV-2c could be successfully detected by PCR and RE analysis while CPV-2b is the major antigenic type prevalent in this region followed by CPV-2a.

  14. A real-time reverse transcriptase polymerase chain reaction for detection and quantification of Vesiculovirus

    Science.gov (United States)

    Tolardo, Aline Lavado; de Souza, William Marciel; Romeiro, Marilia Farignoli; Vieira, Luiz Carlos; Luna, Luciano Kleber de Souza; Henriques, Dyana Alves; de Araujo, Jansen; Siqueira, Carlos Eduardo Hassegawa; Colombo, Tatiana Elias; Aquino, Victor Hugo; da Fonseca, Benedito Antonio Lopes; Bronzoni, Roberta Vieira de Morais; Nogueira, Maurício Lacerda; Durigon, Edison Luiz; Figueiredo, Luiz Tadeu Moraes

    2016-01-01

    Vesiculoviruses (VSV) are zoonotic viruses that cause vesicular stomatitis disease in cattle, horses and pigs, as well as sporadic human cases of acute febrile illness. Therefore, diagnosis of VSV infections by reliable laboratory techniques is important to allow a proper case management and implementation of strategies for the containment of virus spread. We show here a sensitive and reproducible real-time reverse transcriptase polymerase chain reaction (RT-PCR) for detection and quantification of VSV. The assay was evaluated with arthropods and serum samples obtained from horses, cattle and patients with acute febrile disease. The real-time RT-PCR amplified the Piry, Carajas, Alagoas and Indiana Vesiculovirus at a melting temperature 81.02 ± 0.8ºC, and the sensitivity of assay was estimated in 10 RNA copies/mL to the Piry Vesiculovirus. The viral genome has been detected in samples of horses and cattle, but not detected in human sera or arthropods. Thus, this assay allows a preliminary differential diagnosis of VSV infections. PMID:27276185

  15. Polymerase Chain Reaction: A Better Method for Diagnosing Chronic Schistosoma mansoni Infections.

    Science.gov (United States)

    Abdel-Hafeez, Ekhlas Hamed; Mohamed, Rabie M; Belal, Usama S; Abdel-Raheem, Ehab M; Naoi, Koji; Norose, Kazumi

    2015-12-01

    For more effective diagnosis of the acute and chronic stages of Schistosoma mansoni infection in humans, the polymerase chain reaction (PCR) technique was compared with the Kato-Katz method. A total of 150 stool samples were collected from inpatient and outpatient clinics at the Department of Tropical Medicine, Minia University Hospital, Egypt. Three groups of patients, 50 with acute intestinal schistosomiasis, 70 with chronic intestinal schistosomiasis and 30 normal healthy controls were studied. Stool samples were analyzed by PCR and the Kato-Katz method. The mean number of eggs per gram of feces was 4.6 when estimated by the Kato-Katz method in positive stool samples from acute schistosomiasis cases but only 1.7 in chronic cases. In acute intestinal schistosomiasis, 15 and 45 out of 50 cases were positive by Kato-Katz and PCR, respectively. In the chronic intestinal schistosomiasis cases, 6 and 68 out of 70 cases were positive by the Kato-Katz and PCR methods, respectively. We conclude that PCR appears to be an effective diagnostic technique for S. mansoni infection, especially where a low worm burden exists, such as in chronic cases.

  16. Differentiation of Helicobacter pylori isolates by polymerase chain reaction-restriction fragment length polymorphism

    Institute of Scientific and Technical Information of China (English)

    SHI Li; SUN Yong; ZHANG Ya-li; ZHANG Zhen-shu; ZHOU Dian-yuan

    2002-01-01

    Objective: To investigate the association between the diversity of urease gene and urease activity of clinical isolates of Helicobacter pylori (H. pylori). Methods: Polymerase chain reaction-restriction fragment length polymorphism (PCR-RFLP) of urease gene and rapid urease activity test were used to study the urease activity of different clinical isolates of H. pylori. Results: H. pylori clinical isolates were divided into 4types according to their PCR-RFLP results of urease gene and urease activity. Type I , possessing strong urease activity (0. 11) and presented 1 fragment of 1.7 kb by PCR-RFLP, had close relations with gastric ulcer; type Ⅱ , with the weakest urease activity (0. 07) and 2 fragments (1.3 and 0. 4 kb respectively), was associated with duodenal bulb ulcer; type Ⅱ , with the strongest urease activity (0. 12) and 2 fragments (0. 4and 0. 17 kb) with or without 1 fragment (0. 23 or 0. 37 kb) , was responsible for gastritis; type Ⅳ, with weak urease activity (0. 09) and 2 fragments (1.5 and 0. 2 kb), was shown to be related to both gastric and duodenal bulb ulcers. Conclusion: The diversity of urease gene decides different urease activities of different clinical isolates of H. pylori, hence the different possibilities of pathogenesis due to this bacteria.

  17. Detection of Brucella sp. and Leptospira sp. in dogs using conventional polymerase chain reaction

    Directory of Open Access Journals (Sweden)

    Khamesipour Faham

    2014-12-01

    Full Text Available The study was conducted to detect Brucella sp. and Leptospira sp. in blood samples of dogs in Isfahan and Shahrekord province in Iran. A total of 94 blood samples were collected from dogs of different breed, age, sex, and dogs’ type (stray or nonstray. The samples were examined using conventional polymerase chain reaction (PCR. Fourteen (14.89% dogs were positive for Brucella sp. and 18 (19.15%. dogs for Leptospira sp. There were no significant differences between the prevalence of the pathogens, provinces, sex, and age groups (P > 0.05. However, there was a statistically significant difference in prevalence of Brucella sp. and Leptospira sp. between stray and non-stray dogs (P < 0.0001; χ2 = 30.3767. The study also demonstrated that PCR was successfully used for the first time in Iran for the detection of Brucella sp. and Leptospira sp. in blood samples of dogs. Therefore, we recommend the PCR as a supplementary method with other commonly recognised methods (e.g. serological methods for the diagnosis of subclinical infections with the microorganisms. Strict measures for the control of stray dogs are also highly recommended.

  18. Detection of Staphylococcus aureus in Dairy Products by Polymerase Chain Reaction Assay

    Institute of Scientific and Technical Information of China (English)

    YANG Yang; SU Xu-dong; YUAN Yao-wu; KANG Chun-yu; LI Ying-jun; ZHANG wei; ZHONG Xiao-ying

    2007-01-01

    A polymerase chain reaction (PCR) assay was employed for direct detection of Staphylococcus aureus without enrichment in dairy products. A solvent extraction procedure was successfully modified for the extraction of Staphylococcus aureus DNA from artificially contaminated whole milk, skim milk, and cheese. A primer targeting the thermostable nuclease gene (nuc) was used in the PCR. A DNA fragment of 279 bp was amplified. The PCR product was confirmed by DNA sequencing. In this study, the PCR, GB- 4789.10-94, Perifilm RSA.Count Plate, and Baird-Parker + RPF Agar were compared.The sensitivity of the PCR was 10 CFU mL-1 of whole milk, skim milk, and 55 CFU g-1 of cheese. The developed methodology allowed for detection of Staphylococcus aureus in dairy products in less than 6 h. The time taken for the development of this PCR assay was 12-24 h, less than the time taken by the general PCR assay using the enrichment method, and the coincidence rate of this developed PCR was 94.3%, the sensitivity was 100%. It was a rapid, sensitive, and effective method for PCR to detect Staphylococcus aureus in milk and milk products.

  19. Submicroscopic malaria parasite carriage: how reproducible are polymerase chain reaction-based methods?

    Directory of Open Access Journals (Sweden)

    Daniela Camargos Costa

    2014-02-01

    Full Text Available The polymerase chain reaction (PCR-based methods for the diagnosis of malaria infection are expected to accurately identify submicroscopic parasite carriers. Although a significant number of PCR protocols have been described, few studies have addressed the performance of PCR amplification in cases of field samples with submicroscopic malaria infection. Here, the reproducibility of two well-established PCR protocols (nested-PCR and real-time PCR for the Plasmodium 18 small subunit rRNA gene were evaluated in a panel of 34 blood field samples from individuals that are potential reservoirs of malaria infection, but were negative for malaria by optical microscopy. Regardless of the PCR protocol, a large variation between the PCR replicates was observed, leading to alternating positive and negative results in 38% (13 out of 34 of the samples. These findings were quite different from those obtained from the microscopy-positive patients or the unexposed individuals; the diagnosis of these individuals could be confirmed based on the high reproducibility and specificity of the PCR-based protocols. The limitation of PCR amplification was restricted to the field samples with very low levels of parasitaemia because titrations of the DNA templates were able to detect < 3 parasites/µL in the blood. In conclusion, conventional PCR protocols require careful interpretation in cases of submicroscopic malaria infection, as inconsistent and false-negative results can occur.

  20. Development and application of polymerase chain reaction test for detection of Conidiobolus lamprauges

    Directory of Open Access Journals (Sweden)

    Marcelo M. Silveira

    2013-12-01

    Full Text Available Conidiobolomycosis is a granulomatous disease caused by the fungus Conidiobolus spp. in humans and animals. Traditional technique for diagnosis of the disease is isolation of the agent associated with the presence of typical clinical signs and pathological conditions. The aim of this study was to describe the development of a specific polymerase chain reaction (PCR test for Conidiobolus lamprauges to detect the fungus in clinical samples. Samples from suspected animals were collected and submitted to isolation, histopathological analysis and amplification by PCR. DNA from tissues was subjected to PCR with fungi universal primers 18S rDNA gene, and specific primers were designed based on the same gene in C. lamprauges that generated products of about 540 bp and 222 bp respectively. The culture was positive in 26.6% of clinical samples. The PCR technique for C. lamprauges showed amplification of DNA from fresh tissues (80% and paraffin sections (44.4%. In conclusion, the PCR technique described here demonstrated a high sensitivity and specificity for detection of fungal DNA in tissue samples, providing a tool for the rapid diagnosis of C. lamprauges.

  1. Sensitive Detection of Thirteen Bacterial Vaginosis-Associated Agents Using Multiplex Polymerase Chain Reaction.

    Science.gov (United States)

    Malaguti, Natália; Bahls, Larissa Danielle; Uchimura, Nelson Shozo; Gimenes, Fabrícia; Consolaro, Marcia Edilaine Lopes

    2015-01-01

    Bacterial vaginosis (BV) is characterized by a polymicrobial proliferation of anaerobic bacteria and depletion of lactobacilli, which are components of natural vaginal microbiota. Currently, there are limited conventional methods for BV diagnosis, and these methods are time-consuming, expensive, and rarely allow for the detection of more than one agent simultaneously. Therefore, we conceived and validated a multiplex polymerase chain reaction (M-PCR) assay for the simultaneous screening of thirteen bacterial vaginosis-associated agents (BV-AAs) related to symptomatic BV: Gardnerella vaginalis, Mobiluncus curtisii, Mobiluncus mulieris, Bacteroides fragilis, Mycoplasma hominis, Atopobium vaginae, Ureaplasma urealyticum, Megasphaera type I, Clostridia-like bacteria vaginosis-associated bacteria (BVABs) 1, 2, and 3, Sneathia sanguinegens, and Mycoplasma genitalium. The overall validation parameters of M-PCR compared to single PCR (sPCR) were extremely high, including agreement of 99.1% and sensitivity, specificity, and positive predictive values of 100.0%, negative predictive value of 97.0%, accuracy of 99.3%, and agreement with Nugent results of 100.0%. The prevalence of BV-AAs was very high (72.6%), and simultaneous agents were detected in 53.0%, which demonstrates the effectiveness of the M-PCR assay. Therefore, the M-PCR assay has great potential to impact BV diagnostic methods in vaginal samples and diminish associated complications in the near future.

  2. Detection of Leuconostoc strains at a meat processing plant using polymerase chain reaction.

    Science.gov (United States)

    Goto, Seitaro; Takahashi, Hajime; Kawasaki, Susumu; Kimura, Bon; Fujii, Tateo; Nakatsuji, Miki; Watanabe, Itaru

    2004-02-01

    To simplify the labor-intensive conventional routine testing of samples to detect Leuconostoc at a meat processing plant, we developed polymerase chain reaction (PCR) primers specific for Leuconostoc from 16S rRNA gene sequences. These primers did not detect other common lactic acid bacteria such as Lactobacillus plantarum, Lact. sake, Lact. fermentum, Lact. acidophilus and Weissella viridescens. PCR with this primer detected all Leuconostoc species tested (Leu. mesenteroides subsp. mesenteroides, Leu. pseudomesenteroides, Leu. carnosum, Leu. lactic, Leu. citreum, Leu. amelibiosum, Leu. gelidum), except for Leu. fallax, and no other lactic acid bacteria on agarose gel electrophoresis. The method could identify areas contaminated with Leuconostoc in a large-scale industrial meat processing plant. Of 69 samples analyzed, 34 were positive for Leuconostoc according to the conventional culture method (isolation of LAB producing dextran) and PCR, whereas 29 were negative according to both. Six samples were culture-negative but positive by PCR. No false negative results were generated by PCR. The method is rapid and simple, is useful for routinely monitoring areas contaminated with Leuconostoc in meat processing plants, and could help to prevent the spoilage of meat products.

  3. Submicroscopic malaria parasite carriage: how reproducible are polymerase chain reaction-based methods?

    Science.gov (United States)

    Costa, Daniela Camargos; Madureira, Ana Paula; Amaral, Lara Cotta; Sanchez, Bruno Antônio Marinho; Gomes, Luciano Teixeira; Fontes, Cor Jésus Fernandes; Limongi, Jean Ezequiel; Brito, Cristiana Ferreira Alves de; Carvalho, Luzia Helena

    2014-02-01

    The polymerase chain reaction (PCR)-based methods for the diagnosis of malaria infection are expected to accurately identify submicroscopic parasite carriers. Although a significant number of PCR protocols have been described, few studies have addressed the performance of PCR amplification in cases of field samples with submicroscopic malaria infection. Here, the reproducibility of two well-established PCR protocols (nested-PCR and real-time PCR for the Plasmodium 18 small subunit rRNA gene) were evaluated in a panel of 34 blood field samples from individuals that are potential reservoirs of malaria infection, but were negative for malaria by optical microscopy. Regardless of the PCR protocol, a large variation between the PCR replicates was observed, leading to alternating positive and negative results in 38% (13 out of 34) of the samples. These findings were quite different from those obtained from the microscopy-positive patients or the unexposed individuals; the diagnosis of these individuals could be confirmed based on the high reproducibility and specificity of the PCR-based protocols. The limitation of PCR amplification was restricted to the field samples with very low levels of parasitaemia because titrations of the DNA templates were able to detect < 3 parasites/µL in the blood. In conclusion, conventional PCR protocols require careful interpretation in cases of submicroscopic malaria infection, as inconsistent and false-negative results can occur.

  4. Laboratory reporting accuracy of polymerase chain reaction testing for avian polyomavirus.

    Science.gov (United States)

    Fitzgerald, Brenna; Olsen, Geoff; Speer, Brian

    2013-03-01

    Polymerase chain reaction (PCR) assays are available for detection of birds infected with avian polyomavirus (APV). Several laboratories offer this diagnostic assay in the United States, but little information is available regarding assay sensitivity, specificity, and accuracy. In this study, known APV-positive and APV-negative samples (each n = 10, 5 undiluted and 5 diluted) were sent to 5 commercial laboratories. A significant difference in reporting accuracy was found among laboratories, most notably for dilute APV-positive samples. Two out of 5 laboratories provided 100% accurate results, 1 had an accuracy of 90%, and 2 reported 80% and 75% accuracy, respectively. The accuracies of the last 2 laboratories were negatively affected by test sensitivities of 60% and 50%, respectively. These findings show that although accurate results were reported by most laboratories, both false-positive and false-negative results were reported by at least 3 laboratories, and false-negative results reported for dilute APV-positive samples predominated. These study findings illustrate a need for veterinary diagnostic laboratories to institute improved voluntary quality control measures.

  5. Analysis ulcerative colitis for presence Epstein-Barr virus DNA sequences by polymerase chain reaction technique

    Directory of Open Access Journals (Sweden)

    Sahar Mehrabani khasraghi

    2016-02-01

    Full Text Available Introduction: Ulcerative colitis (UC is one type of inflammatory bowel disease (IBD. The purpose of this study is to explore the prevalence of Epstein–Barr virus (EBV in UC patients in comparison with healthy subjects using the polymerase chain reaction (PCR method. Methods: In this case-control study, five biopsies of patients with UC and 30 healthy people as controls were selected. Sampling was performed by endoscopic biopsy operation. After DNA extraction, PCR was used to determine EBV genome by specific primers. Statistical analysis was performed using the chi-square test. Results: The results of PCR indicated that EBV genome was detected in 60.0% of samples in the case group, and 36.7% of samples in the control group were positive for EBV. Thus, no significant association was observed between the prevalence of EBV and incidence of UC in comparison with the control group (P = 0.36. Conclusion: The findings presented herein demonstrate no direct molecular evidence to support an association of EBV with UC. These results, do not exclude the possibility oncogenic role of EBV to infect the different colon cell.

  6. Determination of Sperm Sex Ratio in Bovine Semen Using Multiplex Real-time Polymerase Chain Reaction.

    Science.gov (United States)

    Khamlor, Trisadee; Pongpiachan, Petai; Sangsritavong, Siwat; Chokesajjawatee, Nipa

    2014-10-01

    Gender selection is important in livestock industries; for example, female calves are required in the dairy industry. Sex-sorted semen is commonly used for the production of calves of the desired gender. However, assessment of the sex ratio of the sorted semen is tedious and expensive. In this study, a rapid, cost effective and reliable method for determining the sex ratio was developed using a multiplex real-time polymerase chain reaction (PCR) assay. In this assay, the X and Y chromosome-specific markers, i.e., bovine proteolipid protein (PLP) gene and sex-determining region Y (SRY) were simultaneously quantified in a single tube. The multiplex real-time PCR assay was shown to have high amplification efficiencies (97% to 99%) comparable to the separated-tube simplex real-time PCR assay. The results obtained from both assays were not significantly different (p>0.05). The multiplex assay was validated using reference DNA of known X ratio (10%, 50%, and 90%) as templates. The measured %X in semen samples were the same within 95% confidence intervals as the expected values, i.e., >90% in X-sorted semen, PCR assay as shown in this study can thus be used to assess purity of sex-sorted semen.

  7. A power-efficient thermocycler based on induction heating for DNA amplification by polymerase chain reaction

    Science.gov (United States)

    Pal, Debjani; Venkataraman, V.; Mohan, K. Naga; Chandra, H. Sharat; Natarajan, Vasant

    2004-09-01

    We have built a thermocycler based on the principles of induction heating for polymerase chain reaction (PCR) of target sequences in DNA samples of interest. The cycler has an average heating rate of ˜0.8 °C/s and a cooling rate of ˜0.5 °C/s, and typically takes ˜4 h to complete a 40-cycle PCR protocol. It is power-efficient (˜6 W per reaction tube), micro-processor controlled, and can be adapted for battery operation. Using this instrument, we have successfully amplified a 350 bp segment from a plasmid and SRY, the human sex determining gene, which occurs as a single-copy sequence in genomic DNA of human males. The PCR products from this thermocycler are comparable to those obtained by the use of commercially available machines. Its easy front-end operation, low-power design, portability and low cost makes it suitable for diagnostic field applications of PCR.

  8. Cattle fetal sex determination by polymerase chain reaction using DNA isolated from maternal plasma.

    Science.gov (United States)

    da Cruz, A S; Silva, D C; Costa, E O A; De M-Jr, P; da Silva, C C; Silva, D M; da Cruz, A D

    2012-03-01

    The objective of this study was to evaluate the use of polymerase chain reaction analysis (PCR) of fetal cells/DNA in the maternal plasma of pregnant cows to determine the sex of the fetus. Plasma was harvested from 35 cows of mixed genotype at different stages of pregnancy ranging from 5 to 35 weeks. A male calf and a heifer calf provided the control samples. Fetal sex was determined by amplification of Y-specific sequences. For the 35 cows, the fetal sex predicted by this technique was in accordance with the sex of the calf at birth in 88.6% of cases. The agreement between predicted and observed fetal sex was less for cows with a gestational length of 35-48 days (63.6%). Regression analysis showed that there was a strong relationship between the probability of correctly predicting fetal sex and the stage of gestation. It was estimated that the test performed at 43.8 days post fertilization would have 95% accuracy, increasing to 99% accuracy for testing at 48.4 days and 99.9% accuracy for tests at 55.0 days or later. It was concluded that PCR analysis of fetal cells in maternal plasma can be used to predict successfully the sex of the fetus in cattle.

  9. Polymerase chain reaction and real-time PCR for diagnosing of Leishmania infantum chagasi in dogs.

    Science.gov (United States)

    Ramos, Rafael Antonio do Nascimento; Ramos, Carlos Alberto do Nascimento; Jusi, Márcia Mariza Gomes; de Araújo, Flábio Ribeiro; Machado, Rosangela Zacarias; Faustino, Maria Aparecida da Glória; Alves, Leucio Câmara

    2012-01-01

    The importance of dogs as a reservoir for Leishmania infantumchagasi in urban environments has stimulated numerous studies assessing diagnostic techniques. When performed properly, such procedures are an important step in preventing leishmaniasis in humans. Molecular methods have become prominent for this purpose. The aim of the present study was to determine the performance of the polymerase chain reaction (PCR) and real-time PCR (qPCR) for diagnosing of canine visceral leishmaniasis (CVL) using different biological samples. For this, 35 dogs from an area endemic for CVL were used. Bone marrow aspirate and lymph node and spleen fragments from these dogs were used for the molecular diagnosis. In the present study, qPCR was able to detect a greater number of positive animals than seen with PCR. Among the different biological samples used, there was no significant difference in L. infantumchagasi DNA detection between PCR and qPCR. However, considering that lymph nodes are easy to acquire, these can be considered to be the best samples for making molecular diagnoses of L. infantum chagasi infection.

  10. Molecular sexing of birds: A comparative review of polymerase chain reaction (PCR)-based methods.

    Science.gov (United States)

    Morinha, F; Cabral, J A; Bastos, E

    2012-09-01

    Accurate identification of sex in birds is important for the management and conservation of avian wildlife in several ways, namely in the development of population, behavioral and ecological studies, as well as in the improvement of ex situ captive breeding programs. In general, nestlings, juveniles and adult birds of a wide number of sexually monomorphic species cannot be sexed based on phenotypic traits. The development of molecular methodologies for avian sexing overcame these difficulties, allowing a reliable gender differentiation for these species. The polymerase chain reaction (PCR)-based methods have been widely applied in molecular sexing of birds, using a large diversity of sex-linked markers. During the last 15 yrs, there was a continuous improvement in the PCR-based protocols for bird sexing, increasing the accuracy, speed and high-throughput applicability of these techniques. The recent advances in real-time PCR platforms and whole genome analysis methods provided new resources for the detection and analysis of novel specific markers and protocols. This review presents a comparative guide of classical and recent advances in PCR-based methods for avian molecular sexing, highlighting its strengths and limitations. Future research opportunities in this field are also addressed.

  11. Detection of helicobacter pylori in benign laryngeal lesions by polymerase chain reaction: a cross sectional study

    Directory of Open Access Journals (Sweden)

    Izadi Farzad

    2012-04-01

    Full Text Available Abstract Background Although Helicobacter Pylori (HP was detected in some cases of chronic laryngitis, the results were not confirmed by polymerase chain reaction (PCR. By this time, it has not been found in laryngeal lesions by in house PCR, the most sensitive method for detecting the genome tracks. Regarding the previous results and also few numbers of studies about the presence of HP in benign laryngeal lesions, specifically by PCR, we aimed to investigate the presence of HP in benign laryngeal lesions by in-house PCR. Methods The samples were taken from 55 patients with benign laryngeal lesions and frozen in −20°C. One milliliter (ml of lysis buffer was added to 100 mg (mg of each sample and the tube was placed in 56°C overnight. Then DNA extraction was carried out. Results To find HP DNA, in-house PCR was performed that revealed 5 positive results among 55 patients with benign laryngeal lesions. Of them, 3 were polyp, 1 was nodule and 1 was papilloma. Conclusion Although the number of positive results was not a lot in this study, it was in contrast with previous studies which could not find any HP tracks in benign laryngeal lesions by other methods. More studies about the prevalence of HP in benign laryngeal lesions improve judging about the effect of this infection on benign laryngeal lesions.

  12. Accuracy of mucocutaneous leishmaniasis diagnosis using polymerase chain reaction: systematic literature review and meta-analysis

    Directory of Open Access Journals (Sweden)

    Ciro Martins Gomes

    2015-04-01

    Full Text Available The diagnosis of mucocutaneous leishmaniasis (MCL is hampered by the absence of a gold standard. An accurate diagnosis is essential because of the high toxicity of the medications for the disease. This study aimed to assess the ability of polymerase chain reaction (PCR to identify MCL and to compare these results with clinical research recently published by the authors. A systematic literature review based on the Preferred Reporting Items for Systematic Reviews and Meta-Analyses: the PRISMA Statement was performed using comprehensive search criteria and communication with the authors. A meta-analysis considering the estimates of the univariate and bivariate models was performed. Specificity near 100% was common among the papers. The primary reason for accuracy differences was sensitivity. The meta-analysis, which was only possible for PCR samples of lesion fragments, revealed a sensitivity of 71% [95% confidence interval (CI = 0.59; 0.81] and a specificity of 93% (95% CI = 0.83; 0.98 in the bivariate model. The search for measures that could increase the sensitivity of PCR should be encouraged. The quality of the collected material and the optimisation of the amplification of genetic material should be prioritised.

  13. A multiplex real-time polymerase chain reaction assay to diagnose Epiphyas postvittana (Lepidoptera: Tortricidae).

    Science.gov (United States)

    Barr, N B; Ledezma, L A; Farris, R E; Epstein, M E; Gilligan, T M

    2011-10-01

    A molecular assay for diagnosis of light brown apple moth, Epiphyas postvittana (Walker) (Lepidoptera: Tortricidae), in North America is reported. The assay multiplexes two TaqMan real-time polymerase chain reaction (RT-PCR) probe systems that are designed to target DNA segments of the internal transcribed spacer region 2 (ITS2) and 18S rRNA gene. The RT-PCR probe designed for the 18S target recognizes a DNA sequence conserved in all of the moths included in the study and functions as a control in the assay. The second probe recognizes a segment of the ITS2 specifically found in E. postvittana and not found in the other moths included in the study, i.e., this segment is not conserved. Inclusion of the two markers in a single multiplex reaction did not affect assay performance. The assay was tested against 637 moths representing > 90 taxa in 15 tribes in all three subfamilies in the Tortricidae. The assay generated no false negatives based on analysis of 355 E. postvittana collected from California, Hawaii, England, New Zealand, and Australia. Analysis of a data set including 282 moths representing 41 genera generated no false positives. Only three inconclusive results were generated from the 637 samples. Spike experiments demonstrated that DNA contamination in the assay can affect samples differently. Contaminated samples analyzed with the ITS2 RT-PCR assay and DNA barcode methodology by using the cytochrome oxidase I gene can generate contradictory diagnoses.

  14. Detection of Listeria monocytogenes in cheese with the magnetic immuno-polymerase chain reaction assay.

    Science.gov (United States)

    Fluit, A C; Torensma, R; Visser, M J; Aarsman, C J; Poppelier, M J; Keller, B H; Klapwijk, P; Verhoef, J

    1993-05-01

    A new detection system, the magnetic immuno-polymerase chain reaction (PCR) assay (MIPA) has been developed to detect Listeria monocytogenes in food. This method separates Listeria cells from PCR-inhibitory factors present in enrichment broths containing food samples by using magnetic beads coated with specific monoclonal antibodies (MAbs). The separated bacteria were lysed, and the supernatant containing the bacterial DNA was subjected to the PCR. Detection of L. monocytogenes in three naturally contaminated cheese samples with two different MAbs and PCR primers specific for the gene encoding the delayed-hypersensitivity factor showed that with MAb 55 all three samples were positive whereas with MAb A two samples were positive. A further improvement of the method was obtained by using a PCR step based on the listeriolysin O gene. A MIPA employing MAb 55 and the listeriolysin O gene primer set detected L. monocytogenes after 24 h of culture in Listeria Enrichment Broth samples from Port Salut artificially contaminated with 40 CFU/25 g. We could detect 1 CFU of L. monocytogenes per g of cheese after a second enrichment for 24 h in Fraser broth. The analysis time including both enrichments is approximately 55 h.

  15. An evaluation of serotyping of Avibacterium paragallinarum by use of a multiplex polymerase chain reaction.

    Science.gov (United States)

    Morales-Erasto, Vladimir; Posadas-Quintana, José de Jesús; Fernández-Díaz, Manolo; Saravia, Luis E; Martínez-Castañeda, José Simón; Blackall, Patrick J; Soriano-Vargas, Edgardo

    2014-03-01

    In the present study, the ability of a recently proposed multiplex polymerase chain reaction (mPCR) to determine the serogroups (A, B, and C) of Avibacterium paragallinarum was evaluated. A total of 12 reference strains and 69 field isolates of Av. paragallinarum from Ecuador, Mexico, Panama, and Peru were included in the study. With some exceptions (which were serotyped in the current study), all of the isolates and strains had been previously examined by 2 serotyping schemes (Page and Kume) or were the formal reference strains for the schemes. Three of 6 (50%) reference strains of serogroup A, 2 (100%) of serogroup B, and 1 of 4 (25%) reference strains of serogroup C were correctly serotyped by the mPCR. With the field isolates, the mPCR correctly recognized 16 of the 17 serogroup A isolates, 10 of the 12 serogroup B isolates, and 18 of the 37 serogroup C isolates. Overall, the specificity and sensitivity of the PCR test was as follows: 82.6% and 87.3% (serogroup A), 85.7% and 71.9% (serogroup B), and 46.3% and 100% (serogroup C). The poor performance of the mPCR in terms of recognition of serogroup C isolates (low sensitivity of 46.3%) and the relatively high level of uncertainty about the accuracy of the serogroup A and B results (specificity of 87.3% and 71.9%, respectively) means that the assay cannot be recommended as a replacement for conventional serotyping.

  16. Diagnosis of Brazilian vesiculoviruses by reverse transcription-polymerase chain reaction

    Directory of Open Access Journals (Sweden)

    Daniela Wey Bonutti

    2005-04-01

    Full Text Available We describe a reverse transcription-polymerase chain reaction (RT-PCR and a nested-PCR for diagnosis of Piry, Carajás, Cocal, and Alagoas vesiculoviruses from Brazil. The RNA extracts of viral and clinical samples were submitted to a RT-PCR using Vesiculovirus G primers that amplify part of the glycoprotein gene. The RT-PCR produced amplicons of expected size, 290 base pair, for the four studied viruses. The RT-PCR showed a high sensitivity being 151.3 times (2.18 log more sensitive for the detection of Piry virus than the classical procedure for virus detection in tissue culture based on the viral cytophatic effect. Amplicons had nucleotides sequenced and were aligned in order to select internal primers for a nested-PCR to confirm the origin of Piry, Carajás, Cocal, and Alagoas Vesiculovirus. Ten blood and tarsal pad epithelial samples of infected Guinea-pigs had Vesiculovirus genome amplified by RT-nested-PCR.

  17. Molecular identification of Giardia duodenalis in Ecuador by polymerase chain reaction-restriction fragment length polymorphism

    Directory of Open Access Journals (Sweden)

    Richard Atherton

    2013-06-01

    Full Text Available The aim of this study was to determine the genetic diversity of Giardia duodenalis present in a human population living in a northern Ecuadorian rain forest. All Giardia positive samples (based on an ELISA assay were analysed using a semi-nested polymerase chain reaction-restriction fragment length polymorphism assay that targets the glutamate dehydrogenase (gdh gene; those amplified were subsequently genotyped using NlaIV and RsaI enzymes. The gdh gene was successfully amplified in 74 of 154 ELISA positive samples; 69 of the 74 samples were subsequently genotyped. Of these 69 samples, 42 (61% were classified as assemblage B (26 as BIII and 16 as BIV, 22 (32% as assemblage A (3 as AI and 19 as AII and five (7% as mixed AII and BIII types. In this study site we observe similar diversity in genotypes to other regions in Latin America, though in contrast to some previous studies, we found similar levels of diarrheal symptoms in those individuals infected with assemblage B compared with those infected with assemblage A.

  18. Detection of HCV-RNA by Reverse Transcription Polymerase Chain Reaction Using Biotinylated and Radioiodinated Primers

    Energy Technology Data Exchange (ETDEWEB)

    Ryu, Jin Sook; Moon, Dae Hyuk; Cheon, Jun Hong; Chung, Yoon Young; Park, Hung Dong; Chung, Young Hwa; Lee, Young Sang [Asan Medical Center, University of Ulsan, Seoul (Korea, Republic of)

    1994-07-15

    This study was performed to evaluate the clinical applicability of the reverse transcription polymerase chain reaction (RT-PCR) kit of HCV-RNA using biotinylated and radioiodinated primers. Study subjects were 118 patients with positive anti-HCV. HCV-RNA in patients serum was extracted by guanidium thiocyanate method. After first amplification, the product was reamplified by primers labelled with biotin and I-125. The final amplification product was detected by counting the radioactivity after incubation in avidin coated tubes. In 51 samples, the test was repeated for evaluation of reproducibility. This new method was also compared with conventional RT-PCR methods in 34 samples from patients with chronic liver disease. The results were as follows, 1) HCV-RNA was positive in 85(97%)of 88 patients with chronic liver disease, and in 23 (73%) of 30 patients with normal liver function. 2) In comparison with conventional method, HCV-RNA was detected in 32(94%) of 34 patients with new method, whereas in 27(79% ) of the same group with conventional method 3) Repeated test with new method in 52 samples demonstrated 82% of concordant result. In conclusion, new method with biotinylated and radioiodinated primers was more sensitive than conventional method. However, great care must be taken for quality control because there were considerable interassay variation and possibility of false positivity and false negativity.

  19. An improved electrochemiluminescence polymerase chain reaction method for highly sensitive detection of plant viruses

    Energy Technology Data Exchange (ETDEWEB)

    Tang Yabing [MOE Key Laboratory of Laser Life Science and Institute of Laser Life Science, South China Normal University, Guangzhou 510631 (China); Xing Da [MOE Key Laboratory of Laser Life Science and Institute of Laser Life Science, South China Normal University, Guangzhou 510631 (China)]. E-mail: xingda@scnu.edu.cn; Zhu Debin [MOE Key Laboratory of Laser Life Science and Institute of Laser Life Science, South China Normal University, Guangzhou 510631 (China); Liu Jinfeng [MOE Key Laboratory of Laser Life Science and Institute of Laser Life Science, South China Normal University, Guangzhou 510631 (China)

    2007-01-23

    Recently, we have reported an electrochemiluminescence polymerase chain reaction (ECL-PCR) method for detection of genetically modified organisms. The ECL-PCR method was further improved in the current study by introducing a multi-purpose nucleic acid sequence that was specific to the tris(bipyridine) ruthenium (TBR) labeled probe, into the 5' terminal of the primers. The method was applied to detect plant viruses. Conserved sequence of the plant viruses was amplified by PCR. The product was hybridized with a biotin labeled probe and a TBR labeled probe. The hybridization product was separated by streptavidin-coated magnetic beads, and detected by measuring the ECL signals of the TBR labeled. Under the optimized conditions, the experiment results show that the detection limit is 50 fmol of PCR products, and the signal-to-noise ratio is in excess of 14.6. The method was used to detect banana streak virus, banana bunchy top virus, and papaya leaf curl virus. The experiment results show that this method could reliably identity viruses infected plant samples. The improved ECL-PCR approach has higher sensitivity and lower cost than previous approach. It can effectively detect the plant viruses with simplicity, stability, and high sensitivity.

  20. Coccidioidomycosis: adenosine deaminase levels, serologic parameters, culture results, and polymerase chain reaction testing in pleural fluid.

    Science.gov (United States)

    Thompson, George R; Sharma, Shobha; Bays, Derek J; Pruitt, Rachel; Engelthaler, David M; Bowers, Jolene; Driebe, Elizabeth M; Davis, Michael; Libke, Robert; Cohen, Stuart H; Pappagianis, Demosthenes

    2013-03-01

    In a patient with positive serum serology for coccidioidomycosis, the differential diagnosis of concurrent pleural effusions can be challenging. We, therefore, sought to clarify the performance characteristics of biochemical, serologic, and nucleic-acid-based testing in an attempt to avoid invasive procedures. The utility of adenosine deaminase (ADA), coccidioidal serology, and polymerase chain reaction (PCR) in the evaluation of pleuropulmonary coccidioidomycosis has not been previously reported. Forty consecutive patients evaluated for pleuropulmonary coccidioidomycosis were included. Demographic data, pleural fluid values, culture results, and clinical diagnoses were obtained from patient chart review. ADA testing was performed by ARUP Laboratories, coccidioidal serologic testing was performed by the University of California-Davis coccidioidomycosis serology laboratory, and PCR testing was performed by the Translational Genomics Research Institute using a previously published methodology. Fifteen patients were diagnosed with pleuropulmonary coccidioidomycosis by European Organization for the Research and Treatment of Cancer/Mycoses Study Group criteria. Pleural fluid ADA concentrations were coccidioidomycosis were not elevated in this study. The sensitivity and specificity of coccidioidal serologic testing in nonserum samples remained high, but the clinical usefulness of PCR testing in pleural fluid was disappointing and was comparable to pleural fluid culture.