WorldWideScience

Sample records for quadruplexes sequence effects

  1. Conformation and stability of intramolecular telomeric G-quadruplexes: sequence effects in the loops.

    Directory of Open Access Journals (Sweden)

    Giovanna Sattin

    Full Text Available Telomeres are guanine-rich sequences that protect the ends of chromosomes. These regions can fold into G-quadruplex structures and their stabilization by G-quadruplex ligands has been employed as an anticancer strategy. Genetic analysis in human telomeres revealed extensive allelic variation restricted to loop bases, indicating that the variant telomeric sequences maintain the ability to fold into G-quadruplex. To assess the effect of mutations in loop bases on G-quadruplex folding and stability, we performed a comprehensive analysis of mutant telomeric sequences by spectroscopic techniques, molecular dynamics simulations and gel electrophoresis. We found that when the first position in the loop was mutated from T to C or A the resulting structure adopted a less stable antiparallel topology; when the second position was mutated to C or A, lower thermal stability and no evident conformational change were observed; in contrast, substitution of the third position from A to C induced a more stable and original hybrid conformation, while mutation to T did not significantly affect G-quadruplex topology and stability. Our results indicate that allelic variations generate G-quadruplex telomeric structures with variable conformation and stability. This aspect needs to be taken into account when designing new potential anticancer molecules.

  2. Giardia telomeric sequence d(TAGGG)4 forms two intramolecular G-quadruplexes in K+ solution: effect of loop length and sequence on the folding topology.

    Science.gov (United States)

    Hu, Lanying; Lim, Kah Wai; Bouaziz, Serge; Phan, Anh Tuân

    2009-11-25

    Recently, it has been shown that in K(+) solution the human telomeric sequence d[TAGGG(TTAGGG)(3)] forms a (3 + 1) intramolecular G-quadruplex, while the Bombyx mori telomeric sequence d[TAGG(TTAGG)(3)], which differs from the human counterpart only by one G deletion in each repeat, forms a chair-type intramolecular G-quadruplex, indicating an effect of G-tract length on the folding topology of G-quadruplexes. To explore the effect of loop length and sequence on the folding topology of G-quadruplexes, here we examine the structure of the four-repeat Giardia telomeric sequence d[TAGGG(TAGGG)(3)], which differs from the human counterpart only by one T deletion within the non-G linker in each repeat. We show by NMR that this sequence forms two different intramolecular G-quadruplexes in K(+) solution. The first one is a novel basket-type antiparallel-stranded G-quadruplex containing two G-tetrads, a G x (A-G) triad, and two A x T base pairs; the three loops are consecutively edgewise-diagonal-edgewise. The second one is a propeller-type parallel-stranded G-quadruplex involving three G-tetrads; the three loops are all double-chain-reversal. Recurrence of several structural elements in the observed structures suggests a "cut and paste" principle for the design and prediction of G-quadruplex topologies, for which different elements could be extracted from one G-quadruplex and inserted into another.

  3. Effect of ATRX and G-Quadruplex Formation by the VNTR Sequence on α-Globin Gene Expression.

    Science.gov (United States)

    Li, Yue; Syed, Junetha; Suzuki, Yuki; Asamitsu, Sefan; Shioda, Norifumi; Wada, Takahito; Sugiyama, Hiroshi

    2016-05-17

    ATR-X (α-thalassemia/mental retardation X-linked) syndrome is caused by mutations in chromatin remodeler ATRX. ATRX can bind the variable number of tandem repeats (VNTR) sequence in the promoter region of the α-globin gene cluster. The VNTR sequence, which contains the potential G-quadruplex-forming sequence CGC(GGGGCGGGG)n , is involved in the downregulation of α-globin expression. We investigated G-quadruplex and i-motif formation in single-stranded DNA and long double-stranded DNA. The promoter region without the VNTR sequence showed approximately twofold higher luciferase activity than the promoter region harboring the VNTR sequence. G-quadruplex stabilizers hemin and TMPyP4 reduced the luciferase activity, whereas expression of ATRX led to a recovery in reporter activity. Our results demonstrate that stable G-quadruplex formation by the VNTR sequence downregulates the expression of α-globin genes and that ATRX might bind to and resolve the G-quadruplex. © 2016 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  4. Distance-dependent duplex DNA destabilization proximal to G-quadruplex/i-motif sequences

    Science.gov (United States)

    König, Sebastian L. B.; Huppert, Julian L.; Sigel, Roland K. O.; Evans, Amanda C.

    2013-01-01

    G-quadruplexes and i-motifs are complementary examples of non-canonical nucleic acid substructure conformations. G-quadruplex thermodynamic stability has been extensively studied for a variety of base sequences, but the degree of duplex destabilization that adjacent quadruplex structure formation can cause has yet to be fully addressed. Stable in vivo formation of these alternative nucleic acid structures is likely to be highly dependent on whether sufficient spacing exists between neighbouring duplex- and quadruplex-/i-motif-forming regions to accommodate quadruplexes or i-motifs without disrupting duplex stability. Prediction of putative G-quadruplex-forming regions is likely to be assisted by further understanding of what distance (number of base pairs) is required for duplexes to remain stable as quadruplexes or i-motifs form. Using oligonucleotide constructs derived from precedented G-quadruplexes and i-motif-forming bcl-2 P1 promoter region, initial biophysical stability studies indicate that the formation of G-quadruplex and i-motif conformations do destabilize proximal duplex regions. The undermining effect that quadruplex formation can have on duplex stability is mitigated with increased distance from the duplex region: a spacing of five base pairs or more is sufficient to maintain duplex stability proximal to predicted quadruplex/i-motif-forming regions. PMID:23771141

  5. Effect of Urea on G-Quadruplex Stability.

    Science.gov (United States)

    Aslanyan, Lusine; Ko, Jordan; Kim, Byul G; Vardanyan, Ishkhan; Dalyan, Yeva B; Chalikian, Tigran V

    2017-07-13

    G-quadruplexes represent a class of noncanonical nucleic acid structures implicated in transcriptional regulation, cellular function, and disease. An understanding of the forces involved in stabilization and destabilization of the G-quadruplex conformation relative to the duplex or single-stranded conformation is a key to elucidating the biological role of G-quadruplex-based genomic switches and the quest for therapeutic means for controlled induction or suppression of a G-quadruplex at selected genomic loci. Solute-solvent interactions provide a ubiquitous and, in many cases, the determining thermodynamic force in maintaining and modulating the stability of nucleic acids. These interactions involve water as well as water-soluble cosolvents that may be present in the solution or in the crowded environment in the cell. We present here the first quantitative investigation of the effect of urea, a destabilizing cosolvent, on the conformational preferences of a G-quadruplex formed by the telomeric d[A(G 3 T 2 A) 3 G 3 ] sequence (Tel22). At 20 mM NaCl and room temperature, Tel22 undergoes a two-state urea-induced unfolding transition. An increase in salt mitigates the deleterious effect of urea on Tel22. The urea m-value of Tel22 normalized per change in solvent-accessible surface area, ΔS A , is similar to those for other DNA and RNA structures while being several-fold larger than that of proteins. Our results suggest that urea can be employed as an analytical tool in thermodynamic characterizations of G-quadruplexes in a manner similar to the use of urea in protein studies. We emphasize the need for further studies involving a larger selection of G-quadruplexes varying in sequence, topology (parallel, antiparallel, hybrid), and molecularity (monomolecular, bimolecular, tetramolecular) to outline the advantages and the limits of the use of urea in G-quadruplex studies. A deeper understanding of the effect of solvent and cosolvents on the differential stability of the

  6. Selection of G-quadruplex folding topology with LNA-modified human telomeric sequences in K+ solution

    DEFF Research Database (Denmark)

    Pradhan, Devranjan; Hansen, Lykke H; Vester, Birte

    2011-01-01

    G-rich nucleic acid oligomers can form G-quadruplexes built by G-tetrads stacked upon each other. Depending on the nucleotide sequence, G-quadruplexes fold mainly with two topologies: parallel, in which all G-tracts are oriented parallel to each other, or antiparallel, in which one or more G......-tracts are oriented antiparallel to the other G-tracts. In the former topology, all glycosidic bond angles conform to anti conformations, while in the latter topology they adopt both syn and anti conformations. It is of interest to understand the molecular forces that govern G-quadruplex folding. Here, we approach...... this problem by examining the impact of LNA (locked nucleic acid) modifications on the folding topology of the dimeric model system of the human telomere sequence. In solution, this DNA G-quadruplex forms a mixture of G-quadruplexes with antiparallel and parallel topologies. Using CD and NMR spectroscopies, we...

  7. Sugar-modified G-quadruplexes: effects of LNA-, 2′F-RNA– and 2′F-ANA-guanosine chemistries on G-quadruplex structure and stability

    Science.gov (United States)

    Li, Zhe; Lech, Christopher Jacques; Phan, Anh Tuân

    2014-01-01

    G-quadruplex-forming oligonucleotides containing modified nucleotide chemistries have demonstrated promising pharmaceutical potential. In this work, we systematically investigate the effects of sugar-modified guanosines on the structure and stability of a (4+0) parallel and a (3+1) hybrid G-quadruplex using over 60 modified sequences containing a single-position substitution of 2′-O-4′-C-methylene-guanosine (LNAG), 2′-deoxy-2′-fluoro-riboguanosine (FG) or 2′-deoxy-2′-fluoro-arabinoguanosine (FANAG). Our results are summarized in two parts: (I) Generally, LNAG substitutions into ‘anti’ position guanines within a guanine-tetrad lead to a more stable G-quadruplex, while substitutions into ‘syn’ positions disrupt the native G-quadruplex conformation. However, some interesting exceptions to this trend are observed. We discover that a LNAG modification upstream of a short propeller loop hinders G-quadruplex formation. (II) A single substitution of either FG or FANAG into a ‘syn’ position is powerful enough to perturb the (3+1) G-quadruplex. Substitution of either FG or FANAG into any ‘anti’ position is well tolerated in the two G-quadruplex scaffolds. FANAG substitutions to ‘anti’ positions are better tolerated than their FG counterparts. In both scaffolds, FANAG substitutions to the central tetrad layer are observed to be the most stabilizing. The observations reported herein on the effects of LNAG, FG and FANAG modifications on G-quadruplex structure and stability will enable the future design of pharmaceutically relevant oligonucleotides. PMID:24371274

  8. Duplex/quadruplex oligonucleotides: Role of the duplex domain in the stabilization of a new generation of highly effective anti-thrombin aptamers.

    Science.gov (United States)

    Russo Krauss, Irene; Napolitano, Valeria; Petraccone, Luigi; Troisi, Romualdo; Spiridonova, Vera; Mattia, Carlo Andrea; Sica, Filomena

    2018-02-01

    Recently, mixed duplex/quadruplex oligonucleotides have attracted great interest for use as biomedical aptamers. In the case of anti-thrombin aptamers, the addition of duplex-forming sequences to a G-quadruplex module identical or very similar to the best-known G-quadruplex of the Thrombin Binding Aptamer (HD1) results in new or improved biological properties, such as higher activity or different recognition properties with respect to HD1. Remarkably, this bimodular fold was hypothesized, based on its sequence, for the only anti-thrombin aptamer in advanced clinical trial, NU172. Whereas cation modulation of G-quadruplex conformation and stability is well characterized, only few data from similar analysis on duplex/quadruplex oligonucleotides exist. Here we have performed a characterization of structure and stability of four different duplex/quadruplex anti-thrombin aptamers, including NU172, in the presence of different cations and in physiological-mimicking conditions in comparison to HD1, by means of spectroscopic techniques (UV and circular dichroism) and differential scanning calorimetry. Our data show a strong reciprocal influence of each domain on the stability of the other and in particular suggest a stabilizing effect of the duplex region in the presence of solutions mimicking the physiological conditions, strengthening the idea that bimodular aptamers present better therapeutic potentialities than those containing a single G-quadruplex domain. Copyright © 2017 Elsevier B.V. All rights reserved.

  9. Effects of trimethylamine N-oxide and urea on DNA duplex and G-quadruplex.

    Science.gov (United States)

    Ueda, Yu-Mi; Zouzumi, Yu-Ki; Maruyama, Atsushi; Nakano, Shu-Ichi; Sugimoto, Naoki; Miyoshi, Daisuke

    2016-01-01

    We systematically investigated effects of molecular crowding with trimethylamine N -oxide (TMAO) as a zwitterionic and protective osmolyte and urea as a nonionic denaturing osmolyte on conformation and thermodynamics of the canonical DNA duplex and the non-canonical DNA G-quadruplex. It was found that TMAO and urea stabilized and destabilized, respectively, the G-quadruplex. On the other hand, these osmolytes generally destabilize the duplex; however, it was observed that osmolytes having the trimethylamine group stabilized the duplex at the lower concentrations because of a direct binding to a groove of the duplex. These results are useful not only to predict DNA structures and their thermodynamics under physiological environments in living cells, but also design of polymers and materials to regulate structure and stability of DNA sequences.

  10. Investigation of a Quadruplex-Forming Repeat Sequence Highly Enriched in Xanthomonas and Nostoc sp.

    Science.gov (United States)

    Rehm, Charlotte; Wurmthaler, Lena A; Li, Yuanhao; Frickey, Tancred; Hartig, Jörg S

    2015-01-01

    In prokaryotes simple sequence repeats (SSRs) with unit sizes of 1-5 nucleotides (nt) are causative for phase and antigenic variation. Although an increased abundance of heptameric repeats was noticed in bacteria, reports about SSRs of 6-9 nt are rare. In particular G-rich repeat sequences with the propensity to fold into G-quadruplex (G4) structures have received little attention. In silico analysis of prokaryotic genomes show putative G4 forming sequences to be abundant. This report focuses on a surprisingly enriched G-rich repeat of the type GGGNATC in Xanthomonas and cyanobacteria such as Nostoc. We studied in detail the genomes of Xanthomonas campestris pv. campestris ATCC 33913 (Xcc), Xanthomonas axonopodis pv. citri str. 306 (Xac), and Nostoc sp. strain PCC7120 (Ana). In all three organisms repeats are spread all over the genome with an over-representation in non-coding regions. Extensive variation of the number of repetitive units was observed with repeat numbers ranging from two up to 26 units. However a clear preference for four units was detected. The strong bias for four units coincides with the requirement of four consecutive G-tracts for G4 formation. Evidence for G4 formation of the consensus repeat sequences was found in biophysical studies utilizing CD spectroscopy. The G-rich repeats are preferably located between aligned open reading frames (ORFs) and are under-represented in coding regions or between divergent ORFs. The G-rich repeats are preferentially located within a distance of 50 bp upstream of an ORF on the anti-sense strand or within 50 bp from the stop codon on the sense strand. Analysis of whole transcriptome sequence data showed that the majority of repeat sequences are transcribed. The genetic loci in the vicinity of repeat regions show increased genomic stability. In conclusion, we introduce and characterize a special class of highly abundant and wide-spread quadruplex-forming repeat sequences in bacteria.

  11. Investigation of a Quadruplex-Forming Repeat Sequence Highly Enriched in Xanthomonas and Nostoc sp.

    Directory of Open Access Journals (Sweden)

    Charlotte Rehm

    Full Text Available In prokaryotes simple sequence repeats (SSRs with unit sizes of 1-5 nucleotides (nt are causative for phase and antigenic variation. Although an increased abundance of heptameric repeats was noticed in bacteria, reports about SSRs of 6-9 nt are rare. In particular G-rich repeat sequences with the propensity to fold into G-quadruplex (G4 structures have received little attention. In silico analysis of prokaryotic genomes show putative G4 forming sequences to be abundant. This report focuses on a surprisingly enriched G-rich repeat of the type GGGNATC in Xanthomonas and cyanobacteria such as Nostoc. We studied in detail the genomes of Xanthomonas campestris pv. campestris ATCC 33913 (Xcc, Xanthomonas axonopodis pv. citri str. 306 (Xac, and Nostoc sp. strain PCC7120 (Ana. In all three organisms repeats are spread all over the genome with an over-representation in non-coding regions. Extensive variation of the number of repetitive units was observed with repeat numbers ranging from two up to 26 units. However a clear preference for four units was detected. The strong bias for four units coincides with the requirement of four consecutive G-tracts for G4 formation. Evidence for G4 formation of the consensus repeat sequences was found in biophysical studies utilizing CD spectroscopy. The G-rich repeats are preferably located between aligned open reading frames (ORFs and are under-represented in coding regions or between divergent ORFs. The G-rich repeats are preferentially located within a distance of 50 bp upstream of an ORF on the anti-sense strand or within 50 bp from the stop codon on the sense strand. Analysis of whole transcriptome sequence data showed that the majority of repeat sequences are transcribed. The genetic loci in the vicinity of repeat regions show increased genomic stability. In conclusion, we introduce and characterize a special class of highly abundant and wide-spread quadruplex-forming repeat sequences in bacteria.

  12. Identification and characterisation of a G-quadruplex forming sequence in the promoter region of nuclear factor (erythroid-derived 2)-like 2 (Nrf2)

    Energy Technology Data Exchange (ETDEWEB)

    Waller, Zoë A.E., E-mail: z.waller@uea.ac.uk; Howell, Lesley A.; MacDonald, Colin J.; O’Connell, Maria A.; Searcey, Mark, E-mail: m.searcey@uea.ac.uk

    2014-04-25

    Highlights: • Discovery of a G-quadruplex forming sequence in the promoter sequence of Nrf2. • Characterisation of the G-quadruplex by UV, CD and NMR. • Conformational switching of G-quadruplex induced by 9-aminoacridine. - Abstract: The transcription factor nuclear factor (erythroid-derived 2)-like 2 (Nrf2) regulates multiple antioxidants, Phase II detoxification enzymes and other cytoprotective enzymes in cells. Activation of Nrf2 is recognised as being of potential therapeutic benefit in inflammatory-diseases whereas more recently, it has become clear that the inhibition of Nrf2 may have benefit in the alleviation of resistance in some tumour types. A potential G-quadruplex forming sequence was identified in the promoter region of Nrf2, close to a number of putative transcription factor binding sites. Characterisation of the sequence 5’-d[GGGAAGGGAGCAAGGGCGGGAGGG]-3’ using CD spectroscopy, imino proton NMR resonances and UV melting experiments demonstrated the formation of a parallel intramolecular G-quadruplex in the presence of K{sup +} ions. Incubation with 9-aminoacridine ligands induced a switch from antiparallel to parallel forms. The presence of a G-quadruplex forming sequence in the promoter region of Nrf2 suggests an approach to targeting the production of the protein through stabilisation of the structure, thereby avoiding resistance to antitumour drugs.

  13. The Effect of INA [(R)-1-O-(1-Pyrenylmethyl)Glycerol] Insertions on the Structure and Biological Activity of a G-Quadruplex from a Critical Kras G-Rich Sequence

    DEFF Research Database (Denmark)

    Cogoi, Susanna; Paramasivan, Manikandan; Xodo, Luigi E.

    2007-01-01

    Quadruplex-forming oligonucleotides containing INA [(R)-1-O-(1-pyrenylmethyl)glycerol] insertions have been designed and studied for their capacity to inhibit the expression of the KRAS oncogene in pancreatic adenocarcinoma cells. It is found that INA can influence the folding topology of the G-q...

  14. Binding polarity of RPA to telomeric sequences and influence of G-quadruplex stability.

    Science.gov (United States)

    Safa, Layal; Delagoutte, Emmanuelle; Petruseva, Irina; Alberti, Patrizia; Lavrik, Olga; Riou, Jean-François; Saintomé, Carole

    2014-08-01

    Replication protein A (RPA) is a single-stranded DNA binding protein that plays an essential role in telomere maintenance. RPA binds to and unfolds G-quadruplex (G4) structures formed in telomeric DNA, thus facilitating lagging strand DNA replication and telomerase activity. To investigate the effect of G4 stability on the interactions with human RPA (hRPA), we used a combination of biochemical and biophysical approaches. Our data revealed an inverse relationship between G4 stability and ability of hRPA to bind to telomeric DNA; notably small G4 ligands that enhance G4 stability strongly impaired G4 unfolding by hRPA. To gain more insight into the mechanism of binding and unfolding of telomeric G4 structures by RPA, we carried out photo-crosslinking experiments to elucidate the spatial arrangement of the RPA subunits along the DNA strands. Our results showed that RPA1 and RPA2 are arranged from 5' to 3' along the unfolded telomeric G4, as already described for unstructured single-stranded DNA, while no contact is possible with RPA3 on this short oligonucleotide. In addition, these data are compatible with a 5' to 3' directionality in G4 unfolding by hRPA. Copyright © 2014 Elsevier Masson SAS. All rights reserved.

  15. Transcription arrest by a G quadruplex forming-trinucleotide repeat sequence from the human c-myb gene.

    Science.gov (United States)

    Broxson, Christopher; Beckett, Joshua; Tornaletti, Silvia

    2011-05-17

    Non canonical DNA structures correspond to genomic regions particularly susceptible to genetic instability. The transcription process facilitates formation of these structures and plays a major role in generating the instability associated with these genomic sites. However, little is known about how non canonical structures are processed when encountered by an elongating RNA polymerase. Here we have studied the behavior of T7 RNA polymerase (T7RNAP) when encountering a G quadruplex forming-(GGA)(4) repeat located in the human c-myb proto-oncogene. To make direct correlations between formation of the structure and effects on transcription, we have taken advantage of the ability of the T7 polymerase to transcribe single-stranded substrates and of G4 DNA to form in single-stranded G-rich sequences in the presence of potassium ions. Under physiological KCl concentrations, we found that T7 RNAP transcription was arrested at two sites that mapped to the c-myb (GGA)(4) repeat sequence. The extent of arrest did not change with time, indicating that the c-myb repeat represented an absolute block and not a transient pause to T7 RNAP. Consistent with G4 DNA formation, arrest was not observed in the absence of KCl or in the presence of LiCl. Furthermore, mutations in the c-myb (GGA)(4) repeat, expected to prevent transition to G4, also eliminated the transcription block. We show T7 RNAP arrest at the c-myb repeat in double-stranded DNA under conditions mimicking the cellular concentration of biomolecules and potassium ions, suggesting that the G4 structure formed in the c-myb repeat may represent a transcription roadblock in vivo. Our results support a mechanism of transcription-coupled DNA repair initiated by arrest of transcription at G4 structures.

  16. Spectroscopic insights into quadruplexes of five-repeat telomere DNA sequences upon G-block damage

    Czech Academy of Sciences Publication Activity Database

    Dvořáková, Zuzana; Vorlíčková, Michaela; Renčiuk, Daniel

    2017-01-01

    Roč. 1861, č. 11 (2017), s. 2750-2757 ISSN 0304-4165 R&D Projects: GA ČR(CZ) GJ17-19170Y Institutional support: RVO:68081707 Keywords : k+ solution * guanine quadruplexes Subject RIV: CE - Biochemistry OBOR OECD: Biochemistry and molecular biology Impact factor: 4.702, year: 2016

  17. Evaluation of the effect of polymorphism on G-quadruplex-ligand interaction by means of spectroscopic and chromatographic techniques

    Science.gov (United States)

    Benito, S.; Ferrer, A.; Benabou, S.; Aviñó, A.; Eritja, R.; Gargallo, R.

    2018-05-01

    Guanine-rich sequences may fold into highly ordered structures known as G-quadruplexes. Apart from the monomeric G-quadruplex, these sequences may form multimeric structures that are not usually considered when studying interaction with ligands. This work studies the interaction of a ligand, crystal violet, with three guanine-rich DNA sequences with the capacity to form multimeric structures. These sequences correspond to short stretches found near the promoter regions of c-kit and SMARCA4 genes. Instrumental techniques (circular dichroism, molecular fluorescence, size-exclusion chromatography and electrospray ionization mass spectrometry) and multivariate data analysis were used for this purpose. The polymorphism of G-quadruplexes was characterized prior to the interaction studies. The ligand was shown to interact preferentially with the monomeric G-quadruplex; the binding stoichiometry was 1:1 and the binding constant was in the order of 105 M-1 for all three sequences. The results highlight the importance of DNA treatment prior to interaction studies.

  18. Quadruplex-forming sequences occupy discrete regions inside plant LTR retrotransposons

    Czech Academy of Sciences Publication Activity Database

    Lexa, M.; Kejnovský, Eduard; Šteflová, Pavlína; Konvalinová, H.; Vorlíčková, Michaela; Vyskot, Boris

    2014-01-01

    Roč. 42, č. 2 (2014), s. 968-978 ISSN 0305-1048 R&D Projects: GA ČR(CZ) GAP205/12/0466; GA ČR(CZ) GAP305/10/0930; GA ČR(CZ) GAP501/10/0102; GA ČR(CZ) GA522/09/0083; GA ČR GPP501/10/P483 Institutional support: RVO:68081707 Keywords : INTRAMOLECULAR DNA QUADRUPLEXES * VIRUS TYPE-1 RNA * CIRCULAR-DICHROISM Subject RIV: BO - Biophysics Impact factor: 9.112, year: 2014

  19. DNA adducts of antitumor cisplatin preclude telomeric sequences from forming G quadruplexes

    Czech Academy of Sciences Publication Activity Database

    Heringová, Pavla; Kašpárková, Jana; Brabec, Viktor

    2009-01-01

    Roč. 14, č. 6 (2009), s. 959-968 ISSN 0949-8257 R&D Projects: GA MZd(CZ) NR8562; GA MŠk(CZ) LC06030; GA MŠk(CZ) ME08017; GA MŠk(CZ) OC08003; GA AV ČR(CZ) 1QS500040581; GA AV ČR(CZ) KAN200200651; GA AV ČR(CZ) IAA400040803 Grant - others:GA MŠk(CZ) OC09018 Institutional research plan: CEZ:AV0Z50040507; CEZ:AV0Z50040702 Keywords : cisplatin * DNA quadruplex * telomere Subject RIV: BO - Biophysics Impact factor: 3.415, year: 2009

  20. Computational Analysis of G-Quadruplex Forming Sequences across Chromosomes Reveals High Density Patterns Near the Terminal Ends.

    Directory of Open Access Journals (Sweden)

    Julia H Chariker

    Full Text Available G-quadruplex structures (G4 are found throughout the human genome and are known to play a regulatory role in a variety of molecular processes. Structurally, they have many configurations and can form from one or more DNA strands. At the gene level, they regulate gene expression and protein synthesis. In this paper, chromosomal-level patterns of distribution are analyzed on the human genome to identify high-level distribution patterns potentially related to global functional processes. Here we show unique high density banding patterns on individual chromosomes that are highly correlated, appearing in a mirror pattern, across forward and reverse DNA strands. The highest density of G4 sequences occurs within four megabases of one end of most chromosomes and contains G4 motifs that bind with zinc finger proteins. These findings suggest that G4 may play a role in global chromosomal processes such as those found in meiosis.

  1. The Effects of Molecular Crowding on the Structure and Stability of G-Quadruplexes with an Abasic Site

    Science.gov (United States)

    Fujimoto, Takeshi; Nakano, Shu-ichi; Miyoshi, Daisuke; Sugimoto, Naoki

    2011-01-01

    Both cellular environmental factors and chemical modifications critically affect the properties of nucleic acids. However, the structure and stability of DNA containing abasic sites under cell-mimicking molecular crowding conditions remain unclear. Here, we investigated the molecular crowding effects on the structure and stability of the G-quadruplexes including a single abasic site. Structural analysis by circular dichroism showed that molecular crowding by PEG200 did not affect the topology of the G-quadruplex structure with or without an abasic site. Thermodynamic analysis further demonstrated that the degree of stabilization of the G-quadruplex by molecular crowding decreased with substitution of an abasic site for a single guanine. Notably, we found that the molecular crowding effects on the enthalpy change for G-quadruplex formation had a linear relationship with the abasic site effects depending on its position. These results are useful for predicting the structure and stability of G-quadruplexes with abasic sites in the cell-mimicking conditions. PMID:21949901

  2. Detection of G-Quadruplex Structures Formed by G-Rich Sequences from Rice Genome and Transcriptome Using Combined Probes.

    Science.gov (United States)

    Chang, Tianjun; Li, Weiguo; Ding, Zhan; Cheng, Shaofei; Liang, Kun; Liu, Xiangjun; Bing, Tao; Shangguan, Dihua

    2017-08-01

    Putative G-quadruplex (G4) forming sequences (PQS) are highly prevalent in the genome and transcriptome of various organisms and are considered as potential regulation elements in many biological processes by forming G4 structures. The formation of G4 structures highly depends on the sequences and the environment. In most cases, it is difficult to predict G4 formation by PQS, especially PQS containing G2 tracts. Therefore, the experimental identification of G4 formation is essential in the study of G4-related biological functions. Herein, we report a rapid and simple method for the detection of G4 structures by using a pair of complementary reporters, hemin and BMSP. This method was applied to detect G4 structures formed by PQS (DNA and RNA) searched in the genome and transcriptome of Oryza sativa. Unlike most of the reported G4 probes that only recognize part of G4 structures, the proposed method based on combined probes positively responded to almost all G4 conformations, including parallel, antiparallel, and mixed/hybrid G4, but did not respond to non-G4 sequences. This method shows potential for high-throughput identification of G4 structures in genome and transcriptome. Furthermore, BMSP was observed to drive some PQS to form more stable G4 structures or induce the G4 formation of some PQS that cannot form G4 in normal physiological conditions, which may provide a powerful molecular tool for gene regulation.

  3. Simultaneous Binding of Hybrid Molecules Constructed with Dual DNA-Binding Components to a G-Quadruplex and Its Proximal Duplex.

    Science.gov (United States)

    Asamitsu, Sefan; Obata, Shunsuke; Phan, Anh Tuân; Hashiya, Kaori; Bando, Toshikazu; Sugiyama, Hiroshi

    2018-03-20

    A G-quadruplex (quadruplex) is a nucleic acid secondary structure adopted by guanine-rich sequences and is considered to be relevant to various pharmacological and biological contexts. Although a number of researchers have endeavored to discover and develop quadruplex-interactive molecules, poor ligand designability originating from topological similarity of the skeleton of diverse quadruplexes has remained a bottleneck for gaining specificity for individual quadruplexes. This work reports on hybrid molecules that were constructed with dual DNA-binding components, a cyclic imidazole/lysine polyamide (cIKP), and a hairpin pyrrole/imidazole polyamide (hPIP), with the aim toward specific quadruplex targeting by reading out the local duplex DNA sequence adjacent to designated quadruplexes in the genome. By means of circular dichroism (CD), fluorescence resonance energy transfer (FRET), surface plasmon resonance (SPR), and NMR techniques, we showed the dual and simultaneous recognition of the respective segment via hybrid molecules, and the synergistic and mutual effect of each binding component that was appropriately linked on higher binding affinity and modest sequence specificity. Monitoring quadruplex and duplex imino protons of the quadruplex/duplex motif titrated with hybrid molecules clearly revealed distinct features of the binding of hybrid molecules to the respective segments upon their simultaneous recognition. A series of the systematic and detailed binding assays described here showed that the concept of simultaneous recognition of quadruplex and its proximal duplex by hybrid molecules constructed with the dual DNA-binding components may provide a new strategy for ligand design, enabling targeting of a large variety of designated quadruplexes at specific genome locations. © 2018 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.

  4. Human telomere sequence DNA in water-free and high-viscosity solvents: G-quadruplex folding governed by Kramers rate theory.

    Science.gov (United States)

    Lannan, Ford M; Mamajanov, Irena; Hud, Nicholas V

    2012-09-19

    Structures formed by human telomere sequence (HTS) DNA are of interest due to the implication of telomeres in the aging process and cancer. We present studies of HTS DNA folding in an anhydrous, high viscosity deep eutectic solvent (DES) comprised of choline choride and urea. In this solvent, the HTS DNA forms a G-quadruplex with the parallel-stranded ("propeller") fold, consistent with observations that reduced water activity favors the parallel fold, whereas alternative folds are favored at high water activity. Surprisingly, adoption of the parallel structure by HTS DNA in the DES, after thermal denaturation and quick cooling to room temperature, requires several months, as opposed to less than 2 min in an aqueous solution. This extended folding time in the DES is, in part, due to HTS DNA becoming kinetically trapped in a folded state that is apparently not accessed in lower viscosity solvents. A comparison of times required for the G-quadruplex to convert from its aqueous-preferred folded state to its parallel fold also reveals a dependence on solvent viscosity that is consistent with Kramers rate theory, which predicts that diffusion-controlled transitions will slow proportionally with solvent friction. These results provide an enhanced view of a G-quadruplex folding funnel and highlight the necessity to consider solvent viscosity in studies of G-quadruplex formation in vitro and in vivo. Additionally, the solvents and analyses presented here should prove valuable for understanding the folding of many other nucleic acids and potentially have applications in DNA-based nanotechnology where time-dependent structures are desired.

  5. Characterizing and controlling intrinsic biases of lambda exonuclease in nascent strand sequencing reveals phasing between nucleosomes and G-quadruplex motifs around a subset of human replication origins.

    Science.gov (United States)

    Foulk, Michael S; Urban, John M; Casella, Cinzia; Gerbi, Susan A

    2015-05-01

    Nascent strand sequencing (NS-seq) is used to discover DNA replication origins genome-wide, allowing identification of features for their specification. NS-seq depends on the ability of lambda exonuclease (λ-exo) to efficiently digest parental DNA while leaving RNA-primer protected nascent strands intact. We used genomics and biochemical approaches to determine if λ-exo digests all parental DNA sequences equally. We report that λ-exo does not efficiently digest G-quadruplex (G4) structures in a plasmid. Moreover, λ-exo digestion of nonreplicating genomic DNA (LexoG0) enriches GC-rich DNA and G4 motifs genome-wide. We used LexoG0 data to control for nascent strand-independent λ-exo biases in NS-seq and validated this approach at the rDNA locus. The λ-exo-controlled NS-seq peaks are not GC-rich, and only 35.5% overlap with 6.8% of all G4s, suggesting that G4s are not general determinants for origin specification but may play a role for a subset. Interestingly, we observed a periodic spacing of G4 motifs and nucleosomes around the peak summits, suggesting that G4s may position nucleosomes at this subset of origins. Finally, we demonstrate that use of Na(+) instead of K(+) in the λ-exo digestion buffer reduced the effect of G4s on λ-exo digestion and discuss ways to increase both the sensitivity and specificity of NS-seq. © 2015 Foulk et al.; Published by Cold Spring Harbor Laboratory Press.

  6. Hairpins participating in folding of human telomeric sequence quadruplexes studied by standard and T-REMD simulations

    Czech Academy of Sciences Publication Activity Database

    Stadlbauer, Petr; Kuehrova, P.; Banáš, P.; Koča, J.; Bussi, G.; Trantírek, L.; Otyepka, M.; Šponer, Jiří

    2016-01-01

    Roč. 43, č. 20 (2016), s. 9626-9644 ISSN 0305-1048 R&D Projects: GA ČR(CZ) GAP208/11/1822 Institutional support: RVO:68081707 Keywords : MOLECULAR-DYNAMICS SIMULATIONS * INTRAMOLECULAR DNA QUADRUPLEXES * PARTICLE MESH EWALD Subject RIV: BO - Biophysics Impact factor: 10.162, year: 2016

  7. Amyloid Precursor Protein Translation Is Regulated by a 3'UTR Guanine Quadruplex.

    Directory of Open Access Journals (Sweden)

    Ezekiel Crenshaw

    Full Text Available A central event in Alzheimer's disease is the accumulation of amyloid β (Aβ peptides generated by the proteolytic cleavage of the amyloid precursor protein (APP. APP overexpression leads to increased Aβ generation and Alzheimer's disease in humans and altered neuronal migration and increased long term depression in mice. Conversely, reduction of APP expression results in decreased Aβ levels in mice as well as impaired learning and memory and decreased numbers of dendritic spines. Together these findings indicate that therapeutic interventions that aim to restore APP and Aβ levels must do so within an ideal range. To better understand the effects of modulating APP levels, we explored the mechanisms regulating APP expression focusing on post-transcriptional regulation. Such regulation can be mediated by RNA regulatory elements such as guanine quadruplexes (G-quadruplexes, non-canonical structured RNA motifs that affect RNA stability and translation. Via a bioinformatics approach, we identified a candidate G-quadruplex within the APP mRNA in its 3'UTR (untranslated region at residues 3008-3027 (NM_201414.2. This sequence exhibited characteristics of a parallel G-quadruplex structure as revealed by circular dichroism spectrophotometry. Further, as with other G-quadruplexes, the formation of this structure was dependent on the presence of potassium ions. This G-quadruplex has no apparent role in regulating transcription or mRNA stability as wild type and mutant constructs exhibited equivalent mRNA levels as determined by real time PCR. Instead, we demonstrate that this G-quadruplex negatively regulates APP protein expression using dual luciferase reporter and Western blot analysis. Taken together, our studies reveal post-transcriptional regulation by a 3'UTR G-quadruplex as a novel mechanism regulating APP expression.

  8. Effect of Monovalent Ion Parameters on Molecular Dynamics Simulations of G-Quadruplexes

    Czech Academy of Sciences Publication Activity Database

    Havrila, Marek; Stadlbauer, Petr; Islam, Barira; Otyepka, M.; Šponer, Jiří

    2017-01-01

    Roč. 13, č. 8 (2017), s. 3911-3926 ISSN 1549-9618 R&D Projects: GA MŠk EF15_003/0000477; GA ČR(CZ) GA16-13721S Institutional support: RVO:68081707 Keywords : telomeric g-quadruplex * amber force-field * nucleic-acid quadruplexes Subject RIV: CF - Physical ; Theoretical Chemistry OBOR OECD: Physical chemistry Impact factor: 5.245, year: 2016

  9. Cation Coordination Alters the Conformation of a Thrombin-Binding G-Quadruplex DNA Aptamer That Affects Inhibition of Thrombin.

    Science.gov (United States)

    Zavyalova, Elena; Tagiltsev, Grigory; Reshetnikov, Roman; Arutyunyan, Alexander; Kopylov, Alexey

    2016-10-01

    Thrombin-binding aptamers are promising anticoagulants. HD1 is a monomolecular antiparallel G-quadruplex with two G-quartets linked by three loops. Aptamer-thrombin interactions are mediated with two TT-loops that bind thrombin exosite I. Several cations were shown to be coordinated inside the G-quadruplex, including K + , Na + , NH 4 + , Ba 2+ , and Sr 2+ ; on the contrary, Mn 2+ was coordinated in the grooves, outside the G-quadruplex. K + or Na + coordination provides aptamer functional activity. The effect of other cations on aptamer functional activity has not yet been described, because of a lack of relevant tests. Interactions between aptamer HD1 and a series of cations were studied. A previously developed enzymatic method was applied to evaluate aptamer inhibitory activity. The structure-function correlation was studied using the characterization of G-quadruplex conformation by circular dichroism spectroscopy. K + coordination provided the well-known high inhibitory activity of the aptamer, whereas Na + coordination supported low activity. Although NH 4 + coordination yielded a typical antiparallel G-quadruplex, no inhibitory activity was shown; a similar effect was observed for Ba 2+ and Sr 2+ coordination. Mn 2+ coordination destabilized the G-quadruplex that drastically diminished aptamer inhibitory activity. Therefore, G-quadruplex existence per se is insufficient for aptamer inhibitory activity. To elicit the nature of these effects, we thoroughly analyzed nuclear magnetic resonance (NMR) and X-ray data on the structure of the HD1 G-quadruplex with various cations. The most reasonable explanation is that cation coordination changes the conformation of TT-loops, affecting thrombin binding and inhibition. HD1 counterparts, aptamers 31-TBA and NU172, behaved similarly with some distinctions. In 31-TBA, an additional duplex module stabilized antiparallel G-quadruplex conformation at high concentrations of divalent cations; whereas in NU172, a different

  10. Studies of G-quadruplexes formed within self-assembled DNA mini-circles.

    Science.gov (United States)

    Klejevskaja, Beata; Pyne, Alice L B; Reynolds, Matthew; Shivalingam, Arun; Thorogate, Richard; Hoogenboom, Bart W; Ying, Liming; Vilar, Ramon

    2016-10-13

    We have developed self-assembled DNA mini-circles that contain a G-quadruplex-forming sequence from the c-Myc oncogene promoter and demonstrate by FRET that the G-quadruplex unfolding kinetics are 10-fold slower than for the simpler 24-mer G-quadruplex that is commonly used for FRET experiments.

  11. Electrochemical and AFM Characterization of G-Quadruplex Electrochemical Biosensors and Applications

    Science.gov (United States)

    2018-01-01

    Guanine-rich DNA sequences are able to form G-quadruplexes, being involved in important biological processes and representing smart self-assembling nanomaterials that are increasingly used in DNA nanotechnology and biosensor technology. G-quadruplex electrochemical biosensors have received particular attention, since the electrochemical response is particularly sensitive to the DNA structural changes from single-stranded, double-stranded, or hairpin into a G-quadruplex configuration. Furthermore, the development of an increased number of G-quadruplex aptamers that combine the G-quadruplex stiffness and self-assembling versatility with the aptamer high specificity of binding to a variety of molecular targets allowed the construction of biosensors with increased selectivity and sensitivity. This review discusses the recent advances on the electrochemical characterization, design, and applications of G-quadruplex electrochemical biosensors in the evaluation of metal ions, G-quadruplex ligands, and other small organic molecules, proteins, and cells. The electrochemical and atomic force microscopy characterization of G-quadruplexes is presented. The incubation time and cations concentration dependence in controlling the G-quadruplex folding, stability, and nanostructures formation at carbon electrodes are discussed. Different G-quadruplex electrochemical biosensors design strategies, based on the DNA folding into a G-quadruplex, the use of G-quadruplex aptamers, or the use of hemin/G-quadruplex DNAzymes, are revisited. PMID:29666699

  12. Unexpected Position-Dependent Effects of Ribose G-Quartets in G-Quadruplexes

    Czech Academy of Sciences Publication Activity Database

    Zhou, J.; Amrane, S.; Rosu, F.; Salgado, G.; Bian, Y.; Tateishi-Karimata, H.; Largy, E.; Korkut, D. N.; Bourdoncle, A.; Miyoshi, D.; Zhang, J.; Ju, H.; Wang, W.; Sugimoto, N.; Gabelica, V.; Mergny, Jean-Louis

    2017-01-01

    Roč. 139, č. 23 (2017), s. 7768-7779 ISSN 0002-7863 Institutional support: RVO:68081707 Keywords : human telomeric rna * electrospray mass-spectrometry * molecular crowding conditions * dna g-quadruplexes Subject RIV: BO - Biophysics OBOR OECD: Electrochemistry (dry cells, batteries, fuel cells, corrosion metals, electrolysis) Impact factor: 13.858, year: 2016

  13. G-quadruplex and G-rich sequence stimulate Pif1p-catalyzed downstream duplex DNA unwinding through reducing waiting time at ss/dsDNA junction

    Science.gov (United States)

    Zhang, Bo; Wu, Wen-Qiang; Liu, Na-Nv; Duan, Xiao-Lei; Li, Ming; Dou, Shuo-Xing; Hou, Xi-Miao; Xi, Xu-Guang

    2016-01-01

    Alternative DNA structures that deviate from B-form double-stranded DNA such as G-quadruplex (G4) DNA can be formed by G-rich sequences that are widely distributed throughout the human genome. We have previously shown that Pif1p not only unfolds G4, but also unwinds the downstream duplex DNA in a G4-stimulated manner. In the present study, we further characterized the G4-stimulated duplex DNA unwinding phenomenon by means of single-molecule fluorescence resonance energy transfer. It was found that Pif1p did not unwind the partial duplex DNA immediately after unfolding the upstream G4 structure, but rather, it would dwell at the ss/dsDNA junction with a ‘waiting time’. Further studies revealed that the waiting time was in fact related to a protein dimerization process that was sensitive to ssDNA sequence and would become rapid if the sequence is G-rich. Furthermore, we identified that the G-rich sequence, as the G4 structure, equally stimulates duplex DNA unwinding. The present work sheds new light on the molecular mechanism by which G4-unwinding helicase Pif1p resolves physiological G4/duplex DNA structures in cells. PMID:27471032

  14. G-quadruplex DNA sequences are evolutionarily conserved and associated with distinct genomic features in Saccharomyces cerevisiae.

    Directory of Open Access Journals (Sweden)

    John A Capra

    2010-07-01

    Full Text Available G-quadruplex DNA is a four-stranded DNA structure formed by non-Watson-Crick base pairing between stacked sets of four guanines. Many possible functions have been proposed for this structure, but its in vivo role in the cell is still largely unresolved. We carried out a genome-wide survey of the evolutionary conservation of regions with the potential to form G-quadruplex DNA structures (G4 DNA motifs across seven yeast species. We found that G4 DNA motifs were significantly more conserved than expected by chance, and the nucleotide-level conservation patterns suggested that the motif conservation was the result of the formation of G4 DNA structures. We characterized the association of conserved and non-conserved G4 DNA motifs in Saccharomyces cerevisiae with more than 40 known genome features and gene classes. Our comprehensive, integrated evolutionary and functional analysis confirmed the previously observed associations of G4 DNA motifs with promoter regions and the rDNA, and it identified several previously unrecognized associations of G4 DNA motifs with genomic features, such as mitotic and meiotic double-strand break sites (DSBs. Conserved G4 DNA motifs maintained strong associations with promoters and the rDNA, but not with DSBs. We also performed the first analysis of G4 DNA motifs in the mitochondria, and surprisingly found a tenfold higher concentration of the motifs in the AT-rich yeast mitochondrial DNA than in nuclear DNA. The evolutionary conservation of the G4 DNA motif and its association with specific genome features supports the hypothesis that G4 DNA has in vivo functions that are under evolutionary constraint.

  15. Intramolecular telomeric G-quadruplexes dramatically inhibit DNA synthesis by replicative and translesion polymerases, revealing their potential to lead to genetic change.

    Directory of Open Access Journals (Sweden)

    Deanna N Edwards

    Full Text Available Recent research indicates that hundreds of thousands of G-rich sequences within the human genome have the potential to form secondary structures known as G-quadruplexes. Telomeric regions, consisting of long arrays of TTAGGG/AATCCC repeats, are among the most likely areas in which these structures might form. Since G-quadruplexes assemble from certain G-rich single-stranded sequences, they might arise when duplex DNA is unwound such as during replication. Coincidentally, these bulky structures when present in the DNA template might also hinder the action of DNA polymerases. In this study, single-stranded telomeric templates with the potential to form G-quadruplexes were examined for their effects on a variety of replicative and translesion DNA polymerases from humans and lower organisms. Our results demonstrate that single-stranded templates containing four telomeric GGG runs fold into intramolecular G-quadruplex structures. These intramolecular G quadruplexes are somewhat dynamic in nature and stabilized by increasing KCl concentrations and decreasing temperatures. Furthermore, the presence of these intramolecular G-quadruplexes in the template dramatically inhibits DNA synthesis by various DNA polymerases, including the human polymerase δ employed during lagging strand replication of G-rich telomeric strands and several human translesion DNA polymerases potentially recruited to sites of replication blockage. Notably, misincorporation of nucleotides is observed when certain translesion polymerases are employed on substrates containing intramolecular G-quadruplexes, as is extension of the resulting mismatched base pairs upon dynamic unfolding of this secondary structure. These findings reveal the potential for blockage of DNA replication and genetic changes related to sequences capable of forming intramolecular G-quadruplexes.

  16. DNA Sequences Proximal to Human Mitochondrial DNA Deletion Breakpoints Prevalent in Human Disease Form G-quadruplexes, a Class of DNA Structures Inefficiently Unwound by the Mitochondrial Replicative Twinkle Helicase*

    Science.gov (United States)

    Bharti, Sanjay Kumar; Sommers, Joshua A.; Zhou, Jun; Kaplan, Daniel L.; Spelbrink, Johannes N.; Mergny, Jean-Louis; Brosh, Robert M.

    2014-01-01

    Mitochondrial DNA deletions are prominent in human genetic disorders, cancer, and aging. It is thought that stalling of the mitochondrial replication machinery during DNA synthesis is a prominent source of mitochondrial genome instability; however, the precise molecular determinants of defective mitochondrial replication are not well understood. In this work, we performed a computational analysis of the human mitochondrial genome using the “Pattern Finder” G-quadruplex (G4) predictor algorithm to assess whether G4-forming sequences reside in close proximity (within 20 base pairs) to known mitochondrial DNA deletion breakpoints. We then used this information to map G4P sequences with deletions characteristic of representative mitochondrial genetic disorders and also those identified in various cancers and aging. Circular dichroism and UV spectral analysis demonstrated that mitochondrial G-rich sequences near deletion breakpoints prevalent in human disease form G-quadruplex DNA structures. A biochemical analysis of purified recombinant human Twinkle protein (gene product of c10orf2) showed that the mitochondrial replicative helicase inefficiently unwinds well characterized intermolecular and intramolecular G-quadruplex DNA substrates, as well as a unimolecular G4 substrate derived from a mitochondrial sequence that nests a deletion breakpoint described in human renal cell carcinoma. Although G4 has been implicated in the initiation of mitochondrial DNA replication, our current findings suggest that mitochondrial G-quadruplexes are also likely to be a source of instability for the mitochondrial genome by perturbing the normal progression of the mitochondrial replication machinery, including DNA unwinding by Twinkle helicase. PMID:25193669

  17. Enhanced anti-HIV-1 activity of G-quadruplexes comprising locked nucleic acids and intercalating nucleic acids

    DEFF Research Database (Denmark)

    Pedersen, Erik Bjerregaard; Nielsen, Jakob Toudahl; Nielsen, Claus

    2011-01-01

    Two G-quadruplex forming sequences, 50-TGGGAG and the 17-mer sequence T30177, which exhibit anti-HIV-1 activity on cell lines, were modified using either locked nucleic acids (LNA) or via insertions of (R)-1-O-(pyren-1-ylmethyl)glycerol (intercalating nucleic acid, INA) or (R)-1-O-[4-(1......-pyrenylethynyl)phenylmethyl]glycerol (twisted intercalating nucleic acid, TINA). Incorporation of LNA or INA/TINA monomers provide as much as 8-fold improvement of anti-HIV-1 activity. We demonstrate for the first time a detailed analysis of the effect the incorporation of INA/TINA monomers in quadruplex forming...

  18. Characterizing and controlling intrinsic biases of lambda exonuclease in nascent strand sequencing reveals phasing between nucleosomes and G-quadruplex motifs around a subset of human replication origins

    DEFF Research Database (Denmark)

    Foulk, M. S.; Urban, J. M.; Casella, Cinzia

    2015-01-01

    Nascent strand sequencing (NS-seq) is used to discover DNA replication origins genome-wide, allowing identification of features for their specification. NS-seq depends on the ability of lambda exonuclease (lambda-exo) to efficiently digest parental DNA while leaving RNA-primer protected nascent...... strands intact. We used genomics and biochemical approaches to determine if lambda-exo digests all parental DNA sequences equally. We report that lambda-exo does not efficiently digest G-quadruplex (G4) structures in a plasmid. Moreover, lambda-exo digestion of nonreplicating genomic DNA (LexoG0) enriches...... GC-rich DNA and G4 motifs genome-wide. We used LexoG0 data to control for nascent strand-independent lambda-exo biases in NSseq and validated this approach at the rDNA locus. The lambda-exo-controlled NS-seq peaks are not GC-rich, and only 35.5% overlap with 6.8% of all G4s, suggesting that G4s...

  19. Xanthene and Xanthone Derivatives as G-Quadruplex Stabilizing Ligands

    Directory of Open Access Journals (Sweden)

    Alessandro Altieri

    2013-10-01

    Full Text Available Following previous studies on anthraquinone and acridine-based G-quadruplex ligands, here we present a study of similar aromatic cores, with the specific aim of increasing G-quadruplex binding and selectivity with respect to duplex DNA. Synthesized compounds include two and three-side chain xanthone and xanthene derivatives, as well as a dimeric “bridged” form. ESI and FRET measurements suggest that all the studied molecules are good G-quadruplex ligands, both at telomeres and on G-quadruplex forming sequences of oncogene promoters. The dimeric compound and the three-side chain xanthone derivative have been shown to represent the best compounds emerging from the different series of ligands presented here, having also high selectivity for G-quadruplex structures with respect to duplex DNA. Molecular modeling simulations are in broad agreement with the experimental data.

  20. A Role for the Fifth G-Track in G-Quadruplex Forming Oncogene Promoter Sequences during Oxidative Stress: Do These "Spare Tires" Have an Evolved Function?

    Science.gov (United States)

    Fleming, Aaron M; Zhou, Jia; Wallace, Susan S; Burrows, Cynthia J

    2015-08-26

    Uncontrolled inflammation or oxidative stress generates electron-deficient species that oxidize the genome increasing its instability in cancer. The G-quadruplex (G4) sequences regulating the c-MYC , KRAS , VEGF , BCL-2 , HIF-1α , and RET oncogenes, as examples, are targets for oxidation at loop and 5'-core guanines (G) as showcased in this study by CO 3 •- oxidation of the VEGF G4. Products observed include 8-oxo-7,8-dihydroguanine (OG), spiroiminodihydantoin (Sp), and 5-guanidinohydantoin (Gh). Our previous studies found that OG and Gh, when present in the four G-tracks of the solved structure for VEGF and c-MY C, were not substrates for the base excision repair (BER) DNA glycosylases in biologically relevant KCl solutions. We now hypothesize that a fifth G-track found a few nucleotides distant from the G4 tracks involved in folding can act as a "spare tire," facilitating extrusion of a damaged G-run into a large loop that then becomes a substrate for BER. Thermodynamic, spectroscopic, and DMS footprinting studies verified the fifth domain replacing a damaged G-track with OG or Gh at a loop or core position in the VEGF G4. These new "spare tire"-containing strands with Gh in loops are now found to be substrates for initiation of BER with the NEIL1, NEIL2, and NEIL3 DNA glycosylases. The results support a hypothesis in which regulatory G4s carry a "spare-tire" fifth G-track for aiding in the repair process when these sequences are damaged by radical oxygen species, a feature observed in a large number of these sequences. Furthermore, formation and repair of oxidized bases in promoter regions may constitute an additional example of epigenetic modification, in this case of guanine bases, to regulate gene expression in which the G4 sequences act as sensors of oxidative stress.

  1. pH-Modulated Watson-Crick duplex-quadruplex equilibria of guanine-rich and cytosine-rich DNA sequences 140 base pairs upstream of the c-kit transcription initiation site.

    Science.gov (United States)

    Bucek, Pavel; Jaumot, Joaquim; Aviñó, Anna; Eritja, Ramon; Gargallo, Raimundo

    2009-11-23

    Guanine-rich regions of DNA are sequences capable of forming G-quadruplex structures. The formation of a G-quadruplex structure in a region 140 base pairs (bp) upstream of the c-kit transcription initiation site was recently proposed (Fernando et al., Biochemistry, 2006, 45, 7854). In the present study, the acid-base equilibria and the thermally induced unfolding of the structures formed by a guanine-rich region and by its complementary cytosine-rich strand in c-kit were studied by means of circular dichroism and molecular absorption spectroscopies. In addition, competition between the Watson-Crick duplex and the isolated structures was studied as a function of pH value and temperature. Multivariate data analysis methods based on both hard and soft modeling were used to allow accurate quantification of the various acid-base species present in the mixtures. Results showed that the G-quadruplex and i-motif coexist with the Watson-Crick duplex over the pH range from 3.0 to 6.5, approximately, under the experimental conditions tested in this study. At pH 7.0, the duplex is practically the only species present.

  2. Stabilization of Telomere G-Quadruplexes Interferes with Human Herpesvirus 6A Chromosomal Integration.

    Science.gov (United States)

    Gilbert-Girard, Shella; Gravel, Annie; Artusi, Sara; Richter, Sara N; Wallaschek, Nina; Kaufer, Benedikt B; Flamand, Louis

    2017-07-15

    Human herpesviruses 6A and 6B (HHV-6A/B) can integrate their genomes into the telomeres of human chromosomes using a mechanism that remains poorly understood. To achieve a better understanding of the HHV-6A/B integration mechanism, we made use of BRACO-19, a compound that stabilizes G-quadruplex secondary structures and prevents telomere elongation by the telomerase complex. First, we analyzed the folding of telomeric sequences into G-quadruplex structures and their binding to BRACO-19 using G-quadruplex-specific antibodies and surface plasmon resonance. Circular dichroism studies indicate that BRACO-19 modifies the conformation and greatly stabilizes the G-quadruplexes formed in G-rich telomeric DNA. Subsequently we assessed the effects of BRACO-19 on the HHV-6A initial phase of infection. Our results indicate that BRACO-19 does not affect entry of HHV-6A DNA into cells. We next investigated if stabilization of G-quadruplexes by BRACO-19 affected HHV-6A's ability to integrate its genome into host chromosomes. Incubation of telomerase-expressing cells with BRACO-19, such as HeLa and MCF-7, caused a significant reduction in the HHV-6A integration frequency ( P integration frequency in U2OS cells that lack telomerase activity and elongate their telomeres through alternative lengthening mechanisms. Our data suggest that the fluidity of telomeres is important for efficient chromosomal integration of HHV-6A and that interference with telomerase activity negatively affects the generation of cellular clones containing integrated HHV-6A. IMPORTANCE HHV-6A/B can integrate their genomes into the telomeres of infected cells. Telomeres consist of repeated hexanucleotides (TTAGGG) of various lengths (up to several kilobases) and end with a single-stranded 3' extension. To avoid recognition and induce a DNA damage response, the single-stranded overhang folds back on itself and forms a telomeric loop (T-loop) or adopts a tertiary structure, referred to as a G-quadruplex. In the

  3. A Dual-Specific Targeting Approach Based on the Simultaneous Recognition of Duplex and Quadruplex Motifs.

    Science.gov (United States)

    Nguyen, Thi Quynh Ngoc; Lim, Kah Wai; Phan, Anh Tuân

    2017-09-20

    Small-molecule ligands targeting nucleic acids have been explored as potential therapeutic agents. Duplex groove-binding ligands have been shown to recognize DNA in a sequence-specific manner. On the other hand, quadruplex-binding ligands exhibit high selectivity between quadruplex and duplex, but show limited discrimination between different quadruplex structures. Here we propose a dual-specific approach through the simultaneous application of duplex- and quadruplex-binders. We demonstrated that a quadruplex-specific ligand and a duplex-specific ligand can simultaneously interact at two separate binding sites of a quadruplex-duplex hybrid harbouring both quadruplex and duplex structural elements. Such a dual-specific targeting strategy would combine the sequence specificity of duplex-binders and the strong binding affinity of quadruplex-binders, potentially allowing the specific targeting of unique quadruplex structures. Future research can be directed towards the development of conjugated compounds targeting specific genomic quadruplex-duplex sites, for which the linker would be highly context-dependent in terms of length and flexibility, as well as the attachment points onto both ligands.

  4. Telomeric repeat-containing RNA/G-quadruplex-forming sequences cause genome-wide alteration of gene expression in human cancer cells in vivo.

    Science.gov (United States)

    Hirashima, Kyotaro; Seimiya, Hiroyuki

    2015-02-27

    Telomere erosion causes cell mortality, suggesting that longer telomeres enable more cell divisions. In telomerase-positive human cancer cells, however, telomeres are often kept shorter than those of surrounding normal tissues. Recently, we showed that cancer cell telomere elongation represses innate immune genes and promotes their differentiation in vivo. This implies that short telomeres contribute to cancer malignancy, but it is unclear how such genetic repression is caused by elongated telomeres. Here, we report that telomeric repeat-containing RNA (TERRA) induces a genome-wide alteration of gene expression in telomere-elongated cancer cells. Using three different cell lines, we found that telomere elongation up-regulates TERRA signal and down-regulates innate immune genes such as STAT1, ISG15 and OAS3 in vivo. Ectopic TERRA oligonucleotides repressed these genes even in cells with short telomeres under three-dimensional culture conditions. This appeared to occur from the action of G-quadruplexes (G4) in TERRA, because control oligonucleotides had no effect and a nontelomeric G4-forming oligonucleotide phenocopied the TERRA oligonucleotide. Telomere elongation and G4-forming oligonucleotides showed similar gene expression signatures. Most of the commonly suppressed genes were involved in the innate immune system and were up-regulated in various cancers. We propose that TERRA G4 counteracts cancer malignancy by suppressing innate immune genes. © The Author(s) 2015. Published by Oxford University Press on behalf of Nucleic Acids Research.

  5. Aminoglycosylation can enhance the G-quadruplex binding activity of epigallocatechin.

    Directory of Open Access Journals (Sweden)

    Li-Ping Bai

    Full Text Available With the aim of enhancing G-quadruplex binding activity, two new glucosaminosides (16, 18 of penta-methylated epigallocatechin were synthesized by chemical glycosylation. Subsequent ESI-TOF-MS analysis demonstrated that these two glucosaminoside derivatives exhibit much stronger binding activity to human telomeric DNA and RNA G-quadruplexes than their parent structure (i.e., methylated EGC (14 as well as natural epigallocatechin (EGC, 6. The DNA G-quadruplex binding activity of 16 and 18 is even more potent than strong G-quadruplex binder quercetin, which has a more planar structure. These two synthetic compounds also showed a higher binding strength to human telomeric RNA G-quadruplex than its DNA counterpart. Analysis of the structure-activity relationship revealed that the more basic compound, 16, has a higher binding capacity with DNA and RNA G-quadruplexes than its N-acetyl derivative, 18, suggesting the importance of the basicity of the aminoglycoside for G-quadruplex binding activity. Molecular docking simulation predicted that the aromatic ring of 16 π-stacks with the aromatic ring of guanine nucleotides, with the glucosamine moiety residing in the groove of G-quadruplex. This research indicates that glycosylation of natural products with aminosugar can significantly enhance their G-quadruplex binding activities, thus is an effective way to generate small molecules targeting G-quadruplexes in nucleic acids. In addition, this is the first report that green tea catechin can bind to nucleic acid G-quadruplex structures.

  6. Enantioselective light switch effect of Δ- and Λ-[Ru(phenanthroline)2 dipyrido[3,2-a:2', 3'-c]phenazine]2+ bound to G-quadruplex DNA.

    Science.gov (United States)

    Park, Jin Ha; Lee, Hyun Suk; Jang, Myung Duk; Han, Sung Wook; Kim, Seog K; Lee, Young-Ae

    2018-06-01

    The interaction of Δ- and Λ-[Ru(phen) 2 DPPZ] 2+ (DPPZ = dipyrido[3,2-a:2', 3'-c]phenazine, phen = phenanthroline) with a G-quadruplex formed from 5'-G 2 T 2 G 2 TGTG 2 T 2 G 2-3 '(15-mer) was investigated. The well-known enhancement of luminescence intensity (the 'light-switch' effect) was observed for the [Ru(phen) 2 DPPZ] 2+ complexes upon formation of an adduct with the G-quadruplex. The emission intensity of the G-quadruplex-bound Λ-isomer was 3-fold larger than that of the Δ-isomer when bound to the G-quadruplex, which is opposite of the result observed in the case of double stranded DNA (dsDNA); the light switch effect is larger for the dsDNA-bound Δ-isomer. In the job plot of the G-quadruplex with Δ- and Λ-[Ru(phen) 2 DPPZ] 2+ , a major inflection point for the two isomers was observed at x ≈ .65, which suggests a binding stoichiometry of 2:1 for both enantiomers. When the G base at the 8th position was replaced with 6-methyl isoxanthopterin (6MI), a fluorescent guanine analog, the excited energy of 6-MI transferred to bound Δ- or Λ-[Ru(phen) 2 DPPZ] 2+ , which suggests that at least a part of both Ru(II) enantiomers is close to or in contact with the diagonal loop of the G-quadruplex. A luminescence quenching experiment using [Fe(CN) 6 ] 4- for the G-quadruplex-bound Ru(II) complex revealed downward bending curves for both enantiomers in the Stern-Volmer plot, which suggests the presence of Ru(II) complexes that are both accessible and inaccessible to the quencher and may be related to the 2:1 binding stoichiometry.

  7. Quantification of Chemical and Mechanical Effects on the Formation of the G-Quadruplex and i-Motif in Duplex DNA.

    Science.gov (United States)

    Selvam, Sangeetha; Mandal, Shankar; Mao, Hanbin

    2017-09-05

    The formation of biologically significant tetraplex DNA species, such as G-quadruplexes and i-motifs, is affected by chemical (ions and pH) and mechanical [superhelicity (σ) and molecular crowding] factors. Because of the extremely challenging experimental conditions, the relative importance of these factors on tetraplex folding is unknown. In this work, we quantitatively evaluated the chemical and mechanical effects on the population dynamics of DNA tetraplexes in the insulin-linked polymorphic region using magneto-optical tweezers. By mechanically unfolding individual tetraplexes, we found that ions and pH have the largest effects on the formation of the G-quadruplex and i-motif, respectively. Interestingly, superhelicity has the second largest effect followed by molecular crowding conditions. While chemical effects are specific to tetraplex species, mechanical factors have generic influences. The predominant effect of chemical factors can be attributed to the fact that they directly change the stability of a specific tetraplex, whereas the mechanical factors, superhelicity in particular, reduce the stability of the competing species by changing the kinetics of the melting and annealing of the duplex DNA template in a nonspecific manner. The substantial dependence of tetraplexes on superhelicity provides strong support that DNA tetraplexes can serve as topological sensors to modulate fundamental cellular processes such as transcription.

  8. Structure variations of TBA G-quadruplex induced by 2'-O-methyl nucleotide in K+ and Ca2+ environments.

    Science.gov (United States)

    Zhao, Xiaoyang; Liu, Bo; Yan, Jing; Yuan, Ying; An, Liwen; Guan, Yifu

    2014-10-01

    Thrombin binding aptamer (TBA), a 15-mer oligonucleotide of d(GGTTGGTGTGGTTGG) sequence, folds into a chair-type antiparallel G-quadruplex in the K(+) environment, and each of two G-tetrads is characterized by a syn-anti-syn-anti glycosidic conformation arrangement. To explore its folding topology and structural stability, 2'-O-methyl nucleotide (OMe) with the C3'-endo sugar pucker conformation and anti glycosidic angle was used to selectively substitute for the guanine residues of G-tetrads of TBA, and these substituted TBAs were characterized using a circular dichroism spectrum, thermally differential spectrum, ultraviolet stability analysis, electrophoresis mobility shift assay, and thermodynamic analysis in K(+) and Ca(2+) environments. Results showed that single substitutions for syn-dG residues destabilized the G-quadruplex structure, while single substitutions for anti-dG residues could preserve the G-quadruplex in the K(+) environment. When one or two G-tetrads were modified with OMe, TBA became unstructured. In contrast, in Ca(2+) environment, the native TBA appeared to be unstructured. When two G-tetrads were substituted with OMe, TBA seemed to become a more stable parallel G-4 structure. Further thermodynamic data suggested that OMe-substitutions were an enthalpy-driven event. The results in this study enrich our understanding about the effects of nucleotide derivatives on the G-quadruplex structure stability in different ionic environments, which will help to design G-quadruplex for biological and medical applications. © The Author 2014. Published by ABBS Editorial Office in association with Oxford University Press on behalf of the Institute of Biochemistry and Cell Biology, Shanghai Institutes for Biological Sciences, Chinese Academy of Sciences.

  9. G-Quadruplex Forming Oligonucleotides as Anti-HIV Agents.

    Science.gov (United States)

    Musumeci, Domenica; Riccardi, Claudia; Montesarchio, Daniela

    2015-09-22

    Though a variety of different non-canonical nucleic acids conformations have been recognized, G-quadruplex structures are probably the structural motifs most commonly found within known oligonucleotide-based aptamers. This could be ascribed to several factors, as their large conformational diversity, marked responsiveness of their folding/unfolding processes to external stimuli, high structural compactness and chemo-enzymatic and thermodynamic stability. A number of G-quadruplex-forming oligonucleotides having relevant in vitro anti-HIV activity have been discovered in the last two decades through either SELEX or rational design approaches. Improved aptamers have been obtained by chemical modifications of natural oligonucleotides, as terminal conjugations with large hydrophobic groups, replacement of phosphodiester linkages with phosphorothioate bonds or other surrogates, insertion of base-modified monomers, etc. In turn, detailed structural studies have elucidated the peculiar architectures adopted by many G-quadruplex-based aptamers and provided insight into their mechanism of action. An overview of the state-of-the-art knowledge of the relevance of putative G-quadruplex forming sequences within the viral genome and of the most studied G-quadruplex-forming aptamers, selectively targeting HIV proteins, is here presented.

  10. A new cationic porphyrin derivative (TMPipEOPP with large side arm substituents: a highly selective G-quadruplex optical probe.

    Directory of Open Access Journals (Sweden)

    Li-Na Zhu

    Full Text Available The discovery of uncommon DNA structures and speculation about their potential functions in genes has brought attention to specific DNA structure recognition. G-quadruplexes are four-stranded nucleic acid structures formed by G-rich DNA (or RNA sequences. G-rich sequences with a high potential to form G-quadruplexes have been found in many important genomic regions. Porphyrin derivatives with cationic side arm substituents are important G-quadruplex-binding ligands. For example, 5,10,15,20-Tetrakis(N-methylpyridinium-4-yl-21H,23H-porphyrin (TMPyP4, interacts strongly with G-quadruplexes, but has poor selectivity for G-quadruplex versus duplex DNA. To increase the G-quadruplex recognition specificity, a new cationic porphyrin derivative, 5,10,15,20-tetra-{4-[2-(1-methyl-1-piperidinylethoxy]phenyl} porphyrin (TMPipEOPP, with large side arm substituents was synthesized, and the interactions between TMPipEOPP and different DNA structures were compared. The results show that G-quadruplexes cause large changes in the UV-Vis absorption and fluorescence spectra of TMPipEOPP, but duplex and single-stranded DNAs do not, indicating that TMPipEOPP can be developed as a highly specific optical probe for discriminating G-quadruplex from duplex and single-stranded DNA. Visual discrimination is also possible. Job plot and Scatchard analysis suggest that a complicated binding interaction occurs between TMPipEOPP and G-quadruplexes. At a low [G-quadruplex]/[TMPipEOPP] ratio, one G-quadruplex binds two TMPipEOPP molecules by end-stacking and outside binding modes. At a high [G-quadruplex]/[TMPipEOPP] ratio, two G-quadruplexes bind to one TMPipEOPP molecule in a sandwich-like end-stacking mode.

  11. A new cationic porphyrin derivative (TMPipEOPP) with large side arm substituents: a highly selective G-quadruplex optical probe.

    Science.gov (United States)

    Zhu, Li-Na; Zhao, Shu-Juan; Wu, Bin; Li, Xiao-Zeng; Kong, De-Ming

    2012-01-01

    The discovery of uncommon DNA structures and speculation about their potential functions in genes has brought attention to specific DNA structure recognition. G-quadruplexes are four-stranded nucleic acid structures formed by G-rich DNA (or RNA) sequences. G-rich sequences with a high potential to form G-quadruplexes have been found in many important genomic regions. Porphyrin derivatives with cationic side arm substituents are important G-quadruplex-binding ligands. For example, 5,10,15,20-Tetrakis(N-methylpyridinium-4-yl)-21H,23H-porphyrin (TMPyP4), interacts strongly with G-quadruplexes, but has poor selectivity for G-quadruplex versus duplex DNA. To increase the G-quadruplex recognition specificity, a new cationic porphyrin derivative, 5,10,15,20-tetra-{4-[2-(1-methyl-1-piperidinyl)ethoxy]phenyl} porphyrin (TMPipEOPP), with large side arm substituents was synthesized, and the interactions between TMPipEOPP and different DNA structures were compared. The results show that G-quadruplexes cause large changes in the UV-Vis absorption and fluorescence spectra of TMPipEOPP, but duplex and single-stranded DNAs do not, indicating that TMPipEOPP can be developed as a highly specific optical probe for discriminating G-quadruplex from duplex and single-stranded DNA. Visual discrimination is also possible. Job plot and Scatchard analysis suggest that a complicated binding interaction occurs between TMPipEOPP and G-quadruplexes. At a low [G-quadruplex]/[TMPipEOPP] ratio, one G-quadruplex binds two TMPipEOPP molecules by end-stacking and outside binding modes. At a high [G-quadruplex]/[TMPipEOPP] ratio, two G-quadruplexes bind to one TMPipEOPP molecule in a sandwich-like end-stacking mode.

  12. GNG Motifs Can Replace a GGG Stretch during G-Quadruplex Formation in a Context Dependent Manner.

    Directory of Open Access Journals (Sweden)

    Kohal Das

    Full Text Available G-quadruplexes are one of the most commonly studied non-B DNA structures. Generally, these structures are formed using a minimum of 4, three guanine tracts, with connecting loops ranging from one to seven. Recent studies have reported deviation from this general convention. One such deviation is the involvement of bulges in the guanine tracts. In this study, guanines along with bulges, also referred to as GNG motifs have been extensively studied using recently reported HOX11 breakpoint fragile region I as a model template. By strategic mutagenesis approach we show that the contribution from continuous G-tracts may be dispensible during G-quadruplex formation when such motifs are flanked by GNGs. Importantly, the positioning and number of GNG/GNGNG can also influence the formation of G-quadruplexes. Further, we assessed three genomic regions from HIF1 alpha, VEGF and SHOX gene for G-quadruplex formation using GNG motifs. We show that HIF1 alpha sequence harbouring GNG motifs can fold into intramolecular G-quadruplex. In contrast, GNG motifs in mutant VEGF sequence could not participate in structure formation, suggesting that the usage of GNG is context dependent. Importantly, we show that when two continuous stretches of guanines are flanked by two independent GNG motifs in a naturally occurring sequence (SHOX, it can fold into an intramolecular G-quadruplex. Finally, we show the specific binding of G-quadruplex binding protein, Nucleolin and G-quadruplex antibody, BG4 to SHOX G-quadruplex. Overall, our study provides novel insights into the role of GNG motifs in G-quadruplex structure formation which may have both physiological and pathological implications.

  13. Development of a carbazole-based fluorescence probe for G-quadruplex DNA: The importance of side-group effect on binding specificity

    Science.gov (United States)

    Wang, Ming-Qi; Ren, Gui-Ying; Zhao, Shuang; Lian, Guang-Chang; Chen, Ting-Ting; Ci, Yang; Li, Hong-Yao

    2018-06-01

    G-quadruplex DNAs are highly prevalent in the human genome and involved in many important biological processes. However, many aspects of their biological mechanism and significance still need to be elucidated. Therefore, the development of fluorescent probes for G-quadruplex detection is important for the basic research. We report here on the development of small molecular dyes designed on the basis of carbazole scaffold by introducing styrene-like substituents at its 9-position, for the purpose of G-quadruplex recognition. Results revealed that the side group on the carbazole scaffold was very important for their ability to selectively recognize G-quadruplex DNA structures. 1a with the pyridine side group displayed excellent fluorescence signal turn-on property for the specific discrimination of G-quadruplex DNAs against other nucleic acids. The characteristics of 1a were further investigated with UV-vis spectrophotometry, fluorescence, circular dichroism, FID assay and molecular docking to validate the selectivity, sensitivity and detailed binding mode toward G-quadruplex DNAs.

  14. G-Quadruplex conformational change driven by pH variation with potential application as a nanoswitch.

    Science.gov (United States)

    Yan, Yi-Yong; Tan, Jia-Heng; Lu, Yu-Jing; Yan, Siu-Cheong; Wong, Kwok-Yin; Li, Ding; Gu, Lian-Quan; Huang, Zhi-Shu

    2013-10-01

    G-Quadruplex is a highly polymorphic structure, and its behavior in acidic condition has not been well studied. Circular dichroism (CD) spectra were used to study the conformational change of G-quadruplex. The thermal stabilities of the G-quadruplex were measured with CD melting. Interconversion kinetics profiles were investigated by using CD kinetics. The fluorescence of the inserted 2-Aminopurine (Ap) was monitored during pH change and acrylamide quenching, indicating the status of the loop. Proton NMR was adopted to help illustrate the change of the conformation. G-Quadruplex of specific loop was found to be able to transform upon pH variation. The transformation was resulted from the loop rearrangement. After screening of a library of diverse G-quadruplex, a sequence exhibiting the best transformation property was found. A pH-driven nanoswitch with three gears was obtained based on this transition cycle. Certain G-quadruplex was found to go through conformational change at low pH. Loop was the decisive factor controlling the interconversion upon pH variation. G-Quadruplex with TT central loop could be converted in a much milder condition than the one with TTA loop. It can be used to design pH-driven nanodevices such as a nanoswitch. These results provide more insights into G-quadruplex polymorphism, and also contribute to the design of DNA-based nanomachines and logic gates. © 2013.

  15. Structural Insights into the Quadruplex-Duplex 3' Interface Formed from a Telomeric Repeat: A Potential Molecular Target.

    Science.gov (United States)

    Russo Krauss, Irene; Ramaswamy, Sneha; Neidle, Stephen; Haider, Shozeb; Parkinson, Gary N

    2016-02-03

    We report here on an X-ray crystallographic and molecular modeling investigation into the complex 3' interface formed between putative parallel stranded G-quadruplexes and a duplex DNA sequence constructed from the human telomeric repeat sequence TTAGGG. Our crystallographic approach provides a detailed snapshot of a telomeric 3' quadruplex-duplex junction: a junction that appears to have the potential to form a unique molecular target for small molecule binding and interference with telomere-related functions. This unique target is particularly relevant as current high-affinity compounds that bind putative G-quadruplex forming sequences only rarely have a high degree of selectivity for a particular quadruplex. Here DNA junctions were assembled using different putative quadruplex-forming scaffolds linked at the 3' end to a telomeric duplex sequence and annealed to a complementary strand. We successfully generated a series of G-quadruplex-duplex containing crystals, both alone and in the presence of ligands. The structures demonstrate the formation of a parallel folded G-quadruplex and a B-form duplex DNA stacked coaxially. Most strikingly, structural data reveals the consistent formation of a TAT triad platform between the two motifs. This triad allows for a continuous stack of bases to link the quadruplex motif with the duplex region. For these crystal structures formed in the absence of ligands, the TAT triad interface occludes ligand binding at the 3' quadruplex-duplex interface, in agreement with in silico docking predictions. However, with the rearrangement of a single nucleotide, a stable pocket can be produced, thus providing an opportunity for the binding of selective molecules at the interface.

  16. Pyrrolobenzodiazepines (PBDs do not bind to DNA G-quadruplexes.

    Directory of Open Access Journals (Sweden)

    Khondaker M Rahman

    Full Text Available The pyrrolo[2,1-c][1,4] benzodiazepines (PBDs are a family of sequence-selective, minor-groove binding DNA-interactive agents that covalently attach to guanine residues. A recent publication in this journal (Raju et al, PloS One, 2012, 7, 4, e35920 reported that two PBD molecules were observed to bind with high affinity to the telomeric quadruplex of Tetrahymena glaucoma based on Electrospray Ionisation Mass Spectrometry (ESI-MS, Circular Dichroism, UV-Visible and Fluorescence spectroscopy data. This was a surprising result given the close 3-dimensional shape match between the structure of all PBD molecules and the minor groove of duplex DNA, and the completely different 3-dimensional structure of quadruplex DNA. Therefore, we evaluated the interaction of eight PBD molecules of diverse structure with a range of parallel, antiparallel and mixed DNA quadruplexes using DNA Thermal Denaturation, Circular Dichroism and Molecular Dynamics Simulations. Those PBD molecules without large C8-substitutents had an insignificant affinity for the eight quadruplex types, although those with large π-system-containing C8-substituents (as with the compounds evaluated by Raju and co-workers were found to interact to some extent. Our molecular dynamics simulations support the likelihood that molecules of this type, including those examined by Raju and co-workers, interact with quadruplex DNA through their C8-substituents rather than the PBD moiety itself. It is important for the literature to be clear on this matter, as the mechanism of action of these agents will be under close scrutiny in the near future due to the growing number of PBD-based agents entering the clinic as both single-agents and as components of antibody-drug conjugates (ADCs.

  17. Putting instruction sequences into effect

    NARCIS (Netherlands)

    Bergstra, J.A.

    2011-01-01

    An attempt is made to define the concept of execution of an instruction sequence. It is found to be a special case of directly putting into effect of an instruction sequence. Directly putting into effect of an instruction sequences comprises interpretation as well as execution. Directly putting into

  18. G-quadruplexes as novel cis-elements controlling transcription during embryonic development.

    Science.gov (United States)

    David, Aldana P; Margarit, Ezequiel; Domizi, Pablo; Banchio, Claudia; Armas, Pablo; Calcaterra, Nora B

    2016-05-19

    G-quadruplexes are dynamic structures folded in G-rich single-stranded DNA regions. These structures have been recognized as a potential nucleic acid based mechanism for regulating multiple cellular processes such as replication, transcription and genomic maintenance. So far, their transcriptional role in vivo during vertebrate embryonic development has not yet been addressed. Here, we performed an in silico search to find conserved putative G-quadruplex sequences (PQSs) within proximal promoter regions of human, mouse and zebrafish developmental genes. Among the PQSs able to fold in vitro as G-quadruplex, those present in nog3, col2a1 and fzd5 promoters were selected for further studies. In cellulo studies revealed that the selected G-quadruplexes affected the transcription of luciferase controlled by the SV40 nonrelated promoter. G-quadruplex disruption in vivo by microinjection in zebrafish embryos of either small ligands or DNA oligonucleotides complementary to the selected PQSs resulted in lower transcription of the targeted genes. Moreover, zebrafish embryos and larvae phenotypes caused by the presence of complementary oligonucleotides fully resembled those ones reported for nog3, col2a1 and fzd5 morphants. To our knowledge, this is the first work revealing in vivo the role of conserved G-quadruplexes in the embryonic development, one of the most regulated processes of the vertebrates biology. © The Author(s) 2016. Published by Oxford University Press on behalf of Nucleic Acids Research.

  19. Experimental approaches to identify cellular G-quadruplex structures and functions.

    Science.gov (United States)

    Di Antonio, Marco; Rodriguez, Raphaël; Balasubramanian, Shankar

    2012-05-01

    Guanine-rich nucleic acids can fold into non-canonical DNA secondary structures called G-quadruplexes. The formation of these structures can interfere with the biology that is crucial to sustain cellular homeostases and metabolism via mechanisms that include transcription, translation, splicing, telomere maintenance and DNA recombination. Thus, due to their implication in several biological processes and possible role promoting genomic instability, G-quadruplex forming sequences have emerged as potential therapeutic targets. There has been a growing interest in the development of synthetic molecules and biomolecules for sensing G-quadruplex structures in cellular DNA. In this review, we summarise and discuss recent methods developed for cellular imaging of G-quadruplexes, and the application of experimental genomic approaches to detect G-quadruplexes throughout genomic DNA. In particular, we will discuss the use of engineered small molecules and natural proteins to enable pull-down, ChIP-Seq, ChIP-chip and fluorescence imaging of G-quadruplex structures in cellular DNA. Copyright © 2012 Elsevier Inc. All rights reserved.

  20. A Role for the Fifth G-Track in G-Quadruplex Forming Oncogene Promoter Sequences during Oxidative Stress: Do These “Spare Tires” Have an Evolved Function?

    Science.gov (United States)

    2015-01-01

    Uncontrolled inflammation or oxidative stress generates electron-deficient species that oxidize the genome increasing its instability in cancer. The G-quadruplex (G4) sequences regulating the c-MYC, KRAS, VEGF, BCL-2, HIF-1α, and RET oncogenes, as examples, are targets for oxidation at loop and 5′-core guanines (G) as showcased in this study by CO3•– oxidation of the VEGF G4. Products observed include 8-oxo-7,8-dihydroguanine (OG), spiroiminodihydantoin (Sp), and 5-guanidinohydantoin (Gh). Our previous studies found that OG and Gh, when present in the four G-tracks of the solved structure for VEGF and c-MYC, were not substrates for the base excision repair (BER) DNA glycosylases in biologically relevant KCl solutions. We now hypothesize that a fifth G-track found a few nucleotides distant from the G4 tracks involved in folding can act as a “spare tire,” facilitating extrusion of a damaged G-run into a large loop that then becomes a substrate for BER. Thermodynamic, spectroscopic, and DMS footprinting studies verified the fifth domain replacing a damaged G-track with OG or Gh at a loop or core position in the VEGF G4. These new “spare tire”-containing strands with Gh in loops are now found to be substrates for initiation of BER with the NEIL1, NEIL2, and NEIL3 DNA glycosylases. The results support a hypothesis in which regulatory G4s carry a “spare-tire” fifth G-track for aiding in the repair process when these sequences are damaged by radical oxygen species, a feature observed in a large number of these sequences. Furthermore, formation and repair of oxidized bases in promoter regions may constitute an additional example of epigenetic modification, in this case of guanine bases, to regulate gene expression in which the G4 sequences act as sensors of oxidative stress. PMID:26405692

  1. Macrocyclic G-quadruplex ligands

    DEFF Research Database (Denmark)

    Nielsen, M C; Ulven, Trond

    2010-01-01

    are macrocyclic structures which have been modeled after the natural product telomestatin or from porphyrin-based ligands discovered in the late 1990s. These two structural classes of G-quadruplex ligands are reviewed here with special attention to selectivity and structure-activity relationships, and with focus...

  2. G-Quadruplexes Involving Both Strands of Genomic DNA Are Highly Abundant and Colocalize with Functional Sites in the Human Genome.

    Directory of Open Access Journals (Sweden)

    Andrzej S Kudlicki

    Full Text Available The G-quadruplex is a non-canonical DNA structure biologically significant in DNA replication, transcription and telomere stability. To date, only G4s with all guanines originating from the same strand of DNA have been considered in the context of the human nuclear genome. Here, I discuss interstrand topological configurations of G-quadruplex DNA, consisting of guanines from both strands of genomic DNA; an algorithm is presented for predicting such structures. I have identified over 550,000 non-overlapping interstrand G-quadruplex forming sequences in the human genome--significantly more than intrastrand configurations. Functional analysis of interstrand G-quadruplex sites shows strong association with transcription initiation, the results are consistent with the XPB and XPD transcriptional helicases binding only to G-quadruplex DNA with interstrand topology. Interstrand quadruplexes are also enriched in origin of replication sites. Several topology classes of interstrand quadruplex-forming sequences are possible, and different topologies are enriched in different types of structural elements. The list of interstrand quadruplex forming sequences, and the computer program used for their prediction are available at the web address http://moment.utmb.edu/allquads.

  3. Putative DNA G-quadruplex formation within the promoters of Plasmodium falciparum var genes

    Directory of Open Access Journals (Sweden)

    Rowe J

    2009-08-01

    Full Text Available Abstract Background Guanine-rich nucleic acid sequences are capable of folding into an intramolecular four-stranded structure called a G-quadruplex. When found in gene promoter regions, G-quadruplexes can downregulate gene expression, possibly by blocking the transcriptional machinery. Here we have used a genome-wide bioinformatic approach to identify Putative G-Quadruplex Sequences (PQS in the Plasmodium falciparum genome, along with biophysical techniques to examine the physiological stability of P. falciparum PQS in vitro. Results We identified 63 PQS in the non-telomeric regions of the P. falciparum clone 3D7. Interestingly, 16 of these PQS occurred in the upstream region of a subset of the P. falciparum var genes (group B var genes. The var gene family encodes PfEMP1, the parasite's major variant antigen and adhesin expressed at the surface of infected erythrocytes, that plays a key role in malaria pathogenesis and immune evasion. The ability of the PQS found in the upstream regions of group B var genes (UpsB-Q to form stable G-quadruplex structures in vitro was confirmed using 1H NMR, circular dichroism, UV spectroscopy, and thermal denaturation experiments. Moreover, the synthetic compound BOQ1 that shows a higher affinity for DNA forming quadruplex rather than duplex structures was found to bind with high affinity to the UpsB-Q. Conclusion This is the first demonstration of non-telomeric PQS in the genome of P. falciparum that form stable G-quadruplexes under physiological conditions in vitro. These results allow the generation of a novel hypothesis that the G-quadruplex sequences in the upstream regions of var genes have the potential to play a role in the transcriptional control of this major virulence-associated multi-gene family.

  4. G-quadruplex induced chirality of methylazacalix[6]pyridine via unprecedented binding stoichiometry: en route to multiplex controlled molecular switch

    Science.gov (United States)

    Guan, Ai-Jiao; Shen, Meng-Jie; Xiang, Jun-Feng; Zhang, En-Xuan; Li, Qian; Sun, Hong-Xia; Wang, Li-Xia; Xu, Guang-Zhi; Tang, Ya-Lin; Xu, Li-Jin; Gong, Han-Yuan

    2015-05-01

    Nucleic acid based molecular device is a developing research field which attracts great interests in material for building machinelike nanodevices. G-quadruplex, as a new type of DNA secondary structures, can be harnessed to construct molecular device owing to its rich structural polymorphism. Herein, we developed a switching system based on G-quadruplexes and methylazacalix[6]pyridine (MACP6). The induced circular dichroism (CD) signal of MACP6 was used to monitor the switch controlled by temperature or pH value. Furthermore, the CD titration, Job-plot, variable temperature CD and 1H-NMR experiments not only confirmed the binding mode between MACP6 and G-quadruplex, but also explained the difference switching effect of MACP6 and various G-quadruplexes. The established strategy has the potential to be used as the chiral probe for specific G-quadruplex recognition.

  5. Biochemical techniques for the characterization of G-quadruplex structures: EMSA, DMS footprinting, and DNA polymerase stop assay.

    Science.gov (United States)

    Sun, Daekyu; Hurley, Laurence H

    2010-01-01

    The proximal promoter region of many human growth-related genes contains a polypurine/polypyrimidine tract that serves as multiple binding sites for Sp1 or other transcription factors. These tracts often contain a guanine-rich sequence consisting of four runs of three or more contiguous guanines separated by one or more bases, corresponding to a general motif known for the formation of an intramolecular G-quadruplex. Recent results provide strong evidence that specific G-quadruplex structures form naturally within these polypurine/polypyrimidine tracts in many human promoter regions, raising the possibility that the transcriptional control of these genes can be modulated by G-quadruplex-interactive agents. In this chapter, we describe three general biochemical methodologies, electrophoretic mobility shift assay (EMSA), dimethylsulfate (DMS) footprinting, and the DNA polymerase stop assay, which can be useful for initial characterization of G-quadruplex structures formed by G-rich sequences.

  6. Repair of O6-methylguanine adducts in human telomeric G-quadruplex DNA by O6-alkylguanine-DNA alkyltransferase

    Science.gov (United States)

    Hellman, Lance M.; Spear, Tyler J.; Koontz, Colton J.; Melikishvili, Manana; Fried, Michael G.

    2014-01-01

    O6-alkylguanine-DNA alkyltransferase (AGT) is a single-cycle DNA repair enzyme that removes pro-mutagenic O6-alkylguanine adducts from DNA. Its functions with short single-stranded and duplex substrates have been characterized, but its ability to act on other DNA structures remains poorly understood. Here, we examine the functions of this enzyme on O6-methylguanine (6mG) adducts in the four-stranded structure of the human telomeric G-quadruplex. On a folded 22-nt G-quadruplex substrate, binding saturated at 2 AGT:DNA, significantly less than the ∼5 AGT:DNA found with linear single-stranded DNAs of similar length, and less than the value found with the telomere sequence under conditions that inhibit quadruplex formation (4 AGT:DNA). Despite these differences, AGT repaired 6mG adducts located within folded G-quadruplexes, at rates that were comparable to those found for a duplex DNA substrate under analogous conditions. Repair was kinetically biphasic with the amplitudes of rapid and slow phases dependent on the position of the adduct within the G-quadruplex: in general, adducts located in the top or bottom tetrads of a quadruplex stack exhibited more rapid-phase repair than did adducts located in the inner tetrad. This distinction may reflect differences in the conformational dynamics of 6mG residues in G-quadruplex DNAs. PMID:25080506

  7. Controlling the stoichiometry and strand polarity of a tetramolecular G-quadruplex structure by using a DNA origami frame

    Science.gov (United States)

    Rajendran, Arivazhagan; Endo, Masayuki; Hidaka, Kumi; Lan Thao Tran, Phong; Mergny, Jean-Louis; Sugiyama, Hiroshi

    2013-01-01

    Guanine-rich oligonucleotides often show a strong tendency to form supramolecular architecture, the so-called G-quadruplex structure. Because of the biological significance, it is now considered to be one of the most important conformations of DNA. Here, we describe the direct visualization and single-molecule analysis of the formation of a tetramolecular G-quadruplex in KCl solution. The conformational changes were carried out by incorporating two duplex DNAs, with G–G mismatch repeats in the middle, inside a DNA origami frame and monitoring the topology change of the strands. In the absence of KCl, incorporated duplexes had no interaction and laid parallel to each other. Addition of KCl induced the formation of a G-quadruplex structure by stably binding the duplexes to each other in the middle. Such a quadruplex formation allowed the DNA synapsis without disturbing the duplex regions of the participating sequences, and resulted in an X-shaped structure that was monitored by atomic force microscopy. Further, the G-quadruplex formation in KCl solution and its disruption in KCl-free buffer were analyzed in real-time. The orientation of the G-quadruplex is often difficult to control and investigate using traditional biochemical methods. However, our method using DNA origami could successfully control the strand orientations, topology and stoichiometry of the G-quadruplex. PMID:23863846

  8. Thrombin-Binding Aptamer Quadruplex Formation: AFM and Voltammetric Characterization

    Directory of Open Access Journals (Sweden)

    Victor Constantin Diculescu

    2010-01-01

    Full Text Available The adsorption and the redox behaviour of thrombin-binding aptamer (TBA and extended TBA (eTBA were studied using atomic force microscopy and voltammetry at highly oriented pyrolytic graphite and glassy carbon. The different adsorption patterns and degree of surface coverage were correlated with the sequence base composition, presence/absence of K+, and voltammetric behaviour of TBA and eTBA. In the presence of K+, only a few single-stranded sequences present adsorption, while the majority of the molecules forms stable and rigid quadruplexes with no adsorption. Both TBA and eTBA are oxidized and the only anodic peak corresponds to guanine oxidation. Upon addition of K+ ions, TBA and eTBA fold into a quadruplex, causing the decrease of guanine oxidation peak and occurrence of a new peak at a higher potential due to the oxidation of G-quartets. The higher oxidation potential of G-quartets is due to the greater difficulty of electron transfer from the inside of the quadruplex to the electrode surface than electron transfer from the more flexible single strands.

  9. G quadruplex-based FRET probes with the thrombin-binding aptamer (TBA) sequence designed for the efficient fluorometric detection of the potassium ion.

    Science.gov (United States)

    Nagatoishi, Satoru; Nojima, Takahiko; Galezowska, Elzbieta; Juskowiak, Bernard; Takenaka, Shigeori

    2006-11-01

    The dual-labeled oligonucleotide derivative, FAT-0, carrying 6- carboxyfluorescein (FAM) and 6-carboxytetramethylrhodamine (TAMRA) labels at the 5' and 3' termini of the thrombin-binding aptamer (TBA) sequence 5'-GGT TGG TGT GGT TGG-3', and its derivatives, FAT-n (n=3, 5, and 7) with a spacer at the 5'-end of a TBA sequence of T(m)A (m=2, 4, and 6) have been designed and synthesized. These fluorescent probes were developed for monitoring K(+) concentrations in living organisms. Circular dichroism, UV-visible absorption, and fluorescence studies revealed that all FAT-n probes could form intramolecular tetraplex structures after binding K(+). Fluorescence resonance energy transfer and quenching results are discussed taking into account dye-dye contact interactions. The relationship between the fluorescence behavior of the probes and the spacer length in FAT-n was studied in detail and is discussed.

  10. DNA and RNA Quadruplex-Binding Proteins

    Czech Academy of Sciences Publication Activity Database

    Brázda, Václav; Haroniková, Lucia; Liao, J.C.C.; Fojta, Miroslav

    2014-01-01

    Roč. 15, č. 10 (2014), s. 17493-17517 E-ISSN 1422-0067 R&D Projects: GA ČR(CZ) GBP206/12/G151 Institutional support: RVO:68081707 Keywords : DNA quadruplex * RNA quadruplex * telomere Subject RIV: BO - Biophysics Impact factor: 2.862, year: 2014

  11. Multimerization rules for G-quadruplexes

    Czech Academy of Sciences Publication Activity Database

    Kolesnikova, Sofia; Hubálek, Martin; Bednárová, Lucie; Cvačka, Josef; Curtis, Edward A.

    2017-01-01

    Roč. 45, č. 15 (2017), s. 8684-8696 ISSN 0305-1048 Institutional support: RVO:61388963 Keywords : tetramolecular G-quadruplexes * RNA G-quadruplexes * circular dichroism Subject RIV: CE - Biochemistry OBOR OECD: Biochemistry and molecular biology Impact factor: 10.162, year: 2016 https://academic.oup.com/nar/article/45/15/8684/4002725/Multimerization-rules-for-Gquadruplexes

  12. Behavior of the guanine base in G-quadruplexes probed by the fluorescent guanine analog, 6-methyl isozanthopterin

    Energy Technology Data Exchange (ETDEWEB)

    Han, Ji Hoon; Chitrapriya, Nataraj; Lee, Hyun Suk; Lee, Young Ae; Kim, Seog K. [Dept. of Chemistry, Yeungnam University, Gyeongsan (Korea, Republic of); Jung, Maeng Joon [Dept. of Chemistry, Kyungpook National University, Daegu (Korea, Republic of)

    2017-02-15

    In this study, circular dichroism (CD) spectrum and fluorescence techniques were used to examine the dynamic properties and microenvironment of the guanine base (G) at the central loop and at the middle of the G-stem of the G-quadruplex formed from the G{sub 3}T{sub 2}G{sub 3}TGTG{sub 3}T{sub 2}G{sub 3} sequence (G-quadruplex 1), in which the G base at the 10th and 13th position were replaced with a fluorescent G analog, 6-methyl isoxanthopterin (6MI) (G-quadruplex 2 and 3, respectively). For all G-quadruplexes, the CD spectrum revealed a positive band at 263 nm and a shoulder at 298 nm, and the thermal melting profiles were the sum of at least two sigmoidal curves. These observations indicated the presence of two conformers in the G-quadruplex. The fluorescence intensity of G-quadruplex 2 was greater than 3, as expected from the extent of stacking interaction, which is larger in the G(6MI)G sequence than the T(6MI)T sequence. The efficiency of fluorescence quenching by the polar acrylamide quencher and negatively charged I− quencher were larger for G-quadruplex 3, suggesting that 6MI in the G(6MI)G stem is exposed more to the aqueous environment compared to that in the T(6MI)T central loop. In the latter case, 6MI may direct to the center of the top G-quartet layer. The possibility of hydrogen bond formation between the carbonyl group of 6MI and the acrylamide of the G-quadruplex 3 was proposed.

  13. Inverting the G-Tetrad Polarity of a G-Quadruplex by Using Xanthine and 8-Oxoguanine.

    Science.gov (United States)

    Cheong, Vee Vee; Lech, Christopher Jacques; Heddi, Brahim; Phan, Anh Tuân

    2016-01-04

    G-quadruplexes are four-stranded nucleic acid structures that are built from consecutively stacked guanine tetrad (G-tetrad) assemblies. The simultaneous incorporation of two guanine base lesions, xanthine (X) and 8-oxoguanine (O), within a single G-tetrad of a G-quadruplex was recently shown to lead to the formation of a stable G⋅G⋅X⋅O tetrad. Herein, a judicious introduction of X and O into a human telomeric G-quadruplex-forming sequence is shown to reverse the hydrogen-bond polarity of the modified G-tetrad while preserving the original folding topology. The control exerted over G-tetrad polarity by joint X⋅O modification will be valuable for the design and programming of G-quadruplex structures and their properties. © 2016 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  14. Formation of a unique cluster of G-quadruplex structures in the HIV-1 Nef coding region: implications for antiviral activity.

    Directory of Open Access Journals (Sweden)

    Rosalba Perrone

    Full Text Available G-quadruplexes are tetraplex structures of nucleic acids that can form in G-rich sequences. Their presence and functional role have been established in telomeres, oncogene promoters and coding regions of the human chromosome. In particular, they have been proposed to be directly involved in gene regulation at the level of transcription. Because the HIV-1 Nef protein is a fundamental factor for efficient viral replication, infectivity and pathogenesis in vitro and in vivo, we investigated G-quadruplex formation in the HIV-1 nef gene to assess the potential for viral inhibition through G-quadruplex stabilization. A comprehensive computational analysis of the nef coding region of available strains showed the presence of three conserved sequences that were uniquely clustered. Biophysical testing proved that G-quadruplex conformations were efficiently stabilized or induced by G-quadruplex ligands in all three sequences. Upon incubation with a G-quadruplex ligand, Nef expression was reduced in a reporter gene assay and Nef-dependent enhancement of HIV-1 infectivity was significantly repressed in an antiviral assay. These data constitute the first evidence of the possibility to regulate HIV-1 gene expression and infectivity through G-quadruplex targeting and therefore open a new avenue for viral treatment.

  15. Ion Binding to Quadruplex DNA Stems. Comparison of MM and QM Descriptions Reveals Sizable Polarization Effects Not Included in Contemporary Simulations

    Czech Academy of Sciences Publication Activity Database

    Gkionis, K.; Kruse, H.; Platts, J. A.; Mládek, Arnošt; Koča, J.; Šponer, Jiří

    2014-01-01

    Roč. 10, č. 3 (2014), s. 1326-1340 ISSN 1549-9618 R&D Projects: GA ČR(CZ) GAP208/11/1822; GA MŠk(CZ) ED1.1.00/02.0068 Institutional support: RVO:68081707 Keywords : MOLECULAR-DYNAMICS SIMULATIONS * GAUSSIAN-BASIS SETS * TETRAMOLECULAR G-QUADRUPLEXES Subject RIV: BO - Biophysics Impact factor: 5.498, year: 2014

  16. Expanding the potential of G-quadruplex structures: formation of a heterochiral TBA analogue.

    Science.gov (United States)

    Virgilio, Antonella; Varra, Michela; Scuotto, Maria; Capuozzo, Antonella; Irace, Carlo; Mayol, Luciano; Esposito, Veronica; Galeone, Aldo

    2014-03-21

    In order to expand the potential applications of G-quadruplex structures, we explored the ability of heterochiral oligodeoxynucleotides based on the thrombin-binding aptamer (TBA) sequence to fold into similar complexes, with particular focus on their resistance in biological environments. A combination of CD and NMR techniques was used. Similarly to TBA, the ODN ggTTggtgtggTTgg (lower case letters indicate L residues) is able to fold into a chair-like antiparallel G-quadruplex structure, but has a slightly higher thermal stability. The discovery that heterochiral ODNs are able to form stable G-quadruplex structures opens up new possibilities for their development in several fields, as aptamers, sensors and, as recently shown, as catalysts for enantioselective reactions. © 2014 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  17. Binding modes and pathway of RHPS4 to human telomeric G-quadruplex and duplex DNA probed by all-atom molecular dynamics simulations with explicit solvent.

    Science.gov (United States)

    Mulholland, Kelly; Siddiquei, Farzana; Wu, Chun

    2017-07-19

    RHPS4, a potent binder to human telomeric DNA G-quadruplex, shows high efficacy in tumor cell growth inhibition. However, it's preferential binding to DNA G-quadruplex over DNA duplex (about 10 fold) remains to be improved toward its clinical application. A high resolution structure of the single-stranded telomeric DNA G-quadruplexes, or B-DNA duplex, in complex with RHPS4 is not available yet, and the binding nature of this ligand to these DNA forms remains to be elusive. In this study, we carried out 40 μs molecular dynamics binding simulations with a free ligand to decipher the binding pathway of RHPS4 to a DNA duplex and three G-quadruplex folders (parallel, antiparallel and hybrid) of the human telomeric DNA sequence. The most stable binding mode identified for the duplex, parallel, antiparallel and hybrid G-quadruplexes is an intercalation, bottom stacking, top intercalation and bottom intercalation mode, respectively. The intercalation mode with similar binding strength to both the duplex and the G-quadruplexes, explains the lack of binding selectivity of RHPS4 to the G-quadruplex form. Therefore, a ligand modification that destabilizes the duplex intercalation mode but stabilizes the G-quadruplex intercalation mode will improve the binding selectivity toward G-quadruplex. The intercalation mode of RHPS4 to both the duplex and the antiparallel and the hybrid G-quadruplex follows a base flipping-insertion mechanism rather than an open-insertion mechanism. The groove binding, the side binding and the intercalation with flipping out of base were observed to be intermediate states before the full intercalation state with paired bases.

  18. Volumetric contributions of loop regions of G-quadruplex DNA to the formation of the tertiary structure.

    Science.gov (United States)

    Takahashi, Shuntaro; Sugimoto, Naoki

    2017-12-01

    DNA guanine-quadruplexes (G-quadruplexes) are unique DNA structures formed by guanine-rich sequences. The loop regions of G-quadruplexes play key roles in stability and topology of G-quadruplexes. Here, we investigated volumetric changes induced by pressure in the folding of the G-quadruplex formed by the thrombin binding aptamer (TBA) with mutations within the loop regions. The change of partial molar volume in the transition from coil to G-quadruplex, ∆V tr , of TBA with a mutation from T to A in the 5' most loop (TBA T3A) was 75.5cm 3 mol -1 , which was larger than that of TBA (54.6cm 3 mol -1 ). TBA with a G to T mutation in the central loop (TBA G8T) had thermal stability similar to TBA T3A but a smaller ∆V tr of 41.1cm 3 mol -1 . In the presence of poly(ethylene)glycol 200 (PEG200), ∆V tr values were 14.7cm 3 mol -1 for TBA T3A and 13.2cm 3 mol -1 for TBA G8T. These results suggest that the two mutations destabilize the G-quadruplex structure differently. Thus, volumetric data obtained using pressure-based thermodynamic analyses provides information about the dynamics of the loop regions and the roles of loops in the stabilities and folding of G-quadruplex structures. Copyright © 2017 Elsevier B.V. All rights reserved.

  19. Interaction of Pyrrolobenzodiazepine (PBD) Ligands with Parallel Intermolecular G-Quadruplex Complex Using Spectroscopy and ESI-MS

    Science.gov (United States)

    Raju, Gajjela; Srinivas, Ragampeta; Santhosh Reddy, Vangala; Idris, Mohammed M.; Kamal, Ahmed; Nagesh, Narayana

    2012-01-01

    Studies on ligand interaction with quadruplex DNA, and their role in stabilizing the complex at concentration prevailing under physiological condition, has attained high interest. Electrospray ionization mass spectrometry (ESI-MS) and spectroscopic studies in solution were used to evaluate the interaction of PBD and TMPyP4 ligands, stoichiometry and selectivity to G-quadruplex DNA. Two synthetic ligands from PBD family, namely pyrene-linked pyrrolo[2,1-c][1,4]benzodiazepine hybrid (PBD1), mixed imine-amide pyrrolobenzodiazepine dimer (PBD2) and 5,10,15,20-tetrakis(N-methyl-4-pyridyl)porphyrin (TMPyP4) were studied. G-rich single-stranded oligonucleotide d(5′GGGGTTGGGG3′) designated as d(T2G8), from the telomeric region of Tetrahymena Glaucoma, was considered for the interaction with ligands. ESI-MS and spectroscopic methods viz., circular dichroism (CD), UV-Visible, and fluorescence were employed to investigate the G-quadruplex structures formed by d(T2G8) sequence and its interaction with PBD and TMPyP4 ligands. From ESI-MS spectra, it is evident that the majority of quadruplexes exist as d(T2G8)2 and d(T2G8)4 forms possessing two to ten cations in the centre, thereby stabilizing the complex. CD band of PBD1 and PBD2 showed hypo and hyperchromicity, on interaction with quadruplex DNA, indicating unfolding and stabilization of quadruplex DNA complex, respectively. UV-Visible and fluorescence experiments suggest that PBD1 bind externally where as PBD2 intercalate moderately and bind externally to G-quadruplex DNA. Further, melting experiments using SYBR Green indicate that PBD1 unfolds and PBD2 stabilizes the G-quadruplex complex. ITC experiments using d(T2G8) quadruplex with PBD ligands reveal that PBD1 and PBD2 prefer external/loop binding and external/intercalative binding to quadruplex DNA, respectively. From experimental results it is clear that the interaction of PBD2 and TMPyP4 impart higher stability to the quadruplex complex. PMID:22558271

  20. Interaction of pyrrolobenzodiazepine (PBD ligands with parallel intermolecular G-quadruplex complex using spectroscopy and ESI-MS.

    Directory of Open Access Journals (Sweden)

    Gajjela Raju

    Full Text Available Studies on ligand interaction with quadruplex DNA, and their role in stabilizing the complex at concentration prevailing under physiological condition, has attained high interest. Electrospray ionization mass spectrometry (ESI-MS and spectroscopic studies in solution were used to evaluate the interaction of PBD and TMPyP4 ligands, stoichiometry and selectivity to G-quadruplex DNA. Two synthetic ligands from PBD family, namely pyrene-linked pyrrolo[2,1-c][1,4]benzodiazepine hybrid (PBD1, mixed imine-amide pyrrolobenzodiazepine dimer (PBD2 and 5,10,15,20-tetrakis(N-methyl-4-pyridylporphyrin (TMPyP4 were studied. G-rich single-stranded oligonucleotide d(5'GGGGTTGGGG3' designated as d(T(2G(8, from the telomeric region of Tetrahymena Glaucoma, was considered for the interaction with ligands. ESI-MS and spectroscopic methods viz., circular dichroism (CD, UV-Visible, and fluorescence were employed to investigate the G-quadruplex structures formed by d(T(2G(8 sequence and its interaction with PBD and TMPyP4 ligands. From ESI-MS spectra, it is evident that the majority of quadruplexes exist as d(T(2G(8(2 and d(T(2G(8(4 forms possessing two to ten cations in the centre, thereby stabilizing the complex. CD band of PBD1 and PBD2 showed hypo and hyperchromicity, on interaction with quadruplex DNA, indicating unfolding and stabilization of quadruplex DNA complex, respectively. UV-Visible and fluorescence experiments suggest that PBD1 bind externally where as PBD2 intercalate moderately and bind externally to G-quadruplex DNA. Further, melting experiments using SYBR Green indicate that PBD1 unfolds and PBD2 stabilizes the G-quadruplex complex. ITC experiments using d(T(2G(8 quadruplex with PBD ligands reveal that PBD1 and PBD2 prefer external/loop binding and external/intercalative binding to quadruplex DNA, respectively. From experimental results it is clear that the interaction of PBD2 and TMPyP4 impart higher stability to the quadruplex complex.

  1. Seven essential questions on G-quadruplexes.

    Science.gov (United States)

    König, Sebastian L B; Evans, Amanda C; Huppert, Julian L

    2010-08-01

    The helical duplex architecture of DNA was discovered by Francis Crick and James Watson in 1951 and is well known and understood. However, nucleic acids can also adopt alternative structural conformations that are less familiar, although no less biologically relevant, such as the G-quadruplex. G-quadruplexes continue to be the subject of a rapidly expanding area of research, owing to their significant potential as therapeutic targets and their unique biophysical properties. This review begins by focusing on G-quadruplex structure, elucidating the intermolecular and intramolecular interactions underlying its formation and highlighting several substructural variants. A variety of methods used to characterize these structures are also outlined. The current state of G-quadruplex research is then addressed by proffering seven pertinent questions for discussion. This review concludes with an overview of possible directions for future research trajectories in this exciting and relevant field.

  2. Designing a New Class of Bases for Nucleic Acid Quadruplexes and Quadruplex-Active Ligands.

    Science.gov (United States)

    Bazzi, Sophia; Novotný, Jan; Yurenko, Yevgen P; Marek, Radek

    2015-06-22

    A new class of quadruplex nucleobases, derived from 3-deazaguanine, has been designed for various applications as smart quadruplex ligands as well as quadruplex-based aptamers, receptors, and sensors. An efficient strategy for modifying the guanine quadruplex core has been developed and tested by using quantum chemistry methods. Several potential guanine derivatives modified at the 3- or 8-position or both are analyzed, and the results compared to reference systems containing natural guanine. Analysis of the formation energies (BLYP-D3(BJ)/def2-TZVPP level of theory, in combination with the COSMO model for water) in model systems consisting of two and three stacked tetrads with Na(+) /K(+) ion(s) inside the internal channel indicates that the formation of structures with 3-halo-3-deazaguanine bases leads to a substantial gain in energy, as compared to the corresponding reference guanine complexes. The results cast light on changes in the noncovalent interactions (hydrogen bonding, stacking, and ion coordination) in a quadruplex stem upon modification of the guanine core. In particular, the enhanced stability of the modified quadruplexes was shown to originate mainly from increased π-π stacking. Our study suggests the 3-halo-3-deazaguanine skeleton as a potential building unit for quadruplex systems and smart G-quadruplex ligands. © 2015 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  3. Selectivity in ligand recognition of G-quadruplex loops.

    Science.gov (United States)

    Campbell, Nancy H; Patel, Manisha; Tofa, Amina B; Ghosh, Ragina; Parkinson, Gary N; Neidle, Stephen

    2009-03-03

    A series of disubstituted acridine ligands have been cocrystallized with a bimolecular DNA G-quadruplex. The ligands have a range of cyclic amino end groups of varying size. The crystal structures show that the diagonal loop in this quadruplex results in a large cavity for these groups, in contrast to the steric constraints imposed by propeller loops in human telomeric quadruplexes. We conclude that the nature of the loop has a significant influence on ligand selectivity for particular quadruplex folds.

  4. Quadruplexes in 'Dicty': crystal structure of a four-quartet G-quadruplex formed by G-rich motif found in the Dictyostelium discoideum genome.

    Science.gov (United States)

    Guédin, Aurore; Lin, Linda Yingqi; Armane, Samir; Lacroix, Laurent; Mergny, Jean-Louis; Thore, Stéphane; Yatsunyk, Liliya A

    2018-06-01

    Guanine-rich DNA has the potential to fold into non-canonical G-quadruplex (G4) structures. Analysis of the genome of the social amoeba Dictyostelium discoideum indicates a low number of sequences with G4-forming potential (249-1055). Therefore, D. discoideum is a perfect model organism to investigate the relationship between the presence of G4s and their biological functions. As a first step in this investigation, we crystallized the dGGGGGAGGGGTACAGGGGTACAGGGG sequence from the putative promoter region of two divergent genes in D. discoideum. According to the crystal structure, this sequence folds into a four-quartet intramolecular antiparallel G4 with two lateral and one diagonal loops. The G-quadruplex core is further stabilized by a G-C Watson-Crick base pair and a A-T-A triad and displays high thermal stability (Tm > 90°C at 100 mM KCl). Biophysical characterization of the native sequence and loop mutants suggests that the DNA adopts the same structure in solution and in crystalline form, and that loop interactions are important for the G4 stability but not for its folding. Four-tetrad G4 structures are sparse. Thus, our work advances understanding of the structural diversity of G-quadruplexes and yields coordinates for in silico drug screening programs and G4 predictive tools.

  5. G-Quadruplex DNAzyme Molecular Beacon for Amplified Colorimetric Biosensing of Pseudostellaria heterophylla

    Directory of Open Access Journals (Sweden)

    Juan Hu

    2013-01-01

    Full Text Available With an internal transcribed spacer of 18 S, 5.8 S and 26 S nuclear ribosomal DNA (nrDNA ITS as DNA marker, we report a colorimetric approach for authentication of Pseudostellaria heterophylla (PH and its counterfeit species based on the differentiation of the nrDNA ITS sequence. The assay possesses an unlabelled G-quadruplex DNAzyme molecular beacon (MB probe, employing complementary sequence as biorecognition element and 1:1:1:1 split G-quadruplex halves as reporter. In the absence of target DNA (T-DNA, the probe can shape intermolecular G-quadruplex structures capable of binding hemin to form G-quadruplex-hemin DNAzyme and catalyze the oxidation of ABTS2− to blue-green ABTS•− by H2O2. In the presence of T-DNA, T-DNA can hybridize with the complementary sequence to form a duplex structure, hindering the formation of the G-quadruplex structure and resulting in the loss of the catalytic activity. Consequently, a UV-Vis absorption signal decrease is observed in the ABTS2−-H2O2 system. The “turn-off” assay allows the detection of T-DNA from 1.0 × 10−9 to 3.0 × 10−7 mol·L−1 (R2 = 0.9906, with a low detection limit of 3.1 × 10−10 mol·L−1. The present study provides a sensitive and selective method and may serve as a foundation of utilizing the DNAzyme MB sensor for identifying traditional Chinese medicines.

  6. Structure and possible function of a G-quadruplex in the long terminal repeat of the proviral HIV-1 genome.

    Science.gov (United States)

    De Nicola, Beatrice; Lech, Christopher J; Heddi, Brahim; Regmi, Sagar; Frasson, Ilaria; Perrone, Rosalba; Richter, Sara N; Phan, Anh Tuân

    2016-07-27

    The long terminal repeat (LTR) of the proviral human immunodeficiency virus (HIV)-1 genome is integral to virus transcription and host cell infection. The guanine-rich U3 region within the LTR promoter, previously shown to form G-quadruplex structures, represents an attractive target to inhibit HIV transcription and replication. In this work, we report the structure of a biologically relevant G-quadruplex within the LTR promoter region of HIV-1. The guanine-rich sequence designated LTR-IV forms a well-defined structure in physiological cationic solution. The nuclear magnetic resonance (NMR) structure of this sequence reveals a parallel-stranded G-quadruplex containing a single-nucleotide thymine bulge, which participates in a conserved stacking interaction with a neighboring single-nucleotide adenine loop. Transcription analysis in a HIV-1 replication competent cell indicates that the LTR-IV region may act as a modulator of G-quadruplex formation in the LTR promoter. Consequently, the LTR-IV G-quadruplex structure presented within this work could represent a valuable target for the design of HIV therapeutics. © The Author(s) 2016. Published by Oxford University Press on behalf of Nucleic Acids Research.

  7. Thermal stability of DNA quadruplex-duplex hybrids.

    Science.gov (United States)

    Lim, Kah Wai; Khong, Zi Jian; Phan, Anh Tuân

    2014-01-14

    DNA has the capacity to adopt several distinct structural forms, such as duplex and quadruplex helices, which have been implicated in cellular processes and shown to exhibit important functional properties. Quadruplex-duplex hybrids, generated from the juxtaposition of these two structural elements, could find applications in therapeutics and nanotechnology. Here we used NMR and CD spectroscopy to investigate the thermal stability of two classes of quadruplex-duplex hybrids comprising fundamentally distinct modes of duplex and quadruplex connectivity: Construct I involves the coaxial orientation of the duplex and quadruplex helices with continual base stacking across the two components; Construct II involves the orthogonal orientation of the duplex and quadruplex helices with no base stacking between the two components. We have found that for both constructs, the stability of the quadruplex generally increases with the length of the stem-loop incorporated, with respect to quadruplexes comprising nonstructured loops of the same length, which showed a continuous drop in stability with increasing loop length. The stability of these complexes, particularly Construct I, can be substantially influenced by the base-pair steps proximal to the quadruplex-duplex junction. Bulges at the junction are largely detrimental to the adoption of the desired G-quadruplex topology for Construct I but not for Construct II. These findings should facilitate future design and prediction of quadruplex-duplex hybrids.

  8. Co-transcriptional formation of DNA:RNA hybrid G-quadruplex and potential function as constitutional cis element for transcription control.

    Science.gov (United States)

    Zheng, Ke-wei; Xiao, Shan; Liu, Jia-quan; Zhang, Jia-yu; Hao, Yu-hua; Tan, Zheng

    2013-05-01

    G-quadruplex formation in genomic DNA is considered to regulate transcription. Previous investigations almost exclusively focused on intramolecular G-quadruplexes formed by DNA carrying four or more G-tracts, and structure formation has rarely been studied in physiologically relevant processes. Here, we report an almost entirely neglected, but actually much more prevalent form of G-quadruplexes, DNA:RNA hybrid G-quadruplexes (HQ) that forms in transcription. HQ formation requires as few as two G-tracts instead of four on a non-template DNA strand. Potential HQ sequences (PHQS) are present in >97% of human genes, with an average of 73 PHQSs per gene. HQ modulates transcription under both in vitro and in vivo conditions. Transcriptomal analysis of human tissues implies that maximal gene expression may be limited by the number of PHQS in genes. These features suggest that HQs may play fundamental roles in transcription regulation and other transcription-mediated processes.

  9. A Selective G-Quadruplex DNA-Stabilizing Ligand Based on a Cyclic Naphthalene Diimide Derivative

    Directory of Open Access Journals (Sweden)

    Md. Monirul Islam

    2015-06-01

    Full Text Available A cyclic naphthalene diimide (cyclic NDI, 1, carrying a benzene moiety as linker chain, was synthesized and its interaction with G-quadruplex DNAs of a-core and a-coreTT as a human telomeric DNA, c-kit and c-myc as DNA sequence at promoter region, or thrombin-binding aptamer (TBA studied based on UV-VIS and circular dichroism (CD spectroscopic techniques, thermal melting temperature measurement, and FRET-melting assay. The circular dichroism spectra showed that 1 induced the formation of different types of G-quadruplex DNA structure. Compound 1 bound to these G-quadruplexes with affinities in the range of 106–107 M−1 order and a 2:1 stoichiometry. Compound 1 showed 270-fold higher selectivity for a-core than dsDNA with a preferable a-core binding than a-coreTT, c-kit, c-myc and TBA in the presence of K+, which is supported by thermal melting studies. The FRET-melting assay also showed that 1 bound preferentially to human telomeric DNA. Compound 1 showed potent inhibition against telomerase activity with an IC50 value of 0.9 μM and preferable binding to G-quadruplexes DNA than our previously published cyclic NDI derivative 3 carrying a benzene moiety as longer linker chain.

  10. The G-quadruplex augments translation in the 5' untranslated region of transforming growth factor β2.

    Science.gov (United States)

    Agarwala, Prachi; Pandey, Satyaprakash; Mapa, Koyeli; Maiti, Souvik

    2013-03-05

    Transforming growth factor β2 (TGFβ2) is a versatile cytokine with a prominent role in cell migration, invasion, cellular development, and immunomodulation. TGFβ2 promotes the malignancy of tumors by inducing epithelial-mesenchymal transition, angiogenesis, and immunosuppression. As it is well-documented that nucleic acid secondary structure can regulate gene expression, we assessed whether any secondary motif regulates its expression at the post-transcriptional level. Bioinformatics analysis predicts an existence of a 23-nucleotide putative G-quadruplex sequence (PG4) in the 5' untranslated region (UTR) of TGFβ2 mRNA. The ability of this stretch of sequence to form a highly stable, intramolecular parallel quadruplex was demonstrated using ultraviolet and circular dichroism spectroscopy. Footprinting studies further validated its existence in the presence of a neighboring nucleotide sequence. Following structural characterization, we evaluated the biological relevance of this secondary motif using a dual luciferase assay. Although PG4 inhibits the expression of the reporter gene, its presence in the context of the entire 5' UTR sequence interestingly enhances gene expression. Mutation or removal of the G-quadruplex sequence from the 5' UTR of the gene diminished the level of expression of this gene at the translational level. Thus, here we highlight an activating role of the G-quadruplex in modulating gene expression of TGFβ2 at the translational level and its potential to be used as a target for the development of therapeutics against cancer.

  11. Utilization of circular dichroism and electrospray ionization mass spectrometry to understand the formation and conversion of G-quadruplex DNA at the human c-myb proto-oncogene.

    Science.gov (United States)

    Fu, Hengqing; Yang, Pengfei; Hai, Jinhui; Li, Huihui

    2018-10-05

    G-quadruplex DNAs are involved in a number of key biological processes, including gene expression, transcription, and apoptosis. The c-myb oncogene contains a number of GGA repeats in its promoter which forms G-quadruplex, thus it could be used as a target in cancer therapeutics. Several in-vitro studies have used Circular Dichroism (CD) spectroscopy or electrospray ionization mass spectrometry (ESI-MS) to demonstrate formation and stability of G-quadruplex DNA structure in the promoter region of human c-myb oncogene. The factors affecting the c-myb G-quadruplex structures were investigated, such as cations (i.e. K + , NH 4 + and Na + ) and co-solutes (methanol and polyethylene glycol). The results indicated that the presence of cations and co-solutes could change the G-quadruplex structural population and promote its thermodynamic stabilization as indicated by CD melting curves. It indicated that the co-solutes preferentially stabilize the c-myb G-quadruplex structure containing both homo- and hetero-stacking. In addition, protopine was demonstrated as a binder of c-myb G-quadruplex as screened from a library of natural alkaloids using ESI-MS method. CD spectra showed that it could selectively stabilize the c-myb G-quadruplex structure compared to other six G-quadruplexes from tumor-related G-rich sequences and the duplex DNAs (both long and short-chain ones). The binding of protopine could induce the change in the G-quadruplex structural populations. Therefore, protopine with its high binding specificity could be considered as a precursor for the design of drugs to target and regulate c-myb oncogene transcription. Copyright © 2018 Elsevier B.V. All rights reserved.

  12. Synthesis of potent G-quadruplex binders of macrocyclic heptaoxazole and evaluation of their activities.

    Science.gov (United States)

    Tera, Masayuki; Iida, Keisuke; Shin-ya, Kazuo; Nagasawa, Kazuo

    2009-01-01

    Guanine-rich DNA sequences form unique three-dimensional conformation known as G-quadruplexes (G-q). G-q structures have been found in telomere and in some oncogene promoter. Recently, it was suggested that G-q showed some biological activities including telomere shortening and transcriptional regulation. In this paper, we synthesized selective G-q binders and evaluated of their biological activities.

  13. RNA synthesis is modulated by G-quadruplex formation in Hepatitis C virus negative RNA strand.

    Science.gov (United States)

    Chloé, Jaubert; Amina, Bedrat; Laura, Bartolucci; Carmelo, Di Primo; Michel, Ventura; Jean-Louis, Mergny; Samir, Amrane; Marie-Line, Andreola

    2018-05-25

    DNA and RNA guanine-rich oligonucleotides can form non-canonical structures called G-quadruplexes or "G4" that are based on the stacking of G-quartets. The role of DNA and RNA G4 is documented in eukaryotic cells and in pathogens such as viruses. Yet, G4 have been identified only in a few RNA viruses, including the Flaviviridae family. In this study, we analysed the last 157 nucleotides at the 3'end of the HCV (-) strand. This sequence is known to be the minimal sequence required for an efficient RNA replication. Using bioinformatics and biophysics, we identified a highly conserved G4-prone sequence located in the stem-loop IIy' of the negative strand. We also showed that the formation of this G-quadruplex inhibits the in vitro RNA synthesis by the RdRp. Furthermore, Phen-DC3, a specific G-quadruplex binder, is able to inhibit HCV viral replication in cells in conditions where no cytotoxicity was measured. Considering that this domain of the negative RNA strand is well conserved among HCV genotypes, G4 ligands could be of interest for new antiviral therapies.

  14. Local epigenetic reprogramming induced by G-quadruplex ligands

    Science.gov (United States)

    Guilbaud, Guillaume; Murat, Pierre; Recolin, Bénédicte; Campbell, Beth C.; Maiter, Ahmed; Sale, Julian E.; Balasubramanian, Shankar

    2017-11-01

    DNA and histone modifications regulate transcriptional activity and thus represent valuable targets to reprogram the activity of genes. Current epigenetic therapies target the machinery that regulates these modifications, leading to global transcriptional reprogramming with the potential for extensive undesired effects. Epigenetic information can also be modified as a consequence of disrupting processive DNA replication. Here, we demonstrate that impeding replication by small-molecule-mediated stabilization of G-quadruplex nucleic acid secondary structures triggers local epigenetic plasticity. We report the use of the BU-1 locus of chicken DT40 cells to screen for small molecules able to induce G-quadruplex-dependent transcriptional reprogramming. Further characterization of the top hit compound revealed its ability to induce a dose-dependent inactivation of BU-1 expression in two steps: the loss of H3K4me3 and then subsequent DNA cytosine methylation, changes that were heritable across cell divisions even after the compound was removed. Targeting DNA secondary structures thus represents a potentially new approach for locus-specific epigenetic reprogramming.

  15. Identification of the DNA-Binding Domains of Human Replication Protein A That Recognize G-Quadruplex DNA

    Directory of Open Access Journals (Sweden)

    Aishwarya Prakash

    2011-01-01

    Full Text Available Replication protein A (RPA, a key player in DNA metabolism, has 6 single-stranded DNA-(ssDNA- binding domains (DBDs A-F. SELEX experiments with the DBDs-C, -D, and -E retrieve a 20-nt G-quadruplex forming sequence. Binding studies show that RPA-DE binds preferentially to the G-quadruplex DNA, a unique preference not observed with other RPA constructs. Circular dichroism experiments show that RPA-CDE-core can unfold the G-quadruplex while RPA-DE stabilizes it. Binding studies show that RPA-C binds pyrimidine- and purine-rich sequences similarly. This difference between RPA-C and RPA-DE binding was also indicated by the inability of RPA-CDE-core to unfold an oligonucleotide containing a TC-region 5′ to the G-quadruplex. Molecular modeling studies of RPA-DE and telomere-binding proteins Pot1 and Stn1 reveal structural similarities between the proteins and illuminate potential DNA-binding sites for RPA-DE and Stn1. These data indicate that DBDs of RPA have different ssDNA recognition properties.

  16. Ultrasensitive photoelectrochemical aptasensor for lead ion detection based on sensitization effect of CdTe QDs on MoS2-CdS:Mn nanocomposites by the formation of G-quadruplex structure.

    Science.gov (United States)

    Shi, Jian-Jun; Zhu, Jing-Chun; Zhao, Ming; Wang, Yan; Yang, Ping; He, Jie

    2018-06-01

    An ultrasensitive photoelectrochemical (PEC) aptasensor for lead ion (Pb 2+ ) detection was fabricated based on MoS 2 -CdS:Mn nanocomposites and sensitization effect of CdTe quantum dots (QDs). MoS 2 -CdS:Mn modified electrode was used as the PEC matrix for the immobilization of probe DNA (pDNA) labeled with CdTe QDs. Target DNA (tDNA) were hybridized with pDNA to made the QDs locate away from the electrode surface by the rod-like double helix. The detection of Pb 2+ was based on the conformational change of the pDNA to G-quadruplex structure in the presence of Pb 2+ , which made the labeled QDs move close to the electrode surface, leading to the generation of sensitization effect and evident increase of the photocurrent intensity. The linear range was 50 fM to 100 nM with a detection limit of 16.7 fM. The recoveries of the determination of Pb 2+ in real samples were in the range of 102.5-108.0%. This proposed PEC aptasensor provides a new sensing strategy for various heavy metal ions at ultralow levels. Copyright © 2018 Elsevier B.V. All rights reserved.

  17. Fragile X mental retardation protein recognizes a G quadruplex structure within the survival motor neuron domain containing 1 mRNA 5'-UTR.

    Science.gov (United States)

    McAninch, Damian S; Heinaman, Ashley M; Lang, Cara N; Moss, Kathryn R; Bassell, Gary J; Rita Mihailescu, Mihaela; Evans, Timothy L

    2017-07-25

    G quadruplex structures have been predicted by bioinformatics to form in the 5'- and 3'-untranslated regions (UTRs) of several thousand mature mRNAs and are believed to play a role in translation regulation. Elucidation of these roles has primarily been focused on the 3'-UTR, with limited focus on characterizing the G quadruplex structures and functions in the 5'-UTR. Investigation of the affinity and specificity of RNA binding proteins for 5'-UTR G quadruplexes and the resulting regulatory effects have also been limited. Among the mRNAs predicted to form a G quadruplex structure within the 5'-UTR is the survival motor neuron domain containing 1 (SMNDC1) mRNA, encoding a protein that is critical to the spliceosome. Additionally, this mRNA has been identified as a potential target of the fragile X mental retardation protein (FMRP), whose loss of expression leads to fragile X syndrome. FMRP is an RNA binding protein involved in translation regulation that has been shown to bind mRNA targets that form G quadruplex structures. In this study we have used biophysical methods to investigate G quadruplex formation in the 5'-UTR of SMNDC1 mRNA and analyzed its interactions with FMRP. Our results show that SMNDC1 mRNA 5'-UTR forms an intramolecular, parallel G quadruplex structure comprised of three G quartet planes, which is bound specifically by FMRP both in vitro and in mouse brain lysates. These findings suggest a model by which FMRP might regulate the translation of a subset of its mRNA targets by recognizing the G quadruplex structure present in their 5'-UTR, and affecting their accessibility by the protein synthesis machinery.

  18. Simultaneous G-Quadruplex DNA Logic.

    Science.gov (United States)

    Bader, Antoine; Cockroft, Scott L

    2018-04-03

    A fundamental principle of digital computer operation is Boolean logic, where inputs and outputs are described by binary integer voltages. Similarly, inputs and outputs may be processed on the molecular level as exemplified by synthetic circuits that exploit the programmability of DNA base-pairing. Unlike modern computers, which execute large numbers of logic gates in parallel, most implementations of molecular logic have been limited to single computing tasks, or sensing applications. This work reports three G-quadruplex-based logic gates that operate simultaneously in a single reaction vessel. The gates respond to unique Boolean DNA inputs by undergoing topological conversion from duplex to G-quadruplex states that were resolved using a thioflavin T dye and gel electrophoresis. The modular, addressable, and label-free approach could be incorporated into DNA-based sensors, or used for resolving and debugging parallel processes in DNA computing applications. © 2018 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.

  19. cis sequence effects on gene expression

    Directory of Open Access Journals (Sweden)

    Jacobs Kevin

    2007-08-01

    Full Text Available Abstract Background Sequence and transcriptional variability within and between individuals are typically studied independently. The joint analysis of sequence and gene expression variation (genetical genomics provides insight into the role of linked sequence variation in the regulation of gene expression. We investigated the role of sequence variation in cis on gene expression (cis sequence effects in a group of genes commonly studied in cancer research in lymphoblastoid cell lines. We estimated the proportion of genes exhibiting cis sequence effects and the proportion of gene expression variation explained by cis sequence effects using three different analytical approaches, and compared our results to the literature. Results We generated gene expression profiling data at N = 697 candidate genes from N = 30 lymphoblastoid cell lines for this study and used available candidate gene resequencing data at N = 552 candidate genes to identify N = 30 candidate genes with sufficient variance in both datasets for the investigation of cis sequence effects. We used two additive models and the haplotype phylogeny scanning approach of Templeton (Tree Scanning to evaluate association between individual SNPs, all SNPs at a gene, and diplotypes, with log-transformed gene expression. SNPs and diplotypes at eight candidate genes exhibited statistically significant (p cis sequence effects in our study, respectively. Conclusion Based on analysis of our results and the extant literature, one in four genes exhibits significant cis sequence effects, and for these genes, about 30% of gene expression variation is accounted for by cis sequence variation. Despite diverse experimental approaches, the presence or absence of significant cis sequence effects is largely supported by previously published studies.

  20. Extended molecular dynamics of a c-kit promoter quadruplex

    Czech Academy of Sciences Publication Activity Database

    Islam, B.; Stadlbauer, Petr; Krepl, Miroslav; Koča, J.; Neidle, S.; Haider, S.; Šponer, Jiří

    2015-01-01

    Roč. 43, č. 18 (2015), s. 8673-8693 ISSN 0305-1048 R&D Projects: GA ČR(CZ) GAP208/11/1822 Institutional support: RVO:68081707 Keywords : TELOMERIC G-QUADRUPLEX * INTRAMOLECULAR DNA QUADRUPLEXES * GASTROINTESTINAL STROMAL TUMOR Subject RIV: BO - Biophysics Impact factor: 9.202, year: 2015

  1. Altered biochemical specificity of G-quadruplexes with mutated tetrads

    Czech Academy of Sciences Publication Activity Database

    Švehlová, Kateřina; Lawrence, M. S.; Bednárová, Lucie; Curtis, Edward A.

    2016-01-01

    Roč. 44, č. 22 (2016), s. 10789-10803 ISSN 0305-1048 Institutional support: RVO:61388963 Keywords : G-quadruplex * G motif GTP aptamer * peroxidase deoxyribozyme Subject RIV: CE - Biochemistry Impact factor: 10.162, year: 2016 https://academic.oup.com/nar/article/44/22/10789/2333933/Altered-biochemical-specificity-of-G-quadruplexes

  2. A mRNA-Responsive G-Quadruplex-Based Drug Release System

    Directory of Open Access Journals (Sweden)

    Hidenobu Yaku

    2015-04-01

    Full Text Available G-quadruplex-based drug delivery carriers (GDDCs were designed to capture and release a telomerase inhibitor in response to a target mRNA. Hybridization between a loop on the GDDC structure and the mRNA should cause the G-quadruplex structure of the GDDC to unfold and release the bound inhibitor, anionic copper(II phthalocyanine (CuAPC. As a proof of concept, GDDCs were designed with a 10-30-mer loop, which can hybridize with a target sequence in epidermal growth factor receptor (EGFR mRNA. Structural analysis using circular dichroism (CD spectroscopy showed that the GDDCs form a (3 + 1 type G-quadruplex structure in 100 mM KCl and 10 mM MgCl2 in the absence of the target RNA. Visible absorbance titration experiments showed that the GDDCs bind to CuAPC with Ka values of 1.5 × 105 to 5.9 × 105 M−1 (Kd values of 6.7 to 1.7 μM at 25 °C, depending on the loop length. Fluorescence titration further showed that the G-quadruplex structure unfolds upon binding to the target RNA with Ka values above 1.0 × 108 M−1 (Kd values below 0.01 μM at 25 °C. These results suggest the carrier can sense and bind to the target RNA, which should result in release of the bound drug. Finally, visible absorbance titration experiments demonstrated that the GDDC release CuAPC in response to the target RNA.

  3. DNA sensors and aptasensors based on the hemin/G-quadruplex-controlled aggregation of Au NPs in the presence of L-cysteine.

    Science.gov (United States)

    Niazov-Elkan, Angelica; Golub, Eyal; Sharon, Etery; Balogh, Dora; Willner, Itamar

    2014-07-23

    L-cysteine induces the aggregation of Au nanoparticles (NPs), resulting in a color transition from red to blue due to interparticle plasmonic coupling in the aggregated structure. The hemin/G-quadruplex horseradish peroxidase-mimicking DNAzyme catalyzes the aerobic oxidation of L-cysteine to cystine, a process that inhibits the aggregation of the NPs. The degree of inhibition of the aggregation process is controlled by the concentration of the DNAzyme in the system. These functions are implemented to develop sensing platforms for the detection of a target DNA, for the analysis of aptamer-substrate complexes, and for the analysis of L-cysteine in human urine samples. A hairpin DNA structure that includes a recognition site for the DNA analyte and a caged G-quadruplex sequence, is opened in the presence of the target DNA. The resulting self-assembled hemin/G-quadruplex acts as catalyst that controls the aggregation of the Au NPs. Also, the thrombin-binding aptamer folds into a G-quadruplex nanostructure upon binding to thrombin. The association of hemin to the resulting G-quadruplex aptamer-thrombin complex leads to a catalytic label that controls the L-cysteine-mediated aggregation of the Au NPs. The hemin/G-qaudruplex-controlled aggregation of Au NPs process is further implemented for visual and spectroscopic detection of L-cysteine concentration in urine samples. © 2014 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  4. Fluorescence detection of DNA, adenosine-5'-triphosphate (ATP), and telomerase activity by zinc(II)-protoporphyrin IX/G-quadruplex labels.

    Science.gov (United States)

    Zhang, Zhanxia; Sharon, Etery; Freeman, Ronit; Liu, Xiaoqing; Willner, Itamar

    2012-06-05

    The zinc(II)-protoporphyrin IX (ZnPPIX) fluorophore binds to G-quadruplexes, and this results in the enhanced fluorescence of the fluorophore. This property enabled the development of DNA sensors, aptasensors, and a sensor following telomerase activity. The DNA sensor is based on the design of a hairpin structure that includes a "caged" inactive G-quadruplex sequence. Upon opening the hairpin by the analyte DNA, the resulting fluorescence of the ZnPPIX/G-quadruplex provides the readout signal for the sensing event (detection limit 5 nM). Addition of Exonuclease III to the system allows the recycling of the analyte and its amplified analysis (detection limit, 200 pM). The association of the ZnPPIX to G-quadruplex aptamer-substrate complexes allowed the detection of adenosine-5'-triphosphate (ATP, detection limit 10 μM). Finally, the association of ZnPPIX to the G-quadruplex repeat units of telomers allowed the detection of telomerase activity originating from 380 ± 20 cancer 293T cell extract.

  5. Identification of a New G-Quadruplex Motif in the KRAS Promoter and Design of Pyrene-Modified G4-Decoys with Antiproliferative Activity in Pancreatic Cancer Cells

    DEFF Research Database (Denmark)

    Cogoi, Susanna; Paramasivam, Manikandan; Filitchev, Vyacheslav Viatcheslav

    2009-01-01

    A new quadruplex motif located in the promoter of the human KRAS gene, within a nuclease hypersensitive element (NHE), has been characterized. Oligonucleotides mimicking this quadruplex are found to compete with a DNA-protein complex between NHE and a nuclear extract from pancreatic cancer cells........ When modified with (R)-1-O-[4-1-(1-pyrenylethynyl) phenylmethyl]glycerol insertions (TINA), the quadruplex oligonucleotides showed a dramatic increase of the Tm (ΔTm from 22 to 32 °C) and a strong antiproliferative effects in Panc-1 cells....

  6. Targeting G-quadruplex DNA Structures by EMICORON has a strong antitumor efficacy against advanced models of human colon cancer

    DEFF Research Database (Denmark)

    Porru, Manuela; Artuso, Simona; Salvati, Erica

    2015-01-01

    We previously identified EMICORON as a novel G-quadruplex (G4) ligand showing high selectivity for G4 structures over the duplex DNA, causing telomere damage and inhibition of cell proliferation in transformed and tumor cells. Here, we evaluated the antitumoral effect of EMICORON on advanced mode...

  7. Efficient Long-Range Hole Transport Through G-Quadruplexes.

    Science.gov (United States)

    Wu, Jingyuan; Meng, Zhenyu; Lu, Yunpeng; Shao, Fangwei

    2017-10-09

    DNA offers a means of long-range charge transport for biology and electric nanodevices. Here, a series of tetra-stranded G-quadruplexes were assembled within a dendritic DNA architecture to explore oxidative charge transport (hole transport) through the G-quadruplex. Efficient charge transport was achieved over 28 Å upon UV irradiation. Over a longer G-quadruplex bridge, hole transport was escalated to a higher efficiency, which resulted in a higher yield than that of the optimal duplex DNA for charge transport, that is, the adenine tract. Efficient long-range hole transport suggests tetra-stranded G-quadruplexes, instead of an oxidation hotspot, hold better potential as an electron conduit than duplex DNA. © 2017 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.

  8. Identifying the impact of G-quadruplexes on Affymetrix 3' arrays using cloud computing.

    Science.gov (United States)

    Memon, Farhat N; Owen, Anne M; Sanchez-Graillet, Olivia; Upton, Graham J G; Harrison, Andrew P

    2010-01-15

    A tetramer quadruplex structure is formed by four parallel strands of DNA/ RNA containing runs of guanine. These quadruplexes are able to form because guanine can Hoogsteen hydrogen bond to other guanines, and a tetrad of guanines can form a stable arrangement. Recently we have discovered that probes on Affymetrix GeneChips that contain runs of guanine do not measure gene expression reliably. We associate this finding with the likelihood that quadruplexes are forming on the surface of GeneChips. In order to cope with the rapidly expanding size of GeneChip array datasets in the public domain, we are exploring the use of cloud computing to replicate our experiments on 3' arrays to look at the effect of the location of G-spots (runs of guanines). Cloud computing is a recently introduced high-performance solution that takes advantage of the computational infrastructure of large organisations such as Amazon and Google. We expect that cloud computing will become widely adopted because it enables bioinformaticians to avoid capital expenditure on expensive computing resources and to only pay a cloud computing provider for what is used. Moreover, as well as financial efficiency, cloud computing is an ecologically-friendly technology, it enables efficient data-sharing and we expect it to be faster for development purposes. Here we propose the advantageous use of cloud computing to perform a large data-mining analysis of public domain 3' arrays.

  9. Guanine base stacking in G-quadruplex nucleic acids

    Science.gov (United States)

    Lech, Christopher Jacques; Heddi, Brahim; Phan, Anh Tuân

    2013-01-01

    G-quadruplexes constitute a class of nucleic acid structures defined by stacked guanine tetrads (or G-tetrads) with guanine bases from neighboring tetrads stacking with one another within the G-tetrad core. Individual G-quadruplexes can also stack with one another at their G-tetrad interface leading to higher-order structures as observed in telomeric repeat-containing DNA and RNA. In this study, we investigate how guanine base stacking influences the stability of G-quadruplexes and their stacked higher-order structures. A structural survey of the Protein Data Bank is conducted to characterize experimentally observed guanine base stacking geometries within the core of G-quadruplexes and at the interface between stacked G-quadruplex structures. We couple this survey with a systematic computational examination of stacked G-tetrad energy landscapes using quantum mechanical computations. Energy calculations of stacked G-tetrads reveal large energy differences of up to 12 kcal/mol between experimentally observed geometries at the interface of stacked G-quadruplexes. Energy landscapes are also computed using an AMBER molecular mechanics description of stacking energy and are shown to agree quite well with quantum mechanical calculated landscapes. Molecular dynamics simulations provide a structural explanation for the experimentally observed preference of parallel G-quadruplexes to stack in a 5′–5′ manner based on different accessible tetrad stacking modes at the stacking interfaces of 5′–5′ and 3′–3′ stacked G-quadruplexes. PMID:23268444

  10. Colorimetric detection of genetically modified organisms based on exonuclease III-assisted target recycling and hemin/G-quadruplex DNAzyme amplification.

    Science.gov (United States)

    Zhang, Decai; Wang, Weijia; Dong, Qian; Huang, Yunxiu; Wen, Dongmei; Mu, Yuejing; Yuan, Yong

    2017-12-21

    An isothermal colorimetric method is described for amplified detection of the CaMV 35S promoter sequence in genetically modified organism (GMO). It is based on (a) target DNA-triggered unlabeled molecular beacon (UMB) termini binding, and (b) exonuclease III (Exo III)-assisted target recycling, and (c) hemin/G-quadruplex (DNAzyme) based signal amplification. The specific binding of target to the G-quadruplex sequence-locked UMB triggers the digestion of Exo III. This, in turn, releases an active G-quadruplex segment and target DNA for successive hybridization and cleavage. The Exo III impellent recycling of targets produces numerous G-quadruplex sequences. These further associate with hemin to form DNAzymes and hence will catalyze H 2 O 2 -mediated oxidation of the chromogenic enzyme substrate ABTS 2- causing the formation of a green colored product. This finding enables a sensitive colorimetric determination of GMO DNA (at an analytical wavelength of 420 nm) at concentrations as low as 0.23 nM. By taking advantage of isothermal incubation, this method does not require sophisticated equipment or complicated syntheses. Analyses can be performed within 90 min. The method also discriminates single base mismatches. In our perception, it has a wide scope in that it may be applied to the detection of many other GMOs. Graphical abstract An isothermal and sensitive colorimetric method is described for amplified detection of CaMV 35S promoter sequence in genetically modified organism (GMO). It is based on target DNA-triggered molecular beacon (UMB) termini-binding and exonuclease III assisted target recycling, and on hemin/G-quadruplex (DNAzyme) signal amplification.

  11. Toehold strand displacement-driven assembly of G-quadruplex DNA for enzyme-free and non-label sensitive fluorescent detection of thrombin.

    Science.gov (United States)

    Xu, Yunying; Zhou, Wenjiao; Zhou, Ming; Xiang, Yun; Yuan, Ruo; Chai, Yaqin

    2015-02-15

    Based on a new signal amplification strategy by the toehold strand displacement-driven cyclic assembly of G-quadruplex DNA, the development of an enzyme-free and non-label aptamer sensing approach for sensitive fluorescent detection of thrombin is described. The target thrombin associates with the corresponding aptamer of the partial dsDNA probes and liberates single stranded initiation sequences, which trigger the toehold strand displacement assembly of two G-quadruplex containing hairpin DNAs. This toehold strand displacement reaction leads to the cyclic reuse of the initiation sequences and the production of DNA assemblies with numerous G-quadruplex structures. The fluorescent dye, N-Methyl mesoporphyrin IX, binds to these G-quadruplex structures and generates significantly amplified fluorescent signals to achieve highly sensitive detection of thrombin down to 5 pM. Besides, this method shows high selectivity towards the target thrombin against other control proteins. The developed thrombin sensing method herein avoids the modification of the probes and the involvement of any enzyme or nanomaterial labels for signal amplification. With the successful demonstration for thrombin detection, our approach can be easily adopted to monitor other target molecules in a simple, low-cost, sensitive and selective way by choosing appropriate aptamer/ligand pairs. Copyright © 2014 Elsevier B.V. All rights reserved.

  12. Transcriptional control by G-quadruplexes: In vivo roles and perspectives for specific intervention.

    Science.gov (United States)

    Armas, Pablo; David, Aldana; Calcaterra, Nora B

    2017-01-01

    G-quadruplexes are non-canonical DNA secondary structures involved in several genomic and molecular processes. Here, we summarize the main G-quadruplex features and evidences proving the in vivo role on the transcriptional regulation of genes required for zebrafish embryonic development. We also discuss alternative strategies for specifically interfering G-quadruplex in vivo.

  13. Ball with hair: modular functionalization of highly stable G-quadruplex DNA nano-scaffolds through N2-guanine modification.

    Science.gov (United States)

    Lech, Christopher Jacques; Phan, Anh Tuân

    2017-06-20

    Functionalized nanoparticles have seen valuable applications, particularly in the delivery of therapeutic and diagnostic agents in biological systems. However, the manufacturing of such nano-scale systems with the consistency required for biological application can be challenging, as variation in size and shape have large influences in nanoparticle behavior in vivo. We report on the development of a versatile nano-scaffold based on the modular functionalization of a DNA G-quadruplex. DNA sequences are functionalized in a modular fashion using well-established phosphoramidite chemical synthesis with nucleotides containing modification of the amino (N2) position of the guanine base. In physiological conditions, these sequences fold into well-defined G-quadruplex structures. The resulting DNA nano-scaffolds are thermally stable, consistent in size, and functionalized in a manner that allows for control over the density and relative orientation of functional chemistries on the nano-scaffold surface. Various chemistries including small modifications (N2-methyl-guanine), bulky aromatic modifications (N2-benzyl-guanine), and long chain-like modifications (N2-6-amino-hexyl-guanine) are tested and are found to be generally compatible with G-quadruplex formation. Furthermore, these modifications stabilize the G-quadruplex scaffold by 2.0-13.3 °C per modification in the melting temperature, with concurrent modifications producing extremely stable nano-scaffolds. We demonstrate the potential of this approach by functionalizing nano-scaffolds for use within the biotin-avidin conjugation approach. © The Author(s) 2017. Published by Oxford University Press on behalf of Nucleic Acids Research.

  14. G Quadruplex in Plants: A Ubiquitous Regulatory Element and Its Biological Relevance.

    Science.gov (United States)

    Yadav, Vikas; Hemansi; Kim, Nayun; Tuteja, Narendra; Yadav, Puja

    2017-01-01

    G quadruplexes (G4) are higher-order DNA and RNA secondary structures formed by G-rich sequences that are built around tetrads of hydrogen-bonded guanine bases. Potential G4 quadruplex sequences have been identified in G-rich eukaryotic non-telomeric and telomeric genomic regions. Upon function, G4 formation is known to involve in chromatin remodeling, gene regulation and has been associated with genomic instability, genetic diseases and cancer progression. The natural role and biological validation of G4 structures is starting to be explored, and is of particular interest for the therapeutic interventions for human diseases. However, the existence and physiological role of G4 DNA and G4 RNA in plants species have not been much investigated yet and therefore, is of great interest for the development of improved crop varieties for sustainable agriculture. In this context, several recent studies suggests that these highly diverse G4 structures in plants can be employed to regulate expression of genes involved in several pathophysiological conditions including stress response to biotic and abiotic stresses as well as DNA damage. In the current review, we summarize the recent findings regarding the emerging functional significance of G4 structures in plants and discuss their potential value in the development of improved crop varieties.

  15. G Quadruplex in Plants: A Ubiquitous Regulatory Element and Its Biological Relevance

    Directory of Open Access Journals (Sweden)

    Vikas Yadav

    2017-07-01

    Full Text Available G quadruplexes (G4 are higher-order DNA and RNA secondary structures formed by G-rich sequences that are built around tetrads of hydrogen-bonded guanine bases. Potential G4 quadruplex sequences have been identified in G-rich eukaryotic non-telomeric and telomeric genomic regions. Upon function, G4 formation is known to involve in chromatin remodeling, gene regulation and has been associated with genomic instability, genetic diseases and cancer progression. The natural role and biological validation of G4 structures is starting to be explored, and is of particular interest for the therapeutic interventions for human diseases. However, the existence and physiological role of G4 DNA and G4 RNA in plants species have not been much investigated yet and therefore, is of great interest for the development of improved crop varieties for sustainable agriculture. In this context, several recent studies suggests that these highly diverse G4 structures in plants can be employed to regulate expression of genes involved in several pathophysiological conditions including stress response to biotic and abiotic stresses as well as DNA damage. In the current review, we summarize the recent findings regarding the emerging functional significance of G4 structures in plants and discuss their potential value in the development of improved crop varieties.

  16. Phenanthroline-2,9-bistriazoles as selective G-quadruplex ligands

    DEFF Research Database (Denmark)

    Nielsen, Mads Corvinius; Larsen, Anders Foller; Abdikadir, Faisal Hussein

    2014-01-01

    G-quadruplex (G4) ligands are currently receiving considerable attention as potential anticancer therapeutics. A series of phenanthroline-2,9-bistriazoles carrying tethered positive end groups has been synthesized and evaluated as G4 stabilizers. The compounds were efficiently assembled by copper......(I)-catalyzed azide-alkyne cycloaddition (CuAAC) in CH2Cl2 and water in the presence of a complexing agent. Characterization of the target compounds on telomeric and c-KIT G4 sequences led to the identification of guanidinium-substituted compounds as potent G4 DNA ligands with high selectivity over duplex DNA....... The diisopropylguanidium ligands exhibited high selectivity for the proto-oncogenic sequence c-KIT over the human telomeric sequence in the surface plasmon resonance (SPR) assay, whereas the compounds appeared potent on both G4 structures in the FRET melting temperature assay. The phenanthroline-2,9-bistriazole ligands...

  17. Dual Recognition of Human Telomeric G-quadruplex by Neomycin-anthraquinone Conjugate

    Science.gov (United States)

    Ranjan, Nihar; Davis, Erik; Xue, Liang

    2013-01-01

    The authors report the recognition of a G-quadruplex formed by four repeat human telomeric DNA with aminosugar intercalator conjugates. The recognition of G-quadruplex through dual binding mode ligands significantly increased the affinity of ligands for G-quadruplex. One such example is a neomycin-anthraquinone 2 which exhibited nanomolar affinity for the quadruplex, and the affinity of 2 is nearly 1000 fold higher for human telomeric G-quadruplex DNA than its constituent units, neomycin and anthraquinone. PMID:23698792

  18. c-MYC G-quadruplex binding by the RNA polymerase I inhibitor BMH-21 and analogues revealed by a combined NMR and biochemical Approach.

    Science.gov (United States)

    Musso, Loana; Mazzini, Stefania; Rossini, Anna; Castagnoli, Lorenzo; Scaglioni, Leonardo; Artali, Roberto; Di Nicola, Massimo; Zunino, Franco; Dallavalle, Sabrina

    2018-03-01

    Pyridoquinazolinecarboxamides have been reported as RNA polymerase I inhibitors and represent a novel class of potential antitumor agents. BMH-21, was reported to intercalate with GC-rich rDNA, resulting in nucleolar stress as a primary mechanism of cytotoxicity. The interaction of BMH-21 and analogues with DNA G-quadruplex structures was studied by NMR and molecular modelling. The cellular response was investigated in a panel of human tumor cell lines and protein expression was examined by Western Blot analysis. We explored the ability of BMH-21 and its analogue 2 to bind to G-quadruplex present in the c-MYC promoter, by NMR and molecular modelling studies. We provide evidence that both compounds are not typical DNA intercalators but are effective binders of the tested G-quadruplex. The interaction with c-MYC G-quadruplex was reflected in down-regulation of c-Myc expression in human tumor cells. The inhibitory effect was almost complete in lymphoma cells SUDHL4 characterized by overexpression of c-Myc protein. This downregulation reflected an early and persistent modulation of cMyc mRNA. Given the relevance of c-MYC in regulation of ribosome biogenesis, it is conceivable that the inhibition of c-MYC contributes to the perturbation of nuclear functions and RNA polymerase I activity. Similar experiments with CX-5461, another RNA polymerase I transcription inhibitor, indicate the same behaviour in G-quadruplex stabilization. Our results support the hypothesis that BMH-21 and analogue compounds share the same mechanism, i.e. G-quadruplex binding as a primary event of a cascade leading to inhibition of RNA polymerase I and apoptosis. Copyright © 2017 Elsevier B.V. All rights reserved.

  19. New findings on the d(TGGGAG) sequence: Surprising anti-HIV-1 activity.

    Science.gov (United States)

    Romanucci, Valeria; Zarrelli, Armando; Liekens, Sandra; Noppen, Sam; Pannecouque, Christophe; Di Fabio, Giovanni

    2018-02-10

    The biological relevance of tetramolecular G-quadruplexes especially as anti-HIV agents has been extensively reported in the literature over the last years. In the light of our recent results regarding the slow G-quadruplex folding kinetics of ODNs based on d(TGGGAG) sequence, here we report a systematic anti-HIV screening to investigate the impact of the G-quadruplex folding on their anti-HIV activity. In particular, varying the single stranded concentrations of ODNs, it has been tested a pool of ODN sample solutions with different G-quadruplex concentrations. The anti-HIV assays have been designed favouring the limited kinetics involved in the tetramolecular G4-association based on the d(TGGGAG) sequence. Aiming to determine the stoichiometry of G-quadruplex structures in the same experimental conditions of the anti-HIV assays, a native gel electrophoresis was performed. The gel confirmed the G-quadruplex formation for almost all sample solutions while showing the formation of high order G4 structures for the more concentrated ODNs solutions. The most significant result is the discovery of a potent anti-HIV activity of the G-quadruplex formed by the natural d(TGGGAG) sequence (IC 50  = 14 nM) that, until now, has been reported to be completely inactive against HIV infection. Copyright © 2018 Elsevier Masson SAS. All rights reserved.

  20. A G-quadruplex-based Label-free Fluorometric Aptasensor for Adenosine Triphosphate Detection.

    Science.gov (United States)

    Li, Li Juan; Tian, Xue; Kong, Xiang Juan; Chu, Xia

    2015-01-01

    A G-quadruplex-based, label-free fluorescence assay was demonstrated for the detection of adenosine triphosphate (ATP). A double-stranded DNA (dsDNA), hybridized by ATP-aptamer and its complementary sequence, was employed as a substrate for ATP binding. SYBR Green I (SG I) was a fluorescent probe and exonuclease III (Exo III) was a nuclease to digest the dsDNA. Consequently, in the absence of ATP, the dsDNA was inset with SG I and was digested by Exo III, resulting in a low background signal. In the presence of ATP, the aptamer in dsDNA folded into a G-quadruplex structure that resisted the digestion of Exo III. SG I was inserted into the structure, showing high fluorescence. Owing to a decrease of the background noise, a high signal-to-noise ratio could be obtained. This sensor can detect ATP with a concentration ranging from 50 μM to 5 mM, and possesses a capacity for the sensitive determination of other targets.

  1. Prospect of bioflavonoid fisetin as a quadruplex DNA ligand: a biophysical approach.

    Directory of Open Access Journals (Sweden)

    Bidisha Sengupta

    Full Text Available Quadruplex (G4 forming sequences in telomeric DNA and c-myc promoter regions of human DNA are associated with tumorogenesis. Ligands that can facilitate or stabilize the formation and increase the stabilization of G4 can prevent tumor cell proliferation and have been regarded as potential anti-cancer drugs. In the present study, steady state and time-resolved fluorescence measurements provide important structural and dynamical insights into the free and bound states of the therapeutically potent plant flavonoid fisetin (3,3',4',7-tetrahydroxyflavone in a G4 DNA matrix. The excited state intra-molecular proton transfer (ESPT of fisetin plays an important role in observing and understanding the binding of fisetin with the G4 DNA. Differential absorption spectra, thermal melting, and circular dichroism spectroscopic studies provide evidences for the formation of G4 DNA and size exclusion chromatography (SEC proves the binding and 1∶1 stoichiometry of fisetin in the DNA matrix. Comparative analysis of binding in the presence of EtBr proves that fisetin favors binding at the face of the G-quartet, mostly along the diagonal loop. Time resolved fluorescence anisotropy decay analysis indicates the increase in the restrictions in motion from the free to bound fisetin. We have also investigated the fingerprints of the binding of fisetin in the antiparallel quadruplex using Raman spectroscopy. Preliminary results indicate fisetin to be a prospective candidate as a G4 ligand.

  2. Prospect of Bioflavonoid Fisetin as a Quadruplex DNA Ligand: A Biophysical Approach

    Science.gov (United States)

    Sengupta, Bidisha; Pahari, Biswapathik; Blackmon, Laura; Sengupta, Pradeep K.

    2013-01-01

    Quadruplex (G4) forming sequences in telomeric DNA and c-myc promoter regions of human DNA are associated with tumorogenesis. Ligands that can facilitate or stabilize the formation and increase the stabilization of G4 can prevent tumor cell proliferation and have been regarded as potential anti-cancer drugs. In the present study, steady state and time-resolved fluorescence measurements provide important structural and dynamical insights into the free and bound states of the therapeutically potent plant flavonoid fisetin (3,3′,4′,7-tetrahydroxyflavone) in a G4 DNA matrix. The excited state intra-molecular proton transfer (ESPT) of fisetin plays an important role in observing and understanding the binding of fisetin with the G4 DNA. Differential absorption spectra, thermal melting, and circular dichroism spectroscopic studies provide evidences for the formation of G4 DNA and size exclusion chromatography (SEC) proves the binding and 1∶1 stoichiometry of fisetin in the DNA matrix. Comparative analysis of binding in the presence of EtBr proves that fisetin favors binding at the face of the G-quartet, mostly along the diagonal loop. Time resolved fluorescence anisotropy decay analysis indicates the increase in the restrictions in motion from the free to bound fisetin. We have also investigated the fingerprints of the binding of fisetin in the antiparallel quadruplex using Raman spectroscopy. Preliminary results indicate fisetin to be a prospective candidate as a G4 ligand. PMID:23785423

  3. Toward the design of new DNA G-quadruplex ligands through rational analysis of polymorphism and binding data.

    Science.gov (United States)

    Artese, Anna; Costa, Giosuè; Distinto, Simona; Moraca, Federica; Ortuso, Francesco; Parrotta, Lucia; Alcaro, Stefano

    2013-10-01

    Human telomeres play a key role in protecting chromosomal ends from fusion events; they are composed of d(TTAGGG) repeats, ranging in size from 3 to 15 kb. They form G-quadruplex DNA structures, stabilized by G-quartets in the presence of cations, and are involved in several biological processes. In particular, a telomere maintenance mechanism is provided by a specialized enzyme called telomerase, a reverse transcriptase able to add multiple copies of the 5'-GGTTAG-3' motif to the end of the G-strand of the telomere and which is over-expressed in the majority of cancer cells. The central cation has a crucial role in maintaining the stability of the structure. Based on its nature, it can be associated with different topological telomeric quadruplexes, which depend also on the orientation of the DNA strands and the syn/anti conformation of the guanines. Such a polymorphism, confirmed by the different structures deposited in the Protein Data Bank (PDB), prompted us to apply a computational protocol in order to investigate the conformational properties of a set of known G-quadruplex ligands and their molecular recognition against six different experimental models of the human telomeric sequence d[AG3(T2AG3)3]. The average AutoDock correlation between theoretical and experimental data yielded an r2 value equal to 0.882 among all the studied models. Such a result was always improved with respect to those of the single folds, with the exception of the parallel structure (r2 equal to 0.886), thus suggesting a key role of this G4 conformation in the stacking interaction network. Among the studied binders, a trisubstituted acridine and a dibenzophenanthroline derivative were well recognized by the parallel and the mixed G-quadruplex structures, allowing the identification of specific key contacts with DNA and the further design of more potent or target specific G-quadruplex ligands. Copyright © 2013 Elsevier Masson SAS. All rights reserved.

  4. Stability of Human Telomere Quadruplexes at High DNA Concentrations

    Czech Academy of Sciences Publication Activity Database

    Kejnovská, Iva; Vorlíčková, Michaela; Brázdová, Marie; Sagi, J.

    2014-01-01

    Roč. 101, č. 4 (2014), s. 428-438 ISSN 0006-3525 R&D Projects: GA ČR(CZ) GAP205/12/0466 Institutional support: RVO:68081707 Keywords : quadruplex * DNA concentration * folding topology Subject RIV: BO - Biophysics Impact factor: 2.385, year: 2014

  5. Interference effects in learning similar sequences of discrete movements

    NARCIS (Netherlands)

    Koedijker, J.M.; Oudejans, R.R.D.; Beek, P.J.

    2010-01-01

    Three experiments were conducted to examine proactive and retroactive interference effects in learning two similar sequences of discrete movements. In each experiment, the participants in the experimental group practiced two movement sequences on consecutive days (1 on each day, order

  6. DNA secondary structures: stability and function of G-quadruplex structures

    Science.gov (United States)

    Bochman, Matthew L.; Paeschke, Katrin; Zakian, Virginia A.

    2013-01-01

    In addition to the canonical double helix, DNA can fold into various other inter- and intramolecular secondary structures. Although many such structures were long thought to be in vitro artefacts, bioinformatics demonstrates that DNA sequences capable of forming these structures are conserved throughout evolution, suggesting the existence of non-B-form DNA in vivo. In addition, genes whose products promote formation or resolution of these structures are found in diverse organisms, and a growing body of work suggests that the resolution of DNA secondary structures is critical for genome integrity. This Review focuses on emerging evidence relating to the characteristics of G-quadruplex structures and the possible influence of such structures on genomic stability and cellular processes, such as transcription. PMID:23032257

  7. Tetrasubstituted phenanthrolines as highly potent, water-soluble, and selective g-quadruplex ligands

    DEFF Research Database (Denmark)

    Larsen, Anders Foller; Nielsen, Mads Corvinius; Ulven, Trond

    2012-01-01

    Small molecules capable of stabilizing the G-quadruplex (G4) structure are of interest for the development of improved anticancer drugs. Novel 4,7-diamino-substituted 1,10-phenanthroline-2,9-dicarboxamides that represent hybrid structures of known phenanthroline-based ligands have been designed....... An efficient synthetic route to the compounds has been developed and their interactions with various G4 sequences have been evaluated by Förster resonance energy transfer (FRET) melting assays, fluorescent intercalator displacement (FID), electrospray ionization mass spectrometry (ESI-MS), and circular...... dichroism (CD) spectroscopy. The preferred compounds have high aqueous solubility and are strong and potent G4 binders with a high selectivity over duplex DNA; thus, they represent a significant improvement over the lead compounds. Two of the compounds are inhibitors of HeLa and HT1080 cell proliferation....

  8. A multi-functional guanine derivative for studying the DNA G-quadruplex structure.

    Science.gov (United States)

    Ishizuka, Takumi; Zhao, Pei-Yan; Bao, Hong-Liang; Xu, Yan

    2017-10-23

    In the present study, we developed a multi-functional guanine derivative, 8F G, as a G-quadruplex stabilizer, a fluorescent probe for the detection of G-quadruplex formation, and a 19 F sensor for the observation of the G-quadruplex. We demonstrate that the functional nucleoside bearing a 3,5-bis(trifluoromethyl)benzene group at the 8-position of guanine stabilizes the DNA G-quadruplex structure and fluoresces following the G-quadruplex formation. Furthermore, we show that the functional sensor can be used to directly observe DNA G-quadruplexes by 19 F-NMR in living cells. To our knowledge, this is the first study showing that the nucleoside derivative simultaneously allows for three kinds of functions at a single G-quadruplex DNA. Our results suggest that the multi-functional nucleoside derivative can be broadly used for studying the G-quadruplex structure and serves as a powerful tool for examining the molecular basis of G-quadruplex formation in vitro and in living cells.

  9. Separation of the potential G-quadruplex ligands from the butanol extract of Zanthoxylum ailanthoides Sieb. & Zucc. by countercurrent chromatography and preparative high performance liquid chromatography.

    Science.gov (United States)

    Han, Tian; Cao, Xueli; Xu, Jing; Pei, Hairun; Zhang, Hong; Tang, Yalin

    2017-07-21

    stabilization effects on G-quadruplex by increasing G-quadruplex's T m approximately 10°C, which may be the most potent G-quadruplex ligands in Z. ailanthoides. Copyright © 2017 Elsevier B.V. All rights reserved.

  10. Nucleotide Pool Depletion Induces G-Quadruplex-Dependent Perturbation of Gene Expression

    Directory of Open Access Journals (Sweden)

    Charikleia Papadopoulou

    2015-12-01

    Full Text Available Nucleotide pool imbalance has been proposed to drive genetic instability in cancer. Here, we show that slowing replication forks by depleting nucleotide pools with hydroxyurea (HU can also give rise to both transient and permanent epigenetic instability of a reporter locus, BU-1, in DT40 cells. HU induces stochastic formation of Bu-1low variants in dividing cells, which have lost the H3K4me3 present in untreated cells. This instability is potentiated by an intragenic G quadruplex, which also promotes local H2Ax phosphorylation and transient heterochromatinization. Genome-wide, gene expression changes induced by HU significantly overlap with those resulting from loss of the G4-helicases FANCJ, WRN, and BLM. Thus, the effects of global replication stress induced by nucleotide pool depletion can be focused by local replication impediments caused by G quadruplex formation to induce epigenetic instability and changes in gene expression, a mechanism that may contribute to selectable transcriptional changes in cancer.

  11. Exploring the Interactions of the Dietary Plant Flavonoids Fisetin and Naringenin with G-Quadruplex and Duplex DNA, Showing Contrasting Binding Behavior: Spectroscopic and Molecular Modeling Approaches.

    Science.gov (United States)

    Bhattacharjee, Snehasish; Chakraborty, Sandipan; Sengupta, Pradeep K; Bhowmik, Sudipta

    2016-09-01

    Guanine-rich sequences have the propensity to fold into a four-stranded DNA structure known as a G-quadruplex (G4). G4 forming sequences are abundant in the promoter region of several oncogenes and become a key target for anticancer drug binding. Here we have studied the interactions of two structurally similar dietary plant flavonoids fisetin and naringenin with G4 as well as double stranded (duplex) DNA by using different spectroscopic and modeling techniques. Our study demonstrates the differential binding ability of the two flavonoids with G4 and duplex DNA. Fisetin more strongly interacts with parallel G4 structure than duplex DNA, whereas naringenin shows stronger binding affinity to duplex rather than G4 DNA. Molecular docking results also corroborate our spectroscopic results, and it was found that both of the ligands are stacked externally in the G4 DNA structure. C-ring planarity of the flavonoid structure appears to be a crucial factor for preferential G4 DNA recognition of flavonoids. The goal of this study is to explore the critical effects of small differences in the structure of closely similar chemical classes of such small molecules (flavonoids) which lead to the contrasting binding properties with the two different forms of DNA. The resulting insights may be expected to facilitate the designing of the highly selective G4 DNA binders based on flavonoid scaffolds.

  12. Label-free logic modules and two-layer cascade based on stem-loop probes containing a G-quadruplex domain.

    Science.gov (United States)

    Guo, Yahui; Cheng, Junjie; Wang, Jine; Zhou, Xiaodong; Hu, Jiming; Pei, Renjun

    2014-09-01

    A simple, versatile, and label-free DNA computing strategy was designed by using toehold-mediated strand displacement and stem-loop probes. A full set of logic gates (YES, NOT, OR, NAND, AND, INHIBIT, NOR, XOR, XNOR) and a two-layer logic cascade were constructed. The probes contain a G-quadruplex domain, which was blocked or unfolded through inputs initiating strand displacement and the obviously distinguishable light-up fluorescent signal of G-quadruplex/NMM complex was used as the output readout. The inputs are the disease-specific nucleotide sequences with potential for clinic diagnosis. The developed versatile computing system based on our label-free and modular strategy might be adapted in multi-target diagnosis through DNA hybridization and aptamer-target interaction. © 2014 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  13. Use of alternative alkali chlorides in RT and PCR of polynucleotides containing G quadruplex structures.

    Science.gov (United States)

    Ramos-Alemán, Fabiola; González-Jasso, Eva; Pless, Reynaldo C

    2018-02-15

    Several alkali chlorides were compared for their use in reverse transcription (RT) and PCR of different types of nucleic acid templates. On a test region of biological DNA incapable of forming G quadruplex (G4) structures, Taq DNA polymerase showed similar PCR performance with 50 mM KCl, CsCl, LiCl, and NaCl. In contrast, on a synthetic model polydeoxyribonucleotide prone to G4 formation, good PCR amplification was obtained with 50 mM CsCl, but little or none with LiCl or KCl. Similarly, in RT of a G4-prone model polyribonucleotide, MMLV reverse transcriptase produced a good yield with 50 mM CsCl, mediocre yields with LiCl or without added alkali chloride, and a poor yield with 50 mM KCl. The full RT-PCR assay starting from the G4-prone polyribonucleotide, showed good results with CsCl in both stages, poor results with LiCl, and no product formation with KCl. The model polynucleotides showed fast G quadruplex formation under PCR or RT conditions with 50 mM KCl, but not with CsCl or LiCl. The results argue for the use of CsCl instead of KCl for RT and PCR of G4-prone sequences. No advantage was observed when using the 7-deaza type nucleotide analog c 7 dGTP in PCR amplification of the G4-prone polydeoxyribonucleotide. Copyright © 2017 Elsevier Inc. All rights reserved.

  14. Determinants for Tight and Selective Binding of a Medicinal Dicarbene Gold(I) Complex to a Telomeric DNA G-Quadruplex: a Joint ESI MS and XRD Investigation.

    Science.gov (United States)

    Bazzicalupi, Carla; Ferraroni, Marta; Papi, Francesco; Massai, Lara; Bertrand, Benoît; Messori, Luigi; Gratteri, Paola; Casini, Angela

    2016-03-18

    The dicarbene gold(I) complex [Au(9-methylcaffein-8-ylidene)2 ]BF4 is an exceptional organometallic compound of profound interest as a prospective anticancer agent. This gold(I) complex was previously reported to be highly cytotoxic toward various cancer cell lines in vitro and behaves as a selective G-quadruplex stabilizer. Interactions of the gold complex with various telomeric DNA models have been analyzed by a combined ESI MS and X-ray diffraction (XRD) approach. ESI MS measurements confirmed formation of stable adducts between the intact gold(I) complex and Tel 23 DNA sequence. The crystal structure of the adduct formed between [Au(9-methylcaffein-8-ylidene)2 ](+) and Tel 23 DNA G-quadruplex was solved. Tel 23 maintains a characteristic propeller conformation while binding three gold(I) dicarbene moieties at two distinct sites. Stacking interactions appear to drive noncovalent binding of the gold(I) complex. The structural basis for tight gold(I) complex/G-quadruplex recognition and its selectivity are described. © 2016 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  15. A colorimetric platform for sensitively differentiating telomere DNA with different lengths, monitoring G-quadruplex and dsDNA based on silver nanoclusters and unmodified gold nanoparticles

    Science.gov (United States)

    Qu, Fei; Chen, Zeqiu; You, Jinmao; Song, Cuihua

    2018-05-01

    Human telomere DNA plays a vital role in genome integrity control and carcinogenesis as an indication for extensive cell proliferation. Herein, silver nanoclusters (Ag NCs) templated by polymer and unmodified gold nanoparticles (Au NPs) are designed as a new colorimetric platform for sensitively differentiating telomere DNA with different lengths, monitoring G-quadruplex and dsDNA. Ag NCs can produce the aggregation of Au NPs, so the color of Au NPs changes to blue and the absorption peak moves to 700 nm. While the telomere DNA can protect Au NPs from aggregation, the color turns to red again and the absorption band blue shift. Benefiting from the obvious color change, we can differentiate the length of telomere DNA by naked eyes. As the length of telomere DNA is longer, the variation of color becomes more noticeable. The detection limits of telomere DNA containing 10, 22, 40, 64 bases are estimated to be 1.41, 1.21, 0.23 and 0.22 nM, respectively. On the other hand, when telomere DNA forms G-quadruplex in the presence of K+, or dsDNA with complementary sequence, both G-quadruplex and dsDNA can protect Au NPs better than the unfolded telomere DNA. Hence, a new colorimetric platform for monitoring structure conversion of DNA is established by Ag NCs-Au NPs system, and to prove this type of application, a selective K+ sensor is developed.

  16. Exonuclease-assisted multicolor aptasensor for visual detection of ochratoxin A based on G-quadruplex-hemin DNAzyme-mediated etching of gold nanorod.

    Science.gov (United States)

    Yu, Xinhui; Lin, Yaohui; Wang, Xusheng; Xu, Liangjun; Wang, Zongwen; Fu, FengFu

    2018-04-21

    An exonuclease-assisted multicolor aptasensor was developed for the visual detection of ochratoxin A (OTA). It is based on the etching of gold nanorods (AuNRs) mediated by a G-quadruplex-hemin DNAzyme. A DNA sequence (AG4-OTA) was designed that comprises a hemin aptamer and an OTA aptamer. OTA binds to AG4-OTA to form an antiparallel G-quadruplex, which halts its digestion by exonuclease I (Exo I) from the 3'-end of AG4-OTA. Thus, the retained hemin aptamer can bind to hemin to form a G-quadruplex-hemin DNAzyme. This DNAzyme has peroxidase-like activity that catalyzes the oxidation of 3,3',5,5'-tetramethylbenzidine (TMB) by H 2 O 2 to produce its diimine derivative (TMB 2+ ) in acidic solution. TMB 2+ can etch the AuNRs by oxidizing Au(0) into Au(I). This results in the generation of rainbow-like colors and provides a multicolor platform for the visual detection of OTA. The assay is based on the use of a single isolated aptamer and possesses obvious advantages such as multi-color visual inspection, relatively high sensitivity and accuracy. It can be used to detect as little as 30 nM concentrations of OTA by visual observation and even 10 nM concentrations by spectrophotometry. The method was successfully applied to the determination of OTA in spiked beer where it gave recoveries of 101-108%, with a relative standard deviation (RSD, n = 5) of <5%. Graphical abstract Schematic of an exonuclease-assisted multicolor bioassay based on the G-quadruplex-hemin DNAzyme-mediated etching of gold nanorods (AuNRs). It enables visual detection of ochratoxin A (OTA) with a detection limit of 30 nM.

  17. Identification of New Natural DNA G-Quadruplex Binders Selected by a Structure-Based Virtual Screening Approach

    Directory of Open Access Journals (Sweden)

    Stefano Alcaro

    2013-09-01

    Full Text Available The G-quadruplex DNA structures are mainly present at the terminal portion of telomeres and can be stabilized by ligands able to recognize them in a specific manner. The recognition process is usually related to the inhibition of the enzyme telomerase indirectly involved and over-expressed in a high percentage of human tumors. There are several ligands, characterized by different chemical structures, already reported in the literature for their ability to bind and stabilize the G-quadruplex structures. Using the structural and biological information available on these structures; we performed a high throughput in silico screening of commercially natural compounds databases by means of a structure-based approach followed by docking experiments against the human telomeric sequence d[AG3(T2AG33]. We identified 12 best hits characterized by different chemical scaffolds and conformational and physicochemical properties. All of them were associated to an improved theoretical binding affinity with respect to that of known selective G-binders. Among these hits there is a chalcone derivative; structurally very similar to the polyphenol butein; known to remarkably inhibit the telomerase activity.

  18. Small Molecule Microarrays Enable the Identification of a Selective, Quadruplex-Binding Inhibitor of MYC Expression.

    Science.gov (United States)

    Felsenstein, Kenneth M; Saunders, Lindsey B; Simmons, John K; Leon, Elena; Calabrese, David R; Zhang, Shuling; Michalowski, Aleksandra; Gareiss, Peter; Mock, Beverly A; Schneekloth, John S

    2016-01-15

    The transcription factor MYC plays a pivotal role in cancer initiation, progression, and maintenance. However, it has proven difficult to develop small molecule inhibitors of MYC. One attractive route to pharmacological inhibition of MYC has been the prevention of its expression through small molecule-mediated stabilization of the G-quadruplex (G4) present in its promoter. Although molecules that bind globally to quadruplex DNA and influence gene expression are well-known, the identification of new chemical scaffolds that selectively modulate G4-driven genes remains a challenge. Here, we report an approach for the identification of G4-binding small molecules using small molecule microarrays (SMMs). We use the SMM screening platform to identify a novel G4-binding small molecule that inhibits MYC expression in cell models, with minimal impact on the expression of other G4-associated genes. Surface plasmon resonance (SPR) and thermal melt assays demonstrated that this molecule binds reversibly to the MYC G4 with single digit micromolar affinity, and with weaker or no measurable binding to other G4s. Biochemical and cell-based assays demonstrated that the compound effectively silenced MYC transcription and translation via a G4-dependent mechanism of action. The compound induced G1 arrest and was selectively toxic to MYC-driven cancer cell lines containing the G4 in the promoter but had minimal effects in peripheral blood mononucleocytes or a cell line lacking the G4 in its MYC promoter. As a measure of selectivity, gene expression analysis and qPCR experiments demonstrated that MYC and several MYC target genes were downregulated upon treatment with this compound, while the expression of several other G4-driven genes was not affected. In addition to providing a novel chemical scaffold that modulates MYC expression through G4 binding, this work suggests that the SMM screening approach may be broadly useful as an approach for the identification of new G4-binding small

  19. Superhelicity Constrains a Localized and R-Loop-Dependent Formation of G-Quadruplexes at the Upstream Region of Transcription.

    Science.gov (United States)

    Zheng, Ke-Wei; He, Yi-de; Liu, Hong-He; Li, Xin-Min; Hao, Yu-Hua; Tan, Zheng

    2017-10-20

    Transcription induces formation of intramolecular G-quadruplex structures at the upstream region of a DNA duplex by an upward transmission of negative supercoiling through the DNA. Currently the regulation of such G-quadruplex formation remains unclear. Using plasmid as a model, we demonstrate that while it is the dynamic negative supercoiling generated by a moving RNA polymerase that triggers a formation of a G-quadruplex, the constitutional superhelicity determines the potential and range of the formation of a G-quadruplex by constraining the propagation of the negative supercoiling. G-quadruplex formation is maximal in negatively supercoiled and nearly abolished in relaxed plasmids while being moderate in nicked and linear ones. The formation of a G-quadruplex strongly correlates with the presence of an R-loop. Preventing R-loop formation virtually abolished G-quadruplex formation even in the negatively supercoiled plasmid. Enzymatic action and protein binding that manipulate supercoiling or its propagation all impact the formation of G-quadruplexes. Because chromosomes and plasmids in cells in their natural form are maintained in a supercoiled state, our findings reveal a physical basis that justifies the formation and regulation of G-quadruplexes in vivo. The structural features involved in G-quadruplex formation may all serve as potential targets in clinical and therapeutic applications.

  20. Triple Quenching of a Novel Self-Enhanced Ru(II) Complex by Hemin/G-Quadruplex DNAzymes and Its Potential Application to Quantitative Protein Detection.

    Science.gov (United States)

    Zhao, Min; Liao, Ni; Zhuo, Ying; Chai, Ya-Qin; Wang, Ji-Peng; Yuan, Ruo

    2015-08-04

    Herein, a novel "on-off" electrochemiluminescence (ECL) aptasensor for highly sensitive determination of thrombin has been constructed based on the triple quenching of the effect of hemin/G-quadruplex DNAzymes upon the Ru(II) complex-based ECL system. First, a strong initial ECL signal was achieved by the dual amplification strategies of (i) intramolecular coreaction of a self-enhanced Ru(II)-based molecule (PTCA-PEI-Ru(II)) and (ii) intermolecular coreaction between PTCA-PEI-Ru(II) and nicotinamide adenine dinucleotide (NADH), which was named the signal-on state. Then, a novel triple quenching of the effect of multifunctional hemin/G-quadruplex DNAzymes upon the Ru(II) complex-based ECL system was designed to realize the desirable signal-off state, which was outlined as follows: (i) the hemin/G-quadruplex DNAzymes mimicked NADH oxidase to oxidize NADH and in situ generate the H2O2, consuming the coreactant of NADH; (ii) its active center of hemin could oxidize the excited state PTCA-PEI-Ru(II)* to PTCA-PEI-Ru(III), making the energy and electron transfer quench; (iii) it also acted as horseradish peroxidase (HRP) to catalyze the H2O2 for in situ producing the quencher of O2. Based on triple quenching of the effect of hemin/G-quadruplex DNAzymes, the highly sensitive "on-off" thrombin aptasensor was developed with a wide linear detection range of 1.0 × 10(-14) M to 1.0 × 10(-10) M and a detection limit down to the femtomolar level.

  1. QuadBase2: web server for multiplexed guanine quadruplex mining and visualization

    Science.gov (United States)

    Dhapola, Parashar; Chowdhury, Shantanu

    2016-01-01

    DNA guanine quadruplexes or G4s are non-canonical DNA secondary structures which affect genomic processes like replication, transcription and recombination. G4s are computationally identified by specific nucleotide motifs which are also called putative G4 (PG4) motifs. Despite the general relevance of these structures, there is currently no tool available that can allow batch queries and genome-wide analysis of these motifs in a user-friendly interface. QuadBase2 (quadbase.igib.res.in) presents a completely reinvented web server version of previously published QuadBase database. QuadBase2 enables users to mine PG4 motifs in up to 178 eukaryotes through the EuQuad module. This module interfaces with Ensembl Compara database, to allow users mine PG4 motifs in the orthologues of genes of interest across eukaryotes. PG4 motifs can be mined across genes and their promoter sequences in 1719 prokaryotes through ProQuad module. This module includes a feature that allows genome-wide mining of PG4 motifs and their visualization as circular histograms. TetraplexFinder, the module for mining PG4 motifs in user-provided sequences is now capable of handling up to 20 MB of data. QuadBase2 is a comprehensive PG4 motif mining tool that further expands the configurations and algorithms for mining PG4 motifs in a user-friendly way. PMID:27185890

  2. Studies of G-quadruplex DNA structures at the single molecule level

    DEFF Research Database (Denmark)

    Kragh, Sofie Louise

    2015-01-01

    Folding of G-quaduplex structures adopted by the human telomeric repeat is here studied by single molecule FRET microscopy. This method allows for the investigation of G-quadruplex structures and their conformational dynamic. Telomeres are located at the ends of our chromosomes and end in a single...... with human telomeric repeat adopt several different G-quadruplex conformations in the presence of K+ ions. G-quadruplexes inhibit telomerase activity and are therefore potential targets for anti-cancer drugs, which can be small molecule ligands capable of stabilizing G-quadruplex structures. Understanding...... range. FRET spectroscopy can be performed on an ensemble of molecules, or on the single molecule level. In single molecule FRET experiments it is possible to follow the behaviour in time for each molecule independently, allowing insight into both dynamically and statistically heterogeneous molecular...

  3. Allelic Dropout During Polymerase Chain Reaction due to G-Quadruplex Structures and DNA Methylation Is Widespread at Imprinted Human Loci

    Directory of Open Access Journals (Sweden)

    Aaron J. Stevens

    2017-03-01

    Full Text Available Loss of one allele during polymerase chain reaction (PCR amplification of DNA, known as allelic dropout, can be caused by a variety of mechanisms. Allelic dropout during PCR may have profound implications for molecular diagnostic and research procedures that depend on PCR and assume biallelic amplification has occurred. Complete allelic dropout due to the combined effects of cytosine methylation and G-quadruplex formation was previously described for a differentially methylated region of the human imprinted gene, MEST. We now demonstrate that this parent-of-origin specific allelic dropout can potentially occur at several other genomic regions that display genomic imprinting and have propensity for G-quadruplex formation, including AIM1, BLCAP, DNMT1, PLAGL1, KCNQ1, and GRB10. These findings demonstrate that systematic allelic dropout during PCR is a general phenomenon for regions of the genome where differential allelic methylation and G-quadruplex motifs coincide, and suggest that great care must be taken to ensure biallelic amplification is occurring in such situations.

  4. Allelic Dropout During Polymerase Chain Reaction due to G-Quadruplex Structures and DNA Methylation Is Widespread at Imprinted Human Loci.

    Science.gov (United States)

    Stevens, Aaron J; Taylor, Millie G; Pearce, Frederick Grant; Kennedy, Martin A

    2017-03-10

    Loss of one allele during polymerase chain reaction (PCR) amplification of DNA, known as allelic dropout, can be caused by a variety of mechanisms. Allelic dropout during PCR may have profound implications for molecular diagnostic and research procedures that depend on PCR and assume biallelic amplification has occurred. Complete allelic dropout due to the combined effects of cytosine methylation and G-quadruplex formation was previously described for a differentially methylated region of the human imprinted gene, MEST We now demonstrate that this parent-of-origin specific allelic dropout can potentially occur at several other genomic regions that display genomic imprinting and have propensity for G-quadruplex formation, including AIM1 , BLCAP , DNMT1 , PLAGL1 , KCNQ1 , and GRB10 These findings demonstrate that systematic allelic dropout during PCR is a general phenomenon for regions of the genome where differential allelic methylation and G-quadruplex motifs coincide, and suggest that great care must be taken to ensure biallelic amplification is occurring in such situations. Copyright © 2017 Stevens et al.

  5. Fully integrated graphene electronic biosensor for label-free detection of lead (II) ion based on G-quadruplex structure-switching.

    Science.gov (United States)

    Li, Yijun; Wang, Cheng; Zhu, Yibo; Zhou, Xiaohong; Xiang, Yu; He, Miao; Zeng, Siyu

    2017-03-15

    This work presents a fully integrated graphene field-effect transistor (GFET) biosensor for the label-free detection of lead ions (Pb 2+ ) in aqueous-media, which first implements the G-quadruplex structure-switching biosensing principle in graphene nanoelectronics. We experimentally illustrate the biomolecular interplay that G-rich DNA single-strands with one-end confined on graphene surface can specifically interact with Pb 2+ ions and switch into G-quadruplex structures. Since the structure-switching of electrically charged DNA strands can disrupt the charge distribution in the vicinity of graphene surface, the carrier equilibrium in graphene sheet might be altered, and manifested by the conductivity variation of GFET. The experimental data and theoretical analysis show that our devices are capable of the label-free and specific quantification of Pb 2+ with a detection limit down to 163.7ng/L. These results first verify the signaling principle competency of G-quadruplex structure-switching in graphene electronic biosensors. Combining with the advantages of the compact device structure and convenient electrical signal, a label-free GFET biosensor for Pb 2+ monitoring is enabled with promising application potential. Copyright © 2016 Elsevier B.V. All rights reserved.

  6. Design, synthesis and evaluation of 4,7-diamino-1,10-phenanthroline G-quadruplex ligands

    DEFF Research Database (Denmark)

    Nielsen, Mads Corvinius; Borch, Jonas; Ulven, Trond

    2009-01-01

    the central ionic column. Introduction of positively charged side chains results in compounds with appreciable G-quadruplex stabilizing properties and high aqueous solubility, with the longer side chains giving more potent compounds. Ligands carrying guanidine side chains in general show higher quadruplex...... stabilizing activity and distinctly slower kinetic properties than their amino and dimethylamino analogues, possibly due to specific hydrogen bond interactions with the G-quadruplex loops....

  7. Heterocyclic Dications as a New Class of Telomeric G-Quadruplex Targeting Agents

    Science.gov (United States)

    Nanjunda, Rupesh; Musetti, Caterina; Kumar, Arvind; Ismail, Mohamed A.; Farahat, Abdelbasset A.; Wang, Siming; Sissi, Claudia; Palumbo, Manlio; Boykin, David W.; Wilson, W. David

    2013-01-01

    Small molecules that can induce and stabilize G-quadruplex DNA structures represent a novel approach for anti-cancer and anti-parasitic therapy and extensive efforts have been directed towards discovering lead compounds that are capable of stabilizing quadruplexes. The purpose of this study is to explore conformational modifications in a series of heterocyclic dications to discover structural motifs that can selectively bind and stabilize specific G-quadruplexes, such as those present in the human telomere. The G-quadruplex has various potential recognition sites for small molecules; however, the primary interaction site of most of these ligands is the terminal tetrads. Similar to duplex-DNA groove recognition, quadruplex groove recognition by small molecules offers the potential for enhanced selectivity that can be developed into a viable therapeutic strategy. The compounds investigated were selected based on preliminary studies with DB832, a bifuryl-phenyl diamidine with a unique telomere interaction. This compound provides a paradigm that can help in understanding the optimum compound-DNA interactions that lead to quadruplex groove recognition. DNA recognition by the DB832 derivatives was investigated by biophysical experiments such as thermal melting, circular dichroism, mass spectrometry and NMR. Biological studies were also performed to complement the biophysical data. The results suggest a complex binding mechanism which involves the recognition of grooves for some ligands as well as stacking at the terminal tetrads of the human telomeric G-quadruplex for most of the ligands. These molecules represent an excellent starting point for further SAR analysis for diverse modes of quadruplex recognition and subsequent structure optimization for drug development. PMID:22380518

  8. Thermodynamic fingerprints of ligand binding to human telomeric G-quadruplexes

    OpenAIRE

    Bon?ina, Matja?; Podlipnik, ?rtomir; Piantanida, Ivo; Eilmes, Julita; Teulade-Fichou, Marie-Paule; Vesnaver, Gorazd; Lah, Jurij

    2015-01-01

    Thermodynamic studies of ligand binding to human telomere (ht) DNA quadruplexes, as a rule, neglect the involvement of various ht-DNA conformations in the binding process. Therefore, the thermodynamic driving forces and the mechanisms of ht-DNA G-quadruplex-ligand recognition remain poorly understood. In this work we characterize thermodynamically and structurally binding of netropsin (Net), dibenzotetraaza[14]annulene derivatives (DP77, DP78), cationic porphyrin (TMPyP4) and two bisquinolini...

  9. APTO-253 Stabilizes G-quadruplex DNA, Inhibits MYC Expression, and Induces DNA Damage in Acute Myeloid Leukemia Cells.

    Science.gov (United States)

    Local, Andrea; Zhang, Hongying; Benbatoul, Khalid D; Folger, Peter; Sheng, Xia; Tsai, Cheng-Yu; Howell, Stephen B; Rice, William G

    2018-06-01

    APTO-253 is a phase I clinical stage small molecule that selectively induces CDKN1A (p21), promotes G 0 -G 1 cell-cycle arrest, and triggers apoptosis in acute myeloid leukemia (AML) cells without producing myelosuppression in various animal species and humans. Differential gene expression analysis identified a pharmacodynamic effect on MYC expression, as well as induction of DNA repair and stress response pathways. APTO-253 was found to elicit a concentration- and time-dependent reduction in MYC mRNA expression and protein levels. Gene ontogeny and structural informatic analyses suggested a mechanism involving G-quadruplex (G4) stabilization. Intracellular pharmacokinetic studies in AML cells revealed that APTO-253 is converted intracellularly from a monomer to a ferrous complex [Fe(253) 3 ]. FRET assays demonstrated that both monomeric APTO-253 and Fe(253) 3 stabilize G4 structures from telomeres, MYC, and KIT promoters but do not bind to non-G4 double-stranded DNA. Although APTO-253 exerts a host of mechanistic sequelae, the effect of APTO-253 on MYC expression and its downstream target genes, on cell-cycle arrest, DNA damage, and stress responses can be explained by the action of Fe(253) 3 and APTO-253 on G-quadruplex DNA motifs. Mol Cancer Ther; 17(6); 1177-86. ©2018 AACR . ©2018 American Association for Cancer Research.

  10. The G-quadruplex DNA stabilizing drug pyridostatin promotes DNA damage and downregulates transcription of Brca1 in neurons.

    Science.gov (United States)

    Moruno-Manchon, Jose F; Koellhoffer, Edward C; Gopakumar, Jayakrishnan; Hambarde, Shashank; Kim, Nayun; McCullough, Louise D; Tsvetkov, Andrey S

    2017-09-12

    The G-quadruplex is a non-canonical DNA secondary structure formed by four DNA strands containing multiple runs of guanines. G-quadruplexes play important roles in DNA recombination, replication, telomere maintenance, and regulation of transcription. Small molecules that stabilize the G-quadruplexes alter gene expression in cancer cells. Here, we hypothesized that the G-quadruplexes regulate transcription in neurons. We discovered that pyridostatin, a small molecule that specifically stabilizes G-quadruplex DNA complexes, induced neurotoxicity and promoted the formation of DNA double-strand breaks (DSBs) in cultured neurons. We also found that pyridostatin downregulated transcription of the Brca1 gene, a gene that is critical for DSB repair. Importantly, in an in vitro gel shift assay, we discovered that an antibody specific to the G-quadruplex structure binds to a synthetic oligonucleotide, which corresponds to the first putative G-quadruplex in the Brca1 gene promoter. Our results suggest that the G-quadruplex complexes regulate transcription in neurons. Studying the G-quadruplexes could represent a new avenue for neurodegeneration and brain aging research.

  11. RPA-mediated unfolding of systematically varying G-quadruplex structures.

    Science.gov (United States)

    Ray, Sujay; Qureshi, Mohammad H; Malcolm, Dominic W; Budhathoki, Jagat B; Celik, Uğur; Balci, Hamza

    2013-05-21

    G-quadruplex (GQ) is a noncanonical nucleic acid structure that is formed by guanine rich sequences. Unless it is destabilized by proteins such as replication protein A (RPA), GQ could interfere with DNA metabolic functions, such as replication or repair. We studied RPA-mediated GQ unfolding using single-molecule FRET on two groups of GQ structures that have different loop lengths and different numbers of G-tetrad layers. We observed a linear increase in the steady-state stability of the GQ against RPA-mediated unfolding with increasing number of layers or decreasing loop length. The stability demonstrated by different GQ structures varied by at least three orders of magnitude. Those with shorter loops (less than three nucleotides long) or a greater number of layers (more than three layers) maintained a significant folded population even at physiological RPA concentration (≈1 μM), raising the possibility of physiological viability of such GQ structures. Finally, we measured the transition time between the start and end of the RPA-mediated GQ unfolding process to be 0.35 ± 0.10 s for all GQ constructs we studied, despite significant differences in their steady-state stabilities. We propose a two-step RPA-mediated GQ unfolding mechanism that is consistent with our observations. Copyright © 2013 Biophysical Society. Published by Elsevier Inc. All rights reserved.

  12. G-quadruplex formation in telomeres enhances POT1/TPP1 protection against RPA binding

    Science.gov (United States)

    Ray, Sujay; Bandaria, Jigar N.; Qureshi, Mohammad H.; Yildiz, Ahmet; Balci, Hamza

    2014-01-01

    Human telomeres terminate with a single-stranded 3′ G overhang, which can be recognized as a DNA damage site by replication protein A (RPA). The protection of telomeres (POT1)/POT1-interacting protein 1 (TPP1) heterodimer binds specifically to single-stranded telomeric DNA (ssTEL) and protects G overhangs against RPA binding. The G overhang spontaneously folds into various G-quadruplex (GQ) conformations. It remains unclear whether GQ formation affects the ability of POT1/TPP1 to compete against RPA to access ssTEL. Using single-molecule Förster resonance energy transfer, we showed that POT1 stably loads to a minimal DNA sequence adjacent to a folded GQ. At 150 mM K+, POT1 loading unfolds the antiparallel GQ, as the parallel conformation remains folded. POT1/TPP1 loading blocks RPA’s access to both folded and unfolded telomeres by two orders of magnitude. This protection is not observed at 150 mM Na+, in which ssTEL forms only a less-stable antiparallel GQ. These results suggest that GQ formation of telomeric overhangs may contribute to suppression of DNA damage signals. PMID:24516170

  13. Escherichia coli DNA polymerase I can disrupt G-quadruplex structures during DNA replication.

    Science.gov (United States)

    Teng, Fang-Yuan; Hou, Xi-Miao; Fan, San-Hong; Rety, Stephane; Dou, Shuo-Xing; Xi, Xu-Guang

    2017-12-01

    Non-canonical four-stranded G-quadruplex (G4) DNA structures can form in G-rich sequences that are widely distributed throughout the genome. The presence of G4 structures can impair DNA replication by hindering the progress of replicative polymerases (Pols), and failure to resolve these structures can lead to genetic instability. In the present study, we combined different approaches to address the question of whether and how Escherichia coli Pol I resolves G4 obstacles during DNA replication and/or repair. We found that E. coli Pol I-catalyzed DNA synthesis could be arrested by G4 structures at low protein concentrations and the degree of inhibition was strongly dependent on the stability of the G4 structures. Interestingly, at high protein concentrations, E. coli Pol I was able to overcome some kinds of G4 obstacles without the involvement of other molecules and could achieve complete replication of G4 DNA. Mechanistic studies suggested that multiple Pol I proteins might be implicated in G4 unfolding, and the disruption of G4 structures requires energy derived from dNTP hydrolysis. The present work not only reveals an unrealized function of E. coli Pol I, but also presents a possible mechanism by which G4 structures can be resolved during DNA replication and/or repair in E. coli. © 2017 Federation of European Biochemical Societies.

  14. Domino effect in chemical accidents: main features and accident sequences.

    Science.gov (United States)

    Darbra, R M; Palacios, Adriana; Casal, Joaquim

    2010-11-15

    The main features of domino accidents in process/storage plants and in the transportation of hazardous materials were studied through an analysis of 225 accidents involving this effect. Data on these accidents, which occurred after 1961, were taken from several sources. Aspects analyzed included the accident scenario, the type of accident, the materials involved, the causes and consequences and the most common accident sequences. The analysis showed that the most frequent causes are external events (31%) and mechanical failure (29%). Storage areas (35%) and process plants (28%) are by far the most common settings for domino accidents. Eighty-nine per cent of the accidents involved flammable materials, the most frequent of which was LPG. The domino effect sequences were analyzed using relative probability event trees. The most frequent sequences were explosion→fire (27.6%), fire→explosion (27.5%) and fire→fire (17.8%). Copyright © 2010 Elsevier B.V. All rights reserved.

  15. Surface Plasmon Resonance kinetic analysis of the interaction between G-quadruplex nucleic acids and an anti-G-quadruplex monoclonal antibody.

    Science.gov (United States)

    Lago, Sara; Nadai, Matteo; Rossetto, Monica; Richter, Sara N

    2018-06-01

    G-quadruplexes (G4s) are nucleic acids secondary structures formed in guanine-rich sequences. Anti-G4 antibodies represent a tool for the direct investigation of G4s in cells. Surface Plasmon Resonance (SPR) is a highly sensitive technology, suitable for assessing the affinity between biomolecules. We here aimed at improving the orientation of an anti-G4 antibody on the SPR sensor chip to optimize detection of binding antigens. SPR was employed to characterize the anti-G4 antibody interaction with G4 and non-G4 oligonucleotides. Dextran-functionalized sensor chips were used both in covalent coupling and capturing procedures. The use of two leading molecule for orienting the antibody of interest allowed to improve its activity from completely non-functional to 65% active. The specificity of the anti-G4 antobody for G4 structures could thus be assessed with high sensitivity and reliability. Optimization of the immobilization protocol for SPR biosensing, allowed us to determine the anti-G4 antibody affinity and specificity for G4 antigens with higher sensitivity with respect to other in vitro assays such as ELISA. Anti-G4 antibody specificity is a fundamental assumption for the future utilization of this kind of antibodies for monitoring G4s directly in cells. The heterogeneous orientation of amine-coupling immobilized ligands is a general problem that often leads to partial or complete inactivation of the molecules. Here we describe a new strategy for improving ligand orientation: driving it from two sides. This principle can be virtually applied to every molecule that loses its activity or is poorly immobilized after standard coupling to the SPR chip surface. Copyright © 2018 The Authors. Published by Elsevier B.V. All rights reserved.

  16. TMPyP4 porphyrin distorts RNA G-quadruplex structures of the disease-associated r(GGGGCC)n repeat of the C9orf72 gene and blocks interaction of RNA-binding proteins.

    Science.gov (United States)

    Zamiri, Bita; Reddy, Kaalak; Macgregor, Robert B; Pearson, Christopher E

    2014-02-21

    Certain DNA and RNA sequences can form G-quadruplexes, which can affect genetic instability, promoter activity, RNA splicing, RNA stability, and neurite mRNA localization. Amyotrophic lateral sclerosis and frontotemporal dementia can be caused by expansion of a (GGGGCC)n repeat in the C9orf72 gene. Mutant r(GGGGCC)n- and r(GGCCCC)n-containing transcripts aggregate in nuclear foci, possibly sequestering repeat-binding proteins such as ASF/SF2 and hnRNPA1, suggesting a toxic RNA pathogenesis, as occurs in myotonic dystrophy. Furthermore, the C9orf72 repeat RNA was recently demonstrated to undergo the noncanonical repeat-associated non-AUG translation (RAN translation) into pathologic dipeptide repeats in patient brains, a process that is thought to depend upon RNA structure. We previously demonstrated that the r(GGGGCC)n RNA forms repeat tract length-dependent G-quadruplex structures that bind the ASF/SF2 protein. Here we show that the cationic porphyrin (5,10,15,20-tetra(N-methyl-4-pyridyl) porphyrin (TMPyP4)), which can bind some G-quadruplex-forming sequences, can bind and distort the G-quadruplex formed by r(GGGGCC)8, and this ablates the interaction of either hnRNPA1 or ASF/SF2 with the repeat. These findings provide proof of concept that nucleic acid binding small molecules, such as TMPyP4, can distort the secondary structure of the C9orf72 repeat, which may beneficially disrupt protein interactions, which may ablate either protein sequestration and/or RAN translation into potentially toxic dipeptides. Disruption of secondary structure formation of the C9orf72 RNA repeats may be a viable therapeutic avenue, as well as a means to test the role of RNA structure upon RAN translation.

  17. Comparative effectiveness of inter-simple sequence repeat and ...

    African Journals Online (AJOL)

    A study to compare the effectiveness of inter-simple sequence repeats (ISSR) and randomly amplified polymorphic DNA (RAPD) profiling was carried out with a total of 65 DNA samples using 12 species of Indian Garcinia. ISSR and RAPD profiling were performed with 19 and 12 primers, respectively. ISSR markers ...

  18. Sites of instability in the human TCF3 (E2A) gene adopt G-quadruplex DNA structures in vitro

    Science.gov (United States)

    Williams, Jonathan D.; Fleetwood, Sara; Berroyer, Alexandra; Kim, Nayun; Larson, Erik D.

    2015-01-01

    The formation of highly stable four-stranded DNA, called G-quadruplex (G4), promotes site-specific genome instability. G4 DNA structures fold from repetitive guanine sequences, and increasing experimental evidence connects G4 sequence motifs with specific gene rearrangements. The human transcription factor 3 (TCF3) gene (also termed E2A) is subject to genetic instability associated with severe disease, most notably a common translocation event t(1;19) associated with acute lymphoblastic leukemia. The sites of instability in TCF3 are not randomly distributed, but focused to certain sequences. We asked if G4 DNA formation could explain why TCF3 is prone to recombination and mutagenesis. Here we demonstrate that sequences surrounding the major t(1;19) break site and a region associated with copy number variations both contain G4 sequence motifs. The motifs identified readily adopt G4 DNA structures that are stable enough to interfere with DNA synthesis in physiological salt conditions in vitro. When introduced into the yeast genome, TCF3 G4 motifs promoted gross chromosomal rearrangements in a transcription-dependent manner. Our results provide a molecular rationale for the site-specific instability of human TCF3, suggesting that G4 DNA structures contribute to oncogenic DNA breaks and recombination. PMID:26029241

  19. Parallel Mitogenome Sequencing Alleviates Random Rooting Effect in Phylogeography.

    Science.gov (United States)

    Hirase, Shotaro; Takeshima, Hirohiko; Nishida, Mutsumi; Iwasaki, Wataru

    2016-04-28

    Reliably rooted phylogenetic trees play irreplaceable roles in clarifying diversification in the patterns of species and populations. However, such trees are often unavailable in phylogeographic studies, particularly when the focus is on rapidly expanded populations that exhibit star-like trees. A fundamental bottleneck is known as the random rooting effect, where a distant outgroup tends to root an unrooted tree "randomly." We investigated whether parallel mitochondrial genome (mitogenome) sequencing alleviates this effect in phylogeography using a case study on the Sea of Japan lineage of the intertidal goby Chaenogobius annularis Eighty-three C. annularis individuals were collected and their mitogenomes were determined by high-throughput and low-cost parallel sequencing. Phylogenetic analysis of these mitogenome sequences was conducted to root the Sea of Japan lineage, which has a star-like phylogeny and had not been reliably rooted. The topologies of the bootstrap trees were investigated to determine whether the use of mitogenomes alleviated the random rooting effect. The mitogenome data successfully rooted the Sea of Japan lineage by alleviating the effect, which hindered phylogenetic analysis that used specific gene sequences. The reliable rooting of the lineage led to the discovery of a novel, northern lineage that expanded during an interglacial period with high bootstrap support. Furthermore, the finding of this lineage suggested the existence of additional glacial refugia and provided a new recent calibration point that revised the divergence time estimation between the Sea of Japan and Pacific Ocean lineages. This study illustrates the effectiveness of parallel mitogenome sequencing for solving the random rooting problem in phylogeographic studies. © The Author 2016. Published by Oxford University Press on behalf of the Society for Molecular Biology and Evolution.

  20. The heterogeneous world of congruency sequence effects: An update.

    OpenAIRE

    Wout eDuthoo; Elger eAbrahamse; Senne eBraem; Senne eBraem; C. Nico Boehler; Wim eNotebaert

    2014-01-01

    Congruency sequence effects (CSEs) refer to the observation that congruency effects in conflict tasks are typically smaller following incongruent compared to following congruent trials. This measure has long been thought to provide a unique window into top-down attentional adjustments and their underlying brain mechanisms. According to the renowned conflict monitoring theory, CSEs reflect enhanced selective attention following conflict detection. Still, alternative accounts suggested that bot...

  1. Folding of guanine quadruplex molecules-funnel-like mechanism or kinetic partitioning? An overview from MD simulation studies

    Czech Academy of Sciences Publication Activity Database

    Šponer, Jiří; Bussi, G.; Stadlbauer, Petr; Kührová, P.; Banáš, P.; Islam, Barira; Haider, S.; Neidle, S.; Otyepka, M.

    2017-01-01

    Roč. 1861, č. 5 (2017), s. 1246-1263 ISSN 0304-4165 R&D Projects: GA ČR(CZ) GA16-13721S Institutional support: RVO:68081707 Keywords : telomeric g-quadruplex * parallel g-quadruplex Subject RIV: CE - Biochemistry OBOR OECD: Biochemistry and molecular biology Impact factor: 4.702, year: 2016

  2. Disordering of human telomeric G-quadruplex with novel antiproliferative anthrathiophenedione.

    Directory of Open Access Journals (Sweden)

    Dmitry Kaluzhny

    Full Text Available Linear heteroareneanthracenediones have been shown to interfere with DNA functions, thereby causing death of human tumor cells and their drug resistant counterparts. Here we report the interaction of our novel antiproliferative agent 4,11-bis[(2-{[acetimido]amino}ethylamino]anthra[2,3-b]thiophene-5,10-dione with telomeric DNA structures studied by isothermal titration calorimetry, circular dichroism and UV absorption spectroscopy. New compound demonstrated a high affinity (K(ass∼10⁶ M⁻¹ for human telomeric antiparallel quadruplex d(TTAGGG₄ and duplex d(TTAGGG₄∶d(CCCTAA₄. Importantly, a ∼100-fold higher affinity was determined for the ligand binding to an unordered oligonucleotide d(TTAGGG TTAGAG TTAGGG TTAGGG unable to form quadruplex structures. Moreover, in the presence of Na+ the compound caused dramatic conformational perturbation of the telomeric G-quadruplex, namely, almost complete disordering of G-quartets. Disorganization of a portion of G-quartets in the presence of K+ was also detected. Molecular dynamics simulations were performed to illustrate how the binding of one molecule of the ligand might disrupt the G-quartet adjacent to the diagonal loop of telomeric G-quadruplex. Our results provide evidence for a non-trivial mode of alteration of G-quadruplex structure by tentative antiproliferative drugs.

  3. Effects of sequence on DNA wrapping around histones

    Science.gov (United States)

    Ortiz, Vanessa

    2011-03-01

    A central question in biophysics is whether the sequence of a DNA strand affects its mechanical properties. In epigenetics, these are thought to influence nucleosome positioning and gene expression. Theoretical and experimental attempts to answer this question have been hindered by an inability to directly resolve DNA structure and dynamics at the base-pair level. In our previous studies we used a detailed model of DNA to measure the effects of sequence on the stability of naked DNA under bending. Sequence was shown to influence DNA's ability to form kinks, which arise when certain motifs slide past others to form non-native contacts. Here, we have now included histone-DNA interactions to see if the results obtained for naked DNA are transferable to the problem of nucleosome positioning. Different DNA sequences interacting with the histone protein complex are studied, and their equilibrium and mechanical properties are compared among themselves and with the naked case. NLM training grant to the Computation and Informatics in Biology and Medicine Training Program (NLM T15LM007359).

  4. Domino effect in chemical accidents: main features and accident sequences

    OpenAIRE

    Casal Fàbrega, Joaquim; Darbra Roman, Rosa Maria

    2010-01-01

    The main features of domino accidents in process/storage plants and in the transportation of hazardous materials were studied through an analysis of 225 accidents involving this effect. Data on these accidents, which occurred after 1961, were taken from several sources. Aspects analyzed included the accident scenario, the type of accident, the materials involved, the causes and consequences and the most common accident sequences. The analysis showed that the most frequent causes a...

  5. A label-free ultrasensitive fluorescence detection of viable Salmonella enteritidis using enzyme-induced cascade two-stage toehold strand-displacement-driven assembly of G-quadruplex DNA.

    Science.gov (United States)

    Zhang, Peng; Liu, Hui; Ma, Suzhen; Men, Shuai; Li, Qingzhou; Yang, Xin; Wang, Hongning; Zhang, Anyun

    2016-06-15

    The harm of Salmonella enteritidis (S. enteritidis ) to public health mainly by contaminating fresh food and water emphasizes the urgent need for rapid detection techniques to help control the spread of the pathogen. In this assay, an newly designed capture probe complex that contained specific S. enteritidis-aptamer and hybridized signal target sequence was used for viable S. enteritidis recognition directly. In the presence of the target S. enteritidis, single-stranded target sequences were liberated and initiated the replication-cleavage reaction, producing numerous G-quadruplex structures with a linker on the 3'-end. And then, the sensing system took innovative advantage of quadratic linker-induced strand-displacement for the first time to release target sequence in succession, leading to the cyclic reuse of the target sequences and cascade signal amplification, thereby achieving the successive production of G-quadruplex structures. The fluorescent dye, N-Methyl mesoporphyrin IX, binded to these G-quadruplex structures and generated significantly enhanced fluorescent signals to achieve highly sensitive detection of S. enteritidis down to 60 CFU/mL with a linear range from 10(2) to 10(7)CFU/mL. By coupling the cascade two-stage target sequences-recyclable toehold strand-displacement with aptamer-based target recognition successfully, it is the first report on a novel non-label, modification-free and DNA extraction-free ultrasensitive fluorescence biosensor for detecting viable S. enteritidis directly, which can discriminate from dead S. enteritidis. Copyright © 2016 Elsevier B.V. All rights reserved.

  6. The Effect of Stock Return Sequences on Trading Volumes

    Directory of Open Access Journals (Sweden)

    Andrey Kudryavtsev

    2017-10-01

    Full Text Available The present study explores the effect of the gambler’s fallacy on stock trading volumes. I hypothesize that if a stock’s price rises (falls during a number of consecutive trading days, then the gambler’s fallacy may cause at least some of the investors to expect that the stock’s price “has” to subsequently fall (rise, and thus, to increase their willingness to sell (buy the stock, resulting in a stronger degree of disagreement between the investors and a higher-than-usual stock trading volume on the first day when the stock’s price indeed falls (rises. Employing a large sample of daily price and trading volume data, I document that following relatively long sequences of the same-sign stock returns, on the days when the sign is reversed, the trading activity in the respective stocks is abnormally high. Moreover, average abnormal trading volumes gradually and significantly increase with the length of the preceding return sequence. The effect is slightly more pronounced following the sequences of negative stock returns, and remains significant after controlling for other potentially influential factors, including contemporaneous and lagged actual and absolute stock returns, historical stock returns and volatilities, and company-specific events, such as earnings announcements and dividend payments.

  7. Modular Assembly of Cell-targeting Devices Based on an Uncommon G-quadruplex Aptamer

    Directory of Open Access Journals (Sweden)

    Felipe Opazo

    2015-01-01

    Full Text Available Aptamers are valuable tools that provide great potential to develop cost-effective diagnostics and therapies in the biomedical field. Here, we report a novel DNA aptamer that folds into an unconventional G-quadruplex structure able to recognize and enter specifically into human Burkitt's lymphoma cells. We further optimized this aptamer to a highly versatile and stable minimized version. The minimized aptamer can be easily equipped with different functionalities like quantum dots, organic dyes, or even a second different aptamer domain yielding a bi-paratopic aptamer. Although the target molecule of the aptamer remains unknown, our microscopy and pharmacological studies revealed that the aptamer hijacks the clathrin-mediated endocytosis pathway for its cellular internalization. We conclude that this novel class of aptamers can be used as a modular tool to specifically deliver different cargoes into malignant cells. This work provides a thorough characterization of the aptamer and we expect that our strategy will pave the path for future therapeutic applications.

  8. Synthesis and Molecular Modeling of Thermally Stable DNA G-Quadruplexes with Anthraquinone Insertions

    DEFF Research Database (Denmark)

    Gouda, Alaa S.; Amine, Mahasen S.; Pedersen, Erik Bjerregaard

    2017-01-01

    Two new phosphoramidite building blocks for DNA synthesis were synthesized from 1,5- and 2,6-dihydroxyanthraquinones through alkylation with 3-bromo-1-propanol followed by DMT-protection. The novel synthesized 1,5- and 2,6-disubstituted anthraquinone monomers H15 and H26 are incorporated into a G...... anthraquinone-modified quadruplexes revealed no change of the antiparallel structure when compared with the wild type under potassium buffer conditions. The significantly increased thermostabilities were interpreted by molecular modeling of anthraquinone-modified G-quadruplexes....

  9. Phenolic promiscuity in the cell nucleus--epigallocatechingallate (EGCG) and theaflavin-3,3'-digallate from green and black tea bind to model cell nuclear structures including histone proteins, double stranded DNA and telomeric quadruplex DNA.

    Science.gov (United States)

    Mikutis, Gediminas; Karaköse, Hande; Jaiswal, Rakesh; LeGresley, Adam; Islam, Tuhidul; Fernandez-Lahore, Marcelo; Kuhnert, Nikolai

    2013-02-01

    Flavanols from tea have been reported to accumulate in the cell nucleus in considerable concentrations. The nature of this phenomenon, which could provide novel approaches in understanding the well-known beneficial health effects of tea phenols, is investigated in this contribution. The interaction between epigallocatechin gallate (EGCG) from green tea and a selection of theaflavins from black tea with selected cell nuclear structures such as model histone proteins, double stranded DNA and quadruplex DNA was investigated using mass spectrometry, Circular Dichroism spectroscopy and fluorescent assays. The selected polyphenols were shown to display affinity to all of the selected cell nuclear structures, thereby demonstrating a degree of unexpected molecular promiscuity. Most interestingly theaflavin-digallate was shown to display the highest affinity to quadruplex DNA reported for any naturally occurring molecule reported so far. This finding has immediate implications in rationalising the chemopreventive effect of the tea beverage against cancer and possibly the role of tea phenolics as "life span essentials".

  10. Fluorescent Dansyl-Guanosine Conjugates that Bind c-MYC Promoter G-Quadruplex and Downregulate c-MYC Expression.

    Science.gov (United States)

    Pavan Kumar, Y; Saha, Puja; Saha, Dhurjhoti; Bessi, Irene; Schwalbe, Harald; Chowdhury, Shantanu; Dash, Jyotirmayee

    2016-03-02

    The four-stranded G-quadruplex present in the c-MYC P1 promoter has been shown to play a pivotal role in the regulation of c-MYC transcription. Small-molecule compounds capable of inhibiting the c-MYC promoter activity by stabilising the c-MYC G-quadruplex could potentially be used as anticancer agents. In this context, here we report the synthesis of dansyl-guanosine conjugates through one-pot modular click reactions. The dansyl-guanosine conjugates can selectively detect c-MYC G-quadruplex over other biologically relevant quadruplexes and duplex DNA and can be useful as staining reagents for selective visualisation of c-MYC G-quadruplex over duplex DNA by gel electrophoresis. NMR spectroscopic titrations revealed the preferential binding sites of these dansyl ligands to the c-MYC G-quadruplex. A dual luciferase assay and qRT-PCR revealed that a dansyl-bisguanosine ligand represses the c-MYC expression, possibly by stabilising the c-MYC G-quadruplex. © 2016 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  11. Charge splitters and charge transport junctions based on guanine quadruplexes

    Science.gov (United States)

    Sha, Ruojie; Xiang, Limin; Liu, Chaoren; Balaeff, Alexander; Zhang, Yuqi; Zhang, Peng; Li, Yueqi; Beratan, David N.; Tao, Nongjian; Seeman, Nadrian C.

    2018-04-01

    Self-assembling circuit elements, such as current splitters or combiners at the molecular scale, require the design of building blocks with three or more terminals. A promising material for such building blocks is DNA, wherein multiple strands can self-assemble into multi-ended junctions, and nucleobase stacks can transport charge over long distances. However, nucleobase stacking is often disrupted at junction points, hindering electric charge transport between the two terminals of the junction. Here, we show that a guanine-quadruplex (G4) motif can be used as a connector element for a multi-ended DNA junction. By attaching specific terminal groups to the motif, we demonstrate that charges can enter the structure from one terminal at one end of a three-way G4 motif, and can exit from one of two terminals at the other end with minimal carrier transport attenuation. Moreover, we study four-way G4 junction structures by performing theoretical calculations to assist in the design and optimization of these connectors.

  12. G-Quadruplexes influence pri-microRNA processing.

    Science.gov (United States)

    Rouleau, Samuel G; Garant, Jean-Michel; Bolduc, François; Bisaillon, Martin; Perreault, Jean-Pierre

    2018-02-01

    RNA G-Quadruplexes (G4) have been shown to possess many biological functions, including the regulation of microRNA (miRNA) biogenesis and function. However, their impact on pri-miRNA processing remains unknown. We identified G4 located near the Drosha cleavage site in three distinct pri-miRNAs: pri-mir200c, pri-mir451a, and pri-mir497. The folding of the potential G4 motifs was determined in solution. Subsequently, mutations disrupting G4 folding led to important changes in the mature miRNAs levels in cells. Moreover, using small antisense oligonucleotides binding to the pri-miRNA, it was possible to modulate, either positively or negatively, the mature miRNA levels. Together, these data demonstrate that G4 motifs could contribute to the regulation of pri-mRNA processing, a novel role for G4. Considering that bio-informatics screening indicates that between 9% and 50% of all pri-miRNAs contain a putative G4, these structures possess interesting potential as future therapeutic targets.

  13. G-Quadruplex Identification in the Genome of Protozoan Parasites Points to Naphthalene Diimide Ligands as New Antiparasitic Agents.

    Science.gov (United States)

    Belmonte-Reche, Efres; Martínez-García, Marta; Guédin, Aurore; Zuffo, Michela; Arévalo-Ruiz, Matilde; Doria, Filippo; Campos-Salinas, Jenny; Maynadier, Marjorie; López-Rubio, José Juan; Freccero, Mauro; Mergny, Jean-Louis; Pérez-Victoria, José María; Morales, Juan Carlos

    2018-02-08

    G-quadruplexes (G4) are DNA secondary structures that take part in the regulation of gene expression. Putative G4 forming sequences (PQS) have been reported in mammals, yeast, bacteria, and viruses. Here, we present PQS searches on the genomes of T. brucei, L. major, and P. falciparum. We found telomeric sequences and new PQS motifs. Biophysical experiments showed that EBR1, a 29 nucleotide long highly repeated PQS in T. brucei, forms a stable G4 structure. G4 ligands based on carbohydrate conjugated naphthalene diimides (carb-NDIs) that bind G4's including hTel could bind EBR1 with selectivity versus dsDNA. These ligands showed important antiparasitic activity. IC 50 values were in the nanomolar range against T. brucei with high selectivity against MRC-5 human cells. Confocal microscopy confirmed these ligands localize in the nucleus and kinetoplast of T. brucei suggesting they can reach their potential G4 targets. Cytotoxicity and zebrafish toxicity studies revealed sugar conjugation reduces intrinsic toxicity of NDIs.

  14. Human telomeric DNA: G-quadruplex, i-motif and Watson–Crick double helix

    Science.gov (United States)

    Phan, Anh Tuân; Mergny, Jean-Louis

    2002-01-01

    Human telomeric DNA composed of (TTAGGG/CCCTAA)n repeats may form a classical Watson–Crick double helix. Each individual strand is also prone to quadruplex formation: the G-rich strand may adopt a G-quadruplex conformation involving G-quartets whereas the C-rich strand may fold into an i-motif based on intercalated C·C+ base pairs. Using an equimolar mixture of the telomeric oligonucleotides d[AGGG(TTAGGG)3] and d[(CCCTAA)3CCCT], we defined which structures existed and which would be the predominant species under a variety of experimental conditions. Under near-physiological conditions of pH, temperature and salt concentration, telomeric DNA was predominantly in a double-helix form. However, at lower pH values or higher temperatures, the G-quadruplex and/or the i-motif efficiently competed with the duplex. We also present kinetic and thermodynamic data for duplex association and for G-quadruplex/i-motif unfolding. PMID:12409451

  15. Multifunctional energy landscape for a DNA G-quadruplex: An evolved molecular switch

    Czech Academy of Sciences Publication Activity Database

    Cragnolini, T.; Chakraborty, D.; Šponer, Jiří; Derreumaux, P.; Pasquali, S.; Wales, D.J.

    2017-01-01

    Roč. 147, č. 15 (2017), č. článku 152715. ISSN 0021-9606 R&D Projects: GA ČR(CZ) GA16-13721S Institutional support: RVO:68081707 Keywords : telomeric g-quadruplex * gb1 hairpin peptide Subject RIV: CF - Physical ; Theoretical Chemistry OBOR OECD: Physical chemistry Impact factor: 2.965, year: 2016

  16. Triplex intermediates in folding of human telomeric quadruplexes probed by microsecond-scale molecular dynamics simulations

    Czech Academy of Sciences Publication Activity Database

    Stadlbauer, Petr; Trantírek, L.; Cheatham III, T. E.; Koča, J.; Šponer, Jiří

    105C, OCT2014 (2014), s. 22-35 ISSN 0300-9084 R&D Projects: GA ČR(CZ) GAP208/12/1822; GA ČR(CZ) GA13-28310S Institutional support: RVO:68081707 Keywords : G-DNA folding * Quadruplex * Triplex Subject RIV: BO - Biophysics Impact factor: 2.963, year: 2014

  17. Structural Insight into the interaction of Flavonoids with Human Telomeric Sequence

    Science.gov (United States)

    Tawani, Arpita; Kumar, Amit

    2015-01-01

    Flavonoids are a group of naturally available compounds that are an attractive source for drug discovery. Their potential to act as anti-tumourigenic and anti-proliferative agents has been reported previously but is not yet fully understood. Targeting human telomeric G-quadruplex DNA could be one of the mechanisms by which these flavonoids exert anticancer activity. We have performed detailed biophysical studies for the interaction of four representative flavonoids, Luteolin, Quercetin, Rutin and Genistein, with the human telomeric G-quadruplex sequence tetramolecular d-(T2AG3T) (Tel7). In addition, we used NMR spectroscopy to derive the first model for the complex formed between Quercetin and G-quadruplex sequence. The model showed that Quercetin stabilises the G-quadruplex structure and does not open the G-tetrad. It interacts with the telomeric sequence through π-stacking at two sites: between T1pT2 and between G6pT7. Based on our findings, we suggest that Quercetin could be a potent candidate for targeting the telomere and thus, act as a potent anti-cancer agent. PMID:26627543

  18. Effects of Sequences of Cognitions on Group Performance Over Time.

    Science.gov (United States)

    Molenaar, Inge; Chiu, Ming Ming

    2017-04-01

    Extending past research showing that sequences of low cognitions (low-level processing of information) and high cognitions (high-level processing of information through questions and elaborations) influence the likelihoods of subsequent high and low cognitions, this study examines whether sequences of cognitions are related to group performance over time; 54 primary school students (18 triads) discussed and wrote an essay about living in another country (32,375 turns of talk). Content analysis and statistical discourse analysis showed that within each lesson, groups with more low cognitions or more sequences of low cognition followed by high cognition added more essay words. Groups with more high cognitions, sequences of low cognition followed by low cognition, or sequences of high cognition followed by an action followed by low cognition, showed different words and sequences, suggestive of new ideas. The links between cognition sequences and group performance over time can inform facilitation and assessment of student discussions.

  19. UvrD in Deinococcus radiodurans is optimized for processing G-quadruplex DNA

    International Nuclear Information System (INIS)

    Das, Anubrata; Misra, H.S.

    2015-01-01

    Deinococcus radiodurans R1 is a radiation resistant Gram-positive bacterium capable of tolerating very high doses of DNA-damaging agents such as gamma radiation (D10 ∼ 12kGy) desiccation (∼ 5% relative humidity), UVC radiation (D10 ∼ 800J/m 2 ) and hydrogen peroxide (40 mM). It achieves this by using a complex regulatory mechanism and novel proteins. Recently bioinformatic analysis showed several stretches of guanine runs in D.radiodurans genome, which could form G-quartets. The role of G-quartets in regulatory processes is well documented in various organisms. The presence of G -quartets in D. radiodurans means that there are regulatory or structural proteins which would bind to these elements. Several proteins are known to bind G-quartets. Finding the proteins which would bind to G4 DNA is difficult as no specific motifs are available for binding these elements. Also most of the known proteins that are shown to bind to G-quadruplex DNA are of eukaryotic nature. To overcome these challenges we defined a set of known G-quadruplex binding proteins and used a smith-waterman algorithm with our own scoring matrix to homologs of G-quadruplex binding proteins in D.radiodurans. Using bioinformatics analysis, we showed that UvrD (DR 1775) of D. radiodurans has ability to bind/translocate along G-quadruplex DNA, a novel feature in prokaryotes. The translocase activity of DR1775 is ATP specific and this ATPase activity is attenuated by ssDNA. Data supporting UvrD of D. radiodurans as a G-quadruplex DNA metabolizing proteins would be presented. (author)

  20. G-quadruplex recognition activities of E. Coli MutS

    Directory of Open Access Journals (Sweden)

    Ehrat Edward A

    2012-07-01

    Full Text Available Abstract Background Guanine quadruplex (G4 DNA is a four-stranded structure that contributes to genome instability and site-specific recombination. G4 DNA folds from sequences containing tandemly repetitive guanines, sequence motifs that are found throughout prokaryote and eukaryote genomes. While some cellular activities have been identified with binding or processing G4 DNA, the factors and pathways governing G4 DNA metabolism are largely undefined. Highly conserved mismatch repair factors have emerged as potential G4-responding complexes because, in addition to initiating heteroduplex correction, the human homologs bind non-B form DNA with high affinity. Moreover, the MutS homologs across species have the capacity to recognize a diverse range of DNA pairing variations and damage, suggesting a conserved ability to bind non-B form DNA. Results Here, we asked if E. coli MutS and a heteroduplex recognition mutant, MutS F36A, were capable of recognizing and responding to G4 DNA structures. We find by mobility shift assay that E. coli MutS binds to G4 DNA with high affinity better than binding to G-T heteroduplexes. In the same assay, MutS F36A failed to recognize G-T mismatched oligonucleotides, as expected, but retained an ability to bind to G4 DNA. Association with G4 DNA by MutS is not likely to activate the mismatch repair pathway because nucleotide binding did not promote release of MutS or MutS F36A from G4 DNA as it does for heteroduplexes. G4 recognition activities occur under physiological conditions, and we find that M13 phage harboring G4-capable DNA poorly infected a MutS deficient strain of E. coli compared to M13mp18, suggesting functional roles for mismatch repair factors in the cellular response to unstable genomic elements. Conclusions Taken together, our findings demonstrate that E. coli MutS has a binding activity specific for non-B form G4 DNA, but such binding appears independent of canonical heteroduplex repair activation.

  1. Xanthine and 8-oxoguanine in G-quadruplexes: formation of a G·G·X·O tetrad.

    Science.gov (United States)

    Cheong, Vee Vee; Heddi, Brahim; Lech, Christopher Jacques; Phan, Anh Tuân

    2015-12-02

    G-quadruplexes are four-stranded structures built from stacked G-tetrads (G·G·G·G), which are planar cyclical assemblies of four guanine bases interacting through Hoogsteen hydrogen bonds. A G-quadruplex containing a single guanine analog substitution, such as 8-oxoguanine (O) or xanthine (X), would suffer from a loss of a Hoogsteen hydrogen bond within a G-tetrad and/or potential steric hindrance. We show that a proper arrangement of O and X bases can reestablish the hydrogen-bond pattern within a G·G·X·O tetrad. Rational incorporation of G·G·X·O tetrads in a (3+1) G-quadruplex demonstrated a similar folding topology and thermal stability to that of the unmodified G-quadruplex. pH titration conducted on X·O-modified G-quadruplexes indicated a protonation-deprotonation equilibrium of X with a pKa ∼6.7. The solution structure of a G-quadruplex containing a G·G·X·O tetrad was determined, displaying the same folding topology in both the protonated and deprotonated states. A G-quadruplex containing a deprotonated X·O pair was shown to exhibit a more electronegative groove compared to that of the unmodified one. These differences are likely to manifest in the electronic properties of G-quadruplexes and may have important implications for drug targeting and DNA-protein interactions. © The Author(s) 2015. Published by Oxford University Press on behalf of Nucleic Acids Research.

  2. A twice-as-smart synthetic G-quartet: PyroTASQ is both a smart quadruplex ligand and a smart fluorescent probe.

    Science.gov (United States)

    Laguerre, Aurélien; Stefan, Loic; Larrouy, Manuel; Genest, David; Novotna, Jana; Pirrotta, Marc; Monchaud, David

    2014-09-03

    Recent and unambiguous evidences of the formation of DNA and RNA G-quadruplexes in cells has provided solid support for these structures to be considered as valuable targets in oncology. Beyond this, they have lent further credence to the anticancer strategies relying on small molecules that selectively target these higher-order DNA/RNA architectures, referred to as G-quadruplex ligands. They have also shed bright light on the necessity of designing multitasking ligands, displaying not only enticing quadruplex interacting properties (affinity, structural selectivity) but also additional features that make them usable for detecting quadruplexes in living cells, notably for determining whether, when, and where these structures fold and unfold during the cell cycle and also for better assessing the consequences of their stabilization by external agents. Herein, we report a brand new design of such multitasking ligands, whose structure experiences a quadruplex-promoted conformational switch that triggers not only its quadruplex affinity (i.e., smart ligands, which display high affinity and selectivity for DNA/RNA quadruplexes) but also its fluorescence (i.e., smart probes, which behave as selective light-up fluorescent reporters on the basis of a fluorogenic electron redistribution). The first prototype of such multifunctional ligands, termed PyroTASQ, represents a brand new generation of quadruplex ligands that can be referred to as "twice-as-smart" quadruplex ligands.

  3. Characteristics of the sequence effect in Parkinson's disease.

    Science.gov (United States)

    Kang, Suk Yun; Wasaka, Toshiaki; Shamim, Ejaz A; Auh, Sungyoung; Ueki, Yoshino; Lopez, Grisel J; Kida, Tetsuo; Jin, Seung-Hyun; Dang, Nguyet; Hallett, Mark

    2010-10-15

    The sequence effect (SE) in Parkinson's disease (PD) is progressive slowing of sequential movements. It is a feature of bradykinesia, but is separate from a general slowness without deterioration over time. It is commonly seen in PD, but its physiology is unclear. We measured general slowness and the SE separately with a computer-based, modified Purdue pegboard in 11 patients with advanced PD. We conducted a placebo-controlled, four-way crossover study to learn whether levodopa and repetitive transcranial magnetic stimulation (rTMS) could improve general slowness or the SE. We also examined the correlation between the SE and clinical fatigue. Levodopa alone and rTMS alone improved general slowness, but rTMS showed no additive effect on levodopa. Levodopa alone, rTMS alone, and their combination did not alleviate the SE. There was no correlation between the SE and fatigue. This study suggests that dopaminergic dysfunction and abnormal motor cortex excitability are not the relevant mechanisms for the SE. Additionally, the SE is not a component of clinical fatigue. Further work is needed to establish the physiology and clinical relevance of the SE. © 2010 Movement Disorder Society.

  4. The heterogeneous world of congruency sequence effects: An update.

    Directory of Open Access Journals (Sweden)

    Wout eDuthoo

    2014-09-01

    Full Text Available Congruency sequence effects (CSEs refer to the observation that congruency effects in conflict tasks are typically smaller following incongruent compared to following congruent trials. This measure has long been thought to provide a unique window into top-down attentional adjustments and their underlying brain mechanisms. According to the renowned conflict monitoring theory, CSEs reflect enhanced selective attention following conflict detection. Still, alternative accounts suggested that bottom-up associative learning suffices to explain the pattern of reaction times and error rates. A couple of years ago, a review by Egner (2007 pitted these two rivalry accounts against each other, concluding that both conflict adaptation and feature integration contribute to the CSE. Since then, a wealth of studies has further debated this issue, and two additional accounts have been proposed, offering intriguing alternative explanations. Contingency learning accounts put forward that predictive relationships between stimuli and responses drive the CSE, whereas the repetition expectancy hypothesis suggests that top-down, expectancy-driven control adjustments affect the CSE. In the present paper, we build further on the previous review (Egner, 2007 by summarizing and integrating recent behavioural and neurophysiological studies on the CSE. In doing so, we evaluate the relative contribution and theoretical value of the different attentional and memory-based accounts. Moreover, we review how all of these influences can be experimentally isolated, and discuss designs and procedures that can critically judge between them.

  5. The heterogeneous world of congruency sequence effects: an update.

    Science.gov (United States)

    Duthoo, Wout; Abrahamse, Elger L; Braem, Senne; Boehler, Carsten N; Notebaert, Wim

    2014-01-01

    Congruency sequence effects (CSEs) refer to the observation that congruency effects in conflict tasks are typically smaller following incongruent compared to following congruent trials. This measure has long been thought to provide a unique window into top-down attentional adjustments and their underlying brain mechanisms. According to the renowned conflict monitoring theory, CSEs reflect enhanced selective attention following conflict detection. Still, alternative accounts suggested that bottom-up associative learning suffices to explain the pattern of reaction times and error rates. A couple of years ago, a review by Egner (2007) pitted these two rivalry accounts against each other, concluding that both conflict adaptation and feature integration contribute to the CSE. Since then, a wealth of studies has further debated this issue, and two additional accounts have been proposed, offering intriguing alternative explanations. Contingency learning accounts put forward that predictive relationships between stimuli and responses drive the CSE, whereas the repetition expectancy hypothesis suggests that top-down, expectancy-driven control adjustments affect the CSE. In the present paper, we build further on the previous review (Egner, 2007) by summarizing and integrating recent behavioral and neurophysiological studies on the CSE. In doing so, we evaluate the relative contribution and theoretical value of the different attentional and memory-based accounts. Moreover, we review how all of these influences can be experimentally isolated, and discuss designs and procedures that can critically judge between them.

  6. Higher-order human telomeric G-quadruplex DNA metalloenzymes enhance enantioselectivity in the Diels-Alder reaction.

    Science.gov (United States)

    Li, Yinghao; Jia, Guoqing; Wang, Changhao; Cheng, Mingpan; Li, Can

    2015-03-02

    Short human telomeric (HT) DNA sequences form single G-quadruplex (G4 ) units and exhibit structure-based stereocontrol for a series of reactions. However, for more biologically relevant higher-order HT G4 -DNAs (beyond a single G4 unit), the catalytic performances are unknown. Here, we found that higher-order HT G4 -DNA copper metalloenzymes (two or three G4 units) afford remarkably higher enantioselectivity (>90 % ee) and a five- to sixfold rate increase, compared to a single G4 unit, for the Diels-Alder reaction. Electron paramagnetic resonance (EPR) and enzymatic kinetic studies revealed that the distinct catalytic function between single and higher-order G4 -DNA copper metalloenzymes can be attributed to different Cu(II) coordination environments and substrate specificity. Our finding suggests that, like protein enzymes and ribozymes, higher-order structural organization is crucial for G4 -DNA-based catalysis. © 2015 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  7. Mechanism and manipulation of DNA:RNA hybrid G-quadruplex formation in transcription of G-rich DNA.

    Science.gov (United States)

    Zhang, Jia-yu; Zheng, Ke-wei; Xiao, Shan; Hao, Yu-hua; Tan, Zheng

    2014-01-29

    We recently reported that a DNA:RNA hybrid G-quadruplex (HQ) forms during transcription of DNA that bears two or more tandem guanine tracts (G-tract) on the nontemplate strand. Putative HQ-forming sequences are enriched in the nearby 1000 nt region right downstream of transcription start sites in the nontemplate strand of warm-blooded animals, and HQ regulates transcription under both in vitro and in vivo conditions. Therefore, knowledge of the mechanism of HQ formation is important for understanding the biological function of HQ as well as for manipulating gene expression by targeting HQ. In this work, we studied the mechanism of HQ formation using an in vitro T7 transcription model. We show that RNA synthesis initially produces an R-loop, a DNA:RNA heteroduplex formed by a nascent RNA transcript and the template DNA strand. In the following round of transcription, the RNA in the R-loop is displaced, releasing the RNA in single-stranded form (ssRNA). Then the G-tracts in the RNA can jointly form HQ with those in the nontemplate DNA strand. We demonstrate that the structural cascade R-loop → ssRNA → HQ offers opportunities to intercept HQ formation, which may provide a potential method to manipulate gene expression.

  8. G-quadruplex aptamer targeting Protein A and its capability to detect Staphylococcus aureus demonstrated by ELONA.

    Science.gov (United States)

    Stoltenburg, Regina; Krafčiková, Petra; Víglaský, Viktor; Strehlitz, Beate

    2016-09-21

    Aptamers for whole cell detection are selected mostly by the Cell-SELEX procedure. Alternatively, the use of specific cell surface epitopes as target during aptamer selections allows the development of aptamers with ability to bind whole cells. In this study, we integrated a formerly selected Protein A-binding aptamer PA#2/8 in an assay format called ELONA (Enzyme-Linked OligoNucleotide Assay) and evaluated the ability of the aptamer to recognise and bind to Staphylococcus aureus presenting Protein A on the cell surface. The full-length aptamer and one of its truncated variants could be demonstrated to specifically bind to Protein A-expressing intact cells of S. aureus, and thus have the potential to expand the portfolio of aptamers that can act as an analytical agent for the specific recognition and rapid detection of the bacterial pathogen. The functionality of the aptamer was found to be based on a very complex, but also highly variable structure. Two structural key elements were identified. The aptamer sequence contains several G-clusters allowing folding into a G-quadruplex structure with the potential of dimeric and multimeric assembly. An inverted repeat able to form an imperfect stem-loop at the 5'-end also contributes essentially to the aptameric function.

  9. The Sequence Effect in Parkinson’s Disease

    Directory of Open Access Journals (Sweden)

    Suk Yun Kang

    2011-05-01

    Full Text Available Background and Purpose The sequence effect (SE in Parkinson’s disease (PD denotes progressive slowness in speed or progressive decrease in amplitude of repetitive movements. It is a well-known feature of bradykinesia and is considered unique in PD. Until now, it was well-documented in advanced PD, but not in drug-naïve PD. The aim of this study is to know whether the SE can also be measured in drug-naïve PD. Methods We measured the SE with a computer-based, modified Purdue pegboard in 4 drug-naïve PD patients, which matched our previous study with advanced PD patients. Results We observed progressive slowness during movement, that is, SE. Statistical analysis showed a strong statistical trend toward the SE with the right hand, but no significance with the left hand. There was no statistical significance of SE with either the more or less affected hands. Conclusions These results indicate that the SE can be identified in drug-naïve PD, as well as in advanced PD, with objective measurements and support the idea that the SE is a feature in PD observed during the early stage of the disease without medication.

  10. Effect of promoter strength and signal sequence on the periplasmic ...

    African Journals Online (AJOL)

    Two plasmids, pFLAG-ATS and pET 26b(+), were studied for the periplasmic expression of recombinant human interferon-2b (IFN-2b) in Escherichia coli. The pFLAG-ATS contains ompA signal sequence and tac promoter while pET 26b(+) contains pelB signal sequence and T7lac promoter. It was observed that periplasmic ...

  11. Correlated mutations in protein sequences: Phylogenetic and structural effects

    Energy Technology Data Exchange (ETDEWEB)

    Lapedes, A.S. [Los Alamos National Lab., NM (United States). Theoretical Div.]|[Santa Fe Inst., NM (United States); Giraud, B.G. [C.E.N. Saclay, Gif/Yvette (France). Service Physique Theorique; Liu, L.C. [Los Alamos National Lab., NM (United States). Theoretical Div.; Stormo, G.D. [Univ. of Colorado, Boulder, CO (United States). Dept. of Molecular, Cellular and Developmental Biology

    1998-12-01

    Covariation analysis of sets of aligned sequences for RNA molecules is relatively successful in elucidating RNA secondary structure, as well as some aspects of tertiary structure. Covariation analysis of sets of aligned sequences for protein molecules is successful in certain instances in elucidating certain structural and functional links, but in general, pairs of sites displaying highly covarying mutations in protein sequences do not necessarily correspond to sites that are spatially close in the protein structure. In this paper the authors identify two reasons why naive use of covariation analysis for protein sequences fails to reliably indicate sequence positions that are spatially proximate. The first reason involves the bias introduced in calculation of covariation measures due to the fact that biological sequences are generally related by a non-trivial phylogenetic tree. The authors present a null-model approach to solve this problem. The second reason involves linked chains of covariation which can result in pairs of sites displaying significant covariation even though they are not spatially proximate. They present a maximum entropy solution to this classic problem of causation versus correlation. The methodologies are validated in simulation.

  12. A G-quadruplex-containing RNA activates fluorescence in a GFP-like fluorophore

    Energy Technology Data Exchange (ETDEWEB)

    Huang, Hao; Suslov, Nikolai B.; Li, Nan-Sheng; Shelke, Sandip A.; Evans, Molly E.; Koldobskaya, Yelena; Rice, Phoebe A.; Piccirilli, Joseph A. [UC

    2014-08-21

    Spinach is an in vitro–selected RNA aptamer that binds a GFP-like ligand and activates its green fluorescence. Spinach is thus an RNA analog of GFP and has potentially widespread applications for in vivo labeling and imaging. We used antibody-assisted crystallography to determine the structures of Spinach both with and without bound fluorophore at 2.2-Å and 2.4-Å resolution, respectively. Spinach RNA has an elongated structure containing two helical domains separated by an internal bulge that folds into a G-quadruplex motif of unusual topology. The G-quadruplex motif and adjacent nucleotides comprise a partially preformed binding site for the fluorophore. The fluorophore binds in a planar conformation and makes extensive aromatic stacking and hydrogen bond interactions with the RNA. Our findings provide a foundation for structure-based engineering of new fluorophore-binding RNA aptamers.

  13. G-quadruplex formation in the Oct4 promoter positively regulates Oct4 expression

    Czech Academy of Sciences Publication Activity Database

    Renčiuk, Daniel; Ryneš, J.; Kejnovská, Iva; Foldynova-Trantirkova, S.; Andaeng, M.; Trantírek, L.; Vorlíčková, Michaela

    2017-01-01

    Roč. 1860, č. 2 (2017), s. 175-183 ISSN 1874-9399 R&D Projects: GA ČR(CZ) GP14-33947P; GA ČR GAP205/12/0466; GA ČR(CZ) GA15-06785S Institutional support: RVO:68081707 Keywords : linked polymorphic region * guanine quadruplexes * transcription factor Subject RIV: CE - Biochemistry OBOR OECD: Biochemistry and molecular biology Impact factor: 5.018, year: 2016

  14. Molecular dynamics simulations of guanine quadruplex loops: Advances and force field limitations

    Czech Academy of Sciences Publication Activity Database

    Fadrná, E.; Špačková, Naďa; Štefl, R.; Koča, J.; Cheatham III, T. E.; Šponer, Jiří

    2004-01-01

    Roč. 87, č. 1 (2004), s. 227-242 ISSN 0006-3495 R&D Projects: GA MŠk LN00A016 Grant - others:Wellcome Trust(GB) GR067507MF Institutional research plan: CEZ:AV0Z5004920 Keywords : quanine quadruplex * four-thymidine loop * locally enhanced sampling Subject RIV: BO - Biophysics Impact factor: 4.585, year: 2004

  15. RecQ-core of BLM unfolds telomeric G-quadruplex in the absence of ATP

    Czech Academy of Sciences Publication Activity Database

    Budhathoki, J.B.; Ray, S.; Urban, Václav; Janščák, Pavel; Jodh, J.G.; Balci, H.

    2014-01-01

    Roč. 42, č. 18 (2014), s. 11528-11545 ISSN 0305-1048 R&D Projects: GA ČR GA204/09/0565 Grant - others:U.S. National Science Foundation through the Physics Frontiers Center Program(US) 1430124 Institutional support: RVO:68378050 Keywords : single-stranded DNA * RECQ5 helicase * G-quadruplex structures Subject RIV: EB - Genetics ; Molecular Biology Impact factor: 9.112, year: 2014

  16. Multifunctional energy landscape for a DNA G-quadruplex: An evolved molecular switch

    Science.gov (United States)

    Cragnolini, Tristan; Chakraborty, Debayan; Šponer, Jiří; Derreumaux, Philippe; Pasquali, Samuela; Wales, David J.

    2017-10-01

    We explore the energy landscape for a four-fold telomere repeat, obtaining interconversion pathways between six experimentally characterised G-quadruplex topologies. The results reveal a multi-funnel system, with a variety of intermediate configurations and misfolded states. This organisation is identified with the intrinsically multi-functional nature of the system, suggesting a new paradigm for the classification of such biomolecules and clarifying issues regarding apparently conflicting experimental results.

  17. Quadruplex-forming properties of FRAXA (CGG) repeats interrupted by (AGG) triplets

    Czech Academy of Sciences Publication Activity Database

    Renčiuk, Daniel; Zemánek, Michal; Kejnovská, Iva; Vorlíčková, Michaela

    2009-01-01

    Roč. 91, č. 3 (2009), s. 416-422 ISSN 0300-9084 R&D Projects: GA ČR(CZ) GA204/07/0057; GA AV ČR(CZ) IAA100040701 Institutional research plan: CEZ:AV0Z50040507; CEZ:AV0Z50040702 Keywords : fragile X-chromosome * quadruplex * CD spectroscopy Subject RIV: BO - Biophysics Impact factor: 3.897, year: 2009

  18. Bis-guanylhydrazone diimidazo[1,2-a:1,2-c]pyrimidine as a novel and specific G-quadruplex binding motif.

    Science.gov (United States)

    Sparapani, Silvia; Bellini, Stefania; Gunaratnam, Mekala; Haider, Shozeb M; Andreani, Aldo; Rambaldi, Mirella; Locatelli, Alessandra; Morigi, Rita; Granaiola, Massimiliano; Varoli, Lucilla; Burnelli, Silvia; Leoni, Alberto; Neidle, Stephen

    2010-08-21

    A bis-guanylhydrazone derivative of diimidazo[1,2-a:1,2-c]pyrimidine has unexpectedly been found to be a potent stabiliser of several quadruplex DNAs, whereas there is no significant interaction with duplex DNA. Molecular modeling suggests that the guanylhydrazone groups play an active role in quadruplex binding.

  19. Hsa-miR-1587 G-quadruplex formation and dimerization induced by NH4+, molecular crowding environment and jatrorrhizine derivatives.

    Science.gov (United States)

    Tan, Wei; Yi, Long; Zhu, Zhentao; Zhang, Lulu; Zhou, Jiang; Yuan, Gu

    2018-03-01

    A guanine-rich human mature microRNA, miR-1587, was discovered to form stable intramolecular G-quadruplexes in the presence of K + , Na + and low concentration of NH 4 + (25mM) by electrospray ionization mass spectrometry (ESI-MS) combined with circular dichroism (CD) spectroscopy. Furthermore, under high concentration of NH 4 + (100mM) or molecular crowding environments, miR-1587 formed a dimeric G-quadruplex through 3'-to-3' stacking of two monomeric G-quadruplex subunits with one ammonium ion sandwiched between the interfaces. Specifically, two synthesized jatrorrhizine derivatives with terminal amine groups could also induce the dimerization of miR-1587 G-quadruplex and formed 1:1 and 2:1 complexes with the dimeric G-quadruplex. In contrast, jatrorrhizine could bind with the dimeric miR-1587 G-quadruplex, but could not induce dimerization of miR-1587 G-quadruplex. These results provide a new strategy to regulate the functions of miR-1587 through induction of G-quadruplex formation and dimerization. Copyright © 2017 Elsevier B.V. All rights reserved.

  20. Cation binding to 15-TBA quadruplex DNA is a multiple-pathway cation-dependent process.

    Science.gov (United States)

    Reshetnikov, Roman V; Sponer, Jiri; Rassokhina, Olga I; Kopylov, Alexei M; Tsvetkov, Philipp O; Makarov, Alexander A; Golovin, Andrey V

    2011-12-01

    A combination of explicit solvent molecular dynamics simulation (30 simulations reaching 4 µs in total), hybrid quantum mechanics/molecular mechanics approach and isothermal titration calorimetry was used to investigate the atomistic picture of ion binding to 15-mer thrombin-binding quadruplex DNA (G-DNA) aptamer. Binding of ions to G-DNA is complex multiple pathway process, which is strongly affected by the type of the cation. The individual ion-binding events are substantially modulated by the connecting loops of the aptamer, which play several roles. They stabilize the molecule during time periods when the bound ions are not present, they modulate the route of the ion into the stem and they also stabilize the internal ions by closing the gates through which the ions enter the quadruplex. Using our extensive simulations, we for the first time observed full spontaneous exchange of internal cation between quadruplex molecule and bulk solvent at atomistic resolution. The simulation suggests that expulsion of the internally bound ion is correlated with initial binding of the incoming ion. The incoming ion then readily replaces the bound ion while minimizing any destabilization of the solute molecule during the exchange. © The Author(s) 2011. Published by Oxford University Press.

  1. Cation binding to 15-TBA quadruplex DNA is a multiple-pathway cation-dependent process

    Science.gov (United States)

    Reshetnikov, Roman V.; Sponer, Jiri; Rassokhina, Olga I.; Kopylov, Alexei M.; Tsvetkov, Philipp O.; Makarov, Alexander A.; Golovin, Andrey V.

    2011-01-01

    A combination of explicit solvent molecular dynamics simulation (30 simulations reaching 4 µs in total), hybrid quantum mechanics/molecular mechanics approach and isothermal titration calorimetry was used to investigate the atomistic picture of ion binding to 15-mer thrombin-binding quadruplex DNA (G-DNA) aptamer. Binding of ions to G-DNA is complex multiple pathway process, which is strongly affected by the type of the cation. The individual ion-binding events are substantially modulated by the connecting loops of the aptamer, which play several roles. They stabilize the molecule during time periods when the bound ions are not present, they modulate the route of the ion into the stem and they also stabilize the internal ions by closing the gates through which the ions enter the quadruplex. Using our extensive simulations, we for the first time observed full spontaneous exchange of internal cation between quadruplex molecule and bulk solvent at atomistic resolution. The simulation suggests that expulsion of the internally bound ion is correlated with initial binding of the incoming ion. The incoming ion then readily replaces the bound ion while minimizing any destabilization of the solute molecule during the exchange. PMID:21893589

  2. Thermodynamic fingerprints of ligand binding to human telomeric G-quadruplexes.

    Science.gov (United States)

    Bončina, Matjaž; Podlipnik, Črtomir; Piantanida, Ivo; Eilmes, Julita; Teulade-Fichou, Marie-Paule; Vesnaver, Gorazd; Lah, Jurij

    2015-12-02

    Thermodynamic studies of ligand binding to human telomere (ht) DNA quadruplexes, as a rule, neglect the involvement of various ht-DNA conformations in the binding process. Therefore, the thermodynamic driving forces and the mechanisms of ht-DNA G-quadruplex-ligand recognition remain poorly understood. In this work we characterize thermodynamically and structurally binding of netropsin (Net), dibenzotetraaza[14]annulene derivatives (DP77, DP78), cationic porphyrin (TMPyP4) and two bisquinolinium ligands (Phen-DC3, 360A-Br) to the ht-DNA fragment (Tel22) AGGG(TTAGGG)3 using isothermal titration calorimetry, CD and fluorescence spectroscopy, gel electrophoresis and molecular modeling. By global thermodynamic analysis of experimental data we show that the driving forces characterized by contributions of specific interactions, changes in solvation and conformation differ significantly for binding of ligands with low quadruplex selectivity over duplexes (Net, DP77, DP78, TMPyP4; KTel22 ≈ KdsDNA). These contributions are in accordance with the observed structural features (changes) and suggest that upon binding Net, DP77, DP78 and TMPyP4 select hybrid-1 and/or hybrid-2 conformation while Phen-DC3 and 360A-Br induce the transition of hybrid-1 and hybrid-2 to the structure with characteristics of antiparallel or hybrid-3 type conformation. © The Author(s) 2015. Published by Oxford University Press on behalf of Nucleic Acids Research.

  3. Effects of Early Musical Experience on Auditory Sequence Memory

    Directory of Open Access Journals (Sweden)

    Adam T. Tierney

    2008-12-01

    Full Text Available The present study investigated a possible link between musical training and immediate memory span by testing experienced musicians and three groups of musically inexperienced subjects (gymnasts, Psychology 101 students, and video game players on sequence memory and word familiarity tasks. By including skilled gymnasts who began studying their craft by age six, video game players, and Psychology 101 students as comparison groups, we attempted to control for some of the ways skilled musicians may differ from participants drawn from the general population in terms of gross motor skills and intensive experience in a highly skilled domain from an early age. We found that musicians displayed longer immediate memory spans than the comparison groups on auditory presentation conditions of the sequence reproductive span task. No differences were observed between the four groups on the visual conditions of the sequence memory task. These results provide additional converging support to recent findings showing that early musical experience and activity-dependent learning may selectively affect verbal rehearsal processes and the allocation of attention in sequence memory tasks.

  4. The role of alkali metal cations in the stabilization of guanine quadruplexes: why K(+) is the best.

    Science.gov (United States)

    Zaccaria, F; Paragi, G; Fonseca Guerra, C

    2016-08-21

    The alkali metal ion affinity of guanine quadruplexes has been studied using dispersion-corrected density functional theory (DFT-D). We have done computational investigations in aqueous solution that mimics artificial supramolecular conditions where guanine bases assemble into stacked quartets as well as biological environments in which telomeric quadruplexes are formed. In both cases, an alkali metal cation is needed to assist self-assembly. Our quantum chemical computations on these supramolecular systems are able to reproduce the experimental order of affinity of the guanine quadruplexes for the cations Li(+), Na(+), K(+), Rb(+), and Cs(+). The strongest binding is computed between the potassium cation and the quadruplex as it occurs in nature. The desolvation and the size of alkali metal cations are thought to be responsible for the order of affinity. Until now, the relative importance of these two factors has remained unclear and debated. By assessing the quantum chemical 'size' of the cation, determining the amount of deformation of the quadruplex needed to accommodate the cation and through the energy decomposition analysis (EDA) of the interaction energy between the cation and the guanines, we reveal that the desolvation and size of the alkali metal cation are both almost equally responsible for the order of affinity.

  5. Biophysical Characterization of G-Quadruplex Recognition in the PITX1 mRNA by the Specificity Domain of the Helicase RHAU.

    Directory of Open Access Journals (Sweden)

    Emmanuel O Ariyo

    Full Text Available Nucleic acids rich in guanine are able to fold into unique structures known as G-quadruplexes. G-quadruplexes consist of four tracts of guanylates arranged in parallel or antiparallel strands that are aligned in stacked G-quartet planes. The structure is further stabilized by Hoogsteen hydrogen bonds and monovalent cations centered between the planes. RHAU (RNA helicase associated with AU-rich element is a member of the ATP-dependent DExH/D family of RNA helicases and can bind and resolve G-quadruplexes. RHAU contains a core helicase domain with an N-terminal extension that enables recognition and full binding affinity to RNA and DNA G-quadruplexes. PITX1, a member of the bicoid class of homeobox proteins, is a transcriptional activator active during development of vertebrates, chiefly in the anterior pituitary gland and several other organs. We have previously demonstrated that RHAU regulates PITX1 levels through interaction with G-quadruplexes at the 3'-end of the PITX1 mRNA. To understand the structural basis of G-quadruplex recognition by RHAU, we characterize a purified minimal PITX1 G-quadruplex using a variety of biophysical techniques including electrophoretic mobility shift assays, UV-VIS spectroscopy, circular dichroism, dynamic light scattering, small angle X-ray scattering and nuclear magnetic resonance spectroscopy. Our biophysical analysis provides evidence that the RNA G-quadruplex, but not its DNA counterpart, can adopt a parallel orientation, and that only the RNA can interact with N-terminal domain of RHAU via the tetrad face of the G-quadruplex. This work extends our insight into how the N-terminal region of RHAU recognizes parallel G-quadruplexes.

  6. The Role of RT Carry-Over for Congruence Sequence Effects in Masked Priming

    Science.gov (United States)

    Huber-Huber, Christoph; Ansorge, Ulrich

    2017-01-01

    The present study disentangles 2 sources of the congruence sequence effect with masked primes: congruence and response time of the previous trial (reaction time [RT] carry-over). Using arrows as primes and targets and a metacontrast masking procedure we found congruence as well as congruence sequence effects. In addition, congruence sequence…

  7. Effect of sequences of ozone and nitrogen dioxide on plant dry ...

    African Journals Online (AJOL)

    Ozone (O3) is the most important gaseous air pollutant in the world because of its adverse effects on vegetation in general and crop plants in particular. Since nitrogen dioxide (NO2) is a precursor of ozone, studying the implication of sequences of these two gases is very important. Hence, the effects of sequences of ...

  8. Effective Feature Selection for Classification of Promoter Sequences.

    Directory of Open Access Journals (Sweden)

    Kouser K

    Full Text Available Exploring novel computational methods in making sense of biological data has not only been a necessity, but also productive. A part of this trend is the search for more efficient in silico methods/tools for analysis of promoters, which are parts of DNA sequences that are involved in regulation of expression of genes into other functional molecules. Promoter regions vary greatly in their function based on the sequence of nucleotides and the arrangement of protein-binding short-regions called motifs. In fact, the regulatory nature of the promoters seems to be largely driven by the selective presence and/or the arrangement of these motifs. Here, we explore computational classification of promoter sequences based on the pattern of motif distributions, as such classification can pave a new way of functional analysis of promoters and to discover the functionally crucial motifs. We make use of Position Specific Motif Matrix (PSMM features for exploring the possibility of accurately classifying promoter sequences using some of the popular classification techniques. The classification results on the complete feature set are low, perhaps due to the huge number of features. We propose two ways of reducing features. Our test results show improvement in the classification output after the reduction of features. The results also show that decision trees outperform SVM (Support Vector Machine, KNN (K Nearest Neighbor and ensemble classifier LibD3C, particularly with reduced features. The proposed feature selection methods outperform some of the popular feature transformation methods such as PCA and SVD. Also, the methods proposed are as accurate as MRMR (feature selection method but much faster than MRMR. Such methods could be useful to categorize new promoters and explore regulatory mechanisms of gene expressions in complex eukaryotic species.

  9. Effect of sequences of ozone and nitrogen dioxide on chlorophyll ...

    African Journals Online (AJOL)

    The sequences involved different combinations of exposures to NO2 from 06:00 to 10:00h and/or 18:00 to 22:00hr and O3 from 10:00 to 18:00hr. Relative to the control, early and early + late NO2 resulted in stimulations of quantum yield (Y) and photochemical quenching (qP), with late NO2 resulting in little or no change.

  10. Simple sequence repeat (SSR) markers are effective for identifying ...

    African Journals Online (AJOL)

    DNA was extracted from newly formed leaves and amplified using 21 simple sequence repeat (SSR) markers (NH001c, NH002b, NH005b, NH007b, NH008b, NH009b, NH011b, NH013b, NH012a, NH014a, NH015a, NH017a, KA4b, KA5, KA14, KA16, KB16, KU10, BGA35, BGT23b and HGA8b). The data was analyzed by ...

  11. Base Sequence Context Effects on Nucleotide Excision Repair

    Directory of Open Access Journals (Sweden)

    Yuqin Cai

    2010-01-01

    Full Text Available Nucleotide excision repair (NER plays a critical role in maintaining the integrity of the genome when damaged by bulky DNA lesions, since inefficient repair can cause mutations and human diseases notably cancer. The structural properties of DNA lesions that determine their relative susceptibilities to NER are therefore of great interest. As a model system, we have investigated the major mutagenic lesion derived from the environmental carcinogen benzo[a]pyrene (B[a]P, 10S (+-trans-anti-B[a]P-2-dG in six different sequence contexts that differ in how the lesion is positioned in relation to nearby guanine amino groups. We have obtained molecular structural data by NMR and MD simulations, bending properties from gel electrophoresis studies, and NER data obtained from human HeLa cell extracts for our six investigated sequence contexts. This model system suggests that disturbed Watson-Crick base pairing is a better recognition signal than a flexible bend, and that these can act in concert to provide an enhanced signal. Steric hinderance between the minor groove-aligned lesion and nearby guanine amino groups determines the exact nature of the disturbances. Both nearest neighbor and more distant neighbor sequence contexts have an impact. Regardless of the exact distortions, we hypothesize that they provide a local thermodynamic destabilization signal for repair.

  12. Studies of base pair sequence effects on DNA solvation based on all

    Indian Academy of Sciences (India)

    Detailed analyses of the sequence-dependent solvation and ion atmosphere of DNA are presented based on molecular dynamics (MD) simulations on all the 136 unique tetranucleotide steps obtained by the ABC consortium using the AMBER suite of programs. Significant sequence effects on solvation and ion localization ...

  13. The Effects of Delayed Reinforcement on Variability and Repetition of Response Sequences

    Science.gov (United States)

    Odum, Amy L.; Ward, Ryan D.; Burke, K. Anne; Barnes, Christopher A.

    2006-01-01

    Four experiments examined the effects of delays to reinforcement on key peck sequences of pigeons maintained under multiple schedules of contingencies that produced variable or repetitive behavior. In Experiments 1, 2, and 4, in the repeat component only the sequence right-right-left-left earned food, and in the vary component four-response…

  14. Sleep and memory consolidation: motor performance and proactive interference effects in sequence learning.

    Science.gov (United States)

    Borragán, Guillermo; Urbain, Charline; Schmitz, Rémy; Mary, Alison; Peigneux, Philippe

    2015-04-01

    That post-training sleep supports the consolidation of sequential motor skills remains debated. Performance improvement and sensitivity to proactive interference are both putative measures of long-term memory consolidation. We tested sleep-dependent memory consolidation for visuo-motor sequence learning using a proactive interference paradigm. Thirty-three young adults were trained on sequence A on Day 1, then had Regular Sleep (RS) or were Sleep Deprived (SD) on the night after learning. After two recovery nights, they were tested on the same sequence A, then had to learn a novel, potentially competing sequence B. We hypothesized that proactive interference effects on sequence B due to the prior learning of sequence A would be higher in the RS condition, considering that proactive interference is an indirect marker of the robustness of sequence A, which should be better consolidated over post-training sleep. Results highlighted sleep-dependent improvement for sequence A, with faster RTs overnight for RS participants only. Moreover, the beneficial impact of sleep was specific to the consolidation of motor but not sequential skills. Proactive interference effects on learning a new material at Day 4 were similar between RS and SD participants. These results suggest that post-training sleep contributes to optimizing motor but not sequential components of performance in visuo-motor sequence learning. Copyright © 2015 Elsevier Inc. All rights reserved.

  15. Predicting effects of noncoding variants with deep learning-based sequence model.

    Science.gov (United States)

    Zhou, Jian; Troyanskaya, Olga G

    2015-10-01

    Identifying functional effects of noncoding variants is a major challenge in human genetics. To predict the noncoding-variant effects de novo from sequence, we developed a deep learning-based algorithmic framework, DeepSEA (http://deepsea.princeton.edu/), that directly learns a regulatory sequence code from large-scale chromatin-profiling data, enabling prediction of chromatin effects of sequence alterations with single-nucleotide sensitivity. We further used this capability to improve prioritization of functional variants including expression quantitative trait loci (eQTLs) and disease-associated variants.

  16. Situation models and memory: the effects of temporal and causal information on recall sequence.

    Science.gov (United States)

    Brownstein, Aaron L; Read, Stephen J

    2007-10-01

    Participants watched an episode of the television show Cheers on video and then reported free recall. Recall sequence followed the sequence of events in the story; if one concept was observed immediately after another, it was recalled immediately after it. We also made a causal network of the show's story and found that recall sequence followed causal links; effects were recalled immediately after their causes. Recall sequence was more likely to follow causal links than temporal sequence, and most likely to follow causal links that were temporally sequential. Results were similar at 10-minute and 1-week delayed recall. This is the most direct and detailed evidence reported on sequential effects in recall. The causal network also predicted probability of recall; concepts with more links and concepts on the main causal chain were most likely to be recalled. This extends the causal network model to more complex materials than previous research.

  17. Cation binding to 15-TBA quadruplex DNA is a multiple-pathway cation-dependent process

    Czech Academy of Sciences Publication Activity Database

    Reshetnikov, R.V.; Šponer, Jiří; Rassokhina, O.I.; Kopylov, A.M.; Tsvetkov, P.O.; Makarov, A.A.; Golovin, A.V.

    2011-01-01

    Roč. 39, č. 22 (2011), s. 9789-9802 ISSN 0305-1048 R&D Projects: GA AV ČR(CZ) IAA400040802; GA ČR(CZ) GA203/09/1476; GA ČR(CZ) GAP208/11/1822; GA MŠk(CZ) LC06030 Institutional research plan: CEZ:AV0Z50040507; CEZ:AV0Z50040702 Keywords : QM/MM * quadruplex DNA * molecular dynamics simulation Subject RIV: BO - Biophysics Impact factor: 8.026, year: 2011

  18. Clustered abasic lesions profoundly change the structure and stability of human telomeric G-quadruplexes

    Czech Academy of Sciences Publication Activity Database

    Kejnovská, Iva; Bednářová, Klára; Renčiuk, Daniel; Dvořáková, Zuzana; Školáková, Petra; Trantírek, L.; Fiala, R.; Vorlíčková, Michaela; Sagi, J.

    2017-01-01

    Roč. 45, č. 8 (2017), s. 4294-4305 ISSN 0305-1048 R&D Projects: GA MŠk EF15_003/0000477; GA ČR GAP205/12/0466; GA ČR GA13-28310S; GA ČR(CZ) GA15-06785S; GA MŠk(CZ) LQ1601 Institutional support: RVO:68081707 Keywords : dna-damage clusters * k+ solution * guanine quadruplexes Subject RIV: CE - Biochemistry OBOR OECD: Biochemistry and molecular biology Impact factor: 10.162, year: 2016

  19. G-Quadruplexes in DNA Replication: A Problem or a Necessity?

    Science.gov (United States)

    Valton, Anne-Laure; Prioleau, Marie-Noëlle

    2016-11-01

    DNA replication is a highly regulated process that ensures the correct duplication of the genome at each cell cycle. A precise cell type-specific temporal program controls the duplication of complex vertebrate genomes in an orderly manner. This program is based on the regulation of both replication origin firing and replication fork progression. G-quadruplexes (G4s), DNA secondary structures displaying noncanonical Watson-Crick base pairing, have recently emerged as key controllers of genome duplication. Here we discuss the various means by which G4s affect this fundamental cellular process. Copyright © 2016 Elsevier Ltd. All rights reserved.

  20. Development of an Efficient G-Quadruplex-Stabilised Thrombin-Binding Aptamer Containing a Three-Carbon Spacer Molecule

    DEFF Research Database (Denmark)

    Aaldering, Lukas J.; Poongavanam, Vasanthanathan; Langkjær, Niels

    2017-01-01

    The thrombin-binding aptamer (TBA), which shows anticoagulant properties, is one of the most studied G-quadruplex-forming aptamers. In this study, we investigated the impact of different chemical modifications such as a three-carbon spacer (spacer-C3), unlocked nucleic acid (UNA) and 3′-amino-mod...

  1. Loss of loop adenines alters human telomere d[AG3(TTAG3)3] quadruplex folding

    Czech Academy of Sciences Publication Activity Database

    Babinský, M.; Fiala, R.; Kejnovská, Iva; Bednářová, Klára; Marek, R.; Sagi, J.; Sklenář, V.; Vorlíčková, Michaela

    2014-01-01

    Roč. 42, č. 22 (2014), s. 14031-14041 ISSN 0305-1048 R&D Projects: GA ČR(CZ) GAP205/12/0466 Institutional support: RVO:68081707 Keywords : human telomere * DNA quadruplex * cellular DNA Subject RIV: BO - Biophysics Impact factor: 9.112, year: 2014

  2. Can We Execute Reliable MM-PBSA Free Energy Computations of Relative Stabilities of Different Guanine Quadruplex Folds?

    Czech Academy of Sciences Publication Activity Database

    Islam, B.; Stadlbauer, Petr; Neidle, S.; Haider, S.; Šponer, Jiří

    2016-01-01

    Roč. 120, č. 11 (2016), s. 2899-2912 ISSN 1520-6106 R&D Projects: GA ČR(CZ) GA16-13721S Institutional support: RVO:68081707 Keywords : MOLECULAR-DYNAMICS SIMULATIONS * TELOMERIC G-QUADRUPLEX * AMBER FORCE-FIELD Subject RIV: BO - Biophysics Impact factor: 3.177, year: 2016

  3. Effects of Working Couple's Retirement Sequence on Satisfaction in Patriarchal Culture Country: Probing on Gender Difference.

    Science.gov (United States)

    Lee, Ayoung; Cho, Joonmo

    2017-01-01

    We examined the effects of the differences in the retirement sequence (i.e., who retires first between spouses) on satisfaction in Korea of patriarchal culture. Our empirical study demonstrates that households where men retired first had a much lower satisfaction than households where women retired first. In addition, men were found to show lower satisfaction than wives in both households where women retire first and the households where men retire first. Retirement sequence affecting their satisfaction at the point when only one of the spouses is retired continues to affect their satisfaction after both of them are retired. This means that the difference in the couple's retirement sequence has an ongoing effect on their later happiness. The analysis of the effect of a couple's retirement sequence on the satisfaction in their old life may be useful for improving an individual and couples' quality of life in countries with similar cultures.

  4. Quinone methides tethered to naphthalene diimides as selective G-quadruplex alkylating agents.

    Science.gov (United States)

    Di Antonio, Marco; Doria, Filippo; Richter, Sara N; Bertipaglia, Carolina; Mella, Mariella; Sissi, Claudia; Palumbo, Manlio; Freccero, Mauro

    2009-09-16

    We have developed novel G-quadruplex (G-4) ligand/alkylating hybrid structures, tethering the naphthalene diimide moiety to quaternary ammonium salts of Mannich bases, as quinone-methide precursors, activatable by mild thermal digestion (40 degrees C). The bis-substituted naphthalene diimides were efficiently synthesized, and their reactivity as activatable bis-alkylating agents was investigated in the presence of thiols and amines in aqueous buffered solutions. The electrophilic intermediate, quinone-methide, involved in the alkylation process was trapped, in the presence of ethyl vinyl ether, in a hetero Diels-Alder [4 + 2] cycloaddition reaction, yielding a substituted 2-ethoxychroman. The DNA recognition and alkylation properties of these new derivatives were investigated by gel electrophoresis, circular dichroism, and enzymatic assays. The alkylation process occurred preferentially on the G-4 structure in comparison to other DNA conformations. By dissecting reversible recognition and alkylation events, we found that the reversible process is a prerequisite to DNA alkylation, which in turn reinforces the G-quadruplex structural rearrangement.

  5. Intermolecular G-quadruplex structure-based fluorescent DNA detection system.

    Science.gov (United States)

    Zhou, Hui; Wu, Zai-Sheng; Shen, Guo-Li; Yu, Ru-Qin

    2013-03-15

    Adopting multi-donors to pair with one acceptor could improve the performance of fluorogenic detection probes. However, common dyes (e.g., fluorescein) in close proximity to each other would self-quench the fluorescence, and the fluorescence is difficult to restore. In this contribution, we constructed a novel "multi-donors-to-one acceptor" fluorescent DNA detection system by means of the intermolecular G-quadruplex (IGQ) structure-based fluorescence signal enhancement combined with the hairpin oligonucleotide. The novel IGQ-hairpin system was characterized using the p53 gene as the model target DNA. The proposed system showed an improved assay performance due to the introduction of IGQ-structure into fluorescent signaling probes, which could inhibit the background fluorescence and increase fluorescence restoration amplitude of fluoresceins upon target DNA hybridization. The proof-of-concept scheme is expected to provide new insight into the potential of G-quadruplex structure and promote the application of fluorescent oligonucleotide probes in fundamental research, diagnosis, and treatment of genetic diseases. Copyright © 2012 Elsevier B.V. All rights reserved.

  6. 6-Thioguanine alters the structure and stability of duplex DNA and inhibits quadruplex DNA formation.

    Science.gov (United States)

    Marathias, V M; Sawicki, M J; Bolton, P H

    1999-07-15

    The ability to chemically synthesize biomolecules has opened up the opportunity to observe changes in structure and activity that occur upon single atom substitution. In favorable cases this can provide information about the roles of individual atoms. The substitution of 6-thioguanine (6SG) for guanine is a potentially very useful single atom substitution as 6SG has optical, photocrosslinking, metal ion binding and other properties of potential utility. In addition, 6-mercaptopurine is a clinically important pro-drug that is activated by conversion into 6SG by cells. The results presented here indicate that the presence of 6SG blocks the formation of quadruplex DNA. The presence of 6SG alters the structure and lowers the thermal stability of duplex DNA, but duplex DNA can be formed in the presence of 6SG. These results indicate that some of the cytotoxic activity of 6SG may be due to disruption of the quadruplex structures formed by telomere and other DNAs. This additional mode of action is consistent with the delayed onset of cytotoxicity.

  7. Effects of magnetic fields on main sequence stars

    International Nuclear Information System (INIS)

    Hubbard, E.N.

    1981-01-01

    A number of effects of low to medium strength ( 2 /8π) magnetic field pressure term so that the only effect of such a field may come from its inhibiting convection in the core. Isochrones of both convective and radiative core models of 2-5 M are presented. In the deep envelope, mixing of partially nuclear processed material driven by rising and falling magnetic flux tubes may be seen. The effects of this mixing will be brought to the surface during the deep convection phase of the star's tenure as a red giant. This model is used to predict a signature for magnetic mixing based on the CNO isotope and abundance ratios. In the outer envelope the gas pressure is low enough that one might expect to see a perturbation of the stellar structure due to the magnetic field pressure itself. This perturbation is calculated under several physical models for intermediate and high mass stars and it is determined that sufficient magnetic field energy may be available in the outer envelope to expand a star by about 20% over its unperturbed radius. Finally the evidence for the existence of non-magnetic neutron stars is considered, concluding that while no non-magnetic neutron stars have ever been positively identified, there is no evidence that prevents the existence of at least as many non-magnetic as magnetic neutron stars

  8. “One Ring to Bind Them All”—Part I: The Efficiency of the Macrocyclic Scaffold for G-Quadruplex DNA Recognition

    Directory of Open Access Journals (Sweden)

    David Monchaud

    2010-01-01

    Full Text Available Macrocyclic scaffolds are particularly attractive for designing selective G-quadruplex ligands essentially because, on one hand, they show a poor affinity for the “standard” B-DNA conformation and, on the other hand, they fit nicely with the external G-quartets of quadruplexes. Stimulated by the pioneering studies on the cationic porphyrin TMPyP4 and the natural product telomestatin, follow-up studies have developed, rapidly leading to a large diversity of macrocyclic structures with remarkable-quadruplex binding properties and biological activities. In this review we summarize the current state of the art in detailing the three main categories of quadruplex-binding macrocycles described so far (telomestatin-like polyheteroarenes, porphyrins and derivatives, polyammonium cyclophanes, and in addressing both synthetic issues and biological aspects.

  9. effect of sequences of ozone and nitrogen dioxide on plant dry

    African Journals Online (AJOL)

    Prof. Adipala Ekwamu

    University of Zimbabwe, Crop Science Department, P. O. Box MP 176 Mt ... Exposures to NO2 in sequence with O3 had negative effects on growth. .... fertiliser,14:14:14 NPK (Osmocote; Sierra Chemical .... Effects of treatment on total (A), shoot (B), hypocotyl (C) dry shoot to .... production, in spite of the effects on stomatal.

  10. A dispersion-balanced Discrete Fourier Transform of repetitive pulse sequences using temporal Talbot effect

    Science.gov (United States)

    Fernández-Pousa, Carlos R.

    2017-11-01

    We propose a processor based on the concatenation of two fractional temporal Talbot dispersive lines with balanced dispersion to perform the DFT of a repetitive electrical sequence, for its use as a controlled source of optical pulse sequences. The electrical sequence is used to impart the amplitude and phase of a coherent train of optical pulses by use of a modulator placed between the two Talbot lines. The proposal has been built on a representation of the action of fractional Talbot effect on repetitive pulse sequences and a comparison with related results and proposals. It is shown that the proposed system is reconfigurable within a few repetition periods, has the same processing rate as the input optical pulse train, and requires the same technical complexity in terms of dispersion and pulse width as the standard, passive pulse-repetition rate multipliers based on fractional Talbot effect.

  11. Synthesis and evaluation of sequence-specific DNA alkylating agents: effect of alkylation subunits.

    Science.gov (United States)

    Shimizu, Tatsuhiko; Sasaki, Shunta; Minoshima, Masafumi; Shinohara, Ken-ichi; Bando, Toshikazu; Sugiyama, Hiroshi

    2006-01-01

    We have demonstrated that hairpin pyrrole (Py)- imidazole (Im) polyamide-CBI conjugates selectively alkylate predetermined sequences. In this study, we investigated the effect of alkylation subunits, for example conjugates 1-4 with three types of DNA alkylating units, and Py-Im polyamides with indole linker. Conjugate 3 and 4 selectively alkylated the predetermined sequences as described previously, while conjugates 1 and 2 alkylate at mismatched sites.

  12. Differential effects of simple repeating DNA sequences on gene expression from the SV40 early promoter.

    Science.gov (United States)

    Amirhaeri, S; Wohlrab, F; Wells, R D

    1995-02-17

    The influence of simple repeat sequences, cloned into different positions relative to the SV40 early promoter/enhancer, on the transient expression of the chloramphenicol acetyltransferase (CAT) gene was investigated. Insertion of (G)29.(C)29 in either orientation into the 5'-untranslated region of the CAT gene reduced expression in CV-1 cells 50-100 fold when compared with controls with random sequence inserts. Analysis of CAT-specific mRNA levels demonstrated that the effect was due to a reduction of CAT mRNA production rather than to posttranscriptional events. In contrast, insertion of the same insert in either orientation upstream of the promoter-enhancer or downstream of the gene stimulated gene expression 2-3-fold. These effects could be reversed by cotransfection of a competitor plasmid carrying (G)25.(C)25 sequences. The results suggest that a G.C-binding transcription factor modulates gene expression in this system and that promoter strength can be regulated by providing protein-binding sites in trans. Although constructs containing longer tracts of alternating (C-G), (T-G), or (A-T) sequences inhibited CAT expression when inserted in the 5'-untranslated region of the CAT gene, the amount of CAT mRNA was unaffected. Hence, these inhibitions must be due to posttranscriptional events, presumably at the level of translation. These effects of microsatellite sequences on gene expression are discussed with respect to recent data on related simple repeat sequences which cause several human genetic diseases.

  13. Investigation of ‘Head-to-Tail’-Connected Oligoaryl N,O-Ligands as Recognition Motifs for Cancer-Relevant G-Quadruplexes

    Directory of Open Access Journals (Sweden)

    Natalia Rizeq

    2017-12-01

    Full Text Available Oligomeric compounds, constituted of consecutive N,O-heteroaromatic rings, introduce useful and tunable properties as alternative ligands for biomolecular recognition. In this study, we have explored a synthetic scheme relying on Van Leusen oxazole formation, in conjunction with C–H activation of the formed oxazoles and their subsequent C–C cross-coupling to 2-bromopyridines in order to assemble a library of variable-length, ‘head-to-tail’-connected, pyridyl-oxazole ligands. Through investigation of the interaction of the three longer ligands (5-mer, 6-mer, 7-mer with cancer-relevant G-quadruplex structures (human telomeric/22AG and c-Myc oncogene promoter/Myc2345-Pu22, the asymmetric pyridyl-oxazole motif has been demonstrated to be a prominent recognition element for G-quadruplexes. Fluorescence titrations reveal excellent binding affinities of the 7-mer and 6-mer for a Na+-induced antiparallel 22AG G-quadruplex (KD = 0.6 × 10−7 M−1 and 0.8 × 10−7 M−1, respectively, and satisfactory (albeit lower affinities for the 22AG/K+ and Myc2345-Pu22/K+ G-quadruplexes. All ligands tested exhibit substantial selectivity for G-quadruplex versus duplex (ds26 DNA, as evidenced by competitive Förster resonance energy transfer (FRET melting assays. Additionally, the 7-mer and 6-mer are capable of promoting a sharp morphology transition of 22AG/K+ G-quadruplex.

  14. Phylo-typing of clinical Escherichia coli isolates originating from bovine mastitis and canine pyometra and urinary tract infection by means of quadruplex PCR.

    Science.gov (United States)

    Müştak, Hamit Kaan; Günaydin, Elçin; Kaya, İnci Başak; Salar, Merve Özdal; Babacan, Orkun; Önat, Kaan; Ata, Zafer; Diker, Kadir Serdar

    2015-01-01

    Escherichia coli is one of the major causative agents of bovine mastitis worldwide, and is typically associated with acute, clinical mastitis. Besides this, E. coli strains which belong to the extra-intestinal pathogenic group are also the major cause of urinary tract infections and pyometra in dogs. In this study, it was aimed to investigate phylo-groups/subgroups in 155 E. coli isolates obtained from acute bovine mastitis, 43 from urinary tract infections of dogs and 20 from canine pyometra by a formerly described triplex PCR and recently described new quadruplex polymerase chain reaction (PCR) method. Group A1 (n = 118; 76%) and B1 (n = 71; 46%) were found to be the most prevalent groups by triplex and quadruplex PCR assays in mastitis isolates, respectively. Phylo-typing of 43 urinary tract isolates also revealed that most of the isolates belonged to A1 (n = 23; 54%) by triplex and B2 (n = 36; 84%) by quadruplex PCR assays. The isolates assigned as group A1 (n = 17; 85%) by triplex PCR could not be classified by quadruplex PCR in pyometra isolates. The results support the hypothesis that E. coli strains isolated from bovine mastitis cases are environmental. Also, groups C, E and F were identified as new phylo-groups for the first time in acute bovine mastitis cases. The comparison of triplex PCR with quadruplex PCR results revealed that most of the groups assigned in triplex PCR were altered by quadruplex PCR assay.

  15. Effects of cloning and root-tip size on observations of fungal ITS sequences from Picea glauca roots

    Science.gov (United States)

    Daniel L. Lindner; Mark T. Banik

    2009-01-01

    To better understand the effects of cloning on observations of fungal ITS sequences from Picea glauca (white spruce) roots two techniques were compared: (i) direct sequencing of fungal ITS regions from individual root tips without cloning and (ii) cloning and sequencing of fungal ITS regions from individual root tips. Effect of root tip size was...

  16. Effect of Sequence Blockiness on the Morphologies of Surface-grafted Elastin-like Polypeptides

    Science.gov (United States)

    Albert, Julie; Sintavanon, Kornkanok; Mays, Robin; MacEwan, Sarah; Chilkoti, Ashutosh; Genzer, Jan

    2014-03-01

    The inter- and intra- molecular interactions among monomeric units of copolymers and polypeptides depend strongly on monomer sequence distribution and dictate the phase behavior of these species both in solution and on surfaces. To study the relationship between sequence and phase behavior, we have designed a series of elastin-like polypeptides (ELPs) with controlled monomer sequences that mimic copolymers with various co-monomer sequence distributions and attached them covalently to silicon substrates from buffer solutions at temperatures below and above the bulk ELPs' lower critical solution temperatures (LCSTs). The dependence of ELP grafting density on solution temperature was examined by ellipsometry and the resultant surface morphologies were examined in air and under water with atomic force microscopy. Depositions performed above the LCST resulted in higher grafting densities and greater surface roughness of ELPs relative to depositions carried out below the LCST. In addition, we are using gradient substrates to examine the effect of ELP grafting density on temperature responsiveness.

  17. Effective automated feature construction and selection for classification of biological sequences.

    Directory of Open Access Journals (Sweden)

    Uday Kamath

    Full Text Available Many open problems in bioinformatics involve elucidating underlying functional signals in biological sequences. DNA sequences, in particular, are characterized by rich architectures in which functional signals are increasingly found to combine local and distal interactions at the nucleotide level. Problems of interest include detection of regulatory regions, splice sites, exons, hypersensitive sites, and more. These problems naturally lend themselves to formulation as classification problems in machine learning. When classification is based on features extracted from the sequences under investigation, success is critically dependent on the chosen set of features.We present an algorithmic framework (EFFECT for automated detection of functional signals in biological sequences. We focus here on classification problems involving DNA sequences which state-of-the-art work in machine learning shows to be challenging and involve complex combinations of local and distal features. EFFECT uses a two-stage process to first construct a set of candidate sequence-based features and then select a most effective subset for the classification task at hand. Both stages make heavy use of evolutionary algorithms to efficiently guide the search towards informative features capable of discriminating between sequences that contain a particular functional signal and those that do not.To demonstrate its generality, EFFECT is applied to three separate problems of importance in DNA research: the recognition of hypersensitive sites, splice sites, and ALU sites. Comparisons with state-of-the-art algorithms show that the framework is both general and powerful. In addition, a detailed analysis of the constructed features shows that they contain valuable biological information about DNA architecture, allowing biologists and other researchers to directly inspect the features and potentially use the insights obtained to assist wet-laboratory studies on retainment or modification

  18. Flower bud transcriptome analysis of Sapium sebiferum (Linn.) Roxb. and primary investigation of drought induced flowering: pathway construction and G-quadruplex prediction based on transcriptome.

    Science.gov (United States)

    Yang, Minglei; Wu, Ying; Jin, Shan; Hou, Jinyan; Mao, Yingji; Liu, Wenbo; Shen, Yangcheng; Wu, Lifang

    2015-01-01

    Sapium sebiferum (Linn.) Roxb. (Chinese Tallow Tree) is a perennial woody tree and its seeds are rich in oil which hold great potential for biodiesel production. Despite a traditional woody oil plant, our understanding on S. sebiferum genetics and molecular biology remains scant. In this study, the first comprehensive transcriptome of S. sebiferum flower has been generated by sequencing and de novo assembly. A total of 149,342 unigenes were generated from raw reads, of which 24,289 unigenes were successfully matched to public database. A total of 61 MADS box genes and putative pathways involved in S. sebiferum flower development have been identified. Abiotic stress response network was also constructed in this work, where 2,686 unigenes are involved in the pathway. As for lipid biosynthesis, 161 unigenes have been identified in fatty acid (FA) and triacylglycerol (TAG) biosynthesis. Besides, the G-Quadruplexes in RNA of S. sebiferum also have been predicted. An interesting finding is that the stress-induced flowering was observed in S. sebiferum for the first time. According to the results of semi-quantitative PCR, expression tendencies of flowering-related genes, GA1, AP2 and CRY2, accorded with stress-related genes, such as GRX50435 and PRXⅡ39562. This transcriptome provides functional genomic information for further research of S. sebiferum, especially for the genetic engineering to shorten the juvenile period and improve yield by regulating flower development. It also offers a useful database for the research of other Euphorbiaceae family plants.

  19. Masking as an effective quality control method for next-generation sequencing data analysis.

    Science.gov (United States)

    Yun, Sajung; Yun, Sijung

    2014-12-13

    Next generation sequencing produces base calls with low quality scores that can affect the accuracy of identifying simple nucleotide variation calls, including single nucleotide polymorphisms and small insertions and deletions. Here we compare the effectiveness of two data preprocessing methods, masking and trimming, and the accuracy of simple nucleotide variation calls on whole-genome sequence data from Caenorhabditis elegans. Masking substitutes low quality base calls with 'N's (undetermined bases), whereas trimming removes low quality bases that results in a shorter read lengths. We demonstrate that masking is more effective than trimming in reducing the false-positive rate in single nucleotide polymorphism (SNP) calling. However, both of the preprocessing methods did not affect the false-negative rate in SNP calling with statistical significance compared to the data analysis without preprocessing. False-positive rate and false-negative rate for small insertions and deletions did not show differences between masking and trimming. We recommend masking over trimming as a more effective preprocessing method for next generation sequencing data analysis since masking reduces the false-positive rate in SNP calling without sacrificing the false-negative rate although trimming is more commonly used currently in the field. The perl script for masking is available at http://code.google.com/p/subn/. The sequencing data used in the study were deposited in the Sequence Read Archive (SRX450968 and SRX451773).

  20. Consolidating the effects of waking and sleep on motor-sequence learning.

    Science.gov (United States)

    Brawn, Timothy P; Fenn, Kimberly M; Nusbaum, Howard C; Margoliash, Daniel

    2010-10-20

    Sleep is widely believed to play a critical role in memory consolidation. Sleep-dependent consolidation has been studied extensively in humans using an explicit motor-sequence learning paradigm. In this task, performance has been reported to remain stable across wakefulness and improve significantly after sleep, making motor-sequence learning the definitive example of sleep-dependent enhancement. Recent work, however, has shown that enhancement disappears when the task is modified to reduce task-related inhibition that develops over a training session, thus questioning whether sleep actively consolidates motor learning. Here we use the same motor-sequence task to demonstrate sleep-dependent consolidation for motor-sequence learning and explain the discrepancies in results across studies. We show that when training begins in the morning, motor-sequence performance deteriorates across wakefulness and recovers after sleep, whereas performance remains stable across both sleep and subsequent waking with evening training. This pattern of results challenges an influential model of memory consolidation defined by a time-dependent stabilization phase and a sleep-dependent enhancement phase. Moreover, the present results support a new account of the behavioral effects of waking and sleep on explicit motor-sequence learning that is consistent across a wide range of tasks. These observations indicate that current theories of memory consolidation that have been formulated to explain sleep-dependent performance enhancements are insufficient to explain the range of behavioral changes associated with sleep.

  1. Effects of the bleaching sequence on the optical brighteners action in eucalyptus kraft pulp

    Directory of Open Access Journals (Sweden)

    Mauro Manfredi

    2014-06-01

    Full Text Available During the bleaching process the pulp is treated with chemical reagents that can be retained in the pulp and interfere in the action of the optical brighteners. Different bleaching sequences can produce pulps at the same brightness but with different potential to whiteness increase when treated with optical brighteners. The objective of this study was to evaluate the influence of the bleaching sequence on the efficiency of disulphonated and tetrasulphonated optical brighteners. Eucalyptus kraft pulp was bleached using four different bleaching sequences. For each pulp three brightness targets were aimeds. For each bleaching sequence mathematical model was generated for predicting the final pulp whiteness according to the initial brightness and the optical brightener charge applied. The presence of organochlorine residues in the pulp reduced the effectiveness of the optical brighteners. Therefore, bleaching sequences that use low chlorine dioxide charge favors for greater gains in whiteness with the application of optical brighteners. The replacement of the final chlorine dioxide bleaching stage with a hydrogen peroxide one in the sequence increased the efficiency of the optical brightening agents.

  2. Cost-effectiveness of sequenced treatment of rheumatoid arthritis with targeted immune modulators.

    Science.gov (United States)

    Jansen, Jeroen P; Incerti, Devin; Mutebi, Alex; Peneva, Desi; MacEwan, Joanna P; Stolshek, Bradley; Kaur, Primal; Gharaibeh, Mahdi; Strand, Vibeke

    2017-07-01

    To determine the cost-effectiveness of treatment sequences of biologic disease-modifying anti-rheumatic drugs or Janus kinase/STAT pathway inhibitors (collectively referred to as bDMARDs) vs conventional DMARDs (cDMARDs) from the US societal perspective for treatment of patients with moderately to severely active rheumatoid arthritis (RA) with inadequate responses to cDMARDs. An individual patient simulation model was developed that assesses the impact of treatments on disease based on clinical trial data and real-world evidence. Treatment strategies included sequences starting with etanercept, adalimumab, certolizumab, or abatacept. Each of these treatment strategies was compared with cDMARDs. Incremental cost, incremental quality-adjusted life-years (QALYs), and incremental cost-effectiveness ratios (ICERs) were calculated for each treatment sequence relative to cDMARDs. The cost-effectiveness of each strategy was determined using a US willingness-to-pay (WTP) threshold of $150,000/QALY. For the base-case scenario, bDMARD treatment sequences were associated with greater treatment benefit (i.e. more QALYs), lower lost productivity costs, and greater treatment-related costs than cDMARDs. The expected ICERs for bDMARD sequences ranged from ∼$126,000 to $140,000 per QALY gained, which is below the US-specific WTP. Alternative scenarios examining the effects of homogeneous patients, dose increases, increased costs of hospitalization for severely physically impaired patients, and a lower baseline Health Assessment Questionnaire (HAQ) Disability Index score resulted in similar ICERs. bDMARD treatment sequences are cost-effective from a US societal perspective.

  3. Effects of aging and dopamine genotypes on the emergence of explicit memory during sequence learning.

    Science.gov (United States)

    Schuck, Nicolas W; Frensch, Peter A; Schjeide, Brit-Maren M; Schröder, Julia; Bertram, Lars; Li, Shu-Chen

    2013-11-01

    The striatum and medial temporal lobe play important roles in implicit and explicit memory, respectively. Furthermore, recent studies have linked striatal dopamine modulation to both implicit as well as explicit sequence learning and suggested a potential role of the striatum in the emergence of explicit memory during sequence learning. With respect to aging, previous findings indicated that implicit memory is less impaired than explicit memory in older adults and that genetic effects on cognition are magnified by aging. To understand the links between these findings, we investigated effects of aging and genotypes relevant for striatal dopamine on the implicit and explicit components of sequence learning. Reaction time (RT) and error data from 80 younger (20-30 years) and 70 older adults (60-71 years) during a serial reaction time task showed that age differences in learning-related reduction of RTs emerged gradually over the course of learning. Verbal recall and measures derived from the process-dissociation procedure revealed that younger adults acquired more explicit memory about the sequence than older adults, potentially causing age differences in RT gains in later stages of learning. Of specific interest, polymorphisms of the dopamine- and cAMP-regulated neuronal phosphoprotein (DARPP-32, rs907094) and dopamine transporter (DAT, VNTR) genes showed interactive effects on overall RTs and verbal recall of the sequence in older but not in younger adults. Together our findings show that variations in genotypes relevant for dopamine functions are associated more with aging-related impairments in the explicit than the implicit component of sequence learning, providing support for theories emphasizing the role of dopaminergic modulation in cognitive aging and the magnification of genetic effects in human aging. © 2013 Elsevier Ltd. All rights reserved.

  4. repDNA: a Python package to generate various modes of feature vectors for DNA sequences by incorporating user-defined physicochemical properties and sequence-order effects.

    Science.gov (United States)

    Liu, Bin; Liu, Fule; Fang, Longyun; Wang, Xiaolong; Chou, Kuo-Chen

    2015-04-15

    In order to develop powerful computational predictors for identifying the biological features or attributes of DNAs, one of the most challenging problems is to find a suitable approach to effectively represent the DNA sequences. To facilitate the studies of DNAs and nucleotides, we developed a Python package called representations of DNAs (repDNA) for generating the widely used features reflecting the physicochemical properties and sequence-order effects of DNAs and nucleotides. There are three feature groups composed of 15 features. The first group calculates three nucleic acid composition features describing the local sequence information by means of kmers; the second group calculates six autocorrelation features describing the level of correlation between two oligonucleotides along a DNA sequence in terms of their specific physicochemical properties; the third group calculates six pseudo nucleotide composition features, which can be used to represent a DNA sequence with a discrete model or vector yet still keep considerable sequence-order information via the physicochemical properties of its constituent oligonucleotides. In addition, these features can be easily calculated based on both the built-in and user-defined properties via using repDNA. The repDNA Python package is freely accessible to the public at http://bioinformatics.hitsz.edu.cn/repDNA/. bliu@insun.hit.edu.cn or kcchou@gordonlifescience.org Supplementary data are available at Bioinformatics online. © The Author 2014. Published by Oxford University Press. All rights reserved. For Permissions, please e-mail: journals.permissions@oup.com.

  5. Diesel engine exhaust initiates a sequence of pulmonary and cardiovascular effects in rats

    NARCIS (Netherlands)

    Kooter, I.M.; Gerlofs-Nijland, M.E.; Boere, A.J.F.; Leseman, D.L.A.C.; Fokkens, P.H.B.; Spronk, H.M.H.; Frederix, K.; Ten Cate, H.; Knaapen, A.M.; Vreman, H.J.; Cassee, F.R.

    2010-01-01

    This study was designed to determine the sequence of events leading to cardiopulmonary effects following acute inhalation of diesel engine exhaust in rats. Rats were exposed for 2h to diesel engine exhaust (1.9mg/m3), and biological parameters related to antioxidant defense, inflammation,

  6. Effects of mass loss on the evolution of massive stars. I. Main-sequence evolution

    International Nuclear Information System (INIS)

    Dearborn, D.S.P.; Blake, J.B.; Hainebach, K.L.; Schramm, D.N.

    1978-01-01

    The effect of mass loss on the evolution and surface composition of massive stars during main-sequence evolution are examined. While some details of the evolutionary track depend on the formula used for the mass loss, the results appear most sensitive to the total mass removed during the main-sequence lifetime. It was found that low mass-loss rates have very little effect on the evolution of a star; the track is slightly subluminous, but the lifetime is almost unaffected. High rates of mass loss lead to a hot, high-luminosity stellar model with a helium core surrounded by a hydrogen-deficient (Xapprox.0.1) envelope. The main-sequence lifetime is extended by a factor of 2--3. These models may be identified with Wolf-Rayet stars. Between these mass-loss extremes are intermediate models which appear as OBN stars on the main sequence. The mass-loss rates required for significant observable effects range from 8 x 10 -7 to 10 -5 M/sub sun/ yr -1 , depending on the initial stellar mass. It is found that observationally consistent mass-loss rates for stars with M> or =30 M/sub sun/ may be sufficiently high that these stars lose mass on a time scale more rapidly than their main-sequence core evolution time. This result implies that the helium cores resulting from the main-sequence evolution of these massive stars may all be very similar to that of a star of Mapprox.30 M/sub sun/ regardless of the zero-age mass

  7. Atomistic picture for the folding pathway of a hybrid-1 type human telomeric DNA G-quadruplex.

    Directory of Open Access Journals (Sweden)

    Yunqiang Bian

    2014-04-01

    Full Text Available In this work we studied the folding process of the hybrid-1 type human telomeric DNA G-quadruplex with solvent and K(+ ions explicitly modeled. Enabled by the powerful bias-exchange metadynamics and large-scale conventional molecular dynamic simulations, the free energy landscape of this G-DNA was obtained for the first time and four folding intermediates were identified, including a triplex and a basically formed quadruplex. The simulations also provided atomistic pictures for the structures and cation binding patterns of the intermediates. The results showed that the structure formation and cation binding are cooperative and mutually supporting each other. The syn/anti reorientation dynamics of the intermediates was also investigated. It was found that the nucleotides usually take correct syn/anti configurations when they form native and stable hydrogen bonds with the others, while fluctuating between two configurations when they do not. Misfolded intermediates with wrong syn/anti configurations were observed in the early intermediates but not in the later ones. Based on the simulations, we also discussed the roles of the non-native interactions. Besides, the formation process of the parallel conformation in the first two G-repeats and the associated reversal loop were studied. Based on the above results, we proposed a folding pathway for the hybrid-1 type G-quadruplex with atomistic details, which is new and more complete compared with previous ones. The knowledge gained for this type of G-DNA may provide a general insight for the folding of the other G-quadruplexes.

  8. Does order matter? Investigating the effect of sequence on glance duration during on-road driving.

    Directory of Open Access Journals (Sweden)

    Joonbum Lee

    Full Text Available Previous literature has shown that vehicle crash risks increases as drivers' off-road glance duration increases. Many factors influence drivers' glance duration such as individual differences, driving environment, or task characteristics. Theories and past studies suggest that glance duration increases as the task progresses, but the exact relationship between glance sequence and glance durations is not fully understood. The purpose of this study was to examine the effect of glance sequence on glance duration among drivers completing a visual-manual radio tuning task and an auditory-vocal based multi-modal navigation entry task. Eighty participants drove a vehicle on urban highways while completing radio tuning and navigation entry tasks. Forty participants drove under an experimental protocol that required three button presses followed by rotation of a tuning knob to complete the radio tuning task while the other forty participants completed the task with one less button press. Multiple statistical analyses were conducted to measure the effect of glance sequence on glance duration. Results showed that across both tasks and a variety of statistical tests, glance sequence had inconsistent effects on glance duration-the effects varied according to the number of glances, task type, and data set that was being evaluated. Results suggest that other aspects of the task as well as interface design effect glance duration and should be considered in the context of examining driver attention or lack thereof. All in all, interface design and task characteristics have a more influential impact on glance duration than glance sequence, suggesting that classical design considerations impacting driver attention, such as the size and location of buttons, remain fundamental in designing in-vehicle interfaces.

  9. Effects of stacking sequence on impact damage resistance and residual strength for quasi-isotropic laminates

    Science.gov (United States)

    Dost, Ernest F.; Ilcewicz, Larry B.; Avery, William B.; Coxon, Brian R.

    1991-01-01

    Residual strength of an impacted composite laminate is dependent on details of the damage state. Stacking sequence was varied to judge its effect on damage caused by low-velocity impact. This was done for quasi-isotropic layups of a toughened composite material. Experimental observations on changes in the impact damage state and postimpact compressive performance were presented for seven different laminate stacking sequences. The applicability and limitations of analysis compared to experimental results were also discussed. Postimpact compressive behavior was found to be a strong function of the laminate stacking sequence. This relationship was found to depend on thickness, stacking sequence, size, and location of sublaminates that comprise the impact damage state. The postimpact strength for specimens with a relatively symmetric distribution of damage through the laminate thickness was accurately predicted by models that accounted for sublaminate stability and in-plane stress redistribution. An asymmetric distribution of damage in some laminate stacking sequences tended to alter specimen stability. Geometrically nonlinear finite element analysis was used to predict this behavior.

  10. No effects of transcranial DLPFC stimulation on implicit task sequence learning and consolidation.

    Science.gov (United States)

    Savic, Branislav; Cazzoli, Dario; Müri, René; Meier, Beat

    2017-08-29

    Neurostimulation of the dorsolateral prefrontal cortex (DLPFC) can modulate performance in cognitive tasks. In a recent study, however, transcranial direct current stimulation (tDCS) of the DLPFC did not affect implicit task sequence learning and consolidation in a paradigm that involved bimanual responses. Because bimanual performance increases the coupling between homologous cortical areas of the hemispheres and left and right DLPFC were stimulated separately the null findings may have been due to the bimanual setup. The aim of the present study was to test the effect of neuro-stimulation on sequence learning in a uni-manual setup. For this purpose two experiments were conducted. In Experiment 1, the DLPFC was stimulated with tDCS. In Experiment 2 the DLPFC was stimulated with transcranial magnetic stimulation (TMS). In both experiments, consolidation was measured 24 hours later. The results showed that sequence learning was present in all conditions and sessions, but it was not influenced by stimulation. Likewise, consolidation of sequence learning was robust across sessions, but it was not influenced by stimulation. These results replicate and extend previous findings. They indicate that established tDCS and TMS protocols on the DLPFC do not influence implicit task sequence learning and consolidation.

  11. Model for predicting non-linear crack growth considering load sequence effects (LOSEQ)

    International Nuclear Information System (INIS)

    Fuehring, H.

    1982-01-01

    A new analytical model for predicting non-linear crack growth is presented which takes into account the retardation as well as the acceleration effects due to irregular loading. It considers not only the maximum peak of a load sequence to effect crack growth but also all other loads of the history according to a generalised memory criterion. Comparisons between crack growth predicted by using the LOSEQ-programme and experimentally observed data are presented. (orig.) [de

  12. Yeast Sub1 and human PC4 are G-quadruplex binding proteins that suppress genome instability at co-transcriptionally formed G4 DNA.

    Science.gov (United States)

    Lopez, Christopher R; Singh, Shivani; Hambarde, Shashank; Griffin, Wezley C; Gao, Jun; Chib, Shubeena; Yu, Yang; Ira, Grzegorz; Raney, Kevin D; Kim, Nayun

    2017-06-02

    G-quadruplex or G4 DNA is a non-B secondary DNA structure consisting of a stacked array of guanine-quartets that can disrupt critical cellular functions such as replication and transcription. When sequences that can adopt Non-B structures including G4 DNA are located within actively transcribed genes, the reshaping of DNA topology necessary for transcription process stimulates secondary structure-formation thereby amplifying the potential for genome instability. Using a reporter assay designed to study G4-induced recombination in the context of an actively transcribed locus in Saccharomyces cerevisiae, we tested whether co-transcriptional activator Sub1, recently identified as a G4-binding factor, contributes to genome maintenance at G4-forming sequences. Our data indicate that, upon Sub1-disruption, genome instability linked to co-transcriptionally formed G4 DNA in Top1-deficient cells is significantly augmented and that its highly conserved DNA binding domain or the human homolog PC4 is sufficient to suppress G4-associated genome instability. We also show that Sub1 interacts specifically with co-transcriptionally formed G4 DNA in vivo and that yeast cells become highly sensitivity to G4-stabilizing chemical ligands by the loss of Sub1. Finally, we demonstrate the physical and genetic interaction of Sub1 with the G4-resolving helicase Pif1, suggesting a possible mechanism by which Sub1 suppresses instability at G4 DNA. © The Author(s) 2017. Published by Oxford University Press on behalf of Nucleic Acids Research.

  13. Modeling genetic imprinting effects of DNA sequences with multilocus polymorphism data

    Directory of Open Access Journals (Sweden)

    Staud Roland

    2009-08-01

    Full Text Available Abstract Single nucleotide polymorphisms (SNPs represent the most widespread type of DNA sequence variation in the human genome and they have recently emerged as valuable genetic markers for revealing the genetic architecture of complex traits in terms of nucleotide combination and sequence. Here, we extend an algorithmic model for the haplotype analysis of SNPs to estimate the effects of genetic imprinting expressed at the DNA sequence level. The model provides a general procedure for identifying the number and types of optimal DNA sequence variants that are expressed differently due to their parental origin. The model is used to analyze a genetic data set collected from a pain genetics project. We find that DNA haplotype GAC from three SNPs, OPRKG36T (with two alleles G and T, OPRKA843G (with alleles A and G, and OPRKC846T (with alleles C and T, at the kappa-opioid receptor, triggers a significant effect on pain sensitivity, but with expression significantly depending on the parent from which it is inherited (p = 0.008. With a tremendous advance in SNP identification and automated screening, the model founded on haplotype discovery and statistical inference may provide a useful tool for genetic analysis of any quantitative trait with complex inheritance.

  14. Effects of main-sequence mass loss on stellar and galactic chemical evolution

    International Nuclear Information System (INIS)

    Guzik, J.A.

    1988-01-01

    L.A. Willson, G.H. Bowen and C. Struck-Marcell have proposed that 1 to 3 solar mass stars may experience evolutionarily significant mass loss during the early part of their main-sequence phase. The suggested mass-loss mechanism is pulsation, facilitated by rapid rotation. Initial mass-loss rates may be as large as several times 10 -9 M mass of sun/yr, diminishing over several times 10 8 years. The author attempts to test this hypothesis by comparing some theoretical implications with observations. Three areas are addressed: Solar models, cluster HR diagrams, and galactic chemical evolution. Mass-losing solar models were evolved that match the Sun's luminosity and radius at its present age. The most extreme viable models have initial mass 2.0 M 0 , and mass-loss rates decreasing exponentially over 2-3 x 10 8 years. Evolution calculations incorporating main-sequence mass loss were completed for a grid of models with initial masses 1.25 to 2.0 M mass of sun and mass loss timescales 0.2 to 2.0 Gry. Cluster HR diagrams synthesized with these models confirm the potential for the hypothesis to explain observed spreads or bifurcations in the upper main sequence, blue stragglers, anomalous giants, and poor fits of main-sequence turnoffs by standard isochrones. Simple closed galactic chemical evolution models were used to test the effects of main-sequence mass loss on the F and G dwarf distribution. Stars between 3.0 M mass of sun and a metallicity-dependent lower mass are assumed to lose mass. The models produce a 30 to 60% increase in the stars to stars-plus-remnants ratio, with fewer early-F dwarfs and many more late-F dwarfs remaining on the main sequence to the present

  15. Management of the interplay effect when using dynamic MLC sequences to treat moving targets

    International Nuclear Information System (INIS)

    Court, Laurence E.; Wagar, Matthew; Ionascu, Dan; Berbeco, Ross; Chin, Lee

    2008-01-01

    Interplay between organ motion and leaf motion has been shown to generally have a small dosimetric impact for most clinical intensity-modulated radiation therapy treatments. However, it has also been shown that for some MLC sequences there can be large daily variations in the delivered dose, depending on details of patient motion or the number of fractions. This study investigates guidelines for dynamic MLC sequences that will keep daily dose variations due to the interplay between organ motion and leaf motion within 10%. Dose distributions for a range of MLC separations (0.2-5.0 cm) and displacements between adjacent MLCs (0-1.5 cm) were exported from ECLIPSE to purpose-written software, which simulated the dose distribution delivered to a moving target. Target motion parallel and perpendicular to the MLC motion was investigated for a range of amplitudes (0.5-4.0 cm), periods (1.5-10 s), and MLC speeds (0.1-3.0 cm/s) with target motions modeled as sin 6 . Results were confirmed experimentally by measuring the dose delivered to an ion chamber array in a moving phantom for different MLC sequences. The simulation results were used to identify MLC sequences that kept dose variations within 10% compared to the dose delivered with no motion. The maximum allowable MLC speed, when target motion is parallel to the MLC motion, was found to be a simple function of target period and MLC separation. When the target motion is perpendicular to MLC motion, the maximum allowable MLC speed can be described as a function of MLC separation and the displacement of adjacent MLCs. These guidelines were successfully applied to two-dimensional motion, and a simple program was written to import MLC sequence files and evaluate whether the maximum daily dose discrepancy caused by the interplay effect will be larger than 10%. This software was experimentally evaluated, and found to conservatively predict whether a given MLC sequence could give large daily dose discrepancies

  16. Effects of tonal language background on tests of temporal sequencing in children.

    Science.gov (United States)

    Mukari, Siti Zamratol-Mai S; Yu, Xuan; Ishak, Wan Syafira; Mazlan, Rafidah

    2015-01-01

    The aims of the present study were to determine the effects of language background on the performance of the pitch pattern sequence test (PPST) and duration pattern sequence test (DPST). As temporal order sequencing may be affected by age and working memory, these factors were also studied. Performance of tonal and non-tonal language speakers on PPST and DPST were compared. Twenty-eight native Mandarin (tonal language) speakers and twenty-nine native Malay (non-tonal language) speakers between seven to nine years old participated in this study. The results revealed that relative to native Malay speakers, native Mandarin speakers demonstrated better scores on the PPST in both humming and verbal labeling responses. However, a similar language effect was not apparent in the DPST. An age effect was only significant in the PPST (verbal labeling). Finally, no significant effect of working memory was found on the PPST and the DPST. These findings suggest that the PPST is affected by tonal language background, and highlight the importance of developing different normative values for tonal and non-tonal language speakers.

  17. The effect of cognitive aging on implicit sequence learning and dual tasking

    Directory of Open Access Journals (Sweden)

    Jochen eVandenbossche

    2014-02-01

    Full Text Available We investigated the influence of attentional demands on sequence-specific learning by means of the serial reaction time (SRT task (Nissen & Bullemer, 1987 in young (age 18-25 and aged (age 55-75 adults. Participants had to respond as fast as possible to a stimulus presented in one of four horizontal locations by pressing a key corresponding to the spatial position of the stimulus. During the training phase sequential blocks were accompanied by (1 no secondary task (single, (2 a secondary tone counting task (dual tone, or (3 a secondary shape counting task (dual shape. Both secondary tasks were administered to investigate whether low and high interference tasks interact with implicit learning and age. The testing phase, under baseline single condition, was implemented to assess differences in sequence-specific learning between young and aged adults. Results indicate that (1 aged subjects show less sequence learning compared to young adults, (2 young participants show similar implicit learning effects under both single and dual task conditions when we account for explicit awareness, and (3 aged adults demonstrate reduced learning when the primary task is accompanied with a secondary task, even when explicit awareness is included as a covariate in the analysis. These findings point to implicit learning deficits under dual task conditions that can be related to cognitive aging, demonstrating the need for sufficient cognitive resources while performing a sequence learning task.

  18. Effect of sequence dispersity on morphology of tapered diblock copolymers from molecular dynamics simulations.

    Science.gov (United States)

    Levine, William G; Seo, Youngmi; Brown, Jonathan R; Hall, Lisa M

    2016-12-21

    Tapered diblock copolymers are similar to typical AB diblock copolymers but have an added transition region between the two blocks which changes gradually in composition from pure A to pure B. This tapered region can be varied from 0% (true diblock) to 100% (gradient copolymer) of the polymer length, and this allows some control over the microphase separated domain spacing and other material properties. We perform molecular dynamics simulations of linearly tapered block copolymers with tapers of various lengths, initialized from fluids density functional theory predictions. To investigate the effect of sequence dispersity, we compare systems composed of identical polymers, whose taper has a fixed sequence that most closely approximates a linear gradient, with sequentially disperse polymers, whose sequences are created statistically to yield the appropriate ensemble average linear gradient. Especially at high segregation strength, we find clear differences in polymer conformations and microstructures between these systems. Importantly, the statistical polymers are able to find more favorable conformations given their sequence, for instance, a statistical polymer with a larger fraction of A than the median will tend towards the A lamellae. The conformations of the statistically different polymers can thus be less stretched, and these systems have higher overall density. Consequently, the lamellae formed by statistical polymers have smaller domain spacing with sharper interfaces.

  19. The Effect of Stress and Speech Rate on Vowel Coarticulation in Catalan Vowel-Consonant-Vowel Sequences

    Science.gov (United States)

    Recasens, Daniel

    2015-01-01

    Purpose: The goal of this study was to ascertain the effect of changes in stress and speech rate on vowel coarticulation in vowel-consonant-vowel sequences. Method: Data on second formant coarticulatory effects as a function of changing /i/ versus /a/ were collected for five Catalan speakers' productions of vowel-consonant-vowel sequences with the…

  20. Sequencing Effects of Balance and Plyometric Training on Physical Performance in Youth Soccer Athletes.

    Science.gov (United States)

    Hammami, Raouf; Granacher, Urs; Makhlouf, Issam; Behm, David G; Chaouachi, Anis

    2016-12-01

    Hammami, R, Granacher, U, Makhlouf, I, Behm, DG, and Chaouachi, A. Sequencing effects of balance and plyometric training on physical performance in youth soccer athletes. J Strength Cond Res 30(12): 3278-3289, 2016-Balance training may have a preconditioning effect on subsequent power training with youth. There are no studies examining whether the sequencing of balance and plyometric training has additional training benefits. The objective was to examine the effect of sequencing balance and plyometric training on the performance of 12- to 13-year-old athletes. Twenty-four young elite soccer players trained twice per week for 8 weeks either with an initial 4 weeks of balance training followed by 4 weeks of plyometric training (BPT) or 4 weeks of plyometric training proceeded by 4 weeks of balance training (PBT). Testing was conducted pre- and posttraining and included medicine ball throw; horizontal and vertical jumps; reactive strength; leg stiffness; agility; 10-, 20-, and 30-m sprints; Standing Stork balance test; and Y-Balance test. Results indicated that BPT provided significantly greater improvements with reactive strength index, absolute and relative leg stiffness, triple hop test, and a trend for the Y-Balance test (p = 0.054) compared with PBT. Although all other measures had similar changes for both groups, the average relative improvement for the BPT was 22.4% (d = 1.5) vs. 15.0% (d = 1.1) for the PBT. BPT effect sizes were greater with 8 of 13 measures. In conclusion, although either sequence of BPT or PBT improved jumping, hopping, sprint acceleration, and Standing Stork and Y-Balance, BPT initiated greater training improvements in reactive strength index, absolute and relative leg stiffness, triple hop test, and the Y-Balance test. BPT may provide either similar or superior performance enhancements compared with PBT.

  1. Theoretical evaluation of transcriptional pausing effect on the attenuation in trp leader sequence

    OpenAIRE

    Suzuki, H.; Kunisawa, T.; Otsuka, J.

    1986-01-01

    The effect of transcriptional pausing on attenuation is investigated theoretically on the basis of the attenuation control mechanism presented by Oxender et al. (Oxender, D. L., G. Zurawski, and C. Yanofsky, 1979, Proc. Natl. Acad. Sci. USA. 76:5524-5528). An extended stochastic model including the RNA polymerase pausing in the leader region is developed to calculate the probability of relative position between the RNA polymerase transcribing the trp leader sequence and the ribosome translati...

  2. Far-UV-induced dimeric photoproducts in short oligonucleotides: sequence effects

    International Nuclear Information System (INIS)

    Douki, T.; Zalizniak, T.; Cadet, J.

    1997-01-01

    Cyclobutane pyrimidine dimers and pyrimidine (6-4)pyrimidone adducts represent the two major classes of far-UV-induced DNA photoproducts. Because of the lack of appropriate detection methods for each individual photoproduct, little is known about the effect of the sequence on their formaiton. In the present work, the photoproduct distribution obtained upon exposure of a series of dinucleoside monophosphate to 254 nm light was determined. (author)

  3. SEAPATH: A microcomputer code for evaluating physical security effectiveness using adversary sequence diagrams

    International Nuclear Information System (INIS)

    Darby, J.L.

    1986-01-01

    The Adversary Sequence Diagram (ASD) concept was developed by Sandia National Laboratories (SNL) to examine physical security system effectiveness. Sandia also developed a mainframe computer code, PANL, to analyze the ASD. The authors have developed a microcomputer code, SEAPATH, which also analyzes ASD's. The Authors are supporting SNL in software development of the SAVI code; SAVI utilizes the SEAPATH algorithm to identify and quantify paths

  4. Extreme weather-year sequences have nonadditive effects on environmental nitrogen losses.

    Science.gov (United States)

    Iqbal, Javed; Necpalova, Magdalena; Archontoulis, Sotirios V; Anex, Robert P; Bourguignon, Marie; Herzmann, Daryl; Mitchell, David C; Sawyer, John E; Zhu, Qing; Castellano, Michael J

    2018-01-01

    The frequency and intensity of extreme weather years, characterized by abnormal precipitation and temperature, are increasing. In isolation, these years have disproportionately large effects on environmental N losses. However, the sequence of extreme weather years (e.g., wet-dry vs. dry-wet) may affect cumulative N losses. We calibrated and validated the DAYCENT ecosystem process model with a comprehensive set of biogeophysical measurements from a corn-soybean rotation managed at three N fertilizer inputs with and without a winter cover crop in Iowa, USA. Our objectives were to determine: (i) how 2-year sequences of extreme weather affect 2-year cumulative N losses across the crop rotation, and (ii) if N fertilizer management and the inclusion of a winter cover crop between corn and soybean mitigate the effect of extreme weather on N losses. Using historical weather (1951-2013), we created nine 2-year scenarios with all possible combinations of the driest ("dry"), wettest ("wet"), and average ("normal") weather years. We analyzed the effects of these scenarios following several consecutive years of relatively normal weather. Compared with the normal-normal 2-year weather scenario, 2-year extreme weather scenarios affected 2-year cumulative NO 3 - leaching (range: -93 to +290%) more than N 2 O emissions (range: -49 to +18%). The 2-year weather scenarios had nonadditive effects on N losses: compared with the normal-normal scenario, the dry-wet sequence decreased 2-year cumulative N 2 O emissions while the wet-dry sequence increased 2-year cumulative N 2 O emissions. Although dry weather decreased NO 3 - leaching and N 2 O emissions in isolation, 2-year cumulative N losses from the wet-dry scenario were greater than the dry-wet scenario. Cover crops reduced the effects of extreme weather on NO 3 - leaching but had a lesser effect on N 2 O emissions. As the frequency of extreme weather is expected to increase, these data suggest that the sequence of interannual weather

  5. The effect of music background on the emotional appraisal of film sequences

    Directory of Open Access Journals (Sweden)

    Pavlović Ivanka

    2011-01-01

    Full Text Available In this study the effects of musical background on the emotional appraisal of film sequences was investigated. Four pairs of polar emotions defined in Plutchik’s model were used as basic emotional qualities: joy-sadness, anticipation-surprise, fear-anger, and trust disgust. In the preliminary study eight film sequences and eight music themes were selected as the best representatives of all eight Plutchik’s emotions. In the main experiment the participant judged the emotional qualities of film-music combinations on eight seven-point scales. Half of the combinations were congruent (e.g. joyful film - joyful music, and half were incongruent (e.g. joyful film - sad music. Results have shown that visual information (film had greater effects on the emotion appraisal than auditory information (music. The modulation effects of music background depend on emotional qualities. In some incongruent combinations (joysadness the modulations in the expected directions were obtained (e.g. joyful music reduces the sadness of a sad film, in some cases (anger-fear no modulation effects were obtained, and in some cases (trust-disgust, anticipation-surprise the modulation effects were in an unexpected direction (e.g. trustful music increased the appraisal of disgust of a disgusting film. These results suggest that the appraisals of conjoint effects of emotions depend on the medium (film masks the music and emotional quality (three types of modulation effects.

  6. Effects on in vitro and in vivo angiogenesis induced by small peptides carrying adhesion sequences.

    Science.gov (United States)

    Conconi, Maria Teresa; Ghezzo, Francesca; Dettin, Monica; Urbani, Luca; Grandi, Claudio; Guidolin, Diego; Nico, Beatrice; Di Bello, Carlo; Ribatti, Domenico; Parnigotto, Pier Paolo

    2010-07-01

    It is well known that tumor growth is strictly dependent on neo-vessel formation inside the tumor mass and that cell adhesion is required to allow EC proliferation and migration inside the tumor. In this work, we have evaluated the in vitro and in vivo effects on angiogenesis of some peptides, originally designed to promote cell adhesion on biomaterials, containing RGD motif mediating cell adhesion via integrin receptors [RGD, GRGDSPK, and (GRGDSP)(4)K] or the heparin-binding sequence of human vitronectin that interacts with HSPGs [HVP(351-359)]. Cell adhesion, proliferation, migration, and capillary-like tube formation in Matrigel were determined on HUVECs, whereas the effects on in vivo angiogenesis were evaluated using the CAM assay. (GRGDSP)(4)K linear sequence inhibited cell adhesion, decreased cell proliferation, migration and morphogenesis in Matrigel, and induced anti-angiogenic responses on CAM at higher degree than that determined after incubation with RGD or GRGDSPK. Moreover, it counteracted both in vitro and in vivo the pro-angiogenic effects induced by the Fibroblast growth factor (FGF-2). On the other hand, HVP was not able to affect cell adhesion and appeared less effective than (GRGDSP)(4)K. Our data indicate that the activity of RGD-containing peptides is related to their adhesive properties, and their effects are modulated by the number of cell adhesion motifs and the aminoacidic residues next to these sequences. The anti-angiogenic properties of (GRGDSP)(4)K seem to depend on its interaction with integrins, whereas the effects of HVP may be partially due to an impairment of HSPGs/FGF-2.

  7. Effect of stacking sequence on mechanical properties neem wood veneer plastic composites

    Science.gov (United States)

    Nagamadhu, M.; Kumar, G. C. Mohan; Jeyaraj, P.

    2018-04-01

    This study investigates the effect of wood veneer stacking sequence on mechanical properties of neem wood polymer composite (WPC) experimentally. Wood laminated samples were fabricated by conventional hand layup technique in a mold and cured under pressure at room temperature and then post cured at elevated temperature. Initially, the tensile, flexural, and impact test were conducted to understand the effect of weight fraction of fiber on mechanical properties. The mechanical properties have increased with the weight fraction of fiber. Moreover the stacking sequence of neem wood plays an important role. As it has a significant impact on the mechanical properties. The results indicated that 0°/0° WPC shows highest mechanical properties as compared to other sequences (90°/90°, 0°/90°, 45°/90°, 45°/45°). The Fourier Transform Infrared Spectroscopy (FTIR) Analysis were carried out to identify chemical compounds both in raw neem wood and neem wood epoxy composite. The microstructure raw/neat neem wood and the interfacial bonding characteristics of neem wood composite investigated using Scanning electron microscopy images.

  8. Glucose oxidase-initiated cascade catalysis for sensitive impedimetric aptasensor based on metal-organic frameworks functionalized with Pt nanoparticles and hemin/G-quadruplex as mimicking peroxidases.

    Science.gov (United States)

    Zhou, Xingxing; Guo, Shijing; Gao, Jiaxi; Zhao, Jianmin; Xue, Shuyan; Xu, Wenju

    2017-12-15

    Based on cascade catalysis amplification driven by glucose oxidase (GOx), a sensitive electrochemical impedimetric aptasensor for protein (carcinoembryonic antigen, CEA as tested model) was proposed by using Cu-based metal-organic frameworks functionalized with Pt nanoparticles, aptamer, hemin and GOx (Pt@CuMOFs-hGq-GOx). CEA aptamer loaded onto Pt@CuMOFs was bound with hemin to form hemin@G-quadruplex (hGq) with mimicking peroxidase activity. Through sandwich-type reaction of target CEA and CEA aptamers (Apt1 and Apt2), the obtained Pt@CuMOFs-hGq-GOx as signal transduction probes (STPs) was captured to the modified electrode interface. When 3,3-diaminobenzidine (DAB) and glucose were introduced, the cascade reaction was initiated by GOx to catalyze the oxidation of glucose, in situ generating H 2 O 2 . Simultaneously, the decomposition of the generated H 2 O 2 was greatly promoted by Pt@CuMOFs and hGq as synergistic peroxide catalysts, accompanying with the significant oxidation process of DAB and the formation of nonconductive insoluble precipitates (IPs). As a result, the electron transfer in the resultant sensing interface was effectively hindered and the electrochemical impedimetric signal (EIS) was efficiently amplified. Thus, the high sensitivity of the proposed CEA aptasensor was successfully improved with 0.023pgmL -1 , which may be promising and potential in assaying certain clinical disease related to CEA. Copyright © 2017 Elsevier B.V. All rights reserved.

  9. Spectroscopic studies on the interactions of 5-ethyl-6-phenyl-3,8-bis((3-aminoalkyl)propanamido)phenanthridin-5-ium derivatives with G-quadruplex DNA

    Science.gov (United States)

    Yalçın, Ergin; Duyar, Halil; Ihmels, Heiko; Seferoğlu, Zeynel

    2018-05-01

    An improved microwave-induced synthesis of five ethidium derivatives (Ethidium derivatives, 2a-d) is presented. As the derivatives 2a-d have been proposed previously to be telomerase inhibitors, the binding interactions of these ethidium derivatives with G-quadruplex DNA were evaluated by means of photometric and fluorimetric titration, thermal DNA denaturation, CD and 1H NMR spectroscopy. In particular, the compound bearing 3,8-bis(pyrrolidin-1-yl)propanamido substituent 2a exhibits high selectivity for G-quadruplex DNA relative to duplex DNA.

  10. Flower bud transcriptome analysis of Sapium sebiferum (Linn. Roxb. and primary investigation of drought induced flowering: pathway construction and G-quadruplex prediction based on transcriptome.

    Directory of Open Access Journals (Sweden)

    Minglei Yang

    Full Text Available Sapium sebiferum (Linn. Roxb. (Chinese Tallow Tree is a perennial woody tree and its seeds are rich in oil which hold great potential for biodiesel production. Despite a traditional woody oil plant, our understanding on S. sebiferum genetics and molecular biology remains scant. In this study, the first comprehensive transcriptome of S. sebiferum flower has been generated by sequencing and de novo assembly. A total of 149,342 unigenes were generated from raw reads, of which 24,289 unigenes were successfully matched to public database. A total of 61 MADS box genes and putative pathways involved in S. sebiferum flower development have been identified. Abiotic stress response network was also constructed in this work, where 2,686 unigenes are involved in the pathway. As for lipid biosynthesis, 161 unigenes have been identified in fatty acid (FA and triacylglycerol (TAG biosynthesis. Besides, the G-Quadruplexes in RNA of S. sebiferum also have been predicted. An interesting finding is that the stress-induced flowering was observed in S. sebiferum for the first time. According to the results of semi-quantitative PCR, expression tendencies of flowering-related genes, GA1, AP2 and CRY2, accorded with stress-related genes, such as GRX50435 and PRXⅡ39562. This transcriptome provides functional genomic information for further research of S. sebiferum, especially for the genetic engineering to shorten the juvenile period and improve yield by regulating flower development. It also offers a useful database for the research of other Euphorbiaceae family plants.

  11. Mms1 is an assistant for regulating G-quadruplex DNA structures.

    Science.gov (United States)

    Schwindt, Eike; Paeschke, Katrin

    2017-11-02

    The preservation of genome stability is fundamental for every cell. Genomic integrity is constantly challenged. Among those challenges are also non-canonical nucleic acid structures. In recent years, scientists became aware of the impact of G-quadruplex (G4) structures on genome stability. It has been shown that folded G4-DNA structures cause changes in the cell, such as transcriptional up/down-regulation, replication stalling, or enhanced genome instability. Multiple helicases have been identified to regulate G4 structures and by this preserve genome stability. Interestingly, although these helicases are mostly ubiquitous expressed, they show specificity for G4 regulation in certain cellular processes (e.g., DNA replication). To this date, it is not clear how this process and target specificity of helicases are achieved. Recently, Mms1, an ubiquitin ligase complex protein, was identified as a novel G4-DNA-binding protein that supports genome stability by aiding Pif1 helicase binding to these regions. In this perspective review, we discuss the question if G4-DNA interacting proteins are fundamental for helicase function and specificity at G4-DNA structures.

  12. Quadruplex gold immunochromatogaraphic assay for four families of antibiotic residues in milk.

    Science.gov (United States)

    Zhou, Jinyu; Nie, Wei; Chen, Yiqiang; Yang, Chunjiang; Gong, Lu; Zhang, Chi; Chen, Qian; He, Lidong; Feng, Xiaoyu

    2018-08-01

    In this study, we developed a quadruplex gold immunochromatogaraphic assay (GICA) for the simultaneous determination of four families of antibiotics including β-lactams, tetracyclines, streptomycin and chloramphenicol in milk. For qualitative analysis, the visual cut-off values were measured to be 2-100 ng/mL, 16-32 ng/mL, 50 ng/mL and 2.4 ng/mL for β-lactams, tetracyclines, streptomycin and chloramphenicol, respectively. For quantitative analysis, the detection ranges were 0.13-1 ng/mL for penicillin G, 0.13-8 ng/mL for tetracycline, 0.78-25 ng/mL for streptomycin, 0.019-1.2 ng/mL for chloramphenicol in milk respectively, with linear correlation coefficients higher than 0.97. The spiked experiment indicated that the mean recoveries ranged from 84.5% to 107.6% with coefficient of variations less than 16.2%, and real sample analysis revealed that the GICA can produce consistent results with instrumental analysis. These results demonstrated that this novel immunoassay is a promising approach for rapidly screening common antibiotic residues in milk. Copyright © 2018 Elsevier Ltd. All rights reserved.

  13. Exploring the Dynamics of Propeller Loops in Human Telomeric DNA Quadruplexes Using Atomistic Simulations

    Science.gov (United States)

    2017-01-01

    We have carried out a series of extended unbiased molecular dynamics (MD) simulations (up to 10 μs long, ∼162 μs in total) complemented by replica-exchange with the collective variable tempering (RECT) approach for several human telomeric DNA G-quadruplex (GQ) topologies with TTA propeller loops. We used different AMBER DNA force-field variants and also processed simulations by Markov State Model (MSM) analysis. The slow conformational transitions in the propeller loops took place on a scale of a few μs, emphasizing the need for long simulations in studies of GQ dynamics. The propeller loops sampled similar ensembles for all GQ topologies and for all force-field dihedral-potential variants. The outcomes of standard and RECT simulations were consistent and captured similar spectrum of loop conformations. However, the most common crystallographic loop conformation was very unstable with all force-field versions. Although the loss of canonical γ-trans state of the first propeller loop nucleotide could be related to the indispensable bsc0 α/γ dihedral potential, even supporting this particular dihedral by a bias was insufficient to populate the experimentally dominant loop conformation. In conclusion, while our simulations were capable of providing a reasonable albeit not converged sampling of the TTA propeller loop conformational space, the force-field description still remained far from satisfactory. PMID:28475322

  14. Integration of G-quadruplex and DNA-templated Ag NCs for nonarithmetic information processing.

    Science.gov (United States)

    Gao, Ru-Ru; Yao, Tian-Ming; Lv, Xiao-Yan; Zhu, Yan-Yan; Zhang, Yi-Wei; Shi, Shuo

    2017-06-01

    To create sophisticated molecular logic circuits from scratch, you may not believe how common the building blocks can be and how diverse and powerful such circuits can be when scaled up. Using the two simple building blocks of G-quadruplex and silver nanoclusters (Ag NCs), we experimentally construct a series of multifunctional, label-free, and multi-output logic circuits to perform nonarithmetic functions: a 1-to-2 decoder, a 4-to-2 encoder, an 8-to-3 encoder, dual transfer gates, a 2 : 1 multiplexer, and a 1 : 2 demultiplexer. Moreover, a parity checker which is capable of identifying odd and even numbers from natural numbers is constructed conceptually. Finally, a multi-valued logic gate (ternary inhibit gate) is readily achieved by taking this DNA/Ag NC system as a universal platform. All of the above logic circuits share the same building blocks, indicating the great prospects of the assembly of nanomaterials and DNA for biochemical logic devices. Considering its biocompatibility, the novel prototypes developed here may have potential applications in the fields of biological computers and medical diagnosis and serve as a promising proof of principle in the not-too-distant future.

  15. G-quadruplexes Significantly Stimulate Pif1 Helicase-catalyzed Duplex DNA Unwinding*

    Science.gov (United States)

    Duan, Xiao-Lei; Liu, Na-Nv; Yang, Yan-Tao; Li, Hai-Hong; Li, Ming; Dou, Shuo-Xing; Xi, Xu-Guang

    2015-01-01

    The evolutionarily conserved G-quadruplexes (G4s) are faithfully inherited and serve a variety of cellular functions such as telomere maintenance, gene regulation, DNA replication initiation, and epigenetic regulation. Different from the Watson-Crick base-pairing found in duplex DNA, G4s are formed via Hoogsteen base pairing and are very stable and compact DNA structures. Failure of untangling them in the cell impedes DNA-based transactions and leads to genome instability. Cells have evolved highly specific helicases to resolve G4 structures. We used a recombinant nuclear form of Saccharomyces cerevisiae Pif1 to characterize Pif1-mediated DNA unwinding with a substrate mimicking an ongoing lagging strand synthesis stalled by G4s, which resembles a replication origin and a G4-structured flap in Okazaki fragment maturation. We find that the presence of G4 may greatly stimulate the Pif1 helicase to unwind duplex DNA. Further studies reveal that this stimulation results from G4-enhanced Pif1 dimerization, which is required for duplex DNA unwinding. This finding provides new insights into the properties and functions of G4s. We discuss the observed activation phenomenon in relation to the possible regulatory role of G4s in the rapid rescue of the stalled lagging strand synthesis by helping the replicator recognize and activate the replication origin as well as by quickly removing the G4-structured flap during Okazaki fragment maturation. PMID:25627683

  16. Long-range charge transport in single G-quadruplex DNA molecules

    DEFF Research Database (Denmark)

    Livshits, Gideon I.; Stern, Avigail; Rotem, Dvir

    2014-01-01

    DNA and DNA-based polymers are of interest in molecular electronics because of their versatile and programmable structures. However, transport measurements have produced a range of seemingly contradictory results due to differences in the measured molecules and experimental set-ups, and transport......DNA and DNA-based polymers are of interest in molecular electronics because of their versatile and programmable structures. However, transport measurements have produced a range of seemingly contradictory results due to differences in the measured molecules and experimental set......-ups, and transporting significant current through individual DNA-based molecules remains a considerable challenge. Here, we report reproducible charge transport in guanine-quadruplex (G4) DNA molecules adsorbed on a mica substrate. Currents ranging from tens of picoamperes to more than 100 pA were measured in the G4......-DNA over distances ranging from tens of nanometres to more than 100 nm. Our experimental results, combined with theoretical modelling, suggest that transport occurs via a thermally activated long-range hopping between multi-tetrad segments of DNA. These results could re-ignite interest in DNA...

  17. Effects of Main-Sequence Mass Loss on Stellar and Galactic Chemical Evolution.

    Science.gov (United States)

    Guzik, Joyce Ann

    1988-06-01

    L. A. Willson, G. H. Bowen and C. Struck -Marcell have proposed that 1 to 3 solar mass stars may experience evolutionarily significant mass loss during the early part of their main-sequence phase. The suggested mass-loss mechanism is pulsation, facilitated by rapid rotation. Initial mass-loss rates may be as large as several times 10^{-9}M o/yr, diminishing over several times 10^8 years. We attempted to test this hypothesis by comparing some theoretical implications with observations. Three areas are addressed: Solar models, cluster HR diagrams, and galactic chemical evolution. Mass-losing solar models were evolved that match the Sun's luminosity and radius at its present age. The most extreme viable models have initial mass 2.0 M o, and mass-loss rates decreasing exponentially over 2-3 times 10^8 years. Compared to a constant -mass model, these models require a reduced initial ^4He abundance, have deeper envelope convection zones and higher ^8B neutrino fluxes. Early processing of present surface layers at higher interior temperatures increases the surface ^3He abundance, destroys Li, Be and B, and decreases the surface C/N ratio following first dredge-up. Evolution calculations incorporating main-sequence mass loss were completed for a grid of models with initial masses 1.25 to 2.0 Mo and mass loss timescales 0.2 to 2.0 Gyr. Cluster HR diagrams synthesized with these models confirm the potential for the hypothesis to explain observed spreads or bifurcations in the upper main sequence, blue stragglers, anomalous giants, and poor fits of main-sequence turnoffs by standard isochrones. Simple closed galactic chemical evolution models were used to test the effects of main-sequence mass loss on the F and G dwarf distribution. Stars between 3.0 M o and a metallicity -dependent lower mass are assumed to lose mass. The models produce a 30 to 60% increase in the stars to stars-plus -remnants ratio, with fewer early-F dwarfs and many more late-F dwarfs remaining on the main

  18. Effect of the SH3-SH2 domain linker sequence on the structure of Hck kinase.

    Science.gov (United States)

    Meiselbach, Heike; Sticht, Heinrich

    2011-08-01

    The coordination of activity in biological systems requires the existence of different signal transduction pathways that interact with one another and must be precisely regulated. The Src-family tyrosine kinases, which are found in many signaling pathways, differ in their physiological function despite their high overall structural similarity. In this context, the differences in the SH3-SH2 domain linkers might play a role for differential regulation, but the structural consequences of linker sequence remain poorly understood. We have therefore performed comparative molecular dynamics simulations of wildtype Hck and of a mutant Hck in which the SH3-SH2 domain linker is replaced by the corresponding sequence from the homologous kinase Lck. These simulations reveal that linker replacement not only affects the orientation of the SH3 domain itself, but also leads to an alternative conformation of the activation segment in the Hck kinase domain. The sequence of the SH3-SH2 domain linker thus exerts a remote effect on the active site geometry and might therefore play a role in modulating the structure of the inactive kinase or in fine-tuning the activation process itself.

  19. [Effect of the 10 kb sequence of piscine Streptococcus agalactiae on bacterial virulence].

    Science.gov (United States)

    Liu, Guangjin; Zhu, Jielian; Shi, Ziwei; Ding, Ming; Wang, Ruyi; Yao, Huochun; Lu, Chengping; Xu, Pao

    2016-01-04

    From the previous comparative genomic analysis, we found a specific unknown 10 kb sequence (including 11 Open reading Frames) in Chinese piscine strain GD201008-001 genome. To study the role of 10 kb in the pathogenicity of piscine S. agalactiae, the 10 kb sequence was deleted from the GD201008-001 genome. The isogenic mutant Δ10 kb was constructed by using the temperature-sensitive Streptococcus-E. coli shuttle vector pSET4s. We compared the growth characteristics, adherence to HEp-2 cell and bacterial virulence in a zebrafish infection model between wild strain and mutant. Meanwhile the expressions of the known virulence genes from GD201008-001 and Δ10 kb were also quantified by real-time PCR. The Δ10 kb showed no significant differences in bacterial morphology and adherence to HEp-2 cells compared with the wild-type strain, but the speed of growth was slightly slower than the wild strain. Furthermore the 50% lethal dose of Δ10 kb was decreased up to 10-fold (P kb sequence of piscine Streptococcus agalactiae exerts a significant effect on bacterial virulence and probably regulates the virulence genes expression of GD20 1008-001.

  20. The Effects of Meiosis/Genetics Integration and Instructional Sequence on College Biology Student Achievement in Genetics.

    Science.gov (United States)

    Browning, Mark

    The purpose of the research was to manipulate two aspects of genetics instruction in order to measure their effects on college, introductory biology students' achievement in genetics. One instructional sequence that was used dealt first with monohybrid autosomal inheritance patterns, then sex-linkage. The alternate sequence was the reverse.…

  1. Effect of sequence and stereochemistry reversal on p53 peptide mimicry.

    Directory of Open Access Journals (Sweden)

    Alessio Atzori

    Full Text Available Peptidomimetics effective in modulating protein-protein interactions and resistant to proteolysis have potential in therapeutic applications. An appealing yet underperforming peptidomimetic strategy is to employ D-amino acids and reversed sequences to mimic a lead peptide conformation, either separately or as the combined retro-inverso peptide. In this work, we examine the conformations of inverse, reverse and retro-inverso peptides of p53(15-29 using implicit solvent molecular dynamics simulation and circular dichroism spectroscopy. In order to obtain converged ensembles for the peptides, we find enhanced sampling is required via the replica exchange molecular dynamics method. From these replica exchange simulations, the D-peptide analogues of p53(15-29 result in a predominantly left-handed helical conformation. When the parent sequence is reversed sequence as either the L-peptide and D-peptide, these peptides display a greater helical propensity, feature reflected by NMR and CD studies in TFE/water solvent. The simulations also indicate that, while approximately similar orientations of the side-chains are possible by the peptide analogues, their ability to mimic the parent peptide is severely compromised by backbone orientation (for D-amino acids and side-chain orientation (for reversed sequences. A retro-inverso peptide is disadvantaged as a mimic in both aspects, and further chemical modification is required to enable this concept to be used fruitfully in peptidomimetic design. The replica exchange molecular simulation approach adopted here, with its ability to provide detailed conformational insights into modified peptides, has potential as a tool to guide structure-based design of new improved peptidomimetics.

  2. Effects of loading sequences and size of repeated stress block of loads on fatigue life calculated using fatigue functions

    International Nuclear Information System (INIS)

    Schott, G.

    1989-01-01

    It is well-known that collective form, stress intensity and loading sequence of individual stresses as well as size of repeated stress blocks can influence fatigue life, significantly. The basic variant of the consecutive Woehler curve concept will permit these effects to be involved into fatigue life computation. The paper presented will demonstrate that fatigue life computations using fatigue functions reflect the loading sequence effect with multilevel loading precisely and provide reliable fatigue life data. Effects of size of repeated stress block and loading sequence on fatigue life as observed with block program tests can be reproduced using the new computation method. (orig.) [de

  3. Genepleio software for effective estimation of gene pleiotropy from protein sequences.

    Science.gov (United States)

    Chen, Wenhai; Chen, Dandan; Zhao, Ming; Zou, Yangyun; Zeng, Yanwu; Gu, Xun

    2015-01-01

    Though pleiotropy, which refers to the phenomenon of a gene affecting multiple traits, has long played a central role in genetics, development, and evolution, estimation of the number of pleiotropy components remains a hard mission to accomplish. In this paper, we report a newly developed software package, Genepleio, to estimate the effective gene pleiotropy from phylogenetic analysis of protein sequences. Since this estimate can be interpreted as the minimum pleiotropy of a gene, it is used to play a role of reference for many empirical pleiotropy measures. This work would facilitate our understanding of how gene pleiotropy affects the pattern of genotype-phenotype map and the consequence of organismal evolution.

  4. Identifying transposon insertions and their effects from RNA-sequencing data.

    Science.gov (United States)

    de Ruiter, Julian R; Kas, Sjors M; Schut, Eva; Adams, David J; Koudijs, Marco J; Wessels, Lodewyk F A; Jonkers, Jos

    2017-07-07

    Insertional mutagenesis using engineered transposons is a potent forward genetic screening technique used to identify cancer genes in mouse model systems. In the analysis of these screens, transposon insertion sites are typically identified by targeted DNA-sequencing and subsequently assigned to predicted target genes using heuristics. As such, these approaches provide no direct evidence that insertions actually affect their predicted targets or how transcripts of these genes are affected. To address this, we developed IM-Fusion, an approach that identifies insertion sites from gene-transposon fusions in standard single- and paired-end RNA-sequencing data. We demonstrate IM-Fusion on two separate transposon screens of 123 mammary tumors and 20 B-cell acute lymphoblastic leukemias, respectively. We show that IM-Fusion accurately identifies transposon insertions and their true target genes. Furthermore, by combining the identified insertion sites with expression quantification, we show that we can determine the effect of a transposon insertion on its target gene(s) and prioritize insertions that have a significant effect on expression. We expect that IM-Fusion will significantly enhance the accuracy of cancer gene discovery in forward genetic screens and provide initial insight into the biological effects of insertions on candidate cancer genes. © The Author(s) 2017. Published by Oxford University Press on behalf of Nucleic Acids Research.

  5. Effect of different salt adaptation strategies on the microbial diversity, activity, and settling of nitrifying sludge in sequencing batch reactors

    NARCIS (Netherlands)

    Bassin, J.P.; Kleerebezem, R.; Muyzer, G.; Rosado, A.S.; Van Loosdrecht, M.C.M.; Dezotti, M.

    2011-01-01

    The effect of salinity on the activity of nitrifying bacteria, floc characteristics, and microbial community structure accessed by fluorescent in situ hybridization and polymerase chain reaction–denaturing gradient gel electrophoresis techniques was investigated. Two sequencing batch reactors (SRB1

  6. The effect of cropping sequence on the crop yield and nutrient availability

    International Nuclear Information System (INIS)

    Sisworo, W.H.; Rasjid, H.

    1988-01-01

    A two seasons field experiment was conducted to study the carry over effect of previous crop on the succeeding crop yield and plan nutrient (N and P) availability. The experiment consisted of eight treatments were arranged in a randomized block design with six resplications. Cropping sequence was studied that was soybean followed by corn and a continuous corn system. The effect of added P to the previous crops on the succeeding crops yield was also observed. Labelled fertilizer were used in the experiment to measure dinitrogen fixation of two soybean varieties and the amount of available nutrient in the soil by using isotopic dilution technique. The result obtained showed that corn yield was significantly influenced by cropping sequence, but available nutrient was not. Corn grown after soybean produced about 22 percent more grain than those of the continuous corn system. The phosphorus applied to the first season crops increased significantly the succeeding corn yield. The highest amount of accumulation in soybean was 81 kg N/h, around 40 percent of the amount was obtained through fixation. (authors). 19 refs.; 8 tabs

  7. Porous platinum nanotubes labeled with hemin/G-quadruplex based electrochemical aptasensor for sensitive thrombin analysis via the cascade signal amplification.

    Science.gov (United States)

    Sun, Aili; Qi, Qingan; Wang, Xuannian; Bie, Ping

    2014-07-15

    For the first time, a sensitive electrochemical aptasensor for thrombin (TB) was developed by using porous platinum nanotubes (PtNTs) labeled with hemin/G-quadruplex and glucose dehydrogenase (GDH) as labels. Porous PtNTs with large surface area exhibited the peroxidase-like activity. Coupling with GDH and hemin/G-quadruplex as NADH oxidase and HRP-mimicking DNAzyme, the cascade signal amplification was achieved by the following ways: in the presence of glucose and NAD(+) in the working buffer, GDH electrocatalyzed the oxidation of glucose with the production of NADH. Then, hemin/G-quadruplex as NADH oxidase catalyzed the oxidation of NADH to in situ generate H2O2. Based on the corporate electrocatalysis of PtNTs and hemin/G-quadruplex toward H2O2, the electrochemical signal was significantly amplified, allowing the detection limit of TB down to 0.15 pM level. Moreover, the proposed strategy was simple because the intercalated hemin offered the readout signal, avoiding the adding of additional redox mediator as signal donator. Such an electrochemical aptasensor is highly promising for sensitive detection of other proteins in clinical diagnostics. Copyright © 2014 Elsevier B.V. All rights reserved.

  8. G-quadruplex-based structural transitions in 15-mer DNA oligonucleotides varying in lengths of internal oligo(dG) stretches detected by voltammetric techniques

    Czech Academy of Sciences Publication Activity Database

    Vidláková, Pavlína; Pivoňková, Hana; Kejnovská, Iva; Trnková, L.; Vorlíčková, Michaela; Fojta, Miroslav; Havran, Luděk

    2015-01-01

    Roč. 407, č. 19 (2015), s. 5817-5826 ISSN 1618-2642 R&D Projects: GA ČR GAP206/12/2378 Institutional support: RVO:68081707 Keywords : Oligonucleotides * Electrochemical methods * G-quadruplex Subject RIV: BO - Biophysics Impact factor: 3.125, year: 2015

  9. Voltammetry and Molecular Assembly of G-quadruplex DNAzyme on Single-crystal Au(111)-electrode Surfaces – Hemin as an Electrochemical Intercalator

    DEFF Research Database (Denmark)

    Zhang, Ling; Ulstrup, Jens; Zhang, Jingdong

    2016-01-01

    DNA quadruplexes (qs’s) are a class of “non-canonical” oligonucleotides (OGNs) composed of stacked guanine (G) quartets generally stabilized by monovalent cations. Metal porphyrins selectively bind to G-qs complexes to form DNAzyme, which can exhibit peroxidase and other catalytic activity simila...

  10. Ligand binding to telomeric G-quadruplex DNA investigated by funnel-metadynamics simulations.

    Science.gov (United States)

    Moraca, Federica; Amato, Jussara; Ortuso, Francesco; Artese, Anna; Pagano, Bruno; Novellino, Ettore; Alcaro, Stefano; Parrinello, Michele; Limongelli, Vittorio

    2017-03-14

    G-quadruplexes (G4s) are higher-order DNA structures typically present at promoter regions of genes and telomeres. Here, the G4 formation decreases the replicative DNA at each cell cycle, finally leading to apoptosis. The ability to control this mitotic clock, particularly in cancer cells, is fascinating and passes through a rational understanding of the ligand/G4 interaction. We demonstrate that an accurate description of the ligand/G4 binding mechanism is possible using an innovative free-energy method called funnel-metadynamics (FM), which we have recently developed to investigate ligand/protein interaction. Using FM simulations, we have elucidated the binding mechanism of the anticancer alkaloid berberine to the human telomeric G4 ( d [AG 3 (T 2 AG 3 ) 3 ]), computing also the binding free-energy landscape. Two ligand binding modes have been identified as the lowest energy states. Furthermore, we have found prebinding sites, which are preparatory to reach the final binding mode. In our simulations, the ions and the water molecules have been explicitly represented and the energetic contribution of the solvent during ligand binding evaluated. Our theoretical results provide an accurate estimate of the absolute ligand/DNA binding free energy ([Formula: see text] = -10.3 ± 0.5 kcal/mol) that we validated through steady-state fluorescence binding assays. The good agreement between the theoretical and experimental value demonstrates that FM is a most powerful method to investigate ligand/DNA interaction and can be a useful tool for the rational design also of G4 ligands.

  11. A light-up probe targeting for Bcl-2 2345 G-quadruplex DNA with carbazole TO

    Science.gov (United States)

    Gu, Yingchun; Lin, Dayong; Tang, Yalin; Fei, Xuening; Wang, Cuihong; Zhang, Baolian; Zhou, Jianguo

    2018-02-01

    As its significant role, the selective recognition of G-quadruplex with specific structures and functions is important in biological and medicinal chemistry. Carbazole derivatives have been reported as a kind of fluorescent probe with many excellent optical properties. In the present study, the fluorescence of the dye (carbazole TO) increased almost 70 fold in the presence of bcl-2 2345 G4 compared to that alone in aqueous buffer condition with almost no fluorescence and 10-30 fold than those in the presence of other DNAs. The binding study results by activity inhibition of G4/Hemin peroxidase experiment, NMR titration and molecular docking simulation showed the high affinity and selectivity to bcl-2 2345 G4 arises from its end-stacking interaction with G-quartet. It is said that a facile approach with excellent sensitive, good selectivity and quick response for bcl-2 2345 G-quadruplex was developed and may be used for antitumor recognition or antitumor agents.

  12. Effects of aging and freezing/thawing sequence on quality attributes of bovine and

    Directory of Open Access Journals (Sweden)

    Hyun-Wook Kim

    2017-02-01

    Full Text Available Objective The effects of aging and freezing/thawing sequence on color, physicochemical, and enzymatic characteristics of two beef muscles (Mm. gluteus medius, GM and biceps femoris, BF were evaluated. Methods Beef muscles at 3 d postmortem were assigned to four different combinations of aging and freezing/thawing sequence as follows; aging at 2°C for 3 wk (A3, never-frozen control, freezing at −28°C for 2 wk then thawing (F2, frozen/thawed-only, aging at 2°C for 3 wk, freezing at −28°C for 2 wk then thawing (A3F2, and freezing at −28°C for 2 wk, thawing then further aging at 2°C for 3 wk (F2A3. Results No significant interactions between different aging/freezing/thawing treatments and muscle type on all measurements were found. Postmortem aging, regardless of aging/freezing/thawing sequence, had no impact on color stability of frozen/thawed beef muscles (p<0.05. F2A3 resulted in higher purge loss than F2 and A3F2 treatments (p<0.05. A3F2 and F2A3 treatments resulted in lower shear force of beef muscles compared to F2 (p<0.05. Although there was no significant difference in glutathione peroxidase (GSH-Px activity, F2A3 had the highest β-N-acetyl glucominidase (BNAG activity in purge, but the lowest BNAG activity in muscle (p<0.05. GM muscle exhibited higher total color changes and purge loss, and lower GSH-Px activity than BF muscle. Conclusion The results from this present study indicate that different combinations of aging/freezing/thawing sequence would result in considerable impacts on meat quality attributes, particularly thaw/purge loss and tenderness. Developing a novel freezing strategy combined with postmortem aging will be beneficial for the food/meat industry to maximize its positive impacts on tenderness, while minimizing thaw/purge loss of frozen/thawed meat.

  13. Effect of energy level sequences and neutron–proton interaction on α-particle preformation probability

    International Nuclear Information System (INIS)

    Ismail, M.; Adel, A.

    2013-01-01

    A realistic density-dependent nucleon–nucleon (NN) interaction with finite-range exchange part which produces the nuclear matter saturation curve and the energy dependence of the nucleon–nucleus optical model potential is used to calculate the preformation probability, S α , of α-decay from different isotones with neutron numbers N=124,126,128,130 and 132. We studied the variation of S α with the proton number, Z, for each isotone and found the effect of neutron and proton energy levels of parent nuclei on the behavior of the α-particle preformation probability. We found that S α increases regularly with the proton number when the proton pair in α-particle is emitted from the same level and the neutron level sequence is not changed during the Z-variation. In this case the neutron–proton (n–p) interaction of the two levels, contributing to emission process, is too small. On the contrary, if the proton or neutron level sequence is changed during the emission process, S α behaves irregularly, the irregular behavior increases if both proton and neutron levels are changed. This behavior is accompanied by change or rapid increase in the strength of n–p interaction

  14. Heath Effects Sequence of Meet Halfa Radiological Accident After Twelve Years

    International Nuclear Information System (INIS)

    Shabon, M.H.

    2013-01-01

    The accident of Meet-Halfa developed consequent upon the loss of an industrial gamma radiography source. The source was found by a farmer resident of Meet-Halfa who took it to his house occupied by his family. The sequence of events developed over a period of seven weeks from the time the source was found on May 5, 2000, till the day of its retrieval from the house by the national authorities on June 26. The protracted exposure patterns of the family members during the period of source possession are not precisely known, however these exposures resulted in two fatalities, clinical forms of bone marrow depression, and several skin burns of different severities. The recent sequences of the accident is as follows:-The three survived siblings married and get good children. That mean there is no hereditary stochastic effects. The sister died at 2007 with 72 years old with senility and no specific disease. The youngest daughter amputate the left thumb and index fingers at 2001. The elder son amputate the terminal phalanx of the right thumb at 2009. The youngest daughter amputate the right index finger at 2009. The elder son graft the burn at the lower right quadrant of the abdomen for more than 20 times (3 of them were in the Mansheat Al-Bakry Millitary Hospital), but there is residual of burn untill now. Sever abdominal hernia in the elder son due to necroses in the right quadrant abdominal muscles. Grafting for these muscles occur but failed.

  15. Effects of chlortetracycline amended feed on anaerobic sequencing batch reactor performance of swine manure digestion.

    Science.gov (United States)

    Dreher, Teal M; Mott, Henry V; Lupo, Christopher D; Oswald, Aaron S; Clay, Sharon A; Stone, James J

    2012-12-01

    The effects of antimicrobial chlortetracycline (CTC) on the anaerobic digestion (AD) of swine manure slurry using anaerobic sequencing batch reactors (ASBRs) was investigated. Reactors were loaded with manure collected from pigs receiving CTC and no-antimicrobial amended diets at 2.5 g/L/d. The slurry was intermittently fed to four 9.5L lab-scale anaerobic sequencing batch reactors, two with no-antimicrobial manure, and two with CTC-amended manure, and four 28 day ASBR cycles were completed. The CTC concentration within the manure was 2 8 mg/L immediately after collection and 1.02 mg/L after dilution and 250 days of storage. CTC did not inhibit ASBR biogas production extent, however the volumetric composition of methane was significantly less (approximately 13% and 15% for cycles 1 and 2, respectively) than the no-antimicrobial through 56 d. CTC decreased soluble chemical oxygen demand and acetic acid utilization through 56 d, after which acclimation to CTC was apparent for the duration of the experiment. Copyright © 2012 Elsevier Ltd. All rights reserved.

  16. Shake Table Study on the Effect of Mainshock-Aftershock Sequences on Structures with SFSI

    Directory of Open Access Journals (Sweden)

    Xiaoyang Qin

    2017-01-01

    Full Text Available Observations from recent earthquakes have emphasised the need for a better understanding of the effects of structure-footing-soil interaction on the response of structures. In order to incorporate the influences of soil, a laminar box can be used to contain the soil during experiments. The laminar box simulates field boundary conditions by allowing the soil to shear during shake table tests. A holistic response of a structure and supporting soil can thus be obtained by placing a model structure on the surface of the soil in the laminar box. This work reveals the response of structure with SFSI under mainshock and aftershock earthquake sequences. A large (2 m by 2 m laminar box, capable of simulating the behaviour of both dry and saturated soils, was constructed. A model structure was placed on dry sand in the laminar box. The setup was excited by a sequence of earthquake excitations. The first excitation was used to obtain the response of the model on sand under the mainshock of an earthquake. The second and third excitations represented the first and second aftershocks, respectively.

  17. Effect of Generalized Uncertainty Principle on Main-Sequence Stars and White Dwarfs

    Directory of Open Access Journals (Sweden)

    Mohamed Moussa

    2015-01-01

    Full Text Available This paper addresses the effect of generalized uncertainty principle, emerged from different approaches of quantum gravity within Planck scale, on thermodynamic properties of photon, nonrelativistic ideal gases, and degenerate fermions. A modification in pressure, particle number, and energy density are calculated. Astrophysical objects such as main-sequence stars and white dwarfs are examined and discussed as an application. A modification in Lane-Emden equation due to a change in a polytropic relation caused by the presence of quantum gravity is investigated. The applicable range of quantum gravity parameters is estimated. The bounds in the perturbed parameters are relatively large but they may be considered reasonable values in the astrophysical regime.

  18. Genepleio Software for Effective Estimation of Gene Pleiotropy from Protein Sequences

    Directory of Open Access Journals (Sweden)

    Wenhai Chen

    2015-01-01

    Full Text Available Though pleiotropy, which refers to the phenomenon of a gene affecting multiple traits, has long played a central role in genetics, development, and evolution, estimation of the number of pleiotropy components remains a hard mission to accomplish. In this paper, we report a newly developed software package, Genepleio, to estimate the effective gene pleiotropy from phylogenetic analysis of protein sequences. Since this estimate can be interpreted as the minimum pleiotropy of a gene, it is used to play a role of reference for many empirical pleiotropy measures. This work would facilitate our understanding of how gene pleiotropy affects the pattern of genotype-phenotype map and the consequence of organismal evolution.

  19. A model of human motor sequence learning explains facilitation and interference effects based on spike-timing dependent plasticity.

    Directory of Open Access Journals (Sweden)

    Quan Wang

    2017-08-01

    Full Text Available The ability to learn sequential behaviors is a fundamental property of our brains. Yet a long stream of studies including recent experiments investigating motor sequence learning in adult human subjects have produced a number of puzzling and seemingly contradictory results. In particular, when subjects have to learn multiple action sequences, learning is sometimes impaired by proactive and retroactive interference effects. In other situations, however, learning is accelerated as reflected in facilitation and transfer effects. At present it is unclear what the underlying neural mechanism are that give rise to these diverse findings. Here we show that a recently developed recurrent neural network model readily reproduces this diverse set of findings. The self-organizing recurrent neural network (SORN model is a network of recurrently connected threshold units that combines a simplified form of spike-timing dependent plasticity (STDP with homeostatic plasticity mechanisms ensuring network stability, namely intrinsic plasticity (IP and synaptic normalization (SN. When trained on sequence learning tasks modeled after recent experiments we find that it reproduces the full range of interference, facilitation, and transfer effects. We show how these effects are rooted in the network's changing internal representation of the different sequences across learning and how they depend on an interaction of training schedule and task similarity. Furthermore, since learning in the model is based on fundamental neuronal plasticity mechanisms, the model reveals how these plasticity mechanisms are ultimately responsible for the network's sequence learning abilities. In particular, we find that all three plasticity mechanisms are essential for the network to learn effective internal models of the different training sequences. This ability to form effective internal models is also the basis for the observed interference and facilitation effects. This suggests that

  20. Site Effects Study In Athens (greece) Using The 7th September 1999 Earthquake Aftershock Sequence

    Science.gov (United States)

    Serpetsidaki, A.; Sokos, E.

    On 7 September 1999 at 11:56:50 GMT, an earthquake of Mw=5.9 occurred at Athens capital of Greece. The epicenter was located in the Northwest area of Parnitha Moun- tain at 18km distance from the city centre. This earthquake was one of the most de- structive in Greece during the modern times. The intensity of the earthquake reached IX in the Northwest territories of the city and caused the death of 143 people and seri- ous structural damage in many buildings. On the 13th of September the Seismological Laboratory of Patras University, installed a seismic network of 30 stations in order to observe the evolution of the aftershock sequence. This temporary seismic network remained in the area of Attika for 50 days and recorded a significant part of the af- tershock sequence. In this paper we use the high quality recordings of this network to investigate the influence of the surface geology to the seismic motion, on sites within the epicentral area, which suffered the most during this earthquake. We applied the horizontal-to-vertical (H/V) spectral ratio method on noise and on earthquake records and the obtained results exhibit very good agreement. Finally we compare the results with the geological conditions of the study area and the damage distribution. Most of the obtained amplification levels were low with an exemption in the site of Ano Liosia were a significant amount of damage was observed and the results indicate that the earthquake motion was amplified four times. Based on the above we conclude that the damages in the city of Athens were due to source effects rather than site effects.

  1. A look at the effect of sequence complexity on pressure destabilisation of DNA polymers.

    Science.gov (United States)

    Rayan, Gamal; Macgregor, Robert B

    2015-04-01

    Our previous studies on the helix-coil transition of double-stranded DNA polymers have demonstrated that molar volume change (ΔV) accompanying the thermally-induced transition can be positive or negative depending on the experimental conditions, that the pressure-induced transition is more cooperative than the heat-induced transition [Rayan and Macgregor, J Phys Chem B2005, 109, 15558-15565], and that the pressure-induced transition does not occur in the absence of water [Rayan and Macgregor, Biophys Chem, 2009, 144, 62-66]. Additionally, we have shown that ΔV values obtained by pressure-dependent techniques differ from those obtained by ambient pressure techniques such as PPC [Rayan et al. J Phys Chem B2009, 113, 1738-1742] thus shedding light on the effects of pressure on DNA polymers. Herein, we examine the effect of sequence complexity, and hence cooperativity on pressure destabilisation of DNA polymers. Working with Clostridium perfringes DNA under conditions such that the estimated ΔV of the helix-coil transition corresponds to -1.78 mL/mol (base pair) at atmospheric pressure, we do not observe the pressure-induced helix-coil transition of this DNA polymer, whereas synthetic copolymers poly[d(A-T)] and poly[d(I-C)] undergo cooperative pressure-induced transitions at similar ΔV values. We hypothesise that the reason for the lack of pressure-induced helix-coil transition of C. perfringens DNA under these experimental conditions lies in its sequence complexity. Copyright © 2015 Elsevier B.V. All rights reserved.

  2. Whole exome sequencing in neurogenetic odysseys: An effective, cost- and time-saving diagnostic approach.

    Directory of Open Access Journals (Sweden)

    Marta Córdoba

    Full Text Available Diagnostic trajectories for neurogenetic disorders frequently require the use of considerable time and resources, exposing patients and families to so-called "diagnostic odysseys". Previous studies have provided strong evidence for increased diagnostic and clinical utility of whole-exome sequencing in medical genetics. However, specific reports assessing its utility in a setting such as ours- a neurogeneticist led academic group serving in a low-income country-are rare.To assess the diagnostic yield of WES in patients suspected of having a neurogenetic condition and explore the cost-effectiveness of its implementation in a research group located in an Argentinean public hospital.This is a prospective study of the clinical utility of WES in a series of 40 consecutive patients selected from a Neurogenetic Clinic of a tertiary Hospital in Argentina. We evaluated patients retrospectively for previous diagnostic trajectories. Diagnostic yield, clinical impact on management and economic diagnostic burden were evaluated.We demonstrated the clinical utility of Whole Exome Sequencing in our patient cohort, obtaining a diagnostic yield of 40% (95% CI, 24.8%-55.2% among a diverse group of neurological disorders. The average age at the time of WES was 23 (range 3-70. The mean time elapsed from symptom onset to WES was 11 years (range 3-42. The mean cost of the diagnostic workup prior to WES was USD 1646 (USD 1439 to 1853, which is 60% higher than WES cost in our center.WES for neurogenetics proved to be an effective, cost- and time-saving approach for the molecular diagnosis of this heterogeneous and complex group of patients.

  3. Inferring Fitness Effects from Time-Resolved Sequence Data with a Delay-Deterministic Model.

    Science.gov (United States)

    Nené, Nuno R; Dunham, Alistair S; Illingworth, Christopher J R

    2018-05-01

    A common challenge arising from the observation of an evolutionary system over time is to infer the magnitude of selection acting upon a specific genetic variant, or variants, within the population. The inference of selection may be confounded by the effects of genetic drift in a system, leading to the development of inference procedures to account for these effects. However, recent work has suggested that deterministic models of evolution may be effective in capturing the effects of selection even under complex models of demography, suggesting the more general application of deterministic approaches to inference. Responding to this literature, we here note a case in which a deterministic model of evolution may give highly misleading inferences, resulting from the nondeterministic properties of mutation in a finite population. We propose an alternative approach that acts to correct for this error, and which we denote the delay-deterministic model. Applying our model to a simple evolutionary system, we demonstrate its performance in quantifying the extent of selection acting within that system. We further consider the application of our model to sequence data from an evolutionary experiment. We outline scenarios in which our model may produce improved results for the inference of selection, noting that such situations can be easily identified via the use of a regular deterministic model. Copyright © 2018 Nené et al.

  4. Effects of informed consent for individual genome sequencing on relevant knowledge.

    Science.gov (United States)

    Kaphingst, K A; Facio, F M; Cheng, M-R; Brooks, S; Eidem, H; Linn, A; Biesecker, B B; Biesecker, L G

    2012-11-01

    Increasing availability of individual genomic information suggests that patients will need knowledge about genome sequencing to make informed decisions, but prior research is limited. In this study, we examined genome sequencing knowledge before and after informed consent among 311 participants enrolled in the ClinSeq™ sequencing study. An exploratory factor analysis of knowledge items yielded two factors (sequencing limitations knowledge; sequencing benefits knowledge). In multivariable analysis, high pre-consent sequencing limitations knowledge scores were significantly related to education [odds ratio (OR): 8.7, 95% confidence interval (CI): 2.45-31.10 for post-graduate education, and OR: 3.9; 95% CI: 1.05, 14.61 for college degree compared with less than college degree] and race/ethnicity (OR: 2.4, 95% CI: 1.09, 5.38 for non-Hispanic Whites compared with other racial/ethnic groups). Mean values increased significantly between pre- and post-consent for the sequencing limitations knowledge subscale (6.9-7.7, p benefits knowledge subscale (7.0-7.5, p < 0.0001); increase in knowledge did not differ by sociodemographic characteristics. This study highlights gaps in genome sequencing knowledge and underscores the need to target educational efforts toward participants with less education or from minority racial/ethnic groups. The informed consent process improved genome sequencing knowledge. Future studies could examine how genome sequencing knowledge influences informed decision making. © 2012 John Wiley & Sons A/S.

  5. Effects of heavy metals and phenol on the operation of sequencing batch reactor added activated carbon

    Energy Technology Data Exchange (ETDEWEB)

    Lee, Sang Hoon; Lim, Ji Hun; Park, Chul Hwan; Lee, Jin Won [Dept. of Chemical Engineering, Kwangwoon University, Seoul (Korea); Kim, Sang Yong [Korea Institute of Industrial Technology (Korea); Park, Jin Yong [Dept. of Environmental Engineering, Hallym University (Korea); Lee, Yong Myun [Osung Envi-Tech Company (Korea)

    2000-04-01

    The process of sequencing batch reactor(SBR) added the activated carbon were studied. To investigate the influence of the activated carbon on the treatment of organic materials and the effects of heavy metals on the process, three different kinds of granular activated carbons(GAC) were tested. Teh decrease of SCOD(soluble chemical oxygen demand) was measured at the different concentrations of the activated carbon. Synergistic effects of GAC on the biological activity in the SBR were confirmed from the data comparing adsorbed loadings with apparent loadings. When SBR was operated with GAC, the efficiency of wastewater treatment increased 16%. By comparing the adsorbed amount of SCOD estimated from Freundlich isotherm and the decrease of apparent loading, biological synergistic effect was confirmed. The inhibition of SBR performance from heavy metals or toxic chemicals could be reduced when GAC was added into the SBR process. Pb, Cd, Cr, and phenol were tested as typical inhibitors. When 10mg/L inhibitor was introduced into the SBR process which includes 500 mg/L GAC, the efficiency was increased as 32.6%, 27.2%, 22.3%, and 9.4%, respectively. 22 refs., 13 figs., 3 tabs.

  6. The congruency sequence effect 3.0: a critical test of conflict adaptation.

    Science.gov (United States)

    Duthoo, Wout; Abrahamse, Elger L; Braem, Senne; Boehler, C Nico; Notebaert, Wim

    2014-01-01

    Over the last two decades, the congruency sequence effect (CSE) -the finding of a reduced congruency effect following incongruent trials in conflict tasks- has played a central role in advancing research on cognitive control. According to the influential conflict-monitoring account, the CSE reflects adjustments in selective attention that enhance task focus when needed, often termed conflict adaptation. However, this dominant interpretation of the CSE has been called into question by several alternative accounts that stress the role of episodic memory processes: feature binding and (stimulus-response) contingency learning. To evaluate the notion of conflict adaptation in accounting for the CSE, we construed versions of three widely used experimental paradigms (the colour-word Stroop, picture-word Stroop and flanker task) that effectively control for feature binding and contingency learning. Results revealed that a CSE can emerge in all three tasks. This strongly suggests a contribution of attentional control to the CSE and highlights the potential of these unprecedentedly clean paradigms for further examining cognitive control.

  7. The congruency sequence effect 3.0: a critical test of conflict adaptation.

    Directory of Open Access Journals (Sweden)

    Wout Duthoo

    Full Text Available Over the last two decades, the congruency sequence effect (CSE -the finding of a reduced congruency effect following incongruent trials in conflict tasks- has played a central role in advancing research on cognitive control. According to the influential conflict-monitoring account, the CSE reflects adjustments in selective attention that enhance task focus when needed, often termed conflict adaptation. However, this dominant interpretation of the CSE has been called into question by several alternative accounts that stress the role of episodic memory processes: feature binding and (stimulus-response contingency learning. To evaluate the notion of conflict adaptation in accounting for the CSE, we construed versions of three widely used experimental paradigms (the colour-word Stroop, picture-word Stroop and flanker task that effectively control for feature binding and contingency learning. Results revealed that a CSE can emerge in all three tasks. This strongly suggests a contribution of attentional control to the CSE and highlights the potential of these unprecedentedly clean paradigms for further examining cognitive control.

  8. Electromyographic Patterns during Golf Swing: Activation Sequence Profiling and Prediction of Shot Effectiveness.

    Science.gov (United States)

    Verikas, Antanas; Vaiciukynas, Evaldas; Gelzinis, Adas; Parker, James; Olsson, M Charlotte

    2016-04-23

    This study analyzes muscle activity, recorded in an eight-channel electromyographic (EMG) signal stream, during the golf swing using a 7-iron club and exploits information extracted from EMG dynamics to predict the success of the resulting shot. Muscles of the arm and shoulder on both the left and right sides, namely flexor carpi radialis, extensor digitorum communis, rhomboideus and trapezius, are considered for 15 golf players (∼5 shots each). The method using Gaussian filtering is outlined for EMG onset time estimation in each channel and activation sequence profiling. Shots of each player revealed a persistent pattern of muscle activation. Profiles were plotted and insights with respect to player effectiveness were provided. Inspection of EMG dynamics revealed a pair of highest peaks in each channel as the hallmark of golf swing, and a custom application of peak detection for automatic extraction of swing segment was introduced. Various EMG features, encompassing 22 feature sets, were constructed. Feature sets were used individually and also in decision-level fusion for the prediction of shot effectiveness. The prediction of the target attribute, such as club head speed or ball carry distance, was investigated using random forest as the learner in detection and regression tasks. Detection evaluates the personal effectiveness of a shot with respect to the player-specific average, whereas regression estimates the value of target attribute, using EMG features as predictors. Fusion after decision optimization provided the best results: the equal error rate in detection was 24.3% for the speed and 31.7% for the distance; the mean absolute percentage error in regression was 3.2% for the speed and 6.4% for the distance. Proposed EMG feature sets were found to be useful, especially when used in combination. Rankings of feature sets indicated statistics for muscle activity in both the left and right body sides, correlation-based analysis of EMG dynamics and features

  9. Electromyographic Patterns during Golf Swing: Activation Sequence Profiling and Prediction of Shot Effectiveness

    Directory of Open Access Journals (Sweden)

    Antanas Verikas

    2016-04-01

    Full Text Available This study analyzes muscle activity, recorded in an eight-channel electromyographic (EMG signal stream, during the golf swing using a 7-iron club and exploits information extracted from EMG dynamics to predict the success of the resulting shot. Muscles of the arm and shoulder on both the left and right sides, namely flexor carpi radialis, extensor digitorum communis, rhomboideus and trapezius, are considered for 15 golf players (∼5 shots each. The method using Gaussian filtering is outlined for EMG onset time estimation in each channel and activation sequence profiling. Shots of each player revealed a persistent pattern of muscle activation. Profiles were plotted and insights with respect to player effectiveness were provided. Inspection of EMG dynamics revealed a pair of highest peaks in each channel as the hallmark of golf swing, and a custom application of peak detection for automatic extraction of swing segment was introduced. Various EMG features, encompassing 22 feature sets, were constructed. Feature sets were used individually and also in decision-level fusion for the prediction of shot effectiveness. The prediction of the target attribute, such as club head speed or ball carry distance, was investigated using random forest as the learner in detection and regression tasks. Detection evaluates the personal effectiveness of a shot with respect to the player-specific average, whereas regression estimates the value of target attribute, using EMG features as predictors. Fusion after decision optimization provided the best results: the equal error rate in detection was 24.3% for the speed and 31.7% for the distance; the mean absolute percentage error in regression was 3.2% for the speed and 6.4% for the distance. Proposed EMG feature sets were found to be useful, especially when used in combination. Rankings of feature sets indicated statistics for muscle activity in both the left and right body sides, correlation-based analysis of EMG

  10. [Clinical effect of different sequences of debridement-antibiotic therapy in treatment of severe chronic periodontitis].

    Science.gov (United States)

    Li, Yi; Xu, Li; Lu, Rui-fang; An, Yue-bang; Wang, Xian-e; Song, Wen-li; Meng, Huan-xi

    2015-02-18

    To evaluate the feasibility of full-mouth debridement (subgingival scaling and root planning, SRP) by 2 times within 1 week and compare the clinical effects of different sequences of debridement-antibiotic usage in patients with severe chronic periodontitis (CP). A double-blinded, placebo-controlled, randomized clinical trial was conducted in 30 severe CP patients (14 males and 16 females, 40.5 ± 8.4 years old on average from 35 to 60) receiving 3 different sequences of debridement-antibiotictherapy: Group A, antibiotic usage (metronidazole, MTZ, 0.2 g, tid, 7 d; amoxicillin, AMX 0.5 g, tid, 7 d) was started together with SRP (completed by 2 times in 7 d); Group B, antibiotic usage (MTZ 0.2 g, tid, 7 d; AMX 0.5 g, tid, 7 d) was started 1 d after SRP(completed by 2 times in 7 d); Group C, SRP alone[probing depth (PD), bleeding index (BI) and tooth mobility] was examined. The average full-mouth probing depth, the average full-mouth proximal probing depth (pPD), the percentage of sites with PD>5 mm (PD>5 mm%), the percentage of sites with proximal PD>5 mm (pPD>5 mm%), the average bleeding index (BI) and the percentage of sites with bleeding on probing (BOP%) were calculated. Clinical examinations were performed at baseline and 2 months post therapy. (1) Compared with baseline conditions, all the subjects showed clinical improvements in all the parameters evaluated 2 months post therapy, Pantibiotic usage at the same time comparing with patients using antibiotics after SRP or SRP alone.

  11. The effect of vowel height on Voice Onset Time in stop consonants in CV sequences in spontaneous Danish

    DEFF Research Database (Denmark)

    Mortensen, Johannes; Tøndering, John

    2013-01-01

    Voice onset time has been reported to vary with the height of vowels following the stop consonant. This paper investigates the effects of vowel height on VOT in Danish CV sequences with stop consonants in Danish spontaneous speech. A significant effect of vowel height on VOT was found...

  12. Hi-Plex for Simple, Accurate, and Cost-Effective Amplicon-based Targeted DNA Sequencing.

    Science.gov (United States)

    Pope, Bernard J; Hammet, Fleur; Nguyen-Dumont, Tu; Park, Daniel J

    2018-01-01

    Hi-Plex is a suite of methods to enable simple, accurate, and cost-effective highly multiplex PCR-based targeted sequencing (Nguyen-Dumont et al., Biotechniques 58:33-36, 2015). At its core is the principle of using gene-specific primers (GSPs) to "seed" (or target) the reaction and universal primers to "drive" the majority of the reaction. In this manner, effects on amplification efficiencies across the target amplicons can, to a large extent, be restricted to early seeding cycles. Product sizes are defined within a relatively narrow range to enable high-specificity size selection, replication uniformity across target sites (including in the context of fragmented input DNA such as that derived from fixed tumor specimens (Nguyen-Dumont et al., Biotechniques 55:69-74, 2013; Nguyen-Dumont et al., Anal Biochem 470:48-51, 2015), and application of high-specificity genetic variant calling algorithms (Pope et al., Source Code Biol Med 9:3, 2014; Park et al., BMC Bioinformatics 17:165, 2016). Hi-Plex offers a streamlined workflow that is suitable for testing large numbers of specimens without the need for automation.

  13. Implicit Structured Sequence Learning: An FMRI Study of the Structural Mere-Exposure Effect

    Directory of Open Access Journals (Sweden)

    Vasiliki eFolia

    2014-02-01

    Full Text Available In this event-related FMRI study we investigated the effect of five days of implicit acquisition on preference classification by means of an artificial grammar learning (AGL paradigm based on the structural mere-exposure effect and preference classification using a simple right-linear unification grammar. This allowed us to investigate implicit AGL in a proper learning design by including baseline measurements prior to grammar exposure. After 5 days of implicit acquisition, the FMRI results showed activations in a network of brain regions including the inferior frontal (centered on BA 44/45 and the medial prefrontal regions (centered on BA 8/32. Importantly, and central to this study, the inclusion of a naive preference FMRI baseline measurement allowed us to conclude that these FMRI findings were the intrinsic outcomes of the learning process itself and not a reflection of a preexisting functionality recruited during classification, independent of acquisition. Support for the implicit nature of the knowledge utilized during preference classification on day 5 come from the fact that the basal ganglia, associated with implicit procedural learning, were activated during classification, while the medial temporal lobe system, associated with explicit declarative memory, was consistently deactivated. Thus, preference classification in combination with structural mere-exposure can be used to investigate structural sequence processing (syntax in unsupervised AGL paradigms with proper learning designs.

  14. Treatment of opium alkaloid containing wastewater in sequencing batch reactor (SBR)-Effect of gamma irradiation

    International Nuclear Information System (INIS)

    Bural, Cavit B.; Demirer, Goksel N.; Kantoglu, Omer; Dilek, Filiz B.

    2010-01-01

    Aerobic biological treatment of opium alkaloid containing wastewater as well as the effect of gamma irradiation as pre-treatment was investigated. Biodegradability of raw wastewater was assessed in aerobic batch reactors and was found highly biodegradable (83-90% degradation). The effect of irradiation (40 and 140 kGy) on biodegradability was also evaluated in terms of BOD 5 /COD values and results revealed that irradiation imparted no further enhancement in the biodegradability. Despite the highly biodegradable nature of wastewater, further experiments in sequencing batch reactors (SBR) revealed that the treatment operation was not possible due to sludge settleability problem observed beyond an influent COD value of 2000 mg dm -3 . Possible reasons for this problem were investigated, and the high molecular weight, large size and aromatic structure of the organic pollutants present in wastewater was thought to contribute to poor settleability. Initial efforts to solve this problem by modifying the operational conditions, such as SRT reduction, failed. However, further operational modifications including addition of phosphate buffer cured the settleability problem and influent COD was increased up to 5000 mg dm -3 . Significant COD removal efficiencies (>70%) were obtained in both SBRs fed with original and irradiated wastewaters (by 40 kGy). However, pre-irradiated wastewater provided complete thebain removal and a better settling sludge, which was thought due to degradation of complex structure by radiation application. Degradation of the structure was observed by GC/MS analyses and enhancement in filterability tests.

  15. Implicit structured sequence learning: an fMRI study of the structural mere-exposure effect.

    Science.gov (United States)

    Folia, Vasiliki; Petersson, Karl Magnus

    2014-01-01

    In this event-related fMRI study we investigated the effect of 5 days of implicit acquisition on preference classification by means of an artificial grammar learning (AGL) paradigm based on the structural mere-exposure effect and preference classification using a simple right-linear unification grammar. This allowed us to investigate implicit AGL in a proper learning design by including baseline measurements prior to grammar exposure. After 5 days of implicit acquisition, the fMRI results showed activations in a network of brain regions including the inferior frontal (centered on BA 44/45) and the medial prefrontal regions (centered on BA 8/32). Importantly, and central to this study, the inclusion of a naive preference fMRI baseline measurement allowed us to conclude that these fMRI findings were the intrinsic outcomes of the learning process itself and not a reflection of a preexisting functionality recruited during classification, independent of acquisition. Support for the implicit nature of the knowledge utilized during preference classification on day 5 come from the fact that the basal ganglia, associated with implicit procedural learning, were activated during classification, while the medial temporal lobe system, associated with explicit declarative memory, was consistently deactivated. Thus, preference classification in combination with structural mere-exposure can be used to investigate structural sequence processing (syntax) in unsupervised AGL paradigms with proper learning designs.

  16. Treatment of opium alkaloid containing wastewater in sequencing batch reactor (SBR)-Effect of gamma irradiation

    Energy Technology Data Exchange (ETDEWEB)

    Bural, Cavit B.; Demirer, Goksel N. [Middle East Technical University, Department of Environmental Engineering, 06531 Ankara (Turkey); Kantoglu, Omer [Turkish Atomic Energy Authority, Saraykoy Nuclear Research and Training Center, 06982, Kazan, Ankara (Turkey); Dilek, Filiz B., E-mail: fdilek@metu.edu.t [Middle East Technical University, Department of Environmental Engineering, 06531 Ankara (Turkey)

    2010-04-15

    Aerobic biological treatment of opium alkaloid containing wastewater as well as the effect of gamma irradiation as pre-treatment was investigated. Biodegradability of raw wastewater was assessed in aerobic batch reactors and was found highly biodegradable (83-90% degradation). The effect of irradiation (40 and 140 kGy) on biodegradability was also evaluated in terms of BOD{sub 5}/COD values and results revealed that irradiation imparted no further enhancement in the biodegradability. Despite the highly biodegradable nature of wastewater, further experiments in sequencing batch reactors (SBR) revealed that the treatment operation was not possible due to sludge settleability problem observed beyond an influent COD value of 2000 mg dm{sup -3}. Possible reasons for this problem were investigated, and the high molecular weight, large size and aromatic structure of the organic pollutants present in wastewater was thought to contribute to poor settleability. Initial efforts to solve this problem by modifying the operational conditions, such as SRT reduction, failed. However, further operational modifications including addition of phosphate buffer cured the settleability problem and influent COD was increased up to 5000 mg dm{sup -3}. Significant COD removal efficiencies (>70%) were obtained in both SBRs fed with original and irradiated wastewaters (by 40 kGy). However, pre-irradiated wastewater provided complete thebain removal and a better settling sludge, which was thought due to degradation of complex structure by radiation application. Degradation of the structure was observed by GC/MS analyses and enhancement in filterability tests.

  17. Proton T2 relaxation effect of superparamagnetic iron oxide. Comparison between fast spin echo and conventional spin echo sequence

    International Nuclear Information System (INIS)

    Tanimoto, Akihiro; Satoh, Yoshinori; Higuchi, Nobuya; Izutsu, Mutsumu; Yuasa, Yuji; Hiramatsu, Kyoichi

    1995-01-01

    Superparamagnetic iron oxide (SPIO) particles have been known to show a great T 2 relaxation effect in the liver, which contributes to significant liver signal decrease and detection of hepatic neoplasms. Recently, fast spin echo (FSE) sequence with less scanning time than conventional spin echo (SE) sequence has been rapidly introduced in clinical MR imaging. To investigate whether SPIO would show decreased T 2 relaxation effect on FSE, we obtained T 2 relaxivity (R2) of SPIO in vitro and liver signal decrease caused by SPIO in vivo. SPIO showed 20% less R2 on Carr-Purcell-Meiboom-Gill (CPMG) sequence than on SE. Relative liver signal-to-noise ratio (SNR) decrease caused by SPIO was significantly smaller (p 2 relaxation effect on FSE than on SE. However, further studies will be required to assess the diagnostic capability of SPIO on FSE, in the detection of hepatic neoplasms. (author)

  18. Effects of Early and Late Rest Intervals on Performance and Overnight Consolidation of a Keyboard Sequence

    Science.gov (United States)

    Cash, Carla Davis

    2009-01-01

    Thirty-six nonmusicians practiced a five-element key-press sequence on a digital piano, repeating the sequence as quickly and accurately as possible during twelve 30-s practice blocks alternating with 30-s pauses. Twelve learners rested for 5 min between Blocks 3 and 4, another 12 learners rested for 5 min between Blocks 9 and 10, and the…

  19. Effect of the sequence data deluge on the performance of methods for detecting protein functional residues.

    Science.gov (United States)

    Garrido-Martín, Diego; Pazos, Florencio

    2018-02-27

    The exponential accumulation of new sequences in public databases is expected to improve the performance of all the approaches for predicting protein structural and functional features. Nevertheless, this was never assessed or quantified for some widely used methodologies, such as those aimed at detecting functional sites and functional subfamilies in protein multiple sequence alignments. Using raw protein sequences as only input, these approaches can detect fully conserved positions, as well as those with a family-dependent conservation pattern. Both types of residues are routinely used as predictors of functional sites and, consequently, understanding how the sequence content of the databases affects them is relevant and timely. In this work we evaluate how the growth and change with time in the content of sequence databases affect five sequence-based approaches for detecting functional sites and subfamilies. We do that by recreating historical versions of the multiple sequence alignments that would have been obtained in the past based on the database contents at different time points, covering a period of 20 years. Applying the methods to these historical alignments allows quantifying the temporal variation in their performance. Our results show that the number of families to which these methods can be applied sharply increases with time, while their ability to detect potentially functional residues remains almost constant. These results are informative for the methods' developers and final users, and may have implications in the design of new sequencing initiatives.

  20. Quartz-Seq2: a high-throughput single-cell RNA-sequencing method that effectively uses limited sequence reads.

    Science.gov (United States)

    Sasagawa, Yohei; Danno, Hiroki; Takada, Hitomi; Ebisawa, Masashi; Tanaka, Kaori; Hayashi, Tetsutaro; Kurisaki, Akira; Nikaido, Itoshi

    2018-03-09

    High-throughput single-cell RNA-seq methods assign limited unique molecular identifier (UMI) counts as gene expression values to single cells from shallow sequence reads and detect limited gene counts. We thus developed a high-throughput single-cell RNA-seq method, Quartz-Seq2, to overcome these issues. Our improvements in the reaction steps make it possible to effectively convert initial reads to UMI counts, at a rate of 30-50%, and detect more genes. To demonstrate the power of Quartz-Seq2, we analyzed approximately 10,000 transcriptomes from in vitro embryonic stem cells and an in vivo stromal vascular fraction with a limited number of reads.

  1. Effects of remediation train sequence on decontamination of heavy metal-contaminated soil containing mercury.

    Science.gov (United States)

    Hseu, Zeng-Yei; Huang, Yu-Tuan; Hsi, Hsing-Cheng

    2014-09-01

    When a contaminated site contains pollutants including both nonvolatile metals and Hg, one single remediation technology may not satisfactorily remove all contaminants. Therefore, in this study, chemical extraction and thermal treatment were combined as a remediation train to remove heavy metals, including Hg, from contaminated soil. A 0.2 M solution of ethylenediamine tetraacetic acid (EDTA) was shown to be the most effective reagent for extraction of considerable amounts of Cu, Pb, and Zn (> 50%). Hg removal was ineffective using 0.2 M EDTA, but thermogravimetric analysis suggested that heating to 550 degrees C with a heating rate of 5 degrees C/min for a duration of 1 hr appeared to be an effective approach for Hg removal. With the employment of thermal treatment, up to 99% of Hg could be removed. However executing thermal treatment prior to chemical extraction reduced the effectiveness of the subsequent EDTA extraction because nonvolatile heavy metals were immobilized in soil aggregates after the 550 degrees C treatment. The remediation train of chemical extraction followed by thermal treatment appears to remediate soils that have been contaminated by many nonvolatile heavy metals and Hg. Implications: A remediation train conjoining two or more techniques has been initialized to remove multiple metals. Better understandings of the impacts of treatment sequences, namely, which technique should be employed first on the soil properties and the decontamination efficiency, are in high demand. This study provides a strategy to remove multiple heavy metals including Hg from a contaminated soil. The interactions between thermal treatment and chemical extraction on repartitioning of heavy metals was revealed. The obtained results could offer an integrating strategy to remediate the soil contaminated with both heavy metals and volatile contaminants.

  2. Sub-sequence Factorization-an Effective Approach for Projective Reconstruction under Occlusion

    Institute of Scientific and Technical Information of China (English)

    LU Le; HU Zhanyi

    2001-01-01

    Projective reconstruction is a key step for 3D metric reconstruction from a sequence of images captured by an uncalibrated camera. Due to its inherent robustness, the factorization method is widely used in literatures. However, the main shortcoming of the standard factorization method is that it requires the corresponding points to appear across ALL the images. When large changes of view angles occur in the image sequence, or the scene is easy to be self-occluded, nearly it will be very difficult to have some corresponding points visible across all the images. But it is much easier for only several images to have enough correspondences required by factorization method. These images are called as a subsequence in the whole image set. In this paper,a sub-sequence factorization method is proposed to cope with the problem. The basic principle of the sub-sequence factorization method is to divide a long image sequence into several short subsequences according to its spatial continuity, and the standard factorization method is employed for each subsequence.Then, a novel alignment process is invoked to transform different reconstructions under different subsequences into one reference coordinates system. It is more practical as it only demands that there are enough correspondences in each subsequence, not the whole sequence. The proposed sub-sequence factorization method preserves the robustness aspect embedded in the standard factorization method. The experiments on synthetic and real images validate our proposed new method.

  3. Negative effect of the 5'-untranslated leader sequence on Ac transposon promoter expression.

    Science.gov (United States)

    Scortecci, K C; Raina, R; Fedoroff, N V; Van Sluys, M A

    1999-08-01

    Transposable elements are used in heterologous plant hosts to clone genes by insertional mutagenesis. The Activator (Ac) transposable element has been cloned from maize, and introduced into a variety of plants. However, differences in regulation and transposition frequency have been observed between different host plants. The cause of this variability is still unknown. To better understand the activity of the Ac element, we analyzed the Ac promoter region and its 5'-untranslated leader sequence (5' UTL). Transient assays in tobacco NT1 suspension cells showed that the Ac promoter is a weak promoter and its activity was localized by deletion analyses. The data presented here indicate that the core of the Ac promoter is contained within 153 bp fragment upstream to transcription start sites. An important inhibitory effect (80%) due to the presence of the 5' UTL was found on the expression of LUC reporter gene. Here we demonstrate that the presence of the 5' UTL in the constructs reduces the expression driven by either strong or weak promoters.

  4. Genomic clones of bovine parvovirus: Construction and effect of deletions and terminal sequence inversions on infectivity

    International Nuclear Information System (INIS)

    Shull, B.C.; Chen, K.C.; Lederman, M.; Stout, E.R.; Bates, R.C.

    1988-01-01

    Genomic clones of the autonomous parvovirus bovine parvovirus (BPV) were constructed by blunt-end ligation of reannealed virion plus and minus DNA strands into the plasmid pUC8. These clones were stable during propagation in Escherichia coli JM107. All clones tested were found to be infectious by the criteria of plaque titer and progressive cytophathic effect after transfection into bovine fetal lung cells. Sequencing of the recombinant plasmids demonstrated that all of the BPV inserts had left-end (3')-terminal deletions of up to 34 bases. Defective genomes could also be detected in the progeny DNA even though the infection was initiated with homogeneous, cloned DNA. Full-length genomic clones with 3' flip and 3' flop conformations were constructed and were found to have equal infectivity. Expression of capsid proteins from tranfected genomes was demonstrated by hemagglutination, indirect immunofluorescence, and immunoprecipitation of [ 35 S]methionine-labeled cell lysates. Use of appropriate antiserum for immunoprecipitation showed the synthesis of BPV capsid and noncapsid proteins after transfection. Independently, a series of genomic clones with increasingly larger 3'-terminal deletions was prepared from separately subcloned 3'-terminal fragments. Transfection of these clones into bovine fetal lung cells revealed that deletions of up to 34 bases at the 3' end lowered but did not abolish infectivity, while deletions of greater than 52 bases were lethal. End-label analysis showed that the 34-base deletion was repaired to wild-type length in the progeny virus

  5. Effect of manufacturing process sequence on the corrosion resistance characteristics of coated metallic bipolar plates

    Science.gov (United States)

    Dur, Ender; Cora, Ömer Necati; Koç, Muammer

    2014-01-01

    Metallic bipolar plate (BPP) with high corrosion and low contact resistance, durability, strength, low cost, volume, and weight requirements is one of the critical parts of the PEMFC. This study is dedicated to understand the effect of the process sequence (manufacturing then coating vs. coating then manufacturing) on the corrosion resistance of coated metallic bipolar plates. To this goal, three different PVD coatings (titanium nitride (TiN), chromium nitride (CrN), zirconium nitride (ZrN)), with three thicknesses, (0.1, 0.5, 1 μm) were applied on BPPs made of 316L stainless steel alloy before and after two types of manufacturing (i.e., stamping or hydroforming). Corrosion test results indicated that ZrN coating exhibited the best corrosion protection while the performance of TiN coating was the lowest among the tested coatings and thicknesses. For most of the cases tested, in which coating was applied before manufacturing, occurrence of corrosion was found to be more profound than the case where coating was applied after manufacturing. Increasing the coating thickness was found to improve the corrosion resistance. It was also revealed that hydroformed BPPs performed slightly better than stamped BPPs in terms of the corrosion behavior.

  6. Exploring the effects of gravity on tongue motion using ultrasound image sequences

    Science.gov (United States)

    Stone, Maureen; Crouse, Ulla; Sutton, Marty

    2002-05-01

    Our goal in the research was to explore the effect that gravity had on the vocal-tract system by using ultrasound data collected in the upright and supine positions. All potential subjects were given an ultrasound pretest to determine whether they could repeat a series of 3-4 words precise enough to allow an accurate series of images to be collected. Out of these potential subjects, approximately 5-7 subjects were eventually used in the research. The method of collecting ultrasound data required the immobilization of the patient by restraining their neck in a custom fitted neck restraint. The neck restraint held an ultrasound transducer positioned at a critical angle underneath the patients' lower jawbone, which served to reduce errors and increase image resolution. To accurately analyze the series of images collected from ultrasound imaging, the surfaces of the tongue were digitized and tongue motion was time-aligned across the upright and supine sequences. Comparisons between the upright and supine data were then made by using L2 norms to determine averages and differences regarding the behavior between the two positions. Curves and locations of the maximum and minimum differences will be discussed.

  7. The Effect of Organic Loading Rate on Milk WastewaterTreatment Using Sequencing Batch Reactor (SBR

    Directory of Open Access Journals (Sweden)

    Hooman Hajiabadi

    2009-09-01

    Full Text Available In this study, four aerobic sequencing batch reactors (SBRs were operated under the same conditions for the treatment of milk wastewater at different organic loading rates (OLRs. Cylindrical Plexiglas reactors were run for 56 days (including 21 days of acclimatization and 35 days of data gathering. Effective volume, influent wastewater flowrate, and sludge retention time (SRT of reactors were 5.5 L, 3.5 L/d, and 10 d, respectively. The average COD removal efficiency for the reactors R1, R2, R3, and R4 with influent OLRave values of 633, 929, 1915, and 3261 gCOD/m3d were 95, 96, 95, and 82 percent, respectively. The average effluent suspended solid (SS for all reactors was lower than 44 mg/L. Also, except for R4 with an average effluent turbidity of 270 NTU, other reactors met the Iranian wastewater emission standard (50 NTU. In addition, the average sludge volume index of reactors R1 to R3 was found to be lower than 67 mL/g. According to the results, the overall variation of COD removal efficiency versus influent OLR shows a decreasing rate with a correlation factor of 0.8 (R2.

  8. Training Sequences and their Effects on Task Performance and User Outcomes

    DEFF Research Database (Denmark)

    Sanford, Clive Carlton

    2007-01-01

    This article introduces the concept of information technology (IT) training sequencesand examines how sequencing of conceptual and procedural training impact IT task performance, user satisfaction and users' self-efficacy. Using assimilation theory, we develop four hypotheses related to training...... sequences. These hypotheses were then tested in a database design context using a quasi-experimental study involving student subjects. Empirical results demonstrate improved far-transfer andnear-transfer task performance and higher self-efficacy for subjects trained in the conceptual-procedural sequence vs...

  9. A label-free luminescent switch-on assay for ATP using a G-quadruplex-selective iridium(III) complex.

    Science.gov (United States)

    Leung, Ka-Ho; Lu, Lihua; Wang, Modi; Mak, Tsun-Yin; Chan, Daniel Shiu-Hin; Tang, Fung-Kit; Leung, Chung-Hang; Kwan, Hiu-Yee; Yu, Zhiling; Ma, Dik-Lung

    2013-01-01

    We report herein the G-quadruplex-selective property of a luminescent cyclometallated iridium(III) complex for the detection of adenosine-5'-triphosphate (ATP) in aqueous solution. The ATP-binding aptamer was employed as the ATP recognition unit, while the iridium(III) complex was used to monitor the formation of the G-quadruplex structure induced by ATP. The sensitivity and fold enhancement of the assay were higher than those of the previously reported assay using the organic dye crystal violet as a fluorescent probe. This label-free luminescent switch-on assay exhibits high sensitivity and selectivity towards ATP with a limit of detection of 2.5 µM.

  10. A label-free luminescent switch-on assay for ATP using a G-quadruplex-selective iridium(III complex.

    Directory of Open Access Journals (Sweden)

    Ka-Ho Leung

    Full Text Available We report herein the G-quadruplex-selective property of a luminescent cyclometallated iridium(III complex for the detection of adenosine-5'-triphosphate (ATP in aqueous solution. The ATP-binding aptamer was employed as the ATP recognition unit, while the iridium(III complex was used to monitor the formation of the G-quadruplex structure induced by ATP. The sensitivity and fold enhancement of the assay were higher than those of the previously reported assay using the organic dye crystal violet as a fluorescent probe. This label-free luminescent switch-on assay exhibits high sensitivity and selectivity towards ATP with a limit of detection of 2.5 µM.

  11. Real sequence effects on the search dynamics of transcription factors on DNA

    DEFF Research Database (Denmark)

    Bauer, Maximilian; Rasmussen, Emil S.; Lomholt, Michael A.

    2015-01-01

    Recent experiments show that transcription factors (TFs) indeed use the facilitated diffusion mechanism to locate their target sequences on DNA in living bacteria cells: TFs alternate between sliding motion along DNA and relocation events through the cytoplasm. From simulations and theoretical...... analysis we study the TF-sliding motion for a large section of the DNA-sequence of a common E. coli strain, based on the two-state TF-model with a fast-sliding search state and a recognition state enabling target detection. For the probability to detect the target before dissociating from DNA the TF...... on the underlying nucleotide sequence is varied. A moderate dependence maximises the capability to distinguish between the main operator and similar sequences. Moreover, these auxiliary operators serve as starting points for DNA looping with the main operator, yielding a spectrum of target detection times spanning...

  12. Structural dynamics of thrombin-binding DNA aptamer d(GGTTGGTGTGGTTGG) quadruplex DNA studied by large-scale explicit solvent simulations

    Czech Academy of Sciences Publication Activity Database

    Reshetnikov, R.; Golovin, A.; Spiridonova, V.; Kopylov, A.; Šponer, Jiří

    2010-01-01

    Roč. 6, č. 10 (2010), s. 3003-3014 ISSN 1549-9618 R&D Projects: GA AV ČR(CZ) IAA400040802; GA ČR(CZ) GA203/09/1476; GA MŠk(CZ) LC06030 Institutional research plan: CEZ:AV0Z50040507; CEZ:AV0Z50040702 Keywords : molecular dynamics * quadruplex DNA * thrombin Subject RIV: BO - Biophysics Impact factor: 5.138, year: 2010

  13. Effects of GABA[subscript A] Modulators on the Repeated Acquisition of Response Sequences in Squirrel Monkeys

    Science.gov (United States)

    Campbell, Una C.; Winsauer, Peter J.; Stevenson, Michael W.; Moerschbaecher, Joseph M.

    2004-01-01

    The present study investigated the effects of positive and negative GABA[subscript A] modulators under three different baselines of repeated acquisition in squirrel monkeys in which the monkeys acquired a three-response sequence on three keys under a second-order fixed-ratio (FR) schedule of food reinforcement. In two of these baselines, the…

  14. The Effects of CBI Lesson Sequence Type and Field Dependence on Learning from Computer-Based Cooperative Instruction in Web

    Science.gov (United States)

    Ipek, Ismail

    2010-01-01

    The purpose of this study was to investigate the effects of CBI lesson sequence type and cognitive style of field dependence on learning from Computer-Based Cooperative Instruction (CBCI) in WEB on the dependent measures, achievement, reading comprehension and reading rate. Eighty-seven college undergraduate students were randomly assigned to…

  15. Effect of preemptive weld overlay sequence on residual stress distribution for dissimilar metal weld of Kori nuclear power plant pressurizer

    Energy Technology Data Exchange (ETDEWEB)

    Bae, Hong Yeol; Song, Tae Kwang; Chun, Yun Bae; Oh, Chang Young; Kim, Yun Jae [Korea Univ., Seoul (Korea, Republic of); Lee, Kyoung Soo; Park, Chi Yong [Korea Electric Power Research Institute, Daejeon (Korea, Republic of)

    2008-07-01

    Weld overlay is one of the residual stress mitigation method which arrest crack. An overlay weld sued in this manner is termed a Preemptive Weld OverLay(PWOL). PWOL was good for distribution of residual stress of Dissimilar Metal Weld(DMW) by previous research. Because range of overlay welding is wide relatively, residual stress distribution on PWR is affected by welding sequence. In order to examine the effect of welding sequence, PWOL was applied to a specific DMW of KORI nuclear power plant by finite element analysis method. As a result, the welding direction that from nozzle to pipe is better good for residual stress distribution on PWR.

  16. Effect of preemptive weld overlay sequence on residual stress distribution for dissimilar metal weld of Kori nuclear power plant pressurizer

    International Nuclear Information System (INIS)

    Bae, Hong Yeol; Song, Tae Kwang; Chun, Yun Bae; Oh, Chang Young; Kim, Yun Jae; Lee, Kyoung Soo; Park, Chi Yong

    2008-01-01

    Weld overlay is one of the residual stress mitigation method which arrest crack. An overlay weld sued in this manner is termed a Preemptive Weld OverLay(PWOL). PWOL was good for distribution of residual stress of Dissimilar Metal Weld(DMW) by previous research. Because range of overlay welding is wide relatively, residual stress distribution on PWR is affected by welding sequence. In order to examine the effect of welding sequence, PWOL was applied to a specific DMW of KORI nuclear power plant by finite element analysis method. As a result, the welding direction that from nozzle to pipe is better good for residual stress distribution on PWR

  17. Expression of Telomere-Associated Proteins is Interdependent to Stabilize Native Telomere Structure and Telomere Dysfunction by G-Quadruplex Ligand Causes TERRA Upregulation.

    Science.gov (United States)

    Sadhukhan, Ratan; Chowdhury, Priyanka; Ghosh, Sourav; Ghosh, Utpal

    2018-06-01

    Telomere DNA can form specialized nucleoprotein structure with telomere-associated proteins to hide free DNA ends or G-quadruplex structures under certain conditions especially in presence of G-quadruplex ligand. Telomere DNA is transcribed to form non-coding telomere repeat-containing RNA (TERRA) whose biogenesis and function is poorly understood. Our aim was to find the role of telomere-associated proteins and telomere structures in TERRA transcription. We silenced four [two shelterin (TRF1, TRF2) and two non-shelterin (PARP-1, SLX4)] telomere-associated genes using siRNA and verified depletion in protein level. Knocking down of one gene modulated expression of other telomere-associated genes and increased TERRA from 10q, 15q, XpYp and XqYq chromosomes in A549 cells. Telomere was destabilized or damaged by G-quadruplex ligand pyridostatin (PDS) and bleomycin. Telomere dysfunction-induced foci (TIFs) were observed for each case of depletion of proteins, treatment with PDS or bleomycin. TERRA level was elevated by PDS and bleomycin treatment alone or in combination with depletion of telomere-associated proteins.

  18. Implementing targeted region capture sequencing for the clinical detection of Alagille syndrome: An efficient and cost‑effective method.

    Science.gov (United States)

    Huang, Tianhong; Yang, Guilin; Dang, Xiao; Ao, Feijian; Li, Jiankang; He, Yizhou; Tang, Qiyuan; He, Qing

    2017-11-01

    Alagille syndrome (AGS) is a highly variable, autosomal dominant disease that affects multiple structures including the liver, heart, eyes, bones and face. Targeted region capture sequencing focuses on a panel of known pathogenic genes and provides a rapid, cost‑effective and accurate method for molecular diagnosis. In a Chinese family, this method was used on the proband and Sanger sequencing was applied to validate the candidate mutation. A de novo heterozygous mutation (c.3254_3255insT p.Leu1085PhefsX24) of the jagged 1 gene was identified as the potential disease‑causing gene mutation. In conclusion, the present study suggested that target region capture sequencing is an efficient, reliable and accurate approach for the clinical diagnosis of AGS. Furthermore, these results expand on the understanding of the pathogenesis of AGS.

  19. A test of Monroe's Motivated Sequence for its effects on ratings of message organization and attitude change.

    Science.gov (United States)

    Micciche, T; Pryor, B; Butler, J

    2000-06-01

    The experiment examined Monroe's Motivated Sequence, an organizational pattern commonly taught in basic speech courses for its effects on attitude change and ratings of comprehensibility of messages. Treatment groups of 21, 23, and 24 participants read one of three versions of a persuasive message that advocated a $50 fee increase to improve parking facilities on campus. One version represented Monroe's five-step sequence, a second version reversed the five steps, and a third randomly ordered the steps. A control group of 22 read a message unrelated to the parking issue. Analysis showed no differences in attitude change across the four groups. The Monroe sequence condition did produce significantly higher ratings of comprehensibility on one of four comparisons.

  20. Resonant magnetoelectric response of composite cantilevers: Theory of short vs. open circuit operation and layer sequence effects

    Directory of Open Access Journals (Sweden)

    Matthias C. Krantz

    2015-11-01

    Full Text Available The magnetoelectric effect in layered composite cantilevers consisting of strain coupled layers of magnetostrictive (MS, piezoelectric (PE, and substrate materials is investigated for magnetic field excitation at bending resonance. Analytic theories are derived for the transverse magnetoelectric (ME response in short and open circuit operation for three different layer sequences and results presented and discussed for the FeCoBSi-AlN-Si and the FeCoBSi-PZT-Si composite systems. Response optimized PE-MS layer thickness ratios are found to greatly change with operation mode shifting from near equal MS and PE layer thicknesses in the open circuit mode to near vanishing PE layer thicknesses in short circuit operation for all layer sequences. In addition the substrate layer thickness is found to differently affect the open and short circuit ME response producing shifts and reversal between ME response maxima depending on layer sequence. The observed rich ME response behavior for different layer thicknesses, sequences, operating modes, and PE materials can be explained by common neutral plane effects and different elastic compliance effects in short and open circuit operation.

  1. Sequence context effects on 8-methoxypsoralen photobinding to defined DNA fragments

    International Nuclear Information System (INIS)

    Sage, E.; Moustacchi, E.

    1987-01-01

    The photoreaction of 8-methoxypsoralen (8-MOP) with DNA fragments of defined sequence was studied. The authors took advantage of the blockage by bulky adducts of the 3'-5'-exonuclease activity associated with the T4 DNA polymerase. The action of the exonuclease is stopped by biadducts as well as by monoadducts. The termination products were analyzed on sequencing gels. A strong sequence specificity was observed in the DNA photobinding of 8-MOP. The exonuclease terminates its digestion near thymine residues, mainly at potentially cross-linkable sites. There is an increasing reactivity of thymine residues in the order T < TT << TTT in a GC environment. For thymine residues in cross-linkable sites, the reactivity follows the order AT << TA ∼ TAT << ATA < ATAT < ATATAA. Repeated A-T sequences are hot spots for the photochemical reaction of 8-MOP with DNA. Both monoadducts and interstrand cross-links are formed preferentially in 5'-TpA sites. The results highlight the role of the sequence and consequently of the conformation around a potential site in the photobinding of 8-MOP to DNA

  2. Effects of temperature and mass conservation on the typical chemical sequences of hydrogen oxidation

    Science.gov (United States)

    Nicholson, Schuyler B.; Alaghemandi, Mohammad; Green, Jason R.

    2018-01-01

    Macroscopic properties of reacting mixtures are necessary to design synthetic strategies, determine yield, and improve the energy and atom efficiency of many chemical processes. The set of time-ordered sequences of chemical species are one representation of the evolution from reactants to products. However, only a fraction of the possible sequences is typical, having the majority of the joint probability and characterizing the succession of chemical nonequilibrium states. Here, we extend a variational measure of typicality and apply it to atomistic simulations of a model for hydrogen oxidation over a range of temperatures. We demonstrate an information-theoretic methodology to identify typical sequences under the constraints of mass conservation. Including these constraints leads to an improved ability to learn the chemical sequence mechanism from experimentally accessible data. From these typical sequences, we show that two quantities defining the variational typical set of sequences—the joint entropy rate and the topological entropy rate—increase linearly with temperature. These results suggest that, away from explosion limits, data over a narrow range of thermodynamic parameters could be sufficient to extrapolate these typical features of combustion chemistry to other conditions.

  3. Effect of crop sequence and crop residues on soil C, soil N and yield of maize

    International Nuclear Information System (INIS)

    Shafi, M.; Bakht, J.; Attaullah; Khan, M.A.

    2010-01-01

    Improved management of nitrogen (N) in low N soils is critical for increased soil productivity and crop sustainability. The objective of the present study was to evaluate the effects of residues incorporation, residues retention on soil surface as mulch, fertilizer N and legumes in crop rotation on soil fertility and yield of maize (Zea may L.). Fertilizer N was applied to maize at the rate of 160 kg ha/sup -1/, and to wheat at the rate of 120 kg ha/sup -1/ or no fertilizer N application. Crop rotation with the sequence of maize after wheat (Triticum aestivum L.), maize after lentil (Lens culinaris Medic) or wheat after mash bean (Vigna mungo L.) arranged in a split plot design was followed. Post-harvest incorporation of crop residues and residues retention on soil surface as mulch had significantly (p=0.05) affected grain and stover yield during 2004 and 2005. Two years average data revealed that grain yield was increased by 3.31 and 6.72% due to mulch and residues incorporation. Similarly, stover yield was also enhanced by 5.39 and 10.27% due to the same treatment respectively. Mulch and residues incorporation also improved stover N uptake by 2.23 and 6.58%, respectively. Total soil N and organic matter was non significantly (p=0.05) increased by 5.63 and 2.38% due to mulch and 4.13, 7.75% because of crop residues incorporation in the soil. Maize grain and stover yield responded significantly (p=0.05) to the previous legume (lentil) crop when compared with the previous cereal crop (wheat). The treatment of lentil - maize(+N), on the average, increased grain yield of maize by 15.35%, stover yield by 16.84%, total soil N by 10.31% and organic matter by 10.17%. Similarly, fertilizer N applied to the previous wheat showed carry over effect on grain yield (6.82%) and stover yield (11.37%) of the following maize crop. The present study suggested that retention of residues on soil surface as mulch, incorporation of residues in soil and legume (lentil - maize) rotation

  4. Ancestral sequence reconstruction in primate mitochondrial DNA: compositional bias and effect on functional inference.

    Science.gov (United States)

    Krishnan, Neeraja M; Seligmann, Hervé; Stewart, Caro-Beth; De Koning, A P Jason; Pollock, David D

    2004-10-01

    Reconstruction of ancestral DNA and amino acid sequences is an important means of inferring information about past evolutionary events. Such reconstructions suggest changes in molecular function and evolutionary processes over the course of evolution and are used to infer adaptation and convergence. Maximum likelihood (ML) is generally thought to provide relatively accurate reconstructed sequences compared to parsimony, but both methods lead to the inference of multiple directional changes in nucleotide frequencies in primate mitochondrial DNA (mtDNA). To better understand this surprising result, as well as to better understand how parsimony and ML differ, we constructed a series of computationally simple "conditional pathway" methods that differed in the number of substitutions allowed per site along each branch, and we also evaluated the entire Bayesian posterior frequency distribution of reconstructed ancestral states. We analyzed primate mitochondrial cytochrome b (Cyt-b) and cytochrome oxidase subunit I (COI) genes and found that ML reconstructs ancestral frequencies that are often more different from tip sequences than are parsimony reconstructions. In contrast, frequency reconstructions based on the posterior ensemble more closely resemble extant nucleotide frequencies. Simulations indicate that these differences in ancestral sequence inference are probably due to deterministic bias caused by high uncertainty in the optimization-based ancestral reconstruction methods (parsimony, ML, Bayesian maximum a posteriori). In contrast, ancestral nucleotide frequencies based on an average of the Bayesian set of credible ancestral sequences are much less biased. The methods involving simpler conditional pathway calculations have slightly reduced likelihood values compared to full likelihood calculations, but they can provide fairly unbiased nucleotide reconstructions and may be useful in more complex phylogenetic analyses than considered here due to their speed and

  5. Effect of mutagen combined action on Chlamydomonas reinhardtii cells. I. Lethal effect dependence on the sequence of mutagen application and on cultivation conditions

    Energy Technology Data Exchange (ETDEWEB)

    Vlcek, D; Podstavkova, S; Dubovsky, J [Komenskeho Univ., Bratislava (Czechoslovakia). Prirodovedecka Fakulta

    1978-01-01

    The effect was investigated of single and combined actions of alkylnitrosourea derivatives (N-methyl-N-nitrosourea and N-ethyl-N-nitrosourea) and UV-radiation on the survival of cells of Chlamydomonas reinhardtii algae in dependence on the sequence of application of mutagens and on the given conditions of cultivation following mutagen activity. In particular, the single phases were investigated of the total lethal effect, i.e., the death of cells before division and their death after division. The most pronounced changes in dependence on the sequence of application of mutagens and on the given conditions of cultivation were noted in cell death before division. In dependence on the sequence of application of mutagens, the effect of the combined action on the survival of cells changed from an additive (alkylnitrosourea + UV-radiation) to a protective effect (UV-radiation + alkylnitrosourea).

  6. Studies of base pair sequence effects on DNA solvation based on all-atom molecular dynamics simulations.

    Science.gov (United States)

    Dixit, Surjit B; Mezei, Mihaly; Beveridge, David L

    2012-07-01

    Detailed analyses of the sequence-dependent solvation and ion atmosphere of DNA are presented based on molecular dynamics (MD) simulations on all the 136 unique tetranucleotide steps obtained by the ABC consortium using the AMBER suite of programs. Significant sequence effects on solvation and ion localization were observed in these simulations. The results were compared to essentially all known experimental data on the subject. Proximity analysis was employed to highlight the sequence dependent differences in solvation and ion localization properties in the grooves of DNA. Comparison of the MD-calculated DNA structure with canonical A- and B-forms supports the idea that the G/C-rich sequences are closer to canonical A- than B-form structures, while the reverse is true for the poly A sequences, with the exception of the alternating ATAT sequence. Analysis of hydration density maps reveals that the flexibility of solute molecule has a significant effect on the nature of observed hydration. Energetic analysis of solute-solvent interactions based on proximity analysis of solvent reveals that the GC or CG base pairs interact more strongly with water molecules in the minor groove of DNA that the AT or TA base pairs, while the interactions of the AT or TA pairs in the major groove are stronger than those of the GC or CG pairs. Computation of solvent-accessible surface area of the nucleotide units in the simulated trajectories reveals that the similarity with results derived from analysis of a database of crystallographic structures is excellent. The MD trajectories tend to follow Manning's counterion condensation theory, presenting a region of condensed counterions within a radius of about 17 A from the DNA surface independent of sequence. The GC and CG pairs tend to associate with cations in the major groove of the DNA structure to a greater extent than the AT and TA pairs. Cation association is more frequent in the minor groove of AT than the GC pairs. In general, the

  7. Optimization of dynamic economic dispatch with valve-point effect using chaotic sequence based differential evolution algorithms

    International Nuclear Information System (INIS)

    He Dakuo; Dong Gang; Wang Fuli; Mao Zhizhong

    2011-01-01

    A chaotic sequence based differential evolution (DE) approach for solving the dynamic economic dispatch problem (DEDP) with valve-point effect is presented in this paper. The proposed method combines the DE algorithm with the local search technique to improve the performance of the algorithm. DE is the main optimizer, while an approximated model for local search is applied to fine tune in the solution of the DE run. To accelerate convergence of DE, a series of constraints handling rules are adopted. An initial population obtained by using chaotic sequence exerts optimal performance of the proposed algorithm. The combined algorithm is validated for two test systems consisting of 10 and 13 thermal units whose incremental fuel cost function takes into account the valve-point loading effects. The proposed combined method outperforms other algorithms reported in literatures for DEDP considering valve-point effects.

  8. On the Specificity of Sequential Congruency Effects in Implicit Learning of Motor and Perceptual Sequences

    Science.gov (United States)

    D'Angelo, Maria C.; Jimenez, Luis; Milliken, Bruce; Lupianez, Juan

    2013-01-01

    Individuals experience less interference from conflicting information following events that contain conflicting information. Recently, Jimenez, Lupianez, and Vaquero (2009) demonstrated that such adaptations to conflict occur even when the source of conflict arises from implicit knowledge of sequences. There is accumulating evidence that momentary…

  9. Effect of 5'-flanking sequence deletions on expression of the human insulin gene in transgenic mice

    DEFF Research Database (Denmark)

    Fromont-Racine, M; Bucchini, D; Madsen, O

    1990-01-01

    Expression of the human insulin gene was examined in transgenic mouse lines carrying the gene with various lengths of DNA sequences 5' to the transcription start site (+1). Expression of the transgene was demonstrated by 1) the presence of human C-peptide in urine, 2) the presence of specific...... of the transgene was observed in cell types other than beta-islet cells....

  10. Effect of temperature and cycle length on microbial competition in PHB-producing sequencing batch reactor

    NARCIS (Netherlands)

    Jiang, Y.; Marang, L.; Kleerebezem, R.; Muyzer, G.; van Loosdrecht, M.C.M.

    2011-01-01

    The impact of temperature and cycle length on microbial competition between polyhydroxybutyrate (PHB)-producing populations enriched in feast-famine sequencing batch reactors (SBRs) was investigated at temperatures of 20 °C and 30 °C, and in a cycle length range of 1-18 h. In this study, the

  11. Effective Normalization for Copy Number Variation Detection from Whole Genome Sequencing

    NARCIS (Netherlands)

    Janevski, A.; Varadan, V.; Kamalakaran, S.; Banerjee, N.; Dimitrova, D.

    2012-01-01

    Background Whole genome sequencing enables a high resolution view ofthe human genome and provides unique insights into genome structureat an unprecedented scale. There have been a number of tools to infer copy number variation in the genome. These tools while validatedalso include a number of

  12. Roles of repetitive sequences

    Energy Technology Data Exchange (ETDEWEB)

    Bell, G.I.

    1991-12-31

    The DNA of higher eukaryotes contains many repetitive sequences. The study of repetitive sequences is important, not only because many have important biological function, but also because they provide information on genome organization, evolution and dynamics. In this paper, I will first discuss some generic effects that repetitive sequences will have upon genome dynamics and evolution. In particular, it will be shown that repetitive sequences foster recombination among, and turnover of, the elements of a genome. I will then consider some examples of repetitive sequences, notably minisatellite sequences and telomere sequences as examples of tandem repeats, without and with respectively known function, and Alu sequences as an example of interspersed repeats. Some other examples will also be considered in less detail.

  13. Milk protein-gum tragacanth mixed gels: effect of heat-treatment sequence.

    Science.gov (United States)

    Hatami, Masoud; Nejatian, Mohammad; Mohammadifar, Mohammad Amin; Pourmand, Hanieh

    2014-01-30

    The aim of this study was to investigate the role of the heat-treatment sequence of biopolymer mixtures as a formulation parameter on the acid-induced gelation of tri-polymeric systems composed of sodium caseinate (Na-caseinate), whey protein concentrate (WPC), and gum tragacanth (GT). This was studied by applying four sequences of heat treatment: (A) co-heating all three biopolymers; (B) heating the milk-protein dispersion and the GT dispersion separately; (C) heating the dispersion containing Na-caseinate and GT together and heating whey protein alone; and (D) co-heating whey protein with GT and heating Na-caseinate alone. According to small-deformation rheological measurements, the strength of the mixed-gel network decreased in the order: C>B>D>A samples. SEM micrographs show that the network of sample C is much more homogenous, coarse and dense than sample A, while the networks of samples B and D are of intermediate density. The heat-treatment sequence of the biopolymer mixtures as a formulation parameter thus offers an opportunity to control the microstructure and rheological properties of mixed gels. Copyright © 2013 Elsevier Ltd. All rights reserved.

  14. The SARS-unique domain (SUD of SARS coronavirus contains two macrodomains that bind G-quadruplexes.

    Directory of Open Access Journals (Sweden)

    Jinzhi Tan

    2009-05-01

    Full Text Available Since the outbreak of severe acute respiratory syndrome (SARS in 2003, the three-dimensional structures of several of the replicase/transcriptase components of SARS coronavirus (SARS-CoV, the non-structural proteins (Nsps, have been determined. However, within the large Nsp3 (1922 amino-acid residues, the structure and function of the so-called SARS-unique domain (SUD have remained elusive. SUD occurs only in SARS-CoV and the highly related viruses found in certain bats, but is absent from all other coronaviruses. Therefore, it has been speculated that it may be involved in the extreme pathogenicity of SARS-CoV, compared to other coronaviruses, most of which cause only mild infections in humans. In order to help elucidate the function of the SUD, we have determined crystal structures of fragment 389-652 ("SUD(core" of Nsp3, which comprises 264 of the 338 residues of the domain. Both the monoclinic and triclinic crystal forms (2.2 and 2.8 A resolution, respectively revealed that SUD(core forms a homodimer. Each monomer consists of two subdomains, SUD-N and SUD-M, with a macrodomain fold similar to the SARS-CoV X-domain. However, in contrast to the latter, SUD fails to bind ADP-ribose, as determined by zone-interference gel electrophoresis. Instead, the entire SUD(core as well as its individual subdomains interact with oligonucleotides known to form G-quadruplexes. This includes oligodeoxy- as well as oligoribonucleotides. Mutations of selected lysine residues on the surface of the SUD-N subdomain lead to reduction of G-quadruplex binding, whereas mutations in the SUD-M subdomain abolish it. As there is no evidence for Nsp3 entering the nucleus of the host cell, the SARS-CoV genomic RNA or host-cell mRNA containing long G-stretches may be targets of SUD. The SARS-CoV genome is devoid of G-stretches longer than 5-6 nucleotides, but more extended G-stretches are found in the 3'-nontranslated regions of mRNAs coding for certain host-cell proteins

  15. Fact retrieval and memory consolidation for a movement sequence: bidirectional effects of 'unrelated' cognitive tasks on procedural memory.

    Directory of Open Access Journals (Sweden)

    Rachel Tibi

    Full Text Available The generation of long-term memory for motor skills can be modulated by subsequent motor experiences that interfere with the consolidation process. Recent studies suggest that even a non-motor task may adversely affect some aspects of motor sequence memory. Here we show that motor sequence memory can be either enhanced or reduced, by different cognitive tasks. Participants were trained in performing finger movement sequences. Fully explicit instructions about the target sequence were given before practice. The buildup of procedural knowledge was tested at three time-points: immediately before training (T1, after practice (T2, and 24 hours later (T3. Each participant performed the task on two separate occasions; training on a different movement sequence on each occasion. In one condition, interference, participants performed a non-motor task immediately after T2. Half the participants solved simple math problems and half performed a simple semantic judgment task. In the baseline condition there was no additional task. All participants improved significantly between T1 and T2 (within-session gains. In addition, in the baseline condition, performance significantly improved between T2 and T3 (delayed 'off-line' gains. Solving math problems significantly enhanced these delayed gains in motor performance, whereas performing semantic decisions significantly reduced delayed gains compared to baseline. Thus, procedural motor memory consolidation can be either enhanced or inhibited by subsequent cognitive experiences. These effects do not require explicit or implicit new learning. The retrieval of unrelated, non-motor, well established knowledge can modulate procedural memory.

  16. A survey of single nucleotide polymorphisms identified from whole-genome sequencing and their functional effect in the porcine genome.

    Science.gov (United States)

    Keel, B N; Nonneman, D J; Rohrer, G A

    2017-08-01

    Genetic variants detected from sequence have been used to successfully identify causal variants and map complex traits in several organisms. High and moderate impact variants, those expected to alter or disrupt the protein coded by a gene and those that regulate protein production, likely have a more significant effect on phenotypic variation than do other types of genetic variants. Hence, a comprehensive list of these functional variants would be of considerable interest in swine genomic studies, particularly those targeting fertility and production traits. Whole-genome sequence was obtained from 72 of the founders of an intensely phenotyped experimental swine herd at the U.S. Meat Animal Research Center (USMARC). These animals included all 24 of the founding boars (12 Duroc and 12 Landrace) and 48 Yorkshire-Landrace composite sows. Sequence reads were mapped to the Sscrofa10.2 genome build, resulting in a mean of 6.1 fold (×) coverage per genome. A total of 22 342 915 high confidence SNPs were identified from the sequenced genomes. These included 21 million previously reported SNPs and 79% of the 62 163 SNPs on the PorcineSNP60 BeadChip assay. Variation was detected in the coding sequence or untranslated regions (UTRs) of 87.8% of the genes in the porcine genome: loss-of-function variants were predicted in 504 genes, 10 202 genes contained nonsynonymous variants, 10 773 had variation in UTRs and 13 010 genes contained synonymous variants. Approximately 139 000 SNPs were classified as loss-of-function, nonsynonymous or regulatory, which suggests that over 99% of the variation detected in our pigs could potentially be ignored, allowing us to focus on a much smaller number of functional SNPs during future analyses. Published 2017. This article is a U.S. Government work and is in the public domain in the USA.

  17. Effect of layering sequence and chemical treatment on the mechanical properties of woven kenaf–aramid hybrid laminated composites

    International Nuclear Information System (INIS)

    Yahaya, R.; Sapuan, S.M.; Jawaid, M.; Leman, Z.; Zainudin, E.S.

    2015-01-01

    Highlights: • The mechanical properties of woven kenaf/Kevlar hybrid composites were analysed. • The layering sequences affect the mechanical properties of hybrid composites. • Treated kenaf improves the mechanical properties of hybrid composites. - Abstract: This work aims to evaluate the effect of layering sequence and chemical treatment on mechanical properties of woven kenaf–Kevlar composites. Woven kenaf–aramid hybrid laminated composites fabricated through hand lay-up techniques by arranging woven kenaf and Kevlar fabrics in different layering sequences and by using treated kenaf mat. To evaluate the effect of chemical treatment on hybrid composites, the woven kenaf mat was treated with 6% sodium hydroxide (NaOH) diluted solution and compared mechanical properties with untreated kenaf hybrid composites. Results shows that the tensile properties of hybrid composites improved in 3-layer composites compared to 4-layer composites. Hybrid composite with Kevlar as outer layers display a better mechanical properties as compared to other hybrid composites. Tensile and flexural properties of treated hybrid composites are better than non-treated hybrid composites. The fractured surface of hybrid composites was investigated by scanning electron microscopy. This study is a part of exploration of potential application of the hybrid composite in high velocity impact application

  18. Effect of laying sequence on egg mercury in captive zebra finches: an interpretation considering individual variation.

    Science.gov (United States)

    Ou, Langbo; Varian-Ramos, Claire W; Cristol, Daniel A

    2015-08-01

    Bird eggs are used widely as noninvasive bioindicators for environmental mercury availability. Previous studies, however, have found varying relationships between laying sequence and egg mercury concentrations. Some studies have reported that the mercury concentration was higher in first-laid eggs or declined across the laying sequence, whereas in other studies mercury concentration was not related to egg order. Approximately 300 eggs (61 clutches) were collected from captive zebra finches dosed throughout their reproductive lives with methylmercury (0.3 μg/g, 0.6 μg/g, 1.2 μg/g, or 2.4 μg/g wet wt in diet); the total mercury concentration (mean ± standard deviation [SD] dry wt basis) of their eggs was 7.03 ± 1.38 μg/g, 14.15 ± 2.52 μg/g, 26.85 ± 5.85 μg/g, and 49.76 ± 10.37 μg/g, respectively (equivalent to fresh wt egg mercury concentrations of 1.24 μg/g, 2.50 μg/g, 4.74 μg/g, and 8.79 μg/g). The authors observed a significant decrease in the mercury concentration of successive eggs when compared with the first egg and notable variation between clutches within treatments. The mercury level of individual females within and among treatments did not alter this relationship. Based on the results, sampling of a single egg in each clutch from any position in the laying sequence is sufficient for purposes of population risk assessment, but it is not recommended as a proxy for individual female exposure or as an estimate of average mercury level within the clutch. © 2015 SETAC.

  19. Effect of chronic uremia on the transcriptional profile of the calcified aorta analyzed by RNA sequencing

    DEFF Research Database (Denmark)

    Rukov, Jakob Lewin; Gravesen, Eva; Mace, Maria L.

    2016-01-01

    The development of vascular calcification (VC) in chronic uremia (CU) is a tightly regulated process controlled by factors promoting and inhibiting mineralization. Next-generation high-throughput RNA sequencing (RNA-seq) is a powerful and sensitive tool for quantitative gene expression profiling...... with an expression level of >1 reads/kilobase transcript/million mapped reads, 2,663 genes were differentially expressed with 47% upregulated genes and 53% downregulated genes in uremic rats. Significantly deregulated genes were enriched for ontologies related to the extracellular matrix, response to wounding...

  20. Effect of zinc sources on yield and utilization of zinc in rice-wheat sequence

    International Nuclear Information System (INIS)

    Deb, D.L.

    1990-01-01

    A field experiment was conducted on an inceptisol of Delhi to evaluate three sources of zinc, namely, zinc sulphate, zincated urea and zinc oxide on yield and utilization of zinc in rice-wheat sequence. Results indicated that, amongst the three zinc sources, zinc sulphate and zincated urea gave the best performance in increasing the grain yield of rice whereas zinc oxide depressed the grain yield of wheat significantly when compared to other treatments. The highest Zn derived from fertilizer and its utilization was obtained with zinc sulphate for both rice and wheat crops. (author). 9 refs., 4 tabs

  1. Effects of the amino acid sequence on thermal conduction through β-sheet crystals of natural silk protein.

    Science.gov (United States)

    Zhang, Lin; Bai, Zhitong; Ban, Heng; Liu, Ling

    2015-11-21

    Recent experiments have discovered very different thermal conductivities between the spider silk and the silkworm silk. Decoding the molecular mechanisms underpinning the distinct thermal properties may guide the rational design of synthetic silk materials and other biomaterials for multifunctionality and tunable properties. However, such an understanding is lacking, mainly due to the complex structure and phonon physics associated with the silk materials. Here, using non-equilibrium molecular dynamics, we demonstrate that the amino acid sequence plays a key role in the thermal conduction process through β-sheets, essential building blocks of natural silks and a variety of other biomaterials. Three representative β-sheet types, i.e. poly-A, poly-(GA), and poly-G, are shown to have distinct structural features and phonon dynamics leading to different thermal conductivities. A fundamental understanding of the sequence effects may stimulate the design and engineering of polymers and biopolymers for desired thermal properties.

  2. Label-free detection of kanamycin based on a G-quadruplex DNA aptamer-based fluorescent intercalator displacement assay

    Science.gov (United States)

    Xing, Yun-Peng; Liu, Chun; Zhou, Xiao-Hong; Shi, Han-Chang

    2015-01-01

    This work was the first to report that the kanamycin-binding DNA aptamer (5'-TGG GGG TTG AGG CTA AGC CGA-3') can form stable parallel G-quadruplex DNA (G4-DNA) structures by themselves and that this phenomenon can be verified by nondenaturing polyacrylamide gel electrophoresis and circular dichroism spectroscopy. Based on these findings, we developed a novel label-free strategy for kanamycin detection based on the G4-DNA aptamer-based fluorescent intercalator displacement assay with thiazole orange (TO) as the fluorescence probe. In the proposed strategy, TO became strongly fluorescent upon binding to kanamycin-binding G4-DNA. However, the addition of kanamycin caused the displacement of TO from the G4-DNA-TO conjugate, thereby resulting in decreased fluorescent signal, which was inversely related to the kanamycin concentration. The detection limit of the proposed assay decreased to 59 nM with a linear working range of 0.1 μM to 20 μM for kanamycin. The cross-reactivity against six other antibiotics was negligible compared with the response to kanamycin. A satisfactory recovery of kanamycin in milk samples ranged from 80.1% to 98.0%, confirming the potential of this bioassay in the measurement of kanamycin in various applications. Our results also served as a good reference for developing similar fluorescent G4-DNA-based bioassays in the future.

  3. Effects of main-sequence mass loss on the turnoff ages of globular clusters

    International Nuclear Information System (INIS)

    Guzik, J.A.

    1989-01-01

    Willson, Bowen, and Struck-Marcell have proposed that globular cluster main-sequence turnoff ages can be reconciled with the lower ages of the Galaxy and universe deduced from other methods by incorporating an epoch of early main-sequence mass-loss by stars of spectral types A through early-F. The proposed mass loss is pulsation-driven, and facilitated by rapid rotation. This paper presents stellar evolution calculations of Pop. II (Z = 0.001) mass-losing stars of initial mass 0.8 to 1.6 M circle dot , with exponentially-decreasing mass loss rates of e-folding times 0.5 to 2.0 Gyr, evolving to a final mass of 0.7 M circle dot . The calculations indicate that a globular cluster with apparent turnoff age 18 Gyr could have an actual age as low as ∼12 Gyr. Observational implications that may help to verify the hypothesis, e.g. low C/N abundance ratios among red giants following first dredge-up, blue stragglers, red giant deficiencies, and signatures in cluster mass/luminosity functions, are also discussed.25 refs., 4 figs., 3 tabs

  4. Evolutionary dynamics on networks of selectively neutral genotypes: effects of topology and sequence stability.

    Science.gov (United States)

    Aguirre, Jacobo; Buldú, Javier M; Manrubia, Susanna C

    2009-12-01

    Networks of selectively neutral genotypes underlie the evolution of populations of replicators in constant environments. Previous theoretical analysis predicted that such populations will evolve toward highly connected regions of the genome space. We first study the evolution of populations of replicators on simple networks and quantify how the transient time to equilibrium depends on the initial distribution of sequences on the neutral network, on the topological properties of the latter, and on the mutation rate. Second, network neutrality is broken through the introduction of an energy for each sequence. This allows to study the competition between two features (neutrality and energetic stability) relevant for survival and subjected to different selective pressures. In cases where the two features are negatively correlated, the population experiences sudden migrations in the genome space for values of the relevant parameters that we calculate. The numerical study of larger networks indicates that the qualitative behavior to be expected in more realistic cases is already seen in representative examples of small networks.

  5. Effects of dopamine medication on sequence learning with stochastic feedback in Parkinson's disease

    Directory of Open Access Journals (Sweden)

    Moonsang Seo

    2010-08-01

    Full Text Available A growing body of evidence suggests that the midbrain dopamine system plays a key role in reinforcement learning and disruption of the midbrain dopamine system in Parkinson's disease (PD may lead to deficits on tasks that require learning from feedback. We examined how changes in dopamine levels (‘ON’ and ‘OFF’ their dopamine medication affect sequence learning from stochastic positive and negative feedback using Bayesian reinforcement learning models. We found deficits in sequence learning in patients with PD when they were ‘ON’ and ‘OFF’ medication relative to healthy controls, but smaller differences between patients ‘OFF’ and ‘ON’. The deficits were mainly due to decreased learning from positive feedback, although across all participant groups learning was more strongly associated with positive than negative feedback in our task. The learning in our task is likely mediated by the relatively depleted dorsal striatum and not the relatively intact ventral striatum. Therefore, the changes we see in our task may be due to a strong loss of phasic dopamine signals in the dorsal striatum in PD.

  6. Evolutionary dynamics on networks of selectively neutral genotypes: Effects of topology and sequence stability

    Science.gov (United States)

    Aguirre, Jacobo; Buldú, Javier M.; Manrubia, Susanna C.

    2009-12-01

    Networks of selectively neutral genotypes underlie the evolution of populations of replicators in constant environments. Previous theoretical analysis predicted that such populations will evolve toward highly connected regions of the genome space. We first study the evolution of populations of replicators on simple networks and quantify how the transient time to equilibrium depends on the initial distribution of sequences on the neutral network, on the topological properties of the latter, and on the mutation rate. Second, network neutrality is broken through the introduction of an energy for each sequence. This allows to study the competition between two features (neutrality and energetic stability) relevant for survival and subjected to different selective pressures. In cases where the two features are negatively correlated, the population experiences sudden migrations in the genome space for values of the relevant parameters that we calculate. The numerical study of larger networks indicates that the qualitative behavior to be expected in more realistic cases is already seen in representative examples of small networks.

  7. Effects of Dopamine Medication on Sequence Learning with Stochastic Feedback in Parkinson's Disease

    Science.gov (United States)

    Seo, Moonsang; Beigi, Mazda; Jahanshahi, Marjan; Averbeck, Bruno B.

    2010-01-01

    A growing body of evidence suggests that the midbrain dopamine system plays a key role in reinforcement learning and disruption of the midbrain dopamine system in Parkinson's disease (PD) may lead to deficits on tasks that require learning from feedback. We examined how changes in dopamine levels (“ON” and “OFF” their dopamine medication) affect sequence learning from stochastic positive and negative feedback using Bayesian reinforcement learning models. We found deficits in sequence learning in patients with PD when they were “ON” and “OFF” medication relative to healthy controls, but smaller differences between patients “OFF” and “ON”. The deficits were mainly due to decreased learning from positive feedback, although across all participant groups learning was more strongly associated with positive than negative feedback in our task. The learning in our task is likely mediated by the relatively depleted dorsal striatum and not the relatively intact ventral striatum. Therefore, the changes we see in our task may be due to a strong loss of phasic dopamine signals in the dorsal striatum in PD. PMID:20740077

  8. Proton T2 Relaxation effect of superparamagnetic iron oxide on fast spin echo sequence. Influence of echo number (even or odd) of effective TE

    International Nuclear Information System (INIS)

    Tsuchihashi, Toshio; Maki, Toshio; Kitagawa, Matsuo; Suzuki, Takeshi; Fujita, Isao

    1999-01-01

    The T 2 relaxation effect of the fast spin echo sequence (FSE) was investigated using superparamagnetic iron oxide (SPIO) particles. When even echoes were used as the effective TE of FSE, the signal intensity ratio [signal intensity of FSE/signal intensity of conventional spin echo sequence (CSE)] of FSE and CSE increased, whereas the T 2 relaxation effect of SPIO with FSE was reduced. However, when odd echoes were used, neither signal intensity changed, and weakening of the T 2 relaxation effect, considered a problem with FSE, was reduced. This phenomenon was not observed when the refocusing flip angle was changed to 30 and 60 degrees. However, it was observed when the refocusing flip angle was 120 and 150 degrees. Thus, this phenomenon can be considered to be related to oscillation in longitudinal magnetization when using the Carr-Purcell-Meiboom-Gill (CPMG) technique. (author)

  9. Label-free and enzyme-free detection of transcription factors with graphene oxide fluorescence switch-based multifunctional G-quadruplex-hairpin probe.

    Science.gov (United States)

    Zhu, Desong; Wang, Lei; Xu, Xiaowen; Jiang, Wei

    2016-01-15

    Transcription factors (TFs) play pivotal roles in the regulation of a variety of essential cellular processes and some of them have been recognized as potential diagnostic markers and therapeutic targets of some diseases. Sensitive and accurate detection of TFs is of great importance to better understanding their roles in gene regulation and evaluation of disease state. Here, we developed a simple, label-free and enzyme-free new fluorescent strategy for the detection of TFs by graphene oxide (GO) fluorescence switch-based multifunctional G-quadruplex-hairpin probe (MGHP). The MGHP possessed of three functions simultaneously, adsorbing onto GO with the loop part, binding to target with the stem part and serving as signal carrier with the terminal G-quadruplex. First, the MGHP was adsorbed quickly to GO. Next, the TF bound to the stem part of MGHP to form a huge target-MGHP complex, which led to desorption of the complex from GO. Finally, NMM was inserted into G-quadruplex in the complex to yield an enhanced fluorescence response. The GO used here, as a fluorescence switch, could quickly and efficiently quench the fluorescence of NMM inserted into the MGHP absorbed on the GO, guaranteeing a high signal-to-noise ratio. Sensitive detection of purified NF-κB p50 and HeLa cell nuclear extracts were achieved with detection limits of 0.2nM and 7.8ng/µL, respectively. Moreover, this proposed strategy could be used to screen inhibitors of NF-κB p50 activity. The strategy proposed here might offer a new potential approach for reliable quantification of TFs in clinical diagnostics and treatment research of some diseases. Copyright © 2015 Elsevier B.V. All rights reserved.

  10. Thioflavin T binds dimeric parallel-stranded GA-containing non-G-quadruplex DNAs: a general approach to lighting up double-stranded scaffolds.

    Science.gov (United States)

    Liu, Shuangna; Peng, Pai; Wang, Huihui; Shi, Lili; Li, Tao

    2017-12-01

    A molecular rotor thioflavin T (ThT) is usually used as a fluorescent ligand specific for G-quadruplexes. Here, we demonstrate that ThT can tightly bind non-G-quadruplex DNAs with several GA motifs and dimerize them in a parallel double-stranded mode, accompanied by over 100-fold enhancement in the fluorescence emission of ThT. The introduction of reverse Watson-Crick T-A base pairs into these dimeric parallel-stranded DNA systems remarkably favors the binding of ThT into the pocket between G•G and A•A base pairs, where ThT is encapsulated thereby restricting its two rotary aromatic rings in the excited state. A similar mechanism is also demonstrated in antiparallel DNA duplexes where several motifs of two consecutive G•G wobble base pairs are incorporated and serve as the active pockets for ThT binding. The insight into the interactions of ThT with non-G-quadruplex DNAs allows us to introduce a new concept for constructing DNA-based sensors and devices. As proof-of-concept experiments, we design a DNA triplex containing GA motifs in its Hoogsteen hydrogen-bonded two parallel strands as a pH-driven nanoswitch and two GA-containing parallel duplexes as novel metal sensing platforms where C-C and T-T mismatches are included. This work may find further applications in biological systems (e.g. disease gene detection) where parallel duplex or triplex stretches are involved. © The Author(s) 2017. Published by Oxford University Press on behalf of Nucleic Acids Research.

  11. Effect of stacking sequence and surface treatment on the thermal conductivity of multilayered hybrid nano-composites

    Science.gov (United States)

    Papanicolaou, G. C.; Pappa, E. J.; Portan, D. V.; Kotrotsos, A.; Kollia, E.

    2018-02-01

    The aim of the present investigation was to study the effect of both the stacking sequence and surface treatment on the thermal conductivity of multilayered hybrid nano-composites. Four types of multilayered hybrid nanocomposites were manufactured and tested: Nitinol- CNTs (carbon nanotubes)- Acrylic resin; Nitinol- Acrylic resin- CNTs; Surface treated Nitinol- CNTs- Acrylic resin and Surface treated Nitinol- Acrylic resin- CNTs. Surface treatment of Nitinol plies was realized by means of the electrochemical anodization. Surface topography of the anodized nitinol sheets was investigated through Scanning Electron Microscopy (SEM). It was found that the overall thermal response of the manufactured multilayered nano-composites was greatly influenced by both the anodization and the stacking sequence. A theoretical model for the prediction of the overall thermal conductivity has been developed considering the nature of the different layers, their stacking sequence as well as the interfacial thermal resistance. Thermal conductivity and Differential Scanning Calorimetry (DSC) measurements were conducted, to verify the predicted by the model overall thermal conductivities. In all cases, a good agreement between theoretical predictions and experimental results was found.

  12. Analyzing AbrB-Knockout Effects through Genome and Transcriptome Sequencing of Bacillus licheniformis DW2

    Science.gov (United States)

    Shu, Cheng-Cheng; Wang, Dong; Guo, Jing; Song, Jia-Ming; Chen, Shou-Wen; Chen, Ling-Ling; Gao, Jun-Xiang

    2018-01-01

    As an industrial bacterium, Bacillus licheniformis DW2 produces bacitracin which is an important antibiotic for many pathogenic microorganisms. Our previous study showed AbrB-knockout could significantly increase the production of bacitracin. Accordingly, it was meaningful to understand its genome features, expression differences between wild and AbrB-knockout (ΔAbrB) strains, and the regulation of bacitracin biosynthesis. Here, we sequenced, de novo assembled and annotated its genome, and also sequenced the transcriptomes in three growth phases. The genome of DW2 contained a DNA molecule of 4,468,952 bp with 45.93% GC content and 4,717 protein coding genes. The transcriptome reads were mapped to the assembled genome, and obtained 4,102∼4,536 expressed genes from different samples. We investigated transcription changes in B. licheniformis DW2 and showed that ΔAbrB caused hundreds of genes up-regulation and down-regulation in different growth phases. We identified a complete bacitracin synthetase gene cluster, including the location and length of bacABC, bcrABC, and bacT, as well as their arrangement. The gene cluster bcrABC were significantly up-regulated in ΔAbrB strain, which supported the hypothesis in previous study of bcrABC transporting bacitracin out of the cell to avoid self-intoxication, and was consistent with the previous experimental result that ΔAbrB could yield more bacitracin. This study provided a high quality reference genome for B. licheniformis DW2, and the transcriptome data depicted global alterations across two strains and three phases offered an understanding of AbrB regulation and bacitracin biosynthesis through gene expression. PMID:29599755

  13. Targeted sequencing of plant genomes

    Science.gov (United States)

    Mark D. Huynh

    2014-01-01

    Next-generation sequencing (NGS) has revolutionized the field of genetics by providing a means for fast and relatively affordable sequencing. With the advancement of NGS, wholegenome sequencing (WGS) has become more commonplace. However, sequencing an entire genome is still not cost effective or even beneficial in all cases. In studies that do not require a whole-...

  14. BLM helicase suppresses recombination at G-quadruplex motifs in transcribed genes

    NARCIS (Netherlands)

    van Wietmarschen, Niek; Merzouk, Sarra; Halsema, Nancy; Spierings, Diana C J; Guryev, Victor; Lansdorp, Peter M

    2018-01-01

    Bloom syndrome is a cancer predisposition disorder caused by mutations in the BLM helicase gene. Cells from persons with Bloom syndrome exhibit striking genomic instability characterized by excessive sister chromatid exchange events (SCEs). We applied single-cell DNA template strand sequencing

  15. Sequence assembly

    DEFF Research Database (Denmark)

    Scheibye-Alsing, Karsten; Hoffmann, S.; Frankel, Annett Maria

    2009-01-01

    Despite the rapidly increasing number of sequenced and re-sequenced genomes, many issues regarding the computational assembly of large-scale sequencing data have remain unresolved. Computational assembly is crucial in large genome projects as well for the evolving high-throughput technologies and...... in genomic DNA, highly expressed genes and alternative transcripts in EST sequences. We summarize existing comparisons of different assemblers and provide a detailed descriptions and directions for download of assembly programs at: http://genome.ku.dk/resources/assembly/methods.html....

  16. Genome Sequencing

    DEFF Research Database (Denmark)

    Sato, Shusei; Andersen, Stig Uggerhøj

    2014-01-01

    The current Lotus japonicus reference genome sequence is based on a hybrid assembly of Sanger TAC/BAC, Sanger shotgun and Illumina shotgun sequencing data generated from the Miyakojima-MG20 accession. It covers nearly all expressed L. japonicus genes and has been annotated mainly based on transcr......The current Lotus japonicus reference genome sequence is based on a hybrid assembly of Sanger TAC/BAC, Sanger shotgun and Illumina shotgun sequencing data generated from the Miyakojima-MG20 accession. It covers nearly all expressed L. japonicus genes and has been annotated mainly based...

  17. Effects of order and sequence of resistance and endurance training on body fat in elementary school-aged girls

    Directory of Open Access Journals (Sweden)

    Ana R. Alves

    2017-12-01

    Full Text Available The purpose of this study was to analyse the effects of order and sequence of concurrent resistance and endurance training on body fat percentage (BFP in a large sample of elementary school-aged girls. One hundred and twenty-six healthy girls, aged 10-11 years (10.95 ± 0.48 years, were randomly assigned to six groups to perform different training protocols per week for 8 weeks: Resistance-only (R, Endurance-only (E, Concurrent Distinct Endurance-Resistance (CDER, Concurrent Parallel Endurance-Resistance (CPER, Concurrent Parallel Resistance-Endurance (CPRE, and a Control group (C. In R and E, the subjects performed single sessions of resistance or endurance exercises, respectively (two days per week. In CDER, resistance-endurance training was performed on different days each week (four days per week. CPER and CPRE performed single-session combined endurance-resistance training or combined resistance-endurance training, respectively, each week (two days per week. After an 8-week training period, BFP decreased in all experimental groups (CPER: 13.3%, p0.05; and CDER: 5.6%, p>0.05. However, a significant difference was found in CPER and CPRE when compared to CDER, E, and R, indicating that training sequence may influence BFP. All programmes were effective, but CPER and CPRE obtained better results for BFP than CDER, E, or R. The effects of concurrent resistance and endurance training on body fat percentage can be mediated by order and sequence of exercise. These results provide insight into optimization of school-based fat loss exercise programmes in childhood.

  18. A rapid and effective method for screening, sequencing and reporter verification of engineered frameshift mutations in zebrafish

    Directory of Open Access Journals (Sweden)

    Sergey V. Prykhozhij

    2017-06-01

    Full Text Available Clustered regularly interspaced palindromic repeats (CRISPR/Cas-based adaptive immunity against pathogens in bacteria has been adapted for genome editing and applied in zebrafish (Danio rerio to generate frameshift mutations in protein-coding genes. Although there are methods to detect, quantify and sequence CRISPR/Cas9-induced mutations, identifying mutations in F1 heterozygous fish remains challenging. Additionally, sequencing a mutation and assuming that it causes a frameshift does not prove causality because of possible alternative translation start sites and potential effects of mutations on splicing. This problem is compounded by the relatively few antibodies available for zebrafish proteins, limiting validation at the protein level. To address these issues, we developed a detailed protocol to screen F1 mutation carriers, and clone and sequence identified mutations. In order to verify that mutations actually cause frameshifts, we created a fluorescent reporter system that can detect frameshift efficiency based on the cloning of wild-type and mutant cDNA fragments and their expression levels. As proof of principle, we applied this strategy to three CRISPR/Cas9-induced mutations in pycr1a, chd7 and hace1 genes. An insertion of seven nucleotides in pycr1a resulted in the first reported observation of exon skipping by CRISPR/Cas9-induced mutations in zebrafish. However, of these three mutant genes, the fluorescent reporter revealed effective frameshifting exclusively in the case of a two-nucleotide deletion in chd7, suggesting activity of alternative translation sites in the other two mutants even though pycr1a exon-skipping deletion is likely to be deleterious. This article provides a protocol for characterizing frameshift mutations in zebrafish, and highlights the importance of checking mutations at the mRNA level and verifying their effects on translation by fluorescent reporters when antibody detection of protein loss is not possible.

  19. The effective reflection of a pulse sequence from a four-wave mirror with thermal nonlinearity under parametric feedback

    Science.gov (United States)

    Barashkov, M. S.; Bel'Diugin, I. M.; Zolotarev, M. V.; Kruzhilin, Iu. I.; Krymskii, M. I.

    1989-04-01

    A four-wave mirror with thermal nonlinearity has been experimentally realized with the interaction of corunning waves under parametric feedback with a nonreciprocal element. The effective reflection of a sequence of pulses with duration of about 300 ns from a neodymium-glass laser with maximal reflection coefficients greater than 30 has been demonstrated. The quality of the radiation reflected from the mirror is studied. A significant reduction in the steady-state lasing threshold has been shown with thermal nonlinearity at small angles of the interacting beam convergence, compared to the case of counterrunning convergence.

  20. Effects of sequence of nylon bags rumen incubation on kinetics of degradation in some commonly used feedstuffs in dairy rations

    Institute of Scientific and Technical Information of China (English)

    DONG Shuang-zhao; Arash Azarfar; ZOU Yang; LI Sheng-li; WANG Ya-jing; CAO Zhi-jun

    2017-01-01

    Nowadays, most available information on the degradative behaviour of feeds in ruminants is based onin situ incubation in the rumen, and it is adopted by many feed evaluation systems currently in use for ruminants. However, the outcome of this technique might be affected by many factors such as sequence of nylon bags incubation in the rumen. The objective of current study was to investigate effects of sequence of nylon bag incubation on degradative behavior of dry matter (DM), crude protein (CP), neutral detergent ifber (NDF) and acid detergent ifber (ADF) in some feed ingredients commonly used in dairy rations, including alfalfa haylage, corn silage, corn grain and soybean meal. Four multiparous Holstein lactating cows iftted with permanent ruminal cannulas were used. The nylon bags containing feed samples either were placed in the rumen at once and removed at designated time intervals (all in-gradually out method; AG) or were placed in the rumen at designated time points and retrieved at once (gradually in-all out method; GA). Fractional rate of degradation of potentially degradable fraction, lag time and effective rumen degradability (ED) of DM and CP were signiifcantly higher in the AG compared to the GA method (P namely corn grain and soybean meal. This experiment is the ifrst time to investigate effects of two methods under the same experiment conditions, providing basic data for the determination of ED.

  1. Effect of redox conditions on pharmaceutical loss during biological wastewater treatment using sequencing batch reactors

    Energy Technology Data Exchange (ETDEWEB)

    Stadler, Lauren B., E-mail: lstadler@umich.edu [Department of Civil and Environmental Engineering, University of Michigan, 1351 Beal Avenue, EWRE, Ann Arbor, MI 48109 (United States); Su, Lijuan, E-mail: lijuansu@buffalo.edu [Department of Chemistry, University at Buffalo, State University of New York, Buffalo, NY 14260 (United States); Moline, Christopher J., E-mail: christopher.moline@hdrinc.com [Department of Civil and Environmental Engineering, University of Michigan, 1351 Beal Avenue, EWRE, Ann Arbor, MI 48109 (United States); Ernstoff, Alexi S., E-mail: alexer@dtu.dk [Department of Civil and Environmental Engineering, University of Michigan, 1351 Beal Avenue, EWRE, Ann Arbor, MI 48109 (United States); Aga, Diana S., E-mail: dianaaga@buffalo.edu [Department of Chemistry, University at Buffalo, State University of New York, Buffalo, NY 14260 (United States); Love, Nancy G., E-mail: nglove@umich.edu [Department of Civil and Environmental Engineering, University of Michigan, 1351 Beal Avenue, EWRE, Ann Arbor, MI 48109 (United States)

    2015-01-23

    Highlights: • Pharmaceutical fate was studied in SBRs operated at different redox conditions. • Stable carbon oxidation and nitrification occurred under microaerobic conditions. • Losses of atenolol and trimethoprim were highest under fully aerobic conditions. • Loss of sulfamethoxazole was highest under microaerobic conditions. • Deconjugation occurred during treatment to form sulfamethoxazole and desvenlafaxine. - Abstract: We lack a clear understanding of how wastewater treatment plant (WWTP) process parameters, such as redox environment, impact pharmaceutical fate. WWTPs increasingly install more advanced aeration control systems to save energy and achieve better nutrient removal performance. The impact of redox condition, and specifically the use of microaerobic (low dissolved oxygen) treatment, is poorly understood. In this study, the fate of a mixture of pharmaceuticals and several of their transformation products present in the primary effluent of a local WWTP was assessed in sequencing batch reactors operated under different redox conditions: fully aerobic, anoxic/aerobic, and microaerobic (DO concentration ≈0.3 mg/L). Among the pharmaceuticals that were tracked during this study (atenolol, trimethoprim, sulfamethoxazole, desvenlafaxine, venlafaxine, and phenytoin), overall loss varied between them and between redox environments. Losses of atenolol and trimethoprim were highest in the aerobic reactor; sulfamethoxazole loss was highest in the microaerobic reactors; and phenytoin was recalcitrant in all reactors. Transformation products of sulfamethoxazole and desvenlafaxine resulted in the reformation of their parent compounds during treatment. The results suggest that transformation products must be accounted for when assessing removal efficiencies and that redox environment influences the degree of pharmaceutical loss.

  2. Effect of redox conditions on pharmaceutical loss during biological wastewater treatment using sequencing batch reactors

    International Nuclear Information System (INIS)

    Stadler, Lauren B.; Su, Lijuan; Moline, Christopher J.; Ernstoff, Alexi S.; Aga, Diana S.; Love, Nancy G.

    2015-01-01

    Highlights: • Pharmaceutical fate was studied in SBRs operated at different redox conditions. • Stable carbon oxidation and nitrification occurred under microaerobic conditions. • Losses of atenolol and trimethoprim were highest under fully aerobic conditions. • Loss of sulfamethoxazole was highest under microaerobic conditions. • Deconjugation occurred during treatment to form sulfamethoxazole and desvenlafaxine. - Abstract: We lack a clear understanding of how wastewater treatment plant (WWTP) process parameters, such as redox environment, impact pharmaceutical fate. WWTPs increasingly install more advanced aeration control systems to save energy and achieve better nutrient removal performance. The impact of redox condition, and specifically the use of microaerobic (low dissolved oxygen) treatment, is poorly understood. In this study, the fate of a mixture of pharmaceuticals and several of their transformation products present in the primary effluent of a local WWTP was assessed in sequencing batch reactors operated under different redox conditions: fully aerobic, anoxic/aerobic, and microaerobic (DO concentration ≈0.3 mg/L). Among the pharmaceuticals that were tracked during this study (atenolol, trimethoprim, sulfamethoxazole, desvenlafaxine, venlafaxine, and phenytoin), overall loss varied between them and between redox environments. Losses of atenolol and trimethoprim were highest in the aerobic reactor; sulfamethoxazole loss was highest in the microaerobic reactors; and phenytoin was recalcitrant in all reactors. Transformation products of sulfamethoxazole and desvenlafaxine resulted in the reformation of their parent compounds during treatment. The results suggest that transformation products must be accounted for when assessing removal efficiencies and that redox environment influences the degree of pharmaceutical loss

  3. Modeling earthquake sequences along the Manila subduction zone: Effects of three-dimensional fault geometry

    Science.gov (United States)

    Yu, Hongyu; Liu, Yajing; Yang, Hongfeng; Ning, Jieyuan

    2018-05-01

    To assess the potential of catastrophic megathrust earthquakes (MW > 8) along the Manila Trench, the eastern boundary of the South China Sea, we incorporate a 3D non-planar fault geometry in the framework of rate-state friction to simulate earthquake rupture sequences along the fault segment between 15°N-19°N of northern Luzon. Our simulation results demonstrate that the first-order fault geometry heterogeneity, the transitional-segment (possibly related to the subducting Scarborough seamount chain) connecting the steeper south segment and the flatter north segment, controls earthquake rupture behaviors. The strong along-strike curvature at the transitional-segment typically leads to partial ruptures of MW 8.3 and MW 7.8 along the southern and northern segments respectively. The entire fault occasionally ruptures in MW 8.8 events when the cumulative stress in the transitional-segment is sufficiently high to overcome the geometrical inhibition. Fault shear stress evolution, represented by the S-ratio, is clearly modulated by the width of seismogenic zone (W). At a constant plate convergence rate, a larger W indicates on average lower interseismic stress loading rate and longer rupture recurrence period, and could slow down or sometimes stop ruptures that initiated from a narrower portion. Moreover, the modeled interseismic slip rate before whole-fault rupture events is comparable with the coupling state that was inferred from the interplate seismicity distribution, suggesting the Manila trench could potentially rupture in a M8+ earthquake.

  4. Precipitation sequence and its effect on age hardening of alumina-forming austenitic stainless steel

    Energy Technology Data Exchange (ETDEWEB)

    Moon, Joonoh, E-mail: mjo99@kims.re.kr [Ferrous Alloy Department, Advanced Metallic Materials Division, Korea Institute of Materials Science, Changwon, Gyeongnam 642-831 (Korea, Republic of); Lee, Tae-Ho [Ferrous Alloy Department, Advanced Metallic Materials Division, Korea Institute of Materials Science, Changwon, Gyeongnam 642-831 (Korea, Republic of); Heo, Yoon-Uk [Graduate Institute of Ferrous Technology, Pohang University of Science and Technology, 77 Cheongam-ro, Nam-gu, Gyeongbuk 790-784 (Korea, Republic of); Han, Young-Soo [Neutron Science Division, Korea Atomic Energy Research Institute, Daejeon 305-353 (Korea, Republic of); Kang, Jun-Yun; Ha, Heon-Young [Ferrous Alloy Department, Advanced Metallic Materials Division, Korea Institute of Materials Science, Changwon, Gyeongnam 642-831 (Korea, Republic of); Suh, Dong-Woo [Graduate Institute of Ferrous Technology, Pohang University of Science and Technology, 77 Cheongam-ro, Nam-gu, Gyeongbuk 790-784 (Korea, Republic of)

    2015-10-01

    The precipitation sequence during ageing of Fe–14Cr–20Ni–0.9Nb–2.5Al based alumina-forming austenitic (AFA) steel was explored through a transmission electron microscopy analysis and a small angle neutron scattering experiment. The samples were aged at 700 °C for up to 504 h. Particles of NbC, M{sub 23}C{sub 6} and Ni{sub 3}Al-type L1{sub 2} were observed in the early stage of ageing. Metastable L1{sub 2} particles were formed both in grain interior and along grain boundary. M{sub 23}C{sub 6} carbides precipitated along grain boundary accompanied with precipitation of L1{sub 2} particles. After ageing for longer than 48 h, particles of B2-NiAl and Laves-Fe{sub 2}Nb were newly formed. We suggest the possibility of phase transition from L1{sub 2} to B2 with increase in ageing time. Finally, this study examined the change of mechanical properties during ageing through a Gleeble hot tension test and a Vickers hardness test, and then the relationship between precipitation behavior and mechanical properties was carefully investigated and discussed in terms of precipitation behavior.

  5. Elementary Statistical Models for Vector Collision-Sequence Interference Effects with Poisson-Distributed Collision Times

    International Nuclear Information System (INIS)

    Lewis, J.C.

    2011-01-01

    In a recent paper (Lewis, 2008) a class of models suitable for application to collision-sequence interference was introduced. In these models velocities are assumed to be completely randomized in each collision. The distribution of velocities was assumed to be Gaussian. The integrated induced dipole moment μk, for vector interference, or the scalar modulation μk, for scalar interference, was assumed to be a function of the impulse (integrated force) fk, or its magnitude fk, experienced by the molecule in a collision. For most of (Lewis, 2008) it was assumed that μk fk and μk fk, but it proved to be possible to extend the models, so that the magnitude of the induced dipole moment is equal to an arbitrary power or sum of powers of the intermolecular force. This allows estimates of the in filling of the interference dip by the dis proportionality of the induced dipole moment and force. One particular such model, using data from (Herman and Lewis, 2006), leads to the most realistic estimate for the in filling of the vector interference dip yet obtained. In (Lewis, 2008) the drastic assumption was made that collision times occurred at equal intervals. In the present paper that assumption is removed: the collision times are taken to form a Poisson process. This is much more realistic than the equal-intervals assumption. The interference dip is found to be a Lorentzian in this model

  6. Effect of temperature and cycle length on microbial competition in PHB-producing sequencing batch reactor.

    Science.gov (United States)

    Jiang, Yang; Marang, Leonie; Kleerebezem, Robbert; Muyzer, Gerard; van Loosdrecht, Mark C M

    2011-05-01

    The impact of temperature and cycle length on microbial competition between polyhydroxybutyrate (PHB)-producing populations enriched in feast-famine sequencing batch reactors (SBRs) was investigated at temperatures of 20 °C and 30 °C, and in a cycle length range of 1-18 h. In this study, the microbial community structure of the PHB-producing enrichments was found to be strongly dependent on temperature, but not on cycle length. Zoogloea and Plasticicumulans acidivorans dominated the SBRs operated at 20 °C and 30 °C, respectively. Both enrichments accumulated PHB more than 75% of cell dry weight. Short-term temperature change experiments revealed that P. acidivorans was more temperature sensitive as compared with Zoogloea. This is particularly true for the PHB degradation, resulting in incomplete PHB degradation in P. acidivorans at 20 °C. Incomplete PHB degradation limited biomass growth and allowed Zoogloea to outcompete P. acidivorans. The PHB content at the end of the feast phase correlated well with the cycle length at a constant solid retention time (SRT). These results suggest that to establish enrichment with the capacity to store a high fraction of PHB, the number of cycles per SRT should be minimized independent of the temperature.

  7. Effect of BRCA2 sequence variants predicted to disrupt exonic splice enhancers on BRCA2 transcripts

    Directory of Open Access Journals (Sweden)

    Brewster Brooke L

    2010-05-01

    Full Text Available Abstract Background Genetic screening of breast cancer patients and their families have identified a number of variants of unknown clinical significance in the breast cancer susceptibility genes, BRCA1 and BRCA2. Evaluation of such unclassified variants may be assisted by web-based bioinformatic prediction tools, although accurate prediction of aberrant splicing by unclassified variants affecting exonic splice enhancers (ESEs remains a challenge. Methods This study used a combination of RT-PCR analysis and splicing reporter minigene assays to assess five unclassified variants in the BRCA2 gene that we had previously predicted to disrupt an ESE using bioinformatic approaches. Results Analysis of BRCA2 c.8308 G > A (p.Ala2770Thr by mRNA analysis, and BRCA2 c.8962A > G (p.Ser2988Gly, BRCA2 c.8972G > A (p.Arg2991His, BRCA2 c.9172A > G (p.Ser3058Gly, and BRCA2 c.9213G > T (p.Glu3071Asp by a minigene assay, revealed no evidence for aberrant splicing. Conclusions These results illustrate the need for improved methods for predicting functional ESEs and the potential consequences of sequence variants contained therein.

  8. A sensitive electrochemical aptasensor based on the co-catalysis of hemin/G-quadruplex, platinum nanoparticles and flower-like MnO2 nanosphere functionalized multi-walled carbon nanotubes.

    Science.gov (United States)

    Xu, Wenju; Xue, Shuyan; Yi, Huayu; Jing, Pei; Chai, Yaqin; Yuan, Ruo

    2015-01-28

    In this work, a sensitive electrochemical aptasensor for the detection of thrombin (TB) is developed and demonstrated based on the co-catalysis of hemin/G-quadruplex, platinum nanoparticles (PtNPs) and flower-like MnO2 nanosphere functionalized multi-walled carbon nanotubes (MWCNT-MnO2).

  9. Genome sequence of Ensifer meliloti strain WSM1022; a highly effective microsymbiont of the model legume Medicago truncatula A17.

    Science.gov (United States)

    Terpolilli, Jason; Hill, Yvette; Tian, Rui; Howieson, John; Bräu, Lambert; Goodwin, Lynne; Han, James; Liolios, Konstantinos; Huntemann, Marcel; Pati, Amrita; Woyke, Tanja; Mavromatis, Konstantinos; Markowitz, Victor; Ivanova, Natalia; Kyrpides, Nikos; Reeve, Wayne

    2013-12-20

    Ensifer meliloti WSM1022 is an aerobic, motile, Gram-negative, non-spore-forming rod that can exist as a soil saprophyte or as a legume microsymbiont of Medicago. WSM1022 was isolated in 1987 from a nodule recovered from the roots of the annual Medicago orbicularis growing on the Cyclades Island of Naxos in Greece. WSM1022 is highly effective at fixing nitrogen with M. truncatula and other annual species such as M. tornata and M. littoralis and is also highly effective with the perennial M. sativa (alfalfa or lucerne). In common with other characterized E. meliloti strains, WSM1022 will nodulate but fixes poorly with M. polymorpha and M. sphaerocarpos and does not nodulate M. murex. Here we describe the features of E. meliloti WSM1022, together with genome sequence information and its annotation. The 6,649,661 bp high-quality-draft genome is arranged into 121 scaffolds of 125 contigs containing 6,323 protein-coding genes and 75 RNA-only encoding genes, and is one of 100 rhizobial genomes sequenced as part of the DOE Joint Genome Institute 2010 Genomic Encyclopedia for Bacteria and Archaea-Root Nodule Bacteria (GEBA-RNB) project.

  10. Effect of Varied Computer Based Presentation Sequences on Facilitating Student Achievement.

    Science.gov (United States)

    Noonen, Ann; Dwyer, Francis M.

    1994-01-01

    Examines the effectiveness of visual illustrations in computer-based education, the effect of order of visual presentation, and whether screen design affects students' use of graphics and text. Results indicate that order of presentation and choice of review did not influence student achievement; however, when given a choice, students selected the…

  11. The binding efficiency of RPA to telomeric G-strands folded into contiguous G-quadruplexes is independent of the number of G4 units.

    Science.gov (United States)

    Lancrey, Astrid; Safa, Layal; Chatain, Jean; Delagoutte, Emmanuelle; Riou, Jean-François; Alberti, Patrizia; Saintomé, Carole

    2018-03-01

    Replication protein A (RPA) is a single-stranded DNA binding protein involved in replication and in telomere maintenance. During telomere replication, G-quadruplexes (G4) can accumulate on the lagging strand template and need to be resolved. It has been shown that human RPA is able to unfold a single G4. Nevertheless, the G-strand of human telomeres is prone to fold into higher-order structures formed by contiguous G-quadruplexes. To understand how RPA deals with these structures, we studied its interaction with telomeric G-strands folding into an increasing number of contiguous G4s. The aim of this study was to determine whether the efficiency of binding/unfolding of hRPA to telomeric G-strands depends on the number of G4 units. Our data show that the number n of contiguous G4 units (n ≥ 2) does not affect the efficiency of hRPA to coat transiently exposed single-stranded telomeric G-strands. This feature may be essential in preventing instability due to G4 structures during telomere replication. Copyright © 2017 Elsevier B.V. and Société Française de Biochimie et Biologie Moléculaire (SFBBM). All rights reserved.

  12. Fluorescence enhancement upon G-quadruplex folding: synthesis, structure, and biophysical characterization of a dansyl/cyclodextrin-tagged thrombin binding aptamer.

    Science.gov (United States)

    De Tito, Stefano; Morvan, François; Meyer, Albert; Vasseur, Jean-Jacques; Cummaro, Annunziata; Petraccone, Luigi; Pagano, Bruno; Novellino, Ettore; Randazzo, Antonio; Giancola, Concetta; Montesarchio, Daniela

    2013-11-20

    A novel fluorescent thrombin binding aptamer (TBA), conjugated with the environmentally sensitive dansyl probe at the 3'-end and a β-cyclodextrin residue at the 5'-end, has been efficiently synthesized exploiting Cu(I)-catalyzed azide-alkyne cycloaddition procedures. Its conformation and stability in solution have been studied by an integrated approach, combining in-depth NMR, CD, fluorescence, and DSC studies. ITC measurements have allowed us to analyze in detail its interaction with human thrombin. All the collected data show that this bis-conjugated aptamer fully retains its G-quadruplex formation ability and thrombin recognition properties, with the terminal appendages only marginally interfering with the conformational behavior of TBA. Folding of this modified aptamer into the chairlike, antiparallel G-quadruplex structure, promoted by K(+) and/or thrombin binding, typical of TBA, is associated with a net fluorescence enhancement, due to encapsulation of dansyl, attached at the 3'-end, into the apolar cavity of the β-cyclodextrin at the 5'-end. Overall, the structural characterization of this novel, bis-conjugated TBA fully demonstrates its potential as a diagnostic tool for thrombin recognition, also providing a useful basis for the design of suitable aptamer-based devices for theranostic applications, allowing simultaneously both detection and inhibition or modulation of the thrombin activity.

  13. Label-Free and Ultrasensitive Biomolecule Detection Based on Aggregation Induced Emission Fluorogen via Target-Triggered Hemin/G-Quadruplex-Catalyzed Oxidation Reaction.

    Science.gov (United States)

    Li, Haiyin; Chang, Jiafu; Gai, Panpan; Li, Feng

    2018-02-07

    Fluorescence biosensing strategy has drawn substantial attention due to their advantages of simplicity, convenience, sensitivity, and selectivity, but unsatisfactory structure stability, low fluorescence quantum yield, high cost of labeling, and strict reaction conditions associated with current fluorescence methods severely prohibit their potential application. To address these challenges, we herein propose an ultrasensitive label-free fluorescence biosensor by integrating hemin/G-quadruplex-catalyzed oxidation reaction with aggregation induced emission (AIE) fluorogen-based system. l-Cysteine/TPE-M, which is carefully and elaborately designed and developed, obviously contributes to strong fluorescence emission. In the presence of G-rich DNA along with K + and hemin, efficient destruction of l-cysteine occurs due to hemin/G-quadruplex-catalyzed oxidation reactions. As a result, highly sensitive fluorescence detection of G-rich DNA is readily realized, with a detection limit down to 33 pM. As a validation for the further development of the proposed strategy, we also successfully construct ultrasensitive platforms for microRNA by incorporating the l-cysteine/TPE-M system with target-triggered cyclic amplification reaction. Thus, this proposed strategy is anticipated to find use in basic biochemical research and clinical diagnosis.

  14. Nonlinear optical and G-Quadruplex DNA stabilization properties of novel mixed ligand copper(II) complexes and coordination polymers: Synthesis, structural characterization and computational studies

    Science.gov (United States)

    Rajasekhar, Bathula; Bodavarapu, Navya; Sridevi, M.; Thamizhselvi, G.; RizhaNazar, K.; Padmanaban, R.; Swu, Toka

    2018-03-01

    The present study reports the synthesis and evaluation of nonlinear optical property and G-Quadruplex DNA Stabilization of five novel copper(II) mixed ligand complexes. They were synthesized from copper(II) salt, 2,5- and 2,3- pyridinedicarboxylic acid, diethylenetriamine and amide based ligand (AL). The crystal structure of these complexes were determined through X-ray diffraction and supported by ESI-MAS, NMR, UV-Vis and FT-IR spectroscopic methods. Their nonlinear optical property was studied using Gaussian09 computer program. For structural optimization and nonlinear optical property, density functional theory (DFT) based B3LYP method was used with LANL2DZ basis set for metal ion and 6-31G∗ for C,H,N,O and Cl atoms. The present work reveals that pre-polarized Complex-2 showed higher β value (29.59 × 10-30e.s.u) as compared to that of neutral complex-1 (β = 0.276 × 10-30e.s.u.) which may be due to greater advantage of polarizability. Complex-2 is expected to be a potential material for optoelectronic and photonic technologies. Docking studies using AutodockVina revealed that complex-2 has higher binding energy for both G-Quadruplex DNA (-8.7 kcal/mol) and duplex DNA (-10.1 kcal/mol). It was also observed that structure plays an important role in binding efficiency.

  15. Implicit Structured Sequence Learning: An FMRI Study of the Structural Mere-Exposure Effect

    OpenAIRE

    Vasiliki eFolia; Vasiliki eFolia; Karl Magnus ePetersson; Karl Magnus ePetersson; Karl Magnus ePetersson

    2014-01-01

    In this event-related FMRI study we investigated the effect of five days of implicit acquisition on preference classification by means of an artificial grammar learning (AGL) paradigm based on the structural mere-exposure effect and preference classification using a simple right-linear unification grammar. This allowed us to investigate implicit AGL in a proper learning design by including baseline measurements prior to grammar exposure. After 5 days of implicit acquisition, the FMRI results ...

  16. Targeted genotyping-by-sequencing permits cost-effective identification and discrimination of pasture grass species and cultivars.

    Science.gov (United States)

    Pembleton, Luke W; Drayton, Michelle C; Bain, Melissa; Baillie, Rebecca C; Inch, Courtney; Spangenberg, German C; Wang, Junping; Forster, John W; Cogan, Noel O I

    2016-05-01

    A targeted amplicon-based genotyping-by-sequencing approach has permitted cost-effective and accurate discrimination between ryegrass species (perennial, Italian and inter-species hybrid), and identification of cultivars based on bulked samples. Perennial ryegrass and Italian ryegrass are the most important temperate forage species for global agriculture, and are represented in the commercial pasture seed market by numerous cultivars each composed of multiple highly heterozygous individuals. Previous studies have identified difficulties in the use of morphophysiological criteria to discriminate between these two closely related taxa. Recently, a highly multiplexed single nucleotide polymorphism (SNP)-based genotyping assay has been developed that permits accurate differentiation between both species and cultivars of ryegrasses at the genetic level. This assay has since been further developed into an amplicon-based genotyping-by-sequencing (GBS) approach implemented on a second-generation sequencing platform, allowing accelerated throughput and ca. sixfold reduction in cost. Using the GBS approach, 63 cultivars of perennial, Italian and interspecific hybrid ryegrasses, as well as intergeneric Festulolium hybrids, were genotyped. The genetic relationships between cultivars were interpreted in terms of known breeding histories and indistinct species boundaries within the Lolium genus, as well as suitability of current cultivar registration methodologies. An example of applicability to quality assurance and control (QA/QC) of seed purity is also described. Rapid, low-cost genotypic assays provide new opportunities for breeders to more fully explore genetic diversity within breeding programs, allowing the combination of novel unique genetic backgrounds. Such tools also offer the potential to more accurately define cultivar identities, allowing protection of varieties in the commercial market and supporting processes of cultivar accreditation and quality assurance.

  17. The effect of the multi-pass non-circular drawing sequence on mechanical properties and microstructure evolution of low-carbon steel

    International Nuclear Information System (INIS)

    Lee, Jung Wan; Baek, Hyun Moo; Hwang, Sun Kwang; Son, Il-Heon; Bae, Chul Min; Im, Yong-Taek

    2014-01-01

    Highlights: • A multi-pass non-circular drawing sequence is proposed to make high-strength wires. • The sequence was designed and applied for a low-carbon steel wire up to the 10th pass. • Many LAGBs and small grain size of the wire produced by the sequence were obtained. • High plastic deformation was imposed on the wire, resulting in grain refinement. • The sequence made fine-grained wires with improved UTS, ductility and fatigue life. - Abstract: In this study, the multi-pass non-circular drawing sequence was investigated for manufacturing high-strength wires with better ductility in a simple continuous way without adding additional alloys and heat treatment considering the effect of microstructure evolution and die geometry of the sequence on the mechanical properties of low-carbon steel during the process. For this purpose, the non-circular drawing sequence was designed and applied up to the 10th pass at room temperature. Mechanical properties and microstructure evolution of the specimen processed by the sequence were investigated by tension, Vickers micro-hardness, electron backscattering diffraction (EBSD), and fatigue tests compared with those for the conventional wire-drawing process. From the EBSD results, the higher low angle grain boundaries length per unit area and smaller average grain size of the specimen processed by the non-circular drawing sequence were obtained than those of the specimen processed by the wire-drawing process for the 8th pass. These results indicated that more plastic deformation was imposed in the material by the non-circular drawing sequence, resulting in grain refinement of the deformed specimen compared to the wire-drawing process. It is demonstrated that the multi-pass non-circular drawing sequence could be beneficial in producing fine-grained wires with improved ultimate tensile strength, ductility, and fatigue property by simply changing drawing dies geometry of the conventional wire-drawing process

  18. Diagnostic Impact and Cost-effectiveness of Whole-Exome Sequencing for Ambulant Children With Suspected Monogenic Conditions.

    Science.gov (United States)

    Tan, Tiong Yang; Dillon, Oliver James; Stark, Zornitza; Schofield, Deborah; Alam, Khurshid; Shrestha, Rupendra; Chong, Belinda; Phelan, Dean; Brett, Gemma R; Creed, Emma; Jarmolowicz, Anna; Yap, Patrick; Walsh, Maie; Downie, Lilian; Amor, David J; Savarirayan, Ravi; McGillivray, George; Yeung, Alison; Peters, Heidi; Robertson, Susan J; Robinson, Aaron J; Macciocca, Ivan; Sadedin, Simon; Bell, Katrina; Oshlack, Alicia; Georgeson, Peter; Thorne, Natalie; Gaff, Clara; White, Susan M

    2017-09-01

    Optimal use of whole-exome sequencing (WES) in the pediatric setting requires an understanding of who should be considered for testing and when it should be performed to maximize clinical utility and cost-effectiveness. To investigate the impact of WES in sequencing-naive children suspected of having a monogenic disorder and evaluate its cost-effectiveness if WES had been available at different time points in their diagnostic trajectory. This prospective study was part of the Melbourne Genomics Health Alliance demonstration project. At the ambulatory outpatient clinics of the Victorian Clinical Genetics Services at the Royal Children's Hospital, Melbourne, Australia, children older than 2 years suspected of having a monogenic disorder were prospectively recruited from May 1 through November 30, 2015, by clinical geneticists after referral from general and subspecialist pediatricians. All children had nondiagnostic microarrays and no prior single-gene or panel sequencing. All children underwent singleton WES with targeted phenotype-driven analysis. The study examined the clinical utility of a molecular diagnosis and the cost-effectiveness of alternative diagnostic trajectories, depending on timing of WES. Of 61 children originally assessed, 44 (21 [48%] male and 23 [52%] female) aged 2 to 18 years (mean age at initial presentation, 28 months; range, 0-121 months) were recruited, and a diagnosis was achieved in 23 (52%) by singleton WES. The diagnoses were unexpected in 8 of 23 (35%), and clinical management was altered in 6 of 23 (26%). The mean duration of the diagnostic odyssey was 6 years, with each child having a mean of 19 tests and 4 clinical genetics and 4 nongenetics specialist consultations, and 26 (59%) underwent a procedure while under general anesthetic for diagnostic purposes. Economic analyses of the diagnostic trajectory identified that WES performed at initial tertiary presentation resulted in an incremental cost savings of A$9020 (US$6838) per

  19. A study on the effect of varying sequence of lab performance skills on lab performance of high school physics students

    Science.gov (United States)

    Bournia-Petrou, Ethel A.

    The main goal of this investigation was to study how student rank in class, student gender and skill sequence affect high school students' performance on the lab skills involved in a laboratory-based inquiry task in physics. The focus of the investigation was the effect of skill sequence as determined by the particular task. The skills considered were: Hypothesis, Procedure, Planning, Data, Graph, Calculations and Conclusion. Three physics lab tasks based on the simple pendulum concept were administered to 282 Regents physics high school students. The reliability of the designed tasks was high. Student performance was evaluated on individual student written responses and a scoring rubric. The tasks had high discrimination power and were of moderate difficulty (65%). It was found that, student performance was weak on Conclusion (42%), Hypothesis (48%), and Procedure (51%), where the numbers in parentheses represent the mean as a percentage of the maximum possible score. Student performance was strong on Calculations (91%), Data (82%), Graph (74%) and Plan (68%). Out of all seven skills, Procedure had the strongest correlation (.73) with the overall task performance. Correlation analysis revealed some strong relationships among the seven skills which were grouped in two distinct clusters: Hypothesis, Procedure and Plan belong to one, and Data, Graph, Calculations, and Conclusion belong to the other. This distinction may indicate different mental processes at play within each skill cluster. The effect of student rank was not statistically significant according to the MANOVA results due to the large variation of rank levels among the participating schools. The effect of gender was significant on the entire test because of performance differences on Calculations and Graph, where male students performed better than female students. Skill sequence had a significant effect on the skills of Procedure, Plan, Data and Conclusion. Students are rather weak in proposing a

  20. Effects of metal-rich particulate matter exposure on exogenous and endogenous viral sequence methylation in healthy steel-workers.

    Science.gov (United States)

    Mercorio, Roberta; Bonzini, Matteo; Angelici, Laura; Iodice, Simona; Delbue, Serena; Mariani, Jacopo; Apostoli, Pietro; Pesatori, Angela Cecilia; Bollati, Valentina

    2017-11-01

    Inhaled particles have been shown to produce systemic changes in DNA methylation. Global hypomethylation has been associated to viral sequence reactivation, possibly linked to the activation of pro-inflammatory pathways occurring after exposure. This observation provides a rationale to investigate viral sequence (both exogenous and endogenous) methylation in association to metal-rich particulate matter exposure. To verify this hypothesis, we chose the Wp promoter of the Epstein-Barr Virus (EBV-Wp) and the promoter of the human-endogenous-retrovirus w (HERV-w), respectively as a paradigm of an exogenous and an endogenous retroviral sequence, to be investigated by bisulfite PCR Pyrosequencing. We enrolled 63 male workers in an electric furnace steel plant, exposed to high level of metal-rich particulate matter. Comparing samples obtained in the first day of a work week (time 0-baseline, after 2 days off work) and the samples obtained after 3 days of work (time 1-post exposure), the mean methylation of EBV-Wp was significantly higher at baseline compared to post-exposure (mean baseline = 56.7%5mC; mean post-exposure = 47.9%5mC; p-value = 0.009), whereas the mean methylation of HERV-w did not significantly differ. Individual exposure to inhalable particles and metals was estimated based on measures in all working areas and time spent by the study subjects in each area. In a regression model adjusted for age, body mass index and smoking, PM and metal components had a positive association with EBV-Wp methylation (i.e. PM10: β = 5.99, p-value < 0.038; nickel: β = 17.82, p-value = 0.02; arsenic: β = 13.59, p-value < 0.015). The difference observed comparing baseline and post-exposure samples may be suggestive of a rapid change in EBV methylation induced by air particles, while correlation between EBV methylation and PM/metal exposure may represent a more stable adaptive mechanism. Future studies investigating a larger panel of viral sequences could better elucidate

  1. DNA breaks and repair in interstitial telomere sequences: Influence of chromatin structure

    International Nuclear Information System (INIS)

    Revaud, D.

    2009-06-01

    Interstitial Telomeric Sequences (ITS) are over-involved in spontaneous and radiationinduced chromosome aberrations in chinese hamster cells. We have performed a study to investigate the origin of their instability, spontaneously or after low doses irradiation. Our results demonstrate that ITS have a particular chromatin structure: short nucleotide repeat length, less compaction of the 30 nm chromatin fiber, presence of G-quadruplex structures. These features would modulate breaks production and would favour the recruitment of alternative DNA repair mechanisms, which are prone to produce chromosome aberrations. These pathways could be at the origin of chromosome aberrations in ITS whereas NHEJ and HR Double Strand Break repair pathways are rather required for a correct repair in these regions. (author)

  2. The effects of sequence and type of chemotherapy and radiation therapy on cosmesis and complications after breast conservation therapy

    International Nuclear Information System (INIS)

    Markiewicz, Deborah A.; Schultz, Delray J.; Haas, Jonathan A.; Harris, Eleanor E. R.; Fox, Kevin R.; Glick, John H.; Solin, Lawrence J.

    1996-01-01

    Purpose: Chemotherapy plays an increasingly important role in the treatment of both node-negative and node-positive breast cancer patients, but the optimal sequencing of chemotherapy and radiation therapy is not well established. The purpose of this study is to evaluate the interaction of sequence and type of chemotherapy and hormonal therapy given with radiation therapy on the cosmetic outcome and the incidence of complications of Stage I and II breast cancer patients treated with breast-conserving therapy. Methods and Materials: The records of 1053 Stage I and II breast cancer patients treated with curative intent with breast-conserving surgery, axillary dissection, and radiation therapy between 1977-1991 were reviewed. Median follow-up after treatment was 6.7 years. Two hundred fourteen patients received chemotherapy alone, 141 patients received hormonal therapy alone, 86 patients received both, and 612 patients received no adjuvant therapy. Patients who received chemotherapy ± hormonal therapy were grouped according to sequence of chemotherapy: (a) concurrent = concurrent chemotherapy with radiation therapy followed by chemotherapy; (b) sequential = radiation followed by chemotherapy or chemotherapy followed by radiation; and (c) sandwich = chemotherapy followed by concurrent chemotherapy and radiation followed by chemotherapy. Compared to node negative patients, node-positive patients more commonly received chemotherapy (77 vs. 9%, p < 0.0001) and/or hormonal therapy (40 vs. 14%, p < 0.0001). Among patients who received chemotherapy, the majority (243 patients) received concurrent chemotherapy and radiation therapy with two cycles of cytoxan and 5-fluorouracil (5-FU) administered during radiation followed by six cycles of chemotherapy with cytoxan, 5-fluorouracil and either methotrexate(CMF) or doxorubicin(CAF). For analysis of cosmesis, patients included were relapse free with 3 years minimum follow-up. Results: The use of chemotherapy had an adverse effect

  3. Sequence-engineered mRNA Without Chemical Nucleoside Modifications Enables an Effective Protein Therapy in Large Animals

    Science.gov (United States)

    Thess, Andreas; Grund, Stefanie; Mui, Barbara L; Hope, Michael J; Baumhof, Patrick; Fotin-Mleczek, Mariola; Schlake, Thomas

    2015-01-01

    Being a transient carrier of genetic information, mRNA could be a versatile, flexible, and safe means for protein therapies. While recent findings highlight the enormous therapeutic potential of mRNA, evidence that mRNA-based protein therapies are feasible beyond small animals such as mice is still lacking. Previous studies imply that mRNA therapeutics require chemical nucleoside modifications to obtain sufficient protein expression and avoid activation of the innate immune system. Here we show that chemically unmodified mRNA can achieve those goals as well by applying sequence-engineered molecules. Using erythropoietin (EPO) driven production of red blood cells as the biological model, engineered Epo mRNA elicited meaningful physiological responses from mice to nonhuman primates. Even in pigs of about 20 kg in weight, a single adequate dose of engineered mRNA encapsulated in lipid nanoparticles (LNPs) induced high systemic Epo levels and strong physiological effects. Our results demonstrate that sequence-engineered mRNA has the potential to revolutionize human protein therapies. PMID:26050989

  4. Effect of sequence variants on variance in glucose levels predicts type 2 diabetes risk and accounts for heritability.

    Science.gov (United States)

    Ivarsdottir, Erna V; Steinthorsdottir, Valgerdur; Daneshpour, Maryam S; Thorleifsson, Gudmar; Sulem, Patrick; Holm, Hilma; Sigurdsson, Snaevar; Hreidarsson, Astradur B; Sigurdsson, Gunnar; Bjarnason, Ragnar; Thorsson, Arni V; Benediktsson, Rafn; Eyjolfsson, Gudmundur; Sigurdardottir, Olof; Olafsson, Isleifur; Zeinali, Sirous; Azizi, Fereidoun; Thorsteinsdottir, Unnur; Gudbjartsson, Daniel F; Stefansson, Kari

    2017-09-01

    Sequence variants that affect mean fasting glucose levels do not necessarily affect risk for type 2 diabetes (T2D). We assessed the effects of 36 reported glucose-associated sequence variants on between- and within-subject variance in fasting glucose levels in 69,142 Icelanders. The variant in TCF7L2 that increases fasting glucose levels increases between-subject variance (5.7% per allele, P = 4.2 × 10 -10 ), whereas variants in GCK and G6PC2 that increase fasting glucose levels decrease between-subject variance (7.5% per allele, P = 4.9 × 10 -11 and 7.3% per allele, P = 7.5 × 10 -18 , respectively). Variants that increase mean and between-subject variance in fasting glucose levels tend to increase T2D risk, whereas those that increase the mean but reduce variance do not (r 2 = 0.61). The variants that increase between-subject variance increase fasting glucose heritability estimates. Intuitively, our results show that increasing the mean and variance of glucose levels is more likely to cause pathologically high glucose levels than increase in the mean offset by a decrease in variance.

  5. Demonstrating the Effectiveness of an Integrated and Intensive Research Methods and Statistics Course Sequence

    Science.gov (United States)

    Pliske, Rebecca M.; Caldwell, Tracy L.; Calin-Jageman, Robert J.; Taylor-Ritzler, Tina

    2015-01-01

    We developed a two-semester series of intensive (six-contact hours per week) behavioral research methods courses with an integrated statistics curriculum. Our approach includes the use of team-based learning, authentic projects, and Excel and SPSS. We assessed the effectiveness of our approach by examining our students' content area scores on the…

  6. Opposite Effects of Cortisol on Consolidation of Temporal Sequence Memory during Waking and Sleep

    Science.gov (United States)

    Wilhelm, Ines; Wagner, Ullrich; Born, Jan

    2011-01-01

    Memory functions involve three stages: encoding, consolidation, and retrieval. Modulating effects of glucocorticoids (GCs) have been consistently observed for declarative memory with GCs enhancing encoding and impairing retrieval, but surprisingly, little is known on how GCs affect memory consolidation. Studies in rats suggest a beneficial effect…

  7. DNA oligonucleotide duplexes containing intramolecular platinated cross-links: energetics, hydration, sequence, and ionic effects.

    Science.gov (United States)

    Kankia, Besik I; Soto, Ana Maria; Burns, Nicole; Shikiya, Ronald; Tung, Chang-Shung; Marky, Luis A

    2002-11-05

    The anticancer activity of cisplatin arises from its ability to bind covalently to DNA, forming primarily intrastrand cross-links to adjacent purine residues; the most common adducts involve d(GpG) (65%) and d(ApG) (25%) intrastrand cross-links. The incorporation of these platinum adducts in a B-DNA helix induces local distortions, causing bending and unwinding of the DNA. In this work, we used temperature-dependent UV spectroscopy to investigate the unfolding thermodynamics, and associated ionic effects, of two sets of DNA decamer duplexes containing either cis-[Pt(NH(3))(2)[d(GpG

  8. Phase attraction in sensorimotor synchronization with auditory sequences: effects of single and periodic distractors on synchronization accuracy.

    Science.gov (United States)

    Repp, Bruno H

    2003-04-01

    Four experiments showed that both single and periodic distractor tones affected the timing of finger taps produced in synchrony with an isochronous auditory target sequence. Single distractors had only small effects, but periodic distractors occurring at various fixed or changing phase relationships exerted strong phase attraction. The attraction was asymmetric, being stronger when distractors preceded target tones than when they lagged behind. A large pitch difference between target and distractor tones (20 vs. 3 semitones) did not reduce phase attraction substantially, although in the case of continuously changing phase relationships it did prevent complete capture of the taps by the distractors. The results support the hypothesis that phase attraction is an automatic process that is sensitive primarily to event onsets.

  9. Effective convergence to complete orbital bases and to the atomic Hartree--Fock limit through systematic sequences of Gaussian primitives

    International Nuclear Information System (INIS)

    Schmidt, M.W.; Ruedenberg, K.

    1979-01-01

    Optimal starting points for expanding molecular orbitals in terms of atomic orbitals are the self-consistent-field orbitals of the free atoms and accurate information about the latter is essential for the construction of effective AO bases for molecular calculations. For expansions of atomic SCF orbitals in terms of Gaussian primitives, which are of particular interest for applications in polyatomic quantum chemistry, previous information has been limited in accuracy. In the present investigation a simple procedure is given for finding expansions of atomic self-consistent-field orbitals in terms of Gaussian primitives to arbitrarily high accuracy. The method furthermore opens the first avenue so far for approaching complete basis sets through systematic sequences of atomic orbitals

  10. Effect of DNA sequence of Fab fragment on yield characteristics and cell growth of E. coli.

    Science.gov (United States)

    Kulmala, Antti; Huovinen, Tuomas; Lamminmäki, Urpo

    2017-06-19

    Codon usage is one of the factors influencing recombinant protein expression. We were interested in the codon usage of an antibody Fab fragment gene exhibiting extreme toxicity in the E. coli host. The toxic synthetic human Fab gene contained domains optimized by the "one amino acid-one codon" method. We redesigned five segments of the Fab gene with a "codon harmonization" method described by Angov et al. and studied the effects of these changes on cell viability, Fab yield and display on filamentous phage using different vectors and bacterial strains. The harmonization considerably reduced toxicity, increased Fab expression from negligible levels to 10 mg/l, and restored the display on phage. Testing the impact of the individual redesigned segments revealed that the most significant effects were conferred by changes in the constant domain of the light chain. For some of the Fab gene variants, we also observed striking differences in protein yields when cloned from a chloramphenicol resistant vector into an identical vector, except with ampicillin resistance. In conclusion, our results show that the expression of a heterodimeric secretory protein can be improved by harmonizing selected DNA segments by synonymous codons and reveal additional complexity involved in heterologous protein expression.

  11. An Effective Antifreeze Protein Predictor with Ensemble Classifiers and Comprehensive Sequence Descriptors

    Directory of Open Access Journals (Sweden)

    Runtao Yang

    2015-09-01

    Full Text Available Antifreeze proteins (AFPs play a pivotal role in the antifreeze effect of overwintering organisms. They have a wide range of applications in numerous fields, such as improving the production of crops and the quality of frozen foods. Accurate identification of AFPs may provide important clues to decipher the underlying mechanisms of AFPs in ice-binding and to facilitate the selection of the most appropriate AFPs for several applications. Based on an ensemble learning technique, this study proposes an AFP identification system called AFP-Ensemble. In this system, random forest classifiers are trained by different training subsets and then aggregated into a consensus classifier by majority voting. The resulting predictor yields a sensitivity of 0.892, a specificity of 0.940, an accuracy of 0.938 and a balanced accuracy of 0.916 on an independent dataset, which are far better than the results obtained by previous methods. These results reveal that AFP-Ensemble is an effective and promising predictor for large-scale determination of AFPs. The detailed feature analysis in this study may give useful insights into the molecular mechanisms of AFP-ice interactions and provide guidance for the related experimental validation. A web server has been designed to implement the proposed method.

  12. Superselective Particle Embolization Enhances Efficacy of Radiofrequency Ablation: Effects of Particle Size and Sequence of Action

    International Nuclear Information System (INIS)

    Tanaka, Toshihiro; Isfort, Peter; Braunschweig, Till; Westphal, Saskia; Woitok, Anna; Penzkofer, Tobias; Bruners, Philipp; Kichikawa, Kimihiko; Schmitz-Rode, Thomas; Mahnken, Andreas H.

    2013-01-01

    Purpose. To evaluate the effects of particle size and course of action of superselective bland transcatheter arterial embolization (TAE) on the efficacy of radiofrequency ablation (RFA). Methods. Twenty pigs were divided into five groups: group 1a, 40-μm bland TAE before RFA; group 1b, 40-μm bland TAE after RFA; group 2a, 250-μm bland TAE before RFA; group 2b, 250-μm bland TAE after RFA and group 3, RFA alone. A total of 40 treatments were performed with a combined CT and angiography system. The sizes of the treated zones were measured from contrast-enhanced CTs on days 1 and 28. Animals were humanely killed, and the treated zones were examined pathologically. Results. There were no complications during procedures and follow-up. The short-axis diameter of the ablation zone in group 1a (mean ± standard deviation, 3.19 ± 0.39 cm) was significantly larger than in group 1b (2.44 ± 0.52 cm; P = 0.021), group 2a (2.51 ± 0.32 cm; P = 0.048), group 2b (2.19 ± 0.44 cm; P = 0.02), and group 3 (1.91 ± 0.55 cm; P 3 ). At histology, 40-μm microspheres were observed to occlude smaller and more distal arteries than 250-μm microspheres. Conclusion. Bland TAE is more effective before RFA than postablation embolization. The use of very small 40-μm microspheres enhances the efficacy of RFA more than the use of larger particles.

  13. A study of effective sequences on micro-CT in the dent-maxillo-facial region

    International Nuclear Information System (INIS)

    Kato, Masataka; Mori, Shintaro; Sakayanagi, Masashi; Fujita, Yuzo; Kaneda, Takashi

    2005-01-01

    Microfocus computed tomography (micro-CT) using cone-beam scan is becoming widely used for various studies of oral structures. However, this machine has not been used to evaluate the effective parameters for two-dimensional (2D) or three-dimensional (3D) images. This study evaluated the effective parameters of micro-CT for 2D or 3D images of oral hard tissue structures. We evaluated the CT value of 5 human teeth (upper first molars) to determine suitable CT value examined according to several X-ray parameters using conformal radiotherapy (CRT) on a work station. CT information from the specimens was obtained using a micro-CT (Toscaner-31300 μ, Toshiba ITC), under the conditions of tube voltage of 75 kV, tube current of 120 μA, 100∼1600 views, the number of times of addition, 512 x 512 pixel matrix, and 0.2 slice thickness. We made 3D-reconstruction images from the micro-CT data. Three-dimensional reconstruction was performed using 2D images processed by the volume-rendering method using 3D-reconstruction software (TRI/3D BON, RATOC system engineering). Then, we evaluate the 3D tooth images. In the assessment of images, three dental radiologists evaluated several 3D tooth images using 3D-reconstruction images. Each image was scored on a five-level scale by Scheffe one-pair comparison method as follows: 5: much easier to evaluate, 4: easier to evaluate, 3: equivalent, 2: harder to evaluate, 1: much harder to evaluate. In scoring, each of the three dental radiologists made an individual assessment, and when differences among individual scores occurred, the score was ultimately assigned by consensus among the three individuals. Statistical analysis of the scores assigned by the three dental radiologists as described above was carried out using Stat View-J 5.0 (Abacus Concepts, Inc, USA) statistical software and Tukey-Kramer multiple-comparison testing. The optimal CT value for evaluating the human tooth by micro-CT is 600 on 2D images. On 3D images, the optimal

  14. A new effective method for estimating missing values in the sequence data prior to phylogenetic analysis

    Directory of Open Access Journals (Sweden)

    Abdoulaye Baniré Diallo

    2006-01-01

    Full Text Available In this article we address the problem of phylogenetic inference from nucleic acid data containing missing bases. We introduce a new effective approach, called “Probabilistic estimation of missing values” (PEMV, allowing one to estimate unknown nucleotides prior to computing the evolutionary distances between them. We show that the new method improves the accuracy of phylogenetic inference compared to the existing methods “Ignoring Missing Sites” (IMS, “Proportional Distribution of Missing and Ambiguous Bases” (PDMAB included in the PAUP software [26]. The proposed strategy for estimating missing nucleotides is based on probabilistic formulae developed in the framework of the Jukes-Cantor [10] and Kimura 2-parameter [11] models. The relative performances of the new method were assessed through simulations carried out with the SeqGen program [20], for data generation, and the BioNJ method [7], for inferring phylogenies. We also compared the new method to the DNAML program [5] and “Matrix Representation using Parsimony” (MRP [13], [19] considering an example of 66 eutherian mammals originally analyzed in [17].

  15. Usher syndrome: an effective sequencing approach to establish a genetic and clinical diagnosis.

    Science.gov (United States)

    Lenarduzzi, S; Vozzi, D; Morgan, A; Rubinato, E; D'Eustacchio, A; Osland, T M; Rossi, C; Graziano, C; Castorina, P; Ambrosetti, U; Morgutti, M; Girotto, G

    2015-02-01

    Usher syndrome is an autosomal recessive disorder characterized by retinitis pigmentosa, sensorineural hearing loss and, in some cases, vestibular dysfunction. The disorder is clinically and genetically heterogeneous and, to date, mutations in 11 genes have been described. This finding makes difficult to get a precise molecular diagnosis and offer patients accurate genetic counselling. To overcome this problem and to increase our knowledge of the molecular basis of Usher syndrome, we designed a targeted resequencing custom panel. In a first validation step a series of 16 Italian patients with known molecular diagnosis were analysed and 31 out of 32 alleles were detected (97% of accuracy). After this step, 31 patients without a molecular diagnosis were enrolled in the study. Three out of them with an uncertain Usher diagnosis were excluded. One causative allele was detected in 24 out 28 patients (86%) while the presence of both causative alleles characterized 19 patients out 28 (68%). Sixteen novel and 27 known alleles were found in the following genes: USH2A (50%), MYO7A (7%), CDH23 (11%), PCDH15 (7%) and USH1G (2%). Overall, on the 44 patients the protocol was able to characterize 74 alleles out of 88 (84%). These results suggest that our panel is an effective approach for the genetic diagnosis of Usher syndrome leading to: 1) an accurate molecular diagnosis, 2) better genetic counselling, 3) more precise molecular epidemiology data fundamental for future interventional plans. Copyright © 2014 Elsevier B.V. All rights reserved.

  16. The effect of sequence of skating-specific training on skating performance.

    Science.gov (United States)

    Farlinger, Chris Mj; Fowles, Jonathon R

    2008-06-01

    To determine the effectiveness of a progressively "skating specific" periodized off-season training program on skating performance in competitive hockey players. Twenty (M = 18; F = 2) highly skilled hockey players (age 15.9 +/- 1.5 yr) completed 16 wk of standardized resistance and stability training supplemented with either off-ice simulated skating using the SkateSIM (SIM) or plyometric training (PLY) in a crossover design. Group 1 (PLY-SIM; N = 11) completed 8 wk of PLY followed by 8 wk of SIM. Group 2 (SIM-PLY; N = 9) completed 8 wk of SIM followed by 8 wk of PLY. Subjects completed on- and off-ice testing PRE, MID, and POST training. Significant improvements in on-ice 35-m skating sprint (1.0%; P = .009) with significant improvements of 5% to 12% in various off-ice testing measures were observed PRE-MID in both groups. While few off-ice tests improved MID-POST, on-ice 35-m skating sprint times improved MID-POST by 2.3% (P = .000) with greater improvement in PLYSIM (3.5%) versus SIM-PLY (0.8%; P skating sprint performance. The initial gains PRE-MID and then the lack of improvement in many off-ice tests from the MID-POST supports the principle of diminishing returns in response to standardized resistance training. The improvement in on-ice skating sprint performance when supplemental training progressed in specificity supports the principle of specificity and promotes transfer to a complex sporting movement such as skating.

  17. Effect of stereochemistry, chain length and sequence pattern on antimicrobial properties of short synthetic β-sheet forming peptide amphiphiles.

    Science.gov (United States)

    Ong, Zhan Yuin; Cheng, Junchi; Huang, Yuan; Xu, Kaijin; Ji, Zhongkang; Fan, Weimin; Yang, Yi Yan

    2014-01-01

    In the face of mounting global antibiotics resistance, the identification and development of membrane-active antimicrobial peptides (AMPs) as an alternative class of antimicrobial agent have gained significant attention. The physical perturbation and disruption of microbial membranes by the AMPs have been proposed to be an effective means to overcome conventional mechanisms of drug resistance. Recently, we have reported the design of a series of short synthetic β-sheet folding peptide amphiphiles comprised of recurring (X1Y1X2Y2)n-NH2 sequences where X: hydrophobic amino acids, Y: cationic amino acids and n: number of repeat units. In efforts to investigate the effects of key parameters including stereochemistry, chain length and sequence pattern on antimicrobial effects, systematic d-amino acid substitutions of the lead peptides (IRIK)2-NH2 (IK8-all L) and (IRVK)3-NH2 (IK12-all L) were performed. It was found that the corresponding D-enantiomers exhibited stronger antimicrobial activities with minimal or no change in hemolytic activities, hence translating very high selectivity indices of 407.0 and >9.8 for IK8-all D and IK12-all D respectively. IK8-all D was also demonstrated to be stable to degradation by broad spectrum proteases trypsin and proteinase K. The membrane disrupting bactericidal properties of IK8-all D effectively prevented drug resistance development and inhibited the growth of various clinically isolated MRSA, VRE, Acinetobacter baumanni, Pseudomonas aeruginosa, Cryptococcus. neoformans and Mycobacterium tuberculosis. Significant reduction in intracellular bacteria counts was also observed following treatment with IK8-all D in the Staphylococcus. aureus infected mouse macrophage cell line RAW264.7 (P < 0.01). These results suggest that the d-amino acids substituted β-sheet forming peptide IK8-all D with its enhanced antimicrobial activities and improved protease stability, is a promising therapeutic candidate with potential to combat

  18. It’s all in the past: Temporal-context effects modulate subjective evaluations of emotional visual stimuli, regardless of presentation sequence

    Czech Academy of Sciences Publication Activity Database

    Czekóová, K.; Shaw, D. J.; Janoušová, E.; Urbánek, Tomáš

    2015-01-01

    Roč. 6, č. 367 (2015), s. 1-11 ISSN 1664-1078 Institutional support: RVO:68081740 Keywords : emotion * temporal context * presentation sequence * assimilation effect * contrast effect Subject RIV: AN - Psychology Impact factor: 2.463, year: 2015 http://journal.frontiersin.org/article/10.3389/fpsyg.2015.00367/full

  19. Effects of Recombinant Human Endostatin and Docetaxel on MMP and its Following Anti-neoplastic Effect under Different Administration Sequences

    Directory of Open Access Journals (Sweden)

    Jing YUAN

    2010-06-01

    Full Text Available Background and objective The aim of this study is to observe the changes of MMP-2 and its regulators, and to investigate the mechanism of the two administration sequences of recombinant human endostatin (rh-endostatin and docetaxel. Methods The experiment was performed as 2 stages. Firstly, nude mice with xenograft tumor were randomized into 2 groups as rh-endostatin-treated group with rh-endostatin 400 μg•d-1, d1-d14 and docetaxel-traeted group with docetaxel 10 mg•kg-1•3d-1, d1-d14. Secondly, nude mice with xenograft tumor were randomized into 3 groups as concurrent administration group (rh-endostatin 400 μg•d-1, d1-d35, docetaxel 10 mg•kg-1•3d-1, d1-d19, endo-first group (rh-endostatin 400 μg•d-1, d1-d35, docetaxel 10 mg•kg-1•3d-1, d16-d34 and model group (positive control, mice burdened tumor without treatment. The volume of tumor was measured during treatment. Detection of the expressions of MMP-2, TIMP-2, EMMPRIN and the count of microvessel density (MVD by immunohistochemistry stain examination were carried out at the end of experiment. Results Compared with the docetaxel-treated group, more obvious down-regulation of expression of MMP-2, EMMPRIN (P=0.024, P=0.081 were observed in rh-endostatin-treated group. No significant difference was found in TIMP-2 expression between the 2 groups. In combined treatment groups, at the endpoint tumor volumes of concurrent administration group and the endo-first group were remarkably smaller than that in model group (P<0.001, P=0.003. According to the administration procedure, concurrent administration inhibited tumor growth stronger than endo-first treatment did. Both of the combined groups down-regulated the expression of MMP-2 and decreased microvessel density (P<0.05. Compared with model group, the expression of TIMP-2 was upregulated (P=0.001 as well as EMMPRIN down-regulated (P=0.018 in concurrent adminis-tration group. Oppositely, the same results were not observed in the

  20. Effect of a different concentrate-forage sequence on digesta passage rate, faeces traits and milk features of dairy cows

    Directory of Open Access Journals (Sweden)

    L. Sarti

    2010-04-01

    Full Text Available To ascertain the effects of a different feed sequence, which could modify digestion rate and sites as well as metabolic - endocrine status and milk features, 6 lactating dairy cows have received the same diet with a different time of concentrate administration when close to the two daily forage meals: 30’ before or 60’ after them. Cows were tied in a barn with controlled temperature, humidity and light, individually fed and monitored for: daily dry matter intake, milk yield and its features at 2 milkings, concentrate passage rate and faecal traits. The results have showed that DMI, feeding behaviour, milk yield and milk features were not significantly affected (except fat content, increased when forage was supplied as first feed. The digesta passage rate was also different: concentrate escaped more rapidly from the rumen when fed before forage or 4 hours after them. This effect has not modified the faeces, but some endocrine and /or metabolic changes can be hypothesized, because milk fat content was increased when concentrate was supplied after forage.

  1. Biological phosphorus and nitrogen removal in sequencing batch reactors: effects of cycle length, dissolved oxygen concentration and influent particulate matter.

    Science.gov (United States)

    Ginige, Maneesha P; Kayaalp, Ahmet S; Cheng, Ka Yu; Wylie, Jason; Kaksonen, Anna H

    2013-01-01

    Removal of phosphorus (P) and nitrogen (N) from municipal wastewaters is required to mitigate eutrophication of receiving water bodies. While most treatment plants achieve good N removal using influent carbon (C), the use of influent C to facilitate enhanced biological phosphorus removal (EBPR) is poorly explored. A number of operational parameters can facilitate optimum use of influent C and this study investigated the effects of cycle length, dissolved oxygen (DO) concentration during aerobic period and influent solids on biological P and N removal in sequencing batch reactors (SRBs) using municipal wastewaters. Increasing cycle length from 3 to 6 h increased P removal efficiency, which was attributed to larger portion of N being removed via nitrite pathway and more biodegradable organic C becoming available for EBPR. Further increasing cycle length from 6 to 8 h decreased P removal efficiencies as the demand for biodegradable organic C for denitrification increased as a result of complete nitrification. Decreasing DO concentration in the aerobic period from 2 to 0.8 mg L(-1) increased P removal efficiency but decreased nitrification rates possibly due to oxygen limitation. Further, sedimented wastewater was proved to be a better influent stream than non-sedimented wastewater possibility due to the detrimental effect of particulate matter on biological nutrient removal.

  2. Effect of Si additions on thermal stability and the phase transition sequence of sputtered amorphous alumina thin films

    Energy Technology Data Exchange (ETDEWEB)

    Bolvardi, H.; Baben, M. to; Nahif, F.; Music, D., E-mail: music@mch.rwth-aachen.de; Schnabel, V.; Shaha, K. P.; Mráz, S.; Schneider, J. M. [Materials Chemistry, RWTH Aachen University, Kopernikusstr. 10, D-52074 Aachen (Germany); Bednarcik, J.; Michalikova, J. [Deutsches Elektronen Synchrotron DESY, FS-PE group, Notkestrasse 85, D-22607 Hamburg (Germany)

    2015-01-14

    Si-alloyed amorphous alumina coatings having a silicon concentration of 0 to 2.7 at. % were deposited by combinatorial reactive pulsed DC magnetron sputtering of Al and Al-Si (90-10 at. %) split segments in Ar/O{sub 2} atmosphere. The effect of Si alloying on thermal stability of the as-deposited amorphous alumina thin films and the phase formation sequence was evaluated by using differential scanning calorimetry and X-ray diffraction. The thermal stability window of the amorphous phase containing 2.7 at. % of Si was increased by more than 100 °C compared to that of the unalloyed phase. A similar retarding effect of Si alloying was also observed for the α-Al{sub 2}O{sub 3} formation temperature, which increased by more than 120 °C. While for the latter retardation, the evidence for the presence of SiO{sub 2} at the grain boundaries was presented previously, this obviously cannot explain the stability enhancement reported here for the amorphous phase. Based on density functional theory molecular dynamics simulations and synchrotron X-ray diffraction experiments for amorphous Al{sub 2}O{sub 3} with and without Si incorporation, we suggest that the experimentally identified enhanced thermal stability of amorphous alumina with addition of Si is due to the formation of shorter and stronger Si–O bonds as compared to Al–O bonds.

  3. Treatment of opium alkaloid containing wastewater in sequencing batch reactor (SBR)—Effect of gamma irradiation

    Science.gov (United States)

    Bural, Cavit B.; Demirer, Goksel N.; Kantoglu, Omer; Dilek, Filiz B.

    2010-04-01

    Aerobic biological treatment of opium alkaloid containing wastewater as well as the effect of gamma irradiation as pre-treatment was investigated. Biodegradability of raw wastewater was assessed in aerobic batch reactors and was found highly biodegradable (83-90% degradation). The effect of irradiation (40 and 140 kGy) on biodegradability was also evaluated in terms of BOD 5/COD values and results revealed that irradiation imparted no further enhancement in the biodegradability. Despite the highly biodegradable nature of wastewater, further experiments in sequencing batch reactors (SBR) revealed that the treatment operation was not possible due to sludge settleability problem observed beyond an influent COD value of 2000 mg dm -3. Possible reasons for this problem were investigated, and the high molecular weight, large size and aromatic structure of the organic pollutants present in wastewater was thought to contribute to poor settleability. Initial efforts to solve this problem by modifying the operational conditions, such as SRT reduction, failed. However, further operational modifications including addition of phosphate buffer cured the settleability problem and influent COD was increased up to 5000 mg dm -3. Significant COD removal efficiencies (>70%) were obtained in both SBRs fed with original and irradiated wastewaters (by 40 kGy). However, pre-irradiated wastewater provided complete thebain removal and a better settling sludge, which was thought due to degradation of complex structure by radiation application. Degradation of the structure was observed by GC/MS analyses and enhancement in filterability tests.

  4. Effect of Si additions on thermal stability and the phase transition sequence of sputtered amorphous alumina thin films

    International Nuclear Information System (INIS)

    Bolvardi, H.; Baben, M. to; Nahif, F.; Music, D.; Schnabel, V.; Shaha, K. P.; Mráz, S.; Schneider, J. M.; Bednarcik, J.; Michalikova, J.

    2015-01-01

    Si-alloyed amorphous alumina coatings having a silicon concentration of 0 to 2.7 at. % were deposited by combinatorial reactive pulsed DC magnetron sputtering of Al and Al-Si (90-10 at. %) split segments in Ar/O 2 atmosphere. The effect of Si alloying on thermal stability of the as-deposited amorphous alumina thin films and the phase formation sequence was evaluated by using differential scanning calorimetry and X-ray diffraction. The thermal stability window of the amorphous phase containing 2.7 at. % of Si was increased by more than 100 °C compared to that of the unalloyed phase. A similar retarding effect of Si alloying was also observed for the α-Al 2 O 3 formation temperature, which increased by more than 120 °C. While for the latter retardation, the evidence for the presence of SiO 2 at the grain boundaries was presented previously, this obviously cannot explain the stability enhancement reported here for the amorphous phase. Based on density functional theory molecular dynamics simulations and synchrotron X-ray diffraction experiments for amorphous Al 2 O 3 with and without Si incorporation, we suggest that the experimentally identified enhanced thermal stability of amorphous alumina with addition of Si is due to the formation of shorter and stronger Si–O bonds as compared to Al–O bonds

  5. Effects of imaging gradients in sequences with varying longitudinal storage time-Case of diffusion exchange imaging.

    Science.gov (United States)

    Lasič, Samo; Lundell, Henrik; Topgaard, Daniel; Dyrby, Tim B

    2018-04-01

    To illustrate the potential bias caused by imaging gradients in correlation MRI sequences using longitudinal magnetization storage (LS) and examine the case of filter exchange imaging (FEXI) yielding maps of the apparent exchange rate (AXR). The effects of imaging gradients in FEXI were observed on yeast cells. To analyze the AXR bias, signal evolution was calculated by applying matrix exponential operators. A sharp threshold for the slice thickness was identified, below which the AXR is increasingly underestimated. The bias can be understood in terms of an extended low-pass diffusion filtering during the LS interval, which is more pronounced at lower exchange rates. For a total exchange rate constant larger than 1 s -1 , the AXR bias is expected to be negligible when slices thicker than 2.5 mm are used. In correlation experiments like FEXI, relying on LS with variable duration, imaging gradients may cause disrupting effects that cannot be easily mitigated and should be carefully considered for unbiased results. In typical clinical applications of FEXI, the imaging gradients are expected to cause a negligible AXR bias. However, the AXR bias may be significant in preclinical settings or whenever thin imaging slices are used. Magn Reson Med 79:2228-2235, 2018. © 2017 International Society for Magnetic Resonance in Medicine. © 2017 International Society for Magnetic Resonance in Medicine.

  6. On the interaction between [Ru(NH3)(6)](3+) and the G-quadruplex forming thrombin binding aptamer sequence

    Czech Academy of Sciences Publication Activity Database

    De Rache, A.; Doneux, T.; Kejnovská, Iva; Buess-Herman, C.

    2013-01-01

    Roč. 126, SEP 2013 (2013), s. 84-90 ISSN 0162-0134 Institutional support: RVO:68081707 Keywords : SELF-ASSEMBLED MONOLAYERS * DNA-MODIFIED SURFACES * CIRCULAR-DICHROISM Subject RIV: BO - Biophysics Impact factor: 3.274, year: 2013

  7. The effects of alignment quality, distance calculation method, sequence filtering, and region on the analysis of 16S rRNA gene-based studies.

    Directory of Open Access Journals (Sweden)

    Patrick D Schloss

    Full Text Available Pyrosequencing of PCR-amplified fragments that target variable regions within the 16S rRNA gene has quickly become a powerful method for analyzing the membership and structure of microbial communities. This approach has revealed and introduced questions that were not fully appreciated by those carrying out traditional Sanger sequencing-based methods. These include the effects of alignment quality, the best method of calculating pairwise genetic distances for 16S rRNA genes, whether it is appropriate to filter variable regions, and how the choice of variable region relates to the genetic diversity observed in full-length sequences. I used a diverse collection of 13,501 high-quality full-length sequences to assess each of these questions. First, alignment quality had a significant impact on distance values and downstream analyses. Specifically, the greengenes alignment, which does a poor job of aligning variable regions, predicted higher genetic diversity, richness, and phylogenetic diversity than the SILVA and RDP-based alignments. Second, the effect of different gap treatments in determining pairwise genetic distances was strongly affected by the variation in sequence length for a region; however, the effect of different calculation methods was subtle when determining the sample's richness or phylogenetic diversity for a region. Third, applying a sequence mask to remove variable positions had a profound impact on genetic distances by muting the observed richness and phylogenetic diversity. Finally, the genetic distances calculated for each of the variable regions did a poor job of correlating with the full-length gene. Thus, while it is tempting to apply traditional cutoff levels derived for full-length sequences to these shorter sequences, it is not advisable. Analysis of beta-diversity metrics showed that each of these factors can have a significant impact on the comparison of community membership and structure. Taken together, these results

  8. Effect of ionic strength and cationic DNA affinity binders on the DNA sequence selective alkylation of guanine N7-positions by nitrogen mustards

    International Nuclear Information System (INIS)

    Hartley, J.A.; Forrow, S.M.; Souhami, R.L.

    1990-01-01

    Large variations in alkylation intensities exist among guanines in a DNA sequence following treatment with chemotherapeutic alkylating agents such as nitrogen mustards, and the substituent attached to the reactive group can impose a distinct sequence preference for reaction. In order to understand further the structural and electrostatic factors which determine the sequence selectivity of alkylation reactions, the effect of increase ionic strength, the intercalator ethidium bromide, AT-specific minor groove binders distamycin A and netropsin, and the polyamine spermine on guanine N7-alkylation by L-phenylalanine mustard (L-Pam), uracil mustard (UM), and quinacrine mustard (QM) was investigated with a modification of the guanine-specific chemical cleavage technique for DNA sequencing. The result differed with both the nitrogen mustard and the cationic agent used. The effect, which resulted in both enhancement and suppression of alkylation sites, was most striking in the case of netropsin and distamycin A, which differed from each other. DNA footprinting indicated that selective binding to AT sequences in the minor groove of DNA can have long-range effects on the alkylation pattern of DNA in the major groove

  9. Analysis of the effect of the Electron-Beam welding sequence for a fixed manufacturing route using finite element simulations applied to ITER vacuum vessel manufacture

    Energy Technology Data Exchange (ETDEWEB)

    Martín-Menéndez, Cristina, E-mail: cristina@natec-ingenieros.com [Numerical Analysis Technologies, S.L. Marqués de San Esteban No. 52, 33206 Gijón (Spain); Rodríguez, Eduardo [Department of Mechanical Engineering, University of Oviedo, Campus de Gijón, 33203 Gijón (Spain); Ottolini, Marco [Ansaldo Nucleare S.p.A., Corso Perrone 25, 16152 Genova (Italy); Caixas, Joan [F4E, c/Josep Pla, n.2, Torres Diagonal Litoral, Edificio B3, E-08019 Barcelona (Spain); Guirao, Julio [Numerical Analysis Technologies, S.L. Marqués de San Esteban No. 52, 33206 Gijón (Spain)

    2016-03-15

    Highlights: • The simulation methodology employed in this paper is able to adapt inside a complex manufacturing route. • The effect of the sequence is lower in a highly constrained assembly than in a lowly constrained one. • The most relevant influence on the distortions is the jigs design, instead of the welding sequence. • The welding distortion analysis should be used as a guidance to design and improve the manufacturing strategy. - Abstract: The ITER Vacuum Vessel Sectors have very tight tolerances and high density of welding. Therefore, prediction and reduction of welding distortion are critical to allow the final assembly with the other Vacuum Vessel Sectors without the production of a full scale prototype. In this paper, the effect of the welding sequence in the distortions inside a fixed manufacturing route and in a highly constrained assembly is studied in the poloidal segment named inboard (PS1). This is one of the four poloidal segments (PS) assembled for the sector. Moreover, some restrictions and limitations in the welding sequence related to the manufacturing process are explained. The results obtained show that the effect of the sequence is lower in a highly constrained assembly than in a low constrained one. A prototype manufactured by AMW consortium (PS1 mock-up) is used in order to validate the finite element method welding simulation employed. The obtained results confirmed that for Electron-Beam welds, both the welding simulation and the mock-up show a low value of distortions.

  10. Microwave-Assisted Synthesis of Arene Ru(II Complexes Induce Tumor Cell Apoptosis Through Selectively Binding and Stabilizing bcl-2 G-Quadruplex DNA

    Directory of Open Access Journals (Sweden)

    Yanhua Chen

    2016-05-01

    Full Text Available A series of arene Ru(II complexes coordinated with phenanthroimidazole derivatives, [(η6-C6H6Ru(lCl]Cl(1b L = p-ClPIP = 2-(4-Chlorophenylimidazole[4,5f] 1,10-phenanthroline; 2b L = m-ClPIP = 2-(3-Chlorophenylimidazole[4,5f] 1,10-phenanthroline; 3b L = p-NPIP = 2-(4-Nitrophenylimidazole[4,5f] 1,10-phenanthroline; 4b L = m-NPIP = 2-(3-Nitrophenyl imidazole [4,5f] 1,10-phenanthroline were synthesized in yields of 89.9%–92.7% under conditions of microwave irradiation heating for 30 min to liberate four arene Ru(II complexes (1b, 2b, 3b, 4b. The anti-tumor activity of 1b against various tumor cells was evaluated by MTT assay. The results indicated that this complex blocked the growth of human lung adenocarcinoma A549 cells with an IC50 of 16.59 μM. Flow cytometric analysis showed that apoptosis of A549 cells was observed following treatment with 1b. Furthermore, the in vitro DNA-binding behaviors that were confirmed by spectroscopy indicated that 1b could selectively bind and stabilize bcl-2 G-quadruplex DNA to induce apoptosis of A549 cells. Therefore, the synthesized 1b has impressive bcl-2 G-quadruplex DNA-binding and stabilizing activities with potential applications in cancer chemotherapy.

  11. Effects of antibiotic resistance genes on the performance and stability of different microbial aggregates in a granular sequencing batch reactor

    International Nuclear Information System (INIS)

    Zou, Wenci; Xue, Bin; Zhi, Weijia; Zhao, Tianyu; Yang, Dong; Qiu, Zhigang; Shen, Zhiqiang; Li, Junwen; Zhang, Bin; Wang, Jingfeng

    2016-01-01

    Highlights: • The inoculation of donor strain undermined treatment efficiencies of bioreactor. • The presence of RP4 plasmid affected the activity of ammonia-oxidizing bacteria. • Granular sludge shortened the residence time of RP4 in sludge. • Granular sludge system could reduce the ecological risk from ARGs. - Abstract: Antibiotic resistance genes (ARGs) have emerged as key factors in wastewater environmental contaminants and continue to pose a challenge for wastewater treatment processes. With the aim of investigating the performance of granular sludge system when treating wastewater containing a considerable amount of ARGs, a lab-scale granular sequencing batch reactor (GSBR) where flocculent and granular sludge coexisted was designed. The results showed that after inoculation of donor strain NH 4 + -N purification efficiency diminished from 94.7% to 32.8% and recovered to 95.2% after 10 days. Meanwhile, RP4 plasmid had varying effects on different forms of microbial aggregates. As the size of aggregates increased, the abundance of RP4 in sludge decreased. The residence time of RP4 in granules with particle size exceeding 0.9 mm (14 days) was far shorter than that in flocculent sludge (26 days). Therefore, our studies conclude that with increasing number of ARGs being detected in wastewater, the use of granular sludge system in wastewater treatment processes will allow the reduction of ARGs transmissions and lessen potential ecological threats.

  12. Effects of antibiotic resistance genes on the performance and stability of different microbial aggregates in a granular sequencing batch reactor

    Energy Technology Data Exchange (ETDEWEB)

    Zou, Wenci; Xue, Bin; Zhi, Weijia; Zhao, Tianyu; Yang, Dong; Qiu, Zhigang; Shen, Zhiqiang; Li, Junwen; Zhang, Bin, E-mail: tjzhangbin@sohu.com; Wang, Jingfeng, E-mail: jingfengwang@hotmail.com

    2016-03-05

    Highlights: • The inoculation of donor strain undermined treatment efficiencies of bioreactor. • The presence of RP4 plasmid affected the activity of ammonia-oxidizing bacteria. • Granular sludge shortened the residence time of RP4 in sludge. • Granular sludge system could reduce the ecological risk from ARGs. - Abstract: Antibiotic resistance genes (ARGs) have emerged as key factors in wastewater environmental contaminants and continue to pose a challenge for wastewater treatment processes. With the aim of investigating the performance of granular sludge system when treating wastewater containing a considerable amount of ARGs, a lab-scale granular sequencing batch reactor (GSBR) where flocculent and granular sludge coexisted was designed. The results showed that after inoculation of donor strain NH{sub 4}{sup +}-N purification efficiency diminished from 94.7% to 32.8% and recovered to 95.2% after 10 days. Meanwhile, RP4 plasmid had varying effects on different forms of microbial aggregates. As the size of aggregates increased, the abundance of RP4 in sludge decreased. The residence time of RP4 in granules with particle size exceeding 0.9 mm (14 days) was far shorter than that in flocculent sludge (26 days). Therefore, our studies conclude that with increasing number of ARGs being detected in wastewater, the use of granular sludge system in wastewater treatment processes will allow the reduction of ARGs transmissions and lessen potential ecological threats.

  13. Conflict adaptation and congruency sequence effects to social-emotional stimuli in individuals with autism spectrum disorders.

    Science.gov (United States)

    Worsham, Whitney; Gray, Whitney E; Larson, Michael J; South, Mikle

    2015-11-01

    The modification of performance following conflict can be measured using conflict adaptation tasks thought to measure the change in the allocation of cognitive resources in order to reduce conflict interference and improve performance. While previous studies have suggested atypical processing during nonsocial cognitive control tasks, conflict adaptation (i.e. congruency sequence effects) for social-emotional stimuli have not been previously studied in autism spectrum disorder. A total of 32 participants diagnosed with autism spectrum disorder and 27 typically developing matched controls completed an emotional Stroop conflict task that required the classification of facial affect while simultaneously ignoring an overlaid affective word. Both groups showed behavioral evidence for emotional conflict adaptation based on response times and accuracy rates. However, the autism spectrum disorder group demonstrated a speed-accuracy trade-off manifested through significantly faster response times and decreased accuracy rates on trials containing conflict between the emotional face and the overlaid emotional word. Reduced selective attention toward socially relevant information may bias individuals with autism spectrum disorder toward more rapid processing and decision making even when conflict is present. Nonetheless, the loss of important information from the social stimuli reduces decision-making accuracy, negatively affecting the ability to adapt both cognitively and emotionally when conflict arises. © The Author(s) 2014.

  14. Iodine chemistry effect on source term assessments. A MELCOR 186 YT study of a PWR severe accident sequence

    International Nuclear Information System (INIS)

    Herranz, Luis E.; Garcia, Monica; Otero, Bernadette

    2009-01-01

    Level-2 Probabilistic Safety Analysis has demonstrated to be a powerful tool to give insights into multiple aspects concerning severe accidents: phenomena with the greatest potential to lead to containment failure, safety systems performance and, even, to identify any additional accident management that could mitigate the consequences of such an even, etc. A major result of level-2 PSA is iodine content in Source Term since it is the main responsible for the radiological impact during the first few days after a hypothetical severe accident. Iodine chemistry is known to considerably affect iodine behavior and although understanding has improved substantially since the early 90's, a thorough understanding is still missing and most PSA studies do not address it when assessing severe accident scenarios. This paper emphasizes the quantitative and qualitative significance of considering iodine chemistry in level-2 PSA estimates. To do so a cold leg break, low pressure severe accident sequence of an actual pressurized water reactor has been analyzed with the MELCOR 1.8.6 YT code. Two sets of calculations, with and without chemistry, have been carried out and compared. The study shows that iodine chemistry could result in an iodine release to environment about twice higher, most of which would consist of around 60% of iodine in gaseous form. From these results it is concluded that exploratory studies on the potential effect of iodine chemistry on source term estimates should be carried out. (author)

  15. Effect of fiber angle orientation and stacking sequence on mixed mode fracture toughness of carbon fiber reinforced plastics: Numerical and experimental investigations

    International Nuclear Information System (INIS)

    Naghipour, P.; Bartsch, M.; Chernova, L.; Hausmann, J.; Voggenreiter, H.

    2010-01-01

    This paper focuses on the effect of fiber orientation and stacking sequence on the progressive mixed mode delamination failure in composite laminates using fracture experiments and finite element (FE) simulations. Every laminate is modelled numerically combining damageable layers with defined fiber orientations and cohesive zone interface elements, subjected to mixed mode bending. The numerical simulations are then calibrated and validated through experiments, conducted following standardized mixed mode delamination tests. The numerical model is able to successfully capture the experimentally observed effects of fiber angle orientations and variable stacking sequences on the global load-displacement response and mixed mode inter-laminar fracture toughness of the various laminates. For better understanding of the failure mechanism, fracture surfaces of laminates with different stacking sequences are also studied using scanning electron microscopy (SEM).

  16. SU-E-J-207: Effect of Pulse Sequence Parameters On Geometric Distortions Induced by a Titanium Brachytherapy Applicator

    International Nuclear Information System (INIS)

    Shea, S; Diak, A; Surucu, M; Harkenrider, M; Yacoub, J; Roeske, J; Small, W

    2015-01-01

    Purpose: To investigate the effect of readout bandwidth and voxel size on the appearance of distortion artifacts caused by a titanium brachytherapy applicator. Methods: An acrylic phantom was constructed to rigidly hold a MR conditional, titanium Fletcher-Suit-Delclos-style applicator set (Varian Medical Systems) for imaging on CT (Philips Brilliance) and 1.5T MRI (Siemens Magnetom Aera). Several variants of MRI parameters were tried for 2D T2-weighted turbo spin echo imaging in comparison against the standard clinical protocol with the criteria to keep relative SNR loss less than 20% and imaging time as short as possible. Two 3D sequences were also used for comparison with similar parameters. The applicator tandem was segmented on axial CT images (0.4×0.4×1.5mm 3 resolution) and the CT images were registered to the 3D MR images in Eclipse (Varian). The applicator volume was then overlaid on all MRI sets in 3D-Slicer and distances were measured from the tandem tip to the MRI artifact edge in right/left/superior and anterior/posterior/superior directions from coronal and sagittal 2D acquisitions, respectively, or 3D data reformats. Artifact regions were also manually contoured in coronal/sagittal orientations for area measurements. Results: As would be expected, reductions in voxel size and increases in readout bandwidth reduced artifact size (average max artifact length decreased by 0.95 mm and average max area decrease by 0.27 cm 2 ). Interestingly, bandwidth increases yielded reductions in area (0.19 cm 2 ) and in distance measurements (1 mm) even with voxel increases, as compared to a standard protocol. This could be useful when high performance protocols are not feasible due to long imaging times. Conclusion: We have characterized artifacts caused by cervical brachytherapy applicator across multiple sequence parameters at 1.5T. Future work will focus on finalizing an optimal protocol that balances artifact reduction with imaging time and then testing this new

  17. Hybrid Pareto artificial bee colony algorithm for multi-objective single machine group scheduling problem with sequence-dependent setup times and learning effects.

    Science.gov (United States)

    Yue, Lei; Guan, Zailin; Saif, Ullah; Zhang, Fei; Wang, Hao

    2016-01-01

    Group scheduling is significant for efficient and cost effective production system. However, there exist setup times between the groups, which require to decrease it by sequencing groups in an efficient way. Current research is focused on a sequence dependent group scheduling problem with an aim to minimize the makespan in addition to minimize the total weighted tardiness simultaneously. In most of the production scheduling problems, the processing time of jobs is assumed as fixed. However, the actual processing time of jobs may be reduced due to "learning effect". The integration of sequence dependent group scheduling problem with learning effects has been rarely considered in literature. Therefore, current research considers a single machine group scheduling problem with sequence dependent setup times and learning effects simultaneously. A novel hybrid Pareto artificial bee colony algorithm (HPABC) with some steps of genetic algorithm is proposed for current problem to get Pareto solutions. Furthermore, five different sizes of test problems (small, small medium, medium, large medium, large) are tested using proposed HPABC. Taguchi method is used to tune the effective parameters of the proposed HPABC for each problem category. The performance of HPABC is compared with three famous multi objective optimization algorithms, improved strength Pareto evolutionary algorithm (SPEA2), non-dominated sorting genetic algorithm II (NSGAII) and particle swarm optimization algorithm (PSO). Results indicate that HPABC outperforms SPEA2, NSGAII and PSO and gives better Pareto optimal solutions in terms of diversity and quality for almost all the instances of the different sizes of problems.

  18. Individual and combined effects of organic, toxic, and hydraulic shocks on sequencing batch reactor in treating petroleum refinery wastewater

    Energy Technology Data Exchange (ETDEWEB)

    Mizzouri, Nashwan Sh., E-mail: nashwan_mizzouri@yahoo.com [Department of Civil Engineering, University of Malaya, Lembah Pantai, 50603 Kuala Lumpur (Malaysia); Department of Civil Engineering, University of Duhok, Kurdistan (Iraq); Shaaban, Md Ghazaly [Department of Civil Engineering, University of Malaya, Lembah Pantai, 50603 Kuala Lumpur (Malaysia)

    2013-04-15

    Highlights: ► This research focuses on the combined impact of shock loads on the PRWW treatment. ► System failure resulted when combined shock of organic and hydraulic was applied. ► Recovery was achieved by replacing glucose with PRWW and OLR was decreased to half. ► Worst COD removals were 68.9, and 57.8% for organic, and combined shocks. -- Abstract: This study analyzes the effects of toxic, hydraulic, and organic shocks on the performance of a lab-scale sequencing batch reactor (SBR) with a capacity of 5 L. Petroleum refinery wastewater (PRWW) was treated with an organic loading rate (OLR) of approximately 0.3 kg chemical oxygen demand (COD)/kg MLSS d at 12.8 h hydraulic retention time (HRT). A considerable variation in the COD was observed for organic, toxic, hydraulic, and combined shocks, and the worst values observed were 68.9, 77.1, 70.2, and 57.8%, respectively. Improved control of toxic shock loads of 10 and 20 mg/L of chromium (VI) was identified. The system was adversely affected by the organic shock when a shock load thrice the normal value was used, and this behavior was repeated when the hydraulic shock was 4.8 h HRT. The empirical recovery period was greater than the theoretical period because of the inhibitory effects of phenols, sulfides, high oil, and grease in the PRWW. The system recovery rates from the shocks were in the following order: toxic, organic, hydraulic, and combined shocks. System failure occurred when the combined shocks of organic and hydraulic were applied. The system was resumed by replacing the PRWW with glucose, and the OLR was reduced to half its initial value.

  19. Effects of COD/N ratio on soluble microbial products in effluent from sequencing batch reactors and subsequent membrane fouling.

    Science.gov (United States)

    Ly, Quang Viet; Nghiem, Long D; Sibag, Mark; Maqbool, Tahir; Hur, Jin

    2018-05-01

    The relative ratios of chemical oxygen demand (COD) to nitrogen (N) in wastewater are known to have profound effects on the characteristics of soluble microbial products (SMP) from activated sludge. In this study, the changes in the SMP characteristics upon different COD/N ratios and the subsequent effects on ultrafiltration (UF) membrane fouling potentials were examined in sequencing batch reactors (SBR) using excitation emission matrix-parallel factor analysis (EEM-PARAFAC) and size exclusion chromatography (SEC). Three unique fluorescent components were identified from the SMP samples in the bioreactors operated at the COD/N ratios of 100/10 (N rich), 100/5 (N medium), and 100/2 (N deficient). The tryptophan-like component (C1) was the most depleted at the N medium condition. Fulvic-like (C2) and humic-like (C3) components were more abundant with N rich wastewater. Greater abundances of large size biopolymer (BP) and low molecular weight neutrals (LMWN) were found under the N deficient and N rich conditions, respectively. SMPs from various COD/N exhibited a greater degree on membrane fouling following the order of 100/2 > 100/10 > 100/5. C1 and C2 had close associations with reversible and irreversible fouling, respectively, while the reversible fouling potential of C3 depended on the COD/N ratios. No significant impact of COD/N ratio was observed on the relative contributions of SMP size fractions to either reversible or irreversible fouling potential. However, the COD/N ratios likely altered the BP foulants' composition with greater contribution of proteinaceous substances to reversible fouling under the N deficient condition than at other N richer conditions. The opposite trend was observed for irreversible fouling. Our results provided further insight into changes in different SMP constitutes and their membrane fouling in response to microbial activities under different COD/N ratios. Copyright © 2018 Elsevier Ltd. All rights reserved.

  20. The effect of Zn, N and P application on nutrient uptake in wheat-maize sequence using isotopic techniques

    International Nuclear Information System (INIS)

    Tehrani, M.M.; Sachdev, P.; Sachdev, M.S.

    2006-01-01

    A pot experiment was conducted at the Nuclear Research Laboratory , Indian Agricultural Research Institute, New Delhi in 2000-2001. The experiment was 3x3x3 factorial in Completely Randomized Design (CRD) with three replications. Fertilizers were applied as three levels of zinc 0. 2.5 and 5 mg Zn kg -1 as ZnSO 4 , three levels of phosphorus 0, 7.5 and 15 mg P kg -1 through KH 2 PO 4 and three levels of nitrogen 30, 60 and 90 mg N kg -1 as urea. Zn fertilizer was not applied for the second crop in sequence. The amount of available Zn in soil decreased by the application of P and N, but increased by the Zn application. The P application increased the available pool of P in soil, but the zinc levels had no effect on it. Data revealed that the P application decreased the Zn concentration in plant tissue for both the crops. The per cent N utilization decreased drastically with increasing rate of N application from N 30 to N 90 in wheat. The highest level of P application resulted in least total Zn uptake, per cent Zndff, fertilizer Zn uptake and per cent Zn utilized from fertilizer. The no zinc application showed the highest value of Zn application to the wheat crop. The highest values of total P uptake, per cent Pdff, fertilizer uptake and per cent P utilized from fertilizer in the succeeding crop of maize were observed with residual effect of Zn 5 among three levels of Zn application to the first crop of maize. (author)

  1. Effects of High Intensity White Noise on Short-Term Memory for Position in a List and Sequence

    Science.gov (United States)

    Daee, Safar; Wilding, J. M.

    1977-01-01

    Seven experiments are described investigating the effecy of high intensity white noise during the visual presentation of words on a number of short-term memory tasks. Examines results relative to position learning and sequence learning. (Editor/RK)

  2. DNA breaks and repair in interstitial telomere sequences: Influence of chromatin structure; Etude des cassures de l'ADN et des mecanismes de reparation dans les sequences telomeriques interstitielles: Influence de la structure chromatinienne

    Energy Technology Data Exchange (ETDEWEB)

    Revaud, D.

    2009-06-15

    Interstitial Telomeric Sequences (ITS) are over-involved in spontaneous and radiationinduced chromosome aberrations in chinese hamster cells. We have performed a study to investigate the origin of their instability, spontaneously or after low doses irradiation. Our results demonstrate that ITS have a particular chromatin structure: short nucleotide repeat length, less compaction of the 30 nm chromatin fiber, presence of G-quadruplex structures. These features would modulate breaks production and would favour the recruitment of alternative DNA repair mechanisms, which are prone to produce chromosome aberrations. These pathways could be at the origin of chromosome aberrations in ITS whereas NHEJ and HR Double Strand Break repair pathways are rather required for a correct repair in these regions. (author)

  3. Sequencing the threat and recommendation components of persuasive messages differentially improves the effectiveness of high- and low-distressing imagery in an anti-alcohol message in students.

    Science.gov (United States)

    Brown, Stephen L; West, Charlotte

    2015-05-01

    Distressing imagery is often used to improve the persuasiveness of mass-reach health promotion messages, but its effectiveness may be limited because audiences avoid attending to content. Prior self-affirmation or self-efficacy inductions have been shown to reduce avoidance and improve audience responsiveness to distressing messages, but these are difficult to introduce into a mass-reach context. Reasoning that a behavioural recommendation may have a similar effect, we reversed the traditional threat-behavioural recommendation health promotion message sequence. 2 × 2 experimental design: Factor 1, high- and low-distress images; Factor 2, threat-recommendation and recommendation-threat sequences. Ninety-one students were exposed to an identical text message accompanied by high- or low-distress imagery presented in threat-recommendation and recommendation-threat sequences. For the high-distress message, greater persuasion was observed for the recommendation-threat than the threat-recommendation sequence. This was partially mediated by participants' greater self-exposure to the threat component of the message, which we attribute to the effect of sequence in reducing attentional avoidance. For the low-distress message, greater persuasion was observed for the threat-recommendation sequence, which was not mediated by reading time allocated to the threat. Tailoring message sequence to suit the degree of distress that message developers wish to induce provides a tool that could improve persuasive messages. These findings provide a first step in this process and discuss further steps needed to consolidate and expand these findings. Statement of contribution What is already known on this subject? Health promotion messages accompanied by distressing imagery might, under some circumstances, persuade individuals to engage in healthier behaviour. Audiences can respond defensively to distressing imagery, but may be less inclined to do so when an easily followed behavioural

  4. An effective approach for annotation of protein families with low sequence similarity and conserved motifs: identifying GDSL hydrolases across the plant kingdom.

    Science.gov (United States)

    Vujaklija, Ivan; Bielen, Ana; Paradžik, Tina; Biđin, Siniša; Goldstein, Pavle; Vujaklija, Dušica

    2016-02-18

    the graphical user interface ( http://compbio.math.hr/ ). Our results show that scanning with a carefully parameterized motif-HMM is an effective approach for annotation of protein families with low sequence similarity and conserved motifs. The results of this study expand current knowledge and provide new insights into the evolution of the large GDSL-lipase family in land plants.

  5. Hybrid ligand-alkylating agents targeting telomeric G-quadruplex structures.

    Science.gov (United States)

    Doria, Filippo; Nadai, Matteo; Folini, Marco; Di Antonio, Marco; Germani, Luca; Percivalle, Claudia; Sissi, Claudia; Zaffaroni, Nadia; Alcaro, Stefano; Artese, Anna; Richter, Sara N; Freccero, Mauro

    2012-04-14

    The synthesis, physico-chemical properties and biological effects of a new class of naphthalene diimides (NDIs) capable of reversibly binding telomeric DNA and alkylate it through an electrophilic quinone methide moiety (QM), are reported. FRET and circular dichroism assays showed a marked stabilization and selectivity towards telomeric G4 DNA folded in a hybrid topology. NDI-QMs' alkylating properties revealed a good reactivity on single nucleosides and selectivity towards telomeric G4. A selected NDI was able to significantly impair the growth of melanoma cells by causing telomere dysfunction and down-regulation of telomerase expression. These findings points to our hybrid ligand-alkylating NDIs as possible tools for the development of novel targeted anticancer therapies. This journal is © The Royal Society of Chemistry 2012

  6. Low-Energy Electron-Induced Strand Breaks in Telomere-Derived DNA Sequences-Influence of DNA Sequence and Topology.

    Science.gov (United States)

    Rackwitz, Jenny; Bald, Ilko

    2018-03-26

    During cancer radiation therapy high-energy radiation is used to reduce tumour tissue. The irradiation produces a shower of secondary low-energy (DNA very efficiently by dissociative electron attachment. Recently, it was suggested that low-energy electron-induced DNA strand breaks strongly depend on the specific DNA sequence with a high sensitivity of G-rich sequences. Here, we use DNA origami platforms to expose G-rich telomere sequences to low-energy (8.8 eV) electrons to determine absolute cross sections for strand breakage and to study the influence of sequence modifications and topology of telomeric DNA on the strand breakage. We find that the telomeric DNA 5'-(TTA GGG) 2 is more sensitive to low-energy electrons than an intermixed sequence 5'-(TGT GTG A) 2 confirming the unique electronic properties resulting from G-stacking. With increasing length of the oligonucleotide (i.e., going from 5'-(GGG ATT) 2 to 5'-(GGG ATT) 4 ), both the variety of topology and the electron-induced strand break cross sections increase. Addition of K + ions decreases the strand break cross section for all sequences that are able to fold G-quadruplexes or G-intermediates, whereas the strand break cross section for the intermixed sequence remains unchanged. These results indicate that telomeric DNA is rather sensitive towards low-energy electron-induced strand breakage suggesting significant telomere shortening that can also occur during cancer radiation therapy. © 2018 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.

  7. Quadruplex MAPH: improvement of throughput in high-resolution copy number screening.

    Science.gov (United States)

    Tyson, Jess; Majerus, Tamsin Mo; Walker, Susan; Armour, John Al

    2009-09-28

    Copy number variation (CNV) in the human genome is recognised as a widespread and important source of human genetic variation. Now the challenge is to screen for these CNVs at high resolution in a reliable, accurate and cost-effective way. Multiplex Amplifiable Probe Hybridisation (MAPH) is a sensitive, high-resolution technology appropriate for screening for CNVs in a defined region, for a targeted population. We have developed MAPH to a highly multiplexed format ("QuadMAPH") that allows the user a four-fold increase in the number of loci tested simultaneously. We have used this method to analyse a genomic region of 210 kb, including the MSH2 gene and 120 kb of flanking DNA. We show that the QuadMAPH probes report copy number with equivalent accuracy to simplex MAPH, reliably demonstrating diploid copy number in control samples and accurately detecting deletions in Hereditary Non-Polyposis Colorectal Cancer (HNPCC) samples. QuadMAPH is an accurate, high-resolution method that allows targeted screening of large numbers of subjects without the expense of genome-wide approaches. Whilst we have applied this technique to a region of the human genome, it is equally applicable to the genomes of other organisms.

  8. Quadruplex MAPH: improvement of throughput in high-resolution copy number screening

    Directory of Open Access Journals (Sweden)

    Walker Susan

    2009-09-01

    Full Text Available Abstract Background Copy number variation (CNV in the human genome is recognised as a widespread and important source of human genetic variation. Now the challenge is to screen for these CNVs at high resolution in a reliable, accurate and cost-effective way. Results Multiplex Amplifiable Probe Hybridisation (MAPH is a sensitive, high-resolution technology appropriate for screening for CNVs in a defined region, for a targeted population. We have developed MAPH to a highly multiplexed format ("QuadMAPH" that allows the user a four-fold increase in the number of loci tested simultaneously. We have used this method to analyse a genomic region of 210 kb, including the MSH2 gene and 120 kb of flanking DNA. We show that the QuadMAPH probes report copy number with equivalent accuracy to simplex MAPH, reliably demonstrating diploid copy number in control samples and accurately detecting deletions in Hereditary Non-Polyposis Colorectal Cancer (HNPCC samples. Conclusion QuadMAPH is an accurate, high-resolution method that allows targeted screening of large numbers of subjects without the expense of genome-wide approaches. Whilst we have applied this technique to a region of the human genome, it is equally applicable to the genomes of other organisms.

  9. 16S rRNA gene sequencing reveals effects of photoperiod on cecal microbiota of broiler roosters

    Directory of Open Access Journals (Sweden)

    Jun Wang

    2018-02-01

    Full Text Available Photoperiod is an important factor in stimulating broiler performance in commercial poultry practice. However, the mechanism by which photoperiod affects the performance of broiler chickens has not been adequately explored. The current study evaluated the effects of three different photoperiod regimes (short day (LD = 8 h light, control (CTR = 12.5 h light, and long day (SD = 16 h light on the cecal microbiota of broiler roosters by sequencing bacterial 16S rRNA genes. At the phylum level, the dominant bacteria were Firmicutes (CTR: 68%, SD: 69%, LD: 67% and Bacteroidetes (CTR: 25%, SD: 26%, and LD: 28%. There was a greater abundance of Proteobacteria (p < 0.01 and Cyanobacteria (p < 0.05 in chickens in the LD group than in those in the CTR group. A significantly greater abundance of Actinobacteria was observed in CTR chickens than in SD and LD chickens (p < 0.01. The abundance of Deferribacteres was significantly higher in LD chickens than in SD chickens (p < 0.01. Fusobacteria and Proteobacteria were more abundant in SD chickens than in CTR and LD chickens. The predicted functional properties indicate that cellular processes may be influenced by photoperiod. Conversely, carbohydrate metabolism was enhanced in CTR chickens as compared to that in SD and LD chickens. The current results indicate that different photoperiod regimes may influence the abundance of specific bacterial populations and then contribute to differences in the functional properties of gut microbiota of broiler roosters.

  10. A comparison of the effects of temporary hippocampal lesions on single and dual context versions of the olfactory sequence memory task.

    Science.gov (United States)

    Sill, Orriana C; Smith, David M

    2012-08-01

    In recent years, many animal models of memory have focused on one or more of the various components of episodic memory. For example, the odor sequence memory task requires subjects to remember individual items and events (the odors) and the temporal aspects of the experience (the sequence of odor presentation). The well-known spatial context coding function of the hippocampus, as exemplified by place cell firing, may reflect the "where" component of episodic memory. In the present study, we added a contextual component to the odor sequence memory task by training rats to choose the earlier odor in one context and the later odor in another context and we compared the effects of temporary hippocampal lesions on performance of the original single context task and the new dual context task. Temporary lesions significantly impaired the single context task, although performance remained significantly above chance levels. In contrast, performance dropped all the way to chance when temporary lesions were used in the dual context task. These results demonstrate that rats can learn a dual context version of the odor sequence learning task that requires the use of contextual information along with the requirement to remember the "what" and "when" components of the odor sequence. Moreover, the addition of the contextual component made the task fully dependent on the hippocampus.

  11. Stored word sequences in language learning: the effect of familiarity on children's repetition of four-word combinations.

    Science.gov (United States)

    Bannard, Colin; Matthews, Danielle

    2008-03-01

    Recent accounts of the development of grammar propose that children remember utterances they hear and draw generalizations over these stored exemplars. This study tested these accounts' assumption that children store utterances as wholes by testing memory for familiar sequences of words. Using a newly available, dense corpus of child-directed speech, we identified frequently occurring chunks in the input (e.g., sit in your chair) and matched them to infrequent sequences (e.g., sit in your truck). We tested young children's ability to produce these sequences in a sentence-repetition test. Three-year-olds (n= 21) and 2-year-olds (n= 17) were significantly more likely to repeat frequent sequences correctly than to repeat infrequent sequences correctly. Moreover, the 3-year-olds were significantly faster to repeat the first three words of an item if they formed part of a chunk (e.g., they were quicker to say sit in your when the following word was chair than when it was truck). We discuss the implications of these results for theories of language development and processing.

  12. Investigation of timing effects in modified composite quadrupolar echo pulse sequences by mean of average Hamiltonian theory

    Science.gov (United States)

    Mananga, Eugene Stephane

    2018-01-01

    The utility of the average Hamiltonian theory and its antecedent the Magnus expansion is presented. We assessed the concept of convergence of the Magnus expansion in quadrupolar spectroscopy of spin-1 via the square of the magnitude of the average Hamiltonian. We investigated this approach for two specific modified composite pulse sequences: COM-Im and COM-IVm. It is demonstrated that the size of the square of the magnitude of zero order average Hamiltonian obtained on the appropriated basis is a viable approach to study the convergence of the Magnus expansion. The approach turns to be efficient in studying pulse sequences in general and can be very useful to investigate coherent averaging in the development of high resolution NMR technique in solids. This approach allows comparing theoretically the two modified composite pulse sequences COM-Im and COM-IVm. We also compare theoretically the current modified composite sequences (COM-Im and COM-IVm) to the recently published modified composite pulse sequences (MCOM-I, MCOM-IV, MCOM-I_d, MCOM-IV_d).

  13. Random-effects linear modeling and sample size tables for two special crossover designs of average bioequivalence studies: the four-period, two-sequence, two-formulation and six-period, three-sequence, three-formulation designs.

    Science.gov (United States)

    Diaz, Francisco J; Berg, Michel J; Krebill, Ron; Welty, Timothy; Gidal, Barry E; Alloway, Rita; Privitera, Michael

    2013-12-01

    Due to concern and debate in the epilepsy medical community and to the current interest of the US Food and Drug Administration (FDA) in revising approaches to the approval of generic drugs, the FDA is currently supporting ongoing bioequivalence studies of antiepileptic drugs, the EQUIGEN studies. During the design of these crossover studies, the researchers could not find commercial or non-commercial statistical software that quickly allowed computation of sample sizes for their designs, particularly software implementing the FDA requirement of using random-effects linear models for the analyses of bioequivalence studies. This article presents tables for sample-size evaluations of average bioequivalence studies based on the two crossover designs used in the EQUIGEN studies: the four-period, two-sequence, two-formulation design, and the six-period, three-sequence, three-formulation design. Sample-size computations assume that random-effects linear models are used in bioequivalence analyses with crossover designs. Random-effects linear models have been traditionally viewed by many pharmacologists and clinical researchers as just mathematical devices to analyze repeated-measures data. In contrast, a modern view of these models attributes an important mathematical role in theoretical formulations in personalized medicine to them, because these models not only have parameters that represent average patients, but also have parameters that represent individual patients. Moreover, the notation and language of random-effects linear models have evolved over the years. Thus, another goal of this article is to provide a presentation of the statistical modeling of data from bioequivalence studies that highlights the modern view of these models, with special emphasis on power analyses and sample-size computations.

  14. Draft genome sequence of Bradyrhizobium sp. strain BR 3262, an effective microsymbiont recommended for cowpea inoculation in Brazil.

    Science.gov (United States)

    Simões-Araújo, Jean Luiz; Leite, Jakson; Marie Rouws, Luc Felicianus; Passos, Samuel Ribeiro; Xavier, Gustavo Ribeiro; Rumjanek, Norma Gouvêa; Zilli, Jerri Édson

    The strain BR 3262 was isolated from nodule of cowpea (Vigna unguiculata L. Walp) growing in soil of the Atlantic Forest area in Brazil and it is reported as an efficient nitrogen fixing bacterium associated to cowpea. Firstly, this strain was assigned as Bradyrhizobium elkanii, however, recently a more detailed genetic and molecular characterization has indicated it could be a Bradyrhizobium pachyrhizi species. We report here the draft genome sequence of B. pachyrhizi strain BR 3262, an elite bacterium used as inoculant for cowpea. The whole genome with 116 scaffolds, 8,965,178bp and 63.8% of C+G content for BR 3262 was obtained using Illumina MiSeq sequencing technology. Annotation was added by the RAST prokaryotic genome annotation service and shown 8369 coding sequences, 52 RNAs genes, classified in 504 subsystems. Published by Elsevier Editora Ltda.

  15. Draft genome sequence of Bradyrhizobium sp. strain BR 3262, an effective microsymbiont recommended for cowpea inoculation in Brazil

    Directory of Open Access Journals (Sweden)

    Jean Luiz Simões-Araújo

    Full Text Available Abstract The strain BR 3262 was isolated from nodule of cowpea (Vigna unguiculata L. Walp growing in soil of the Atlantic Forest area in Brazil and it is reported as an efficient nitrogen fixing bacterium associated to cowpea. Firstly, this strain was assigned as Bradyrhizobium elkanii, however, recently a more detailed genetic and molecular characterization has indicated it could be a Bradyrhizobium pachyrhizi species. We report here the draft genome sequence of B. pachyrhizi strain BR 3262, an elite bacterium used as inoculant for cowpea. The whole genome with 116 scaffolds, 8,965,178 bp and 63.8% of C+G content for BR 3262 was obtained using Illumina MiSeq sequencing technology. Annotation was added by the RAST prokaryotic genome annotation service and shown 8369 coding sequences, 52 RNAs genes, classified in 504 subsystems.

  16. Investigation of the effect of finite pulse errors on the BABA pulse sequence using the Floquet-Magnus expansion approach

    Science.gov (United States)

    Mananga, Eugene S.; Reid, Alicia E.

    2013-01-01

    This paper presents a study of finite pulse widths for the BABA pulse sequence using the Floquet-Magnus expansion (FME) approach. In the FME scheme, the first order ? is identical to its counterparts in average Hamiltonian theory (AHT) and Floquet theory (FT). However, the timing part in the FME approach is introduced via the ? function not present in other schemes. This function provides an easy way for evaluating the spin evolution during the time in between' through the Magnus expansion of the operator connected to the timing part of the evolution. The evaluation of ? is particularly useful for the analysis of the non-stroboscopic evolution. Here, the importance of the boundary conditions, which provide a natural choice of ? , is ignored. This work uses the ? function to compare the efficiency of the BABA pulse sequence with ? and the BABA pulse sequence with finite pulses. Calculations of ? and ? are presented.

  17. Experimental investigation on the effect of the tube vibration on the aerosol retention during SGTR meltdown sequences

    International Nuclear Information System (INIS)

    Tardaguila, R. D.; Herranz, L. E.

    2013-01-01

    In PWRs Steam Generator Tube Rupture (SGTR) severe accident sequences scenario, with containment bypass, may become a significant contribution to the NPP risk. Since last two decades the EU-SGTR, ARTIST 1 and 2 and the on-going ARTIST-extension programs have investigated the potential attenuation of the source term in these accidental sequences. Thanks to them, it has been identified key factors that could influence on the source term attenuation as the tube vibration. This paper presents the results of the Phenomenon Test (PT) campaign, focused on the vibration influence on the mass retention on the break stage of a SG and the characterization of the tubes vibration.

  18. Comparison of multiple DNA dyes for real-time PCR: effects of dye concentration and sequence composition on DNA amplification and melting temperature

    DEFF Research Database (Denmark)

    Guðnason, Haukur; Dufva, Hans Martin; Bang, Dang Duong

    2007-01-01

    investigate 15 different intercalating DNA dyes for their inhibitory effects on PCR, effects on DNA melting temperature and possible preferential binding to GC-rich sequences. Our results demonstrated that in contrast to the results of SYBR Green I, two intercalating dyes SYTO-13 and SYTO-82 do not inhibit......The importance of real-time polymerase chain reaction (PCR) has increased steadily in clinical applications over the last decade. Many applications utilize SYBR Green I dye to follow the accumulation of amplicons in real time. SYBR Green I has, however, a number of limitations that include...... the inhibition of PCR, preferential binding to GC-rich sequences and effects on melting curve analysis. Although a few alternative dyes without some of these limitations have been recently proposed, no large-scale investigation into the properties of intercalating dyes has been performed. In this study, we...

  19. Identification of DNA-binding protein target sequences by physical effective energy functions: free energy analysis of lambda repressor-DNA complexes.

    Directory of Open Access Journals (Sweden)

    Caselle Michele

    2007-09-01

    Full Text Available Abstract Background Specific binding of proteins to DNA is one of the most common ways gene expression is controlled. Although general rules for the DNA-protein recognition can be derived, the ambiguous and complex nature of this mechanism precludes a simple recognition code, therefore the prediction of DNA target sequences is not straightforward. DNA-protein interactions can be studied using computational methods which can complement the current experimental methods and offer some advantages. In the present work we use physical effective potentials to evaluate the DNA-protein binding affinities for the λ repressor-DNA complex for which structural and thermodynamic experimental data are available. Results The binding free energy of two molecules can be expressed as the sum of an intermolecular energy (evaluated using a molecular mechanics forcefield, a solvation free energy term and an entropic term. Different solvation models are used including distance dependent dielectric constants, solvent accessible surface tension models and the Generalized Born model. The effect of conformational sampling by Molecular Dynamics simulations on the computed binding energy is assessed; results show that this effect is in general negative and the reproducibility of the experimental values decreases with the increase of simulation time considered. The free energy of binding for non-specific complexes, estimated using the best energetic model, agrees with earlier theoretical suggestions. As a results of these analyses, we propose a protocol for the prediction of DNA-binding target sequences. The possibility of searching regulatory elements within the bacteriophage λ genome using this protocol is explored. Our analysis shows good prediction capabilities, even in absence of any thermodynamic data and information on the naturally recognized sequence. Conclusion This study supports the conclusion that physics-based methods can offer a completely complementary

  20. Effects of stacking sequence on fracture mechanisms in quasi-isotropic Carbon/epoxy laminates under tensile loading

    International Nuclear Information System (INIS)

    Hessabi, Z. R.; Majidi, B.; Aghazadeh, J.

    2006-01-01

    The progress of damage in quasi-isotropic carbon/epoxy laminates under tensile loading has been Investigated microscopically. One significant mode of failure in laminated composites is delamination initiating at free edges. The interlaminar stress in the boundary ply along the free edges of a laminated composite is the main factor to cause delamination. The laminate stacking sequence affects the interlaminar stress distribution and consequently may change the mode of failure. It is of design importance to determine a suitable criterion based on stress analysis to obtain the best stacking sequence. In the present work, tensile properties of six samples with different stacking sequences have been examined. Results showed that stress analysis at distance very close to the free edges is a suitable criterion to predict the initiation of delamination and the stacking sequence of [90/45/0/-45] s , has the highest strength among the others. Furthermore finite element analysis showed that the adjacent ±45 plies cause premature delamination during tensile loading

  1. Effects of Temporal Sequencing and Auditory Discrimination on Children's Memory Patterns for Tones, Numbers, and Nonsense Words

    Science.gov (United States)

    Gromko, Joyce Eastlund; Hansen, Dee; Tortora, Anne Halloran; Higgins, Daniel; Boccia, Eric

    2009-01-01

    The purpose of this study was to determine whether children's recall of tones, numbers, and words was supported by a common temporal sequencing mechanism; whether children's patterns of memory for tones, numbers, and nonsense words were the same despite differences in symbol systems; and whether children's recall of tones, numbers, and nonsense…

  2. A comparison of step-and-shoot leaf sequencing algorithms that eliminate tongue-and-groove effects

    International Nuclear Information System (INIS)

    Kamath, Srijit; Sahni, Sartaj; Ranka, Sanjay; Li, Jonathan; Palta, Jatinder

    2004-01-01

    The performances of three recently published leaf sequencing algorithms for step-and-shoot intensity-modulated radiation therapy delivery that eliminates tongue-and-groove underdosage are evaluated. Proofs are given to show that the algorithm of Que et al (2004 Phys. Med. Biol. 49 399-405) generates leaf sequences free of tongue-and-groove underdosage and interdigitation. However, the total beam-on times could be up to n times those of the sequences generated by the algorithms of Kamath et al (2004 Phys. Med. Biol. 49 N7-N19), which are optimal in beam-on time for unidirectional leaf movement under the same constraints, where n is the total number of involved leaf pairs. Using 19 clinical fluence matrices and 100 000 randomly generated 15 x 15 matrices, the average monitor units and number of segments of the leaf sequences generated using the algorithm of Que et al are about two to four times those generated by the algorithm of Kamath et al

  3. A comparison of step-and-shoot leaf sequencing algorithms that eliminate tongue-and-groove effects

    Energy Technology Data Exchange (ETDEWEB)

    Kamath, Srijit [Department of Computer and Information Science and Engineering, University of Florida, Gainesville, FL (United States); Sahni, Sartaj [Department of Computer and Information Science and Engineering, University of Florida, Gainesville, FL (United States); Ranka, Sanjay [Department of Computer and Information Science and Engineering, University of Florida, Gainesville, FL (United States); Li, Jonathan [Department of Radiation Oncology, University of Florida, Gainesville, FL (United States); Palta, Jatinder [Department of Radiation Oncology, University of Florida, Gainesville, FL (United States)

    2004-07-21

    The performances of three recently published leaf sequencing algorithms for step-and-shoot intensity-modulated radiation therapy delivery that eliminates tongue-and-groove underdosage are evaluated. Proofs are given to show that the algorithm of Que et al (2004 Phys. Med. Biol. 49 399-405) generates leaf sequences free of tongue-and-groove underdosage and interdigitation. However, the total beam-on times could be up to n times those of the sequences generated by the algorithms of Kamath et al (2004 Phys. Med. Biol. 49 N7-N19), which are optimal in beam-on time for unidirectional leaf movement under the same constraints, where n is the total number of involved leaf pairs. Using 19 clinical fluence matrices and 100 000 randomly generated 15 x 15 matrices, the average monitor units and number of segments of the leaf sequences generated using the algorithm of Que et al are about two to four times those generated by the algorithm of Kamath et al.

  4. The Effect of Using a Visual Representation Tool in a Teaching-Learning Sequence for Teaching Newton's Third Law

    Science.gov (United States)

    Savinainen, Antti; Mäkynen, Asko; Nieminen, Pasi; Viiri, Jouni

    2017-01-01

    This paper presents a research-based teaching-learning sequence (TLS) that focuses on the notion of interaction in teaching Newton's third law (N3 law) which is, as earlier studies have shown, a challenging topic for students to learn. The TLS made systematic use of a visual representation tool--an interaction diagram (ID)--highlighting…

  5. The Effect of a Classroom-Based Intensive Robotics and Programming Workshop on Sequencing Ability in Early Childhood

    Science.gov (United States)

    Kazakoff, Elizabeth R.; Sullivan, Amanda; Bers, Marina U.

    2013-01-01

    This paper examines the impact of programming robots on sequencing ability during a 1-week intensive robotics workshop at an early childhood STEM magnet school in the Harlem area of New York City. Children participated in computer programming activities using a developmentally appropriate tangible programming language CHERP, specifically designed…

  6. Examining the Effectiveness of a Semi-Self-Paced Flipped Learning Format in a College General Chemistry Sequence

    Science.gov (United States)

    Hibbard, Lisa; Sung, Shannon; Wells, Breche´

    2016-01-01

    Flipped learning has come to the forefront in education. It maximizes learning by moving content delivery online, where learning can be self-paced, allowing for class time to focus on student-centered active learning. This five-year cross-sectional study assessed student performance in a college general chemistry for majors sequence taught by a…

  7. Application of Ion Torrent Sequencing to the Assessment of the Effect of Alkali Ballast Water Treatment on Microbial Community Diversity

    Science.gov (United States)

    Fujimoto, Masanori; Moyerbrailean, Gregory A.; Noman, Sifat; Gizicki, Jason P.; Ram, Michal L.; Green, Phyllis A.; Ram, Jeffrey L.

    2014-01-01

    The impact of NaOH as a ballast water treatment (BWT) on microbial community diversity was assessed using the 16S rRNA gene based Ion Torrent sequencing with its new 400 base chemistry. Ballast water samples from a Great Lakes ship were collected from the intake and discharge of both control and NaOH (pH 12) treated tanks and were analyzed in duplicates. One set of duplicates was treated with the membrane-impermeable DNA cross-linking reagent propidium mono-azide (PMA) prior to PCR amplification to differentiate between live and dead microorganisms. Ion Torrent sequencing generated nearly 580,000 reads for 31 bar-coded samples and revealed alterations of the microbial community structure in ballast water that had been treated with NaOH. Rarefaction analysis of the Ion Torrent sequencing data showed that BWT using NaOH significantly decreased microbial community diversity relative to control discharge (pbased principal coordinate analysis (PCoA) plots and UPGMA tree analysis revealed that NaOH-treated ballast water microbial communities differed from both intake communities and control discharge communities. After NaOH treatment, bacteria from the genus Alishewanella became dominant in the NaOH-treated samples, accounting for alkali ballast water treatment in reducing ballast water microbial diversity and demonstrated the application of new Ion Torrent sequencing techniques to microbial community studies. PMID:25222021

  8. Effects of the Sequence of Isocaloric Meals with Different Protein Contents on Plasma Biochemical Indexes in Pigs.

    Directory of Open Access Journals (Sweden)

    Chunyan Xie

    Full Text Available Nutrient composition and pattern of food intake may play a significant role in weight gain. The aim of this study was to document the effects of a daily 3-meal pattern with isocaloric diets containing different dietary protein contents on growth performance and different plasma biochemical indexes including amino acid plasma concentration in castrated male pigs. Then, 21 DLY (Duroc×Landrace×Yorkshire pigs aged 60 days were assigned randomly into 3 groups: a control group (crude protein, CP 18.1%, a group receiving high then basal and then low CP meals (High-Low group and a group receiving low then basal and then high CP meal (Low-High group for 40 days with pigs being feed-restricted. On day 40, after 12 h fasting, blood samples were obtained for analysis. The results showed that the insulin/glucagon ratio was lower in the High-Low group (P<0.05 when compared with the control group. Compared with the control group, the average daily gain of pigs from the High-Low group increased by 14.10% (P = 0.046. Compared with the control group, serum gamma-glutamyl transferase (GGT decreased significantly (P<0.05 in both the High-Low and Low-High groups. Plasma concentrations of branched-chain amino acids (BCAA: valine, isoleucine and leucine increased in the Low-High group (P<0.05 when compared with the control group; and plasma methionine and serine decreased in both the two experimental groups (P<0.05. Compared with the High-Low group, all the BCAA increased significantly (P<0.05 in the Low-High group. These findings suggest that the sequence and quantity of alimentary protein intake affect the insulin/glucagon ratio, as well as amino acid concentrations including BCAA, methionine and serine. It is proposed that meal pattern with pigs receiving high then basal and then low CP meals daily may help to improve the weight gain of pigs.

  9. MR imaging of the temporomandibular joint. Part 2. Effect of flip angle on MR imaging with FLASH sequence

    International Nuclear Information System (INIS)

    Sakamoto, Maya; Sasano, Takashi; Higano, Shuichi; Takahashi, Shoki; Kurihara, Noriko

    1998-01-01

    In our previous study on MR imaging of the temporomandibular joint (TMJ), fast low angle shot (FLASH) showed the highest image contrast between disc and surrounding TMJ tissues compared with those of 4 other sequences (i,e., fast imaging with steady precession (FISP), conventional T1-weighted spin echo (SE) and fast spin echo (FSE, TR/TE/ETL: 1100/12/3, 3000/15/7)). Furthermore, FLASH also received a high score on visual evaluation including the position and contour of the disc, and the border between the disc and surrounding tissues. Therefore, we concluded that FLASH was the most suitable sequence for evaluating the TMJ disc. However, the image contrast and signal intensity on MR imaging with gradient echo pulse sequence are affected by flip angle. Consequently, in this report, to find the most suitable flip angle for MR scanning of the TMJ using a FLASH sequence (TR/TE: 450/11), ten TMJs of 5 volunteers were experimentally imaged with various flip angles from 10 degrees to 70 degrees at an interval of 10 degrees between 10 to 70. The image contrast and contrast-to-noise ratio (CNR) between the disc and surrounding tissues were compared. In addition, signal-to-noise ratio (SNR) of phantoms was also calculated using the same imaging parameters. Visual evaluation including position and contour of the disc, and the border between the disc and surrounding tissues, was also performed by 4 radiologists. As the flip angle increased, imaging contrast decreased while SNR increased. Images with flip angles between 30 and 60 degrees demonstrated high CNR. On visual evaluation, images using flip angles between 30 and 50 degrees received high scores. In conclusion, FLASH sequence with a flip angle between 30 and 50 degrees was considered most suitable for evaluating the TMJ disc based on the results of visual assessment and analysis of three major components of image diagnostic quality: image contrast, CNR and SNR. (author)

  10. Application of ion torrent sequencing to the assessment of the effect of alkali ballast water treatment on microbial community diversity.

    Science.gov (United States)

    Fujimoto, Masanori; Moyerbrailean, Gregory A; Noman, Sifat; Gizicki, Jason P; Ram, Michal L; Green, Phyllis A; Ram, Jeffrey L

    2014-01-01

    The impact of NaOH as a ballast water treatment (BWT) on microbial community diversity was assessed using the 16S rRNA gene based Ion Torrent sequencing with its new 400 base chemistry. Ballast water samples from a Great Lakes ship were collected from the intake and discharge of both control and NaOH (pH 12) treated tanks and were analyzed in duplicates. One set of duplicates was treated with the membrane-impermeable DNA cross-linking reagent propidium mono-azide (PMA) prior to PCR amplification to differentiate between live and dead microorganisms. Ion Torrent sequencing generated nearly 580,000 reads for 31 bar-coded samples and revealed alterations of the microbial community structure in ballast water that had been treated with NaOH. Rarefaction analysis of the Ion Torrent sequencing data showed that BWT using NaOH significantly decreased microbial community diversity relative to control discharge (pPCoA) plots and UPGMA tree analysis revealed that NaOH-treated ballast water microbial communities differed from both intake communities and control discharge communities. After NaOH treatment, bacteria from the genus Alishewanella became dominant in the NaOH-treated samples, accounting for microbial community structure between PMA-processed and non-PMA samples occurred in intake water samples, which exhibited a significantly higher amount of PMA-sensitive cyanobacteria/chloroplast 16S rRNA than their corresponding non-PMA total DNA samples. The community assembly obtained using Ion Torrent sequencing was comparable to that obtained from a subset of samples that were also subjected to 454 pyrosequencing. This study showed the efficacy of alkali ballast water treatment in reducing ballast water microbial diversity and demonstrated the application of new Ion Torrent sequencing techniques to microbial community studies.

  11. Quantum-Sequencing: Fast electronic single DNA molecule sequencing

    Science.gov (United States)

    Casamada Ribot, Josep; Chatterjee, Anushree; Nagpal, Prashant

    2014-03-01

    A major goal of third-generation sequencing technologies is to develop a fast, reliable, enzyme-free, high-throughput and cost-effective, single-molecule sequencing method. Here, we present the first demonstration of unique ``electronic fingerprint'' of all nucleotides (A, G, T, C), with single-molecule DNA sequencing, using Quantum-tunneling Sequencing (Q-Seq) at room temperature. We show that the electronic state of the nucleobases shift depending on the pH, with most distinct states identified at acidic pH. We also demonstrate identification of single nucleotide modifications (methylation here). Using these unique electronic fingerprints (or tunneling data), we report a partial sequence of beta lactamase (bla) gene, which encodes resistance to beta-lactam antibiotics, with over 95% success rate. These results highlight the potential of Q-Seq as a robust technique for next-generation sequencing.

  12. Draft genome sequence of Bradyrhizobium manausense strain BR 3351T, an effective symbiont isolated from Amazon rainforest.

    Science.gov (United States)

    Simões-Araújo, Jean Luiz; Rumjanek, Norma Gouvêa; Xavier, Gustavo Ribeiro; Zilli, Jerri Édson

    The strain BR 3351 T (Bradyrhizobium manausense) was obtained from nodules of cowpea (Vigna unguiculata L. Walp) growing in soil collected from Amazon rainforest. Furthermore, it was observed that the strain has high capacity to fix nitrogen symbiotically in symbioses with cowpea. We report here the draft genome sequence of strain BR 3351 T . The information presented will be important for comparative analysis of nodulation and nitrogen fixation for diazotrophic bacteria. A draft genome with 9,145,311bp and 62.9% of GC content was assembled in 127 scaffolds using 100bp pair-end Illumina MiSeq system. The RAST annotation identified 8603 coding sequences, 51 RNAs genes, classified in 504 subsystems. Published by Elsevier Editora Ltda.

  13. Effect of mixing sequence on the curing of amine-hardened epoxy/ alumina nanocomposites as assessed by optical refractometry

    Directory of Open Access Journals (Sweden)

    2008-08-01

    Full Text Available High performance refractometry has been proven to be a useful tool to elucidate the isothermal curing process of nanocomposites. As a model system an amine-hardening epoxy filled with non-surface-treated alumina nanoparticles was selected. The tremendous resolution of this experimental technique is used to study morphological changes within nanocomposites via the refractive index. It is shown that these morphological changes are not simply due to the curing process but also depend on the sequence of mixing the nanoparticles either first into the resin or first into the hardener. Independent of the resin/hardener composition, the type of the mixing sequence discriminates systematically between two distinct refractive index curves produced by the curing process. The difference between the two refractive index curves increases monotonically with curing time, which underlines the importance of the initial molecular environment of the nanoparticles.

  14. Effect of thermal-treatment sequence on sound absorbing and mechanical properties of porous sound-absorbing/thermal-insulating composites

    Directory of Open Access Journals (Sweden)

    Huang Chen-Hung

    2016-01-01

    Full Text Available Due to recent rapid commercial and industrial development, mechanical equipment is supplemented massively in the factory and thus mechanical operation causes noise which distresses living at home. In livelihood, neighborhood, transportation equipment, jobsite construction noises impact on quality of life not only factory noise. This study aims to preparation technique and property evaluation of porous sound-absorbing/thermal-insulating composites. Hollow three-dimensional crimp PET fibers blended with low-melting PET fibers were fabricated into hollow PET/low-melting PET nonwoven after opening, blending, carding, lapping and needle-bonding process. Then, hollow PET/low-melting PET nonwovens were laminated into sound-absorbing/thermal-insulating composites by changing sequence of needle-bonding and thermal-treatment. The optimal thermal-treated sequence was found by tensile strength, tearing strength, sound-absorbing coefficient and thermal conductivity coefficient tests of porous composites.

  15. Draft genome sequence of Bradyrhizobium manausense strain BR 3351T, an effective symbiont isolated from Amazon rainforest

    Directory of Open Access Journals (Sweden)

    Jean Luiz Simões-Araújo

    Full Text Available ABSTRACT The strain BR 3351T (Bradyrhizobium manausense was obtained from nodules of cowpea (Vigna unguiculata L. Walp growing in soil collected from Amazon rainforest. Furthermore, it was observed that the strain has high capacity to fix nitrogen symbiotically in symbioses with cowpea. We report here the draft genome sequence of strain BR 3351T. The information presented will be important for comparative analysis of nodulation and nitrogen fixation for diazotrophic bacteria. A draft genome with 9,145,311 bp and 62.9% of GC content was assembled in 127 scaffolds using 100 bp pair-end Illumina MiSeq system. The RAST annotation identified 8603 coding sequences, 51 RNAs genes, classified in 504 subsystems.

  16. Effectiveness of the STIR turbo spin–echo sequence MR imaging in evaluation of lymphadenopathy in esophageal cancer

    International Nuclear Information System (INIS)

    Alper, Fatih; Turkyilmaz, Atila; Kurtcan, Serpil; Aydin, Yener; Onbas, Omer; Acemoglu, Hamit; Eroglu, Atilla

    2011-01-01

    Purpose: We have investigated the utility of the STIR TSE sequence in the differentiation of benign from malignant mediastinal lymph nodes in patients with esophageal cancer. Patients and methods: This study included 35 consecutive patients who were diagnosed as esophageal cancer and were undergone surgery. STIR TSE sequences were obtained as the ECG trigger. The signal intensity of the benign and malign lymph nodes, normal esophagus, and pathologic esophagus can be calculated on STIR sequence. Results: Pathologically, the number of total lymph nodes in 35 operated cases was 482. Approximately 152 lymph nodes were detected with MR imaging. Of these, 28 were thought to be malignant, and 124 were thought to be benign, although 32 were malignant and 120 were benign according pathological results. The ratio of benign lymph node intensity value to normal esophagus intensity value was 0.73 ± 0.3. The ratio of malignant lymph node intensity value to normal esophagus intensity value ratio was 2.03 ± 0.4. According to these results, the sensitivity of MR was 81.3%, the specificity was 98.3%. Conclusion: We think that if motionless images can be obtained with MRI, we may be able to differentiate benign lymph nodes from malignant ones.

  17. Investigation of the Effect of Finite Pulse Errors on BABA Pulse Sequence Using Floquet-Magnus Expansion Approach.

    Science.gov (United States)

    Mananga, Eugene S; Reid, Alicia E

    This paper presents the study of finite pulse widths for the BABA pulse sequence using the Floquet-Magnus expansion (FME) approach. In the FME scheme, the first order F 1 is identical to its counterparts in average Hamiltonian theory (AHT) and Floquet theory (FT). However, the timing part in the FME approach is introduced via the Λ 1 ( t ) function not present in other schemes. This function provides an easy way for evaluating the spin evolution during "the time in between" through the Magnus expansion of the operator connected to the timing part of the evolution. The evaluation of Λ 1 ( t ) is useful especially for the analysis of the non-stroboscopic evolution. Here, the importance of the boundary conditions, which provides a natural choice of Λ 1 (0) is ignored. This work uses the Λ 1 ( t ) function to compare the efficiency of the BABA pulse sequence with δ - pulses and the BABA pulse sequence with finite pulses. Calculations of Λ 1 ( t ) and F 1 are presented.

  18. Application of ion torrent sequencing to the assessment of the effect of alkali ballast water treatment on microbial community diversity.

    Directory of Open Access Journals (Sweden)

    Masanori Fujimoto

    Full Text Available The impact of NaOH as a ballast water treatment (BWT on microbial community diversity was assessed using the 16S rRNA gene based Ion Torrent sequencing with its new 400 base chemistry. Ballast water samples from a Great Lakes ship were collected from the intake and discharge of both control and NaOH (pH 12 treated tanks and were analyzed in duplicates. One set of duplicates was treated with the membrane-impermeable DNA cross-linking reagent propidium mono-azide (PMA prior to PCR amplification to differentiate between live and dead microorganisms. Ion Torrent sequencing generated nearly 580,000 reads for 31 bar-coded samples and revealed alterations of the microbial community structure in ballast water that had been treated with NaOH. Rarefaction analysis of the Ion Torrent sequencing data showed that BWT using NaOH significantly decreased microbial community diversity relative to control discharge (p<0.001. UniFrac distance based principal coordinate analysis (PCoA plots and UPGMA tree analysis revealed that NaOH-treated ballast water microbial communities differed from both intake communities and control discharge communities. After NaOH treatment, bacteria from the genus Alishewanella became dominant in the NaOH-treated samples, accounting for <0.5% of the total reads in intake samples but more than 50% of the reads in the treated discharge samples. The only apparent difference in microbial community structure between PMA-processed and non-PMA samples occurred in intake water samples, which exhibited a significantly higher amount of PMA-sensitive cyanobacteria/chloroplast 16S rRNA than their corresponding non-PMA total DNA samples. The community assembly obtained using Ion Torrent sequencing was comparable to that obtained from a subset of samples that were also subjected to 454 pyrosequencing. This study showed the efficacy of alkali ballast water treatment in reducing ballast water microbial diversity and demonstrated the application of new

  19. Deep Illumina-based shotgun sequencing reveals dietary effects on the structure and function of the fecal microbiome of growing kittens.

    Directory of Open Access Journals (Sweden)

    Oliver Deusch

    Full Text Available Previously, we demonstrated that dietary protein:carbohydrate ratio dramatically affects the fecal microbial taxonomic structure of kittens using targeted 16S gene sequencing. The present study, using the same fecal samples, applied deep Illumina shotgun sequencing to identify the diet-associated functional potential and analyze taxonomic changes of the feline fecal microbiome.Fecal samples from kittens fed one of two diets differing in protein and carbohydrate content (high-protein, low-carbohydrate, HPLC; and moderate-protein, moderate-carbohydrate, MPMC were collected at 8, 12 and 16 weeks of age (n = 6 per group. A total of 345.3 gigabases of sequence were generated from 36 samples, with 99.75% of annotated sequences identified as bacterial. At the genus level, 26% and 39% of reads were annotated for HPLC- and MPMC-fed kittens, with HPLC-fed cats showing greater species richness and microbial diversity. Two phyla, ten families and fifteen genera were responsible for more than 80% of the sequences at each taxonomic level for both diet groups, consistent with the previous taxonomic study. Significantly different abundances between diet groups were observed for 324 genera (56% of all genera identified demonstrating widespread diet-induced changes in microbial taxonomic structure. Diversity was not affected over time. Functional analysis identified 2,013 putative enzyme function groups were different (p<0.000007 between the two dietary groups and were associated to 194 pathways, which formed five discrete clusters based on average relative abundance. Of those, ten contained more (p<0.022 enzyme functions with significant diet effects than expected by chance. Six pathways were related to amino acid biosynthesis and metabolism linking changes in dietary protein with functional differences of the gut microbiome.These data indicate that feline feces-derived microbiomes have large structural and functional differences relating to the dietary

  20. Derivation of Reliable Geometries in QM Calculations of DNA Structures: Explicit Solvent QM/MM and Restrained Implicit Solvent QM Optimizations of G-Quadruplexes.

    Science.gov (United States)

    Gkionis, Konstantinos; Kruse, Holger; Šponer, Jiří

    2016-04-12

    Modern dispersion-corrected DFT methods have made it possible to perform reliable QM studies on complete nucleic acid (NA) building blocks having hundreds of atoms. Such calculations, although still limited to investigations of potential energy surfaces, enhance the portfolio of computational methods applicable to NAs and offer considerably more accurate intrinsic descriptions of NAs than standard MM. However, in practice such calculations are hampered by the use of implicit solvent environments and truncation of the systems. Conventional QM optimizations are spoiled by spurious intramolecular interactions and severe structural deformations. Here we compare two approaches designed to suppress such artifacts: partially restrained continuum solvent QM and explicit solvent QM/MM optimizations. We report geometry relaxations of a set of diverse double-quartet guanine quadruplex (GQ) DNA stems. Both methods provide neat structures without major artifacts. However, each one also has distinct weaknesses. In restrained optimizations, all errors in the target geometries (i.e., low-resolution X-ray and NMR structures) are transferred to the optimized geometries. In QM/MM, the initial solvent configuration causes some heterogeneity in the geometries. Nevertheless, both approaches represent a decisive step forward compared to conventional optimizations. We refine earlier computations that revealed sizable differences in the relative energies of GQ stems computed with AMBER MM and QM. We also explore the dependence of the QM/MM results on the applied computational protocol.

  1. The estimation of H-bond and metal ion-ligand interaction energies in the G-Quadruplex ⋯ Mn+ complexes

    Science.gov (United States)

    Mostafavi, Najmeh; Ebrahimi, Ali

    2018-06-01

    In order to characterize various interactions in the G-quadruplex ⋯ Mn+ (G-Q ⋯ Mn+) complexes, the individual H-bond (EHB) and metal ion-ligand interaction (EMO) energies have been estimated using the electron charge densities (ρs) calculated at the X ⋯ H (X = N and O) and Mn+ ⋯ O (Mn+ is an alkaline, alkaline earth and transition metal ion) bond critical points (BCPs) obtained from the atoms in molecules (AIM) analysis. The estimated values of EMO and EHB were evaluated using the structural parameters, results of natural bond orbital analysis (NBO), aromaticity indexes and atomic charges. The EMO value increase with the ratio of ionic charge to radius, e/r, where a linear correlation is observed between EMO and e/r (R = 0.97). Meaningful relationships are also observed between EMO and indexes used for aromaticity estimation. The ENH value is higher than EOH in the complexes; this is in complete agreement with the trend of N⋯Hsbnd N and O⋯Hsbnd N angles, the E (2) value of nN → σ*NH and nO → σ*NH interactions and the difference between the natural charges on the H-bonded atom and the hydrogen atom of guanine (Δq). In general, the O1MO2 angle becomes closer to 109.5° with the increase in EMO and decrease in EHB in the presence of metal ion.

  2. Molecular recognition of naphthalene diimide ligands by telomeric quadruplex-DNA: the importance of the protonation state and mediated hydrogen bonds.

    Science.gov (United States)

    Spinello, A; Barone, G; Grunenberg, J

    2016-01-28

    In depth Monte Carlo conformational scans in combination with molecular dynamics (MD) simulations and electronic structure calculations were applied in order to study the molecular recognition process between tetrasubstituted naphthalene diimide (ND) guests and G-quadruplex (G4) DNA receptors. ND guests are a promising class of telomere stabilizers due to which they are used in novel anticancer therapeutics. Though several ND guests have been studied experimentally in the past, the protonation state under physiological conditions is still unclear. Based on chemical intuition, in the case of N-methyl-piperazine substitution, different protonation states are possible and might play a crucial role in the molecular recognition process by G4-DNA. Depending on the proton concentration, different nitrogen atoms of the N-methyl-piperazine might (or might not) be protonated. This fact was considered in our simulation in terms of a case by case analysis, since the process of molecular recognition is determined by possible donor or acceptor positions. The results of our simulations show that the electrostatic interactions between the ND ligands and the G4 receptor are maximized in the case of the protonation of the terminal nitrogen atoms, forming compact ND G4 complexes inside the grooves. The influence of different protonation states in terms of the ability to form hydrogen bonds with the sugar-phosphate backbone, as well as the importance of mediated vs. direct hydrogen bonding, was analyzed in detail by MD and relaxed force constant (compliance constant) simulations.

  3. Salt-bridging effects on short amphiphilic helical structure and introducing sequence-based short beta-turn motifs.

    Science.gov (United States)

    Guarracino, Danielle A; Gentile, Kayla; Grossman, Alec; Li, Evan; Refai, Nader; Mohnot, Joy; King, Daniel

    2018-02-01

    Determining the minimal sequence necessary to induce protein folding is beneficial in understanding the role of protein-protein interactions in biological systems, as their three-dimensional structures often dictate their activity. Proteins are generally comprised of discrete secondary structures, from α-helices to β-turns and larger β-sheets, each of which is influenced by its primary structure. Manipulating the sequence of short, moderately helical peptides can help elucidate the influences on folding. We created two new scaffolds based on a modestly helical eight-residue peptide, PT3, we previously published. Using circular dichroism (CD) spectroscopy and changing the possible salt-bridging residues to new combinations of Lys, Arg, Glu, and Asp, we found that our most helical improvements came from the Arg-Glu combination, whereas the Lys-Asp was not significantly different from the Lys-Glu of the parent scaffold, PT3. The marked 3 10 -helical contributions in PT3 were lessened in the Arg-Glu-containing peptide with the beginning of cooperative unfolding seen through a thermal denaturation. However, a unique and unexpected signature was seen for the denaturation of the Lys-Asp peptide which could help elucidate the stages of folding between the 3 10 and α-helix. In addition, we developed a short six-residue peptide with β-turn/sheet CD signature, again to help study minimal sequences needed for folding. Overall, the results indicate that improvements made to short peptide scaffolds by fine-tuning the salt-bridging residues can enhance scaffold structure. Likewise, with the results from the new, short β-turn motif, these can help impact future peptidomimetic designs in creating biologically useful, short, structured β-sheet-forming peptides.

  4. A cost-effectiveness analysis of first-line induction and maintenance treatment sequences in patients with advanced nonsquamous non-small-cell lung cancer in France

    Directory of Open Access Journals (Sweden)

    Taipale K

    2017-08-01

    Full Text Available Kaisa Taipale,1 Katherine B Winfree,2 Mark Boye,2 Mickael Basson,3 Ghassan Sleilaty,4 James Eaton,5 Rachel Evans,5 Christos Chouaid6 1Global Patient Outcomes and Real World Evidence International, Oy Eli Lilly Finland AB, Helsinki, Finland; 2Global Patient Outcomes and Real World Evidence, Eli Lilly and Company, Indianapolis, IN, USA; 3Corporate Affairs, Lilly France, Neuilly-sur-Seine, 4Bio-Medicines Medical Affairs, Lilly France, Neuilly-sur-Seine, France; 5ICON Health Economics and Epidemiology, ICON Plc, Milton Park, UK; 6Thoracic Oncology, Service de Pneumologie, Centre Hospitalier Intercommunal Créteil, Créteil, France Background: Comparative effectiveness and cost-effectiveness data for induction–maintenance (I–M sequences for the treatment of patients with nonsquamous non-small-cell lung cancer (nsqNSCLC are limited because of a lack of direct evidence. This analysis aimed to compare the cost-effectiveness of I–M pemetrexed with those of other I–M regimens used for the treatment of patients with advanced nsqNSCLC in the French health-care setting. Materials and methods: A previously developed global partitioned survival model was adapted to the France-only setting by restricting treatment sequences to include 12 I–M regimens most relevant to France, and incorporating French costs and resource-use data. Following a systematic literature review, network meta-analyses were performed to obtain hazard ratios for progression-free survival (PFS and overall survival (OS relative to gemcitabine + cisplatin (induction sequences or best supportive care (BSC (maintenance sequences. Modeled health-care benefits were expressed as life-years (LYs and quality-adjusted LYs (QALYs (estimated using French EuroQol five-dimension questionnaire tariffs. The study was conducted from the payer perspective (National Health Insurance. Cost- and benefit-model inputs were discounted at an annual rate of 4%. Results: Base-case results showed pemetrexed

  5. Finite-size effects in transcript sequencing count distribution: its power-law correction necessarily precedes downstream normalization and comparative analysis.

    Science.gov (United States)

    Wong, Wing-Cheong; Ng, Hong-Kiat; Tantoso, Erwin; Soong, Richie; Eisenhaber, Frank

    2018-02-12

    Though earlier works on modelling transcript abundance from vertebrates to lower eukaroytes have specifically singled out the Zip's law, the observed distributions often deviate from a single power-law slope. In hindsight, while power-laws of critical phenomena are derived asymptotically under the conditions of infinite observations, real world observations are finite where the finite-size effects will set in to force a power-law distribution into an exponential decay and consequently, manifests as a curvature (i.e., varying exponent values) in a log-log plot. If transcript abundance is truly power-law distributed, the varying exponent signifies changing mathematical moments (e.g., mean, variance) and creates heteroskedasticity which compromises statistical rigor in analysis. The impact of this deviation from the asymptotic power-law on sequencing count data has never truly been examined and quantified. The anecdotal description of transcript abundance being almost Zipf's law-like distributed can be conceptualized as the imperfect mathematical rendition of the Pareto power-law distribution when subjected to the finite-size effects in the real world; This is regardless of the advancement in sequencing technology since sampling is finite in practice. Our conceptualization agrees well with our empirical analysis of two modern day NGS (Next-generation sequencing) datasets: an in-house generated dilution miRNA study of two gastric cancer cell lines (NUGC3 and AGS) and a publicly available spike-in miRNA data; Firstly, the finite-size effects causes the deviations of sequencing count data from Zipf's law and issues of reproducibility in sequencing experiments. Secondly, it manifests as heteroskedasticity among experimental replicates to bring about statistical woes. Surprisingly, a straightforward power-law correction that restores the distribution distortion to a single exponent value can dramatically reduce data heteroskedasticity to invoke an instant increase in

  6. Is sequence awareness mandatory for perceptual sequence learning: An assessment using a pure perceptual sequence learning design.

    Science.gov (United States)

    Deroost, Natacha; Coomans, Daphné

    2018-02-01

    We examined the role of sequence awareness in a pure perceptual sequence learning design. Participants had to react to the target's colour that changed according to a perceptual sequence. By varying the mapping of the target's colour onto the response keys, motor responses changed randomly. The effect of sequence awareness on perceptual sequence learning was determined by manipulating the learning instructions (explicit versus implicit) and assessing the amount of sequence awareness after the experiment. In the explicit instruction condition (n = 15), participants were instructed to intentionally search for the colour sequence, whereas in the implicit instruction condition (n = 15), they were left uninformed about the sequenced nature of the task. Sequence awareness after the sequence learning task was tested by means of a questionnaire and the process-dissociation-procedure. The results showed that the instruction manipulation had no effect on the amount of perceptual sequence learning. Based on their report to have actively applied their sequence knowledge during the experiment, participants were subsequently regrouped in a sequence strategy group (n = 14, of which 4 participants from the implicit instruction condition and 10 participants from the explicit instruction condition) and a no-sequence strategy group (n = 16, of which 11 participants from the implicit instruction condition and 5 participants from the explicit instruction condition). Only participants of the sequence strategy group showed reliable perceptual sequence learning and sequence awareness. These results indicate that perceptual sequence learning depends upon the continuous employment of strategic cognitive control processes on sequence knowledge. Sequence awareness is suggested to be a necessary but not sufficient condition for perceptual learning to take place. Copyright © 2018 Elsevier B.V. All rights reserved.

  7. Small RNA Deep Sequencing and the Effects of microRNA408 on Root Gravitropic Bending in Arabidopsis

    Science.gov (United States)

    Li, Huasheng; Lu, Jinying; Sun, Qiao; Chen, Yu; He, Dacheng; Liu, Min

    2015-11-01

    MicroRNA (miRNA) is a non-coding small RNA composed of 20 to 24 nucleotides that influences plant root development. This study analyzed the miRNA expression in Arabidopsis root tip cells using Illumina sequencing and real-time PCR before (sample 0) and 15 min after (sample 15) a 3-D clinostat rotational treatment was administered. After stimulation was performed, the expression levels of seven miRNA genes, including Arabidopsis miR160, miR161, miR394, miR402, miR403, miR408, and miR823, were significantly upregulated. Illumina sequencing results also revealed two novel miRNAsthat have not been previously reported, The target genes of these miRNAs included pentatricopeptide repeat-containing protein and diadenosine tetraphosphate hydrolase. An overexpression vector of Arabidopsis miR408 was constructed and transferred to Arabidopsis plant. The roots of plants over expressing miR408 exhibited a slower reorientation upon gravistimulation in comparison with those of wild-type. This result indicate that miR408 could play a role in root gravitropic response.

  8. Shotgun protein sequencing.

    Energy Technology Data Exchange (ETDEWEB)

    Faulon, Jean-Loup Michel; Heffelfinger, Grant S.

    2009-06-01

    A novel experimental and computational technique based on multiple enzymatic digestion of a protein or protein mixture that reconstructs protein sequences from sequences of overlapping peptides is described in this SAND report. This approach, analogous to shotgun sequencing of DNA, is to be used to sequence alternative spliced proteins, to identify post-translational modifications, and to sequence genetically engineered proteins.

  9. Effect of local versus remote tonic heat pain during training on acquisition and retention of a finger-tapping sequence task.

    Science.gov (United States)

    Bilodeau, Marie-Claude; Roosink, Meyke; Mercier, Catherine

    2016-02-01

    Although pain is present in a large proportion of patients receiving rehabilitation, its impact on motor learning is still unclear, especially in the case of neuropathic pain that is not tightly linked to specific movements. The aim of this study was to determine the effect of local and remote tonic cutaneous heat pain applied during training on motor learning of a finger-tapping sequence task. Forty-five healthy participants, randomized to the control, local pain or remote pain groups, were trained to perform an explicit finger motor sequence of five items as fast as possible. During the 10 training blocks (30 s each), local pain and remote pain groups received a heat pain stimulus on the wrist or leg, respectively. Performance was tested in the absence of pain in all groups before (baseline), immediately after (post-immediate), 60 min after (post-60 min) and 24 h after training (post-24 h) to assess both acquisition and next-day retention. Speed increased over time from baseline to post-24 h (p pain during training. No changes were observed on error rates, which were very low even at baseline. These results with experimental heat pain suggest that the ability to relearn finger sequence should not be affected by concomitant neuropathic pain in neurorehabilitation. However, these results need to be validated in the context of chronic pain, by including pain as a co-variable in motor rehabilitation trials.

  10. Overview of the creative genome: effects of genome structure and sequence on the generation of variation and evolution.

    Science.gov (United States)

    Caporale, Lynn Helena

    2012-09-01

    This overview of a special issue of Annals of the New York Academy of Sciences discusses uneven distribution of distinct types of variation across the genome, the dependence of specific types of variation upon distinct classes of DNA sequences and/or the induction of specific proteins, the circumstances in which distinct variation-generating systems are activated, and the implications of this work for our understanding of evolution and of cancer. Also discussed is the value of non text-based computational methods for analyzing information carried by DNA, early insights into organizational frameworks that affect genome behavior, and implications of this work for comparative genomics. © 2012 New York Academy of Sciences.

  11. The effect of the number of condensed phases modeled on aerosol behavior during an induced steam generator tube rupture sequence

    International Nuclear Information System (INIS)

    Bixler, N.E.; Schaperow, J.H.

    1998-06-01

    VICTORIA is a mechanistic computer code designed to analyze fission product behavior within a nuclear reactor coolant system (RCS) during a severe accident. It provides detailed predictions of the release of radioactive and nonradioactive materials from the reactor core and transport and deposition of these materials within the RCS. A recently completed independent peer review of VICTORIA, while confirming the overall adequacy of the code, recommended a number of modeling improvements. One of these recommendations, to model three rather than a single condensed phase, is the focus of the work reported here. The recommendation has been implemented as an option so that either a single or three condensed phases can be treated. Both options have been employed in the study of fission product behavior during an induced steam generator tube rupture sequence. Differences in deposition patterns and mechanisms predicted using these two options are discussed

  12. Investigation of the effects of process sequence on the contact resistance characteristics of coated metallic bipolar plates for polymer electrolyte membrane fuel cells

    Science.gov (United States)

    Turan, Cabir; Cora, Ömer Necati; Koç, Muammer

    2013-12-01

    In this study, results of an investigation on the effects of manufacturing and coating process sequence on the contact resistance (ICR) of metallic bipolar plates (BPP) for polymer electrolyte membrane fuel cells (PEMFCs) are presented. Firstly, uncoated stainless steel 316L blanks were formed into BPP through hydroforming and stamping processes. Then, these formed BPP samples were coated with three different PVD coatings (CrN, TiN and ZrN) at three different thicknesses (0.1, 0.5 and 1 μm). Secondly, blanks of the same alloy were coated first with the same coatings, thickness and technique; then, they were formed into BPPs of the same shape and dimensions using the manufacturing methods as in the first group. Finally, these two groups of BPP samples were tested for their ICR to reveal the effect of process sequence. ICR tests were also conducted on the BPP plates both before and after exposure to corrosion to disclose the effect of corrosion on ICR. Coated-then-formed BPP samples exhibited similar or even better ICR performance than formed-then-coated BPP samples. Thus, manufacturing of coated blanks can be concluded to be more favorable and worth further investigation in quest of making cost effective BPPs for mass production of PEMFC.

  13. The Effect of Initial Inoculum Source on the Microbial Community Structure and Dynamics in Laboratory-Scale Sequencing Batch Reactors

    KAUST Repository

    Hernandez, Susana

    2011-07-01

    Understanding the factors that shapes the microbial community assembly in activated sludge wastewater treatment processes provide a conceptual foundation for improving process performance. The aim of this study was to compare two major theories (deterministic theory and neutral theory) regarding the assembly of microorganisms in activated sludge: Six lab-scale activated sludge sequencing batch reactors were inoculated with activated sludge collected from three different sources (domestic, industrial, and sugar industry WWTP). Additionally, two reactors were seeded with equal proportion of sludge from the three WWTPs. Duplicate reactors were used for each sludge source (i.e. domestic, industrial, sugar and mix). Reactors were operated in parallel for 11 weeks under identical conditions. Bacterial diversity and community structure in the eight SBRs were assessed by 16S rRNA gene pyrosequencing. The 16S rRNA gene sequences were analyzed using taxonomic and clustering analysis and by measuring diversity indices (Shannon-weaver and Chao1 indices). Cluster analysis revealed that the microbial community structure was dynamic and that replicate reactors evolved differently. Also the microbial community structure in the SBRs seeded with a different sludge did not converge after 11 weeks of operation under identical conditions. These results suggest that history and distribution of taxa in the source inoculum were stronger regulating factors in shaping bacterial community structure than environmental factors. This supports the neutral theory which states that the assembly of the local microbial community from the metacommunity is random and is regulated by the size and diversity of the metacommunity. Furthermore, sludge performance, measured by COD and ammonia removal, confirmed that broad-scale functions (e.g. COD removal) are not influenced by dynamics in the microbial composition, while specific functions (e.g. nitrification) are more susceptible to these changes.

  14. Geochemical features and effects on deep-seated fluids during the May-June 2012 southern Po Valley seismic sequence

    Directory of Open Access Journals (Sweden)

    Francesco Italiano

    2012-10-01

    Full Text Available A periodic sampling of the groundwaters and dissolved and free gases in selected deep wells located in the area affected by the May-June 2012 southern Po Valley seismic sequence has provided insight into seismogenic-induced changes of the local aquifer systems. The results obtained show progressive changes in the fluid geochemistry, allowing it to be established that deep-seated fluids were mobilized during the seismic sequence and reached surface layers along faults and fractures, which generated significant geochemical anomalies. The May-June 2012 seismic swarm (mainshock on May 29, 2012, M 5.8; 7 shocks M >5, about 200 events 3 > M > 5 induced several modifications in the circulating fluids. This study reports the preliminary results obtained for the geochemical features of the waters and gases collected over the epicentral area from boreholes drilled at different depths, thus intercepting water and gases with different origins and circulation. The aim of the investigations was to improve our knowledge of the fluids circulating over the seismic area (e.g. origin, provenance, interactions, mixing of different components, temporal changes. This was achieved by collecting samples from both shallow and deep-drilled boreholes, and then, after the selection of the relevant sites, we looked for temporal changes with mid-to-long-term monitoring activity following a constant sampling rate. This allowed us to gain better insight into the relationships between the fluid circulation and the faulting activity. The sampling sites are listed in Table 1, along with the analytical results of the gas phase. […

  15. Multimodal sequence learning.

    Science.gov (United States)

    Kemény, Ferenc; Meier, Beat

    2016-02-01

    While sequence learning research models complex phenomena, previous studies have mostly focused on unimodal sequences. The goal of the current experiment is to put implicit sequence learning into a multimodal context: to test whether it can operate across different modalities. We used the Task Sequence Learning paradigm to test whether sequence learning varies across modalities, and whether participants are able to learn multimodal sequences. Our results show that implicit sequence learning is very similar regardless of the source modality. However, the presence of correlated task and response sequences was required for learning to take place. The experiment provides new evidence for implicit sequence learning of abstract conceptual representations. In general, the results suggest that correlated sequences are necessary for implicit sequence learning to occur. Moreover, they show that elements from different modalities can be automatically integrated into one unitary multimodal sequence. Copyright © 2015 Elsevier B.V. All rights reserved.

  16. Sequence Read Archive (SRA)

    Data.gov (United States)

    U.S. Department of Health & Human Services — The Sequence Read Archive (SRA) stores raw sequencing data from the next generation of sequencing platforms including Roche 454 GS System®, Illumina Genome...

  17. Comparative effectiveness of eight antiepileptic drugs in adults with focal refractory epilepsy: the influence of age, gender, and the sequence in which drugs were introduced onto the market.

    Science.gov (United States)

    Mäkinen, Jussi; Peltola, Jukka; Raitanen, Jani; Alapirtti, Tiina; Rainesalo, Sirpa

    2017-07-01

    The first objective was to determine the long-term retention rate of eight antiepileptic drugs (AEDs) commonly used as adjunctive therapy in adults with focal refractory epilepsy. Second, we assessed the effects of age and gender on retention rates. Third, we examined if the retention rate could be influenced by the sequence in which the AEDs had entered the market. Patients with focal refractory epilepsy treated with any of the eight AEDs in Tampere University Hospital were identified retrospectively (N = 507). Retention rates were evaluated with the Kaplan-Meier method. Follow-up started at the first date of treatment and each individual was followed a maximum of 36 months. We calculated the following 3-year retention rates: lacosamide 77.1% (N = 137), lamotrigine 68.3% (N = 177), levetiracetam 66.7% (N = 319), clobazam 65.6% (N = 130), topiramate 61.6% (N = 178), zonisamide 60.4% (N = 103), pregabalin 54.6% (N = 127), and gabapentin 40.2% (N = 66). Lacosamide, levetiracetam, and clobazam were the most effective AEDs in the elderly. The retention rate for pregabalin was higher in males (65%) than females (51%) whereas females had higher retention rates for both topiramate (72 vs. 58%) and zonisamide (67 vs. 57%). The retention rate was influenced by the sequence in which these AEDs entered the market. We provide important information about practical aspects of these eight AEDs, revealing that there are differences in their effectiveness as adjunctive treatment for focal refractory epilepsy. Most importantly, the retention rate appears to be influenced by the sequence in which these AEDs were introduced onto the market.

  18. G4-DNA formation in the HRAS promoter and rational design of decoy oligonucleotides for cancer therapy.

    Directory of Open Access Journals (Sweden)

    Alexandro Membrino

    Full Text Available HRAS is a proto-oncogene involved in the tumorigenesis of urinary bladder cancer. In the HRAS promoter we identified two G-rich elements, hras-1 and hras-2, that fold, respectively, into an antiparallel and a parallel quadruplex (qhras-1, qhras-2. When we introduced in sequence hras-1 or hras-2 two point mutations that block quadruplex formation, transcription increased 5-fold, but when we stabilized the G-quadruplexes by guanidinium phthalocyanines, transcription decreased to 20% of control. By ChIP we found that sequence hras-1 is bound only by MAZ, while hras-2 is bound by MAZ and Sp1: two transcription factors recognizing guanine boxes. We also discovered by EMSA that recombinant MAZ-GST binds to both HRAS quadruplexes, while Sp1-GST only binds to qhras-1. The over-expression of MAZ and Sp1 synergistically activates HRAS transcription, while silencing each gene by RNAi results in a strong down-regulation of transcription. All these data indicate that the HRAS G-quadruplexes behave as transcription repressors. Finally, we designed decoy oligonucleotides mimicking the HRAS quadruplexes, bearing (R-1-O-[4-(1-Pyrenylethynyl phenylmethyl] glycerol and LNA modifications to increase their stability and nuclease resistance (G4-decoys. The G4-decoys repressed HRAS transcription and caused a strong antiproliferative effect, mediated by apoptosis, in T24 bladder cancer cells where HRAS is mutated.

  19. Phylogenetic analyses of Vitis (Vitaceae) based on complete chloroplast genome sequences: effects of taxon sampling and phylogenetic methods on resolving relationships among rosids.

    Science.gov (United States)

    Jansen, Robert K; Kaittanis, Charalambos; Saski, Christopher; Lee, Seung-Bum; Tomkins, Jeffrey; Alverson, Andrew J; Daniell, Henry

    2006-04-09

    The Vitaceae (grape) is an economically important family of angiosperms whose phylogenetic placement is currently unresolved. Recent phylogenetic analyses based on one to several genes have suggested several alternative placements of this family, including sister to Caryophyllales, asterids, Saxifragales, Dilleniaceae or to rest of rosids, though support for these different results has been weak. There has been a recent interest in using complete chloroplast genome sequences for resolving phylogenetic relationships among angiosperms. These studies have clarified relationships among several major lineages but they have also emphasized the importance of taxon sampling and the effects of different phylogenetic methods for obtaining accurate phylogenies. We sequenced the complete chloroplast genome of Vitis vinifera and used these data to assess relationships among 27 angiosperms, including nine taxa of rosids. The Vitis vinifera chloroplast genome is 160,928 bp in length, including a pair of inverted repeats of 26,358 bp that are separated by small and large single copy regions of 19,065 bp and 89,147 bp, respectively. The gene content and order of Vitis is identical to many other unrearranged angiosperm chloroplast genomes, including tobacco. Phylogenetic analyses using