WorldWideScience

Sample records for putative intronic mirna

  1. Putative miRNAs for the diagnosis of dyslexia, dyspraxia, and specific language impairment.

    Science.gov (United States)

    Rudov, Alexander; Rocchi, Marco Bruno Luigi; Accorsi, Augusto; Spada, Giorgio; Procopio, Antonio Domenico; Olivieri, Fabiola; Rippo, Maria Rita; Albertini, Maria Cristina

    2013-10-01

    Disorders of human communication abilities can be classified into speech and language disorders. Speech disorders (e.g., dyspraxia) affect the sound generation and sequencing, while language disorders (e.g., dyslexia and specific language impairment, or SLI) are deficits in the encoding and decoding of language according to its rules (reading, spelling, grammar). The diagnosis of such disorders is often complicated, especially when a patient presents more than one disorder at the same time. The present review focuses on these challenges. We have combined data available from the literature with an in silico approach in an attempt to identify putative miRNAs that may have a key role in dyspraxia, dyslexia and SLI. We suggest the use of new miRNAs, which could have an important impact on the three diseases. Further, we relate those miRNAs to the axon guidance pathway and discuss possible interactions and the role of likely deregulated proteins. In addition, we describe potential differences in expressional deregulation and its role in the improvement of diagnosis. We encourage experimental investigations to test the data obtained in silico.

  2. Computational identification of putative miRNAs and their target genes in pathogenic amoeba Naegleria fowleri.

    Science.gov (United States)

    Padmashree, Dyavegowda; Swamy, Narayanaswamy Ramachandra

    2015-01-01

    Naegleria fowleri is a parasitic unicellular free living eukaryotic amoeba. The parasite spreads through contaminated water and causes primary amoebic meningoencephalitis (PAM). Therefore, it is of interest to understand its molecular pathogenesis. Hence, we analyzed the parasite genome for miRNAs (microRNAs) that are non-coding, single stranded RNA molecules. We identified 245 miRNAs using computational methods in N. fowleri, of which five miRNAs are conserved. The predicted miRNA targets were analyzed by using miRanda (software) and further studied the functions by subsequently annotating using AmiGo (a gene ontology web tool).

  3. DNA methylation of miRNA coding sequences putatively associated with childhood obesity.

    Science.gov (United States)

    Mansego, M L; Garcia-Lacarte, M; Milagro, F I; Marti, A; Martinez, J A

    2017-02-01

    Epigenetic mechanisms may be involved in obesity onset and its consequences. The aim of the present study was to evaluate whether DNA methylation status in microRNA (miRNA) coding regions is associated with childhood obesity. DNA isolated from white blood cells of 24 children (identification sample: 12 obese and 12 non-obese) from the Grupo Navarro de Obesidad Infantil study was hybridized in a 450 K methylation microarray. Several CpGs whose DNA methylation levels were statistically different between obese and non-obese were validated by MassArray® in 95 children (validation sample) from the same study. Microarray analysis identified 16 differentially methylated CpGs between both groups (6 hypermethylated and 10 hypomethylated). DNA methylation levels in miR-1203, miR-412 and miR-216A coding regions significantly correlated with body mass index standard deviation score (BMI-SDS) and explained up to 40% of the variation of BMI-SDS. The network analysis identified 19 well-defined obesity-relevant biological pathways from the KEGG database. MassArray® validation identified three regions located in or near miR-1203, miR-412 and miR-216A coding regions differentially methylated between obese and non-obese children. The current work identified three CpG sites located in coding regions of three miRNAs (miR-1203, miR-412 and miR-216A) that were differentially methylated between obese and non-obese children, suggesting a role of miRNA epigenetic regulation in childhood obesity. © 2016 World Obesity Federation.

  4. Small RNA profiling of Xenopus embryos reveals novel miRNAs and a new class of small RNAs derived from intronic transposable elements.

    Science.gov (United States)

    Harding, Joanne L; Horswell, Stuart; Heliot, Claire; Armisen, Javier; Zimmerman, Lyle B; Luscombe, Nicholas M; Miska, Eric A; Hill, Caroline S

    2014-01-01

    Small RNA control of gene expression is critical for developmental processes in vertebrate embryos. To determine the dynamics of small RNA expression and to uncover novel small RNAs in the early vertebrate embryo, we performed high-throughput sequencing of all small RNAs in Xenopus tropicalis embryos at three developmental time points and in dissected halves of gastrula embryos. This analysis allowed us to identify novel microRNAs and we show that microRNA expression is highly dynamic and spatially localized in early embryos. In addition, we have developed a microRNA prediction pipeline and demonstrate that it has the power to predict new miRNAs that are experimentally detectable in frogs, mice, and humans. By combining the small RNA sequencing with mRNA profiling at the different developmental stages, we identify a new class of small noncoding RNAs that we name siteRNAs, which align in clusters to introns of protein-coding genes. We show that siteRNAs are derived from remnants of transposable elements present in the introns. We find that genes containing clusters of siteRNAs are transcriptionally repressed as compared with all genes. Furthermore, we show that this is true for individual genes containing siteRNA clusters, and that these genes are enriched in specific repressive histone modifications. Our data thus suggest a new mechanism of siteRNA-mediated gene silencing in vertebrates, and provide an example of how mobile elements can affect gene regulation.

  5. Expression of intronic miRNAs and their host gene Igf2 in a murine unilateral ureteral obstruction model

    Energy Technology Data Exchange (ETDEWEB)

    Li, N.Q. [Nephrology Department, The First Affiliated Hospital, Harbin Medical University, Harbin (China); Yang, J. [Nephrology Department, Daqing Oilfield General Hospital, Daqing (China); Cui, L. [Nephrology Department, The First Affiliated Hospital, Harbin Medical University, Harbin (China); Ma, N. [Department of Biochemistry and Molecular Biology, Harbin Medical University, Harbin (China); Zhang, L.; Hao, L.R. [Nephrology Department, The First Affiliated Hospital, Harbin Medical University, Harbin (China)

    2015-03-27

    The objective of this study was to determine the expression of miR-483 and miR-483* and the relationship among them, their host gene (Igf2), and other cytokines in a murine model of renal fibrosis. The extent of renal fibrosis was visualized using Masson staining, and fibrosis was scored 3 days and 1 and 2 weeks after unilateral ureteral obstruction (UUO). Expression of miR-483, miR-483* and various cytokine mRNAs was detected by real-time polymerase chain reaction (PCR). Expression of miR-483 and miR-483* was significantly upregulated in the UUO model, particularly miR-483 expression was the greatest 2 weeks after surgery. Additionally, miR-483 and miR-483* expression negatively correlated with Bmp7 expression and positively correlated with Igf2, Tgfβ, Hgf, and Ctgf expression, as determined by Pearson's correlation analysis. Hgf expression significantly increased at 1 and 2 weeks after the surgery compared to the control group. This study showed that miR-483 and miR-483* expression was upregulated in a murine UUO model. These data suggest that miR-483 and miR-483* play a role in renal fibrosis and that miR-483* may interact with miR-483 in renal fibrosis. Thus, these miRNAs may play a role in the pathogenesis of renal fibrosis and coexpression of their host gene Igf2.

  6. Identification of miRNAs and miRNA-mediated regulatory pathways in Carica papaya.

    Science.gov (United States)

    Liang, Gang; Li, Yang; He, Hua; Wang, Fang; Yu, Diqiu

    2013-10-01

    Plant microRNAs (miRNAs) post-transcriptionally regulate target gene expression to modulate growth and development and biotic and abiotic stress responses. By analyzing small RNA deep sequencing data in combination with the genome sequence, we identified 75 conserved miRNAs and 11 novel miRNAs. Their target genes were also predicted. For most conserved miRNAs, the miRNA-target pairs were conserved across plant species. In addition to these conserved miRNA-target pairs, we also identified some papaya-specific miRNA-target regulatory pathways. Both miR168 and miR530 target the Argonaute 1 gene, indicating a second autoregulatory mechanism for miRNA regulation. A non-conserved miRNA was mapped within an intron of Dicer-like 1 (DCL1), suggesting a conserved homeostatic autoregulatory mechanism for DCL1 expression. A 21-nt miRNA triggers secondary siRNA production from its target genes, nucleotide-binding site leucine-rich repeat protein genes. Certain phased-miRNAs were processed from their conserved miRNA precursors, indicating a putative miRNA evolution mechanism. In addition, we identified a Carica papaya-specific miRNA that targets an ethylene receptor gene, implying its function in the ethylene signaling pathway. This work will also advance our understanding of miRNA functions and evolution in plants.

  7. Genomewide analysis of intronic microRNAs in rice and Arabidopsis

    Indian Academy of Sciences (India)

    G. D. Yang; K. Yan; B. J. Wu; Y. H. Wang; Y. X. Gao; C. C. Zheng

    2012-12-01

    MicroRNAs (miRNAs) are potent regulators of gene transcription and posttranscriptional processes. The majority of miRNAs are localized within intronic regions of protein-coding genes (host genes) and have diverse functions in regulating important cellular processes in animals. To date, few plant intronic miRNAs have been studied functionally. Here we report a comprehensive computational analysis to characterize intronic miRNAs in rice and Arabidopsis. RT-PCR analysis confirmed that the identified intronic miRNAs were derived from the real introns of host genes. Interestingly, 13 intronic miRNAs in rice and two in Arabidopsis were located within seven clusters, of which four polycistronic clusters contain miRNAs derived from different families, suggesting that these clustered intronic miRNAs might be involved in extremely complex regulation in rice. Length analysis of miRNA-carrying introns, promoter prediction and qRT-PCR analysis results indicated that intronic miRNAs are coexpressed with their host genes. Expression pattern analysis demonstrated that host genes had a very broad expression spectrum in different stages of development, suggesting the intronic miRNAs might play an important role in plant development. This comparative genomics analysis of intronic miRNAs in rice and Arabidopsis provides new insight into the functions and regulatory mechanisms of intronic miRNAs in monocots and dicots.

  8. New phagotrophic euglenoid species (new genus Decastava; Scytomonas saepesedens; Entosiphon oblongum), Hsp90 introns, and putative euglenoid Hsp90 pre-mRNA insertional editing.

    Science.gov (United States)

    Cavalier-Smith, Thomas; Chao, Ema E; Vickerman, Keith

    2016-10-01

    We describe three new phagotrophic euglenoid species by light microscopy and 18S rDNA and Hsp90 sequencing: Scytomonas saepesedens; Decastava edaphica; Entosiphon oblongum. We studied Scytomonas and Decastava ultrastructure. Scytomonas saepesedens feeds when sessile with actively beating cilium, and has five pellicular strips with flush joints and Calycimonas-like microtubule-supported cytopharynx. Decastava, sister to Keelungia forming new clade Decastavida on 18S rDNA trees, has 10 broad strips with cusp-like joints, not bifurcate ridges like Ploeotia and Serpenomonas (phylogenetically and cytologically distinct genera), and Serpenomonas-like feeding apparatus (8-9 unreinforced microtubule pairs loop from dorsal jaw support to cytostome). Hsp90 and 18S rDNA trees group Scytomonas with Petalomonas and show Entosiphon as the earliest euglenoid branch. Basal euglenoids have rigid longitudinal strips; derived clade Spirocuta has spiral often slideable strips. Decastava Hsp90 genes have introns. Decastava/Entosiphon Hsp90 frameshifts imply insertional RNA editing. Petalomonas is too heterogeneous in pellicle structure for one genus; we retain Scytomonas (sometimes lumped with it) and segregate four former Petalomonas as new genus Biundula with pellicle cross section showing 2-8 smooth undulations and typified by Biundula (=Petalomonas) sphagnophila comb. n. Our taxon-rich site-heterogeneous rDNA trees confirm that Heteronema is excessively heterogeneous; therefore we establish new genus Teloprocta for Heteronema scaphurum.

  9. ZDHHC8 as a candidate gene for schizophrenia: Analysis of a putative functional intronic marker in case-control and family-based association studies

    Directory of Open Access Journals (Sweden)

    Jabs Burkhard

    2005-10-01

    Full Text Available Abstract Background The chromosome 22q11 region is proposed as a major candidate locus for susceptibility genes to schizophrenia. Recently, the gene ZDHHC8 encoding a putative palmitoyltransferase at 22q11 was proposed to increase liability to schizophrenia based on both animal models and human association studies by significant over-transmission of allele rs175174A in female, but not male subjects with schizophrenia. Methods Given the genetic complexity of schizophrenia and the potential genetic heterogeneity in different populations, we examined rs175174 in 204 German proband-parent triads and in an independent case-control study (schizophrenic cases: n = 433; controls: n = 186. Results In the triads heterozygous parents transmitted allele G preferentially to females, and allele A to males (heterogeneity χ2 = 4.43; p = 0.035. The case-control sample provided no further evidence for overall or gender-specific effects regarding allele and genotype frequency distributions. Conclusion The findings on rs175174 at ZDHHC8 are still far from being conclusive, but evidence for sexual dimorphism is moderate, and our data do not support a significant genetic contribution of rs175174 to the aetiopathogenesis of schizophrenia.

  10. A spliceosomal intron in Giardia lamblia

    Science.gov (United States)

    Nixon, Julie E. J.; Wang, Amy; Morrison, Hilary G.; McArthur, Andrew G.; Sogin, Mitchell L.; Loftus, Brendan J.; Samuelson, John

    2002-01-01

    Short introns occur in numerous protist lineages, but there are no reports of intervening sequences in the protists Giardia lamblia and Trichomonas vaginalis, which may represent the deepest known branches in the eukaryotic line of descent. We have discovered a 35-bp spliceosomal intron in a gene encoding a putative [2Fe-2S] ferredoxin of G. lamblia. The Giardia intron contains a canonical splice site at its 3′ end (AG), a noncanonical splice site at its 5′ end (CT), and a branch point sequence that fits the yeast consensus sequence of TACTAAC except for the first nucleotide (AACTAAC). We have also identified several G. lamblia genes with spliceosomal peptides, including homologues of eukaryote-specific spliceosomal peptides (Prp8 and Prp11), several DExH-box RNA-helicases that have homologues in eubacteria, but serve essential functions in the splicing of introns in eukaryotes, and 11 predicted archaebacteria-like Sm and like-Sm core peptides, which coat small nuclear RNAs. Phylogenetic analyses show the Giardia Sm core peptides are the products of multiple, ancestral gene duplications followed by divergence, but they retain strong similarity to Sm and like-Sm peptides of other eukaryotes. Although we have documented only a single intron in Giardia, it likely has other introns and fully functional, spliceosomal machinery. If introns were added during eukaryotic evolution (the introns-late hypothesis), then these results push back the date of this event before the branching of G. lamblia. PMID:11854456

  11. Group I intron ribozymes

    DEFF Research Database (Denmark)

    Nielsen, Henrik

    2012-01-01

    Group I intron ribozymes constitute one of the main classes of ribozymes and have been a particularly important model in the discovery of key concepts in RNA biology as well as in the development of new methods. Compared to other ribozyme classes, group I intron ribozymes display considerable......, the intronic products of these pathways have the potential to integrate into targets and to form various types of circular RNA molecules. Thus, group I intron ribozymes and associated elements found within group I introns is a rich source of biological phenomena. This chapter provides a strategy and protocols...... for initial characterization of new group I intron ribozymes....

  12. Origin of introns by 'intronization' of exonic sequences

    DEFF Research Database (Denmark)

    Irimia, Manuel; Rukov, Jakob Lewin; Penny, David;

    2008-01-01

    The mechanisms of spliceosomal intron creation have proved elusive. Here we describe a new mechanism: the recruitment of internal exonic sequences ('intronization') in Caenorhabditis species. The numbers of intronization events and introns gained by other mechanisms are similar, suggesting...

  13. New miRNAs cloned from neuroblastoma

    Directory of Open Access Journals (Sweden)

    Glatting Karl-Heinz

    2008-01-01

    Full Text Available Abstract Background MicroRNAs (miRNAs are a novel class of gene expression regulators implicated in cancer biology. Neuroblastoma (NB is an embryonal tumour consisting of neural crest-derived undifferentiated cells and is characterised by variable clinical courses ranging from spontaneous regression to therapy-resistant progression. Recent advances identified a subset of miRNAs with putative function in NB biology. However, the full repertoire of miRNAs expressed in NBs is not available. Results We describe miRNA profiles of 13 NB specimens and 2 NB cell lines as determined by miRNA cloning. A total of 3153 sequences were sequenced and analysed by a miRNA prediction tool (miRpredict. Our library covered 27% miRNAs known to date. 39 reads corresponding to 25 individual sequences were classified as novel miRNAs, including miRNA* species of 10 known miRNAs. Expression of 5 new miRNA* forms and 8 individual sequences was supported by Northern blotting. Most of the novel miRNA genes are not related to each other and do not share homology with the annotated sequences in the public miRNA database, but they are conserved within mammals or have close homologues in primates genomes. Conclusion We provide evidence for 29 new miRNA and miRNA-like sequences (24 novel sequences and 5 miRNAs discovered initially in other species. Some of these newly identified sequences reside within frequently altered chromosomal regions in NB tumours and may play a role in NB biology.

  14. Phase distribution of spliceosomal introns: implications for intron origin

    Directory of Open Access Journals (Sweden)

    Yoshihama Maki

    2006-09-01

    Full Text Available Abstract Background The origin of spliceosomal introns is the central subject of the introns-early versus introns-late debate. The distribution of intron phases is non-uniform, with an excess of phase-0 introns. Introns-early explains this by speculating that a fraction of present-day introns were present between minigenes in the progenote and therefore must lie in phase-0. In contrast, introns-late predicts that the nonuniformity of intron phase distribution reflects the nonrandomness of intron insertions. Results In this paper, we tested the two theories using analyses of intron phase distribution. We inferred the evolution of intron phase distribution from a dataset of 684 gene orthologs from seven eukaryotes using a maximum likelihood method. We also tested whether the observed intron phase distributions from 10 eukaryotes can be explained by intron insertions on a genome-wide scale. In contrast to the prediction of introns-early, the inferred evolution of intron phase distribution showed that the proportion of phase-0 introns increased over evolution. Consistent with introns-late, the observed intron phase distributions matched those predicted by an intron insertion model quite well. Conclusion Our results strongly support the introns-late hypothesis of the origin of spliceosomal introns.

  15. Dissection of miRNA pathways using arabidopsis mesophyll protoplasts.

    Science.gov (United States)

    Martinho, Cláudia; Confraria, Ana; Elias, Carlos Alexandre; Crozet, Pierre; Rubio-Somoza, Ignacio; Weigel, Detlef; Baena-González, Elena

    2015-02-01

    MicroRNAs (miRNAs) control gene expression mostly post-transcriptionally by guiding transcript cleavage and/or translational repression of complementary mRNA targets, thereby regulating developmental processes and stress responses. Despite the remarkable expansion of the field, the mechanisms underlying miRNA activity are not fully understood. In this article, we describe a transient expression system in Arabidopsis mesophyll protoplasts, which is highly amenable for the dissection of miRNA pathways. We show that by transiently overexpressing primary miRNAs and target mimics, we can manipulate miRNA levels and consequently impact on their targets. Furthermore, we developed a set of luciferase-based sensors for quantifying miRNA activity that respond specifically to both endogenous and overexpressed miRNAs and target mimics. We demonstrate that these miRNA sensors can be used to test the impact of putative components of the miRNA pathway on miRNA activity, as well as the impact of specific mutations, by either overexpression or the use of protoplasts from the corresponding mutants. We further show that our miRNA sensors can be used for investigating the effect of chemicals on miRNA activity. Our cell-based transient expression system is fast and easy to set up, and generates quantitative results, being a powerful tool for assaying miRNA activity in vivo.

  16. Intronic alternative splicing regulators identified by comparative genomics in nematodes.

    Directory of Open Access Journals (Sweden)

    Jennifer L Kabat

    2006-07-01

    Full Text Available Many alternative splicing events are regulated by pentameric and hexameric intronic sequences that serve as binding sites for splicing regulatory factors. We hypothesized that intronic elements that regulate alternative splicing are under selective pressure for evolutionary conservation. Using a Wobble Aware Bulk Aligner genomic alignment of Caenorhabditis elegans and Caenorhabditis briggsae, we identified 147 alternatively spliced cassette exons that exhibit short regions of high nucleotide conservation in the introns flanking the alternative exon. In vivo experiments on the alternatively spliced let-2 gene confirm that these conserved regions can be important for alternative splicing regulation. Conserved intronic element sequences were collected into a dataset and the occurrence of each pentamer and hexamer motif was counted. We compared the frequency of pentamers and hexamers in the conserved intronic elements to a dataset of all C. elegans intron sequences in order to identify short intronic motifs that are more likely to be associated with alternative splicing. High-scoring motifs were examined for upstream or downstream preferences in introns surrounding alternative exons. Many of the high-scoring nematode pentamer and hexamer motifs correspond to known mammalian splicing regulatory sequences, such as (TGCATG, indicating that the mechanism of alternative splicing regulation is well conserved in metazoans. A comparison of the analysis of the conserved intronic elements, and analysis of the entire introns flanking these same exons, reveals that focusing on intronic conservation can increase the sensitivity of detecting putative splicing regulatory motifs. This approach also identified novel sequences whose role in splicing is under investigation and has allowed us to take a step forward in defining a catalog of splicing regulatory elements for an organism. In vivo experiments confirm that one novel high-scoring sequence from our analysis

  17. A novel marsupial pri-miRNA transcript has a putative role in gamete maintenance and defines a vertebrate miRNA cluster paralogous to the miR-15a/miR-16-1 cluster.

    Science.gov (United States)

    Au, Phil Chi Khang; Frankenberg, Stephen; Selwood, Lynne; Familari, Mary

    2011-10-01

    Successful maintenance, survival and maturation of gametes rely on bidirectional communication between the gamete and its supporting cells. Before puberty, factors from the gamete and its supporting cells are necessary for spermatogonial stem cell and primordial follicle oocyte maintenance. Following gametogenesis, gametes rely on factors and nutrients secreted by cells of the reproductive tracts, the epididymis and/or oviduct, to complete maturation. Despite extensive studies on female and male reproduction, many of the molecular mechanisms of germ cell maintenance remain relatively unknown, particularly in marsupial species. We present the first study and characterisation of a novel primary miRNA transcript, pri-miR-16c, in the marsupial, the stripe-faced dunnart. Bioinformatic analysis showed that its predicted processed miRNA - miR-16c - is present in a wide range of vertebrates, but not eutherians. In situ hybridisation revealed dunnart pri-miR-16c expression in day 4 (primordial germ cells) and day 7 (oogonia) pouch young, in primary oocytes and follicle cells of primordial follicles but then only in follicle cells of primary, secondary and antral follicles in adult ovaries. In the adult testis, pri-miR-16c transcripts were present in the cytoplasm of spermatogonial cells. The oviduct and the epididymis both showed expression, but not any other somatic tissues examined or conceptuses during early embryonic development. This pattern of expression suggests that pri-miR-16c function may be associated with gamete maintenance, possibly through mechanisms involving RNA transfer, until the zygote enters the uterus at the pronuclear stage.

  18. Introns: The Functional Benefits of Introns in Genomes

    Directory of Open Access Journals (Sweden)

    Bong-Seok Jo

    2015-12-01

    Full Text Available The intron has been a big biological mystery since it was first discovered in several aspects. First, all of the completely sequenced eukaryotes harbor introns in the genomic structure, whereas no prokaryotes identified so far carry introns. Second, the amount of total introns varies in different species. Third, the length and number of introns vary in different genes, even within the same species genome. Fourth, all introns are copied into RNAs by transcription and DNAs by replication processes, but intron sequences do not participate in protein-coding sequences. The existence of introns in the genome should be a burden to some cells, because cells have to consume a great deal of energy to copy and excise them exactly at the correct positions with the help of complicated spliceosomal machineries. The existence throughout the long evolutionary history is explained, only if selective advantages of carrying introns are assumed to be given to cells to overcome the negative effect of introns. In that regard, we summarize previous research about the functional roles or benefits of introns. Additionally, several other studies strongly suggesting that introns should not be junk will be introduced.

  19. Introns in higher plant genes

    Institute of Scientific and Technical Information of China (English)

    2002-01-01

    The intron is an important component of eukaryotic gene. Extensive studies have been conducted to get a better understanding of its structure and function. This paper presents a brief review of the structure and function of introns in higher plant genes. It is shown that higher plant introns possess structural properties shared by all eukaryotic introns, however, they also exhibit a striking degree of diversity. The process of intron splicing in higher plant genes involves interaction between multiple cis-acting elements and trans-acting factors, such as 5′ splicing site, 3′ splicing site and many protein factors. The process of intron splicing is an important level at which gene expression is regulated. Especially alternative splicing of intron can regulate time and space of gene expression. In addition, some introns in higher plant genes also regulate gene expression by affecting the pattern of gene expression, enhancing the level of gene expression and driving the gene expression.

  20. An intronic microRNA silences genes that are functionally antagonistic to its host gene

    OpenAIRE

    Barik, Sailen

    2008-01-01

    MicroRNAs (miRNAs) are short noncoding RNAs that down-regulate gene expression by silencing specific target mRNAs. While many miRNAs are transcribed from their own genes, nearly half map within introns of ‘host’ genes, the significance of which remains unclear. We report that transcriptional activation of apoptosis-associated tyrosine kinase (AATK), essential for neuronal differentiation, also generates miR-338 from an AATK gene intron that silences a family of mRNAs whose protein products ar...

  1. Functional comparison of three transformer gene introns regulating conditional female lethality

    Science.gov (United States)

    The trasformer gene plays a critical role in the sex determination pathways of many insects. We cloned two transformer gene introns from Anastrepha suspensa, the Caribbean fruit fly. These introns have sequences that putatively have a role in sex-specific splicing patterns that affect sex determinat...

  2. The microRNA (miRNA): overview of the RNA genes that modulate gene function.

    Science.gov (United States)

    Ying, Shao-Yao; Chang, Donald C; Lin, Shi-Lung

    2008-03-01

    MicroRNAs (miRNAs), widely distributed, small regulatory RNA genes, target both messenger RNA (mRNA) degradation and suppression of protein translation based on sequence complementarity between the miRNA and its targeted mRNA. Different names have been used to describe various types of miRNA. During evolution, RNA retroviruses or transgenes invaded the eukaryotic genome and inserted in the non-coding regions of DNA, conceivably acting as transposon-like jumping genes, providing defense from viral invasion and fine-tuning of gene expression as a secondary level of gene modulation in eukaryotes. When a transposon is inserted in the intron, it becomes an intronic miRNA, taking advantage of the protein synthesis machinery, i.e., mRNA transcription and splicing, as a means for processing and maturation. Recently, miRNAs have been found to play an important, but not life-threatening, role in embryonic development. They might play a pivotal role in diverse biological systems in various organisms, facilitating a quick response and accurate plotting of body physiology and structures. Based on these unique properties, man-made intronic miRNAs have been developed for in vitro evaluation of gene function, in vivo gene therapy and generation of transgenic animal models. The biogenesis and identification of miRNAs, potential applications, and future directions for research are presented, hopefully providing a guideline for further miRNA and gene function studies.

  3. Vertical evolution and intragenic spread of lichen-fungal group I introns.

    Science.gov (United States)

    Bhattacharya, Debashish; Friedl, Thomas; Helms, Gert

    2002-07-01

    One family within the Euascomycetes (Ascomycota), the lichen-forming Physciaceae, is particularly rich in nuclear ribosomal [r]DNA group I introns. We used phylogenetic analyses of group I introns and lichen-fungal host cells to address four questions about group I intron evolution in lichens, and generally in all eukaryotes: 1) Is intron spread in the lichens associated with the intimate association of the fungal and photosynthetic cells that make up the lichen thallus? 2) Are the multiple group I introns in the lichen-fungi of independent origins, or have existing introns spread into novel sites in the rDNA? 3) If introns have moved to novel sites, then does the exon context of these sites provide insights into the mechanism of intron spread? and 4) What is the pattern of intron loss in the small subunit rDNA gene of lichen-fungi? Our analyses show that group I introns in the lichen-fungi and in the lichen-algae (and lichenized cyanobacteria) do not share a close evolutionary relationship, suggesting that these introns do not move between the symbionts. Many group I introns appear to have originated in the common ancestor of the Lecanorales, whereas others have spread within this lineage (particularly in the Physciaceae) putatively through reverse-splicing into novel rRNA sites. We suggest that the evolutionary history of most lichen-fungal group I introns is characterized by rare gains followed by extensive losses in descendants, resulting in a sporadic intron distribution. Detailed phylogenetic analyses of the introns and host cells are required, therefore, to distinguish this scenario from the alternative hypothesis of widespread and independent intron gains in the different lichen-fungal lineages.

  4. A potential role for intragenic miRNAs on their hosts' interactome

    Directory of Open Access Journals (Sweden)

    Kuo Winston P

    2010-10-01

    Full Text Available Abstract Background miRNAs are small, non-coding RNA molecules that mainly act as negative regulators of target gene messages. Due to their regulatory functions, they have lately been implicated in several diseases, including malignancies. Roughly half of known miRNA genes are located within previously annotated protein-coding regions ("intragenic miRNAs". Although a role of intragenic miRNAs as negative feedback regulators has been speculated, to the best of our knowledge there have been no conclusive large-scale studies investigating the relationship between intragenic miRNAs and host genes and their pathways. Results miRNA-containing host genes were three times longer, contained more introns and had longer 5' introns compared to a randomly sampled gene cohort. These results are consistent with the observation that more than 60% of intronic miRNAs are found within the first five 5' introns. Host gene 3'-untranslated regions (3'-UTRs were 40% longer and contained significantly more adenylate/uridylate-rich elements (AREs compared to a randomly sampled gene cohort. Coincidentally, recent literature suggests that several components of the miRNA biogenesis pathway are required for the rapid decay of mRNAs containing AREs. A high-confidence set of predicted mRNA targets of intragenic miRNAs also shared many of these features with the host genes. Approximately 20% of intragenic miRNAs were predicted to target their host mRNA transcript. Further, KEGG pathway analysis demonstrated that 22 of the 74 pathways in which host genes were associated showed significant overrepresentation of proteins encoded by the mRNA targets of associated intragenic miRNAs. Conclusions Our findings suggest that both host genes and intragenic miRNA targets may potentially be subject to multiple layers of regulation. Tight regulatory control of these genes is likely critical for cellular homeostasis and absence of disease. To this end, we examined the potential for negative

  5. Investigation of miRNA Biology by Bioinformatic Tools and Impact of miRNAs in Colorectal Cancer: Regulatory Relationship of c-Myc and p53 with miRNAs

    Directory of Open Access Journals (Sweden)

    Yaguang Xi

    2007-01-01

    Full Text Available MicroRNAs (miRNAs are a class of small non-coding RNAs that mediate gene expression at the posttranscriptional and translational levels and have been demonstrated to be involved in diverse biological functions. Mounting evidence in recent years has shown that miRNAs play key roles in tumorigenesis due to abnormal expression of and mutations in miRNAs. High throughput miRNA expression profiling of several major tumor types has identified miRNAs associated with clinical diagnosis and prognosis of cancer treatment. Previously our group has discovered a novel regulatory relationship between tumor suppressor gene p53 with miRNAs expression and a number of miRNA promoters contain putative p53 binding sites. In addition, others have reported that c-myc can mediate a large number of miRNAs expression. In this review, we will emphasize algorithms to identify mRNA targets of miRNAs and the roles of miRNAs in colorectal cancer. In particular, we will discuss a novel regulatory relationship of miRNAs with tumor suppressor p53 and c-myc. miRNAs are becoming promising novel targets and biomarkers for future cancer therapeutic development and clinical molecular diagnosis.

  6. A Burst of miRNA Innovation in the Early Evolution of Butterflies and Moths

    Science.gov (United States)

    Quah, Shan; Hui, Jerome H.L.; Holland, Peter W.H.

    2015-01-01

    MicroRNAs (miRNAs) are involved in posttranscriptional regulation of gene expression. Because several miRNAs are known to affect the stability or translation of developmental regulatory genes, the origin of novel miRNAs may have contributed to the evolution of developmental processes and morphology. Lepidoptera (butterflies and moths) is a species-rich clade with a well-established phylogeny and abundant genomic resources, thereby representing an ideal system in which to study miRNA evolution. We sequenced small RNA libraries from developmental stages of two divergent lepidopterans, Cameraria ohridella (Horse chestnut Leafminer) and Pararge aegeria (Speckled Wood butterfly), discovering 90 and 81 conserved miRNAs, respectively, and many species-specific miRNA sequences. Mapping miRNAs onto the lepidopteran phylogeny reveals rapid miRNA turnover and an episode of miRNA fixation early in lepidopteran evolution, implying that miRNA acquisition accompanied the early radiation of the Lepidoptera. One lepidopteran-specific miRNA gene, miR-2768, is located within an intron of the homeobox gene invected, involved in insect segmental and wing patterning. We identified cubitus interruptus (ci) as a likely direct target of miR-2768, and validated this suppression using a luciferase assay system. We propose a model by which miR-2768 modulates expression of ci in the segmentation pathway and in patterning of lepidopteran wing primordia. PMID:25576364

  7. The Biology of Intron Gain and Loss

    DEFF Research Database (Denmark)

    Jeffares, Daniel C; Mourier, Tobias; Penny, David

    2006-01-01

    Intron density in eukaryote genomes varies by more than three orders of magnitude, so there must have been extensive intron gain and/or intron loss during evolution. A favored and partial explanation for this range of intron densities has been that introns have accumulated stochastically in large...... eukaryote genomes during their evolution from an intron-poor ancestor. However, recent studies have shown that some eukaryotes lost many introns, whereas others accumulated and/or gained many introns. In this article, we discuss the growing evidence that these differences are subject to selection acting...... on introns depending on the biology of the organism and the gene involved....

  8. Identification and Expression Analyses of miRNAs from Two Contrasting Flower Color Cultivars of Canna by Deep Sequencing.

    Science.gov (United States)

    Roy, Sribash; Tripathi, Abhinandan Mani; Yadav, Amrita; Mishra, Parneeta; Nautiyal, Chandra Shekhar

    2016-01-01

    miRNAs are endogenous small RNA (sRNA) that play critical roles in plant development processes. Canna is an ornamental plant belonging to family Cannaceae. Here, we report for the first time the identification and differential expression of miRNAs in two contrasting flower color cultivars of Canna, Tropical sunrise and Red president. A total of 313 known miRNAs belonging to 78 miRNA families were identified from both the cultivars. Thirty one miRNAs (17 miRNA families) were specific to Tropical sunrise and 43 miRNAs (10 miRNA families) were specific to Red president. Thirty two and 18 putative new miRNAs were identified from Tropical sunrise and Red president, respectively. One hundred and nine miRNAs were differentially expressed in the two cultivars targeting 1343 genes. Among these, 16 miRNAs families targeting 60 genes were involved in flower development related traits and five miRNA families targeting five genes were involved in phenyl propanoid and pigment metabolic processes. We further validated the expression analysis of a few miRNA and their target genes by qRT-PCR. Transcription factors were the major miRNA targets identified. Target validation of a few randomly selected miRNAs by RLM-RACE was performed but was successful with only miR162. These findings will help in understanding flower development processes, particularly the color development in Canna.

  9. 50/50 Expressional Odds of Retention Signifies the Distinction between Retained Introns and Constitutively Spliced Introns in Arabidopsis thaliana

    Directory of Open Access Journals (Sweden)

    Rui Mao

    2017-10-01

    Full Text Available Intron retention, one of the most prevalent alternative splicing events in plants, can lead to introns retained in mature mRNAs. However, in comparison with constitutively spliced introns (CSIs, the relevantly distinguishable features for retained introns (RIs are still poorly understood. This work proposes a computational pipeline to discover novel RIs from multiple next-generation RNA sequencing (RNA-Seq datasets of Arabidopsis thaliana. Using this pipeline, we detected 3,472 novel RIs from 18 RNA-Seq datasets and re-confirmed 1,384 RIs which are currently annotated in the TAIR10 database. We also use the expression of intron-containing isoforms as a new feature in addition to the conventional features. Based on these features, RIs are highly distinguishable from CSIs by machine learning methods, especially when the expressional odds of retention (i.e., the expression ratio of the RI-containing isoforms relative to the isoforms without RIs for the same gene reaches to or larger than 50/50. In this case, the RIs and CSIs can be clearly separated by the Random Forest with an outstanding performance of 0.95 on AUC (the area under a receiver operating characteristics curve. The closely related characteristics to the RIs include the low strength of splice sites, high similarity with the flanking exon sequences, low occurrence percentage of YTRAY near the acceptor site, existence of putative intronic splicing silencers (ISSs, i.e., AG/GA-rich motifs and intronic splicing enhancers (ISEs, i.e., TTTT-containing motifs, and enrichment of Serine/Arginine-Rich (SR proteins and heterogeneous nuclear ribonucleoparticle proteins (hnRNPs.

  10. Mutation of miRNA target sequences during human evolution

    DEFF Research Database (Denmark)

    Gardner, Paul P; Vinther, Jeppe

    2008-01-01

    It has long-been hypothesized that changes in non-protein-coding genes and the regulatory sequences controlling expression could undergo positive selection. Here we identify 402 putative microRNA (miRNA) target sequences that have been mutated specifically in the human lineage and show that genes...... containing such deletions are more highly expressed than their mouse orthologs. Our findings indicate that some miRNA target mutations are fixed by positive selection and might have been involved in the evolution of human-specific traits.......It has long-been hypothesized that changes in non-protein-coding genes and the regulatory sequences controlling expression could undergo positive selection. Here we identify 402 putative microRNA (miRNA) target sequences that have been mutated specifically in the human lineage and show that genes...

  11. Molecular characterization of a new member of the lariat capping twin-ribozyme introns

    Science.gov (United States)

    2014-01-01

    Background Twin-ribozyme introns represent a complex class of mobile group I introns that harbour a lariat capping (LC) ribozyme and a homing endonuclease gene embedded in a conventional self-splicing group I ribozyme (GIR2). Twin-ribozyme introns have so far been confined to nucleolar DNA in Naegleria amoeboflagellates and the myxomycete Didymium iridis. Results We characterize structural organization, catalytic properties and molecular evolution of a new twin-ribozyme intron in Allovahlkampfia (Heterolobosea). The intron contains two ribozyme domains with different functions in ribosomal RNA splicing and homing endonuclease mRNA maturation. We found Allovahlkampfia GIR2 to be a typical group IC1 splicing ribozyme responsible for addition of the exogenous guanosine cofactor (exoG), exon ligation and circularization of intron RNA. The Allovahlkampfia LC ribozyme, by contrast, represents an efficient self-cleaving ribozyme that generates a small 2′,5′ lariat cap at the 5′ end of the homing endonuclease mRNA, and thus contributes to intron mobility. Conclusions The discovery of a twin-ribozyme intron in a member of Heterolobosea expands the distribution pattern of LC ribozymes. We identify a putative regulatory RNA element (AP2.1) in the Allovahlkampfia LC ribozyme that involves homing endonuclease mRNA coding sequences as an important structural component. PMID:25342998

  12. Some novel intron positions in conserved Drosophila genes are caused by intron sliding or tandem duplication

    Directory of Open Access Journals (Sweden)

    Stadler Peter F

    2010-05-01

    Full Text Available Abstract Background Positions of spliceosomal introns are often conserved between remotely related genes. Introns that reside in non-conserved positions are either novel or remnants of frequent losses of introns in some evolutionary lineages. A recent gain of such introns is difficult to prove. However, introns verified as novel are needed to evaluate contemporary processes of intron gain. Results We identified 25 unambiguous cases of novel intron positions in 31 Drosophila genes that exhibit near intron pairs (NIPs. Here, a NIP consists of an ancient and a novel intron position that are separated by less than 32 nt. Within a single gene, such closely-spaced introns are very unlikely to have coexisted. In most cases, therefore, the ancient intron position must have disappeared in favour of the novel one. A survey for NIPs among 12 Drosophila genomes identifies intron sliding (migration as one of the more frequent causes of novel intron positions. Other novel introns seem to have been gained by regional tandem duplications of coding sequences containing a proto-splice site. Conclusions Recent intron gains sometimes appear to have arisen by duplication of exonic sequences and subsequent intronization of one of the copies. Intron migration and exon duplication together may account for a significant amount of novel intron positions in conserved coding sequences.

  13. Intronic Alus influence alternative splicing.

    Directory of Open Access Journals (Sweden)

    Galit Lev-Maor

    Full Text Available Examination of the human transcriptome reveals higher levels of RNA editing than in any other organism tested to date. This is indicative of extensive double-stranded RNA (dsRNA formation within the human transcriptome. Most of the editing sites are located in the primate-specific retrotransposed element called Alu. A large fraction of Alus are found in intronic sequences, implying extensive Alu-Alu dsRNA formation in mRNA precursors. Yet, the effect of these intronic Alus on splicing of the flanking exons is largely unknown. Here, we show that more Alus flank alternatively spliced exons than constitutively spliced ones; this is especially notable for those exons that have changed their mode of splicing from constitutive to alternative during human evolution. This implies that Alu insertions may change the mode of splicing of the flanking exons. Indeed, we demonstrate experimentally that two Alu elements that were inserted into an intron in opposite orientation undergo base-pairing, as evident by RNA editing, and affect the splicing patterns of a downstream exon, shifting it from constitutive to alternative. Our results indicate the importance of intronic Alus in influencing the splicing of flanking exons, further emphasizing the role of Alus in shaping of the human transcriptome.

  14. Statistical characteristics of eukaryotic intron database

    Institute of Scientific and Technical Information of China (English)

    HE Miao; LI Jidong; ZHANG Shanghong

    2006-01-01

    A database called eukaryotic intron database (EID) was developed based on the data from GenBank.Studies on the statistical characteristics of EID show that there were 103,848 genes,478,484 introns,and 582,332 exons,with an average of 4.61 introns and 5.61 exons per gene.Introns of 40-120 nt in length were abundant in the database.Results of the statistical analysis on the data from nine model species showed that in eukaryotes,higher species do not necessarily have more introns or exons in a gene than lower species.Furthermore,characteristics of EID,such as intron phase,distribution of different splice sites,and the relationship between genome size and intron proportion or intron density,have been studied.

  15. Complex group-I introns in nuclear SSU rDNA of red and green algae: evidence of homing-endonuclease pseudogenes in the Bangiophyceae

    DEFF Research Database (Denmark)

    Haugen, P; Huss, V A; Nielsen, Henrik

    1999-01-01

    The green alga Scenedesmus pupukensis and the red alga Porphyra spiralis contain large group-IC1 introns in their nuclear small subunit ribosomal RNA genes due to the presence of open reading frames at the 5' end of the introns. The putative 555 amino-acid Scenedesmus-encoded protein harbors...

  16. Putative cross-kingdom horizontal gene transfer in sponge (Porifera mitochondria

    Directory of Open Access Journals (Sweden)

    Ilan Micha

    2006-09-01

    Full Text Available Abstract Background The mitochondrial genome of Metazoa is usually a compact molecule without introns. Exceptions to this rule have been reported only in corals and sea anemones (Cnidaria, in which group I introns have been discovered in the cox1 and nad5 genes. Here we show several lines of evidence demonstrating that introns can also be found in the mitochondria of sponges (Porifera. Results A 2,349 bp fragment of the mitochondrial cox1 gene was sequenced from the sponge Tetilla sp. (Spirophorida. This fragment suggests the presence of a 1143 bp intron. Similar to all the cnidarian mitochondrial introns, the putative intron has group I intron characteristics. The intron is present in the cox1 gene and encodes a putative homing endonuclease. In order to establish the distribution of this intron in sponges, the cox1 gene was sequenced from several representatives of the demosponge diversity. The intron was found only in the sponge order Spirophorida. A phylogenetic analysis of the COI protein sequence and of the intron open reading frame suggests that the intron may have been transmitted horizontally from a fungus donor. Conclusion Little is known about sponge-associated fungi, although in the last few years the latter have been frequently isolated from sponges. We suggest that the horizontal gene transfer of a mitochondrial intron was facilitated by a symbiotic relationship between fungus and sponge. Ecological relationships are known to have implications at the genomic level. Here, an ecological relationship between sponge and fungus is suggested based on the genomic analysis.

  17. Putative cross-kingdom horizontal gene transfer in sponge (Porifera) mitochondria

    Science.gov (United States)

    Rot, Chagai; Goldfarb, Itay; Ilan, Micha; Huchon, Dorothée

    2006-01-01

    Background The mitochondrial genome of Metazoa is usually a compact molecule without introns. Exceptions to this rule have been reported only in corals and sea anemones (Cnidaria), in which group I introns have been discovered in the cox1 and nad5 genes. Here we show several lines of evidence demonstrating that introns can also be found in the mitochondria of sponges (Porifera). Results A 2,349 bp fragment of the mitochondrial cox1 gene was sequenced from the sponge Tetilla sp. (Spirophorida). This fragment suggests the presence of a 1143 bp intron. Similar to all the cnidarian mitochondrial introns, the putative intron has group I intron characteristics. The intron is present in the cox1 gene and encodes a putative homing endonuclease. In order to establish the distribution of this intron in sponges, the cox1 gene was sequenced from several representatives of the demosponge diversity. The intron was found only in the sponge order Spirophorida. A phylogenetic analysis of the COI protein sequence and of the intron open reading frame suggests that the intron may have been transmitted horizontally from a fungus donor. Conclusion Little is known about sponge-associated fungi, although in the last few years the latter have been frequently isolated from sponges. We suggest that the horizontal gene transfer of a mitochondrial intron was facilitated by a symbiotic relationship between fungus and sponge. Ecological relationships are known to have implications at the genomic level. Here, an ecological relationship between sponge and fungus is suggested based on the genomic analysis. PMID:16972986

  18. Microarray analysis of colorectal cancer stromal tissue reveals upregulation of two oncogenic miRNA clusters.

    Science.gov (United States)

    Nishida, Naohiro; Nagahara, Makoto; Sato, Tetsuya; Mimori, Koshi; Sudo, Tomoya; Tanaka, Fumiaki; Shibata, Kohei; Ishii, Hideshi; Sugihara, Kenichi; Doki, Yuichiro; Mori, Masaki

    2012-06-01

    Cancer stroma plays an important role in the progression of cancer. Although alterations in miRNA expression have been explored in various kinds of cancers, the expression of miRNAs in cancer stroma has not been explored in detail. Using a laser microdissection technique, we collected RNA samples specific for epithelium or stroma from 13 colorectal cancer tissues and four normal tissues, and miRNA microarray and gene expression microarray were carried out. The expression status of miRNAs was confirmed by reverse transcriptase PCR. Furthermore, we investigated whether miRNA expression status in stromal tissue could influence the clinicopathologic factors. Oncogenic miRNAs, including two miRNA clusters, miR-17-92a and miR-106b-25 cluster, were upregulated in cancer stromal tissues compared with normal stroma. Gene expression profiles from cDNA microarray analyses of the same stromal tissue samples revealed that putative targets of these miRNA clusters, predicted by Target Scan, such as TGFBR2, SMAD2, and BMP family genes, were significantly downregulated in cancer stromal tissue. Downregulated putative targets were also found to be involved in cytokine interaction and cellular adhesion. Importantly, expression of miR-25 and miR-92a in stromal tissues was associated with a variety of clinicopathologic factors. Oncogenic miRNAs were highly expressed in cancer stroma. Although further validation is required, the finding that stromal miRNA expression levels were associated with clinicopathologic factors suggests the possibility that miRNAs in cancer stroma are crucially involved in cancer progression.

  19. The regulatory effect of miRNAs is a heritable genetic trait in humans

    Directory of Open Access Journals (Sweden)

    Geeleher Paul

    2012-08-01

    Full Text Available Abstract Background microRNAs (miRNAs have been shown to regulate the expression of a large number of genes and play key roles in many biological processes. Several previous studies have quantified the inhibitory effect of a miRNA indirectly by considering the expression levels of genes that are predicted to be targeted by the miRNA and this approach has been shown to be robust to the choice of prediction algorithm. Given a gene expression dataset, Cheng et al. defined the regulatory effect score (RE-score of a miRNA as the difference in the gene expression rank of targets of the miRNA compared to non-targeted genes. Results Using microarray data from parent-offspring trios from the International HapMap project, we show that the RE-score of most miRNAs is correlated between parents and offspring and, thus, inter-individual variation in RE-score has a genetic component in humans. Indeed, the mean RE-score across miRNAs is correlated between parents and offspring, suggesting genetic differences in the overall efficiency of the miRNA biogenesis pathway between individuals. To explore the genetics of this quantitative trait further, we carried out a genome-wide association study of the mean RE-score separately in two HapMap populations (CEU and YRI. No genome-wide significant associations were discovered; however, a SNP rs17409624, in an intron of DROSHA, was significantly associated with mean RE-score in the CEU population following permutation-based control for multiple testing based on all SNPs mapped to the canonical miRNA biogenesis pathway; of 244 individual miRNA RE-scores assessed in the CEU, 214 were associated (p p = 0.04 with mean RE-score in the YRI population. Interestingly, the same SNP was associated with 17 (8.5% of all expressed miRNA expression levels in the CEU. We also show here that the expression of the targets of most miRNAs is more highly correlated with global changes in miRNA regulatory effect than with the expression of

  20. In silico miRNA prediction in metazoan genomes: balancing between sensitivity and specificity

    Directory of Open Access Journals (Sweden)

    Fiers Mark WJE

    2009-04-01

    Full Text Available Abstract Background MicroRNAs (miRNAs, short ~21-nucleotide RNA molecules, play an important role in post-transcriptional regulation of gene expression. The number of known miRNA hairpins registered in the miRBase database is rapidly increasing, but recent reports suggest that many miRNAs with restricted temporal or tissue-specific expression remain undiscovered. Various strategies for in silico miRNA identification have been proposed to facilitate miRNA discovery. Notably support vector machine (SVM methods have recently gained popularity. However, a drawback of these methods is that they do not provide insight into the biological properties of miRNA sequences. Results We here propose a new strategy for miRNA hairpin prediction in which the likelihood that a genomic hairpin is a true miRNA hairpin is evaluated based on statistical distributions of observed biological variation of properties (descriptors of known miRNA hairpins. These distributions are transformed into a single and continuous outcome classifier called the L score. Using a dataset of known miRNA hairpins from the miRBase database and an exhaustive set of genomic hairpins identified in the genome of Caenorhabditis elegans, a subset of 18 most informative descriptors was selected after detailed analysis of correlation among and discriminative power of individual descriptors. We show that the majority of previously identified miRNA hairpins have high L scores, that the method outperforms miRNA prediction by threshold filtering and that it is more transparent than SVM classifiers. Conclusion The L score is applicable as a prediction classifier with high sensitivity for novel miRNA hairpins. The L-score approach can be used to rank and select interesting miRNA hairpin candidates for downstream experimental analysis when coupled to a genome-wide set of in silico-identified hairpins or to facilitate the analysis of large sets of putative miRNA hairpin loci obtained in deep

  1. Reenacting the birth of an intron

    Energy Technology Data Exchange (ETDEWEB)

    Hellsten, Uffe; Aspden, Julie L.; Rio, Donald C.; Rokhsar, Daniel S.

    2011-07-01

    An intron is an extended genomic feature whose function requires multiple constrained positions - donor and acceptor splice sites, a branch point, a polypyrimidine tract and suitable splicing enhancers - that may be distributed over hundreds or thousands of nucleotides. New introns are therefore unlikely to emerge by incremental accumulation of functional sub-elements. Here we demonstrate that a functional intron can be created de novo in a single step by a segmental genomic duplication. This experiment recapitulates in vivo the birth of an intron that arose in the ancestral jawed vertebrate lineage nearly half a billion years ago.

  2. The mitochondrial LSU rRNA group II intron of Ustilago maydis encodes an active homing endonuclease likely involved in intron mobility.

    Directory of Open Access Journals (Sweden)

    Anja Pfeifer

    Full Text Available BACKGROUND: The a2 mating type locus gene lga2 is critical for uniparental mitochondrial DNA inheritance during sexual development of Ustilago maydis. Specifically, the absence of lga2 results in biparental inheritance, along with efficient transfer of intronic regions in the large subunit rRNA gene between parental molecules. However, the underlying role of the predicted LAGLIDADG homing endonuclease gene I-UmaI located within the group II intron LRII1 has remained unresolved. METHODOLOGY/PRINCIPAL FINDINGS: We have investigated the enzymatic activity of I-UmaI in vitro based on expression of a tagged full-length and a naturally occurring mutant derivative, which harbors only the N-terminal LAGLIDADG domain. This confirmed Mg²⁺-dependent endonuclease activity and cleavage at the LRII1 insertion site to generate four base pair extensions with 3' overhangs. Specifically, I-UmaI recognizes an asymmetric DNA sequence with a minimum length of 14 base pairs (5'-GACGGGAAGACCCT-3' and tolerates subtle base pair substitutions within the homing site. Enzymatic analysis of the mutant variant indicated a correlation between the activity in vitro and intron homing. Bioinformatic analyses revealed that putatively functional or former functional I-UmaI homologs are confined to a few members within the Ustilaginales and Agaricales, including the phylogenetically distant species Lentinula edodes, and are linked to group II introns inserted into homologous positions in the LSU rDNA. CONCLUSIONS/SIGNIFICANCE: The present data provide strong evidence that intron homing efficiently operates under conditions of biparental inheritance in U. maydis. Conversely, uniparental inheritance may be critical to restrict the transmission of mobile introns. Bioinformatic analyses suggest that I-UmaI-associated introns have been acquired independently in distant taxa and are more widespread than anticipated from available genomic data.

  3. Reference miRNAs for miRNAome analysis of urothelial carcinomas.

    Directory of Open Access Journals (Sweden)

    Nadine Ratert

    Full Text Available BACKGROUND/OBJECTIVE: Reverse transcription quantitative real-time PCR (RT-qPCR is widely used in microRNA (miRNA expression studies on cancer. To compensate for the analytical variability produced by the multiple steps of the method, relative quantification of the measured miRNAs is required, which is based on normalization to endogenous reference genes. No study has been performed so far on reference miRNAs for normalization of miRNA expression in urothelial carcinoma. The aim of this study was to identify suitable reference miRNAs for miRNA expression studies by RT-qPCR in urothelial carcinoma. METHODS: Candidate reference miRNAs were selected from 24 urothelial carcinoma and normal bladder tissue samples by miRNA microarrays. The usefulness of these candidate reference miRNAs together with the commonly for normalization purposes used small nuclear RNAs RNU6B, RNU48, and Z30 were thereafter validated by RT-qPCR in 58 tissue samples and analyzed by the algorithms geNorm, NormFinder, and BestKeeper. PRINCIPAL FINDINGS: Based on the miRNA microarray data, a total of 16 miRNAs were identified as putative reference genes. After validation by RT-qPCR, miR-101, miR-125a-5p, miR-148b, miR-151-5p, miR-181a, miR-181b, miR-29c, miR-324-3p, miR-424, miR-874, RNU6B, RNU48, and Z30 were used for geNorm, NormFinder, and BestKeeper analyses that gave different combinations of recommended reference genes for normalization. CONCLUSIONS: The present study provided the first systematic analysis for identifying suitable reference miRNAs for miRNA expression studies of urothelial carcinoma by RT-qPCR. Different combinations of reference genes resulted in reliable expression data for both strongly and less strongly altered miRNAs. Notably, RNU6B, which is the most frequently used reference gene for miRNA studies, gave inaccurate normalization. The combination of four (miR-101, miR-125a-5p, miR-148b, and miR-151-5p or three (miR-148b, miR-181b, and miR-874

  4. Generation of miRNA sponge constructs

    NARCIS (Netherlands)

    Kluiver, Joost; Slezak-Prochazka, Izabella; Smigielska-Czepiel, Katarzyna; Halsema, Nancy; Kroesen, Bart-Jan; van den Berg, Anke

    2012-01-01

    MicroRNA (miRNA) sponges are RNA molecules with repeated miRNA antisense sequences that can sequester miRNAs from their endogenous targets and thus serve as a decoy. Stably expressed miRNA sponges are especially valuable for long-term loss-of-function studies and can be used in vitro and in vivo. We

  5. Caryophyllales: Evaluating phylogenetic signal in trnK intron versus matK

    Institute of Scientific and Technical Information of China (English)

    Sunny S. CRAWLEY; Khidir W. HILU

    2012-01-01

    We assess the phylogenetic information in trnK intron at the ordinal level using the Caryophyllales and compare it with that derived from matK.The trnK gene is split into two exons by an intron that includes the matK gene.The plastid trnK is a tRNA gene encoding Lysine(UUU),whereas the matK gene is a putative group Ⅱ intron maturase.The two regions are usually coamplified,and trnK intron is partially sequenced but its sequences are often excluded from phylogenetic reconstruction at deep historic levels.This study shows that the two regions are comparable in proportion of variable sites,possess a comparable pattern of substitution rates per site,and display similar phylogenetic informativeness profiles and per-site informativeness.Phylogenetic analyses show strong congruence between phylogenetic trees based on matK and trnK intron partitioned datasets from 45 genera representing 30 of the 34 recognized Caryophyllales families.The trnK intron alone provides a relatively well-resolved topology for the order.Combining the trnK intron with matK sequence data resulted in six most parsimonious trees,differing only in the placement of Claytonia (Portulacaceae) within the noncore group.A well-supported major basal split in the order into core and noncore Caryophyllales with Rhabdodendraceae,Simmondsiaceae,and Asteropeiaceae as sister to remaining core lineages is evident in partitioned and combined analyses.The placement of these three families has been disputable,impacting the overall backbone topology of the Caryophyllales.This study demonstrates the cost effectiveness of using the trnK intron along with matK (both substitutions and insertions/deletions) at deeper phylogenetic level.

  6. Computational prediction of candidate miRNAs and their targets from the completed Linum ussitatissimum genome and EST database

    Directory of Open Access Journals (Sweden)

    Tiffanie Y. Moss

    2012-06-01

    Full Text Available Flax is an important agronomic crop grown for its fiber (linen and oil (linseed oil. In spite of many thousands of years of breeding some fiber varieties have been shown to rapidly respond to environmental stress with heritable changes to its genome. Many miRNAs appear to be induced by abiotic or biotic conditions experienced through the plant life cycle. Computational miRNA analysis of the flax genome provides a foundation for subsequent research on miRNA function in Linum usitatissimum and may also provide novel insight into any regulatory role the RNAi pathway may play in generating adaptive structural variation in response to environmental stress. Here a bioinformatics approach is used to screen for miRNAs previously identified in other plant species, as well as to predict putative miRNAs unique to a particular species which may not have been identified as they are less abundant or dependent upon a specific set of environmental conditions. Twelve miRNA genes were identified in flax on the basis of unique pre-miRNA positions with structural homology to plant pre-miRNAs and complete sequence homology to published plant miRNAs. These miRNAs were found to belong to 7 miRNA families, with an additional 2 matches corresponding to as yet unnamed poplar miRNAs and a parologous miRNA with partial sequence homology to mtr-miR4414b. An additional 649 novel and distinct flax miRNA genes were identified to form from canonical hairpin structures and to have putative targets among the ~30,000 flax Unigenes.

  7. Energizing miRNA research: a review of the role of miRNAs in lipid metabolism, with a prediction that miR-103/107 regulates human metabolic pathways.

    Science.gov (United States)

    Wilfred, Bernard R; Wang, Wang-Xia; Nelson, Peter T

    2007-07-01

    MicroRNAs (miRNAs) are powerful regulators of gene expression. Although first discovered in worm larvae, miRNAs play fundamental biological roles-including in humans-well beyond development. MiRNAs participate in the regulation of metabolism (including lipid metabolism) for all animal species studied. A review of the fascinating and fast-growing literature on miRNA regulation of metabolism can be parsed into three main categories: (1) adipocyte biochemistry and cell fate determination; (2) regulation of metabolic biochemistry in invertebrates; and (3) regulation of metabolic biochemistry in mammals. Most research into the 'function' of a given miRNA in metabolic pathways has concentrated on a given miRNA acting upon a particular 'target' mRNA. Whereas in some biological contexts the effects of a given miRNA:mRNA pair may predominate, this might not be the case generally. In order to provide an example of how a single miRNA could regulate multiple 'target' mRNAs or even entire human metabolic pathways, we include a discussion of metabolic pathways that are predicted to be regulated by the miRNA paralogs, miR-103 and miR-107. These miRNAs, which exist in vertebrate genomes within introns of the pantothenate kinase (PANK) genes, are predicted by bioinformatics to affect multiple mRNA targets in pathways that involve cellular Acetyl-CoA and lipid levels. Significantly, PANK enzymes also affect these pathways, so the miRNA and 'host' gene may act synergistically. These predictions require experimental verification. In conclusion, a review of the literature on miRNA regulation of metabolism leads us believe that the future will provide researchers with many additional energizing revelations.

  8. miRNAs Related to Skeletal Diseases.

    Science.gov (United States)

    Seeliger, Claudine; Balmayor, Elizabeth R; van Griensven, Martijn

    2016-09-01

    miRNAs as non-coding, short, double-stranded RNA segments are important for cellular biological functions, such as proliferation, differentiation, and apoptosis. miRNAs mainly contribute to the inhibition of important protein translations through their cleavage or direct repression of target messenger RNAs expressions. In the last decade, miRNAs got in the focus of interest with new publications on miRNAs in the context of different diseases. For many types of cancer or myocardial damage, typical signatures of local or systemically circulating miRNAs have already been described. However, little is known about miRNA expressions and their molecular effect in skeletal diseases. An overview of published studies reporting miRNAs detection linked with skeletal diseases was conducted. All regulated miRNAs were summarized and their molecular interactions were illustrated. This review summarizes the involvement and interaction of miRNAs in different skeletal diseases. Thereby, 59 miRNAs were described to be deregulated in tissue, cells, or in the circulation of osteoarthritis (OA), 23 miRNAs deregulated in osteoporosis, and 107 miRNAs deregulated in osteosarcoma (OS). The molecular influences of miRNAs regarding OA, osteoporosis, and OS were illustrated. Specific miRNA signatures for skeletal diseases are described in the literature. Some overlapped, but also unique ones for each disease exist. These miRNAs may present useful targets for the development of new therapeutic approaches and are candidates for diagnostic evaluations.

  9. Preliminary analysis of miRNA pathway in Schistosoma mansoni.

    Science.gov (United States)

    Gomes, Matheus S; Cabral, Fernanda J; Jannotti-Passos, Liana K; Carvalho, Omar; Rodrigues, Vanderlei; Baba, Elio H; Sá, Renata G

    2009-03-01

    RNA silencing refers to a series of nuclear and cytoplasmatic processes involved in the post-transcriptional regulation of gene expression or post-transcriptional gene silencing (PTGS), either by sequence-specific mRNA degradation or by translational arrest. The best characterized small RNAs are microRNAs (miRNAs), which predominantly perform gene silencing through post-transcriptional mechanisms. In this work we used bioinformatic approaches to identify the parasitic trematode Schistosoma mansoni sequences that are similar to enzymes involved in the post-transcriptional gene silencing mediated by miRNA pathway. We used amino acid sequences of well-known proteins involved in the miRNA pathway against S. mansoni genome and transcriptome databases identifying a total of 13 putative proteins in the parasite. In addition, the transcript levels of SmDicer1 and SmAgo2/3/4 were identified by qRT-PCR using cercariae, adult worms, eggs and in vitro cultivated schistosomula. Our results showed that the SmDicer1 and SmAgo2/3/4 are differentially expressed during schistosomula development, suggesting that the miRNA pathway is regulated at the transcript level and therefore may control gene expression during the life cycle of S. mansoni.

  10. Genic regions of a large salamander genome contain long introns and novel genes

    Directory of Open Access Journals (Sweden)

    Bryant Susan V

    2009-01-01

    Full Text Available Abstract Background The basis of genome size variation remains an outstanding question because DNA sequence data are lacking for organisms with large genomes. Sixteen BAC clones from the Mexican axolotl (Ambystoma mexicanum: c-value = 32 × 109 bp were isolated and sequenced to characterize the structure of genic regions. Results Annotation of genes within BACs showed that axolotl introns are on average 10× longer than orthologous vertebrate introns and they are predicted to contain more functional elements, including miRNAs and snoRNAs. Loci were discovered within BACs for two novel EST transcripts that are differentially expressed during spinal cord regeneration and skin metamorphosis. Unexpectedly, a third novel gene was also discovered while manually annotating BACs. Analysis of human-axolotl protein-coding sequences suggests there are 2% more lineage specific genes in the axolotl genome than the human genome, but the great majority (86% of genes between axolotl and human are predicted to be 1:1 orthologs. Considering that axolotl genes are on average 5× larger than human genes, the genic component of the salamander genome is estimated to be incredibly large, approximately 2.8 gigabases! Conclusion This study shows that a large salamander genome has a correspondingly large genic component, primarily because genes have incredibly long introns. These intronic sequences may harbor novel coding and non-coding sequences that regulate biological processes that are unique to salamanders.

  11. A comprehensive genome-wide study on tissue-specific and abiotic stress-specific miRNAs in Triticum aestivum.

    Directory of Open Access Journals (Sweden)

    Ritu Pandey

    Full Text Available Productivity of wheat crop is largely dependent on its growth and development that, in turn, is mainly regulated by environmental conditions, including abiotic stress factors. miRNAs are key regulators of gene expression networks involved in diverse aspects of development and stress responses in plants. Using high-throughput sequencing of eight small RNA libraries prepared from diverse abiotic stresses and tissues, we identified 47 known miRNAs belonging to 20 families, 49 true novel and 1030 candidate novel miRNAs. Digital gene expression analysis revealed that 257 miRNAs exhibited tissue-specific expression and 74 were associated with abiotic stresses. Putative target genes were predicted for miRNAs identified in this study and their grouping into functional categories indicated that the putative targets were involved in diverse biological processes. RLM-RACE of predicted targets of three known miRNAs (miR156, miR160 and miR164 confirmed their mRNA cleavage, thus indicating their regulation at post-transcriptional level by the corresponding miRNAs. Mapping of the sequenced data onto the wheat progenitors and closely related monocots revealed a large number of evolutionary conserved miRNAs. Additional expression profiling of some of these miRNAs in other abiotic stresses underline their involvement in multiple stresses. Our findings provide valuable resource for an improved understanding of the role of miRNAs in stress tolerance as well as plant development.

  12. Prioritizing and selecting likely novel miRNAs from NGS data.

    Science.gov (United States)

    Backes, Christina; Meder, Benjamin; Hart, Martin; Ludwig, Nicole; Leidinger, Petra; Vogel, Britta; Galata, Valentina; Roth, Patrick; Menegatti, Jennifer; Grässer, Friedrich; Ruprecht, Klemens; Kahraman, Mustafa; Grossmann, Thomas; Haas, Jan; Meese, Eckart; Keller, Andreas

    2016-04-07

    Small non-coding RNAs play a key role in many physiological and pathological processes. Since 2004, miRNA sequences have been catalogued in miRBase, which is currently in its 21st version. We investigated sequence and structural features of miRNAs annotated in the miRBase and compared them between different versions of this reference database. We have identified that the two most recent releases (v20 and v21) are influenced by next-generation sequencing based miRNA predictions and show significant deviation from miRNAs discovered prior to the high-throughput profiling period. From the analysis of miRBase, we derived a set of key characteristics to predict new miRNAs and applied the implemented algorithm to evaluate novel blood-borne miRNA candidates. We carried out 705 individual whole miRNA sequencings of blood cells and collected a total of 9.7 billion reads. Using miRDeep2 we initially predicted 1452 potentially novel miRNAs. After excluding false positives, 518 candidates remained. These novel candidates were ranked according to their distance to the features in the early miRBase versions allowing for an easier selection of a subset of putative miRNAs for validation. Selected candidates were successfully validated by qRT-PCR and northern blotting. In addition, we implemented a web-server for ranking potential miRNA candidates, which is available at:www.ccb.uni-saarland.de/novomirank.

  13. The Tumor Cytosol miRNAs, Fluid miRNAs and Exosome miRNAs in Lung Cancer

    Directory of Open Access Journals (Sweden)

    Xin eQin

    2015-01-01

    Full Text Available The focus of this review is to provide an update on the progress of microRNAs (miRNAs as potential biomarkers for lung cancer. miRNAs are single-stranded, small noncoding RNAs that regulate gene expression and show tissue-specific signatures. Accumulating evidence indicates that miRNA expression patterns represent the in vivo status in physiology and disease. Moreover, miRNAs are stable in serum and other clinically convenient and available tissue sources, so they are being developed as biomarkers for cancer and other diseases. Cancer is currently the primary driver of the field, but miRNA biomarkers are being developed for many other diseases such as cardiovascular and central nervous system diseases. Here we examine the framework and scope of the miRNA landscape as it specifically relates to the translation of miRNA expression patterns/signatures into biomarkers for developing diagnostics for lung cancer. We focus on examining tumor cytosol miRNAs, fluid miRNAs, and exosome miRNAs in lung cancer, the connections among these miRNAs, and the potential of miRNA biomarkers for the development of diagnostics. In lung cancer, miRNAs have been studied in both cell populations and in the circulation. However, a major challenge is to develop biomarkers to monitor cancer development and to identify circulating miRNAs that are linked to cancer stage. Importantly, the fact that miRNAs can be successfully harvested from biological fluids allows for the development of biofluid biopsies, in which miRNAs as circulating biomarkers can be captured and analyzed ex vivo. Our hope is that these minimally invasive entities provide a window to the in vivo milieu of the patients without the need for costly, complex invasive procedures, rapidly moving miRNAs from research to the clinic.

  14. Conserved intron positions in ancient protein modules

    Directory of Open Access Journals (Sweden)

    de Roos Albert DG

    2007-02-01

    Full Text Available Abstract Background The timing of the origin of introns is of crucial importance for an understanding of early genome architecture. The Exon theory of genes proposed a role for introns in the formation of multi-exon proteins by exon shuffling and predicts the presence of conserved splice sites in ancient genes. In this study, large-scale analysis of potential conserved splice sites was performed using an intron-exon database (ExInt derived from GenBank. Results A set of conserved intron positions was found by matching identical splice sites sequences from distantly-related eukaryotic kingdoms. Most amino acid sequences with conserved introns were homologous to consensus sequences of functional domains from conserved proteins including kinases, phosphatases, small GTPases, transporters and matrix proteins. These included ancient proteins that originated before the eukaryote-prokaryote split, for instance the catalytic domain of protein phosphatase 2A where a total of eleven conserved introns were found. Using an experimental setup in which the relation between a splice site and the ancientness of its surrounding sequence could be studied, it was found that the presence of an intron was positively correlated to the ancientness of its surrounding sequence. Intron phase conservation was linked to the conservation of the gene sequence and not to the splice site sequence itself. However, no apparent differences in phase distribution were found between introns in conserved versus non-conserved sequences. Conclusion The data confirm an origin of introns deep in the eukaryotic branch and is in concordance with the presence of introns in the first functional protein modules in an 'Exon theory of genes' scenario. A model is proposed in which shuffling of primordial short exonic sequences led to the formation of the first functional protein modules, in line with hypotheses that see the formation of introns integral to the origins of genome evolution

  15. Circulating miRNAs: roles in cancer diagnosis, prognosis and therapy.

    Science.gov (United States)

    Cheng, Guofeng

    2015-01-01

    MicroRNAs (miRNAs) belong to a class of small non-coding RNAs that regulate numerous biological processes by targeting a broad set of messenger RNAs. Recently, miRNAs have been detected in remarkably stable forms in many types of body fluids. A comparison between cancer patients and healthy individuals has clearly shown that certain types of circulating miRNAs are associated with cancer initiation and progression. Research on miRNA-based biomarkers has witnessed phenomenal growth, owing to the non-invasive nature of miRNA-based screening assays and their sensitivity and specificity in detecting cancers. Consequently, a considerable effort has been devoted to identify suitable miRNAs for cancer diagnosis and also decode the information carried by circulating miRNAs. This review highlights the current studies that focus on the identification of circulating miRNA-based diagnostic and prognostic markers, for the most prevalent types of cancer. Additionally, the review also provides an insight into the putative functions of miRNAs, and attempts to delineate the mechanisms through which they are released into the bloodstream. Moreover, methodologies and strategies for identification of circulating miRNAs in cancers are summarized. Finally, potential strategies for circulating miRNA-based cancer therapies are proposed.

  16. Small RNA Sequencing Based Identification of MiRNAs in Daphnia magna.

    Science.gov (United States)

    Ünlü, Ercan Selçuk; Gordon, Donna M; Telli, Murat

    2015-01-01

    Small RNA molecules are short, non-coding RNAs identified for their crucial role in post-transcriptional regulation. A well-studied example includes miRNAs (microRNAs) which have been identified in several model organisms including the freshwater flea and planktonic crustacean Daphnia. A model for epigenetic-based studies with an available genome database, the identification of miRNAs and their potential role in regulating Daphnia gene expression has only recently garnered interest. Computational-based work using Daphnia pulex, has indicated the existence of 45 miRNAs, 14 of which have been experimentally verified. To extend this study, we took a sequencing approach towards identifying miRNAs present in a small RNA library isolated from Daphnia magna. Using Perl codes designed for comparative genomic analysis, 815,699 reads were obtained from 4 million raw reads and run against a database file of known miRNA sequences. Using this approach, we have identified 205 putative mature miRNA sequences belonging to 188 distinct miRNA families. Data from this study provides critical information necessary to begin an investigation into a role for these transcripts in the epigenetic regulation of Daphnia magna.

  17. Nuclear group I introns in self-splicing and beyond

    Science.gov (United States)

    2013-01-01

    Group I introns are a distinct class of RNA self-splicing introns with an ancient origin. All known group I introns present in eukaryote nuclei interrupt functional ribosomal RNA genes located in ribosomal DNA loci. The discovery of the Tetrahymena intron more than 30 years ago has been essential to our understanding of group I intron catalysis, higher-order RNA structure, and RNA folding, but other intron models have provided information about the biological role. Nuclear group I introns appear widespread among eukaryotic microorganisms, and the plasmodial slime molds (myxomycetes) contain an abundance of self-splicing introns. Here, we summarize the main conclusions from previous work on the Tetrahymena intron on RNA self-splicing catalysis as well as more recent work on myxomycete intron biology. Group I introns in myxomycetes that represent different evolutionary stages, biological roles, and functional settings are discussed. PMID:23738941

  18. Intron phase correlations and the evolution of the intron/exon structure of genes.

    Science.gov (United States)

    Long, M; Rosenberg, C; Gilbert, W

    1995-01-01

    Two issues in the evolution of the intron/exon structure of genes are the role of exon shuffling and the origin of introns. Using a large data base of eukaryotic intron-containing genes, we have found that there are correlations between intron phases leading to an excess of symmetric exons and symmetric exon sets. We interpret these excesses as manifestations of exon shuffling and make a conservative estimate that at least 19% of the exons in the data base were involved in exon shuffling, suggesting an important role for exon shuffling in evolution. Furthermore, these excesses of symmetric exons appear also in those regions of eukaryotic genes that are homologous to prokaryotic genes: the ancient conserved regions. This last fact cannot be explained in terms of the insertional theory of introns but rather supports the concept that some of the introns were ancient, the exon theory of genes. PMID:8618928

  19. Systematic Analysis of Small RNAs Associated with Human Mitochondria by Deep Sequencing: Detailed Analysis of Mitochondrial Associated miRNA

    Science.gov (United States)

    Sripada, Lakshmi; Tomar, Dhanendra; Prajapati, Paresh; Singh, Rochika; Singh, Arun Kumar; Singh, Rajesh

    2012-01-01

    Mitochondria are one of the central regulators of many cellular processes beyond its well established role in energy metabolism. The inter-organellar crosstalk is critical for the optimal function of mitochondria. Many nuclear encoded proteins and RNA are imported to mitochondria. The translocation of small RNA (sRNA) including miRNA to mitochondria and other sub-cellular organelle is still not clear. We characterized here sRNA including miRNA associated with human mitochondria by cellular fractionation and deep sequencing approach. Mitochondria were purified from HEK293 and HeLa cells for RNA isolation. The sRNA library was generated and sequenced using Illumina system. The analysis showed the presence of unique population of sRNA associated with mitochondria including miRNA. Putative novel miRNAs were characterized from unannotated sRNA sequences. The study showed the association of 428 known, 196 putative novel miRNAs to mitochondria of HEK293 and 327 known, 13 putative novel miRNAs to mitochondria of HeLa cells. The alignment of sRNA to mitochondrial genome was also studied. The targets were analyzed using DAVID to classify them in unique networks using GO and KEGG tools. Analysis of identified targets showed that miRNA associated with mitochondria regulates critical cellular processes like RNA turnover, apoptosis, cell cycle and nucleotide metabolism. The six miRNAs (counts >1000) associated with mitochondria of both HEK293 and HeLa were validated by RT-qPCR. To our knowledge, this is the first systematic study demonstrating the associations of sRNA including miRNA with mitochondria that may regulate site-specific turnover of target mRNA important for mitochondrial related functions. PMID:22984580

  20. The origin of introns and their role in eukaryogenesis: a compromise solution to the introns-early versus introns-late debate?

    Directory of Open Access Journals (Sweden)

    Koonin Eugene V

    2006-08-01

    Full Text Available Abstract Background Ever since the discovery of 'genes in pieces' and mRNA splicing in eukaryotes, origin and evolution of spliceosomal introns have been considered within the conceptual framework of the 'introns early' versus 'introns late' debate. The 'introns early' hypothesis, which is closely linked to the so-called exon theory of gene evolution, posits that protein-coding genes were interrupted by numerous introns even at the earliest stages of life's evolution and that introns played a major role in the origin of proteins by facilitating recombination of sequences coding for small protein/peptide modules. Under this scenario, the absence of spliceosomal introns in prokaryotes is considered to be a result of "genome streamlining". The 'introns late' hypothesis counters that spliceosomal introns emerged only in eukaryotes, and moreover, have been inserted into protein-coding genes continuously throughout the evolution of eukaryotes. Beyond the formal dilemma, the more substantial side of this debate has to do with possible roles of introns in the evolution of eukaryotes. Results I argue that several lines of evidence now suggest a coherent solution to the introns-early versus introns-late debate, and the emerging picture of intron evolution integrates aspects of both views although, formally, there seems to be no support for the original version of introns-early. Firstly, there is growing evidence that spliceosomal introns evolved from group II self-splicing introns which are present, usually, in small numbers, in many bacteria, and probably, moved into the evolving eukaryotic genome from the α-proteobacterial progenitor of the mitochondria. Secondly, the concept of a primordial pool of 'virus-like' genetic elements implies that self-splicing introns are among the most ancient genetic entities. Thirdly, reconstructions of the ancestral state of eukaryotic genes suggest that the last common ancestor of extant eukaryotes had an intron

  1. Review of miRNA Technology

    Institute of Scientific and Technical Information of China (English)

    Zhang Tangyao

    2015-01-01

    miRNAs are non-coding RNA molecules exist in eukaryotic with 22 nucleotides. The abnormal expression of miRNAs are also lead to somedisease. The monitoring of cancer related miRNAs, oncomiRs, will help diagnose caners. The main methods to analyzing the profile of miRNA expression fordiagnosing cancer are microarray test and real-time PCR. The the studies on miRomics will bring revolutionary breakthrough to medicine and carcinobiology.

  2. Small RNA Sequencing Reveals Differential miRNA Expression in the Early Development of Broccoli (Brassica oleracea var. italica) Pollen

    Science.gov (United States)

    Li, Hui; Wang, Yu; Wu, Mei; Li, Lihong; Jin, Chuan; Zhang, Qingli; Chen, Chengbin; Song, Wenqin; Wang, Chunguo

    2017-01-01

    Pollen development is an important and complex biological process in the sexual reproduction of flowering plants. Although the cytological characteristics of pollen development are well defined, the regulation of its early stages remains largely unknown. In the present study, miRNAs were explored in the early development of broccoli (Brassica oleracea var. italica) pollen. A total of 333 known miRNAs that originated from 235 miRNA families were detected. Fifty-five novel miRNA candidates were identified. Sixty of the 333 known miRNAs and 49 of the 55 predicted novel miRNAs exhibited significantly differential expression profiling in the three distinct developmental stages of broccoli pollen. Among these differentially expressed miRNAs, miRNAs that would be involved in the developmental phase transition from uninucleate microspores to binucleate pollen grains or from binucleate to trinucleate pollen grains were identified. miRNAs that showed significantly enriched expression in a specific early stage of broccoli pollen development were also observed. In addition, 552 targets for 127 known miRNAs and 69 targets for 40 predicted novel miRNAs were bioinformatically identified. Functional annotation and GO (Gene Ontology) analysis indicated that the putative miRNA targets showed significant enrichment in GO terms that were related to plant organ formation and morphogenesis. Some of enriched GO terms were detected for the targets directly involved in plant male reproduction development. These findings provided new insights into the functions of miRNA-mediated regulatory networks in broccoli pollen development.

  3. Challenges in the miRNA research

    DEFF Research Database (Denmark)

    Singh, Tiratha Raj; Gupta, Arun; Suravajhala, Prashanth

    2013-01-01

    While it is known that the human genes are regulated by microRNAs (miRNAs), recent links with cancer and other diseases have widely caught interest. With several bioinformatics platforms and approaches on rise that has led to discovery of human miRNAs, validation and need for understanding miRNAs...

  4. Role of miRNAs in Epicardial Adipose Tissue in CAD Patients with T2DM

    Directory of Open Access Journals (Sweden)

    Yang Liu

    2016-01-01

    Full Text Available Background. Epicardial adipose tissue (EAT is identified as an atypical fat depot surrounding the heart with a putative role in the involvement of metabolic disorders, including obesity, type-2 diabetes mellitus, and atherosclerosis. We profiled miRNAs in EAT of metabolic patients with coronary artery disease (CAD and type-2 diabetes mellitus (T2DM versus metabolically healthy patients by microarray. Compared to metabolically healthy patients, we identified forty-two miRNAs that are differentially expressed in patients with CAD and T2DM from Xinjiang, China. Eleven miRNAs were selected as potential novel miRNAs according to P value and fold change. Then the potential novel miRNAs targeted genes were predicted via TargetScan, PicTar, and miRTarbase, and the function of the target genes was predicted via Gene Ontology (GO analysis while the enriched KEGG pathway analyses of the miRNAs targeted genes were performed by bioinformatics software DAVID. Then protein-protein interaction networks of the targeted gene were conducted by online software STRING. Finally, using microarray, bioinformatics approaches revealed the possible molecular mechanisms pathogenesis of CAD and T2DM. A total of 11 differentially expressed miRNAs were identified and among them, hsa-miR-4687-3p drew specific attention. Bioinformatics analysis revealed that insulin signaling pathway is the central way involved in the progression of metabolic disorders. Conclusions. The current findings support the fact that miRNAs are involved in the pathogenesis of metabolic disorders in EAT of CAD patients with T2DM, and validation of the results of these miRNAs by independent and prospective study is certainly warranted.

  5. FGLamide Allatostatin genes in Arthropoda: introns early or late?

    Science.gov (United States)

    Martínez-Pérez, Francisco; Bendena, William G; Chang, Belinda S W; Tobe, Stephen S

    2009-07-01

    FGLamide allatostatins are invertebrate neuropeptides which inhibit juvenile hormone biosynthesis in Dictyoptera and related orders and also show myomodulatory activity. The FGLamide allatostatin (AST) gene structure in Dictyoptera is intronless within the ORF, whereas in 9 species of Diptera, the FGLamide AST ORF has one intron. To investigate the evolutionary history of AST intron structure, (intron early versus intron late hypothesis), all available Arthropoda FGLamide AST gene sequences were examined from genome databases with reference to intron presence and position/phase. Three types of FGLamide AST ORF organization were found: intronless in I. scapularis and P. humanus corporis; one intron in D. pulex, A. pisum, A. mellifera and five Drosophila sp.; two introns in N. vitripennis, B. mori strains, A. aegypti, A. gambiae and C. quinquefasciatus. The literature suggests that for the majority of genes examined, most introns exist between codons (phase 0) which may reflect an ancient function of introns to separate protein modules. 60% of the FGLamide AST ORFs introns were between the first and second base within a codon (phase 1), 28% were between the second and third nucleotides within a codon (phase two) and 12% were phase 0. As would be required for correct intron splicing consensus sequence, 84% of introns were in codons starting with guanine. The positioning of introns was a maximum of 9 codons from a dibasic cleavage site. Our results suggest that the introns in the analyzed species support the intron late model.

  6. miRNAs in brain development

    Energy Technology Data Exchange (ETDEWEB)

    Petri, Rebecca; Malmevik, Josephine; Fasching, Liana; Åkerblom, Malin; Jakobsson, Johan, E-mail: johan.jakobsson@med.lu.se

    2014-02-01

    MicroRNAs (miRNAs) are small, non-coding RNAs that negatively regulate gene expression at the post-transcriptional level. In the brain, a large number of miRNAs are expressed and there is a growing body of evidence demonstrating that miRNAs are essential for brain development and neuronal function. Conditional knockout studies of the core components in the miRNA biogenesis pathway, such as Dicer and DGCR8, have demonstrated a crucial role for miRNAs during the development of the central nervous system. Furthermore, mice deleted for specific miRNAs and miRNA-clusters demonstrate diverse functional roles for different miRNAs during the development of different brain structures. miRNAs have been proposed to regulate cellular functions such as differentiation, proliferation and fate-determination of neural progenitors. In this review we summarise the findings from recent studies that highlight the importance of miRNAs in brain development with a focus on the mouse model. We also discuss the technical limitations of current miRNA studies that still limit our understanding of this family of non-coding RNAs and propose the use of novel and refined technologies that are needed in order to fully determine the impact of specific miRNAs in brain development. - Highlights: • miRNAs are essential for brain development and neuronal function. • KO of Dicer is embryonically lethal. • Conditional Dicer KO results in defective proliferation or increased apoptosis. • KO of individual miRNAs or miRNA families is necessary to determine function.

  7. Determination of the human cardiomyocyte mRNA and miRNA differentiation network by fine-scale profiling.

    Science.gov (United States)

    Babiarz, Joshua E; Ravon, Morgane; Sridhar, Sriram; Ravindran, Palanikumar; Swanson, Brad; Bitter, Hans; Weiser, Thomas; Chiao, Eric; Certa, Ulrich; Kolaja, Kyle L

    2012-07-20

    To gain insight into the molecular regulation of human heart development, a detailed comparison of the mRNA and miRNA transcriptomes across differentiating human-induced pluripotent stem cell (hiPSC)-derived cardiomyocytes and biopsies from fetal, adult, and hypertensive human hearts was performed. Gene ontology analysis of the mRNA expression levels of the hiPSCs differentiating into cardiomyocytes revealed 3 distinct groups of genes: pluripotent specific, transitional cardiac specification, and mature cardiomyocyte specific. Hierarchical clustering of the mRNA data revealed that the transcriptome of hiPSC cardiomyocytes largely stabilizes 20 days after initiation of differentiation. Nevertheless, analysis of cells continuously cultured for 120 days indicated that the cardiomyocytes continued to mature toward a more adult-like gene expression pattern. Analysis of cardiomyocyte-specific miRNAs (miR-1, miR-133a/b, and miR-208a/b) revealed an miRNA pattern indicative of stem cell to cardiomyocyte specification. A biostatistitical approach integrated the miRNA and mRNA expression profiles revealing a cardiomyocyte differentiation miRNA network and identified putative mRNAs targeted by multiple miRNAs. Together, these data reveal the miRNA network in human heart development and support the notion that overlapping miRNA networks re-enforce transcriptional control during developmental specification.

  8. Dynamics of miRNA transcriptome during gonadal development of zebrafish

    Science.gov (United States)

    Presslauer, Christopher; Tilahun Bizuayehu, Teshome; Kopp, Martina; Fernandes, Jorge M. O.; Babiak, Igor

    2017-01-01

    Studies in non-teleost vertebrates have found microRNAs (miRNAs) to be essential for proper gonadal development. However, comparatively little is known about their role during gonadal development in teleost fishes. So far in zebrafish, a model teleost, transcript profiling throughout gonadal development has not been established because of a tiny size of an organ in juvenile stages and its poor distinguishability from surrounding tissues. We performed small RNA sequencing on isolated gonads of See-Thru-Gonad line, from the undifferentiated state at 3 weeks post fertilization (wpf) to fully mature adults at 24 wpf. We identified 520 gonadal mature miRNAs; 111 of them had significant changes in abundance over time, while 50 miRNAs were either testis- or ovary-enriched significantly in at least one developmental stage. We characterized patterns of miRNA abundance over time including isomiR variants. We identified putative germline versus gonadal somatic miRNAs through differential small RNA sequencing of isolated gametes versus the whole gonads. This report is the most comprehensive analysis of the miRNA repertoire in zebrafish gonads during the sexual development to date and provides an important database from which functional studies can be performed. PMID:28262836

  9. MAGIA, a web-based tool for miRNA and Genes Integrated Analysis.

    Science.gov (United States)

    Sales, Gabriele; Coppe, Alessandro; Bisognin, Andrea; Biasiolo, Marta; Bortoluzzi, Stefania; Romualdi, Chiara

    2010-07-01

    MAGIA (miRNA and genes integrated analysis) is a novel web tool for the integrative analysis of target predictions, miRNA and gene expression data. MAGIA is divided into two parts: the query section allows the user to retrieve and browse updated miRNA target predictions computed with a number of different algorithms (PITA, miRanda and Target Scan) and Boolean combinations thereof. The analysis section comprises a multistep procedure for (i) direct integration through different functional measures (parametric and non-parametric correlation indexes, a variational Bayesian model, mutual information and a meta-analysis approach based on P-value combination) of mRNA and miRNA expression data, (ii) construction of bipartite regulatory network of the best miRNA and mRNA putative interactions and (iii) retrieval of information available in several public databases of genes, miRNAs and diseases and via scientific literature text-mining. MAGIA is freely available for Academic users at http://gencomp.bio.unipd.it/magia.

  10. Proliferation of group II introns in the chloroplast genome of the green alga Oedocladium carolinianum (Chlorophyceae

    Directory of Open Access Journals (Sweden)

    Jean-Simon Brouard

    2016-10-01

    Full Text Available Background The chloroplast genome sustained extensive changes in architecture during the evolution of the Chlorophyceae, a morphologically and ecologically diverse class of green algae belonging to the Chlorophyta; however, the forces driving these changes are poorly understood. The five orders recognized in the Chlorophyceae form two major clades: the CS clade consisting of the Chlamydomonadales and Sphaeropleales, and the OCC clade consisting of the Oedogoniales, Chaetophorales, and Chaetopeltidales. In the OCC clade, considerable variations in chloroplast DNA (cpDNA structure, size, gene order, and intron content have been observed. The large inverted repeat (IR, an ancestral feature characteristic of most green plants, is present in Oedogonium cardiacum (Oedogoniales but is lacking in the examined members of the Chaetophorales and Chaetopeltidales. Remarkably, the Oedogonium 35.5-kb IR houses genes that were putatively acquired through horizontal DNA transfer. To better understand the dynamics of chloroplast genome evolution in the Oedogoniales, we analyzed the cpDNA of a second representative of this order, Oedocladium carolinianum. Methods The Oedocladium cpDNA was sequenced and annotated. The evolutionary distances separating Oedocladium and Oedogonium cpDNAs and two other pairs of chlorophycean cpDNAs were estimated using a 61-gene data set. Phylogenetic analysis of an alignment of group IIA introns from members of the OCC clade was performed. Secondary structures and insertion sites of oedogonialean group IIA introns were analyzed. Results The 204,438-bp Oedocladium genome is 7.9 kb larger than the Oedogonium genome, but its repertoire of conserved genes is remarkably similar and gene order differs by only one reversal. Although the 23.7-kb IR is missing the putative foreign genes found in Oedogonium, it contains sequences coding for a putative phage or bacterial DNA primase and a hypothetical protein. Intergenic sequences are 1.5-fold

  11. Identification and Validation of miRNAs Associated with the Resistance of Maize (Zea mays L.) to Exserohilum turcicum

    Science.gov (United States)

    Jin, Weibo

    2014-01-01

    Northern leaf blight, caused by the fungus Exserohilum turcicum (Pass.), is a major disease of maize (Zea mays L.). MicroRNAs (miRNAs) have been recently reported as gene expression regulators related to several stress responses; however, evidence of the role of miRNAs in plant response to biotic stresses is limited. In this study, the miRNA expression patterns in maize in response to E. turcicum stress were investigated using a plant miRNA microarray platform. A total of 118 miRNAs were detected in mock- and E. turcicum-inoculated leaves. Among these miRNAs, miR530, miR811, miR829, and miR845 were identified as new miRNAs in maize through a homology-based approach. The secondary structures and putative targets of these miRNAs were also predicted. In addition, four miRNAs were differentially regulated in response to E. turcicum: miR811, miR829, miR845, and miR408. The functional annotation of the predicted targets indicated that these stress-responsive miRNAs regulate metabolic, morphologic, and physiologic adaptations in maize seedlings at the post-transcriptional level. Four targets were negatively correlated with their corresponding miRNAs (miR811, miR829, and miR408). Furthermore, we have demonstrated for the first time that miR811 and miR829 confers a high degree of resistance to E. turcicum, which can be used in maize breeding programs. PMID:24489881

  12. miRNA expression profile during osteogenic differentiation of human adipose-derived stem cells.

    Science.gov (United States)

    Zhang, Zi-ji; Zhang, Hao; Kang, Yan; Sheng, Pu-yi; Ma, Yuan-chen; Yang, Zi-bo; Zhang, Zhi-qi; Fu, Ming; He, Ai-shan; Liao, Wei-ming

    2012-03-01

    Human adipose-derived stem cells (hADSC) are capable of differentiating into an osteogenic lineage. It is believed that microRNAs (miRNAs) play important roles in regulating this osteogenic differentiation of human adipose-derived cells, although its molecular mechanism remains unclear. We investigated the miRNA expression profile during osteogenic differentiation of hADSCs, and assessed the roles of involved miRNAs during the osteogenic differentiation. We obtained and cultured human adipose-derived stems cells from donors who underwent elective liposuction or other abdominal surgery at our institution. miRNA expression profiles pre- and post-osteogenic induction were obtained using microarray essay, and differently expressed miRNAs were verified using quantitative real-time polymerase chain reaction (qRT-PCR). The expression of osteogenic proteins was detected using an enzyme-linked immunosorbent assay. Putative targets of the miRNAs were predicted using online software MiRanda, TargetScan, and miRBase. Eight miRNAs were found differently expressed pre- and post-osteogenic induction, among which four miRNAs (miR-17, miR-20a, miR-20b, and miR-106a) were up-regulated and four miRNAs (miR-31, miR-125a-5p, miR-125b, and miR-193a) were down-regulated. qRT-PCR analysis further confirmed the results. Predicted target genes of the differentially expressed miRNAs based on the overlap from three public prediction algorithms: MiRanda, TargetScan, and miRBase Target have the known functions of regulating stem cell osteogenic differentiation, self-renewal, signal transduction, and cell cycle control. We identified a group of miRNAs that may play important roles in regulating hADSC cell differentiation toward an osteoblast lineage. Further study of these miRNAs may elucidate the mechanism of hADSC differentiation into adipose tissue, and thus provide basis for tissue engineering. © 2011 Wiley Periodicals, Inc.

  13. Splicing-related features of introns serve to propel evolution.

    Science.gov (United States)

    Luo, Yuping; Li, Chun; Gong, Xi; Wang, Yanlu; Zhang, Kunshan; Cui, Yaru; Sun, Yi Eve; Li, Siguang

    2013-01-01

    The role of spliceosomal intronic structures played in evolution has only begun to be elucidated. Comparative genomic analyses of fungal snoRNA sequences, which are often contained within introns and/or exons, revealed that about one-third of snoRNA-associated introns in three major snoRNA gene clusters manifested polymorphisms, likely resulting from intron loss and gain events during fungi evolution. Genomic deletions can clearly be observed as one mechanism underlying intron and exon loss, as well as generation of complex introns where several introns lie in juxtaposition without intercalating exons. Strikingly, by tracking conserved snoRNAs in introns, we found that some introns had moved from one position to another by excision from donor sites and insertion into target sties elsewhere in the genome without needing transposon structures. This study revealed the origin of many newly gained introns. Moreover, our analyses suggested that intron-containing sequences were more prone to sustainable structural changes than DNA sequences without introns due to intron's ability to jump within the genome via unknown mechanisms. We propose that splicing-related structural features of introns serve as an additional motor to propel evolution.

  14. Splicing-related features of introns serve to propel evolution.

    Directory of Open Access Journals (Sweden)

    Yuping Luo

    Full Text Available The role of spliceosomal intronic structures played in evolution has only begun to be elucidated. Comparative genomic analyses of fungal snoRNA sequences, which are often contained within introns and/or exons, revealed that about one-third of snoRNA-associated introns in three major snoRNA gene clusters manifested polymorphisms, likely resulting from intron loss and gain events during fungi evolution. Genomic deletions can clearly be observed as one mechanism underlying intron and exon loss, as well as generation of complex introns where several introns lie in juxtaposition without intercalating exons. Strikingly, by tracking conserved snoRNAs in introns, we found that some introns had moved from one position to another by excision from donor sites and insertion into target sties elsewhere in the genome without needing transposon structures. This study revealed the origin of many newly gained introns. Moreover, our analyses suggested that intron-containing sequences were more prone to sustainable structural changes than DNA sequences without introns due to intron's ability to jump within the genome via unknown mechanisms. We propose that splicing-related structural features of introns serve as an additional motor to propel evolution.

  15. Alterations in hepatic miRNA expression during negative energy balance in postpartum dairy cattle.

    Science.gov (United States)

    Fatima, Attia; Waters, Sinead; O'Boyle, Padraig; Seoighe, Cathal; Morris, Dermot G

    2014-01-15

    Negative energy balance (NEB), an altered metabolic state, occurs in early postpartum dairy cattle when energy demands to support lactation exceed energy intake. During NEB the liver undergoes oxidative stress and increased breakdown of fatty acids accompanied by changes in gene expression. It is now known that micro RNAs (miRNA) can have a role in mediating such alterations in gene expression through repression or degradation of target mRNAs. miRNA expression is known to be altered by metabolism and environmental factors and miRNAs are implicated in expression modulation of metabolism related genes. miRNA expression was profiled in the liver of moderate yielding dairy cattle under severe NEB (SNEB) and mild NEB (MNEB) using the Affymetrix Gene Chip miRNA_2.0 array with 679 probe sets for Bos-taurus miRNAs. Ten miRNAs were found to be differentially expressed using the 'samr' statistical package (delta = 0.6) at a q-value FDR of genes were also identified among 418 differentially expressed hepatic genes previously reported for the same animal model. Among these, GPR37 (G protein-coupled receptor 37), HEYL (hairy/enhancer-of-split related with YRPW motif-like), DNJA1, CD14 (Cluster of differentiation 14) and GNS (glucosamine (N-acetyl)-6-sulfatase) are known to be associated with hepatic metabolic disorders. In addition miR-140 and miR-2885 have binding sites on the most down-regulated of these genes, FADS2 (Fatty acid desaturase 2) which encodes an enzyme critical in lipid biosynthesis. Furthermore, HNF3-gamma (Hepatocyte nuclear factor 3-gamma), a hepatic transcription factor (TF) that is involved in IGF-1 expression regulation and maintenance of glucose homeostasis is a putative target of miR-31. This study shows that SNEB affects liver miRNA expression and these miRNAs have putative targets in hepatic genes down-regulated under this condition. This study highlights the potential role of miRNAs in transcription regulation of hepatic gene expression during SNEB in

  16. Mechanisms of intron gain and loss in Drosophila

    Directory of Open Access Journals (Sweden)

    Yenerall Paul

    2011-12-01

    Full Text Available Abstract Background It is widely accepted that orthologous genes have lost or gained introns throughout evolution. However, the specific mechanisms that generate these changes have proved elusive. Introns are known to affect nearly every level of gene expression. Therefore, understanding their mechanism of evolution after their initial fixation in eukaryotes is pertinent to understanding the means by which organisms develop greater regulation and complexity. Results To investigate possible mechanisms of intron gain and loss, we identified 189 intron gain and 297 intron loss events among 11 Drosophila species. We then investigated these events for signatures of previously proposed mechanisms of intron gain and loss. This work constitutes the first comprehensive study into the specific mechanisms that may generate intron gains and losses in Drosophila. We report evidence of intron gain via transposon insertion; the first intron loss that may have occurred via non-homologous end joining; intron gains via the repair of a double strand break; evidence of intron sliding; and evidence that internal or 5' introns may not frequently be deleted via the self-priming of reverse transcription during mRNA-mediated intron loss. Our data also suggest that the transcription process may promote or result in intron gain. Conclusion Our findings support the occurrence of intron gain via transposon insertion, repair of double strand breaks, as well as intron loss via non-homologous end joining. Furthermore, our data suggest that intron gain may be enabled by or due to transcription, and we shed further light on the exact mechanism of mRNA-mediated intron loss.

  17. Multigenic lentiviral vectors for combined and tissue-specific expression of miRNA- and protein-based antiangiogenic factors

    DEFF Research Database (Denmark)

    Askou, Anne Louise; Aagaard, Lars; Kostic, Corinne

    2015-01-01

    Lentivirus-based gene delivery vectors carrying multiple gene cassettes are powerful tools in gene transfer studies and gene therapy, allowing coexpression of multiple therapeutic factors and, if desired, fluorescent reporters. Current strategies to express transgenes and microRNA (miRNA) clusters......-to-back RNApolII-driven expression cassettes. This configuration allows effective production of intron-embedded miRNAs that are released upon transduction of target cells. Exploiting such multigenic lentiviral vectors, we demonstrate robust miRNA-directed downregulation of vascular endothelial growth factor...... by the VMD2 promoter, verifying that multigenic lentiviral vectors can be produced with high titers sufficient for in vivo applications. Altogether, our results suggest the potential applicability of combined miRNA- and protein-encoding lentiviral vectors in antiangiogenic gene therapy, including new...

  18. Is the human dystrophin gene's intron structure related to its intron instability?

    Institute of Scientific and Technical Information of China (English)

    盛文利; 陈江瑛; 朱良付; 刘焯霖

    2003-01-01

    Objective To study the human dystrophin gene molecular deletion mechanism, we analyzed breakpoint regions within junction fragments of deletion-type patients and investigated whether the dystrophin gene's intron structure might be related to intron instability.Methods Junction fragments corresponding to exon 46 and 51 deletions were cloned. The breakpoint regions were sequenced, and the features of introns with available Genebank sequences were analyzed.Results An analysis of junction fragment sequences corresponding to exon 46 and 51 deletions showed that all 5' and 3' breakpoints are located within repeat sequences. No small insertions, small deletions, or point mutations are located near the breakpoint junctions. By analyzing the secondary structure of the junction fragments, we demonstrated that all junction fragment breakpoints are located in non-matching regions of single-stranded hairpin loops. A high concentration of repetitive elements is found to be a key feature of many dystrophin introns. In total, 34.8% of the overall dystrophin intron sequences is composed of repeat sequences.Conclusion Repeat elements in many dystrophin gene introns are the key to their structural bases and reflect intron instability. As a result of the primary DNA sequences, single-stranded hairpin loops form, increasing the instability of the gene, and forming the base for breaks in the DNA. The formation of the single-stranded hairpins can result in reattachment of two different breakpoints, producing a deletion.

  19. Functional characterisation of an intron retaining K+ transporter of barley reveals intron-mediated alternate splicing

    KAUST Repository

    Shahzad, K.

    2015-01-01

    Intron retention in transcripts and the presence of 5 and 3 splice sites within these introns mediate alternate splicing, which is widely observed in animals and plants. Here, functional characterisation of the K+ transporter, HvHKT2;1, with stably retained introns from barley (Hordeum vulgare) in yeast (Saccharomyces cerevisiae), and transcript profiling in yeast and transgenic tobacco (Nicotiana tabacum) is presented. Expression of intron-retaining HvHKT2;1 cDNA (HvHKT2;1-i) in trk1, trk2 yeast strain defective in K+ uptake restored growth in medium containing hygromycin in the presence of different concentrations of K+ and mediated hypersensitivity to Na+. HvHKT2;1-i produces multiple transcripts via alternate splicing of two regular introns and three exons in different compositions. HKT isoforms with retained introns and exon skipping variants were detected in relative expression analysis of (i) HvHKT2;1-i in barley under native conditions, (ii) in transgenic tobacco plants constitutively expressing HvHKT2;1-i, and (iii) in trk1, trk2 yeast expressing HvHKT2;1-i under control of an inducible promoter. Mixed proportions of three HKT transcripts: HvHKT2;1-e (first exon region), HvHKT2;1-i1 (first intron) and HvHKT2;1-i2 (second intron) were observed. The variation in transcript accumulation in response to changing K+ and Na+ concentrations was observed in both heterologous and plant systems. These findings suggest a link between intron-retaining transcripts and different splice variants to ion homeostasis, and their possible role in salt stress.

  20. MiRNA182 regulates percentage of myeloid and erythroid cells in chronic myeloid leukemia.

    Science.gov (United States)

    Arya, Deepak; Sachithanandan, Sasikala P; Ross, Cecil; Palakodeti, Dasaradhi; Li, Shang; Krishna, Sudhir

    2017-01-12

    The deregulation of lineage control programs is often associated with the progression of haematological malignancies. The molecular regulators of lineage choices in the context of tyrosine kinase inhibitor (TKI) resistance remain poorly understood in chronic myeloid leukemia (CML). To find a potential molecular regulator contributing to lineage distribution and TKI resistance, we undertook an RNA-sequencing approach for identifying microRNAs (miRNAs). Following an unbiased screen, elevated miRNA182-5p levels were detected in Bcr-Abl-inhibited K562 cells (CML blast crisis cell line) and in a panel of CML patients. Earlier, miRNA182-5p upregulation was reported in several solid tumours and haematological malignancies. We undertook a strategy involving transient modulation and CRISPR/Cas9 (clustered regularly interspersed short palindromic repeats)-mediated knockout of the MIR182 locus in CML cells. The lineage contribution was assessed by methylcellulose colony formation assay. The transient modulation of miRNA182-5p revealed a biased phenotype. Strikingly, Δ182 cells (homozygous deletion of MIR182 locus) produced a marked shift in lineage distribution. The phenotype was rescued by ectopic expression of miRNA182-5p in Δ182 cells. A bioinformatic analysis and Hes1 modulation data suggested that Hes1 could be a putative target of miRNA182-5p. A reciprocal relationship between miRNA182-5p and Hes1 was seen in the context of TK inhibition. In conclusion, we reveal a key role for miRNA182-5p in restricting the myeloid development of leukemic cells. We propose that the Δ182 cell line will be valuable in designing experiments for next-generation pharmacological interventions.

  1. Pluripotent and Multipotent Stem Cells Display Distinct Hypoxic miRNA Expression Profiles

    Science.gov (United States)

    Agrawal, Rahul; Dale, Tina P.; Al-Zubaidi, Mohammed A.; Benny Malgulwar, Prit; Forsyth, Nicholas R.; Kulshreshtha, Ritu

    2016-01-01

    MicroRNAs are reported to have a crucial role in the regulation of self-renewal and differentiation of stem cells. Hypoxia has been identified as a key biophysical element of the stem cell culture milieu however, the link between hypoxia and miRNA expression in stem cells remains poorly understood. We therefore explored miRNA expression in hypoxic human embryonic and mesenchymal stem cells (hESCs and hMSCs). A total of 50 and 76 miRNAs were differentially regulated by hypoxia (2% O2) in hESCs and hMSCs, respectively, with a negligible overlap of only three miRNAs. We found coordinate regulation of precursor and mature miRNAs under hypoxia suggesting their regulation mainly at transcriptional level. Hypoxia response elements were located upstream of 97% of upregulated hypoxia regulated miRNAs (HRMs) suggesting hypoxia-inducible-factor (HIF) driven transcription. HIF binding to the candidate cis-elements of specific miRNAs under hypoxia was confirmed by Chromatin immunoprecipitation coupled with qPCR. Role analysis of a subset of upregulated HRMs identified linkage to reported inhibition of differentiation while a downregulated subset of HRMs had a putative role in the promotion of differentiation. MiRNA-target prediction correlation with published hypoxic hESC and hMSC gene expression profiles revealed HRM target genes enriched in the cytokine:cytokine receptor, HIF signalling and pathways in cancer. Overall, our study reveals, novel and distinct hypoxia-driven miRNA signatures in hESCs and hMSCs with the potential for application in optimised culture and differentiation models for both therapeutic application and improved understanding of stem cell biology. PMID:27783707

  2. Functional intron+ and intron- rDNA in the same macronucleus of the ciliate Tetrahymena pigmentosa

    DEFF Research Database (Denmark)

    Nielsen, Henrik; Engberg, J

    1985-01-01

    alleles was followed in the total culture and in single cells during their vegetative segregation and it was observed that replication was non-preferential with respect to the two alleles. The diallelic clones were also used to demonstrate that intron-containing rDNA was transcribed and the transcript......Diallelic clones of Tetrahymena pigmentosa containing equal amounts of intron+ and intron- rDNA in the macronucleus were constructed. The macronucleus of the resulting strains divides amitotically during vegetative growth and the diallelic genotype is therefore unstable. The coexistence of the two...

  3. Ago HITS-CLIP expands understanding of Kaposi's sarcoma-associated herpesvirus miRNA function in primary effusion lymphomas.

    Directory of Open Access Journals (Sweden)

    Irina Haecker

    Full Text Available KSHV is the etiological agent of Kaposi's sarcoma (KS, primary effusion lymphoma (PEL, and a subset of multicentricCastleman's disease (MCD. The fact that KSHV-encoded miRNAs are readily detectable in all KSHV-associated tumors suggests a potential role in viral pathogenesis and tumorigenesis. MiRNA-mediated regulation of gene expression is a complex network with each miRNA having many potential targets, and to date only few KSHV miRNA targets have been experimentally determined. A detailed understanding of KSHV miRNA functions requires high-through putribonomics to globally analyze putative miRNA targets in a cell type-specific manner. We performed Ago HITS-CLIP to identify viral and cellular miRNAs and their cognate targets in two latently KSHV-infected PEL cell lines. Ago HITS-CLIP recovered 1170 and 950 cellular KSHV miRNA targets from BCBL-1 and BC-3, respectively. Importantly, enriched clusters contained KSHV miRNA seed matches in the 3'UTRs of numerous well characterized targets, among them THBS1, BACH1, and C/EBPβ. KSHV miRNA targets were strongly enriched for genes involved in multiple pathways central for KSHV biology, such as apoptosis, cell cycle regulation, lymphocyte proliferation, and immune evasion, thus further supporting a role in KSHV pathogenesis and potentially tumorigenesis. A limited number of viral transcripts were also enriched by HITS-CLIP including vIL-6 expressed only in a subset of PEL cells during latency. Interestingly, Ago HITS-CLIP revealed extremely high levels of Ago-associated KSHV miRNAs especially in BC-3 cells where more than 70% of all miRNAs are of viral origin. This suggests that in addition to seed match-specific targeting of cellular genes, KSHV miRNAs may also function by hijacking RISCs, thereby contributing to a global de-repression of cellular gene expression due to the loss of regulation by human miRNAs. In summary, we provide an extensive list of cellular and viral miRNA targets representing an

  4. Conservation of the Exon-Intron Structure of Long Intergenic Non-Coding RNA Genes in Eutherian Mammals

    Directory of Open Access Journals (Sweden)

    Diana Chernikova

    2016-07-01

    Full Text Available The abundance of mammalian long intergenic non-coding RNA (lincRNA genes is high, yet their functions remain largely unknown. One possible way to study this important question is to use large-scale comparisons of various characteristics of lincRNA with those of protein-coding genes for which a large body of functional information is available. A prominent feature of mammalian protein-coding genes is the high evolutionary conservation of the exon-intron structure. Comparative analysis of putative intron positions in lincRNA genes from various mammalian genomes suggests that some lincRNA introns have been conserved for over 100 million years, thus the primary and/or secondary structure of these molecules is likely to be functionally important.

  5. Challenges in the miRNA research

    DEFF Research Database (Denmark)

    Singh, Tiratha Raj; Gupta, Arun; Suravajhala, Prashanth

    2013-01-01

    RNAs from their progenitor messenger RNAs (mRNAs) have arisen. Furthermore, the miRNAs are known to have synergism involving regulation of their condition-specific target genes (mRNAs). In this review, we provide a bioinformatics approach of the miRNAs and their challenges with respect to annotation......While it is known that the human genes are regulated by microRNAs (miRNAs), recent links with cancer and other diseases have widely caught interest. With several bioinformatics platforms and approaches on rise that has led to discovery of human miRNAs, validation and need for understanding mi...

  6. The regulatory epicenter of miRNAs

    Indian Academy of Sciences (India)

    Ashwani Jha; Mrigaya Mehra; Ravi Shankar

    2011-09-01

    miRNAs are small non-coding RNAs with average length of ∼21 bp. miRNA formation seems to be dependent upon multiple factors besides Drosha and Dicer, in a tissue/stage-specific manner, with interplay of several specific binding factors. In the present study, we have investigated transcription factor binding sites in and around the genomic sequences of precursor miRNAs and RNA-binding protein (RBP) sites in miRNA precursor sequences, analysed and tested in comprehensive manner. Here, we report that miRNA precursor regions are positionally enriched for binding of transcription factors as well as RBPs around the 3′ end of mature miRNA region in 5′ arm. The pattern and distribution of such regulatory sites appears to be a characteristic of precursor miRNA sequences when compared with non-miRNA sequences as negative dataset and tested statistically. When compared with 1 kb upstreamregions, a sudden sharp peak for binding sites arises in the enriched zone near the mature miRNA region. An expression-data-based correlation analysis was performed between such miRNAs and their corresponding transcription factors and RBPs for this region. Some specific groups of binding factors and associated miRNAs were identified. We also identified some of the overrepresented transcription factors and associated miRNAs with high expression correlation values which could be useful in cancer-related studies. The highly correlated groups were found to host experimentally validated composite regulatory modules, in which Lmo2-GATA1 appeared as the predominant one. For many of RBP–miRNAs associations, co-expression similarity was also evident among the associated miRNA common to given RBPs, supporting the Regulon model, suggesting a common role and common control of these miRNAs by the associated RBPs. Based on our findings, we propose that the observed characteristic distribution of regulatory sites in precursor miRNA sequence regions could be critical inmiRNA transcription, processing

  7. Circulating miRNA and cancer diagnosis

    Institute of Scientific and Technical Information of China (English)

    2009-01-01

    miRNAs are a class of small RNA molecules with regulatory function, and play an important role in tumor development and progression. It has been demonstrated that tumor-derived miRNAs exist in the circulating nucleic acids of cancer patients. This phenomenon implies that detection of the circulating miRNA may be an effective method for non-invasive diagnosis of cancer. In this review, we summarize the applications of the circulating miRNA as biomarkers in cancer diagnosis, as well as the latest research progress in this area.

  8. Extensive intron gain in the ancestor of placental mammals

    Science.gov (United States)

    2011-01-01

    Background Genome-wide studies of intron dynamics in mammalian orthologous genes have found convincing evidence for loss of introns but very little for intron turnover. Similarly, large-scale analysis of intron dynamics in a few vertebrate genomes has identified only intron losses and no gains, indicating that intron gain is an extremely rare event in vertebrate evolution. These studies suggest that the intron-rich genomes of vertebrates do not allow intron gain. The aim of this study was to search for evidence of de novo intron gain in domesticated genes from an analysis of their exon/intron structures. Results A phylogenomic approach has been used to analyse all domesticated genes in mammals and chordates that originated from the coding parts of transposable elements. Gain of introns in domesticated genes has been reconstructed on well established mammalian, vertebrate and chordate phylogenies, and examined as to where and when the gain events occurred. The locations, sizes and amounts of de novo introns gained in the domesticated genes during the evolution of mammals and chordates has been analyzed. A significant amount of intron gain was found only in domesticated genes of placental mammals, where more than 70 cases were identified. De novo gained introns show clear positional bias, since they are distributed mainly in 5' UTR and coding regions, while 3' UTR introns are very rare. In the coding regions of some domesticated genes up to 8 de novo gained introns have been found. Intron densities in Eutheria-specific domesticated genes and in older domesticated genes that originated early in vertebrates are lower than those for normal mammalian and vertebrate genes. Surprisingly, the majority of intron gains have occurred in the ancestor of placentals. Conclusions This study provides the first evidence for numerous intron gains in the ancestor of placental mammals and demonstrates that adequate taxon sampling is crucial for reconstructing intron evolution. The

  9. Extensive intron gain in the ancestor of placental mammals

    Directory of Open Access Journals (Sweden)

    Kordiš Dušan

    2011-11-01

    Full Text Available Abstract Background Genome-wide studies of intron dynamics in mammalian orthologous genes have found convincing evidence for loss of introns but very little for intron turnover. Similarly, large-scale analysis of intron dynamics in a few vertebrate genomes has identified only intron losses and no gains, indicating that intron gain is an extremely rare event in vertebrate evolution. These studies suggest that the intron-rich genomes of vertebrates do not allow intron gain. The aim of this study was to search for evidence of de novo intron gain in domesticated genes from an analysis of their exon/intron structures. Results A phylogenomic approach has been used to analyse all domesticated genes in mammals and chordates that originated from the coding parts of transposable elements. Gain of introns in domesticated genes has been reconstructed on well established mammalian, vertebrate and chordate phylogenies, and examined as to where and when the gain events occurred. The locations, sizes and amounts of de novo introns gained in the domesticated genes during the evolution of mammals and chordates has been analyzed. A significant amount of intron gain was found only in domesticated genes of placental mammals, where more than 70 cases were identified. De novo gained introns show clear positional bias, since they are distributed mainly in 5' UTR and coding regions, while 3' UTR introns are very rare. In the coding regions of some domesticated genes up to 8 de novo gained introns have been found. Intron densities in Eutheria-specific domesticated genes and in older domesticated genes that originated early in vertebrates are lower than those for normal mammalian and vertebrate genes. Surprisingly, the majority of intron gains have occurred in the ancestor of placentals. Conclusions This study provides the first evidence for numerous intron gains in the ancestor of placental mammals and demonstrates that adequate taxon sampling is crucial for

  10. Identification and comparative analyses of myocardial miRNAs involved in the fetal response to maternal obesity

    Science.gov (United States)

    Muralimanoharan, Sribalasubashini; Huffman, Steven; Cox, Laura A.; Nathanielsz, Peter W.; Myatt, Leslie; Nijland, Mark J.

    2013-01-01

    Human and animal studies show that suboptimal intrauterine environments lead to fetal programming, predisposing offspring to disease in later life. Maternal obesity has been shown to program offspring for cardiovascular disease (CVD), diabetes, and obesity. MicroRNAs (miRNAs) are small, noncoding RNA molecules that act as key regulators of numerous cellular processes. Compelling evidence links miRNAs to the control of cardiac development and etiology of cardiac pathology; however, little is known about their role in the fetal cardiac response to maternal obesity. Our aim was to sequence and profile the cardiac miRNAs that are dysregulated in the hearts of baboon fetuses born to high fat/high fructose-diet (HFD) fed mothers for comparison with fetal hearts from mothers eating a regular diet. Eighty miRNAs were differentially expressed. Of those, 55 miRNAs were upregulated and 25 downregulated with HFD. Twenty-two miRNAs were mapped to human; 14 of these miRNAs were previously reported to be dysregulated in experimental or human CVD. We used an Ingenuity Pathway Analysis to integrate miRNA profiling and bioinformatics predictions to determine miRNA-regulated processes and genes potentially involved in fetal programming. We found a correlation between miRNA expression and putative gene targets involved in developmental disorders and CVD. Cellular death, growth, and proliferation were the most affected cellular functions in response to maternal obesity. Thus, the current study reveals significant alterations in cardiac miRNA expression in the fetus of obese baboons. The epigenetic modifications caused by adverse prenatal environment may represent one of the mechanisms underlying fetal programming of CVD. PMID:23922128

  11. Analysis of ribosomal protein gene structures: implications for intron evolution.

    Directory of Open Access Journals (Sweden)

    2006-03-01

    Full Text Available Many spliceosomal introns exist in the eukaryotic nuclear genome. Despite much research, the evolution of spliceosomal introns remains poorly understood. In this paper, we tried to gain insights into intron evolution from a novel perspective by comparing the gene structures of cytoplasmic ribosomal proteins (CRPs and mitochondrial ribosomal proteins (MRPs, which are held to be of archaeal and bacterial origin, respectively. We analyzed 25 homologous pairs of CRP and MRP genes that together had a total of 527 intron positions. We found that all 12 of the intron positions shared by CRP and MRP genes resulted from parallel intron gains and none could be considered to be "conserved," i.e., descendants of the same ancestor. This was supported further by the high frequency of proto-splice sites at these shared positions; proto-splice sites are proposed to be sites for intron insertion. Although we could not definitively disprove that spliceosomal introns were already present in the last universal common ancestor, our results lend more support to the idea that introns were gained late. At least, our results show that MRP genes were intronless at the time of endosymbiosis. The parallel intron gains between CRP and MRP genes accounted for 2.3% of total intron positions, which should provide a reliable estimate for future inferences of intron evolution.

  12. Identification of GATA2 and AP-1 activator elements within the enhancer VNTR occurring in intron 5 of the human SIRT3 gene

    Science.gov (United States)

    Human SIRT3 gene contains an intronic VNTR enhancer. A T > C transition occurring in the second repeat of each VNTR allele implies the presence/absence of a putative GATA binding motif. A partially overlapping AP-1 site, not affected by the transition, was also identified. Aims of the present study ...

  13. Retrohoming of a Mobile Group II Intron in Human Cells Suggests How Eukaryotes Limit Group II Intron Proliferation.

    Directory of Open Access Journals (Sweden)

    David M Truong

    2015-08-01

    Full Text Available Mobile bacterial group II introns are evolutionary ancestors of spliceosomal introns and retroelements in eukaryotes. They consist of an autocatalytic intron RNA (a "ribozyme" and an intron-encoded reverse transcriptase, which function together to promote intron integration into new DNA sites by a mechanism termed "retrohoming". Although mobile group II introns splice and retrohome efficiently in bacteria, all examined thus far function inefficiently in eukaryotes, where their ribozyme activity is limited by low Mg2+ concentrations, and intron-containing transcripts are subject to nonsense-mediated decay (NMD and translational repression. Here, by using RNA polymerase II to express a humanized group II intron reverse transcriptase and T7 RNA polymerase to express intron transcripts resistant to NMD, we find that simply supplementing culture medium with Mg2+ induces the Lactococcus lactis Ll.LtrB intron to retrohome into plasmid and chromosomal sites, the latter at frequencies up to ~0.1%, in viable HEK-293 cells. Surprisingly, under these conditions, the Ll.LtrB intron reverse transcriptase is required for retrohoming but not for RNA splicing as in bacteria. By using a genetic assay for in vivo selections combined with deep sequencing, we identified intron RNA mutations that enhance retrohoming in human cells, but <4-fold and not without added Mg2+. Further, the selected mutations lie outside the ribozyme catalytic core, which appears not readily modified to function efficiently at low Mg2+ concentrations. Our results reveal differences between group II intron retrohoming in human cells and bacteria and suggest constraints on critical nucleotide residues of the ribozyme core that limit how much group II intron retrohoming in eukaryotes can be enhanced. These findings have implications for group II intron use for gene targeting in eukaryotes and suggest how differences in intracellular Mg2+ concentrations between bacteria and eukarya may have

  14. Identification of MiRNA from eggplant (Solanum melongena L. by small RNA deep sequencing and their response to Verticillium dahliae infection.

    Directory of Open Access Journals (Sweden)

    Liu Yang

    Full Text Available MiRNAs are a class of non-coding small RNAs that play important roles in the regulation of gene expression. Although plant miRNAs have been extensively studied in model systems, less is known in other plants with limited genome sequence data, including eggplant (Solanum melongena L.. To identify miRNAs in eggplant and their response to Verticillium dahliae infection, a fungal pathogen for which clear understanding of infection mechanisms and effective cure methods are currently lacking, we deep-sequenced two small RNA (sRNA libraries prepared from mock-infected and infected seedlings of eggplants. Specifically, 30,830,792 reads produced 7,716,328 unique miRNAs representing 99 known miRNA families that have been identified in other plant species. Two novel putative miRNAs were predicted with eggplant ESTs. The potential targets of the identified known and novel miRNAs were also predicted based on sequence homology search. It was observed that the length distribution of obtained sRNAs and the expression of 6 miRNA families were obviously different between the two libraries. These results provide a framework for further analysis of miRNAs and their role in regulating plant response to fungal infection and Verticillium wilt in particular.

  15. Mechanisms used for genomic proliferation by thermophilic group II introns.

    Directory of Open Access Journals (Sweden)

    Georg Mohr

    Full Text Available Mobile group II introns, which are found in bacterial and organellar genomes, are site-specific retroelements hypothesized to be evolutionary ancestors of spliceosomal introns and retrotransposons in higher organisms. Most bacteria, however, contain no more than one or a few group II introns, making it unclear how introns could have proliferated to higher copy numbers in eukaryotic genomes. An exception is the thermophilic cyanobacterium Thermosynechococcus elongatus, which contains 28 closely related copies of a group II intron, constituting approximately 1.3% of the genome. Here, by using a combination of bioinformatics and mobility assays at different temperatures, we identified mechanisms that contribute to the proliferation of T. elongatus group II introns. These mechanisms include divergence of DNA target specificity to avoid target site saturation; adaptation of some intron-encoded reverse transcriptases to splice and mobilize multiple degenerate introns that do not encode reverse transcriptases, leading to a common splicing apparatus; and preferential insertion within other mobile introns or insertion elements, which provide new unoccupied sites in expanding non-essential DNA regions. Additionally, unlike mesophilic group II introns, the thermophilic T. elongatus introns rely on elevated temperatures to help promote DNA strand separation, enabling access to a larger number of DNA target sites by base pairing of the intron RNA, with minimal constraint from the reverse transcriptase. Our results provide insight into group II intron proliferation mechanisms and show that higher temperatures, which are thought to have prevailed on Earth during the emergence of eukaryotes, favor intron proliferation by increasing the accessibility of DNA target sites. We also identify actively mobile thermophilic introns, which may be useful for structural studies, gene targeting in thermophiles, and as a source of thermostable reverse transcriptases.

  16. A novel mouse c-fos intronic promoter that responds to CREB and AP-1 is developmentally regulated in vivo.

    Directory of Open Access Journals (Sweden)

    Vincent Coulon

    Full Text Available BACKGROUND: The c-fos proto-oncogene is an archetype for rapid and integrative transcriptional activation. Innumerable studies have focused on the canonical promoter, located upstream from the transcriptional start site. However, several regulatory sequences have been found in the first intron. METHODOLOGY/PRINCIPAL FINDINGS: Here we describe an extremely conserved region in c-fos first intron that contains a putative TATA box, and functional TRE and CRE sites. This fragment drives reporter gene activation in fibroblasts, which is enhanced by increasing intracellular calcium and cAMP and by cotransfection of CREB or c-Fos/c-Jun expression vectors. We produced transgenic mice expressing a lacZ reporter controlled by the intronic promoter. Lac Z expression of this promoter is restricted to the developing central nervous system (CNS and the mesenchyme of developing mammary buds in embryos 12.5 days post-conception, and to brain tissue in adults. RT-QPCR analysis of tissue mRNA, including the anlage of the mammary gland and the CNS, confirms the existence of a novel, nested mRNA initiated in the first intron. CONCLUSIONS/SIGNIFICANCE: Our results provide evidence for a novel, developmentally regulated promoter in the first intron of the c-fos gene.

  17. A genome-wide survey for prion-regulated miRNAs associated with cholesterol homeostasis

    Directory of Open Access Journals (Sweden)

    Montag Judith

    2012-09-01

    Full Text Available Abstract Background Prion diseases are neurodegenerative diseases that are characterized by the conversion of the cellular prion protein (PrPc into a pathogenic isoform (PrPSc. It is known that neurodegeneration is often accompanied by the disturbance of cholesterol homeostasis. We have recently identified a set of genes that were upregulated after prion infection of N2a neuronal cells (Bach et al., 2009. Results We have now used ultra-deep sequencing technology to profile all microRNAs (miRNA that could be associated with this effect in these N2a cells. Using stringent filters and normalization strategies we identified a small set of miRNAs that were up- or downregulated upon prion infection. Using bioinformatic tools we predicted whether the downregulated miRNAs could target mRNAs that have been previously identified to enhance cholesterol synthesis in these cells. Application of this joint profiling approach revealed that nine miRNAs potentially target cholesterol-related genes. Four of those miRNAs are localized in a miRNA-dense cluster on the mouse X-chromosome. Among these, twofold downregulation of mmu-miR-351 and mmu-miR-542-5p was confirmed by qRT-PCR. The same miRNAs were predicted as putative regulators of the sterol regulatory element-binding factor 2 (Srebf2, the low-density lipoprotein receptor (Ldlr or the IPP isomerase. Conclusions The results demonstrate that joined profiling by ultra-deep sequencing is highly valuable to identify candidate miRNAs involved in prion-induced dysregulation of cholesterol homeostasis.

  18. An intron in a ribosomal protein gene from Tetrahymena

    DEFF Research Database (Denmark)

    Nielsen, Henrik; Andreasen, Per Hove; Dreisig, Hanne

    1986-01-01

    of hybrid-selected mRNA and authentic ribosomal proteins. The proteins show strong homology to ribosomal protein S12 from Escherichia coli. The coding region of the gene is interrupted by a 979-bp intron 68 bp downstream of the translation start. This is the first intron in a protein encoding gene...... of a ciliate to be described at the nucleotide sequence level. The intron obeys the GT/AG rule for splice junctions of nuclear mRNA introns from higher eukaryotes but lacks the pyrimidine stretch usually found in the immediate vicinity of the 3' splice junction. The structure of the intron and the fact...

  19. miRNA deregulation in multiple myeloma

    Institute of Scientific and Technical Information of China (English)

    BI Chong Lei; CHNG Wee Joo

    2011-01-01

    Multiple myeloma (MM) is an incurable plasma cell malignancy and is the second most common hematological cancer. It is characterized by complex, recurrent genetic and epigenetic abnormalities. Recent publications have linked miRNAs, a novel class of gene regulators to cancer including MM. miRNAs are about 20 nucleotide, single strand, non-coding RNAs that repress gene expression by mRNA degradation or translational repression. Aberrant miRNA expression profiles have been described in MM, and their functional roles in MM pathogenesis are being increasingly recognized. This review summarizes the current literature on the role of miRNAs in MM and offers perspectives on future research and utilization of miRNAs in MM management.

  20. Ancient nature of alternative splicing and functions of introns

    Energy Technology Data Exchange (ETDEWEB)

    Zhou, Kemin; Salamov, Asaf; Kuo, Alan; Aerts, Andrea; Grigoriev, Igor

    2011-03-21

    Using four genomes: Chamydomonas reinhardtii, Agaricus bisporus, Aspergillus carbonarius, and Sporotricum thermophile with EST coverage of 2.9x, 8.9x, 29.5x, and 46.3x respectively, we identified 11 alternative splicing (AS) types that were dominated by intron retention (RI; biased toward short introns) and found 15, 35, 52, and 63percent AS of multiexon genes respectively. Genes with AS were more ancient, and number of AS correlated with number of exons, expression level, and maximum intron length of the gene. Introns with tendency to be retained had either stop codons or length of 3n+1 or 3n+2 presumably triggering nonsense-mediated mRNA decay (NMD), but introns retained in major isoforms (0.2-6percent of all introns) were biased toward 3n length and stop codon free. Stopless introns were biased toward phase 0, but 3n introns favored phase 1 that introduced more flexible and hydrophilic amino acids on both ends of introns which would be less disruptive to protein structure. We proposed a model in which minor RI intron could evolve into major RI that could facilitate intron loss through exonization.

  1. Alterations of serum levels of BDNF-related miRNAs in patients with depression.

    Directory of Open Access Journals (Sweden)

    You-Jie Li

    Full Text Available Depression is a serious and potentially life-threatening mental disorder with unknown etiology. Emerging evidence shows that brain-derived neurotrophic factor (BDNF and microRNAs (miRNAs play critical roles in the etiology of depression. Here this study was aimed to identify and characterize the roles of BDNF and its putative regulatory miRNAs in depression. First, we identified that miR-182 may be a putative miRNA that regulates BDNF levels by bioinformatic studies, and characterized the effects of miR-182 on the BDNF levels using cell-based studies, side by side with miR-132 (a known miRNA that regulates BDNF expression. We showed that treatment of miR-132 and miR-182 respectively decreased the BDNF protein levels in a human neuronal cell model, supporting the regulatory roles of miR-132 and miR-182 on the BDNF expression. Furthermore, we explored the roles of miR-132 and miR-182 on the BDNF levels in depression using human subjects by assessing their serum levels. Compared with the healthy controls, patients with depression showed lower serum BDNF levels (via the enzyme-linked immunosorbent assays and higher serum miR-132 and miR-182 levels (via the real-time PCR. Finally, the Pearson's (or Spearman's correlation coefficient was calculated to study whether there was a relationship among the Self-Rating Depression Scale score, the serum BDNF levels, and serum BDNF-related miRNA levels. Our results revealed that there was a significant negative correlation between the SDS scores and the serum BDNF levels, and a positive correlation between the SDS scores and miR-132 levels. In addition, we found a reverse relationship between the serum BDNF levels and the miR-132/miR-182 levels in depression. Collectively, we provided evidence supporting that miR-182 is a putative BDNF-regulatory miRNA, and suggested that the serum BDNF and its related miRNAs may be utilized as important biomarkers in the diagnosis or as therapeutic targets of depression.

  2. Identification and functional analysis of miRNAs in developing kernels of a viviparous mutant in maize

    Directory of Open Access Journals (Sweden)

    Haiping Ding

    2013-12-01

    Full Text Available Given the important roles of miRNAs in post-transcriptional gene regulation, identification of differentially expressed miRNAs will facilitate the elucidation of molecular mechanisms underlying kernel development. In this study, we constructed a small RNA library to comprehensively represent the full complement of individual small RNAs and to characterize miRNA expression profiles in pooled ears of maize (Zea mays L. at 10, 15, 20, 22, 25 and 30 days after pollination (DAP. At least 21 miRNAs were differentially expressed. The differential expression of three of these miRNAs, i.e., miR528a, miR167a and miR160b, at each stage was verified by qRT-PCR. The results indicated that these miRNAs might be involved in kernel development. In addition, the predicted functions of target genes indicated that most of the target genes are involved in signal transduction and cell communication pathways, particularly the auxin signaling pathway. The expression of candidate germination-associated miRNAs was analyzed by hybridization to a maize genome microarray, and revealed differential expression of genes involved in plant hormone signaling pathways. This finding suggests that phytohormones play a critical role in the development of maize kernels. We found that in combination with other miRNAs, miR528a regulated a putative laccase, a Ring-H2 zinc finger protein and a MADS box-like protein, whereas miR167a and miR160b regulated multiple target genes, including ARF (auxin response factor, a member of the B3 transcription factor family. All three miRNAs are important for ear germination, development and physiology. The small RNA transcriptomes and mRNA obtained in this study will help us gain a better understanding of the expression and function of small RNAs in the development of maize kernel.

  3. Identification and functional analysis of miRNAs in developing kernels of a viviparous mutant in maize

    Institute of Scientific and Technical Information of China (English)

    Haiping; Ding; Jian; Gao; Mao; Luo; Hua; Peng; Haijian; Lin; Guangsheng; Yuan; Yaou; Shen; Maojun; Zhao; Guangtang; Pan; Zhiming; Zhang

    2013-01-01

    Given the important roles of miRNAs in post-transcriptional gene regulation, identification of differentially expressed miRNAs will facilitate the elucidation of molecular mechanisms underlying kernel development. In this study, we constructed a small RNA library to comprehensively represent the full complement of individual small RNAs and to characterize miRNA expression profiles in pooled ears of maize(Zea mays L.) at 10, 15,20, 22, 25 and 30 days after pollination(DAP). At least 21 miRNAs were differentially expressed. The differential expression of three of these miRNAs, i.e., miR528a, miR167a and miR160b, at each stage was verified by qRT-PCR. The results indicated that these miRNAs might be involved in kernel development. In addition, the predicted functions of target genes indicated that most of the target genes are involved in signal transduction and cell communication pathways, particularly the auxin signaling pathway. The expression of candidate germination-associated miRNAs was analyzed by hybridization to a maize genome microarray, and revealed differential expression of genes involved in plant hormone signaling pathways. This finding suggests that phytohormones play a critical role in the development of maize kernels. We found that in combination with other miRNAs, miR528a regulated a putative laccase, a Ring-H2 zinc finger protein and a MADS box-like protein, whereas miR167a and miR160b regulated multiple target genes,including ARF(auxin response factor), a member of the B3 transcription factor family. All three miRNAs are important for ear germination, development and physiology. The small RNA transcriptomes and mRNA obtained in this study will help us gain a betterunderstanding of the expression and function of small RNAs in the development of maize kernel.

  4. Functional analysis of deep intronic SNP rs13438494 in intron 24 of PCLO gene.

    Directory of Open Access Journals (Sweden)

    Seunghee Seo

    Full Text Available The single nucleotide polymorphism (SNP rs13438494 in intron 24 of PCLO was significantly associated with bipolar disorder in a meta-analysis of genome-wide association studies. In this study, we performed functional minigene analysis and bioinformatics prediction of splicing regulatory sequences to characterize the deep intronic SNP rs13438494. We constructed minigenes with A and C alleles containing exon 24, intron 24, and exon 25 of PCLO to assess the genetic effect of rs13438494 on splicing. We found that the C allele of rs13438494 reduces the splicing efficiency of the PCLO minigene. In addition, prediction analysis of enhancer/silencer motifs using the Human Splice Finder web tool indicated that rs13438494 induces the abrogation or creation of such binding sites. Our results indicate that rs13438494 alters splicing efficiency by creating or disrupting a splicing motif, which functions by binding of splicing regulatory proteins, and may ultimately result in bipolar disorder in affected people.

  5. Evolution of group I introns in Porifera: new evidence for intron mobility and implications for DNA barcoding.

    Science.gov (United States)

    Schuster, Astrid; Lopez, Jose V; Becking, Leontine E; Kelly, Michelle; Pomponi, Shirley A; Wörheide, Gert; Erpenbeck, Dirk; Cárdenas, Paco

    2017-03-20

    Mitochondrial introns intermit coding regions of genes and feature characteristic secondary structures and splicing mechanisms. In metazoans, mitochondrial introns have only been detected in sponges, cnidarians, placozoans and one annelid species. Within demosponges, group I and group II introns are present in six families. Based on different insertion sites within the cox1 gene and secondary structures, four types of group I and two types of group II introns are known, which can harbor up to three encoding homing endonuclease genes (HEG) of the LAGLIDADG family (group I) and/or reverse transcriptase (group II). However, only little is known about sponge intron mobility, transmission, and origin due to the lack of a comprehensive dataset. We analyzed the largest dataset on sponge mitochondrial group I introns to date: 95 specimens, from 11 different sponge genera which provided novel insights into the evolution of group I introns. For the first time group I introns were detected in four genera of the sponge family Scleritodermidae (Scleritoderma, Microscleroderma, Aciculites, Setidium). We demonstrated that group I introns in sponges aggregate in the most conserved regions of cox1. We showed that co-occurrence of two introns in cox1 is unique among metazoans, but not uncommon in sponges. However, this combination always associates an active intron with a degenerating one. Earlier hypotheses of HGT were confirmed and for the first time VGT and secondary losses of introns conclusively demonstrated. This study validates the subclass Spirophorina (Tetractinellida) as an intron hotspot in sponges. Our analyses confirm that most sponge group I introns probably originated from fungi. DNA barcoding is discussed and the application of alternative primers suggested.

  6. Spliceosomal intron size expansion in domesticated grapevine (Vitis vinifera

    Directory of Open Access Journals (Sweden)

    Goertzen Leslie R

    2011-03-01

    Full Text Available Abstract Background Spliceosomal introns are important components of eukaryotic genes as their structure, sizes and contents reflect the architecture of gene and genomes. Intron size, determined by both neutral evolution, repetitive elements activities and potential functional constraints, varies significantly in eukaryotes, suggesting unique dynamics and evolution in different lineages of eukaryotic organisms. However, the evolution of intron size, is rarely studied. To investigate intron size dynamics in flowering plants, in particular domesticated grapevines, a survey of intron size and content in wine grape (Vitis vinifera Pinot Noir genes was conducted by assembling and mapping the transcriptome of V. vinifera genes from ESTs to characterize and analyze spliceosomal introns. Results Uncommonly large size of spliceosomal intron was observed in V. vinifera genome, otherwise inconsistent with overall genome size dynamics when comparing Arabidopsis, Populus and Vitis. In domesticated grapevine, intron size is generally not related to gene function. The composition of enlarged introns in grapevines indicated extensive transposable element (TE activity within intronic regions. TEs comprise about 80% of the expanded intron space and in particular, recent LTR retrotransposon insertions are enriched in these intronic regions, suggesting an intron size expansion in the lineage leading to domesticated grapevine, instead of size contractions in Arabidopsis and Populus. Comparative analysis of selected intronic regions in V. vinifera cultivars and wild grapevine species revealed that accelerated TE activity was associated with grapevine domestication, and in some cases with the development of specific cultivars. Conclusions In this study, we showed intron size expansion driven by TE activities in domesticated grapevines, likely a result of long-term vegetative propagation and intensive human care, which simultaneously promote TE proliferation and

  7. Dissecting miRNAs in Wheat D Genome Progenitor, Aegilops tauschii.

    Science.gov (United States)

    Akpinar, Bala A; Budak, Hikmet

    2016-01-01

    As the post-transcriptional regulators of gene expression, microRNAs or miRNAs comprise an integral part of understanding how genomes function. Although miRNAs have been a major focus of recent efforts, miRNA research is still in its infancy in most plant species. Aegilops tauschii, the D genome progenitor of bread wheat, is a wild diploid grass exhibiting remarkable population diversity. Due to the direct ancestry and the diverse gene pool, A. tauschii is a promising source for bread wheat improvement. In this study, a total of 87 Aegilops miRNA families, including 51 previously unknown, were computationally identified both at the subgenomic level, using flow-sorted A. tauschii 5D chromosome, and at the whole genome level. Predictions at the genomic and subgenomic levels suggested A. tauschii 5D chromosome as rich in pre-miRNAs that are highly associated with Class II DNA transposons. In order to gain insights into miRNA evolution, putative 5D chromosome miRNAs were compared to its modern ortholog, Triticum aestivum 5D chromosome, revealing that 48 of the 58 A. tauschii 5D miRNAs were conserved in orthologous T. aestivum 5D chromosome. The expression profiles of selected miRNAs (miR167, miR5205, miR5175, miR5523) provided the first experimental evidence for miR5175, miR5205 and miR5523, and revealed differential expressional changes in response to drought in different genetic backgrounds for miR167 and miR5175. Interestingly, while miR5523 coding regions were present and expressed as pre-miR5523 in both T. aestivum and A. tauschii, the expression of mature miR5523 was observed only in A. tauschii under normal conditions, pointing out to an interference at the downstream processing of pre-miR5523 in T. aestivum. Overall, this study expands our knowledge on the miRNA catalog of A. tauschii, locating a subset specifically to the 5D chromosome, with ample functional and comparative insight which should contribute to and complement efforts to develop drought tolerant

  8. Dissecting miRNAs in wheat D genome progenitor, Aegilops tauschii

    Directory of Open Access Journals (Sweden)

    Hikmet eBudak

    2016-05-01

    Full Text Available As the post-transcriptional regulators of gene expression, microRNAs or miRNAs comprise an integral part of understanding how genomes function. Although miRNAs have been a major focus of recent efforts, miRNA research is still in its infancy in most plant species. Aegilops tauschii, the D genome progenitor of bread wheat, is a wild diploid grass exhibiting remarkable population diversity. Due to the direct ancestry and the diverse gene pool, A. tauschii is a promising source for bread wheat improvement. In this study, a total of 87 Aegilops miRNA families, including 51 previously unknown, were computationally identified both at the subgenomic level, using flow-sorted A. tauschii 5D chromosome, and at the whole genome level. Predictions at the genomic and subgenomic levels suggested A. tauschii 5D chromosome as rich in pre-miRNAs that are highly associated with Class II DNA transposons. In order to gain insights into miRNA evolution, putative 5D chromosome miRNAs were compared to its modern ortholog, T. aestivum 5D chromosome, revealing that 48 of the 58 A. tauschii 5D miRNAs were conserved in orthologous T. aestivum 5D chromosome. The expression profiles of selected miRNAs (miR167, miR5205, miR5175, miR5523 provided the first experimental evidence for miR5175, miR5205 and miR5523, and revealed differential expressional changes in response to drought in different genetic backgrounds for miR167 and miR5175. Interestingly, while miR5523 coding regions were present and expressed as pre-miR5523 in both T. aestivum and A. tauschii, the expression of mature miR5523 was observed only in A. tauschii under normal conditions, pointing out to an interference at the downstream processing of pre-miR5523 in T. aestivum. Overall, this study expands our knowledge on the miRNA catalogue of Aegilops tauschii, locating a subset specifically to the 5D chromosome, with ample functional and comparative insight which should contribute to and complement efforts to

  9. Geographical mapping of a multifocal thyroid tumour using genetic alteration analysis & miRNA profiling

    Directory of Open Access Journals (Sweden)

    Li Jing

    2008-12-01

    Full Text Available Abstract Background Papillary thyroid carcinoma (PTC frequently presents as multiple tumour-foci within a single thyroid gland or pluriform, with synchronous tumours comprising different histological variants, raising questions regarding its clonality. Among the genetic aberrations described in PTC, the BRAF V600E mutation and ret/PTC activation occur most commonly. Several studies have investigated the genetic alteration status of multifocal thyroid tumours, with discordant results. To address the question of clonality this study examined disparate geographical and morphological areas from a single PTC (classic PTC, insular and anaplastic foci, and tumour cells adjacent to vascular invasion and lymphocytic infiltrate for the presence of ret/PTC 1 or BRAF mutations. Moreover, we wanted to investigate the consistency of miRNA signatures within disparate areas of a tumour, and geographical data was further correlated with expression profiles of 330 different miRNAs. Putative miRNA gene targets were predicted for differentially regulated miRNAs and immunohistochemistry was performed on tissue sections in an effort to investigate phenotypic variations in microvascular density (MVD, and cytokeratin and p53 protein expression levels. Results All of the morphological areas proved negative for ret/PTC 1 rearrangement. Two distinct foci with classic morphology harboured the BRAF mutation. All other regions, including the insular and anaplastic areas were negative for the mutation. MiRNA profiles were found to distinguish tumours containing the BRAF mutation from the other tumour types, and to differentiate between the more aggressive insular & anaplastic tumours, and the classic variant. Our data corroborated miRNAs previously discovered in this carcinoma, and additional miRNAs linked to various processes involved in tumour growth and proliferation. Conclusion The initial genetic alteration analysis indicated that pluriform PTC did not necessarily evolve

  10. miRNA profiling of high, low and non-producing CHO cells during biphasic fed-batch cultivation reveals process relevant targets for host cell engineering.

    Science.gov (United States)

    Stiefel, Fabian; Fischer, Simon; Sczyrba, Alexander; Otte, Kerstin; Hesse, Friedemann

    2016-05-10

    Fed-batch cultivation of recombinant Chinese hamster ovary (CHO) cell lines is one of the most widely used production modes for commercial manufacturing of recombinant protein therapeutics. Furthermore, fed-batch cultivations are often conducted as biphasic processes where the culture temperature is decreased to maximize volumetric product yields. However, it remains to be elucidated which intracellular regulatory elements actually control the observed pro-productive phenotypes. Recently, several studies have revealed microRNAs (miRNAs) to be important molecular switches of cell phenotypes. In this study, we analyzed miRNA profiles of two different recombinant CHO cell lines (high and low producer), and compared them to a non-producing CHO DG44 host cell line during fed-batch cultivation at 37°C versus a temperature shift to 30°C. Taking advantage of next-generation sequencing combined with cluster, correlation and differential expression analyses, we could identify 89 different miRNAs, which were differentially expressed in the different cell lines and cultivation phases. Functional validation experiments using 19 validated target miRNAs confirmed that these miRNAs indeed induced changes in process relevant phenotypes. Furthermore, computational miRNA target prediction combined with functional clustering identified putative target genes and cellular pathways, which might be regulated by these miRNAs. This study systematically identified novel target miRNAs during different phases and conditions of a biphasic fed-batch production process and functionally evaluated their potential for host cell engineering.

  11. MicroRNAs, macrocontrol : Regulation of miRNA processing

    NARCIS (Netherlands)

    Slezak-Prochazka, Izabella; Durmus, Selvi; Kroesen, Bart-Jan; van den Berg, Anke

    2010-01-01

    MicroRNAs (miRNAs) are a set of small, non-protein-coding RNAs that regulate gene expression at the post-transcriptional level. Maturation of miRNAs comprises several regulated steps resulting in similar to 22-nucleotide single-stranded mature miRNAs. Regulation of miRNA expression can occur both at

  12. Global gene expression analysis reveals reduced abundance of putative microRNA targets in human prostate tumours

    Directory of Open Access Journals (Sweden)

    Xie Yi

    2009-02-01

    Full Text Available Abstract Background Recently, microRNAs (miRNAs have taken centre stage in the field of human molecular oncology. Several studies have shown that miRNA profiling analyses offer new possibilities in cancer classification, diagnosis and prognosis. However, the function of miRNAs that are dysregulated in tumours remains largely a mystery. Global analysis of miRNA-target gene expression has helped illuminate the role of miRNAs in developmental gene expression programs, but such an approach has not been reported in cancer transcriptomics. Results In this study, we globally analysed the expression patterns of miRNA target genes in prostate cancer by using several public microarray datasets. Intriguingly, we found that, in contrast to global mRNA transcript levels, putative miRNA targets showed a reduced abundance in prostate tumours relative to benign prostate tissue. Additionally, the down-regulation of these miRNA targets positively correlated with the number of types of miRNA target-sites in the 3' untranslated regions of these targets. Further investigation revealed that the globally low expression was mainly driven by the targets of 36 specific miRNAs that were reported to be up-regulated in prostate cancer by a miRNA expression profiling study. We also found that the transcript levels of miRNA targets were lower in androgen-independent prostate cancer than in androgen-dependent prostate cancer. Moreover, when the global analysis was extended to four other cancers, significant differences in transcript levels between miRNA targets and total mRNA backgrounds were found. Conclusion Global gene expression analysis, along with further investigation, suggests that miRNA targets have a significantly reduced transcript abundance in prostate cancer, when compared with the combined pool of all mRNAs. The abnormal expression pattern of miRNA targets in human cancer could be a common feature of the human cancer transcriptome. Our study may help to shed new

  13. The RNA-binding protein HOS5 and serine/arginine-rich proteins RS40 and RS41 participate in miRNA biogenesis in Arabidopsis

    KAUST Repository

    Chen, Tao

    2015-07-30

    MicroRNAs are a class of small regulatory RNAs that are generated from primary miRNA (pri-miRNA) transcripts with a stem-loop structure. Accuracy of the processing of pri-miRNA into mature miRNA in plants can be enhanced by SERRATE (SE) and HYPONASTIC LEAVES 1 (HYL1). HYL1 activity is regulated by the FIERY2 (FRY2)/RNA polymerase II C-terminal domain phosphatase-like 1 (CPL1). Here, we discover that HIGH OSMOTIC STRESS GENE EXPRESSION 5 (HOS5) and two serine/arginine-rich splicing factors RS40 and RS41, previously shown to be involved in pre-mRNA splicing, affect the biogenesis of a subset of miRNA. These proteins are required for correct miRNA strand selection and the maintenance of miRNA levels. FRY2 dephosphorylates HOS5 whose phosphorylation status affects its subnuclear localization. HOS5 and the RS proteins bind both intronless and intron-containing pri-miRNAs. Importantly, all of these splicing-related factors directly interact with both HYL1 and SE in nuclear splicing speckles. Our results indicate that these splicing factors are directly involved in the biogenesis of a group of miRNA.

  14. The RNA-binding protein HOS5 and serine/arginine-rich proteins RS40 and RS41 participate in miRNA biogenesis in Arabidopsis.

    Science.gov (United States)

    Chen, Tao; Cui, Peng; Xiong, Liming

    2015-09-30

    MicroRNAs are a class of small regulatory RNAs that are generated from primary miRNA (pri-miRNA) transcripts with a stem-loop structure. Accuracy of the processing of pri-miRNA into mature miRNA in plants can be enhanced by SERRATE (SE) and HYPONASTIC LEAVES 1 (HYL1). HYL1 activity is regulated by the FIERY2 (FRY2)/RNA polymerase II C-terminal domain phosphatase-like 1 (CPL1). Here, we discover that HIGH OSMOTIC STRESS GENE EXPRESSION 5 (HOS5) and two serine/arginine-rich splicing factors RS40 and RS41, previously shown to be involved in pre-mRNA splicing, affect the biogenesis of a subset of miRNA. These proteins are required for correct miRNA strand selection and the maintenance of miRNA levels. FRY2 dephosphorylates HOS5 whose phosphorylation status affects its subnuclear localization. HOS5 and the RS proteins bind both intronless and intron-containing pri-miRNAs. Importantly, all of these splicing-related factors directly interact with both HYL1 and SE in nuclear splicing speckles. Our results indicate that these splicing factors are directly involved in the biogenesis of a group of miRNA.

  15. The peculiarities of large intron splicing in animals.

    Science.gov (United States)

    Shepard, Samuel; McCreary, Mark; Fedorov, Alexei

    2009-11-16

    In mammals a considerable 92% of genes contain introns, with hundreds and hundreds of these introns reaching the incredible size of over 50,000 nucleotides. These "large introns" must be spliced out of the pre-mRNA in a timely fashion, which involves bringing together distant 5' and 3' acceptor and donor splice sites. In invertebrates, especially Drosophila, it has been shown that larger introns can be spliced efficiently through a process known as recursive splicing-a consecutive splicing from the 5'-end at a series of combined donor-acceptor splice sites called RP-sites. Using a computational analysis of the genomic sequences, we show that vertebrates lack the proper enrichment of RP-sites in their large introns, and, therefore, require some other method to aid splicing. We analyzed over 15,000 non-redundant, large introns from six mammals, 1,600 from chicken and zebrafish, and 560 non-redundant large introns from five invertebrates. Our bioinformatic investigation demonstrates that, unlike the studied invertebrates, the studied vertebrate genomes contain consistently abundant amounts of direct and complementary strand interspersed repetitive elements (mainly SINEs and LINEs) that may form stems with each other in large introns. This examination showed that predicted stems are indeed abundant and stable in the large introns of mammals. We hypothesize that such stems with long loops within large introns allow intron splice sites to find each other more quickly by folding the intronic RNA upon itself at smaller intervals and, thus, reducing the distance between donor and acceptor sites.

  16. The peculiarities of large intron splicing in animals.

    Directory of Open Access Journals (Sweden)

    Samuel Shepard

    Full Text Available In mammals a considerable 92% of genes contain introns, with hundreds and hundreds of these introns reaching the incredible size of over 50,000 nucleotides. These "large introns" must be spliced out of the pre-mRNA in a timely fashion, which involves bringing together distant 5' and 3' acceptor and donor splice sites. In invertebrates, especially Drosophila, it has been shown that larger introns can be spliced efficiently through a process known as recursive splicing-a consecutive splicing from the 5'-end at a series of combined donor-acceptor splice sites called RP-sites. Using a computational analysis of the genomic sequences, we show that vertebrates lack the proper enrichment of RP-sites in their large introns, and, therefore, require some other method to aid splicing. We analyzed over 15,000 non-redundant, large introns from six mammals, 1,600 from chicken and zebrafish, and 560 non-redundant large introns from five invertebrates. Our bioinformatic investigation demonstrates that, unlike the studied invertebrates, the studied vertebrate genomes contain consistently abundant amounts of direct and complementary strand interspersed repetitive elements (mainly SINEs and LINEs that may form stems with each other in large introns. This examination showed that predicted stems are indeed abundant and stable in the large introns of mammals. We hypothesize that such stems with long loops within large introns allow intron splice sites to find each other more quickly by folding the intronic RNA upon itself at smaller intervals and, thus, reducing the distance between donor and acceptor sites.

  17. Intronic polymorphisms of cytochromes P450

    Directory of Open Access Journals (Sweden)

    Ingelman-Sundberg Magnus

    2010-08-01

    Full Text Available Abstract The cytochrome P450 enzymes active in drug metabolism are highly polymorphic. Most allelic variants have been described for enzymes encoded by the cytochrome P450 family 2 (CYP2 gene family, which has 252 different alleles. The intronic polymorphisms in the cytochrome P450 genes account for only a small number of the important variant alleles; however, the most important ones are CYP2D6*4 and CYP2D6*41, which cause abolished and reduced CYP2D6 activity, respectively, and CYP3A5*3 and CYP3A5*5, common in Caucasian populations, which cause almost null activity. Their discoveries have been based on phenotypic alterations within individuals in a population, and their identification has, in several cases, been difficult and taken a long time. In light of the next-generation sequencing projects, it is anticipated that further alleles with intronic mutations will be identified that can explain the hitherto unidentified genetic basis of inter-individual differences in cytochrome P450-mediated drug and steroid metabolism.

  18. Epigenetic Regulation of Intronic Transgenes in Arabidopsis

    Science.gov (United States)

    Osabe, Kenji; Harukawa, Yoshiko; Miura, Saori; Saze, Hidetoshi

    2017-01-01

    Defense mechanisms of plant genomes can epigenetically inactivate repetitive sequences and exogenous transgenes. Loss of mutant phenotypes in intronic T-DNA insertion lines by interaction with another T-DNA locus, termed T-DNA suppression, has been observed in Arabidopsis thaliana, although the molecular basis of establishment and maintenance of T-DNA suppression is poorly understood. Here we show that maintenance of T-DNA suppression requires heterochromatinisation of T-DNA sequences and the nuclear proteins, INCREASED IN BONSAI METHYLATION 2 (IBM2) and ENHANCED DOWNY MILDEW 2 (EDM2), which prevent ectopic 3′ end processing of mRNA in atypically long introns containing T-DNA sequences. Initiation of T-DNA suppression is mediated by the canonical RdDM pathway after hybridisation of two T-DNA strains, accompanied by DNA hypermethylation of T-DNA sequences in the F1 generation. Our results reveal the presence of a genome surveillance mechanism through genome hybridisation that masks repetitive DNAs intruding into transcription units. PMID:28338020

  19. The intraspecific variability of mitochondrial genes of Agaricus bisporus reveals an extensive group I intron mobility combined with low nucleotide substitution rates.

    Science.gov (United States)

    Jalalzadeh, Banafsheh; Saré, Idy Carras; Férandon, Cyril; Callac, Philippe; Farsi, Mohammad; Savoie, Jean-Michel; Barroso, Gérard

    2015-02-01

    Intraspecific mitochondrial variability was studied in ten strains of A. bisporus var. bisporus, in a strain representative of A. bisporus var. eurotetrasporus and in a strain of the closely related species Agaricus devoniensis. In A. bisporus, the cox1 gene is the richest in group I introns harboring homing endonuclease genes (heg). This study led to identify group I introns as the main source of cox1 gene polymorphism. Among the studied introns, two groups were distinguished according to the heg they contained. One group harbored heg maintained putatively functional. The other group was composed of eroded heg sequences that appeared to evolve toward their elimination. Low nucleotide substitution rates were found in both types of intronic sequences. This feature was also shared by all types of studied mitochondrial sequences, not only intronic but also genic and intergenic ones, when compared with nuclear sequences. Hence, the intraspecific evolution of A. bisporus mitochondrial genome appears characterized by both an important mobility (presence/absence) of large group I introns and by low nt substitution rates. This stringent conservation of mitochondrial sequences, when compared with their nuclear counterparts, appears irrespective of their apparent functionality and contrasts to what is widely accepted in fungal sequence evolution. This strengthens the usefulness of mtDNA sequences to get clues on intraspecific evolution.

  20. Influence of intron length on interaction characters between post-spliced intron and its CDS in ribosomal protein genes

    Science.gov (United States)

    Zhao, Xiaoqing; Li, Hong; Bao, Tonglaga; Ying, Zhiqiang

    2012-09-01

    Many experiment evidences showed that sequence structures of introns and intron loss/gain can influence gene expression, but current mechanisms did not refer to the functions of post-spliced introns directly. We propose that postspliced introns play their functions in gene expression by interacting with their mRNA sequences and the interaction is characterized by the matched segments between introns and their CDS. In this study, we investigated the interaction characters with length series by improved Smith-Waterman local alignment software for the ribosomal protein genes in C. elegans and D. melanogaster. Our results showed that RF values of five intron groups are significantly high in the central non-conserved region and very low in 5'-end and 3'-end splicing region. It is interesting that the number of the optimal matched regions gradually increases with intron length. Distributions of the optimal matched regions are different for five intron groups. Our study revealed that there are more interaction regions between longer introns and their CDS than shorter, and it provides a positive pattern for regulating the gene expression.

  1. Sequence features responsible for intron retention in human

    Directory of Open Access Journals (Sweden)

    Sakabe Noboru

    2007-02-01

    Full Text Available Abstract Background One of the least common types of alternative splicing is the complete retention of an intron in a mature transcript. Intron retention (IR is believed to be the result of intron, rather than exon, definition associated with failure of the recognition of weak splice sites flanking short introns. Although studies on individual retained introns have been published, few systematic surveys of large amounts of data have been conducted on the mechanisms that lead to IR. Results TTo understand how sequence features are associated with or control IR, and to produce a generalized model that could reveal previously unknown signals that regulate this type of alternative splicing, we partitioned intron retention events observed in human cDNAs into two groups based on the relative abundance of both isoforms and compared relevant features. We found that a higher frequency of IR in human is associated with individual introns that have weaker splice sites, genes with shorter intron lengths, higher expression levels and lower density of both a set of exon splicing silencers (ESSs and the intronic splicing enhancer GGG. Both groups of retained introns presented events conserved in mouse, in which the retained introns were also short and presented weaker splice sites. Conclusion Although our results confirmed that weaker splice sites are associated with IR, they showed that this feature alone cannot explain a non-negligible fraction of events. Our analysis suggests that cis-regulatory elements are likely to play a crucial role in regulating IR and also reveals previously unknown features that seem to influence its occurrence. These results highlight the importance of considering the interplay among these features in the regulation of the relative frequency of IR.

  2. Effects of polycystic ovary syndrome (PCOS), sex hormones, and obesity on circulating miRNA-21, miRNA-27b, miRNA-103, and miRNA-155 expression.

    Science.gov (United States)

    Murri, Mora; Insenser, María; Fernández-Durán, Elena; San-Millán, José L; Escobar-Morreale, Héctor F

    2013-11-01

    MicroRNAs (miRNAs) are small, noncoding RNA sequences that negatively regulate gene expression at the post-transcriptional level. miRNA-21, miRNA-27b, miRNA-103, and miRNA-155 have been associated with metabolic disorders such as obesity and diabetes, which are also associated with polycystic ovary syndrome (PCOS). We aimed to evaluate the effects of sex, sex hormones, and PCOS and their interactions with obesity on the expression in the circulation of these miRNAs. This was a case-control study. The setting was an academic hospital. We included 12 control women, 12 patients with PCOS, and 12 men selected as to have similar body mass index (BMI) and age. Six subjects per group had normal weight (BMI obese (BMI ≥ 30 kg/m(2)). Blood samples were collected early in the morning after a 12-hour fast. We measured whole blood expression of miRNA-21, miRNA-27b, miRNA-103, and miRNA-155. Obesity significantly reduced the expression of miRNA-21, miRNA-27b, and miRNA-103. However, there was a significant interaction between obesity and the group of subjects in the expression of miRNA-21, miRNA-27b, miRNA-103, and miRNA-155 consisting of obesity reducing the expression of these miRNAs in control woman and men, but tending to increase their expression in women with PCOS. These differences paralleled those observed in serum T concentrations. The present results suggest that miRNAs that play an important role in metabolic and immune system processes are influenced by obesity and circulating androgen concentrations.

  3. IL-4 Up-Regulates MiR-21 and the MiRNAs Hosted in the CLCN5 Gene in Chronic Lymphocytic Leukemia.

    Directory of Open Access Journals (Sweden)

    Natalia Ruiz-Lafuente

    Full Text Available Interleukin 4 (IL-4 induces B-cell differentiation and survival of chronic lymphocytic leukemia (CLL cells. MicroRNAs (miRNAs regulate mRNA and protein expression, and several miRNAs, deregulated in CLL, might play roles as oncogenes or tumor suppressors. We have studied the miRNA profile of CLL, and its response to IL-4, by oligonucleotide microarrays, resulting in the detection of a set of 129 mature miRNAs consistently expressed in CLL, which included 41 differentially expressed compared to normal B cells (NBC, and 6 significantly underexpressed in ZAP-70 positive patients. IL-4 stimulation brought about up-regulation of the 5p and 3p mature variants of the miR-21 gene, which maps immediately downstream to the VMP1 gene, and of the mature forms generated from the miR-362 (3p and 5p, miR-500a (3p, miR-502 (3p, and miR-532 (3p and 5p genes, which map within the third intron of the CLCN5 gene. Both genes are in turn regulated by IL-4, suggesting that these miRNAs were regulated by IL-4 as passengers from their carrier genes. Their levels of up-regulation by IL-4 significantly correlated with cytoprotection. MiR-21 has been reported to be leukemogenic, associated to bad prognosis in CLL, and the miRNA more frequently overexpressed in human cancer. Up-regulation by IL-4 of miR-21 and the miRNAs hosted in the CLCN5 locus may contribute to evasion of apoptosis of CLL cells. These findings indicate that the IL-4 pathway and the miRNAs induced by IL-4 are promising targets for the development of novel therapies in CLL.

  4. Mammalian Introns: When the Junk Generates Molecular Diversity

    Directory of Open Access Journals (Sweden)

    Florent Hubé

    2015-02-01

    Full Text Available Introns represent almost half of the human genome, yet their vast majority is eliminated from eukaryotic transcripts through RNA splicing. Nevertheless, they feature key elements and functions that deserve further interest. At the level of DNA, introns are genomic segments that can shelter independent transcription units for coding and non-coding RNAs which transcription may interfere with that of the host gene, and regulatory elements that can influence gene expression and splicing itself. From the RNA perspective, some introns can be subjected to alternative splicing. Intron retention appear to provide some plasticity to the nature of the protein produced, its distribution in a given cell type and timing of its translation. Intron retention may also serve as a switch to produce coding or non-coding RNAs from the same transcription unit. Conversely, splicing of introns has been directly implicated in the production of small regulatory RNAs. Hence, splicing of introns also appears to provide plasticity to the type of RNA produced from a genetic locus (coding, non-coding, short or long. We addressed these aspects to add to our understanding of mechanisms that control the fate of introns and could be instrumental in regulating genomic output and hence cell fate.

  5. Analysis of high iron rice lines reveals new miRNAs that target iron transporters in roots

    Science.gov (United States)

    Paul, Soumitra; Gayen, Dipak; Datta, Swapan K.; Datta, Karabi

    2016-01-01

    The present study highlights the molecular regulation of iron transport in soyFER1-overexpressing transgenic rice. Accumulation of iron in three different seed developmental stages, milk, dough, and mature, has been examined. The transgenic seeds of the milk stage showed significant augmentation of iron and zinc levels compared with wild-type seeds, and similar results were observed throughout the dough and mature stages. To investigate the regulation of iron transport, the role of miRNAs was studied in roots of transgenic rice. Sequencing of small RNA libraries revealed 153 known and 41 novel miRNAs in roots. Among them, 59 known and 14 novel miRNAs were found to be significantly expressed. miR166, miR399, and miR408 were identified as playing a vital role in iron uptake in roots of transgenic plants . Most importantly, four putative novel miRNAs, namely miR11, miR26, miR30, and miR31, were found to be down-regulated in roots of transgenic plants. For all these four novel miRNAs, natural resistance-associated macrophage protein 4 (NRAMP4), encoding a metal transporter, was predicted as a target gene. It is hypothesized that the NRAMP4 transporter is activated in roots of transgenic plants due to the lower abundance of its corresponding putative novel miRNAs. The relative transcript level of the NRAMP4 transcript was increased from 0.107 in the wild type to 65.24 and 55.39 in transgenic plants, which demonstrates the elevated amount of iron transport in transgenic plants. In addition, up-regulation of OsYSL15, OsFRO2, and OsIRT1 in roots also facilitates iron loading in transgenic seeds. PMID:27729476

  6. Epithelium-specific ets transcription factor 2 upregulates cytokeratin 18 expression in pulmonary epithelial cells through an interaction with cytokeratin 18 intron 1

    Institute of Scientific and Technical Information of China (English)

    Deanna YANIW; Jim HU

    2005-01-01

    The role of Ese-2, an Ets family transcription factor, in gene regulation is not known. In this study, the interaction between Ese-2 and cytokeratin 18 (K18) intron 1 was characterized in lung epithelial cells. Reporter gene assays showed Ese-2 was able to upregulate K18 intron 1 enhanced reporter gene expression by approximately 2-fold. We found that full length Ese-2 did not bind DNA strongly, therefore truncated versions of the protein, containing the ETS domain or Pointed domain, were created and tested in electrophoresis mobility shift assays. Multiple interactions between the ETS domain and putative DNA binding sites within K18 intron 1 were observed, which led to the determination of a possible Ese-2 DNA binding consensus sequence. These experiments suggest that Ese-2 could play a role in the regulation of K18 expression in lung epithelial cells.

  7. MiRNA Biogenesis and Intersecting Pathways

    DEFF Research Database (Denmark)

    Ben Chaabane, Samir

    MicroRNAs (miRNAs) are small non-coding RNAs that function as guide molecules in RNA silencing. Plant miRNAs are critical for plant growth, development and stress response, and are processed in Arabidopsis from primary miRNA transcripts (pri-miRNAs) by the endonuclease activity of the DICER-LIKE1...... of action and turnover. During my PhD period we have shown that the STA1 protein, a factor for pre-mRNA splicing and mRNA stability, is specifically involved in the splicing of pri-miRNAs and in the modulation of DCL1 transcript levels. Also, we established a novel and essential regulatory network in which...

  8. Use of Mature miRNA Strand Selection in miRNAs Families in Cervical Cancer Development

    Directory of Open Access Journals (Sweden)

    Angelica Judith Granados-López

    2017-02-01

    Full Text Available Aberrant miRNA expression is well recognized as a cancer hallmark, nevertheless miRNA function and expression does not always correlate in patients tissues and cell lines studies. In addition to this issue, miRNA strand usage conduces to increased cell signaling pathways modulation diversifying cellular processes regulation. In cervical cancer, 20 miRNA families are involved in carcinogenesis induction and development to this moment. These families have 5p and 3p strands with different nucleotide (nt chain sizes. In general, mature 5p strands are larger: two miRNAs of 24 nt, 24 miRNAs of 23 nt, 35 miRNAs of 22 nt and three miRNAs of 21 nt. On the other hand, the 3p strands lengths observed are: seven miRNAs of 23 nt, 50 miRNAs of 22 nt, six miRNAs of 21 nt and four miRNAs of 20 nt. Based on the analysis of the 20 miRNA families associated with cervical cancer, 67 3p strands and 65 5p strands are selected suggesting selectivity and specificity mechanisms regulating cell processes like proliferation, apoptosis, migration, invasion, metabolism and Warburg effect. The insight reviewed here could be used in the miRNA based therapy, diagnosis and prognosis approaches.

  9. Use of Mature miRNA Strand Selection in miRNAs Families in Cervical Cancer Development

    Science.gov (United States)

    Granados-López, Angelica Judith; Ruiz-Carrillo, José Luis; Servín-González, Luis Steven; Martínez-Rodríguez, José Luis; Reyes-Estrada, Claudia Araceli; Gutiérrez-Hernández, Rosalinda; López, Jesús Adrián

    2017-01-01

    Aberrant miRNA expression is well recognized as a cancer hallmark, nevertheless miRNA function and expression does not always correlate in patients tissues and cell lines studies. In addition to this issue, miRNA strand usage conduces to increased cell signaling pathways modulation diversifying cellular processes regulation. In cervical cancer, 20 miRNA families are involved in carcinogenesis induction and development to this moment. These families have 5p and 3p strands with different nucleotide (nt) chain sizes. In general, mature 5p strands are larger: two miRNAs of 24 nt, 24 miRNAs of 23 nt, 35 miRNAs of 22 nt and three miRNAs of 21 nt. On the other hand, the 3p strands lengths observed are: seven miRNAs of 23 nt, 50 miRNAs of 22 nt, six miRNAs of 21 nt and four miRNAs of 20 nt. Based on the analysis of the 20 miRNA families associated with cervical cancer, 67 3p strands and 65 5p strands are selected suggesting selectivity and specificity mechanisms regulating cell processes like proliferation, apoptosis, migration, invasion, metabolism and Warburg effect. The insight reviewed here could be used in the miRNA based therapy, diagnosis and prognosis approaches. PMID:28216603

  10. Molecular evolution of Adh and LEAFY and the phylogenetic utility of their introns in Pyrus (Rosaceae

    Directory of Open Access Journals (Sweden)

    Cao Jiashu

    2011-09-01

    Full Text Available Abstract Background The genus Pyrus belongs to the tribe Pyreae (the former subfamily Maloideae of the family Rosaceae, and includes one of the most important commercial fruit crops, pear. The phylogeny of Pyrus has not been definitively reconstructed. In our previous efforts, the internal transcribed spacer region (ITS revealed a poorly resolved phylogeny due to non-concerted evolution of nrDNA arrays. Therefore, introns of low copy nuclear genes (LCNG are explored here for improved resolution. However, paralogs and lineage sorting are still two challenges for applying LCNGs in phylogenetic studies, and at least two independent nuclear loci should be compared. In this work the second intron of LEAFY and the alcohol dehydrogenase gene (Adh were selected to investigate their molecular evolution and phylogenetic utility. Results DNA sequence analyses revealed a complex ortholog and paralog structure of Adh genes in Pyrus and Malus, the pears and apples. Comparisons between sequences from RT-PCR and genomic PCR indicate that some Adh homologs are putatively nonfunctional. A partial region of Adh1 was sequenced for 18 Pyrus species and three subparalogs representing Adh1-1 were identified. These led to poorly resolved phylogenies due to low sequence divergence and the inclusion of putative recombinants. For the second intron of LEAFY, multiple inparalogs were discovered for both LFY1int2 and LFY2int2. LFY1int2 is inadequate for phylogenetic analysis due to lineage sorting of two inparalogs. LFY2int2-N, however, showed a relatively high sequence divergence and led to the best-resolved phylogeny. This study documents the coexistence of outparalogs and inparalogs, and lineage sorting of these paralogs and orthologous copies. It reveals putative recombinants that can lead to incorrect phylogenetic inferences, and presents an improved phylogenetic resolution of Pyrus using LFY2int2-N. Conclusions Our study represents the first phylogenetic analyses based

  11. Exosomes as miRNA Carriers: Formation-Function-Future.

    Science.gov (United States)

    Yu, Xiaojie; Odenthal, Margarete; Fries, Jochen W U

    2016-12-02

    Exosomes, which are one of the smallest extracellular vesicles released from cells, have been shown to carry different nucleic acids, including microRNAs (miRNAs). miRNAs significantly regulate cell growth and metabolism by posttranscriptional inhibition of gene expression. The rapidly changing understanding of exosomes' formation and function in delivering miRNAs from cell to cell has prompted us to review current knowledge in exosomal miRNA secretion mechanisms as well as possible therapeutic applications for personalized medicine.

  12. miRNA expression profiles in chronic lymphocytic and acute lymphocytic leukemia

    Directory of Open Access Journals (Sweden)

    D.L. Zanette

    2007-11-01

    Full Text Available MicroRNAs (miRNAs are a class of small endogenous RNAs that play important regulatory roles by targeting mRNAs for cleavage or translational repression. miRNAs act in diverse biological processes including development, cell growth, apoptosis, and hematopoiesis, suggesting their association with cancer. We determined the miRNA expression profile of chronic and acute lymphocytic leukemias (CLL and ALL using the TaqMan® MicroRNA Assays Human Panel (Applied Biosystems. Pooled leukemia samples were compared to pooled CD19+ samples from healthy individuals (calibrator by the 2-DDCt method. Total RNA input was normalized based on the Ct values obtained for hsa-miR-30b. The five most highly expressed miRNAs were miR-128b, miR-204, miR-218, miR-331, and miR-181b-1 in ALL, and miR-331, miR-29a, miR-195, miR-34a, and miR-29c in CLL. To our knowledge, this is the first report associating miR-128b, miR-204 and miR-331 to hematological malignancies. The miR-17-92 cluster was also found to be up-regulated in ALL, as previously reported for some types of lymphomas. The differences observed in gene expression levels were validated for miR-331 and miR-128b in ALL and CD19+ samples. These miRNAs were up-regulated in ALL, in agreement with our initial results. A brief target analysis was performed for miR-331. One of its putative targets, SOCS1, promotes STAT activation, which is a known mediator of cell proliferation and survival, suggesting the possibility of an association between miR-331 and these processes. This initial screening provided information on miRNA differentially expressed in normal and malignant B-cells that could suggest the potential roles of these miRNAs in hematopoiesis and leukemogenesis.

  13. Intron evolution in Neurospora: the role of mutational bias and selection.

    Science.gov (United States)

    Sun, Yu; Whittle, Carrie A; Corcoran, Pádraic; Johannesson, Hanna

    2015-01-01

    We used comparative and population genomics to study intron evolutionary dynamics in the fungal model genus Neurospora. For our investigation, we used well-annotated genomes of N. crassa, N. discreta, and N. tetrasperma, and 92 resequenced genomes of N. tetrasperma from natural populations. By analyzing the four well-annotated genomes, we identified 9495 intron sites in 7619 orthologous genes. Our data supports nonhomologous end joining (NHEJ) and tandem duplication as mechanisms for intron gains in the genus and the RT-mRNA process as a mechanism for intron loss. We found a moderate intron gain rate (5.78-6.89 × 10(-13) intron gains per nucleotide site per year) and a high intron loss rate (7.53-13.76 × 10(-10) intron losses per intron sites per year) as compared to other eukaryotes. The derived intron gains and losses are skewed to high frequencies, relative to neutral SNPs, in natural populations of N. tetrasperma, suggesting that selection is involved in maintaining a high intron turnover. Furthermore, our analyses of the association between intron population-level frequency and genomic features suggest that selection is involved in shaping a 5' intron position bias and a low intron GC content. However, intron sequence analyses suggest that the gained introns were not exposed to recent selective sweeps. Taken together, this work contributes to our understanding of the importance of mutational bias and selection in shaping the intron distribution in eukaryotic genomes.

  14. Discovery of miRNAs and Their Corresponding miRNA Genes in Atlantic Cod (Gadus morhua: Use of Stable miRNAs as Reference Genes Reveals Subgroups of miRNAs That Are Highly Expressed in Particular Organs.

    Directory of Open Access Journals (Sweden)

    Rune Andreassen

    Full Text Available Atlantic cod (Gadus morhua is among the economically most important species in the northern Atlantic Ocean and a model species for studying development of the immune system in vertebrates. MicroRNAs (miRNAs are an abundant class of small RNA molecules that regulate fundamental biological processes at the post-transcriptional level. Detailed knowledge about a species miRNA repertoire is necessary to study how the miRNA transcriptome modulate gene expression. We have therefore discovered and characterized mature miRNAs and their corresponding miRNA genes in Atlantic cod. We have also performed a validation study to identify suitable reference genes for RT-qPCR analysis of miRNA expression in Atlantic cod. Finally, we utilized the newly characterized miRNA repertoire and the dedicated RT-qPCR method to reveal miRNAs that are highly expressed in certain organs.The discovery analysis revealed 490 mature miRNAs (401 unique sequences along with precursor sequences and genomic location of the miRNA genes. Twenty six of these were novel miRNA genes. Validation studies ranked gmo-miR-17-1-5p or the two-gene combination gmo-miR25-3p and gmo-miR210-5p as most suitable qPCR reference genes. Analysis by RT-qPCR revealed 45 miRNAs with significantly higher expression in tissues from one or a few organs. Comparisons to other vertebrates indicate that some of these miRNAs may regulate processes like growth, lipid metabolism, immune response to microbial infections and scar damage repair. Three teleost-specific and three novel Atlantic cod miRNAs were among the differentially expressed miRNAs.The number of known mature miRNAs was considerably increased by our identification of miRNAs and miRNA genes in Atlantic cod. This will benefit further functional studies of miRNA expression using deep sequencing methods. The validation study showed that stable miRNAs are suitable reference genes for RT-qPCR analysis of miRNA expression. Applying RT-qPCR we have identified

  15. Identification and Analyses of miRNA Genes in Allotetraploid Gossypium hirsutum Fiber Cells Based on the Sequenced Diploid G.raimondii Genome

    Institute of Scientific and Technical Information of China (English)

    Qin Li; Xiang Jin; Yu-Xian Zhu

    2012-01-01

    The plant genome possesses a large number of microRNAs (miRNAs) mainly 21-24 nucleotides in length.They play a vital role in regulation of target gene expression at various stages throughout the whole plant life cycle.Here we sequenced and analyzed ~ 10 million non-coding RNAs (ncRNAs) derived from fiber tissue of the allotetraploid cotton (Gossypium hirsutum) 7 days post-anthesis using ncRNA-seq technology.In terms of distinct reads,24 nt ncRNA is by far the dominant species,followed by 21 nt and 23 nt ncRNAs.Using ab initio prediction,we identified and characterized a total of 562 candidate miRNA gene loci on the recently assembled D5 genome of the diploid cotton G.raimondii.Of all the 562 predicted miRNAs,22 were previously discovered in cotton species and 187 had sequence conservation and homology to homologous miRNAs of other plant species.Nucleotide bias analysis showed that the 9th and 1st positions were significantly conserved among different types of miRNA genes.Among the 463 putative miRNA target genes,most significant up/down-regulation occurred in 10-20 days post-anthesis,indicating that miRNAs played an important role during the elongation and secondary cell wall synthesis stages of cotton fiber developmem.The discovery of new miRNA genes will help understand the mechanisms of miRNA generation and regulation in cotton.

  16. miRNA array analysis determines miR-205 is overexpressed in head and neck squamous cell carcinoma and enhances cellular proliferation

    Directory of Open Access Journals (Sweden)

    Howard JD

    2013-08-01

    Full Text Available MicroRNAs (miRNAs play a critical role in cell cycle and pro-survival signal regulation. Consequently, their deregulation can enhance tumorigenesis and cancer progression. In the current investigation, we determined whether cancer- or human papillomavirus (HPV-specific miRNA deregulation could further elucidate signal transduction events unique to head and neck squamous cell carcinoma (HNSCC. Twenty-nine newly diagnosed HNSCC tumors (HPV-positive: 14, HPV-negative: 15 and four normal mucosa samples were analyzed for global miRNA expression. Differential miRNA expression analysis concluded HNSCC is characterized by a general upregulation of miRNAs compared to normal mucosa. Additionally, miR-449a and miR-129-3p were statistically significant miRNAs differentially expressed between HPV-positive and HPV-negative HNSCC. The upregulation of miR-449a was also validated within an independent dataset obtained from TCGA containing 279 HNSCCs and 39 normal adjacent mucosa samples. To gain a better understanding of miRNA-mediated cell cycle deregulation in HNSCC, we functionally evaluated miR-205, a transcript upregulated in our cancer-specific analysis and a putative regulator of E2F1. Modulation of miR-205 with a miRNA mimic and inhibitor revealed miR-205 is capable of regulating E2F1 expression in HNSCC and overexpression of this transcript enhances proliferation. This study demonstrates miRNA expression is highly deregulated in HNSCC and functional evaluations of these miRNAs may reveal novel HPV context dependent mechanisms in this disease.

  17. An overview of circulating cell-free microRNAs as putative biomarkers in Alzheimer's and Parkinson's Diseases.

    Science.gov (United States)

    Batistela, Meire Silva; Josviak, Nalini Drieli; Sulzbach, Carla Daniela; de Souza, Ricardo Lehtonen Rodrigues

    2016-07-20

    Circulating cell-free microRNAs (miRNAs) are stable in many biological fluids and their expression profiles can suffer changes under different physiological and pathological conditions. In the last few years, miRNAs have been proposed as putative noninvasive biomarkers in diagnosis, prognosis and response to treatment for several diseases, including neurodegenerative disorders as Alzheimer's disease (AD) and Parkinson's disease (PD). Cognitive and/or motor impairments are usually considered for establishing clinical diagnosis, and at this stage, the majority of the neurons may already be lost making difficult attempts of novel therapies. In this review, we intend to survey the circulating cell-free miRNAs found as dysregulated in cerebrospinal fluid, serum and plasma samples in AD and PD patients, and show how those miRNAs can be useful for early and differential diagnosis. Beyond that, we highlighted the miRNAs that are possibly related to common molecular mechanisms in the neurodegeneration process, as well those miRNAs related to specific disease pathways.

  18. Group II intron-anchored gene deletion in Clostridium.

    Directory of Open Access Journals (Sweden)

    Kaizhi Jia

    Full Text Available Clostridium plays an important role in commercial and medical use, for which targeted gene deletion is difficult. We proposed an intron-anchored gene deletion approach for Clostridium, which combines the advantage of the group II intron "ClosTron" system and homologous recombination. In this approach, an intron carrying a fragment homologous to upstream or downstream of the target site was first inserted into the genome by retrotransposition, followed by homologous recombination, resulting in gene deletion. A functional unknown operon CAC1493-1494 located in the chromosome, and an operon ctfAB located in the megaplasmid of C. acetobutylicum DSM1731 were successfully deleted by using this approach, without leaving antibiotic marker in the genome. We therefore propose this approach can be used for targeted gene deletion in Clostridium. This approach might also be applicable for gene deletion in other bacterial species if group II intron retrotransposition system is established.

  19. The regulation of miRNA-211 expression and its role in melanoma cell invasiveness.

    Directory of Open Access Journals (Sweden)

    Joseph Mazar

    Full Text Available The immediate molecular mechanisms behind invasive melanoma are poorly understood. Recent studies implicate microRNAs (miRNAs as important agents in melanoma and other cancers. To investigate the role of miRNAs in melanoma, we subjected human melanoma cell lines to miRNA expression profiling, and report a range of variations in several miRNAs. Specifically, compared with expression levels in melanocytes, levels of miR-211 were consistently reduced in all eight non-pigmented melanoma cell lines we examined; they were also reduced in 21 out of 30 distinct melanoma samples from patients, classified as primary in situ, regional metastatic, distant metastatic, and nodal metastatic. The levels of several predicted target mRNAs of miR-211 were reduced in melanoma cell lines that ectopically expressed miR-211. In vivo target cleavage assays confirmed one such target mRNA encoded by KCNMA1. Mutating the miR-211 binding site seed sequences at the KCNMA1 3'-UTR abolished target cleavage. KCNMA1 mRNA and protein expression levels varied inversely with miR-211 levels. Two different melanoma cell lines ectopically expressing miR-211 exhibited significant growth inhibition and reduced invasiveness compared with the respective parental melanoma cell lines. An shRNA against KCNMA1 mRNA also demonstrated similar effects on melanoma cells. miR-211 is encoded within the sixth intron of TRPM1, a candidate suppressor of melanoma metastasis. The transcription factor MITF, important for melanocyte development and function, is needed for high TRPM1 expression. MITF is also needed for miR-211 expression, suggesting that the tumor-suppressor activities of MITF and/or TRPM1 may at least partially be due to miR-211's negative post transcriptional effects on the KCNMA1 transcript. Given previous reports of high KCNMA1 levels in metastasizing melanoma, prostate cancer and glioma, our findings that miR-211 is a direct posttranscriptional regulator of KCNMA1 expression as well

  20. Identification of miRNAs contributing to neuroblastoma chemoresistance

    Directory of Open Access Journals (Sweden)

    Duncan Ayers

    2015-01-01

    Conclusions: Based on the initial miRNA findings, this study elucidates the dys-regulation of four miRNAs in three separate NB chemoresistant cell line models, spanning two cell lines (SH-SY5Y and UKF-NB-3 and two chemotherapeutic agents (doxorubicin and etoposide. These miRNAs may thus be possibly linked to chemoresistance induction in NB. Such miRNAs are good candidates to be novel drug targets for future miRNA based therapies against aggressive tumours that are not responding to conventional chemotherapy.

  1. Epigenetic architecture and miRNA: reciprocal regulators

    DEFF Research Database (Denmark)

    Wiklund, Erik Digman; Kjems, Jørgen; Clark, Susan

    2010-01-01

    Deregulation of epigenetic and microRNA (miRNA) pathways are emerging as key events in carcinogenesis. miRNA genes can be epigenetically regulated and miRNAs can themselves repress key enzymes that drive epigenetic remodeling. Epigenetic and miRNA functions are thus tightly interconnected......RNAs) are considered especially promising in clinical applications, and their biogenesis and function is a subject of active research. In this review, the current status of epigenetic miRNA regulation is summarized and future therapeutic prospects in the field are discussed with a focus on cancer....

  2. Epigenetic architecture and miRNA: reciprocal regulators

    DEFF Research Database (Denmark)

    Wiklund, Erik Digman; Kjems, Jørgen; Clark, Susan

    2010-01-01

    Deregulation of epigenetic and microRNA (miRNA) pathways are emerging as key events in carcinogenesis. miRNA genes can be epigenetically regulated and miRNAs can themselves repress key enzymes that drive epigenetic remodeling. Epigenetic and miRNA functions are thus tightly interconnected......RNAs) are considered especially promising in clinical applications, and their biogenesis and function is a subject of active research. In this review, the current status of epigenetic miRNA regulation is summarized and future therapeutic prospects in the field are discussed with a focus on cancer....

  3. Identification of novel miRNAs and miRNA dependent developmental shifts of gene expression in Arabidopsis thaliana.

    Directory of Open Access Journals (Sweden)

    Shuhua Zhan

    Full Text Available microRNAs (miRNAs are small, endogenous RNAs of 20 approximately 25 nucleotides, processed from stem-loop regions of longer RNA precursors. Plant miRNAs act as negative regulators of target mRNAs predominately by slicing target transcripts, and a number of miRNAs play important roles in development. We analyzed a number of published datasets from Arabidopsis thaliana to characterize novel miRNAs, novel miRNA targets, and miRNA-regulated developmental changes in gene expression. These data include microarray profiling data and small RNA (sRNA deep sequencing data derived from miRNA biogenesis/transport mutants, microarray profiling data of mRNAs in a developmental series, and computational predictions of conserved genomic stem-loop structures. Our conservative analyses identified five novel mature miRNAs and seven miRNA targets, including one novel target gene. Two complementary miRNAs that target distinct mRNAs were encoded by one gene. We found that genes targeted by known miRNAs, and genes up-regulated or down-regulated in miRNA mutant inflorescences, are highly expressed in the wild type inflorescence. In addition, transcripts upregulated within the mutant inflorescences were abundant in wild type leaves and shoot meristems and low in pollen and seed. Downregulated transcripts were abundant in wild type pollen and seed and low in shoot meristems, roots and leaves. Thus, disrupting miRNA function causes the inflorescence transcriptome to resemble the leaf and meristem and to differ from pollen and seed. Applications of our computational approach to other species and the use of more liberal criteria than reported here will further expand the number of identified miRNAs and miRNA targets. Our findings suggest that miRNAs have a global role in promoting vegetative to reproductive transitions in A. thaliana.

  4. miRConnect: identifying effector genes of miRNAs and miRNA families in cancer cells.

    Directory of Open Access Journals (Sweden)

    Youjia Hua

    Full Text Available micro(miRNAs are small non-coding RNAs that negatively regulate expression of most mRNAs. They are powerful regulators of various differentiation stages, and the expression of genes that either negatively or positively correlate with expressed miRNAs is expected to hold information on the biological state of the cell and, hence, of the function of the expressed miRNAs. We have compared the large amount of available gene array data on the steady state system of the NCI60 cell lines to two different data sets containing information on the expression of 583 individual miRNAs. In addition, we have generated custom data sets containing expression information of 54 miRNA families sharing the same seed match. We have developed a novel strategy for correlating miRNAs with individual genes based on a summed Pearson Correlation Coefficient (sPCC that mimics an in silico titration experiment. By focusing on the genes that correlate with the expression of miRNAs without necessarily being direct targets of miRNAs, we have clustered miRNAs into different functional groups. This has resulted in the identification of three novel miRNAs that are linked to the epithelial-to-mesenchymal transition (EMT in addition to the known EMT regulators of the miR-200 miRNA family. In addition, an analysis of gene signatures associated with EMT, c-MYC activity, and ribosomal protein gene expression allowed us to assign different activities to each of the functional clusters of miRNAs. All correlation data are available via a web interface that allows investigators to identify genes whose expression correlates with the expression of single miRNAs or entire miRNA families. miRConnect.org will aid in identifying pathways regulated by miRNAs without requiring specific knowledge of miRNA targets.

  5. miRConnect: identifying effector genes of miRNAs and miRNA families in cancer cells.

    Science.gov (United States)

    Hua, Youjia; Duan, Shiwei; Murmann, Andrea E; Larsen, Niels; Kjems, Jørgen; Lund, Anders H; Peter, Marcus E

    2011-01-01

    micro(mi)RNAs are small non-coding RNAs that negatively regulate expression of most mRNAs. They are powerful regulators of various differentiation stages, and the expression of genes that either negatively or positively correlate with expressed miRNAs is expected to hold information on the biological state of the cell and, hence, of the function of the expressed miRNAs. We have compared the large amount of available gene array data on the steady state system of the NCI60 cell lines to two different data sets containing information on the expression of 583 individual miRNAs. In addition, we have generated custom data sets containing expression information of 54 miRNA families sharing the same seed match. We have developed a novel strategy for correlating miRNAs with individual genes based on a summed Pearson Correlation Coefficient (sPCC) that mimics an in silico titration experiment. By focusing on the genes that correlate with the expression of miRNAs without necessarily being direct targets of miRNAs, we have clustered miRNAs into different functional groups. This has resulted in the identification of three novel miRNAs that are linked to the epithelial-to-mesenchymal transition (EMT) in addition to the known EMT regulators of the miR-200 miRNA family. In addition, an analysis of gene signatures associated with EMT, c-MYC activity, and ribosomal protein gene expression allowed us to assign different activities to each of the functional clusters of miRNAs. All correlation data are available via a web interface that allows investigators to identify genes whose expression correlates with the expression of single miRNAs or entire miRNA families. miRConnect.org will aid in identifying pathways regulated by miRNAs without requiring specific knowledge of miRNA targets.

  6. Frequency of intron loss correlates with processed pseudogene abundance: a novel strategy to test the reverse transcriptase model of intron loss

    Science.gov (United States)

    2013-01-01

    Background Although intron loss in evolution has been described, the mechanism involved is still unclear. Three models have been proposed, the reverse transcriptase (RT) model, genomic deletion model and double-strand-break repair model. The RT model, also termed mRNA-mediated intron loss, suggests that cDNA molecules reverse transcribed from spliced mRNA recombine with genomic DNA causing intron loss. Many studies have attempted to test this model based on its predictions, such as simultaneous loss of adjacent introns, 3'-side bias of intron loss, and germline expression of intron-lost genes. Evidence either supporting or opposing the model has been reported. The mechanism of intron loss proposed in the RT model shares the process of reverse transcription with the formation of processed pseudogenes. If the RT model is correct, genes that have produced more processed pseudogenes are more likely to undergo intron loss. Results In the present study, we observed that the frequency of intron loss is correlated with processed pseudogene abundance by analyzing a new dataset of intron loss obtained in mice and rats. Furthermore, we found that mRNA molecules of intron-lost genes are mostly translated on free cytoplasmic ribosomes, a feature shared by mRNA molecules of the parental genes of processed pseudogenes and long interspersed elements. This feature is likely convenient for intron-lost gene mRNA molecules to be reverse transcribed. Analyses of adjacent intron loss, 3'-side bias of intron loss, and germline expression of intron-lost genes also support the RT model. Conclusions Compared with previous evidence, the correlation between the abundance of processed pseudogenes and intron loss frequency more directly supports the RT model of intron loss. Exploring such a correlation is a new strategy to test the RT model in organisms with abundant processed pseudogenes. PMID:23497167

  7. Evolutionary dynamics of triosephosphate isomerase gene intron location pattern in Metazoa: A new perspective on intron evolution in animals.

    Science.gov (United States)

    Chen, Bing; Shao, Jingru; Zhuang, Huifu; Wen, Jianfan

    2017-02-20

    Intron evolution, including its dynamics in the evolutionary transitions and diversification of eukaryotes, remains elusive. Inadequate taxon sampling due to data shortage, unclear phylogenetic framework, and inappropriate outgroup application might be among the causes. Besides, the integrity of all the introns within a gene was often neglected previously. Taking advantage of the ancient conserved triosephosphate isomerase gene (tim), the relatively robust phylogeny of Metazoa, and choanoflagellates as outgroup, the evolutionary dynamics of tim intron location pattern (ILP) in Metazoa was investigated. From 133 representative species of ten phyla, 30 types of ILPs were identified. A most common one, which harbors the maximum six intron positions, is deduced to be the common ancestral tim ILP of Metazoa, which almost had formed in their protozoan ancestor and was surprisingly retained and passed down till to each ancestors of metazoan phyla. In the subsequent animal diversification, it underwent different evolutionary trajectories: within Deuterostomia, it was almost completely retained only with changes in a few species with relatively recently fast-evolving histories, while within the rapidly radiating Protostomia, besides few but remarkable retention, it usually displayed extensive intron losses and a few gains. Therefore, a common ancestral exon-intron arrangement pattern of an animal gene is definitely discovered; besides the 'intron-rich view' of early animal genes being confirmed, the novel insight that high exon-intron re-arrangements of genes seem to be associated with the relatively recently rapid evolution of lineages/species/genomes but have no correlation with the ancient major evolutionary transitions in animal evolution, is revealed. Copyright © 2016 Elsevier B.V. All rights reserved.

  8. Occurrence of Can-SINEs and intron sequence evolution supports robust phylogeny of pinniped carnivores and their terrestrial relatives.

    Science.gov (United States)

    Schröder, Christiane; Bleidorn, Christoph; Hartmann, Stefanie; Tiedemann, Ralph

    2009-12-15

    Investigating the dog genome we found 178965 introns with a moderate length of 200-1000 bp. A screening of these sequences against 23 different repeat libraries to find insertions of short interspersed elements (SINEs) detected 45276 SINEs. Virtually all of these SINEs (98%) belong to the tRNA-derived Can-SINE family. Can-SINEs arose about 55 million years ago before Carnivora split into two basal groups, the Caniformia (dog-like carnivores) and the Feliformia (cat-like carnivores). Genome comparisons of dog and cat recovered 506 putatively informative SINE loci for caniformian phylogeny. In this study we show how to use such genome information of model organisms to research the phylogeny of related non-model species of interest. Investigating a dataset including representatives of all major caniformian lineages, we analysed 24 randomly chosen loci for 22 taxa. All loci were amplifiable and revealed 17 parsimony-informative SINE insertions. The screening for informative SINE insertions yields a large amount of sequence information, in particular of introns, which contain reliable phylogenetic information as well. A phylogenetic analysis of intron- and SINE sequence data provided a statistically robust phylogeny which is congruent with the absence/presence pattern of our SINE markers. This phylogeny strongly supports a sistergroup relationship of Musteloidea and Pinnipedia. Within Pinnipedia, we see strong support from bootstrapping and the presence of a SINE insertion for a sistergroup relationship of the walrus with the Otariidae.

  9. A factor related to pseudouridine synthases is required for chloroplast group II intron trans-splicing in Chlamydomonas reinhardtii.

    Science.gov (United States)

    Perron, K; Goldschmidt-Clermont, M; Rochaix, J D

    1999-11-15

    In Chlamydomonas reinhardtii, the psaA mRNA is assembled by a process involving two steps of trans-splicing that remove two group II introns and give rise to the mature mRNA. The products of at least 14 nuclear genes and one chloroplast gene (tscA) are necessary for this process. We have cloned Maa2, one of the nuclear genes involved in trans-splicing of the second intron. Maa2 encodes a protein with similarity to conserved domains of pseudouridine synthases, but mutagenesis of putative catalytic residues showed that this activity may not be required for trans-splicing of psaA RNA. Although it is not clear whether the pseudouridine synthase activity has been maintained in Maa2, it is possible that this enzyme was recruited during evolution as an RNA chaperone for folding or stabilizing the psaA intron. The Maa2 protein appears to be associated through ionic interactions with a low density membrane system in the chloroplast that also contains RNA-binding proteins involved in translation.

  10. Evidence for stage-specific modulation of specific microRNAs (miRNAs) and miRNA processing components in zygotic embryo and female gametophyte of loblolly pine (Pinus taeda).

    Science.gov (United States)

    Oh, Thomas J; Wartell, Roger M; Cairney, John; Pullman, Gerald S

    2008-01-01

    MicroRNAs (miRNAs) are known to regulate plant development, but have not been studied in gymnosperm seed tissues. The presence and characteristics of several miRNAs were examined in zygotic embryos (ZEs) and female gametophytes (FGs) of Pinus taeda (loblolly pine). Evidence for miRNAs was obtained using northern analyses and quantitative reverse transcription polymerase chain reaction (qRT-PCR) mediated with poly(A) polymerase. Partial sequences of two miRNAs were verified. Three regions of putative mRNA targets were analyzed by qRT-PCR to monitor the occurrence of stage-dependent miRNA-mediated cleavage. Five miRNAs were identified in ZEs and FGs along with partial sequences of Pta-miR166 and Pta-miR167. Both miRNAs showed differing degrees of tissue-specific and stage-specific modulation. Analysis of HB15L mRNA (a potential Pta-miR166 target) suggested miRNA-guided cleavage in ZEs and FGs. Analysis of ARF8L mRNA (a potential Pta-miR167 target) implied cleavage in ZEs but not in FGs. Argonaute9-like mRNA (ptAGO9L) showed stage-specific modulation of expression in ZEs that appeared to be inverted in the corresponding FGs. MicroRNAs and argonaute genes varied spatiotemporally during seed development. The peak levels of Pta-miR166 in FGs and ptAGO9L in embryos occurred at stage 9.1, a critical transition point during embryo development and a point where somatic embryo maturation often stops. MicroRNAs identified in FG tissue may play a role in embryogenesis.

  11. Evolutionary relationships between miRNA genes and their activity.

    Science.gov (United States)

    Zhu, Yan; Skogerbø, Geir; Ning, Qianqian; Wang, Zhen; Li, Biqing; Yang, Shuang; Sun, Hong; Li, Yixue

    2012-12-22

    The emergence of vertebrates is characterized by a strong increase in miRNA families. MicroRNAs interact broadly with many transcripts, and the evolution of such a system is intriguing. However, evolutionary questions concerning the origin of miRNA genes and their subsequent evolution remain unexplained. In order to systematically understand the evolutionary relationship between miRNAs gene and their function, we classified human known miRNAs into eight groups based on their evolutionary ages estimated by maximum parsimony method. New miRNA genes with new functional sequences accumulated more dynamically in vertebrates than that observed in Drosophila. Different levels of evolutionary selection were observed over miRNA gene sequences with different time of origin. Most genic miRNAs differ from their host genes in time of origin, there is no particular relationship between the age of a miRNA and the age of its host genes, genic miRNAs are mostly younger than the corresponding host genes. MicroRNAs originated over different time-scales are often predicted/verified to target the same or overlapping sets of genes, opening the possibility of substantial functional redundancy among miRNAs of different ages. Higher degree of tissue specificity and lower expression level was found in young miRNAs. Our data showed that compared with protein coding genes, miRNA genes are more dynamic in terms of emergence and decay. Evolution patterns are quite different between miRNAs of different ages. MicroRNAs activity is under tight control with well-regulated expression increased and targeting decreased over time. Our work calls attention to the study of miRNA activity with a consideration of their origin time.

  12. Evidence for a DNA-based mechanism of intron-mediated enhancement

    Directory of Open Access Journals (Sweden)

    Alan B. Rose

    2011-12-01

    Full Text Available Many introns significantly increase gene expression through a process termed Intron-Mediated Enhancement (IME. Introns exist in the transcribed DNA and the nascent RNA, and could affect expression from either location. To determine which is more relevant to IME, hybrid introns were constructed that contain sequences from stimulating Arabidopsis thaliana introns either in their normal orientation or as the reverse complement. Both ends of each intron are from the non-stimulatory COR15a intron in their normal orientation to allow splicing. The inversions create major alterations to the sequence of the transcribed RNA with relatively minor changes to the DNA structure. Introns containing portions of either the UBQ10 or ATPK1 intron increased expression to a similar degree regardless of orientation. Also, computational predictions of IME improve when both intron strands are considered. These findings are more consistent with models of IME that act at the level of DNA rather than RNA.

  13. Comparative Profiling of miRNAs and Target Gene Identification in Distant-Grafting between Tomato and Lycium (Goji Berry)

    Science.gov (United States)

    Khaldun, A. B. M.; Huang, Wenjun; Lv, Haiyan; Liao, Sihong; Zeng, Shaohua; Wang, Ying

    2016-01-01

    Local translocation of small RNAs between cells is proved. Long distance translocation between rootstock and scion is also well documented in the homo-grafting system, but the process in distant-grafting is widely unexplored where rootstock and scion belonging to different genera. Micro RNAs are a class of small, endogenous, noncoding, gene silencing RNAs that regulate target genes of a wide range of important biological pathways in plants. In this study, tomato was grafted onto goji (Lycium chinense Mill.) to reveal the insight of miRNAs regulation and expression patterns within a distant-grafting system. Goji is an important traditional Chinese medicinal plant with enriched phytochemicals. Illumina sequencing technology has identified 68 evolutionary known miRNAs of 37 miRNA families. Moreover, 168 putative novel miRNAs were also identified. Compared with control tomato, 43 (11 known and 32 novels) and 163 (33 known and 130 novels) miRNAs were expressed significantly different in shoot and fruit of grafted tomato, respectively. The fruiting stage was identified as the most responsive in the distant-grafting approach and 123 miRNAs were found as up-regulating in the grafted fruit which is remarkably higher compare to the grafted shoot tip (28). Potential targets of differentially expressed miRNAs were found to be involved in diverse metabolic and regulatory pathways. ADP binding activities, molybdopterin synthase complex and RNA helicase activity were found as enriched terms in GO (Gene Ontology) analysis. Additionally, “metabolic pathways” was revealed as the most significant pathway in KEGG (Kyoto Encyclopedia of Genes and Genomes) analysis. The information of the small RNA transcriptomes that are obtained from this study might be the first miRNAs elucidation for a distant-grafting system, particularly between goji and tomato. The results from this study will provide the insights into the molecular aspects of miRNA-mediated regulation in the medicinal plant

  14. Changes in miRNA expression profile of space-flown Caenorhabditis elegans during Shenzhou-8 mission

    Science.gov (United States)

    Xu, Dan; Gao, Ying; Huang, Lei; Sun, Yeqing

    2014-04-01

    Recent advances in the field of molecular biology have demonstrated that small non-coding microRNAs (miRNAs) have a broad effect on gene expression networks and play a key role in biological responses to environmental stressors. However, little is known about how space radiation exposure and altered gravity affect miRNA expression. The "International Space Biological Experiments" project was carried out in November 2011 by an international collaboration between China and Germany during the Shenzhou-8 (SZ-8) mission. To study the effects of spaceflight on Caenorhabditis elegans (C. elegans), we explored the expression profile miRNA changes in space-flown C. elegans. Dauer C. elegans larvae were taken by SZ-8 spacecraft and experienced the 16.5-day shuttle spaceflight. We performed miRNA microarray analysis, and the results showed that 23 miRNAs were altered in a complex space environment and different expression patterns were observed in the space synthetic and radiation environments. Most putative target genes of the altered miRNAs in the space synthetic environment were predicted to be involved in developmental processes instead of in the regulation of transcription, and the enrichment of these genes was due to space radiation. Furthermore, integration analysis of the miRNA and mRNA expression profiles confirmed that twelve genes were differently regulated by seven miRNAs. These genes may be involved in embryonic development, reproduction, transcription factor activity, oviposition in a space synthetic environment, positive regulation of growth and body morphogenesis in a space radiation environment. Specifically, we found that cel-miR-52, -55, and -56 of the miR-51 family were sensitive to space environmental stressors and could regulate biological behavioural responses and neprilysin activity through the different isoforms of T01C4.1 and F18A12.8. These findings suggest that C. elegans responded to spaceflight by altering the expression of miRNAs and some target

  15. Comparative profiling of miRNAs and target gene identification in distant-grafting between tomato and Lycium (goji berry

    Directory of Open Access Journals (Sweden)

    A B M Khaldun

    2016-10-01

    Full Text Available Local translocation of small RNAs between cells is proved. Long distance translocation between rootstock and scion is also well documented in the homo-grafting system, but the process in distant-grafting is widely unexplored where rootstock and scion belonging to different genera. Micro RNAs are a class of small, endogenous, noncoding, gene silencing RNAs that regulate target genes of a wide range of important biological pathways in plants. In this study, tomato was grafted onto goji (Lycium chinense Mill. to reveal the insight of miRNAs regulation and expression patterns within a distant-grafting system. Goji is an important traditional Chinese medicinal plant with enriched phytochemicals. Illumina sequencing technology has identified 68 evolutionary known miRNAs of 37 miRNA families. Moreover, 168 putative novel miRNAs were also identified. Compared with control tomato, 43 (11 known and 32 novels and 163 (33 known and 130 novels miRNAs were expressed significantly different in shoot and fruit of grafted tomato, respectively. The fruiting stage was identified as the most responsive in the distant-grafting approach and 123 miRNAs were found as up-regulating in the grafted fruit which is remarkably higher compare to the grafted shoot tip (28. Potential targets of differentially expressed miRNAs were found to be involved in diverse metabolic and regulatory pathways. ADP binding activities, molybdopterin synthase complex and RNA helicase activity were found as enriched terms in GO (Gene Ontology analysis. Additionally, ‘metabolic pathways’ was revealed as the most significant pathway in KEGG (Kyoto Encyclopedia of Genes and Genomes analysis. The information of the small RNA transcriptomes that are obtained from this study might be the first miRNAs elucidation for a distant-grafting system, particularly between goji and tomato. The results from this study will provide the insights into the molecular aspects of miRNA-mediated regulation in the

  16. Assembly and Annotation of Transcriptome Provided Evidence of miRNA Mobility between Wheat and Wheat Stem Sawfly

    Directory of Open Access Journals (Sweden)

    Halise B. Cagirici

    2017-09-01

    Full Text Available Wheat Stem Sawfly (WSS, Cephus Cinctus Norton (Hymenoptera: Cephidae, is one of the most important pests, causing yield and economic losses in wheat and barley. The lack of information about molecular mechanisms of WSS for defeating plant’s resistance prevents application of effective pest control strategies therefore, it is essential to identify the genes and their regulators behind WSS infestations. Long non-coding RNAs (lncRNAs and microRNAs (miRNAs are recognized with their regulatory functions on gene expression, tuning protein production by controlling transcriptional and post-transcriptional activities. A transcriptome-guided approach was followed in order to identify miRNAs, lncRNAs, and mRNA of WSS, and their interaction networks. A total of 1,893 were presented here as differentially expressed between larva and adult WSS insects. There were 11 miRNA families detected in WSS transcriptome. Together with the annotation of 1,251 novel mRNAs, the amount of genetic information available for WSS was expanded. The network between WSS miRNAs, lncRNAs, and mRNAs suggested miRNA-mediated regulatory roles of lncRNAs as competing endogenous RNAs. In the light of the previous evidence that small RNA molecules of a pathogen could suppress the immune response of host plant, we analyzed the putative interactions between larvae and wheat at the miRNA level. Overall, this study provides a profile of larva and adult WSS life stages in terms of coding and non-coding elements. These findings also emphasize the potential roles of wheat and larval miRNAs in wheat resistance to infestation and in the suppression of resistance which is critical for the development of effective pest control strategies.

  17. Discovery of precursor and mature microRNAs and their putative gene targets using high-throughput sequencing in pineapple (Ananas comosus var. comosus).

    Science.gov (United States)

    Yusuf, Noor Hydayaty Md; Ong, Wen Dee; Redwan, Raimi Mohamed; Latip, Mariam Abd; Kumar, S Vijay

    2015-10-15

    MicroRNAs (miRNAs) are a class of small, endogenous non-coding RNAs that negatively regulate gene expression, resulting in the silencing of target mRNA transcripts through mRNA cleavage or translational inhibition. MiRNAs play significant roles in various biological and physiological processes in plants. However, the miRNA-mediated gene regulatory network in pineapple, the model tropical non-climacteric fruit, remains largely unexplored. Here, we report a complete list of pineapple mature miRNAs obtained from high-throughput small RNA sequencing and precursor miRNAs (pre-miRNAs) obtained from ESTs. Two small RNA libraries were constructed from pineapple fruits and leaves, respectively, using Illumina's Solexa technology. Sequence similarity analysis using miRBase revealed 579,179 reads homologous to 153 miRNAs from 41 miRNA families. In addition, a pineapple fruit transcriptome library consisting of approximately 30,000 EST contigs constructed using Solexa sequencing was used for the discovery of pre-miRNAs. In all, four pre-miRNAs were identified (MIR156, MIR399, MIR444 and MIR2673). Furthermore, the same pineapple transcriptome was used to dissect the function of the miRNAs in pineapple by predicting their putative targets in conjunction with their regulatory networks. In total, 23 metabolic pathways were found to be regulated by miRNAs in pineapple. The use of high-throughput sequencing in pineapples to unveil the presence of miRNAs and their regulatory pathways provides insight into the repertoire of miRNA regulation used exclusively in this non-climacteric model plant.

  18. miRNA Isolation from FFPET Specimen: A Technical Comparison of miRNA and Total RNA Isolation Methods.

    Science.gov (United States)

    Nagy, Zsófia Brigitta; Wichmann, Barnabás; Kalmár, Alexandra; Barták, Barbara Kinga; Tulassay, Zsolt; Molnár, Béla

    2016-07-01

    MiRNA remain stable for detection and PCR-based amplification in FFPE tissue samples. Several miRNA extraction kits are available, however miRNA fraction, as part of total RNA can be isolated using total RNA purification methods, as well. Our primary aim was to compare four different miRNA and total RNA isolation methods from FFPE tissues. Further purposes were to evaluate quantitatively and qualitatively the yield of the isolated miRNA. MiRNAs were isolated from normal colorectal cancer FFPE specimens from the same patients. Two miRNA isolation kits (High Pure miRNA Isolation Kit, miRCURY™ RNA Isolation Kit) and two total RNA isolation kits were compared (High Pure RNA Paraffin Kit, MagNA Pure 96 Cellular RNA LV Kit). Quantity and quality were determined, expression analysis was performed by real-time PCR using qPCR Human Panel I + II (Exiqon) method detecting 742 human miRNAs in parallel. The yield of total RNA was found to be higher than miRNA purification protocols (in CRC: Ex: 0203 ± 0021 μg; HPm: 1,45 ± 0,8 μg; HPp: 21,36 ± 4,98 μg; MP: 8,6 ± 5,1 μg). MiRNAs were detected in lower relative quantity of total RNA compared to the miRNA kits. Higher number of miRNAs could be detected by the miRNA isolation kits in comparison to the total RNA isolation methods. (Ex: 497 ± 16; HPm: 542 ± 11; HPp: 332 ± 36; MP: 295 ± 74). Colon specific miRNAs (miR-21-5p;-34-5p) give satisfying results by miRNA isolation kits. Although miRNA can be detected also after total RNA isolation methods, for reliable and reproducible miRNA expression profiling the use of miRNA isolation kits are more suitable.

  19. Short interspersed DNA elements and miRNAs: a novel hidden gene regulation layer in zebrafish?

    Science.gov (United States)

    Scarpato, Margherita; Angelini, Claudia; Cocca, Ennio; Pallotta, Maria M; Morescalchi, Maria A; Capriglione, Teresa

    2015-09-01

    In this study, we investigated by in silico analysis the possible correlation between microRNAs (miRNAs) and Anamnia V-SINEs (a superfamily of short interspersed nuclear elements), which belong to those retroposon families that have been preserved in vertebrate genomes for millions of years and are actively transcribed because they are embedded in the 3' untranslated region (UTR) of several genes. We report the results of the analysis of the genomic distribution of these mobile elements in zebrafish (Danio rerio) and discuss their involvement in generating miRNA gene loci. The computational study showed that the genes predicted to bear V-SINEs can be targeted by miRNAs with a very high hybridization E-value. Gene ontology analysis indicates that these genes are mainly involved in metabolic, membrane, and cytoplasmic signaling pathways. Nearly all the miRNAs that were predicted to target the V-SINEs of these genes, i.e., miR-338, miR-9, miR-181, miR-724, miR-735, and miR-204, have been validated in similar regulatory roles in mammals. The large number of genes bearing a V-SINE involved in metabolic and cellular processes suggests that V-SINEs may play a role in modulating cell responses to different stimuli and in preserving the metabolic balance during cell proliferation and differentiation. Although they need experimental validation, these preliminary results suggest that in the genome of D. rerio, as in other TE families in vertebrates, the preservation of V-SINE retroposons may also have been favored by their putative role in gene network modulation.

  20. Neuronal Activity Regulates Hippocampal miRNA Expression

    Science.gov (United States)

    Eacker, Stephen M.; Keuss, Matthew J.; Berezikov, Eugene; Dawson, Valina L.; Dawson, Ted M.

    2011-01-01

    Neuronal activity regulates a broad range of processes in the hippocampus, including the precise regulation of translation. Disruptions in proper translational control in the nervous system are associated with a variety of disorders that fall in the autistic spectrum. MicroRNA (miRNA) represent a relatively recently discovered player in the regulation of translation in the nervous system. We have conducted an in depth analysis of how neuronal activity regulates miRNA expression in the hippocampus. Using deep sequencing we exhaustively identify all miRNAs, including 15 novel miRNAs, expressed in hippocampus of the adult mouse. We identified 119 miRNAs documented in miRBase but less than half of these miRNA were expressed at a level greater than 0.1% of total miRNA. Expression profiling following induction of neuronal activity by electroconvulsive shock demonstrates that most miRNA show a biphasic pattern of expression: rapid induction of specific mature miRNA expression followed by a decline in expression. These results have important implications into how miRNAs influence activity-dependent translational control. PMID:21984899

  1. Neuronal activity regulates hippocampal miRNA expression.

    Directory of Open Access Journals (Sweden)

    Stephen M Eacker

    Full Text Available Neuronal activity regulates a broad range of processes in the hippocampus, including the precise regulation of translation. Disruptions in proper translational control in the nervous system are associated with a variety of disorders that fall in the autistic spectrum. MicroRNA (miRNA represent a relatively recently discovered player in the regulation of translation in the nervous system. We have conducted an in depth analysis of how neuronal activity regulates miRNA expression in the hippocampus. Using deep sequencing we exhaustively identify all miRNAs, including 15 novel miRNAs, expressed in hippocampus of the adult mouse. We identified 119 miRNAs documented in miRBase but less than half of these miRNA were expressed at a level greater than 0.1% of total miRNA. Expression profiling following induction of neuronal activity by electroconvulsive shock demonstrates that most miRNA show a biphasic pattern of expression: rapid induction of specific mature miRNA expression followed by a decline in expression. These results have important implications into how miRNAs influence activity-dependent translational control.

  2. Intronic splicing mutations in PTCH1 cause Gorlin syndrome.

    Science.gov (United States)

    Bholah, Zaynab; Smith, Miriam J; Byers, Helen J; Miles, Emma K; Evans, D Gareth; Newman, William G

    2014-09-01

    Gorlin syndrome is an autosomal dominant disorder characterized by multiple early-onset basal cell carcinoma, odontogenic keratocysts and skeletal abnormalities. It is caused by heterozygous mutations in the tumour suppressor PTCH1. Routine clinical genetic testing, by Sanger sequencing and multiplex ligation-dependent probe amplification (MLPA) to confirm a clinical diagnosis of Gorlin syndrome, identifies a mutation in 60-90 % of cases. We undertook RNA analysis on lymphocytes from ten individuals diagnosed with Gorlin syndrome, but without known PTCH1 mutations by exonic sequencing or MLPA. Two altered PTCH1 transcripts were identified. Genomic DNA sequence analysis identified an intron 7 mutation c.1068-10T>A, which created a strong cryptic splice acceptor site, leading to an intronic insertion of eight bases; this is predicted to create a frameshift p.(His358Alafs*12). Secondly, a deep intronic mutation c.2561-2057A>G caused an inframe insertion of 78 intronic bases in the cDNA transcript, leading to a premature stop codon p.(Gly854fs*3). The mutations are predicted to cause loss of function of PTCH1, consistent with its tumour suppressor function. The findings indicate the importance of RNA analysis to detect intronic mutations in PTCH1 not identified by routine screening techniques.

  3. Intronic L1 retrotransposons and nested genes cause transcriptional interference by inducing intron retention, exonization and cryptic polyadenylation.

    Directory of Open Access Journals (Sweden)

    Kristel Kaer

    Full Text Available BACKGROUND: Transcriptional interference has been recently recognized as an unexpectedly complex and mostly negative regulation of genes. Despite a relatively few studies that emerged in recent years, it has been demonstrated that a readthrough transcription derived from one gene can influence the transcription of another overlapping or nested gene. However, the molecular effects resulting from this interaction are largely unknown. METHODOLOGY/PRINCIPAL FINDINGS: Using in silico chromosome walking, we searched for prematurely terminated transcripts bearing signatures of intron retention or exonization of intronic sequence at their 3' ends upstream to human L1 retrotransposons, protein-coding and noncoding nested genes. We demonstrate that transcriptional interference induced by intronic L1s (or other repeated DNAs and nested genes could be characterized by intron retention, forced exonization and cryptic polyadenylation. These molecular effects were revealed from the analysis of endogenous transcripts derived from different cell lines and tissues and confirmed by the expression of three minigenes in cell culture. While intron retention and exonization were comparably observed in introns upstream to L1s, forced exonization was preferentially detected in nested genes. Transcriptional interference induced by L1 or nested genes was dependent on the presence or absence of cryptic splice sites, affected the inclusion or exclusion of the upstream exon and the use of cryptic polyadenylation signals. CONCLUSIONS/SIGNIFICANCE: Our results suggest that transcriptional interference induced by intronic L1s and nested genes could influence the transcription of the large number of genes in normal as well as in tumor tissues. Therefore, this type of interference could have a major impact on the regulation of the host gene expression.

  4. Heterogeneity of miRNA expression in localized prostate cancer with clinicopathological correlations

    DEFF Research Database (Denmark)

    Zedan, Ahmed Hussein; Blavnsfeldt, Søren Garm; Hansen, Torben Frøstrup

    2017-01-01

    curatively intended surgery for localized PCa, were investigated with a panel of 6 miRNAs (miRNA-21, miRNA-34a, miRNA-125b, miRNA-126, miRNA-143, and miRNA-145) using tissue micro-array (TMA) and in situ hybridization (ISH). Inter- and intra-patient variation was assessed using intra-class correlation (ICC...

  5. Alternative splicing mechanisms orchestrating post-transcriptional gene expression: intron retention and the intron-rich genome of apicomplexan parasites.

    Science.gov (United States)

    Lunghi, Matteo; Spano, Furio; Magini, Alessandro; Emiliani, Carla; Carruthers, Vern B; Di Cristina, Manlio

    2016-02-01

    Apicomplexan parasites including Toxoplasma gondii and Plasmodium species have complex life cycles that include multiple hosts and differentiation through several morphologically distinct stages requiring marked changes in gene expression. This review highlights emerging evidence implicating regulation of mRNA splicing as a mechanism to prime these parasites for rapid gene expression upon differentiation. We summarize the most important insights in alternative splicing including its role in regulating gene expression by decreasing mRNA abundance via 'Regulated Unproductive Splicing and Translation'. As a related but less well-understood mechanism, we discuss also our recent work suggesting a role for intron retention for precluding translation of stage specific isoforms of T. gondii glycolytic enzymes. We additionally provide new evidence that intron retention might be a widespread mechanism during parasite differentiation. Supporting this notion, recent genome-wide analysis of Toxoplasma and Plasmodium suggests intron retention is more pervasive than heretofore thought. These findings parallel recent emergence of intron retention being more prevalent in mammals than previously believed, thereby adding to the established roles in plants, fungi and unicellular eukaryotes. Deeper mechanistic studies of intron retention will provide important insight into its role in regulating gene expression in apicomplexan parasites and more general in eukaryotic organisms.

  6. Correlations between recombination rate and intron distributions along chromosomes of C.elegans

    Institute of Scientific and Technical Information of China (English)

    Hong Li; Guoqing Liu; Xuhua Xia

    2009-01-01

    Generally speaking,the intron size positively correlates with recombination rate in Caenorhabditis elegans genome.Here,we analyze the correlations between recombination rate and some measures of different intron lengths so as to know whether the recombination influences the introns of different lengths in the same way.Results show that the correlation between the recombination rate and the percentage of short introns(<100 bp)is negative,but the correlation between the recombination rate and the percentage of introns that are larger than 500 bp is positive.Average intron length correlates positively with the recombination rate for introns whose length is in the range of 100-1000 bp.We speculate that the recombination mainly exerts impact on introns whose length ranges from 100-1000 bp.We also show that the average intron number per gene correlates negatively with the recombination rate.

  7. Reprogramming of miRNA networks in cancer and leukemia

    Science.gov (United States)

    Volinia, Stefano; Galasso, Marco; Costinean, Stefan; Tagliavini, Luca; Gamberoni, Giacomo; Drusco, Alessandra; Marchesini, Jlenia; Mascellani, Nicoletta; Sana, Maria Elena; Abu Jarour, Ramzey; Desponts, Caroline; Teitell, Michael; Baffa, Raffaele; Aqeilan, Rami; Iorio, Marilena V.; Taccioli, Cristian; Garzon, Ramiro; Di Leva, Gianpiero; Fabbri, Muller; Catozzi, Marco; Previati, Maurizio; Ambs, Stefan; Palumbo, Tiziana; Garofalo, Michela; Veronese, Angelo; Bottoni, Arianna; Gasparini, Pierluigi; Harris, Curtis C.; Visone, Rosa; Pekarsky, Yuri; de la Chapelle, Albert; Bloomston, Mark; Dillhoff, Mary; Rassenti, Laura Z.; Kipps, Thomas J.; Huebner, Kay; Pichiorri, Flavia; Lenze, Dido; Cairo, Stefano; Buendia, Marie-Annick; Pineau, Pascal; Dejean, Anne; Zanesi, Nicola; Rossi, Simona; Calin, George A.; Liu, Chang-Gong; Palatini, Jeff; Negrini, Massimo; Vecchione, Andrea; Rosenberg, Anne; Croce, Carlo M.

    2010-01-01

    We studied miRNA profiles in 4419 human samples (3312 neoplastic, 1107 nonmalignant), corresponding to 50 normal tissues and 51 cancer types. The complexity of our database enabled us to perform a detailed analysis of microRNA (miRNA) activities. We inferred genetic networks from miRNA expression in normal tissues and cancer. We also built, for the first time, specialized miRNA networks for solid tumors and leukemias. Nonmalignant tissues and cancer networks displayed a change in hubs, the most connected miRNAs. hsa-miR-103/106 were downgraded in cancer, whereas hsa-miR-30 became most prominent. Cancer networks appeared as built from disjointed subnetworks, as opposed to normal tissues. A comparison of these nets allowed us to identify key miRNA cliques in cancer. We also investigated miRNA copy number alterations in 744 cancer samples, at a resolution of 150 kb. Members of miRNA families should be similarly deleted or amplified, since they repress the same cellular targets and are thus expected to have similar impacts on oncogenesis. We correctly identified hsa-miR-17/92 family as amplified and the hsa-miR-143/145 cluster as deleted. Other miRNAs, such as hsa-miR-30 and hsa-miR-204, were found to be physically altered at the DNA copy number level as well. By combining differential expression, genetic networks, and DNA copy number alterations, we confirmed, or discovered, miRNAs with comprehensive roles in cancer. Finally, we experimentally validated the miRNA network with acute lymphocytic leukemia originated in Mir155 transgenic mice. Most of miRNAs deregulated in these transgenic mice were located close to hsa-miR-155 in the cancer network. PMID:20439436

  8. An intron in a ribosomal protein gene from Tetrahymena

    DEFF Research Database (Denmark)

    Nielsen, Henrik; Andreasen, Per Hove; Dreisig, Hanne

    1986-01-01

    We have cloned and sequenced a single copy gene encoding a ribosomal protein from the ciliate Tetrahymena thermophila. The gene product was identified as ribosomal protein S25 by comparison of the migration in two-dimensional polyacrylamide gels of the protein synthesized by translation in vitro...... of hybrid-selected mRNA and authentic ribosomal proteins. The proteins show strong homology to ribosomal protein S12 from Escherichia coli. The coding region of the gene is interrupted by a 979-bp intron 68 bp downstream of the translation start. This is the first intron in a protein encoding gene...

  9. Development of Novel, Exon-Primed Intron-Crossing (EPIC Markers from EST Databases and Evaluation of their Phylogenetic Utility in Commiphora (Burseraceae

    Directory of Open Access Journals (Sweden)

    Morgan R. Gostel

    2014-03-01

    Full Text Available Premise of the study: Novel nuclear exon-primed intron-crossing (EPIC markers were developed to increase phylogenetic resolution among recently diverged lineages in the frankincense and myrrh family, Burseraceae, using Citrus, Arabidopsis, and Oryza genome resources. Methods and Results: Primer pairs for 48 nuclear introns were developed using the genome resource IntrEST and were screened using species of Commiphora and other Burseraceae taxa. Four putative intron regions (RPT6A, BXL2, mtATP Synthase D, and Rab6 sequenced successfully for multiple taxa and recovered phylogenies consistent with those of existing studies. In some cases, these regions yielded informative sequence variation on par with that of the nuclear ribosomal DNA internal transcribed spacer. Conclusions: The combination of freely available genome resources and our design criteria have uncovered four single-copy nuclear intron regions that are useful for phylogenetic reconstruction of Burseraceae taxa. Because our EPIC primers also amplify Arabidopsis, we recommend their trial in other rosid and eudicot lineages.

  10. Cross Platform Standardisation of an Experimental Pipeline for Use in the Identification of Dysregulated Human Circulating MiRNAs.

    Directory of Open Access Journals (Sweden)

    Helena Kelly

    Full Text Available Micro RNAs (miRNAs are a class of highly conserved small non-coding RNAs that play an important part in the post-transcriptional regulation of gene expression. A substantial number of miRNAs have been proposed as biomarkers for diseases. While reverse transcriptase Real-time PCR (RT-qPCR is considered the gold standard for the evaluation and validation of miRNA biomarkers, small RNA sequencing is now routinely being adopted for the identification of dysregulated miRNAs. However, in many cases where putative miRNA biomarkers are identified using small RNA sequencing, they are not substantiated when RT-qPCR is used for validation. To date, there is a lack of consensus regarding optimal methodologies for miRNA detection, quantification and standardisation when different platform technologies are used.In this study we present an experimental pipeline that takes into consideration sample collection, processing, enrichment, and the subsequent comparative analysis of circulating small ribonucleic acids using small RNA sequencing and RT-qPCR.Initially, a panel of miRNAs dysregulated in circulating blood from breast cancer patients compared to healthy women were identified using small RNA sequencing. MiR-320a was identified as the most dysregulated miRNA between the two female cohorts. Total RNA and enriched small RNA populations (<30 bp isolated from peripheral blood from the same female cohort samples were then tested for using a miR-320a RT-qPCR assay. When total RNA was analysed with this miR-320a RT-qPCR assay, a 2.3-fold decrease in expression levels was observed between blood samples from healthy controls and breast cancer patients. However, upon enrichment for the small RNA population and subsequent analysis of miR-320a using RT-qPCR, its dysregulation in breast cancer patients was more pronounced with an 8.89-fold decrease in miR-320a expression. We propose that the experimental pipeline outlined could serve as a robust approach for the

  11. An intronic open reading frame was released from one of group II introns in the mitochondrial genome of the haptophyte Chrysochromulina sp. NIES-1333.

    Science.gov (United States)

    Nishimura, Yuki; Kamikawa, Ryoma; Hashimoto, Tetsuo; Inagaki, Yuji

    2014-01-01

    Mitochondrial (mt) genome sequences, which often bear introns, have been sampled from phylogenetically diverse eukaryotes. Thus, we can anticipate novel insights into intron evolution from previously unstudied mt genomes. We here investigated the origins and evolution of three introns in the mt genome of the haptophyte Chrysochromulina sp. NIES-1333, which was sequenced completely in this study. All the three introns were characterized as group II, on the basis of predicted secondary structure, and the conserved sequence motifs at the 5' and 3' termini. Our comparative studies on diverse mt genomes prompt us to propose that the Chrysochromulina mt genome laterally acquired the introns from mt genomes in distantly related eukaryotes. Many group II introns harbor intronic open reading frames for the proteins (intron-encoded proteins or IEPs), which likely facilitate the splicing of their host introns. However, we propose that a "free-standing," IEP-like protein, which is not encoded within any introns in the Chrysochromulina mt genome, is involved in the splicing of the first cox1 intron that lacks any open reading frames.

  12. Analytical Study of Hexapod miRNAs using Phylogenetic Methods

    CERN Document Server

    Mishra, A K

    2012-01-01

    MicroRNAs (miRNAs) are a class of non-coding RNAs that regulate gene expression. Identification of total number of miRNAs even in completely sequenced organisms is still an open problem. However, researchers have been using techniques that can predict limited number of miRNA in an organism. In this paper, we have used homology based approach for comparative analysis of miRNA of hexapoda group .We have used Apis mellifera, Bombyx mori, Anopholes gambiae and Drosophila melanogaster miRNA datasets from miRBase repository. We have done pair wise as well as multiple alignments for the available miRNAs in the repository to identify and analyse conserved regions among related species. Unfortunately, to the best of our knowledge, miRNA related literature does not provide in depth analysis of hexapods. We have made an attempt to derive the commonality among the miRNAs and to identify the conserved regions which are still not available in miRNA repositories. The results are good approximation with a small number of mis...

  13. Exploration of miRNA families for hypotheses generation.

    KAUST Repository

    Kamanu, T.K.

    2013-10-15

    Technological improvements have resulted in increased discovery of new microRNAs (miRNAs) and refinement and enrichment of existing miRNA families. miRNA families are important because they suggest a common sequence or structure configuration in sets of genes that hint to a shared function. Exploratory tools to enhance investigation of characteristics of miRNA families and the functions of family-specific miRNA genes are lacking. We have developed, miRNAVISA, a user-friendly web-based tool that allows customized interrogation and comparisons of miRNA families for hypotheses generation, and comparison of per-species chromosomal distribution of miRNA genes in different families. This study illustrates hypothesis generation using miRNAVISA in seven species. Our results unveil a subclass of miRNAs that may be regulated by genomic imprinting, and also suggest that some miRNA families may be species-specific, as well as chromosome- and/or strand-specific.

  14. Comparative analysis of known miRNAs across platyhelminths.

    Science.gov (United States)

    Jin, Xiaoliang; Lu, Lixia; Su, Hailong; Lou, Zhongzi; Wang, Fang; Zheng, Yadong; Xu, Guo-Tong

    2013-08-01

    MicroRNAs (miRNAs) are a subtype of small regulatory RNAs that are involved in numerous biological processes through small RNA-induced silencing networks. In an attempt to explore the phylogeny of miRNAs across five platyhelminths, we integrated annotated miRNAs and their full genomes. We identified conserved miRNA clusters and, in particular, miR-71/2 was conserved from planarian to parasitic flatworms and was expanded in free-living Schmidtea mediterranea. Analysis of 22 miRNA loci provided compelling evidence that most known miRNAs are conserved across platyhelminths. Meanwhile, we also observed alterations of known protein-coding genes flanking miRNA(s), such as transcriptional direction conversion and locus relocation, in around ~ 41% of 22 known miRNA loci. Compared with Echinococcus multilocularis, the majority of these events occurred in evolution-distant Hymenolepis microstoma, Schistosoma japonicum or/and S. mediterranea. These results imply rearrangement events occurred near the known miRNA loci.

  15. miRNAs as biomarkers of atrial fibrillation.

    Science.gov (United States)

    Gomes da Silva, Ananília Medeiros; Silbiger, Vivian Nogueira

    2014-12-01

    Atrial fibrillation (AF) is a highly prevalent arrhythmia with pronounced morbidity and mortality. Genetics analysis has established electrophysiological substrates, which determine individual vulnerability to AF occurrence and maintenance. MicroRNAs (miRNAs) found in virtually all organisms function as negative regulators of protein-coding genes. Several studies have suggested a role for miRNAs in the regulation of cardiac excitability and arrhythmogenesis. This review is based on 18 studies conducted between 2009 and 2013 to investigate the association of miRNAs with AF. miRNAs are discussed here as candidate biomarkers for AF in blood and cardiac tissues and as potential targets for AF therapy.

  16. Exosomes as miRNA Carriers: Formation–Function–Future

    Directory of Open Access Journals (Sweden)

    Xiaojie Yu

    2016-12-01

    Full Text Available Exosomes, which are one of the smallest extracellular vesicles released from cells, have been shown to carry different nucleic acids, including microRNAs (miRNAs. miRNAs significantly regulate cell growth and metabolism by posttranscriptional inhibition of gene expression. The rapidly changing understanding of exosomes’ formation and function in delivering miRNAs from cell to cell has prompted us to review current knowledge in exosomal miRNA secretion mechanisms as well as possible therapeutic applications for personalized medicine.

  17. Methylation of miRNA genes and oncogenesis.

    Science.gov (United States)

    Loginov, V I; Rykov, S V; Fridman, M V; Braga, E A

    2015-02-01

    Interaction between microRNA (miRNA) and messenger RNA of target genes at the posttranscriptional level provides fine-tuned dynamic regulation of cell signaling pathways. Each miRNA can be involved in regulating hundreds of protein-coding genes, and, conversely, a number of different miRNAs usually target a structural gene. Epigenetic gene inactivation associated with methylation of promoter CpG-islands is common to both protein-coding genes and miRNA genes. Here, data on functions of miRNAs in development of tumor-cell phenotype are reviewed. Genomic organization of promoter CpG-islands of the miRNA genes located in inter- and intragenic areas is discussed. The literature and our own results on frequency of CpG-island methylation in miRNA genes from tumors are summarized, and data regarding a link between such modification and changed activity of miRNA genes and, consequently, protein-coding target genes are presented. Moreover, the impact of miRNA gene methylation on key oncogenetic processes as well as affected signaling pathways is discussed.

  18. miRNA expression during prickly pear cactus fruit development.

    Science.gov (United States)

    Rosas-Cárdenas, Flor de Fátima; Caballero-Pérez, Juan; Gutiérrez-Ramos, Ximena; Marsch-Martínez, Nayelli; Cruz-Hernández, Andrés; de Folter, Stefan

    2015-02-01

    miRNAs are a class of small non-coding RNAs that regulate gene expression. They are involved in the control of many developmental processes, including fruit development. The increasing amount of information on miRNAs, on their expression, abundance, and conservation between various species, provides a new opportunity to study the role of miRNAs in non-model plant species. In this work, we used a combination of Northern blot and tissue print hybridization analysis to identify conserved miRNAs expressed during prickly pear cactus (Opuntia ficus indica) fruit development. Comparative profiling detected the expression of 34 miRNAs, which were clustered in three different groups that were associated with the different phases of fruit development. Variation in the level of miRNA expression was observed. Gradual expression increase of several miRNAs was observed during fruit development, including miR164. miR164 was selected for stem-loop RT-PCR and for a detailed spatial-temporal expression analysis. At early floral stages, miR164 was mainly localized in meristematic tissues, boundaries and fusion zones, while it was more homogenously expressed in fruit tissues. Our results provide the first evidence of miRNA expression in the prickly pear cactus and provide the basis for future research on miRNAs in Opuntia. Moreover, our analyses suggest that miR164 plays different roles during prickly pear cactus fruit development.

  19. Comparative analysis reveals dynamic changes in miRNAs and their targets and expression during somatic embryogenesis in longan (Dimocarpus longan Lour..

    Directory of Open Access Journals (Sweden)

    Yuling Lin

    Full Text Available Somatic embryogenesis (SE, which resembles zygotic embryogenesis, is an essential component of the process of plant cell differentiation and embryo development. Although microRNAs (miRNAs are important regulators of many plant develop- mental processes, their roles in SE have not been thoroughly investigated. In this study, we used deep-sequencing, computational, and qPCR methods to identify, profile, and describe conserved and novel miRNAs involved in longan (Dimocarpus longan SE. A total of 643 conserved and 29 novel miRNAs (including star strands from more than 169 miRNA families were identified in longan embryogenic tissue using Solexa sequencing. By combining computational and degradome sequencing approaches, we were able to predict 2063 targets of 272 miRNAs and verify 862 targets of 181 miRNAs. Target annotation revealed that the putative targets were involved in a broad variety of biological processes, including plant metabolism, signal transduction, and stimulus response. Analysis of stage- and tissue-specific expressions of 20 conserved and 4 novel miRNAs indicated their possible roles in longan SE. These miRNAs were dlo-miR156 family members and dlo-miR166c* associated with early embryonic culture developmental stages; dlo-miR26, dlo-miR160a, and families dlo-miR159, dlo-miR390, and dlo-miR398b related to heart-shaped and torpedo- shaped embryo formation; dlo-miR4a, dlo-miR24, dlo-miR167a, dlo-miR168a*, dlo-miR397a, dlo-miR398b.1, dlo-miR398b.2, dlo-miR808 and dlo-miR5077 involved in cotyledonary embryonic development; and dlo-miR17 and dlo-miR2089*-1 that have regulatory roles during longan SE. In addition, dlo-miR167a, dlo-miR808, and dlo-miR5077 may be required for mature embryo formation. This study is the first reported investigation of longan SE involving large-scale cloning, characterization, and expression profiling of miRNAs and their targets. The reported results contribute to our knowledge of somatic embryo miRNAs and

  20. Widespread regulation of miRNA biogenesis at the Dicer step by the cold-inducible RNA-binding protein, RBM3.

    Directory of Open Access Journals (Sweden)

    Julie Pilotte

    Full Text Available MicroRNAs (miRNAs play critical roles in diverse cellular events through their effects on translation. Emerging data suggest that modulation of miRNA biogenesis at post-transcriptional steps by RNA-binding proteins is a key point of regulatory control over the expression of some miRNAs and the cellular processes they influence. However, the extent and conditions under which the miRNA pathway is amenable to regulation at posttranscriptional steps are poorly understood. Here we show that RBM3, a cold-inducible, developmentally regulated RNA-binding protein and putative protooncogene, is an essential regulator of miRNA biogenesis. Utilizing miRNA array, Northern blot, and PCR methods, we observed that over 60% of miRNAs detectable in a neuronal cell line were significantly downregulated by knockdown of RBM3. Conversely, for select miRNAs assayed by Northern blot, induction of RBM3 by overexpression or mild hypothermia increased their levels. Changes in miRNA expression were accompanied by changes in the levels of their ~70 nt precursors, whereas primary transcript levels were unaffected. Mechanistic studies revealed that knockdown of RBM3 does not reduce Dicer activity or impede transport of pre-miRNAs into the cytoplasm. Rather, we find that RBM3 binds directly to ~70 nt pre-miRNA intermediates and promotes / de-represses their ability as larger ribonucleoproteins (pre-miRNPs to associate with active Dicer complexes. Our findings suggest that the processing of a majority of pre-miRNPs by Dicer is subject to an intrinsic inhibitory influence that is overcome by RBM3 expression. RBM3 may thus orchestrate changes in miRNA expression during hypothermia and other cellular stresses, and in the euthermic contexts of early development, differentiation, and oncogenesis where RBM3 expression is highly elevated. Additionally, our data suggest that temperature-dependent changes in miRNA expression mediated by RBM3 may contribute to the therapeutic effects of

  1. 5´-UTR introns enhance protein expression in the yeast Saccharomyces cerevisiae.

    Science.gov (United States)

    Hoshida, Hisashi; Kondo, Masaki; Kobayashi, Takafumi; Yarimizu, Tohru; Akada, Rinji

    2017-01-01

    Saccharomyces cerevisiae is one of the most suitable microorganisms for recombinant protein production. To enhance protein production, various expression systems have been intensively studied. However, the effect of introns on protein expression has not been examined deeply in S. cerevisiae. In this study, we analyzed the effect of some introns on protein expression. RPS25A, RPS26A, and RPS26B contain single introns within the 5´-untranslated regions (5´-UTRs), and RPS24A has an intron just downstream of the initiation codon. Expression activity of the promoter regions containing introns (intron promoters) were analyzed by luciferase reporter assays. These intron promoters showed higher expression than the TDH3 promoter (TDH3p), which is one of the strongest promoters in S. cerevisiae. Deletion of the introns from these promoters decreased luciferase expression, indicating that introns have a role in enhancing protein expression. To develop artificial strong intron promoters, several chimeric promoters were constructed using the TDH3p and the RPS25A intron promoter. A construct containing the entire TDH3p followed by the RPS25A intron showed about 50-fold higher expression than the TDH3p alone. Inducible expressions driven by the GAL10 promoter and the CUP1 promoter were also enhanced by the RPS25A intron. However, enhancement of mRNA accumulation by the TDH3p and the GAL10 promoter with the RPS25A intron was lower than the effect on luciferase activity, suggesting that the intron affects post-transcriptionally. The chimeric promoter, TDH3p-RPS25A-intron, enhanced expressions of some, but not all proteins examined, indicating that 5'-UTR introns increase production of a certain type of recombinant proteins in S. cerevisiae.

  2. Frequent gain and loss of introns in fungal cytochrome b genes.

    Directory of Open Access Journals (Sweden)

    Liang-Fen Yin

    Full Text Available In this study, all available cytochrome b (Cyt b genes from the GOBASE database were compiled and the evolutionary dynamics of the Cyt b gene introns was assessed. Cyt b gene introns were frequently present in the fungal kingdom and some lower plants, but generally absent or rare in Chromista, Protozoa, and Animalia. Fungal Cyt b introns were found at 35 positions in Cyt b genes and the number of introns varied at individual positions from a single representative to 32 different introns at position 131, showing a wide and patchy distribution. Many homologous introns were present at the same position in distantly related species but absent in closely related species, suggesting that introns of the Cyt b genes were frequently lost. On the other hand, highly similar intron sequences were observed in some distantly related species rather than in closely related species, suggesting that these introns were gained independently, likely through lateral transfers. The intron loss-and-gain events could be mediated by transpositions that might have occurred between nuclear and mitochondria. Southern hybridization analysis confirmed that some introns contained repetitive sequences and might be transposable elements. An intron gain in Botryotinia fuckeliana prevented the development of QoI fungicide resistance, suggesting that intron loss-and-gain events were not necessarily beneficial to their host organisms.

  3. Inheritance of the group I rDNA intron in Tetrahymena pigmentosa.

    Science.gov (United States)

    Nielsen, H; Simon, E M; Engberg, J

    1992-01-01

    We have previously argued from phylogenetic sequence data that the group I intron in the rRNA genes of Tetrahymena was acquired by different Tetrahymena species at different times during evolution. We have now approached the question of intron mobility experimentally by crossing intron+ and intron- strains looking for a strong polarity in the inheritance of the intron (intron homing). Based on the genetic analysis we find that the intron in T. pigmentosa is inherited as a neutral character and that intron+ and intron- alleles segregate in a Mendelian fashion with no sign of intron homing. In an analysis of vegetatively growing cells containing intron+ and intron- rDNA, initially in the same macronucleus, we similarly find no evidence of intron homing. During the course of this work, we observed to our surprise that progeny clones from some crosses contained three types of rDNA. One possible explanation is that T. pigmentosa has two rdn loci in contrast to the single locus found in T. thermophila. Some of the progeny clones from the genetic analysis were expanded for several hundred generations, and allelic assortment of the rDNA was demonstrated by subcloning analysis.

  4. Origin and inheritance of group I introns in 26S rRNA genes of Gaeumannomyces graminis.

    Science.gov (United States)

    Tan, M K

    1997-06-01

    Studies of the distribution of the three group I introns (intron A, intron T, and intron AT) in the 26S rDNA of Gaeumannomyces graminis had suggested that they were transferred to a common ancestor of G. graminis var. avenae and var. tritici after it had branched off from var. graminis. Intron AT and intron A exhibited vertical inheritance and coevolved in concert with their hosts. Intron loss could occur after its acquisition. Loss of any one of the three introns could occur in var. tritici whereas only loss of intron T had been found in the majority of var. avenae isolates. The existence of isolates of var. tritici and var. avenae with three introns suggested that intron loss could be reversed by intron acquisition and that the whole process is a dynamic one. This process of intron acquisition and intron loss reached different equilibrium points for different varieties and subgroups, which explained the irregular distribution of these introns in G. graminis. Each of the three group I introns was more closely related to other intron sequences that share the same insertion point in the 26S rDNA than to each other. These introns in distantly related organisms appeared to have a common ancestry. This system had provided a good model for studies on both the lateral transfer and common ancestry of group I introns in the 26S rRNA genes.

  5. Molecular characterization of a new member of the lariat capping twin-ribozyme introns

    DEFF Research Database (Denmark)

    Tang, Yunjia; Nielsen, Henrik; Masquida, Benoît

    2014-01-01

    in Naegleria amoeboflagellates and the myxomycete Didymium iridis. RESULTS: We characterize structural organization, catalytic properties and molecular evolution of a new twin-ribozyme intron in Allovahlkampfia (Heterolobosea). The intron contains two ribozyme domains with different functions in ribosomal RNA...

  6. Position-dependent repression and promotion of DQB1 intron 3 splicing by GGGG motifs

    National Research Council Canada - National Science Library

    Královicová, Jana; Vorechovsky, Igor

    2006-01-01

    ...) repeats on intron 3 removal. We found that the GGG or GGGG repeats generally improved splicing of DQB1 intron 3, except for those that were adjacent to the 5' splice site where they had the opposite effect...

  7. miRNA control of tissue repair and regeneration.

    Science.gov (United States)

    Sen, Chandan K; Ghatak, Subhadip

    2015-10-01

    Tissue repair and regeneration rely on the function of miRNA, molecular silencers that enact post-transcriptional gene silencing of coding genes. Disruption of miRNA homeostasis is developmentally lethal, indicating that fetal tissue development is tightly controlled by miRNAs. Multiple critical facets of adult tissue repair are subject to control by miRNAs, as well. Sources of cell pool for tissue repair and regeneration are diverse and provided by processes including cellular dedifferentiation, transdifferentiation, and reprogramming. Each of these processes is regulated by miRNAs. Furthermore, induced pluripotency may be achieved by miRNA-based strategies independent of transcription factor manipulation. The observation that miRNA does not integrate into the genome makes miRNA-based therapeutic strategies translationally valuable. Tools to manipulate cellular and tissue miRNA levels include mimics and inhibitors that may be specifically targeted to cells of interest at the injury site. Here, we discuss the extraordinary importance of miRNAs in tissue repair and regeneration based on emergent reports and rapid advances in miRNA-based therapeutics.

  8. Exosomal miRNAs as biomarkers for prostate cancer

    Directory of Open Access Journals (Sweden)

    Nina Pettersen Hessvik

    2013-03-01

    Full Text Available miRNAs are small non-coding RNAs that finely regulate gene expression in cells. Alterations in miRNA expression have been associated with development of cancer, and miRNAs are now being investigated as biomarkers for cancer as well as other diseases. Recently, miRNAs have been found outside cells in body fluids. Extracellular miRNAs exist in different forms - associated with Ago2 proteins, loaded into extracellular vesicles (exosomes, microvesicles or apoptotic bodies or into high density lipoprotein particles. These extracellular miRNAs are probably products of distinct cellular processes, and might therefore play different roles. However, their functions in vivo are currently unknown. In spite of this, they are considered as promising, noninvasive diagnostic and prognostic tools. Prostate cancer is the most common cancer in men in the Western world, but the currently used biomarker (prostate specific antigen has low specificity. Therefore, novel biomarkers are highly needed. In this review we will discuss possible biological functions of extracellular miRNAs, as well as the potential use of miRNAs from extracellular vesicles as biomarkers for prostate cancer.

  9. Base Composition Characteristics of Mammalian miRNAs

    Directory of Open Access Journals (Sweden)

    Bin Wang

    2013-01-01

    Full Text Available MicroRNAs (miRNAs are short RNA sequences that repress protein synthesis by either inhibiting the translation of messenger RNA (mRNA or increasing mRNA degradation. Endogenous miRNAs have been found in various organisms, including animals, plants, and viruses. Mammalian miRNAs are evolutionarily conserved, are scattered throughout chromosomes, and play an important role in the immune response and the onset of cancer. For this study, the author explored the base composition characteristics of miRNA genes from the six mammalian species that contain the largest number of known miRNAs. It was found that mammalian miRNAs are evolutionarily conserved and GU-rich. Interestingly, in the miRNA sequences investigated, A residues are clearly the most frequent occupants of positions 2 and 3 of the 5′ end of miRNAs. Unlike G and U residues that may pair with C/U and A/G, respectively, A residues can only pair with U residues of target mRNAs, which may augment the recognition specificity of the 5′ seed region.

  10. Progress in miRNA target prediction and identification

    Institute of Scientific and Technical Information of China (English)

    2009-01-01

    Recently, the identification of miRNA targets has received much attention. The strategies to determine miRNA targets include bioinformatic prediction and experimental assays. The bioinformatic prediction methods are mainly based on the confirmed rules of interaction between miRNAs and their targets, and are carried out by programs, such as miRanda, TargetScan, TargetScanS, RNAhybrid, DIANA-microT, PicTar, RNA22 and FindTar, which follow well-known principles. The experimental assays to find miRNA targets employ immunoprecipitation of AGO proteins to identify interacting mRNAs, or the analysis of mRNA or protein levels to identify genes which can be regulated by miRNAs. The improvement of current bioinformatic and experimental assays and the development of novel assays will enable greater efficiency in the identification of miRNA targets and thus facilitate miRNA research. This paper describes progress in the prediction and identification of miRNA targets.

  11. Multi-species comparative analysis of the equine ACE gene identifies a highly conserved potential transcription factor binding site in intron 16.

    Directory of Open Access Journals (Sweden)

    Natasha A Hamilton

    Full Text Available Angiotensin converting enzyme (ACE is essential for control of blood pressure. The human ACE gene contains an intronic Alu indel (I/D polymorphism that has been associated with variation in serum enzyme levels, although the functional mechanism has not been identified. The polymorphism has also been associated with cardiovascular disease, type II diabetes, renal disease and elite athleticism. We have characterized the ACE gene in horses of breeds selected for differing physical abilities. The equine gene has a similar structure to that of all known mammalian ACE genes. Nine common single nucleotide polymorphisms (SNPs discovered in pooled DNA were found to be inherited in nine haplotypes. Three of these SNPs were located in intron 16, homologous to that containing the Alu polymorphism in the human. A highly conserved 18 bp sequence, also within that intron, was identified as being a potential binding site for the transcription factors Oct-1, HFH-1 and HNF-3β, and lies within a larger area of higher than normal homology. This putative regulatory element may contribute to regulation of the documented inter-individual variation in human circulating enzyme levels, for which a functional mechanism is yet to be defined. Two equine SNPs occurred within the conserved area in intron 16, although neither of them disrupted the putative binding site. We propose a possible regulatory mechanism of the ACE gene in mammalian species which was previously unknown. This advance will allow further analysis leading to a better understanding of the mechanisms underpinning the associations seen between the human Alu polymorphism and enzyme levels, cardiovascular disease states and elite athleticism.

  12. Nearest neighbour spacing distribution of basis in some intron-less and intron-containing DNA sequences

    CERN Document Server

    Higareda, M F; Méndez-Sánchez, R A

    2006-01-01

    We show that the nearest neighbour distribution of distances between basis pairs of some intron-less and intron-containing coding regions are the same when a procedure, called {\\em unfolding}, is applied. Such a procedure consists in separating the secular variations from the oscillatory terms. The form of the distribution obtained is quite similar to that of a random, i.e. Poissonian, sequence. This is done for the HUMBMYH7CD, DROMYONMA, HUMBMYH7 and DROMHC sequences. The first two correspond to highly coding regions while the last two correspond to non-coding regions. We also show that the distributions before the unfolding procedure depend on the secular part but, after the unfolding procedure we obtain an striking result: all distributions are similar to each other. The result becomes independent of the content of introns or the species we have chosen. This is in contradiction with the results obtained with the detrended fluctuation analysis in which the correlations yield different results for intron-les...

  13. A site-specific endonuclease encoded by a typical archaeal intron

    DEFF Research Database (Denmark)

    Dalgaard, Jacob; Garrett, Roger Antony; Belfort, Malene

    1993-01-01

    The protein encoded by the archaeal intron in the 23S rRNA gene of the hyperthermophile Desulfurococcus mobilis is a double-strand DNase that, like group I intron homing endonucleases, is capable of cleaving an intronless allele of the gene. This enzyme, I-Dmo I, is unusual among the intron...... of endonucleases and intron core elements and are consistent with the invasive potential of endonuclease genes....

  14. Impact of tiny miRNAs on cancers

    Institute of Scientific and Technical Information of China (English)

    Wei Liu; Sheng-Yong Mao; Wei-Yun Zhu

    2007-01-01

    miRNAs are a class of small, ~22nt, non-coding RNAs that negatively regulate gene expression at the posttranscriptional level. They play profound and pervasive roles in manipulating gene expression involved in cell development, proliferation and apoptosis in various eukaryotes, which, in theory, could provide an access to many human diseases in theory. Recent evidence demonstrates that aberrant miRNA expression is a hallmark of tumor development, revealing that miRNA genes could function as potential oncogenes and repressors in the human body. miRNAs can affect tumorigenesis mainly by interrupting the cell cycle at the cellular level and by interacting with signaling,oncogenes and with the response to environmental factors at the molecular level. The established miRNA expression signature could be a potent tool to diagnose and treat human cancers in the future.

  15. Distribution of miRNA expression across human tissues.

    Science.gov (United States)

    Ludwig, Nicole; Leidinger, Petra; Becker, Kurt; Backes, Christina; Fehlmann, Tobias; Pallasch, Christian; Rheinheimer, Steffi; Meder, Benjamin; Stähler, Cord; Meese, Eckart; Keller, Andreas

    2016-05-05

    We present a human miRNA tissue atlas by determining the abundance of 1997 miRNAs in 61 tissue biopsies of different organs from two individuals collected post-mortem. One thousand three hundred sixty-four miRNAs were discovered in at least one tissue, 143 were present in each tissue. To define the distribution of miRNAs, we utilized a tissue specificity index (TSI). The majority of miRNAs (82.9%) fell in a middle TSI range i.e. were neither specific for single tissues (TSI > 0.85) nor housekeeping miRNAs (TSI tissues. Clustering of miRNA abundances revealed that tissues like several areas of the brain clustered together. Considering -3p and -5p mature forms we observed miR-150 with different tissue specificity. Analysis of additional lung and prostate biopsies indicated that inter-organism variability was significantly lower than inter-organ variability. Tissue-specific differences between the miRNA patterns appeared not to be significantly altered by storage as shown for heart and lung tissue. MiRNAs TSI values of human tissues were significantly (P = 10(-8)) correlated with those of rats; miRNAs that were highly abundant in certain human tissues were likewise abundant in according rat tissues. We implemented a web-based repository enabling scientists to access and browse the data (https://ccb-web.cs.uni-saarland.de/tissueatlas). © The Author(s) 2016. Published by Oxford University Press on behalf of Nucleic Acids Research.

  16. Differentially expressed miRNAs in trisomy 21 placentas.

    Science.gov (United States)

    Svobodová, Iveta; Korabečná, Marie; Calda, Pavel; Břešťák, Miroslav; Pazourková, Eva; Pospíšilová, Šárka; Krkavcová, Miroslava; Novotná, Michaela; Hořínek, Aleš

    2016-08-01

    Molecular pathogenesis of Down syndrome (DS) is still incompletely understood. Epigenetic mechanisms, including miRNAs gene expression regulation, belong to potential influencing factors. The aims of this study were to compare miRNAs expressions in placentas with normal and trisomic karyotype and to associate differentially expressed miRNAs with concrete biological pathways. A total of 80 CVS samples - 41 with trisomy 21 and 39 with normal karyotype - were included in our study. Results obtained in the pilot study using real-time PCR technology and TaqMan Human miRNA Array Cards were subsequently validated on different samples using individual TaqMan miRNA Assays. Seven miRNAs were verified as upregulated in DS placentas (miR-99a, miR-542-5p, miR-10b, miR-125b, miR-615, let-7c and miR-654); three of these miRNAs are located on chromosome 21 (miR-99a, miR-125b and let-7c). Many essential biological processes, transcriptional regulation or apoptosis, were identified as being potentially influenced by altered miRNA levels. Moreover, miRNAs overexpressed in DS placenta apparently regulate genes involved in placenta development (GJA1, CDH11, EGF, ERVW-1, ERVFRD-1, LEP or INHA). These findings suggest the possible participation of miRNAs in Down syndrome impaired placentation and connected pregnancy pathologies. © 2016 John Wiley & Sons, Ltd. © 2016 John Wiley & Sons, Ltd.

  17. Accumulation of Stable Full-Length Circular Group I Intron RNAs during Heat-Shock

    DEFF Research Database (Denmark)

    Andersen, Kasper L.; Beckert, Bertrand; Masquida, Benoit;

    2016-01-01

    the copy number of circular intron RNA from the myxomycete Didymium iridis. In exponentially growing amoebae, the circular introns are nuclear and found in 70 copies per cell. During heat-shock, the circular form is up-regulated to more than 500 copies per cell. The intron harbours two ribozymes that have...

  18. Accumulation of Stable Full-Length Circular Group I Intron RNAs during Heat-Shock

    DEFF Research Database (Denmark)

    Andersen, Kasper L.; Beckert, Bertrand; Masquida, Benoit

    2016-01-01

    the copy number of circular intron RNA from the myxomycete Didymium iridis. In exponentially growing amoebae, the circular introns are nuclear and found in 70 copies per cell. During heat-shock, the circular form is up-regulated to more than 500 copies per cell. The intron harbours two ribozymes that have...

  19. miRNA and miRNA target genes in copy number variations occurring in individuals with intellectual disability.

    Science.gov (United States)

    Qiao, Ying; Badduke, Chansonette; Mercier, Eloi; Lewis, Suzanne M E; Pavlidis, Paul; Rajcan-Separovic, Evica

    2013-08-10

    MicroRNAs (miRNAs) are a family of short, non-coding RNAs modulating expression of human protein coding genes (miRNA target genes). Their dysfunction is associated with many human diseases, including neurodevelopmental disorders. It has been recently shown that genomic copy number variations (CNVs) can cause aberrant expression of integral miRNAs and their target genes, and contribute to intellectual disability (ID). To better understand the CNV-miRNA relationship in ID, we investigated the prevalence and function of miRNAs and miRNA target genes in five groups of CNVs. Three groups of CNVs were from 213 probands with ID (24 de novo CNVs, 46 familial and 216 common CNVs), one group of CNVs was from a cohort of 32 cognitively normal subjects (67 CNVs) and one group of CNVs represented 40 ID related syndromic regions listed in DECIPHER (30 CNVs) which served as positive controls for CNVs causing or predisposing to ID. Our results show that 1). The number of miRNAs is significantly higher in de novo or DECIPHER CNVs than in familial or common CNV subgroups (P genes are found in de novo, familial and DECIPHER CNVs than in the common CNV subgroup (P genes from de novo and DECIPHER CNV subgroups. Our findings reveal an increase in miRNA and miRNA target gene content in de novo versus common CNVs in subjects with ID. Their expression profile and participation in pathways support a possible role of miRNA copy number change in cognition and/or CNV-mediated developmental delay. Systematic analysis of expression/function of miRNAs in addition to coding genes integral to CNVs could uncover new causes of ID.

  20. Cyanobacterial ribosomal RNA genes with multiple, endonuclease-encoding group I introns

    Directory of Open Access Journals (Sweden)

    Turner Seán

    2007-09-01

    Full Text Available Abstract Background Group I introns are one of the four major classes of introns as defined by their distinct splicing mechanisms. Because they catalyze their own removal from precursor transcripts, group I introns are referred to as autocatalytic introns. Group I introns are common in fungal and protist nuclear ribosomal RNA genes and in organellar genomes. In contrast, they are rare in all other organisms and genomes, including bacteria. Results Here we report five group I introns, each containing a LAGLIDADG homing endonuclease gene (HEG, in large subunit (LSU rRNA genes of cyanobacteria. Three of the introns are located in the LSU gene of Synechococcus sp. C9, and the other two are in the LSU gene of Synechococcus lividus strain C1. Phylogenetic analyses show that these introns and their HEGs are closely related to introns and HEGs located at homologous insertion sites in organellar and bacterial rDNA genes. We also present a compilation of group I introns with homing endonuclease genes in bacteria. Conclusion We have discovered multiple HEG-containing group I introns in a single bacterial gene. To our knowledge, these are the first cases of multiple group I introns in the same bacterial gene (multiple group I introns have been reported in at least one phage gene and one prophage gene. The HEGs each contain one copy of the LAGLIDADG motif and presumably function as homodimers. Phylogenetic analysis, in conjunction with their patchy taxonomic distribution, suggests that these intron-HEG elements have been transferred horizontally among organelles and bacteria. However, the mode of transfer and the nature of the biological connections among the intron-containing organisms are unknown.

  1. Naturally occuring nucleosome positioning signals in human exons and introns

    DEFF Research Database (Denmark)

    Baldi, Pierre; Brunak, Søren; Chauvin, Yves;

    1996-01-01

    alignments of internal exon and intron sequences corresponds to a periodic "in phase" bending potential towards the major groove of the DNA. The nucleosome positioning data show that the consensus triplets (and their complements) have a preference for locations on a bent double helix where the major groove...... of roughly ten nucleotides. The periodic pattern is also present in intron sequences, although the strength per nucleotide is weaker. Using two independent profile methods based on triplet bendability parameters from DNase I experiments and nucleosome positioning data, we show that the pattern in multiple...... faces inward and is compressed. The in-phase triplets are located adjacent to GCC/GGC triplets known to have the strongest bias in their positioning on the nucleosome. Analysis of mRNA sequences encoding proteins with known tertiary structure exclude the possibility that the pattern is a consequence...

  2. Intron analyses reveal multiple calmodulin copies in Littorina.

    Science.gov (United States)

    Simpson, R J; Wilding, C S; Grahame, J

    2005-04-01

    Intron 3 and the flanking exons of the calmodulin gene have been amplified, cloned, and sequenced from 18 members of the gastropod genus Littorina. From the 48 sequences, at least five different gene copies have been identified and their functionality characterized using a strategy based upon the potential protein product predicted from flanking exon data. The functionality analyses suggest that four of the genes code for functional copies of calmodulin. All five copies have been identified across a wide range of littorinid species although not ubiquitously. Using this novel approach based on intron sequences, we have identified an unprecedented number of potential calmodulin copies in Littorina, exceeding that reported for any other invertebrate. This suggests a higher number of, and more ancient, gene duplications than previously detected in a single genus.

  3. MicroRNAs (miRNAs) in neurodegenerative diseases.

    Science.gov (United States)

    Nelson, Peter T; Wang, Wang-Xia; Rajeev, Bernard W

    2008-01-01

    Aging-related neurodegenerative diseases (NDs) are the culmination of many different genetic and environmental influences. Prior studies have shown that RNAs are pathologically altered during the inexorable course of some NDs. Recent evidence suggests that microRNAs (miRNAs) may be a contributing factor in neurodegeneration. miRNAs are brain-enriched, small ( approximately 22 nucleotides) non-coding RNAs that participate in mRNA translational regulation. Although discovered in the framework of worm development, miRNAs are now appreciated to play a dynamic role in many mammalian brain-related biochemical pathways, including neuroplasticity and stress responses. Research about miRNAs in the context of neurodegeneration is accumulating rapidly, and the goal of this review is to provide perspective for these new data that may be helpful to specialists in either field. An overview is provided about the normal functions for miRNAs, including some of the newer concepts related to the human brain. Recently published studies pertaining to the roles of miRNAs in NDs--including Alzheimer's disease, Parkinson's disease and triplet repeat disorders-are described. Finally, a discussion is included with theoretical syntheses and possible future directions in exploring the nexus between miRNA and ND research.

  4. miRNA Expression Analyses in Prostate Cancer Clinical Tissues.

    Science.gov (United States)

    Bucay, Nathan; Shahryari, Varahram; Majid, Shahana; Yamamura, Soichiro; Mitsui, Yozo; Tabatabai, Z Laura; Greene, Kirsten; Deng, Guoren; Dahiya, Rajvir; Tanaka, Yuichiro; Saini, Sharanjot

    2015-09-08

    A critical challenge in prostate cancer (PCa) clinical management is posed by the inadequacy of currently used biomarkers for disease screening, diagnosis, prognosis and treatment. In recent years, microRNAs (miRNAs) have emerged as promising alternate biomarkers for prostate cancer diagnosis and prognosis. However, the development of miRNAs as effective biomarkers for prostate cancer heavily relies on their accurate detection in clinical tissues. miRNA analyses in prostate cancer clinical specimens is often challenging owing to tumor heterogeneity, sampling errors, stromal contamination etc. The goal of this article is to describe a simplified workflow for miRNA analyses in archived FFPE or fresh frozen prostate cancer clinical specimens using a combination of quantitative real-time PCR (RT-PCR) and in situ hybridization (ISH). Within this workflow, we optimize the existing methodologies for miRNA extraction from FFPE and frozen prostate tissues and expression analyses by Taqman-probe based miRNA RT-PCR. In addition, we describe an optimized method for ISH analyses formiRNA detection in prostate tissues using locked nucleic acid (LNA)- based probes. Our optimized miRNA ISH protocol can be applied to prostate cancer tissue slides or prostate cancer tissue microarrays (TMA).

  5. Entropy-based model for miRNA isoform analysis.

    Directory of Open Access Journals (Sweden)

    Shengqin Wang

    Full Text Available MiRNAs have been widely studied due to their important post-transcriptional regulatory roles in gene expression. Many reports have demonstrated the evidence of miRNA isoform products (isomiRs in high-throughput small RNA sequencing data. However, the biological function involved in these molecules is still not well investigated. Here, we developed a Shannon entropy-based model to estimate isomiR expression profiles of high-throughput small RNA sequencing data extracted from miRBase webserver. By using the Kolmogorov-Smirnov statistical test (KS test, we demonstrated that the 5p and 3p miRNAs present more variants than the single arm miRNAs. We also found that the isomiR variant, except the 3' isomiR variant, is strongly correlated with Minimum Free Energy (MFE of pre-miRNA, suggesting the intrinsic feature of pre-miRNA should be one of the important factors for the miRNA regulation. The functional enrichment analysis showed that the miRNAs with high variation, particularly the 5' end variation, are enriched in a set of critical functions, supporting these molecules should not be randomly produced. Our results provide a probabilistic framework for miRNA isoforms analysis, and give functional insights into pre-miRNA processing.

  6. Exosomal miRNAs as cancer biomarkers and therapeutic targets

    Directory of Open Access Journals (Sweden)

    Arron Thind

    2016-07-01

    Full Text Available Intercommunication between cancer cells and with their surrounding and distant environments is key to the survival, progression and metastasis of the tumour. Exosomes play a role in this communication process. MicroRNA (miRNA expression is frequently dysregulated in tumour cells and can be reflected by distinct exosomal miRNA (ex-miRNA profiles isolated from the bodily fluids of cancer patients. Here, the potential of ex-miRNA as a cancer biomarker and therapeutic target is critically analysed. Exosomes are a stable source of miRNA in bodily fluids but, despite a number of methods for exosome extraction and miRNA quantification, their suitability for diagnostics in a clinical setting is questionable. Furthermore, exosomally transferred miRNAs can alter the behaviour of recipient tumour and stromal cells to promote oncogenesis, highlighting a role in cell communication in cancer. However, our incomplete understanding of exosome biogenesis and miRNA loading mechanisms means that strategies to target exosomes or their transferred miRNAs are limited and not specific to tumour cells. Therefore, if ex-miRNA is to be employed in novel non-invasive diagnostic approaches and as a therapeutic target in cancer, two further advances are necessary: in methods to isolate and detect ex-miRNA, and a better understanding of their biogenesis and functions in tumour-cell communication.

  7. Differential splicing of human androgen receptor pre-mRNA in X-linked reifenstein syndrome, because of a deletion involving a putative branch site

    Energy Technology Data Exchange (ETDEWEB)

    Ris-Stalpers, C.; Verleun-Mooijman, M.C.T.; Blaeij, T.J.P. de; Brinkmann, A.O.; Degenhart, H.J.; Trapman, J. (Erasmus Univ., Rotterdam (Netherlands))

    1994-04-01

    The analysis of the androgen receptor (AR) gene, mRNA, and protein in a subject with X-linked Reifenstein syndrome (partial androgen insensitivity) is reported. The presence of two mature AR transcripts in genital skin fibroblasts of the patient is established, and, by reverse transcriptase-PCR and RNase transcription analysis, the wild-type transcript and a transcript in which exon 3 sequences are absent without disruption of the translational reading frame are identified. Sequencing and hybridization analysis show a deletion of >6 kb in intron 2 of the human AR gene, starting 18 bp upstream of exon 3. The deletion includes the putative branch-point sequence (BPS) but not the acceptor splice site on the intron 2/exon 3 boundary. The deletion of the putative intron 2 BPS results in 90% inhibition of wild-type splicing. The mutant transcript encodes an AR protein lacking the second zinc finger of the DNA-binding domain. Western/immunoblotting analysis is used to show that the mutant AR protein is expressed in genital skin fibroblasts of the patient. The residual 10% wild-type transcript can be the result of the use of a cryptic BPS located 63 bp upstream of the intron 2/exon 3 boundary of the mutant AR gene. The mutated AR protein has no transcription-activating potential and does not influence the transactivating properties of the wild-type AR, as tested in cotransfection studies. It is concluded that the partial androgen-insensitivity syndrome of this patient is the consequence of the limited amount of wild-type AR protein expressed in androgen target cells, resulting from the deletion of the intron 2 putative BPS. 42 refs., 6 figs., 1 tab.

  8. Sequencing of mitochondrial genomes of nine Aspergillus and Penicillium species identifies mobile introns and accessory genes as main sources of genome size variability

    Directory of Open Access Journals (Sweden)

    Joardar Vinita

    2012-12-01

    Full Text Available Abstract Background The genera Aspergillus and Penicillium include some of the most beneficial as well as the most harmful fungal species such as the penicillin-producer Penicillium chrysogenum and the human pathogen Aspergillus fumigatus, respectively. Their mitochondrial genomic sequences may hold vital clues into the mechanisms of their evolution, population genetics, and biology, yet only a handful of these genomes have been fully sequenced and annotated. Results Here we report the complete sequence and annotation of the mitochondrial genomes of six Aspergillus and three Penicillium species: A. fumigatus, A. clavatus, A. oryzae, A. flavus, Neosartorya fischeri (A. fischerianus, A. terreus, P. chrysogenum, P. marneffei, and Talaromyces stipitatus (P. stipitatum. The accompanying comparative analysis of these and related publicly available mitochondrial genomes reveals wide variation in size (25–36 Kb among these closely related fungi. The sources of genome expansion include group I introns and accessory genes encoding putative homing endonucleases, DNA and RNA polymerases (presumed to be of plasmid origin and hypothetical proteins. The two smallest sequenced genomes (A. terreus and P. chrysogenum do not contain introns in protein-coding genes, whereas the largest genome (T. stipitatus, contains a total of eleven introns. All of the sequenced genomes have a group I intron in the large ribosomal subunit RNA gene, suggesting that this intron is fixed in these species. Subsequent analysis of several A. fumigatus strains showed low intraspecies variation. This study also includes a phylogenetic analysis based on 14 concatenated core mitochondrial proteins. The phylogenetic tree has a different topology from published multilocus trees, highlighting the challenges still facing the Aspergillus systematics. Conclusions The study expands the genomic resources available to fungal biologists by providing mitochondrial genomes with consistent

  9. A novel SP1/SP3 dependent intronic enhancer governing transcription of the UCP3 gene in brown adipocytes.

    Directory of Open Access Journals (Sweden)

    Christoph Hoffmann

    Full Text Available Uncoupling protein (UCP 3 is a mitochondrial inner membrane protein implicated in lipid handling and metabolism of reactive oxygen species. Its transcription is mainly regulated by peroxisome proliferator-activated receptors (PPAR, a family of nuclear hormone receptors. Employing bandshift assays, RNA interference and reporter gene assays we examine an intronic region in the UCP3 gene harboring a cis-element essential for expression in brown adipocytes. We demonstrate binding of SP1 and SP3 to this element which is adjacent to a direct repeat 1 element mediating activation of UCP3 expression by PPARγ agonists. Transactivation mediated by these elements is interdependent and indispensable for UCP3 expression. Systematic deletion uncovered a third binding element, a putative NF1 site, in close proximity to the SP1/3 and PPARγ binding elements. Data mining demonstrated binding of MyoD and Myogenin to this third element in C2C12 cells, and, furthermore, revealed recruitment of p300. Taken together, this intronic region is the main enhancer driving UCP3 expression with SP1/3 and PPARγ as the core factors required for expression.

  10. Expression and characterization of rice putative PAUSED gene

    Institute of Scientific and Technical Information of China (English)

    Chengguo Yao; Liangfa Ge; Wei Li; Botao Zhao; Chaoqun Li; Kangcheng Ruan; Hongxuan Lin; Youxin Jin

    2008-01-01

    In Arab idopsis, PA USED ( PSD ) encodes the ortholog of loslp/ exportin-t, which mediates the nuclear export of transfer RNA (tRNA) in yeast and mammals. However, in monocot plants such as rice, knowledge of the corresponding ortholog is limited, and its effects on growth development and productivity remain unknown. In this study, we verified a rice transfer-DNA insertional mutantpsd line and analyzed its phenotypes;the mutant displayed severe morphological defects including retarded development and low fertility compared with wild-type rice. Examining intronless tRNA-Tyr and intron-containing pre-tRNA-Ala expression levels in cytoplasmic and nuclear fraction with Northern blot analysis between wild -type and mutant leaf tissue suggested that rice PSD might be involved in tRNA export from the nucleus to the cytoplasm.Additionally, reverse transcription-polymerase chain reaction analysis revealed that PSD transcript was expressed throughout normal rice plant development, and subcellular localization assays showed that rice PSD protein was present in both the nucleus and cytoplasm. In summary, our data implied that the putative PSD gene might be indispensable for normal rice development and its function might be the same as that ofArabidopsis PSD.

  11. A group I intron in the nuclear small subunit ribosomal DNA of Gaeumannomyces graminis.

    Science.gov (United States)

    Fouly, H M; Wilkinson, H T

    2000-05-01

    The length of the small subunit ribosomal DNA (SSU rDNA) differs among isolates of species and varieties of Gaeumannomyces. The sequence of the 3' region of the SSU rDNA revealed 340-, 365-, and 520-bp insertions for G. graminis varieties avenae, tritici, and graminis, respectively. The intron sequences from varities tritici and avenae were similar, except there was an insert of 23 nucleotides at base 328 from the 5' end of the G. g. var. tritici intron. The G. g. var. graminis intron sequences had 92.4% homology compared with the intron sequences of varieties tritici and avenae. In addition, the intron sequence of variety graminis is larger, having an insert of 155 nucleotides at base 365 of the 5' end of the intron. Little variation in the DNA sequences flanking the introns has been detected among the isolates of Gaeumannomyces that either have or lack an intron. Reverse transcriptase PCR (RT-PCR) indicated the absence of the intron in the mature rRNA. The intron sequence had both a conserved sequence and secondary structural elements classifying it as a group I intron.

  12. Localized Retroprocessing as a Model of Intron Loss in the Plant Mitochondrial Genome.

    Science.gov (United States)

    Cuenca, Argelia; Ross, T Gregory; Graham, Sean W; Barrett, Craig F; Davis, Jerrold I; Seberg, Ole; Petersen, Gitte

    2016-08-03

    Loss of introns in plant mitochondrial genes is commonly explained by retroprocessing. Under this model, an mRNA is reverse transcribed and integrated back into the genome, simultaneously affecting the contents of introns and edited sites. To evaluate the extent to which retroprocessing explains intron loss, we analyzed patterns of intron content and predicted RNA editing for whole mitochondrial genomes of 30 species in the monocot order Alismatales. In this group, we found an unusually high degree of variation in the intron content, even expanding the hitherto known variation among angiosperms. Some species have lost some two-third of the cis-spliced introns. We found a strong correlation between intron content and editing frequency, and detected 27 events in which intron loss is consistent with the presence of nucleotides in an edited state, supporting retroprocessing. However, we also detected seven cases of intron loss not readily being explained by retroprocession. Our analyses are also not consistent with the entire length of a fully processed cDNA copy being integrated into the genome, but instead indicate that retroprocessing usually occurs for only part of the gene. In some cases, several rounds of retroprocessing may explain intron loss in genes completely devoid of introns. A number of taxa retroprocessing seem to be very common and a possibly ongoing process. It affects the entire mitochondrial genome.

  13. Site-specific reverse splicing of a HEG-containing group I intron in ribosomal RNA

    Science.gov (United States)

    Birgisdottir, Åsa B.; Johansen, Steinar

    2005-01-01

    The wide, but scattered distribution of group I introns in nature is a result of two processes; the vertical inheritance of introns with or without losses, and the occasional transfer of introns across species barriers. Reversal of the group I intron self-splicing reaction, termed reverse splicing, coupled with reverse transcription and genomic integration potentially mediate an RNA-based intron mobility pathway. Compared to the well characterized endonuclease-mediated intron homing, reverse splicing is less specific and represents a likely explanation for many intron transpositions into new genomic sites. However, the frequency and general role of an RNA-based mobility pathway in the spread of natural group I introns is still unclear. We have used the twin-ribozyme intron (Dir.S956-1) from the myxomycete Didymium iridis to test how a mobile group I intron containing a homing endonuclease gene (HEG) selects between potential insertion sites in the small subunit (SSU) rRNA in vitro, in Escherichia coli and in yeast. Surprisingly, the results show a site-specific RNA-based targeting of Dir.S956-1 into its natural (S956) SSU rRNA site. Our results suggest that reverse splicing, in addition to the established endonuclease-mediated homing mechanism, potentially accounts for group I intron spread into the homologous sites of different strains and species. PMID:15817568

  14. What an Intron May Tell: Several Sexual Biospecies Coexist in Meriderma spp. (Myxomycetes).

    Science.gov (United States)

    Feng, Yun; Klahr, Anja; Janik, Paulina; Ronikier, Anna; Hoppe, Thomas; Novozhilov, Yuri K; Schnittler, Martin

    2016-06-01

    Specimens of the snowbank myxomycete Meriderma atrosporum agg. from five European mountain ranges were sequenced for parts of the nuclear small subunit ribosomal RNA gene (SSU) and the protein elongation factor 1 alpha gene (EF1A). A phylogeny of the EF1A gene, including a very variable spliceosomal intron, resulted in seven phylogroups, and this topology was confirmed by SSU sequences. Two thirds of all specimens were heterozygous for the EF1A gene, and the two haplotypes of these specimens occurred always in the same phylogroup. Except for two cases in closely related phylogroups all ribotypes were as well limited to one phylogroup. This pattern is consistent with the assumption of reproductively isolated sexual biospecies. Numbers of EF1A-haplotypes shared between mountain ranges correlate with geographical distance, suggesting relative isolation but occasional long-distance dispersal by spores. Most subpopulations (divided by putative biospecies and mountain ranges) were in Hardy-Weinberg equilibrium. A simulation assuming panmixis within but not in between subpopulations suggested that similar numbers of shared genotypes can be created by chance through sexual reproduction alone. Our results support the biospecies concept, derived from experiments with cultivable members of the Physarales. We discuss the results on the background of possible reproductive options in myxomycetes. Copyright © 2016 Elsevier GmbH. All rights reserved.

  15. A general model for the evolution of nuclear pre-mRNA introns.

    Science.gov (United States)

    Hickey, D A; Benkel, B F; Abukashawa, S M

    1989-03-07

    We present an overview of the evolution of eukaryotic split gene structure and pre-mRNA splicing mechanisms. We have drawn together several seemingly conflicting ideas and we show that they can all be incorporated in a single unified theory of intron evolution. The resulting model is consistent with the notion that introns, as a class, are very ancient, having originated in the "RNA world"; it also supports the concept that introns may have played a crucial role in the construction of many eukaryotic genes and it accommodates the idea that introns are related to mobile insertion elements. Our conclusion is that introns could have a profound effect on the course of eukaryotic gene evolution, but that the origin and maintenance of intron sequences depends, largely, on natural selection acting on the intron sequences themselves.

  16. miRNA expression analysis in cortical dysplasia: regulation of mTOR and LIS1 pathway.

    Science.gov (United States)

    Lee, Ji Yeoun; Park, Ae-Kyung; Lee, Eun-Sun; Park, Woong-Yang; Park, Sung-Hye; Choi, Jung Won; Phi, Ji Hoon; Wang, Kyu-Chang; Kim, Seung-Ki

    2014-03-01

    Cortical dysplasia (CD) is a common cause of epilepsy in children and is characterized by focal regions of malformed cerebral cortex. The pathogenesis and epileptogenesis of CD have not been fully elucidated, and in particular, the potential role of epigenetics has not been examined. miRNA microarray was performed on surgical specimens from CD (n=8) and normal control (n=2) children. A total of 10 differentially expressed miRNAs (DEmiRs) that were up-regulated in CD were identified including hsa-miR-21 and hsa-miR-155. The microarray results were validated using quantitative real-time PCR. After searching for the putative target genes of the DEmiRs, their biological significance was further evaluated by exploring the pathways in which the genes were enriched. The mammalian target of rapamycin (mTOR) signaling pathway was the most significantly associated, and the pathway of lissencephaly gene in neuronal migration and development was also noted. This study suggests a possible role for miRNAs in the pathogenesis of CD, especially in relation to the mTOR signaling pathway. Future studies on the epigenetic mechanisms underlying CD pathogenesis and epileptogenesis are needed.

  17. Identification and characterization of three putative genes for 1-aminocyclopropane-1-carboxylate synthase from etiolated mung bean hypocotyl segments.

    Science.gov (United States)

    Botella, J R; Schlagnhaufer, C D; Arteca, R N; Phillips, A T

    1992-02-01

    The polymerase chain reaction (PCR) was used to produce 3 putative clones for ACC synthase from etiolated mung bean (Vigna radiata Rwilcz cv. Berken) hypocotyls. This was accomplished by utilizing genomic DNA from mung bean and degenerate primers made from information derived from highly conserved regions of ACC synthase from different plant tissues. The total length of pMAC-1, pMAC-2 and pMAC-3 are 308, 321, and 326 bp, respectively, all of which code for 68 amino acids. The introns for pMAC-1, pMAC-2 and pMAC-3 are 92, 105, and 110 bp, respectively. The degrees of homology at the DNA level for each of these clones is ca. 80% in their coding region and ca. 50% in their respective introns. This is the first report providing evidence that there are at least 3 genes for ACC synthase in etiolated mung bean.

  18. An intronic G run within HIV-1 intron 2 is critical for splicing regulation of vif mRNA.

    Science.gov (United States)

    Widera, Marek; Erkelenz, Steffen; Hillebrand, Frank; Krikoni, Aikaterini; Widera, Darius; Kaisers, Wolfgang; Deenen, René; Gombert, Michael; Dellen, Rafael; Pfeiffer, Tanya; Kaltschmidt, Barbara; Münk, Carsten; Bosch, Valerie; Köhrer, Karl; Schaal, Heiner

    2013-03-01

    Within target T lymphocytes, human immunodeficiency virus type I (HIV-1) encounters the retroviral restriction factor APOBEC3G (apolipoprotein B mRNA-editing enzyme, catalytic polypeptide-like 3G; A3G), which is counteracted by the HIV-1 accessory protein Vif. Vif is encoded by intron-containing viral RNAs that are generated by splicing at 3' splice site (3'ss) A1 but lack splicing at 5'ss D2, which results in the retention of a large downstream intron. Hence, the extents of activation of 3'ss A1 and repression of D2, respectively, determine the levels of vif mRNA and thus the ability to evade A3G-mediated antiviral effects. The use of 3'ss A1 can be enhanced or repressed by splicing regulatory elements that control the recognition of downstream 5'ss D2. Here we show that an intronic G run (G(I2)-1) represses the use of a second 5'ss, termed D2b, that is embedded within intron 2 and, as determined by RNA deep-sequencing analysis, is normally inefficiently used. Mutations of G(I2)-1 and activation of D2b led to the generation of transcripts coding for Gp41 and Rev protein isoforms but primarily led to considerable upregulation of vif mRNA expression. We further demonstrate, however, that higher levels of Vif protein are actually detrimental to viral replication in A3G-expressing T cell lines but not in A3G-deficient cells. These observations suggest that an appropriate ratio of Vif-to-A3G protein levels is required for optimal virus replication and that part of Vif level regulation is effected by the novel G run identified here.

  19. Identification of targets of miRNA-221 and miRNA-222 in fulvestrant-resistant breast cancer

    Science.gov (United States)

    Liu, Pengfei; Sun, Manna; Jiang, Wenhua; Zhao, Jinkun; Liang, Chunyong; Zhang, Huilai

    2016-01-01

    The present study aimed to identify the differentially expressed genes (DEGs) regulated by microRNA (miRNA)-221 and miRNA-222 that are associated with the resistance of breast cancer to fulvestrant. The GSE19777 transcription profile was downloaded from the Gene Expression Omnibus database, and includes data from three samples of antisense miRNA-221-transfected fulvestrant-resistant MCF7-FR breast cancer cells, three samples of antisense miRNA-222-transfected fulvestrant-resistant MCF7-FR cells and three samples of control inhibitor (green fluorescent protein)-treated fulvestrant-resistant MCF7-FR cells. The linear models for microarray data package in R/Bioconductor was employed to screen for DEGs in the miRNA-transfected cells, and the pheatmap package in R was used to perform two-way clustering. Pathway enrichment was conducted using the Gene Set Enrichment Analysis tool. Furthermore, a miRNA-messenger (m) RNA regulatory network depicting interactions between miRNA-targeted upregulated DEGs was constructed and visualized using Cytoscape. In total, 492 and 404 DEGs were identified for the antisense miRNA-221-transfected MCF7-FR cells and the antisense miRNA-222-transfected MCF7-FR cells, respectively. Genes of the pentose phosphate pathway (PPP) were significantly enriched in the antisense miRNA-221-transfected MCF7-FR cells. In addition, components of the Wnt signaling pathway and cell adhesion molecules (CAMs) were significantly enriched in the antisense miRNA-222-transfected MCF7-FR cells. In the miRNA-mRNA regulatory network, miRNA-222 was demonstrated to target protocadherin 10 (PCDH10). The results of the present study suggested that the PPP and Wnt signaling pathways, as well as CAMs and PCDH10, may be associated with the resistance of breast cancer to fulvestrant. PMID:27895744

  20. Single nucleotide polymorphisms in intron 1 and intron 2 of Larimichthys crocea growth hormone gene are correlated with growth traits

    Science.gov (United States)

    Ni, Jing; You, Feng; Xu, Jianhe; Xu, Dongdong; Wen, Aiyun; Wu, Zhihao; Xu, Yongli; Zhang, Peijun

    2012-03-01

    The growth hormone gene ( GH) affects animal growth and is a potential target for genetic studies of variation related to growth traits. In this study, we analyzed single nucleotide polymorphisms (SNPs) in GH intron regions and their associations with growth traits in large yellow croaker, Larimichthys crocea, from Zhejiang and Fujian stocks. The results of PCR-single strand conformation polymorphism showed two haplotypes of intron 1, named AA and AB genotypes, in Zhejiang stock. AB exhibited an SNP at position 196 (G→A) that was negatively correlated with body height and positively correlated with standard length/body height ( P≤0.05). Two different genotypes, CC and CD, were identified in intron 2 in Fujian stock, with CD showing an SNP at position 692 (T→C). The CD genotype had a significantly positive correlation with both weight and total length ( P≤0.01). These basic data highlight the potential for using GH as a genetic marker of fish growth in marker assisted selection.

  1. Single nucleotide polymorphisms in intron 1 and intron 2 of Larimichthys crocea growth hormone gene are correlated with growth traits

    Institute of Scientific and Technical Information of China (English)

    NI Jing; YOU Feng; XU Jianhe; XU Dongdong; WEN Aiyun; WU Zhihao; XU Yongli; ZHANG Peijun

    2012-01-01

    The growth hormone gene (GH) affects animal growth and is a potential target for genetic studies of variation related to growth traits.In this study,we analyzed single nucleotide polymorphisms (SNPs) in GH intron regions and their associations with growth traits in large yellow croaker,Larimichthys crocea,from Zhejiang and Fujian stocks.The results of PCR-single strand conformation polymorphism showed two haplotypes of intron 1,named AA and AB genotypes,in Zhejiang stock.AB exhibited an SNP at position 196 (G→A) that was negatively correlated with body height and positively correlated with standard length/body height (P≤0.05).Two different genotypes,CC and CD,were identified in intron 2 in Fujian stock,with CD showing an SNP at position 692 (T→C).The CD genotype had a significantly positive correlation with both weight and total length (P≤0.01).These basic data highlight the potential for using GH as a genetic marker of fish growth in marker assisted selection.

  2. Identification of intron 1 and intron 22 inversions of factor VIII gene in Serbian patients with hemophilia A

    Directory of Open Access Journals (Sweden)

    Ilić Nina

    2013-01-01

    Full Text Available Hemophilia A (HA is a common X-linked recessive bleeding disease caused by mutations of FVIII gene. Inversion of intron 1 (inv1 and intron 22 (inv22 are recurrent mutations in severe HA, causing 50% of cases. Inv1 has been reported to occur in 2-5% and inv 22 in 45% of severe HA patients. Our objective was to determine, for the first time in Serbia, the frequency of inv1 and inv22 in a group of severe HA patients and to compare these data with those from other countries. Study subjects were 50 HA patients, diagnosed and treated from April 2009 to June 2012 at Mother and Child Health Care Institute of Serbia “Dr Vukan Cupic” (IHS and Institute for Child and Youth Health Care of Vojvodina (IHV.The presence of inv1 and inv22 was analyzed using Inverse shifting PCR (IS-PCR. Our results revealed that the frequencies of inv1 and inv22 in the cohort of Serbian patients were 6 % and 42% (34% of inv22 type I and 8% of inv22 type II respectively . These frequencies were in line with those found in other populations. Carrier status analyses of 65 family members (mothers and sisters showed the de novo inversion of intron 22 in one patient. Genetic Counseling Units of IHS and IHV provide the adequate genetic advice to all HA affected patients and their family members. [Projekat Ministarstva nauke Republike Srbije, br. 173046 i br. 175056

  3. Vasopressin-regulated miRNAs and AQP2-targeting miRNAs in kidney collecting duct cells.

    Science.gov (United States)

    Kim, Jae-Eun; Jung, Hyun Jun; Lee, Yu-Jung; Kwon, Tae-Hwan

    2015-04-01

    Mature microRNA (miRNA) acts as an important posttranscriptional regulator. We aimed to profile vasopressin-responsive miRNAs in kidney inner medullary collecting duct cells and to identify aquaporin-2 (AQP2)-targeting miRNAs. Microarray chip assay was carried out in inner medullary collecting duct tubule suspensions from rat kidneys in the absence or presence of desmopressin (dDAVP) stimulation (10(-9) M, 2 h). The results demonstrated 19 miRNAs, including both precursor and mature miRNAs, as potential candidates that showed significant changes in expression after dDAVP stimulation (P 1.3-fold changes in expression on the microarray (miR-127, miR-1, miR-873, miR-16, miR-206, miR-678, miR-496, miR-298, and miR-463) were further examined by quantitative real-time PCR, and target genes of the selected miRNAs were predicted. Next, to identify AQP2-targeting miRNAs, in silico analysis was performed. Four miRNAs (miR-32, miR-137, miR-216a, and miR-216b) target the 3'-untranslated region of rat AQP2 mRNA. Target seed regions of miR-32 and miR-137 were also conserved in the 3'-untranslated region of mouse AQP2 mRNA. Quantitative real-time PCR and immunoblot analysis demonstrated that dDAVP-induced AQP2 expression was significantly attenuated in mpkCCDc14 cells when cells were transfected with miRNA mimics of miR-32 or miR-137. Moreover, luciferase reporter assay demonstrated a significant decrease of AQP2 translation in mpkCCDc14 cells transfected with miRNA mimics of miR-32 or miR-137. The present study provides novel insights into the regulation of AQP2 by RNA interference; however, vasopressin-regulated miRNAs did not include miR-32 or miR-137, indicating that the interaction of miRNAs with the AQP2 regulatory pathway requires further analysis. Copyright © 2015 the American Physiological Society.

  4. An ultraconserved lnc to miRNA processing.

    Science.gov (United States)

    Plosky, Brian S

    2014-07-03

    Very few specific functions have been assigned to ultraconserved regions. In this issue of Molecular Cell, Liz et al. (2014) describe how a lncRNA transcribed from an ultraconserved region can negatively regulate miRNA maturation.

  5. Circulating miRNAs as biomarkers for endocrine disorders.

    Science.gov (United States)

    Butz, H; Kinga, N; Racz, K; Patocs, A

    2016-01-01

    Specific, sensitive and non-invasive biomarkers are always needed in endocrine disorders. miRNAs are short, non-coding RNA molecules with well-known role in gene expression regulation. They are frequently dysregulated in metabolic and endocrine diseases. Recently it has been shown that they are secreted into biofluids by nearly all kind of cell types. As they can be taken up by other cells they may have a role in a new kind of paracrine, cell-to-cell communication. Circulating miRNAs are protected by RNA-binding proteins or microvesicles hence they can be attractive candidates as diagnostic or prognostic biomarkers. In this review, we summarize the characteristics of extracellular miRNA's and our knowledge about their origin and potential roles in endocrine and metabolic diseases. Discussions about the technical challenges occurring during identification and measurement of extracellular miRNAs and future perspectives about their roles are also highlighted.

  6. In silico identification of miRNAs and their target genes and analysis of gene co-expression network in saffron (Crocus sativus L.) stigma.

    Science.gov (United States)

    Zinati, Zahra; Shamloo-Dashtpagerdi, Roohollah; Behpouri, Ali

    2016-12-01

    As an aromatic and colorful plant of substantive taste, saffron (Crocus sativus L.) owes such properties of matter to growing class of the secondary metabolites derived from the carotenoids, apocarotenoids. Regarding the critical role of microRNAs in secondary metabolic synthesis and the limited number of identified miRNAs in C. sativus, on the other hand, one may see the point how the characterization of miRNAs along with the corresponding target genes in C. sativus might expand our perspectives on the roles of miRNAs in carotenoid/apocarotenoid biosynthetic pathway. A computational analysis was used to identify miRNAs and their targets using EST (Expressed Sequence Tag) library from mature saffron stigmas. Then, a gene co- expression network was constructed to identify genes which are potentially involved in carotenoid/apocarotenoid biosynthetic pathways. EST analysis led to the identification of two putative miRNAs (miR414 and miR837-5p) along with the corresponding stem- looped precursors. To our knowledge, this is the first report on miR414 and miR837-5p in C. sativus. Co-expression network analysis indicated that miR414 and miR837-5p may play roles in C. sativus metabolic pathways and led to identification of candidate genes including six transcription factors and one protein kinase probably involved in carotenoid/apocarotenoid biosynthetic pathway. Presence of transcription factors, miRNAs and protein kinase in the network indicated multiple layers of regulation in saffron stigma. The candidate genes from this study may help unraveling regulatory networks underlying the carotenoid/apocarotenoid biosynthesis in saffron and designing metabolic engineering for enhanced secondary metabolites.

  7. In silico identification of miRNAs and their target genes and analysis of gene co-expression network in saffron (Crocus sativus L. stigma

    Directory of Open Access Journals (Sweden)

    Zahra Zinati

    2016-12-01

    Full Text Available As an aromatic and colorful plant of substantive taste, saffron (Crocus sativus L. owes such properties of matter to growing class of the secondary metabolites derived from the carotenoids, apocarotenoids. Regarding the critical role of microRNAs in secondary metabolic synthesis and the limited number of identified miRNAs in C. sativus, on the other hand, one may see the point how the characterization of miRNAs along with the corresponding target genes in C. sativus might expand our perspectives on the roles of miRNAs in carotenoid/apocarotenoid biosynthetic pathway. A computational analysis was used to identify miRNAs and their targets using EST (Expressed Sequence Tag library from mature saffron stigmas. Then, a gene co-expression network was constructed to identify genes which are potentially involved in carotenoid/apocarotenoid biosynthetic pathways. EST analysis led to the identification of two putative miRNAs (miR414 and miR837-5p along with the corresponding stem-looped precursors. To our knowledge, this is the first report on miR414 and miR837-5p in C. sativus. Co-expression network analysis indicated that miR414 and miR837-5p may play roles in C. sativus metabolic pathways and led to identification of candidate genes including six transcription factors and one protein kinase probably involved in carotenoid/apocarotenoid biosynthetic pathway. Presence of transcription factors, miRNAs and protein kinase in the network indicated multiple layers of regulation in saffron stigma. The candidate genes from this study may help unraveling regulatory networks underlying the carotenoid/apocarotenoid biosynthesis in saffron and designing metabolic engineering for enhanced secondary metabolites.

  8. In silico identification of miRNAs and their target genes and analysis of gene co-expression network in saffron (Crocus sativus L.) stigma

    Science.gov (United States)

    Zinati, Zahra; Shamloo-Dashtpagerdi, Roohollah; Behpouri, Ali

    2016-01-01

    As an aromatic and colorful plant of substantive taste, saffron (Crocus sativus L.) owes such properties of matter to growing class of the secondary metabolites derived from the carotenoids, apocarotenoids. Regarding the critical role of microRNAs in secondary metabolic synthesis and the limited number of identified miRNAs in C. sativus, on the other hand, one may see the point how the characterization of miRNAs along with the corresponding target genes in C. sativus might expand our perspectives on the roles of miRNAs in carotenoid/apocarotenoid biosynthetic pathway. A computational analysis was used to identify miRNAs and their targets using EST (Expressed Sequence Tag) library from mature saffron stigmas. Then, a gene co- expression network was constructed to identify genes which are potentially involved in carotenoid/apocarotenoid biosynthetic pathways. EST analysis led to the identification of two putative miRNAs (miR414 and miR837-5p) along with the corresponding stem- looped precursors. To our knowledge, this is the first report on miR414 and miR837-5p in C. sativus. Co-expression network analysis indicated that miR414 and miR837-5p may play roles in C. sativus metabolic pathways and led to identification of candidate genes including six transcription factors and one protein kinase probably involved in carotenoid/apocarotenoid biosynthetic pathway. Presence of transcription factors, miRNAs and protein kinase in the network indicated multiple layers of regulation in saffron stigma. The candidate genes from this study may help unraveling regulatory networks underlying the carotenoid/apocarotenoid biosynthesis in saffron and designing metabolic engineering for enhanced secondary metabolites. PMID:28261627

  9. Resequencing PNMT in European hypertensive and normotensive individuals: no common susceptibilily variants for hypertension and purifying selection on intron 1

    Directory of Open Access Journals (Sweden)

    Viigimaa Margus

    2007-07-01

    Full Text Available Abstract Background Human linkage and animal QTL studies have indicated the contribution of genes on Chr17 into blood pressure regulation. One candidate gene is PNMT, coding for phenylethanolamine-N-methyltransferase, catalyzing the synthesis of epinephrine from norepinephrine. Methods Fine-scale variation of PNMT was screened by resequencing hypertensive (n = 50 and normotensive (n = 50 individuals from two European populations (Estonians and Czechs. The resulting polymorphism data were analyzed by statistical genetics methods using Genepop 3.4, PHASE 2.1 and DnaSP 4.0 software programs. In silico prediction of transcription factor binding sites for intron 1 was performed with MatInspector 2.2 software. Results PNMT was characterized by minimum variation and excess of rare SNPs in both normo- and hypertensive individuals. None of the SNPs showed significant differences in allelic frequencies among population samples, as well as between screened hypertensives and normotensives. In the joint case-control analysis of the Estonian and the Czech samples, hypertension patients had a significant excess of heterozygotes for two promoter region polymorphisms (SNP-184; SNP-390. The identified variation pattern of PNMT reflects the effect of purifying selection consistent with an important role of PNMT-synthesized epinephrine in the regulation of cardiovascular and metabolic functions, and as a CNS neurotransmitter. A striking feature is the lack of intronic variation. In silico analysis of PNMT intron 1 confirmed the presence of a human-specific putative Glucocorticoid Responsive Element (GRE, inserted by Alu-mediated transfer. Further analysis of intron 1 supported the possible existence of a full Glucocorticoid Responsive Unit (GRU predicted to consist of multiple gene regulatory elements known to cooperate with GRE in driving transcription. The role of these elements in regulating PNMT expression patterns and thus determining the dynamics of the

  10. Endogenous factor VIII synthesis from the intron 22-inverted F8 locus may modulate the immunogenicity of replacement therapy for hemophilia A.

    Science.gov (United States)

    Pandey, Gouri Shankar; Yanover, Chen; Miller-Jenkins, Lisa M; Garfield, Susan; Cole, Shelley A; Curran, Joanne E; Moses, Eric K; Rydz, Natalia; Simhadri, Vijaya; Kimchi-Sarfaty, Chava; Lillicrap, David; Viel, Kevin R; Przytycka, Teresa M; Pierce, Glenn F; Howard, Tom E; Sauna, Zuben E

    2013-10-01

    Neutralizing antibodies (inhibitors) to replacement factor VIII (FVIII, either plasma derived or recombinant) impair the effective management of hemophilia A. Individuals with hemophilia A due to major deletions of the FVIII gene (F8) lack antigenically cross-reactive material in their plasma ("CRM-negative"), and the prevalence of inhibitors in these individuals may be as high as 90%. Conversely, individuals with hemophilia A caused by F8 missense mutations are CRM-positive, and their overall prevalence of inhibitors is hemophilia A) have been grouped with the former on the basis of their genetic defect and CRM-negative status. However, only ∼20% of these individuals develop inhibitors. Here we demonstrate that the levels of F8 mRNA and intracellular FVIII protein in B lymphoblastoid cells and liver biopsies from individuals with the intron 22 inversion are comparable to those in healthy controls. These results support the hypothesis that most individuals with the intron 22 inversion are tolerized to FVIII and thus do not develop inhibitors. Furthermore, we developed a new pharmacogenetic algorithm that permits the stratification of inhibitor risk for individuals and subpopulations by predicting the immunogenicity of replacement FVIII using, as input, the number of putative T cell epitopes in the infused protein and the competence of major histocompatibility complex class II molecules to present such epitopes. This algorithm showed statistically significant accuracy in predicting the presence of inhibitors in 25 unrelated individuals with the intron 22 inversion.

  11. The fission yeast RNA binding protein Mmi1 regulates meiotic genes by controlling intron specific splicing and polyadenylation coupled RNA turnover.

    Directory of Open Access Journals (Sweden)

    Huei-Mei Chen

    Full Text Available The polyA tails of mRNAs are monitored by the exosome as a quality control mechanism. We find that fission yeast, Schizosaccharomyces pombe, adopts this RNA quality control mechanism to regulate a group of 30 or more meiotic genes at the level of both splicing and RNA turnover. In vegetative cells the RNA binding protein Mmi1 binds to the primary transcripts of these genes. We find the novel motif U(U/C/GAAAC highly over-represented in targets of Mmi1. Mmi1 can specifically regulate the splicing of particular introns in a transcript: it inhibits the splicing of introns that are in the vicinity of putative Mmi1 binding sites, while allowing the splicing of other introns that are far from such sites. In addition, binding of Mmi1, particularly near the 3' end, alters 3' processing to promote extremely long polyA tails of up to a kilobase. The hyperadenylated transcripts are then targeted for degradation by the nuclear exonuclease Rrp6. The nuclear polyA binding protein Pab2 assists this hyperadenylation-mediated RNA decay. Rrp6 also targets other hyperadenylated transcripts, which become hyperadenylated in an unknown, but Mmi1-independent way. Thus, hyperadenylation may be a general signal for RNA degradation. In addition, binding of Mmi1 can affect the efficiency of 3' cleavage. Inactivation of Mmi1 in meiosis allows meiotic expression, through splicing and RNA stabilization, of at least 29 target genes, which are apparently constitutively transcribed.

  12. Cell-free Circulating miRNA Biomarkers in Cancer

    Directory of Open Access Journals (Sweden)

    Meng-Hsuan Mo, Liang Chen, Yebo Fu, Wendy Wang, Sidney W. Fu

    2012-01-01

    Full Text Available Considerable attention and an enormous amount of resources have been dedicated to cancer biomarker discovery and validation. However, there are still a limited number of useful biomarkers available for clinical use. An ideal biomarker should be easily assayed with minimally invasive medical procedures but possess high sensitivity and specificity. Commonly used circulating biomarkers are proteins in serum, most of which require labor-intensive analysis hindered by low sensitivity in early tumor detection. Since the deregulation of microRNA (miRNA is associated with cancer development and progression, profiling of circulating miRNAs has been used in a number of studies to identify novel minimally invasive miRNA biomarkers. In this review, we discuss the origin of the circulating cell-free miRNAs and their carriers in blood. We summarize the clinical use and function of potentially promising miRNA biomarkers in a variety of different cancers, along with their downstream target genes in tumor initiation and development. Additionally, we analyze some technical challenges in applying miRNA biomarkers to clinical practice.

  13. Lipid Nanoparticles to Deliver miRNA in Cancer.

    Science.gov (United States)

    Campani, Virginia; De Rosa, Giuseppe; Misso, Gabriella; Zarone, Mayra R; Grimaldi, Anna

    MicroRNAs (miRNAs) are a class of post-transcriptional gene expression modulators. In the past two decades, over 1500 human miRNAs were discovered. These small non-coding RNAs regulate various biological processes, including cell growth, proliferation, differentiation, and cell death. Thus, miRNAs have been proposed as new therapeutical agents in different multifactorial diseases such as cancer. Since miRNAs therapies represent a great promise, many research studies have been focused on the development of delivery strategies to overcome miRNAs biopharmaceutical issues. Lipid delivery systems are undoubtedly the non-viral carriers most largely investigated due to their biocompatibility, biodegradability, easy production, low toxicity and immunogenicity, possibility to easily modify the carriers for targeting strategies. In this mini-review we provide a rapid and updated overview on the lipid delivery system currently used to deliver miRNAs, pointing out the progresses achieved in the optimization of these nanovectors, which led up to the first clinical trial.

  14. Genome-wide mapping of conserved microRNAs and their host transcripts in Tribolium castaneum

    Institute of Scientific and Technical Information of China (English)

    Qibin Luo; Qing Zhou; Xiaomin Yu; Hongbin Lin; Songnian Hu; Jun Yu

    2008-01-01

    MicroRNAs (miRNAs) are endogenous 22-nt RNAs, which play important regulatory roles by post-transcriptional gene silencing. A computational strategy has been developed for the identification of conserved miRNAs based on features of known metazoan miRNAs in red flour beetle (Tribolium castaneum), which is regarded as one of the major laboratory models of arthropods. Among 118 putative miRNAs, 47% and 53% of the predicted miRNAs from the red flour beetle are harbored by known protein-coding genes (intronic) and genes located outside (intergenic miRNA), respectively. There are 31 intronic miRNAs in the same transcriptional orientation as the host genes, which may share RNA polymerase Ⅱ and spliceosomal machinery with their host genes for their biogenesis. A hypothetical feedback model has been proposed based on the analysis of the relationship between intronic miRNAs and their host genes in the development of red flour beetle.

  15. Structural and functional characterization of ribosomal protein gene introns in sponges.

    Science.gov (United States)

    Perina, Drago; Korolija, Marina; Mikoč, Andreja; Roller, Maša; Pleše, Bruna; Imešek, Mirna; Morrow, Christine; Batel, Renato; Ćetković, Helena

    2012-01-01

    Ribosomal protein genes (RPGs) are a powerful tool for studying intron evolution. They exist in all three domains of life and are much conserved. Accumulating genomic data suggest that RPG introns in many organisms abound with non-protein-coding-RNAs (ncRNAs). These ancient ncRNAs are small nucleolar RNAs (snoRNAs) essential for ribosome assembly. They are also mobile genetic elements and therefore probably important in diversification and enrichment of transcriptomes through various mechanisms such as intron/exon gain/loss. snoRNAs in basal metazoans are poorly characterized. We examined 449 RPG introns, in total, from four demosponges: Amphimedon queenslandica, Suberites domuncula, Suberites ficus and Suberites pagurorum and showed that RPG introns from A. queenslandica share position conservancy and some structural similarity with "higher" metazoans. Moreover, our study indicates that mobile element insertions play an important role in the evolution of their size. In four sponges 51 snoRNAs were identified. The analysis showed discrepancies between the snoRNA pools of orthologous RPG introns between S. domuncula and A. queenslandica. Furthermore, these two sponges show as much conservancy of RPG intron positions between each other as between themselves and human. Sponges from the Suberites genus show consistency in RPG intron position conservation. However, significant differences in some of the orthologous RPG introns of closely related sponges were observed. This indicates that RPG introns are dynamic even on these shorter evolutionary time scales.

  16. Structural and functional characterization of ribosomal protein gene introns in sponges.

    Directory of Open Access Journals (Sweden)

    Drago Perina

    Full Text Available Ribosomal protein genes (RPGs are a powerful tool for studying intron evolution. They exist in all three domains of life and are much conserved. Accumulating genomic data suggest that RPG introns in many organisms abound with non-protein-coding-RNAs (ncRNAs. These ancient ncRNAs are small nucleolar RNAs (snoRNAs essential for ribosome assembly. They are also mobile genetic elements and therefore probably important in diversification and enrichment of transcriptomes through various mechanisms such as intron/exon gain/loss. snoRNAs in basal metazoans are poorly characterized. We examined 449 RPG introns, in total, from four demosponges: Amphimedon queenslandica, Suberites domuncula, Suberites ficus and Suberites pagurorum and showed that RPG introns from A. queenslandica share position conservancy and some structural similarity with "higher" metazoans. Moreover, our study indicates that mobile element insertions play an important role in the evolution of their size. In four sponges 51 snoRNAs were identified. The analysis showed discrepancies between the snoRNA pools of orthologous RPG introns between S. domuncula and A. queenslandica. Furthermore, these two sponges show as much conservancy of RPG intron positions between each other as between themselves and human. Sponges from the Suberites genus show consistency in RPG intron position conservation. However, significant differences in some of the orthologous RPG introns of closely related sponges were observed. This indicates that RPG introns are dynamic even on these shorter evolutionary time scales.

  17. "Cryptic" group-I introns in the nuclear SSU-rRNA gene of Verticillium dahliae.

    Science.gov (United States)

    Papaioannou, Ioannis A; Dimopoulou, Chrysoula D; Typas, Milton A

    2014-08-01

    Group-I introns are widespread--though irregularly distributed--in eukaryotic organisms, and they have been extensively used for discrimination and phylogenetic analyses. Within the Verticillium genus, which comprises important phytopathogenic fungi, a group-I intron was previously identified in the SSU-rRNA (18S) gene of only V. longisporum. In this work, we aimed at elucidating the SSU-located intron distribution in V. dahliae and other Verticillium species, and the assessment of heterogeneity regarding intron content among rDNA repeats of fungal strains. Using conserved PCR primers for the amplification of the SSU gene, a structurally similar novel intron (sub-group IC1) was detected in only a few V. dahliae isolates. However, when intron-specific primers were used for the screening of a diverse collection of Verticillium isolates that originally failed to produce intron-containing SSU amplicons, most were found to contain one or both intron types, at variable rDNA repeat numbers. This marked heterogeneity was confirmed with qRT-PCR by testing rDNA copy numbers (varying from 39 to 70 copies per haploid genome) and intron copy ratios in selected isolates. Our results demonstrate that (a) IC1 group-I introns are not specific to V. longisporum within the Verticillium genus, (b) V. dahliae isolates of vegetative compatibility groups (VCGs) 4A and 6, which bear the novel intron at most of their rDNA repeats, are closely related, and (c) there is considerable intra-genomic heterogeneity for the presence or absence of introns among the ribosomal repeats. These findings underline that distributions of introns in the highly heterogeneous repetitive rDNA complex should always be verified with sensitive methods to avoid misleading conclusions for the phylogeny of fungi and other organisms.

  18. A Large-Scale Analysis of Genetic Variants within Putative miRNA Binding Sites in Prostate Cancer

    DEFF Research Database (Denmark)

    Stegeman, Shane; Amankwah, Ernest; Klein, Kerenaftali

    2015-01-01

    UNLABELLED: Prostate cancer is the second most common malignancy among men worldwide. Genome-wide association studies have identified 100 risk variants for prostate cancer, which can explain approximately 33% of the familial risk of the disease. We hypothesized that a comprehensive analysis of ge...

  19. miRConnect:Identifying effector genes of miRNAs and miRNA families in cancer cells

    DEFF Research Database (Denmark)

    Hua, Youjia; Duan, Shiwei; Murmann, Andrea E

    2011-01-01

    micro(mi)RNAs are small non-coding RNAs that negatively regulate expression of most mRNAs. They are powerful regulators of various differentiation stages, and the expression of genes that either negatively or positively correlate with expressed miRNAs is expected to hold information on the biolog......micro(mi)RNAs are small non-coding RNAs that negatively regulate expression of most mRNAs. They are powerful regulators of various differentiation stages, and the expression of genes that either negatively or positively correlate with expressed miRNAs is expected to hold information...... have generated custom data sets containing expression information of 54 miRNA families sharing the same seed match. We have developed a novel strategy for correlating miRNAs with individual genes based on a summed Pearson Correlation Coefficient (sPCC) that mimics an in silico titration experiment...

  20. Novel nuclear intron-spanning primers for Arecaceae evolutionary biology.

    Science.gov (United States)

    Bacon, Christine D; Feltus, F Alex; Paterson, Andrew H; Bailey, C Donovan

    2008-01-01

    In this study, 96 nuclear 'conserved intron-scanning primers' were screened across subfamilies the Arecaceae (palms) for potential use in research focused on palm evolutionary biology. Primers were evaluated based on their ability to amplify single polymerase chain reaction products in Arecaceae, the clarity of sequencing reads, and the interspecific variability observed. Ultimately, the results suggest that: (i) seven of the loci are likely to be suitable when comparing non-Arecaceae outgroups and Arecaceae ingroups; (ii) seven loci may be of use when comparing subfamilies of Arecaceae; and (iii) four of the loci may be of use when comparing closely related genera.

  1. Entangling Relation of Micro RNA-let7, miRNA-200 and miRNA-125 with Various Cancers.

    Science.gov (United States)

    Masood, Nosheen; Yasmin, Azra

    2017-01-09

    Involvement of micro RNAs (miRNA) is currently the focus for cancer studies as they effect the post transcriptional expression of different genes. Let-7 family is among the firstly discovered miRNAs that play important role in cell proliferation and dysregulation leading to cell based diseases including cancer. Another family, miRNA-200 prevents transformation of cell to malignant form and tumor formation by interacting with epidermal mesenchymal transition (EMT). Similarly miRNA-125 controls apoptosis and proliferation by affecting multiple genes involved in transcription, immunological defense, resistance against viral and bacterial infections that ultimately leads to cell proliferation, metastasis and finally cancer. All of these micro RNAs are known to be either upregulated or downregulated in various cancers. Current review is focused to elaborate the role of these three families of micro RNAs on different genes that ultimately cause cancer. In conclusion we can say that the miRNAs discussed here are mostly downregulated in various cancers with some exceptions when upregulation of miRNA-125 may be attributed to cancer formation.

  2. Human Lin28 Forms a High-Affinity 1:1 Complex with the 106~363 Cluster miRNA miR-363.

    Science.gov (United States)

    Peters, Daniel T; Fung, Herman K H; Levdikov, Vladimir M; Irmscher, Tobias; Warrander, Fiona C; Greive, Sandra J; Kovalevskiy, Oleg; Isaacs, Harry V; Coles, Mark; Antson, Alfred A

    2016-09-13

    Lin28A is a post-transcriptional regulator of gene expression that interacts with and negatively regulates the biogenesis of let-7 family miRNAs. Recent data suggested that Lin28A also binds the putative tumor suppressor miR-363, a member of the 106~363 cluster of miRNAs. Affinity for this miRNA and the stoichiometry of the protein-RNA complex are unknown. Characterization of human Lin28's interaction with RNA has been complicated by difficulties in producing stable RNA-free protein. We have engineered a maltose binding protein fusion with Lin28, which binds let-7 miRNA with a Kd of 54.1 ± 4.2 nM, in agreement with previous data on a murine homologue. We show that human Lin28A binds miR-363 with a 1:1 stoichiometry and with a similar, if not higher, affinity (Kd = 16.6 ± 1.9 nM). Further analysis suggests that the interaction of the N-terminal cold shock domain of Lin28A with RNA is salt-dependent, supporting a model in which the cold shock domain allows the protein to sample RNA substrates through transient electrostatic interactions.

  3. Human Lin28 Forms a High-Affinity 1:1 Complex with the 106~363 Cluster miRNA miR-363

    Science.gov (United States)

    2016-01-01

    Lin28A is a post-transcriptional regulator of gene expression that interacts with and negatively regulates the biogenesis of let-7 family miRNAs. Recent data suggested that Lin28A also binds the putative tumor suppressor miR-363, a member of the 106~363 cluster of miRNAs. Affinity for this miRNA and the stoichiometry of the protein–RNA complex are unknown. Characterization of human Lin28’s interaction with RNA has been complicated by difficulties in producing stable RNA-free protein. We have engineered a maltose binding protein fusion with Lin28, which binds let-7 miRNA with a Kd of 54.1 ± 4.2 nM, in agreement with previous data on a murine homologue. We show that human Lin28A binds miR-363 with a 1:1 stoichiometry and with a similar, if not higher, affinity (Kd = 16.6 ± 1.9 nM). Further analysis suggests that the interaction of the N-terminal cold shock domain of Lin28A with RNA is salt-dependent, supporting a model in which the cold shock domain allows the protein to sample RNA substrates through transient electrostatic interactions. PMID:27559824

  4. An intron within the 16S ribosomal RNA gene of the archaeon Pyrobaculum aerophilum

    Science.gov (United States)

    Burggraf, S.; Larsen, N.; Woese, C. R.; Stetter, K. O.

    1993-01-01

    The 16S rRNA genes of Pyrobaculum aerophilum and Pyrobaculum islandicum were amplified by the polymerase chain reaction, and the resulting products were sequenced directly. The two organisms are closely related by this measure (over 98% similar). However, they differ in that the (lone) 16S rRNA gene of Pyrobaculum aerophilum contains a 713-bp intron not seen in the corresponding gene of Pyrobaculum islandicum. To our knowledge, this is the only intron so far reported in the small subunit rRNA gene of a prokaryote. Upon excision the intron is circularized. A secondary structure model of the intron-containing rRNA suggests a splicing mechanism of the same type as that invoked for the tRNA introns of the Archaea and Eucarya and 23S rRNAs of the Archaea. The intron contains an open reading frame whose protein translation shows no certain homology with any known protein sequence.

  5. An intron within the 16S ribosomal RNA gene of the archaeon Pyrobaculum aerophilum

    Science.gov (United States)

    Burggraf, S.; Larsen, N.; Woese, C. R.; Stetter, K. O.

    1993-01-01

    The 16S rRNA genes of Pyrobaculum aerophilum and Pyrobaculum islandicum were amplified by the polymerase chain reaction, and the resulting products were sequenced directly. The two organisms are closely related by this measure (over 98% similar). However, they differ in that the (lone) 16S rRNA gene of Pyrobaculum aerophilum contains a 713-bp intron not seen in the corresponding gene of Pyrobaculum islandicum. To our knowledge, this is the only intron so far reported in the small subunit rRNA gene of a prokaryote. Upon excision the intron is circularized. A secondary structure model of the intron-containing rRNA suggests a splicing mechanism of the same type as that invoked for the tRNA introns of the Archaea and Eucarya and 23S rRNAs of the Archaea. The intron contains an open reading frame whose protein translation shows no certain homology with any known protein sequence.

  6. miRNA profiling of B-cell subsets : specific miRNA profile for germinal center B cells with variation between centroblasts and centrocytes

    NARCIS (Netherlands)

    Tan, Lu Ping; Wang, Miao; Robertus, Jan-Lukas; Schakel, Rikst Nynke; Gibcus, Johan H.; Diepstra, Arjan; Harms, Geert; Peh, Suat-Cheng; Reijmers, Rogier M.; Pals, Steven T.; Kroesen, Bart-Jan; Kluin, Philip M.; Poppema, Sibrand; van den Berg, Anke

    2009-01-01

    MicroRNAs ( miRNAs) are an important class of small RNAs that regulate gene expression at the post-transcriptional level. It has become evident that miRNAs are involved in hematopoiesis, and that deregulation of miRNAs may give rise to hematopoietic malignancies. The aim of our study was to establis

  7. The miRNA-200 family and miRNA-9 exhibit differential expression in primary versus corresponding metastatic tissue in breast cancer

    DEFF Research Database (Denmark)

    Gravgaard, Karina H; Lyng, Maria Bibi; Laenkholm, Anne-Vibeke;

    2012-01-01

    progression. Global miRNA expression profiling was performed on 47 tumor samples from 14 patients with paired samples from primary breast tumors and corresponding lymph node and distant metastases using LNA-enhanced miRNA microarrays. The identified miRNA expression alterations were validated by real-time PCR...

  8. Nucleolar introns from Physarum flavicomum contain insertion elements that may explain how mobile group I introns gained their open reading frames.

    Science.gov (United States)

    Vader, A; Naess, J; Haugli, K; Haugli, F; Johansen, S

    1994-01-01

    Comparison of two group I intron sequences in the nucleolar genome of the myxomycete Physarum flavicomum to their homologs in the closely related Physarum polycephalum revealed insertion-like elements. One of the insertion-like elements consists of two repetitive sequence motifs of 11 and 101 bp in five and three copies, respectively. The smaller motif, which flanks the larger, resembles a target duplication and indicates a relationship to transposons or retroelements. The insertion-like elements are found in the peripheral loops of the RNA structure; the positions occupied by the ORFs of mobile nucleolar group I introns. The P. flavicomum introns are 1184 and 637 bp in size, located in the large subunit ribosomal RNA gene, and can be folded into group I intron structures at the RNA level. However, the intron 2s from both P. flavicomum and P. polycephalum contain an unusual core region that lacks the P8 segment. None of the introns are able to self-splice in vitro. Southern analysis of different isolates indicates that the introns are not optional in myxomycetes. Images PMID:7984404

  9. Characteristic differences between the promoters of intron-containing and intronless ribosomal protein genes in yeast

    Directory of Open Access Journals (Sweden)

    Vingron Martin

    2008-10-01

    Full Text Available Abstract Background More than two thirds of the highly expressed ribosomal protein (RP genes in Saccharomyces cerevisiae contain introns, which is in sharp contrast to the genome-wide five percent intron-containing genes. It is well established that introns carry regulatory sequences and that the transcription of RP genes is extensively and coordinately regulated. Here we test the hypotheses that introns are innately associated with heavily transcribed genes and that introns of RP genes contribute regulatory TF binding sequences. Moreover, we investigate whether promoter features are significantly different between intron-containing and intronless RP genes. Results We find that directly measured transcription rates tend to be lower for intron-containing compared to intronless RP genes. We do not observe any specifically enriched sequence motifs in the introns of RP genes other than those of the branch point and the two splice sites. Comparing the promoters of intron-containing and intronless RP genes, we detect differences in number and position of Rap1-binding and IFHL motifs. Moreover, the analysis of the length distribution and the folding free energies suggest that, at least in a sub-population of RP genes, the 5' untranslated sequences are optimized for regulatory function. Conclusion Our results argue against the direct involvement of introns in the regulation of transcription of highly expressed genes. Moreover, systematic differences in motif distributions suggest that RP transcription factors may act differently on intron-containing and intronless gene promoters. Thus, our findings contribute to the decoding of the RP promoter architecture and may fuel the discussion on the evolution of introns.

  10. Propionic and Methylmalonic Acidemia: Antisense Therapeutics for Intronic Variations Causing Aberrantly Spliced Messenger RNA

    OpenAIRE

    Rincón, A. ; Aguado, C. ; Desviat, L. R. ; Sánchez-Alcudia, R. ; Ugarte, M. ; Pérez, B. 

    2007-01-01

    We describe the use of antisense morpholino oligonucleotides (AMOs) to restore normal splicing caused by intronic molecular defects identified in methylmalonic acidemia (MMA) and propionic acidemia (PA). The three new point mutations described in deep intronic regions increase the splicing scores of pseudoexons or generate consensus binding motifs for splicing factors, such as SRp40, which favor the intronic inclusions in MUT (r.1957ins76), PCCA (r.1284ins84), or PCCB (r.654ins72) messenger R...

  11. Using intron position conservation for homology-based gene prediction.

    Science.gov (United States)

    Keilwagen, Jens; Wenk, Michael; Erickson, Jessica L; Schattat, Martin H; Grau, Jan; Hartung, Frank

    2016-05-19

    Annotation of protein-coding genes is very important in bioinformatics and biology and has a decisive influence on many downstream analyses. Homology-based gene prediction programs allow for transferring knowledge about protein-coding genes from an annotated organism to an organism of interest.Here, we present a homology-based gene prediction program called GeMoMa. GeMoMa utilizes the conservation of intron positions within genes to predict related genes in other organisms. We assess the performance of GeMoMa and compare it with state-of-the-art competitors on plant and animal genomes using an extended best reciprocal hit approach. We find that GeMoMa often makes more precise predictions than its competitors yielding a substantially increased number of correct transcripts. Subsequently, we exemplarily validate GeMoMa predictions using Sanger sequencing. Finally, we use RNA-seq data to compare the predictions of homology-based gene prediction programs, and find again that GeMoMa performs well.Hence, we conclude that exploiting intron position conservation improves homology-based gene prediction, and we make GeMoMa freely available as command-line tool and Galaxy integration. © The Author(s) 2016. Published by Oxford University Press on behalf of Nucleic Acids Research.

  12. The Chloroplast Genome of Euglena mutabilis-Cluster Arrangement, Intron Analysis, and Intrageneric Trends.

    Science.gov (United States)

    Dabbagh, Nadja; Preisfeld, Angelika

    2017-01-01

    A comparative analysis of the chloroplast genome of Euglena mutabilis underlined a high diversity in the evolution of plastids in euglenids. Gene clusters in more derived Euglenales increased in complexity with only a few, but remarkable changes in the genus Euglena. Euglena mutabilis differed from other Euglena species in a mirror-inverted arrangement of 12 from 15 identified clusters, making it very likely that the emergence at the base of the genus Euglena, which has been considered a long branch artifact, is truly a probable position. This was corroborated by many similarities in gene arrangement and orientation with Strombomonas and Monomorphina, rendering the genome organization of E. mutabilis in certain clusters as plesiomorphic feature. By RNA analysis exact exon-intron boundaries and the type of the 77 introns identified were mostly determined unambiguously. A detailed intron study of psbC pointed at two important issues: First, the number of introns varied even between species, and no trend from few to many introns could be observed. Second, mat1 was localized in Eutreptiales exclusively in intron 1, and mat2 was not identified. With the emergence of Euglenaceae in most species, a new intron containing mat2 inserted in front of the previous intron 1 and thereby became intron 2 with mat1.

  13. Selection for reduced translation costs at the intronic 5′ end in fungi

    Science.gov (United States)

    Zafrir, Zohar; Zur, Hadas; Tuller, Tamir

    2016-01-01

    It is generally believed that introns are not translated; therefore, the potential intronic features that may be related to the translation step (occurring after splicing) have yet to be thoroughly studied. Here, focusing on four fungi, we performed for the first time a comprehensive study aimed at characterizing how translation efficiency is encoded in introns and affects their evolution. By analysing their intronome we provide evidence of selection for STOP codons close to the intronic 5′ end, and show that the beginning of introns are selected for significantly high translation, presumably to reduce translation and metabolic costs in cases of non-spliced introns. Ribosomal profiling data analysis in Saccharomyces cerevisiae supports the conjecture that in this organism intron retention frequently occurs, introns are partially translated, and their translation efficiency affects organismal fitness. We show that the reported results are more significant in highly translated and highly spliced genes, but are not associated only with genes with a specific function. We also discuss the potential relation of the reported signals to efficient nonsense-mediated decay due to splicing errors. These new discoveries are supported by population-genetics considerations. In addition, they are contributory steps towards a broader understanding of intron evolution and the effect of silent mutations on gene expression and organismal fitness. PMID:27260512

  14. miRNAs of two medically important mosquito species: Aedes aegypti and Anopheles stephensi

    Science.gov (United States)

    Hu, Wanqi; Crisione, Frank; Liang, Shaohui; Tu, Zhijian

    2014-01-01

    MicroRNAs (miRNAs) are endogenous, single-stranded small RNAs that have important regulatory functions at the post-transcriptional level. Here, we characterize miRNAs in two divergent mosquito species, Aedes aegypti and Anopheles stephensi, through deep sequencing of small RNAs spanning all developmental stages. We discovered eight novel miRNAs in Ae. aegypti and 20 novel miRNAs in An. stephensi, which enabled the first systematic analysis of miRNA evolution in mosquitos. We traced the phylogenetic history of all miRNAs in both species and report a rate of 0.055–0.13 miRNA net gain per million years. Most novel miRNAs originate de novo. Duplications that produced miRNA clusters and families are more common in Ae. aegypti than in An. stephensi. We also identified arm-switch as a source of new miRNAs. Expression profile analysis identified mosquito-specific miRNAs that showed strong stage-specific expression in one or both lineages. For example, the aae-miR-2941/2946 family represents the most abundant maternally-deposited and zygotically transcribed miRNAs in Ae. aegypti. miR-2943 is a highly expressed zygotic miRNA in both Ae. aegypti and An. stephensi. Such information provides the basis to study the function of these miRNAs in biology common to all mosquitos or unique to one particular lineage. PMID:25420875

  15. Microprocessor activity controls differential miRNA biogenesis In Vivo.

    Science.gov (United States)

    Conrad, Thomas; Marsico, Annalisa; Gehre, Maja; Orom, Ulf Andersson

    2014-10-23

    In miRNA biogenesis, pri-miRNA transcripts are converted into pre-miRNA hairpins. The in vivo properties of this process remain enigmatic. Here, we determine in vivo transcriptome-wide pri-miRNA processing using next-generation sequencing of chromatin-associated pri-miRNAs. We identify a distinctive Microprocessor signature in the transcriptome profile from which efficiency of the endogenous processing event can be accurately quantified. This analysis reveals differential susceptibility to Microprocessor cleavage as a key regulatory step in miRNA biogenesis. Processing is highly variable among pri-miRNAs and a better predictor of miRNA abundance than primary transcription itself. Processing is also largely stable across three cell lines, suggesting a major contribution of sequence determinants. On the basis of differential processing efficiencies, we define functionality for short sequence features adjacent to the pre-miRNA hairpin. In conclusion, we identify Microprocessor as the main hub for diversified miRNA output and suggest a role for uncoupling miRNA biogenesis from host gene expression.

  16. Use of miRNAs as Biomarkers in Sepsis

    Science.gov (United States)

    Dumache, Raluca; Rogobete, Alexandru Florin; Bedreag, Ovidiu Horea; Sarandan, Mirela; Cradigati, Alina Carmen; Papurica, Marius; Dumbuleu, Corina Maria; Nartita, Radu; Sandesc, Dorel

    2015-01-01

    Sepsis is one of the most common causes of death in critical patients. Severe generalized inflammation, infections, and severe physiological imbalances significantly decrease the survival rate with more than 50%. Moreover, monitoring, evaluation, and therapy management often become extremely difficult for the clinician in this type of patients. Current methods of diagnosing sepsis vary based especially on the determination of biochemical-humoral markers, such as cytokines, components of the complement, and proinflammatory and anti-inflammatory compounds. Recent studies highlight the use of new biomarkers for sepsis, namely, miRNAs. miRNAs belong to a class of small, noncoding RNAs with an approximate content of 19–23 nucleotides. Following biochemical and physiological imbalances, the expression of miRNAs in blood or other body fluids changes significantly. Moreover, its stability, specificity, and selectivity make miRNAs ideal candidates for sepsis biomarkers. In conclusion, we can affirm that stable species of circulating miRNAs represent potential biomarkers for monitoring the evolution of sepsis. PMID:26221578

  17. miRNA therapeutics in cardiovascular diseases: promises and problems

    Directory of Open Access Journals (Sweden)

    Nazila eNouraee

    2015-06-01

    Full Text Available miRNAs are a novel class of non-coding RNAs which found their way into the clinic due to their fundamental roles in cellular processes such as differentiation, proliferation and apoptosis. Recently, miRNAs have been known as micromodulators in cellular communications being involved in cell signaling and microenvironment remodeling. In this review, we will focus on the role of miRNAs in cardiovascular diseases (CVDs and their reliability as diagnostic and therapeutic biomarkers in these conditions. Cardiovascular diseases comprise a variety of blood vessels and heart disorders with a high rate of morbidity and mortality worldwide. This necessitates introduction of novel molecular biomarkers for early detection, prevention or treatment of these diseases. miRNAs, due to their stability, tissue-specific expression pattern and secretion to the corresponding body fluids, are attractive targets for cardiovascular-associated therapeutics. Explaining the challenges ahead of miRNA-based therapies, we will discuss the exosomes as delivery packages for miRNA drugs and promising novel strategies for the future of miRNA-based therapeutics. These approaches provide insights to the future of personalized medicine for the treatment of cardiovascular diseases.

  18. Use of miRNAs as Biomarkers in Sepsis

    Directory of Open Access Journals (Sweden)

    Raluca Dumache

    2015-01-01

    Full Text Available Sepsis is one of the most common causes of death in critical patients. Severe generalized inflammation, infections, and severe physiological imbalances significantly decrease the survival rate with more than 50%. Moreover, monitoring, evaluation, and therapy management often become extremely difficult for the clinician in this type of patients. Current methods of diagnosing sepsis vary based especially on the determination of biochemical-humoral markers, such as cytokines, components of the complement, and proinflammatory and anti-inflammatory compounds. Recent studies highlight the use of new biomarkers for sepsis, namely, miRNAs. miRNAs belong to a class of small, noncoding RNAs with an approximate content of 19–23 nucleotides. Following biochemical and physiological imbalances, the expression of miRNAs in blood or other body fluids changes significantly. Moreover, its stability, specificity, and selectivity make miRNAs ideal candidates for sepsis biomarkers. In conclusion, we can affirm that stable species of circulating miRNAs represent potential biomarkers for monitoring the evolution of sepsis.

  19. Identification of ovarian cancer metastatic miRNAs.

    Directory of Open Access Journals (Sweden)

    Souriya Vang

    Full Text Available Serous epithelial ovarian cancer (EOC patients often succumb to aggressive metastatic disease, yet little is known about the behavior and genetics of ovarian cancer metastasis. Here, we aim to understand how omental metastases differ from primary tumors and how these differences may influence chemotherapy. We analyzed the miRNA expression profiles of primary EOC tumors and their respective omental metastases from 9 patients using miRNA Taqman qPCR arrays. We find 17 miRNAs with differential expression in omental lesions compared to primary tumors. miR-21, miR-150, and miR-146a have low expression in most primary tumors with significantly increased expression in omental lesions, with concomitant decreased expression of predicted mRNA targets based on mRNA expression. We find that miR-150 and miR-146a mediate spheroid size. Both miR-146a and miR-150 increase the number of residual surviving cells by 2-4 fold when challenged with lethal cisplatin concentrations. These observations suggest that at least two of the miRNAs, miR-146a and miR-150, up-regulated in omental lesions, stimulate survival and increase drug tolerance. Our observations suggest that cancer cells in omental tumors express key miRNAs differently than primary tumors, and that at least some of these microRNAs may be critical regulators of the emergence of drug resistant disease.

  20. An ancient spliceosomal intron in the ribosomal protein L7a gene (Rpl7a of Giardia lamblia

    Directory of Open Access Journals (Sweden)

    Gray Michael W

    2005-08-01

    Full Text Available Abstract Background Only one spliceosomal-type intron has previously been identified in the unicellular eukaryotic parasite, Giardia lamblia (a diplomonad. This intron is only 35 nucleotides in length and is unusual in possessing a non-canonical 5' intron boundary sequence, CT, instead of GT. Results We have identified a second spliceosomal-type intron in G. lamblia, in the ribosomal protein L7a gene (Rpl7a, that possesses a canonical GT 5' intron boundary sequence. A comparison of the two known Giardia intron sequences revealed extensive nucleotide identity at both the 5' and 3' intron boundaries, similar to the conserved sequence motifs recently identified at the boundaries of spliceosomal-type introns in Trichomonas vaginalis (a parabasalid. Based on these observations, we searched the partial G. lamblia genome sequence for these conserved features and identified a third spliceosomal intron, in an unassigned open reading frame. Our comprehensive analysis of the Rpl7a intron in other eukaryotic taxa demonstrates that it is evolutionarily conserved and is an ancient eukaryotic intron. Conclusion An analysis of the phylogenetic distribution and properties of the Rpl7a intron suggests its utility as a phylogenetic marker to evaluate particular eukaryotic groupings. Additionally, analysis of the G. lamblia introns has provided further insight into some of the conserved and unique features possessed by the recently identified spliceosomal introns in related organisms such as T. vaginalis and Carpediemonas membranifera.

  1. Intron distribution in Plantae: 500 million years of stasis during land plant evolution.

    Science.gov (United States)

    Teich, René; Grauvogel, Carina; Petersen, Jörn

    2007-06-01

    Little is known about the evolution of the intron-exon organization in the more primitive groups of land plants, and the intron distribution among Plantae (glauco-, rhodo-, chloro- and streptophytes) has not been investigated so far. The present study is focused on some key species such as the liverwort Marchantia polymorpha, representing the most ancient lineage of land plants, and the streptophycean green alga Mesostigma viride, branching prior to charophycean green algae and terrestrial plants. The intron distribution of six genes for sugar phosphate metabolism was analyzed including four different glyceraldehyde-3-phosphate dehydrogenases (GAPDH), the sedoheptulose-1,7-bisphosphatase (SBP) and the glucose-6-phosphate isomerase (GPI). We established 15 new sequences including three cDNA and twelve genomic clones with up to 24 introns per gene, which were identified in the GPI of Marchantia. The intron patterns of all six genes are completely conserved among seed plants, lycopods, mosses and even liverworts. This intron stasis without any gain of novel introns seem to last for nearly 500 million years and may be characteristic for land plants in general. Some unique intron positions in Mesostigma document that a uniform distribution is no common trait of all streptophytes, but it may correlate with the transition to terrestrial habitats. However, the respective genes of chlorophycean green algae display largely different patterns, thus indicating at least one phase of massive intron rearrangement in the green lineage. We moreover included rhodophyte and glaucophyte reference sequences in our analyses and, even if the well documented monophyly of Plantae is not reflected by a uniform intron distribution, at least one GPI intron is strictly conserved for 1.5 billion years.

  2. The miRNAs of Herpes Simplex Virus (HSV)

    Institute of Scientific and Technical Information of China (English)

    Le Sun; Qihan Li

    2012-01-01

    Herpes simplex virus (HSV) is a group of common human pathogens with two serotypes HSV-1 and HSV-2.The prevalence of HSV is worldwide.It primarily infects humans through epithelial cells,when it introduces a latent infection into the nervous system.During viral latency,only a region known as the latency-associated transcript (LAT) is expressed.The discovery of HSV miRNAs helps to draw a larger picture of the infection and pathogenesis of the virus.This review summarizes miRNAs found in HSV-1 and HSV-2 so far.The functional studies of miRNAs in HSV to date indicate that they play a stage-specific role coordinated with viral proteins to maintain the virus life cycle.

  3. Embryonic miRNA profiles of normal and ectopic pregnancies.

    Directory of Open Access Journals (Sweden)

    Francisco Dominguez

    Full Text Available Our objective was to investigate the miRNA profile of embryonic tissues in ectopic pregnancies (EPs and controlled abortions (voluntary termination of pregnancy; VTOP. Twenty-three patients suffering from tubal EP and twenty-nine patients with a normal ongoing pregnancy scheduled for a VTOP were recruited. Embryonic tissue samples were analyzed by miRNA microarray and further validated by real time PCR. Microarray studies showed that four miRNAs were differentially downregulated (hsa-mir-196b, hsa-mir-30a, hsa-mir-873, and hsa-mir-337-3p and three upregulated (hsa-mir-1288, hsa-mir-451, and hsa-mir-223 in EP compared to control tissue samples. Hsa-miR-196, hsa-miR-223, and hsa-miR-451 were further validated by real time PCR in a wider population of EP and control samples. We also performed a computational analysis to identify the gene targets and pathways which might be modulated by these three differentially expressed miRNAs. The most significant pathways found were the mucin type O-glycan biosynthesis and the ECM-receptor-interaction pathways. We also checked that the dysregulation of these three miRNAs was able to alter the expression of the gene targets in the embryonic tissues included in these pathways such as GALNT13 and ITGA2 genes. In conclusion, analysis of miRNAs in ectopic and eutopic embryonic tissues shows different expression patterns that could modify pathways which are critical for correct implantation, providing new insights into the understanding of ectopic implantation in humans.

  4. Potential role of miRNAs in developmental haemostasis.

    Directory of Open Access Journals (Sweden)

    Raúl Teruel

    Full Text Available MicroRNAs (miRNAs are an abundant class of small non-coding RNAs that are negative regulators in a crescent number of physiological and pathological processes. However, their role in haemostasis, a complex physiological process involving multitude of effectors, is just beginning to be characterized. We evaluated the changes of expression of miRNAs in livers of neonates (day one after birth and adult mice by microarray and qRT-PCR trying to identify miRNAs that potentially may also be involved in the control of the dramatic change of hepatic haemostatic protein levels associated with this transition. Twenty one out of 41 miRNAs overexpressed in neonate mice have hepatic haemostatic mRNA as potential targets. Six of them identified by two in silico algorithms potentially bind the 3'UTR regions of F7, F9, F12, FXIIIB, PLG and SERPINC1 mRNA. Interestingly, miR-18a and miR-19b, overexpressed 5.4 and 8.2-fold respectively in neonates, have antithrombin, a key anti-coagulant with strong anti-angiogenic and anti-inflammatory roles, as a potential target. The levels of these two miRNAs inversely correlated with antithrombin mRNA levels during development (miR-19b: R = 0.81; p = 0.03; miR-18a: R = 0.91; p<0.001. These data suggest that miRNAs could be potential modulators of the haemostatic system involved in developmental haemostasis.

  5. Hypothalamic miRNAs: emerging roles in energy balance control.

    Science.gov (United States)

    Schneeberger, Marc; Gomez-Valadés, Alicia G; Ramirez, Sara; Gomis, Ramon; Claret, Marc

    2015-01-01

    The hypothalamus is a crucial central nervous system area controlling appetite, body weight and metabolism. It consists in multiple neuronal types that sense, integrate and generate appropriate responses to hormonal and nutritional signals partly by fine-tuning the expression of specific batteries of genes. However, the mechanisms regulating these neuronal gene programmes in physiology and pathophysiology are not completely understood. MicroRNAs (miRNAs) are key regulators of gene expression that recently emerged as pivotal modulators of systemic metabolism. In this article we will review current evidence indicating that miRNAs in hypothalamic neurons are also implicated in appetite and whole-body energy balance control.

  6. Hypothalamic miRNAs: emerging roles in energy balance control

    Directory of Open Access Journals (Sweden)

    Marc eSchneeberger

    2015-02-01

    Full Text Available The hypothalamus is a crucial central nervous system area controlling appetite, body weight and metabolism. It consists in multiple neuronal types that sense, integrate and generate appropriate responses to hormonal and nutritional signals partly by fine-tuning the expression of specific batteries of genes. However, the mechanisms regulating these neuronal gene programmes in physiology and pathophysiology are not completely understood. MicroRNAs (miRNAs are key regulators of gene expression that recently emerged as pivotal modulators of systemic metabolism. In this article we will review current evidence indicating that miRNAs in hypothalamic neurons are also implicated in appetite and whole-body energy balance control.

  7. A putative viral defence mechanism in archaeal cells

    Directory of Open Access Journals (Sweden)

    Reidun Lillestøl

    2006-01-01

    Full Text Available Clusters of regularly spaced direct repeats, separated by unconserved spacer sequences, are ubiquitous in archaeal chromosomes and occur in some plasmids. Some clusters constitute around 1% of chromosomal DNA. Similarly structured clusters, generally smaller, also occur in some bacterial chromosomes. Although early studies implicated these clusters in segregation/partition functions, recent evidence suggests that the spacer sequences derive from extrachromosomal elements, and, primarily, viruses. This has led to the proposal that the clusters provide a defence against viral propagation in cells, and that both the mode of inhibition of viral propagation and the mechanism of adding spacer-repeat units to clusters, are dependent on RNAs transcribed from the clusters. Moreover, the putative inhibitory apparatus (piRNA-based may be evolutionarily related to the interference RNA systems (siRNA and miRNA, which are common in eukarya. Here, we analyze all the current data on archaeal repeat clusters and provide some new insights into their diverse structures, transcriptional properties and mode of structural development. The results are consistent with larger cluster transcripts being processed at the centers of the repeat sequences and being further trimmed by exonucleases to yield a dominant, intracellular RNA species, which corresponds approximately to the size of a spacer. Furthermore, analysis of the extensive clusters of Sulfolobus solfataricus strains P1 and P2B provides support for the presence of a flanking sequence adjoining a cluster being a prerequisite for the incorporation of new spacer-repeat units, which occurs between the flanking sequence and the cluster. An archaeal database summarizing the data will be maintained at http://dac.molbio.ku.dk/dbs/SRSR/.

  8. Monitoring the Spatiotemporal Activities of miRNAs in Small Animal Models Using Molecular Imaging Modalities

    Directory of Open Access Journals (Sweden)

    Patrick Baril

    2015-03-01

    Full Text Available MicroRNAs (miRNAs are a class of small non-coding RNAs that regulate gene expression by binding mRNA targets via sequence complementary inducing translational repression and/or mRNA degradation. A current challenge in the field of miRNA biology is to understand the functionality of miRNAs under physiopathological conditions. Recent evidence indicates that miRNA expression is more complex than simple regulation at the transcriptional level. MiRNAs undergo complex post-transcriptional regulations such miRNA processing, editing, accumulation and re-cycling within P-bodies. They are dynamically regulated and have a well-orchestrated spatiotemporal localization pattern. Real-time and spatio-temporal analyses of miRNA expression are difficult to evaluate and often underestimated. Therefore, important information connecting miRNA expression and function can be lost. Conventional miRNA profiling methods such as Northern blot, real-time PCR, microarray, in situ hybridization and deep sequencing continue to contribute to our knowledge of miRNA biology. However, these methods can seldom shed light on the spatiotemporal organization and function of miRNAs in real-time. Non-invasive molecular imaging methods have the potential to address these issues and are thus attracting increasing attention. This paper reviews the state-of-the-art of methods used to detect miRNAs and discusses their contribution in the emerging field of miRNA biology and therapy.

  9. Seminal miRNA Relationship with Apoptotic Markers and Oxidative Stress in Infertile Men with Varicocele

    Science.gov (United States)

    Rashed, Laila A.; Nabil, Nashaat I.; Osman, Ihab; Mostafa, Rashad; Farag, Mohamed

    2016-01-01

    Aim. This study aimed to assess seminal miRNA relationship with seminal apoptotic markers and oxidative stress (OS) in infertile men associated with varicocele (Vx). Methods. In all, 220 subjects were divided into the following groups: fertile normozoospermic men, fertile normozoospermic men with Vx, infertile oligoasthenoteratozoospermic (OAT) men without Vx, and infertile OAT men with Vx. They were subjected to history taking, clinical examination, and semen analysis. In their semen, the following were estimated: miRNA-122, miRNA-181a, and miRNA-34c5 using quantitative real-time PCR, apoptotic markers (BAX, BCL2) protein expression, and OS markers [malondialdehyde (MDA) and glutathione peroxidase (GPx)]. Results. The mean levels of seminal miRNA-122, miRNA-181a, and miRNA-34c5 were significantly reduced in infertile OAT men with Vx compared with other groups coupled with Vx grade and Vx bilaterality. Seminal miRNA-122, miRNA-181a, and miRNA-34c5 were positively correlated with sperm concentration, total sperm motility, sperm normal morphology, seminal GPx, and seminal BCL2 and negatively correlated with seminal MDA and seminal BAX. Conclusions. Seminal miRNA-122, miRNA-181a, and miRNA-34c5 are decreased in infertile OAT men with Vx associated with increased Vx grade and Vx bilaterality. In addition, they are positively correlated with sperm parameters and negatively correlated with OS, apoptotic markers. PMID:28105423

  10. Seminal miRNA Relationship with Apoptotic Markers and Oxidative Stress in Infertile Men with Varicocele

    Directory of Open Access Journals (Sweden)

    Taymour Mostafa

    2016-01-01

    Full Text Available Aim. This study aimed to assess seminal miRNA relationship with seminal apoptotic markers and oxidative stress (OS in infertile men associated with varicocele (Vx. Methods. In all, 220 subjects were divided into the following groups: fertile normozoospermic men, fertile normozoospermic men with Vx, infertile oligoasthenoteratozoospermic (OAT men without Vx, and infertile OAT men with Vx. They were subjected to history taking, clinical examination, and semen analysis. In their semen, the following were estimated: miRNA-122, miRNA-181a, and miRNA-34c5 using quantitative real-time PCR, apoptotic markers (BAX, BCL2 protein expression, and OS markers [malondialdehyde (MDA and glutathione peroxidase (GPx]. Results. The mean levels of seminal miRNA-122, miRNA-181a, and miRNA-34c5 were significantly reduced in infertile OAT men with Vx compared with other groups coupled with Vx grade and Vx bilaterality. Seminal miRNA-122, miRNA-181a, and miRNA-34c5 were positively correlated with sperm concentration, total sperm motility, sperm normal morphology, seminal GPx, and seminal BCL2 and negatively correlated with seminal MDA and seminal BAX. Conclusions. Seminal miRNA-122, miRNA-181a, and miRNA-34c5 are decreased in infertile OAT men with Vx associated with increased Vx grade and Vx bilaterality. In addition, they are positively correlated with sperm parameters and negatively correlated with OS, apoptotic markers.

  11. Monitoring the Spatiotemporal Activities of miRNAs in Small Animal Models Using Molecular Imaging Modalities

    Science.gov (United States)

    Baril, Patrick; Ezzine, Safia; Pichon, Chantal

    2015-01-01

    MicroRNAs (miRNAs) are a class of small non-coding RNAs that regulate gene expression by binding mRNA targets via sequence complementary inducing translational repression and/or mRNA degradation. A current challenge in the field of miRNA biology is to understand the functionality of miRNAs under physiopathological conditions. Recent evidence indicates that miRNA expression is more complex than simple regulation at the transcriptional level. MiRNAs undergo complex post-transcriptional regulations such miRNA processing, editing, accumulation and re-cycling within P-bodies. They are dynamically regulated and have a well-orchestrated spatiotemporal localization pattern. Real-time and spatio-temporal analyses of miRNA expression are difficult to evaluate and often underestimated. Therefore, important information connecting miRNA expression and function can be lost. Conventional miRNA profiling methods such as Northern blot, real-time PCR, microarray, in situ hybridization and deep sequencing continue to contribute to our knowledge of miRNA biology. However, these methods can seldom shed light on the spatiotemporal organization and function of miRNAs in real-time. Non-invasive molecular imaging methods have the potential to address these issues and are thus attracting increasing attention. This paper reviews the state-of-the-art of methods used to detect miRNAs and discusses their contribution in the emerging field of miRNA biology and therapy. PMID:25749473

  12. Novel Insights into miRNA in Lung and Heart Inflammatory Diseases

    Directory of Open Access Journals (Sweden)

    Amit Kishore

    2014-01-01

    Full Text Available MicroRNAs (miRNAs are noncoding regulatory sequences that govern posttranscriptional inhibition of genes through binding mainly at regulatory regions. The regulatory mechanism of miRNAs are influenced by complex crosstalk among single nucleotide polymorphisms (SNPs within miRNA seed region and epigenetic modifications. Circulating miRNAs exhibit potential characteristics as stable biomarker. Functionally, miRNAs are involved in basic regulatory mechanisms of cells including inflammation. Thus, miRNA dysregulation, resulting in aberrant expression of a gene, is suggested to play an important role in disease susceptibility. This review focuses on the role of miRNA as diagnostic marker in pathogenesis of lung inflammatory diseases and in cardiac remodelling events during inflammation. From recent reports, In this context, the information about the models in which miRNAs expression were investigated including types of biological samples, as well as on the methods for miRNA validation and prediction/definition of their gene targets are emphasized in the review. Besides disease pathogenesis, promising role of miRNAs in early disease diagnosis and prognostication is also discussed. However, some miRNAs are also indicated with protective role. Thus, identifications and usage of such potential miRNAs as well as disruption of disease susceptible miRNAs using antagonists, antagomirs, are imperative and may provide a novel therapeutic approach towards combating the disease progression.

  13. Compensatory relationship between splice sites and exonic splicing signals depending on the length of vertebrate introns

    Directory of Open Access Journals (Sweden)

    Rogozin Igor B

    2006-12-01

    Full Text Available Abstract Background The signals that determine the specificity and efficiency of splicing are multiple and complex, and are not fully understood. Among other factors, the relative contributions of different mechanisms appear to depend on intron size inasmuch as long introns might hinder the activity of the spliceosome through interference with the proper positioning of the intron-exon junctions. Indeed, it has been shown that the information content of splice sites positively correlates with intron length in the nematode, Drosophila, and fungi. We explored the connections between the length of vertebrate introns, the strength of splice sites, exonic splicing signals, and evolution of flanking exons. Results A compensatory relationship is shown to exist between different types of signals, namely, the splice sites and the exonic splicing enhancers (ESEs. In the range of relatively short introns (approximately, Conclusion Several weak but statistically significant correlations were observed between vertebrate intron length, splice site strength, and potential exonic splicing signals. Taken together, these findings attest to a compensatory relationship between splice sites and exonic splicing signals, depending on intron length.

  14. Forks in the tracks: Group II introns, spliceosomes, telomeres and beyond.

    Science.gov (United States)

    Agrawal, Rajendra Kumar; Wang, Hong-Wei; Belfort, Marlene

    2016-12-01

    Group II introns are large catalytic RNAs that form a ribonucleoprotein (RNP) complex by binding to an intron-encoded protein (IEP). The IEP, which facilitates both RNA splicing and intron mobility, has multiple activities including reverse transcriptase. Recent structures of a group II intron RNP complex and of IEPs from diverse bacteria fuel arguments that group II introns are ancestrally related to eukaryotic spliceosomes as well as to telomerase and viruses. Furthermore, recent structural studies of various functional states of the spliceosome allow us to draw parallels between the group II intron RNP and the spliceosome. Here we present an overview of these studies, with an emphasis on the structure of the IEPs in their isolated and RNA-bound states and on their evolutionary relatedness. In addition, we address the conundrum of the free, albeit truncated IEPs forming dimers, whereas the IEP bound to the intron ribozyme is a monomer in the mature RNP. Future studies needed to resolve some of the outstanding issues related to group II intron RNP function and dynamics are also discussed.

  15. Many independent origins of trans splicing of a plant mitochondrial group II intron.

    Science.gov (United States)

    Qiu, Yin-Long; Palmer, Jeffrey D

    2004-07-01

    We examined the cis- vs. trans-splicing status of the mitochondrial group II intron nad1i728 in 439 species (427 genera) of land plants, using both Southern hybridization results (for 416 species) and intron sequence data from the literature. A total of 164 species (157 genera), all angiosperms, was found to have a trans-spliced form of the intron. Using a multigene land plant phylogeny, we infer that the intron underwent a transition from cis to trans splicing 15 times among the sampled angiosperms. In 10 cases, the intron was fractured between its 5' end and the intron-encoded matR gene, while in the other 5 cases the fracture occurred between matR and the 3' end of the intron. The 15 intron fractures took place at different time depths during the evolution of angiosperms, with those in Nymphaeales, Austrobaileyales, Chloranthaceae, and eumonocots occurring early in angiosperm evolution and those in Syringodium filiforme, Hydrocharis morsus- ranae, Najas, and Erodium relatively recently. The trans-splicing events uncovered in Austrobaileyales, eumonocots, Polygonales, Caryophyllales, Sapindales, and core Rosales reinforce the naturalness of these major clades of angiosperms, some of which have been identified solely on the basis of recent DNA sequence analyses.

  16. EVIDENCE FOR INDEPENDENT ACQUISITION OF GROUP-I INTRONS IN GREEN-ALGAE

    NARCIS (Netherlands)

    VANOPPEN, MJH; OLSEN, JL; STAM, WT

    1993-01-01

    We report the occurrence of a group I intron, 452 nucleotides in length, in the nuclear small-subunit ribosomal gene of the benthic seaweed Urospora penicilliformis, a member of the green algal class Ulvophyceae. Group I introns have been reported in fungi, myxomycetes, the ciliate genus

  17. EVIDENCE FOR INDEPENDENT ACQUISITION OF GROUP-I INTRONS IN GREEN-ALGAE

    NARCIS (Netherlands)

    VANOPPEN, MJH; OLSEN, JL; STAM, WT

    1993-01-01

    We report the occurrence of a group I intron, 452 nucleotides in length, in the nuclear small-subunit ribosomal gene of the benthic seaweed Urospora penicilliformis, a member of the green algal class Ulvophyceae. Group I introns have been reported in fungi, myxomycetes, the ciliate genus Tetrahymena

  18. Two CRM protein subfamilies cooperate in the splicing of group IIB introns in chloroplasts.

    Science.gov (United States)

    Asakura, Yukari; Bayraktar, Omer Ali; Barkan, Alice

    2008-11-01

    Chloroplast genomes in angiosperms encode approximately 20 group II introns, approximately half of which are classified as subgroup IIB. The splicing of all but one of the subgroup IIB introns requires a heterodimer containing the peptidyl-tRNA hydrolase homolog CRS2 and one of two closely related proteins, CAF1 or CAF2, that harbor a recently recognized RNA binding domain called the CRM domain. Two CRS2/CAF-dependent introns require, in addition, a CRM domain protein called CFM2 that is only distantly related to CAF1 and CAF2. Here, we show that CFM3, a close relative of CFM2, associates in vivo with those CRS2/CAF-dependent introns that are not CFM2 ligands. Mutant phenotypes in rice and Arabidopsis support a role for CFM3 in the splicing of most of the introns with which it associates. These results show that either CAF1 or CAF2 and either CFM2 or CFM3 simultaneously bind most chloroplast subgroup IIB introns in vivo, and that the CAF and CFM subunits play nonredundant roles in splicing. These results suggest that the expansion of the CRM protein family in plants resulted in two subfamilies that play different roles in group II intron splicing, with further diversification within a subfamily to accommodate multiple intron ligands.

  19. U12 type introns were lost at multiple occasions during evolution

    Directory of Open Access Journals (Sweden)

    Bartschat Sebastian

    2010-02-01

    Full Text Available Abstract Background Two categories of introns are known, a common U2 type and a rare U12 type. These two types of introns are removed by distinct spliceosomes. The phylogenetic distribution of spliceosomal RNAs that are characteristic of the U12 spliceosome, i.e. the U11, U12, U4atac and U6atac RNAs, suggest that U12 spliceosomes were lost in many phylogenetic groups. We have now examined the distribution of U2 and U12 introns in many of these groups. Results U2 and U12 introns were predicted by making use of available EST and genomic sequences. The results show that in species or branches where U12 spliceosomal components are missing, also U12 type of introns are lacking. Examples are the choanoflagellate Monosiga brevicollis, Entamoeba histolytica, green algae, diatoms, and the fungal lineage Basidiomycota. Furthermore, whereas U12 splicing does not occur in Caenorhabditis elegans, U12 introns as well as U12 snRNAs are present in Trichinella spiralis, which is deeply branching in the nematode tree. A comparison of homologous genes in T. spiralis and C. elegans revealed different mechanisms whereby U12 introns were lost. Conclusions The phylogenetic distribution of U12 introns and spliceosomal RNAs give further support to an early origin of U12 dependent splicing. In addition, this distribution identifies a large number of instances during eukaryotic evolution where such splicing was lost.

  20. The Role of miRNA in Papillary Thyroid Cancer in the Context of miRNA Let-7 Family

    Directory of Open Access Journals (Sweden)

    Ewelina Perdas

    2016-06-01

    Full Text Available Papillary thyroid carcinoma (PTC is the most common endocrine malignancy. RET/PTC rearrangement is the most common genetic modification identified in this category of cancer, increasing proliferation and dedifferentiation by the activation of the RET/PTC-RAS-BRAF-MAPK-ERK signaling pathway. Recently, let-7 miRNA was found to reduce RAS levels, acting as a tumor suppressor gene. Circulating miRNA profiles of the let-7 family may be used as novel noninvasive diagnostic, prognostic, treatment and surveillance markers for PTC.

  1. Intronic RNAs constitute the major fraction of the non-coding RNA in mammalian cells

    Directory of Open Access Journals (Sweden)

    St Laurent Georges

    2012-09-01

    Full Text Available Abstract Background The function of RNA from the non-coding (the so called “dark matter” regions of the genome has been a subject of considerable recent debate. Perhaps the most controversy is regarding the function of RNAs found in introns of annotated transcripts, where most of the reads that map outside of exons are usually found. However, it has been reported that the levels of RNA in introns are minor relative to those of the corresponding exons, and that changes in the levels of intronic RNAs correlate tightly with that of adjacent exons. This would suggest that RNAs produced from the vast expanse of intronic space are just pieces of pre-mRNAs or excised introns en route to degradation. Results We present data that challenges the notion that intronic RNAs are mere by-standers in the cell. By performing a highly quantitative RNAseq analysis of transcriptome changes during an inflammation time course, we show that intronic RNAs have a number of features that would be expected from functional, standalone RNA species. We show that there are thousands of introns in the mouse genome that generate RNAs whose overall abundance, which changes throughout the inflammation timecourse, and other properties suggest that they function in yet unknown ways. Conclusions So far, the focus of non-coding RNA discovery has shied away from intronic regions as those were believed to simply encode parts of pre-mRNAs. Results presented here suggest a very different situation – the sequences encoded in the introns appear to harbor a yet unexplored reservoir of novel, functional RNAs. As such, they should not be ignored in surveys of functional transcripts or other genomic studies.

  2. Beta-globin LCR and intron elements cooperate and direct spatial reorganization for gene therapy.

    Directory of Open Access Journals (Sweden)

    Alla Buzina

    2008-04-01

    Full Text Available The Locus Control Region (LCR requires intronic elements within beta-globin transgenes to direct high level expression at all ectopic integration sites. However, these essential intronic elements cannot be transmitted through retrovirus vectors and their deletion may compromise the therapeutic potential for gene therapy. Here, we systematically regenerate functional beta-globin intron 2 elements that rescue LCR activity directed by 5'HS3. Evaluation in transgenic mice demonstrates that an Oct-1 binding site and an enhancer in the intron cooperate to increase expression levels from LCR globin transgenes. Replacement of the intronic AT-rich region with the Igmu 3'MAR rescues LCR activity in single copy transgenic mice. Importantly, a combination of the Oct-1 site, Igmu 3'MAR and intronic enhancer in the BGT158 cassette directs more consistent levels of expression in transgenic mice. By introducing intron-modified transgenes into the same genomic integration site in erythroid cells, we show that BGT158 has the greatest transcriptional induction. 3D DNA FISH establishes that induction stimulates this small 5'HS3 containing transgene and the endogenous locus to spatially reorganize towards more central locations in erythroid nuclei. Electron Spectroscopic Imaging (ESI of chromatin fibers demonstrates that ultrastructural heterochromatin is primarily perinuclear and does not reorganize. Finally, we transmit intron-modified globin transgenes through insulated self-inactivating (SIN lentivirus vectors into erythroid cells. We show efficient transfer and robust mRNA and protein expression by the BGT158 vector, and virus titer improvements mediated by the modified intron 2 in the presence of an LCR cassette composed of 5'HS2-4. Our results have important implications for the mechanism of LCR activity at ectopic integration sites. The modified transgenes are the first to transfer intronic elements that potentiate LCR activity and are designed to facilitate

  3. Identification and characterization of miRNA transcriptome in potato by high-throughput sequencing.

    Directory of Open Access Journals (Sweden)

    Runxuan Zhang

    Full Text Available Micro RNAs (miRNAs represent a class of short, non-coding, endogenous RNAs which play important roles in post-transcriptional regulation of gene expression. While the diverse functions of miRNAs in model plants have been well studied, the impact of miRNAs in crop plant biology is poorly understood. Here we used high-throughput sequencing and bioinformatics analysis to analyze miRNAs in the tuber bearing crop potato (Solanum tuberosum. Small RNAs were analysed from leaf and stolon tissues. 28 conserved miRNA families were found and potato-specific miRNAs were identified and validated by RNA gel blot hybridization. The size, origin and predicted targets of conserved and potato specific miRNAs are described. The large number of miRNAs and complex population of small RNAs in potato suggest important roles for these non-coding RNAs in diverse physiological and metabolic pathways.

  4. Identification and characterization of miRNA transcriptome in potato by high-throughput sequencing.

    Science.gov (United States)

    Zhang, Runxuan; Marshall, David; Bryan, Glenn J; Hornyik, Csaba

    2013-01-01

    Micro RNAs (miRNAs) represent a class of short, non-coding, endogenous RNAs which play important roles in post-transcriptional regulation of gene expression. While the diverse functions of miRNAs in model plants have been well studied, the impact of miRNAs in crop plant biology is poorly understood. Here we used high-throughput sequencing and bioinformatics analysis to analyze miRNAs in the tuber bearing crop potato (Solanum tuberosum). Small RNAs were analysed from leaf and stolon tissues. 28 conserved miRNA families were found and potato-specific miRNAs were identified and validated by RNA gel blot hybridization. The size, origin and predicted targets of conserved and potato specific miRNAs are described. The large number of miRNAs and complex population of small RNAs in potato suggest important roles for these non-coding RNAs in diverse physiological and metabolic pathways.

  5. miRNA gene counts in chromosomes vary widely in a species and biogenesis of miRNA largely depends on transcription or posttranscriptional processing of coding genes

    Directory of Open Access Journals (Sweden)

    Atanu eGhorai

    2014-04-01

    Full Text Available MicroRNAs target specific mRNA(s to silence its expression and thereby regulate various cellular processes. We have investigated miRNA gene counts in chromosomes for 20 different species and observed wide variation. Certain chromosomes have extremely high number of miRNA gene compared with others in all the species. For example, high number of miRNA gene in X chromosome and the least or absence of miRNA gene in Y chromosome was observed in all species. To search the criteria governing such variation of miRNA gene counts in chromosomes, we have selected three parameters- length, number of non-coding and coding genes in a chromosome. We have calculated Pearson’s correlation coefficient of miRNA gene counts with length, number of non-coding and coding genes in a chromosome for all 20 species. Major number of species showed that number of miRNA gene was not correlated with chromosome length. 85% of species under study showed strong positive correlation coefficient (r≥0.5 between the numbers of miRNA gene vs non-coding gene in chromosomes as expected because miRNA is a sub-set of non-coding genes. 55% species under study showed strong positive correlation coefficient (r≥0.5 between numbers of miRNA gene vs coding gene. We hypothesize biogenesis of miRNA largely depends on coding genes, an evolutionary conserved process. Chromosomes having higher number of miRNA genes will be most likely playing regulatory roles in several cellular processes including different disorders. In humans, cancer and cardiovascular disease associated miRNAs are mostly intergenic and located in Chromosome 19, X, 14 and 1.

  6. Neuronal Activity Regulates Hippocampal miRNA Expression

    NARCIS (Netherlands)

    Eacker, Stephen M.; Keuss, Matthew J.; Berezikov, Eugene; Dawson, Valina L.; Dawson, Ted M.

    2011-01-01

    Neuronal activity regulates a broad range of processes in the hippocampus, including the precise regulation of translation. Disruptions in proper translational control in the nervous system are associated with a variety of disorders that fall in the autistic spectrum. MicroRNA (miRNA) represent a re

  7. miRNAs in development and pathogenesis of the nervous system.

    Science.gov (United States)

    Nowak, Jakub S; Michlewski, Gracjan

    2013-08-01

    The human nervous system expresses approximately 70% of all miRNAs (microRNAs). Changing levels of certain ubiquitous and brain-specific miRNAs shape the development and function of the nervous system. It is becoming clear that misexpression of some miRNAs can contribute towards neurodevelopmental disorders. In the present article, we review the current knowledge of the role of miRNAs in development and pathogenesis of the nervous system.

  8. Direct sequencing and expression analysis of a large number of miRNAs in Aedes aegypti and a multi-species survey of novel mosquito miRNAs

    Directory of Open Access Journals (Sweden)

    Liang Shaohui

    2009-12-01

    Full Text Available Abstract Background MicroRNAs (miRNAs are a novel class of gene regulators whose biogenesis involves hairpin structures called precursor miRNAs, or pre-miRNAs. A pre-miRNA is processed to make a miRNA:miRNA* duplex, which is then separated to generate a mature miRNA and a miRNA*. The mature miRNAs play key regulatory roles during embryonic development as well as other cellular processes. They are also implicated in control of viral infection as well as innate immunity. Direct experimental evidence for mosquito miRNAs has been recently reported in anopheline mosquitoes based on small-scale cloning efforts. Results We obtained approximately 130, 000 small RNA sequences from the yellow fever mosquito, Aedes aegypti, by 454 sequencing of samples that were isolated from mixed-age embryos and midguts from sugar-fed and blood-fed females, respectively. We also performed bioinformatics analysis on the Ae. aegypti genome assembly to identify evidence for additional miRNAs. The combination of these approaches uncovered 98 different pre-miRNAs in Ae. aegypti which could produce 86 distinct miRNAs. Thirteen miRNAs, including eight novel miRNAs identified in this study, are currently only found in mosquitoes. We also identified five potential revisions to previously annotated miRNAs at the miRNA termini, two cases of highly abundant miRNA* sequences, 14 miRNA clusters, and 17 cases where more than one pre-miRNA hairpin produces the same or highly similar mature miRNAs. A number of miRNAs showed higher levels in midgut from blood-fed female than that from sugar-fed female, which was confirmed by northern blots on two of these miRNAs. Northern blots also revealed several miRNAs that showed stage-specific expression. Detailed expression analysis of eight of the 13 mosquito-specific miRNAs in four divergent mosquito genera identified cases of clearly conserved expression patterns and obvious differences. Four of the 13 miRNAs are specific to certain lineage

  9. Integrating mRNA and miRNA Weighted Gene Co-Expression Networks with eQTLs in the Nucleus Accumbens of Subjects with Alcohol Dependence.

    Directory of Open Access Journals (Sweden)

    Mohammed Mamdani

    Full Text Available Alcohol consumption is known to lead to gene expression changes in the brain. After performing weighted gene co-expression network analyses (WGCNA on genome-wide mRNA and microRNA (miRNA expression in Nucleus Accumbens (NAc of subjects with alcohol dependence (AD; N = 18 and of matched controls (N = 18, six mRNA and three miRNA modules significantly correlated with AD were identified (Bonferoni-adj. p≤ 0.05. Cell-type-specific transcriptome analyses revealed two of the mRNA modules to be enriched for neuronal specific marker genes and downregulated in AD, whereas the remaining four mRNA modules were enriched for astrocyte and microglial specific marker genes and upregulated in AD. Gene set enrichment analysis demonstrated that neuronal specific modules were enriched for genes involved in oxidative phosphorylation, mitochondrial dysfunction and MAPK signaling. Glial-specific modules were predominantly enriched for genes involved in processes related to immune functions, i.e. cytokine signaling (all adj. p≤ 0.05. In mRNA and miRNA modules, 461 and 25 candidate hub genes were identified, respectively. In contrast to the expected biological functions of miRNAs, correlation analyses between mRNA and miRNA hub genes revealed a higher number of positive than negative correlations (χ2 test p≤ 0.0001. Integration of hub gene expression with genome-wide genotypic data resulted in 591 mRNA cis-eQTLs and 62 miRNA cis-eQTLs. mRNA cis-eQTLs were significantly enriched for AD diagnosis and AD symptom counts (adj. p = 0.014 and p = 0.024, respectively in AD GWAS signals in a large, independent genetic sample from the Collaborative Study on Genetics of Alcohol (COGA. In conclusion, our study identified putative gene network hubs coordinating mRNA and miRNA co-expression changes in the NAc of AD subjects, and our genetic (cis-eQTL analysis provides novel insights into the etiological mechanisms of AD.

  10. Diversity, mobility, and structural and functional evolution of group II introns carrying an unusual 3' extension

    Directory of Open Access Journals (Sweden)

    Tourasse Nicolas J

    2011-12-01

    Full Text Available Abstract Background Group II introns are widespread genetic elements endowed with a dual functionality. They are catalytic RNAs (ribozymes that are able of self-splicing and they are also mobile retroelements that can invade genomic DNA. The group II intron RNA secondary structure is typically made up of six domains. However, a number of unusual group II introns carrying a unique extension of 53-56 nucleotides at the 3' end have been identified previously in bacteria of the Bacillus cereus group. Methods In the present study, we conducted combined sequence comparisons and phylogenetic analyses of introns, host gene, plasmid and chromosome of host strains in order to gain insights into mobility, dispersal, and evolution of the unusual introns and their extension. We also performed in vitro mutational and kinetic experiments to investigate possible functional features related to the extension. Results We report the identification of novel copies of group II introns carrying a 3' extension including the first two copies in bacteria not belonging to the B. cereus group, Bacillus pseudofirmus OF4 and Bacillus sp. 2_A_57_CT2, an uncharacterized species phylogenetically close to B. firmus. Interestingly, the B. pseudofirmus intron has a longer extension of 70 bases. From sequence comparisons and phylogenetic analyses, several possible separate events of mobility involving the atypical introns could be identified, including both retrohoming and retrotransposition events. In addition, identical extensions were found in introns that otherwise exhibit little sequence conservation in the rest of their structures, with the exception of the conserved and catalytically critical domains V and VI, suggesting either separate acquisition of the extra segment by different group II introns or a strong selection pressure acting on the extension. Furthermore, we show by in vitro splicing experiments that the 3' extension affects the splicing properties differently in

  11. Conservation of intron and intein insertion sites: implications for life histories of parasitic genetic elements

    Directory of Open Access Journals (Sweden)

    Senejani Alireza G

    2009-12-01

    Full Text Available Abstract Background Inteins and introns are genetic elements that are removed from proteins and RNA after translation or transcription, respectively. Previous studies have suggested that these genetic elements are found in conserved parts of the host protein. To our knowledge this type of analysis has not been done for group II introns residing within a gene. Here we provide quantitative statistical support from an analyses of proteins that host inteins, group I introns, group II introns and spliceosomal introns across all three domains of life. Results To determine whether or not inteins, group I, group II, and spliceosomal introns are found preferentially in conserved regions of their respective host protein, conservation profiles were generated and intein and intron positions were mapped to the profiles. Fisher's combined probability test was used to determine the significance of the distribution of insertion sites across the conservation profile for each protein. For a subset of studied proteins, the conservation profile and insertion positions were mapped to protein structures to determine if the insertion sites correlate to regions of functional activity. All inteins and most group I introns were found to be preferentially located within conserved regions; in contrast, a bacterial intein-like protein, group II and spliceosomal introns did not show a preference for conserved sites. Conclusions These findings demonstrate that inteins and group I introns are found preferentially in conserved regions of their respective host proteins. Homing endonucleases are often located within inteins and group I introns and these may facilitate mobility to conserved regions. Insertion at these conserved positions decreases the chance of elimination, and slows deletion of the elements, since removal of the elements has to be precise as not to disrupt the function of the protein. Furthermore, functional constrains on the targeted site make it more difficult

  12. Phylogenetic distribution of intron positions in alpha-amylase genes of bilateria suggests numerous gains and losses.

    Directory of Open Access Journals (Sweden)

    Jean-Luc Da Lage

    Full Text Available Most eukaryotes have at least some genes interrupted by introns. While it is well accepted that introns were already present at moderate density in the last eukaryote common ancestor, the conspicuous diversity of intron density among genomes suggests a complex evolutionary history, with marked differences between phyla. The question of the rates of intron gains and loss in the course of evolution and factors influencing them remains controversial. We have investigated a single gene family, alpha-amylase, in 55 species covering a variety of animal phyla. Comparison of intron positions across phyla suggests a complex history, with a likely ancestral intronless gene undergoing frequent intron loss and gain, leading to extant intron/exon structures that are highly variable, even among species from the same phylum. Because introns are known to play no regulatory role in this gene and there is no alternative splicing, the structural differences may be interpreted more easily: intron positions, sizes, losses or gains may be more likely related to factors linked to splicing mechanisms and requirements, and to recognition of introns and exons, or to more extrinsic factors, such as life cycle and population size. We have shown that intron losses outnumbered gains in recent periods, but that "resets" of intron positions occurred at the origin of several phyla, including vertebrates. Rates of gain and loss appear to be positively correlated. No phase preference was found. We also found evidence for parallel gains and for intron sliding. Presence of introns at given positions was correlated to a strong protosplice consensus sequence AG/G, which was much weaker in the absence of intron. In contrast, recent intron insertions were not associated with a specific sequence. In animal Amy genes, population size and generation time seem to have played only minor roles in shaping gene structures.

  13. A bootstrap based analysis pipeline for efficient classification of phylogenetically related animal miRNAs

    Directory of Open Access Journals (Sweden)

    Gu Xun

    2007-03-01

    Full Text Available Abstract Background Phylogenetically related miRNAs (miRNA families convey important information of the function and evolution of miRNAs. Due to the special sequence features of miRNAs, pair-wise sequence identity between miRNA precursors alone is often inadequate for unequivocally judging the phylogenetic relationships between miRNAs. Most of the current methods for miRNA classification rely heavily on manual inspection and lack measurements of the reliability of the results. Results In this study, we designed an analysis pipeline (the Phylogeny-Bootstrap-Cluster (PBC pipeline to identify miRNA families based on branch stability in the bootstrap trees derived from overlapping genome-wide miRNA sequence sets. We tested the PBC analysis pipeline with the miRNAs from six animal species, H. sapiens, M. musculus, G. gallus, D. rerio, D. melanogaster, and C. elegans. The resulting classification was compared with the miRNA families defined in miRBase. The two classifications were largely consistent. Conclusion The PBC analysis pipeline is an efficient method for classifying large numbers of heterogeneous miRNA sequences. It requires minimum human involvement and provides measurements of the reliability of the classification results.

  14. Deregulation of the miRNAs Expression in Cervical Cancer: Human Papillomavirus Implications

    Directory of Open Access Journals (Sweden)

    Yazmín Gómez-Gómez

    2013-01-01

    Full Text Available MicroRNAs (miRNAs are a class of small non coding RNAs of 18–25 nucleotides in length. The temporal or short-lived expression of the miRNAs modulates gene expression post transcriptionally. Studies have revealed that miRNAs deregulation correlates and is involved with the initiation and progression of human tumors. Cervical cancer (CC displays notably increased or decreased expression of a large number of cellular oncogenic or tumor suppressive miRNAs, respectively. However, understanding the potential role of miRNAs in CC is still limited. In CC, the high-risk human papillomaviruses (HR-HPVs infection can affect the miRNAs expression through oncoprotein E6 and E7 that contribute to viral pathogenesis, although other viral proteins might also be involved. This deregulation in the miRNAs expression has an important role in the hallmarks of CC. Interestingly, the miRNA expression profile in CC can discriminate between normal and tumor tissue and the extraordinary stability of miRNAs makes it suitable to serve as diagnostic and prognostic biomarkers of cancer. In this review, we will summarize the role of the HR-HPVs in miRNA expression, the role of miRNAs in the hallmarks of CC, and the use of miRNAs as potential prognostic biomarkers in CC.

  15. Structure et réarrangements conformationnels au cours de l’épissage du composant ribozyme d’un intron de groupe II

    OpenAIRE

    Li, Cheng-Fang

    2011-01-01

    Group II introns are a class of RNAs best known for their ribozyme-catalyzed, self-splicing reaction. Under certain conditions, the introns can excise themselves from precursor mRNAs and ligate together their flanking exons, without the aid of proteins. Group II introns generally excise from pre-mRNA as a lariat, like the one formed by spliceosomal introns, similarities in the splicing mechanism suggest that group II introns and nuclear spliceosomal introns may share a common evolutionary anc...

  16. The brown algae Pl.LSU/2 group II intron-encoded protein has functional reverse transcriptase and maturase activities.

    Directory of Open Access Journals (Sweden)

    Madeleine Zerbato

    Full Text Available Group II introns are self-splicing mobile elements found in prokaryotes and eukaryotic organelles. These introns propagate by homing into precise genomic locations, following assembly of a ribonucleoprotein complex containing the intron-encoded protein (IEP and the spliced intron RNA. Engineered group II introns are now commonly used tools for targeted genomic modifications in prokaryotes but not in eukaryotes. We speculate that the catalytic activation of currently known group II introns is limited in eukaryotic cells. The brown algae Pylaiella littoralis Pl.LSU/2 group II intron is uniquely capable of in vitro ribozyme activity at physiological level of magnesium but this intron remains poorly characterized. We purified and characterized recombinant Pl.LSU/2 IEP. Unlike most IEPs, Pl.LSU/2 IEP displayed a reverse transcriptase activity without intronic RNA. The Pl.LSU/2 intron could be engineered to splice accurately in Saccharomyces cerevisiae and splicing efficiency was increased by the maturase activity of the IEP. However, spliced transcripts were not expressed. Furthermore, intron splicing was not detected in human cells. While further tool development is needed, these data provide the first functional characterization of the PI.LSU/2 IEP and the first evidence that the Pl.LSU/2 group II intron splicing occurs in vivo in eukaryotes in an IEP-dependent manner.

  17. The brown algae Pl.LSU/2 group II intron-encoded protein has functional reverse transcriptase and maturase activities.

    Science.gov (United States)

    Zerbato, Madeleine; Holic, Nathalie; Moniot-Frin, Sophie; Ingrao, Dina; Galy, Anne; Perea, Javier

    2013-01-01

    Group II introns are self-splicing mobile elements found in prokaryotes and eukaryotic organelles. These introns propagate by homing into precise genomic locations, following assembly of a ribonucleoprotein complex containing the intron-encoded protein (IEP) and the spliced intron RNA. Engineered group II introns are now commonly used tools for targeted genomic modifications in prokaryotes but not in eukaryotes. We speculate that the catalytic activation of currently known group II introns is limited in eukaryotic cells. The brown algae Pylaiella littoralis Pl.LSU/2 group II intron is uniquely capable of in vitro ribozyme activity at physiological level of magnesium but this intron remains poorly characterized. We purified and characterized recombinant Pl.LSU/2 IEP. Unlike most IEPs, Pl.LSU/2 IEP displayed a reverse transcriptase activity without intronic RNA. The Pl.LSU/2 intron could be engineered to splice accurately in Saccharomyces cerevisiae and splicing efficiency was increased by the maturase activity of the IEP. However, spliced transcripts were not expressed. Furthermore, intron splicing was not detected in human cells. While further tool development is needed, these data provide the first functional characterization of the PI.LSU/2 IEP and the first evidence that the Pl.LSU/2 group II intron splicing occurs in vivo in eukaryotes in an IEP-dependent manner.

  18. Ancient, highly polymorphic human major histocompatibility complex DQA1 intron sequence

    Energy Technology Data Exchange (ETDEWEB)

    McGinnis, M.D.; Quinn, D.L.; Lebo, R.V. [Univ. of California, San Francisco, CA (United States); Simons, M.J. [GeneType Pty. Ltd., Fitzroy, Victoria (Australia)

    1994-10-01

    A 438 basepair intron 1 sequence adjacent to exon 2 in the human major histocompatibility complex DQA1 gene defined 16 allelic variants in 69 individuals from wide ethnic backgrounds. In contrast, the most variable coding region spanned by the 247 basepair exon 2 defined 11 allelic variants. Our phylogenetic human intron 1 tree derived by the Bootstrap algorithm reflects the same relative allelic relationships as the reported DQA1 exon 2 have cosegregated since divergence of the human races. Comparison of human alleles to a Rhesus monkey DQA1 first intron sequence found only 10 nucleotide substitutions unique to Rhesus, with the other 428 positions (98%) found in at least one human allele. This high degree of homology reflects the evolutionary stability of intron sequences since these two species diverged over 20 million years ago. Because more intron 1 alleles exist than exon 2 alleles, these polymorphic introns can be used to improve tissue typing for transplantation, paternity testing, and forensics and to derive more complete phylogenetic trees. These results suggest that introns represent a previously underutilized polymorphic resource. 42 refs., 3 figs., 1 tab.

  19. Extensive mis-splicing of a bi-partite plant mitochondrial group II intron.

    Science.gov (United States)

    Elina, Helen; Brown, Gregory G

    2010-01-01

    Expression of the seed plant mitochondrial nad5 gene involves two trans-splicing events that remove fragmented group II introns and join the small, central exon c to exons b and d. We show that in both monocot and eudicot plants, extensive mis-splicing of the bi-partite intron 2 takes place, resulting in the formation of aberrantly spliced products in which exon c is joined to various sites within exon b. These mis-spliced products accumulate to levels comparable to or greater than that of the correctly spliced mRNA. We suggest that mis-splicing may result from folding constraints imposed on intron 2 by base-pairing between exon a and a portion of the bi-partite intron 3 downstream of exon c. Consistent with this hypothesis, we find that mis-splicing does not occur in Oenothera mitochondria, where intron 3 is further fragmented such that the predicted base-pairing region is not covalently linked to exon c. Our findings suggest that intron fragmentation may lead to mis-splicing, which may be corrected by further intron fragmentation.

  20. Accumulation of Stable Full-Length Circular Group I Intron RNAs during Heat-Shock

    Directory of Open Access Journals (Sweden)

    Kasper L. Andersen

    2016-10-01

    Full Text Available Group I introns in nuclear ribosomal RNA of eukaryotic microorganisms are processed by splicing or circularization. The latter results in formation of full-length circular introns without ligation of the exons and has been proposed to be active in intron mobility. We applied qRT-PCR to estimate the copy number of circular intron RNA from the myxomycete Didymium iridis. In exponentially growing amoebae, the circular introns are nuclear and found in 70 copies per cell. During heat-shock, the circular form is up-regulated to more than 500 copies per cell. The intron harbours two ribozymes that have the potential to linearize the circle. To understand the structural features that maintain circle integrity, we performed chemical and enzymatic probing of the splicing ribozyme combined with molecular modeling to arrive at models of the inactive circular form and its active linear counterpart. We show that the two forms have the same overall structure but differ in key parts, including the catalytic core element P7 and the junctions at which reactions take place. These differences explain the relative stability of the circular species, demonstrate how it is prone to react with a target molecule for circle integration and thus supports the notion that the circular form is a biologically significant molecule possibly with a role in intron mobility.

  1. Accumulation of Stable Full-Length Circular Group I Intron RNAs during Heat-Shock.

    Science.gov (United States)

    Andersen, Kasper L; Beckert, Bertrand; Masquida, Benoit; Johansen, Steinar D; Nielsen, Henrik

    2016-10-31

    Group I introns in nuclear ribosomal RNA of eukaryotic microorganisms are processed by splicing or circularization. The latter results in formation of full-length circular introns without ligation of the exons and has been proposed to be active in intron mobility. We applied qRT-PCR to estimate the copy number of circular intron RNA from the myxomycete Didymium iridis. In exponentially growing amoebae, the circular introns are nuclear and found in 70 copies per cell. During heat-shock, the circular form is up-regulated to more than 500 copies per cell. The intron harbours two ribozymes that have the potential to linearize the circle. To understand the structural features that maintain circle integrity, we performed chemical and enzymatic probing of the splicing ribozyme combined with molecular modeling to arrive at models of the inactive circular form and its active linear counterpart. We show that the two forms have the same overall structure but differ in key parts, including the catalytic core element P7 and the junctions at which reactions take place. These differences explain the relative stability of the circular species, demonstrate how it is prone to react with a target molecule for circle integration and thus supports the notion that the circular form is a biologically significant molecule possibly with a role in intron mobility.

  2. Functionality of in vitro reconstituted group II intron RmInt1-derived ribonucleoprotein particles

    Directory of Open Access Journals (Sweden)

    María Dolores Molina-Sánchez

    2016-09-01

    Full Text Available The functional unit of mobile group II introns is a ribonucleoprotein particle (RNP consisting of the intron-encoded protein (IEP and the excised intron RNA. The IEP has reverse transcriptase activity but also promotes RNA splicing, and the RNA-protein complex triggers site-specific DNA insertion by reverse splicing, in a process called retrohoming. In vitro reconstituted ribonucleoprotein complexes from the Lactococcus lactis group II intron Ll.LtrB, which produce a double strand break, have recently been studied as a means of developing group II intron-based gene targeting methods for higher organisms. The Sinorhizobium meliloti group II intron RmInt1 is an efficient mobile retroelement, the dispersal of which appears to be linked to transient single-stranded DNA during replication. The RmInt1IEP lacks the endonuclease domain (En and cannot cut the bottom strand to generate the 3’ end to initiate reverse transcription. We used an Escherichia coli expression system to produce soluble and active RmInt1 IEP and reconstituted RNPs with purified components in vitro. The RNPs generated were functional and reverse-spliced into a single-stranded DNA target. This work constitutes the starting point for the use of group II introns lacking DNA endonuclease domain-derived RNPs for highly specific gene targeting methods.

  3. Pre-Mrna Introns as a Model for Cryptographic Algorithm:. Theory and Experiments

    Science.gov (United States)

    Regoli, Massimo

    2010-01-01

    The RNA-Crypto System (shortly RCS) is a symmetric key algorithm to cipher data. The idea for this new algorithm starts from the observation of nature. In particular from the observation of RNA behavior and some of its properties. In particular the RNA sequences have some sections called Introns. Introns, derived from the term "intragenic regions", are non-coding sections of precursor mRNA (pre-mRNA) or other RNAs, that are removed (spliced out of the RNA) before the mature RNA is formed. Once the introns have been spliced out of a pre-mRNA, the resulting mRNA sequence is ready to be translated into a protein. The corresponding parts of a gene are known as introns as well. The nature and the role of Introns in the pre-mRNA is not clear and it is under ponderous researches by Biologists but, in our case, we will use the presence of Introns in the RNA-Crypto System output as a strong method to add chaotic non coding information and an unnecessary behaviour in the access to the secret key to code the messages. In the RNA-Crypto System algorithm the introns are sections of the ciphered message with non-coding information as well as in the precursor mRNA.

  4. First intron retention in part transcripts of OsEBP-89 gene in tissues of rice

    Institute of Scientific and Technical Information of China (English)

    2002-01-01

    OsEBP-89 is a transcription factor gene of rice.It contains two introns. Using RT-PCR and Southern hybridization to study OsEBP-89 tissue-specific expression, we found that its first intron (115 bp in length) of its was retained in a fraction of its transcripts of this gene in rice developing seeds. Furthermore, two OsEBP-89 cDNA clones (c89L and c89LH) were screened from a rice cDNA library.Sequence analysis revealed that the first intron was retained in c89L clone, whereas, both the first and second intron sequences were spliced in c89LH. In addition to developing seeds, the first intron unspliced transcripts of OsEBP-89 are detected in leaves and roots of rice, too. However, the ratio of the first intron unspliced to spliced OsEBP-89 transcripts varied in different tissues examined. The potential biological significance of intron retention in OsEBP-89 transcript was discussed.

  5. a Simple Symmetric Algorithm Using a Likeness with Introns Behavior in RNA Sequences

    Science.gov (United States)

    Regoli, Massimo

    2009-02-01

    The RNA-Crypto System (shortly RCS) is a symmetric key algorithm to cipher data. The idea for this new algorithm starts from the observation of nature. In particular from the observation of RNA behavior and some of its properties. The RNA sequences has some sections called Introns. Introns, derived from the term "intragenic regions", are non-coding sections of precursor mRNA (pre-mRNA) or other RNAs, that are removed (spliced out of the RNA) before the mature RNA is formed. Once the introns have been spliced out of a pre-mRNA, the resulting mRNA sequence is ready to be translated into a protein. The corresponding parts of a gene are known as introns as well. The nature and the role of Introns in the pre-mRNA is not clear and it is under ponderous researches by Biologists but, in our case, we will use the presence of Introns in the RNA-Crypto System output as a strong method to add chaotic non coding information and an unnecessary behaviour in the access to the secret key to code the messages. In the RNA-Crypto System algoritnm the introns are sections of the ciphered message with non-coding information as well as in the precursor mRNA.

  6. Alternative splicing of a group II intron in a surface layer protein gene in Clostridium tetani.

    Science.gov (United States)

    McNeil, Bonnie A; Simon, Dawn M; Zimmerly, Steven

    2014-02-01

    Group II introns are ribozymes and retroelements found in bacteria, and are thought to have been the ancestors of nuclear pre-mRNA introns. Whereas nuclear introns undergo prolific alternative splicing in some species, group II introns are not known to carry out equivalent reactions. Here we report a group II intron in the human pathogen Clostridium tetani, which undergoes four alternative splicing reactions in vivo. Together with unspliced transcript, five mRNAs are produced, each encoding a distinct surface layer protein isoform. Correct fusion of exon reading frames requires a shifted 5' splice site located 8 nt upstream of the canonical boundary motif. The shifted junction is accomplished by an altered IBS1-EBS1 pairing between the intron and 5' exon. Growth of C. tetani under a variety of conditions did not result in large changes in alternative splicing levels, raising the possibility that alternative splicing is constitutive. This work demonstrates a novel type of gene organization and regulation in bacteria, and provides an additional parallel between group II and nuclear pre-mRNA introns.

  7. Widespread dysregulation of MiRNAs by MYCN amplification and chromosomal imbalances in neuroblastoma: association of miRNA expression with survival.

    LENUS (Irish Health Repository)

    Bray, Isabella

    2009-01-01

    MiRNAs regulate gene expression at a post-transcriptional level and their dysregulation can play major roles in the pathogenesis of many different forms of cancer, including neuroblastoma, an often fatal paediatric cancer originating from precursor cells of the sympathetic nervous system. We have analyzed a set of neuroblastoma (n = 145) that is broadly representative of the genetic subtypes of this disease for miRNA expression (430 loci by stem-loop RT qPCR) and for DNA copy number alterations (array CGH) to assess miRNA involvement in disease pathogenesis. The tumors were stratified and then randomly split into a training set (n = 96) and a validation set (n = 49) for data analysis. Thirty-seven miRNAs were significantly over- or under-expressed in MYCN amplified tumors relative to MYCN single copy tumors, indicating a potential role for the MYCN transcription factor in either the direct or indirect dysregulation of these loci. In addition, we also determined that there was a highly significant correlation between miRNA expression levels and DNA copy number, indicating a role for large-scale genomic imbalances in the dysregulation of miRNA expression. In order to directly assess whether miRNA expression was predictive of clinical outcome, we used the Random Forest classifier to identify miRNAs that were most significantly associated with poor overall patient survival and developed a 15 miRNA signature that was predictive of overall survival with 72.7% sensitivity and 86.5% specificity in the validation set of tumors. We conclude that there is widespread dysregulation of miRNA expression in neuroblastoma tumors caused by both over-expression of the MYCN transcription factor and by large-scale chromosomal imbalances. MiRNA expression patterns are also predicative of clinical outcome, highlighting the potential for miRNA mediated diagnostics and therapeutics.

  8. Widespread dysregulation of MiRNAs by MYCN amplification and chromosomal imbalances in neuroblastoma: association of miRNA expression with survival.

    Directory of Open Access Journals (Sweden)

    Isabella Bray

    Full Text Available MiRNAs regulate gene expression at a post-transcriptional level and their dysregulation can play major roles in the pathogenesis of many different forms of cancer, including neuroblastoma, an often fatal paediatric cancer originating from precursor cells of the sympathetic nervous system. We have analyzed a set of neuroblastoma (n = 145 that is broadly representative of the genetic subtypes of this disease for miRNA expression (430 loci by stem-loop RT qPCR and for DNA copy number alterations (array CGH to assess miRNA involvement in disease pathogenesis. The tumors were stratified and then randomly split into a training set (n = 96 and a validation set (n = 49 for data analysis. Thirty-seven miRNAs were significantly over- or under-expressed in MYCN amplified tumors relative to MYCN single copy tumors, indicating a potential role for the MYCN transcription factor in either the direct or indirect dysregulation of these loci. In addition, we also determined that there was a highly significant correlation between miRNA expression levels and DNA copy number, indicating a role for large-scale genomic imbalances in the dysregulation of miRNA expression. In order to directly assess whether miRNA expression was predictive of clinical outcome, we used the Random Forest classifier to identify miRNAs that were most significantly associated with poor overall patient survival and developed a 15 miRNA signature that was predictive of overall survival with 72.7% sensitivity and 86.5% specificity in the validation set of tumors. We conclude that there is widespread dysregulation of miRNA expression in neuroblastoma tumors caused by both over-expression of the MYCN transcription factor and by large-scale chromosomal imbalances. MiRNA expression patterns are also predicative of clinical outcome, highlighting the potential for miRNA mediated diagnostics and therapeutics.

  9. Identification and target prediction of miRNAs specifically expressed in rat neural tissue

    Directory of Open Access Journals (Sweden)

    Tu Kang

    2009-05-01

    Full Text Available Abstract Background MicroRNAs (miRNAs are a large group of RNAs that play important roles in regulating gene expression and protein translation. Several studies have indicated that some miRNAs are specifically expressed in human, mouse and zebrafish tissues. For example, miR-1 and miR-133 are specifically expressed in muscles. Tissue-specific miRNAs may have particular functions. Although previous studies have reported the presence of human, mouse and zebrafish tissue-specific miRNAs, there have been no detailed reports of rat tissue-specific miRNAs. In this study, Home-made rat miRNA microarrays which established in our previous study were used to investigate rat neural tissue-specific miRNAs, and mapped their target genes in rat tissues. This study will provide information for the functional analysis of these miRNAs. Results In order to obtain as complete a picture of specific miRNA expression in rat neural tissues as possible, customized miRNA microarrays with 152 selected miRNAs from miRBase were used to detect miRNA expression in 14 rat tissues. After a general clustering analysis, 14 rat tissues could be clearly classified into neural and non-neural tissues based on the obtained expression profiles with p values Conclusion Our work provides a global view of rat neural tissue-specific miRNA profiles and a target map of miRNAs, which is expected to contribute to future investigations of miRNA regulatory mechanisms in neural systems.

  10. Differential expression patterns of conserved miRNAs and isomiRs during Atlantic halibut development

    Directory of Open Access Journals (Sweden)

    Bizuayehu Teshome T

    2012-01-01

    Full Text Available Abstract Background MicroRNAs (miRNAs play a major role in animal ontogenesis. Size variants of miRNAs, isomiRs, are observed along with the main miRNA types, but their origin and possible biological role are uncovered yet. Developmental profiles of miRNAs have been reported in few fish species only and, to our knowledge, differential expressions of isomiRs have not yet been shown during fish development. Atlantic halibut, Hippoglossus hippoglossus L., undergoes dramatic metamorphosis during early development from symmetrical pelagic larval stage to unsymmetrical flatfish. No data exist on role of miRNAs in halibut metamorphosis. Results miRNA profiling using SOLiD deep sequencing technology revealed a total of 199 conserved, one novel antisense, and one miRNA* mature form. Digital expression profiles of selected miRNAs were validated using reverse transcription quantitative PCR. We found developmental transition-specific miRNA expression. Expression of some miRNA* exceeded the guide strand miRNA. We revealed that nucleotide truncations and/or additions at the 3' end of mature miRNAs resulted in size variants showing differential expression patterns during the development in a number of miRNA families. We confirmed the presence of isomiRs by cloning and Sanger sequencing. Also, we found inverse relationship between expression levels of sense/antisense miRNAs during halibut development. Conclusion Developmental transitions during early development of Atlantic halibut are associated with expression of certain miRNA types. IsomiRs are abundant and often show differential expression during the development.

  11. Identification and characterization of new miRNAs cloned from normal mouse mammary gland

    Directory of Open Access Journals (Sweden)

    Vilotte Jean-Luc

    2009-04-01

    Full Text Available Abstract Background MicroRNAs (miRNAs are small non-coding RNAs that have been found to play important roles in silencing target genes and that are involved in the regulation of various normal cellular processes. Until now their implication in the mammary gland biology was suggested by few studies mainly focusing on pathological situations allowing the characterization of miRNAs as markers of breast cancer tumour classes. If in the normal mammary gland, the expression of known miRNAs has been studied in human and mice but the full repertoire of miRNAs expressed in this tissue is not yet available. Results To extend the repertoire of mouse mammary gland expressed miRNAs, we have constructed several libraries of small miRNAs allowing the cloning of 455 sequences. After bioinformatics' analysis, 3 known miRNA (present in miRbase and 33 new miRNAs were identified. Expression of 24 out of the 33 has been confirmed by RT-PCR. Expression of none of them was found to be mammary specific, despite a tissue-restricted distribution of some of them. No correlation could be established between their expression pattern and evolutionary conservation. Six of them appear to be mouse specific. In several cases, multiple potential precursors of miRNA were present in the genome and we have developed a strategy to determine which of them was able to mature the miRNA. Conclusion The cloning approach has allowed improving the repertoire of miRNAs in the mammary gland, an evolutionary recent organ. This tissue is a good candidate to find tissue-specific miRNAs and to detect miRNA specific to mammals. We provide evidence for 24 new miRNA. If none of them is mammary gland specific, a few of them are not ubiquitously expressed. For the first time 6 mouse specific miRNA have been identified.

  12. Intron sequences provide a tool for high-resolution phylogenetic analysis of volvocine algae.

    Science.gov (United States)

    Liss, M; Kirk, D L; Beyser, K; Fabry, S

    1997-03-01

    Three nuclear spliceosomal introns in conserved locations were amplified and sequenced from 28 strains representing 14 species and 4 genera of volvocalean green algae. Data derived from the three different introns yielded congruent results in nearly all cases. In pairwise comparisons, a spectrum of taxon-specific sequence differences ranging from complete identity to no significant similarity was observed, with the most distantly related organisms lacking any conserved elements apart from exon-intron boundaries and a pyrimidine-rich stretch near the 3' splice site. A metric (SI50), providing a measure of the degree of similarity of any pair of intron sequences, was defined and used to calculate phylogenetic distances between organisms whose introns displayed statistically significant similarities. The rate of sequences divergence in the introns was great enough to provide useful information about relationships among different geographical isolates of a single species, but in most cases was too great to provide reliable guides to relationships above the species level. A substitution rate of approximately 3 x 10(-8) per intron position per year was estimated, which is about 150-fold higher than in nuclear genes encoding rRNA and about 10-fold higher than the synonymous substitution rate in protein-coding regions. Thus, these homologous introns not only provide useful information about intraspecific phylogenetic relationships, but also illustrate the concept that different parts of a gene may be subject to extremely different intensities of selection. The intron data generated here (1) reliably resolve for the first time the relationships among the five most extensively studied strains of Volvox, (2) reveal that two other Volvox species may be more closely related than had previously been suspected, (3) confirm prior evidence that particular isolates of Eudorina elegans and Pleodorina illinoisensis appear to be sibling taxa, and (4) contribute to the resolution of

  13. Changes in exon–intron structure during vertebrate evolution affect the splicing pattern of exons

    Science.gov (United States)

    Gelfman, Sahar; Burstein, David; Penn, Osnat; Savchenko, Anna; Amit, Maayan; Schwartz, Schraga; Pupko, Tal; Ast, Gil

    2012-01-01

    Exon–intron architecture is one of the major features directing the splicing machinery to the short exons that are located within long flanking introns. However, the evolutionary dynamics of exon–intron architecture and its impact on splicing is largely unknown. Using a comparative genomic approach, we analyzed 17 vertebrate genomes and reconstructed the ancestral motifs of both 3′ and 5′ splice sites, as also the ancestral length of exons and introns. Our analyses suggest that vertebrate introns increased in length from the shortest ancestral introns to the longest primate introns. An evolutionary analysis of splice sites revealed that weak splice sites act as a restrictive force keeping introns short. In contrast, strong splice sites allow recognition of exons flanked by long introns. Reconstruction of the ancestral state suggests these phenomena were not prevalent in the vertebrate ancestor, but appeared during vertebrate evolution. By calculating evolutionary rate shifts in exons, we identified cis-acting regulatory sequences that became fixed during the transition from early vertebrates to mammals. Experimental validations performed on a selection of these hexamers confirmed their regulatory function. We additionally revealed many features of exons that can discriminate alternative from constitutive exons. These features were integrated into a machine-learning approach to predict whether an exon is alternative. Our algorithm obtains very high predictive power (AUC of 0.91), and using these predictions we have identified and successfully validated novel alternatively spliced exons. Overall, we provide novel insights regarding the evolutionary constraints acting upon exons and their recognition by the splicing machinery. PMID:21974994

  14. Did group II intron proliferation in an endosymbiont-bearing archaeon create eukaryotes?

    Directory of Open Access Journals (Sweden)

    Poole Anthony M

    2006-12-01

    Full Text Available Abstract Martin & Koonin recently proposed that the eukaryote nucleus evolved as a quality control mechanism to prevent ribosome readthrough into introns. In their scenario, the bacterial ancestor of mitochondria was resident in an archaeal cell, and group II introns (carried by the fledgling mitochondrion inserted into coding regions in the archaeal host genome. They suggest that if transcription and translation were coupled, and because splicing is expected to have been slower than translation, the effect of insertion would have been ribosome readthrough into introns, resulting in production of aberrant proteins. The emergence of the nuclear compartment would thus have served to separate transcription and splicing from translation, thereby alleviating this problem. In this article, I argue that Martin & Koonin's model is not compatible with current knowledge. The model requires that group II introns would spread aggressively through an archaeal genome. It is well known that selfish elements can spread through an outbreeding sexual population despite a substantial fitness cost to the host. The same is not true for asexual lineages however, where both theory and observation argue that such elements will be under pressure to reduce proliferation, and may be lost completely. The recent introduction of group II introns into archaea by horizontal transfer provides a natural test case with which to evaluate Martin & Koonin's model. The distribution and behaviour of these introns fits prior theoretical expectations, not the scenario of aggressive proliferation advocated by Martin & Koonin. I therefore conclude that the mitochondrial seed hypothesis for the origin of eukaryote introns, on which their model is based, better explains the early expansion of introns in eukaryotes. The mitochondrial seed hypothesis has the capacity to separate the origin of eukaryotes from the origin of introns, leaving open the possibility that the cell that engulfed the

  15. Intron Retention and TE Exonization Events in ZRANB2

    Directory of Open Access Journals (Sweden)

    Sang-Je Park

    2012-01-01

    Full Text Available The Zinc finger, RAN-binding domain-containing protein 2 (ZRANB2, contains arginine/serine-rich (RS domains that mediate its function in the regulation of alternative splicing. The ZRANB2 gene contains 2 LINE elements (L3b, Plat_L3 between the 9th and 10th exons. We identified the exonization event of a LINE element (Plat_L3. Using genomic PCR, RT-PCR amplification, and sequencing of primate DNA and RNA samples, we analyzed the evolutionary features of ZRANB2 transcripts. The results indicated that 2 of the LINE elements were integrated in human and all of the tested primate samples (hominoids: 3 species; Old World monkey: 8 species; New World monkey: 6 species; prosimian: 1 species. Human, rhesus monkey, crab-eating monkey, African-green monkey, and marmoset harbor the exon derived from LINE element (Plat_L3. RT-PCR amplification revealed the long transcripts and their differential expression patterns. Intriguingly, these long transcripts were abundantly expressed in Old World monkey lineages (rhesus, crab-eating, and African-green monkeys and were expressed via intron retention (IR. Thus, the ZRANB2 gene produces 3 transcript variants in which the Cterminus varies by transposable elements (TEs exonization and IR mechanisms. Therefore, ZRANB2 is valuable for investigating the evolutionary mechanisms of TE exonization and IR during primate evolution.

  16. Insertion of Introns: A Strategy to Facilitate Assembly of Infectious Full Length Clones

    DEFF Research Database (Denmark)

    Johansen, Ida Elisabeth; Lund, Ole Søgaard

    2008-01-01

    Some DNA fragments are difficult to clone in Escherichia coli by standard methods. It has been speculated that unintended transcription and translation result in expression of proteins that are toxic to the bacteria. This problem is frequently observed during assembly of infectious full......-length virus clones. If the clone is constructed for transcription in vivo, interrupting the virus sequence with an intron can solve the toxicity problem. The AU-rich introns generally contain many stop codons, which interrupt translation in E. coli, while the intron sequence is precisely eliminated from...

  17. Inheritance of the group I rDNA intron in Tetrahymena pigmentosa

    DEFF Research Database (Denmark)

    Nielsen, Henrik; Simon, E M; Engberg, J

    1992-01-01

    . In an analysis of vegetatively growing cells containing intron+ and intron- rDNA, initially in the same macronucleus, we similarly find no evidence of intron homing. During the course of this work, we observed to our surprise that progeny clones from some crosses contained three types of rDNA. One possible...... explanation is that T. pigmentosa has two rdn loci in contrast to the single locus found in T. thermophila. Some of the progeny clones from the genetic analysis were expanded for several hundred generations, and allelic assortment of the rDNA was demonstrated by subcloning analysis....

  18. Identification of miRNAs associated with recurrence of stage II colorectal cancer

    DEFF Research Database (Denmark)

    Christensen, Lise Lotte; Tobiasen, Heidi; Schepeler, Troels;

    . Kaplan Meier analysis showed significant correlations between low expression of the four miRNAs and poor prognosis. Functional characterization of their impact on cell viability using MTT analysis demonstrated that they all inhibit the viability of HCT116 cells. One miRNAs also inhibited the viability...... selected for detailed analysis. Luciferase miRNA target reporter assays confirmed all three mRNAs to be direct targets. Secondly, siRNA mediated knock-down of the potential targets resulted in growth suppression of HCT116 cells, mimicking the effect of the miRNA. In conclusion, miRNAs are associated...

  19. Identification of miRNA targets with stable isotope labeling by amino acids in cell culture

    DEFF Research Database (Denmark)

    Vinther, Jeppe; Hedegaard, Mads Marquardt; Gardner, Paul Phillip

    2006-01-01

    miRNAs are small noncoding RNAs that regulate gene expression. We have used stable isotope labeling by amino acids in cell culture (SILAC) to investigate the effect of miRNA-1 on the HeLa cell proteome. Expression of 12 out of 504 investigated proteins was repressed by miRNA-1 transfection....... This repressed set of genes significantly overlaps with miRNA-1 regulated genes that have been identified with DNA array technology and are predicted by computational methods. Moreover, we find that the 3'-untranslated region for the repressed set are enriched in miRNA-1 complementary sites. Our findings...

  20. Transcriptome-Based Examination of Putative Pollen Allergens of Rice(Oryza sativa ssp.japonica)

    Institute of Scientific and Technical Information of China (English)

    Scott D.Russell; Prem L Bhalla; Mohan B.Singh

    2008-01-01

    Pollen allergens are among the most abundantly transcribed and translated products in the Iife history of plants,and particularly grasses.To identify different pollen allergens in rice,putative allergens were identified in the rice genome and their expression characterized using the Affymetrix 57K rice GeneChip microarray.Among the most abundant pollen-specific candidate transcripts were Ory s 1 beta-expansin.Ory s 2,Ory s 7 EFhand,Ory s 11,Ory s 12 profilin A,Ory s 23,glycosyl hydrolase family 28(polygalacturonase).and FAD binding proteins.Highly expressed pollen proteins are frequently present in multiple copy numbers,sometimes with mirror images Iocated on nearby regions of the opposite DNA strand.Many of these are intronless and inserted as copies that retain nearly exact copies of their regulatory elements.Ory s 23 reflects low variability and high copy number,suggesting recent gene amplification.Some copies contain pseudogenes,which may reflect their origin through activity of retrotransposition;some putative allergenic sequences bear fusion products with repeat sequences of transposable elements(LTRs).The abundance of nearby repetitive sequences,activation of transposable elements.and high production of mRNA transcripts appear to coincide in pollen and may contribute to a syndrome in which highly transcribed proteins may be copied and inserted with streamlined features for translation,including grouping and removaI of introns.

  1. Frequent mutations of the CA simple sequence repeat in intron 1 of EGFR in mismatch repair-deficient colorectal cancers

    Institute of Scientific and Technical Information of China (English)

    Marie-Pierre Buisine; Thècla Lesuffleur; Agnès Wacrenier; Christophe Mariette; Emmanuelle Leteurtre; Fabienne Escande; Sana Aissi; Amandine Ketele; Annette Leclercq; Nicole Porchet

    2008-01-01

    AIM:To investigate the polymorphic simple sequence repeat in intron 1 of the epidermal growth factor receptor gene(EGFR)(CA-SSR I),which is known to affect the efficiency of gene transcription as a putative target of the mismatch repair (MMR) machinery in colorectal tumors.METHODS:The CA-SSR I genotype was analyzed in a total of 86 primary colorectal tumors,selected upon their microsatellite instability (MSI) status [42 with high frequency MSI (MSI-H) and 44 microsatellite stable (MSS)]and their respective normal tissue.The effect of the CASSR I genotype on the expression of the EGFR gene was evaluated in 18 specimens using quantitative real-time reverse transcription PCR and immunohistochemistry.RESULTS:Mutations in CA-SSR I were detected in 86%(36 of 42) of MSI-H colorectal tumors and 0% (0 of 44) of MSS tumors,indicating the EGFR gene as a novel putative specific target of the defective MMR system (P<0.001).Impaired expression of EGFR was detected in most of the colorectal tumors analyzed [6/12 (50%) at the mRNA level and 15/18 (83%) at the peptide level].However,no association was apparent between EGFR expression and CA-SSR I status in tumors or normal tissues.CONCLUSION:Our results suggest that CA-SSR I sequence does not contribute to the regulation of EGFR transcription in colon,and should thus not be considered as a promising predictive marker for response to EGFR inhibitors in patients with colorectal cancer.

  2. Prediction and Expression Analysis of miRNAs Associated with Heat Stress in Oryza sativa

    Institute of Scientific and Technical Information of China (English)

    B.SAILAJA; S.R.VOLETI; D.SUBRAHMANYAM; N.SARLA; V.VISHNU PRASANTH; V.P.BHADANA; S.K.MANGRAUTHIA

    2014-01-01

    Computational prediction of potential microRNAs (miRNAs) and their target genes was performed to identify the miRNAs and genes associated with temperature response in rice. The data of temperature-responsive miRNAs of Arabidopsis, and miRNAs and the whole genome data of rice were used to predict potential miRNAs in Oryza sativa involved in temperature response. A total of 55 miRNAs were common in both the species, and 27 miRNAs were predicted at the first time in rice. Target genes were searched for these 27 miRNAs in rice genome following stringent criteria. Real time PCR based on expression analysis of nine miRNAs showed that majority of the miRNAs were down regulated under heat stress for rice cultivar Nagina 22. Furthermore, miR169, miR1884 and miR160 showed differential expression in root and shoot tissues of rice. Identification and expression studies of miRNAs during heat stress will advance the understanding of gene regulation under stress in rice.

  3. miRNA gene promoters are frequent targets of aberrant DNA methylation in human breast cancer.

    Science.gov (United States)

    Vrba, Lukas; Muñoz-Rodríguez, José L; Stampfer, Martha R; Futscher, Bernard W

    2013-01-01

    miRNAs are important regulators of gene expression that are frequently deregulated in cancer, with aberrant DNA methylation being an epigenetic mechanism involved in this process. We previously identified miRNA promoter regions active in normal mammary cell types and here we analyzed which of these promoters are targets of aberrant DNA methylation in human breast cancer cell lines and breast tumor specimens. Using 5-methylcytosine immunoprecipitation coupled to miRNA tiling microarray hybridization, we performed comprehensive evaluation of DNA methylation of miRNA gene promoters in breast cancer. We found almost one third (55/167) of miRNA promoters were targets for aberrant methylation in breast cancer cell lines. Breast tumor specimens displayed DNA methylation of majority of these miRNA promoters, indicating that these changes in DNA methylation might be clinically relevant. Aberrantly methylated miRNA promoters were, similar to protein coding genes, enriched for promoters targeted by polycomb in normal cells. Detailed analysis of selected miRNA promoters revealed decreased expression of miRNA linked to increased promoter methylation for mir-31, mir-130a, let-7a-3/let-7b, mir-155, mir-137 and mir-34b/mir-34c genes. The proportion of miRNA promoters we found aberrantly methylated in breast cancer is several fold larger than that observed for protein coding genes, indicating an important role of DNA methylation in miRNA deregulation in cancer.

  4. Global Analysis of miRNA Gene Clusters and Gene Families Reveals Dynamic and Coordinated Expression

    Directory of Open Access Journals (Sweden)

    Li Guo

    2014-01-01

    Full Text Available To further understand the potential expression relationships of miRNAs in miRNA gene clusters and gene families, a global analysis was performed in 4 paired tumor (breast cancer and adjacent normal tissue samples using deep sequencing datasets. The compositions of miRNA gene clusters and families are not random, and clustered and homologous miRNAs may have close relationships with overlapped miRNA species. Members in the miRNA group always had various expression levels, and even some showed larger expression divergence. Despite the dynamic expression as well as individual difference, these miRNAs always indicated consistent or similar deregulation patterns. The consistent deregulation expression may contribute to dynamic and coordinated interaction between different miRNAs in regulatory network. Further, we found that those clustered or homologous miRNAs that were also identified as sense and antisense miRNAs showed larger expression divergence. miRNA gene clusters and families indicated important biological roles, and the specific distribution and expression further enrich and ensure the flexible and robust regulatory network.

  5. Transcriptome and small RNA deep sequencing reveals deregulation of miRNA biogenesis in human glioma.

    Science.gov (United States)

    Moore, Lynette M; Kivinen, Virpi; Liu, Yuexin; Annala, Matti; Cogdell, David; Liu, Xiuping; Liu, Chang-Gong; Sawaya, Raymond; Yli-Harja, Olli; Shmulevich, Ilya; Fuller, Gregory N; Zhang, Wei; Nykter, Matti

    2013-02-01

    Altered expression of oncogenic and tumour-suppressing microRNAs (miRNAs) is widely associated with tumourigenesis. However, the regulatory mechanisms underlying these alterations are poorly understood. We sought to shed light on the deregulation of miRNA biogenesis promoting the aberrant miRNA expression profiles identified in these tumours. Using sequencing technology to perform both whole-transcriptome and small RNA sequencing of glioma patient samples, we examined precursor and mature miRNAs to directly evaluate the miRNA maturation process, and examined expression profiles for genes involved in the major steps of miRNA biogenesis. We found that ratios of mature to precursor forms of a large number of miRNAs increased with the progression from normal brain to low-grade and then to high-grade gliomas. The expression levels of genes involved in each of the three major steps of miRNA biogenesis (nuclear processing, nucleo-cytoplasmic transport, and cytoplasmic processing) were systematically altered in glioma tissues. Survival analysis of an independent data set demonstrated that the alteration of genes involved in miRNA maturation correlates with survival in glioma patients. Direct quantification of miRNA maturation with deep sequencing demonstrated that deregulation of the miRNA biogenesis pathway is a hallmark for glioma genesis and progression.

  6. Barcoding bias in high-throughput multiplex sequencing of miRNA.

    Science.gov (United States)

    Alon, Shahar; Vigneault, Francois; Eminaga, Seda; Christodoulou, Danos C; Seidman, Jonathan G; Church, George M; Eisenberg, Eli

    2011-09-01

    Second-generation sequencing is gradually becoming the method of choice for miRNA detection and expression profiling. Given the relatively small number of miRNAs and improvements in DNA sequencing technology, studying miRNA expression profiles of multiple samples in a single flow cell lane becomes feasible. Multiplexing strategies require marking each miRNA library with a DNA barcode. Here we report that barcodes introduced through adapter ligation confer significant bias on miRNA expression profiles. This bias is much higher than the expected Poisson noise and masks significant expression differences between miRNA libraries. This bias can be eliminated by adding barcodes during PCR amplification of libraries. The accuracy of miRNA expression measurement in multiplexed experiments becomes a function of sample number.

  7. miRNA Repertoires of Demosponges Stylissa carteri and Xestospongia testudinaria

    KAUST Repository

    Liew, Yi Jin

    2016-02-12

    MicroRNAs (miRNAs) are small regulatory RNAs that are involved in many biological process in eukaryotes. They play a crucial role in modulating genetic expression of their targets, which makes them integral components of transcriptional regulatory networks. As sponges (phylum Porifera) are commonly considered the most basal metazoan, the in-depth capture of miRNAs from these organisms provides additional clues to the evolution of miRNA families in metazoans. Here, we identified the core proteins involved in the biogenesis of miRNAs, and obtained evidence for bona fide miRNA sequences for two marine sponges Stylissa carteri and Xestospongia testudinaria (11 and 19 respectively). Our analysis identified several miRNAs that are conserved amongst demosponges, and revealed that all of the novel miRNAs identified in these two species are specific to the class Demospongiae.

  8. Analysis of miRNA market trends reveals hotspots of research activity.

    Science.gov (United States)

    Oosta, Gary; Razvi, Enal

    2012-04-01

    We have conducted an analysis of the miRNA research marketplace by evaluating the publication trends in the field. In this article, we present the results of our analysis which reveals that hotspots exist in terms of research activities in the miRNA space--these hotspots illustrate the areas in the miRNA research space where specific miRNAs have been extensively studied, and other areas that represent new territory. We frame these data into the context of areas of opportunity for miRNA content harvest versus segments of opportunity for the development of research tools. Also presented in this article are the primary market data from online surveys we have performed with researchers involved in miRNA research around the world. Taken together, these data frame the current state of the miRNA marketplace and provide niches of opportunity for new entrants into this space.

  9. miRNA Repertoires of Demosponges Stylissa carteri and Xestospongia testudinaria.

    Directory of Open Access Journals (Sweden)

    Yi Jin Liew

    Full Text Available MicroRNAs (miRNAs are small regulatory RNAs that are involved in many biological process in eukaryotes. They play a crucial role in modulating genetic expression of their targets, which makes them integral components of transcriptional regulatory networks. As sponges (phylum Porifera are commonly considered the most basal metazoan, the in-depth capture of miRNAs from these organisms provides additional clues to the evolution of miRNA families in metazoans. Here, we identified the core proteins involved in the biogenesis of miRNAs, and obtained evidence for bona fide miRNA sequences for two marine sponges Stylissa carteri and Xestospongia testudinaria (11 and 19 respectively. Our analysis identified several miRNAs that are conserved amongst demosponges, and revealed that all of the novel miRNAs identified in these two species are specific to the class Demospongiae.

  10. miRNA in the regulation of skeletal muscle adaptation to acute endurance exercise in C57Bl/6J male mice.

    Directory of Open Access Journals (Sweden)

    Adeel Safdar

    Full Text Available MicroRNAs (miRNAs are evolutionarily conserved small non-coding RNA species involved in post-transcriptional gene regulation. In vitro studies have identified a small number of skeletal muscle-specific miRNAs which play a crucial role in myoblast proliferation and differentiation. In skeletal muscle, an acute bout of endurance exercise results in the up-regulation of transcriptional networks that regulate mitochondrial biogenesis, glucose and fatty acid metabolism, and skeletal muscle remodelling. The purpose of this study was to assess the expressional profile of targeted miRNA species following an acute bout of endurance exercise and to determine relationships with previously established endurance exercise responsive transcriptional networks. C57Bl/6J wild-type male mice (N = 7/group were randomly assigned to either sedentary or forced-endurance exercise (treadmill run @ 15 m/min for 90 min group. The endurance exercise group was sacrificed three hours following a single bout of exercise. The expression of miR- 181, 1, 133, 23, and 107, all of which have been predicted to regulate transcription factors and co-activators involved in the adaptive response to exercise, was measured in quadriceps femoris muscle. Endurance exercise significantly increased the expression of miR-181, miR-1, and miR-107 by 37%, 40%, and 56%, respectively, and reduced miR-23 expression by 84% (PmiRNA-23, a putative negative regulator of PGC-1alpha was consistent with increased expression of PGC-1alpha mRNA and protein along with several downstream targets of PGC-1alpha including ALAS, CS, and cytochrome c mRNA. PDK4 protein content remains unaltered despite an increase in its putative negative regulator, miR-107, and PDK4 mRNA expression. mRNA expression of miRNA processing machinery (Drosha, Dicer, and DGCR8 remained unchanged. We conclude that miRNA-mediated post

  11. Origin and evolution of a new retained intron on the vulcan gene in Drosophila melanogaster subgroup species.

    Science.gov (United States)

    Zhan, Leilei; Meng, Qiaohong; Chen, Ran; Yue, Yuan; Jin, Yongfeng

    2014-10-01

    Although numerous intron gains have been discovered, the mechanisms of intron creation have proven to be elusive. Previous study revealed that the vulcan gene of Drosophila melanogaster contained four exons in its coding region. In the current study, a newly created intron (Intron L) was identified on exon 2 of vulcan in D. melanogaster by comparing expression sequence tags. The RT-PCR experiment revealed that Intron L was associated with intron retention, in which two alternative transcripts of the gene differ by the inclusion or removal of an intron. It was found that Intron L was created by intronization of exonic sequence, and its donor and acceptor splice sites were created by synonymous mutation, leading to the origin of a new vulcan protein that is 22 amino acids shorter than the previously reported vulcan protein. Moreover, to track the origin of Intron L, 36 orthologous genes of species of Drosophila were cloned or annotated, and phylogenetic analysis was carried out. It indicated that the common ancestor of D. melangaster subgroup species created Intron L about 15 million years ago.

  12. Insights into the strategies used by related group II introns to adapt successfully for the colonisation of a bacterial genome.

    Science.gov (United States)

    Martínez-Rodríguez, Laura; García-Rodríguez, Fernando M; Molina-Sánchez, María Dolores; Toro, Nicolás; Martínez-Abarca, Francisco

    2014-01-01

    Group II introns are self-splicing RNAs and site-specific mobile retroelements found in bacterial and organellar genomes. The group II intron RmInt1 is present at high copy number in Sinorhizobium meliloti species, and has a multifunctional intron-encoded protein (IEP) with reverse transcriptase/maturase activities, but lacking the DNA-binding and endonuclease domains. We characterized two RmInt1-related group II introns RmInt2 from S. meliloti strain GR4 and Sr.md.I1 from S. medicae strain WSM419 in terms of splicing and mobility activities. We used both wild-type and engineered intron-donor constructs based on ribozyme ΔORF-coding sequence derivatives, and we determined the DNA target requirements for RmInt2, the element most distantly related to RmInt1. The excision and mobility patterns of intron-donor constructs expressing different combinations of IEP and intron RNA provided experimental evidence for the co-operation of IEPs and intron RNAs from related elements in intron splicing and, in some cases, in intron homing. We were also able to identify the DNA target regions recognized by these IEPs lacking the DNA endonuclease domain. Our results provide new insight into the versatility of related group II introns and the possible co-operation between these elements to facilitate the colonization of bacterial genomes.

  13. Recent mobility of plastid encoded group II introns and twintrons in five strains of the unicellular red alga Porphyridium

    Directory of Open Access Journals (Sweden)

    Marie-Mathilde Perrineau

    2015-06-01

    Full Text Available Group II introns are closely linked to eukaryote evolution because nuclear spliceosomal introns and the small RNAs associated with the spliceosome are thought to trace their ancient origins to these mobile elements. Therefore, elucidating how group II introns move, and how they lose mobility can potentially shed light on fundamental aspects of eukaryote biology. To this end, we studied five strains of the unicellular red alga Porphyridium purpureum that surprisingly contain 42 group II introns in their plastid genomes. We focused on a subset of these introns that encode mobility-conferring intron-encoded proteins (IEPs and found them to be distributed among the strains in a lineage-specific manner. The reverse transcriptase and maturase domains were present in all lineages but the DNA endonuclease domain was deleted in vertically inherited introns, demonstrating a key step in the loss of mobility. P. purpureum plastid intron RNAs had a classic group IIB secondary structure despite variability in the DIII and DVI domains. We report for the first time the presence of twintrons (introns-within-introns, derived from the same mobile element in Rhodophyta. The P. purpureum IEPs and their mobile introns provide a valuable model for the study of mobile retroelements in eukaryotes and offer promise for biotechnological applications.

  14. Recent mobility of plastid encoded group II introns and twintrons in five strains of the unicellular red alga Porphyridium.

    Science.gov (United States)

    Perrineau, Marie-Mathilde; Price, Dana C; Mohr, Georg; Bhattacharya, Debashish

    2015-01-01

    Group II introns are closely linked to eukaryote evolution because nuclear spliceosomal introns and the small RNAs associated with the spliceosome are thought to trace their ancient origins to these mobile elements. Therefore, elucidating how group II introns move, and how they lose mobility can potentially shed light on fundamental aspects of eukaryote biology. To this end, we studied five strains of the unicellular red alga Porphyridium purpureum that surprisingly contain 42 group II introns in their plastid genomes. We focused on a subset of these introns that encode mobility-conferring intron-encoded proteins (IEPs) and found them to be distributed among the strains in a lineage-specific manner. The reverse transcriptase and maturase domains were present in all lineages but the DNA endonuclease domain was deleted in vertically inherited introns, demonstrating a key step in the loss of mobility. P. purpureum plastid intron RNAs had a classic group IIB secondary structure despite variability in the DIII and DVI domains. We report for the first time the presence of twintrons (introns-within-introns, derived from the same mobile element) in Rhodophyta. The P. purpureum IEPs and their mobile introns provide a valuable model for the study of mobile retroelements in eukaryotes and offer promise for biotechnological applications.

  15. miRNA genes of an invasive vector mosquito, Aedes albopictus.

    Directory of Open Access Journals (Sweden)

    Jinbao Gu

    Full Text Available Aedes albopictus, a vector of Dengue and Chikungunya viruses, is a robust invasive species in both tropical and temperate environments. MicroRNAs (miRNAs regulate gene expression and biological processes including embryonic development, innate immunity and infection. While a number of miRNAs have been discovered in some mosquitoes, no comprehensive effort has been made to characterize them from different developmental stages from a single species. Systematic analysis of miRNAs in Ae. albopictus will improve our understanding of its basic biology and inform novel strategies to prevent virus transmission. Between 10-14 million Illumina sequencing reads per sample were obtained from embryos, larvae, pupae, adult males, sugar-fed and blood-fed adult females. A total of 119 miRNA genes represented by 215 miRNA or miRNA star (miRNA* sequences were identified, 15 of which are novel. Eleven, two, and two of the newly-discovered miRNA genes appear specific to Aedes, Culicinae, and Culicidae, respectively. A number of miRNAs accumulate predominantly in one or two developmental stages and the large number that showed differences in abundance following a blood meal likely are important in blood-induced mosquito biology. Gene Ontology (GO analysis of the targets of all Ae. albopictus miRNAs provides a useful starting point for the study of their functions in mosquitoes. This study is the first systematic analysis of miRNAs based on deep-sequencing of small RNA samples of all developmental stages of a mosquito species. A number of miRNAs are related to specific physiological states, most notably, pre- and post-blood feeding. The distribution of lineage-specific miRNAs is consistent with mosquito phylogeny and the presence of a number of Aedes-specific miRNAs likely reflects the divergence between the Aedes and Culex genera.

  16. miRNA genes of an invasive vector mosquito, Aedes albopictus.

    Science.gov (United States)

    Gu, Jinbao; Hu, Wanqi; Wu, Jinya; Zheng, Peiming; Chen, Maoshan; James, Anthony A; Chen, Xiaoguang; Tu, Zhijian

    2013-01-01

    Aedes albopictus, a vector of Dengue and Chikungunya viruses, is a robust invasive species in both tropical and temperate environments. MicroRNAs (miRNAs) regulate gene expression and biological processes including embryonic development, innate immunity and infection. While a number of miRNAs have been discovered in some mosquitoes, no comprehensive effort has been made to characterize them from different developmental stages from a single species. Systematic analysis of miRNAs in Ae. albopictus will improve our understanding of its basic biology and inform novel strategies to prevent virus transmission. Between 10-14 million Illumina sequencing reads per sample were obtained from embryos, larvae, pupae, adult males, sugar-fed and blood-fed adult females. A total of 119 miRNA genes represented by 215 miRNA or miRNA star (miRNA*) sequences were identified, 15 of which are novel. Eleven, two, and two of the newly-discovered miRNA genes appear specific to Aedes, Culicinae, and Culicidae, respectively. A number of miRNAs accumulate predominantly in one or two developmental stages and the large number that showed differences in abundance following a blood meal likely are important in blood-induced mosquito biology. Gene Ontology (GO) analysis of the targets of all Ae. albopictus miRNAs provides a useful starting point for the study of their functions in mosquitoes. This study is the first systematic analysis of miRNAs based on deep-sequencing of small RNA samples of all developmental stages of a mosquito species. A number of miRNAs are related to specific physiological states, most notably, pre- and post-blood feeding. The distribution of lineage-specific miRNAs is consistent with mosquito phylogeny and the presence of a number of Aedes-specific miRNAs likely reflects the divergence between the Aedes and Culex genera.

  17. Regulation of gene expression in plants through miRNA inactivation.

    Directory of Open Access Journals (Sweden)

    Sergey Ivashuta

    Full Text Available Eukaryotic organisms possess a complex RNA-directed gene expression regulatory network allowing the production of unique gene expression patterns. A recent addition to the repertoire of RNA-based gene regulation is miRNA target decoys, endogenous RNA that can negatively regulate miRNA activity. miRNA decoys have been shown to be a valuable tool for understanding the function of several miRNA families in plants and invertebrates. Engineering and precise manipulation of an endogenous RNA regulatory network through modification of miRNA activity also affords a significant opportunity to achieve a desired outcome of enhanced plant development or response to environmental stresses. Here we report that expression of miRNA decoys as single or heteromeric non-cleavable microRNA (miRNA sites embedded in either non-protein-coding or within the 3' untranslated region of protein-coding transcripts can regulate the expression of one or more miRNA targets. By altering the sequence of the miRNA decoy sites, we were able to attenuate miRNA inactivation, which allowed for fine regulation of native miRNA targets and the production of a desirable range of plant phenotypes. Thus, our results demonstrate miRNA decoys are a flexible and robust tool, not only for studying miRNA function, but also for targeted engineering of gene expression in plants. Computational analysis of the Arabidopsis transcriptome revealed a number of potential miRNA decoys, suggesting that endogenous decoys may have an important role in natural modulation of expression in plants.

  18. UPR-inducible miRNAs contribute to stressful situations.

    Science.gov (United States)

    Chitnis, Nilesh; Pytel, Dariusz; Diehl, J Alan

    2013-09-01

    The endoplasmic reticulum (ER) senses both extracellular and intracellular stresses that can disrupt its ability to facilitate the maturation of proteins destined for secretory pathways. The accumulation of misfolded proteins within the ER triggers an adaptive signaling pathway coined the unfolded protein response (UPR). UPR activation contributes to cell adaptation by reducing the rate of protein translation while increasing the synthesis of chaperones. Although we have gained considerable insight into the mechanisms that regulate gene expression and certain aspects of protein translation, the contribution of miRNAs to UPR-dependent activities has only recently been investigated. Here we highlight recent insights into the contribution of miRNAs to UPR-dependent cellular adaptive responses.

  19. Viral miRNA targeting of bicistronic and polycistronic transcripts.

    Science.gov (United States)

    Zhu, Ying; Huang, Yufei; Jung, Jae U; Lu, Chun; Gao, Shou-Jiang

    2014-08-01

    Successful viral infection entails a choreographic regulation of viral gene expression program. Kaposi's sarcoma-associated herpesvirus (KSHV) encodes numerous miRNAs that regulate viral life cycle. However, few viral targets have been identified due to the lack of information on KSHV 3' untranslated regions (3'UTRs). Recent genome-wide mapping of KSHV transcripts and 3'UTRs has revealed abundant bicistronic and polycistronic transcripts. The extended 3'UTRs of the 5' proximal genes of bicistronic and polycistronic transcripts offer additional regulatory targets. Indeed, a genome-wide screening of KSHV 3'UTRs has identified several bicistronic and polycistronic transcripts as the novel targets of viral miRNAs. Together, these works have expanded our knowledge of the unique features of KSHV gene regulation program and provided valuable resources for the research community.

  20. miRNAs modulate the drug response of tumor cells

    Institute of Scientific and Technical Information of China (English)

    2009-01-01

    Chemotherapy is one of the major treatments of malignant carcinomas. However,its efficiency is affected by both intrinsic and acquired resistance to anticancer drugs. The cellular mechanisms of drug resistance include the overexpression of energy-dependent transporters that eject anticancer drugs from cells such as p-glycoprotein and multidrug resistance related protein (MRP),the mutation of drug targets,the activation of DNA repair pathways,the defects in cellular death pathways and so on. The genetic and epigenetic changes of these genes can lead to cancer drug resistance. Among these mechanisms,microRNAs (miRNAs) which are critical and essential for many important processes such as development,differentiation,and even carcinogenesis have been reported to regulate the chemosen-sitivity of tumor cells. In this paper we briefly review the relationship between miRNA and cancer drug resistance.

  1. Exosomes and Exosomal miRNA in Respiratory Diseases

    Science.gov (United States)

    Alipoor, Shamila D.; Garssen, Johan; Movassaghi, Masoud

    2016-01-01

    Exosomes are nanosized vesicles released from every cell in the body including those in the respiratory tract and lungs. They are found in most body fluids and contain a number of different biomolecules including proteins, lipids, and both mRNA and noncoding RNAs. Since they can release their contents, particularly miRNAs, to both neighboring and distal cells, they are considered important in cell-cell communication. Recent evidence has shown their possible importance in the pathogenesis of several pulmonary diseases. The differential expression of exosomes and of exosomal miRNAs in disease has driven their promise as biomarkers of disease enabling noninvasive clinical diagnosis in addition to their use as therapeutic tools. In this review, we summarize recent advances in this area as applicable to pulmonary diseases.

  2. Exosomes and Exosomal miRNA in Respiratory Diseases

    Directory of Open Access Journals (Sweden)

    Shamila D. Alipoor

    2016-01-01

    Full Text Available Exosomes are nanosized vesicles released from every cell in the body including those in the respiratory tract and lungs. They are found in most body fluids and contain a number of different biomolecules including proteins, lipids, and both mRNA and noncoding RNAs. Since they can release their contents, particularly miRNAs, to both neighboring and distal cells, they are considered important in cell-cell communication. Recent evidence has shown their possible importance in the pathogenesis of several pulmonary diseases. The differential expression of exosomes and of exosomal miRNAs in disease has driven their promise as biomarkers of disease enabling noninvasive clinical diagnosis in addition to their use as therapeutic tools. In this review, we summarize recent advances in this area as applicable to pulmonary diseases.

  3. miRNAs modulate the drug response of tumor cells

    Institute of Scientific and Technical Information of China (English)

    WU XueMei; XIAO HuaSheng

    2009-01-01

    Chemotherapy is one of the major treatments of malignant carcinomas. However, its efficiency is af-fected by both intrinsic and acquired resistance to anticancer drugs. The cellular mechanisms of drug resistance include the overexpression of energy-dependent transporters that eject anticancer drugs from cells such as p-glycoprotein and multidrug resistance related protein (MRP), the mutation of drug targets, the activation of DNA repair pathways, the defects in cellular death pathways and so on. The genetic and epigenetic changes of these genes can lead to cancer drug resistance. Among these mechanisms, microRNAs (miRNAs) which are critical and essential for many important processes such as development, differentiation, and even carcinogenesis have been reported to regulate the chemo-sensitivity of tumor cells. In this paper we briefly review the relationship between miRNA and cancer drug resistance.

  4. miRNA signature identification of retinoblastoma and the correlations between differentially expressed miRNAs during retinoblastoma progression.

    Science.gov (United States)

    Yang, Yang; Mei, Qi

    2015-01-01

    Retinoblastoma (RB) is a common pediatric cancer. The study aimed to uncover the mechanisms of RB progression and identify novel therapeutic biomarkers. The miRNA expression profile GSE7072, which includes three RB samples and three healthy retina samples, was used. After data normalization using the preprocessCore package, differentially expressed miRNAs (DE-miRs) were selected by the limma package. The targets of the DE-miRs were predicted based on two databases, followed by construction of the miRNA-target network. Pathway enrichment analysis was conducted for the targets of the DE-miRNAs using DAVID. The CTD database was used to predict RB-related genes, followed by clustering analysis using the pvclust package. The correlation network of DE-miRs was established. MiRNA expression was validated in another data set, GSE41321. In total, 24 DE-miRs were identified whose targets were correlated with the cell cycle pathway. Among them, hsa-miR-373, hsa-miR-125b, and hsa-miR-181a were highlighted in the miRNA-target regulatory network; 14 DE-miRs, including hsa-miR-373, hsa-miR-125b, hsa-miR-18a, hsa-miR-25, hsa-miR-20a, and hsa-let-7 (a, b, c), were shown to distinguish RB from healthy tissue. In addition, hsa-miR-25, hsa-miR-18a, and hsa-miR-20a shared the common target BCL2L11; hsa-let-7b and hsa-miR-125b targeted the genes CDC25A, CDK6, and LIN28A. Expression of three miRNAs in GSE41321 was consistent with that in GSE7072. Several critical miRNAs were identified in RB progression. Hsa-miR-373 might regulate RB invasion and metastasis, hsa-miR-181a might involve in the CDKN1B-mediated cell cycle pathway, and hsa-miR-125b and hsa-let-7b might serve as tumor suppressors by coregulating CDK6, CDC25A, and LIN28A. The miRNAs hsa-miR-25, hsa-miR-18a, and hsa-miR-20a might exert their function by coregulating BCL2L1.

  5. Bacterial group II introns in a deep-sea hydrothermal vent environment.

    Science.gov (United States)

    Podar, Mircea; Mullineaux, Lauren; Huang, Hon-Ren; Perlman, Philip S; Sogin, Mitchell L

    2002-12-01

    Group II introns are catalytic RNAs and mobile retrotransposable elements known to be present in the genomes of some nonmarine bacteria and eukaryotic organelles. Here we report the discovery of group II introns in a bacterial mat sample collected from a deep-sea hydrothermal vent near 9 degrees N on the East Pacific Rise. One of the introns was shown to self-splice in vitro. This is the first example of marine bacterial introns from molecular population structure studies of microorganisms that live in the proximity of hydrothermal vents. These types of mobile genetic elements may prove useful in improving our understanding of bacterial genome evolution and may serve as valuable markers in comparative studies of bacterial communities.

  6. Cotranscriptional splicing of a group I intron is facilitated by the Cbp2 protein

    Energy Technology Data Exchange (ETDEWEB)

    Lewin, A.S.; Thomas, J. Jr.; Tirupati, H.K. [Univ. of Florida College of Medicine, Gainesville, FL (United States)

    1995-12-01

    This report investigates the coupling between transcription and splicing of a mitochondrial group I intron in Saccharomyces cerevisiae and the effect of the Cbp2 protein on splicing. 65 refs., 7 figs.

  7. Hypothalamic miRNAs: emerging roles in energy balance control

    OpenAIRE

    Schneeberger, Marc; Gomez-Valadés, Alicia G.; Ramirez, Sara; Gomis, Ramon; Claret, Marc

    2015-01-01

    The hypothalamus is a crucial central nervous system area controlling appetite, body weight and metabolism. It consists in multiple neuronal types that sense, integrate and generate appropriate responses to hormonal and nutritional signals partly by fine-tuning the expression of specific batteries of genes. However, the mechanisms regulating these neuronal gene programmes in physiology and pathophysiology are not completely understood. MicroRNAs (miRNAs) are key regulators of gene expression ...

  8. Role of miRNA-9 in Brain Development

    Science.gov (United States)

    Radhakrishnan, Balachandar; Alwin Prem Anand, A.

    2016-01-01

    MicroRNAs (miRNAs) are a class of small regulatory RNAs involved in gene regulation. The regulation is effected by either translational inhibition or transcriptional silencing. In vertebrates, the importance of miRNA in development was discovered from mice and zebrafish dicer knockouts. The miRNA-9 (miR-9) is one of the most highly expressed miRNAs in the early and adult vertebrate brain. It has diverse functions within the developing vertebrate brain. In this article, the role of miR-9 in the developing forebrain (telencephalon and diencephalon), midbrain, hindbrain, and spinal cord of vertebrate species is highlighted. In the forebrain, miR-9 is necessary for the proper development of dorsoventral telencephalon by targeting marker genes expressed in the telencephalon. It regulates proliferation in telencephalon by regulating Foxg1, Pax6, Gsh2, and Meis2 genes. The feedback loop regulation between miR-9 and Nr2e1/Tlx helps in neuronal migration and differentiation. Targeting Foxp1 and Foxp2, and Map1b by miR-9 regulates the radial migration of neurons and axonal development. In the organizers, miR-9 is inversely regulated by hairy1 and Fgf8 to maintain zona limitans interthalamica and midbrain–hindbrain boundary (MHB). It maintains the MHB by inhibiting Fgf signaling genes and is involved in the neurogenesis of the midbrain–hindbrain by regulating Her genes. In the hindbrain, miR-9 modulates progenitor proliferation and differentiation by regulating Her genes and Elav3. In the spinal cord, miR-9 modulates the regulation of Foxp1 and Onecut1 for motor neuron development. In the forebrain, midbrain, and hindbrain, miR-9 is necessary for proper neuronal progenitor maintenance, neurogenesis, and differentiation. In vertebrate brain development, miR-9 is involved in regulating several region-specific genes in a spatiotemporal pattern. PMID:27721656

  9. Effects of Antioxidants in Human Cancers: Differential Effects on Non-Coding Intronic RNA Expression

    Directory of Open Access Journals (Sweden)

    Shreya Menon

    2016-01-01

    Full Text Available The notion that dietary antioxidants can help fight cancer is popular. However, the mechanism(s behind the effect of antioxidants in cancer is still unclear. Previous studies indicate that supplements can influence gene expression; however, all of these studies were focused on the coding/exonic gene expression. Studies are now emerging to highlight critical functional roles for RNAs expressed from the non-coding regions. This project was designed to study the effect of antioxidant supplements on non-coding intronic RNA expression in human cancers. Vitamin E, N-Acetyl cysteine (NAC and Sulforaphane are commonly used supplements to prevent diseases including cancers. We studied the effect of these antioxidant supplements on the non-coding intronic RNA expression using publicly available datasets from a mouse model for lung cancer and prostate cancer cell lines. Although high throughput polyA-enriched RNA-Seq data characterize spliced coding mRNA regions, recent studies reveal the expression of reads from the non-coding intronic regions. Our analyses indicate that cancer cells have higher expression of introns compared to that of normal cells and that treatment with antioxidant supplements reduces the increased expression of introns of several genes. However, we did find high expression of introns of multiple genes including many oncogenes in the supplement treated groups compared to that of the control; this effect was distinct depending on the cell type and the supplement studied. Using RT-PCRs, we validated the expression of introns of two oncogenes, DLK1 and LRG1, known to be key players in lung cancer progression, and demonstrate changed intronic expression with supplement treatment in cancer cells. With regard to the antioxidant system, supplements did not change the intronic RNAs for endogenous antioxidant enzymes except for a significant decrease in the expression of superoxide dismutase (SOD intronic RNA. Concurrently, we also found that a

  10. Analysis of phylogenetic signal in protostomial intron patterns using Mutual Information.

    Science.gov (United States)

    Hill, Natascha; Leow, Alexander; Bleidorn, Christoph; Groth, Detlef; Tiedemann, Ralph; Selbig, Joachim; Hartmann, Stefanie

    2013-06-01

    Many deep evolutionary divergences still remain unresolved, such as those among major taxa of the Lophotrochozoa. As alternative phylogenetic markers, the intron-exon structure of eukaryotic genomes and the patterns of absence and presence of spliceosomal introns appear to be promising. However, given the potential homoplasy of intron presence, the phylogenetic analysis of this data using standard evolutionary approaches has remained a challenge. Here, we used Mutual Information (MI) to estimate the phylogeny of Protostomia using gene structure data, and we compared these results with those obtained with Dollo Parsimony. Using full genome sequences from nine Metazoa, we identified 447 groups of orthologous sequences with 21,732 introns in 4,870 unique intron positions. We determined the shared absence and presence of introns in the corresponding sequence alignments and have made this data available in "IntronBase", a web-accessible and downloadable SQLite database. Our results obtained using Dollo Parsimony are obviously misled through systematic errors that arise from multiple intron loss events, but extensive filtering of data improved the quality of the estimated phylogenies. Mutual Information, in contrast, performs better with larger datasets, but at the same time it requires a complete data set, which is difficult to obtain for orthologs from a large number of taxa. Nevertheless, Mutual Information-based distances proved to be useful in analyzing this kind of data, also because the estimation of MI-based distances is independent of evolutionary models and therefore no pre-definitions of ancestral and derived character states are necessary.

  11. Asthma and COPD in cystic fibrosis intron-8 5T carriers. A population-based study

    DEFF Research Database (Denmark)

    Dahl, Morten; Tybjaerg-Hansen, Anne; Lange, Peter;

    2005-01-01

    Carriers of cystic fibrosis intron-8 5T alleles with high exon-9 skipping could have increased annual lung function decline and increased risk for asthma or chronic obstructive pulmonary disease (COPD).......Carriers of cystic fibrosis intron-8 5T alleles with high exon-9 skipping could have increased annual lung function decline and increased risk for asthma or chronic obstructive pulmonary disease (COPD)....

  12. Discovery and analysis of evolutionarily conserved intronic splicing regulatory elements.

    Directory of Open Access Journals (Sweden)

    Gene W Yeo

    2007-05-01

    Full Text Available Knowledge of the functional cis-regulatory elements that regulate constitutive and alternative pre-mRNA splicing is fundamental for biology and medicine. Here we undertook a genome-wide comparative genomics approach using available mammalian genomes to identify conserved intronic splicing regulatory elements (ISREs. Our approach yielded 314 ISREs, and insertions of ~70 ISREs between competing splice sites demonstrated that 84% of ISREs altered 5' and 94% altered 3' splice site choice in human cells. Consistent with our experiments, comparisons of ISREs to known splicing regulatory elements revealed that 40%-45% of ISREs might have dual roles as exonic splicing silencers. Supporting a role for ISREs in alternative splicing, we found that 30%-50% of ISREs were enriched near alternatively spliced (AS exons, and included almost all known binding sites of tissue-specific alternative splicing factors. Further, we observed that genes harboring ISRE-proximal exons have biases for tissue expression and molecular functions that are ISRE-specific. Finally, we discovered that for Nova1, neuronal PTB, hnRNP C, and FOX1, the most frequently occurring ISRE proximal to an alternative conserved exon in the splicing factor strongly resembled its own known RNA binding site, suggesting a novel application of ISRE density and the propensity for splicing factors to auto-regulate to associate RNA binding sites to splicing factors. Our results demonstrate that ISREs are crucial building blocks in understanding general and tissue-specific AS regulation and the biological pathways and functions regulated by these AS events.

  13. Novel mutations in the GH gene (GH1) uncover putative splicing regulatory elements.

    Science.gov (United States)

    Babu, Deepak; Mellone, Simona; Fusco, Ileana; Petri, Antonella; Walker, Gillian E; Bellone, Simonetta; Prodam, Flavia; Momigliano-Richiardi, Patricia; Bona, Gianni; Giordano, Mara

    2014-05-01

    Mutations affecting exon 3 splicing are the main cause of autosomal dominant Isolated GH Deficiency II (IGHDII) by increasing the level of exon 3-skipped mRNA encoding the functionally inactive dominant-negative 17.5-kDa isoform. The exons and introns of the gene encoding GH (GH1) were screened for the presence of mutations in 103 sporadic isolated GH deficiency cases. Four different variations within exon 3 were identified in 3 patients. One carried c.261C>T (p.Pro87Pro) and c.272A>T (p.Glu91Val), the second c.255G>A (p.Pro85Pro) and c.261 C>T, and the third c.246G>C (p.Glu82Asp). All the variants were likely generated by gene conversion from an homologous gene in the GH1 cluster. In silico analysis predicted that positions c.255 and c.272 were included within 2 putative novel exon splicing enhancers (ESEs). Their effect on splicing was confirmed in vitro. Constructs bearing these 2 variants induced consistently higher levels both of transcript and protein corresponding to the 17.5-kDa isoform. When c.255 and c.272 were combined in cis with the c.261 variant, as in our patients, their effect was weaker. In conclusion, we identified 2 variations, c.255G>A and c.272A>T, located in 2 novel putative exon splicing enhancers and affecting GH1 splicing in vitro by increasing the production of alternatively spliced isoforms. The amount of aberrant isoforms is further regulated by the presence in cis of the c.261 variant. Thus, our results evidenced novel putative splicing regulatory elements within exon 3, confirming the crucial role of this exon in mRNA processing.

  14. Putative archaeal viruses from the mesopelagic ocean.

    Science.gov (United States)

    Vik, Dean R; Roux, Simon; Brum, Jennifer R; Bolduc, Ben; Emerson, Joanne B; Padilla, Cory C; Stewart, Frank J; Sullivan, Matthew B

    2017-01-01

    Oceanic viruses that infect bacteria, or phages, are known to modulate host diversity, metabolisms, and biogeochemical cycling, while the viruses that infect marine Archaea remain understudied despite the critical ecosystem roles played by their hosts. Here we introduce "MArVD", for Metagenomic Archaeal Virus Detector, an annotation tool designed to identify putative archaeal virus contigs in metagenomic datasets. MArVD is made publicly available through the online iVirus analytical platform. Benchmarking analysis of MArVD showed it to be >99% accurate and 100% sensitive in identifying the 127 known archaeal viruses among the 12,499 viruses in the VirSorter curated dataset. Application of MArVD to 10 viral metagenomes from two depth profiles in the Eastern Tropical North Pacific (ETNP) oxygen minimum zone revealed 43 new putative archaeal virus genomes and large genome fragments ranging in size from 10 to 31 kb. Network-based classifications, which were consistent with marker gene phylogenies where available, suggested that these putative archaeal virus contigs represented six novel candidate genera. Ecological analyses, via fragment recruitment and ordination, revealed that the diversity and relative abundances of these putative archaeal viruses were correlated with oxygen concentration and temperature along two OMZ-spanning depth profiles, presumably due to structuring of the host Archaea community. Peak viral diversity and abundances were found in surface waters, where Thermoplasmata 16S rRNA genes are prevalent, suggesting these archaea as hosts in the surface habitats. Together these findings provide a baseline for identifying archaeal viruses in sequence datasets, and an initial picture of the ecology of such viruses in non-extreme environments.

  15. Evidence for intron length conservation in a set of mammalian genes associated with embryonic development

    LENUS (Irish Health Repository)

    2011-10-05

    Abstract Background We carried out an analysis of intron length conservation across a diverse group of nineteen mammalian species. Motivated by recent research suggesting a role for time delays associated with intron transcription in gene expression oscillations required for early embryonic patterning, we searched for examples of genes that showed the most extreme conservation of total intron content in mammals. Results Gene sets annotated as being involved in pattern specification in the early embryo or containing the homeobox DNA-binding domain, were significantly enriched among genes with highly conserved intron content. We used ancestral sequences reconstructed with probabilistic models that account for insertion and deletion mutations to distinguish insertion and deletion events on lineages leading to human and mouse from their last common ancestor. Using a randomization procedure, we show that genes containing the homeobox domain show less change in intron content than expected, given the number of insertion and deletion events within their introns. Conclusions Our results suggest selection for gene expression precision or the existence of additional development-associated genes for which transcriptional delay is functionally significant.

  16. CYP17A1 intron mutation causing cryptic splicing in 17α-hydroxylase deficiency.

    Directory of Open Access Journals (Sweden)

    Daw-Yang Hwang

    Full Text Available 17α-Hydroxylase/17, 20-lyase deficiency (17OHD is an autosomal recessive disease causing congenital adrenal hyperplasia and a rare cause of hypertension with hypokalemia. The CYP17A1 gene mutation leads to 17OHD and its clinical features. We described an 18 y/o female with clinical features of 17α-hydroxylase/17, 20-lyase deficiency and characterized the functional consequences of an intronic CYP17A1 mutation. The coding regions and flanking intronic bases of the CYP17A1 gene were amplified by PCR and sequenced. The patient is a compound heterozygote for the previously described p.R358X and IVS1 +2T>C mutations. A first intron splice donor site mutation was re-created in minigene and full-length expression vectors. Pre-mRNA splicing of the variant CYP17A1 intron was studied in transfected cells and in a transformed lymphoblastoid cell line. When the full-length CYP17A1 gene and minigene containing the intronic mutation was expressed in transfected cells, the majority (>90% of mRNA transcripts were incorrectly spliced. Only the p.R358X transcript was detected in the EBV-transformed lymphoblastoid cell line. The IVS1 +2T>C mutation abolished most 17α-hydroxylase/17, 20-lyase enzyme activity by aberrant mRNA splicing to an intronic pseudo-exon, causing a frame shift and early termination.

  17. Genome-wide transcript profiling reveals novel breast cancer-associated intronic sense RNAs.

    Science.gov (United States)

    Kim, Sang Woo; Fishilevich, Elane; Arango-Argoty, Gustavo; Lin, Yuefeng; Liu, Guodong; Li, Zhihua; Monaghan, A Paula; Nichols, Mark; John, Bino

    2015-01-01

    Non-coding RNAs (ncRNAs) play major roles in development and cancer progression. To identify novel ncRNAs that may identify key pathways in breast cancer development, we performed high-throughput transcript profiling of tumor and normal matched-pair tissue samples. Initial transcriptome profiling using high-density genome-wide tiling arrays revealed changes in over 200 novel candidate genomic regions that map to intronic regions. Sixteen genomic loci were identified that map to the long introns of five key protein-coding genes, CRIM1, EPAS1, ZEB2, RBMS1, and RFX2. Consistent with the known role of the tumor suppressor ZEB2 in the cancer-associated epithelial to mesenchymal transition (EMT), in situ hybridization reveals that the intronic regions deriving from ZEB2 as well as those from RFX2 and EPAS1 are down-regulated in cells of epithelial morphology, suggesting that these regions may be important for maintaining normal epithelial cell morphology. Paired-end deep sequencing analysis reveals a large number of distinct genomic clusters with no coding potential within the introns of these genes. These novel transcripts are only transcribed from the coding strand. A comprehensive search for breast cancer associated genes reveals enrichment for transcribed intronic regions from these loci, pointing to an underappreciated role of introns or mechanisms relating to their biology in EMT and breast cancer.

  18. Genome-wide transcript profiling reveals novel breast cancer-associated intronic sense RNAs.

    Directory of Open Access Journals (Sweden)

    Sang Woo Kim

    Full Text Available Non-coding RNAs (ncRNAs play major roles in development and cancer progression. To identify novel ncRNAs that may identify key pathways in breast cancer development, we performed high-throughput transcript profiling of tumor and normal matched-pair tissue samples. Initial transcriptome profiling using high-density genome-wide tiling arrays revealed changes in over 200 novel candidate genomic regions that map to intronic regions. Sixteen genomic loci were identified that map to the long introns of five key protein-coding genes, CRIM1, EPAS1, ZEB2, RBMS1, and RFX2. Consistent with the known role of the tumor suppressor ZEB2 in the cancer-associated epithelial to mesenchymal transition (EMT, in situ hybridization reveals that the intronic regions deriving from ZEB2 as well as those from RFX2 and EPAS1 are down-regulated in cells of epithelial morphology, suggesting that these regions may be important for maintaining normal epithelial cell morphology. Paired-end deep sequencing analysis reveals a large number of distinct genomic clusters with no coding potential within the introns of these genes. These novel transcripts are only transcribed from the coding strand. A comprehensive search for breast cancer associated genes reveals enrichment for transcribed intronic regions from these loci, pointing to an underappreciated role of introns or mechanisms relating to their biology in EMT and breast cancer.

  19. Characterization of the molecular basis of group II intron RNA recognition by CRS1-CRM domains.

    Science.gov (United States)

    Keren, Ido; Klipcan, Liron; Bezawork-Geleta, Ayenachew; Kolton, Max; Shaya, Felix; Ostersetzer-Biran, Oren

    2008-08-22

    CRM (chloroplast RNA splicing and ribosome maturation) is a recently recognized RNA-binding domain of ancient origin that has been retained in eukaryotic genomes only within the plant lineage. Whereas in bacteria CRM domains exist as single domain proteins involved in ribosome maturation, in plants they are found in a family of proteins that contain between one and four repeats. Several members of this family with multiple CRM domains have been shown to be required for the splicing of specific plastidic group II introns. Detailed biochemical analysis of one of these factors in maize, CRS1, demonstrated its high affinity and specific binding to the single group II intron whose splicing it facilitates, the plastid-encoded atpF intron RNA. Through its association with two intronic regions, CRS1 guides the folding of atpF intron RNA into its predicted "catalytically active" form. To understand how multiple CRM domains cooperate to achieve high affinity sequence-specific binding to RNA, we analyzed the RNA binding affinity and specificity associated with each individual CRM domain in CRS1; whereas CRM3 bound tightly to the RNA, CRM1 associated specifically with a unique region found within atpF intron domain I. CRM2, which demonstrated only low binding affinity, also seems to form specific interactions with regions localized to domains I, III, and IV. We further show that CRM domains share structural similarities and RNA binding characteristics with the well known RNA recognition motif domain.

  20. Evidence for intron length conservation in a set of mammalian genes associated with embryonic development

    Directory of Open Access Journals (Sweden)

    Korir Paul K

    2011-10-01

    Full Text Available Abstract Background We carried out an analysis of intron length conservation across a diverse group of nineteen mammalian species. Motivated by recent research suggesting a role for time delays associated with intron transcription in gene expression oscillations required for early embryonic patterning, we searched for examples of genes that showed the most extreme conservation of total intron content in mammals. Results Gene sets annotated as being involved in pattern specification in the early embryo or containing the homeobox DNA-binding domain, were significantly enriched among genes with highly conserved intron content. We used ancestral sequences reconstructed with probabilistic models that account for insertion and deletion mutations to distinguish insertion and deletion events on lineages leading to human and mouse from their last common ancestor. Using a randomization procedure, we show that genes containing the homeobox domain show less change in intron content than expected, given the number of insertion and deletion events within their introns. Conclusions Our results suggest selection for gene expression precision or the existence of additional development-associated genes for which transcriptional delay is functionally significant.

  1. miRNA-146a, miRNA-155 and JNK expression levels in peripheral blood mononuclear cells according to grade of knee osteoarthritis.

    Science.gov (United States)

    Soyocak, Ahu; Kurt, Hulyam; Ozgen, Merih; Turgut Cosan, Didem; Colak, Ertugrul; Gunes, Hasan Veysi

    2017-09-05

    Osteoarthritis (OA) is the most common joint disease characterized by joint pain and a progressive loss of articular cartilage. OA known as a non-inflammatory disease. Despite this the recent studies are shown synovitis and low inflammation to have a role in OA pathophysiology. The aim of this study to determine the roles of a potential therapeutic targets miRNA-146a, miRNA-155 and JNK expression levels in OA patients. Peripheral mononuclear blood cells (PBMCs) were extracted from OA patients and healthy subjects. The expression levels of miRNA-146a, miRNA-155 and JNK were quantified using by real-time PCR assay. According to study results a statistically significant increase was observed only in miRNA-155 expression level (p=0,039). However, miRNA-146a and miRNA-155 expressions increased in the progressive stages (grade 3 and grade 4) in OA patients. Our data suggests that correlation of miRNAs regulating and signal pathways can play an important role in OA pathogenesis and disease progression. Copyright © 2017 Elsevier B.V. All rights reserved.

  2. Grouping miRNAs of similar functions via weighted information content of gene ontology.

    Science.gov (United States)

    Lan, Chaowang; Chen, Qingfeng; Li, Jinyan

    2016-12-22

    Regulation mechanisms between miRNAs and genes are complicated. To accomplish a biological function, a miRNA may regulate multiple target genes, and similarly a target gene may be regulated by multiple miRNAs. Wet-lab knowledge of co-regulating miRNAs is limited. This work introduces a computational method to group miRNAs of similar functions to identify co-regulating miRNAsfrom a similarity matrix of miRNAs. We define a novel information content of gene ontology (GO) to measure similarity between two sets of GO graphs corresponding to the two sets of target genes of two miRNAs. This between-graph similarity is then transferred as a functional similarity between the two miRNAs. Our definition of the information content is based on the size of a GO term's descendants, but adjusted by a weight derived from its depth level and the GO relationships at its path to the root node or to the most informative common ancestor (MICA). Further, a self-tuning technique and the eigenvalues of the normalized Laplacian matrix are applied to determine the optimal parameters for the spectral clustering of the similarity matrix of the miRNAs. Experimental results demonstrate that our method has better clustering performance than the existing edge-based, node-based or hybrid methods. Our method has also demonstrated a novel usefulness for the function annotation of new miRNAs, as reported in the detailed case studies.

  3. miRNAs: small genes with big potential in metazoan phylogenetics.

    Science.gov (United States)

    Tarver, James E; Sperling, Erik A; Nailor, Audrey; Heimberg, Alysha M; Robinson, Jeffrey M; King, Benjamin L; Pisani, Davide; Donoghue, Philip C J; Peterson, Kevin J

    2013-11-01

    microRNAs (miRNAs) are a key component of gene regulatory networks and have been implicated in the regulation of virtually every biological process found in multicellular eukaryotes. What makes them interesting from a phylogenetic perspective is the high conservation of primary sequence between taxa, their accrual in metazoan genomes through evolutionary time, and the rarity of secondary loss in most metazoan taxa. Despite these properties, the use of miRNAs as phylogenetic markers has not yet been discussed within a clear conceptual framework. Here we highlight five properties of miRNAs that underlie their utility in phylogenetics: 1) The processes of miRNA biogenesis enable the identification of novel miRNAs without prior knowledge of sequence; 2) The continuous addition of miRNA families to metazoan genomes through evolutionary time; 3) The low level of secondary gene loss in most metazoan taxa; 4) The low substitution rate in the mature miRNA sequence; and 5) The small probability of convergent evolution of two miRNAs. Phylogenetic analyses using both Bayesian and parsimony methods on a eumetazoan miRNA data set highlight the potential of miRNAs to become an invaluable new tool, especially when used as an additional line of evidence, to resolve previously intractable nodes within the tree of life.

  4. Analysis of miRNAs and their targets during adventitious shoot organogenesis of Acacia crassicarpa.

    Directory of Open Access Journals (Sweden)

    Weina Liu

    Full Text Available Organogenesis is an important process for plant regeneration by tissue or cell mass differentiation to regenerate a complete plant. MicroRNAs (miRNAs play an essential role in regulating plant development by mediating target genes at transcriptional and post-transcriptional levels, but the diversity of miRNAs and their potential roles in organogenesis of Acacia crassicarpa have rarely been investigated. In this study, approximately 10 million sequence reads were obtained from a small RNA library, from which 189 conserved miRNAs from 57 miRNA families, and 7 novel miRNAs from 5 families, were identified from A. crassicarpa organogenetic tissues. Target prediction for these miRNAs yielded 237 potentially unique genes, of which 207 received target Gene Ontology annotations. On the basis of a bioinformatic analysis, one novel and 13 conserved miRNAs were selected to investigate their possible roles in A. crassicarpa organogenesis by qRT-PCR. The stage-specific expression patterns of the miRNAs provided information on their possible regulatory functions, including shoot bud formation, modulated function after transfer of the culture to light, and regulatory roles during induction of organogenesis. This study is the first to investigate miRNAs associated with A. crassicarpa organogenesis. The results provide a foundation for further characterization of miRNA expression profiles and roles in the regulation of diverse physiological pathways during adventitious shoot organogenesis of A. crassicarpa.

  5. High-throughput sequencing, characterization and detection of new and conserved cucumber miRNAs.

    Directory of Open Access Journals (Sweden)

    Germán Martínez

    Full Text Available Micro RNAS (miRNAs are a class of endogenous small non coding RNAs involved in the post-transcriptional regulation of gene expression. In plants, a great number of conserved and specific miRNAs, mainly arising from model species, have been identified to date. However less is known about the diversity of these regulatory RNAs in vegetal species with agricultural and/or horticultural importance. Here we report a combined approach of bioinformatics prediction, high-throughput sequencing data and molecular methods to analyze miRNAs populations in cucumber (Cucumis sativus plants. A set of 19 conserved and 6 known but non-conserved miRNA families were found in our cucumber small RNA dataset. We also identified 7 (3 with their miRNA* strand not previously described miRNAs, candidates to be cucumber-specific. To validate their description these new C. sativus miRNAs were detected by northern blot hybridization. Additionally, potential targets for most conserved and new miRNAs were identified in cucumber genome.In summary, in this study we have identified, by first time, conserved, known non-conserved and new miRNAs arising from an agronomically important species such as C. sativus. The detection of this complex population of regulatory small RNAs suggests that similarly to that observe in other plant species, cucumber miRNAs may possibly play an important role in diverse biological and metabolic processes.

  6. miRNA in situ hybridization in circulating tumor cells - MishCTC

    Science.gov (United States)

    Ortega, Francisco G.; Lorente, Jose A.; Garcia Puche, Jose L.; Ruiz, Maria P.; Sanchez-Martin, Rosario M.; de Miguel-Pérez, Diego; Diaz-Mochon, Juan J.; Serrano, Maria J.

    2015-01-01

    Circulating tumor cells (CTCs) must be phenotypically and genetically characterized before they can be utilized in clinical applications. Here, we present the first protocol for the detection of miRNAs in CTCs using in situ hybridization (ISH) combined with immunomagnetic selection based on cytokeratin (CK) expression and immunocytochemistry. Locked-Nucleic Acid (LNA) probes associated with an enzyme-labeled fluorescence (ELF) signal amplification approach were used to detect miRNA-21 in CTCs. This protocol was optimized using both epithelial tumor (MDA-MB468) and epithelial non-tumor (MCF-10A) cell lines, and miRNA-21 was selected as the target miRNA because of its known role as an onco-miRNA. Hematopoietic cells do not express miRNA-21; thus, miRNA-21 is an ideal marker for detecting CTCs. Peripheral blood samples were taken from 25 cancer patients and these samples were analyzed using our developed protocol. Of the 25 samples, 11 contained CTCs. For all 11 CTC-positive samples, the isolated CTCs expressed both CK and miRNA-21. Finally, the protocol was applied to monitor miRNA-21 expression in epithelial to mesenchymal transition (EMT)-induced MCF-7 cells, an epithelial tumor cell line. CK expression was lost in these cells, whereas miRNA-21 was still expressed, suggesting that miRNA-21 might be a good marker for detecting CTCs with an EMT phenotype. PMID:25777797

  7. Genome-wide fungal stress responsive miRNA expression in wheat.

    Science.gov (United States)

    Inal, Behçet; Türktaş, Mine; Eren, Hakan; Ilhan, Emre; Okay, Sezer; Atak, Mehmet; Erayman, Mustafa; Unver, Turgay

    2014-12-01

    MicroRNAs (miRNAs) are small non-coding class of RNAs. They were identified in many plants with their diverse regulatory roles in several cellular and metabolic processes. A number of miRNAs were involved in biotic and abiotic stress responses. Here, fungal stress responsive wheat miRNAs were analyzed by using miRNA-microarray strategy. Two different fungi (Fusarium culmorum and Bipolaris sorokiniana) were inoculated on resistant and sensitive wheat cultivars. A total of 87 differentially regulated miRNAs were detected in the 8 × 15 K array including all of the available plant miRNAs. Using bioinformatics tools, the target transcripts of responsive miRNAs were predicted, and related biological processes and mechanisms were assessed. A number of the miRNAs such as miR2592s, miR869.1, miR169b were highly differentially regulated showing more than 200-fold change upon fungal-inoculation. Some of the miRNAs were identified as fungal-inoculation responsive for the first time. The analyses showed that some of the differentially regulated miRNAs targeted resistance-related genes such as LRR, glucuronosyl transferase, peroxidase and Pto kinase. The comparison of the two miRNA-microarray analyses indicated that fungal-responsive wheat miRNAs were differentially regulated in pathogen- and cultivar-specific manners.

  8. The molecular evolution and structural organization of self-splicing group I introns at position 516 in nuclear SSU rDNA of myxomycetes.

    Science.gov (United States)

    Haugen, Peik; Coucheron, Dag H; Rønning, Sissel B; Haugli, Kari; Johansen, Steinar

    2003-01-01

    Group I introns are relatively common within nuclear ribosomal DNA of eukaryotic microorganisms, especially in myxomycetes. Introns at position S516 in the small subunit ribosomal RNA gene are particularly common, but have a sporadic occurrence in myxomycetes. Fuligo septica, Badhamia gracilis, and Physarum flavicomum, all members of the family Physaraceae, contain related group IC1 introns at this site. The F. septica intron was studied at the molecular level and found to self-splice as naked RNA and to generate full-length intron RNA circles during incubation. Group I introns at position S516 appear to have a particularly widespread distribution among protists and fungi. Secondary structural analysis of more than 140 S516 group I introns available in the database revealed five different types of organization, including IC1 introns with and without His-Cys homing endonuclease genes, complex twin-ribozyme introns, IE introns, and degenerate group I-like introns. Both intron structural and phylogenetic analyses indicate a multiple origin of the S516 introns during evolution. The myxomycete introns are related to S516 introns in the more distantly related brown algae and Acanthamoeba species. Possible mechanisms of intron transfer both at the RNA- and DNA-levels are discussed in order to explain the observed widespread, but scattered, phylogenetic distribution.

  9. Contribution of Intronic miR-338-3p and Its Hosting Gene AATK to Compensatory β-Cell Mass Expansion.

    Science.gov (United States)

    Jacovetti, Cécile; Jimenez, Veronica; Ayuso, Eduard; Laybutt, Ross; Peyot, Marie-Line; Prentki, Marc; Bosch, Fatima; Regazzi, Romano

    2015-05-01

    The elucidation of the mechanisms directing β-cell mass regeneration and maintenance is of interest, because the deficit of β-cell mass contributes to diabetes onset and progression. We previously found that the level of the microRNA (miRNA) miR-338-3p is decreased in pancreatic islets from rodent models displaying insulin resistance and compensatory β-cell mass expansion, including pregnant rats, diet-induced obese mice, and db/db mice. Transfection of rat islet cells with oligonucleotides that specifically block miR-338-3p activity increased the fraction of proliferating β-cells in vitro and promoted survival under proapoptotic conditions without affecting the capacity of β-cells to release insulin in response to glucose. Here, we evaluated the role of miR-338-3p in vivo by injecting mice with an adeno-associated viral vector permitting specific sequestration of this miRNA in β-cells. We found that the adeno-associated viral construct increased the fraction of proliferating β-cells confirming the data obtained in vitro. miR-338-3p is generated from an intron of the gene coding for apoptosis-associated tyrosine kinase (AATK). Similarly to miR-338-3p, we found that AATK is down-regulated in rat and human islets and INS832/13 β-cells in the presence of the cAMP-raising agents exendin-4, estradiol, and a G-protein-coupled Receptor 30 agonist. Moreover, AATK expression is reduced in islets of insulin resistant animal models and selective silencing of AATK in INS832/13 cells by RNA interference promoted β-cell proliferation. The results point to a coordinated reduction of miR-338-3p and AATK under insulin resistance conditions and provide evidence for a cooperative action of the miRNA and its hosting gene in compensatory β-cell mass expansion.

  10. Combined miRNA profiling and proteomics demonstrates that different miRNAs target a common set of proteins to promote colorectal cancer metastasis.

    Science.gov (United States)

    Torres, Sofía; Garcia-Palmero, Irene; Bartolomé, Rubén A; Fernandez-Aceñero, María Jesús; Molina, Elena; Calviño, Eva; Segura, Miguel F; Casal, J Ignacio

    2017-05-01

    The process of liver colonization in colorectal cancer remains poorly characterized. Here, we addressed the role of microRNA (miRNA) dysregulation in metastasis. We first compared miRNA expression profiles between colorectal cancer cell lines with different metastatic properties and then identified target proteins of the dysregulated miRNAs to establish their functions and prognostic value. We found that 38 miRNAs were differentially expressed between highly metastatic (KM12SM/SW620) and poorly metastatic (KM12C/SW480) cancer cell lines. After initial validation, we determined that three miRNAs (miR-424-3p, -503, and -1292) were overexpressed in metastatic colorectal cancer cell lines and human samples. Stable transduction of non-metastatic cells with each of the three miRNAs promoted metastatic properties in culture and increased liver colonization in vivo. Moreover, miR-424-3p and miR-1292 were associated with poor prognosis in human patients. A quantitative proteomic analysis of colorectal cancer cells transfected with miR-424-3p, miR-503, or miR-1292 identified alterations in 149, 129, or 121 proteins, respectively, with an extensive overlap of the target proteins of the three miRNAs. Importantly, down-regulation of two of these shared target proteins, CKB and UBA2, increased cell adhesion and proliferation in colorectal cancer cells. The capacity of distinct miRNAs to regulate the same mRNAs boosts the capacity of miRNAs to regulate cancer metastasis and underscores the necessity of targeting multiple miRNAs for effective cancer therapy. Copyright © 2017 Pathological Society of Great Britain and Ireland. Published by John Wiley & Sons, Ltd. Copyright © 2017 Pathological Society of Great Britain and Ireland. Published by John Wiley & Sons, Ltd.

  11. miRNA profiles in plasma from patients with sleep disorders reveal dysregulation of miRNAs in narcolepsy and other central hypersomnias.

    Science.gov (United States)

    Holm, Anja; Bang-Berthelsen, Claus Heiner; Knudsen, Stine; Kornum, Birgitte R; Modvig, Signe; Jennum, Poul; Gammeltoft, Steen

    2014-09-01

    MicroRNAs (miRNAs) have been implicated in the pathogenesis of human diseases including neurological disorders. The aim is to address the involvement of miRNAs in the pathophysiology of central hypersomnias including autoimmune narcolepsy with cataplexy and hypocretin deficiency (type 1 narcolepsy), narcolepsy without cataplexy (type 2 narcolepsy), and idiopathic hypersomnia. We conducted high-throughput analysis of miRNA in plasma from three groups of patients-with type 1 narcolepsy, type 2 narcolepsy, and idiopathic hypersomnia, respectively-in comparison with healthy controls using quantitative real-time polymerase chain reaction (qPCR) panels. University hospital based sleep clinic and research laboratories. Twelve patients with type 1 narcolepsy, 12 patients with type 2 narcolepsy, 12 patients with idiopathic hypersomnia, and 12 healthy controls. By analyzing miRNA in plasma with qPCR we identified 50, 24, and 6 miRNAs that were different in patients with type 1 narcolepsy, type 2 narcolepsy, and idiopathic hypersomnia, respectively, compared with healthy controls. Twenty miRNA candidates who fulfilled the criteria of at least two-fold difference and p-value narcolepsy patients and healthy controls. Levels of miR-30c, let-7f, and miR-26a were higher, whereas the level of miR-130a was lower in type 1 narcolepsy than healthy controls. The miRNA differences were not specific for type 1 narcolepsy, since the levels of the four miRNAs were also altered in patients with type 2 narcolepsy and idiopathic hypersomnia compared with healthy controls. The levels of four miRNAs differed in plasma from patients with type 1 narcolepsy, type 2 narcolepsy and idiopathic hypersomnia suggesting that alterations of miRNAs may be involved in the pathophysiology of central hypersomnias. © 2014 Associated Professional Sleep Societies, LLC.

  12. Lineage-specific group II intron gains and losses of the mitochondrial rps3 gene in gymnosperms.

    Science.gov (United States)

    Regina, Teresa M R; Quagliariello, Carla

    2010-08-01

    According to PCR assays and sequencing, we now report the shared presence of two rps3 introns, namely the rps3i74 and the rps3i249, in the mitochondria of all the classes representing the surviving lineages of gymnosperms, and unveil several lineages experiencing intron loss. Interestingly, the rps3 intron gains and losses within the four groups of gymnosperms let us sort out the Pinaceae and the non-Pinaceae into intron (+)- and intron (-)-lineages, respectively. Worthy of mention is also the finding that only Gnetum within the Gnetales harbours both the rps3 introns. This intron distribution pattern is consistent with the hypothesis that the two rps3 introns were likely present in the common ancestor of the seed plants and, then, independently lost in the non-Pinaceae during gymnosperm evolution. The derived secondary structural model of the novel group IIA intron improves our understanding of the significance and origin of the extraordinary length polymorphisms observed among rps3i249 orthologs. Despite the remarkable structural plasticity to adopt and reject introns, the rps3 mRNAs undergo accurate processing by splicing and extensive editing in gymnosperm mitochondria. This study provides additional insights into the evolutionarily high dynamics of mitochondrial introns which may come and go in closely related plant species. The turnover of the mitochondrial rps3 group II introns seen among lineages of seed plants further suggests that these introns might be an additional signature to discriminate between particularly cryptical taxonomic groups for which there is a need of a further evaluation of their evolutionary affiliation.

  13. The Agaricus bisporus cox1 Gene: The Longest Mitochondrial Gene and the Largest Reservoir of Mitochondrial Group I Introns

    Science.gov (United States)

    Férandon, Cyril; Moukha, Serge; Callac, Philippe; Benedetto, Jean-Pierre; Castroviejo, Michel; Barroso, Gérard

    2010-01-01

    In eukaryotes, introns are located in nuclear and organelle genes from several kingdoms. Large introns (up to 5 kbp) are frequent in mitochondrial genomes of plant and fungi but scarce in Metazoa, even if these organisms are grouped with fungi among the Opisthokonts. Mitochondrial introns are classified in two groups (I and II) according to their RNA secondary structure involved in the intron self-splicing mechanism. Most of these mitochondrial group I introns carry a “Homing Endonuclease Gene” (heg) encoding a DNA endonuclease acting in transfer and site-specific integration (“homing”) and allowing intron spreading and gain after lateral transfer even between species from different kingdoms. Opposed to this gain mechanism, is another which implies that introns, which would have been abundant in the ancestral genes, would mainly evolve by loss. The importance of both mechanisms (loss and gain) is matter of debate. Here we report the sequence of the cox1 gene of the button mushroom Agaricus bisporus, the most widely cultivated mushroom in the world. This gene is both the longest mitochondrial gene (29,902 nt) and the largest group I intron reservoir reported to date with 18 group I and 1 group II. An exhaustive analysis of the group I introns available in cox1 genes shows that they are mobile genetic elements whose numerous events of loss and gain by lateral transfer combine to explain their wide and patchy distribution extending over several kingdoms. An overview of intron distribution, together with the high frequency of eroded heg, suggests that they are evolving towards loss. In this landscape of eroded and lost intron sequences, the A. bisporus cox1 gene exhibits a peculiar dynamics of intron keeping and catching, leading to the largest collection of mitochondrial group I introns reported to date in a Eukaryote. PMID:21124976

  14. Exon sequence requirements for excision in vivo of the bacterial group II intron RmInt1

    Directory of Open Access Journals (Sweden)

    Toro Nicolás

    2011-05-01

    Full Text Available Abstract Background Group II intron splicing proceeds through two sequential transesterification reactions in which the 5' and 3'-exons are joined together and the lariat intron is released. The intron-encoded protein (IEP assists the splicing of the intron in vivo and remains bound to the excised intron lariat RNA in a ribonucleoprotein particle (RNP that promotes intron mobility. Exon recognition occurs through base-pairing interactions between two guide sequences on the ribozyme domain dI known as EBS1 and EBS2 and two stretches of sequence known as IBS1 and IBS2 on the 5' exon, whereas the 3' exon is recognized through interaction with the sequence immediately upstream from EBS1 [(δ-δ' interaction (subgroup IIA] or with a nucleotide [(EBS3-IBS3 interaction (subgroup IIB and IIC] located in the coordination-loop of dI. The δ nucleotide is involved in base pairing with another intron residue (δ' in subgroup IIB introns and this interaction facilitates base pairing between the 5' exon and the intron. Results In this study, we investigated nucleotide requirements in the distal 5'- and 3' exon regions, EBS-IBS interactions and δ-δ' pairing for excision of the group IIB intron RmInt1 in vivo. We found that the EBS1-IBS1 interaction was required and sufficient for RmInt1 excision. In addition, we provide evidence for the occurrence of canonical δ-δ' pairing and its importance for the intron excision in vivo. Conclusions The excision in vivo of the RmInt1 intron is a favored process, with very few constraints for sequence recognition in both the 5' and 3'-exons. Our results contribute to understand how group II introns spread in nature, and might facilitate the use of RmInt1 in gene targeting.

  15. The Agaricus bisporus cox1 gene: the longest mitochondrial gene and the largest reservoir of mitochondrial group i introns.

    Directory of Open Access Journals (Sweden)

    Cyril Férandon

    Full Text Available In eukaryotes, introns are located in nuclear and organelle genes from several kingdoms. Large introns (up to 5 kbp are frequent in mitochondrial genomes of plant and fungi but scarce in Metazoa, even if these organisms are grouped with fungi among the Opisthokonts. Mitochondrial introns are classified in two groups (I and II according to their RNA secondary structure involved in the intron self-splicing mechanism. Most of these mitochondrial group I introns carry a "Homing Endonuclease Gene" (heg encoding a DNA endonuclease acting in transfer and site-specific integration ("homing" and allowing intron spreading and gain after lateral transfer even between species from different kingdoms. Opposed to this gain mechanism, is another which implies that introns, which would have been abundant in the ancestral genes, would mainly evolve by loss. The importance of both mechanisms (loss and gain is matter of debate. Here we report the sequence of the cox1 gene of the button mushroom Agaricus bisporus, the most widely cultivated mushroom in the world. This gene is both the longest mitochondrial gene (29,902 nt and the largest group I intron reservoir reported to date with 18 group I and 1 group II. An exhaustive analysis of the group I introns available in cox1 genes shows that they are mobile genetic elements whose numerous events of loss and gain by lateral transfer combine to explain their wide and patchy distribution extending over several kingdoms. An overview of intron distribution, together with the high frequency of eroded heg, suggests that they are evolving towards loss. In this landscape of eroded and lost intron sequences, the A. bisporus cox1 gene exhibits a peculiar dynamics of intron keeping and catching, leading to the largest collection of mitochondrial group I introns reported to date in a Eukaryote.

  16. miRNA profiling of naive, effector and memory CD8 T cells.

    Directory of Open Access Journals (Sweden)

    Haoquan Wu

    Full Text Available microRNAs have recently emerged as master regulators of gene expression during development and cell differentiation. Although profound changes in gene expression also occur during antigen-induced T cell differentiation, the role of miRNAs in the process is not known. We compared the miRNA expression profiles between antigen-specific naïve, effector and memory CD8+ T cells using 3 different methods--small RNA cloning, miRNA microarray analysis and real-time PCR. Although many miRNAs were expressed in all the T cell subsets, the frequency of 7 miRNAs (miR-16, miR-21, miR-142-3p, miR-142-5p, miR-150, miR-15b and let-7f alone accounted for approximately 60% of all miRNAs, and their expression was several fold higher than the other expressed miRNAs. Global downregulation of miRNAs (including 6/7 dominantly expressed miRNAs was observed in effector T cells compared to naïve cells and the miRNA expression levels tended to come back up in memory T cells. However, a few miRNAs, notably miR-21 were higher in effector and memory T cells compared to naïve T cells. These results suggest that concomitant with profound changes in gene expression, miRNA profile also changes dynamically during T cell differentiation. Sequence analysis of the cloned mature miRNAs revealed an extensive degree of end polymorphism. While 3'end polymorphisms dominated, heterogeneity at both ends, resembling drosha/dicer processing shift was also seen in miR-142, suggesting a possible novel mechanism to generate new miRNA and/or to diversify miRNA target selection. Overall, our results suggest that dynamic changes in the expression of miRNAs may be important for the regulation of gene expression during antigen-induced T cell differentiation. Our study also suggests possible novel mechanisms for miRNA biogenesis and function.

  17. Differential expression profile of miRNAs in porcine muscle and adipose tissue during development.

    Science.gov (United States)

    Wang, Qi; Qi, Renli; Wang, Jing; Huang, Wenming; Wu, Yongjiang; Huang, Xiaofeng; Yang, Feiyun; Huang, Jinxiu

    2017-06-30

    MicroRNAs (miRNAs) are a class of non-coding RNAs that play a crucial regulatory role in many biological processes. Previous studies have reported miRNAs that are associated with the growth, differentiation, and proliferation of myocytes and adipocytes in pigs. However, differences in the miRNA expression profiles between muscle and adipose tissues during porcine development are unknown. Muscle and adipose tissues are the two major organs that are crucial for dynamic energy balance in the development and metabolism. Identification of differential expression profile of miRNAs will be useful for understanding the regulatory role of miRNAs in growth, development and evolution of these two tissues, and the research results will provide theoretical basis to improve meat quality. Therefore, we applied Hiseq sequencing to profile miRNAs in muscle and adipose tissues during four development stage at 1, 30, 90 and 240-day-old to explore their regulatory patterns at critical growth stages of pigs. We slaughtered 6 pigs at each developmental stages (24 pigs in total), respectively, RNA of three individual pigs were pooled and duplicate samples at each time point were given to sequence. We obtained a total of 96 million clean reads, and identified 329 known miRNAs and 157 novel miRNAs from all the libraries. We detected 37 miRNAs that were differentially expressed between porcine muscle and adipose tissues; 17 miRNAs which differentially expressed at 30, 90 and 240-day-old were considered as core differentially expressed miRNAs, among them, three miRNAs (ssc-miR-128, -133a-5p, -489) were differentially expressed at all four stages. KEGG analysis revealed the target genes of 17 core differentially expressed miRNAs were involved in 27 significantly enriched pathways (Pmuscle and adipose tissues, respectively, of 30, 90, and 240-day-old pigs compared with the tissues of 1-day-old pigs. We selected five miRNAs from 17 core differentially expressed miRNAs to validate the mi

  18. The dynamic loss and gain of introns during the evolution of the Brassicaceae.

    Science.gov (United States)

    Milia, Giampiera; Camiolo, Salvatore; Avesani, Linda; Porceddu, Andrea

    2015-06-01

    Sequence comparison allows the detailed analysis of evolution at the nucleotide and amino acid levels, but much less information is known about the structural evolution of genes, i.e. how the number, length and distribution of introns change over time. We constructed a parsimonious model for the evolutionary rate of intron loss (IL) and intron gain (IG) within the Brassicaceae and found that IL/IG has been highly dynamic, with substantial differences between and even within lineages. The divergence of the Brassicaceae lineages I and II marked a dramatic change in the IL rate, with the common ancestor of lineage I losing introns three times more rapidly than the common ancestor of lineage II. Our data also indicate a subsequent declining trend in the rate of IL, although in Arabidopsis thaliana introns continue to be lost at approximately the ancestral rate. Variations in the rate of IL/IG within lineage II have been even more remarkable. Brassica rapa appears to have lost introns approximately 15 times more rapidly than the common ancestor of B. rapa and Schenkiella parvula, and approximately 25 times more rapidly than its sister species Eutrema salsugineum. Microhomology was detected at the splice sites of several dynamic introns suggesting that the non-homologous end-joining and double-strand break repair is a common pathway underlying IL/IG in these species. We also detected molecular signatures typical of mRNA-mediated IL, but only in B. rapa. © 2015 The Authors The Plant Journal © 2015 John Wiley & Sons Ltd.

  19. Development of rapidly evolving intron markers to estimate multilocus species trees of rodents.

    Directory of Open Access Journals (Sweden)

    Ana Rodríguez-Prieto

    Full Text Available One of the major challenges in the analysis of closely related species, speciation and phylogeography is the identification of variable sequence markers that allow the determination of genealogical relationships in multiple genomic regions using coalescent and species tree approaches. Rodent species represent nearly half of the mammalian diversity, but so far no systematic study has been carried out to detect suitable informative markers for this group. Here, we used a bioinformatic pipeline to extract intron sequences from rodent genomes available in databases and applied a series of filters that allowed the identification of 208 introns that adequately fulfilled several criteria for these studies. The main required characteristics of the introns were that they had the maximum possible mutation rates, that they were part of single-copy genes, that they had an appropriate sequence length for amplification, and that they were flanked by exons with suitable regions for primer design. In addition, in order to determine the validity of this approach, we chose ten of these introns for primer design and tested them in a panel of eleven rodent species belonging to different representative families. We show that all these introns can be amplified in the majority of species and that, overall, 79% of the amplifications worked with minimum optimization of the annealing temperature. In addition, we confirmed for a pair of sister species the relatively high level of sequence divergence of these introns. Therefore, we provide here a set of adequate intron markers that can be applied to different species of Rodentia for their use in studies that require significant sequence variability.

  20. The Role of miRNAs as Key Regulators in the Neoplastic Microenvironment

    Directory of Open Access Journals (Sweden)

    K. K. Wentz-Hunter

    2011-01-01

    Full Text Available The neoplastic microenvironment has been recognized to play a critical role in the development of cancer. Although a large body of evidence has established the importance of the cancer microenvironment, the manners of crosstalk between it and the cancer cells still remains unclear. Emerging mechanisms of communication include microRNAs (miRNAs. miRNAs are small noncoding RNA molecules that are involved in the posttranscriptional regulation of mRNA. Both intracellular and circulating miRNAs are differentially expressed in cancer and some of these alterations have been correlated with clinical patient outcomes. The role of miRNAs in the tumor microenvironment has only recently become a focus of research, however. In this paper, we discuss the influence of miRNAs on the tumor microenvironment as it relates to cancer progression. We conclude that miRNAs are a critical component in understanding invasion and metastasis of cancer cells.

  1. A method for clustering of miRNA sequences using fragmented programming

    Science.gov (United States)

    Ivashchenko, Anatoly; Pyrkova, Anna; Niyazova, Raigul

    2016-01-01

    Clustering of miRNA sequences is an important problem in molecular genetics associated cellular biology. Thousands of such sequences are known today through advancement in sophisticated molecular tools, sequencing techniques, computational resources and rule based mathematical models. Analysis of such large-scale miRNA sequences for inferring patterns towards deducing cellular function is a great challenge in modern molecular biology. Therefore, it is of interest to develop mathematical models specific for miRNA sequences. The process is to group (cluster) such miRNA sequences using well-defined known features. We describe a method for clustering of miRNA sequences using fragmented programming. Subsequently, we illustrated the utility of the model using a dendrogram (a tree diagram) for publically known A.thaliana miRNA nucleotide sequences towards the inference of observed conserved patterns PMID:27212839

  2. New insight into the role of miRNAs in leukemia

    Institute of Scientific and Technical Information of China (English)

    2009-01-01

    Recent studies have shown that microRNAs(miRNAs) play an important role in cell differentiation,growth,and death,including the functional study of miRNAs in tumorigenesis.To date,miRNA expression profiles in many types of cancers have been identified and miRNA expression signatures associated with types and cytogenetics of leukemia have also been reported.Increasing evidence has shown that miRNAs could function as either tumor suppressors or oncogenes in cancers such as leukemia,while other miRNAs might be benefitcial for diagnosis and prognosis,predicted to be newly developed biomarkers.In this review,we summarize the recent progress about miRNAs in leukemia and present a miRNA-mediated network involved in differentiation,proliferation and apoptosis predicted to be the roles of miRNAs in the pathogenesis of leukemia.

  3. Naive and primed murine pluripotent stem cells have distinct miRNA expression profiles

    OpenAIRE

    Jouneau, A.; Ciaudo, C.; Sismeiro, O.; Brochard, V.; Jouneau, L.; Vandormael-Pournin, S; Coppee, J.-Y.; Zhou, Q.; Heard, E.; Antoniewski, C.; Cohen-Tannoudji, M.

    2012-01-01

    Over the last years, the microRNA (miRNA) pathway has emerged as a key component of the regulatory network of pluripotency. Although clearly distinct states of pluripotency have been described in vivo and ex vivo, differences in miRNA expression profiles associated with the developmental modulation of pluripotency have not been extensively studied. Here, the authors performed deep sequencing to profile miRNA expression in naive (embryonic stem cell [ESC]) and primed (epiblast stem cell [EpiSC...

  4. Histone acetyltransferase GCN5 interferes with the miRNA pathway in Arabidopsis

    Institute of Scientific and Technical Information of China (English)

    Wanhui Kim; Moussa Benhamed; Caroline Servet; David Latrasse; Wei Zhang; Marianne Delarue; Dao-Xiu Zhou

    2009-01-01

    MicroRNAs (miRNA) that guide sequence-specific posttranscriptional gene silencing play an important role in gene expression required for both developmental processes and responses to environmental conditions in plants. However, little is known about the transcriptional and posttranscriptional regulation of miRNA expression. Histone acetylation plays an important role in chromatin remodeling and is required for gene activation. By analyzing the accumulation of subset of miRNAs and the corresponding primary miRNAs in mutants of Arabidopsis, we show that histone acetyltransferase GCN5 (General control non-repressed protein5) has a general repressive effect on miRNA production, while it is required for the expression of a subset of (e.g. stress-inducible) MIRNA genes. The general negative function of GCN5 in miRNA production is likely achieved through an indirect repression of the miRNA ma-chinery genes such as DICER LIKE1 (DCLI), SERRATE (SE), HYPONASTIC LEAVES1 (HYL1) and ARGONAUTE1(AGOI). Chromatin immunoprecipitation assays revealed that GCN5 targets to a subset of MIRNA genes and is required for acetylation of histone H3 lysine 14 at these loci. Moreover, inhibition of histone deacetylation by trichos-tatin A treatment or in histone deacetylase gene mutants impaired the accumulation of certain miRNAs. These data together suggest that Arabidopsis GCN5 interferes with the miRNA pathway at both the transcriptional and post-transcriptional levels and histone acetylation/deacetylation is an epigenetic mechanism involved in the regulation of miRNA production.

  5. Identification of mouse liver mitochondria-associated miRNAs and their potential biological functions

    Institute of Scientific and Technical Information of China (English)

    Zhen Bian; Li-Min Li; Rui Tang; Dong-Xia Hou; Xi Chen; Chen-Yu Zhang; Ke Zen

    2010-01-01

    @@ Dear Editor, By analyzing the genome-wide microRNA(miRNA)expression profile using microRNA microarray and stemloop miRNA qPCR assay,we report that unique miRNAs are enriched in mitochondria and these mitochondriaassociated miRNAs may be involved in the regulation of gene expression of mitochondria and other general cellular processes such as apoptosis,proliferation and differentiation.

  6. Platelets confound the measurement of extracellular miRNA in archived plasma

    OpenAIRE

    Mitchell, Adam J.; Gray, Warren D; Hayek, Salim S.; Yi-An Ko; Sheena Thomas; Kim Rooney; Mosaab Awad; John D. Roback; Arshed Quyyumi; Searles, Charles D.

    2016-01-01

    Extracellular miRNAs are detectable in biofluids and represent a novel class of disease biomarker. Although many studies have utilized archived plasma for miRNA biomarker discovery, the effects of processing and storage have not been rigorously studied. Previous reports have suggested plasma samples are commonly contaminated by platelets, significantly confounding the measurement of extracellular miRNA, which was thought to be easily addressed by additional post-thaw plasma processing. In a c...

  7. A Leader Intron of a Soybean Elongation Factor 1A (eEF1A) Gene Interacts with Proximal Promoter Elements to Regulate Gene Expression in Synthetic Promoters.

    Science.gov (United States)

    Zhang, Ning; McHale, Leah K; Finer, John J

    2016-01-01

    Introns, especially the first intron in the 5' untranslated region (5'UTR), can significantly impact gene expression via intron-mediated enhancement (IME). In this study, we demonstrate the leader intron of a soybean elongation factor 1A (eEF1A) gene (GmScreamM8) was essential for the high activity of the native promoter. Furthermore, the interaction of the GmScreamM8 leader intron with regulatory element sequences from several soybean eEF1A promoters was studied using synthetic promoters, which consisted of element tetramers upstream of a core promoter used to regulate a green fluorescent protein (gfp) reporter gene. Element tetramers, placed upstream of a GmScreamM8 core promoter, showed very high activity using both transient expression in lima bean cotyledons and stable expression in soybean hairy roots, only if the native leader intron was included, suggesting an interaction between intronic sequences and promoter elements. Partial deletions of the leader intron showed that a 222 bp intronic sequence significantly contributed to very high levels of GFP expression. Generation of synthetic intron variants with a monomeric or trimeric repeat of the 222 bp intronic sequence, yielded almost two-fold higher expression compared to the original intron, while partial deletion of the 222 bp intronic repeated sequence significantly decreased gene expression, indicating that this intronic sequence was essential for the intron-element interaction enhancement.

  8. Circulating miRNAs as biomarkers for neurodegenerative disorders.

    Science.gov (United States)

    Grasso, Margherita; Piscopo, Paola; Confaloni, Annamaria; Denti, Michela A

    2014-05-23

    Neurodegenerative disorders, such as Alzheimer's disease (AD), Parkinson's disease (PD) and frontotemporal dementias (FTD), are considered distinct entities, however, there is increasing evidence of an overlap from the clinical, pathological and genetic points of view. All neurodegenerative diseases are characterized by neuronal loss and death in specific areas of the brain, for example, hippocampus and cortex for AD, midbrain for PD, frontal and temporal lobes for FTD. Loss of neurons is a relatively late event in the progression of neurodegenerative diseases that is typically preceded by other events such as metabolic changes, synaptic dysfunction and loss, neurite retraction, and the appearance of other abnormalities, such as axonal transport defects. The brain's ability to compensate for these dysfunctions occurs over a long period of time and results in late clinical manifestation of symptoms, when successful pharmacological intervention is no longer feasible. Currently, diagnosis of AD, PD and different forms of dementia is based primarily on analysis of the patient's cognitive function. It is therefore important to find non-invasive diagnostic methods useful to detect neurodegenerative diseases during early, preferably asymptomatic stages, when a pharmacological intervention is still possible. Altered expression of microRNAs (miRNAs) in many disease states, including neurodegeneration, and increasing relevance of miRNAs in biofluids in different pathologies has prompted the study of their possible application as neurodegenerative diseases biomarkers in order to identify new therapeutic targets. Here, we review what is known about the role of miRNAs in the pathogenesis of neurodegeneration and the possibilities and challenges of using these small RNA molecules as a signature for neurodegenerative conditions.

  9. Circulating miRNAs as Biomarkers for Neurodegenerative Disorders

    Directory of Open Access Journals (Sweden)

    Margherita Grasso

    2014-05-01

    Full Text Available Neurodegenerative disorders, such as Alzheimer’s disease (AD, Parkinson’s disease (PD and frontotemporal dementias (FTD, are considered distinct entities, however, there is increasing evidence of an overlap from the clinical, pathological and genetic points of view. All neurodegenerative diseases are characterized by neuronal loss and death in specific areas of the brain, for example, hippocampus and cortex for AD, midbrain for PD, frontal and temporal lobes for FTD. Loss of neurons is a relatively late event in the progression of neurodegenerative diseases that is typically preceded by other events such as metabolic changes, synaptic dysfunction and loss, neurite retraction, and the appearance of other abnormalities, such as axonal transport defects. The brain’s ability to compensate for these dysfunctions occurs over a long period of time and results in late clinical manifestation of symptoms, when successful pharmacological intervention is no longer feasible. Currently, diagnosis of AD, PD and different forms of dementia is based primarily on analysis of the patient’s cognitive function. It is therefore important to find non-invasive diagnostic methods useful to detect neurodegenerative diseases during early, preferably asymptomatic stages, when a pharmacological intervention is still possible. Altered expression of microRNAs (miRNAs in many disease states, including neurodegeneration, and increasing relevance of miRNAs in biofluids in different pathologies has prompted the study of their possible application as neurodegenerative diseases biomarkers in order to identify new therapeutic targets. Here, we review what is known about the role of miRNAs in the pathogenesis of neurodegeneration and the possibilities and challenges of using these small RNA molecules as a signature for neurodegenerative conditions.

  10. Mutant p53 inhibits miRNA biogenesis by interfering with the microprocessor complex.

    Science.gov (United States)

    Garibaldi, F; Falcone, E; Trisciuoglio, D; Colombo, T; Lisek, K; Walerych, D; Del Sal, G; Paci, P; Bossi, G; Piaggio, G; Gurtner, A

    2016-07-21

    Downregulation of microRNAs (miRNAs) is commonly observed in cancers and promotes tumorigenesis suggesting that miRNAs may function as tumor suppressors. However, the mechanism through which miRNAs are regulated in cancer, and the connection between oncogenes and miRNA biogenesis remain poorly understood. The TP53 tumor-suppressor gene is mutated in half of human cancers resulting in an oncogene with gain-of-function activities. Here we demonstrate that mutant p53 (mutp53) oncoproteins modulate the biogenesis of a subset of miRNAs in cancer cells inhibiting their post-transcriptional maturation. Interestingly, among these miRNAs several are also downregulated in human tumors. By confocal, co-immunoprecipitation and RNA-chromatin immunoprecipitation experiments, we show that endogenous mutp53 binds and sequesters RNA helicases p72/82 from the microprocessor complex, interfering with Drosha-pri-miRNAs association. In agreement with this, the overexpression of p72 leads to an increase of mature miRNAs levels. Moreover, functional experiments demonstrate the oncosuppressive role of mutp53-dependent miRNAs (miR-517a, -519a, -218, -105). Our study highlights a previously undescribed mechanism by which mutp53 interferes with Drosha-p72/82 association leading, at least in part, to miRNA deregulation observed in cancer.

  11. miRNA in Prostate Cancer: New Prospects for Old Challenges

    OpenAIRE

    Mekhail, Samy M; Yousef, Peter G; Jackinsky, Stephen W; Pasic, Maria; Yousef, George M

    2014-01-01

    Abstract Prostate cancer (PCa) is one of the most commonly diagnosed cancers among men but has limited prognostic biomarkers available for follow up. MicroRNAs (miRNAs) are small non-coding RNAs that regulate expression of their target genes. Accumulating experimental evidence reports differential miRNA expression in PCa, and that miRNAs are actively involved in the pathogenesis and progression of PCa. miRNA and androgen receptor signaling cross-talk is an established factor in PCa pathogenes...

  12. Elsevier Trophoblast Research Award Lecture: origin, evolution and future of placenta miRNAs.

    Science.gov (United States)

    Morales-Prieto, D M; Ospina-Prieto, S; Schmidt, A; Chaiwangyen, W; Markert, U R

    2014-02-01

    MicroRNAs (miRNAs) regulate the expression of a large number of genes in plants and animals. Placental miRNAs appeared late in evolution and can be found only in mammals. Nevertheless, these miRNAs are constantly under evolutionary pressure. As a consequence, miRNA sequences and their mRNA targets may differ between species, and some miRNAs can only be found in humans. Their expression can be tissue- or cell-specific and can vary time-dependently. Human placenta tissue exhibits a specific miRNA expression pattern that dynamically changes during pregnancy and is reflected in the maternal plasma. Some placental miRNAs are involved in or associated with major pregnancy disorders, such as preeclampsia, intrauterine growth restriction or preterm delivery and, therefore, have a strong potential for usage as sensitive and specific biomarkers. In this review we summarize current knowledge on the origin of placental miRNAs, their expression in humans with special regard to trophoblast cells, interspecies differences, and their future as biomarkers. It can be concluded that animal models for human reproduction have a different panel of miRNAs and targets, and can only partly reflect or predict the situation in humans.

  13. In-silico identification of miRNAs and their regulating target functions in Ocimum basilicum.

    Science.gov (United States)

    Singh, Noopur; Sharma, Ashok

    2014-12-01

    microRNA is known to play an important role in growth and development of the plants and also in environmental stress. Ocimum basilicum (Basil) is a well known herb for its medicinal properties. In this study, we used in-silico approaches to identify miRNAs and their targets regulating different functions in O. basilicum using EST approach. Additionally, functional annotation, gene ontology and pathway analysis of identified target transcripts were also done. Seven miRNA families were identified. Meaningful regulations of target transcript by identified miRNAs were computationally evaluated. Four miRNA families have been reported by us for the first time from the Lamiaceae. Our results further confirmed that uracil was the predominant base in the first positions of identified mature miRNA sequence, while adenine and uracil were predominant in pre-miRNA sequences. Phylogenetic analysis was carried out to determine the relation between O. basilicum and other plant pre-miRNAs. Thirteen potential targets were evaluated for 4 miRNA families. Majority of the identified target transcripts regulated by miRNAs showed response to stress. miRNA 5021 was also indicated for playing an important role in the amino acid metabolism and co-factor metabolism in this plant. To the best of our knowledge this is the first in silico study describing miRNAs and their regulation in different metabolic pathways of O. basilicum.

  14. Reliable reference miRNAs for quantitative gene expression analysis of stress responses in Caenorhabditis elegans

    DEFF Research Database (Denmark)

    Kagias, Konstantinos; Podolska, Agnieszka; Pocock, Roger David John

    2014-01-01

    Quantitative real-time PCR (qPCR) has become the "gold standard" for measuring expression levels of individual miRNAs. However, little is known about the validity of reference miRNAs, the improper use of which can result in misleading interpretation of data.......Quantitative real-time PCR (qPCR) has become the "gold standard" for measuring expression levels of individual miRNAs. However, little is known about the validity of reference miRNAs, the improper use of which can result in misleading interpretation of data....

  15. Detection of cancer with serum miRNAs on an oligonucleotide microarray.

    Directory of Open Access Journals (Sweden)

    Michael J Lodes

    Full Text Available Micro RNAs (miRNAs are a class of small, non-coding RNA species that play critical roles throughout cellular development and regulation. miRNA expression patterns taken from various tissue types often point to the cellular lineage of an individual tissue type, thereby being a more invariant hallmark of tissue type. Recent work has shown that these miRNA expression patterns can be used to classify tumor cells, and that this classification can be more accurate than the classification achieved by using messenger RNA gene expression patterns. One aspect of miRNA biogenesis that makes them particularly attractive as a biomarker is the fact that they are maintained in a protected state in serum and plasma, thus allowing the detection of miRNA expression patterns directly from serum. This study is focused on the evaluation of miRNA expression patterns in human serum for five types of human cancer, prostate, colon, ovarian, breast and lung, using a pan-human microRNA, high density microarray. This microarray platform enables the simultaneous analysis of all human microRNAs by either fluorescent or electrochemical signals, and can be easily redesigned to include newly identified miRNAs. We show that sufficient miRNAs are present in one milliliter of serum to detect miRNA expression patterns, without the need for amplification techniques. In addition, we are able to use these expression patterns to correctly discriminate between normal and cancer patient samples.

  16. miRNA profiles in cerebrospinal fluid from patients with central hypersomnias

    DEFF Research Database (Denmark)

    Holm, Anja; Bang-Berthelsen, Claus Heiner; Knudsen, Stine;

    2014-01-01

    MicroRNAs (miRNAs) are involved in the pathogenesis of many human diseases, including some neurological disorders. Recently, we have reported dysregulated miRNAs in plasma from patients with central hypersomnias including type 1 and type 2 narcolepsy, and idiopathic hypersomnia. This study......-fold change in concentration in CSF from patients with type 1 and type 2 narcolepsy and idiopathic hypersomnia, respectively, compared with matched healthy controls. Most miRNAs differed in more than one of the sleep disorders. However, all miRNAs were detected at low levels in CSF and varied between...

  17. Differential expression of miRNAs and their relation to active tuberculosis.

    Science.gov (United States)

    Xu, Zhihong; Zhou, Aiping; Ni, Jinjing; Zhang, Qiufen; Wang, Ying; Lu, Jie; Wu, Wenjuan; Karakousis, Petros C; Lu, Shuihua; Yao, Yufeng

    2015-07-01

    The aim of this work was to screen miRNA signatures dysregulated in tuberculosis to improve our understanding of the biological role of miRNAs involved in the disease. Datasets deposited in publically available databases from microarray studies on infectious diseases and malignancies were retrieved, screened, and subjected to further analysis. Effect sizes were combined using the inverse-variance model and between-study heterogeneity was evaluated by the random effects model. 35 miRNAs were differentially expressed (12 up-regulated, 23 down-regulated; p tuberculosis and other infectious diseases. 15 miRNAs were found to be significantly differentially regulated (7 up-regulated, 8 down-regulated; p tuberculosis and malignancies. Most of the miRNA signatures identified in this study were found to be involved in immune responses and metabolism. Expression of these miRNA signatures in serum samples from TB subjects (n = 11) as well as healthy controls (n = 10) was examined by TaqMan miRNA array. Taken together, the results revealed differential expression of miRNAs in TB, but available datasets are limited and these miRNA signatures should be validated in future studies. Copyright © 2015 Elsevier Ltd. All rights reserved.

  18. Conserved miRNAs and Their Response to Salt Stress in Wild Eggplant Solanum linnaeanum Roots

    Directory of Open Access Journals (Sweden)

    Yong Zhuang

    2014-01-01

    Full Text Available The Solanaceae family includes some important vegetable crops, and they often suffer from salinity stress. Some miRNAs have been identified to regulate gene expression in plant response to salt stress; however, little is known about the involvement of miRNAs in Solanaceae species. To identify salt-responsive miRNAs, high-throughput sequencing was used to sequence libraries constructed from roots of the salt tolerant species, Solanum linnaeanum, treated with and without NaCl. The sequencing identified 98 conserved miRNAs corresponding to 37 families, and some of these miRNAs and their expression were verified by quantitative real-time PCR. Under the salt stress, 11 of the miRNAs were down-regulated, and 3 of the miRNAs were up-regulated. Potential targets of the salt-responsive miRNAs were predicted to be involved in diverse cellular processes in plants. This investigation provides valuable information for functional characterization of miRNAs in S. linnaeanum, and would be useful for developing strategies for the genetic improvement of the Solanaceae crops.

  19. Identification of miRNAs that modulate glucocerebrosidase activity in Gaucher disease cells.

    Science.gov (United States)

    Siebert, Marina; Westbroek, Wendy; Chen, Yu-Chi; Moaven, Nima; Li, Yan; Velayati, Arash; Saraiva-Pereira, Maria Luiza; Martin, Scott E; Sidransky, Ellen

    2014-01-01

    Gaucher disease is an autosomal recessive disorder caused by deficiency of the enzyme glucocerebrosidase. Although it is a monogenic disease, there is vast phenotypic heterogeneity, even among patients with the same genotype. MicroRNAs (miRNAs) are small non-coding RNAs involved in many biological processes and diseases. To determine whether miRNAs can affect glucocerebrosidase activity, we performed a screen of 875 different miRNA mimics. The screen was performed using Gaucher fibroblasts, and glucocerebrosidase activity was used as the initial outcome parameter. We found several miRNAs that either up- or down-regulated glucocerebrosidase activity. In follow-up assays, we confirmed that one specific miRNA (miR-127-5p) down-regulated both glucocerebrosidase activity and protein levels by down-regulation of LIMP-2, the receptor involved in proper trafficking of glucocerebrosidase from the endoplasmic reticulum to the lysosome. A conditioned media assay demonstrated that cells treated with this miRNA secreted glucocerebrosidase into the extracellular environment, supporting impaired LIMP-2 function. Two other miRNAs, miR-16-5p and miR-195-5p, were found to up-regulate glucocerebrosidase activity by greater than 40% and to enhance expression and protein levels of the enzyme. In conclusion, we show that miRNAs can alter glucocerebrosidase activity in patient cells, indicating that miRNAs can potentially act as modifiers in Gaucher disease.

  20. Platelets confound the measurement of extracellular miRNA in archived plasma.

    Science.gov (United States)

    Mitchell, Adam J; Gray, Warren D; Hayek, Salim S; Ko, Yi-An; Thomas, Sheena; Rooney, Kim; Awad, Mosaab; Roback, John D; Quyyumi, Arshed; Searles, Charles D

    2016-09-13

    Extracellular miRNAs are detectable in biofluids and represent a novel class of disease biomarker. Although many studies have utilized archived plasma for miRNA biomarker discovery, the effects of processing and storage have not been rigorously studied. Previous reports have suggested plasma samples are commonly contaminated by platelets, significantly confounding the measurement of extracellular miRNA, which was thought to be easily addressed by additional post-thaw plasma processing. In a case-control study of archived plasma, we noted a significant correlation between miRNA levels and platelet counts despite post-thaw processing. We thus examined the effects of a single freeze/thaw cycle on microparticles (MPs) and miRNA levels, and show that a single freeze/thaw cycle of plasma dramatically increases the number of platelet-derived MPs, contaminates the extracellular miRNA pool, and profoundly affects the levels of miRNAs detected. The measurement of extracellular miRNAs in archived samples is critically dependent on the removal of residual platelets prior to freezing plasma samples. Many previous clinical studies of extracellular miRNA in archived plasma should be interpreted with caution and future studies should avoid the effects of platelet contamination.

  1. Association between the miRNA Signatures in Plasma and Bronchoalveolar Fluid in Respiratory Pathologies

    Directory of Open Access Journals (Sweden)

    Sonia Molina-Pinelo

    2012-01-01

    Full Text Available The identification of new less invasive biomarkers is necessary to improve the detection and prognostic outcome of respiratory pathological processes. The measurement of miRNA expression through less invasive techniques such as plasma and serum have been suggested to analysis of several lung malignancies including lung cancer. These studies are assuming a common deregulated miRNA expression both in blood and lung tissue. The present study aimed to obtain miRNA representative signatures both in plasma and bronchoalveolar cell fraction that could serve as biomarker in respiratory diseases. Ten patients were evaluated to assess the expression levels of 381 miRNAs. We found that around 50% miRNAs were no detected in both plasma and bronchoalveolar cell fraction and only 20% of miRNAs showed similar expression in both samples. These results show a lack of association of miRNA signatures between plasma and bronchoalveolar cytology in the same patient. The profiles are not comparable; however, there is a similarity in the relative expression in a very small subset of miRNAs (miR-17, miR-19b, miR-195 and miR-20b between both biological samples in all patients. This finding supports that the miRNAs profiles obtained from different biological samples have to be carefully validated to link with respiratory diseases.

  2. Recent horizontal transfer, functional adaptation and dissemination of a bacterial group II intron.

    Science.gov (United States)

    LaRoche-Johnston, Félix; Monat, Caroline; Cousineau, Benoit

    2016-10-20

    Group II introns are catalytically active RNA and mobile retroelements present in certain eukaryotic organelles, bacteria and archaea. These ribozymes self-splice from the pre-mRNA of interrupted genes and reinsert within target DNA sequences by retrohoming and retrotransposition. Evolutionary hypotheses place these retromobile elements at the origin of over half the human genome. Nevertheless, the evolution and dissemination of group II introns was found to be quite difficult to infer. We characterized the functional and evolutionary relationship between the model group II intron from Lactococcus lactis, Ll.LtrB, and Ef.PcfG, a newly discovered intron from a clinical strain of Enterococcus faecalis. Ef.PcfG was found to be homologous to Ll.LtrB and to splice and mobilize in its native environment as well as in L. lactis. Interestingly, Ef.PcfG was shown to splice at the same level as Ll.LtrB but to be significantly less efficient to invade the Ll.LtrB recognition site. We also demonstrated that specific point mutations between the IEPs of both introns correspond to functional adaptations which developed in L. lactis as a response to selective pressure on mobility efficiency independently of splicing. The sequence of all the homologous full-length variants of Ll.LtrB were compared and shown to share a conserved pattern of mutation acquisition. This work shows that Ll.LtrB and Ef.PcfG are homologous and have a common origin resulting from a recent lateral transfer event followed by further adaptation to the new target site and/or host environment. We hypothesize that Ef.PcfG is the ancestor of Ll.LtrB and was initially acquired by L. lactis, most probably by conjugation, via a single event of horizontal transfer. Strong selective pressure on homing site invasion efficiency then led to the emergence of beneficial point mutations in the IEP, enabling the successful establishment and survival of the group II intron in its novel lactococcal environment. The current

  3. PCR primers for an aldolase-B intron in acanthopterygian fishes

    Directory of Open Access Journals (Sweden)

    Jones William J

    2001-11-01

    Full Text Available Abstract Background Nuclear DNA sequences provide genetic information that complements studies using mitochondrial DNA. Some 'universal' primer sets have been developed that target introns within protein-coding loci, but many simultaneously amplify introns from paralogous loci. Refining existing primer sets to target a single locus could circumvent this problem. Results Aldolase intron 'G' was amplified from four fish species using previously described primer sets that target several loci indiscriminately. Phylogenetic analyses were used to group these fragments and other full-length aldolase proteins from teleost fishes into orthologous clades and a primer set was designed to target specifically an intron within the aldolase-B locus in acanthopterygian fishes. DNA amplifications were tried in a variety of acanthopterygian fishes and amplification products, identifiable as aldolase-B intron 'G', were observed in all atherinomorph and percomorph taxa examined. Sequence variation within this locus was found within and among several species examined. Conclusions Using 'universal' primer sets coupled with phylogenetic analyses it was possible to develop a genetic assay to target a specific locus in a variety of fish taxa. Sequence variation was observed within and among species suggesting that this targeted assay might facilitate interspecific and intraspecific comparisons.

  4. Evidence against the energetic cost hypothesis for the short introns in highly expressed genes

    Directory of Open Access Journals (Sweden)

    Niu Deng-Ke

    2008-05-01

    Full Text Available Abstract Background In animals, the moss Physcomitrella patens and the pollen of Arabidopsis thaliana, highly expressed genes have shorter introns than weakly expressed genes. A popular explanation for this is selection for transcription efficiency, which includes two sub-hypotheses: to minimize the energetic cost or to minimize the time cost. Results In an individual human, different organs may differ up to hundreds of times in cell number (for example, a liver versus a hypothalamus. Considered at the individual level, a gene specifically expressed in a large organ is actually transcribed tens or hundreds of times more than a gene with a similar expression level (a measure of mRNA abundance per cell specifically expressed in a small organ. According to the energetic cost hypothesis, the former should have shorter introns than the latter. However, in humans and mice we have not found significant differences in intron length between large-tissue/organ-specific genes and small-tissue/organ-specific genes with similar expression levels. Qualitative estimation shows that the deleterious effect (that is, the energetic burden of long introns in highly expressed genes is too negligible to be efficiently selected against in mammals. Conclusion The short introns in highly expressed genes should not be attributed to energy constraint. We evaluated evidence for the time cost hypothesis and other alternatives.

  5. Short-term sequence evolution and vertical inheritance of the Naegleria twin-ribozyme group I intron

    Directory of Open Access Journals (Sweden)

    De Jonckheere Johan F

    2006-05-01

    Full Text Available Abstract Background Ribosomal DNA of several species of the free-living Naegleria amoeba harbors an optional group I intron within the nuclear small subunit ribosomal RNA gene. The intron (Nae.S516 has a complex organization of two ribozyme domains (NaGIR1 and NaGIR2 and a homing endonuclease gene (NaHEG. NaGIR2 is responsible for intron excision, exon ligation, and full-length intron RNA circularization, reactions typical for nuclear group I intron ribozymes. NaGIR1, however, is essential for NaHEG expression by generating the 5' end of the homing endonuclease messenger RNA. Interestingly, this unusual class of ribozyme adds a lariat-cap at the mRNA. Results To elucidate the evolutionary history of the Nae.S516 twin-ribozyme introns we have analyzed 13 natural variants present in distinct Naegleria isolates. Structural variabilities were noted within both the ribozyme domains and provide strong comparative support to the intron secondary structure. One of the introns, present in N. martinezi NG872, contains hallmarks of a degenerated NaHEG. Phylogenetic analyses performed on separate data sets representing NaGIR1, NaGIR2, NaHEG, and ITS1-5.8S-ITS2 ribosomal DNA are consistent with an overall vertical inheritance pattern of the intron within the Naegleria genus. Conclusion The Nae.S516 twin-ribozyme intron was gained early in the Naegleria evolution with subsequent vertical inheritance. The intron was lost in the majority of isolates (70%, leaving a widespread but scattered distribution pattern. Why the apparent asexual Naegleria amoebae harbors active intron homing endonucleases, dependent on sexual reproduction for its function, remains a puzzle.

  6. A Novel Regulatory Mechanism of Type II Collagen Expression via a SOX9-dependent Enhancer in Intron 6.

    Science.gov (United States)

    Yasuda, Hideyo; Oh, Chun-do; Chen, Di; de Crombrugghe, Benoit; Kim, Jin-Hoi

    2017-01-13

    Type II collagen α1 is specific for cartilaginous tissues, and mutations in its gene are associated with skeletal diseases. Its expression has been shown to be dependent on SOX9, a master transcription factor required for chondrogenesis that binds to an enhancer region in intron 1. However, ChIP sequencing revealed that SOX9 does not strongly bind to intron 1, but rather it binds to intron 6 and a site 30 kb upstream of the transcription start site. Here, we aimed to determine the role of the novel SOX9-binding site in intron 6. We prepared reporter constructs that contain a Col2a1 promoter, intron 1 with or without intron 6, and the luciferase gene. Although the reporter constructs were not activated by SOX9 alone, the construct that contained both introns 1 and 6 was activated 5-10-fold by the SOX9/SOX5 or the SOX9/SOX6 combination in transient-transfection assays in 293T cells. This enhancement was also observed in rat chondrosarcoma cells that stably expressed the construct. CRISPR/Cas9-induced deletion of intron 6 in RCS cells revealed that a 10-bp region of intron 6 is necessary both for Col2a1 expression and SOX9 binding. Furthermore, SOX9, but not SOX5, binds to this region as demonstrated in an electrophoretic mobility shift assay, although both SOX9 and SOX5 bind to a larger 325-bp fragment of intron 6 containing this small sequence. These findings suggest a novel mechanism of action of SOX5/6; namely, the SOX9/5/6 combination enhances Col2a1 transcription through a novel enhancer in intron 6 together with the enhancer in intron 1. © 2017 by The American Society for Biochemistry and Molecular Biology, Inc.

  7. Ten Putative Contributors to the Obesity Epidemic

    Science.gov (United States)

    McAllister, Emily J.; Dhurandhar, Nikhil V.; Keith, Scott W.; Aronne, Louis J.; Barger, Jamie; Baskin, Monica; Benca, Ruth M.; Biggio, Joseph; Boggiano, Mary M.; Eisenmann, Joe C.; Elobeid, Mai; Fontaine, Kevin R.; Gluckman, Peter; Hanlon, Erin C.; Katzmarzyk, Peter; Pietrobelli, Angelo; Redden, David T.; Ruden, Douglas M.; Wang, Chenxi; Waterland, Robert A.; Wright, Suzanne M.; Allison, David B.

    2010-01-01

    The obesity epidemic is a global issue and shows no signs of abating, while the cause of this epidemic remains unclear. Marketing practices of energy-dense foods and institutionally-driven declines in physical activity are the alleged perpetrators for the epidemic, despite a lack of solid evidence to demonstrate their causal role. While both may contribute to obesity, we call attention to their unquestioned dominance in program funding and public efforts to reduce obesity, and propose several alternative putative contributors that would benefit from equal consideration and attention. Evidence for microorganisms, epigenetics, increasing maternal age, greater fecundity among people with higher adiposity, assortative mating, sleep debt, endocrine disruptors, pharmaceutical iatrogenesis, reduction in variability of ambient temperatures, and intrauterine and intergenerational effects, as contributing factors to the obesity epidemic are reviewed herein. While the evidence is strong for some contributors such as pharmaceutical-induced weight gain, it is still emerging for other reviewed factors. Considering the role of such putative etiological factors of obesity may lead to comprehensive, cause specific, and effective strategies for prevention and treatment of this global epidemic. PMID:19960394

  8. miRNA-197 and miRNA-223 Predict Cardiovascular Death in a Cohort of Patients with Symptomatic Coronary Artery Disease.

    Directory of Open Access Journals (Sweden)

    Christian Schulte

    Full Text Available Circulating microRNAs (miRNAs have been described as potential diagnostic biomarkers in cardiovascular disease and in particular, coronary artery disease (CAD. Few studies were undertaken to perform analyses with regard to risk stratification of future cardiovascular events. miR-126, miR-197 and miR-223 are involved in endovascular inflammation and platelet activation and have been described as biomarkers in the diagnosis of CAD. They were identified in a prospective study in relation to future myocardial infarction.The aim of our study was to further evaluate the prognostic value of these miRNAs in a large prospective cohort of patients with documented CAD.Levels of miR-126, miR-197 and miR-223 were evaluated in serum samples of 873 CAD patients with respect to the endpoint cardiovascular death. miRNA quantification was performed using real time polymerase chain reaction (RT-qPCR.The median follow-up period was 4 years (IQR 2.78-5.04. The median age of all patients was 64 years (IQR 57-69 with 80.2% males. 38.9% of the patients presented with acute coronary syndrome (ACS, 61.1% were diagnosed with stable angina pectoris (SAP. Elevated levels of miRNA-197 and miRNA-223 reliably predicted future cardiovascular death in the overall group (miRNA-197: hazard ratio (HR 1.77 per one standard deviation (SD increase (95% confidence interval (CI 1.20; 2.60, p = 0.004, C-index 0.78; miRNA-223: HR 2.23 per one SD increase (1.20; 4.14, p = 0.011, C-index 0.80. In ACS patients the prognostic power of both miRNAs was even higher (miRNA-197: HR 2.24 per one SD increase (1.25; 4.01, p = 0.006, C-index 0.89; miRA-223: HR 4.94 per one SD increase (1.42; 17.20, p = 0.012, C-index 0.89.Serum-derived circulating miRNA-197 and miRNA-223 were identified as predictors for cardiovascular death in a large patient cohort with CAD. These results reinforce the assumption that circulating miRNAs are promising biomarkers with prognostic value with respect to future

  9. Simultaneous inhibition of multiple oncogenic miRNAs by a multi-potent microRNA sponge.

    Science.gov (United States)

    Jung, Jaeyun; Yeom, Chanjoo; Choi, Yeon-Sook; Kim, Sinae; Lee, EunJi; Park, Min Ji; Kang, Sang Wook; Kim, Sung Bae; Chang, Suhwan

    2015-08-21

    The roles of oncogenic miRNAs are widely recognized in many cancers. Inhibition of single miRNA using antagomiR can efficiently knock-down a specific miRNA. However, the effect is transient and often results in subtle phenotype, as there are other miRNAs contribute to tumorigenesis. Here we report a multi-potent miRNA sponge inhibiting multiple miRNAs simultaneously. As a model system, we targeted miR-21, miR-155 and miR-221/222, known as oncogenic miRNAs in multiple tumors including breast and pancreatic cancers. To achieve efficient knockdown, we generated perfect and bulged-matched miRNA binding sites (MBS) and introduced multiple copies of MBS, ranging from one to five, in the multi-potent miRNA sponge. Luciferase reporter assay showed the multi-potent miRNA sponge efficiently inhibited 4 miRNAs in breast and pancreatic cancer cells. Furthermore, a stable and inducible version of the multi-potent miRNA sponge cell line showed the miRNA sponge efficiently reduces the level of 4 target miRNAs and increase target protein level of these oncogenic miRNAs. Finally, we showed the miRNA sponge sensitize cells to cancer drug and attenuate cell migratory activity. Altogether, our study demonstrates the multi-potent miRNA sponge is a useful tool to examine the functional impact of simultaneous inhibition of multiple miRNAs and proposes a therapeutic potential.

  10. Fine-tuning oligodendrocyte development by miRNAs

    Directory of Open Access Journals (Sweden)

    Richard eLu

    2012-02-01

    Full Text Available Myelination of axons by oligodendrocytes in the central nervous system is essential for normal neuronal functions. The failure of remyelination due to injury or pathological insults results in devastating demyelinating diseases. Oligodendrocytes originate in restricted regions of the embryonic ventral neural tube. After migration to populate all areas of the brain and spinal cord, they undergo a temporally well-defined series of molecular and structural changes, ultimately culminating in the cessation of proliferation, and the elaboration of a highly complex myelin sheath. The emergence of microRNAs as potent regulators of gene expression at the post-transcriptional level has broad implications in all facets of biology. Recent studies have demonstrated a critical role of microRNAs in oligodendrocyte development, including cell proliferation, maturation, and myelin formation. In this review, we will highlight and discuss the recent understanding of functional links of miRNAs to regulatory networks for central myelination, as well as perspectives on the role of miRNAs in demyelinating diseases.

  11. The Sequence Variations of Intron-3 of the α-Amylase Gene in Adzuki Bean

    Institute of Scientific and Technical Information of China (English)

    JIN Wen-lin; Yamaguchi Hirofumi; Isigami Matiko; Yasuda Kentaro

    2003-01-01

    This study describes variation of intron-3 of a-amylase gene from 156 breeds of adzuki beansusing SSCP(single-strand conformation polymorphism)analysis. Based on a-amylase gene structure and se-quence, A pair of PCR primers, F (CCTACATTCTAACACACCCT) and R (GCATATTGTGCCAGTACAAT)were designed to amplify intron-3 fragments of a-amylase gene. 14 variant types were detected, including 13,9, 10, 4 variant types in the wild, weed, locally cultivated and modern brought-up adzuki beans respectively,9, 8, 7 variant types of the wild adzuki beans from Japan, China and Korea respectively, and some other va-riant types in the local adzuki beans from China and Bhutan. 60 % of subjects of cultivated races were found tobe EE type in the experiment. In addition, sequence analysis of intron-3 of α-amylase gene from 8 varianttypes reveals the evolution process of various variant types in adzuki beans.

  12. Exon-primed intron-crossing (EPIC markers as a tool for ant phylogeography

    Directory of Open Access Journals (Sweden)

    Patrícia R. Ströher

    2013-12-01

    Full Text Available Exon-primed intron-crossing (EPIC markers as a tool for ant phylogeography. Due to their local abundance, diversity of adaptations and worldwide distribution, ants are a classic example of adaptive radiation. Despite this evolutionary and ecological importance, phylogeographical studies on ants have relied largely on mitochondrial markers. In this study we design and test exon-primed intron-crossing (EPIC markers, which can be widely used to uncover ant intraspecific variation. Candidate markers were obtained through screening the available ant genomes for unlinked conserved exonic regions interspersed with introns. A subset of 15 markers was tested in vitro and showed successful amplification in several phylogenetically distant ant species. These markers represent an important step forward in ant phylogeography and population genetics, allowing for more extensive characterization of variation in ant nuclear DNA without the need to develop species-specific markers.

  13. The strength of intron donor splice sites in human genes displays a bell-shaped pattern

    DEFF Research Database (Denmark)

    Wang, Kai; Wernersson, Rasmus; Brunak, Søren

    2011-01-01

    MOTIVATION: The gene concept has recently changed from the classical one protein notion into a much more diverse picture, where overlapping or fused transcripts, alternative transcription initiation, and genes within genes, add to the complexity generated by alternative splicing. Increased...... understanding of the mechanisms controlling pre-mRNA splicing is thus important for a wide range of aspects relating to gene expression. RESULTS: We have discovered a convex gene delineating pattern in the strength of 5' intron splice sites. When comparing the strengths of >18 000 intron containing Human genes......, we found that when analysing them separately according to the number of introns they contain, initial splice sites were always stronger on average than subsequent ones, and that a similar reversed trend exist towards the terminal gene part. The convex pattern is strongest for genes with up to 10...

  14. Splicing of Nascent RNA Coincides with Intron Exit from RNA Polymerase II.

    Science.gov (United States)

    Carrillo Oesterreich, Fernando; Herzel, Lydia; Straube, Korinna; Hujer, Katja; Howard, Jonathon; Neugebauer, Karla M

    2016-04-01

    Protein-coding genes in eukaryotes are transcribed by RNA polymerase II (Pol II) and introns are removed from pre-mRNA by the spliceosome. Understanding the time lag between Pol II progression and splicing could provide mechanistic insights into the regulation of gene expression. Here, we present two single-molecule nascent RNA sequencing methods that directly determine the progress of splicing catalysis as a function of Pol II position. Endogenous genes were analyzed on a global scale in budding yeast. We show that splicing is 50% complete when Pol II is only 45 nt downstream of introns, with the first spliced products observed as introns emerge from Pol II. Perturbations that slow the rate of spliceosome assembly or speed up the rate of transcription caused splicing delays, showing that regulation of both processes determines in vivo splicing profiles. We propose that matched rates streamline the gene expression pathway, while allowing regulation through kinetic competition.

  15. Diet and lifestyle factors associated with miRNA expression in colorectal tissue

    Directory of Open Access Journals (Sweden)

    Slattery ML

    2016-12-01

    Full Text Available Martha L Slattery,1 Jennifer S Herrick,1 Lila E Mullany,1 John R Stevens,2 Roger K Wolff1 1Department of Internal Medicine, The University of Utah, Salt Lake City, 2Department of Mathematics and Statistics, Utah State University, Logan, UT, USA Abstract: MicroRNAs (miRNAs are small non-protein-coding RNA molecules that regulate gene expression. Diet and lifestyle factors have been hypothesized to be involved in the regulation of miRNA expression. In this study it was hypothesized that diet and lifestyle factors are associated with miRNA expression. Data from 1,447 cases of colorectal cancer to evaluate 34 diet and lifestyle variables using miRNA expression in normal colorectal mucosa as well as for differential expression between paired carcinoma and normal tissue were used. miRNA data were obtained using an Agilent platform. Multiple comparisons were adjusted for using the false discovery rate q-value. There were 250 miRNAs differentially expressed between carcinoma and normal colonic tissue by level of carbohydrate intake and 198 miRNAs differentially expressed by the level of sucrose intake. Of these miRNAs, 166 miRNAs were differentially expressed for both carbohydrate intake and sucrose intake. Ninety-nine miRNAs were differentially expressed by the level of whole grain intake in normal colonic mucosa. Level of oxidative balance score was associated with 137 differentially expressed miRNAs between carcinoma and paired normal rectal mucosa. Additionally, 135 miRNAs were differentially expressed in colon tissue based on recent NSAID use. Other dietary factors, body mass index, waist and hip circumference, and long-term physical activity levels did not alter miRNA expression after adjustment for multiple comparisons. These results suggest that diet and lifestyle factors regulate miRNA level. They provide additional support for the influence of carbohydrate, sucrose, whole grains, NSAIDs, and oxidative balance score on colorectal cancer risk

  16. Epigenetic regulation of normal human mammary cell type-specific miRNAs

    Energy Technology Data Exchange (ETDEWEB)

    Vrba, Lukas [Univ. of Arizona, Tucson, AZ (United States). Arizona Cancer Center; Inst. of Plant Molecular Biology, Ceske Budejovice (Czech Republic). Biology Centre ASCR; Garbe, James C. [Lawrence Berkeley National Lab. (LBNL), Berkeley, CA (United States). Life Sciences Center; Stampfer, Martha R. [Univ. of Arizona, Tucson, AZ (United States). Arizona Cancer Center; Lawrence Berkeley National Lab. (LBNL), Berkeley, CA (United States). Life Sciences Center; Futscher, Bernard W. [Univ. of Arizona, Tucson, AZ (United States). Arizona Cancer Center and Dept. of Pharmacology & Toxicology

    2011-08-26

    Epigenetic mechanisms are important regulators of cell type–specific genes, including miRNAs. In order to identify cell type-specific miRNAs regulated by epigenetic mechanisms, we undertook a global analysis of miRNA expression and epigenetic states in three isogenic pairs of human mammary epithelial cells (HMEC) and human mammary fibroblasts (HMF), which represent two differentiated cell types typically present within a given organ, each with a distinct phenotype and a distinct epigenotype. While miRNA expression and epigenetic states showed strong interindividual concordance within a given cell type, almost 10% of the expressed miRNA showed a cell type–specific pattern of expression that was linked to the epigenetic state of their promoter. The tissue-specific miRNA genes were epigenetically repressed in nonexpressing cells by DNA methylation (38%) and H3K27me3 (58%), with only a small set of miRNAs (21%) showing a dual epigenetic repression where both DNA methylation and H3K27me3 were present at their promoters, such as MIR10A and MIR10B. Individual miRNA clusters of closely related miRNA gene families can each display cell type–specific repression by the same or complementary epigenetic mechanisms, such as the MIR200 family, and MIR205, where fibroblasts repress MIR200C/141 by DNA methylation, MIR200A/200B/429 by H3K27me3, and MIR205 by both DNA methylation and H3K27me3. Since deregulation of many of the epigenetically regulated miRNAs that we identified have been linked to disease processes such as cancer, it is predicted that compromise of the epigenetic control mechanisms is important for this process. Overall, these results highlight the importance of epigenetic regulation in the control of normal cell type–specific miRNA expression.

  17. Identification of miRNAs in Bovine Endometrium through RNAseq and Prediction of Regulated Pathways.

    Science.gov (United States)

    Palma-Vera, S E; Sharbati, S; Einspanier, R

    2015-10-01

    Detection of miRNAs in reproductive tissues is a key step to understand their role in fertility. We hypothesize that miRNAs must be involved in pathways controlling endometrial physiology and defense against pathogens. In this study, we aimed to characterize miRNAs present in bovine endometrium and to predict regulated pathways. Cytobrush endometrial samples from four cows were collected at oestrous cycle days 1-5, 6-12, 13-18 and 19-21. RNA was extracted and sequenced using Ion Torrent (®) technology. After mapping of the reads to miRNA stem loops, rRNAs and tRNAs, data were normalized and analysed using DESeq2. Targets and pathways were predicted with miRmap and KEGG, respectively. Validation of miRNAs in tissue was done by RT-qPCR (miR-Q). A total of 221 identities were common among groups, accumulating more than 99% of miRNA expression. MiRNAs were predicted to regulate MAPK signalling pathway, lysosome and extracellular matrix (ECM)-receptor interaction. Eight miRNAs were validated by miR-Q, showing that let-7a-5p and let-7b were regulated across the oestrous cycle. This study demonstrated a high similarity in miRNA expression profile across the oestrous cycles in bovine endometrium. These miRNAs were predicted to regulate pathways involved in cell proliferation, differentiation, transport and catabolism. The number of pathways shared by different miRNAs indicates the broad range of regulation these molecules exhibit in the endometrium. © 2015 Blackwell Verlag GmbH.

  18. High-throughput miRNA profiling of human melanoma blood samples

    Directory of Open Access Journals (Sweden)

    Rass Knuth

    2010-06-01

    Full Text Available Abstract Background MicroRNA (miRNA signatures are not only found in cancer tissue but also in blood of cancer patients. Specifically, miRNA detection in blood offers the prospect of a non-invasive analysis tool. Methods Using a microarray based approach we screened almost 900 human miRNAs to detect miRNAs that are deregulated in their expression in blood cells of melanoma patients. We analyzed 55 blood samples, including 20 samples of healthy individuals, 24 samples of melanoma patients as test set, and 11 samples of melanoma patients as independent validation set. Results A hypothesis test based approch detected 51 differentially regulated miRNAs, including 21 miRNAs that were downregulated in blood cells of melanoma patients and 30 miRNAs that were upregulated in blood cells of melanoma patients as compared to blood cells of healthy controls. The tets set and the independent validation set of the melanoma samples showed a high correlation of fold changes (0.81. Applying hierarchical clustering and principal component analysis we found that blood samples of melanoma patients and healthy individuals can be well differentiated from each other based on miRNA expression analysis. Using a subset of 16 significant deregulated miRNAs, we were able to reach a classification accuracy of 97.4%, a specificity of 95% and a sensitivity of 98.9% by supervised analysis. MiRNA microarray data were validated by qRT-PCR. Conclusions Our study provides strong evidence for miRNA expression signatures of blood cells as useful biomarkers for melanoma.

  19. Alu-directed transcriptional regulation of some novel miRNAs

    Directory of Open Access Journals (Sweden)

    Zhao Xi W

    2009-11-01

    Full Text Available Abstract Background Despite many studies on the biogenesis, molecular structure and biological functions of microRNAs, little is known about the transcriptional regulatory mechanisms controlling the spatiotemporal expression pattern of human miRNA gene loci. Several lines of experimental results have indicated that both polymerase II (Pol-II and polymerase III (Pol-III may be involved in transcribing miRNAs. Here, we assessed the genomic evidence for Alu-directed transcriptional regulation of some novel miRNA genes in humans. Our data demonstrate that the expression of these Alu-related miRNAs may be modulated by Pol-III. Results We present a comprehensive exploration of the Alu-directed transcriptional regulation of some new miRNAs. Using a new computational approach, a variety of Alu-related sequences from multiple sources were pooled and filtered to obtain a subset containing Alu elements and characterized miRNA genes for which there is clear evidence of full-length transcription (embedded in EST. We systematically demonstrated that 73 miRNAs including five known ones may be transcribed by Pol-III through Alu or MIR. Among the new miRNAs, 33 were determined by high-throughput Solexa sequencing. Real-time TaqMan PCR and Northern blotting verified that three newly identified miRNAs could be induced to co-express with their upstream Alu transcripts by heat shock or cycloheximide. Conclusion Through genomic analysis, Solexa sequencing and experimental validation, we have identified candidate sequences for Alu-related miRNAs, and have found that the transcription of these miRNAs could be governed by Pol-III. Thus, this study may elucidate the mechanisms by which the expression of a class of small RNAs may be regulated by their upstream repeat elements.

  20. Comparative studies of two methods for miRNA isolation from milk whey.

    Science.gov (United States)

    Jin, Xiao-lu; Wei, Zi-hai; Liu, Lan; Liu, Hong-yun; Liu, Jian-xin

    2015-06-01

    MicroRNAs (miRNAs) from milk whey have been considered for their potential as noninvasive biomarkers for milk quality control and disease diagnosis. However, standard protocols for miRNA isolation and quantification from milk whey are not well established. The objective of this study was to compare two methods for the isolation of miRNAs from milk whey. These two methods were modified phenol-based technique (Trizol LS(®) followed by phenol precipitation, the TP method) and combined phenol and column-based approach (Trizol LS(®) followed by cleanup using the miRNeasy kit, the TM method). Yield and quality of RNA were rigorously measured using a NanoDrop ND-1000 spectrophotometer and then the distribution of RNA was precisely detected in a Bioanalyzer 2100 instrument by microchip gel electrophoresis. Several endogenous miRNAs (bta-miR-141, bta-miR-146a, bta-miR-148a, bta-miR-200c, bta-miR-362, and bta-miR-375) and an exogenous spike-in synthetic control miRNA (cel-miR-39) were quantified by real-time polymerase chain reaction (PCR) to examine the apparent recovery efficiency of milk whey miRNAs. Both methods could successfully isolate sufficient small RNA (milk whey, and their yields were quite similar. However, the quantification results show that the total miRNA recovery efficiency by the TM method is superior to that by the TP method. The TM method performed better than the TP for recovery of milk whey miRNA due to its consistency and good repeatability in endogenous and spike-in miRNA recovery. Additionally, quantitative recovery analysis of a spike-in miRNA may be more accurate to reflect the milk whey miRNA recovery efficiency than using traditional RNA quality analysis instruments (NanoDrop or Bioanalyzer 2100).

  1. Identification of novel and candidate miRNAs in rice by high throughput sequencing

    Directory of Open Access Journals (Sweden)

    Zhang Weixiong

    2008-02-01

    Full Text Available Abstract Background Small RNA-guided gene silencing at the transcriptional and post-transcriptional levels has emerged as an important mode of gene regulation in plants and animals. Thus far, conventional sequencing of small RNA libraries from rice led to the identification of most of the conserved miRNAs. Deep sequencing of small RNA libraries is an effective approach to uncover rare and lineage- and/or species-specific microRNAs (miRNAs in any organism. Results In order to identify new miRNAs and possibly abiotic-stress regulated small RNAs in rice, three small RNA libraries were constructed from control rice seedlings and seedlings exposed to drought or salt stress, and then subjected to pyrosequencing. A total of 58,781, 43,003 and 80,990 unique genome-matching small RNAs were obtained from the control, drought and salt stress libraries, respectively. Sequence analysis confirmed the expression of most of the conserved miRNAs in rice. Importantly, 23 new miRNAs mostly each derived from a unique locus in rice genome were identified. Six of the new miRNAs are conserved in other monocots. Additionally, we identified 40 candidate miRNAs. Allowing not more than 3 mis-matches between a miRNA and its target mRNA, we predicted 20 targets for 9 of the new miRNAs. Conclusion Deep sequencing proved to be an effective strategy that allowed the discovery of 23 low-abundance new miRNAs and 40 candidate miRNAs in rice.

  2. A common set of developmental miRNAs are upregulated in Nicotiana benthamiana by diverse begomoviruses

    Directory of Open Access Journals (Sweden)

    Mansoor Shahid

    2011-03-01

    Full Text Available Abstract Background Begomoviruses are single-stranded DNA viruses that cause economically important diseases of many crops throughout the world and induce symptoms in plants, including enations, leaf curling and stunting, that resemble developmental abnormalities. MicroRNAs (miRNAs are small endogenous RNAs that are involved in a variety of activities, including plant development, signal transduction and protein degradation, as well as response to environmental stress, and pathogen invasion. Results The present study was aimed at understanding the deregulation of miRNAs upon begomovirus infection. Four distinct begomoviruses African cassava mosaic virus (ACMV, Cabbage leaf curl virus (CbLCuV, Tomato yellow leaf curl virus (TYLCV and Cotton leaf curl Multan virus/Cotton leaf curl betasatellite (CLCuV/CLCuMB, were used in this study. Ten developmental miRNA were studied. N. benthamiana plants were inoculated with begomoviruses and their miRNA profiles were analysed by northern blotting using specific miRNA probes. The levels of most developmental miRNA were increased in N. benthamiana by TYLCV, CLCuMV/CLCuMB and CbLCuV infection with a common pattern despite their diverse genomic components. However, the increased levels of individual miRNAs differed for distinct begomoviruses, reflecting differences in severity of symptom phenotypes. Some of these miRNA were also common to ACMV infection. Conclusions Our results have shown a common pattern of miRNAs accumulation upon begomovirus infection. It was found that begomoviruses generally increase the accumulation of miRNA and thus result in the decreased translation of genes involved in the development of plants. Identification of common miRNAs that are deregulated upon begomovirus infection may provide novel targets for control strategies aimed at developing broad-spectrum resistance.

  3. In vivo expression of the nucleolar group I intron-encoded I-dirI homing endonuclease involves the removal of a spliceosomal intron

    DEFF Research Database (Denmark)

    Vader, A; Nielsen, Henrik; Johansen, S

    1999-01-01

    ) is inserted in DiGIR2, carries out hydrolysis at internal processing sites (IPS1 and IPS2) located at its 3' end. Examination of the in vivo expression of DiSSU1 shows that after excision, DiSSU1 is matured further into the I-DirI mRNA by internal DiGIR1-catalysed cleavage upstream of the ORF 5' end, as well......The Didymium iridis DiSSU1 intron is located in the nuclear SSU rDNA and has an unusual twin-ribozyme organization. One of the ribozymes (DiGIR2) catalyses intron excision and exon ligation. The other ribozyme (DiGIR1), which along with the endonuclease-encoding I-DirI open reading frame (ORF...

  4. Novel RNA structural features of an alternatively splicing group II intron from Clostridium tetani.

    Science.gov (United States)

    McNeil, Bonnie A; Zimmerly, Steven

    2014-06-01

    Group II introns are ribozymes in bacterial and organellar genomes that function as self-splicing introns and as retroelements. Previously, we reported that the group II intron C.te.I1 of Clostridium tetani alternatively splices in vivo to produce five distinct coding mRNAs. Accurate fusion of upstream and downstream reading frames requires a shifted 5' splice site located 8 nt upstream of the usual 5' GUGYG motif. This site is specified by the ribozyme through an altered intron/exon-binding site 1 (IBS1-EBS1) pairing. Here we use mutagenesis and self-splicing assays to investigate in more detail the significance of the structural features of the C.te.I1 ribozyme. The shifted 5' splice site is shown to be affected by structures in addition to IBS1-EBS1, and unlike other group II introns, C.te.I1 appears to require a spacer between IBS1 and the GUGYG motif. In addition, the mechanism of 3' exon recognition is modified from the ancestral IIB mechanism to a IIA-like mechanism that appears to be longer than the typical single base-pair interaction and may extend up to 4 bp. The novel ribozyme properties that have evolved for C.te.I1 illustrate the plasticity of group II introns in adapting new structural and catalytic properties that can be utilized to affect gene expression. © 2014 McNeil and Zimmerly; Published by Cold Spring Harbor Laboratory Press for the RNA Society.

  5. Macronuclear genome structure of the ciliate Nyctotherus ovalis: Single-gene chromosomes and tiny introns

    Directory of Open Access Journals (Sweden)

    Landweber Laura F

    2008-12-01

    Full Text Available Abstract Background Nyctotherus ovalis is a single-celled eukaryote that has hydrogen-producing mitochondria and lives in the hindgut of cockroaches. Like all members of the ciliate taxon, it has two types of nuclei, a micronucleus and a macronucleus. N. ovalis generates its macronuclear chromosomes by forming polytene chromosomes that subsequently develop into macronuclear chromosomes by DNA elimination and rearrangement. Results We examined the structure of these gene-sized macronuclear chromosomes in N. ovalis. We determined the telomeres, subtelomeric regions, UTRs, coding regions and introns by sequencing a large set of macronuclear DNA sequences (4,242 and cDNAs (5,484 and comparing them with each other. The telomeres consist of repeats CCC(AAAACCCCn, similar to those in spirotrichous ciliates such as Euplotes, Sterkiella (Oxytricha and Stylonychia. Per sequenced chromosome we found evidence for either a single protein-coding gene, a single tRNA, or the complete ribosomal RNAs cluster. Hence the chromosomes appear to encode single transcripts. In the short subtelomeric regions we identified a few overrepresented motifs that could be involved in gene regulation, but there is no consensus polyadenylation site. The introns are short (21–29 nucleotides, and a significant fraction (1/3 of the tiny introns is conserved in the distantly related ciliate Paramecium tetraurelia. As has been observed in P. tetraurelia, the N. ovalis introns tend to contain in-frame stop codons or have a length that is not dividable by three. This pattern causes premature termination of mRNA translation in the event of intron retention, and potentially degradation of unspliced mRNAs by the nonsense-mediated mRNA decay pathway. Conclusion The combination of short leaders, tiny introns and single genes leads to very minimal macronuclear chromosomes. The smallest we identified contained only 150 nucleotides.

  6. A novel additional group II intron distinguishes the mitochondrial rps3 gene in gymnosperms.

    Science.gov (United States)

    Regina, Teresa M R; Picardi, Ernesto; Lopez, Loredana; Pesole, Graziano; Quagliariello, Carla

    2005-02-01

    Comparative analysis of the ribosomal protein S3 gene (rps3) in the mitochondrial genome of Cycas with newly sequenced counterparts from Magnolia and Helianthus and available sequences from higher plants revealed that the positional clustering with the genes for ribosomal protein S19 (rps19) and L16 (rpl16) is preserved in gymnosperms. However, in contrast to the other land plant species, the rps3 gene in Cycas mitochondria is unique in possessing a second intron: rps3i2. Reverse transcription-polymerase chain reaction (RT-PCR) analysis of the transcripts generated from the rps19-rps3-rpl16 cluster in Cycas mitochondria demonstrated that the genes are cotranscribed and extensively modified by RNA editing and that both introns are efficiently spliced. Despite remarkable size heterogeneity, the Cycas rps3i1 can be shown to be homologous to the group IIA introns present within the rps3 gene of algae and land plants, including Magnolia and Helianthus. Conversely, sequences similar to the rps3i2 have not been reported previously. On the basis of conserved primary and secondary structure the second intervening sequence interrupting the Cycas rps3 gene has been classified as a group II intron. The close relationship of the rps3i2 to a group of different plant mitochondrial introns is intriguing and suggestive of a mitochondrial derivation for this novel intervening sequence. Interestingly, the rps3i2 appears to be conserved at the same gene location in other gymnosperms. Furthermore, the pattern of the rps3i2 distribution among algae and land plants provides evidence for the evolutionary acquisition of this novel intron in gymnosperms via intragenomic transposition or retrotransposition.

  7. miRNA profiles in plasma from patients with sleep disorders reveal dysregulation of miRNAs in narcolepsy and other central hypersomnias

    DEFF Research Database (Denmark)

    Holm, Anja; Bang-Berthelsen, Claus Heiner; Knudsen, Stine

    2014-01-01

    controls using quantitative real-time polymerase chain reaction (qPCR) panels. SETTING: University hospital based sleep clinic and research laboratories. PATIENTS: Twelve patients with type 1 narcolepsy, 12 patients with type 2 narcolepsy, 12 patients with idiopathic hypersomnia, and 12 healthy controls...... (type 1 narcolepsy), narcolepsy without cataplexy (type 2 narcolepsy), and idiopathic hypersomnia. DESIGN: We conducted high-throughput analysis of miRNA in plasma from three groups of patients-with type 1 narcolepsy, type 2 narcolepsy, and idiopathic hypersomnia, respectively-in comparison with healthy....... MEASUREMENTS AND RESULTS: By analyzing miRNA in plasma with qPCR we identified 50, 24, and 6 miRNAs that were different in patients with type 1 narcolepsy, type 2 narcolepsy, and idiopathic hypersomnia, respectively, compared with healthy controls. Twenty miRNA candidates who fulfilled the criteria of at least...

  8. Putative Nitrogen Sensing Systems in Higher Plants

    Institute of Scientific and Technical Information of China (English)

    Hon-Ming Lam; Ying Ann Chiao; Man-Wah Li; Yuk-Kwong Yung; Sang Ji

    2006-01-01

    Nitrogen (N) metabolism is essential for the biosynthesis of vital biomolecules. N status thus exerts profound effects on plant growth and development, and must be closely monitored. In bacteria and fungi, a few sophisticated N sensing systems have been extensively studied. In animals, the ability to receive amino acid signals has evolved to become an integral part of the nervous coordination system. In this review, we will summarize recent developments in the search for putative N sensing systems in higher plants based on homologous systems in bacteria, fungi, and animals. Apparently, although plants have separated and diversified from other organisms during the evolution process, striking similarities can be found in their N sensing systems compared with those of their counterparts; however, our understanding of these systems is still incomplete. Significant modifications of the N sensing systems (including cross-talk with other signal transduction pathways) in higher plants may be a strategy of adaptation to their unique mode of life.

  9. Putative respiratory chain of Porphyromonas gingivalis.

    Science.gov (United States)

    Meuric, Vincent; Rouillon, Astrid; Chandad, Fatiha; Bonnaure-Mallet, Martine

    2010-05-01

    The electron transfer chain in Porphyromonas gingivalis, or periodontopathogens, has not yet been characterized. P. gingivalis, a strict anaerobic bacteria and the second colonizer of the oral cavity, is considered to be a major causal agent involved in periodontal diseases. Primary colonizers create a favorable environment for P. gingivalis growth by decreasing oxygen pressure. Oxygen does not appear to be the final electron acceptor of the respiratory chain. Fumarate and cytochrome b have been implicated as major components of the respiratory activity. However, the P. gingivalis genome shows many other enzymes that could be implicated in aerobic or nitrite respiration. Using bioinformatic tools and literature studies of respiratory pathways, the ATP synthesis mechanism from the sodium cycle and nutrients metabolism, the putative respirasome of P. gingivalis has been proposed.

  10. Hsp27gene in Drosophila ananassae subgroup was split by a recently acquired intron

    Indian Academy of Sciences (India)

    LI ZHANG; HAN KANG; SHAN JIN; QING TAO ZENG; YONG YANG

    2016-06-01

    InDrosophila , heat shock protein 27 (Hsp27) is a critical single-copy intron-free nuclear gene involved in the defense responseagainst fungi and bacteria, and is a regulator of adult lifespan. In the present study, 33 homologousHsp27nucleotide sequencesfrom differentDrosophilaspecies were amplified by PCR and reverse transcription PCR, and the phylogenetic relationshipswere analysed using neighbour-joining, maximum-likelihood and Bayesian methods. The phylogenetic topologies from anal-ysis with different algorithms were similar, suggesting that theHsp27gene was split by a recently acquired intron during theevolution of theDrosophila ananassaesubgroup

  11. Intron and intronless transcription of the chicken polyubiquitin gene UbII.

    Science.gov (United States)

    Mezquita, J; López-Ibor, B; Pau, M; Mezquita, C

    1993-03-22

    We have previously reported that the chicken polyubiquitin gene UbII is preferentially expressed during spermatogenesis and we show here that UbII is the predominant polyubiquitin gene expressed in early embryogenesis. Two main initiation sites were detected. Transcription from the initiation site used in early embryos results in the presence of an intron in the 5'-untranslated region of the transcripts as has been reported for other polyubiquitin messages. In mature testis, however, the use of a different initiation site, located within the intron, produces intronless transcripts. Distinct promoter sequences, present in each initiation site, may regulate the differential expression observed in this gene.

  12. Mobile group II intron based gene targeting in Lactobacillus plantarum WCFS1.

    Science.gov (United States)

    Sasikumar, Ponnusamy; Paul, Eldho; Gomathi, Sivasamy; Abhishek, Albert; Sasikumar, Sundaresan; Selvam, Govindan Sadasivam

    2016-10-01

    The usage of recombinant lactic acid bacteria for delivery of therapeutic proteins to the mucosa has been emerging. In the present study, an attempt was made to engineer a thyA mutant of Lactobacillus plantarum (L. plantarum) using lactococcal group II intron Ll.LtrB for the development of biologically contained recombinant L. plantarum for prevention of calcium oxalate stone disease. The 3 kb Ll.LtrB intron donor cassettes from the source vector pACD4C was PCR amplified, ligated into pSIP series of lactobacillus vector pLp_3050sAmyA, yielding a novel vector pLpACD4C (8.6 kb). The quantitative real-time PCR experiment shows 94-fold increased expression of Ll.LtrB intron and 14-fold increased expression of ltrA gene in recombinant L. plantarum containing pLpACD4C. In order to target the thyA gene, the potential intron RNA binding sites in the thyA gene of L. plantarum was predicted with help of computer algorithm. The insertion location 188|189s of thyA gene (lowest E-0.134) was chosen and the wild type intron Ll.LtrB was PCR modified, yielding a retargeted intron of pLpACDthyA. The retargeted intron was expressed by using induction peptide (sppIP), subsequently the integration of intron in thyA gene was identified by PCR screening and finally ThyA(-) mutant of L. plantarum (ThyA18) was detected. In vitro growth curve result showed that in the absence of thymidine, colony forming units of mutant ThyA18 was decreased, whereas high thymidine concentration (10 μM) supported the growth of the culture until saturation. In conclusion, ThyA(-) mutant of L. plantarum (ThyA18) constructed in this study will be used as a biologically contained recombinant probiotic to deliver oxalate decarboxylase into the lumen for treatment of hyperoxaluria and calcium oxalate stone deposition.

  13. Identification of precursor transcripts for 6 novel miRNAs expands the diversity on the genomic organisation and expression of miRNA genes in rice

    Directory of Open Access Journals (Sweden)

    Panaud Olivier

    2008-12-01

    Full Text Available Abstract Background The plant miRNAs represent an important class of endogenous small RNAs that guide cleavage of an mRNA target or repress its translation to control development and adaptation to stresses. MiRNAs are nuclear-encoded genes transcribed by RNA polymerase II, producing a primary precursor that is subsequently processed by DCL1 an RNase III Dicer-like protein. In rice hundreds of miRNAs have been described or predicted, but little is known on their genes and precursors which are important criteria to distinguish them from siRNAs. Here we develop a combination of experimental approaches to detect novel miRNAs in rice, identify their precursor transcripts and genes and predict or validate their mRNA targets. Results We produced four cDNA libraries from small RNA fractions extracted from distinct rice tissues. By in silico analysis we selected 6 potential novel miRNAs, and confirmed that their expression requires OsDCL1. We predicted their targets and used 5'RACE to validate cleavage for three of them, targeting a PPR, an SPX domain protein and a GT-like transcription factor respectively. In addition, we identified precursor transcripts for the 6 miRNAs expressed in rice, showing that these precursors can be efficiently processed using a transient expression assay in transfected Nicotiana benthamiana leaves. Most interestingly, we describe two precursors producing tandem miRNAs, but in distinct arrays. We focus on one of them encoding osa-miR159a.2, a novel miRNA produced from the same stem-loop structure encoding the conserved osa-miR159a.1. We show that this dual osa-miR159a.2-osa-miR159a.1 structure is conserved in distant rice species and maize. Finally we show that the predicted mRNA target of osa-miR159a.2 encoding a GT-like transcription factor is cleaved in vivo at the expected site. Conclusion The combination of approaches developed here identified six novel miRNAs expressed in rice which can be clearly distinguished from si

  14. Evidence for transitional stages in the evolution of euglenid group II introns and twintrons in the Monomorphina aenigmatica plastid genome.

    Directory of Open Access Journals (Sweden)

    Jean-François Pombert

    Full Text Available BACKGROUND: Photosynthetic euglenids acquired their plastid by secondary endosymbiosis of a prasinophyte-like green alga. But unlike its prasinophyte counterparts, the plastid genome of the euglenid Euglena gracilis is riddled with introns that interrupt almost every protein-encoding gene. The atypical group II introns and twintrons (introns-within-introns found in the E. gracilis plastid have been hypothesized to have been acquired late in the evolution of euglenids, implying that massive numbers of introns may be lacking in other taxa. This late emergence was recently corroborated by the plastid genome sequences of the two basal euglenids, Eutreptiella gymnastica and Eutreptia viridis, which were found to contain fewer introns. METHODOLOGY/PRINCIPAL FINDINGS: To gain further insights into the proliferation of introns in euglenid plastids, we have characterized the complete plastid genome sequence of Monomorphina aenigmatica, a freshwater species occupying an intermediate phylogenetic position between early and late branching euglenids. The M. aenigmatica UTEX 1284 plastid genome (74,746 bp, 70.6% A+T, 87 genes contains 53 intron insertion sites, of which 41 were found to be shared with other euglenids including 12 of the 15 twintron insertion sites reported in E. gracilis. CONCLUSIONS: The pattern of insertion sites suggests an ongoing but uneven process of intron gain in the lineage, with perhaps a minimum of two bursts of rapid intron proliferation. We also identified several sites that represent intermediates in the process of twintron evolution, where the external intron is in place, but not the internal one, offering a glimpse into how these convoluted molecular contraptions originate.

  15. MiRNA expression signatures induced by Marek disease virus infection in chickens

    Science.gov (United States)

    MMicroRNAs (miRNAs) are small, non-coding RNAs that regulate gene expression at the post-transcriptional level. Emerging evidence suggests that differential miRNA expression is associated with viral infection and cancer. Marek's disease virus infection induces lymphoma in chickens. However, the host...

  16. Identification of mouse serum miRNA endogenous references by global gene expression profiles.

    Directory of Open Access Journals (Sweden)

    Qing-Sheng Mi

    Full Text Available MicroRNAs (miRNAs are recently discovered small non-coding RNAs and can serve as serum biomarkers for disease diagnosis and prognoses. Lack of reliable serum miRNA endogenous references for normalization in miRNA gene expression makes single miRNA assays inaccurate. Using TaqMan® real-time PCR miRNA arrays with a global gene expression normalization strategy, we have analyzed serum miRNA expression profiles of 20 female mice of NOD/ShiLtJ (n = 8, NOR/LtJ (n = 6, and C57BL/6J (n = 6 at different ages and disease conditions. We identified five miRNAs, miR-146a, miR-16, miR-195, miR-30e and miR-744, to be stably expressed in all strains, which could serve as mouse serum miRNA endogenous references for single assay experiments.

  17. Two novel aspects of the kinetics of gene expression including miRNAs

    Science.gov (United States)

    Zhdanov, Vladimir

    2013-04-01

    In eukaryotic cells, many genes are transcribed into non-coding RNAs. Small RNAs or, more specifically, microRNAs (miRNAs) form an abundant sub-class of such RNAs. miRNAs are transcribed as long noncoding RNA and then generated via a processing pathway down to the 20-24-nucleotide length. The key ability of miRNAs is to associate with target mRNAs and to suppress their translation and/or facilitate degradation. Using the mean-field kinetic equations and Monte Carlo simulations, we analyze two aspects of this interplay. First, we describe the situation when the formation of mRNA or miRNA is periodically modulated by a transcription factor which itself is not perturbed by these species. Depending on the ratio between the mRNA and miRNA formation rates, the corresponding induced periodic kinetics are shown to be either nearly harmonic or shaped as anti-phase pulses. The second part of the work is related to recent experimental studies indicating that differentiation of stem cells often involves changes in gene transcription into miRNAs and/or the interference between miRNAs, mRNAs and proteins. In particular, the regulatory protein obtained via mRNA translation may suppress the miRNA formation, and the latter may suppress in turn the miRNA-mRNA association and degradation. The corresponding bistable kinetics are described in detail.

  18. Circulating miRNAs as biomarkers for oral squamous cell carcinoma recurrence in operated patients

    DEFF Research Database (Denmark)

    Yan, Yan; Wang, Xuan; Venø, Morten Trillingsgaard

    2017-01-01

    MicroRNAs (miRNAs) are small regulatory non-coding RNAs for which altered expression in cancers can serve as potential biomarkers for diseases. We here investigated whether circulating miRNAs can serve as biomarkers for predicting post-operational recurrence of oral squamous cell carcinoma (OSCC)...

  19. Different miRNA signatures of oral and pharyngeal squamous cell carcinomas: a prospective translational study

    DEFF Research Database (Denmark)

    Lajer, C B; Nielsen, F C; Friis-Hansen, L

    2011-01-01

    MicroRNAs (miRNAs) are small non-coding RNAs, which regulate mRNA translation/decay, and may serve as biomarkers. We characterised the expression of miRNAs in clinically sampled oral and pharyngeal squamous cell carcinoma (OSCC and PSCC) and described the influence of human papilloma virus (HPV)....

  20. The role of miRNAs in human papilloma virus (HPV)-associated cancers

    DEFF Research Database (Denmark)

    Lajer, C.B.; Garnæs, E.; Friis-Hansen, Lennart Jan

    2012-01-01

    Although the role of human papilloma virus (HPV) in cervical squamous cell carcinoma (CSCC) is well established, the role in head and neck SCC (HNSCC) is less clear. MicroRNAs (miRNAs) have a role in the cancer development, and HPV status may affect the miRNA expression pattern in HNSCC. To explore...

  1. INCREASED LEVELS OF MIRNA-146A IN SERUM AND HISTOLOGIC SAMPLES OF PATIENTS WITH UVEAL MELANOMA

    Directory of Open Access Journals (Sweden)

    ANDREA RUSSO

    2016-11-01

    Full Text Available Purpose: to analyze MiRs expression in serum of UM patients, respect to healthy donors, and to compare this data with MiRs expressed in formalin-fixed, paraffin-embedded UM samples.Methods: Expression profile of 754 miRNAs was performed in serum from patients with uveal melanoma that underwent primary enucleation. The level of miRNAs increased in serum was individually analyzed on FFPE UM samples and compared to choroidal melanocytes from unaffected eyes.Results: 14 patients with uveal melanoma were included in the study. We found 8 serum miRNAs differentially expressed compared to normal controls: 2 upregulated miRNAs (miR-146a, miR-523; 6 downregulated miRNAs (miR-19a, miR-30d, miR-127, miR-451, miR-518f, miR-1274B. When data on upregulated miRNAs were singularly validated only a significant overexpression of miR-146a was found. A statistically significant upregulation of miRNA-146a was also found on FFPE UM samples, compared to choroidal melanocytes from unaffected eyes. Conclusions: miRNA-146a is increased in serum of patients with UM and in FFPE tumour samples. Further studies will show if it could be considered a potential marker of UM in the blood.

  2. Effect of triazophos, fipronil and their mixture on miRNA expression in adult zebrafish.

    Science.gov (United States)

    Wang, Xingxing; Zhou, Shengli; Ding, Xianfeng; Zhu, Guonian; Guo, Jiangfeng

    2010-10-01

    MicroRNA (miRNA) plays a crucial role in gene expression regulation. However, no data are available on change of miRNA expression of zebrafish (Danio rerio) after treatment with pesticides. We evaluated the effect of fipronil (5-amino-1-[2, 6-dichloro-4-(trifluoromethyl) phenyl]-4-[(trifluoromethyl) sulfinyl]-1H-pyrazole-3-carbonitrile) and triazophos (3-(O, O-diethyl)-1-phenyl thiophosphoryl-1, 2, 4-triazol) and their mixture on miRNA expression in zebrafish.MiRNA expression profiles in zebrafish were altered after treatment with these chemicals. An association between these chemicals and the expression of 21 miRNAs was found 96 h after treatment. Among them, 14 miRNAs were differentially expressed due to the treatments with fipronil, triazophos and their mixture; 5 miRNAs showed altered expression level after treatment with formulations of these chemicals; miR-29b and miR-738 were differentially expressed after treatment with adjuvants. MiRNAs might present a novel toxicological response that could be used as a toxicological biomarker and have a different direction for future investigations of their association with miRNAs involved in chemical related diseases.

  3. Systemic miRNA-7 delivery inhibits tumor angiogenesis and growth in murine xenograft glioblastoma

    NARCIS (Netherlands)

    Babae, N.; Bourajjaj, M.; Liu, Y.; Beijnum, J.R.; Cerisoli, F.; Scaria, P.V.; Verheul, Mark; Berkel, M.P.; Pieters, E.H.; van Haastert, R.J.; Yousefi, A.; Mastrobattista, E.; Storm, Gerrit; Berezikov, E.; Cuppen, E.; Woodle, M.; Schaapveld, R.Q.J.; Prevost, G.P.; Griffioen, A.W.; Noort, P.I.; Schiffelers, R.M.

    2014-01-01

    Tumor-angiogenesis is the multi-factorial process of sprouting of endothelial cells (EC) into micro-vessels to provide tumor cells with nutrients and oxygen. To explore miRNAs as therapeutic angiogenesis-inhibitors, we performed a functional screen to identify miRNAs that are able to decrease EC

  4. A Broad RNA Virus Survey Reveals Both miRNA Dependence and Functional Sequestration

    DEFF Research Database (Denmark)

    Scheel, Troels K H; Luna, Joseph M; Liniger, Matthias;

    2016-01-01

    Small non-coding RNAs have emerged as key modulators of viral infection. However, with the exception of hepatitis C virus, which requires the liver-specific microRNA (miRNA)-122, the interactions of RNA viruses with host miRNAs remain poorly characterized. Here, we used crosslinking immunoprecipi...

  5. An integrated expression atlas of miRNAs and their promoters in human and mouse

    DEFF Research Database (Denmark)

    de Rie, Derek; Abugessaisa, Imad; Alam, Tanvir

    2017-01-01

    MicroRNAs (miRNAs) are short non-coding RNAs with key roles in cellular regulation. As part of the fifth edition of the Functional Annotation of Mammalian Genome (FANTOM5) project, we created an integrated expression atlas of miRNAs and their promoters by deep-sequencing 492 short RNA (sRNA) libr...

  6. Developmental and Activity-Dependent miRNA Expression Profiling in Primary Hippocampal Neuron Cultures

    NARCIS (Netherlands)

    M. van Spronsen (Myrrhe); E.Y. van Battum (Eljo); M. Kuijpers (Marijn); V.R. Vangoor (Vamshidhar); M.L. Rietman (M. Liset); J. Pothof (Joris); L.F. Gumy (Laura); W.F.J. van IJcken (Wilfred); A.S. Akhmanova (Anna); R.J. Pasterkamp (Jeroen); C.C. Hoogenraad (Casper)

    2013-01-01

    textabstractMicroRNAs (miRNAs) are evolutionarily conserved non-coding RNAs of ∼22 nucleotides that regulate gene expression at the level of translation and play vital roles in hippocampal neuron development, function and plasticity. Here, we performed a systematic and in-depth analysis of miRNA exp

  7. Exosome-mediated delivery of functionally active miRNA-155 inhibitor to macrophages.

    Science.gov (United States)

    Momen-Heravi, Fatemeh; Bala, Shashi; Bukong, Terence; Szabo, Gyongyi

    2014-10-01

    Exosomes, membranous nanovesicles, naturally carry bio-macromolecules and play pivotal roles in both physiological intercellular crosstalk and disease pathogenesis. Here, we showed that B cell-derived exosomes can function as vehicles to deliver exogenous miRNA-155 mimic or inhibitor into hepatocytes or macrophages, respectively. Stimulation of B cells significantly increased exosome production. Unlike in parental cells, baseline level of miRNA-155 was very low in exosomes derived from stimulated B cells. Exosomes loaded with a miRNA-155 mimic significantly increased miRNA-155 levels in primary mouse hepatocytes and the liver of miRNA-155 knockout mice. Treatment of RAW macrophages with miRNA-155 inhibitor loaded exosomes resulted in statistically significant reduction in LPS-induced TNFα production and partially prevented LPS-induced decrease in SOCS1 mRNA levels. Furthermore, exosome-mediated miRNA-155 inhibitor delivery resulted in functionally more efficient inhibition and less cellular toxicity compared to conventional transfection methods. Similar approaches could be useful in modification of target biomolecules in vitro and in vivo. From the clinical editor: In this study, exosome-based delivery of miRNA-155 mimicker or inhibitor was found to have significant biological response in hepatocytes and macrophages. Exosome-based approaches may be useful in the modification of other target biomolecules.

  8. Hodgkin Lymphoma Cell Lines Are Characterized by a Specific miRNA Expression Profile

    NARCIS (Netherlands)

    Gibcus, Johan H.; Tan, Lu Ping; Harms, Geert; Schakel, Rikst Nynke; de Jong, Debora; Blokzijl, T.; Moller, Peter; Poppema, Sibrand; Kroesen, Bart-Jan; van den Berg, Anke

    Hodgkin lymphoma (HL) is derived from preapoptotic germinal center B cells, although a general loss of B cell phenotype is noted. Using quantitative reverse transcription-polymerase chain reaction and miRNA microarray, we determined the microRNA (miRNA) profile of HL and compared this with the

  9. Mitochondrial miRNA (MitomiR): a new player in cardiovascular health.

    Science.gov (United States)

    Srinivasan, Hemalatha; Das, Samarjit

    2015-10-01

    Cardiovascular disease is one of the major causes of human morbidity and mortality in the world. MicroRNAs (miRNAs) are small RNAs that regulate gene expression and are known to be involved in the pathogenesis of heart diseases, but the translocation phenomenon and the mode of action in mitochondria are largely unknown. Recent mitochondrial proteome analysis unveiled at least 2000 proteins, of which only 13 are made by the mitochondrial genome. There are numerous studies demonstrating the translocation of proteins into the mitochondria and also translocation of ribosomal RNA (viz., 5S rRNA) into mitochondria. Recent studies have suggested that miRNAs contain sequence elements that affect their subcellular localization, particularly nuclear localization. If there are sequence elements that direct miRNAs to the nucleus, it is also possible that similar sequence elements exist to direct miRNAs to the mitochondria. In this review we have summarized most of the miRNAs that have been shown to play an important role in mitochondrial function, either by regulating mitochondrial genes or by regulating nuclear genes that are known to influence mitochondrial function. While the focus of this review is cardiovascular diseases, we also illustrate the role of mitochondrial miRNA (MitomiR) in the initiation and progression of various diseases, including cardiovascular diseases, metabolic diseases, and cancer. Our goal here is to summarize the miRNAs that are localized to the mitochondrial fraction of cells, and how these miRNAs modulate cardiovascular health.

  10. miRNAs in inflammatory skin diseases and their clinical implications

    DEFF Research Database (Denmark)

    Løvendorf, Marianne B; Skov, Lone

    2015-01-01

    miRNAs are a class of non-coding RNA molecules that modulate gene expression post-transcriptionally. They have a major impact on several physiological and pathological cellular processes including modulation of the innate and the adaptive immune system. The role of miRNAs in skin biology is still...

  11. MiRNA-365 and miRNA-520c-3p respond to risperidone treatment in first-episode schizophrenia after a 1 year remission

    Institute of Scientific and Technical Information of China (English)

    LIU Sha; YUAN Yan-bo; GUAN Li-li; WEI Hui; CHENG Zhang; HAN Xue; YANG Lei

    2013-01-01

    Background MicroRNAs (miRNAs) control gene expression by destabilizing target transcripts and inhibiting their translation.Aberrant expression of miRNAs has been described in many human diseases,including schizophrenia.However,the effects on miRNA expression in response to antipsychotic treatment in peripheral circulation have not been thoroughly examined.Methods Using quantitative real-time PCR (qRT-PCR),We quantified the expression of seven candidate miRNAs in plasma samples of 40 first-episode schizophrenics before and after antipsychotic treatment.The patients were all treated with risperidone and achieved remission in 1 year.Results Compared with the baseline,the expression levels of miR-365 and miR-520c-3p were significantly downregulated after 1 year of risperidone treatment (P <0.001).There were no significant correlations between the clinical symptoms and the expression levels of these two miRNAs (P >0.05).Conclusions This study analyzed possible circulating miRNAs in response to antipsychotic monotherapy for schizophrenia,the further mechanism need to be confirmed.

  12. miRNAs target databases: developmental methods and target identification techniques with functional annotations.

    Science.gov (United States)

    Singh, Nagendra Kumar

    2017-06-01

    microRNA (miRNA) regulates diverse biological mechanisms and metabolisms in plants and animals. Thus, the discoveries of miRNA has revolutionized the life sciences and medical research.The miRNA represses and cleaves the targeted mRNA by binding perfect or near perfect or imperfect complementary base pairs by RNA-induced silencing complex (RISC) formation during biogenesis process. One miRNA interacts with one or more mRNA genes and vice versa, hence takes part in causing various diseases. In this paper, the different microRNA target databases and their functional annotations developed by various researchers have been reviewed. The concurrent research review aims at comprehending the significance of miRNA and presenting the existing status of annotated miRNA target resources built by researchers henceforth discovering the knowledge for diagnosis and prognosis. This review discusses the applications and developmental methodologies for constructing target database as well as the utility of user interface design. An integrated architecture is drawn and a graphically comparative study of present status of miRNA targets in diverse diseases and various biological processes is performed. These databases comprise of information such as miRNA target-associated disease, transcription factor binding sites (TFBSs) in miRNA genomic locations, polymorphism in miRNA target, A-to-I edited target, Gene Ontology (GO), genome annotations, KEGG (Kyoto Encyclopedia of Genes and Genomes) pathways, target expression analysis, TF-miRNA and miRNA-mRNA interaction networks, drugs-targets interactions, etc. miRNA target databases contain diverse experimentally and computationally predicted target through various algorithms. The comparison of various miRNA target database has been performed on various parameters. The computationally predicted target databases suffer from false positive information as there is no common theory for prediction of miRNA targets. The review conclusion emphasizes

  13. Analyzing miRNA co-expression networks to explore TF-miRNA regulation

    Directory of Open Access Journals (Sweden)

    Bhattacharyya Malay

    2009-05-01

    Full Text Available Abstract Background Current microRNA (miRNA research in progress has engendered rapid accumulation of expression data evolving from microarray experiments. Such experiments are generally performed over different tissues belonging to a specific species of metazoan. For disease diagnosis, microarray probes are also prepared with tissues taken from similar organs of different candidates of an organism. Expression data of miRNAs are frequently mapped to co-expression networks to study the functions of miRNAs, their regulation on genes and to explore the complex regulatory network that might exist between Transcription Factors (TFs, genes and miRNAs. These directions of research relating miRNAs are still not fully explored, and therefore, construction of reliable and compatible methods for mining miRNA co-expression networks has become an emerging area. This paper introduces a novel method for mining the miRNA co-expression networks in order to obtain co-expressed miRNAs under the hypothesis that these might be regulated by common TFs. Results Three co-expression networks, configured from one patient-specific, one tissue-specific and a stem cell-based miRNA expression data, are studied for analyzing the proposed methodology. A novel compactness measure is introduced. The results establish the statistical significance of the sets of miRNAs evolved and the efficacy of the self-pruning phase employed by the proposed method. All these datasets yield similar network patterns and produce coherent groups of miRNAs. The existence of common TFs, regulating these groups of miRNAs, is empirically tested. The results found are very promising. A novel visual validation method is also proposed that reflects the homogeneity as well as statistical properties of the grouped miRNAs. This visual validation method provides a promising and statistically significant graphical tool for expression analysis. Conclusion A heuristic mining methodology that resembles a

  14. The interplay between MDV and HVT affects viral miRNa expression.

    Science.gov (United States)

    Goher, Mohamed; Hicks, Julie A; Liu, Hsiao-Ching

    2013-06-01

    It is well established that herpesviruses encode numerous microRNAs (miRNAs) and that these virally encoded small RNAs play multiple roles in infection. The present study was undertaken to determine how co-infection of a pathogenic MDV serotype one (MDV1) strain (MD5) and a vaccine strain (herpesvirus of turkeys [HVT]) alters viral miRNA expression in vivo. We first used small RNA deep sequencing to identify MDV1-encoded miRNAs that are expressed in tumorigenic spleens of MDV1-infected birds. The expression patterns of these miRNAs were then further assessed at an early time point (7 days postinfection [dpi]) and a late time point (42 dpi) in birds with and without HVT vaccination using real-time PCR (RT-PCR). Additionally, the effect of MDV1 co-infection on HVT-encoded miRNAs was determined using RT-PCR. A diverse population of miRNAs was expressed in MDV-induced tumorigenic spleens at 42 dpi, with 18 of the 26 known mature miRNAs represented. Of these, both mdv1-miR-M4-5p and mdv1-miR-M2-3p were the most highly expressed miRNAs. RT-PCR analysis further revealed that nine MDV miRNAs were differentially expressed between 7 dpi and 42 dpi infected spleens. At 7 dpi, three miRNAs were differentially expressed between the spleens of birds co-infected with HVT and MD5 compared with birds singly infected with MD5, whereas at 42 dpi, nine miRNAs were differentially expressed. At 7 dpi, the expression of seven HVT-encoded miRNAs was affected in the spleens of co-infected birds compared with birds only receiving the HVT vaccine. At 42 dpi, six HVT-encoded miRNAs were differentially expressed between the two groups. Target prediction analysis suggests that these differentially expressed viral miRNAs are involved in regulating several cellular processes, including cell proliferation and the adaptive immune response.

  15. Role of miRNA in Mammary Gland Development and Lactation

    Institute of Scientific and Technical Information of China (English)

    Li Qing-zhang; Wang Chun-mei; Gao Xue-jun

    2014-01-01

    miRNA can regulate development and milk yield of the mammary gland through epigenetic mechanism. miRNA can directly and indirectly modulate the activity of the epigenetic machinery, target genes through post-inhibition of translation initiation, mediate miRNA decay, target genes and inhibit the positive regulation, regulate tone modification, and regulate DNA methylation of target genes. Here we reviewed the role of miRNAs in mammary gland development and lactation. Researching miRNA in mammary gland development and lactation process, and understanding the response of the epigenetic mechanisms to external stimuli will be an important necessity to devise new technologies for maximizing their activity and milk production in the dairy cow.

  16. Shen 4-marker miRNA panel for lung cancer — EDRN Public Portal

    Science.gov (United States)

    We initially validated expressions of a set of miRNAs in paired lung tumor tissues and plasma specimens from 28 stage I NSCLC patients by real-time quantitative reverse transcription PCR, and then evaluated diagnostic value of the plasma miRNAs in a cohort of 58 NSCLC patients and 29 healthy individuals. The altered miRNA expressions were reproducibly confirmed in the tumor tissues. The miRNAs were stably present and reliably measurable in plasma. A logistic regression model with the best prediction was defined on the basis of the four genes (miRNA-21, -126, -210, and 486-5p), yielding 86.22% sensitivity and 96.55% specificity in distinguishing NSCLC patients from the healthy controls. (Lab Invest. 2011 Apr;91(4):579-87, PMID: 21116241)

  17. Functional screening identifies miRNAs influencing apoptosis and proliferation in colorectal cancer

    DEFF Research Database (Denmark)

    Christensen, Lise Lotte; Holm, Anja; Rantala, Juha

    2014-01-01

    MicroRNAs (miRNAs) play a critical role in many biological processes and are aberrantly expressed in human cancers. Particular miRNAs function either as tumor suppressors or oncogenes and appear to have diagnostic and prognostic significance. Although numerous miRNAs are dys-regulated in colorectal...... cancer (CRC) only a small fraction has been characterized functionally. Using high-throughput functional screening and miRNA profiling of clinical samples the present study aims at identifying miRNAs important for the control of cellular growth and/or apoptosis in CRC. The high-throughput functional...... analysis of transient and stable transfected CRC cell lines confirmed that miR-375 reduces cell viability through the induction of apoptotic death. We identified YAP1 as a direct miR-375 target in CRC and show that HELLS and NOLC1 are down-stream targets. Knock-down of YAP1 mimicked the phenotype induced...

  18. The role of microRNAs (miRNA) in circadian rhythmicity

    Indian Academy of Sciences (India)

    Mirko Pegoraro; Eran Tauber

    2008-12-01

    MicroRNA (miRNA) is a recently discovered new class of small RNA molecules that have a significant role in regulating gene and protein expression. These small RNAs (∼22 nt) bind to 3′ untranslated regions (3′UTRs) and induce degradation or repression of translation of their mRNA targets. Hundreds of miRNAs have been identified in various organisms and have been shown to play a significant role in development and normal cell functioning. Recently, a few studies have suggested that miRNAs may be an important regulators of circadian rhythmicity, providing a new dimension (posttranscriptional) of our understanding of biological clocks. Here, we describe the mechanisms of miRNA regulation, and recent studies attempting to identify clock miRNAs and their function in the circadian system.

  19. siRNA and miRNA processing: new functions for Cajal bodies.

    Science.gov (United States)

    Pontes, Olga; Pikaard, Craig S

    2008-04-01

    In diverse eukaryotes, micro-RNAs (miRNAs) and small interfering RNAs (siRNAs) regulate important processes that include mRNA inactivation, viral defense, chromatin modification, and transposon silencing. Recently, nucleolus-associated Cajal bodies in plants have been implicated as sites of siRNA and miRNA biogenesis, whereas in animals siRNA and miRNA dicing occurs in the cytoplasm. The plant nucleolus also contains proteins of the nonsense-mediated mRNA decay pathway that in animals are found associated with cytoplasmic processing bodies (P-bodies). P-bodies also function in the degradation of mRNAs subjected to miRNA and siRNA targeting. Collectively, these observations suggest interesting variations in the way siRNAs and miRNAs can accomplish their similar functions in plants and animals.

  20. Profiling circulating miRNAs in serum from pigs infected with the porcine whipworm, Trichuris suis

    DEFF Research Database (Denm