WorldWideScience

Sample records for putative dna g-quadruplex

  1. Putative DNA G-quadruplex formation within the promoters of Plasmodium falciparum var genes

    Directory of Open Access Journals (Sweden)

    Rowe J

    2009-08-01

    Full Text Available Abstract Background Guanine-rich nucleic acid sequences are capable of folding into an intramolecular four-stranded structure called a G-quadruplex. When found in gene promoter regions, G-quadruplexes can downregulate gene expression, possibly by blocking the transcriptional machinery. Here we have used a genome-wide bioinformatic approach to identify Putative G-Quadruplex Sequences (PQS in the Plasmodium falciparum genome, along with biophysical techniques to examine the physiological stability of P. falciparum PQS in vitro. Results We identified 63 PQS in the non-telomeric regions of the P. falciparum clone 3D7. Interestingly, 16 of these PQS occurred in the upstream region of a subset of the P. falciparum var genes (group B var genes. The var gene family encodes PfEMP1, the parasite's major variant antigen and adhesin expressed at the surface of infected erythrocytes, that plays a key role in malaria pathogenesis and immune evasion. The ability of the PQS found in the upstream regions of group B var genes (UpsB-Q to form stable G-quadruplex structures in vitro was confirmed using 1H NMR, circular dichroism, UV spectroscopy, and thermal denaturation experiments. Moreover, the synthetic compound BOQ1 that shows a higher affinity for DNA forming quadruplex rather than duplex structures was found to bind with high affinity to the UpsB-Q. Conclusion This is the first demonstration of non-telomeric PQS in the genome of P. falciparum that form stable G-quadruplexes under physiological conditions in vitro. These results allow the generation of a novel hypothesis that the G-quadruplex sequences in the upstream regions of var genes have the potential to play a role in the transcriptional control of this major virulence-associated multi-gene family.

  2. Simultaneous G-Quadruplex DNA Logic.

    Science.gov (United States)

    Bader, Antoine; Cockroft, Scott L

    2018-04-03

    A fundamental principle of digital computer operation is Boolean logic, where inputs and outputs are described by binary integer voltages. Similarly, inputs and outputs may be processed on the molecular level as exemplified by synthetic circuits that exploit the programmability of DNA base-pairing. Unlike modern computers, which execute large numbers of logic gates in parallel, most implementations of molecular logic have been limited to single computing tasks, or sensing applications. This work reports three G-quadruplex-based logic gates that operate simultaneously in a single reaction vessel. The gates respond to unique Boolean DNA inputs by undergoing topological conversion from duplex to G-quadruplex states that were resolved using a thioflavin T dye and gel electrophoresis. The modular, addressable, and label-free approach could be incorporated into DNA-based sensors, or used for resolving and debugging parallel processes in DNA computing applications. © 2018 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.

  3. The G-quadruplex DNA stabilizing drug pyridostatin promotes DNA damage and downregulates transcription of Brca1 in neurons.

    Science.gov (United States)

    Moruno-Manchon, Jose F; Koellhoffer, Edward C; Gopakumar, Jayakrishnan; Hambarde, Shashank; Kim, Nayun; McCullough, Louise D; Tsvetkov, Andrey S

    2017-09-12

    The G-quadruplex is a non-canonical DNA secondary structure formed by four DNA strands containing multiple runs of guanines. G-quadruplexes play important roles in DNA recombination, replication, telomere maintenance, and regulation of transcription. Small molecules that stabilize the G-quadruplexes alter gene expression in cancer cells. Here, we hypothesized that the G-quadruplexes regulate transcription in neurons. We discovered that pyridostatin, a small molecule that specifically stabilizes G-quadruplex DNA complexes, induced neurotoxicity and promoted the formation of DNA double-strand breaks (DSBs) in cultured neurons. We also found that pyridostatin downregulated transcription of the Brca1 gene, a gene that is critical for DSB repair. Importantly, in an in vitro gel shift assay, we discovered that an antibody specific to the G-quadruplex structure binds to a synthetic oligonucleotide, which corresponds to the first putative G-quadruplex in the Brca1 gene promoter. Our results suggest that the G-quadruplex complexes regulate transcription in neurons. Studying the G-quadruplexes could represent a new avenue for neurodegeneration and brain aging research.

  4. Studies of G-quadruplexes formed within self-assembled DNA mini-circles.

    Science.gov (United States)

    Klejevskaja, Beata; Pyne, Alice L B; Reynolds, Matthew; Shivalingam, Arun; Thorogate, Richard; Hoogenboom, Bart W; Ying, Liming; Vilar, Ramon

    2016-10-13

    We have developed self-assembled DNA mini-circles that contain a G-quadruplex-forming sequence from the c-Myc oncogene promoter and demonstrate by FRET that the G-quadruplex unfolding kinetics are 10-fold slower than for the simpler 24-mer G-quadruplex that is commonly used for FRET experiments.

  5. A multi-functional guanine derivative for studying the DNA G-quadruplex structure.

    Science.gov (United States)

    Ishizuka, Takumi; Zhao, Pei-Yan; Bao, Hong-Liang; Xu, Yan

    2017-10-23

    In the present study, we developed a multi-functional guanine derivative, 8F G, as a G-quadruplex stabilizer, a fluorescent probe for the detection of G-quadruplex formation, and a 19 F sensor for the observation of the G-quadruplex. We demonstrate that the functional nucleoside bearing a 3,5-bis(trifluoromethyl)benzene group at the 8-position of guanine stabilizes the DNA G-quadruplex structure and fluoresces following the G-quadruplex formation. Furthermore, we show that the functional sensor can be used to directly observe DNA G-quadruplexes by 19 F-NMR in living cells. To our knowledge, this is the first study showing that the nucleoside derivative simultaneously allows for three kinds of functions at a single G-quadruplex DNA. Our results suggest that the multi-functional nucleoside derivative can be broadly used for studying the G-quadruplex structure and serves as a powerful tool for examining the molecular basis of G-quadruplex formation in vitro and in living cells.

  6. Distance-dependent duplex DNA destabilization proximal to G-quadruplex/i-motif sequences

    Science.gov (United States)

    König, Sebastian L. B.; Huppert, Julian L.; Sigel, Roland K. O.; Evans, Amanda C.

    2013-01-01

    G-quadruplexes and i-motifs are complementary examples of non-canonical nucleic acid substructure conformations. G-quadruplex thermodynamic stability has been extensively studied for a variety of base sequences, but the degree of duplex destabilization that adjacent quadruplex structure formation can cause has yet to be fully addressed. Stable in vivo formation of these alternative nucleic acid structures is likely to be highly dependent on whether sufficient spacing exists between neighbouring duplex- and quadruplex-/i-motif-forming regions to accommodate quadruplexes or i-motifs without disrupting duplex stability. Prediction of putative G-quadruplex-forming regions is likely to be assisted by further understanding of what distance (number of base pairs) is required for duplexes to remain stable as quadruplexes or i-motifs form. Using oligonucleotide constructs derived from precedented G-quadruplexes and i-motif-forming bcl-2 P1 promoter region, initial biophysical stability studies indicate that the formation of G-quadruplex and i-motif conformations do destabilize proximal duplex regions. The undermining effect that quadruplex formation can have on duplex stability is mitigated with increased distance from the duplex region: a spacing of five base pairs or more is sufficient to maintain duplex stability proximal to predicted quadruplex/i-motif-forming regions. PMID:23771141

  7. A Selective G-Quadruplex DNA-Stabilizing Ligand Based on a Cyclic Naphthalene Diimide Derivative

    Directory of Open Access Journals (Sweden)

    Md. Monirul Islam

    2015-06-01

    Full Text Available A cyclic naphthalene diimide (cyclic NDI, 1, carrying a benzene moiety as linker chain, was synthesized and its interaction with G-quadruplex DNAs of a-core and a-coreTT as a human telomeric DNA, c-kit and c-myc as DNA sequence at promoter region, or thrombin-binding aptamer (TBA studied based on UV-VIS and circular dichroism (CD spectroscopic techniques, thermal melting temperature measurement, and FRET-melting assay. The circular dichroism spectra showed that 1 induced the formation of different types of G-quadruplex DNA structure. Compound 1 bound to these G-quadruplexes with affinities in the range of 106–107 M−1 order and a 2:1 stoichiometry. Compound 1 showed 270-fold higher selectivity for a-core than dsDNA with a preferable a-core binding than a-coreTT, c-kit, c-myc and TBA in the presence of K+, which is supported by thermal melting studies. The FRET-melting assay also showed that 1 bound preferentially to human telomeric DNA. Compound 1 showed potent inhibition against telomerase activity with an IC50 value of 0.9 μM and preferable binding to G-quadruplexes DNA than our previously published cyclic NDI derivative 3 carrying a benzene moiety as longer linker chain.

  8. UvrD in Deinococcus radiodurans is optimized for processing G-quadruplex DNA

    International Nuclear Information System (INIS)

    Das, Anubrata; Misra, H.S.

    2015-01-01

    Deinococcus radiodurans R1 is a radiation resistant Gram-positive bacterium capable of tolerating very high doses of DNA-damaging agents such as gamma radiation (D10 ∼ 12kGy) desiccation (∼ 5% relative humidity), UVC radiation (D10 ∼ 800J/m 2 ) and hydrogen peroxide (40 mM). It achieves this by using a complex regulatory mechanism and novel proteins. Recently bioinformatic analysis showed several stretches of guanine runs in D.radiodurans genome, which could form G-quartets. The role of G-quartets in regulatory processes is well documented in various organisms. The presence of G -quartets in D. radiodurans means that there are regulatory or structural proteins which would bind to these elements. Several proteins are known to bind G-quartets. Finding the proteins which would bind to G4 DNA is difficult as no specific motifs are available for binding these elements. Also most of the known proteins that are shown to bind to G-quadruplex DNA are of eukaryotic nature. To overcome these challenges we defined a set of known G-quadruplex binding proteins and used a smith-waterman algorithm with our own scoring matrix to homologs of G-quadruplex binding proteins in D.radiodurans. Using bioinformatics analysis, we showed that UvrD (DR 1775) of D. radiodurans has ability to bind/translocate along G-quadruplex DNA, a novel feature in prokaryotes. The translocase activity of DR1775 is ATP specific and this ATPase activity is attenuated by ssDNA. Data supporting UvrD of D. radiodurans as a G-quadruplex DNA metabolizing proteins would be presented. (author)

  9. Effects of trimethylamine N-oxide and urea on DNA duplex and G-quadruplex.

    Science.gov (United States)

    Ueda, Yu-Mi; Zouzumi, Yu-Ki; Maruyama, Atsushi; Nakano, Shu-Ichi; Sugimoto, Naoki; Miyoshi, Daisuke

    2016-01-01

    We systematically investigated effects of molecular crowding with trimethylamine N -oxide (TMAO) as a zwitterionic and protective osmolyte and urea as a nonionic denaturing osmolyte on conformation and thermodynamics of the canonical DNA duplex and the non-canonical DNA G-quadruplex. It was found that TMAO and urea stabilized and destabilized, respectively, the G-quadruplex. On the other hand, these osmolytes generally destabilize the duplex; however, it was observed that osmolytes having the trimethylamine group stabilized the duplex at the lower concentrations because of a direct binding to a groove of the duplex. These results are useful not only to predict DNA structures and their thermodynamics under physiological environments in living cells, but also design of polymers and materials to regulate structure and stability of DNA sequences.

  10. Repair of O6-methylguanine adducts in human telomeric G-quadruplex DNA by O6-alkylguanine-DNA alkyltransferase

    Science.gov (United States)

    Hellman, Lance M.; Spear, Tyler J.; Koontz, Colton J.; Melikishvili, Manana; Fried, Michael G.

    2014-01-01

    O6-alkylguanine-DNA alkyltransferase (AGT) is a single-cycle DNA repair enzyme that removes pro-mutagenic O6-alkylguanine adducts from DNA. Its functions with short single-stranded and duplex substrates have been characterized, but its ability to act on other DNA structures remains poorly understood. Here, we examine the functions of this enzyme on O6-methylguanine (6mG) adducts in the four-stranded structure of the human telomeric G-quadruplex. On a folded 22-nt G-quadruplex substrate, binding saturated at 2 AGT:DNA, significantly less than the ∼5 AGT:DNA found with linear single-stranded DNAs of similar length, and less than the value found with the telomere sequence under conditions that inhibit quadruplex formation (4 AGT:DNA). Despite these differences, AGT repaired 6mG adducts located within folded G-quadruplexes, at rates that were comparable to those found for a duplex DNA substrate under analogous conditions. Repair was kinetically biphasic with the amplitudes of rapid and slow phases dependent on the position of the adduct within the G-quadruplex: in general, adducts located in the top or bottom tetrads of a quadruplex stack exhibited more rapid-phase repair than did adducts located in the inner tetrad. This distinction may reflect differences in the conformational dynamics of 6mG residues in G-quadruplex DNAs. PMID:25080506

  11. Human telomeric DNA: G-quadruplex, i-motif and Watson–Crick double helix

    Science.gov (United States)

    Phan, Anh Tuân; Mergny, Jean-Louis

    2002-01-01

    Human telomeric DNA composed of (TTAGGG/CCCTAA)n repeats may form a classical Watson–Crick double helix. Each individual strand is also prone to quadruplex formation: the G-rich strand may adopt a G-quadruplex conformation involving G-quartets whereas the C-rich strand may fold into an i-motif based on intercalated C·C+ base pairs. Using an equimolar mixture of the telomeric oligonucleotides d[AGGG(TTAGGG)3] and d[(CCCTAA)3CCCT], we defined which structures existed and which would be the predominant species under a variety of experimental conditions. Under near-physiological conditions of pH, temperature and salt concentration, telomeric DNA was predominantly in a double-helix form. However, at lower pH values or higher temperatures, the G-quadruplex and/or the i-motif efficiently competed with the duplex. We also present kinetic and thermodynamic data for duplex association and for G-quadruplex/i-motif unfolding. PMID:12409451

  12. Pyrrolobenzodiazepines (PBDs do not bind to DNA G-quadruplexes.

    Directory of Open Access Journals (Sweden)

    Khondaker M Rahman

    Full Text Available The pyrrolo[2,1-c][1,4] benzodiazepines (PBDs are a family of sequence-selective, minor-groove binding DNA-interactive agents that covalently attach to guanine residues. A recent publication in this journal (Raju et al, PloS One, 2012, 7, 4, e35920 reported that two PBD molecules were observed to bind with high affinity to the telomeric quadruplex of Tetrahymena glaucoma based on Electrospray Ionisation Mass Spectrometry (ESI-MS, Circular Dichroism, UV-Visible and Fluorescence spectroscopy data. This was a surprising result given the close 3-dimensional shape match between the structure of all PBD molecules and the minor groove of duplex DNA, and the completely different 3-dimensional structure of quadruplex DNA. Therefore, we evaluated the interaction of eight PBD molecules of diverse structure with a range of parallel, antiparallel and mixed DNA quadruplexes using DNA Thermal Denaturation, Circular Dichroism and Molecular Dynamics Simulations. Those PBD molecules without large C8-substitutents had an insignificant affinity for the eight quadruplex types, although those with large π-system-containing C8-substituents (as with the compounds evaluated by Raju and co-workers were found to interact to some extent. Our molecular dynamics simulations support the likelihood that molecules of this type, including those examined by Raju and co-workers, interact with quadruplex DNA through their C8-substituents rather than the PBD moiety itself. It is important for the literature to be clear on this matter, as the mechanism of action of these agents will be under close scrutiny in the near future due to the growing number of PBD-based agents entering the clinic as both single-agents and as components of antibody-drug conjugates (ADCs.

  13. Controlling the stoichiometry and strand polarity of a tetramolecular G-quadruplex structure by using a DNA origami frame

    Science.gov (United States)

    Rajendran, Arivazhagan; Endo, Masayuki; Hidaka, Kumi; Lan Thao Tran, Phong; Mergny, Jean-Louis; Sugiyama, Hiroshi

    2013-01-01

    Guanine-rich oligonucleotides often show a strong tendency to form supramolecular architecture, the so-called G-quadruplex structure. Because of the biological significance, it is now considered to be one of the most important conformations of DNA. Here, we describe the direct visualization and single-molecule analysis of the formation of a tetramolecular G-quadruplex in KCl solution. The conformational changes were carried out by incorporating two duplex DNAs, with G–G mismatch repeats in the middle, inside a DNA origami frame and monitoring the topology change of the strands. In the absence of KCl, incorporated duplexes had no interaction and laid parallel to each other. Addition of KCl induced the formation of a G-quadruplex structure by stably binding the duplexes to each other in the middle. Such a quadruplex formation allowed the DNA synapsis without disturbing the duplex regions of the participating sequences, and resulted in an X-shaped structure that was monitored by atomic force microscopy. Further, the G-quadruplex formation in KCl solution and its disruption in KCl-free buffer were analyzed in real-time. The orientation of the G-quadruplex is often difficult to control and investigate using traditional biochemical methods. However, our method using DNA origami could successfully control the strand orientations, topology and stoichiometry of the G-quadruplex. PMID:23863846

  14. Biochemical techniques for the characterization of G-quadruplex structures: EMSA, DMS footprinting, and DNA polymerase stop assay.

    Science.gov (United States)

    Sun, Daekyu; Hurley, Laurence H

    2010-01-01

    The proximal promoter region of many human growth-related genes contains a polypurine/polypyrimidine tract that serves as multiple binding sites for Sp1 or other transcription factors. These tracts often contain a guanine-rich sequence consisting of four runs of three or more contiguous guanines separated by one or more bases, corresponding to a general motif known for the formation of an intramolecular G-quadruplex. Recent results provide strong evidence that specific G-quadruplex structures form naturally within these polypurine/polypyrimidine tracts in many human promoter regions, raising the possibility that the transcriptional control of these genes can be modulated by G-quadruplex-interactive agents. In this chapter, we describe three general biochemical methodologies, electrophoretic mobility shift assay (EMSA), dimethylsulfate (DMS) footprinting, and the DNA polymerase stop assay, which can be useful for initial characterization of G-quadruplex structures formed by G-rich sequences.

  15. G-Quadruplexes in DNA Replication: A Problem or a Necessity?

    Science.gov (United States)

    Valton, Anne-Laure; Prioleau, Marie-Noëlle

    2016-11-01

    DNA replication is a highly regulated process that ensures the correct duplication of the genome at each cell cycle. A precise cell type-specific temporal program controls the duplication of complex vertebrate genomes in an orderly manner. This program is based on the regulation of both replication origin firing and replication fork progression. G-quadruplexes (G4s), DNA secondary structures displaying noncanonical Watson-Crick base pairing, have recently emerged as key controllers of genome duplication. Here we discuss the various means by which G4s affect this fundamental cellular process. Copyright © 2016 Elsevier Ltd. All rights reserved.

  16. Identification of the DNA-Binding Domains of Human Replication Protein A That Recognize G-Quadruplex DNA

    Directory of Open Access Journals (Sweden)

    Aishwarya Prakash

    2011-01-01

    Full Text Available Replication protein A (RPA, a key player in DNA metabolism, has 6 single-stranded DNA-(ssDNA- binding domains (DBDs A-F. SELEX experiments with the DBDs-C, -D, and -E retrieve a 20-nt G-quadruplex forming sequence. Binding studies show that RPA-DE binds preferentially to the G-quadruplex DNA, a unique preference not observed with other RPA constructs. Circular dichroism experiments show that RPA-CDE-core can unfold the G-quadruplex while RPA-DE stabilizes it. Binding studies show that RPA-C binds pyrimidine- and purine-rich sequences similarly. This difference between RPA-C and RPA-DE binding was also indicated by the inability of RPA-CDE-core to unfold an oligonucleotide containing a TC-region 5′ to the G-quadruplex. Molecular modeling studies of RPA-DE and telomere-binding proteins Pot1 and Stn1 reveal structural similarities between the proteins and illuminate potential DNA-binding sites for RPA-DE and Stn1. These data indicate that DBDs of RPA have different ssDNA recognition properties.

  17. Synthesis and Molecular Modeling of Thermally Stable DNA G-Quadruplexes with Anthraquinone Insertions

    DEFF Research Database (Denmark)

    Gouda, Alaa S.; Amine, Mahasen S.; Pedersen, Erik Bjerregaard

    2017-01-01

    Two new phosphoramidite building blocks for DNA synthesis were synthesized from 1,5- and 2,6-dihydroxyanthraquinones through alkylation with 3-bromo-1-propanol followed by DMT-protection. The novel synthesized 1,5- and 2,6-disubstituted anthraquinone monomers H15 and H26 are incorporated into a G...... anthraquinone-modified quadruplexes revealed no change of the antiparallel structure when compared with the wild type under potassium buffer conditions. The significantly increased thermostabilities were interpreted by molecular modeling of anthraquinone-modified G-quadruplexes....

  18. Mechanism and manipulation of DNA:RNA hybrid G-quadruplex formation in transcription of G-rich DNA.

    Science.gov (United States)

    Zhang, Jia-yu; Zheng, Ke-wei; Xiao, Shan; Hao, Yu-hua; Tan, Zheng

    2014-01-29

    We recently reported that a DNA:RNA hybrid G-quadruplex (HQ) forms during transcription of DNA that bears two or more tandem guanine tracts (G-tract) on the nontemplate strand. Putative HQ-forming sequences are enriched in the nearby 1000 nt region right downstream of transcription start sites in the nontemplate strand of warm-blooded animals, and HQ regulates transcription under both in vitro and in vivo conditions. Therefore, knowledge of the mechanism of HQ formation is important for understanding the biological function of HQ as well as for manipulating gene expression by targeting HQ. In this work, we studied the mechanism of HQ formation using an in vitro T7 transcription model. We show that RNA synthesis initially produces an R-loop, a DNA:RNA heteroduplex formed by a nascent RNA transcript and the template DNA strand. In the following round of transcription, the RNA in the R-loop is displaced, releasing the RNA in single-stranded form (ssRNA). Then the G-tracts in the RNA can jointly form HQ with those in the nontemplate DNA strand. We demonstrate that the structural cascade R-loop → ssRNA → HQ offers opportunities to intercept HQ formation, which may provide a potential method to manipulate gene expression.

  19. Escherichia coli DNA polymerase I can disrupt G-quadruplex structures during DNA replication.

    Science.gov (United States)

    Teng, Fang-Yuan; Hou, Xi-Miao; Fan, San-Hong; Rety, Stephane; Dou, Shuo-Xing; Xi, Xu-Guang

    2017-12-01

    Non-canonical four-stranded G-quadruplex (G4) DNA structures can form in G-rich sequences that are widely distributed throughout the genome. The presence of G4 structures can impair DNA replication by hindering the progress of replicative polymerases (Pols), and failure to resolve these structures can lead to genetic instability. In the present study, we combined different approaches to address the question of whether and how Escherichia coli Pol I resolves G4 obstacles during DNA replication and/or repair. We found that E. coli Pol I-catalyzed DNA synthesis could be arrested by G4 structures at low protein concentrations and the degree of inhibition was strongly dependent on the stability of the G4 structures. Interestingly, at high protein concentrations, E. coli Pol I was able to overcome some kinds of G4 obstacles without the involvement of other molecules and could achieve complete replication of G4 DNA. Mechanistic studies suggested that multiple Pol I proteins might be implicated in G4 unfolding, and the disruption of G4 structures requires energy derived from dNTP hydrolysis. The present work not only reveals an unrealized function of E. coli Pol I, but also presents a possible mechanism by which G4 structures can be resolved during DNA replication and/or repair in E. coli. © 2017 Federation of European Biochemical Societies.

  20. Intermolecular G-quadruplex structure-based fluorescent DNA detection system.

    Science.gov (United States)

    Zhou, Hui; Wu, Zai-Sheng; Shen, Guo-Li; Yu, Ru-Qin

    2013-03-15

    Adopting multi-donors to pair with one acceptor could improve the performance of fluorogenic detection probes. However, common dyes (e.g., fluorescein) in close proximity to each other would self-quench the fluorescence, and the fluorescence is difficult to restore. In this contribution, we constructed a novel "multi-donors-to-one acceptor" fluorescent DNA detection system by means of the intermolecular G-quadruplex (IGQ) structure-based fluorescence signal enhancement combined with the hairpin oligonucleotide. The novel IGQ-hairpin system was characterized using the p53 gene as the model target DNA. The proposed system showed an improved assay performance due to the introduction of IGQ-structure into fluorescent signaling probes, which could inhibit the background fluorescence and increase fluorescence restoration amplitude of fluoresceins upon target DNA hybridization. The proof-of-concept scheme is expected to provide new insight into the potential of G-quadruplex structure and promote the application of fluorescent oligonucleotide probes in fundamental research, diagnosis, and treatment of genetic diseases. Copyright © 2012 Elsevier B.V. All rights reserved.

  1. Volumetric contributions of loop regions of G-quadruplex DNA to the formation of the tertiary structure.

    Science.gov (United States)

    Takahashi, Shuntaro; Sugimoto, Naoki

    2017-12-01

    DNA guanine-quadruplexes (G-quadruplexes) are unique DNA structures formed by guanine-rich sequences. The loop regions of G-quadruplexes play key roles in stability and topology of G-quadruplexes. Here, we investigated volumetric changes induced by pressure in the folding of the G-quadruplex formed by the thrombin binding aptamer (TBA) with mutations within the loop regions. The change of partial molar volume in the transition from coil to G-quadruplex, ∆V tr , of TBA with a mutation from T to A in the 5' most loop (TBA T3A) was 75.5cm 3 mol -1 , which was larger than that of TBA (54.6cm 3 mol -1 ). TBA with a G to T mutation in the central loop (TBA G8T) had thermal stability similar to TBA T3A but a smaller ∆V tr of 41.1cm 3 mol -1 . In the presence of poly(ethylene)glycol 200 (PEG200), ∆V tr values were 14.7cm 3 mol -1 for TBA T3A and 13.2cm 3 mol -1 for TBA G8T. These results suggest that the two mutations destabilize the G-quadruplex structure differently. Thus, volumetric data obtained using pressure-based thermodynamic analyses provides information about the dynamics of the loop regions and the roles of loops in the stabilities and folding of G-quadruplex structures. Copyright © 2017 Elsevier B.V. All rights reserved.

  2. DNA secondary structures: stability and function of G-quadruplex structures

    Science.gov (United States)

    Bochman, Matthew L.; Paeschke, Katrin; Zakian, Virginia A.

    2013-01-01

    In addition to the canonical double helix, DNA can fold into various other inter- and intramolecular secondary structures. Although many such structures were long thought to be in vitro artefacts, bioinformatics demonstrates that DNA sequences capable of forming these structures are conserved throughout evolution, suggesting the existence of non-B-form DNA in vivo. In addition, genes whose products promote formation or resolution of these structures are found in diverse organisms, and a growing body of work suggests that the resolution of DNA secondary structures is critical for genome integrity. This Review focuses on emerging evidence relating to the characteristics of G-quadruplex structures and the possible influence of such structures on genomic stability and cellular processes, such as transcription. PMID:23032257

  3. Targeting G-quadruplex DNA Structures by EMICORON has a strong antitumor efficacy against advanced models of human colon cancer

    DEFF Research Database (Denmark)

    Porru, Manuela; Artuso, Simona; Salvati, Erica

    2015-01-01

    We previously identified EMICORON as a novel G-quadruplex (G4) ligand showing high selectivity for G4 structures over the duplex DNA, causing telomere damage and inhibition of cell proliferation in transformed and tumor cells. Here, we evaluated the antitumoral effect of EMICORON on advanced mode...

  4. G-quadruplexes Significantly Stimulate Pif1 Helicase-catalyzed Duplex DNA Unwinding*

    Science.gov (United States)

    Duan, Xiao-Lei; Liu, Na-Nv; Yang, Yan-Tao; Li, Hai-Hong; Li, Ming; Dou, Shuo-Xing; Xi, Xu-Guang

    2015-01-01

    The evolutionarily conserved G-quadruplexes (G4s) are faithfully inherited and serve a variety of cellular functions such as telomere maintenance, gene regulation, DNA replication initiation, and epigenetic regulation. Different from the Watson-Crick base-pairing found in duplex DNA, G4s are formed via Hoogsteen base pairing and are very stable and compact DNA structures. Failure of untangling them in the cell impedes DNA-based transactions and leads to genome instability. Cells have evolved highly specific helicases to resolve G4 structures. We used a recombinant nuclear form of Saccharomyces cerevisiae Pif1 to characterize Pif1-mediated DNA unwinding with a substrate mimicking an ongoing lagging strand synthesis stalled by G4s, which resembles a replication origin and a G4-structured flap in Okazaki fragment maturation. We find that the presence of G4 may greatly stimulate the Pif1 helicase to unwind duplex DNA. Further studies reveal that this stimulation results from G4-enhanced Pif1 dimerization, which is required for duplex DNA unwinding. This finding provides new insights into the properties and functions of G4s. We discuss the observed activation phenomenon in relation to the possible regulatory role of G4s in the rapid rescue of the stalled lagging strand synthesis by helping the replicator recognize and activate the replication origin as well as by quickly removing the G4-structured flap during Okazaki fragment maturation. PMID:25627683

  5. Binding modes and pathway of RHPS4 to human telomeric G-quadruplex and duplex DNA probed by all-atom molecular dynamics simulations with explicit solvent.

    Science.gov (United States)

    Mulholland, Kelly; Siddiquei, Farzana; Wu, Chun

    2017-07-19

    RHPS4, a potent binder to human telomeric DNA G-quadruplex, shows high efficacy in tumor cell growth inhibition. However, it's preferential binding to DNA G-quadruplex over DNA duplex (about 10 fold) remains to be improved toward its clinical application. A high resolution structure of the single-stranded telomeric DNA G-quadruplexes, or B-DNA duplex, in complex with RHPS4 is not available yet, and the binding nature of this ligand to these DNA forms remains to be elusive. In this study, we carried out 40 μs molecular dynamics binding simulations with a free ligand to decipher the binding pathway of RHPS4 to a DNA duplex and three G-quadruplex folders (parallel, antiparallel and hybrid) of the human telomeric DNA sequence. The most stable binding mode identified for the duplex, parallel, antiparallel and hybrid G-quadruplexes is an intercalation, bottom stacking, top intercalation and bottom intercalation mode, respectively. The intercalation mode with similar binding strength to both the duplex and the G-quadruplexes, explains the lack of binding selectivity of RHPS4 to the G-quadruplex form. Therefore, a ligand modification that destabilizes the duplex intercalation mode but stabilizes the G-quadruplex intercalation mode will improve the binding selectivity toward G-quadruplex. The intercalation mode of RHPS4 to both the duplex and the antiparallel and the hybrid G-quadruplex follows a base flipping-insertion mechanism rather than an open-insertion mechanism. The groove binding, the side binding and the intercalation with flipping out of base were observed to be intermediate states before the full intercalation state with paired bases.

  6. Mms1 is an assistant for regulating G-quadruplex DNA structures.

    Science.gov (United States)

    Schwindt, Eike; Paeschke, Katrin

    2017-11-02

    The preservation of genome stability is fundamental for every cell. Genomic integrity is constantly challenged. Among those challenges are also non-canonical nucleic acid structures. In recent years, scientists became aware of the impact of G-quadruplex (G4) structures on genome stability. It has been shown that folded G4-DNA structures cause changes in the cell, such as transcriptional up/down-regulation, replication stalling, or enhanced genome instability. Multiple helicases have been identified to regulate G4 structures and by this preserve genome stability. Interestingly, although these helicases are mostly ubiquitous expressed, they show specificity for G4 regulation in certain cellular processes (e.g., DNA replication). To this date, it is not clear how this process and target specificity of helicases are achieved. Recently, Mms1, an ubiquitin ligase complex protein, was identified as a novel G4-DNA-binding protein that supports genome stability by aiding Pif1 helicase binding to these regions. In this perspective review, we discuss the question if G4-DNA interacting proteins are fundamental for helicase function and specificity at G4-DNA structures.

  7. Studies of G-quadruplex DNA structures at the single molecule level

    DEFF Research Database (Denmark)

    Kragh, Sofie Louise

    2015-01-01

    Folding of G-quaduplex structures adopted by the human telomeric repeat is here studied by single molecule FRET microscopy. This method allows for the investigation of G-quadruplex structures and their conformational dynamic. Telomeres are located at the ends of our chromosomes and end in a single...... with human telomeric repeat adopt several different G-quadruplex conformations in the presence of K+ ions. G-quadruplexes inhibit telomerase activity and are therefore potential targets for anti-cancer drugs, which can be small molecule ligands capable of stabilizing G-quadruplex structures. Understanding...... range. FRET spectroscopy can be performed on an ensemble of molecules, or on the single molecule level. In single molecule FRET experiments it is possible to follow the behaviour in time for each molecule independently, allowing insight into both dynamically and statistically heterogeneous molecular...

  8. Integration of G-quadruplex and DNA-templated Ag NCs for nonarithmetic information processing.

    Science.gov (United States)

    Gao, Ru-Ru; Yao, Tian-Ming; Lv, Xiao-Yan; Zhu, Yan-Yan; Zhang, Yi-Wei; Shi, Shuo

    2017-06-01

    To create sophisticated molecular logic circuits from scratch, you may not believe how common the building blocks can be and how diverse and powerful such circuits can be when scaled up. Using the two simple building blocks of G-quadruplex and silver nanoclusters (Ag NCs), we experimentally construct a series of multifunctional, label-free, and multi-output logic circuits to perform nonarithmetic functions: a 1-to-2 decoder, a 4-to-2 encoder, an 8-to-3 encoder, dual transfer gates, a 2 : 1 multiplexer, and a 1 : 2 demultiplexer. Moreover, a parity checker which is capable of identifying odd and even numbers from natural numbers is constructed conceptually. Finally, a multi-valued logic gate (ternary inhibit gate) is readily achieved by taking this DNA/Ag NC system as a universal platform. All of the above logic circuits share the same building blocks, indicating the great prospects of the assembly of nanomaterials and DNA for biochemical logic devices. Considering its biocompatibility, the novel prototypes developed here may have potential applications in the fields of biological computers and medical diagnosis and serve as a promising proof of principle in the not-too-distant future.

  9. Ligand binding to telomeric G-quadruplex DNA investigated by funnel-metadynamics simulations.

    Science.gov (United States)

    Moraca, Federica; Amato, Jussara; Ortuso, Francesco; Artese, Anna; Pagano, Bruno; Novellino, Ettore; Alcaro, Stefano; Parrinello, Michele; Limongelli, Vittorio

    2017-03-14

    G-quadruplexes (G4s) are higher-order DNA structures typically present at promoter regions of genes and telomeres. Here, the G4 formation decreases the replicative DNA at each cell cycle, finally leading to apoptosis. The ability to control this mitotic clock, particularly in cancer cells, is fascinating and passes through a rational understanding of the ligand/G4 interaction. We demonstrate that an accurate description of the ligand/G4 binding mechanism is possible using an innovative free-energy method called funnel-metadynamics (FM), which we have recently developed to investigate ligand/protein interaction. Using FM simulations, we have elucidated the binding mechanism of the anticancer alkaloid berberine to the human telomeric G4 ( d [AG 3 (T 2 AG 3 ) 3 ]), computing also the binding free-energy landscape. Two ligand binding modes have been identified as the lowest energy states. Furthermore, we have found prebinding sites, which are preparatory to reach the final binding mode. In our simulations, the ions and the water molecules have been explicitly represented and the energetic contribution of the solvent during ligand binding evaluated. Our theoretical results provide an accurate estimate of the absolute ligand/DNA binding free energy ([Formula: see text] = -10.3 ± 0.5 kcal/mol) that we validated through steady-state fluorescence binding assays. The good agreement between the theoretical and experimental value demonstrates that FM is a most powerful method to investigate ligand/DNA interaction and can be a useful tool for the rational design also of G4 ligands.

  10. APTO-253 Stabilizes G-quadruplex DNA, Inhibits MYC Expression, and Induces DNA Damage in Acute Myeloid Leukemia Cells.

    Science.gov (United States)

    Local, Andrea; Zhang, Hongying; Benbatoul, Khalid D; Folger, Peter; Sheng, Xia; Tsai, Cheng-Yu; Howell, Stephen B; Rice, William G

    2018-06-01

    APTO-253 is a phase I clinical stage small molecule that selectively induces CDKN1A (p21), promotes G 0 -G 1 cell-cycle arrest, and triggers apoptosis in acute myeloid leukemia (AML) cells without producing myelosuppression in various animal species and humans. Differential gene expression analysis identified a pharmacodynamic effect on MYC expression, as well as induction of DNA repair and stress response pathways. APTO-253 was found to elicit a concentration- and time-dependent reduction in MYC mRNA expression and protein levels. Gene ontogeny and structural informatic analyses suggested a mechanism involving G-quadruplex (G4) stabilization. Intracellular pharmacokinetic studies in AML cells revealed that APTO-253 is converted intracellularly from a monomer to a ferrous complex [Fe(253) 3 ]. FRET assays demonstrated that both monomeric APTO-253 and Fe(253) 3 stabilize G4 structures from telomeres, MYC, and KIT promoters but do not bind to non-G4 double-stranded DNA. Although APTO-253 exerts a host of mechanistic sequelae, the effect of APTO-253 on MYC expression and its downstream target genes, on cell-cycle arrest, DNA damage, and stress responses can be explained by the action of Fe(253) 3 and APTO-253 on G-quadruplex DNA motifs. Mol Cancer Ther; 17(6); 1177-86. ©2018 AACR . ©2018 American Association for Cancer Research.

  11. Ball with hair: modular functionalization of highly stable G-quadruplex DNA nano-scaffolds through N2-guanine modification.

    Science.gov (United States)

    Lech, Christopher Jacques; Phan, Anh Tuân

    2017-06-20

    Functionalized nanoparticles have seen valuable applications, particularly in the delivery of therapeutic and diagnostic agents in biological systems. However, the manufacturing of such nano-scale systems with the consistency required for biological application can be challenging, as variation in size and shape have large influences in nanoparticle behavior in vivo. We report on the development of a versatile nano-scaffold based on the modular functionalization of a DNA G-quadruplex. DNA sequences are functionalized in a modular fashion using well-established phosphoramidite chemical synthesis with nucleotides containing modification of the amino (N2) position of the guanine base. In physiological conditions, these sequences fold into well-defined G-quadruplex structures. The resulting DNA nano-scaffolds are thermally stable, consistent in size, and functionalized in a manner that allows for control over the density and relative orientation of functional chemistries on the nano-scaffold surface. Various chemistries including small modifications (N2-methyl-guanine), bulky aromatic modifications (N2-benzyl-guanine), and long chain-like modifications (N2-6-amino-hexyl-guanine) are tested and are found to be generally compatible with G-quadruplex formation. Furthermore, these modifications stabilize the G-quadruplex scaffold by 2.0-13.3 °C per modification in the melting temperature, with concurrent modifications producing extremely stable nano-scaffolds. We demonstrate the potential of this approach by functionalizing nano-scaffolds for use within the biotin-avidin conjugation approach. © The Author(s) 2017. Published by Oxford University Press on behalf of Nucleic Acids Research.

  12. Co-transcriptional formation of DNA:RNA hybrid G-quadruplex and potential function as constitutional cis element for transcription control.

    Science.gov (United States)

    Zheng, Ke-wei; Xiao, Shan; Liu, Jia-quan; Zhang, Jia-yu; Hao, Yu-hua; Tan, Zheng

    2013-05-01

    G-quadruplex formation in genomic DNA is considered to regulate transcription. Previous investigations almost exclusively focused on intramolecular G-quadruplexes formed by DNA carrying four or more G-tracts, and structure formation has rarely been studied in physiologically relevant processes. Here, we report an almost entirely neglected, but actually much more prevalent form of G-quadruplexes, DNA:RNA hybrid G-quadruplexes (HQ) that forms in transcription. HQ formation requires as few as two G-tracts instead of four on a non-template DNA strand. Potential HQ sequences (PHQS) are present in >97% of human genes, with an average of 73 PHQSs per gene. HQ modulates transcription under both in vitro and in vivo conditions. Transcriptomal analysis of human tissues implies that maximal gene expression may be limited by the number of PHQS in genes. These features suggest that HQs may play fundamental roles in transcription regulation and other transcription-mediated processes.

  13. Intramolecular telomeric G-quadruplexes dramatically inhibit DNA synthesis by replicative and translesion polymerases, revealing their potential to lead to genetic change.

    Directory of Open Access Journals (Sweden)

    Deanna N Edwards

    Full Text Available Recent research indicates that hundreds of thousands of G-rich sequences within the human genome have the potential to form secondary structures known as G-quadruplexes. Telomeric regions, consisting of long arrays of TTAGGG/AATCCC repeats, are among the most likely areas in which these structures might form. Since G-quadruplexes assemble from certain G-rich single-stranded sequences, they might arise when duplex DNA is unwound such as during replication. Coincidentally, these bulky structures when present in the DNA template might also hinder the action of DNA polymerases. In this study, single-stranded telomeric templates with the potential to form G-quadruplexes were examined for their effects on a variety of replicative and translesion DNA polymerases from humans and lower organisms. Our results demonstrate that single-stranded templates containing four telomeric GGG runs fold into intramolecular G-quadruplex structures. These intramolecular G quadruplexes are somewhat dynamic in nature and stabilized by increasing KCl concentrations and decreasing temperatures. Furthermore, the presence of these intramolecular G-quadruplexes in the template dramatically inhibits DNA synthesis by various DNA polymerases, including the human polymerase δ employed during lagging strand replication of G-rich telomeric strands and several human translesion DNA polymerases potentially recruited to sites of replication blockage. Notably, misincorporation of nucleotides is observed when certain translesion polymerases are employed on substrates containing intramolecular G-quadruplexes, as is extension of the resulting mismatched base pairs upon dynamic unfolding of this secondary structure. These findings reveal the potential for blockage of DNA replication and genetic changes related to sequences capable of forming intramolecular G-quadruplexes.

  14. Multifunctional energy landscape for a DNA G-quadruplex: An evolved molecular switch

    Czech Academy of Sciences Publication Activity Database

    Cragnolini, T.; Chakraborty, D.; Šponer, Jiří; Derreumaux, P.; Pasquali, S.; Wales, D.J.

    2017-01-01

    Roč. 147, č. 15 (2017), č. článku 152715. ISSN 0021-9606 R&D Projects: GA ČR(CZ) GA16-13721S Institutional support: RVO:68081707 Keywords : telomeric g-quadruplex * gb1 hairpin peptide Subject RIV: CF - Physical ; Theoretical Chemistry OBOR OECD: Physical chemistry Impact factor: 2.965, year: 2016

  15. Multifunctional energy landscape for a DNA G-quadruplex: An evolved molecular switch

    Science.gov (United States)

    Cragnolini, Tristan; Chakraborty, Debayan; Šponer, Jiří; Derreumaux, Philippe; Pasquali, Samuela; Wales, David J.

    2017-10-01

    We explore the energy landscape for a four-fold telomere repeat, obtaining interconversion pathways between six experimentally characterised G-quadruplex topologies. The results reveal a multi-funnel system, with a variety of intermediate configurations and misfolded states. This organisation is identified with the intrinsically multi-functional nature of the system, suggesting a new paradigm for the classification of such biomolecules and clarifying issues regarding apparently conflicting experimental results.

  16. Atomistic picture for the folding pathway of a hybrid-1 type human telomeric DNA G-quadruplex.

    Directory of Open Access Journals (Sweden)

    Yunqiang Bian

    2014-04-01

    Full Text Available In this work we studied the folding process of the hybrid-1 type human telomeric DNA G-quadruplex with solvent and K(+ ions explicitly modeled. Enabled by the powerful bias-exchange metadynamics and large-scale conventional molecular dynamic simulations, the free energy landscape of this G-DNA was obtained for the first time and four folding intermediates were identified, including a triplex and a basically formed quadruplex. The simulations also provided atomistic pictures for the structures and cation binding patterns of the intermediates. The results showed that the structure formation and cation binding are cooperative and mutually supporting each other. The syn/anti reorientation dynamics of the intermediates was also investigated. It was found that the nucleotides usually take correct syn/anti configurations when they form native and stable hydrogen bonds with the others, while fluctuating between two configurations when they do not. Misfolded intermediates with wrong syn/anti configurations were observed in the early intermediates but not in the later ones. Based on the simulations, we also discussed the roles of the non-native interactions. Besides, the formation process of the parallel conformation in the first two G-repeats and the associated reversal loop were studied. Based on the above results, we proposed a folding pathway for the hybrid-1 type G-quadruplex with atomistic details, which is new and more complete compared with previous ones. The knowledge gained for this type of G-DNA may provide a general insight for the folding of the other G-quadruplexes.

  17. G-quadruplex DNA sequences are evolutionarily conserved and associated with distinct genomic features in Saccharomyces cerevisiae.

    Directory of Open Access Journals (Sweden)

    John A Capra

    2010-07-01

    Full Text Available G-quadruplex DNA is a four-stranded DNA structure formed by non-Watson-Crick base pairing between stacked sets of four guanines. Many possible functions have been proposed for this structure, but its in vivo role in the cell is still largely unresolved. We carried out a genome-wide survey of the evolutionary conservation of regions with the potential to form G-quadruplex DNA structures (G4 DNA motifs across seven yeast species. We found that G4 DNA motifs were significantly more conserved than expected by chance, and the nucleotide-level conservation patterns suggested that the motif conservation was the result of the formation of G4 DNA structures. We characterized the association of conserved and non-conserved G4 DNA motifs in Saccharomyces cerevisiae with more than 40 known genome features and gene classes. Our comprehensive, integrated evolutionary and functional analysis confirmed the previously observed associations of G4 DNA motifs with promoter regions and the rDNA, and it identified several previously unrecognized associations of G4 DNA motifs with genomic features, such as mitotic and meiotic double-strand break sites (DSBs. Conserved G4 DNA motifs maintained strong associations with promoters and the rDNA, but not with DSBs. We also performed the first analysis of G4 DNA motifs in the mitochondria, and surprisingly found a tenfold higher concentration of the motifs in the AT-rich yeast mitochondrial DNA than in nuclear DNA. The evolutionary conservation of the G4 DNA motif and its association with specific genome features supports the hypothesis that G4 DNA has in vivo functions that are under evolutionary constraint.

  18. Development of a carbazole-based fluorescence probe for G-quadruplex DNA: The importance of side-group effect on binding specificity

    Science.gov (United States)

    Wang, Ming-Qi; Ren, Gui-Ying; Zhao, Shuang; Lian, Guang-Chang; Chen, Ting-Ting; Ci, Yang; Li, Hong-Yao

    2018-06-01

    G-quadruplex DNAs are highly prevalent in the human genome and involved in many important biological processes. However, many aspects of their biological mechanism and significance still need to be elucidated. Therefore, the development of fluorescent probes for G-quadruplex detection is important for the basic research. We report here on the development of small molecular dyes designed on the basis of carbazole scaffold by introducing styrene-like substituents at its 9-position, for the purpose of G-quadruplex recognition. Results revealed that the side group on the carbazole scaffold was very important for their ability to selectively recognize G-quadruplex DNA structures. 1a with the pyridine side group displayed excellent fluorescence signal turn-on property for the specific discrimination of G-quadruplex DNAs against other nucleic acids. The characteristics of 1a were further investigated with UV-vis spectrophotometry, fluorescence, circular dichroism, FID assay and molecular docking to validate the selectivity, sensitivity and detailed binding mode toward G-quadruplex DNAs.

  19. Toward the design of new DNA G-quadruplex ligands through rational analysis of polymorphism and binding data.

    Science.gov (United States)

    Artese, Anna; Costa, Giosuè; Distinto, Simona; Moraca, Federica; Ortuso, Francesco; Parrotta, Lucia; Alcaro, Stefano

    2013-10-01

    Human telomeres play a key role in protecting chromosomal ends from fusion events; they are composed of d(TTAGGG) repeats, ranging in size from 3 to 15 kb. They form G-quadruplex DNA structures, stabilized by G-quartets in the presence of cations, and are involved in several biological processes. In particular, a telomere maintenance mechanism is provided by a specialized enzyme called telomerase, a reverse transcriptase able to add multiple copies of the 5'-GGTTAG-3' motif to the end of the G-strand of the telomere and which is over-expressed in the majority of cancer cells. The central cation has a crucial role in maintaining the stability of the structure. Based on its nature, it can be associated with different topological telomeric quadruplexes, which depend also on the orientation of the DNA strands and the syn/anti conformation of the guanines. Such a polymorphism, confirmed by the different structures deposited in the Protein Data Bank (PDB), prompted us to apply a computational protocol in order to investigate the conformational properties of a set of known G-quadruplex ligands and their molecular recognition against six different experimental models of the human telomeric sequence d[AG3(T2AG3)3]. The average AutoDock correlation between theoretical and experimental data yielded an r2 value equal to 0.882 among all the studied models. Such a result was always improved with respect to those of the single folds, with the exception of the parallel structure (r2 equal to 0.886), thus suggesting a key role of this G4 conformation in the stacking interaction network. Among the studied binders, a trisubstituted acridine and a dibenzophenanthroline derivative were well recognized by the parallel and the mixed G-quadruplex structures, allowing the identification of specific key contacts with DNA and the further design of more potent or target specific G-quadruplex ligands. Copyright © 2013 Elsevier Masson SAS. All rights reserved.

  20. G-Quadruplexes Involving Both Strands of Genomic DNA Are Highly Abundant and Colocalize with Functional Sites in the Human Genome.

    Directory of Open Access Journals (Sweden)

    Andrzej S Kudlicki

    Full Text Available The G-quadruplex is a non-canonical DNA structure biologically significant in DNA replication, transcription and telomere stability. To date, only G4s with all guanines originating from the same strand of DNA have been considered in the context of the human nuclear genome. Here, I discuss interstrand topological configurations of G-quadruplex DNA, consisting of guanines from both strands of genomic DNA; an algorithm is presented for predicting such structures. I have identified over 550,000 non-overlapping interstrand G-quadruplex forming sequences in the human genome--significantly more than intrastrand configurations. Functional analysis of interstrand G-quadruplex sites shows strong association with transcription initiation, the results are consistent with the XPB and XPD transcriptional helicases binding only to G-quadruplex DNA with interstrand topology. Interstrand quadruplexes are also enriched in origin of replication sites. Several topology classes of interstrand quadruplex-forming sequences are possible, and different topologies are enriched in different types of structural elements. The list of interstrand quadruplex forming sequences, and the computer program used for their prediction are available at the web address http://moment.utmb.edu/allquads.

  1. Spectroscopic studies on the interactions of 5-ethyl-6-phenyl-3,8-bis((3-aminoalkyl)propanamido)phenanthridin-5-ium derivatives with G-quadruplex DNA

    Science.gov (United States)

    Yalçın, Ergin; Duyar, Halil; Ihmels, Heiko; Seferoğlu, Zeynel

    2018-05-01

    An improved microwave-induced synthesis of five ethidium derivatives (Ethidium derivatives, 2a-d) is presented. As the derivatives 2a-d have been proposed previously to be telomerase inhibitors, the binding interactions of these ethidium derivatives with G-quadruplex DNA were evaluated by means of photometric and fluorimetric titration, thermal DNA denaturation, CD and 1H NMR spectroscopy. In particular, the compound bearing 3,8-bis(pyrrolidin-1-yl)propanamido substituent 2a exhibits high selectivity for G-quadruplex DNA relative to duplex DNA.

  2. DNA sensors and aptasensors based on the hemin/G-quadruplex-controlled aggregation of Au NPs in the presence of L-cysteine.

    Science.gov (United States)

    Niazov-Elkan, Angelica; Golub, Eyal; Sharon, Etery; Balogh, Dora; Willner, Itamar

    2014-07-23

    L-cysteine induces the aggregation of Au nanoparticles (NPs), resulting in a color transition from red to blue due to interparticle plasmonic coupling in the aggregated structure. The hemin/G-quadruplex horseradish peroxidase-mimicking DNAzyme catalyzes the aerobic oxidation of L-cysteine to cystine, a process that inhibits the aggregation of the NPs. The degree of inhibition of the aggregation process is controlled by the concentration of the DNAzyme in the system. These functions are implemented to develop sensing platforms for the detection of a target DNA, for the analysis of aptamer-substrate complexes, and for the analysis of L-cysteine in human urine samples. A hairpin DNA structure that includes a recognition site for the DNA analyte and a caged G-quadruplex sequence, is opened in the presence of the target DNA. The resulting self-assembled hemin/G-quadruplex acts as catalyst that controls the aggregation of the Au NPs. Also, the thrombin-binding aptamer folds into a G-quadruplex nanostructure upon binding to thrombin. The association of hemin to the resulting G-quadruplex aptamer-thrombin complex leads to a catalytic label that controls the L-cysteine-mediated aggregation of the Au NPs. The hemin/G-qaudruplex-controlled aggregation of Au NPs process is further implemented for visual and spectroscopic detection of L-cysteine concentration in urine samples. © 2014 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  3. Fluorescence detection of DNA, adenosine-5'-triphosphate (ATP), and telomerase activity by zinc(II)-protoporphyrin IX/G-quadruplex labels.

    Science.gov (United States)

    Zhang, Zhanxia; Sharon, Etery; Freeman, Ronit; Liu, Xiaoqing; Willner, Itamar

    2012-06-05

    The zinc(II)-protoporphyrin IX (ZnPPIX) fluorophore binds to G-quadruplexes, and this results in the enhanced fluorescence of the fluorophore. This property enabled the development of DNA sensors, aptasensors, and a sensor following telomerase activity. The DNA sensor is based on the design of a hairpin structure that includes a "caged" inactive G-quadruplex sequence. Upon opening the hairpin by the analyte DNA, the resulting fluorescence of the ZnPPIX/G-quadruplex provides the readout signal for the sensing event (detection limit 5 nM). Addition of Exonuclease III to the system allows the recycling of the analyte and its amplified analysis (detection limit, 200 pM). The association of the ZnPPIX to G-quadruplex aptamer-substrate complexes allowed the detection of adenosine-5'-triphosphate (ATP, detection limit 10 μM). Finally, the association of ZnPPIX to the G-quadruplex repeat units of telomers allowed the detection of telomerase activity originating from 380 ± 20 cancer 293T cell extract.

  4. A colorimetric platform for sensitively differentiating telomere DNA with different lengths, monitoring G-quadruplex and dsDNA based on silver nanoclusters and unmodified gold nanoparticles

    Science.gov (United States)

    Qu, Fei; Chen, Zeqiu; You, Jinmao; Song, Cuihua

    2018-05-01

    Human telomere DNA plays a vital role in genome integrity control and carcinogenesis as an indication for extensive cell proliferation. Herein, silver nanoclusters (Ag NCs) templated by polymer and unmodified gold nanoparticles (Au NPs) are designed as a new colorimetric platform for sensitively differentiating telomere DNA with different lengths, monitoring G-quadruplex and dsDNA. Ag NCs can produce the aggregation of Au NPs, so the color of Au NPs changes to blue and the absorption peak moves to 700 nm. While the telomere DNA can protect Au NPs from aggregation, the color turns to red again and the absorption band blue shift. Benefiting from the obvious color change, we can differentiate the length of telomere DNA by naked eyes. As the length of telomere DNA is longer, the variation of color becomes more noticeable. The detection limits of telomere DNA containing 10, 22, 40, 64 bases are estimated to be 1.41, 1.21, 0.23 and 0.22 nM, respectively. On the other hand, when telomere DNA forms G-quadruplex in the presence of K+, or dsDNA with complementary sequence, both G-quadruplex and dsDNA can protect Au NPs better than the unfolded telomere DNA. Hence, a new colorimetric platform for monitoring structure conversion of DNA is established by Ag NCs-Au NPs system, and to prove this type of application, a selective K+ sensor is developed.

  5. Identification of New Natural DNA G-Quadruplex Binders Selected by a Structure-Based Virtual Screening Approach

    Directory of Open Access Journals (Sweden)

    Stefano Alcaro

    2013-09-01

    Full Text Available The G-quadruplex DNA structures are mainly present at the terminal portion of telomeres and can be stabilized by ligands able to recognize them in a specific manner. The recognition process is usually related to the inhibition of the enzyme telomerase indirectly involved and over-expressed in a high percentage of human tumors. There are several ligands, characterized by different chemical structures, already reported in the literature for their ability to bind and stabilize the G-quadruplex structures. Using the structural and biological information available on these structures; we performed a high throughput in silico screening of commercially natural compounds databases by means of a structure-based approach followed by docking experiments against the human telomeric sequence d[AG3(T2AG33]. We identified 12 best hits characterized by different chemical scaffolds and conformational and physicochemical properties. All of them were associated to an improved theoretical binding affinity with respect to that of known selective G-binders. Among these hits there is a chalcone derivative; structurally very similar to the polyphenol butein; known to remarkably inhibit the telomerase activity.

  6. Sites of instability in the human TCF3 (E2A) gene adopt G-quadruplex DNA structures in vitro

    Science.gov (United States)

    Williams, Jonathan D.; Fleetwood, Sara; Berroyer, Alexandra; Kim, Nayun; Larson, Erik D.

    2015-01-01

    The formation of highly stable four-stranded DNA, called G-quadruplex (G4), promotes site-specific genome instability. G4 DNA structures fold from repetitive guanine sequences, and increasing experimental evidence connects G4 sequence motifs with specific gene rearrangements. The human transcription factor 3 (TCF3) gene (also termed E2A) is subject to genetic instability associated with severe disease, most notably a common translocation event t(1;19) associated with acute lymphoblastic leukemia. The sites of instability in TCF3 are not randomly distributed, but focused to certain sequences. We asked if G4 DNA formation could explain why TCF3 is prone to recombination and mutagenesis. Here we demonstrate that sequences surrounding the major t(1;19) break site and a region associated with copy number variations both contain G4 sequence motifs. The motifs identified readily adopt G4 DNA structures that are stable enough to interfere with DNA synthesis in physiological salt conditions in vitro. When introduced into the yeast genome, TCF3 G4 motifs promoted gross chromosomal rearrangements in a transcription-dependent manner. Our results provide a molecular rationale for the site-specific instability of human TCF3, suggesting that G4 DNA structures contribute to oncogenic DNA breaks and recombination. PMID:26029241

  7. Label-free detection of kanamycin based on a G-quadruplex DNA aptamer-based fluorescent intercalator displacement assay

    Science.gov (United States)

    Xing, Yun-Peng; Liu, Chun; Zhou, Xiao-Hong; Shi, Han-Chang

    2015-01-01

    This work was the first to report that the kanamycin-binding DNA aptamer (5'-TGG GGG TTG AGG CTA AGC CGA-3') can form stable parallel G-quadruplex DNA (G4-DNA) structures by themselves and that this phenomenon can be verified by nondenaturing polyacrylamide gel electrophoresis and circular dichroism spectroscopy. Based on these findings, we developed a novel label-free strategy for kanamycin detection based on the G4-DNA aptamer-based fluorescent intercalator displacement assay with thiazole orange (TO) as the fluorescence probe. In the proposed strategy, TO became strongly fluorescent upon binding to kanamycin-binding G4-DNA. However, the addition of kanamycin caused the displacement of TO from the G4-DNA-TO conjugate, thereby resulting in decreased fluorescent signal, which was inversely related to the kanamycin concentration. The detection limit of the proposed assay decreased to 59 nM with a linear working range of 0.1 μM to 20 μM for kanamycin. The cross-reactivity against six other antibiotics was negligible compared with the response to kanamycin. A satisfactory recovery of kanamycin in milk samples ranged from 80.1% to 98.0%, confirming the potential of this bioassay in the measurement of kanamycin in various applications. Our results also served as a good reference for developing similar fluorescent G4-DNA-based bioassays in the future.

  8. Toehold strand displacement-driven assembly of G-quadruplex DNA for enzyme-free and non-label sensitive fluorescent detection of thrombin.

    Science.gov (United States)

    Xu, Yunying; Zhou, Wenjiao; Zhou, Ming; Xiang, Yun; Yuan, Ruo; Chai, Yaqin

    2015-02-15

    Based on a new signal amplification strategy by the toehold strand displacement-driven cyclic assembly of G-quadruplex DNA, the development of an enzyme-free and non-label aptamer sensing approach for sensitive fluorescent detection of thrombin is described. The target thrombin associates with the corresponding aptamer of the partial dsDNA probes and liberates single stranded initiation sequences, which trigger the toehold strand displacement assembly of two G-quadruplex containing hairpin DNAs. This toehold strand displacement reaction leads to the cyclic reuse of the initiation sequences and the production of DNA assemblies with numerous G-quadruplex structures. The fluorescent dye, N-Methyl mesoporphyrin IX, binds to these G-quadruplex structures and generates significantly amplified fluorescent signals to achieve highly sensitive detection of thrombin down to 5 pM. Besides, this method shows high selectivity towards the target thrombin against other control proteins. The developed thrombin sensing method herein avoids the modification of the probes and the involvement of any enzyme or nanomaterial labels for signal amplification. With the successful demonstration for thrombin detection, our approach can be easily adopted to monitor other target molecules in a simple, low-cost, sensitive and selective way by choosing appropriate aptamer/ligand pairs. Copyright © 2014 Elsevier B.V. All rights reserved.

  9. Cation Coordination Alters the Conformation of a Thrombin-Binding G-Quadruplex DNA Aptamer That Affects Inhibition of Thrombin.

    Science.gov (United States)

    Zavyalova, Elena; Tagiltsev, Grigory; Reshetnikov, Roman; Arutyunyan, Alexander; Kopylov, Alexey

    2016-10-01

    Thrombin-binding aptamers are promising anticoagulants. HD1 is a monomolecular antiparallel G-quadruplex with two G-quartets linked by three loops. Aptamer-thrombin interactions are mediated with two TT-loops that bind thrombin exosite I. Several cations were shown to be coordinated inside the G-quadruplex, including K + , Na + , NH 4 + , Ba 2+ , and Sr 2+ ; on the contrary, Mn 2+ was coordinated in the grooves, outside the G-quadruplex. K + or Na + coordination provides aptamer functional activity. The effect of other cations on aptamer functional activity has not yet been described, because of a lack of relevant tests. Interactions between aptamer HD1 and a series of cations were studied. A previously developed enzymatic method was applied to evaluate aptamer inhibitory activity. The structure-function correlation was studied using the characterization of G-quadruplex conformation by circular dichroism spectroscopy. K + coordination provided the well-known high inhibitory activity of the aptamer, whereas Na + coordination supported low activity. Although NH 4 + coordination yielded a typical antiparallel G-quadruplex, no inhibitory activity was shown; a similar effect was observed for Ba 2+ and Sr 2+ coordination. Mn 2+ coordination destabilized the G-quadruplex that drastically diminished aptamer inhibitory activity. Therefore, G-quadruplex existence per se is insufficient for aptamer inhibitory activity. To elicit the nature of these effects, we thoroughly analyzed nuclear magnetic resonance (NMR) and X-ray data on the structure of the HD1 G-quadruplex with various cations. The most reasonable explanation is that cation coordination changes the conformation of TT-loops, affecting thrombin binding and inhibition. HD1 counterparts, aptamers 31-TBA and NU172, behaved similarly with some distinctions. In 31-TBA, an additional duplex module stabilized antiparallel G-quadruplex conformation at high concentrations of divalent cations; whereas in NU172, a different

  10. Higher-order human telomeric G-quadruplex DNA metalloenzymes enhance enantioselectivity in the Diels-Alder reaction.

    Science.gov (United States)

    Li, Yinghao; Jia, Guoqing; Wang, Changhao; Cheng, Mingpan; Li, Can

    2015-03-02

    Short human telomeric (HT) DNA sequences form single G-quadruplex (G4 ) units and exhibit structure-based stereocontrol for a series of reactions. However, for more biologically relevant higher-order HT G4 -DNAs (beyond a single G4 unit), the catalytic performances are unknown. Here, we found that higher-order HT G4 -DNA copper metalloenzymes (two or three G4 units) afford remarkably higher enantioselectivity (>90 % ee) and a five- to sixfold rate increase, compared to a single G4 unit, for the Diels-Alder reaction. Electron paramagnetic resonance (EPR) and enzymatic kinetic studies revealed that the distinct catalytic function between single and higher-order G4 -DNA copper metalloenzymes can be attributed to different Cu(II) coordination environments and substrate specificity. Our finding suggests that, like protein enzymes and ribozymes, higher-order structural organization is crucial for G4 -DNA-based catalysis. © 2015 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  11. G-quadruplexes as novel cis-elements controlling transcription during embryonic development.

    Science.gov (United States)

    David, Aldana P; Margarit, Ezequiel; Domizi, Pablo; Banchio, Claudia; Armas, Pablo; Calcaterra, Nora B

    2016-05-19

    G-quadruplexes are dynamic structures folded in G-rich single-stranded DNA regions. These structures have been recognized as a potential nucleic acid based mechanism for regulating multiple cellular processes such as replication, transcription and genomic maintenance. So far, their transcriptional role in vivo during vertebrate embryonic development has not yet been addressed. Here, we performed an in silico search to find conserved putative G-quadruplex sequences (PQSs) within proximal promoter regions of human, mouse and zebrafish developmental genes. Among the PQSs able to fold in vitro as G-quadruplex, those present in nog3, col2a1 and fzd5 promoters were selected for further studies. In cellulo studies revealed that the selected G-quadruplexes affected the transcription of luciferase controlled by the SV40 nonrelated promoter. G-quadruplex disruption in vivo by microinjection in zebrafish embryos of either small ligands or DNA oligonucleotides complementary to the selected PQSs resulted in lower transcription of the targeted genes. Moreover, zebrafish embryos and larvae phenotypes caused by the presence of complementary oligonucleotides fully resembled those ones reported for nog3, col2a1 and fzd5 morphants. To our knowledge, this is the first work revealing in vivo the role of conserved G-quadruplexes in the embryonic development, one of the most regulated processes of the vertebrates biology. © The Author(s) 2016. Published by Oxford University Press on behalf of Nucleic Acids Research.

  12. Seven essential questions on G-quadruplexes.

    Science.gov (United States)

    König, Sebastian L B; Evans, Amanda C; Huppert, Julian L

    2010-08-01

    The helical duplex architecture of DNA was discovered by Francis Crick and James Watson in 1951 and is well known and understood. However, nucleic acids can also adopt alternative structural conformations that are less familiar, although no less biologically relevant, such as the G-quadruplex. G-quadruplexes continue to be the subject of a rapidly expanding area of research, owing to their significant potential as therapeutic targets and their unique biophysical properties. This review begins by focusing on G-quadruplex structure, elucidating the intermolecular and intramolecular interactions underlying its formation and highlighting several substructural variants. A variety of methods used to characterize these structures are also outlined. The current state of G-quadruplex research is then addressed by proffering seven pertinent questions for discussion. This review concludes with an overview of possible directions for future research trajectories in this exciting and relevant field.

  13. Human telomere sequence DNA in water-free and high-viscosity solvents: G-quadruplex folding governed by Kramers rate theory.

    Science.gov (United States)

    Lannan, Ford M; Mamajanov, Irena; Hud, Nicholas V

    2012-09-19

    Structures formed by human telomere sequence (HTS) DNA are of interest due to the implication of telomeres in the aging process and cancer. We present studies of HTS DNA folding in an anhydrous, high viscosity deep eutectic solvent (DES) comprised of choline choride and urea. In this solvent, the HTS DNA forms a G-quadruplex with the parallel-stranded ("propeller") fold, consistent with observations that reduced water activity favors the parallel fold, whereas alternative folds are favored at high water activity. Surprisingly, adoption of the parallel structure by HTS DNA in the DES, after thermal denaturation and quick cooling to room temperature, requires several months, as opposed to less than 2 min in an aqueous solution. This extended folding time in the DES is, in part, due to HTS DNA becoming kinetically trapped in a folded state that is apparently not accessed in lower viscosity solvents. A comparison of times required for the G-quadruplex to convert from its aqueous-preferred folded state to its parallel fold also reveals a dependence on solvent viscosity that is consistent with Kramers rate theory, which predicts that diffusion-controlled transitions will slow proportionally with solvent friction. These results provide an enhanced view of a G-quadruplex folding funnel and highlight the necessity to consider solvent viscosity in studies of G-quadruplex formation in vitro and in vivo. Additionally, the solvents and analyses presented here should prove valuable for understanding the folding of many other nucleic acids and potentially have applications in DNA-based nanotechnology where time-dependent structures are desired.

  14. Utilization of circular dichroism and electrospray ionization mass spectrometry to understand the formation and conversion of G-quadruplex DNA at the human c-myb proto-oncogene.

    Science.gov (United States)

    Fu, Hengqing; Yang, Pengfei; Hai, Jinhui; Li, Huihui

    2018-10-05

    G-quadruplex DNAs are involved in a number of key biological processes, including gene expression, transcription, and apoptosis. The c-myb oncogene contains a number of GGA repeats in its promoter which forms G-quadruplex, thus it could be used as a target in cancer therapeutics. Several in-vitro studies have used Circular Dichroism (CD) spectroscopy or electrospray ionization mass spectrometry (ESI-MS) to demonstrate formation and stability of G-quadruplex DNA structure in the promoter region of human c-myb oncogene. The factors affecting the c-myb G-quadruplex structures were investigated, such as cations (i.e. K + , NH 4 + and Na + ) and co-solutes (methanol and polyethylene glycol). The results indicated that the presence of cations and co-solutes could change the G-quadruplex structural population and promote its thermodynamic stabilization as indicated by CD melting curves. It indicated that the co-solutes preferentially stabilize the c-myb G-quadruplex structure containing both homo- and hetero-stacking. In addition, protopine was demonstrated as a binder of c-myb G-quadruplex as screened from a library of natural alkaloids using ESI-MS method. CD spectra showed that it could selectively stabilize the c-myb G-quadruplex structure compared to other six G-quadruplexes from tumor-related G-rich sequences and the duplex DNAs (both long and short-chain ones). The binding of protopine could induce the change in the G-quadruplex structural populations. Therefore, protopine with its high binding specificity could be considered as a precursor for the design of drugs to target and regulate c-myb oncogene transcription. Copyright © 2018 Elsevier B.V. All rights reserved.

  15. Long-range charge transport in single G-quadruplex DNA molecules

    DEFF Research Database (Denmark)

    Livshits, Gideon I.; Stern, Avigail; Rotem, Dvir

    2014-01-01

    DNA and DNA-based polymers are of interest in molecular electronics because of their versatile and programmable structures. However, transport measurements have produced a range of seemingly contradictory results due to differences in the measured molecules and experimental set-ups, and transport......DNA and DNA-based polymers are of interest in molecular electronics because of their versatile and programmable structures. However, transport measurements have produced a range of seemingly contradictory results due to differences in the measured molecules and experimental set......-ups, and transporting significant current through individual DNA-based molecules remains a considerable challenge. Here, we report reproducible charge transport in guanine-quadruplex (G4) DNA molecules adsorbed on a mica substrate. Currents ranging from tens of picoamperes to more than 100 pA were measured in the G4......-DNA over distances ranging from tens of nanometres to more than 100 nm. Our experimental results, combined with theoretical modelling, suggest that transport occurs via a thermally activated long-range hopping between multi-tetrad segments of DNA. These results could re-ignite interest in DNA...

  16. Determinants for Tight and Selective Binding of a Medicinal Dicarbene Gold(I) Complex to a Telomeric DNA G-Quadruplex: a Joint ESI MS and XRD Investigation.

    Science.gov (United States)

    Bazzicalupi, Carla; Ferraroni, Marta; Papi, Francesco; Massai, Lara; Bertrand, Benoît; Messori, Luigi; Gratteri, Paola; Casini, Angela

    2016-03-18

    The dicarbene gold(I) complex [Au(9-methylcaffein-8-ylidene)2 ]BF4 is an exceptional organometallic compound of profound interest as a prospective anticancer agent. This gold(I) complex was previously reported to be highly cytotoxic toward various cancer cell lines in vitro and behaves as a selective G-quadruplex stabilizer. Interactions of the gold complex with various telomeric DNA models have been analyzed by a combined ESI MS and X-ray diffraction (XRD) approach. ESI MS measurements confirmed formation of stable adducts between the intact gold(I) complex and Tel 23 DNA sequence. The crystal structure of the adduct formed between [Au(9-methylcaffein-8-ylidene)2 ](+) and Tel 23 DNA G-quadruplex was solved. Tel 23 maintains a characteristic propeller conformation while binding three gold(I) dicarbene moieties at two distinct sites. Stacking interactions appear to drive noncovalent binding of the gold(I) complex. The structural basis for tight gold(I) complex/G-quadruplex recognition and its selectivity are described. © 2016 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  17. DNA adducts of antitumor cisplatin preclude telomeric sequences from forming G quadruplexes

    Czech Academy of Sciences Publication Activity Database

    Heringová, Pavla; Kašpárková, Jana; Brabec, Viktor

    2009-01-01

    Roč. 14, č. 6 (2009), s. 959-968 ISSN 0949-8257 R&D Projects: GA MZd(CZ) NR8562; GA MŠk(CZ) LC06030; GA MŠk(CZ) ME08017; GA MŠk(CZ) OC08003; GA AV ČR(CZ) 1QS500040581; GA AV ČR(CZ) KAN200200651; GA AV ČR(CZ) IAA400040803 Grant - others:GA MŠk(CZ) OC09018 Institutional research plan: CEZ:AV0Z50040507; CEZ:AV0Z50040702 Keywords : cisplatin * DNA quadruplex * telomere Subject RIV: BO - Biophysics Impact factor: 3.415, year: 2009

  18. Allelic Dropout During Polymerase Chain Reaction due to G-Quadruplex Structures and DNA Methylation Is Widespread at Imprinted Human Loci

    Directory of Open Access Journals (Sweden)

    Aaron J. Stevens

    2017-03-01

    Full Text Available Loss of one allele during polymerase chain reaction (PCR amplification of DNA, known as allelic dropout, can be caused by a variety of mechanisms. Allelic dropout during PCR may have profound implications for molecular diagnostic and research procedures that depend on PCR and assume biallelic amplification has occurred. Complete allelic dropout due to the combined effects of cytosine methylation and G-quadruplex formation was previously described for a differentially methylated region of the human imprinted gene, MEST. We now demonstrate that this parent-of-origin specific allelic dropout can potentially occur at several other genomic regions that display genomic imprinting and have propensity for G-quadruplex formation, including AIM1, BLCAP, DNMT1, PLAGL1, KCNQ1, and GRB10. These findings demonstrate that systematic allelic dropout during PCR is a general phenomenon for regions of the genome where differential allelic methylation and G-quadruplex motifs coincide, and suggest that great care must be taken to ensure biallelic amplification is occurring in such situations.

  19. Allelic Dropout During Polymerase Chain Reaction due to G-Quadruplex Structures and DNA Methylation Is Widespread at Imprinted Human Loci.

    Science.gov (United States)

    Stevens, Aaron J; Taylor, Millie G; Pearce, Frederick Grant; Kennedy, Martin A

    2017-03-10

    Loss of one allele during polymerase chain reaction (PCR) amplification of DNA, known as allelic dropout, can be caused by a variety of mechanisms. Allelic dropout during PCR may have profound implications for molecular diagnostic and research procedures that depend on PCR and assume biallelic amplification has occurred. Complete allelic dropout due to the combined effects of cytosine methylation and G-quadruplex formation was previously described for a differentially methylated region of the human imprinted gene, MEST We now demonstrate that this parent-of-origin specific allelic dropout can potentially occur at several other genomic regions that display genomic imprinting and have propensity for G-quadruplex formation, including AIM1 , BLCAP , DNMT1 , PLAGL1 , KCNQ1 , and GRB10 These findings demonstrate that systematic allelic dropout during PCR is a general phenomenon for regions of the genome where differential allelic methylation and G-quadruplex motifs coincide, and suggest that great care must be taken to ensure biallelic amplification is occurring in such situations. Copyright © 2017 Stevens et al.

  20. Electrochemical and AFM Characterization of G-Quadruplex Electrochemical Biosensors and Applications

    Science.gov (United States)

    2018-01-01

    Guanine-rich DNA sequences are able to form G-quadruplexes, being involved in important biological processes and representing smart self-assembling nanomaterials that are increasingly used in DNA nanotechnology and biosensor technology. G-quadruplex electrochemical biosensors have received particular attention, since the electrochemical response is particularly sensitive to the DNA structural changes from single-stranded, double-stranded, or hairpin into a G-quadruplex configuration. Furthermore, the development of an increased number of G-quadruplex aptamers that combine the G-quadruplex stiffness and self-assembling versatility with the aptamer high specificity of binding to a variety of molecular targets allowed the construction of biosensors with increased selectivity and sensitivity. This review discusses the recent advances on the electrochemical characterization, design, and applications of G-quadruplex electrochemical biosensors in the evaluation of metal ions, G-quadruplex ligands, and other small organic molecules, proteins, and cells. The electrochemical and atomic force microscopy characterization of G-quadruplexes is presented. The incubation time and cations concentration dependence in controlling the G-quadruplex folding, stability, and nanostructures formation at carbon electrodes are discussed. Different G-quadruplex electrochemical biosensors design strategies, based on the DNA folding into a G-quadruplex, the use of G-quadruplex aptamers, or the use of hemin/G-quadruplex DNAzymes, are revisited. PMID:29666699

  1. Quantification of Chemical and Mechanical Effects on the Formation of the G-Quadruplex and i-Motif in Duplex DNA.

    Science.gov (United States)

    Selvam, Sangeetha; Mandal, Shankar; Mao, Hanbin

    2017-09-05

    The formation of biologically significant tetraplex DNA species, such as G-quadruplexes and i-motifs, is affected by chemical (ions and pH) and mechanical [superhelicity (σ) and molecular crowding] factors. Because of the extremely challenging experimental conditions, the relative importance of these factors on tetraplex folding is unknown. In this work, we quantitatively evaluated the chemical and mechanical effects on the population dynamics of DNA tetraplexes in the insulin-linked polymorphic region using magneto-optical tweezers. By mechanically unfolding individual tetraplexes, we found that ions and pH have the largest effects on the formation of the G-quadruplex and i-motif, respectively. Interestingly, superhelicity has the second largest effect followed by molecular crowding conditions. While chemical effects are specific to tetraplex species, mechanical factors have generic influences. The predominant effect of chemical factors can be attributed to the fact that they directly change the stability of a specific tetraplex, whereas the mechanical factors, superhelicity in particular, reduce the stability of the competing species by changing the kinetics of the melting and annealing of the duplex DNA template in a nonspecific manner. The substantial dependence of tetraplexes on superhelicity provides strong support that DNA tetraplexes can serve as topological sensors to modulate fundamental cellular processes such as transcription.

  2. G-quadruplex and G-rich sequence stimulate Pif1p-catalyzed downstream duplex DNA unwinding through reducing waiting time at ss/dsDNA junction

    Science.gov (United States)

    Zhang, Bo; Wu, Wen-Qiang; Liu, Na-Nv; Duan, Xiao-Lei; Li, Ming; Dou, Shuo-Xing; Hou, Xi-Miao; Xi, Xu-Guang

    2016-01-01

    Alternative DNA structures that deviate from B-form double-stranded DNA such as G-quadruplex (G4) DNA can be formed by G-rich sequences that are widely distributed throughout the human genome. We have previously shown that Pif1p not only unfolds G4, but also unwinds the downstream duplex DNA in a G4-stimulated manner. In the present study, we further characterized the G4-stimulated duplex DNA unwinding phenomenon by means of single-molecule fluorescence resonance energy transfer. It was found that Pif1p did not unwind the partial duplex DNA immediately after unfolding the upstream G4 structure, but rather, it would dwell at the ss/dsDNA junction with a ‘waiting time’. Further studies revealed that the waiting time was in fact related to a protein dimerization process that was sensitive to ssDNA sequence and would become rapid if the sequence is G-rich. Furthermore, we identified that the G-rich sequence, as the G4 structure, equally stimulates duplex DNA unwinding. The present work sheds new light on the molecular mechanism by which G4-unwinding helicase Pif1p resolves physiological G4/duplex DNA structures in cells. PMID:27471032

  3. Nonlinear optical and G-Quadruplex DNA stabilization properties of novel mixed ligand copper(II) complexes and coordination polymers: Synthesis, structural characterization and computational studies

    Science.gov (United States)

    Rajasekhar, Bathula; Bodavarapu, Navya; Sridevi, M.; Thamizhselvi, G.; RizhaNazar, K.; Padmanaban, R.; Swu, Toka

    2018-03-01

    The present study reports the synthesis and evaluation of nonlinear optical property and G-Quadruplex DNA Stabilization of five novel copper(II) mixed ligand complexes. They were synthesized from copper(II) salt, 2,5- and 2,3- pyridinedicarboxylic acid, diethylenetriamine and amide based ligand (AL). The crystal structure of these complexes were determined through X-ray diffraction and supported by ESI-MAS, NMR, UV-Vis and FT-IR spectroscopic methods. Their nonlinear optical property was studied using Gaussian09 computer program. For structural optimization and nonlinear optical property, density functional theory (DFT) based B3LYP method was used with LANL2DZ basis set for metal ion and 6-31G∗ for C,H,N,O and Cl atoms. The present work reveals that pre-polarized Complex-2 showed higher β value (29.59 × 10-30e.s.u) as compared to that of neutral complex-1 (β = 0.276 × 10-30e.s.u.) which may be due to greater advantage of polarizability. Complex-2 is expected to be a potential material for optoelectronic and photonic technologies. Docking studies using AutodockVina revealed that complex-2 has higher binding energy for both G-Quadruplex DNA (-8.7 kcal/mol) and duplex DNA (-10.1 kcal/mol). It was also observed that structure plays an important role in binding efficiency.

  4. Enantioselective light switch effect of Δ- and Λ-[Ru(phenanthroline)2 dipyrido[3,2-a:2', 3'-c]phenazine]2+ bound to G-quadruplex DNA.

    Science.gov (United States)

    Park, Jin Ha; Lee, Hyun Suk; Jang, Myung Duk; Han, Sung Wook; Kim, Seog K; Lee, Young-Ae

    2018-06-01

    The interaction of Δ- and Λ-[Ru(phen) 2 DPPZ] 2+ (DPPZ = dipyrido[3,2-a:2', 3'-c]phenazine, phen = phenanthroline) with a G-quadruplex formed from 5'-G 2 T 2 G 2 TGTG 2 T 2 G 2-3 '(15-mer) was investigated. The well-known enhancement of luminescence intensity (the 'light-switch' effect) was observed for the [Ru(phen) 2 DPPZ] 2+ complexes upon formation of an adduct with the G-quadruplex. The emission intensity of the G-quadruplex-bound Λ-isomer was 3-fold larger than that of the Δ-isomer when bound to the G-quadruplex, which is opposite of the result observed in the case of double stranded DNA (dsDNA); the light switch effect is larger for the dsDNA-bound Δ-isomer. In the job plot of the G-quadruplex with Δ- and Λ-[Ru(phen) 2 DPPZ] 2+ , a major inflection point for the two isomers was observed at x ≈ .65, which suggests a binding stoichiometry of 2:1 for both enantiomers. When the G base at the 8th position was replaced with 6-methyl isoxanthopterin (6MI), a fluorescent guanine analog, the excited energy of 6-MI transferred to bound Δ- or Λ-[Ru(phen) 2 DPPZ] 2+ , which suggests that at least a part of both Ru(II) enantiomers is close to or in contact with the diagonal loop of the G-quadruplex. A luminescence quenching experiment using [Fe(CN) 6 ] 4- for the G-quadruplex-bound Ru(II) complex revealed downward bending curves for both enantiomers in the Stern-Volmer plot, which suggests the presence of Ru(II) complexes that are both accessible and inaccessible to the quencher and may be related to the 2:1 binding stoichiometry.

  5. Xanthene and Xanthone Derivatives as G-Quadruplex Stabilizing Ligands

    Directory of Open Access Journals (Sweden)

    Alessandro Altieri

    2013-10-01

    Full Text Available Following previous studies on anthraquinone and acridine-based G-quadruplex ligands, here we present a study of similar aromatic cores, with the specific aim of increasing G-quadruplex binding and selectivity with respect to duplex DNA. Synthesized compounds include two and three-side chain xanthone and xanthene derivatives, as well as a dimeric “bridged” form. ESI and FRET measurements suggest that all the studied molecules are good G-quadruplex ligands, both at telomeres and on G-quadruplex forming sequences of oncogene promoters. The dimeric compound and the three-side chain xanthone derivative have been shown to represent the best compounds emerging from the different series of ligands presented here, having also high selectivity for G-quadruplex structures with respect to duplex DNA. Molecular modeling simulations are in broad agreement with the experimental data.

  6. A light-up probe targeting for Bcl-2 2345 G-quadruplex DNA with carbazole TO

    Science.gov (United States)

    Gu, Yingchun; Lin, Dayong; Tang, Yalin; Fei, Xuening; Wang, Cuihong; Zhang, Baolian; Zhou, Jianguo

    2018-02-01

    As its significant role, the selective recognition of G-quadruplex with specific structures and functions is important in biological and medicinal chemistry. Carbazole derivatives have been reported as a kind of fluorescent probe with many excellent optical properties. In the present study, the fluorescence of the dye (carbazole TO) increased almost 70 fold in the presence of bcl-2 2345 G4 compared to that alone in aqueous buffer condition with almost no fluorescence and 10-30 fold than those in the presence of other DNAs. The binding study results by activity inhibition of G4/Hemin peroxidase experiment, NMR titration and molecular docking simulation showed the high affinity and selectivity to bcl-2 2345 G4 arises from its end-stacking interaction with G-quartet. It is said that a facile approach with excellent sensitive, good selectivity and quick response for bcl-2 2345 G-quadruplex was developed and may be used for antitumor recognition or antitumor agents.

  7. DNA Sequences Proximal to Human Mitochondrial DNA Deletion Breakpoints Prevalent in Human Disease Form G-quadruplexes, a Class of DNA Structures Inefficiently Unwound by the Mitochondrial Replicative Twinkle Helicase*

    Science.gov (United States)

    Bharti, Sanjay Kumar; Sommers, Joshua A.; Zhou, Jun; Kaplan, Daniel L.; Spelbrink, Johannes N.; Mergny, Jean-Louis; Brosh, Robert M.

    2014-01-01

    Mitochondrial DNA deletions are prominent in human genetic disorders, cancer, and aging. It is thought that stalling of the mitochondrial replication machinery during DNA synthesis is a prominent source of mitochondrial genome instability; however, the precise molecular determinants of defective mitochondrial replication are not well understood. In this work, we performed a computational analysis of the human mitochondrial genome using the “Pattern Finder” G-quadruplex (G4) predictor algorithm to assess whether G4-forming sequences reside in close proximity (within 20 base pairs) to known mitochondrial DNA deletion breakpoints. We then used this information to map G4P sequences with deletions characteristic of representative mitochondrial genetic disorders and also those identified in various cancers and aging. Circular dichroism and UV spectral analysis demonstrated that mitochondrial G-rich sequences near deletion breakpoints prevalent in human disease form G-quadruplex DNA structures. A biochemical analysis of purified recombinant human Twinkle protein (gene product of c10orf2) showed that the mitochondrial replicative helicase inefficiently unwinds well characterized intermolecular and intramolecular G-quadruplex DNA substrates, as well as a unimolecular G4 substrate derived from a mitochondrial sequence that nests a deletion breakpoint described in human renal cell carcinoma. Although G4 has been implicated in the initiation of mitochondrial DNA replication, our current findings suggest that mitochondrial G-quadruplexes are also likely to be a source of instability for the mitochondrial genome by perturbing the normal progression of the mitochondrial replication machinery, including DNA unwinding by Twinkle helicase. PMID:25193669

  8. Transcriptional control by G-quadruplexes: In vivo roles and perspectives for specific intervention.

    Science.gov (United States)

    Armas, Pablo; David, Aldana; Calcaterra, Nora B

    2017-01-01

    G-quadruplexes are non-canonical DNA secondary structures involved in several genomic and molecular processes. Here, we summarize the main G-quadruplex features and evidences proving the in vivo role on the transcriptional regulation of genes required for zebrafish embryonic development. We also discuss alternative strategies for specifically interfering G-quadruplex in vivo.

  9. Microwave-Assisted Synthesis of Arene Ru(II Complexes Induce Tumor Cell Apoptosis Through Selectively Binding and Stabilizing bcl-2 G-Quadruplex DNA

    Directory of Open Access Journals (Sweden)

    Yanhua Chen

    2016-05-01

    Full Text Available A series of arene Ru(II complexes coordinated with phenanthroimidazole derivatives, [(η6-C6H6Ru(lCl]Cl(1b L = p-ClPIP = 2-(4-Chlorophenylimidazole[4,5f] 1,10-phenanthroline; 2b L = m-ClPIP = 2-(3-Chlorophenylimidazole[4,5f] 1,10-phenanthroline; 3b L = p-NPIP = 2-(4-Nitrophenylimidazole[4,5f] 1,10-phenanthroline; 4b L = m-NPIP = 2-(3-Nitrophenyl imidazole [4,5f] 1,10-phenanthroline were synthesized in yields of 89.9%–92.7% under conditions of microwave irradiation heating for 30 min to liberate four arene Ru(II complexes (1b, 2b, 3b, 4b. The anti-tumor activity of 1b against various tumor cells was evaluated by MTT assay. The results indicated that this complex blocked the growth of human lung adenocarcinoma A549 cells with an IC50 of 16.59 μM. Flow cytometric analysis showed that apoptosis of A549 cells was observed following treatment with 1b. Furthermore, the in vitro DNA-binding behaviors that were confirmed by spectroscopy indicated that 1b could selectively bind and stabilize bcl-2 G-quadruplex DNA to induce apoptosis of A549 cells. Therefore, the synthesized 1b has impressive bcl-2 G-quadruplex DNA-binding and stabilizing activities with potential applications in cancer chemotherapy.

  10. Efficient Long-Range Hole Transport Through G-Quadruplexes.

    Science.gov (United States)

    Wu, Jingyuan; Meng, Zhenyu; Lu, Yunpeng; Shao, Fangwei

    2017-10-09

    DNA offers a means of long-range charge transport for biology and electric nanodevices. Here, a series of tetra-stranded G-quadruplexes were assembled within a dendritic DNA architecture to explore oxidative charge transport (hole transport) through the G-quadruplex. Efficient charge transport was achieved over 28 Å upon UV irradiation. Over a longer G-quadruplex bridge, hole transport was escalated to a higher efficiency, which resulted in a higher yield than that of the optimal duplex DNA for charge transport, that is, the adenine tract. Efficient long-range hole transport suggests tetra-stranded G-quadruplexes, instead of an oxidation hotspot, hold better potential as an electron conduit than duplex DNA. © 2017 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.

  11. “One Ring to Bind Them All”—Part I: The Efficiency of the Macrocyclic Scaffold for G-Quadruplex DNA Recognition

    Directory of Open Access Journals (Sweden)

    David Monchaud

    2010-01-01

    Full Text Available Macrocyclic scaffolds are particularly attractive for designing selective G-quadruplex ligands essentially because, on one hand, they show a poor affinity for the “standard” B-DNA conformation and, on the other hand, they fit nicely with the external G-quartets of quadruplexes. Stimulated by the pioneering studies on the cationic porphyrin TMPyP4 and the natural product telomestatin, follow-up studies have developed, rapidly leading to a large diversity of macrocyclic structures with remarkable-quadruplex binding properties and biological activities. In this review we summarize the current state of the art in detailing the three main categories of quadruplex-binding macrocycles described so far (telomestatin-like polyheteroarenes, porphyrins and derivatives, polyammonium cyclophanes, and in addressing both synthetic issues and biological aspects.

  12. Aminoglycosylation can enhance the G-quadruplex binding activity of epigallocatechin.

    Directory of Open Access Journals (Sweden)

    Li-Ping Bai

    Full Text Available With the aim of enhancing G-quadruplex binding activity, two new glucosaminosides (16, 18 of penta-methylated epigallocatechin were synthesized by chemical glycosylation. Subsequent ESI-TOF-MS analysis demonstrated that these two glucosaminoside derivatives exhibit much stronger binding activity to human telomeric DNA and RNA G-quadruplexes than their parent structure (i.e., methylated EGC (14 as well as natural epigallocatechin (EGC, 6. The DNA G-quadruplex binding activity of 16 and 18 is even more potent than strong G-quadruplex binder quercetin, which has a more planar structure. These two synthetic compounds also showed a higher binding strength to human telomeric RNA G-quadruplex than its DNA counterpart. Analysis of the structure-activity relationship revealed that the more basic compound, 16, has a higher binding capacity with DNA and RNA G-quadruplexes than its N-acetyl derivative, 18, suggesting the importance of the basicity of the aminoglycoside for G-quadruplex binding activity. Molecular docking simulation predicted that the aromatic ring of 16 π-stacks with the aromatic ring of guanine nucleotides, with the glucosamine moiety residing in the groove of G-quadruplex. This research indicates that glycosylation of natural products with aminosugar can significantly enhance their G-quadruplex binding activities, thus is an effective way to generate small molecules targeting G-quadruplexes in nucleic acids. In addition, this is the first report that green tea catechin can bind to nucleic acid G-quadruplex structures.

  13. Exploring the Interactions of the Dietary Plant Flavonoids Fisetin and Naringenin with G-Quadruplex and Duplex DNA, Showing Contrasting Binding Behavior: Spectroscopic and Molecular Modeling Approaches.

    Science.gov (United States)

    Bhattacharjee, Snehasish; Chakraborty, Sandipan; Sengupta, Pradeep K; Bhowmik, Sudipta

    2016-09-01

    Guanine-rich sequences have the propensity to fold into a four-stranded DNA structure known as a G-quadruplex (G4). G4 forming sequences are abundant in the promoter region of several oncogenes and become a key target for anticancer drug binding. Here we have studied the interactions of two structurally similar dietary plant flavonoids fisetin and naringenin with G4 as well as double stranded (duplex) DNA by using different spectroscopic and modeling techniques. Our study demonstrates the differential binding ability of the two flavonoids with G4 and duplex DNA. Fisetin more strongly interacts with parallel G4 structure than duplex DNA, whereas naringenin shows stronger binding affinity to duplex rather than G4 DNA. Molecular docking results also corroborate our spectroscopic results, and it was found that both of the ligands are stacked externally in the G4 DNA structure. C-ring planarity of the flavonoid structure appears to be a crucial factor for preferential G4 DNA recognition of flavonoids. The goal of this study is to explore the critical effects of small differences in the structure of closely similar chemical classes of such small molecules (flavonoids) which lead to the contrasting binding properties with the two different forms of DNA. The resulting insights may be expected to facilitate the designing of the highly selective G4 DNA binders based on flavonoid scaffolds.

  14. Yeast Sub1 and human PC4 are G-quadruplex binding proteins that suppress genome instability at co-transcriptionally formed G4 DNA.

    Science.gov (United States)

    Lopez, Christopher R; Singh, Shivani; Hambarde, Shashank; Griffin, Wezley C; Gao, Jun; Chib, Shubeena; Yu, Yang; Ira, Grzegorz; Raney, Kevin D; Kim, Nayun

    2017-06-02

    G-quadruplex or G4 DNA is a non-B secondary DNA structure consisting of a stacked array of guanine-quartets that can disrupt critical cellular functions such as replication and transcription. When sequences that can adopt Non-B structures including G4 DNA are located within actively transcribed genes, the reshaping of DNA topology necessary for transcription process stimulates secondary structure-formation thereby amplifying the potential for genome instability. Using a reporter assay designed to study G4-induced recombination in the context of an actively transcribed locus in Saccharomyces cerevisiae, we tested whether co-transcriptional activator Sub1, recently identified as a G4-binding factor, contributes to genome maintenance at G4-forming sequences. Our data indicate that, upon Sub1-disruption, genome instability linked to co-transcriptionally formed G4 DNA in Top1-deficient cells is significantly augmented and that its highly conserved DNA binding domain or the human homolog PC4 is sufficient to suppress G4-associated genome instability. We also show that Sub1 interacts specifically with co-transcriptionally formed G4 DNA in vivo and that yeast cells become highly sensitivity to G4-stabilizing chemical ligands by the loss of Sub1. Finally, we demonstrate the physical and genetic interaction of Sub1 with the G4-resolving helicase Pif1, suggesting a possible mechanism by which Sub1 suppresses instability at G4 DNA. © The Author(s) 2017. Published by Oxford University Press on behalf of Nucleic Acids Research.

  15. Guanine base stacking in G-quadruplex nucleic acids

    Science.gov (United States)

    Lech, Christopher Jacques; Heddi, Brahim; Phan, Anh Tuân

    2013-01-01

    G-quadruplexes constitute a class of nucleic acid structures defined by stacked guanine tetrads (or G-tetrads) with guanine bases from neighboring tetrads stacking with one another within the G-tetrad core. Individual G-quadruplexes can also stack with one another at their G-tetrad interface leading to higher-order structures as observed in telomeric repeat-containing DNA and RNA. In this study, we investigate how guanine base stacking influences the stability of G-quadruplexes and their stacked higher-order structures. A structural survey of the Protein Data Bank is conducted to characterize experimentally observed guanine base stacking geometries within the core of G-quadruplexes and at the interface between stacked G-quadruplex structures. We couple this survey with a systematic computational examination of stacked G-tetrad energy landscapes using quantum mechanical computations. Energy calculations of stacked G-tetrads reveal large energy differences of up to 12 kcal/mol between experimentally observed geometries at the interface of stacked G-quadruplexes. Energy landscapes are also computed using an AMBER molecular mechanics description of stacking energy and are shown to agree quite well with quantum mechanical calculated landscapes. Molecular dynamics simulations provide a structural explanation for the experimentally observed preference of parallel G-quadruplexes to stack in a 5′–5′ manner based on different accessible tetrad stacking modes at the stacking interfaces of 5′–5′ and 3′–3′ stacked G-quadruplexes. PMID:23268444

  16. Macrocyclic G-quadruplex ligands

    DEFF Research Database (Denmark)

    Nielsen, M C; Ulven, Trond

    2010-01-01

    are macrocyclic structures which have been modeled after the natural product telomestatin or from porphyrin-based ligands discovered in the late 1990s. These two structural classes of G-quadruplex ligands are reviewed here with special attention to selectivity and structure-activity relationships, and with focus...

  17. Dual Recognition of Human Telomeric G-quadruplex by Neomycin-anthraquinone Conjugate

    Science.gov (United States)

    Ranjan, Nihar; Davis, Erik; Xue, Liang

    2013-01-01

    The authors report the recognition of a G-quadruplex formed by four repeat human telomeric DNA with aminosugar intercalator conjugates. The recognition of G-quadruplex through dual binding mode ligands significantly increased the affinity of ligands for G-quadruplex. One such example is a neomycin-anthraquinone 2 which exhibited nanomolar affinity for the quadruplex, and the affinity of 2 is nearly 1000 fold higher for human telomeric G-quadruplex DNA than its constituent units, neomycin and anthraquinone. PMID:23698792

  18. Simultaneous Binding of Hybrid Molecules Constructed with Dual DNA-Binding Components to a G-Quadruplex and Its Proximal Duplex.

    Science.gov (United States)

    Asamitsu, Sefan; Obata, Shunsuke; Phan, Anh Tuân; Hashiya, Kaori; Bando, Toshikazu; Sugiyama, Hiroshi

    2018-03-20

    A G-quadruplex (quadruplex) is a nucleic acid secondary structure adopted by guanine-rich sequences and is considered to be relevant to various pharmacological and biological contexts. Although a number of researchers have endeavored to discover and develop quadruplex-interactive molecules, poor ligand designability originating from topological similarity of the skeleton of diverse quadruplexes has remained a bottleneck for gaining specificity for individual quadruplexes. This work reports on hybrid molecules that were constructed with dual DNA-binding components, a cyclic imidazole/lysine polyamide (cIKP), and a hairpin pyrrole/imidazole polyamide (hPIP), with the aim toward specific quadruplex targeting by reading out the local duplex DNA sequence adjacent to designated quadruplexes in the genome. By means of circular dichroism (CD), fluorescence resonance energy transfer (FRET), surface plasmon resonance (SPR), and NMR techniques, we showed the dual and simultaneous recognition of the respective segment via hybrid molecules, and the synergistic and mutual effect of each binding component that was appropriately linked on higher binding affinity and modest sequence specificity. Monitoring quadruplex and duplex imino protons of the quadruplex/duplex motif titrated with hybrid molecules clearly revealed distinct features of the binding of hybrid molecules to the respective segments upon their simultaneous recognition. A series of the systematic and detailed binding assays described here showed that the concept of simultaneous recognition of quadruplex and its proximal duplex by hybrid molecules constructed with the dual DNA-binding components may provide a new strategy for ligand design, enabling targeting of a large variety of designated quadruplexes at specific genome locations. © 2018 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.

  19. Effect of Urea on G-Quadruplex Stability.

    Science.gov (United States)

    Aslanyan, Lusine; Ko, Jordan; Kim, Byul G; Vardanyan, Ishkhan; Dalyan, Yeva B; Chalikian, Tigran V

    2017-07-13

    G-quadruplexes represent a class of noncanonical nucleic acid structures implicated in transcriptional regulation, cellular function, and disease. An understanding of the forces involved in stabilization and destabilization of the G-quadruplex conformation relative to the duplex or single-stranded conformation is a key to elucidating the biological role of G-quadruplex-based genomic switches and the quest for therapeutic means for controlled induction or suppression of a G-quadruplex at selected genomic loci. Solute-solvent interactions provide a ubiquitous and, in many cases, the determining thermodynamic force in maintaining and modulating the stability of nucleic acids. These interactions involve water as well as water-soluble cosolvents that may be present in the solution or in the crowded environment in the cell. We present here the first quantitative investigation of the effect of urea, a destabilizing cosolvent, on the conformational preferences of a G-quadruplex formed by the telomeric d[A(G 3 T 2 A) 3 G 3 ] sequence (Tel22). At 20 mM NaCl and room temperature, Tel22 undergoes a two-state urea-induced unfolding transition. An increase in salt mitigates the deleterious effect of urea on Tel22. The urea m-value of Tel22 normalized per change in solvent-accessible surface area, ΔS A , is similar to those for other DNA and RNA structures while being several-fold larger than that of proteins. Our results suggest that urea can be employed as an analytical tool in thermodynamic characterizations of G-quadruplexes in a manner similar to the use of urea in protein studies. We emphasize the need for further studies involving a larger selection of G-quadruplexes varying in sequence, topology (parallel, antiparallel, hybrid), and molecularity (monomolecular, bimolecular, tetramolecular) to outline the advantages and the limits of the use of urea in G-quadruplex studies. A deeper understanding of the effect of solvent and cosolvents on the differential stability of the

  20. G-Quadruplex Forming Oligonucleotides as Anti-HIV Agents.

    Science.gov (United States)

    Musumeci, Domenica; Riccardi, Claudia; Montesarchio, Daniela

    2015-09-22

    Though a variety of different non-canonical nucleic acids conformations have been recognized, G-quadruplex structures are probably the structural motifs most commonly found within known oligonucleotide-based aptamers. This could be ascribed to several factors, as their large conformational diversity, marked responsiveness of their folding/unfolding processes to external stimuli, high structural compactness and chemo-enzymatic and thermodynamic stability. A number of G-quadruplex-forming oligonucleotides having relevant in vitro anti-HIV activity have been discovered in the last two decades through either SELEX or rational design approaches. Improved aptamers have been obtained by chemical modifications of natural oligonucleotides, as terminal conjugations with large hydrophobic groups, replacement of phosphodiester linkages with phosphorothioate bonds or other surrogates, insertion of base-modified monomers, etc. In turn, detailed structural studies have elucidated the peculiar architectures adopted by many G-quadruplex-based aptamers and provided insight into their mechanism of action. An overview of the state-of-the-art knowledge of the relevance of putative G-quadruplex forming sequences within the viral genome and of the most studied G-quadruplex-forming aptamers, selectively targeting HIV proteins, is here presented.

  1. G-quadruplex-based structural transitions in 15-mer DNA oligonucleotides varying in lengths of internal oligo(dG) stretches detected by voltammetric techniques

    Czech Academy of Sciences Publication Activity Database

    Vidláková, Pavlína; Pivoňková, Hana; Kejnovská, Iva; Trnková, L.; Vorlíčková, Michaela; Fojta, Miroslav; Havran, Luděk

    2015-01-01

    Roč. 407, č. 19 (2015), s. 5817-5826 ISSN 1618-2642 R&D Projects: GA ČR GAP206/12/2378 Institutional support: RVO:68081707 Keywords : Oligonucleotides * Electrochemical methods * G-quadruplex Subject RIV: BO - Biophysics Impact factor: 3.125, year: 2015

  2. Multimerization rules for G-quadruplexes

    Czech Academy of Sciences Publication Activity Database

    Kolesnikova, Sofia; Hubálek, Martin; Bednárová, Lucie; Cvačka, Josef; Curtis, Edward A.

    2017-01-01

    Roč. 45, č. 15 (2017), s. 8684-8696 ISSN 0305-1048 Institutional support: RVO:61388963 Keywords : tetramolecular G-quadruplexes * RNA G-quadruplexes * circular dichroism Subject RIV: CE - Biochemistry OBOR OECD: Biochemistry and molecular biology Impact factor: 10.162, year: 2016 https://academic.oup.com/nar/article/45/15/8684/4002725/Multimerization-rules-for-Gquadruplexes

  3. Superhelicity Constrains a Localized and R-Loop-Dependent Formation of G-Quadruplexes at the Upstream Region of Transcription.

    Science.gov (United States)

    Zheng, Ke-Wei; He, Yi-de; Liu, Hong-He; Li, Xin-Min; Hao, Yu-Hua; Tan, Zheng

    2017-10-20

    Transcription induces formation of intramolecular G-quadruplex structures at the upstream region of a DNA duplex by an upward transmission of negative supercoiling through the DNA. Currently the regulation of such G-quadruplex formation remains unclear. Using plasmid as a model, we demonstrate that while it is the dynamic negative supercoiling generated by a moving RNA polymerase that triggers a formation of a G-quadruplex, the constitutional superhelicity determines the potential and range of the formation of a G-quadruplex by constraining the propagation of the negative supercoiling. G-quadruplex formation is maximal in negatively supercoiled and nearly abolished in relaxed plasmids while being moderate in nicked and linear ones. The formation of a G-quadruplex strongly correlates with the presence of an R-loop. Preventing R-loop formation virtually abolished G-quadruplex formation even in the negatively supercoiled plasmid. Enzymatic action and protein binding that manipulate supercoiling or its propagation all impact the formation of G-quadruplexes. Because chromosomes and plasmids in cells in their natural form are maintained in a supercoiled state, our findings reveal a physical basis that justifies the formation and regulation of G-quadruplexes in vivo. The structural features involved in G-quadruplex formation may all serve as potential targets in clinical and therapeutic applications.

  4. A label-free ultrasensitive fluorescence detection of viable Salmonella enteritidis using enzyme-induced cascade two-stage toehold strand-displacement-driven assembly of G-quadruplex DNA.

    Science.gov (United States)

    Zhang, Peng; Liu, Hui; Ma, Suzhen; Men, Shuai; Li, Qingzhou; Yang, Xin; Wang, Hongning; Zhang, Anyun

    2016-06-15

    The harm of Salmonella enteritidis (S. enteritidis ) to public health mainly by contaminating fresh food and water emphasizes the urgent need for rapid detection techniques to help control the spread of the pathogen. In this assay, an newly designed capture probe complex that contained specific S. enteritidis-aptamer and hybridized signal target sequence was used for viable S. enteritidis recognition directly. In the presence of the target S. enteritidis, single-stranded target sequences were liberated and initiated the replication-cleavage reaction, producing numerous G-quadruplex structures with a linker on the 3'-end. And then, the sensing system took innovative advantage of quadratic linker-induced strand-displacement for the first time to release target sequence in succession, leading to the cyclic reuse of the target sequences and cascade signal amplification, thereby achieving the successive production of G-quadruplex structures. The fluorescent dye, N-Methyl mesoporphyrin IX, binded to these G-quadruplex structures and generated significantly enhanced fluorescent signals to achieve highly sensitive detection of S. enteritidis down to 60 CFU/mL with a linear range from 10(2) to 10(7)CFU/mL. By coupling the cascade two-stage target sequences-recyclable toehold strand-displacement with aptamer-based target recognition successfully, it is the first report on a novel non-label, modification-free and DNA extraction-free ultrasensitive fluorescence biosensor for detecting viable S. enteritidis directly, which can discriminate from dead S. enteritidis. Copyright © 2016 Elsevier B.V. All rights reserved.

  5. Selectivity in ligand recognition of G-quadruplex loops.

    Science.gov (United States)

    Campbell, Nancy H; Patel, Manisha; Tofa, Amina B; Ghosh, Ragina; Parkinson, Gary N; Neidle, Stephen

    2009-03-03

    A series of disubstituted acridine ligands have been cocrystallized with a bimolecular DNA G-quadruplex. The ligands have a range of cyclic amino end groups of varying size. The crystal structures show that the diagonal loop in this quadruplex results in a large cavity for these groups, in contrast to the steric constraints imposed by propeller loops in human telomeric quadruplexes. We conclude that the nature of the loop has a significant influence on ligand selectivity for particular quadruplex folds.

  6. Experimental approaches to identify cellular G-quadruplex structures and functions.

    Science.gov (United States)

    Di Antonio, Marco; Rodriguez, Raphaël; Balasubramanian, Shankar

    2012-05-01

    Guanine-rich nucleic acids can fold into non-canonical DNA secondary structures called G-quadruplexes. The formation of these structures can interfere with the biology that is crucial to sustain cellular homeostases and metabolism via mechanisms that include transcription, translation, splicing, telomere maintenance and DNA recombination. Thus, due to their implication in several biological processes and possible role promoting genomic instability, G-quadruplex forming sequences have emerged as potential therapeutic targets. There has been a growing interest in the development of synthetic molecules and biomolecules for sensing G-quadruplex structures in cellular DNA. In this review, we summarise and discuss recent methods developed for cellular imaging of G-quadruplexes, and the application of experimental genomic approaches to detect G-quadruplexes throughout genomic DNA. In particular, we will discuss the use of engineered small molecules and natural proteins to enable pull-down, ChIP-Seq, ChIP-chip and fluorescence imaging of G-quadruplex structures in cellular DNA. Copyright © 2012 Elsevier Inc. All rights reserved.

  7. A new cationic porphyrin derivative (TMPipEOPP with large side arm substituents: a highly selective G-quadruplex optical probe.

    Directory of Open Access Journals (Sweden)

    Li-Na Zhu

    Full Text Available The discovery of uncommon DNA structures and speculation about their potential functions in genes has brought attention to specific DNA structure recognition. G-quadruplexes are four-stranded nucleic acid structures formed by G-rich DNA (or RNA sequences. G-rich sequences with a high potential to form G-quadruplexes have been found in many important genomic regions. Porphyrin derivatives with cationic side arm substituents are important G-quadruplex-binding ligands. For example, 5,10,15,20-Tetrakis(N-methylpyridinium-4-yl-21H,23H-porphyrin (TMPyP4, interacts strongly with G-quadruplexes, but has poor selectivity for G-quadruplex versus duplex DNA. To increase the G-quadruplex recognition specificity, a new cationic porphyrin derivative, 5,10,15,20-tetra-{4-[2-(1-methyl-1-piperidinylethoxy]phenyl} porphyrin (TMPipEOPP, with large side arm substituents was synthesized, and the interactions between TMPipEOPP and different DNA structures were compared. The results show that G-quadruplexes cause large changes in the UV-Vis absorption and fluorescence spectra of TMPipEOPP, but duplex and single-stranded DNAs do not, indicating that TMPipEOPP can be developed as a highly specific optical probe for discriminating G-quadruplex from duplex and single-stranded DNA. Visual discrimination is also possible. Job plot and Scatchard analysis suggest that a complicated binding interaction occurs between TMPipEOPP and G-quadruplexes. At a low [G-quadruplex]/[TMPipEOPP] ratio, one G-quadruplex binds two TMPipEOPP molecules by end-stacking and outside binding modes. At a high [G-quadruplex]/[TMPipEOPP] ratio, two G-quadruplexes bind to one TMPipEOPP molecule in a sandwich-like end-stacking mode.

  8. A new cationic porphyrin derivative (TMPipEOPP) with large side arm substituents: a highly selective G-quadruplex optical probe.

    Science.gov (United States)

    Zhu, Li-Na; Zhao, Shu-Juan; Wu, Bin; Li, Xiao-Zeng; Kong, De-Ming

    2012-01-01

    The discovery of uncommon DNA structures and speculation about their potential functions in genes has brought attention to specific DNA structure recognition. G-quadruplexes are four-stranded nucleic acid structures formed by G-rich DNA (or RNA) sequences. G-rich sequences with a high potential to form G-quadruplexes have been found in many important genomic regions. Porphyrin derivatives with cationic side arm substituents are important G-quadruplex-binding ligands. For example, 5,10,15,20-Tetrakis(N-methylpyridinium-4-yl)-21H,23H-porphyrin (TMPyP4), interacts strongly with G-quadruplexes, but has poor selectivity for G-quadruplex versus duplex DNA. To increase the G-quadruplex recognition specificity, a new cationic porphyrin derivative, 5,10,15,20-tetra-{4-[2-(1-methyl-1-piperidinyl)ethoxy]phenyl} porphyrin (TMPipEOPP), with large side arm substituents was synthesized, and the interactions between TMPipEOPP and different DNA structures were compared. The results show that G-quadruplexes cause large changes in the UV-Vis absorption and fluorescence spectra of TMPipEOPP, but duplex and single-stranded DNAs do not, indicating that TMPipEOPP can be developed as a highly specific optical probe for discriminating G-quadruplex from duplex and single-stranded DNA. Visual discrimination is also possible. Job plot and Scatchard analysis suggest that a complicated binding interaction occurs between TMPipEOPP and G-quadruplexes. At a low [G-quadruplex]/[TMPipEOPP] ratio, one G-quadruplex binds two TMPipEOPP molecules by end-stacking and outside binding modes. At a high [G-quadruplex]/[TMPipEOPP] ratio, two G-quadruplexes bind to one TMPipEOPP molecule in a sandwich-like end-stacking mode.

  9. G-Quadruplex conformational change driven by pH variation with potential application as a nanoswitch.

    Science.gov (United States)

    Yan, Yi-Yong; Tan, Jia-Heng; Lu, Yu-Jing; Yan, Siu-Cheong; Wong, Kwok-Yin; Li, Ding; Gu, Lian-Quan; Huang, Zhi-Shu

    2013-10-01

    G-Quadruplex is a highly polymorphic structure, and its behavior in acidic condition has not been well studied. Circular dichroism (CD) spectra were used to study the conformational change of G-quadruplex. The thermal stabilities of the G-quadruplex were measured with CD melting. Interconversion kinetics profiles were investigated by using CD kinetics. The fluorescence of the inserted 2-Aminopurine (Ap) was monitored during pH change and acrylamide quenching, indicating the status of the loop. Proton NMR was adopted to help illustrate the change of the conformation. G-Quadruplex of specific loop was found to be able to transform upon pH variation. The transformation was resulted from the loop rearrangement. After screening of a library of diverse G-quadruplex, a sequence exhibiting the best transformation property was found. A pH-driven nanoswitch with three gears was obtained based on this transition cycle. Certain G-quadruplex was found to go through conformational change at low pH. Loop was the decisive factor controlling the interconversion upon pH variation. G-Quadruplex with TT central loop could be converted in a much milder condition than the one with TTA loop. It can be used to design pH-driven nanodevices such as a nanoswitch. These results provide more insights into G-quadruplex polymorphism, and also contribute to the design of DNA-based nanomachines and logic gates. © 2013.

  10. G-quadruplex induced chirality of methylazacalix[6]pyridine via unprecedented binding stoichiometry: en route to multiplex controlled molecular switch

    Science.gov (United States)

    Guan, Ai-Jiao; Shen, Meng-Jie; Xiang, Jun-Feng; Zhang, En-Xuan; Li, Qian; Sun, Hong-Xia; Wang, Li-Xia; Xu, Guang-Zhi; Tang, Ya-Lin; Xu, Li-Jin; Gong, Han-Yuan

    2015-05-01

    Nucleic acid based molecular device is a developing research field which attracts great interests in material for building machinelike nanodevices. G-quadruplex, as a new type of DNA secondary structures, can be harnessed to construct molecular device owing to its rich structural polymorphism. Herein, we developed a switching system based on G-quadruplexes and methylazacalix[6]pyridine (MACP6). The induced circular dichroism (CD) signal of MACP6 was used to monitor the switch controlled by temperature or pH value. Furthermore, the CD titration, Job-plot, variable temperature CD and 1H-NMR experiments not only confirmed the binding mode between MACP6 and G-quadruplex, but also explained the difference switching effect of MACP6 and various G-quadruplexes. The established strategy has the potential to be used as the chiral probe for specific G-quadruplex recognition.

  11. Selection of G-quadruplex folding topology with LNA-modified human telomeric sequences in K+ solution

    DEFF Research Database (Denmark)

    Pradhan, Devranjan; Hansen, Lykke H; Vester, Birte

    2011-01-01

    G-rich nucleic acid oligomers can form G-quadruplexes built by G-tetrads stacked upon each other. Depending on the nucleotide sequence, G-quadruplexes fold mainly with two topologies: parallel, in which all G-tracts are oriented parallel to each other, or antiparallel, in which one or more G......-tracts are oriented antiparallel to the other G-tracts. In the former topology, all glycosidic bond angles conform to anti conformations, while in the latter topology they adopt both syn and anti conformations. It is of interest to understand the molecular forces that govern G-quadruplex folding. Here, we approach...... this problem by examining the impact of LNA (locked nucleic acid) modifications on the folding topology of the dimeric model system of the human telomere sequence. In solution, this DNA G-quadruplex forms a mixture of G-quadruplexes with antiparallel and parallel topologies. Using CD and NMR spectroscopies, we...

  12. GNG Motifs Can Replace a GGG Stretch during G-Quadruplex Formation in a Context Dependent Manner.

    Directory of Open Access Journals (Sweden)

    Kohal Das

    Full Text Available G-quadruplexes are one of the most commonly studied non-B DNA structures. Generally, these structures are formed using a minimum of 4, three guanine tracts, with connecting loops ranging from one to seven. Recent studies have reported deviation from this general convention. One such deviation is the involvement of bulges in the guanine tracts. In this study, guanines along with bulges, also referred to as GNG motifs have been extensively studied using recently reported HOX11 breakpoint fragile region I as a model template. By strategic mutagenesis approach we show that the contribution from continuous G-tracts may be dispensible during G-quadruplex formation when such motifs are flanked by GNGs. Importantly, the positioning and number of GNG/GNGNG can also influence the formation of G-quadruplexes. Further, we assessed three genomic regions from HIF1 alpha, VEGF and SHOX gene for G-quadruplex formation using GNG motifs. We show that HIF1 alpha sequence harbouring GNG motifs can fold into intramolecular G-quadruplex. In contrast, GNG motifs in mutant VEGF sequence could not participate in structure formation, suggesting that the usage of GNG is context dependent. Importantly, we show that when two continuous stretches of guanines are flanked by two independent GNG motifs in a naturally occurring sequence (SHOX, it can fold into an intramolecular G-quadruplex. Finally, we show the specific binding of G-quadruplex binding protein, Nucleolin and G-quadruplex antibody, BG4 to SHOX G-quadruplex. Overall, our study provides novel insights into the role of GNG motifs in G-quadruplex structure formation which may have both physiological and pathological implications.

  13. Integration of G-quadruplex and DNA-templated Ag NCs for nonarithmetic information processing† †Electronic supplementary information (ESI) available. See DOI: 10.1039/c7sc00361g Click here for additional data file.

    Science.gov (United States)

    Gao, Ru-Ru; Lv, Xiao-Yan; Zhu, Yan-Yan; Zhang, Yi-Wei

    2017-01-01

    To create sophisticated molecular logic circuits from scratch, you may not believe how common the building blocks can be and how diverse and powerful such circuits can be when scaled up. Using the two simple building blocks of G-quadruplex and silver nanoclusters (Ag NCs), we experimentally construct a series of multifunctional, label-free, and multi-output logic circuits to perform nonarithmetic functions: a 1-to-2 decoder, a 4-to-2 encoder, an 8-to-3 encoder, dual transfer gates, a 2 : 1 multiplexer, and a 1 : 2 demultiplexer. Moreover, a parity checker which is capable of identifying odd and even numbers from natural numbers is constructed conceptually. Finally, a multi-valued logic gate (ternary inhibit gate) is readily achieved by taking this DNA/Ag NC system as a universal platform. All of the above logic circuits share the same building blocks, indicating the great prospects of the assembly of nanomaterials and DNA for biochemical logic devices. Considering its biocompatibility, the novel prototypes developed here may have potential applications in the fields of biological computers and medical diagnosis and serve as a promising proof of principle in the not-too-distant future. PMID:28626564

  14. Local epigenetic reprogramming induced by G-quadruplex ligands

    Science.gov (United States)

    Guilbaud, Guillaume; Murat, Pierre; Recolin, Bénédicte; Campbell, Beth C.; Maiter, Ahmed; Sale, Julian E.; Balasubramanian, Shankar

    2017-11-01

    DNA and histone modifications regulate transcriptional activity and thus represent valuable targets to reprogram the activity of genes. Current epigenetic therapies target the machinery that regulates these modifications, leading to global transcriptional reprogramming with the potential for extensive undesired effects. Epigenetic information can also be modified as a consequence of disrupting processive DNA replication. Here, we demonstrate that impeding replication by small-molecule-mediated stabilization of G-quadruplex nucleic acid secondary structures triggers local epigenetic plasticity. We report the use of the BU-1 locus of chicken DT40 cells to screen for small molecules able to induce G-quadruplex-dependent transcriptional reprogramming. Further characterization of the top hit compound revealed its ability to induce a dose-dependent inactivation of BU-1 expression in two steps: the loss of H3K4me3 and then subsequent DNA cytosine methylation, changes that were heritable across cell divisions even after the compound was removed. Targeting DNA secondary structures thus represents a potentially new approach for locus-specific epigenetic reprogramming.

  15. Quadruplexes in 'Dicty': crystal structure of a four-quartet G-quadruplex formed by G-rich motif found in the Dictyostelium discoideum genome.

    Science.gov (United States)

    Guédin, Aurore; Lin, Linda Yingqi; Armane, Samir; Lacroix, Laurent; Mergny, Jean-Louis; Thore, Stéphane; Yatsunyk, Liliya A

    2018-06-01

    Guanine-rich DNA has the potential to fold into non-canonical G-quadruplex (G4) structures. Analysis of the genome of the social amoeba Dictyostelium discoideum indicates a low number of sequences with G4-forming potential (249-1055). Therefore, D. discoideum is a perfect model organism to investigate the relationship between the presence of G4s and their biological functions. As a first step in this investigation, we crystallized the dGGGGGAGGGGTACAGGGGTACAGGGG sequence from the putative promoter region of two divergent genes in D. discoideum. According to the crystal structure, this sequence folds into a four-quartet intramolecular antiparallel G4 with two lateral and one diagonal loops. The G-quadruplex core is further stabilized by a G-C Watson-Crick base pair and a A-T-A triad and displays high thermal stability (Tm > 90°C at 100 mM KCl). Biophysical characterization of the native sequence and loop mutants suggests that the DNA adopts the same structure in solution and in crystalline form, and that loop interactions are important for the G4 stability but not for its folding. Four-tetrad G4 structures are sparse. Thus, our work advances understanding of the structural diversity of G-quadruplexes and yields coordinates for in silico drug screening programs and G4 predictive tools.

  16. G-Quadruplex DNAzyme Molecular Beacon for Amplified Colorimetric Biosensing of Pseudostellaria heterophylla

    Directory of Open Access Journals (Sweden)

    Juan Hu

    2013-01-01

    Full Text Available With an internal transcribed spacer of 18 S, 5.8 S and 26 S nuclear ribosomal DNA (nrDNA ITS as DNA marker, we report a colorimetric approach for authentication of Pseudostellaria heterophylla (PH and its counterfeit species based on the differentiation of the nrDNA ITS sequence. The assay possesses an unlabelled G-quadruplex DNAzyme molecular beacon (MB probe, employing complementary sequence as biorecognition element and 1:1:1:1 split G-quadruplex halves as reporter. In the absence of target DNA (T-DNA, the probe can shape intermolecular G-quadruplex structures capable of binding hemin to form G-quadruplex-hemin DNAzyme and catalyze the oxidation of ABTS2− to blue-green ABTS•− by H2O2. In the presence of T-DNA, T-DNA can hybridize with the complementary sequence to form a duplex structure, hindering the formation of the G-quadruplex structure and resulting in the loss of the catalytic activity. Consequently, a UV-Vis absorption signal decrease is observed in the ABTS2−-H2O2 system. The “turn-off” assay allows the detection of T-DNA from 1.0 × 10−9 to 3.0 × 10−7 mol·L−1 (R2 = 0.9906, with a low detection limit of 3.1 × 10−10 mol·L−1. The present study provides a sensitive and selective method and may serve as a foundation of utilizing the DNAzyme MB sensor for identifying traditional Chinese medicines.

  17. Stabilization of Telomere G-Quadruplexes Interferes with Human Herpesvirus 6A Chromosomal Integration.

    Science.gov (United States)

    Gilbert-Girard, Shella; Gravel, Annie; Artusi, Sara; Richter, Sara N; Wallaschek, Nina; Kaufer, Benedikt B; Flamand, Louis

    2017-07-15

    Human herpesviruses 6A and 6B (HHV-6A/B) can integrate their genomes into the telomeres of human chromosomes using a mechanism that remains poorly understood. To achieve a better understanding of the HHV-6A/B integration mechanism, we made use of BRACO-19, a compound that stabilizes G-quadruplex secondary structures and prevents telomere elongation by the telomerase complex. First, we analyzed the folding of telomeric sequences into G-quadruplex structures and their binding to BRACO-19 using G-quadruplex-specific antibodies and surface plasmon resonance. Circular dichroism studies indicate that BRACO-19 modifies the conformation and greatly stabilizes the G-quadruplexes formed in G-rich telomeric DNA. Subsequently we assessed the effects of BRACO-19 on the HHV-6A initial phase of infection. Our results indicate that BRACO-19 does not affect entry of HHV-6A DNA into cells. We next investigated if stabilization of G-quadruplexes by BRACO-19 affected HHV-6A's ability to integrate its genome into host chromosomes. Incubation of telomerase-expressing cells with BRACO-19, such as HeLa and MCF-7, caused a significant reduction in the HHV-6A integration frequency ( P integration frequency in U2OS cells that lack telomerase activity and elongate their telomeres through alternative lengthening mechanisms. Our data suggest that the fluidity of telomeres is important for efficient chromosomal integration of HHV-6A and that interference with telomerase activity negatively affects the generation of cellular clones containing integrated HHV-6A. IMPORTANCE HHV-6A/B can integrate their genomes into the telomeres of infected cells. Telomeres consist of repeated hexanucleotides (TTAGGG) of various lengths (up to several kilobases) and end with a single-stranded 3' extension. To avoid recognition and induce a DNA damage response, the single-stranded overhang folds back on itself and forms a telomeric loop (T-loop) or adopts a tertiary structure, referred to as a G-quadruplex. In the

  18. Unexpected Position-Dependent Effects of Ribose G-Quartets in G-Quadruplexes

    Czech Academy of Sciences Publication Activity Database

    Zhou, J.; Amrane, S.; Rosu, F.; Salgado, G.; Bian, Y.; Tateishi-Karimata, H.; Largy, E.; Korkut, D. N.; Bourdoncle, A.; Miyoshi, D.; Zhang, J.; Ju, H.; Wang, W.; Sugimoto, N.; Gabelica, V.; Mergny, Jean-Louis

    2017-01-01

    Roč. 139, č. 23 (2017), s. 7768-7779 ISSN 0002-7863 Institutional support: RVO:68081707 Keywords : human telomeric rna * electrospray mass-spectrometry * molecular crowding conditions * dna g-quadruplexes Subject RIV: BO - Biophysics OBOR OECD: Electrochemistry (dry cells, batteries, fuel cells, corrosion metals, electrolysis) Impact factor: 13.858, year: 2016

  19. Derivation of Reliable Geometries in QM Calculations of DNA Structures: Explicit Solvent QM/MM and Restrained Implicit Solvent QM Optimizations of G-Quadruplexes.

    Science.gov (United States)

    Gkionis, Konstantinos; Kruse, Holger; Šponer, Jiří

    2016-04-12

    Modern dispersion-corrected DFT methods have made it possible to perform reliable QM studies on complete nucleic acid (NA) building blocks having hundreds of atoms. Such calculations, although still limited to investigations of potential energy surfaces, enhance the portfolio of computational methods applicable to NAs and offer considerably more accurate intrinsic descriptions of NAs than standard MM. However, in practice such calculations are hampered by the use of implicit solvent environments and truncation of the systems. Conventional QM optimizations are spoiled by spurious intramolecular interactions and severe structural deformations. Here we compare two approaches designed to suppress such artifacts: partially restrained continuum solvent QM and explicit solvent QM/MM optimizations. We report geometry relaxations of a set of diverse double-quartet guanine quadruplex (GQ) DNA stems. Both methods provide neat structures without major artifacts. However, each one also has distinct weaknesses. In restrained optimizations, all errors in the target geometries (i.e., low-resolution X-ray and NMR structures) are transferred to the optimized geometries. In QM/MM, the initial solvent configuration causes some heterogeneity in the geometries. Nevertheless, both approaches represent a decisive step forward compared to conventional optimizations. We refine earlier computations that revealed sizable differences in the relative energies of GQ stems computed with AMBER MM and QM. We also explore the dependence of the QM/MM results on the applied computational protocol.

  20. Fluorescent Dansyl-Guanosine Conjugates that Bind c-MYC Promoter G-Quadruplex and Downregulate c-MYC Expression.

    Science.gov (United States)

    Pavan Kumar, Y; Saha, Puja; Saha, Dhurjhoti; Bessi, Irene; Schwalbe, Harald; Chowdhury, Shantanu; Dash, Jyotirmayee

    2016-03-02

    The four-stranded G-quadruplex present in the c-MYC P1 promoter has been shown to play a pivotal role in the regulation of c-MYC transcription. Small-molecule compounds capable of inhibiting the c-MYC promoter activity by stabilising the c-MYC G-quadruplex could potentially be used as anticancer agents. In this context, here we report the synthesis of dansyl-guanosine conjugates through one-pot modular click reactions. The dansyl-guanosine conjugates can selectively detect c-MYC G-quadruplex over other biologically relevant quadruplexes and duplex DNA and can be useful as staining reagents for selective visualisation of c-MYC G-quadruplex over duplex DNA by gel electrophoresis. NMR spectroscopic titrations revealed the preferential binding sites of these dansyl ligands to the c-MYC G-quadruplex. A dual luciferase assay and qRT-PCR revealed that a dansyl-bisguanosine ligand represses the c-MYC expression, possibly by stabilising the c-MYC G-quadruplex. © 2016 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  1. Altered biochemical specificity of G-quadruplexes with mutated tetrads

    Czech Academy of Sciences Publication Activity Database

    Švehlová, Kateřina; Lawrence, M. S.; Bednárová, Lucie; Curtis, Edward A.

    2016-01-01

    Roč. 44, č. 22 (2016), s. 10789-10803 ISSN 0305-1048 Institutional support: RVO:61388963 Keywords : G-quadruplex * G motif GTP aptamer * peroxidase deoxyribozyme Subject RIV: CE - Biochemistry Impact factor: 10.162, year: 2016 https://academic.oup.com/nar/article/44/22/10789/2333933/Altered-biochemical-specificity-of-G-quadruplexes

  2. Xanthine and 8-oxoguanine in G-quadruplexes: formation of a G·G·X·O tetrad.

    Science.gov (United States)

    Cheong, Vee Vee; Heddi, Brahim; Lech, Christopher Jacques; Phan, Anh Tuân

    2015-12-02

    G-quadruplexes are four-stranded structures built from stacked G-tetrads (G·G·G·G), which are planar cyclical assemblies of four guanine bases interacting through Hoogsteen hydrogen bonds. A G-quadruplex containing a single guanine analog substitution, such as 8-oxoguanine (O) or xanthine (X), would suffer from a loss of a Hoogsteen hydrogen bond within a G-tetrad and/or potential steric hindrance. We show that a proper arrangement of O and X bases can reestablish the hydrogen-bond pattern within a G·G·X·O tetrad. Rational incorporation of G·G·X·O tetrads in a (3+1) G-quadruplex demonstrated a similar folding topology and thermal stability to that of the unmodified G-quadruplex. pH titration conducted on X·O-modified G-quadruplexes indicated a protonation-deprotonation equilibrium of X with a pKa ∼6.7. The solution structure of a G-quadruplex containing a G·G·X·O tetrad was determined, displaying the same folding topology in both the protonated and deprotonated states. A G-quadruplex containing a deprotonated X·O pair was shown to exhibit a more electronegative groove compared to that of the unmodified one. These differences are likely to manifest in the electronic properties of G-quadruplexes and may have important implications for drug targeting and DNA-protein interactions. © The Author(s) 2015. Published by Oxford University Press on behalf of Nucleic Acids Research.

  3. Biophysical Characterization of G-Quadruplex Recognition in the PITX1 mRNA by the Specificity Domain of the Helicase RHAU.

    Directory of Open Access Journals (Sweden)

    Emmanuel O Ariyo

    Full Text Available Nucleic acids rich in guanine are able to fold into unique structures known as G-quadruplexes. G-quadruplexes consist of four tracts of guanylates arranged in parallel or antiparallel strands that are aligned in stacked G-quartet planes. The structure is further stabilized by Hoogsteen hydrogen bonds and monovalent cations centered between the planes. RHAU (RNA helicase associated with AU-rich element is a member of the ATP-dependent DExH/D family of RNA helicases and can bind and resolve G-quadruplexes. RHAU contains a core helicase domain with an N-terminal extension that enables recognition and full binding affinity to RNA and DNA G-quadruplexes. PITX1, a member of the bicoid class of homeobox proteins, is a transcriptional activator active during development of vertebrates, chiefly in the anterior pituitary gland and several other organs. We have previously demonstrated that RHAU regulates PITX1 levels through interaction with G-quadruplexes at the 3'-end of the PITX1 mRNA. To understand the structural basis of G-quadruplex recognition by RHAU, we characterize a purified minimal PITX1 G-quadruplex using a variety of biophysical techniques including electrophoretic mobility shift assays, UV-VIS spectroscopy, circular dichroism, dynamic light scattering, small angle X-ray scattering and nuclear magnetic resonance spectroscopy. Our biophysical analysis provides evidence that the RNA G-quadruplex, but not its DNA counterpart, can adopt a parallel orientation, and that only the RNA can interact with N-terminal domain of RHAU via the tetrad face of the G-quadruplex. This work extends our insight into how the N-terminal region of RHAU recognizes parallel G-quadruplexes.

  4. Thermodynamic fingerprints of ligand binding to human telomeric G-quadruplexes

    OpenAIRE

    Bon?ina, Matja?; Podlipnik, ?rtomir; Piantanida, Ivo; Eilmes, Julita; Teulade-Fichou, Marie-Paule; Vesnaver, Gorazd; Lah, Jurij

    2015-01-01

    Thermodynamic studies of ligand binding to human telomere (ht) DNA quadruplexes, as a rule, neglect the involvement of various ht-DNA conformations in the binding process. Therefore, the thermodynamic driving forces and the mechanisms of ht-DNA G-quadruplex-ligand recognition remain poorly understood. In this work we characterize thermodynamically and structurally binding of netropsin (Net), dibenzotetraaza[14]annulene derivatives (DP77, DP78), cationic porphyrin (TMPyP4) and two bisquinolini...

  5. Effect of ATRX and G-Quadruplex Formation by the VNTR Sequence on α-Globin Gene Expression.

    Science.gov (United States)

    Li, Yue; Syed, Junetha; Suzuki, Yuki; Asamitsu, Sefan; Shioda, Norifumi; Wada, Takahito; Sugiyama, Hiroshi

    2016-05-17

    ATR-X (α-thalassemia/mental retardation X-linked) syndrome is caused by mutations in chromatin remodeler ATRX. ATRX can bind the variable number of tandem repeats (VNTR) sequence in the promoter region of the α-globin gene cluster. The VNTR sequence, which contains the potential G-quadruplex-forming sequence CGC(GGGGCGGGG)n , is involved in the downregulation of α-globin expression. We investigated G-quadruplex and i-motif formation in single-stranded DNA and long double-stranded DNA. The promoter region without the VNTR sequence showed approximately twofold higher luciferase activity than the promoter region harboring the VNTR sequence. G-quadruplex stabilizers hemin and TMPyP4 reduced the luciferase activity, whereas expression of ATRX led to a recovery in reporter activity. Our results demonstrate that stable G-quadruplex formation by the VNTR sequence downregulates the expression of α-globin genes and that ATRX might bind to and resolve the G-quadruplex. © 2016 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  6. G-Quadruplexes influence pri-microRNA processing.

    Science.gov (United States)

    Rouleau, Samuel G; Garant, Jean-Michel; Bolduc, François; Bisaillon, Martin; Perreault, Jean-Pierre

    2018-02-01

    RNA G-Quadruplexes (G4) have been shown to possess many biological functions, including the regulation of microRNA (miRNA) biogenesis and function. However, their impact on pri-miRNA processing remains unknown. We identified G4 located near the Drosha cleavage site in three distinct pri-miRNAs: pri-mir200c, pri-mir451a, and pri-mir497. The folding of the potential G4 motifs was determined in solution. Subsequently, mutations disrupting G4 folding led to important changes in the mature miRNAs levels in cells. Moreover, using small antisense oligonucleotides binding to the pri-miRNA, it was possible to modulate, either positively or negatively, the mature miRNA levels. Together, these data demonstrate that G4 motifs could contribute to the regulation of pri-mRNA processing, a novel role for G4. Considering that bio-informatics screening indicates that between 9% and 50% of all pri-miRNAs contain a putative G4, these structures possess interesting potential as future therapeutic targets.

  7. Synthesis of potent G-quadruplex binders of macrocyclic heptaoxazole and evaluation of their activities.

    Science.gov (United States)

    Tera, Masayuki; Iida, Keisuke; Shin-ya, Kazuo; Nagasawa, Kazuo

    2009-01-01

    Guanine-rich DNA sequences form unique three-dimensional conformation known as G-quadruplexes (G-q). G-q structures have been found in telomere and in some oncogene promoter. Recently, it was suggested that G-q showed some biological activities including telomere shortening and transcriptional regulation. In this paper, we synthesized selective G-q binders and evaluated of their biological activities.

  8. Heterocyclic Dications as a New Class of Telomeric G-Quadruplex Targeting Agents

    Science.gov (United States)

    Nanjunda, Rupesh; Musetti, Caterina; Kumar, Arvind; Ismail, Mohamed A.; Farahat, Abdelbasset A.; Wang, Siming; Sissi, Claudia; Palumbo, Manlio; Boykin, David W.; Wilson, W. David

    2013-01-01

    Small molecules that can induce and stabilize G-quadruplex DNA structures represent a novel approach for anti-cancer and anti-parasitic therapy and extensive efforts have been directed towards discovering lead compounds that are capable of stabilizing quadruplexes. The purpose of this study is to explore conformational modifications in a series of heterocyclic dications to discover structural motifs that can selectively bind and stabilize specific G-quadruplexes, such as those present in the human telomere. The G-quadruplex has various potential recognition sites for small molecules; however, the primary interaction site of most of these ligands is the terminal tetrads. Similar to duplex-DNA groove recognition, quadruplex groove recognition by small molecules offers the potential for enhanced selectivity that can be developed into a viable therapeutic strategy. The compounds investigated were selected based on preliminary studies with DB832, a bifuryl-phenyl diamidine with a unique telomere interaction. This compound provides a paradigm that can help in understanding the optimum compound-DNA interactions that lead to quadruplex groove recognition. DNA recognition by the DB832 derivatives was investigated by biophysical experiments such as thermal melting, circular dichroism, mass spectrometry and NMR. Biological studies were also performed to complement the biophysical data. The results suggest a complex binding mechanism which involves the recognition of grooves for some ligands as well as stacking at the terminal tetrads of the human telomeric G-quadruplex for most of the ligands. These molecules represent an excellent starting point for further SAR analysis for diverse modes of quadruplex recognition and subsequent structure optimization for drug development. PMID:22380518

  9. RecQ-core of BLM unfolds telomeric G-quadruplex in the absence of ATP

    Czech Academy of Sciences Publication Activity Database

    Budhathoki, J.B.; Ray, S.; Urban, Václav; Janščák, Pavel; Jodh, J.G.; Balci, H.

    2014-01-01

    Roč. 42, č. 18 (2014), s. 11528-11545 ISSN 0305-1048 R&D Projects: GA ČR GA204/09/0565 Grant - others:U.S. National Science Foundation through the Physics Frontiers Center Program(US) 1430124 Institutional support: RVO:68378050 Keywords : single-stranded DNA * RECQ5 helicase * G-quadruplex structures Subject RIV: EB - Genetics ; Molecular Biology Impact factor: 9.112, year: 2014

  10. The Effects of Molecular Crowding on the Structure and Stability of G-Quadruplexes with an Abasic Site

    Science.gov (United States)

    Fujimoto, Takeshi; Nakano, Shu-ichi; Miyoshi, Daisuke; Sugimoto, Naoki

    2011-01-01

    Both cellular environmental factors and chemical modifications critically affect the properties of nucleic acids. However, the structure and stability of DNA containing abasic sites under cell-mimicking molecular crowding conditions remain unclear. Here, we investigated the molecular crowding effects on the structure and stability of the G-quadruplexes including a single abasic site. Structural analysis by circular dichroism showed that molecular crowding by PEG200 did not affect the topology of the G-quadruplex structure with or without an abasic site. Thermodynamic analysis further demonstrated that the degree of stabilization of the G-quadruplex by molecular crowding decreased with substitution of an abasic site for a single guanine. Notably, we found that the molecular crowding effects on the enthalpy change for G-quadruplex formation had a linear relationship with the abasic site effects depending on its position. These results are useful for predicting the structure and stability of G-quadruplexes with abasic sites in the cell-mimicking conditions. PMID:21949901

  11. Disordering of human telomeric G-quadruplex with novel antiproliferative anthrathiophenedione.

    Directory of Open Access Journals (Sweden)

    Dmitry Kaluzhny

    Full Text Available Linear heteroareneanthracenediones have been shown to interfere with DNA functions, thereby causing death of human tumor cells and their drug resistant counterparts. Here we report the interaction of our novel antiproliferative agent 4,11-bis[(2-{[acetimido]amino}ethylamino]anthra[2,3-b]thiophene-5,10-dione with telomeric DNA structures studied by isothermal titration calorimetry, circular dichroism and UV absorption spectroscopy. New compound demonstrated a high affinity (K(ass∼10⁶ M⁻¹ for human telomeric antiparallel quadruplex d(TTAGGG₄ and duplex d(TTAGGG₄∶d(CCCTAA₄. Importantly, a ∼100-fold higher affinity was determined for the ligand binding to an unordered oligonucleotide d(TTAGGG TTAGAG TTAGGG TTAGGG unable to form quadruplex structures. Moreover, in the presence of Na+ the compound caused dramatic conformational perturbation of the telomeric G-quadruplex, namely, almost complete disordering of G-quartets. Disorganization of a portion of G-quartets in the presence of K+ was also detected. Molecular dynamics simulations were performed to illustrate how the binding of one molecule of the ligand might disrupt the G-quartet adjacent to the diagonal loop of telomeric G-quadruplex. Our results provide evidence for a non-trivial mode of alteration of G-quadruplex structure by tentative antiproliferative drugs.

  12. RNA synthesis is modulated by G-quadruplex formation in Hepatitis C virus negative RNA strand.

    Science.gov (United States)

    Chloé, Jaubert; Amina, Bedrat; Laura, Bartolucci; Carmelo, Di Primo; Michel, Ventura; Jean-Louis, Mergny; Samir, Amrane; Marie-Line, Andreola

    2018-05-25

    DNA and RNA guanine-rich oligonucleotides can form non-canonical structures called G-quadruplexes or "G4" that are based on the stacking of G-quartets. The role of DNA and RNA G4 is documented in eukaryotic cells and in pathogens such as viruses. Yet, G4 have been identified only in a few RNA viruses, including the Flaviviridae family. In this study, we analysed the last 157 nucleotides at the 3'end of the HCV (-) strand. This sequence is known to be the minimal sequence required for an efficient RNA replication. Using bioinformatics and biophysics, we identified a highly conserved G4-prone sequence located in the stem-loop IIy' of the negative strand. We also showed that the formation of this G-quadruplex inhibits the in vitro RNA synthesis by the RdRp. Furthermore, Phen-DC3, a specific G-quadruplex binder, is able to inhibit HCV viral replication in cells in conditions where no cytotoxicity was measured. Considering that this domain of the negative RNA strand is well conserved among HCV genotypes, G4 ligands could be of interest for new antiviral therapies.

  13. Identification and characterisation of a G-quadruplex forming sequence in the promoter region of nuclear factor (erythroid-derived 2)-like 2 (Nrf2)

    Energy Technology Data Exchange (ETDEWEB)

    Waller, Zoë A.E., E-mail: z.waller@uea.ac.uk; Howell, Lesley A.; MacDonald, Colin J.; O’Connell, Maria A.; Searcey, Mark, E-mail: m.searcey@uea.ac.uk

    2014-04-25

    Highlights: • Discovery of a G-quadruplex forming sequence in the promoter sequence of Nrf2. • Characterisation of the G-quadruplex by UV, CD and NMR. • Conformational switching of G-quadruplex induced by 9-aminoacridine. - Abstract: The transcription factor nuclear factor (erythroid-derived 2)-like 2 (Nrf2) regulates multiple antioxidants, Phase II detoxification enzymes and other cytoprotective enzymes in cells. Activation of Nrf2 is recognised as being of potential therapeutic benefit in inflammatory-diseases whereas more recently, it has become clear that the inhibition of Nrf2 may have benefit in the alleviation of resistance in some tumour types. A potential G-quadruplex forming sequence was identified in the promoter region of Nrf2, close to a number of putative transcription factor binding sites. Characterisation of the sequence 5’-d[GGGAAGGGAGCAAGGGCGGGAGGG]-3’ using CD spectroscopy, imino proton NMR resonances and UV melting experiments demonstrated the formation of a parallel intramolecular G-quadruplex in the presence of K{sup +} ions. Incubation with 9-aminoacridine ligands induced a switch from antiparallel to parallel forms. The presence of a G-quadruplex forming sequence in the promoter region of Nrf2 suggests an approach to targeting the production of the protein through stabilisation of the structure, thereby avoiding resistance to antitumour drugs.

  14. Investigation of ‘Head-to-Tail’-Connected Oligoaryl N,O-Ligands as Recognition Motifs for Cancer-Relevant G-Quadruplexes

    Directory of Open Access Journals (Sweden)

    Natalia Rizeq

    2017-12-01

    Full Text Available Oligomeric compounds, constituted of consecutive N,O-heteroaromatic rings, introduce useful and tunable properties as alternative ligands for biomolecular recognition. In this study, we have explored a synthetic scheme relying on Van Leusen oxazole formation, in conjunction with C–H activation of the formed oxazoles and their subsequent C–C cross-coupling to 2-bromopyridines in order to assemble a library of variable-length, ‘head-to-tail’-connected, pyridyl-oxazole ligands. Through investigation of the interaction of the three longer ligands (5-mer, 6-mer, 7-mer with cancer-relevant G-quadruplex structures (human telomeric/22AG and c-Myc oncogene promoter/Myc2345-Pu22, the asymmetric pyridyl-oxazole motif has been demonstrated to be a prominent recognition element for G-quadruplexes. Fluorescence titrations reveal excellent binding affinities of the 7-mer and 6-mer for a Na+-induced antiparallel 22AG G-quadruplex (KD = 0.6 × 10−7 M−1 and 0.8 × 10−7 M−1, respectively, and satisfactory (albeit lower affinities for the 22AG/K+ and Myc2345-Pu22/K+ G-quadruplexes. All ligands tested exhibit substantial selectivity for G-quadruplex versus duplex (ds26 DNA, as evidenced by competitive Förster resonance energy transfer (FRET melting assays. Additionally, the 7-mer and 6-mer are capable of promoting a sharp morphology transition of 22AG/K+ G-quadruplex.

  15. Evaluation of the effect of polymorphism on G-quadruplex-ligand interaction by means of spectroscopic and chromatographic techniques

    Science.gov (United States)

    Benito, S.; Ferrer, A.; Benabou, S.; Aviñó, A.; Eritja, R.; Gargallo, R.

    2018-05-01

    Guanine-rich sequences may fold into highly ordered structures known as G-quadruplexes. Apart from the monomeric G-quadruplex, these sequences may form multimeric structures that are not usually considered when studying interaction with ligands. This work studies the interaction of a ligand, crystal violet, with three guanine-rich DNA sequences with the capacity to form multimeric structures. These sequences correspond to short stretches found near the promoter regions of c-kit and SMARCA4 genes. Instrumental techniques (circular dichroism, molecular fluorescence, size-exclusion chromatography and electrospray ionization mass spectrometry) and multivariate data analysis were used for this purpose. The polymorphism of G-quadruplexes was characterized prior to the interaction studies. The ligand was shown to interact preferentially with the monomeric G-quadruplex; the binding stoichiometry was 1:1 and the binding constant was in the order of 105 M-1 for all three sequences. The results highlight the importance of DNA treatment prior to interaction studies.

  16. G-Quadruplex Identification in the Genome of Protozoan Parasites Points to Naphthalene Diimide Ligands as New Antiparasitic Agents.

    Science.gov (United States)

    Belmonte-Reche, Efres; Martínez-García, Marta; Guédin, Aurore; Zuffo, Michela; Arévalo-Ruiz, Matilde; Doria, Filippo; Campos-Salinas, Jenny; Maynadier, Marjorie; López-Rubio, José Juan; Freccero, Mauro; Mergny, Jean-Louis; Pérez-Victoria, José María; Morales, Juan Carlos

    2018-02-08

    G-quadruplexes (G4) are DNA secondary structures that take part in the regulation of gene expression. Putative G4 forming sequences (PQS) have been reported in mammals, yeast, bacteria, and viruses. Here, we present PQS searches on the genomes of T. brucei, L. major, and P. falciparum. We found telomeric sequences and new PQS motifs. Biophysical experiments showed that EBR1, a 29 nucleotide long highly repeated PQS in T. brucei, forms a stable G4 structure. G4 ligands based on carbohydrate conjugated naphthalene diimides (carb-NDIs) that bind G4's including hTel could bind EBR1 with selectivity versus dsDNA. These ligands showed important antiparasitic activity. IC 50 values were in the nanomolar range against T. brucei with high selectivity against MRC-5 human cells. Confocal microscopy confirmed these ligands localize in the nucleus and kinetoplast of T. brucei suggesting they can reach their potential G4 targets. Cytotoxicity and zebrafish toxicity studies revealed sugar conjugation reduces intrinsic toxicity of NDIs.

  17. A G-quadruplex-based Label-free Fluorometric Aptasensor for Adenosine Triphosphate Detection.

    Science.gov (United States)

    Li, Li Juan; Tian, Xue; Kong, Xiang Juan; Chu, Xia

    2015-01-01

    A G-quadruplex-based, label-free fluorescence assay was demonstrated for the detection of adenosine triphosphate (ATP). A double-stranded DNA (dsDNA), hybridized by ATP-aptamer and its complementary sequence, was employed as a substrate for ATP binding. SYBR Green I (SG I) was a fluorescent probe and exonuclease III (Exo III) was a nuclease to digest the dsDNA. Consequently, in the absence of ATP, the dsDNA was inset with SG I and was digested by Exo III, resulting in a low background signal. In the presence of ATP, the aptamer in dsDNA folded into a G-quadruplex structure that resisted the digestion of Exo III. SG I was inserted into the structure, showing high fluorescence. Owing to a decrease of the background noise, a high signal-to-noise ratio could be obtained. This sensor can detect ATP with a concentration ranging from 50 μM to 5 mM, and possesses a capacity for the sensitive determination of other targets.

  18. Transposable elements and G-quadruplexes

    Czech Academy of Sciences Publication Activity Database

    Kejnovský, Eduard; Tokan, Viktor; Lexa, M.

    2015-01-01

    Roč. 23, č. 3 (2015), s. 615-623 ISSN 0967-3849 R&D Projects: GA ČR(CZ) GA15-02891S Institutional support: RVO:68081707 Keywords : TRINUCLEOTIDE REPEAT DNA * LTR RETROTRANSPOSONS * BINDING PROTEIN Subject RIV: BO - Biophysics Impact factor: 2.590, year: 2015

  19. Quinone methides tethered to naphthalene diimides as selective G-quadruplex alkylating agents.

    Science.gov (United States)

    Di Antonio, Marco; Doria, Filippo; Richter, Sara N; Bertipaglia, Carolina; Mella, Mariella; Sissi, Claudia; Palumbo, Manlio; Freccero, Mauro

    2009-09-16

    We have developed novel G-quadruplex (G-4) ligand/alkylating hybrid structures, tethering the naphthalene diimide moiety to quaternary ammonium salts of Mannich bases, as quinone-methide precursors, activatable by mild thermal digestion (40 degrees C). The bis-substituted naphthalene diimides were efficiently synthesized, and their reactivity as activatable bis-alkylating agents was investigated in the presence of thiols and amines in aqueous buffered solutions. The electrophilic intermediate, quinone-methide, involved in the alkylation process was trapped, in the presence of ethyl vinyl ether, in a hetero Diels-Alder [4 + 2] cycloaddition reaction, yielding a substituted 2-ethoxychroman. The DNA recognition and alkylation properties of these new derivatives were investigated by gel electrophoresis, circular dichroism, and enzymatic assays. The alkylation process occurred preferentially on the G-4 structure in comparison to other DNA conformations. By dissecting reversible recognition and alkylation events, we found that the reversible process is a prerequisite to DNA alkylation, which in turn reinforces the G-quadruplex structural rearrangement.

  20. Detection of G-Quadruplex Structures Formed by G-Rich Sequences from Rice Genome and Transcriptome Using Combined Probes.

    Science.gov (United States)

    Chang, Tianjun; Li, Weiguo; Ding, Zhan; Cheng, Shaofei; Liang, Kun; Liu, Xiangjun; Bing, Tao; Shangguan, Dihua

    2017-08-01

    Putative G-quadruplex (G4) forming sequences (PQS) are highly prevalent in the genome and transcriptome of various organisms and are considered as potential regulation elements in many biological processes by forming G4 structures. The formation of G4 structures highly depends on the sequences and the environment. In most cases, it is difficult to predict G4 formation by PQS, especially PQS containing G2 tracts. Therefore, the experimental identification of G4 formation is essential in the study of G4-related biological functions. Herein, we report a rapid and simple method for the detection of G4 structures by using a pair of complementary reporters, hemin and BMSP. This method was applied to detect G4 structures formed by PQS (DNA and RNA) searched in the genome and transcriptome of Oryza sativa. Unlike most of the reported G4 probes that only recognize part of G4 structures, the proposed method based on combined probes positively responded to almost all G4 conformations, including parallel, antiparallel, and mixed/hybrid G4, but did not respond to non-G4 sequences. This method shows potential for high-throughput identification of G4 structures in genome and transcriptome. Furthermore, BMSP was observed to drive some PQS to form more stable G4 structures or induce the G4 formation of some PQS that cannot form G4 in normal physiological conditions, which may provide a powerful molecular tool for gene regulation.

  1. The G-quadruplex augments translation in the 5' untranslated region of transforming growth factor β2.

    Science.gov (United States)

    Agarwala, Prachi; Pandey, Satyaprakash; Mapa, Koyeli; Maiti, Souvik

    2013-03-05

    Transforming growth factor β2 (TGFβ2) is a versatile cytokine with a prominent role in cell migration, invasion, cellular development, and immunomodulation. TGFβ2 promotes the malignancy of tumors by inducing epithelial-mesenchymal transition, angiogenesis, and immunosuppression. As it is well-documented that nucleic acid secondary structure can regulate gene expression, we assessed whether any secondary motif regulates its expression at the post-transcriptional level. Bioinformatics analysis predicts an existence of a 23-nucleotide putative G-quadruplex sequence (PG4) in the 5' untranslated region (UTR) of TGFβ2 mRNA. The ability of this stretch of sequence to form a highly stable, intramolecular parallel quadruplex was demonstrated using ultraviolet and circular dichroism spectroscopy. Footprinting studies further validated its existence in the presence of a neighboring nucleotide sequence. Following structural characterization, we evaluated the biological relevance of this secondary motif using a dual luciferase assay. Although PG4 inhibits the expression of the reporter gene, its presence in the context of the entire 5' UTR sequence interestingly enhances gene expression. Mutation or removal of the G-quadruplex sequence from the 5' UTR of the gene diminished the level of expression of this gene at the translational level. Thus, here we highlight an activating role of the G-quadruplex in modulating gene expression of TGFβ2 at the translational level and its potential to be used as a target for the development of therapeutics against cancer.

  2. c-MYC G-quadruplex binding by the RNA polymerase I inhibitor BMH-21 and analogues revealed by a combined NMR and biochemical Approach.

    Science.gov (United States)

    Musso, Loana; Mazzini, Stefania; Rossini, Anna; Castagnoli, Lorenzo; Scaglioni, Leonardo; Artali, Roberto; Di Nicola, Massimo; Zunino, Franco; Dallavalle, Sabrina

    2018-03-01

    Pyridoquinazolinecarboxamides have been reported as RNA polymerase I inhibitors and represent a novel class of potential antitumor agents. BMH-21, was reported to intercalate with GC-rich rDNA, resulting in nucleolar stress as a primary mechanism of cytotoxicity. The interaction of BMH-21 and analogues with DNA G-quadruplex structures was studied by NMR and molecular modelling. The cellular response was investigated in a panel of human tumor cell lines and protein expression was examined by Western Blot analysis. We explored the ability of BMH-21 and its analogue 2 to bind to G-quadruplex present in the c-MYC promoter, by NMR and molecular modelling studies. We provide evidence that both compounds are not typical DNA intercalators but are effective binders of the tested G-quadruplex. The interaction with c-MYC G-quadruplex was reflected in down-regulation of c-Myc expression in human tumor cells. The inhibitory effect was almost complete in lymphoma cells SUDHL4 characterized by overexpression of c-Myc protein. This downregulation reflected an early and persistent modulation of cMyc mRNA. Given the relevance of c-MYC in regulation of ribosome biogenesis, it is conceivable that the inhibition of c-MYC contributes to the perturbation of nuclear functions and RNA polymerase I activity. Similar experiments with CX-5461, another RNA polymerase I transcription inhibitor, indicate the same behaviour in G-quadruplex stabilization. Our results support the hypothesis that BMH-21 and analogue compounds share the same mechanism, i.e. G-quadruplex binding as a primary event of a cascade leading to inhibition of RNA polymerase I and apoptosis. Copyright © 2017 Elsevier B.V. All rights reserved.

  3. Phenanthroline-2,9-bistriazoles as selective G-quadruplex ligands

    DEFF Research Database (Denmark)

    Nielsen, Mads Corvinius; Larsen, Anders Foller; Abdikadir, Faisal Hussein

    2014-01-01

    G-quadruplex (G4) ligands are currently receiving considerable attention as potential anticancer therapeutics. A series of phenanthroline-2,9-bistriazoles carrying tethered positive end groups has been synthesized and evaluated as G4 stabilizers. The compounds were efficiently assembled by copper......(I)-catalyzed azide-alkyne cycloaddition (CuAAC) in CH2Cl2 and water in the presence of a complexing agent. Characterization of the target compounds on telomeric and c-KIT G4 sequences led to the identification of guanidinium-substituted compounds as potent G4 DNA ligands with high selectivity over duplex DNA....... The diisopropylguanidium ligands exhibited high selectivity for the proto-oncogenic sequence c-KIT over the human telomeric sequence in the surface plasmon resonance (SPR) assay, whereas the compounds appeared potent on both G4 structures in the FRET melting temperature assay. The phenanthroline-2,9-bistriazole ligands...

  4. Tetrasubstituted phenanthrolines as highly potent, water-soluble, and selective g-quadruplex ligands

    DEFF Research Database (Denmark)

    Larsen, Anders Foller; Nielsen, Mads Corvinius; Ulven, Trond

    2012-01-01

    Small molecules capable of stabilizing the G-quadruplex (G4) structure are of interest for the development of improved anticancer drugs. Novel 4,7-diamino-substituted 1,10-phenanthroline-2,9-dicarboxamides that represent hybrid structures of known phenanthroline-based ligands have been designed....... An efficient synthetic route to the compounds has been developed and their interactions with various G4 sequences have been evaluated by Förster resonance energy transfer (FRET) melting assays, fluorescent intercalator displacement (FID), electrospray ionization mass spectrometry (ESI-MS), and circular...... dichroism (CD) spectroscopy. The preferred compounds have high aqueous solubility and are strong and potent G4 binders with a high selectivity over duplex DNA; thus, they represent a significant improvement over the lead compounds. Two of the compounds are inhibitors of HeLa and HT1080 cell proliferation....

  5. Colorimetric detection of genetically modified organisms based on exonuclease III-assisted target recycling and hemin/G-quadruplex DNAzyme amplification.

    Science.gov (United States)

    Zhang, Decai; Wang, Weijia; Dong, Qian; Huang, Yunxiu; Wen, Dongmei; Mu, Yuejing; Yuan, Yong

    2017-12-21

    An isothermal colorimetric method is described for amplified detection of the CaMV 35S promoter sequence in genetically modified organism (GMO). It is based on (a) target DNA-triggered unlabeled molecular beacon (UMB) termini binding, and (b) exonuclease III (Exo III)-assisted target recycling, and (c) hemin/G-quadruplex (DNAzyme) based signal amplification. The specific binding of target to the G-quadruplex sequence-locked UMB triggers the digestion of Exo III. This, in turn, releases an active G-quadruplex segment and target DNA for successive hybridization and cleavage. The Exo III impellent recycling of targets produces numerous G-quadruplex sequences. These further associate with hemin to form DNAzymes and hence will catalyze H 2 O 2 -mediated oxidation of the chromogenic enzyme substrate ABTS 2- causing the formation of a green colored product. This finding enables a sensitive colorimetric determination of GMO DNA (at an analytical wavelength of 420 nm) at concentrations as low as 0.23 nM. By taking advantage of isothermal incubation, this method does not require sophisticated equipment or complicated syntheses. Analyses can be performed within 90 min. The method also discriminates single base mismatches. In our perception, it has a wide scope in that it may be applied to the detection of many other GMOs. Graphical abstract An isothermal and sensitive colorimetric method is described for amplified detection of CaMV 35S promoter sequence in genetically modified organism (GMO). It is based on target DNA-triggered molecular beacon (UMB) termini-binding and exonuclease III assisted target recycling, and on hemin/G-quadruplex (DNAzyme) signal amplification.

  6. Use of alternative alkali chlorides in RT and PCR of polynucleotides containing G quadruplex structures.

    Science.gov (United States)

    Ramos-Alemán, Fabiola; González-Jasso, Eva; Pless, Reynaldo C

    2018-02-15

    Several alkali chlorides were compared for their use in reverse transcription (RT) and PCR of different types of nucleic acid templates. On a test region of biological DNA incapable of forming G quadruplex (G4) structures, Taq DNA polymerase showed similar PCR performance with 50 mM KCl, CsCl, LiCl, and NaCl. In contrast, on a synthetic model polydeoxyribonucleotide prone to G4 formation, good PCR amplification was obtained with 50 mM CsCl, but little or none with LiCl or KCl. Similarly, in RT of a G4-prone model polyribonucleotide, MMLV reverse transcriptase produced a good yield with 50 mM CsCl, mediocre yields with LiCl or without added alkali chloride, and a poor yield with 50 mM KCl. The full RT-PCR assay starting from the G4-prone polyribonucleotide, showed good results with CsCl in both stages, poor results with LiCl, and no product formation with KCl. The model polynucleotides showed fast G quadruplex formation under PCR or RT conditions with 50 mM KCl, but not with CsCl or LiCl. The results argue for the use of CsCl instead of KCl for RT and PCR of G4-prone sequences. No advantage was observed when using the 7-deaza type nucleotide analog c 7 dGTP in PCR amplification of the G4-prone polydeoxyribonucleotide. Copyright © 2017 Elsevier Inc. All rights reserved.

  7. Interaction of Pyrrolobenzodiazepine (PBD) Ligands with Parallel Intermolecular G-Quadruplex Complex Using Spectroscopy and ESI-MS

    Science.gov (United States)

    Raju, Gajjela; Srinivas, Ragampeta; Santhosh Reddy, Vangala; Idris, Mohammed M.; Kamal, Ahmed; Nagesh, Narayana

    2012-01-01

    Studies on ligand interaction with quadruplex DNA, and their role in stabilizing the complex at concentration prevailing under physiological condition, has attained high interest. Electrospray ionization mass spectrometry (ESI-MS) and spectroscopic studies in solution were used to evaluate the interaction of PBD and TMPyP4 ligands, stoichiometry and selectivity to G-quadruplex DNA. Two synthetic ligands from PBD family, namely pyrene-linked pyrrolo[2,1-c][1,4]benzodiazepine hybrid (PBD1), mixed imine-amide pyrrolobenzodiazepine dimer (PBD2) and 5,10,15,20-tetrakis(N-methyl-4-pyridyl)porphyrin (TMPyP4) were studied. G-rich single-stranded oligonucleotide d(5′GGGGTTGGGG3′) designated as d(T2G8), from the telomeric region of Tetrahymena Glaucoma, was considered for the interaction with ligands. ESI-MS and spectroscopic methods viz., circular dichroism (CD), UV-Visible, and fluorescence were employed to investigate the G-quadruplex structures formed by d(T2G8) sequence and its interaction with PBD and TMPyP4 ligands. From ESI-MS spectra, it is evident that the majority of quadruplexes exist as d(T2G8)2 and d(T2G8)4 forms possessing two to ten cations in the centre, thereby stabilizing the complex. CD band of PBD1 and PBD2 showed hypo and hyperchromicity, on interaction with quadruplex DNA, indicating unfolding and stabilization of quadruplex DNA complex, respectively. UV-Visible and fluorescence experiments suggest that PBD1 bind externally where as PBD2 intercalate moderately and bind externally to G-quadruplex DNA. Further, melting experiments using SYBR Green indicate that PBD1 unfolds and PBD2 stabilizes the G-quadruplex complex. ITC experiments using d(T2G8) quadruplex with PBD ligands reveal that PBD1 and PBD2 prefer external/loop binding and external/intercalative binding to quadruplex DNA, respectively. From experimental results it is clear that the interaction of PBD2 and TMPyP4 impart higher stability to the quadruplex complex. PMID:22558271

  8. Interaction of pyrrolobenzodiazepine (PBD ligands with parallel intermolecular G-quadruplex complex using spectroscopy and ESI-MS.

    Directory of Open Access Journals (Sweden)

    Gajjela Raju

    Full Text Available Studies on ligand interaction with quadruplex DNA, and their role in stabilizing the complex at concentration prevailing under physiological condition, has attained high interest. Electrospray ionization mass spectrometry (ESI-MS and spectroscopic studies in solution were used to evaluate the interaction of PBD and TMPyP4 ligands, stoichiometry and selectivity to G-quadruplex DNA. Two synthetic ligands from PBD family, namely pyrene-linked pyrrolo[2,1-c][1,4]benzodiazepine hybrid (PBD1, mixed imine-amide pyrrolobenzodiazepine dimer (PBD2 and 5,10,15,20-tetrakis(N-methyl-4-pyridylporphyrin (TMPyP4 were studied. G-rich single-stranded oligonucleotide d(5'GGGGTTGGGG3' designated as d(T(2G(8, from the telomeric region of Tetrahymena Glaucoma, was considered for the interaction with ligands. ESI-MS and spectroscopic methods viz., circular dichroism (CD, UV-Visible, and fluorescence were employed to investigate the G-quadruplex structures formed by d(T(2G(8 sequence and its interaction with PBD and TMPyP4 ligands. From ESI-MS spectra, it is evident that the majority of quadruplexes exist as d(T(2G(8(2 and d(T(2G(8(4 forms possessing two to ten cations in the centre, thereby stabilizing the complex. CD band of PBD1 and PBD2 showed hypo and hyperchromicity, on interaction with quadruplex DNA, indicating unfolding and stabilization of quadruplex DNA complex, respectively. UV-Visible and fluorescence experiments suggest that PBD1 bind externally where as PBD2 intercalate moderately and bind externally to G-quadruplex DNA. Further, melting experiments using SYBR Green indicate that PBD1 unfolds and PBD2 stabilizes the G-quadruplex complex. ITC experiments using d(T(2G(8 quadruplex with PBD ligands reveal that PBD1 and PBD2 prefer external/loop binding and external/intercalative binding to quadruplex DNA, respectively. From experimental results it is clear that the interaction of PBD2 and TMPyP4 impart higher stability to the quadruplex complex.

  9. Binding polarity of RPA to telomeric sequences and influence of G-quadruplex stability.

    Science.gov (United States)

    Safa, Layal; Delagoutte, Emmanuelle; Petruseva, Irina; Alberti, Patrizia; Lavrik, Olga; Riou, Jean-François; Saintomé, Carole

    2014-08-01

    Replication protein A (RPA) is a single-stranded DNA binding protein that plays an essential role in telomere maintenance. RPA binds to and unfolds G-quadruplex (G4) structures formed in telomeric DNA, thus facilitating lagging strand DNA replication and telomerase activity. To investigate the effect of G4 stability on the interactions with human RPA (hRPA), we used a combination of biochemical and biophysical approaches. Our data revealed an inverse relationship between G4 stability and ability of hRPA to bind to telomeric DNA; notably small G4 ligands that enhance G4 stability strongly impaired G4 unfolding by hRPA. To gain more insight into the mechanism of binding and unfolding of telomeric G4 structures by RPA, we carried out photo-crosslinking experiments to elucidate the spatial arrangement of the RPA subunits along the DNA strands. Our results showed that RPA1 and RPA2 are arranged from 5' to 3' along the unfolded telomeric G4, as already described for unstructured single-stranded DNA, while no contact is possible with RPA3 on this short oligonucleotide. In addition, these data are compatible with a 5' to 3' directionality in G4 unfolding by hRPA. Copyright © 2014 Elsevier Masson SAS. All rights reserved.

  10. Separation of the potential G-quadruplex ligands from the butanol extract of Zanthoxylum ailanthoides Sieb. & Zucc. by countercurrent chromatography and preparative high performance liquid chromatography.

    Science.gov (United States)

    Han, Tian; Cao, Xueli; Xu, Jing; Pei, Hairun; Zhang, Hong; Tang, Yalin

    2017-07-21

    G-quadruplex DNA structure is considered to be a very attractive target for antitumor drug design due to its unique role in maintaining telomerase activities. Therefore, discovering ligands with high stability of G-quadruplex structure is of great interest. In this paper, pH-zone refining counter current chromatography (CCC) and preparative high performance liquid chromatography (HPLC) were employed for the separation of potent G-quadruplex ligands from the n-butanol fraction of the crude extract of Zanthoxylum ailanthoides, which is a traditional Chinese medicine recently found to display high inhibitory activity against several human cancer cells. The 75% aqueous ethanol extract of the stem bark of Z. ailanthoides and its fractions with petroleum ether, ethyl acetate and n-butanol displayed almost the same G-quadruplex stabilization ability. Here, pH-zone refining CCC was used for the separation of the alkaloids from the n-butanol fraction by a seldom used solvent system composed of dichloromethane-methanol-water (4:1:2.5) with 10mM TEA in the organic stationary phase as retainer and 10mM HCl in the aqueous mobile phase as eluter. Compounds I, II and III were obtained, with purity greater than 95%, in the quantities of 31.2, 94.0, and 26.4mg respectively from 300mg of lipophilic fraction within 80min, which were identified as three tetrahydroprotoberberines isolated for the first time in this plant. In addition, a phenylpropanoid glycoside compound IV (Syringin), an isoquinoline (Magnoflorine, V), and two lignin isomers (+)-lyoniresiol-3α-O-β-d-glucopyranoside (VI) and (-)-lyoniresinol -3α-O-β-D -glucopyranoside (VII) were isolated by traditional CCC together with preparative HPLC. Compounds IV, V, VI and VII were obtained, with purity greater than 95%, in the quantities of 4.0, 13.2, 6.7, and 6.5mg respectively from 960mg of hydrophilic fraction. Among the seven isolated compounds, tetrahydroprotoberberine I, II and III were found to display remarkable

  11. Thermodynamic fingerprints of ligand binding to human telomeric G-quadruplexes.

    Science.gov (United States)

    Bončina, Matjaž; Podlipnik, Črtomir; Piantanida, Ivo; Eilmes, Julita; Teulade-Fichou, Marie-Paule; Vesnaver, Gorazd; Lah, Jurij

    2015-12-02

    Thermodynamic studies of ligand binding to human telomere (ht) DNA quadruplexes, as a rule, neglect the involvement of various ht-DNA conformations in the binding process. Therefore, the thermodynamic driving forces and the mechanisms of ht-DNA G-quadruplex-ligand recognition remain poorly understood. In this work we characterize thermodynamically and structurally binding of netropsin (Net), dibenzotetraaza[14]annulene derivatives (DP77, DP78), cationic porphyrin (TMPyP4) and two bisquinolinium ligands (Phen-DC3, 360A-Br) to the ht-DNA fragment (Tel22) AGGG(TTAGGG)3 using isothermal titration calorimetry, CD and fluorescence spectroscopy, gel electrophoresis and molecular modeling. By global thermodynamic analysis of experimental data we show that the driving forces characterized by contributions of specific interactions, changes in solvation and conformation differ significantly for binding of ligands with low quadruplex selectivity over duplexes (Net, DP77, DP78, TMPyP4; KTel22 ≈ KdsDNA). These contributions are in accordance with the observed structural features (changes) and suggest that upon binding Net, DP77, DP78 and TMPyP4 select hybrid-1 and/or hybrid-2 conformation while Phen-DC3 and 360A-Br induce the transition of hybrid-1 and hybrid-2 to the structure with characteristics of antiparallel or hybrid-3 type conformation. © The Author(s) 2015. Published by Oxford University Press on behalf of Nucleic Acids Research.

  12. G-quadruplex formation in telomeres enhances POT1/TPP1 protection against RPA binding

    Science.gov (United States)

    Ray, Sujay; Bandaria, Jigar N.; Qureshi, Mohammad H.; Yildiz, Ahmet; Balci, Hamza

    2014-01-01

    Human telomeres terminate with a single-stranded 3′ G overhang, which can be recognized as a DNA damage site by replication protein A (RPA). The protection of telomeres (POT1)/POT1-interacting protein 1 (TPP1) heterodimer binds specifically to single-stranded telomeric DNA (ssTEL) and protects G overhangs against RPA binding. The G overhang spontaneously folds into various G-quadruplex (GQ) conformations. It remains unclear whether GQ formation affects the ability of POT1/TPP1 to compete against RPA to access ssTEL. Using single-molecule Förster resonance energy transfer, we showed that POT1 stably loads to a minimal DNA sequence adjacent to a folded GQ. At 150 mM K+, POT1 loading unfolds the antiparallel GQ, as the parallel conformation remains folded. POT1/TPP1 loading blocks RPA’s access to both folded and unfolded telomeres by two orders of magnitude. This protection is not observed at 150 mM Na+, in which ssTEL forms only a less-stable antiparallel GQ. These results suggest that GQ formation of telomeric overhangs may contribute to suppression of DNA damage signals. PMID:24516170

  13. Conformation and stability of intramolecular telomeric G-quadruplexes: sequence effects in the loops.

    Directory of Open Access Journals (Sweden)

    Giovanna Sattin

    Full Text Available Telomeres are guanine-rich sequences that protect the ends of chromosomes. These regions can fold into G-quadruplex structures and their stabilization by G-quadruplex ligands has been employed as an anticancer strategy. Genetic analysis in human telomeres revealed extensive allelic variation restricted to loop bases, indicating that the variant telomeric sequences maintain the ability to fold into G-quadruplex. To assess the effect of mutations in loop bases on G-quadruplex folding and stability, we performed a comprehensive analysis of mutant telomeric sequences by spectroscopic techniques, molecular dynamics simulations and gel electrophoresis. We found that when the first position in the loop was mutated from T to C or A the resulting structure adopted a less stable antiparallel topology; when the second position was mutated to C or A, lower thermal stability and no evident conformational change were observed; in contrast, substitution of the third position from A to C induced a more stable and original hybrid conformation, while mutation to T did not significantly affect G-quadruplex topology and stability. Our results indicate that allelic variations generate G-quadruplex telomeric structures with variable conformation and stability. This aspect needs to be taken into account when designing new potential anticancer molecules.

  14. G Quadruplex in Plants: A Ubiquitous Regulatory Element and Its Biological Relevance.

    Science.gov (United States)

    Yadav, Vikas; Hemansi; Kim, Nayun; Tuteja, Narendra; Yadav, Puja

    2017-01-01

    G quadruplexes (G4) are higher-order DNA and RNA secondary structures formed by G-rich sequences that are built around tetrads of hydrogen-bonded guanine bases. Potential G4 quadruplex sequences have been identified in G-rich eukaryotic non-telomeric and telomeric genomic regions. Upon function, G4 formation is known to involve in chromatin remodeling, gene regulation and has been associated with genomic instability, genetic diseases and cancer progression. The natural role and biological validation of G4 structures is starting to be explored, and is of particular interest for the therapeutic interventions for human diseases. However, the existence and physiological role of G4 DNA and G4 RNA in plants species have not been much investigated yet and therefore, is of great interest for the development of improved crop varieties for sustainable agriculture. In this context, several recent studies suggests that these highly diverse G4 structures in plants can be employed to regulate expression of genes involved in several pathophysiological conditions including stress response to biotic and abiotic stresses as well as DNA damage. In the current review, we summarize the recent findings regarding the emerging functional significance of G4 structures in plants and discuss their potential value in the development of improved crop varieties.

  15. G Quadruplex in Plants: A Ubiquitous Regulatory Element and Its Biological Relevance

    Directory of Open Access Journals (Sweden)

    Vikas Yadav

    2017-07-01

    Full Text Available G quadruplexes (G4 are higher-order DNA and RNA secondary structures formed by G-rich sequences that are built around tetrads of hydrogen-bonded guanine bases. Potential G4 quadruplex sequences have been identified in G-rich eukaryotic non-telomeric and telomeric genomic regions. Upon function, G4 formation is known to involve in chromatin remodeling, gene regulation and has been associated with genomic instability, genetic diseases and cancer progression. The natural role and biological validation of G4 structures is starting to be explored, and is of particular interest for the therapeutic interventions for human diseases. However, the existence and physiological role of G4 DNA and G4 RNA in plants species have not been much investigated yet and therefore, is of great interest for the development of improved crop varieties for sustainable agriculture. In this context, several recent studies suggests that these highly diverse G4 structures in plants can be employed to regulate expression of genes involved in several pathophysiological conditions including stress response to biotic and abiotic stresses as well as DNA damage. In the current review, we summarize the recent findings regarding the emerging functional significance of G4 structures in plants and discuss their potential value in the development of improved crop varieties.

  16. Label-free logic modules and two-layer cascade based on stem-loop probes containing a G-quadruplex domain.

    Science.gov (United States)

    Guo, Yahui; Cheng, Junjie; Wang, Jine; Zhou, Xiaodong; Hu, Jiming; Pei, Renjun

    2014-09-01

    A simple, versatile, and label-free DNA computing strategy was designed by using toehold-mediated strand displacement and stem-loop probes. A full set of logic gates (YES, NOT, OR, NAND, AND, INHIBIT, NOR, XOR, XNOR) and a two-layer logic cascade were constructed. The probes contain a G-quadruplex domain, which was blocked or unfolded through inputs initiating strand displacement and the obviously distinguishable light-up fluorescent signal of G-quadruplex/NMM complex was used as the output readout. The inputs are the disease-specific nucleotide sequences with potential for clinic diagnosis. The developed versatile computing system based on our label-free and modular strategy might be adapted in multi-target diagnosis through DNA hybridization and aptamer-target interaction. © 2014 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  17. Expression of Telomere-Associated Proteins is Interdependent to Stabilize Native Telomere Structure and Telomere Dysfunction by G-Quadruplex Ligand Causes TERRA Upregulation.

    Science.gov (United States)

    Sadhukhan, Ratan; Chowdhury, Priyanka; Ghosh, Sourav; Ghosh, Utpal

    2018-06-01

    Telomere DNA can form specialized nucleoprotein structure with telomere-associated proteins to hide free DNA ends or G-quadruplex structures under certain conditions especially in presence of G-quadruplex ligand. Telomere DNA is transcribed to form non-coding telomere repeat-containing RNA (TERRA) whose biogenesis and function is poorly understood. Our aim was to find the role of telomere-associated proteins and telomere structures in TERRA transcription. We silenced four [two shelterin (TRF1, TRF2) and two non-shelterin (PARP-1, SLX4)] telomere-associated genes using siRNA and verified depletion in protein level. Knocking down of one gene modulated expression of other telomere-associated genes and increased TERRA from 10q, 15q, XpYp and XqYq chromosomes in A549 cells. Telomere was destabilized or damaged by G-quadruplex ligand pyridostatin (PDS) and bleomycin. Telomere dysfunction-induced foci (TIFs) were observed for each case of depletion of proteins, treatment with PDS or bleomycin. TERRA level was elevated by PDS and bleomycin treatment alone or in combination with depletion of telomere-associated proteins.

  18. Fully integrated graphene electronic biosensor for label-free detection of lead (II) ion based on G-quadruplex structure-switching.

    Science.gov (United States)

    Li, Yijun; Wang, Cheng; Zhu, Yibo; Zhou, Xiaohong; Xiang, Yu; He, Miao; Zeng, Siyu

    2017-03-15

    This work presents a fully integrated graphene field-effect transistor (GFET) biosensor for the label-free detection of lead ions (Pb 2+ ) in aqueous-media, which first implements the G-quadruplex structure-switching biosensing principle in graphene nanoelectronics. We experimentally illustrate the biomolecular interplay that G-rich DNA single-strands with one-end confined on graphene surface can specifically interact with Pb 2+ ions and switch into G-quadruplex structures. Since the structure-switching of electrically charged DNA strands can disrupt the charge distribution in the vicinity of graphene surface, the carrier equilibrium in graphene sheet might be altered, and manifested by the conductivity variation of GFET. The experimental data and theoretical analysis show that our devices are capable of the label-free and specific quantification of Pb 2+ with a detection limit down to 163.7ng/L. These results first verify the signaling principle competency of G-quadruplex structure-switching in graphene electronic biosensors. Combining with the advantages of the compact device structure and convenient electrical signal, a label-free GFET biosensor for Pb 2+ monitoring is enabled with promising application potential. Copyright © 2016 Elsevier B.V. All rights reserved.

  19. RPA-mediated unfolding of systematically varying G-quadruplex structures.

    Science.gov (United States)

    Ray, Sujay; Qureshi, Mohammad H; Malcolm, Dominic W; Budhathoki, Jagat B; Celik, Uğur; Balci, Hamza

    2013-05-21

    G-quadruplex (GQ) is a noncanonical nucleic acid structure that is formed by guanine rich sequences. Unless it is destabilized by proteins such as replication protein A (RPA), GQ could interfere with DNA metabolic functions, such as replication or repair. We studied RPA-mediated GQ unfolding using single-molecule FRET on two groups of GQ structures that have different loop lengths and different numbers of G-tetrad layers. We observed a linear increase in the steady-state stability of the GQ against RPA-mediated unfolding with increasing number of layers or decreasing loop length. The stability demonstrated by different GQ structures varied by at least three orders of magnitude. Those with shorter loops (less than three nucleotides long) or a greater number of layers (more than three layers) maintained a significant folded population even at physiological RPA concentration (≈1 μM), raising the possibility of physiological viability of such GQ structures. Finally, we measured the transition time between the start and end of the RPA-mediated GQ unfolding process to be 0.35 ± 0.10 s for all GQ constructs we studied, despite significant differences in their steady-state stabilities. We propose a two-step RPA-mediated GQ unfolding mechanism that is consistent with our observations. Copyright © 2013 Biophysical Society. Published by Elsevier Inc. All rights reserved.

  20. Modular Assembly of Cell-targeting Devices Based on an Uncommon G-quadruplex Aptamer

    Directory of Open Access Journals (Sweden)

    Felipe Opazo

    2015-01-01

    Full Text Available Aptamers are valuable tools that provide great potential to develop cost-effective diagnostics and therapies in the biomedical field. Here, we report a novel DNA aptamer that folds into an unconventional G-quadruplex structure able to recognize and enter specifically into human Burkitt's lymphoma cells. We further optimized this aptamer to a highly versatile and stable minimized version. The minimized aptamer can be easily equipped with different functionalities like quantum dots, organic dyes, or even a second different aptamer domain yielding a bi-paratopic aptamer. Although the target molecule of the aptamer remains unknown, our microscopy and pharmacological studies revealed that the aptamer hijacks the clathrin-mediated endocytosis pathway for its cellular internalization. We conclude that this novel class of aptamers can be used as a modular tool to specifically deliver different cargoes into malignant cells. This work provides a thorough characterization of the aptamer and we expect that our strategy will pave the path for future therapeutic applications.

  1. Computational Analysis of G-Quadruplex Forming Sequences across Chromosomes Reveals High Density Patterns Near the Terminal Ends.

    Directory of Open Access Journals (Sweden)

    Julia H Chariker

    Full Text Available G-quadruplex structures (G4 are found throughout the human genome and are known to play a regulatory role in a variety of molecular processes. Structurally, they have many configurations and can form from one or more DNA strands. At the gene level, they regulate gene expression and protein synthesis. In this paper, chromosomal-level patterns of distribution are analyzed on the human genome to identify high-level distribution patterns potentially related to global functional processes. Here we show unique high density banding patterns on individual chromosomes that are highly correlated, appearing in a mirror pattern, across forward and reverse DNA strands. The highest density of G4 sequences occurs within four megabases of one end of most chromosomes and contains G4 motifs that bind with zinc finger proteins. These findings suggest that G4 may play a role in global chromosomal processes such as those found in meiosis.

  2. Expanding the potential of G-quadruplex structures: formation of a heterochiral TBA analogue.

    Science.gov (United States)

    Virgilio, Antonella; Varra, Michela; Scuotto, Maria; Capuozzo, Antonella; Irace, Carlo; Mayol, Luciano; Esposito, Veronica; Galeone, Aldo

    2014-03-21

    In order to expand the potential applications of G-quadruplex structures, we explored the ability of heterochiral oligodeoxynucleotides based on the thrombin-binding aptamer (TBA) sequence to fold into similar complexes, with particular focus on their resistance in biological environments. A combination of CD and NMR techniques was used. Similarly to TBA, the ODN ggTTggtgtggTTgg (lower case letters indicate L residues) is able to fold into a chair-like antiparallel G-quadruplex structure, but has a slightly higher thermal stability. The discovery that heterochiral ODNs are able to form stable G-quadruplex structures opens up new possibilities for their development in several fields, as aptamers, sensors and, as recently shown, as catalysts for enantioselective reactions. © 2014 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  3. Exonuclease-assisted multicolor aptasensor for visual detection of ochratoxin A based on G-quadruplex-hemin DNAzyme-mediated etching of gold nanorod.

    Science.gov (United States)

    Yu, Xinhui; Lin, Yaohui; Wang, Xusheng; Xu, Liangjun; Wang, Zongwen; Fu, FengFu

    2018-04-21

    An exonuclease-assisted multicolor aptasensor was developed for the visual detection of ochratoxin A (OTA). It is based on the etching of gold nanorods (AuNRs) mediated by a G-quadruplex-hemin DNAzyme. A DNA sequence (AG4-OTA) was designed that comprises a hemin aptamer and an OTA aptamer. OTA binds to AG4-OTA to form an antiparallel G-quadruplex, which halts its digestion by exonuclease I (Exo I) from the 3'-end of AG4-OTA. Thus, the retained hemin aptamer can bind to hemin to form a G-quadruplex-hemin DNAzyme. This DNAzyme has peroxidase-like activity that catalyzes the oxidation of 3,3',5,5'-tetramethylbenzidine (TMB) by H 2 O 2 to produce its diimine derivative (TMB 2+ ) in acidic solution. TMB 2+ can etch the AuNRs by oxidizing Au(0) into Au(I). This results in the generation of rainbow-like colors and provides a multicolor platform for the visual detection of OTA. The assay is based on the use of a single isolated aptamer and possesses obvious advantages such as multi-color visual inspection, relatively high sensitivity and accuracy. It can be used to detect as little as 30 nM concentrations of OTA by visual observation and even 10 nM concentrations by spectrophotometry. The method was successfully applied to the determination of OTA in spiked beer where it gave recoveries of 101-108%, with a relative standard deviation (RSD, n = 5) of <5%. Graphical abstract Schematic of an exonuclease-assisted multicolor bioassay based on the G-quadruplex-hemin DNAzyme-mediated etching of gold nanorods (AuNRs). It enables visual detection of ochratoxin A (OTA) with a detection limit of 30 nM.

  4. Thioflavin T binds dimeric parallel-stranded GA-containing non-G-quadruplex DNAs: a general approach to lighting up double-stranded scaffolds.

    Science.gov (United States)

    Liu, Shuangna; Peng, Pai; Wang, Huihui; Shi, Lili; Li, Tao

    2017-12-01

    A molecular rotor thioflavin T (ThT) is usually used as a fluorescent ligand specific for G-quadruplexes. Here, we demonstrate that ThT can tightly bind non-G-quadruplex DNAs with several GA motifs and dimerize them in a parallel double-stranded mode, accompanied by over 100-fold enhancement in the fluorescence emission of ThT. The introduction of reverse Watson-Crick T-A base pairs into these dimeric parallel-stranded DNA systems remarkably favors the binding of ThT into the pocket between G•G and A•A base pairs, where ThT is encapsulated thereby restricting its two rotary aromatic rings in the excited state. A similar mechanism is also demonstrated in antiparallel DNA duplexes where several motifs of two consecutive G•G wobble base pairs are incorporated and serve as the active pockets for ThT binding. The insight into the interactions of ThT with non-G-quadruplex DNAs allows us to introduce a new concept for constructing DNA-based sensors and devices. As proof-of-concept experiments, we design a DNA triplex containing GA motifs in its Hoogsteen hydrogen-bonded two parallel strands as a pH-driven nanoswitch and two GA-containing parallel duplexes as novel metal sensing platforms where C-C and T-T mismatches are included. This work may find further applications in biological systems (e.g. disease gene detection) where parallel duplex or triplex stretches are involved. © The Author(s) 2017. Published by Oxford University Press on behalf of Nucleic Acids Research.

  5. p53 binds human telomeric G-quadruplex in vitro

    Czech Academy of Sciences Publication Activity Database

    Adámik, Matěj; Kejnovská, Iva; Bažantová, Pavla; Petr, Marek; Renčiuk, Daniel; Vorlíčková, Michaela; Brázdová, Marie

    2016-01-01

    Roč. 128, SEPT2016 (2016), s. 83-91 ISSN 0300-9084 R&D Projects: GA ČR GA13-36108S; GA ČR(CZ) GP14-33947P Institutional support: RVO:68081707 Keywords : crystal-structure * human-chromosomes * supercoiled dna Subject RIV: BO - Biophysics Impact factor: 3.112, year: 2016

  6. A G-quadruplex-containing RNA activates fluorescence in a GFP-like fluorophore

    Energy Technology Data Exchange (ETDEWEB)

    Huang, Hao; Suslov, Nikolai B.; Li, Nan-Sheng; Shelke, Sandip A.; Evans, Molly E.; Koldobskaya, Yelena; Rice, Phoebe A.; Piccirilli, Joseph A. [UC

    2014-08-21

    Spinach is an in vitro–selected RNA aptamer that binds a GFP-like ligand and activates its green fluorescence. Spinach is thus an RNA analog of GFP and has potentially widespread applications for in vivo labeling and imaging. We used antibody-assisted crystallography to determine the structures of Spinach both with and without bound fluorophore at 2.2-Å and 2.4-Å resolution, respectively. Spinach RNA has an elongated structure containing two helical domains separated by an internal bulge that folds into a G-quadruplex motif of unusual topology. The G-quadruplex motif and adjacent nucleotides comprise a partially preformed binding site for the fluorophore. The fluorophore binds in a planar conformation and makes extensive aromatic stacking and hydrogen bond interactions with the RNA. Our findings provide a foundation for structure-based engineering of new fluorophore-binding RNA aptamers.

  7. Effect of Monovalent Ion Parameters on Molecular Dynamics Simulations of G-Quadruplexes

    Czech Academy of Sciences Publication Activity Database

    Havrila, Marek; Stadlbauer, Petr; Islam, Barira; Otyepka, M.; Šponer, Jiří

    2017-01-01

    Roč. 13, č. 8 (2017), s. 3911-3926 ISSN 1549-9618 R&D Projects: GA MŠk EF15_003/0000477; GA ČR(CZ) GA16-13721S Institutional support: RVO:68081707 Keywords : telomeric g-quadruplex * amber force-field * nucleic-acid quadruplexes Subject RIV: CF - Physical ; Theoretical Chemistry OBOR OECD: Physical chemistry Impact factor: 5.245, year: 2016

  8. A mRNA-Responsive G-Quadruplex-Based Drug Release System

    Directory of Open Access Journals (Sweden)

    Hidenobu Yaku

    2015-04-01

    Full Text Available G-quadruplex-based drug delivery carriers (GDDCs were designed to capture and release a telomerase inhibitor in response to a target mRNA. Hybridization between a loop on the GDDC structure and the mRNA should cause the G-quadruplex structure of the GDDC to unfold and release the bound inhibitor, anionic copper(II phthalocyanine (CuAPC. As a proof of concept, GDDCs were designed with a 10-30-mer loop, which can hybridize with a target sequence in epidermal growth factor receptor (EGFR mRNA. Structural analysis using circular dichroism (CD spectroscopy showed that the GDDCs form a (3 + 1 type G-quadruplex structure in 100 mM KCl and 10 mM MgCl2 in the absence of the target RNA. Visible absorbance titration experiments showed that the GDDCs bind to CuAPC with Ka values of 1.5 × 105 to 5.9 × 105 M−1 (Kd values of 6.7 to 1.7 μM at 25 °C, depending on the loop length. Fluorescence titration further showed that the G-quadruplex structure unfolds upon binding to the target RNA with Ka values above 1.0 × 108 M−1 (Kd values below 0.01 μM at 25 °C. These results suggest the carrier can sense and bind to the target RNA, which should result in release of the bound drug. Finally, visible absorbance titration experiments demonstrated that the GDDC release CuAPC in response to the target RNA.

  9. Sugar-modified G-quadruplexes: effects of LNA-, 2′F-RNA– and 2′F-ANA-guanosine chemistries on G-quadruplex structure and stability

    Science.gov (United States)

    Li, Zhe; Lech, Christopher Jacques; Phan, Anh Tuân

    2014-01-01

    G-quadruplex-forming oligonucleotides containing modified nucleotide chemistries have demonstrated promising pharmaceutical potential. In this work, we systematically investigate the effects of sugar-modified guanosines on the structure and stability of a (4+0) parallel and a (3+1) hybrid G-quadruplex using over 60 modified sequences containing a single-position substitution of 2′-O-4′-C-methylene-guanosine (LNAG), 2′-deoxy-2′-fluoro-riboguanosine (FG) or 2′-deoxy-2′-fluoro-arabinoguanosine (FANAG). Our results are summarized in two parts: (I) Generally, LNAG substitutions into ‘anti’ position guanines within a guanine-tetrad lead to a more stable G-quadruplex, while substitutions into ‘syn’ positions disrupt the native G-quadruplex conformation. However, some interesting exceptions to this trend are observed. We discover that a LNAG modification upstream of a short propeller loop hinders G-quadruplex formation. (II) A single substitution of either FG or FANAG into a ‘syn’ position is powerful enough to perturb the (3+1) G-quadruplex. Substitution of either FG or FANAG into any ‘anti’ position is well tolerated in the two G-quadruplex scaffolds. FANAG substitutions to ‘anti’ positions are better tolerated than their FG counterparts. In both scaffolds, FANAG substitutions to the central tetrad layer are observed to be the most stabilizing. The observations reported herein on the effects of LNAG, FG and FANAG modifications on G-quadruplex structure and stability will enable the future design of pharmaceutically relevant oligonucleotides. PMID:24371274

  10. Inverting the G-Tetrad Polarity of a G-Quadruplex by Using Xanthine and 8-Oxoguanine.

    Science.gov (United States)

    Cheong, Vee Vee; Lech, Christopher Jacques; Heddi, Brahim; Phan, Anh Tuân

    2016-01-04

    G-quadruplexes are four-stranded nucleic acid structures that are built from consecutively stacked guanine tetrad (G-tetrad) assemblies. The simultaneous incorporation of two guanine base lesions, xanthine (X) and 8-oxoguanine (O), within a single G-tetrad of a G-quadruplex was recently shown to lead to the formation of a stable G⋅G⋅X⋅O tetrad. Herein, a judicious introduction of X and O into a human telomeric G-quadruplex-forming sequence is shown to reverse the hydrogen-bond polarity of the modified G-tetrad while preserving the original folding topology. The control exerted over G-tetrad polarity by joint X⋅O modification will be valuable for the design and programming of G-quadruplex structures and their properties. © 2016 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  11. Behavior of the guanine base in G-quadruplexes probed by the fluorescent guanine analog, 6-methyl isozanthopterin

    Energy Technology Data Exchange (ETDEWEB)

    Han, Ji Hoon; Chitrapriya, Nataraj; Lee, Hyun Suk; Lee, Young Ae; Kim, Seog K. [Dept. of Chemistry, Yeungnam University, Gyeongsan (Korea, Republic of); Jung, Maeng Joon [Dept. of Chemistry, Kyungpook National University, Daegu (Korea, Republic of)

    2017-02-15

    In this study, circular dichroism (CD) spectrum and fluorescence techniques were used to examine the dynamic properties and microenvironment of the guanine base (G) at the central loop and at the middle of the G-stem of the G-quadruplex formed from the G{sub 3}T{sub 2}G{sub 3}TGTG{sub 3}T{sub 2}G{sub 3} sequence (G-quadruplex 1), in which the G base at the 10th and 13th position were replaced with a fluorescent G analog, 6-methyl isoxanthopterin (6MI) (G-quadruplex 2 and 3, respectively). For all G-quadruplexes, the CD spectrum revealed a positive band at 263 nm and a shoulder at 298 nm, and the thermal melting profiles were the sum of at least two sigmoidal curves. These observations indicated the presence of two conformers in the G-quadruplex. The fluorescence intensity of G-quadruplex 2 was greater than 3, as expected from the extent of stacking interaction, which is larger in the G(6MI)G sequence than the T(6MI)T sequence. The efficiency of fluorescence quenching by the polar acrylamide quencher and negatively charged I− quencher were larger for G-quadruplex 3, suggesting that 6MI in the G(6MI)G stem is exposed more to the aqueous environment compared to that in the T(6MI)T central loop. In the latter case, 6MI may direct to the center of the top G-quartet layer. The possibility of hydrogen bond formation between the carbonyl group of 6MI and the acrylamide of the G-quadruplex 3 was proposed.

  12. Design, synthesis and evaluation of 4,7-diamino-1,10-phenanthroline G-quadruplex ligands

    DEFF Research Database (Denmark)

    Nielsen, Mads Corvinius; Borch, Jonas; Ulven, Trond

    2009-01-01

    the central ionic column. Introduction of positively charged side chains results in compounds with appreciable G-quadruplex stabilizing properties and high aqueous solubility, with the longer side chains giving more potent compounds. Ligands carrying guanidine side chains in general show higher quadruplex...... stabilizing activity and distinctly slower kinetic properties than their amino and dimethylamino analogues, possibly due to specific hydrogen bond interactions with the G-quadruplex loops....

  13. Label-Free and Ultrasensitive Biomolecule Detection Based on Aggregation Induced Emission Fluorogen via Target-Triggered Hemin/G-Quadruplex-Catalyzed Oxidation Reaction.

    Science.gov (United States)

    Li, Haiyin; Chang, Jiafu; Gai, Panpan; Li, Feng

    2018-02-07

    Fluorescence biosensing strategy has drawn substantial attention due to their advantages of simplicity, convenience, sensitivity, and selectivity, but unsatisfactory structure stability, low fluorescence quantum yield, high cost of labeling, and strict reaction conditions associated with current fluorescence methods severely prohibit their potential application. To address these challenges, we herein propose an ultrasensitive label-free fluorescence biosensor by integrating hemin/G-quadruplex-catalyzed oxidation reaction with aggregation induced emission (AIE) fluorogen-based system. l-Cysteine/TPE-M, which is carefully and elaborately designed and developed, obviously contributes to strong fluorescence emission. In the presence of G-rich DNA along with K + and hemin, efficient destruction of l-cysteine occurs due to hemin/G-quadruplex-catalyzed oxidation reactions. As a result, highly sensitive fluorescence detection of G-rich DNA is readily realized, with a detection limit down to 33 pM. As a validation for the further development of the proposed strategy, we also successfully construct ultrasensitive platforms for microRNA by incorporating the l-cysteine/TPE-M system with target-triggered cyclic amplification reaction. Thus, this proposed strategy is anticipated to find use in basic biochemical research and clinical diagnosis.

  14. The binding efficiency of RPA to telomeric G-strands folded into contiguous G-quadruplexes is independent of the number of G4 units.

    Science.gov (United States)

    Lancrey, Astrid; Safa, Layal; Chatain, Jean; Delagoutte, Emmanuelle; Riou, Jean-François; Alberti, Patrizia; Saintomé, Carole

    2018-03-01

    Replication protein A (RPA) is a single-stranded DNA binding protein involved in replication and in telomere maintenance. During telomere replication, G-quadruplexes (G4) can accumulate on the lagging strand template and need to be resolved. It has been shown that human RPA is able to unfold a single G4. Nevertheless, the G-strand of human telomeres is prone to fold into higher-order structures formed by contiguous G-quadruplexes. To understand how RPA deals with these structures, we studied its interaction with telomeric G-strands folding into an increasing number of contiguous G4s. The aim of this study was to determine whether the efficiency of binding/unfolding of hRPA to telomeric G-strands depends on the number of G4 units. Our data show that the number n of contiguous G4 units (n ≥ 2) does not affect the efficiency of hRPA to coat transiently exposed single-stranded telomeric G-strands. This feature may be essential in preventing instability due to G4 structures during telomere replication. Copyright © 2017 Elsevier B.V. and Société Française de Biochimie et Biologie Moléculaire (SFBBM). All rights reserved.

  15. Transcription arrest by a G quadruplex forming-trinucleotide repeat sequence from the human c-myb gene.

    Science.gov (United States)

    Broxson, Christopher; Beckett, Joshua; Tornaletti, Silvia

    2011-05-17

    Non canonical DNA structures correspond to genomic regions particularly susceptible to genetic instability. The transcription process facilitates formation of these structures and plays a major role in generating the instability associated with these genomic sites. However, little is known about how non canonical structures are processed when encountered by an elongating RNA polymerase. Here we have studied the behavior of T7 RNA polymerase (T7RNAP) when encountering a G quadruplex forming-(GGA)(4) repeat located in the human c-myb proto-oncogene. To make direct correlations between formation of the structure and effects on transcription, we have taken advantage of the ability of the T7 polymerase to transcribe single-stranded substrates and of G4 DNA to form in single-stranded G-rich sequences in the presence of potassium ions. Under physiological KCl concentrations, we found that T7 RNAP transcription was arrested at two sites that mapped to the c-myb (GGA)(4) repeat sequence. The extent of arrest did not change with time, indicating that the c-myb repeat represented an absolute block and not a transient pause to T7 RNAP. Consistent with G4 DNA formation, arrest was not observed in the absence of KCl or in the presence of LiCl. Furthermore, mutations in the c-myb (GGA)(4) repeat, expected to prevent transition to G4, also eliminated the transcription block. We show T7 RNAP arrest at the c-myb repeat in double-stranded DNA under conditions mimicking the cellular concentration of biomolecules and potassium ions, suggesting that the G4 structure formed in the c-myb repeat may represent a transcription roadblock in vivo. Our results support a mechanism of transcription-coupled DNA repair initiated by arrest of transcription at G4 structures.

  16. Structure and possible function of a G-quadruplex in the long terminal repeat of the proviral HIV-1 genome.

    Science.gov (United States)

    De Nicola, Beatrice; Lech, Christopher J; Heddi, Brahim; Regmi, Sagar; Frasson, Ilaria; Perrone, Rosalba; Richter, Sara N; Phan, Anh Tuân

    2016-07-27

    The long terminal repeat (LTR) of the proviral human immunodeficiency virus (HIV)-1 genome is integral to virus transcription and host cell infection. The guanine-rich U3 region within the LTR promoter, previously shown to form G-quadruplex structures, represents an attractive target to inhibit HIV transcription and replication. In this work, we report the structure of a biologically relevant G-quadruplex within the LTR promoter region of HIV-1. The guanine-rich sequence designated LTR-IV forms a well-defined structure in physiological cationic solution. The nuclear magnetic resonance (NMR) structure of this sequence reveals a parallel-stranded G-quadruplex containing a single-nucleotide thymine bulge, which participates in a conserved stacking interaction with a neighboring single-nucleotide adenine loop. Transcription analysis in a HIV-1 replication competent cell indicates that the LTR-IV region may act as a modulator of G-quadruplex formation in the LTR promoter. Consequently, the LTR-IV G-quadruplex structure presented within this work could represent a valuable target for the design of HIV therapeutics. © The Author(s) 2016. Published by Oxford University Press on behalf of Nucleic Acids Research.

  17. Nucleotide Pool Depletion Induces G-Quadruplex-Dependent Perturbation of Gene Expression

    Directory of Open Access Journals (Sweden)

    Charikleia Papadopoulou

    2015-12-01

    Full Text Available Nucleotide pool imbalance has been proposed to drive genetic instability in cancer. Here, we show that slowing replication forks by depleting nucleotide pools with hydroxyurea (HU can also give rise to both transient and permanent epigenetic instability of a reporter locus, BU-1, in DT40 cells. HU induces stochastic formation of Bu-1low variants in dividing cells, which have lost the H3K4me3 present in untreated cells. This instability is potentiated by an intragenic G quadruplex, which also promotes local H2Ax phosphorylation and transient heterochromatinization. Genome-wide, gene expression changes induced by HU significantly overlap with those resulting from loss of the G4-helicases FANCJ, WRN, and BLM. Thus, the effects of global replication stress induced by nucleotide pool depletion can be focused by local replication impediments caused by G quadruplex formation to induce epigenetic instability and changes in gene expression, a mechanism that may contribute to selectable transcriptional changes in cancer.

  18. TMPyP4 porphyrin distorts RNA G-quadruplex structures of the disease-associated r(GGGGCC)n repeat of the C9orf72 gene and blocks interaction of RNA-binding proteins.

    Science.gov (United States)

    Zamiri, Bita; Reddy, Kaalak; Macgregor, Robert B; Pearson, Christopher E

    2014-02-21

    Certain DNA and RNA sequences can form G-quadruplexes, which can affect genetic instability, promoter activity, RNA splicing, RNA stability, and neurite mRNA localization. Amyotrophic lateral sclerosis and frontotemporal dementia can be caused by expansion of a (GGGGCC)n repeat in the C9orf72 gene. Mutant r(GGGGCC)n- and r(GGCCCC)n-containing transcripts aggregate in nuclear foci, possibly sequestering repeat-binding proteins such as ASF/SF2 and hnRNPA1, suggesting a toxic RNA pathogenesis, as occurs in myotonic dystrophy. Furthermore, the C9orf72 repeat RNA was recently demonstrated to undergo the noncanonical repeat-associated non-AUG translation (RAN translation) into pathologic dipeptide repeats in patient brains, a process that is thought to depend upon RNA structure. We previously demonstrated that the r(GGGGCC)n RNA forms repeat tract length-dependent G-quadruplex structures that bind the ASF/SF2 protein. Here we show that the cationic porphyrin (5,10,15,20-tetra(N-methyl-4-pyridyl) porphyrin (TMPyP4)), which can bind some G-quadruplex-forming sequences, can bind and distort the G-quadruplex formed by r(GGGGCC)8, and this ablates the interaction of either hnRNPA1 or ASF/SF2 with the repeat. These findings provide proof of concept that nucleic acid binding small molecules, such as TMPyP4, can distort the secondary structure of the C9orf72 repeat, which may beneficially disrupt protein interactions, which may ablate either protein sequestration and/or RAN translation into potentially toxic dipeptides. Disruption of secondary structure formation of the C9orf72 RNA repeats may be a viable therapeutic avenue, as well as a means to test the role of RNA structure upon RAN translation.

  19. Hsa-miR-1587 G-quadruplex formation and dimerization induced by NH4+, molecular crowding environment and jatrorrhizine derivatives.

    Science.gov (United States)

    Tan, Wei; Yi, Long; Zhu, Zhentao; Zhang, Lulu; Zhou, Jiang; Yuan, Gu

    2018-03-01

    A guanine-rich human mature microRNA, miR-1587, was discovered to form stable intramolecular G-quadruplexes in the presence of K + , Na + and low concentration of NH 4 + (25mM) by electrospray ionization mass spectrometry (ESI-MS) combined with circular dichroism (CD) spectroscopy. Furthermore, under high concentration of NH 4 + (100mM) or molecular crowding environments, miR-1587 formed a dimeric G-quadruplex through 3'-to-3' stacking of two monomeric G-quadruplex subunits with one ammonium ion sandwiched between the interfaces. Specifically, two synthesized jatrorrhizine derivatives with terminal amine groups could also induce the dimerization of miR-1587 G-quadruplex and formed 1:1 and 2:1 complexes with the dimeric G-quadruplex. In contrast, jatrorrhizine could bind with the dimeric miR-1587 G-quadruplex, but could not induce dimerization of miR-1587 G-quadruplex. These results provide a new strategy to regulate the functions of miR-1587 through induction of G-quadruplex formation and dimerization. Copyright © 2017 Elsevier B.V. All rights reserved.

  20. Surface Plasmon Resonance kinetic analysis of the interaction between G-quadruplex nucleic acids and an anti-G-quadruplex monoclonal antibody.

    Science.gov (United States)

    Lago, Sara; Nadai, Matteo; Rossetto, Monica; Richter, Sara N

    2018-06-01

    G-quadruplexes (G4s) are nucleic acids secondary structures formed in guanine-rich sequences. Anti-G4 antibodies represent a tool for the direct investigation of G4s in cells. Surface Plasmon Resonance (SPR) is a highly sensitive technology, suitable for assessing the affinity between biomolecules. We here aimed at improving the orientation of an anti-G4 antibody on the SPR sensor chip to optimize detection of binding antigens. SPR was employed to characterize the anti-G4 antibody interaction with G4 and non-G4 oligonucleotides. Dextran-functionalized sensor chips were used both in covalent coupling and capturing procedures. The use of two leading molecule for orienting the antibody of interest allowed to improve its activity from completely non-functional to 65% active. The specificity of the anti-G4 antobody for G4 structures could thus be assessed with high sensitivity and reliability. Optimization of the immobilization protocol for SPR biosensing, allowed us to determine the anti-G4 antibody affinity and specificity for G4 antigens with higher sensitivity with respect to other in vitro assays such as ELISA. Anti-G4 antibody specificity is a fundamental assumption for the future utilization of this kind of antibodies for monitoring G4s directly in cells. The heterogeneous orientation of amine-coupling immobilized ligands is a general problem that often leads to partial or complete inactivation of the molecules. Here we describe a new strategy for improving ligand orientation: driving it from two sides. This principle can be virtually applied to every molecule that loses its activity or is poorly immobilized after standard coupling to the SPR chip surface. Copyright © 2018 The Authors. Published by Elsevier B.V. All rights reserved.

  1. Development of an Efficient G-Quadruplex-Stabilised Thrombin-Binding Aptamer Containing a Three-Carbon Spacer Molecule

    DEFF Research Database (Denmark)

    Aaldering, Lukas J.; Poongavanam, Vasanthanathan; Langkjær, Niels

    2017-01-01

    The thrombin-binding aptamer (TBA), which shows anticoagulant properties, is one of the most studied G-quadruplex-forming aptamers. In this study, we investigated the impact of different chemical modifications such as a three-carbon spacer (spacer-C3), unlocked nucleic acid (UNA) and 3′-amino-mod...

  2. Structure variations of TBA G-quadruplex induced by 2'-O-methyl nucleotide in K+ and Ca2+ environments.

    Science.gov (United States)

    Zhao, Xiaoyang; Liu, Bo; Yan, Jing; Yuan, Ying; An, Liwen; Guan, Yifu

    2014-10-01

    Thrombin binding aptamer (TBA), a 15-mer oligonucleotide of d(GGTTGGTGTGGTTGG) sequence, folds into a chair-type antiparallel G-quadruplex in the K(+) environment, and each of two G-tetrads is characterized by a syn-anti-syn-anti glycosidic conformation arrangement. To explore its folding topology and structural stability, 2'-O-methyl nucleotide (OMe) with the C3'-endo sugar pucker conformation and anti glycosidic angle was used to selectively substitute for the guanine residues of G-tetrads of TBA, and these substituted TBAs were characterized using a circular dichroism spectrum, thermally differential spectrum, ultraviolet stability analysis, electrophoresis mobility shift assay, and thermodynamic analysis in K(+) and Ca(2+) environments. Results showed that single substitutions for syn-dG residues destabilized the G-quadruplex structure, while single substitutions for anti-dG residues could preserve the G-quadruplex in the K(+) environment. When one or two G-tetrads were modified with OMe, TBA became unstructured. In contrast, in Ca(2+) environment, the native TBA appeared to be unstructured. When two G-tetrads were substituted with OMe, TBA seemed to become a more stable parallel G-4 structure. Further thermodynamic data suggested that OMe-substitutions were an enthalpy-driven event. The results in this study enrich our understanding about the effects of nucleotide derivatives on the G-quadruplex structure stability in different ionic environments, which will help to design G-quadruplex for biological and medical applications. © The Author 2014. Published by ABBS Editorial Office in association with Oxford University Press on behalf of the Institute of Biochemistry and Cell Biology, Shanghai Institutes for Biological Sciences, Chinese Academy of Sciences.

  3. Formation of a unique cluster of G-quadruplex structures in the HIV-1 Nef coding region: implications for antiviral activity.

    Directory of Open Access Journals (Sweden)

    Rosalba Perrone

    Full Text Available G-quadruplexes are tetraplex structures of nucleic acids that can form in G-rich sequences. Their presence and functional role have been established in telomeres, oncogene promoters and coding regions of the human chromosome. In particular, they have been proposed to be directly involved in gene regulation at the level of transcription. Because the HIV-1 Nef protein is a fundamental factor for efficient viral replication, infectivity and pathogenesis in vitro and in vivo, we investigated G-quadruplex formation in the HIV-1 nef gene to assess the potential for viral inhibition through G-quadruplex stabilization. A comprehensive computational analysis of the nef coding region of available strains showed the presence of three conserved sequences that were uniquely clustered. Biophysical testing proved that G-quadruplex conformations were efficiently stabilized or induced by G-quadruplex ligands in all three sequences. Upon incubation with a G-quadruplex ligand, Nef expression was reduced in a reporter gene assay and Nef-dependent enhancement of HIV-1 infectivity was significantly repressed in an antiviral assay. These data constitute the first evidence of the possibility to regulate HIV-1 gene expression and infectivity through G-quadruplex targeting and therefore open a new avenue for viral treatment.

  4. Characterizing and controlling intrinsic biases of lambda exonuclease in nascent strand sequencing reveals phasing between nucleosomes and G-quadruplex motifs around a subset of human replication origins

    DEFF Research Database (Denmark)

    Foulk, M. S.; Urban, J. M.; Casella, Cinzia

    2015-01-01

    Nascent strand sequencing (NS-seq) is used to discover DNA replication origins genome-wide, allowing identification of features for their specification. NS-seq depends on the ability of lambda exonuclease (lambda-exo) to efficiently digest parental DNA while leaving RNA-primer protected nascent...... strands intact. We used genomics and biochemical approaches to determine if lambda-exo digests all parental DNA sequences equally. We report that lambda-exo does not efficiently digest G-quadruplex (G4) structures in a plasmid. Moreover, lambda-exo digestion of nonreplicating genomic DNA (LexoG0) enriches...... GC-rich DNA and G4 motifs genome-wide. We used LexoG0 data to control for nascent strand-independent lambda-exo biases in NSseq and validated this approach at the rDNA locus. The lambda-exo-controlled NS-seq peaks are not GC-rich, and only 35.5% overlap with 6.8% of all G4s, suggesting that G4s...

  5. Giardia telomeric sequence d(TAGGG)4 forms two intramolecular G-quadruplexes in K+ solution: effect of loop length and sequence on the folding topology.

    Science.gov (United States)

    Hu, Lanying; Lim, Kah Wai; Bouaziz, Serge; Phan, Anh Tuân

    2009-11-25

    Recently, it has been shown that in K(+) solution the human telomeric sequence d[TAGGG(TTAGGG)(3)] forms a (3 + 1) intramolecular G-quadruplex, while the Bombyx mori telomeric sequence d[TAGG(TTAGG)(3)], which differs from the human counterpart only by one G deletion in each repeat, forms a chair-type intramolecular G-quadruplex, indicating an effect of G-tract length on the folding topology of G-quadruplexes. To explore the effect of loop length and sequence on the folding topology of G-quadruplexes, here we examine the structure of the four-repeat Giardia telomeric sequence d[TAGGG(TAGGG)(3)], which differs from the human counterpart only by one T deletion within the non-G linker in each repeat. We show by NMR that this sequence forms two different intramolecular G-quadruplexes in K(+) solution. The first one is a novel basket-type antiparallel-stranded G-quadruplex containing two G-tetrads, a G x (A-G) triad, and two A x T base pairs; the three loops are consecutively edgewise-diagonal-edgewise. The second one is a propeller-type parallel-stranded G-quadruplex involving three G-tetrads; the three loops are all double-chain-reversal. Recurrence of several structural elements in the observed structures suggests a "cut and paste" principle for the design and prediction of G-quadruplex topologies, for which different elements could be extracted from one G-quadruplex and inserted into another.

  6. Fragile X mental retardation protein recognizes a G quadruplex structure within the survival motor neuron domain containing 1 mRNA 5'-UTR.

    Science.gov (United States)

    McAninch, Damian S; Heinaman, Ashley M; Lang, Cara N; Moss, Kathryn R; Bassell, Gary J; Rita Mihailescu, Mihaela; Evans, Timothy L

    2017-07-25

    G quadruplex structures have been predicted by bioinformatics to form in the 5'- and 3'-untranslated regions (UTRs) of several thousand mature mRNAs and are believed to play a role in translation regulation. Elucidation of these roles has primarily been focused on the 3'-UTR, with limited focus on characterizing the G quadruplex structures and functions in the 5'-UTR. Investigation of the affinity and specificity of RNA binding proteins for 5'-UTR G quadruplexes and the resulting regulatory effects have also been limited. Among the mRNAs predicted to form a G quadruplex structure within the 5'-UTR is the survival motor neuron domain containing 1 (SMNDC1) mRNA, encoding a protein that is critical to the spliceosome. Additionally, this mRNA has been identified as a potential target of the fragile X mental retardation protein (FMRP), whose loss of expression leads to fragile X syndrome. FMRP is an RNA binding protein involved in translation regulation that has been shown to bind mRNA targets that form G quadruplex structures. In this study we have used biophysical methods to investigate G quadruplex formation in the 5'-UTR of SMNDC1 mRNA and analyzed its interactions with FMRP. Our results show that SMNDC1 mRNA 5'-UTR forms an intramolecular, parallel G quadruplex structure comprised of three G quartet planes, which is bound specifically by FMRP both in vitro and in mouse brain lysates. These findings suggest a model by which FMRP might regulate the translation of a subset of its mRNA targets by recognizing the G quadruplex structure present in their 5'-UTR, and affecting their accessibility by the protein synthesis machinery.

  7. Flower bud transcriptome analysis of Sapium sebiferum (Linn.) Roxb. and primary investigation of drought induced flowering: pathway construction and G-quadruplex prediction based on transcriptome.

    Science.gov (United States)

    Yang, Minglei; Wu, Ying; Jin, Shan; Hou, Jinyan; Mao, Yingji; Liu, Wenbo; Shen, Yangcheng; Wu, Lifang

    2015-01-01

    Sapium sebiferum (Linn.) Roxb. (Chinese Tallow Tree) is a perennial woody tree and its seeds are rich in oil which hold great potential for biodiesel production. Despite a traditional woody oil plant, our understanding on S. sebiferum genetics and molecular biology remains scant. In this study, the first comprehensive transcriptome of S. sebiferum flower has been generated by sequencing and de novo assembly. A total of 149,342 unigenes were generated from raw reads, of which 24,289 unigenes were successfully matched to public database. A total of 61 MADS box genes and putative pathways involved in S. sebiferum flower development have been identified. Abiotic stress response network was also constructed in this work, where 2,686 unigenes are involved in the pathway. As for lipid biosynthesis, 161 unigenes have been identified in fatty acid (FA) and triacylglycerol (TAG) biosynthesis. Besides, the G-Quadruplexes in RNA of S. sebiferum also have been predicted. An interesting finding is that the stress-induced flowering was observed in S. sebiferum for the first time. According to the results of semi-quantitative PCR, expression tendencies of flowering-related genes, GA1, AP2 and CRY2, accorded with stress-related genes, such as GRX50435 and PRXⅡ39562. This transcriptome provides functional genomic information for further research of S. sebiferum, especially for the genetic engineering to shorten the juvenile period and improve yield by regulating flower development. It also offers a useful database for the research of other Euphorbiaceae family plants.

  8. A new signal-on method for the detection of protein based on binding-induced strategy and photoinduced electron transfer between Ag nanoclusters and split G-quadruplex-hemin complexes

    Energy Technology Data Exchange (ETDEWEB)

    Zhang, Kai, E-mail: zhangkai@jsinm.org; Wang, Ke; Zhu, Xue; Xie, Minhao

    2015-08-05

    Proteins play important roles in biological and cellular processes. The levels of proteins can be useful biomarkers for cellular events or disease diagnosis, thus the method for sensitive and selective detection of proteins is imperative to proteins express, study, and clinical diagnosis. Herein, we report a “signal-on” platform for the assay of protein based on binding-induced strategy and photoinduced electron transfer between Ag nanoclusters and split G-quadruplex-hemin complexes. By using biotin as the affinity ligand, this simple protocol could sensitively detect streptavidin with a detection limit down to 10 pM. With the use of an antibody as the affinity ligand, a method for homogeneous fluorescence detection of Prostate Specific Antigen (PSA) was also proposed with a detection limit of 10 pM. The one-step and wash-free assay showed good selectivity. Its high sensitivity, acceptable accuracy, and satisfactory versatility of analytes led to various applications in bioanalysis. - Highlights: • AgNCs have great potential for application in biomedicine. • Binding of two affinity ligands can result in binding-induced DNA assemblies. • PET can be happened between DNA/AgNCs and G-quadruplex/hemin complexes. • A platform for the detection of proteins was proposed by using PET and binding-induced strategy.

  9. Synthesis of New DNA G-Quadruplex Constructs with Anthraquinone Insertions and Their Anticoagulant Activity

    DEFF Research Database (Denmark)

    Gouda, Alaa S.; Amine, Mahasen S.; Pedersen, Erik Bjerregaard

    2016-01-01

    1,4-Dihydroxyanthraquinone and 1,8-dihydroxyanthraquinone were alkylated with 3-bromopropan-1-ol and subsequently transformed into the corresponding DMT protected phosphoramidite building blocks for insertion into loops of the Gquadruplex of the thrombin binding aptamer (TBA). The 1,4-disubstituted...... potassium buffer conditions as previously observed for TBA. Although the majority of the anthraquinone modified TBA analogues showed a decrease in clotting times in a fibrinogen clotting assay when compared to TBA, modified aptamers containing a 1,8-disubstituted anthraquinone linker replacing G8 or T9...

  10. Characterizing and controlling intrinsic biases of lambda exonuclease in nascent strand sequencing reveals phasing between nucleosomes and G-quadruplex motifs around a subset of human replication origins.

    Science.gov (United States)

    Foulk, Michael S; Urban, John M; Casella, Cinzia; Gerbi, Susan A

    2015-05-01

    Nascent strand sequencing (NS-seq) is used to discover DNA replication origins genome-wide, allowing identification of features for their specification. NS-seq depends on the ability of lambda exonuclease (λ-exo) to efficiently digest parental DNA while leaving RNA-primer protected nascent strands intact. We used genomics and biochemical approaches to determine if λ-exo digests all parental DNA sequences equally. We report that λ-exo does not efficiently digest G-quadruplex (G4) structures in a plasmid. Moreover, λ-exo digestion of nonreplicating genomic DNA (LexoG0) enriches GC-rich DNA and G4 motifs genome-wide. We used LexoG0 data to control for nascent strand-independent λ-exo biases in NS-seq and validated this approach at the rDNA locus. The λ-exo-controlled NS-seq peaks are not GC-rich, and only 35.5% overlap with 6.8% of all G4s, suggesting that G4s are not general determinants for origin specification but may play a role for a subset. Interestingly, we observed a periodic spacing of G4 motifs and nucleosomes around the peak summits, suggesting that G4s may position nucleosomes at this subset of origins. Finally, we demonstrate that use of Na(+) instead of K(+) in the λ-exo digestion buffer reduced the effect of G4s on λ-exo digestion and discuss ways to increase both the sensitivity and specificity of NS-seq. © 2015 Foulk et al.; Published by Cold Spring Harbor Laboratory Press.

  11. Enhanced anti-HIV-1 activity of G-quadruplexes comprising locked nucleic acids and intercalating nucleic acids

    DEFF Research Database (Denmark)

    Pedersen, Erik Bjerregaard; Nielsen, Jakob Toudahl; Nielsen, Claus

    2011-01-01

    Two G-quadruplex forming sequences, 50-TGGGAG and the 17-mer sequence T30177, which exhibit anti-HIV-1 activity on cell lines, were modified using either locked nucleic acids (LNA) or via insertions of (R)-1-O-(pyren-1-ylmethyl)glycerol (intercalating nucleic acid, INA) or (R)-1-O-[4-(1......-pyrenylethynyl)phenylmethyl]glycerol (twisted intercalating nucleic acid, TINA). Incorporation of LNA or INA/TINA monomers provide as much as 8-fold improvement of anti-HIV-1 activity. We demonstrate for the first time a detailed analysis of the effect the incorporation of INA/TINA monomers in quadruplex forming...

  12. Oligomer formation and G-quadruplex binding by purified murine Rif1 protein, a key organizer of higher-order chromatin architecture.

    Science.gov (United States)

    Moriyama, Kenji; Yoshizawa-Sugata, Naoko; Masai, Hisao

    2018-03-09

    Rap1-interacting protein 1 (Rif1) regulates telomere length in budding yeast. We previously reported that, in metazoans and fission yeast, Rif1 also plays pivotal roles in controlling genome-wide DNA replication timing. We proposed that Rif1 may assemble chromatin compartments that contain specific replication-timing domains by promoting chromatin loop formation. Rif1 also is involved in DNA lesion repair, restart after replication fork collapse, anti-apoptosis activities, replicative senescence, and transcriptional regulation. Although multiple physiological functions of Rif1 have been characterized, biochemical and structural information on mammalian Rif1 is limited, mainly because of difficulties in purifying the full-length protein. Here, we expressed and purified the 2418-amino-acid-long, full-length murine Rif1 as well as its partially truncated variants in human 293T cells. Hydrodynamic analyses indicated that Rif1 forms elongated or extended homo-oligomers in solution, consistent with the presence of a HEAT-type helical repeat segment known to adopt an elongated shape. We also observed that the purified murine Rif1 bound G-quadruplex (G4) DNA with high specificity and affinity, as was previously shown for Rif1 from fission yeast. Both the N-terminal (HEAT-repeat) and C-terminal segments were involved in oligomer formation and specifically bound G4 DNA, and the central intrinsically disordered polypeptide segment increased the affinity for G4. Of note, pulldown assays revealed that Rif1 simultaneously binds multiple G4 molecules. Our findings support a model in which Rif1 modulates chromatin loop structures through binding to multiple G4 assemblies and by holding chromatin fibers together. © 2018 by The American Society for Biochemistry and Molecular Biology, Inc.

  13. Delineation of G-Quadruplex Alkylation Sites Mediated by 3,6-Bis(1-methyl-4-vinylpyridinium iodide)carbazole-Aniline Mustard Conjugates.

    Science.gov (United States)

    Chen, Chien-Han; Hu, Tsung-Hao; Huang, Tzu-Chiao; Chen, Ying-Lan; Chen, Yet-Ran; Cheng, Chien-Chung; Chen, Chao-Tsen

    2015-11-23

    A new G-quadruplex (G-4)-directing alkylating agent BMVC-C3M was designed and synthesized to integrate 3,6-bis(1-methyl-4-vinylpyridinium iodide)carbazole (BMVC) with aniline mustard. Various telomeric G-4 structures (hybrid-2 type and antiparallel) and an oncogene promoter, c-MYC (parallel), were constructed to react with BMVC-C3M, yielding 35 % alkylation yield toward G-4 DNA over other DNA categories (alkylation adducts by electrospray ionization mass spectroscopy (ESI-MS) revealed the stepwise DNA alkylation mechanism of aniline mustard for the first time. Furthermore, the monoalkylation sites and intrastrand cross-linking sites were determined and found to be dependent on G-4 topology based on the results of footprinting analysis in combination with mass spectroscopic techniques and in silico modeling. The results indicated that BMVC-C3M preferentially alkylated at A15 (H26), G12 (H24), and G2 (c-MYC), respectively, as monoalkylated adducts and formed A15-C3M-A21 (H26), G12-C3M-G4 (H24), and G2-C3M-G4/G17 (c-MYC), respectively, as cross-linked dialkylated adducts. Collectively, the stability and site-selective cross-linking capacity of BMVC-C3M provides a credible tool for the structural and functional characterization of G-4 DNAs in biological systems. © 2015 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  14. Flower bud transcriptome analysis of Sapium sebiferum (Linn. Roxb. and primary investigation of drought induced flowering: pathway construction and G-quadruplex prediction based on transcriptome.

    Directory of Open Access Journals (Sweden)

    Minglei Yang

    Full Text Available Sapium sebiferum (Linn. Roxb. (Chinese Tallow Tree is a perennial woody tree and its seeds are rich in oil which hold great potential for biodiesel production. Despite a traditional woody oil plant, our understanding on S. sebiferum genetics and molecular biology remains scant. In this study, the first comprehensive transcriptome of S. sebiferum flower has been generated by sequencing and de novo assembly. A total of 149,342 unigenes were generated from raw reads, of which 24,289 unigenes were successfully matched to public database. A total of 61 MADS box genes and putative pathways involved in S. sebiferum flower development have been identified. Abiotic stress response network was also constructed in this work, where 2,686 unigenes are involved in the pathway. As for lipid biosynthesis, 161 unigenes have been identified in fatty acid (FA and triacylglycerol (TAG biosynthesis. Besides, the G-Quadruplexes in RNA of S. sebiferum also have been predicted. An interesting finding is that the stress-induced flowering was observed in S. sebiferum for the first time. According to the results of semi-quantitative PCR, expression tendencies of flowering-related genes, GA1, AP2 and CRY2, accorded with stress-related genes, such as GRX50435 and PRXⅡ39562. This transcriptome provides functional genomic information for further research of S. sebiferum, especially for the genetic engineering to shorten the juvenile period and improve yield by regulating flower development. It also offers a useful database for the research of other Euphorbiaceae family plants.

  15. A Role for the Fifth G-Track in G-Quadruplex Forming Oncogene Promoter Sequences during Oxidative Stress: Do These "Spare Tires" Have an Evolved Function?

    Science.gov (United States)

    Fleming, Aaron M; Zhou, Jia; Wallace, Susan S; Burrows, Cynthia J

    2015-08-26

    Uncontrolled inflammation or oxidative stress generates electron-deficient species that oxidize the genome increasing its instability in cancer. The G-quadruplex (G4) sequences regulating the c-MYC , KRAS , VEGF , BCL-2 , HIF-1α , and RET oncogenes, as examples, are targets for oxidation at loop and 5'-core guanines (G) as showcased in this study by CO 3 •- oxidation of the VEGF G4. Products observed include 8-oxo-7,8-dihydroguanine (OG), spiroiminodihydantoin (Sp), and 5-guanidinohydantoin (Gh). Our previous studies found that OG and Gh, when present in the four G-tracks of the solved structure for VEGF and c-MY C, were not substrates for the base excision repair (BER) DNA glycosylases in biologically relevant KCl solutions. We now hypothesize that a fifth G-track found a few nucleotides distant from the G4 tracks involved in folding can act as a "spare tire," facilitating extrusion of a damaged G-run into a large loop that then becomes a substrate for BER. Thermodynamic, spectroscopic, and DMS footprinting studies verified the fifth domain replacing a damaged G-track with OG or Gh at a loop or core position in the VEGF G4. These new "spare tire"-containing strands with Gh in loops are now found to be substrates for initiation of BER with the NEIL1, NEIL2, and NEIL3 DNA glycosylases. The results support a hypothesis in which regulatory G4s carry a "spare-tire" fifth G-track for aiding in the repair process when these sequences are damaged by radical oxygen species, a feature observed in a large number of these sequences. Furthermore, formation and repair of oxidized bases in promoter regions may constitute an additional example of epigenetic modification, in this case of guanine bases, to regulate gene expression in which the G4 sequences act as sensors of oxidative stress.

  16. Porous platinum nanotubes labeled with hemin/G-quadruplex based electrochemical aptasensor for sensitive thrombin analysis via the cascade signal amplification.

    Science.gov (United States)

    Sun, Aili; Qi, Qingan; Wang, Xuannian; Bie, Ping

    2014-07-15

    For the first time, a sensitive electrochemical aptasensor for thrombin (TB) was developed by using porous platinum nanotubes (PtNTs) labeled with hemin/G-quadruplex and glucose dehydrogenase (GDH) as labels. Porous PtNTs with large surface area exhibited the peroxidase-like activity. Coupling with GDH and hemin/G-quadruplex as NADH oxidase and HRP-mimicking DNAzyme, the cascade signal amplification was achieved by the following ways: in the presence of glucose and NAD(+) in the working buffer, GDH electrocatalyzed the oxidation of glucose with the production of NADH. Then, hemin/G-quadruplex as NADH oxidase catalyzed the oxidation of NADH to in situ generate H2O2. Based on the corporate electrocatalysis of PtNTs and hemin/G-quadruplex toward H2O2, the electrochemical signal was significantly amplified, allowing the detection limit of TB down to 0.15 pM level. Moreover, the proposed strategy was simple because the intercalated hemin offered the readout signal, avoiding the adding of additional redox mediator as signal donator. Such an electrochemical aptasensor is highly promising for sensitive detection of other proteins in clinical diagnostics. Copyright © 2014 Elsevier B.V. All rights reserved.

  17. Cockayne syndrome group A and B proteins converge on transcription-linked resolution of non-B DNA

    DEFF Research Database (Denmark)

    Scheibye-Knudsen, Morten; Tseng, Anne; Jensen, Martin Borch

    2016-01-01

    of CSA or CSB in a neuroblastoma cell line converges on mitochondrial dysfunction caused by defects in ribosomal DNA transcription and activation of the DNA damage sensor poly-ADP ribose polymerase 1 (PARP1). Indeed, inhibition of ribosomal DNA transcription leads to mitochondrial dysfunction in a number...... to polymerase stalling at non-B DNA in a neuroblastoma cell line, in particular at G-quadruplex structures, and recombinant CSB can melt G-quadruplex structures. Indeed, stabilization of G-quadruplex structures activates PARP1 and leads to accelerated aging in Caenorhabditis elegans. In conclusion, this work...

  18. G-quadruplex recognition activities of E. Coli MutS

    Directory of Open Access Journals (Sweden)

    Ehrat Edward A

    2012-07-01

    Full Text Available Abstract Background Guanine quadruplex (G4 DNA is a four-stranded structure that contributes to genome instability and site-specific recombination. G4 DNA folds from sequences containing tandemly repetitive guanines, sequence motifs that are found throughout prokaryote and eukaryote genomes. While some cellular activities have been identified with binding or processing G4 DNA, the factors and pathways governing G4 DNA metabolism are largely undefined. Highly conserved mismatch repair factors have emerged as potential G4-responding complexes because, in addition to initiating heteroduplex correction, the human homologs bind non-B form DNA with high affinity. Moreover, the MutS homologs across species have the capacity to recognize a diverse range of DNA pairing variations and damage, suggesting a conserved ability to bind non-B form DNA. Results Here, we asked if E. coli MutS and a heteroduplex recognition mutant, MutS F36A, were capable of recognizing and responding to G4 DNA structures. We find by mobility shift assay that E. coli MutS binds to G4 DNA with high affinity better than binding to G-T heteroduplexes. In the same assay, MutS F36A failed to recognize G-T mismatched oligonucleotides, as expected, but retained an ability to bind to G4 DNA. Association with G4 DNA by MutS is not likely to activate the mismatch repair pathway because nucleotide binding did not promote release of MutS or MutS F36A from G4 DNA as it does for heteroduplexes. G4 recognition activities occur under physiological conditions, and we find that M13 phage harboring G4-capable DNA poorly infected a MutS deficient strain of E. coli compared to M13mp18, suggesting functional roles for mismatch repair factors in the cellular response to unstable genomic elements. Conclusions Taken together, our findings demonstrate that E. coli MutS has a binding activity specific for non-B form G4 DNA, but such binding appears independent of canonical heteroduplex repair activation.

  19. Ultrasensitive photoelectrochemical aptasensor for lead ion detection based on sensitization effect of CdTe QDs on MoS2-CdS:Mn nanocomposites by the formation of G-quadruplex structure.

    Science.gov (United States)

    Shi, Jian-Jun; Zhu, Jing-Chun; Zhao, Ming; Wang, Yan; Yang, Ping; He, Jie

    2018-06-01

    An ultrasensitive photoelectrochemical (PEC) aptasensor for lead ion (Pb 2+ ) detection was fabricated based on MoS 2 -CdS:Mn nanocomposites and sensitization effect of CdTe quantum dots (QDs). MoS 2 -CdS:Mn modified electrode was used as the PEC matrix for the immobilization of probe DNA (pDNA) labeled with CdTe QDs. Target DNA (tDNA) were hybridized with pDNA to made the QDs locate away from the electrode surface by the rod-like double helix. The detection of Pb 2+ was based on the conformational change of the pDNA to G-quadruplex structure in the presence of Pb 2+ , which made the labeled QDs move close to the electrode surface, leading to the generation of sensitization effect and evident increase of the photocurrent intensity. The linear range was 50 fM to 100 nM with a detection limit of 16.7 fM. The recoveries of the determination of Pb 2+ in real samples were in the range of 102.5-108.0%. This proposed PEC aptasensor provides a new sensing strategy for various heavy metal ions at ultralow levels. Copyright © 2018 Elsevier B.V. All rights reserved.

  20. The SARS-unique domain (SUD of SARS coronavirus contains two macrodomains that bind G-quadruplexes.

    Directory of Open Access Journals (Sweden)

    Jinzhi Tan

    2009-05-01

    Full Text Available Since the outbreak of severe acute respiratory syndrome (SARS in 2003, the three-dimensional structures of several of the replicase/transcriptase components of SARS coronavirus (SARS-CoV, the non-structural proteins (Nsps, have been determined. However, within the large Nsp3 (1922 amino-acid residues, the structure and function of the so-called SARS-unique domain (SUD have remained elusive. SUD occurs only in SARS-CoV and the highly related viruses found in certain bats, but is absent from all other coronaviruses. Therefore, it has been speculated that it may be involved in the extreme pathogenicity of SARS-CoV, compared to other coronaviruses, most of which cause only mild infections in humans. In order to help elucidate the function of the SUD, we have determined crystal structures of fragment 389-652 ("SUD(core" of Nsp3, which comprises 264 of the 338 residues of the domain. Both the monoclinic and triclinic crystal forms (2.2 and 2.8 A resolution, respectively revealed that SUD(core forms a homodimer. Each monomer consists of two subdomains, SUD-N and SUD-M, with a macrodomain fold similar to the SARS-CoV X-domain. However, in contrast to the latter, SUD fails to bind ADP-ribose, as determined by zone-interference gel electrophoresis. Instead, the entire SUD(core as well as its individual subdomains interact with oligonucleotides known to form G-quadruplexes. This includes oligodeoxy- as well as oligoribonucleotides. Mutations of selected lysine residues on the surface of the SUD-N subdomain lead to reduction of G-quadruplex binding, whereas mutations in the SUD-M subdomain abolish it. As there is no evidence for Nsp3 entering the nucleus of the host cell, the SARS-CoV genomic RNA or host-cell mRNA containing long G-stretches may be targets of SUD. The SARS-CoV genome is devoid of G-stretches longer than 5-6 nucleotides, but more extended G-stretches are found in the 3'-nontranslated regions of mRNAs coding for certain host-cell proteins

  1. BLM helicase suppresses recombination at G-quadruplex motifs in transcribed genes

    NARCIS (Netherlands)

    van Wietmarschen, Niek; Merzouk, Sarra; Halsema, Nancy; Spierings, Diana C J; Guryev, Victor; Lansdorp, Peter M

    2018-01-01

    Bloom syndrome is a cancer predisposition disorder caused by mutations in the BLM helicase gene. Cells from persons with Bloom syndrome exhibit striking genomic instability characterized by excessive sister chromatid exchange events (SCEs). We applied single-cell DNA template strand sequencing

  2. Hybrid ligand-alkylating agents targeting telomeric G-quadruplex structures.

    Science.gov (United States)

    Doria, Filippo; Nadai, Matteo; Folini, Marco; Di Antonio, Marco; Germani, Luca; Percivalle, Claudia; Sissi, Claudia; Zaffaroni, Nadia; Alcaro, Stefano; Artese, Anna; Richter, Sara N; Freccero, Mauro

    2012-04-14

    The synthesis, physico-chemical properties and biological effects of a new class of naphthalene diimides (NDIs) capable of reversibly binding telomeric DNA and alkylate it through an electrophilic quinone methide moiety (QM), are reported. FRET and circular dichroism assays showed a marked stabilization and selectivity towards telomeric G4 DNA folded in a hybrid topology. NDI-QMs' alkylating properties revealed a good reactivity on single nucleosides and selectivity towards telomeric G4. A selected NDI was able to significantly impair the growth of melanoma cells by causing telomere dysfunction and down-regulation of telomerase expression. These findings points to our hybrid ligand-alkylating NDIs as possible tools for the development of novel targeted anticancer therapies. This journal is © The Royal Society of Chemistry 2012

  3. Novel molecular targets for kRAS downregulation: promoter G-quadruplexes

    Science.gov (United States)

    2016-11-01

    proteins studied. 6. Products: • Publications, conference papers , and presentations o Journal Publications • Morgan, RK; Batra, H; Gaerig, VC; Hockings, J... papers , and presentations • Batra, H; Brooks, TA. Binding and function of regulatory proteins to the kRAS promoter: a role in pancreatic cancer. 6th...development due to difficulties with delivery and excessive albumin binding, and antisoma’s G-rich phosphodiester oligonucleotide AS1411, a DNA aptamer with

  4. G-quadruplex aptamer targeting Protein A and its capability to detect Staphylococcus aureus demonstrated by ELONA.

    Science.gov (United States)

    Stoltenburg, Regina; Krafčiková, Petra; Víglaský, Viktor; Strehlitz, Beate

    2016-09-21

    Aptamers for whole cell detection are selected mostly by the Cell-SELEX procedure. Alternatively, the use of specific cell surface epitopes as target during aptamer selections allows the development of aptamers with ability to bind whole cells. In this study, we integrated a formerly selected Protein A-binding aptamer PA#2/8 in an assay format called ELONA (Enzyme-Linked OligoNucleotide Assay) and evaluated the ability of the aptamer to recognise and bind to Staphylococcus aureus presenting Protein A on the cell surface. The full-length aptamer and one of its truncated variants could be demonstrated to specifically bind to Protein A-expressing intact cells of S. aureus, and thus have the potential to expand the portfolio of aptamers that can act as an analytical agent for the specific recognition and rapid detection of the bacterial pathogen. The functionality of the aptamer was found to be based on a very complex, but also highly variable structure. Two structural key elements were identified. The aptamer sequence contains several G-clusters allowing folding into a G-quadruplex structure with the potential of dimeric and multimeric assembly. An inverted repeat able to form an imperfect stem-loop at the 5'-end also contributes essentially to the aptameric function.

  5. A label-free luminescent switch-on assay for ATP using a G-quadruplex-selective iridium(III) complex.

    Science.gov (United States)

    Leung, Ka-Ho; Lu, Lihua; Wang, Modi; Mak, Tsun-Yin; Chan, Daniel Shiu-Hin; Tang, Fung-Kit; Leung, Chung-Hang; Kwan, Hiu-Yee; Yu, Zhiling; Ma, Dik-Lung

    2013-01-01

    We report herein the G-quadruplex-selective property of a luminescent cyclometallated iridium(III) complex for the detection of adenosine-5'-triphosphate (ATP) in aqueous solution. The ATP-binding aptamer was employed as the ATP recognition unit, while the iridium(III) complex was used to monitor the formation of the G-quadruplex structure induced by ATP. The sensitivity and fold enhancement of the assay were higher than those of the previously reported assay using the organic dye crystal violet as a fluorescent probe. This label-free luminescent switch-on assay exhibits high sensitivity and selectivity towards ATP with a limit of detection of 2.5 µM.

  6. A label-free luminescent switch-on assay for ATP using a G-quadruplex-selective iridium(III complex.

    Directory of Open Access Journals (Sweden)

    Ka-Ho Leung

    Full Text Available We report herein the G-quadruplex-selective property of a luminescent cyclometallated iridium(III complex for the detection of adenosine-5'-triphosphate (ATP in aqueous solution. The ATP-binding aptamer was employed as the ATP recognition unit, while the iridium(III complex was used to monitor the formation of the G-quadruplex structure induced by ATP. The sensitivity and fold enhancement of the assay were higher than those of the previously reported assay using the organic dye crystal violet as a fluorescent probe. This label-free luminescent switch-on assay exhibits high sensitivity and selectivity towards ATP with a limit of detection of 2.5 µM.

  7. Clustered abasic lesions profoundly change the structure and stability of human telomeric G-quadruplexes

    Czech Academy of Sciences Publication Activity Database

    Kejnovská, Iva; Bednářová, Klára; Renčiuk, Daniel; Dvořáková, Zuzana; Školáková, Petra; Trantírek, L.; Fiala, R.; Vorlíčková, Michaela; Sagi, J.

    2017-01-01

    Roč. 45, č. 8 (2017), s. 4294-4305 ISSN 0305-1048 R&D Projects: GA MŠk EF15_003/0000477; GA ČR GAP205/12/0466; GA ČR GA13-28310S; GA ČR(CZ) GA15-06785S; GA MŠk(CZ) LQ1601 Institutional support: RVO:68081707 Keywords : dna-damage clusters * k+ solution * guanine quadruplexes Subject RIV: CE - Biochemistry OBOR OECD: Biochemistry and molecular biology Impact factor: 10.162, year: 2016

  8. Triple Quenching of a Novel Self-Enhanced Ru(II) Complex by Hemin/G-Quadruplex DNAzymes and Its Potential Application to Quantitative Protein Detection.

    Science.gov (United States)

    Zhao, Min; Liao, Ni; Zhuo, Ying; Chai, Ya-Qin; Wang, Ji-Peng; Yuan, Ruo

    2015-08-04

    Herein, a novel "on-off" electrochemiluminescence (ECL) aptasensor for highly sensitive determination of thrombin has been constructed based on the triple quenching of the effect of hemin/G-quadruplex DNAzymes upon the Ru(II) complex-based ECL system. First, a strong initial ECL signal was achieved by the dual amplification strategies of (i) intramolecular coreaction of a self-enhanced Ru(II)-based molecule (PTCA-PEI-Ru(II)) and (ii) intermolecular coreaction between PTCA-PEI-Ru(II) and nicotinamide adenine dinucleotide (NADH), which was named the signal-on state. Then, a novel triple quenching of the effect of multifunctional hemin/G-quadruplex DNAzymes upon the Ru(II) complex-based ECL system was designed to realize the desirable signal-off state, which was outlined as follows: (i) the hemin/G-quadruplex DNAzymes mimicked NADH oxidase to oxidize NADH and in situ generate the H2O2, consuming the coreactant of NADH; (ii) its active center of hemin could oxidize the excited state PTCA-PEI-Ru(II)* to PTCA-PEI-Ru(III), making the energy and electron transfer quench; (iii) it also acted as horseradish peroxidase (HRP) to catalyze the H2O2 for in situ producing the quencher of O2. Based on triple quenching of the effect of hemin/G-quadruplex DNAzymes, the highly sensitive "on-off" thrombin aptasensor was developed with a wide linear detection range of 1.0 × 10(-14) M to 1.0 × 10(-10) M and a detection limit down to the femtomolar level.

  9. Human telomeric G-quadruplex formation and highly selective fluorescence detection of toxic strontium ions.

    Science.gov (United States)

    Qu, Konggang; Zhao, Chuanqi; Ren, Jinsong; Qu, Xiaogang

    2012-03-01

    Strontium ions play important roles in biological systems. The inhalation of strontium can cause severe respiratory difficulties, anaphylactic reaction and extreme tachycardia. Strontium can replace calcium in organisms, inhibit normal calcium absorption and induce strontium "rickets" in childhood. Thus, the development of sensitive and selective methods for the determination of trace amounts of Sr(2+) in aqueous media is of considerable importance for environmental and human health protection. A number of methodologies, such as X-ray energy dispersive spectrometry, inductively coupled argon plasma atomic emission spectroscopy (ICP-AES), atomic absorption spectrometry (AAS) and instrumental thermal neutron activation analysis, have been reported. However, these methods are somewhat complex, costly, time consuming and, especially, need special instruments. Thus, the design of convenient and inexpensive approaches for the sensitive and selective detection of Sr(2+) with rapid, easy manipulation is in ever-increasing demand. To the best of our knowledge, using DNA conformational change to detect Sr(2+) has not yet been reported. Herein we utilized thiazole orange (TO) as a signal reporter to devise a simple Sr(2+) detection assay based on Sr(2+) induced human telomeric DNA conformational change in the presence of SWNTs. The limit of detection is 10 nM Sr(2+) (0.87 μg L(-1)), far below 4 mg L(-1), the U.S. Federal threshold in drinking water defined by the U.S. EPA.

  10. Identifying the impact of G-quadruplexes on Affymetrix 3' arrays using cloud computing.

    Science.gov (United States)

    Memon, Farhat N; Owen, Anne M; Sanchez-Graillet, Olivia; Upton, Graham J G; Harrison, Andrew P

    2010-01-15

    A tetramer quadruplex structure is formed by four parallel strands of DNA/ RNA containing runs of guanine. These quadruplexes are able to form because guanine can Hoogsteen hydrogen bond to other guanines, and a tetrad of guanines can form a stable arrangement. Recently we have discovered that probes on Affymetrix GeneChips that contain runs of guanine do not measure gene expression reliably. We associate this finding with the likelihood that quadruplexes are forming on the surface of GeneChips. In order to cope with the rapidly expanding size of GeneChip array datasets in the public domain, we are exploring the use of cloud computing to replicate our experiments on 3' arrays to look at the effect of the location of G-spots (runs of guanines). Cloud computing is a recently introduced high-performance solution that takes advantage of the computational infrastructure of large organisations such as Amazon and Google. We expect that cloud computing will become widely adopted because it enables bioinformaticians to avoid capital expenditure on expensive computing resources and to only pay a cloud computing provider for what is used. Moreover, as well as financial efficiency, cloud computing is an ecologically-friendly technology, it enables efficient data-sharing and we expect it to be faster for development purposes. Here we propose the advantageous use of cloud computing to perform a large data-mining analysis of public domain 3' arrays.

  11. Investigation of paternity establishing without the putative father using hypervariable DNA probes.

    Science.gov (United States)

    Yokoi, T; Odaira, T; Nata, M; Sagisaka, K

    1990-09-01

    Seven kinds of DNA probes which recognize hypervariable loci were applied for paternity test. The putative father was decreased and unavailable for the test. The two legitimate children and their mother (the deceased's wife) and the four illegitimate children and their mother (the deceased's kept mistress) were available for analysis. Paternity index of four illegitimate child was investigated. Allelic frequencies and their confidence intervals among unrelated Japanese individuals were previously reported from our laboratory, and co-dominant segregation of the polymorphism was confirmed in family studies. Cumulative paternity indices of four illegitimate children from 16 kinds of standard blood group markers were 165, 42, 0.09, and 36, respectively. On the other hand, cumulative paternity indices from 7 kinds of DNA probes are 2,363, 4,685, 57,678, and 54,994, respectively, which are 14, 113, 640, 864, and 1,509 times higher than that from standard blood group markers. The DNA analyses gave nearly conclusive evidence that the putative father was the biological father of the children. Especially, the paternity relation of the third illegitimate child could not be established without the DNA analyses. Accordingly, DNA polymorphism is considered to be informative enough for paternity test.

  12. Label-free and enzyme-free detection of transcription factors with graphene oxide fluorescence switch-based multifunctional G-quadruplex-hairpin probe.

    Science.gov (United States)

    Zhu, Desong; Wang, Lei; Xu, Xiaowen; Jiang, Wei

    2016-01-15

    Transcription factors (TFs) play pivotal roles in the regulation of a variety of essential cellular processes and some of them have been recognized as potential diagnostic markers and therapeutic targets of some diseases. Sensitive and accurate detection of TFs is of great importance to better understanding their roles in gene regulation and evaluation of disease state. Here, we developed a simple, label-free and enzyme-free new fluorescent strategy for the detection of TFs by graphene oxide (GO) fluorescence switch-based multifunctional G-quadruplex-hairpin probe (MGHP). The MGHP possessed of three functions simultaneously, adsorbing onto GO with the loop part, binding to target with the stem part and serving as signal carrier with the terminal G-quadruplex. First, the MGHP was adsorbed quickly to GO. Next, the TF bound to the stem part of MGHP to form a huge target-MGHP complex, which led to desorption of the complex from GO. Finally, NMM was inserted into G-quadruplex in the complex to yield an enhanced fluorescence response. The GO used here, as a fluorescence switch, could quickly and efficiently quench the fluorescence of NMM inserted into the MGHP absorbed on the GO, guaranteeing a high signal-to-noise ratio. Sensitive detection of purified NF-κB p50 and HeLa cell nuclear extracts were achieved with detection limits of 0.2nM and 7.8ng/µL, respectively. Moreover, this proposed strategy could be used to screen inhibitors of NF-κB p50 activity. The strategy proposed here might offer a new potential approach for reliable quantification of TFs in clinical diagnostics and treatment research of some diseases. Copyright © 2015 Elsevier B.V. All rights reserved.

  13. Regulation of gene expression by the BLM helicase correlates with the presence of G-quadruplex DNA motifs

    DEFF Research Database (Denmark)

    Nguyen, Giang Huong; Tang, Weiliang; Robles, Ana I

    2014-01-01

    Bloom syndrome is a rare autosomal recessive disorder characterized by genetic instability and cancer predisposition, and caused by mutations in the gene encoding the Bloom syndrome, RecQ helicase-like (BLM) protein. To determine whether altered gene expression might be responsible for pathologic...

  14. A putative peroxidase cDNA from turnip and analysis of the encoded protein sequence.

    Science.gov (United States)

    Romero-Gómez, S; Duarte-Vázquez, M A; García-Almendárez, B E; Mayorga-Martínez, L; Cervantes-Avilés, O; Regalado, C

    2008-12-01

    A putative peroxidase cDNA was isolated from turnip roots (Brassica napus L. var. purple top white globe) by reverse transcriptase-polymerase chain reaction (RT-PCR) and rapid amplification of cDNA ends (RACE). Total RNA extracted from mature turnip roots was used as a template for RT-PCR, using a degenerated primer designed to amplify the highly conserved distal motif of plant peroxidases. The resulting partial sequence was used to design the rest of the specific primers for 5' and 3' RACE. Two cDNA fragments were purified, sequenced, and aligned with the partial sequence from RT-PCR, and a complete overlapping sequence was obtained and labeled as BbPA (Genbank Accession No. AY423440, named as podC). The full length cDNA is 1167bp long and contains a 1077bp open reading frame (ORF) encoding a 358 deduced amino acid peroxidase polypeptide. The putative peroxidase (BnPA) showed a calculated Mr of 34kDa, and isoelectric point (pI) of 4.5, with no significant identity with other reported turnip peroxidases. Sequence alignment showed that only three peroxidases have a significant identity with BnPA namely AtP29a (84%), and AtPA2 (81%) from Arabidopsis thaliana, and HRPA2 (82%) from horseradish (Armoracia rusticana). Work is in progress to clone this gene into an adequate host to study the specific role and possible biotechnological applications of this alternative peroxidase source.

  15. Fluorescence enhancement upon G-quadruplex folding: synthesis, structure, and biophysical characterization of a dansyl/cyclodextrin-tagged thrombin binding aptamer.

    Science.gov (United States)

    De Tito, Stefano; Morvan, François; Meyer, Albert; Vasseur, Jean-Jacques; Cummaro, Annunziata; Petraccone, Luigi; Pagano, Bruno; Novellino, Ettore; Randazzo, Antonio; Giancola, Concetta; Montesarchio, Daniela

    2013-11-20

    A novel fluorescent thrombin binding aptamer (TBA), conjugated with the environmentally sensitive dansyl probe at the 3'-end and a β-cyclodextrin residue at the 5'-end, has been efficiently synthesized exploiting Cu(I)-catalyzed azide-alkyne cycloaddition procedures. Its conformation and stability in solution have been studied by an integrated approach, combining in-depth NMR, CD, fluorescence, and DSC studies. ITC measurements have allowed us to analyze in detail its interaction with human thrombin. All the collected data show that this bis-conjugated aptamer fully retains its G-quadruplex formation ability and thrombin recognition properties, with the terminal appendages only marginally interfering with the conformational behavior of TBA. Folding of this modified aptamer into the chairlike, antiparallel G-quadruplex structure, promoted by K(+) and/or thrombin binding, typical of TBA, is associated with a net fluorescence enhancement, due to encapsulation of dansyl, attached at the 3'-end, into the apolar cavity of the β-cyclodextrin at the 5'-end. Overall, the structural characterization of this novel, bis-conjugated TBA fully demonstrates its potential as a diagnostic tool for thrombin recognition, also providing a useful basis for the design of suitable aptamer-based devices for theranostic applications, allowing simultaneously both detection and inhibition or modulation of the thrombin activity.

  16. Zuotin, a putative Z-DNA binding protein in Saccharomyces cerevisiae

    Science.gov (United States)

    Zhang, S.; Lockshin, C.; Herbert, A.; Winter, E.; Rich, A.

    1992-01-01

    A putative Z-DNA binding protein, named zuotin, was purified from a yeast nuclear extract by means of a Z-DNA binding assay using [32P]poly(dG-m5dC) and [32P]oligo(dG-Br5dC)22 in the presence of B-DNA competitor. Poly(dG-Br5dC) in the Z-form competed well for the binding of a zuotin containing fraction, but salmon sperm DNA, poly(dG-dC) and poly(dA-dT) were not effective. Negatively supercoiled plasmid pUC19 did not compete, whereas an otherwise identical plasmid pUC19(CG), which contained a (dG-dC)7 segment in the Z-form was an excellent competitor. A Southwestern blot using [32P]poly(dG-m5dC) as a probe in the presence of MgCl2 identified a protein having a molecular weight of 51 kDa. The 51 kDa zuotin was partially sequenced at the N-terminal and the gene, ZUO1, was cloned, sequenced and expressed in Escherichia coli; the expressed zuotin showed similar Z-DNA binding activity, but with lower affinity than zuotin that had been partially purified from yeast. Zuotin was deduced to have a number of potential phosphorylation sites including two CDC28 (homologous to the human and Schizosaccharomyces pombe cdc2) phosphorylation sites. The hexapeptide motif KYHPDK was found in zuotin as well as in several yeast proteins, DnaJ of E.coli, csp29 and csp32 proteins of Drosophila and the small t and large T antigens of the polyoma virus. A 60 amino acid segment of zuotin has similarity to several histone H1 sequences. Disruption of ZUO1 in yeast resulted in a slow growth phenotype.

  17. Identification of Putative Coffee Rust Mycoparasites via Single-Molecule DNA Sequencing of Infected Pustules.

    Science.gov (United States)

    James, Timothy Y; Marino, John A; Perfecto, Ivette; Vandermeer, John

    2016-01-15

    The interaction of crop pests with their natural enemies is a fundament to their control. Natural enemies of fungal pathogens of crops are poorly known relative to those of insect pests, despite the diversity of fungal pathogens and their economic importance. Currently, many regions across Latin America are experiencing unprecedented epidemics of coffee rust (Hemileia vastatrix). Identification of natural enemies of coffee rust could aid in developing management strategies or in pinpointing species that could be used for biocontrol. In the present study, we characterized fungal communities associated with coffee rust lesions by single-molecule DNA sequencing of fungal rRNA gene bar codes from leaf discs (≈28 mm(2)) containing rust lesions and control discs with no rust lesions. The leaf disc communities were hyperdiverse in terms of fungi, with up to 69 operational taxonomic units (putative species) per control disc, and the diversity was only slightly reduced in rust-infected discs, with up to 63 putative species. However, geography had a greater influence on the fungal community than whether the disc was infected by coffee rust. Through comparisons between control and rust-infected leaf discs, as well as taxonomic criteria, we identified 15 putative mycoparasitic fungi. These fungi are concentrated in the fungal family Cordycipitaceae and the order Tremellales. These data emphasize the complexity of diverse fungi of unknown ecological function within a leaf that might influence plant disease epidemics or lead to the development of species for biocontrol of fungal disease. Copyright © 2016, American Society for Microbiology. All Rights Reserved.

  18. Genomic localization, sequence analysis, and transcription of the putative human cytomegalovirus DNA polymerase gene

    International Nuclear Information System (INIS)

    Heilbronn, T.; Jahn, G.; Buerkle, A.; Freese, U.K.; Fleckenstein, B.; Zur Hausen, H.

    1987-01-01

    The human cytomegalovirus (HCMV)-induced DNA polymerase has been well characterized biochemically and functionally, but its genomic location has not yet been assigned. To identify the coding sequence, cross-hybridization with the herpes simplex virus type 1 (HSV-1) polymerase gene was used, as suggested by the close similarity of the herpes group virus-induced DNA polymerases to the HCMV DNA polymerase. A cosmid and plasmid library of the entire HCMV genome was screened with the BamHI Q fragment of HSF-1 at different stringency conditions. One PstI-HincII restriction fragment of 850 base pairs mapping within the EcoRI M fragment of HCMV cross-hybridized at T/sub m/ - 25/degrees/C. Sequence analysis revealed one open reading frame spanning the entire sequence. The amino acid sequence showed a highly conserved domain of 133 amino acids shared with the HSV and putative Esptein-Barr virus polymerase sequences. This domain maps within the C-terminal part of the HSV polymerase gene, which has been suggested to contain part of the catalytic center of the enzyme. Transcription analysis revealed one 5.4-kilobase early transcript in the sense orientation with respect to the open reading frame identified. This transcript appears to code for the 140-kilodalton HCMV polymerase protein

  19. Disintegration of cruciform and G-quadruplex structures during the course of helicase-dependent amplification (HDA).

    Science.gov (United States)

    Li, Dawei; Lv, Bei; Zhang, Hao; Lee, Jasmine Yiqin; Li, Tianhu

    2015-04-15

    Unlike chemical damages on DNA, physical alterations of B-form of DNA occur commonly in organisms that serve as signals for specified cellular events. Although the modes of action for repairing of chemically damaged DNA have been well studied nowadays, the repairing mechanisms for physically altered DNA structures have not yet been understood. Our current in vitro studies show that both breakdown of stable non-B DNA structures and resumption of canonical B-conformation of DNA can take place during the courses of isothermal helicase-dependent amplification (HDA). The pathway that makes the non-B DNA structures repairable is presumably the relieving of the accumulated torsional stress that was caused by the positive supercoiling. Our new findings suggest that living organisms might have evolved this distinct and economical pathway for repairing their physically altered DNA structures. Copyright © 2015 Elsevier Ltd. All rights reserved.

  20. A sensitive electrochemical aptasensor based on the co-catalysis of hemin/G-quadruplex, platinum nanoparticles and flower-like MnO2 nanosphere functionalized multi-walled carbon nanotubes.

    Science.gov (United States)

    Xu, Wenju; Xue, Shuyan; Yi, Huayu; Jing, Pei; Chai, Yaqin; Yuan, Ruo

    2015-01-28

    In this work, a sensitive electrochemical aptasensor for the detection of thrombin (TB) is developed and demonstrated based on the co-catalysis of hemin/G-quadruplex, platinum nanoparticles (PtNPs) and flower-like MnO2 nanosphere functionalized multi-walled carbon nanotubes (MWCNT-MnO2).

  1. Interdependence of pyrene interactions and tetramolecular G4-DNA assembly.

    Science.gov (United States)

    Doluca, Osman; Withers, Jamie M; Loo, Trevor S; Edwards, Patrick J B; González, Carlos; Filichev, Vyacheslav V

    2015-03-28

    Controlling the arrangement of organic chromophores in supramolecular architectures is of primary importance for the development of novel functional molecules. Insertion of a twisted intercalating nucleic acid (TINA) moiety, containing phenylethynylpyren-1-yl derivatives, into a G-rich DNA sequence alters G-quadruplex folding, resulting in supramolecular structures with defined pyrene arrangements. Based on CD, NMR and ESI-mass-spectra, as well as TINA excited dimer (excimer) fluorescence emission we propose that insertion of the TINA monomer in the middle of a dTG4T sequence (i.e. dTGGXGGT, where X is TINA) converts a parallel tetramolecular G-quadruplex into an assembly composed of two identical antiparallel G-quadruplex subunits stacked via TINA-TINA interface. Kinetic analysis showed that TINA-TINA association controls complex formation in the presence of Na(+) but barely competes with guanine-mediated association in K(+) or in the sequence with the longer G-run (dTGGGXGGGT). These results demonstrate new perspectives in the design of molecular entities that can kinetically control G-quadruplex formation and show how tetramolecular G-quadruplexes can be used as a tuneable scaffold to control the arrangement of organic chromophores.

  2. Glucose oxidase-initiated cascade catalysis for sensitive impedimetric aptasensor based on metal-organic frameworks functionalized with Pt nanoparticles and hemin/G-quadruplex as mimicking peroxidases.

    Science.gov (United States)

    Zhou, Xingxing; Guo, Shijing; Gao, Jiaxi; Zhao, Jianmin; Xue, Shuyan; Xu, Wenju

    2017-12-15

    Based on cascade catalysis amplification driven by glucose oxidase (GOx), a sensitive electrochemical impedimetric aptasensor for protein (carcinoembryonic antigen, CEA as tested model) was proposed by using Cu-based metal-organic frameworks functionalized with Pt nanoparticles, aptamer, hemin and GOx (Pt@CuMOFs-hGq-GOx). CEA aptamer loaded onto Pt@CuMOFs was bound with hemin to form hemin@G-quadruplex (hGq) with mimicking peroxidase activity. Through sandwich-type reaction of target CEA and CEA aptamers (Apt1 and Apt2), the obtained Pt@CuMOFs-hGq-GOx as signal transduction probes (STPs) was captured to the modified electrode interface. When 3,3-diaminobenzidine (DAB) and glucose were introduced, the cascade reaction was initiated by GOx to catalyze the oxidation of glucose, in situ generating H 2 O 2 . Simultaneously, the decomposition of the generated H 2 O 2 was greatly promoted by Pt@CuMOFs and hGq as synergistic peroxide catalysts, accompanying with the significant oxidation process of DAB and the formation of nonconductive insoluble precipitates (IPs). As a result, the electron transfer in the resultant sensing interface was effectively hindered and the electrochemical impedimetric signal (EIS) was efficiently amplified. Thus, the high sensitivity of the proposed CEA aptasensor was successfully improved with 0.023pgmL -1 , which may be promising and potential in assaying certain clinical disease related to CEA. Copyright © 2017 Elsevier B.V. All rights reserved.

  3. The estimation of H-bond and metal ion-ligand interaction energies in the G-Quadruplex ⋯ Mn+ complexes

    Science.gov (United States)

    Mostafavi, Najmeh; Ebrahimi, Ali

    2018-06-01

    In order to characterize various interactions in the G-quadruplex ⋯ Mn+ (G-Q ⋯ Mn+) complexes, the individual H-bond (EHB) and metal ion-ligand interaction (EMO) energies have been estimated using the electron charge densities (ρs) calculated at the X ⋯ H (X = N and O) and Mn+ ⋯ O (Mn+ is an alkaline, alkaline earth and transition metal ion) bond critical points (BCPs) obtained from the atoms in molecules (AIM) analysis. The estimated values of EMO and EHB were evaluated using the structural parameters, results of natural bond orbital analysis (NBO), aromaticity indexes and atomic charges. The EMO value increase with the ratio of ionic charge to radius, e/r, where a linear correlation is observed between EMO and e/r (R = 0.97). Meaningful relationships are also observed between EMO and indexes used for aromaticity estimation. The ENH value is higher than EOH in the complexes; this is in complete agreement with the trend of N⋯Hsbnd N and O⋯Hsbnd N angles, the E (2) value of nN → σ*NH and nO → σ*NH interactions and the difference between the natural charges on the H-bonded atom and the hydrogen atom of guanine (Δq). In general, the O1MO2 angle becomes closer to 109.5° with the increase in EMO and decrease in EHB in the presence of metal ion.

  4. Telomeric repeat-containing RNA/G-quadruplex-forming sequences cause genome-wide alteration of gene expression in human cancer cells in vivo.

    Science.gov (United States)

    Hirashima, Kyotaro; Seimiya, Hiroyuki

    2015-02-27

    Telomere erosion causes cell mortality, suggesting that longer telomeres enable more cell divisions. In telomerase-positive human cancer cells, however, telomeres are often kept shorter than those of surrounding normal tissues. Recently, we showed that cancer cell telomere elongation represses innate immune genes and promotes their differentiation in vivo. This implies that short telomeres contribute to cancer malignancy, but it is unclear how such genetic repression is caused by elongated telomeres. Here, we report that telomeric repeat-containing RNA (TERRA) induces a genome-wide alteration of gene expression in telomere-elongated cancer cells. Using three different cell lines, we found that telomere elongation up-regulates TERRA signal and down-regulates innate immune genes such as STAT1, ISG15 and OAS3 in vivo. Ectopic TERRA oligonucleotides repressed these genes even in cells with short telomeres under three-dimensional culture conditions. This appeared to occur from the action of G-quadruplexes (G4) in TERRA, because control oligonucleotides had no effect and a nontelomeric G4-forming oligonucleotide phenocopied the TERRA oligonucleotide. Telomere elongation and G4-forming oligonucleotides showed similar gene expression signatures. Most of the commonly suppressed genes were involved in the innate immune system and were up-regulated in various cancers. We propose that TERRA G4 counteracts cancer malignancy by suppressing innate immune genes. © The Author(s) 2015. Published by Oxford University Press on behalf of Nucleic Acids Research.

  5. A Role for the Fifth G-Track in G-Quadruplex Forming Oncogene Promoter Sequences during Oxidative Stress: Do These “Spare Tires” Have an Evolved Function?

    Science.gov (United States)

    2015-01-01

    Uncontrolled inflammation or oxidative stress generates electron-deficient species that oxidize the genome increasing its instability in cancer. The G-quadruplex (G4) sequences regulating the c-MYC, KRAS, VEGF, BCL-2, HIF-1α, and RET oncogenes, as examples, are targets for oxidation at loop and 5′-core guanines (G) as showcased in this study by CO3•– oxidation of the VEGF G4. Products observed include 8-oxo-7,8-dihydroguanine (OG), spiroiminodihydantoin (Sp), and 5-guanidinohydantoin (Gh). Our previous studies found that OG and Gh, when present in the four G-tracks of the solved structure for VEGF and c-MYC, were not substrates for the base excision repair (BER) DNA glycosylases in biologically relevant KCl solutions. We now hypothesize that a fifth G-track found a few nucleotides distant from the G4 tracks involved in folding can act as a “spare tire,” facilitating extrusion of a damaged G-run into a large loop that then becomes a substrate for BER. Thermodynamic, spectroscopic, and DMS footprinting studies verified the fifth domain replacing a damaged G-track with OG or Gh at a loop or core position in the VEGF G4. These new “spare tire”-containing strands with Gh in loops are now found to be substrates for initiation of BER with the NEIL1, NEIL2, and NEIL3 DNA glycosylases. The results support a hypothesis in which regulatory G4s carry a “spare-tire” fifth G-track for aiding in the repair process when these sequences are damaged by radical oxygen species, a feature observed in a large number of these sequences. Furthermore, formation and repair of oxidized bases in promoter regions may constitute an additional example of epigenetic modification, in this case of guanine bases, to regulate gene expression in which the G4 sequences act as sensors of oxidative stress. PMID:26405692

  6. Mitochondrial DNA analysis of the putative heart of Louis XVII, son of Louis XVI and Marie-Antoinette.

    Science.gov (United States)

    Jehaes, E; Pfeiffer, H; Toprak, K; Decorte, R; Brinkmann, B; Cassiman, J J

    2001-03-01

    According to official historiography, the 10-year-old Louis XVII died in the Temple of Paris on June 8, 1795. However, public rumour spread the theory that Louis XVII escaped and that his descendants would be alive today. One such putative 'Louis XVII' was Carl Wilhelm Naundorff, who died in 1845 in Delft (the Netherlands). Comparative mitochondrial DNA (mtDNA) analysis gave evidence that his remains could not be identified as those of Louis XVII. In the present study, mtDNA analysis was performed on the heart of the young boy who died in the prison of Paris in 1795. In order to obtain the strongest evidence possible, two laboratories independently analysed the heart. The results showed that the consensus mtDNA sequence of the heart was identical to that of the maternal relatives of Louis XVII.

  7. Isolation of full-length putative rat lysophospholipase cDNA using improved methods for mRNA isolation and cDNA cloning

    International Nuclear Information System (INIS)

    Han, J.H.; Stratowa, C.; Rutter, W.J.

    1987-01-01

    The authors have cloned a full-length putative rat pancreatic lysophospholipase cDNA by an improved mRNA isolation method and cDNA cloning strategy using [ 32 P]-labelled nucleotides. These new methods allow the construction of a cDNA library from the adult rat pancreas in which the majority of recombinant clones contained complete sequences for the corresponding mRNAs. A previously recognized but unidentified long and relatively rare cDNA clone containing the entire sequence from the cap site at the 5' end to the poly(A) tail at the 3' end of the mRNA was isolated by single-step screening of the library. The size, amino acid composition, and the activity of the protein expressed in heterologous cells strongly suggest this mRNA codes for lysophospholipase

  8. Stretching chimeric DNA: A test for the putative S-form

    Science.gov (United States)

    Whitelam, Stephen; Pronk, Sander; Geissler, Phillip L.

    2008-11-01

    Double-stranded DNA "overstretches" at a pulling force of about 65 pN, increasing in length by a factor of 1.7. The nature of the overstretched state is unknown, despite its considerable importance for DNA's biological function and technological application. Overstretching is thought by some to be a force-induced denaturation and by others to consist of a transition to an elongated, hybridized state called S-DNA. Within a statistical mechanical model, we consider the effect upon overstretching of extreme sequence heterogeneity. "Chimeric" sequences possessing halves of markedly different AT composition elongate under fixed external conditions via distinct, spatially segregated transitions. The corresponding force-extension data vary with pulling rate in a manner that depends qualitatively and strikingly upon whether the hybridized S-form is accessible. This observation implies a test for S-DNA that could be performed in experiment.

  9. Cloning of oleosin, a putative new hazelnut allergen, using a hazelnut cDNA library

    NARCIS (Netherlands)

    Akkerdaas, Jaap H.; Schocker, Frauke; Vieths, Stefan; Versteeg, Serge; Zuidmeer, Laurian; Hefle, Sue L.; Aalberse, Rob C.; Richter, Klaus; Ferreira, Fatima; van Ree, Ronald

    2006-01-01

    The clinical presentation of non-pollen related allergy to hazelnut can be severe and systemic. So far, only a limited number of non-pollen related hazelnut allergens have been identified and characterized. The aim of this study was to identify and clone new hazelnut allergens. A lambda ZAP cDNA

  10. Structural revisions of small molecules reported to cross-link G-quadruplex DNA in vivo reveal a repetitive assignment error in the literature

    Czech Academy of Sciences Publication Activity Database

    Reyes Gutierrez, Paul Eduardo; Kapal, Tomáš; Klepetářová, Blanka; Šaman, David; Pohl, Radek; Zawada, Zbigniew; Kužmová, Erika; Hájek, Miroslav; Teplý, Filip

    2016-01-01

    Roč. 6, Mar 23 (2016), č. článku 23499. ISSN 2045-2322 R&D Projects: GA ČR GA13-19213S; GA MŠk LO1302 Grant - others:AV ČR(CZ) M200551208 Institutional support: RVO:61388963 Keywords : 1,2-disubstituted benzimidazoles * chemical synthesis * promoter region Subject RIV: CC - Organic Chemistry Impact factor: 4.259, year: 2016 http://www.nature.com/articles/srep23499

  11. Derivation of Reliable Geometries in QM Calculations of DNA Structures: Explicit Solvent QM/MM and Restrained Implicit Solvent QM Optimizations of G-Quadruplexes

    Czech Academy of Sciences Publication Activity Database

    Gkionis, Konstantinos; Kruse, Holger; Šponer, Jiří

    2016-01-01

    Roč. 12, č. 4 (2016), s. 2000-2016 ISSN 1549-9618 R&D Projects: GA ČR(CZ) GAP208/11/1822 Institutional support: RVO:68081707 Keywords : molecular-dynamics simulations * quantum-chemical computations * continuum solvation models Subject RIV: BO - Biophysics Impact factor: 5.245, year: 2016

  12. Putative DNA-dependent RNA polymerase in Mitochondrial Plasmid of Paramecium caudatum Stock GT704

    Directory of Open Access Journals (Sweden)

    Trina Ekawati Tallei

    2015-10-01

    Full Text Available Mitochondria of Paramecium caudatum stock GT704 has a set of four kinds of linear plasmids with sizes of 8.2, 4.1, 2.8 and 1.4 kb. The plasmids of 8.2 and 2.8 kb exist as dimers consisting of 4.1- and 1.4-kb monomers, respectively. The plasmid 2.8 kb, designated as pGT704-2.8, contains an open reading frame encodes for putative DNA-dependent RNA polymerase (RNAP. This study reveals that this RNAP belongs to superfamily of DNA/RNA polymerase and family of T7/T3 single chain RNA polymerase and those of mitochondrial plasmid of fungi belonging to Basidiomycota and Ascomycota. It is suggested that RNAP of pGT704-2.8 can perform transcription without transcription factor as promoter recognition. Given that only two motifs were found, it could not be ascertained whether this RNAP has a full function independently or integrated with mtDNA in carrying out its function.

  13. SAD-3, a Putative Helicase Required for Meiotic Silencing by Unpaired DNA, Interacts with Other Components of the Silencing Machinery

    Science.gov (United States)

    Hammond, Thomas M.; Xiao, Hua; Boone, Erin C.; Perdue, Tony D.; Pukkila, Patricia J.; Shiu, Patrick K. T.

    2011-01-01

    In Neurospora crassa, genes lacking a pairing partner during meiosis are suppressed by a process known as meiotic silencing by unpaired DNA (MSUD). To identify novel MSUD components, we have developed a high-throughput reverse-genetic screen for use with the N. crassa knockout library. Here we describe the screening method and the characterization of a gene (sad-3) subsequently discovered. SAD-3 is a putative helicase required for MSUD and sexual spore production. It exists in a complex with other known MSUD proteins in the perinuclear region, a center for meiotic silencing activity. Orthologs of SAD-3 include Schizosaccharomyces pombe Hrr1, a helicase required for RNAi-induced heterochromatin formation. Both SAD-3 and Hrr1 interact with an RNA-directed RNA polymerase and an Argonaute, suggesting that certain aspects of silencing complex formation may be conserved between the two fungal species. PMID:22384347

  14. Expression, purification and DNA-binding activities of two putative ModE proteins of Herbaspirillum seropedicae (Burkholderiales, Oxalobacteraceae

    Directory of Open Access Journals (Sweden)

    André L.F. Souza

    2008-01-01

    Full Text Available In prokaryotes molybdenum is taken up by a high-affinity ABC-type transporter system encoded by the modABC genes. The endophyte β-Proteobacterium Herbaspirillum seropedicae has two modABC gene clusters and two genes encoding putative Mo-dependent regulator proteins (ModE1 and ModE2. Analysis of the amino acid sequence of the ModE1 protein of H. seropedicae revealed the presence of an N-terminal domain containing a DNA-binding helix-turn-helix motif (HTH and a C-terminal domain with a molybdate-binding motif. The second putative regulator protein, ModE2, contains only the helix-turn-helix motif, similar to that observed in some sequenced genomes. We cloned the modE1 (810 bp and modE2 (372 bp genes and expressed them in Escherichia coli as His-tagged fusion proteins, which we subsequently purified. The over-expressed recombinant His-ModE1 was insoluble and was purified after solubilization with urea and then on-column refolded during affinity chromatography. The His-ModE2 was expressed as a soluble protein and purified by affinity chromatography. These purified proteins were analyzed by DNA band-shift assays using the modA2 promoter region as probe. Our results indicate that His-ModE1 and His-ModE2 are able to bind to the modA2 promoter region, suggesting that both proteins may play a role in the regulation of molybdenum uptake and metabolism in H. seropedicae.

  15. DNA methylation of miRNA coding sequences putatively associated with childhood obesity.

    Science.gov (United States)

    Mansego, M L; Garcia-Lacarte, M; Milagro, F I; Marti, A; Martinez, J A

    2017-02-01

    Epigenetic mechanisms may be involved in obesity onset and its consequences. The aim of the present study was to evaluate whether DNA methylation status in microRNA (miRNA) coding regions is associated with childhood obesity. DNA isolated from white blood cells of 24 children (identification sample: 12 obese and 12 non-obese) from the Grupo Navarro de Obesidad Infantil study was hybridized in a 450 K methylation microarray. Several CpGs whose DNA methylation levels were statistically different between obese and non-obese were validated by MassArray® in 95 children (validation sample) from the same study. Microarray analysis identified 16 differentially methylated CpGs between both groups (6 hypermethylated and 10 hypomethylated). DNA methylation levels in miR-1203, miR-412 and miR-216A coding regions significantly correlated with body mass index standard deviation score (BMI-SDS) and explained up to 40% of the variation of BMI-SDS. The network analysis identified 19 well-defined obesity-relevant biological pathways from the KEGG database. MassArray® validation identified three regions located in or near miR-1203, miR-412 and miR-216A coding regions differentially methylated between obese and non-obese children. The current work identified three CpG sites located in coding regions of three miRNAs (miR-1203, miR-412 and miR-216A) that were differentially methylated between obese and non-obese children, suggesting a role of miRNA epigenetic regulation in childhood obesity. © 2016 World Obesity Federation.

  16. Real-Time Study of the Interaction between G-Rich DNA Oligonucleotides and Lead Ion on DNA Tetrahedron-Functionalized Sensing Platform by Dual Polarization Interferometry.

    Science.gov (United States)

    Wang, Shuang; Lu, Shasha; Zhao, Jiahui; Huang, Jianshe; Yang, Xiurong

    2017-11-29

    G-quadruplex plays roles in numerous physiological and pathological processes of organisms. Due to the unique properties of G-quadruplex (e.g., forming G4/hemin complexes with catalytic activity and electron acceptability, binding with metal ions, proteins, fluorescent ligands, and so on), it has been widely applied in biosensing. But the formation process of G-quadruplex is not yet fully understood. Here, a DNA tetrahedron platform with higher reproducibility, regenerative ability, and time-saving building process was coupled with dual polarization interferometry technique for the real-time and label-free investigation of the specific interaction process of guanine-rich singled-stranded DNA (G-rich ssDNA) and Pb 2+ . The oriented immobilization of probes greatly decreased the spatial hindrance effect and improved the accessibility of the probes to the Pb 2+ ions. Through real-time monitoring of the whole formation process of the G-quadruplex, we speculated that the probes on the tetrahedron platform initially stood on the sensing surface with a random coil conformation, then the G-rich ssDNA preliminarily formed unstable G-quartets by H-bonding and cation binding, subsequently forming a completely folded and stable quadruplex structure through relatively slow strand rearrangements. On the basis of these studies, we also developed a novel sensing platform for the specific and sensitive determination of Pb 2+ and its chelating agent ethylenediaminetetraacetic acid. This study not only provides a proof-of-concept for conformational dynamics of G-quadruplex-related drugs and pathogenes, but also enriches the biosensor tools by combining nanomaterial with interfaces technique.

  17. HRR25, a putative protein kinase from budding yeast: Association with repair of damaged DNA

    International Nuclear Information System (INIS)

    Hoekstra, M.F.; Ou, A.C.; DeMaggio, A.J.; Burbee, D.G.; Liskay, R.M.; Heffron, F.

    1991-01-01

    In simple eukaryotes, protein kinases regulate mitotic and meiotic cell cycles, the response to polypeptide pheromones, and the initiation of nuclear DNA synthesis. The protein HRR25 from the budding yeast Saccharomyces cerevisiae was defined by the mutation hrr25-1. This mutation resulted in sensitivity to continuous expression of the HO double-strand endonuclease, to methyl methanesulfonate, and to x-irradiation. Homozygotes of hrr25-1 were unable to sporulate and disruption and deletion of HRR25 interfered with mitotic and meiotic cell division. Sequence analysis revealed two distinctive regions in the protein. The NH 2 -terminus of HRR25 contains the hallmark features of protein kinases, whereas the COOH-terminus is rich in proline and glutamine. Mutations in HRR25 at conserved residues found in all protein kinases inactivated the gene, and these mutants exhibited the hrr25 null phenotypes. Taken together, the hrr25 mutant phenotypes and the features of the gene product indicate that HRR25 is a distinctive member of the protein kinase superfamily

  18. Cockayne syndrome group A and B proteins converge on transcription-linked resolution of non-B DNA.

    Science.gov (United States)

    Scheibye-Knudsen, Morten; Tseng, Anne; Borch Jensen, Martin; Scheibye-Alsing, Karsten; Fang, Evandro Fei; Iyama, Teruaki; Bharti, Sanjay Kumar; Marosi, Krisztina; Froetscher, Lynn; Kassahun, Henok; Eckley, David Mark; Maul, Robert W; Bastian, Paul; De, Supriyo; Ghosh, Soumita; Nilsen, Hilde; Goldberg, Ilya G; Mattson, Mark P; Wilson, David M; Brosh, Robert M; Gorospe, Myriam; Bohr, Vilhelm A

    2016-11-01

    Cockayne syndrome is a neurodegenerative accelerated aging disorder caused by mutations in the CSA or CSB genes. Although the pathogenesis of Cockayne syndrome has remained elusive, recent work implicates mitochondrial dysfunction in the disease progression. Here, we present evidence that loss of CSA or CSB in a neuroblastoma cell line converges on mitochondrial dysfunction caused by defects in ribosomal DNA transcription and activation of the DNA damage sensor poly-ADP ribose polymerase 1 (PARP1). Indeed, inhibition of ribosomal DNA transcription leads to mitochondrial dysfunction in a number of cell lines. Furthermore, machine-learning algorithms predict that diseases with defects in ribosomal DNA (rDNA) transcription have mitochondrial dysfunction, and, accordingly, this is found when factors involved in rDNA transcription are knocked down. Mechanistically, loss of CSA or CSB leads to polymerase stalling at non-B DNA in a neuroblastoma cell line, in particular at G-quadruplex structures, and recombinant CSB can melt G-quadruplex structures. Indeed, stabilization of G-quadruplex structures activates PARP1 and leads to accelerated aging in Caenorhabditis elegans In conclusion, this work supports a role for impaired ribosomal DNA transcription in Cockayne syndrome and suggests that transcription-coupled resolution of secondary structures may be a mechanism to repress spurious activation of a DNA damage response.

  19. Bis-guanylhydrazone diimidazo[1,2-a:1,2-c]pyrimidine as a novel and specific G-quadruplex binding motif.

    Science.gov (United States)

    Sparapani, Silvia; Bellini, Stefania; Gunaratnam, Mekala; Haider, Shozeb M; Andreani, Aldo; Rambaldi, Mirella; Locatelli, Alessandra; Morigi, Rita; Granaiola, Massimiliano; Varoli, Lucilla; Burnelli, Silvia; Leoni, Alberto; Neidle, Stephen

    2010-08-21

    A bis-guanylhydrazone derivative of diimidazo[1,2-a:1,2-c]pyrimidine has unexpectedly been found to be a potent stabiliser of several quadruplex DNAs, whereas there is no significant interaction with duplex DNA. Molecular modeling suggests that the guanylhydrazone groups play an active role in quadruplex binding.

  20. Coarse-Grained Simulations Complemented by Atomistic Molecular Dynamics Provide New Insights into Folding and Unfolding of Human Telomeric G-Quadruplexes

    Czech Academy of Sciences Publication Activity Database

    Stadlbauer, Petr; Mazzanti, L.; Cragnolini, T.; Wales, D.J.; Derreumaux, P.; Pasquali, C.; Sponer, Jiri

    2016-01-01

    Roč. 12, č. 12 (2016), s. 6077-6097 ISSN 1549-9618 R&D Projects: GA ČR(CZ) GA16-13721S Institutional support: RVO:68081707 Keywords : particle mesh ewald * amber force-field * free-energy profiles * binding dna aptamer Subject RIV: BO - Biophysics Impact factor: 5.245, year: 2016

  1. On the interaction between [Ru(NH3)(6)](3+) and the G-quadruplex forming thrombin binding aptamer sequence

    Czech Academy of Sciences Publication Activity Database

    De Rache, A.; Doneux, T.; Kejnovská, Iva; Buess-Herman, C.

    2013-01-01

    Roč. 126, SEP 2013 (2013), s. 84-90 ISSN 0162-0134 Institutional support: RVO:68081707 Keywords : SELF-ASSEMBLED MONOLAYERS * DNA-MODIFIED SURFACES * CIRCULAR-DICHROISM Subject RIV: BO - Biophysics Impact factor: 3.274, year: 2013

  2. Voltammetry and Molecular Assembly of G-quadruplex DNAzyme on Single-crystal Au(111)-electrode Surfaces – Hemin as an Electrochemical Intercalator

    DEFF Research Database (Denmark)

    Zhang, Ling; Ulstrup, Jens; Zhang, Jingdong

    2016-01-01

    DNA quadruplexes (qs’s) are a class of “non-canonical” oligonucleotides (OGNs) composed of stacked guanine (G) quartets generally stabilized by monovalent cations. Metal porphyrins selectively bind to G-qs complexes to form DNAzyme, which can exhibit peroxidase and other catalytic activity simila...

  3. Enzyme-free colorimetric detection systems based on the DNA strand displacement competition reaction

    DEFF Research Database (Denmark)

    Zhang, Zhao; Birkedal, Victoria; Gothelf, Kurt Vesterager

    2016-01-01

    The strand displacement competition assay is based on the dynamic equilibrium of the competitive hybridization of two oligonucleotides (A and B) to a third oligonucleotide (S). In the presence of an analyte that binds to a specific affinity-moiety conjugated to strand B, the equilibrium shifts, w...... G-quadruplex DNAzyme for colorimetric readout of the detection of streptavidin by the naked eye. Finally, we integrate the whole G-quadruplex DNAzyme system in a single DNA strand and show that it is applicable to colorimetric detection......., which can be detected by a shift in the fluorescence resonance energy transfer signal between dyes attached to the DNA strands. In the present study we have integrated an ATP aptamer in the strand B and demonstrated the optical detection of ATP. Furthermore we explore a new readout method using a split...

  4. Enzyme-free colorimetric detection systems based on the DNA strand displacement competition reaction

    Science.gov (United States)

    Zhang, Z.; Birkedal, V.; Gothelf, K. V.

    2016-05-01

    The strand displacement competition assay is based on the dynamic equilibrium of the competitive hybridization of two oligonucleotides (A and B) to a third oligonucleotide (S). In the presence of an analyte that binds to a specific affinity-moiety conjugated to strand B, the equilibrium shifts, which can be detected by a shift in the fluorescence resonance energy transfer signal between dyes attached to the DNA strands. In the present study we have integrated an ATP aptamer in the strand B and demonstrated the optical detection of ATP. Furthermore we explore a new readout method using a split G-quadruplex DNAzyme for colorimetric readout of the detection of streptavidin by the naked eye. Finally, we integrate the whole G-quadruplex DNAzyme system in a single DNA strand and show that it is applicable to colorimetric detection.

  5. Synthesis and Characterization of thermo/pH-responsive Supramolecular G-Quadruplexes for the Construction of Supramolecular Hacky Sacks for Biorelevant Applications

    Science.gov (United States)

    Negron Rios, Luis M.

    The impact of size, shape, and distribution of lipophilic regions on the surfaces of nanoscopic objects that are amphiphilic or patchy (such as proteins) are yet to be fully understood. One of the reasons for this is the lack of an appropriate model systems in which to probe this question. Our group has previously reported 2'-deoxyguanosine (8ArG) derivatives that self-assemble in aqueous media into discrete supramolecular hexadecamers that show the lower critical solution temperature (LCST) phenomenon. The LCST phenomenon is a convenient and rigorous strategy to measure the hydrophobicity of a system. Although these SGQs are potentially attractive for biomedical applications like drug-delivery, the narrow window of physiological temperatures complicates their implementation. This moved us to redesign the constituent 8ArG subunits to incorporate imidazole moieties that would lead to pH-responsive SGQs, working isothermally. Upon reaching a threshold temperature (Lower Critical Solution Temperature, LCST) at pH 7, these dual-responsive SGQs further self-assemble to form nano/micro hydrogel globules that we called them supramolecular hacky sacks (SHS). However, we can isolate kinetically stable versions of these SHS by lowering the ionic strength of the medium (i.e., from the molar to the millimolar range) in a process that we term "fixing the SHS", in which these SHS maintain their integrity (size and shape) and stability without the requirement of crosslinking agents. After structural characterization and in vitro studies of SHS, we performed encapsulation studies of DOX, rhodamine, dsDNA (F26T), thrombin binding aptamer (TBA) and dextran (3 kDa) Texas Red conjugate. Then we performed in vivo studies of cell internalization and drug delivery with neuroblastoma SY-SH5Y. The performed studies will bring new approaches for the development of new biotechnology for fundamental applications and the emerging of novel therapeutic agents for biomedical applications.

  6. i-Motif of cytosine-rich human telomere DNA fragments containing natural base lesions

    Czech Academy of Sciences Publication Activity Database

    Dvořáková, Zuzana; Renčiuk, Daniel; Kejnovská, Iva; Školáková, Petra; Bednářová, Klára; Sagi, J.; Vorlíčková, Michaela

    2018-01-01

    Roč. 46, č. 4 (2018), s. 1624-1634 ISSN 1362-4962 R&D Projects: GA ČR(CZ) GA15-06785S; GA ČR GA17-12075S; GA ČR(CZ) GJ17-19170Y; GA MŠk EF15_003/0000477 Institutional support: RVO:68081707 Keywords : pair opening kinetics * g-quadruplex dna Subject RIV: CE - Biochemistry OBOR OECD: Biochemistry and molecular biology

  7. Evaluation of the Stability of DNA i-Motifs in the Nuclei of Living Mammalian Cells

    Czech Academy of Sciences Publication Activity Database

    Dzatko, S.; Krafčíková, M.; Haensel-Hertsch, R.; Fessl, T.; Fiala, R.; Loja, T.; Krafčík, D.; Mergny, Jean-Louis; Foldynova-Trantirkova, Silvie; Trantírek, L.

    2018-01-01

    Roč. 57, č. 8 (2018), s. 2165-2169 ISSN 1433-7851 R&D Projects: GA MŠk EF15_003/0000477 Institutional support: RVO:68081707 Keywords : g-quadruplex * telomeric dna * base-pairs * molecular switch Subject RIV: CG - Electrochemistry OBOR OECD: Electrochemistry (dry cells, batteries, fuel cells, corrosion metals, electrolysis) Impact factor: 11.994, year: 2016

  8. New insights into transcription fidelity: thermal stability of non-canonical structures in template DNA regulates transcriptional arrest, pause, and slippage.

    Science.gov (United States)

    Tateishi-Karimata, Hisae; Isono, Noburu; Sugimoto, Naoki

    2014-01-01

    The thermal stability and topology of non-canonical structures of G-quadruplexes and hairpins in template DNA were investigated, and the effect of non-canonical structures on transcription fidelity was evaluated quantitatively. We designed ten template DNAs: A linear sequence that does not have significant higher-order structure, three sequences that form hairpin structures, and six sequences that form G-quadruplex structures with different stabilities. Templates with non-canonical structures induced the production of an arrested, a slipped, and a full-length transcript, whereas the linear sequence produced only a full-length transcript. The efficiency of production for run-off transcripts (full-length and slipped transcripts) from templates that formed the non-canonical structures was lower than that from the linear. G-quadruplex structures were more effective inhibitors of full-length product formation than were hairpin structure even when the stability of the G-quadruplex in an aqueous solution was the same as that of the hairpin. We considered that intra-polymerase conditions may differentially affect the stability of non-canonical structures. The values of transcription efficiencies of run-off or arrest transcripts were correlated with stabilities of non-canonical structures in the intra-polymerase condition mimicked by 20 wt% polyethylene glycol (PEG). Transcriptional arrest was induced when the stability of the G-quadruplex structure (-ΔG°37) in the presence of 20 wt% PEG was more than 8.2 kcal mol(-1). Thus, values of stability in the presence of 20 wt% PEG are an important indicator of transcription perturbation. Our results further our understanding of the impact of template structure on the transcription process and may guide logical design of transcription-regulating drugs.

  9. Mitochondrial DNA analysis on remains of a putative son of Louis XVI, King of France and Marie-Antoinette.

    Science.gov (United States)

    Jehaes, E; Decorte, R; Peneau, A; Petrie, J H; Boiry, P A; Gilissen, A; Moisan, J P; Van den Berghe, H; Pascal, O; Cassiman, J J

    1998-01-01

    Carl Wilhelm Naundorff was buried in 1845 in Delft as Louis Charles, Duc de Normandie, 'Louis XVII'. However, the son of Louis XVI and Marie-Antoinette-Louis XVII--officially died in the Temple of Paris in 1795. In order to resolve the identity of Naundorff, mitochondrial DNA (mtDNA) D-loop sequences of his remains were compared with the sequences obtained from the hairs of two sisters of Marie-Antoinette, Marie-Antoinette herself, and with the sequences obtained from DNA samples of two living maternal relatives. The mtDNA sequence of a bone sample from Naundorff showed two nucleotide differences from the sequences of the three sisters and four differences from the sequences of living maternal relatives. Based on this evidence it becomes very unlikely that Naundroff is the son of Marie-Antoinette.

  10. An efficient cDNA-AFLP-based strategy for the identification of putative pathogenicity factors from the potato cyst nematode Globodera rostochiensis.

    Science.gov (United States)

    Qin, L; Overmars, H; Helder, J; Popeijus, H; van der Voort, J R; Groenink, W; van Koert, P; Schots, A; Bakker, J; Smant, G

    2000-08-01

    A new strategy has been designed to identify putative pathogenicity factors from the dorsal or subventral esophageal glands of the potato cyst nematode Globodera rostochiensis. Three independent criteria were used for selection. First, genes of interest should predominantly be expressed in infective second-stage juveniles, and not, or to a far lesser extent, in younger developmental stages. For this, gene expression profiles from five different developmental stages were generated with cDNA-AFLP (amplified fragment length polymorphism). Secondly, the mRNA corresponding to such a putative pathogenicity factor should predominantly be present in the esophageal glands of pre-parasitic juveniles. This was checked by in situ hybridization. As a third criterion, these proteinaceous factors should be preceded by a signal peptide for secretion. Expression profiles of more than 4,000 genes were generated and three up-regulated, dorsal gland-specific proteins preceded by signal peptide for secretion were identified. No dorsal gland genes have been cloned before from plant-parasitic nematodes. The partial sequence of these three factors, A4, A18, and A41, showed no significant homology to any known gene. Their presence in the dorsal glands of infective juveniles suggests that these proteins could be involved in feeding cell initiation, and not in migration in the plant root or in protection against plant defense responses. Finally, the applicability of this new strategy in other plant-microbe interactions is discussed.

  11. Reconstruction of putative DNA virus from endogenous rice tungro bacilliform virus-like sequences in the rice genome: implications for integration and evolution

    Directory of Open Access Journals (Sweden)

    Kishima Yuji

    2004-10-01

    Full Text Available Abstract Background Plant genomes contain various kinds of repetitive sequences such as transposable elements, microsatellites, tandem repeats and virus-like sequences. Most of them, with the exception of virus-like sequences, do not allow us to trace their origins nor to follow the process of their integration into the host genome. Recent discoveries of virus-like sequences in plant genomes led us to set the objective of elucidating the origin of the repetitive sequences. Endogenous rice tungro bacilliform virus (RTBV-like sequences (ERTBVs have been found throughout the rice genome. Here, we reconstructed putative virus structures from RTBV-like sequences in the rice genome and characterized to understand evolutionary implication, integration manner and involvements of endogenous virus segments in the corresponding disease response. Results We have collected ERTBVs from the rice genomes. They contain rearranged structures and no intact ORFs. The identified ERTBV segments were shown to be phylogenetically divided into three clusters. For each phylogenetic cluster, we were able to make a consensus alignment for a circular virus-like structure carrying two complete ORFs. Comparisons of DNA and amino acid sequences suggested the closely relationship between ERTBV and RTBV. The Oryza AA-genome species vary in the ERTBV copy number. The species carrying low-copy-number of ERTBV segments have been reported to be extremely susceptible to RTBV. The DNA methylation state of the ERTBV sequences was correlated with their copy number in the genome. Conclusions These ERTBV segments are unlikely to have functional potential as a virus. However, these sequences facilitate to establish putative virus that provided information underlying virus integration and evolutionary relationship with existing virus. Comparison of ERTBV among the Oryza AA-genome species allowed us to speculate a possible role of endogenous virus segments against its related disease.

  12. Putative cruciform DNA structures at BCL6 breakpoint region may explain BCL6 translocation in diffuse large B-Cell lymphoma

    International Nuclear Information System (INIS)

    Bhatelia, Khyati D.; Nambiar, Mridula; Choudhary, Bibha; Raghvan, Sathees C.

    2010-01-01

    Cancer is a disease characterized by uncontrolled proliferation of cells, caused by genetic alterations such as chromosomal translocations, which are present in almost all hematological malignancies. Diffuse Large B-cell Lymphoma (DLBL) is the most common non-Hodgkin's lymphoma, comprising 40-50% of all lymphomas both in India and worldwide, and is characterized by BCL6 chromosomal translocation. However, the mechanism of this translocation is completely unknown. By mapping of translocation breakpoints from patients, we have identified three breakpoint cluster regions at 5' UTR of BCL6 gene. Bioinformatics analysis of cluster II, which possesses majority of breakpoints, this region may form cruciform DNA structures. Gel mobility shift assays using oligomeric DNA from the region suggested that a portion of cluster II folded into hairpin structures. Mutations to the wild type sequences disrupted hairpin formation. Circular dichroism studies on BCL6 oligomers resulted in a spectra containing two overlapping peaks at 265 nm and 285 nm, confirming hairpin structure. Further, the structure was destroyed upon heating, and reformed when appropriate conditions were provided. P1 nuclease assay in conjunction with KMnO 4 probing suggested that the structure possessed an eight nucleotide double-stranded stem and a nine nucleotide loop. To further understand the mechanism of BCL6 translocation in vivo, human cells were transfected with episomes harboring cluster II region and the results obtained will be discussed. Hence, our results suggest the formation of a putative cruciform DNA structure at BCL6 breakpoint region and that may facilitate breakage at BCL6 gene explaining chromosomal translocations in DLBL. (author)

  13. Cytomolecular analysis of ribosomal DNA evolution in a natural allotetraploid Brachypodium hybridum and its putative ancestors – dissecting complex repetitive structure of intergenic spacers

    Directory of Open Access Journals (Sweden)

    Natalia Borowska-Zuchowska

    2016-10-01

    Full Text Available Nucleolar dominance is an epigenetic phenomenon associated with nuclear 35S rRNA genes and consists in selective suppression of gene loci inherited from one of the progenitors in the allopolyploid. Our understanding of the exact mechanisms that determine this process is still fragmentary, especially in case of the grass species. This study aimed to shed some light on the molecular basis of this genome-specific inactivation of 35S rDNA loci in an allotetraploid Brachypodium hybridum (2n=30, which arose from the interspecific hybridization between two diploid ancestors that were very similar to modern B. distachyon (2n=10 and B. stacei (2n=20. Using fluorescence in situ hybridization with 25S rDNA and chromosome-specific BAC clones as probes we revealed that the nucleolar dominance is present not only in meristematic root-tip cells but also in differentiated cell fraction of B. hybridum. Additionally, the intergenic spacers (IGSs from both of the putative ancestors and the allotetraploid were sequenced and analyzed. The presumptive transcription initiation sites, spacer promoters and repeated elements were identified within the IGSs. Two different length variants, 2.3 kb and 3.5 kb, of IGSs were identified in B. distachyon and B. stacei, respectively, however only the IGS that had originated from B. distachyon-like ancestor was present in the allotetraploid. The amplification pattern of B. hybridum IGSs suggests that some genetic changes occurred in inactive B. stacei-like rDNA loci during the evolution of the allotetraploid. We hypothesize that their preferential silencing is an effect of structural changes in the sequence rather than just the result of the sole inactivation at the epigenetic level.

  14. Genomic diversity of Mycobacterium tuberculosis Beijing strains isolated in Tuscany, Italy, based on large sequence deletions, SNPs in putative DNA repair genes and MIRU-VNTR polymorphisms.

    Science.gov (United States)

    Garzelli, Carlo; Lari, Nicoletta; Rindi, Laura

    2016-03-01

    The Beijing genotype of Mycobacterium tuberculosis is cause of global concern as it is rapidly spreading worldwide, is considered hypervirulent, and is most often associated to massive spread of MDR/XDR TB, although these epidemiological or pathological properties have not been confirmed for all strains and in all geographic settings. In this paper, to gain new insights into the biogeographical heterogeneity of the Beijing family, we investigated a global sample of Beijing strains (22% from Italian-born, 78% from foreign-born patients) by determining large sequence polymorphism of regions RD105, RD181, RD150 and RD142, single nucleotide polymorphism of putative DNA repair genes mutT4 and mutT2 and MIRU-VNTR profiles based on 11 discriminative loci. We found that, although our sample of Beijing strains showed a considerable genomic heterogeneity, yielding both ancient and recent phylogenetic strains, the prevalent successful Beijing subsets were characterized by deletions of RD105 and RD181 and by one nucleotide substitution in one or both mutT genes. MIRU-VNTR analysis revealed 47 unique patterns and 9 clusters including a total of 33 isolates (41% of total isolates); the relatively high proportion of Italian-born Beijing TB patients, often occurring in mixed clusters, supports the possibility of an ongoing cross-transmission of the Beijing genotype to autochthonous population. High rates of extra-pulmonary localization and drug-resistance, particularly MDR, frequently reported for Beijing strains in other settings, were not observed in our survey. Copyright © 2015 Elsevier Ltd. All rights reserved.

  15. Internal Light Source-Driven Photoelectrochemical 3D-rGO/Cellulose Device Based on Cascade DNA Amplification Strategy Integrating Target Analog Chain and DNA Mimic Enzyme.

    Science.gov (United States)

    Lan, Feifei; Liang, Linlin; Zhang, Yan; Li, Li; Ren, Na; Yan, Mei; Ge, Shenguang; Yu, Jinghua

    2017-11-01

    In this work, a chemiluminescence-driven collapsible greeting card-like photoelectrochemical lab-on-paper device (GPECD) with hollow channel was demonstrated, in which target-triggering cascade DNA amplification strategy was ingeniously introduced. The GPECD had the functions of reagents storage and signal collection, and the change of configuration could control fluidic path, reaction time and alterations in electrical connectivity. In addition, three-dimentional reduced graphene oxide affixed Au flower was in situ grown on paper cellulose fiber for achieving excellent conductivity and biocompatibility. The cascade DNA amplification strategy referred to the cyclic formation of target analog chain and its trigger action to hybridization chain reaction (HCR), leading to the formation of numerous hemin/G-quadruplex DNA mimic enzyme with the presence of hemin. Subjected to the catalysis of hemin/G-quadruplex, the strong chemiluminiscence of luminol-H 2 O 2 system was obtained, which then was used as internal light source to excite photoactive materials realizing the simplification of instrument. In this analyzing process, thrombin served as proof-of-concept, and the concentration of target was converted into the DNA signal output by the specific recognition of aptamer-protein and target analog chain recycling. The target analog chain was produced in quantity with the presence of target, which further triggered abundant HCR and introduced hemin/G-quadruplex into the system. The photocurrent signal was obtained after the nitrogen-doped carbon dots sensitized ZnO was stimulated by chemiluminescence. The proposed GPECD exhibited excellent specificity and sensitivity toward thrombin with a detection limit of 16.7 fM. This judiciously engineered GPECD paved a luciferous way for detecting other protein with trace amounts in bioanalysis and clinical biomedicine.

  16. Equilibrious Strand Exchange Promoted by DNA Conformational Switching

    Science.gov (United States)

    Wu, Zhiguo; Xie, Xiao; Li, Puzhen; Zhao, Jiayi; Huang, Lili; Zhou, Xiang

    2013-01-01

    Most of DNA strand exchange reactions in vitro are based on toehold strategy which is generally nonequilibrium, and intracellular strand exchange mediated by proteins shows little sequence specificity. Herein, a new strand exchange promoted by equilibrious DNA conformational switching is verified. Duplexes containing c-myc sequence which is potentially converted into G-quadruplex are designed in this strategy. The dynamic equilibrium between duplex and G4-DNA is response to the specific exchange of homologous single-stranded DNA (ssDNA). The SER is enzyme free and sequence specific. No ATP is needed and the displaced ssDNAs are identical to the homologous ssDNAs. The SER products and exchange kenetics are analyzed by PAGE and the RecA mediated SER is performed as the contrast. This SER is a new feature of G4-DNAs and a novel strategy to utilize the dynamic equilibrium of DNA conformations.

  17. pH-Modulated Watson-Crick duplex-quadruplex equilibria of guanine-rich and cytosine-rich DNA sequences 140 base pairs upstream of the c-kit transcription initiation site.

    Science.gov (United States)

    Bucek, Pavel; Jaumot, Joaquim; Aviñó, Anna; Eritja, Ramon; Gargallo, Raimundo

    2009-11-23

    Guanine-rich regions of DNA are sequences capable of forming G-quadruplex structures. The formation of a G-quadruplex structure in a region 140 base pairs (bp) upstream of the c-kit transcription initiation site was recently proposed (Fernando et al., Biochemistry, 2006, 45, 7854). In the present study, the acid-base equilibria and the thermally induced unfolding of the structures formed by a guanine-rich region and by its complementary cytosine-rich strand in c-kit were studied by means of circular dichroism and molecular absorption spectroscopies. In addition, competition between the Watson-Crick duplex and the isolated structures was studied as a function of pH value and temperature. Multivariate data analysis methods based on both hard and soft modeling were used to allow accurate quantification of the various acid-base species present in the mixtures. Results showed that the G-quadruplex and i-motif coexist with the Watson-Crick duplex over the pH range from 3.0 to 6.5, approximately, under the experimental conditions tested in this study. At pH 7.0, the duplex is practically the only species present.

  18. A putative non-hr origin of DNA replication in the HindIII-K fragment of Autographa californica multiple nucleocapsid nuclear polyhedrosis virus

    NARCIS (Netherlands)

    Kool, M.; Goldbach, R. W.; Vlak, J. M.

    1994-01-01

    In addition to the seven known homologous regions (hrs) of Autographa californica multiple nucleocapsid polyhedrosis virus (AcMNPV) the HindIII-K fragment was also found to carry a putative ori, although this fragment does not contain an hr. Deletion analysis showed that this ori contains several

  19. Tyramine Hydrochloride Based Label-Free System for Operating Various DNA Logic Gates and a DNA Caliper for Base Number Measurements.

    Science.gov (United States)

    Fan, Daoqing; Zhu, Xiaoqing; Dong, Shaojun; Wang, Erkang

    2017-07-05

    DNA is believed to be a promising candidate for molecular logic computation, and the fluorogenic/colorimetric substrates of G-quadruplex DNAzyme (G4zyme) are broadly used as label-free output reporters of DNA logic circuits. Herein, for the first time, tyramine-HCl (a fluorogenic substrate of G4zyme) is applied to DNA logic computation and a series of label-free DNA-input logic gates, including elementary AND, OR, and INHIBIT logic gates, as well as a two to one encoder, are constructed. Furthermore, a DNA caliper that can measure the base number of target DNA as low as three bases is also fabricated. This DNA caliper can also perform concatenated AND-AND logic computation to fulfil the requirements of sophisticated logic computing. © 2017 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.

  20. Identification of a New G-Quadruplex Motif in the KRAS Promoter and Design of Pyrene-Modified G4-Decoys with Antiproliferative Activity in Pancreatic Cancer Cells

    DEFF Research Database (Denmark)

    Cogoi, Susanna; Paramasivam, Manikandan; Filitchev, Vyacheslav Viatcheslav

    2009-01-01

    A new quadruplex motif located in the promoter of the human KRAS gene, within a nuclease hypersensitive element (NHE), has been characterized. Oligonucleotides mimicking this quadruplex are found to compete with a DNA-protein complex between NHE and a nuclear extract from pancreatic cancer cells........ When modified with (R)-1-O-[4-1-(1-pyrenylethynyl) phenylmethyl]glycerol insertions (TINA), the quadruplex oligonucleotides showed a dramatic increase of the Tm (ΔTm from 22 to 32 °C) and a strong antiproliferative effects in Panc-1 cells....

  1. A prime/boost strategy using DNA/fowlpox recombinants expressing the genetically attenuated E6 protein as a putative vaccine against HPV-16-associated cancers.

    Science.gov (United States)

    Bissa, Massimiliano; Illiano, Elena; Pacchioni, Sole; Paolini, Francesca; Zanotto, Carlo; De Giuli Morghen, Carlo; Massa, Silvia; Franconi, Rosella; Radaelli, Antonia; Venuti, Aldo

    2015-03-05

    Considering the high number of new cases of cervical cancer each year that are caused by human papilloma viruses (HPVs), the development of an effective vaccine for prevention and therapy of HPV-associated cancers, and in particular against the high-risk HPV-16 genotype, remains a priority. Vaccines expressing the E6 and E7 proteins that are detectable in all HPV-positive pre-cancerous and cancer cells might support the treatment of HPV-related lesions and clear already established tumors. In this study, DNA and fowlpox virus recombinants expressing the E6F47R mutant of the HPV-16 E6 oncoprotein were generated, and their correct expression verified by RT-PCR, Western blotting and immunofluorescence. Immunization protocols were tested in a preventive or therapeutic pre-clinical mouse model of HPV-16 tumorigenicity using heterologous (DNA/FP) or homologous (DNA/DNA and FP/FP) prime/boost regimens. The immune responses and therapeutic efficacy were evaluated by ELISA, ELISPOT assays, and challenge with TC-1* cells. In the preventive protocol, while an anti-E6-specific humoral response was just detectable, a specific CD8(+) cytotoxic T-cell response was elicited in immunized mice. After the challenge, there was a delay in cancer appearance and a significant reduction of tumor volume in the two groups of E6-immunized mice, thus confirming the pivotal role of the CD8(+) T-cell response in the control of tumor growth in the absence of E6-specific antibodies. In the therapeutic protocol, in-vivo experiments resulted in a higher number of tumor-free mice after the homologous DNA/DNA or heterologous DNA/FP immunization. These data establish a preliminary indication for the prevention and treatment of HPV-related tumors by the use of DNA and avipox constructs as safe and effective immunogens following a prime/boost strategy. The combined use of recombinants expressing both E6 and E7 proteins might improve the antitumor efficacy, and should represent an important approach to

  2. Redox cycling of endogenous copper by ferulic acid leads to cellular DNA breakage and consequent cell death: A putative cancer chemotherapy mechanism

    Energy Technology Data Exchange (ETDEWEB)

    Sarwar, Tarique [Department of Biochemistry, Faculty of Life Sciences, A.M. University, Aligarh, UP 202002 (India); Zafaryab, Md [Genome Biology Lab, Department of Biosciences, Jamia Millia Islamia, Central University, New Delhi 110025 (India); Husain, Mohammed Amir; Ishqi, Hassan Mubarak; Rehman, Sayeed Ur [Department of Biochemistry, Faculty of Life Sciences, A.M. University, Aligarh, UP 202002 (India); Moshahid Alam Rizvi, M. [Genome Biology Lab, Department of Biosciences, Jamia Millia Islamia, Central University, New Delhi 110025 (India); Tabish, Mohammad, E-mail: tabish.bcmlab@gmail.com [Department of Biochemistry, Faculty of Life Sciences, A.M. University, Aligarh, UP 202002 (India)

    2015-12-01

    Ferulic acid (FA) is a plant polyphenol showing diverse therapeutic effects against cancer, diabetes, cardiovascular and neurodegenerative diseases. FA is a known antioxidant at lower concentrations, however at higher concentrations or in the presence of metal ions such as copper, it may act as a pro-oxidant. It has been reported that copper levels are significantly raised in different malignancies. Cancer cells are under increased oxidative stress as compared to normal cells. Certain therapeutic substances like polyphenols can further increase this oxidative stress and kill cancer cells without affecting the proliferation of normal cells. Through various in vitro experiments we have shown that the pro-oxidant properties of FA are enhanced in the presence of copper. Comet assay demonstrated the ability of FA to cause oxidative DNA breakage in human peripheral lymphocytes which was ameliorated by specific copper-chelating agent such as neocuproine and scavengers of ROS. This suggested the mobilization of endogenous copper in ROS generation and consequent DNA damage. These results were further validated through cytotoxicity experiments involving different cell lines. Thus, we conclude that such a pro-oxidant mechanism involving endogenous copper better explains the anticancer activities of FA. This would be an alternate non-enzymatic, and copper-mediated pathway for the cytotoxic activities of FA where it can selectively target cancer cells with elevated levels of copper and ROS. - Highlights: • Pro-oxidant properties of ferulic acid are enhanced in presence of copper. • Ferulic acid causes oxidative DNA damage in lymphocytes as observed by comet assay. • DNA damage was ameliorated by copper chelating agent neocuproine and ROS scavengers. • Endogenous copper is involved in ROS generation causing DNA damage. • Ferulic acid exerts cancer cell specific cytotoxicity as observed by MTT assay.

  3. TRE5-A retrotransposition profiling reveals putative RNA polymerase III transcription complex binding sites on the Dictyostelium extrachromosomal rDNA element.

    Directory of Open Access Journals (Sweden)

    Thomas Spaller

    Full Text Available The amoeba Dictyostelium discoideum has a haploid genome in which two thirds of the DNA encodes proteins. Consequently, the space available for selfish mobile elements to expand without excess damage to the host genome is limited. The non-long terminal repeat retrotransposon TRE5-A maintains an active population in the D. discoideum genome and apparently adapted to this gene-dense environment by targeting positions ~47 bp upstream of tRNA genes that are devoid of protein-coding regions. Because only ~24% of tRNA genes are associated with a TRE5-A element in the reference genome, we evaluated whether TRE5-A retrotransposition is limited to this subset of tRNA genes. We determined that a tagged TRE5-A element (TRE5-Absr integrated at 384 of 405 tRNA genes, suggesting that expansion of the current natural TRE5-A population is not limited by the availability of targets. We further observed that TRE5-Absr targets the ribosomal 5S gene on the multicopy extrachromosomal DNA element that carries the ribosomal RNA genes, indicating that TRE5-A integration may extend to the entire RNA polymerase III (Pol III transcriptome. We determined that both natural TRE5-A and cloned TRE5-Absr retrotranspose to locations on the extrachromosomal rDNA element that contain tRNA gene-typical A/B box promoter motifs without displaying any other tRNA gene context. Based on previous data suggesting that TRE5-A targets tRNA genes by locating Pol III transcription complexes, we propose that A/B box loci reflect Pol III transcription complex assembly sites that possess a function in the biology of the extrachromosomal rDNA element.

  4. Identification of Novel Gene Targets and Putative Regulators of Arsenic-Associated DNA Methylation in Human Urothelial Cells and Bladder Cancer

    Science.gov (United States)

    Rager, Julia E.; Miller, Sloane; Tulenko, Samantha E.; Smeester, Lisa; Ray, Paul D.; Yosim, Andrew; Currier, Jenna M.; Ishida, María C.; González-Horta, Maria del Carmen; Sánchez-Ramírez, Blanca; Ballinas-Casarrubias, Lourdes; Gutiérrez-Torres, Daniela S.; Drobná, Zuzana; Del Razo, Luz M.; García-Vargas, Gonzalo G.; Kim, William Y.; Zhou, Yi-Hui; Wright, Fred A.; Stýblo, Miroslav; Fry, Rebecca C.

    2016-01-01

    There is strong epidemiologic evidence linking chronic exposure to inorganic arsenic (iAs) to a myriad of adverse health effects, including cancer of the bladder. The present study set out to identify DNA methylation patterns associated with iAs and its metabolites in exfoliated urothelial cells (EUCs) that originate primarily from the urinary bladder, one of the targets of arsenic (As)-induced carcinogenesis. Genome-wide, gene-specific promoter DNA methylation levels were assessed in EUCs from 46 residents of Chihuahua, Mexico, and the relationship was examined between promoter methylation profiles and the intracellular concentrations of total As (tAs) and As species. A set of 49 differentially methylated genes was identified with increased promoter methylation associated with EUC tAs, iAs, and/or monomethylated As (MMAs) enriched for their roles in metabolic disease and cancer. Notably, no genes had differential methylation associated with EUC dimethylated As (DMAs), suggesting that DMAs may influence DNA methylation-mediated urothelial cell responses to a lesser extent than iAs or MMAs. Further analysis showed that 22 of the 49 As-associated genes (45%) are also differentially methylated in bladder cancer tissue identified using The Cancer Genome Atlas repository. Both the As- and cancer-associated genes are enriched for the binding sites of common transcription factors known to play roles in carcinogenesis, demonstrating a novel potential mechanistic link between iAs exposure and bladder cancer. PMID:26039340

  5. Cell-to-cell transformation in Escherichia coli: a novel type of natural transformation involving cell-derived DNA and a putative promoting pheromone.

    Directory of Open Access Journals (Sweden)

    Rika Etchuuya

    Full Text Available Escherichia coli is not assumed to be naturally transformable. However, several recent reports have shown that E. coli can express modest genetic competence in certain conditions that may arise in its environment. We have shown previously that spontaneous lateral transfer of non-conjugative plasmids occurs in a colony biofilm of mixed E. coli strains (a set of a donor strain harbouring a plasmid and a plasmid-free recipient strain. In this study, with high-frequency combinations of strains and a plasmid, we constructed the same lateral plasmid transfer system in liquid culture. Using this system, we demonstrated that this lateral plasmid transfer was DNase-sensitive, indicating that it is a kind of transformation in which DNase-accessible extracellular naked DNA is essential. However, this transformation did not occur with purified plasmid DNA and required a direct supply of plasmid from co-existing donor cells. Based on this feature, we have termed this transformation type as 'cell-to-cell transformation'. Analyses using medium conditioned with the high-frequency strain revealed that this strain released a certain factor(s that promoted cell-to-cell transformation and arrested growth of the other strains. This factor is heat-labile and protease-sensitive, and its roughly estimated molecular mass was between ∼9 kDa and ∼30 kDa, indicating that it is a polypeptide factor. Interestingly, this factor was effective even when the conditioned medium was diluted 10(-5-10(-6, suggesting that it acts like a pheromone with high bioactivity. Based on these results, we propose that cell-to-cell transformation is a novel natural transformation mechanism in E. coli that requires cell-derived DNA and is promoted by a peptide pheromone. This is the first evidence that suggests the existence of a peptide pheromone-regulated transformation mechanism in E. coli and in Gram-negative bacteria.

  6. Putative prophages related to lytic tailless marine dsDNA phage PM2 are widespread in the genomes of aquatic bacteria

    Directory of Open Access Journals (Sweden)

    Bamford Dennis H

    2007-07-01

    Full Text Available Abstract Background The origin and evolution of viruses is currently a heavily discussed issue. One element in this discussion is the innate viral "self" concept, which suggests that viral structures and functions can be divided into two categories. The first category consists of genetic determinants that are inherited from a viral ancestor and encode the viral "self". The second group consists of another set of structures and functions, the "nonself", which is interchangeable between different viruses and can be obtained via lateral gene transfer. Comparing the structures and sequences of the "self" elements, we have proposed that viruses can be grouped into lineages regardless of which domain of life (bacteria, archaea, eukarya they infect. It has also been suggested that viruses are ancient and possibly predate modern cells. Results Here we identified thirteen putative prophages (viral genomes integrated into bacterial chromosome closely related to the virulent icosahedral tailless lipid-containing bacteriophage PM2. Using the comparative genomics approach, we present evidence to support the viral "self" hypothesis and divide genes of the bacteriophage PM2 and related prophages into "self" and "nonself" categories. Conclusion We show here that the previously proposed most conserved viral "self" determinants, the major coat protein and the packaging ATPase, were the only proteins that could be recognized in all detected corticoviral elements. We also argue here that the genes needed for viral genome replication, as well as for host cell lysis, belong to the "nonself" category of genes. Furthermore, we suggest that abundance of PM2-like viruses in the aquatic environment as well as their importance in the ecology of aquatic microorganisms might have been underestimated.

  7. TcA, the putative transposase of the C. elegans Tc1 transposon, has an N-terminal DNA binding domain.

    OpenAIRE

    Schukkink, R F; Plasterk, R H

    1990-01-01

    Tc1 is a transposon present in several copies in the genome of all natural isolates of the nematode C.elegans; it is actively transposing in many strains. In those strains Tc1 insertion is the main cause of spontaneous mutations. The transposon contains one large ORF that we call TcA; we assume that the TcA protein is the transposase of Tc1. We expressed TcA in E.coli, purified the protein and showed that it has a strong affinity for DNA (both single stranded and double stranded). A fusion pr...

  8. Tetrahelical structural family adopted by AGCGA-rich regulatory DNA regions

    Science.gov (United States)

    Kocman, Vojč; Plavec, Janez

    2017-05-01

    Here we describe AGCGA-quadruplexes, an unexpected addition to the well-known tetrahelical families, G-quadruplexes and i-motifs, that have been a focus of intense research due to their potential biological impact in G- and C-rich DNA regions, respectively. High-resolution structures determined by solution-state nuclear magnetic resonance (NMR) spectroscopy demonstrate that AGCGA-quadruplexes comprise four 5'-AGCGA-3' tracts and are stabilized by G-A and G-C base pairs forming GAGA- and GCGC-quartets, respectively. Residues in the core of the structure are connected with edge-type loops. Sequences of alternating 5'-AGCGA-3' and 5'-GGG-3' repeats could be expected to form G-quadruplexes, but are shown herein to form AGCGA-quadruplexes instead. Unique structural features of AGCGA-quadruplexes together with lower sensitivity to cation and pH variation imply their potential biological relevance in regulatory regions of genes responsible for basic cellular processes that are related to neurological disorders, cancer and abnormalities in bone and cartilage development.

  9. Ultrasensitive electrochemical detection of avian influenza A (H7N9) virus DNA based on isothermal exponential amplification coupled with hybridization chain reaction of DNAzyme nanowires.

    Science.gov (United States)

    Yu, Yanyan; Chen, Zuanguang; Jian, Wensi; Sun, Duanping; Zhang, Beibei; Li, Xinchun; Yao, Meicun

    2015-02-15

    In this work, a simple and label-free electrochemical biosensor with duel amplification strategy was developed for DNA detection based on isothermal exponential amplification (EXPAR) coupled with hybridization chain reaction (HCR) of DNAzymes nanowires. Through rational design, neither the primer nor the DNAzymes containing molecular beacons (MBs) could react with the duplex probe which were fixed on the electrode surface. Once challenged with target, the duplex probe cleaved and triggered the EXPAR mediated target recycle and regeneration circles as well as the HCR process. As a result, a greater amount of targets were generated to cleave the duplex probes. Subsequently, the nanowires consisting of the G-quadruplex units were self-assembled through hybridization with the strand fixed on the electrode surface. In the presence of hemin, the resulting catalytic G-quadruplex-hemin HRP-mimicking DNAzymes were formed. Electrochemical signals can be obtained by measuring the increase in reduction current of oxidized 3.3',5.5'-tetramethylbenzidine sulfate (TMB), which was generated by DNAzyme in the presence of H2O2. This method exhibited ultrahigh sensitivity towards avian influenza A (H7N9) virus DNA sequence with detection limits of 9.4 fM and a detection range of 4 orders of magnitude. The biosensor was also capable of discriminating single-nucleotide difference among concomitant DNA sequences and performed well in spiked cell lysates. Copyright © 2014 Elsevier B.V. All rights reserved.

  10. DNA based identification of medicinal materials in Chinese patent medicines

    Science.gov (United States)

    Chen, Rong; Dong, Juan; Cui, Xin; Wang, Wei; Yasmeen, Afshan; Deng, Yun; Zeng, Xiaomao; Tang, Zhuo

    2012-12-01

    Chinese patent medicines (CPM) are highly processed and easy to use Traditional Chinese Medicine (TCM). The market for CPM in China alone is tens of billions US dollars annually and some of the CPM are also used as dietary supplements for health augmentation in the western countries. But concerns continue to be raised about the legality, safety and efficacy of many popular CPM. Here we report a pioneer work of applying molecular biotechnology to the identification of CPM, particularly well refined oral liquids and injections. What's more, this PCR based method can also be developed to an easy to use and cost-effective visual chip by taking advantage of G-quadruplex based Hybridization Chain Reaction. This study demonstrates that DNA identification of specific Medicinal materials is an efficient and cost-effective way to audit highly processed CPM and will assist in monitoring their quality and legality.

  11. High-Resolution Profiling of Drosophila Replication Start Sites Reveals a DNA Shape and Chromatin Signature of Metazoan Origins

    Directory of Open Access Journals (Sweden)

    Federico Comoglio

    2015-05-01

    Full Text Available At every cell cycle, faithful inheritance of metazoan genomes requires the concerted activation of thousands of DNA replication origins. However, the genetic and chromatin features defining metazoan replication start sites remain largely unknown. Here, we delineate the origin repertoire of the Drosophila genome at high resolution. We address the role of origin-proximal G-quadruplexes and suggest that they transiently stall replication forks in vivo. We dissect the chromatin configuration of replication origins and identify a rich spatial organization of chromatin features at initiation sites. DNA shape and chromatin configurations, not strict sequence motifs, mark and predict origins in higher eukaryotes. We further examine the link between transcription and origin firing and reveal that modulation of origin activity across cell types is intimately linked to cell-type-specific transcriptional programs. Our study unravels conserved origin features and provides unique insights into the relationship among DNA topology, chromatin, transcription, and replication initiation across metazoa.

  12. DNA breaks and repair in interstitial telomere sequences: Influence of chromatin structure

    International Nuclear Information System (INIS)

    Revaud, D.

    2009-06-01

    Interstitial Telomeric Sequences (ITS) are over-involved in spontaneous and radiationinduced chromosome aberrations in chinese hamster cells. We have performed a study to investigate the origin of their instability, spontaneously or after low doses irradiation. Our results demonstrate that ITS have a particular chromatin structure: short nucleotide repeat length, less compaction of the 30 nm chromatin fiber, presence of G-quadruplex structures. These features would modulate breaks production and would favour the recruitment of alternative DNA repair mechanisms, which are prone to produce chromosome aberrations. These pathways could be at the origin of chromosome aberrations in ITS whereas NHEJ and HR Double Strand Break repair pathways are rather required for a correct repair in these regions. (author)

  13. DNA origami nanorobot fiber optic genosensor to TMV.

    Science.gov (United States)

    Torelli, Emanuela; Manzano, Marisa; Srivastava, Sachin K; Marks, Robert S

    2018-01-15

    In the quest of greater sensitivity and specificity of diagnostic systems, one continually searches for alternative DNA hybridization methods, enabling greater versatility and where possible field-enabled detection of target analytes. We present, herein, a hybrid molecular self-assembled scaffolded DNA origami entity, intimately immobilized via capture probes linked to aminopropyltriethoxysilane, onto a glass optical fiber end-face transducer, thus producing a novel biosensor. Immobilized DNA nanorobots with a switchable flap can then be actuated by a specific target DNA present in a sample, by exposing a hemin/G-quadruplex DNAzyme, which then catalyzes the generation of chemiluminescence, once the specific fiber probes are immersed in a luminol-based solution. Integrating organic nanorobots to inorganic fiber optics creates a hybrid system that we demonstrate as a proof-of-principle can be utilized in specific DNA sequence detection. This system has potential applications in a wide range of fields, including point-of-care diagnostics or cellular in vivo biosensing when using ultrathin fiber optic probes for research purposes. Copyright © 2017 Elsevier B.V. All rights reserved.

  14. Label-Free Ag+ Detection by Enhancing DNA Sensitized Tb3+ Luminescence

    Directory of Open Access Journals (Sweden)

    Kimberly Kleinke

    2016-08-01

    Full Text Available In this work, the effect of Ag+ on DNA sensitized Tb3+ luminescence was studied initially using the Ag+-specific RNA-cleaving DNAzyme, Ag10c. While we expected to observe luminescence quenching by Ag+, a significant enhancement was produced. Based on this observation, simple DNA oligonucleotide homopolymers were used with systematically varied sequence and length. We discovered that both poly-G and poly-T DNA have a significant emission enhancement by Ag+, while the absolute intensity is stronger with the poly-G DNA, indicating that a G-quadruplex DNA is not required for this enhancement. Using the optimized length of the G7 DNA (an oligo constituted with seven guanines, Ag+ was measured with a detection limit of 57.6 nM. The signaling kinetics, G7 DNA conformation, and the binding affinity of Tb3+ to the DNA in the presence or absence of Ag+ are also studied to reveal the mechanism of emission enhancement. This observation is useful not only for label-free detection of Ag+, but also interesting for the rational design of new biosensors using Tb3+ luminescence.

  15. Structural basis for IL-1α recognition by a modified DNA aptamer that specifically inhibits IL-1α signaling

    Energy Technology Data Exchange (ETDEWEB)

    Ren, Xiaoming; Gelinas, Amy D.; von Carlowitz, Ira; Janjic, Nebojsa; Pyle, Anna Marie (Yale); (SomaLogic)

    2017-10-09

    IL-1α is an essential cytokine that contributes to inflammatory responses and is implicated in various forms of pathogenesis and cancer. Here we report a naphthyl modified DNA aptamer that specifically binds IL-1α and inhibits its signaling pathway. By solving the crystal structure of the IL-1α/aptamer, we provide a high-resolution structure of this critical cytokine and we reveal its functional interaction interface with high-affinity ligands. The non-helical aptamer, which represents a highly compact nucleic acid structure, contains a wealth of new conformational features, including an unknown form of G-quadruplex. The IL-1α/aptamer interface is composed of unusual polar and hydrophobic elements, along with an elaborate hydrogen bonding network that is mediated by sodium ion. IL-1α uses the same interface to interact with both the aptamer and its cognate receptor IL-1RI, thereby suggesting a novel route to immunomodulatory therapeutics.

  16. MTBP, the partner of Treslin, contains a novel DNA-binding domain that is essential for proper initiation of DNA replication.

    Science.gov (United States)

    Kumagai, Akiko; Dunphy, William G

    2017-11-01

    Treslin, which is essential for incorporation of Cdc45 into the replicative helicase, possesses a partner called MTBP (Mdm2-binding protein). We have analyzed Xenopus and human MTBP to assess its role in DNA replication. Depletion of MTBP from Xenopus egg extracts, which also removes Treslin, abolishes DNA replication. These extracts be can rescued with recombinant Treslin-MTBP but not Treslin or MTBP alone. Thus, Treslin-MTBP is collectively necessary for replication. We have identified a C-terminal region of MTBP (the CTM domain) that binds efficiently to both double-stranded DNA and G-quadruplex (G4) DNA. This domain also exhibits homology with budding yeast Sld7. Mutants of MTBP without a functional CTM domain are defective for DNA replication in Xenopus egg extracts. These mutants display an impaired localization to chromatin and the inability to support loading of Cdc45. Human cells harboring such a mutant also display severe S-phase defects. Thus, the CTM domain of MTBP plays a critical role in localizing Treslin-MTBP to the replication apparatus for initiation. © 2017 Kumagai and Dunphy. This article is distributed by The American Society for Cell Biology under license from the author(s). Two months after publication it is available to the public under an Attribution–Noncommercial–Share Alike 3.0 Unported Creative Commons License (http://creativecommons.org/licenses/by-nc-sa/3.0).

  17. Concatenated logic circuits based on a three-way DNA junction: a keypad-lock security system with visible readout and an automatic reset function.

    Science.gov (United States)

    Chen, Junhua; Zhou, Shungui; Wen, Junlin

    2015-01-07

    Concatenated logic circuits operating as a biocomputing keypad-lock security system with an automatic reset function have been successfully constructed on the basis of toehold-mediated strand displacement and three-way-DNA-junction architecture. In comparison with previously reported keypad locks, the distinctive advantage of the proposed security system is that it can be reset and cycled spontaneously a large number of times without an external stimulus, thus making practical applications possible. By the use of a split-G-quadruplex DNAzyme as the signal reporter, the output of the keypad lock can be recognized readily by the naked eye. The "lock" is opened only when the inputs are introduced in an exact order. This requirement provides defense against illegal invasion to protect information at the molecular scale. © 2015 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  18. Structural Insights into the Quadruplex-Duplex 3' Interface Formed from a Telomeric Repeat: A Potential Molecular Target.

    Science.gov (United States)

    Russo Krauss, Irene; Ramaswamy, Sneha; Neidle, Stephen; Haider, Shozeb; Parkinson, Gary N

    2016-02-03

    We report here on an X-ray crystallographic and molecular modeling investigation into the complex 3' interface formed between putative parallel stranded G-quadruplexes and a duplex DNA sequence constructed from the human telomeric repeat sequence TTAGGG. Our crystallographic approach provides a detailed snapshot of a telomeric 3' quadruplex-duplex junction: a junction that appears to have the potential to form a unique molecular target for small molecule binding and interference with telomere-related functions. This unique target is particularly relevant as current high-affinity compounds that bind putative G-quadruplex forming sequences only rarely have a high degree of selectivity for a particular quadruplex. Here DNA junctions were assembled using different putative quadruplex-forming scaffolds linked at the 3' end to a telomeric duplex sequence and annealed to a complementary strand. We successfully generated a series of G-quadruplex-duplex containing crystals, both alone and in the presence of ligands. The structures demonstrate the formation of a parallel folded G-quadruplex and a B-form duplex DNA stacked coaxially. Most strikingly, structural data reveals the consistent formation of a TAT triad platform between the two motifs. This triad allows for a continuous stack of bases to link the quadruplex motif with the duplex region. For these crystal structures formed in the absence of ligands, the TAT triad interface occludes ligand binding at the 3' quadruplex-duplex interface, in agreement with in silico docking predictions. However, with the rearrangement of a single nucleotide, a stable pocket can be produced, thus providing an opportunity for the binding of selective molecules at the interface.

  19. RTEL1 dismantles T loops and counteracts telomeric G4-DNA to maintain telomere integrity.

    Science.gov (United States)

    Vannier, Jean-Baptiste; Pavicic-Kaltenbrunner, Visnja; Petalcorin, Mark I R; Ding, Hao; Boulton, Simon J

    2012-05-11

    T loops and telomeric G-quadruplex (G4) DNA structures pose a potential threat to genome stability and must be dismantled to permit efficient telomere replication. Here we implicate the helicase RTEL1 in the removal of telomeric DNA secondary structures, which is essential for preventing telomere fragility and loss. In the absence of RTEL1, T loops are inappropriately resolved by the SLX4 nuclease complex, resulting in loss of the telomere as a circle. Depleting SLX4 or blocking DNA replication abolished telomere circles (TCs) and rescued telomere loss in RTEL1(-/-) cells but failed to suppress telomere fragility. Conversely, stabilization of telomeric G4-DNA or loss of BLM dramatically enhanced telomere fragility in RTEL1-deficient cells but had no impact on TC formation or telomere loss. We propose that RTEL1 performs two distinct functions at telomeres: it disassembles T loops and also counteracts telomeric G4-DNA structures, which together ensure the dynamics and stability of the telomere. Copyright © 2012 Elsevier Inc. All rights reserved.

  20. Identification and quantification of (5'R)- and (5'S)-8,5'-cyclo-2'-deoxyadenosines in human urine as putative biomarkers of oxidatively induced damage to DNA

    Energy Technology Data Exchange (ETDEWEB)

    Jaruga, Pawel, E-mail: pawel.jaruga@nist.gov [Biochemical Science Division, National Institute of Standards and Technology, Gaithersburg, MD 20899 (United States); Department of Clinical Biochemistry, Collegium Medicum, Nicolaus Copernicus University, Bydgoszcz (Poland); Dizdaroglu, Miral [Biochemical Science Division, National Institute of Standards and Technology, Gaithersburg, MD 20899 (United States)

    2010-06-18

    Biomarkers of oxidatively induced DNA damage are of great interest and can potentially be used for the early detection of disease, monitoring the progression of disease and determining the efficacy of therapy. The present work deals with the measurement in human urine of (5'R)-8,5'-cyclo-2'-deoxyadenosine (R-cdA) and (5'S)-8,5'-cyclo-2'-deoxyadenosine (S-cdA). These modified nucleosides had hitherto not been considered or investigated to be present in urine as possible biomarkers of oxidatively induced DNA damage. Urine samples were collected from volunteers, purified and analyzed by LC-MS/MS with isotope-dilution. R-cdA and S-cdA were detected in urine and quantified. Creatinine levels were also measured. In addition, we measured 8-hydroxy-2'-deoxyguanosine that is commonly used as a biomarker. This study shows, for the first time, that R-cdA and S-cdA exist in human urine and can be identified and quantified by LC-MS/MS. We propose that R-cdA and S-cdA may be well-suited biomarkers for disease processes such as carcinogenesis.

  1. Escherichia coli and Neisseria gonorrhoeae UvrD helicase unwinds G4 DNA structures.

    Science.gov (United States)

    Shukla, Kaustubh; Thakur, Roshan Singh; Ganguli, Debayan; Rao, Desirazu Narasimha; Nagaraju, Ganesh

    2017-10-18

    G-quadruplex (G4) secondary structures have been implicated in various biological processes, including gene expression, DNA replication and telomere maintenance. However, unresolved G4 structures impede replication progression which can lead to the generation of DNA double-strand breaks and genome instability. Helicases have been shown to resolve G4 structures to facilitate faithful duplication of the genome. Escherichia coli UvrD (EcUvrD) helicase plays a crucial role in nucleotide excision repair, mismatch repair and in the regulation of homologous recombination. Here, we demonstrate a novel role of E. coli and Neisseria gonorrhoeae UvrD in resolving G4 tetraplexes. EcUvrD and N gonorrhoeae UvrD were proficient in unwinding previously characterized tetramolecular G4 structures. Notably, EcUvrD was equally efficient in resolving tetramolecular and bimolecular G4 DNA that were derived from the potential G4-forming sequences from the genome of E. coli Interestingly, in addition to resolving intermolecular G4 structures, EcUvrD was robust in unwinding intramolecular G4 structures. These data for the first time provide evidence for the role of UvrD in the resolution of G4 structures, which has implications for the in vivo role of UvrD helicase in G4 DNA resolution and genome maintenance. © 2017 The Author(s). Published by Portland Press Limited on behalf of the Biochemical Society.

  2. DNA breaks and repair in interstitial telomere sequences: Influence of chromatin structure; Etude des cassures de l'ADN et des mecanismes de reparation dans les sequences telomeriques interstitielles: Influence de la structure chromatinienne

    Energy Technology Data Exchange (ETDEWEB)

    Revaud, D.

    2009-06-15

    Interstitial Telomeric Sequences (ITS) are over-involved in spontaneous and radiationinduced chromosome aberrations in chinese hamster cells. We have performed a study to investigate the origin of their instability, spontaneously or after low doses irradiation. Our results demonstrate that ITS have a particular chromatin structure: short nucleotide repeat length, less compaction of the 30 nm chromatin fiber, presence of G-quadruplex structures. These features would modulate breaks production and would favour the recruitment of alternative DNA repair mechanisms, which are prone to produce chromosome aberrations. These pathways could be at the origin of chromosome aberrations in ITS whereas NHEJ and HR Double Strand Break repair pathways are rather required for a correct repair in these regions. (author)

  3. Thorough in silico and in vitro cDNA analysis of 21 putative BRCA1 and BRCA2 splice variants and a complex tandem duplication in BRCA2 allowing the identification of activated cryptic splice donor sites in BRCA2 exon 11.

    Science.gov (United States)

    Baert, Annelot; Machackova, Eva; Coene, Ilse; Cremin, Carol; Turner, Kristin; Portigal-Todd, Cheryl; Asrat, Marie Jill; Nuk, Jennifer; Mindlin, Allison; Young, Sean; MacMillan, Andree; Van Maerken, Tom; Trbusek, Martin; McKinnon, Wendy; Wood, Marie E; Foulkes, William D; Santamariña, Marta; de la Hoya, Miguel; Foretova, Lenka; Poppe, Bruce; Vral, Anne; Rosseel, Toon; De Leeneer, Kim; Vega, Ana; Claes, Kathleen B M

    2018-04-01

    For 21 putative BRCA1 and BRCA2 splice site variants, the concordance between mRNA analysis and predictions by in silico programs was evaluated. Aberrant splicing was confirmed for 12 alterations. In silico prediction tools were helpful to determine for which variants cDNA analysis is warranted, however, predictions for variants in the Cartegni consensus region but outside the canonical sites, were less reliable. Learning algorithms like Adaboost and Random Forest outperformed the classical tools. Further validations are warranted prior to implementation of these novel tools in clinical settings. Additionally, we report here for the first time activated cryptic donor sites in the large exon 11 of BRCA2 by evaluating the effect at the cDNA level of a novel tandem duplication (5' breakpoint in intron 4; 3' breakpoint in exon 11) and of a variant disrupting the splice donor site of exon 11 (c.6841+1G > C). Additional sites were predicted, but not activated. These sites warrant further research to increase our knowledge on cis and trans acting factors involved in the conservation of correct transcription of this large exon. This may contribute to adequate design of ASOs (antisense oligonucleotides), an emerging therapy to render cancer cells sensitive to PARP inhibitor and platinum therapies. © 2017 Wiley Periodicals, Inc.

  4. Identification of EhTIF-IA: The putative E. histolytica orthologue of the ...

    Indian Academy of Sciences (India)

    2016-02-04

    Feb 4, 2016 ... We have identified the E. histolytica equivalent of TIF-1A (EhTIF-IA) by homology search within ..... a putative EhTIF-IA with e-value (3e−25). Comparison of .... some biogenesis is correlated with altered rates of rDNA transcription ..... ylation by CK2 facilitates rDNA transcription by promoting dissociation of ...

  5. A DNA origami nanorobot controlled by nucleic acid hybridization

    KAUST Repository

    Torelli, Emanuela

    2014-03-20

    A prototype for a DNA origami nanorobot is designed, produced, and tested. The cylindrical nanorobot (diameter of 14 nm and length of 48 nm) with a switchable flap, is able to respond to an external stimulus and reacts by a physical switch from a disarmed to an armed configuration able to deliver a cellular compatible message. In the tested design the robot weapon is a nucleic acid fully contained in the inner of the tube and linked to a single point of the internal face of the flap. Upon actuation the nanorobot moves the flap extracting the nucleic acid that assembles into a hemin/G-quadruplex horseradish peroxidase mimicking DNAzyme catalyzing a colorimetric reaction or chemiluminescence generation. The actuation switch is triggered by an external nucleic acid (target) that interacts with a complementary nucleic acid that is beard externally by the nanorobot (probe). Hybridization of probe and target produces a localized structural change that results in flap opening. The flap movement is studied on a two-dimensional prototype origami using Förster resonance energy transfer and is shown to be triggered by a variety of targets, including natural RNAs. The nanorobot has potential for in vivo biosensing and intelligent delivery of biological activators. © 2014 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  6. A DNA origami nanorobot controlled by nucleic acid hybridization.

    Science.gov (United States)

    Torelli, Emanuela; Marini, Monica; Palmano, Sabrina; Piantanida, Luca; Polano, Cesare; Scarpellini, Alice; Lazzarino, Marco; Firrao, Giuseppe

    2014-07-23

    A prototype for a DNA origami nanorobot is designed, produced, and tested. The cylindrical nanorobot (diameter of 14 nm and length of 48 nm) with a switchable flap, is able to respond to an external stimulus and reacts by a physical switch from a disarmed to an armed configuration able to deliver a cellular compatible message. In the tested design the robot weapon is a nucleic acid fully contained in the inner of the tube and linked to a single point of the internal face of the flap. Upon actuation the nanorobot moves the flap extracting the nucleic acid that assembles into a hemin/G-quadruplex horseradish peroxidase mimicking DNAzyme catalyzing a colorimetric reaction or chemiluminescence generation. The actuation switch is triggered by an external nucleic acid (target) that interacts with a complementary nucleic acid that is beard externally by the nanorobot (probe). Hybridization of probe and target produces a localized structural change that results in flap opening. The flap movement is studied on a two-dimensional prototype origami using Förster resonance energy transfer and is shown to be triggered by a variety of targets, including natural RNAs. The nanorobot has potential for in vivo biosensing and intelligent delivery of biological activators. © 2014 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  7. Thermal stability of DNA quadruplex-duplex hybrids.

    Science.gov (United States)

    Lim, Kah Wai; Khong, Zi Jian; Phan, Anh Tuân

    2014-01-14

    DNA has the capacity to adopt several distinct structural forms, such as duplex and quadruplex helices, which have been implicated in cellular processes and shown to exhibit important functional properties. Quadruplex-duplex hybrids, generated from the juxtaposition of these two structural elements, could find applications in therapeutics and nanotechnology. Here we used NMR and CD spectroscopy to investigate the thermal stability of two classes of quadruplex-duplex hybrids comprising fundamentally distinct modes of duplex and quadruplex connectivity: Construct I involves the coaxial orientation of the duplex and quadruplex helices with continual base stacking across the two components; Construct II involves the orthogonal orientation of the duplex and quadruplex helices with no base stacking between the two components. We have found that for both constructs, the stability of the quadruplex generally increases with the length of the stem-loop incorporated, with respect to quadruplexes comprising nonstructured loops of the same length, which showed a continuous drop in stability with increasing loop length. The stability of these complexes, particularly Construct I, can be substantially influenced by the base-pair steps proximal to the quadruplex-duplex junction. Bulges at the junction are largely detrimental to the adoption of the desired G-quadruplex topology for Construct I but not for Construct II. These findings should facilitate future design and prediction of quadruplex-duplex hybrids.

  8. R-loops and initiation of DNA replication in human cells: a missing link?

    Directory of Open Access Journals (Sweden)

    Rodrigo eLombraña

    2015-04-01

    Full Text Available The unanticipated widespread occurrence of stable hybrid DNA/RNA structures (R-loops in human cells and the increasing evidence of their involvement in several human malignancies have invigorated the research on R-loop biology in recent years. Here we propose that physiological R-loop formation at CpG island promoters can contribute to DNA replication origin specification at these regions, the most efficient replication initiation sites in mammalian cells. Quite likely, this occurs by the strand-displacement reaction activating the formation of G-quadruplex structures that target the Origin Recognition Complex (ORC in the single-stranded conformation. In agreement with this, we found that R-loops co-localize with the ORC within the same CpG island region in a significant fraction of these efficient replication origins, precisely at the position displaying the highest density of G4 motifs. This scenario builds on the connection between transcription and replication in human cells and suggests that R-loop dysregulation at CpG island promoter-origins might contribute to the phenotype of DNA replication abnormalities and loss of genome integrity detected in cancer cells.

  9. TERRA mimicking ssRNAs prevail over the DNA substrate for telomerase in vitro due to interactions with the alternative binding site.

    Science.gov (United States)

    Azhibek, Dulat; Skvortsov, Dmitry; Andreeva, Anna; Zatsepin, Timofei; Arutyunyan, Alexandr; Zvereva, Maria; Dontsova, Olga

    2016-06-01

    Telomerase is a key component of the telomere length maintenance system in the majority of eukaryotes. Telomerase displays maximal activity in stem and cancer cells with high proliferative potential. In humans, telomerase activity is regulated by various mechanisms, including the interaction with telomere ssDNA overhangs that contain a repetitive G-rich sequence, and with noncoding RNA, Telomeric repeat-containing RNA (TERRA), that contains the same sequence. So these nucleic acids can compete for telomerase RNA templates in the cell. In this study, we have investigated the ability of different model substrates mimicking telomere DNA overhangs and TERRA RNA to compete for telomerase in vitro through a previously developed telomerase inhibitor assay. We have shown in this study that RNA oligonucleotides are better competitors for telomerase that DNA ones as RNA also use an alternative binding site on telomerase, and the presence of 2'-OH groups is significant in these interactions. In contrast to DNA, the possibility of forming intramolecular G-quadruplex structures has a minor effect for RNA binding to telomerase. Taking together our data, we propose that TERRA RNA binds better to telomerase compared with its native substrate - the 3'-end of telomere DNA overhang. As a result, some specific factor may exist that participates in switching telomerase from TERRA to the 3'-end of DNA for telomere elongation at the distinct period of a cell cycle in vivo. Copyright © 2015 John Wiley & Sons, Ltd. Copyright © 2015 John Wiley & Sons, Ltd.

  10. Highly sensitive and selective detection of Pb2+ using a turn-on fluorescent aptamer DNA silver nanoclusters sensor.

    Science.gov (United States)

    Zhang, Baozhu; Wei, Chunying

    2018-05-15

    A novel turn-on fluorescent biosensor has been constructed using C-PS2.M-DNA-templated silver nanoclusters (Ag NCs) with an average diameter of about 1 nm. The proposed approach presents a low-toxic, simple, sensitive, and selective detection for Pb 2+ . The fluorescence intensity of C-PS2.M-DNA-Ag NCs enhances significantly in the presence of Pb 2+ , which is attributed to the special interaction between Pb 2+ and its aptamer DNA PS2.M. Pb 2+ induces the aptamer to form G-quadruplex and makes two darkish DNA/Ag NCs located at the 3' and 5' terminus close, resulting in the fluorescence light-up. Moreover, Pb 2+ can be detected as low as 3.0 nM within a good linear range from 5 to 50 nM (R = 0.9862). Furthermore, the application for detection of Pb 2+ in real water samples further demonstrates the reliability of the sensor. Thus, this sensor system shows a potential application for monitoring Pb 2+ in environmental samples. Copyright © 2018 Elsevier B.V. All rights reserved.

  11. Low-Energy Electron-Induced Strand Breaks in Telomere-Derived DNA Sequences-Influence of DNA Sequence and Topology.

    Science.gov (United States)

    Rackwitz, Jenny; Bald, Ilko

    2018-03-26

    During cancer radiation therapy high-energy radiation is used to reduce tumour tissue. The irradiation produces a shower of secondary low-energy (DNA very efficiently by dissociative electron attachment. Recently, it was suggested that low-energy electron-induced DNA strand breaks strongly depend on the specific DNA sequence with a high sensitivity of G-rich sequences. Here, we use DNA origami platforms to expose G-rich telomere sequences to low-energy (8.8 eV) electrons to determine absolute cross sections for strand breakage and to study the influence of sequence modifications and topology of telomeric DNA on the strand breakage. We find that the telomeric DNA 5'-(TTA GGG) 2 is more sensitive to low-energy electrons than an intermixed sequence 5'-(TGT GTG A) 2 confirming the unique electronic properties resulting from G-stacking. With increasing length of the oligonucleotide (i.e., going from 5'-(GGG ATT) 2 to 5'-(GGG ATT) 4 ), both the variety of topology and the electron-induced strand break cross sections increase. Addition of K + ions decreases the strand break cross section for all sequences that are able to fold G-quadruplexes or G-intermediates, whereas the strand break cross section for the intermixed sequence remains unchanged. These results indicate that telomeric DNA is rather sensitive towards low-energy electron-induced strand breakage suggesting significant telomere shortening that can also occur during cancer radiation therapy. © 2018 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.

  12. Thermodynamic properties of water molecules in the presence of cosolute depend on DNA structure: a study using grid inhomogeneous solvation theory

    Science.gov (United States)

    Nakano, Miki; Tateishi-Karimata, Hisae; Tanaka, Shigenori; Tama, Florence; Miyashita, Osamu; Nakano, Shu-ichi; Sugimoto, Naoki

    2015-01-01

    In conditions that mimic those of the living cell, where various biomolecules and other components are present, DNA strands can adopt many structures in addition to the canonical B-form duplex. Previous studies in the presence of cosolutes that induce molecular crowding showed that thermal stabilities of DNA structures are associated with the properties of the water molecules around the DNAs. To understand how cosolutes, such as ethylene glycol, affect the thermal stability of DNA structures, we investigated the thermodynamic properties of water molecules around a hairpin duplex and a G-quadruplex using grid inhomogeneous solvation theory (GIST) with or without cosolutes. Our analysis indicated that (i) cosolutes increased the free energy of water molecules around DNA by disrupting water–water interactions, (ii) ethylene glycol more effectively disrupted water–water interactions around Watson–Crick base pairs than those around G-quartets or non-paired bases, (iii) due to the negative electrostatic potential there was a thicker hydration shell around G-quartets than around Watson–Crick-paired bases. Our findings suggest that the thermal stability of the hydration shell around DNAs is one factor that affects the thermal stabilities of DNA structures under the crowding conditions. PMID:26538600

  13. Reversible Modulation of DNA-Based Hydrogel Shapes by Internal Stress Interactions.

    Science.gov (United States)

    Hu, Yuwei; Kahn, Jason S; Guo, Weiwei; Huang, Fujian; Fadeev, Michael; Harries, Daniel; Willner, Itamar

    2016-12-14

    We present the assembly of asymmetric two-layer hybrid DNA-based hydrogels revealing stimuli-triggered reversibly modulated shape transitions. Asymmetric, linear hydrogels that include layer-selective switchable stimuli-responsive elements that control the hydrogel stiffness are designed. Trigger-induced stress in one of the layers results in the bending of the linear hybrid structure, thereby minimizing the elastic free energy of the systems. The removal of the stress by a counter-trigger restores the original linear bilayer hydrogel. The stiffness of the DNA hydrogel layers is controlled by thermal, pH (i-motif), K + ion/crown ether (G-quadruplexes), chemical (pH-doped polyaniline), or biocatalytic (glucose oxidase/urease) triggers. A theoretical model relating the experimental bending radius of curvatures of the hydrogels with the Young's moduli and geometrical parameters of the hydrogels is provided. Promising applications of shape-regulated stimuli-responsive asymmetric hydrogels include their use as valves, actuators, sensors, and drug delivery devices.

  14. Exploring the Dynamics of Propeller Loops in Human Telomeric DNA Quadruplexes Using Atomistic Simulations

    Science.gov (United States)

    2017-01-01

    We have carried out a series of extended unbiased molecular dynamics (MD) simulations (up to 10 μs long, ∼162 μs in total) complemented by replica-exchange with the collective variable tempering (RECT) approach for several human telomeric DNA G-quadruplex (GQ) topologies with TTA propeller loops. We used different AMBER DNA force-field variants and also processed simulations by Markov State Model (MSM) analysis. The slow conformational transitions in the propeller loops took place on a scale of a few μs, emphasizing the need for long simulations in studies of GQ dynamics. The propeller loops sampled similar ensembles for all GQ topologies and for all force-field dihedral-potential variants. The outcomes of standard and RECT simulations were consistent and captured similar spectrum of loop conformations. However, the most common crystallographic loop conformation was very unstable with all force-field versions. Although the loss of canonical γ-trans state of the first propeller loop nucleotide could be related to the indispensable bsc0 α/γ dihedral potential, even supporting this particular dihedral by a bias was insufficient to populate the experimentally dominant loop conformation. In conclusion, while our simulations were capable of providing a reasonable albeit not converged sampling of the TTA propeller loop conformational space, the force-field description still remained far from satisfactory. PMID:28475322

  15. Logic gates and antisense DNA devices operating on a translator nucleic Acid scaffold.

    Science.gov (United States)

    Shlyahovsky, Bella; Li, Yang; Lioubashevski, Oleg; Elbaz, Johann; Willner, Itamar

    2009-07-28

    A series of logic gates, "AND", "OR", and "XOR", are designed using a DNA scaffold that includes four "footholds" on which the logic operations are activated. Two of the footholds represent input-recognition strands, and these are blocked by complementary nucleic acids, whereas the other two footholds are blocked by nucleic acids that include the horseradish peroxidase (HRP)-mimicking DNAzyme sequence. The logic gates are activated by either nucleic acid inputs that hybridize to the respective "footholds", or by low-molecular-weight inputs (adenosine monophosphate or cocaine) that yield the respective aptamer-substrate complexes. This results in the respective translocation of the blocking nucleic acids to the footholds carrying the HRP-mimicking DNAzyme sequence, and the concomitant release of the respective DNAzyme. The released product-strands then self-assemble into the hemin/G-quadruplex-HRP-mimicking DNAzyme that biocatalyzes the formation of a colored product and provides an output signal for the different logic gates. The principle of the logic operation is, then, implemented as a possible paradigm for future nanomedicine. The nucleic acid inputs that bind to the blocked footholds result in the translocation of the blocking nucleic acids to the respective footholds carrying the antithrombin aptamer. The released aptamer inhibits, then, the hydrolytic activity of thrombin. The system demonstrates the regulation of a biocatalytic reaction by a translator system activated on a DNA scaffold.

  16. Tomato protoplast DNA transformation : physical linkage and recombination of exogenous DNA sequences

    NARCIS (Netherlands)

    Jongsma, Maarten; Koornneef, Maarten; Zabel, Pim; Hille, Jacques

    1987-01-01

    Tomato protoplasts have been transformed with plasmid DNA's, containing a chimeric kanamycin resistance gene and putative tomato origins of replication. A calcium phosphate-DNA mediated transformation procedure was employed in combination with either polyethylene glycol or polyvinyl alcohol. There

  17. Shedding lights on the flexible-armed porphyrins: Human telomeric G4 DNA interaction and cell photocytotoxicity research.

    Science.gov (United States)

    Sun, Xiang-Yu; Zhao, Ping; Jin, Shu-Fang; Liu, Min-Chao; Wang, Xia-Hong; Huang, Yu-Min; Cheng, Zhen-Feng; Yan, Si-Qi; Li, Yan-Yu; Chen, Ya-Qing; Zhong, Yan-Mei

    2017-08-01

    DNA polymorphism exerts a fascination on a large scientific community. Without crystallographic structural data, clarification of the binding modes between G-quadruplex (G4) and ligand (complex) is a challenging job. In the present work, three porphyrin compounds with different flexible carbon chains (arms) were designed, synthesized and characterized. Their binding, folding and stabilizing abilities to human telomeric G4 DNA structures were comparatively researched. Positive charges at the end of the flexible carbon chains seem to be favorable for the DNA-porphyrin interactions, which were evidenced by the spectral results and further confirmed by the molecular docking calculations. Biological function analysis demonstrated that these porphyrins show no substantial inhibition to Hela, A549 and BEL 7402 cancer cell lines under dark while exhibit broad inhibition under visible light. This significantly enhanced photocytotoxicity relative to the dark control is an essential property of photochemotherapeutic agents. The feature of the flexible arms emerges as critical influencing factors in the cell photocytotoxicity. Moreover, an ROS-mediated mitochondrial dysfunction pathway was suggested for the cell apoptosis induced by these flexible-armed porphyrins. It is found that the porphyrins with positive charges located at the end of the flexible arms represent an exciting opportunity for photochemotherapeutic anti-cancer drug design. Copyright © 2017. Published by Elsevier B.V.

  18. Dynamic DNA binding, junction recognition and G4 melting activity underlie the telomeric and genome-wide roles of human CST.

    Science.gov (United States)

    Bhattacharjee, Anukana; Wang, Yongyao; Diao, Jiajie; Price, Carolyn M

    2017-12-01

    Human CST (CTC1-STN1-TEN1) is a ssDNA-binding complex that helps resolve replication problems both at telomeres and genome-wide. CST resembles Replication Protein A (RPA) in that the two complexes harbor comparable arrays of OB-folds and have structurally similar small subunits. However, the overall architecture and functions of CST and RPA are distinct. Currently, the mechanism underlying CST action at diverse replication issues remains unclear. To clarify CST mechanism, we examined the capacity of CST to bind and resolve DNA structures found at sites of CST activity. We show that CST binds preferentially to ss-dsDNA junctions, an activity that can explain the incremental nature of telomeric C-strand synthesis following telomerase action. We also show that CST unfolds G-quadruplex structures, thus providing a mechanism for CST to facilitate replication through telomeres and other GC-rich regions. Finally, smFRET analysis indicates that CST binding to ssDNA is dynamic with CST complexes undergoing concentration-dependent self-displacement. These findings support an RPA-based model where dissociation and re-association of individual OB-folds allow CST to mediate loading and unloading of partner proteins to facilitate various aspects of telomere replication and genome-wide resolution of replication stress. © The Author(s) 2017. Published by Oxford University Press on behalf of Nucleic Acids Research.

  19. Modular Nuclease-Responsive DNA Three-Way Junction-Based Dynamic Assembly of a DNA Device and Its Sensing Application.

    Science.gov (United States)

    Zhu, Jing; Wang, Lei; Xu, Xiaowen; Wei, Haiping; Jiang, Wei

    2016-04-05

    Here, we explored a modular strategy for rational design of nuclease-responsive three-way junctions (TWJs) and fabricated a dynamic DNA device in a "plug-and-play" fashion. First, inactivated TWJs were designed, which contained three functional domains: the inaccessible toehold and branch migration domains, the specific sites of nucleases, and the auxiliary complementary sequence. The actions of different nucleases on their specific sites in TWJs caused the close proximity of the same toehold and branch migration domains, resulting in the activation of the TWJs and the formation of a universal trigger for the subsequent dynamic assembly. Second, two hairpins (H1 and H2) were introduced, which could coexist in a metastable state, initially to act as the components for the dynamic assembly. Once the trigger initiated the opening of H1 via TWJs-driven strand displacement, the cascade hybridization of hairpins immediately switched on, resulting in the formation of the concatemers of H1/H2 complex appending numerous integrated G-quadruplexes, which were used to obtain label-free signal readout. The inherent modularity of this design allowed us to fabricate a flexible DNA dynamic device and detect multiple nucleases through altering the recognition pattern slightly. Taking uracil-DNA glycosylase and CpG methyltransferase M.SssI as models, we successfully realized the butt joint between the uracil-DNA glycosylase and M.SssI recognition events and the dynamic assembly process. Furthermore, we achieved ultrasensitive assay of nuclease activity and the inhibitor screening. The DNA device proposed here will offer an adaptive and flexible tool for clinical diagnosis and anticancer drug discovery.

  20. Targeting C-Myc Promoter: Helquats As Novel G-Quadruplex Stabilizing Ligands

    Czech Academy of Sciences Publication Activity Database

    Kužmová, Erika; Kozák, Jaroslav; Komárková, Veronika; Pytlík, R.; Teplý, Filip; Hájek, Miroslav

    2014-01-01

    Roč. 124, č. 21 (2014) ISSN 0006-4971. [Annual Meeting of the American Society of Hematology /56./. 06.12.2014-09.12.2014, San Francisco] Institutional support: RVO:61388963 Keywords : helquats * C-Myc * leukemia Subject RIV: CE - Biochemistry

  1. Conformations of Human Telomeric G-Quadruplex Studied Using a Nucleotide-Independent Nitroxide Label

    Czech Academy of Sciences Publication Activity Database

    Zhang, X.J.; Xu, C.X.; Di Felice, R.; Šponer, Jiří; Islam, B.; Stadlbauer, Petr; Ding, Y.; Mao, L.; Mao, Z.W.; Qin, P.Z.

    2016-01-01

    Roč. 55, č. 2 (2016), s. 360-372 ISSN 0006-2960 R&D Projects: GA ČR(CZ) GAP208/11/1822; GA MŠk(CZ) ED1.1.00/02.0068 Institutional support: RVO:68081707 Keywords : PARAMAGNETIC-RESONANCE SPECTROSCOPY * AMBER FORCE-FIELD * NUCLEIC-ACIDS Subject RIV: BO - Biophysics Impact factor: 2.938, year: 2016

  2. Wild-type p53 binds to MYC promoter G-quadruplex

    Czech Academy of Sciences Publication Activity Database

    Petr, Marek; Helma, Robert; Polášková, Alena; Krejci, Aneta; Dvořáková, Zuzana; Kejnovská, Iva; Navrátilová, Lucie; Adámik, Matěj; Vorlíčková, Michaela; Brázdová, Marie

    2016-01-01

    Roč. 36, OCT2016 (2016), č. článku e00397. ISSN 0144-8463 R&D Projects: GA ČR GA13-36108S; GA ČR GAP205/12/0466 Institutional support: RVO:68081707 Keywords : nuclease-hypersensitive element * c-terminal domain * gene-expression Subject RIV: BO - Biophysics Impact factor: 2.906, year: 2016

  3. Modular Assembly of Cell-targeting Devices Based on an Uncommon G-quadruplex Aptamer

    DEFF Research Database (Denmark)

    Opazo, Felipe; Eiden, Laura; Hansen, Line

    2015-01-01

    cells. We further optimized this aptamer to a highly versatile and stable minimized version. The minimized aptamer can be easily equipped with different functionalities like quantum dots, organic dyes, or even a second different aptamer domain yielding a bi-paratopic aptamer. Although the target...

  4. G-quadruplex formation in the Oct4 promoter positively regulates Oct4 expression

    Czech Academy of Sciences Publication Activity Database

    Renčiuk, Daniel; Ryneš, J.; Kejnovská, Iva; Foldynova-Trantirkova, S.; Andaeng, M.; Trantírek, L.; Vorlíčková, Michaela

    2017-01-01

    Roč. 1860, č. 2 (2017), s. 175-183 ISSN 1874-9399 R&D Projects: GA ČR(CZ) GP14-33947P; GA ČR GAP205/12/0466; GA ČR(CZ) GA15-06785S Institutional support: RVO:68081707 Keywords : linked polymorphic region * guanine quadruplexes * transcription factor Subject RIV: CE - Biochemistry OBOR OECD: Biochemistry and molecular biology Impact factor: 5.018, year: 2016

  5. Stephen Neidle on cancer therapy and G-quadruplex inhibitors. Interview by Joanna De Souza.

    Science.gov (United States)

    Neidle, Stephen

    2004-09-15

    Stephen Neidle was educated at Imperial College, London, where he graduated in chemistry and then proceeded to do a PhD in crystallography. After a period as an ICI Fellow, he joined the Biophysics Department at King's College, which ignited his interest in nucleic acid structural studies. He was appointed as one of the first Cancer Research Campaign Career Development Awardees, becoming a Life Fellow on moving to the Institute of Cancer Research. He was appointed to the Chair of Biophysics at the Institute of Cancer Research in 1990, and moved to the new Chair of Chemical Biology at the School of Pharmacy in the University of London in 2002, where he also directs the Cancer Research UK Biomolecular Structure Group. He is currently Chairman of the Chemical Biology Forum of the Royal Society of Chemistry, which is involved in developing the interface between chemistry and the life sciences. He will shortly assume the Directorship of the newly-established Centre for Cancer Medicines at the School. Stephen Neidle has received several awards for his work on drug-nucleic acid recognition and drug design, including the 2000 prize of the Biological and Medicinal Chemistry Sector of the Royal Society of Chemistry, and its 2002 Interdisciplinary Award. He was the 2004 Paul Ehrlich Lecturer of the French Societé de Chimie Therapeutique, and was recently awarded the 2004 Aventis Prize in Medicinal Chemistry.

  6. RecQ-core of BLM unfolds telomeric G-quadruplex in the absence of ATP

    Czech Academy of Sciences Publication Activity Database

    Budhathoki, J.B.; Ray, S.; Urban, Václav; Janščák, Pavel; Yodh, J.G.; Balci, H.

    2014-01-01

    Roč. 42, č. 18 (2014), 11528–11545 ISSN 0305-1048 R&D Projects: GA ČR GA204/09/0565 Grant - others:U.S. National Science Foundation(US) 1430124 Institutional support: RVO:68378050 Keywords : Bloom helicase * ATP * Gquadruplex (GQ) structure * GQ destabilization Subject RIV: EB - Genetics ; Molecular Biology Impact factor: 9.112, year: 2014

  7. Bloom’s syndrome protein unfolding G-quadruplexes in two pathways

    Science.gov (United States)

    Zhao, Zhen-Ye; Xu, Chun-Hua; Shi, Jing; Li, Jing-Hua; Ma, Jian-Bing; Jia, Qi; Ma, Dong-Fei; Li, Ming; Lu, Ying

    2017-08-01

    Not Available Project supported by the National Natural Science Foundation of China (Grant Nos. 11674382, 11574381, and 11574382) and the Key Research Program of Frontier Sciences, Chinese Academy of Sciences (Grant No. QYZDJ-SSW-SYS014).

  8. DNA Replication Dynamics of the GGGGCC Repeat of the C9orf72 Gene.

    Science.gov (United States)

    Thys, Ryan Griffin; Wang, Yuh-Hwa

    2015-11-27

    DNA has the ability to form a variety of secondary structures in addition to the normal B-form DNA, including hairpins and quadruplexes. These structures are implicated in a number of neurological diseases and cancer. Expansion of a GGGGCC repeat located at C9orf72 is associated with familial amyotrophic lateral sclerosis and frontotemporal dementia. This repeat expands from two to 24 copies in normal individuals to several hundreds or thousands of repeats in individuals with the disease. Biochemical studies have demonstrated that as little as four repeats have the ability to form a stable DNA secondary structure known as a G-quadruplex. Quadruplex structures have the ability to disrupt normal DNA processes such as DNA replication and transcription. Here we examine the role of GGGGCC repeat length and orientation on DNA replication using an SV40 replication system in human cells. Replication through GGGGCC repeats leads to a decrease in overall replication efficiency and an increase in instability in a length-dependent manner. Both repeat expansions and contractions are observed, and replication orientation is found to influence the propensity for expansions or contractions. The presence of replication stress, such as low-dose aphidicolin, diminishes replication efficiency but has no effect on instability. Two-dimensional gel electrophoresis analysis demonstrates a replication stall with as few as 20 GGGGCC repeats. These results suggest that replication of the GGGGCC repeat at C9orf72 is perturbed by the presence of expanded repeats, which has the potential to result in further expansion, leading to disease. © 2015 by The American Society for Biochemistry and Molecular Biology, Inc.

  9. Label-free and sensitive detection of T4 polynucleotide kinase activity via coupling DNA strand displacement reaction with enzymatic-aided amplification.

    Science.gov (United States)

    Cheng, Rui; Tao, Mangjuan; Shi, Zhilu; Zhang, Xiafei; Jin, Yan; Li, Baoxin

    2015-11-15

    Several fluorescence signal amplification strategies have been developed for sensitive detection of T4 polynucleotide kinase (T4 PNK) activity, but they need fluorescence dye labeled DNA probe. We have addressed the limitation and report here a label-free strategy for sensitive detection of PNK activity by coupling DNA strand displacement reaction with enzymatic-aided amplification. A hairpin oligonucleotide (hpDNA) with blunt ends was used as the substrate for T4 PNK phosphorylation. In the presence of T4 PNK, the stem of hpDNA was phosphorylated and further degraded by lambda exonuclease (λ exo) from 5' to 3' direction to release a single-stranded DNA as a trigger of DNA strand displacement reaction (SDR). The trigger DNA can continuously displace DNA P2 from P1/P2 hybrid with the help of specific cleavage of nicking endonuclease (Nt.BbvCI). Then, DNA P2 can form G-quadruplex in the presence of potassium ions and quadruplex-selective fluorphore, N-methyl mesoporphyrin IX (NMM), resulting in a significant increase in fluorescence intensity of NMM. Thus, the accumulative release of DNA P2 led to fluorescence signal amplification for determining T4 PNK activity with a detection limit of 6.6×10(-4) U/mL, which is superior or comparative with established approaches. By ingeniously utilizing T4 PNK-triggered DNA SDR, T4 PNK activity can be specifically and facilely studied in homogeneous solution containing complex matrix without any external fluorescence labeling. Moreover, the influence of different inhibitors on the T4 PNK activity revealed that it also can be explored to screen T4 PNK inhibitors. Therefore, this label-free amplification strategy presents a facile and cost-effective approach for nucleic acid phosphorylation related research. Copyright © 2015 Elsevier B.V. All rights reserved.

  10. Toehold-mediated strand displacement reaction-dependent fluorescent strategy for sensitive detection of uracil-DNA glycosylase activity.

    Science.gov (United States)

    Wu, Yushu; Wang, Lei; Jiang, Wei

    2017-03-15

    Sensitive detection of uracil-DNA glycosylase (UDG) activity is beneficial for evaluating the repairing process of DNA lesions. Here, toehold-mediated strand displacement reaction (TSDR)-dependent fluorescent strategy was constructed for sensitive detection of UDG activity. A single-stranded DNA (ssDNA) probe with two uracil bases and a trigger sequence were designed. A hairpin probe with toehold domain was designed, and a reporter probe was also designed. Under the action of UDG, two uracil bases were removed from ssDNA probe, generating apurinic/apyrimidinic (AP) sites. Then, the AP sites could inhibit the TSDR between ssDNA probe and hairpin probe, leaving the trigger sequence in ssDNA probe still free. Subsequently, the trigger sequence was annealed with the reporter probe, initiating the polymerization and nicking amplification reaction. As a result, numerous G-quadruplex (G4) structures were formed, which could bind with N-methyl-mesoporphyrin IX (NMM) to generate enhanced fluorescent signal. In the absence of UDG, the ssDNA probe could hybridize with the toehold domain of the hairpin probe to initiate TSDR, blocking the trigger sequence, and then the subsequent amplification reaction would not occur. The proposed strategy was successfully implemented for detecting UDG activity with a detection limit of 2.7×10 -5 U/mL. Moreover, the strategy could distinguish UDG well from other interference enzymes. Furthermore, the strategy was also applied for detecting UDG activity in HeLa cells lysate with low effect of cellular components. These results indicated that the proposed strategy offered a promising tool for sensitive quantification of UDG activity in UDG-related function study and disease prognosis. Copyright © 2016 Elsevier B.V. All rights reserved.

  11. A novel microfluidic mixer based on dual-hydrodynamic focusing for interrogating the kinetics of DNA-protein interaction.

    Science.gov (United States)

    Li, Ying; Xu, Fei; Liu, Chao; Xu, Youzhi; Feng, Xiaojun; Liu, Bi-Feng

    2013-08-21

    Kinetic measurement of biomacromolecular interaction plays a significant role in revealing the underlying mechanisms of cellular activities. Due to the small diffusion coefficient of biomacromolecules, it is difficult to resolve the rapid kinetic process with traditional analytical methods such as stopped-flow or laminar mixers. Here, we demonstrated a unique continuous-flow laminar mixer based on microfluidic dual-hydrodynamic focusing to characterize the kinetics of DNA-protein interactions. The time window of this mixer for kinetics observation could cover from sub-milliseconds to seconds, which made it possible to capture the folding process with a wide dynamic range. Moreover, the sample consumption was remarkably reduced to <0.55 μL min⁻¹, over 1000-fold saving in comparison to those reported previously. We further interrogated the interaction kinetics of G-quadruplex and the single-stranded DNA binding protein, indicating that this novel micromixer would be a useful approach for analyzing the interaction kinetics of biomacromolecules.

  12. Orthogonal Operation of Constitutional Dynamic Networks Consisting of DNA-Tweezer Machines.

    Science.gov (United States)

    Yue, Liang; Wang, Shan; Cecconello, Alessandro; Lehn, Jean-Marie; Willner, Itamar

    2017-12-26

    Overexpression or down-regulation of cellular processes are often controlled by dynamic chemical networks. Bioinspired by nature, we introduce constitutional dynamic networks (CDNs) as systems that emulate the principle of the nature processes. The CDNs comprise dynamically interconvertible equilibrated constituents that respond to external triggers by adapting the composition of the dynamic mixture to the energetic stabilization of the constituents. We introduce a nucleic acid-based CDN that includes four interconvertible and mechanically triggered tweezers, AA', BB', AB' and BA', existing in closed, closed, open, and open configurations, respectively. By subjecting the CDN to auxiliary triggers, the guided stabilization of one of the network constituents dictates the dynamic reconfiguration of the structures of the tweezers constituents. The orthogonal and reversible operations of the CDN DNA tweezers are demonstrated, using T-A·T triplex or K + -stabilized G-quadruplex as structural motifs that control the stabilities of the constituents. The implications of the study rest on the possible applications of input-guided CDN assemblies for sensing, logic gate operations, and programmed activation of molecular machines.

  13. High-resolution AFM structure of DNA G-wires in aqueous solution.

    Science.gov (United States)

    Bose, Krishnashish; Lech, Christopher J; Heddi, Brahim; Phan, Anh Tuân

    2018-05-17

    We investigate the self-assembly of short pieces of the Tetrahymena telomeric DNA sequence d[G 4 T 2 G 4 ] in physiologically relevant aqueous solution using atomic force microscopy (AFM). Wire-like structures (G-wires) of 3.0 nm height with well-defined surface periodic features were observed. Analysis of high-resolution AFM images allowed their classification based on the periodicity of these features. A major species is identified with periodic features of 4.3 nm displaying left-handed ridges or zigzag features on the molecular surface. A minor species shows primarily left-handed periodic features of 2.2 nm. In addition to 4.3 and 2.2 nm ridges, background features with periodicity of 0.9 nm are also observed. Using molecular modeling and simulation, we identify a molecular structure that can explain both the periodicity and handedness of the major G-wire species. Our results demonstrate the potential structural diversity of G-wire formation and provide valuable insight into the structure of higher-order intermolecular G-quadruplexes. Our results also demonstrate how AFM can be combined with simulation to gain insight into biomolecular structure.

  14. Improved Inhibition of Telomerase by Short Twisted Intercalating Nucleic Acids under Molecular Crowding Conditions

    DEFF Research Database (Denmark)

    Agarwal, Tani; Pradhan, Devranjan; Géci, Imrich

    2012-01-01

    Human telomeric DNA has the ability to fold into a 4-stranded G-quadruplex structure. Several G-quadruplex ligands are known to stabilize the structure and thereby inhibit telomerase activity. Such ligands have demonstrated efficient telomerase inhibition in dilute conditions, but under molecular...

  15. Mycobacterium tuberculosis DinG is a structure-specific helicase that unwinds G4 DNA: implications for targeting G4 DNA as a novel therapeutic approach.

    Science.gov (United States)

    Thakur, Roshan Singh; Desingu, Ambika; Basavaraju, Shivakumar; Subramanya, Shreelakshmi; Rao, Desirazu N; Nagaraju, Ganesh

    2014-09-05

    The significance of G-quadruplexes and the helicases that resolve G4 structures in prokaryotes is poorly understood. The Mycobacterium tuberculosis genome is GC-rich and contains >10,000 sequences that have the potential to form G4 structures. In Escherichia coli, RecQ helicase unwinds G4 structures. However, RecQ is absent in M. tuberculosis, and the helicase that participates in G4 resolution in M. tuberculosis is obscure. Here, we show that M. tuberculosis DinG (MtDinG) exhibits high affinity for ssDNA and ssDNA translocation with a 5' → 3' polarity. Interestingly, MtDinG unwinds overhangs, flap structures, and forked duplexes but fails to unwind linear duplex DNA. Our data with DNase I footprinting provide mechanistic insights and suggest that MtDinG is a 5' → 3' polarity helicase. Notably, in contrast to E. coli DinG, MtDinG catalyzes unwinding of replication fork and Holliday junction structures. Strikingly, we find that MtDinG resolves intermolecular G4 structures. These data suggest that MtDinG is a multifunctional structure-specific helicase that unwinds model structures of DNA replication, repair, and recombination as well as G4 structures. We finally demonstrate that promoter sequences of M. tuberculosis PE_PGRS2, mce1R, and moeB1 genes contain G4 structures, implying that G4 structures may regulate gene expression in M. tuberculosis. We discuss these data and implicate targeting G4 structures and DinG helicase in M. tuberculosis could be a novel therapeutic strategy for culminating the infection with this pathogen. © 2014 by The American Society for Biochemistry and Molecular Biology, Inc.

  16. Lentivector Integration Sites in Ependymal Cells From a Model of Metachromatic Leukodystrophy: Non-B DNA as a New Factor Influencing Integration

    Science.gov (United States)

    McAllister, Robert G; Liu, Jiahui; Woods, Matthew W; Tom, Sean K; Rupar, C Anthony; Barr, Stephen D

    2014-01-01

    The blood–brain barrier controls the passage of molecules from the blood into the central nervous system (CNS) and is a major challenge for treatment of neurological diseases. Metachromatic leukodystrophy is a neurodegenerative lysosomal storage disease caused by loss of arylsulfatase A (ARSA) activity. Gene therapy via intraventricular injection of a lentiviral vector is a potential approach to rapidly and permanently deliver therapeutic levels of ARSA to the CNS. We present the distribution of integration sites of a lentiviral vector encoding human ARSA (LV-ARSA) in murine brain choroid plexus and ependymal cells, administered via a single intracranial injection into the CNS. LV-ARSA did not exhibit a strong preference for integration in or near actively transcribed genes, but exhibited a strong preference for integration in or near satellite DNA. We identified several genomic hotspots for LV-ARSA integration and identified a consensus target site sequence characterized by two G-quadruplex-forming motifs flanking the integration site. In addition, our analysis identified several other non-B DNA motifs as new factors that potentially influence lentivirus integration, including human immunodeficiency virus type-1 in human cells. Together, our data demonstrate a clinically favorable integration site profile in the murine brain and identify non-B DNA as a potential new host factor that influences lentiviral integration in murine and human cells. PMID:25158091

  17. The Putative Son's Attractiveness Alters the Perceived Attractiveness of the Putative Father.

    Science.gov (United States)

    Prokop, Pavol

    2015-08-01

    A body of literature has investigated female mate choice in the pre-mating context (pre-mating sexual selection). Humans, however, are long-living mammals forming pair-bonds which sequentially produce offspring. Post-mating evaluations of a partner's attractiveness may thus significantly influence the reproductive success of men and women. I tested herein the theory that the attractiveness of putative sons provides extra information about the genetic quality of fathers, thereby influencing fathers' attractiveness across three studies. As predicted, facially attractive boys were more frequently attributed to attractive putative fathers and vice versa (Study 1). Furthermore, priming with an attractive putative son increased the attractiveness of the putative father with the reverse being true for unattractive putative sons. When putative fathers were presented as stepfathers, the effect of the boy's attractiveness on the stepfather's attractiveness was lower and less consistent (Study 2). This suggests that the presence of an attractive boy has the strongest effect on the perceived attractiveness of putative fathers rather than on non-fathers. The generalized effect of priming with beautiful non-human objects also exists, but its effect is much weaker compared with the effects of putative biological sons (Study 3). Overall, this study highlighted the importance of post-mating sexual selection in humans and suggests that the heritable attractive traits of men are also evaluated by females after mating and/or may be used by females in mate poaching.

  18. EST Table: DC572689 [KAIKOcDNA[Archive

    Lifescience Database Archive (English)

    Full Text Available DC572689 E_FL_wd--_27G20_R_0 10/09/28 53 %/126 aa ref|XP_002400269.1| DNA mismatch repair protein mlh1..., putative [Ixodes scapularis] gb|EEC09245.1| DNA mismatch repair protein mlh1, putative

  19. EST Table: DC572641 [KAIKOcDNA[Archive

    Lifescience Database Archive (English)

    Full Text Available DC572641 E_FL_wd--_27E09_R_0 10/09/28 52 %/145 aa ref|XP_002400269.1| DNA mismatch repair protein mlh1..., putative [Ixodes scapularis] gb|EEC09245.1| DNA mismatch repair protein mlh1, putative

  20. EST Table: DC563666 [KAIKOcDNA[Archive

    Lifescience Database Archive (English)

    Full Text Available DC563666 E_FL_wd--_01A16_R_0 10/09/28 53 %/141 aa ref|XP_002400269.1| DNA mismatch repair protein mlh1..., putative [Ixodes scapularis] gb|EEC09245.1| DNA mismatch repair protein mlh1, putative

  1. EST Table: DC566703 [KAIKOcDNA[Archive

    Lifescience Database Archive (English)

    Full Text Available DC566703 E_FL_wd--_09O22_R_0 10/09/28 52 %/145 aa ref|XP_002400269.1| DNA mismatch repair protein mlh1..., putative [Ixodes scapularis] gb|EEC09245.1| DNA mismatch repair protein mlh1, putative

  2. Crystal Structure of a Putative HTH-Type Transcriptional Regulator yxaF from Bacillus subtilis

    International Nuclear Information System (INIS)

    Seetharaman, J.; Kumaran, D.; Bonanno, J.; Burley, S.; Swaminathan, S.

    2006-01-01

    The New York Structural GenomiX Research Consortium (NYSGXRC) has selected the protein coded by yxaF gene from Bacillus subtilis as a target for structure determination. The yxaF protein has 191 residues with a molecular mass of 21 kDa and had no sequence homology to any structure in the Protein Data Bank (PDB) at the time of target selection. We aimed to elucidate the three-dimensional structure for the putative protein yxaF to better understand the relationship between protein sequence, structure, and function. This protein is annotated as a putative helix-turn-helix (HTH) type transcriptional regulator. Many transcriptional regulators like TetR and QacR use a structurally well-defined DNA-binding HTH motif to recognize the target DNA sequences. DNA-HTH motif interactions have been extensively studied. As the HTH motif is structurally conserved in many regulatory proteins, these DNA-protein complexes show some similarity in DNA recognition patterns. Many such regulatory proteins have a ligand-binding domain in addition to the DNA-binding domain. Structural studies on ligand-binding regulatory proteins provide a wealth of information on ligand-, and possibly drug-, binding mechanisms. Understanding the ligand-binding mechanism may help overcome problems with drug resistance, which represent increasing challenges in medicine. The protein encoded by yxaF, hereafter called T1414, shows fold similar to QacR repressor and TetR/CamR repressor and possesses putative DNA and ligand-binding domains. Here, we report the crystal structure of T1414 and compare it with structurally similar drug and DNA-binding proteins

  3. Identification and characterization of putative conserved IAM ...

    African Journals Online (AJOL)

    Available putative AMI sequences from a wide array of monocot and dicot plants were identified and the phylogenetic tree was constructed and analyzed. We identified in this tree, a clade that contained sequences from species across the plant kingdom suggesting that AMI is conserved and may have a primary role in plant ...

  4. Toddlers' Duration of Attention toward Putative Threat

    Science.gov (United States)

    Kiel, Elizabeth J.; Buss, Kristin A.

    2011-01-01

    Although individual differences in reactions to novelty in the toddler years have been consistently linked to risk of developing anxious behavior, toddlers' attention toward a novel, putatively threatening stimulus while in the presence of other enjoyable activities has rarely been examined as a precursor to such risk. The current study examined…

  5. Molecular recognition of naphthalene diimide ligands by telomeric quadruplex-DNA: the importance of the protonation state and mediated hydrogen bonds.

    Science.gov (United States)

    Spinello, A; Barone, G; Grunenberg, J

    2016-01-28

    In depth Monte Carlo conformational scans in combination with molecular dynamics (MD) simulations and electronic structure calculations were applied in order to study the molecular recognition process between tetrasubstituted naphthalene diimide (ND) guests and G-quadruplex (G4) DNA receptors. ND guests are a promising class of telomere stabilizers due to which they are used in novel anticancer therapeutics. Though several ND guests have been studied experimentally in the past, the protonation state under physiological conditions is still unclear. Based on chemical intuition, in the case of N-methyl-piperazine substitution, different protonation states are possible and might play a crucial role in the molecular recognition process by G4-DNA. Depending on the proton concentration, different nitrogen atoms of the N-methyl-piperazine might (or might not) be protonated. This fact was considered in our simulation in terms of a case by case analysis, since the process of molecular recognition is determined by possible donor or acceptor positions. The results of our simulations show that the electrostatic interactions between the ND ligands and the G4 receptor are maximized in the case of the protonation of the terminal nitrogen atoms, forming compact ND G4 complexes inside the grooves. The influence of different protonation states in terms of the ability to form hydrogen bonds with the sugar-phosphate backbone, as well as the importance of mediated vs. direct hydrogen bonding, was analyzed in detail by MD and relaxed force constant (compliance constant) simulations.

  6. Genome-wide identification and characterisation of human DNA replication origins by initiation site sequencing (ini-seq).

    Science.gov (United States)

    Langley, Alexander R; Gräf, Stefan; Smith, James C; Krude, Torsten

    2016-12-01

    Next-generation sequencing has enabled the genome-wide identification of human DNA replication origins. However, different approaches to mapping replication origins, namely (i) sequencing isolated small nascent DNA strands (SNS-seq); (ii) sequencing replication bubbles (bubble-seq) and (iii) sequencing Okazaki fragments (OK-seq), show only limited concordance. To address this controversy, we describe here an independent high-resolution origin mapping technique that we call initiation site sequencing (ini-seq). In this approach, newly replicated DNA is directly labelled with digoxigenin-dUTP near the sites of its initiation in a cell-free system. The labelled DNA is then immunoprecipitated and genomic locations are determined by DNA sequencing. Using this technique we identify >25,000 discrete origin sites at sub-kilobase resolution on the human genome, with high concordance between biological replicates. Most activated origins identified by ini-seq are found at transcriptional start sites and contain G-quadruplex (G4) motifs. They tend to cluster in early-replicating domains, providing a correlation between early replication timing and local density of activated origins. Origins identified by ini-seq show highest concordance with sites identified by SNS-seq, followed by OK-seq and bubble-seq. Furthermore, germline origins identified by positive nucleotide distribution skew jumps overlap with origins identified by ini-seq and OK-seq more frequently and more specifically than do sites identified by either SNS-seq or bubble-seq. © The Author(s) 2016. Published by Oxford University Press on behalf of Nucleic Acids Research.

  7. DNA Fingerprinting Using PCR: A Practical Forensic Science Activity

    Science.gov (United States)

    Choi, Hyun-Jung; Ahn, Jung Hoon; Ko, Minsu

    2008-01-01

    This paper describes a forensic science simulation programme applicable for use in colleges. Students were asked to find a putative suspect by DNA fingerprinting using a simple protocol developed in this study. DNA samples were obtained from a hair root and a drop of blood, common sources of DNA in forensic science. The DNA fingerprinting protocol…

  8. Thermodynamic and spectroscopic investigations of TMPyP4 association with guanine- and cytosine-rich DNA and RNA repeats of C9orf72.

    Science.gov (United States)

    Alniss, Hasan; Zamiri, Bita; Khalaj, Melisa; Pearson, Christopher E; Macgregor, Robert B

    2018-01-22

    An expansion of the hexanucleotide repeat (GGGGCC)n·(GGCCCC)n in the C9orf72 promoter has been shown to be the cause of Amyotrophic lateral sclerosis and frontotemporal dementia (ALS-FTD). The C9orf72 repeat can form four-stranded structures; the cationic porphyrin (TMPyP4) binds and distorts these structures. Isothermal titration calorimetry (ITC), and circular dichroism (CD) were used to study the binding of TMPyP4 to the C-rich and G-rich DNA and RNA oligos containing the hexanucleotide repeat at pH 7.5 and 0.1 M K + . The CD spectra of G-rich DNA and RNA TMPyP4 complexes showed features of antiparallel and parallel G-quadruplexes, respectively. The shoulder at 260 nm in the CD spectrum becomes more intense upon formation of complexes between TMPyP4 and the C-rich DNA. The peak at 290 nm becomes more intense in the c-rich RNA molecules, suggesting induction of an i-motif structure. The ITC data showed that TMPyP4 binds at two independent sites for all DNA and RNA molecules. For DNA, the data are consistent with TMPyP4 stacking on the terminal tetrads and intercalation. For RNA, the thermodynamics of the two binding modes are consistent with groove binding and intercalation. In both cases, intercalation is the weaker binding mode. These findings are considered with respect to the structural differences of the folded DNA and RNA molecules and the energetics of the processes that drive site-specific recognition by TMPyP4; these data will be helpful in efforts to optimize the specificity and affinity of the binding of porphyrin-like molecules. Copyright © 2018 Elsevier Inc. All rights reserved.

  9. Characteristics of functional enrichment and gene expression level of human putative transcriptional target genes.

    Science.gov (United States)

    Osato, Naoki

    2018-01-19

    Transcriptional target genes show functional enrichment of genes. However, how many and how significantly transcriptional target genes include functional enrichments are still unclear. To address these issues, I predicted human transcriptional target genes using open chromatin regions, ChIP-seq data and DNA binding sequences of transcription factors in databases, and examined functional enrichment and gene expression level of putative transcriptional target genes. Gene Ontology annotations showed four times larger numbers of functional enrichments in putative transcriptional target genes than gene expression information alone, independent of transcriptional target genes. To compare the number of functional enrichments of putative transcriptional target genes between cells or search conditions, I normalized the number of functional enrichment by calculating its ratios in the total number of transcriptional target genes. With this analysis, native putative transcriptional target genes showed the largest normalized number of functional enrichments, compared with target genes including 5-60% of randomly selected genes. The normalized number of functional enrichments was changed according to the criteria of enhancer-promoter interactions such as distance from transcriptional start sites and orientation of CTCF-binding sites. Forward-reverse orientation of CTCF-binding sites showed significantly higher normalized number of functional enrichments than the other orientations. Journal papers showed that the top five frequent functional enrichments were related to the cellular functions in the three cell types. The median expression level of transcriptional target genes changed according to the criteria of enhancer-promoter assignments (i.e. interactions) and was correlated with the changes of the normalized number of functional enrichments of transcriptional target genes. Human putative transcriptional target genes showed significant functional enrichments. Functional

  10. Ten Putative Contributors to the Obesity Epidemic

    Science.gov (United States)

    McAllister, Emily J.; Dhurandhar, Nikhil V.; Keith, Scott W.; Aronne, Louis J.; Barger, Jamie; Baskin, Monica; Benca, Ruth M.; Biggio, Joseph; Boggiano, Mary M.; Eisenmann, Joe C.; Elobeid, Mai; Fontaine, Kevin R.; Gluckman, Peter; Hanlon, Erin C.; Katzmarzyk, Peter; Pietrobelli, Angelo; Redden, David T.; Ruden, Douglas M.; Wang, Chenxi; Waterland, Robert A.; Wright, Suzanne M.; Allison, David B.

    2010-01-01

    The obesity epidemic is a global issue and shows no signs of abating, while the cause of this epidemic remains unclear. Marketing practices of energy-dense foods and institutionally-driven declines in physical activity are the alleged perpetrators for the epidemic, despite a lack of solid evidence to demonstrate their causal role. While both may contribute to obesity, we call attention to their unquestioned dominance in program funding and public efforts to reduce obesity, and propose several alternative putative contributors that would benefit from equal consideration and attention. Evidence for microorganisms, epigenetics, increasing maternal age, greater fecundity among people with higher adiposity, assortative mating, sleep debt, endocrine disruptors, pharmaceutical iatrogenesis, reduction in variability of ambient temperatures, and intrauterine and intergenerational effects, as contributing factors to the obesity epidemic are reviewed herein. While the evidence is strong for some contributors such as pharmaceutical-induced weight gain, it is still emerging for other reviewed factors. Considering the role of such putative etiological factors of obesity may lead to comprehensive, cause specific, and effective strategies for prevention and treatment of this global epidemic. PMID:19960394

  11. KLONING GEN PUTATIVE CLEAVAGE PROTEIN 1 (PCP-1 PADA UDANG VANAME (Litopenaeus vannamei YANG TERSERANG INFECTIOUS MYONECROSIS VIRUS

    Directory of Open Access Journals (Sweden)

    Hessy Novita

    2016-12-01

    Full Text Available Penanggulangan penyakit ikan dapat dilakukan dengan cara meningkatkan kekebalan tubuh ikan melalui program vaksinasi. Namun vaksinasi tidak tepat untuk udang, karena udang tidak mempunyai immunological memory seperti ikan. Oleh karena itu, perlindungan udang terhadap serangan penyakit viral dengan menggunakan RNA interference (RNAi. Teknologi RNAi digunakan untuk menghalangi (interfere proses replikasi infectious myonecrosis virus (IMNV pada udang vaname dengan cara menon-aktifkan gen putative cleavage protein 1 (PCP-1, yang berfungsi dalam pembentukan capsid dan proses transkripsi RNA IMNV. Penelitian ini bertujuan untuk melakukan kloning gen putative cleavage protein 1 dalam rangka perakitan teknologi RNAi untuk pengendalian penyakit IMNV pada udang vaname. Tahapan penelitian meliputi koleksi sampel, isolasi RNA, sintesis cDNA, amplifikasi PCR, purifikasi DNA, transformasi, isolasi plasmid, serta sekuensing dan analisis data. Hasil isolasi plasmid cDNA PCP-1 memperlihatkan semua koloni bakteri terseleksi ternyata membawa plasmid hasil insersi DNA gen PCP–1, hasil sekuen dengan nilai homologinya mencapai 100% dan 99% yang dibandingkan dengan sekuen di Genebank. Hasil penelitian menunjukkan bahwa kloning gen putative cleavage protein 1 (PCP-1 dari udang vaname yang terserang Infectious Myonecrosis Virus berhasil dikloning yang nantinya digunakan untuk perakitan RNAi. The prevention of fish diseases can be done by increasing of the fish immune through vaccination programs. However, the vaccination can not be done for the shrimp,due to the absence of  immunological memory. Therefore, the protection of shrimp against viral diseases was done by using of RNA interference (RNAi. RNAi technology is used to interfere infectious myonecrosis virus (IMNV replication process on white shrimp by disabling of putative cleavage protein 1 (PCP-1gene, which functions in capsid formation and RNA transcription process. The study was conducted to perform putative

  12. Expression of putative expansin genes in phylloxera (Daktulosphaira vitifoliae Fitch) induced root galls of Vitis spp.

    Science.gov (United States)

    Lawo, N C; Griesser, M; Forneck, A

    Grape phylloxera ( Daktulosphaira vitifoliae Fitch) is a serious global pest in viticulture. The insects are sedentary feeders and require a gall to feed and reproduce. The insects induce their feeding site within the meristematic zone of the root tip, where they stay attached, feeding both intra- and intercellularly, and causing damage by reducing plant vigour. Several changes in cell structure and composition, including increased cell division and tissue swelling close to the feeding site, cause an organoid gall called a nodosity to develop. Because alpha expansin genes are involved in cell enlargement and cell wall loosening in many plant tissues it may be anticipated that they are also involved in nodosity formation. To identify expansin genes in Vitis vinifera cv. Pinot noir , we mined for orthologues genes in a comparative analysis. Eleven putative expansin genes were identified and shown to be present in the rootstock Teleki 5C ( V. berlandieri Planch. x V. riparia Michx.) using specific PCR followed by DNA sequencing. Expression analysis of young and mature nodosities and uninfested root tips were conducted via quantitative real time PCR (qRT-PCR). Up-regulation was measured for three putative expansin genes (VvEXPA15, -A17 and partly -A20) or down-regulation for three other putative genes (VvEXPA7, -A12, -A20) in nodosities. The present study clearly shows the involvement of putative expansin genes in the phylloxera-root interaction.

  13. Ancient DNA

    DEFF Research Database (Denmark)

    Willerslev, Eske; Cooper, Alan

    2004-01-01

    ancient DNA, palaeontology, palaeoecology, archaeology, population genetics, DNA damage and repair......ancient DNA, palaeontology, palaeoecology, archaeology, population genetics, DNA damage and repair...

  14. Strong preference of BRCA1 protein to topologically constrained non-B DNA structures

    Czech Academy of Sciences Publication Activity Database

    Brázda, Václav; Haroniková, Lucia; Liao, J.C.C.; Fridrichova, Helena; Jagelská, Eva

    2016-01-01

    Roč. 17, JAN2016 (2016), č. článku 14. ISSN 1471-2199 R&D Projects: GA ČR GA15-21855S Institutional support: RVO:68081707 Keywords : double-strand breaks * g-quadruplexes * c-myc Subject RIV: BO - Biophysics Impact factor: 1.939, year: 2016

  15. Putative neuroprotective agents in neuropsychiatric disorders.

    Science.gov (United States)

    Dodd, Seetal; Maes, Michael; Anderson, George; Dean, Olivia M; Moylan, Steven; Berk, Michael

    2013-04-05

    In many individuals with major neuropsychiatric disorders including depression, bipolar disorder and schizophrenia, their disease characteristics are consistent with a neuroprogressive illness. This includes progressive structural brain changes, cognitive and functional decline, poorer treatment response and an increasing vulnerability to relapse with chronicity. The underlying molecular mechanisms of neuroprogression are thought to include neurotrophins and regulation of neurogenesis and apoptosis, neurotransmitters, inflammatory, oxidative and nitrosative stress, mitochondrial dysfunction, cortisol and the hypothalamic-pituitary-adrenal axis, and epigenetic influences. Knowledge of the involvement of each of these pathways implies that specific agents that act on some or multiple of these pathways may thus block this cascade and have neuroprotective properties. This paper reviews the potential of the most promising of these agents, including lithium and other known psychotropics, aspirin, minocycline, statins, N-acetylcysteine, leptin and melatonin. These agents are putative neuroprotective agents for schizophrenia and mood disorders. Copyright © 2012 Elsevier Inc. All rights reserved.

  16. [Detection of putative polysaccharide biosynthesis genes in Azospirillum brasilense strains from serogroups I and II].

    Science.gov (United States)

    Petrova, L P; Prilipov, A G; Katsy, E I

    2017-01-01

    It is known that in Azospirillum brasilense strains Sp245 and SR75 included in serogroup I, the repeat units of their O-polysaccharides consist of five residues of D-rhamnose, and in strain SR15, of four; and the heteropolymeric O-polysaccharide of A. brasilense type strain Sp7 from serogroup II contains not less than five types of repeat units. In the present work, a complex of nondegenerate primers to the genes of A. brasilense Sp245 plasmids AZOBR_p6, AZOBR_p3, and AZOBR_p2, which encode putative enzymes for the biosynthesis of core oligosaccharide and O-polysaccharide of lipopolysaccharide, capsular polysaccharides, and exopolysaccharides, was proposed. By using the designed primers, products of the expected sizes were synthesized in polymerase chain reactions on genomic DNA of A. brasilense Sp245, SR75, SR15, and Sp7 in 36, 29, 23, and 12 cases, respectively. As a result of sequencing of a number of amplicons, a high (86–99%) level of identity of the corresponding putative polysaccharide biosynthesis genes in three A. brasilense strains from serogroup I was detected. In a blotting-hybridization reaction with the biotin-labeled DNA of the A. brasilense gene AZOBR_p60122 coding for putative permease of the ABC transporter of polysaccharides, localization of the homologous gene in ~120-MDa plasmids of the bacteria A. brasilense SR15 and SR75 was revealed.

  17. Toehold-mediated strand displacement reaction triggered isothermal DNA amplification for highly sensitive and selective fluorescent detection of single-base mutation.

    Science.gov (United States)

    Zhu, Jing; Ding, Yongshun; Liu, Xingti; Wang, Lei; Jiang, Wei

    2014-09-15

    Highly sensitive and selective detection strategy for single-base mutations is essential for risk assessment of malignancy and disease prognosis. In this work, a fluorescent detection method for single-base mutation was proposed based on high selectivity of toehold-mediated strand displacement reaction (TSDR) and powerful signal amplification capability of isothermal DNA amplification. A discrimination probe was specially designed with a stem-loop structure and an overhanging toehold domain. Hybridization between the toehold domain and the perfect matched target initiated the TSDR along with the unfolding of the discrimination probe. Subsequently, the target sequence acted as a primer to initiate the polymerization and nicking reactions, which released a great abundant of short sequences. Finally, the released strands were annealed with the reporter probe, launching another polymerization and nicking reaction to produce lots of G-quadruplex DNA, which could bind the N-methyl mesoporphyrin IX to yield an enhanced fluorescence response. However, when there was even a single base mismatch in the target DNA, the TSDR was suppressed and so subsequent isothermal DNA amplification and fluorescence response process could not occur. The proposed approach has been successfully implemented for the identification of the single-base mutant sequences in the human KRAS gene with a detection limit of 1.8 pM. Furthermore, a recovery of 90% was obtained when detecting the target sequence in spiked HeLa cells lysate, demonstrating the feasibility of this detection strategy for single-base mutations in biological samples. Copyright © 2014 Elsevier B.V. All rights reserved.

  18. Optofluidics-based DNA structure-competitive aptasensor for rapid on-site detection of lead(II) in an aquatic environment.

    Science.gov (United States)

    Long, Feng; Zhu, Anna; Wang, Hongchen

    2014-11-07

    Lead ions (Pb(2+)), ubiquitous and one of the most toxic metallic pollutants, have attracted increasing attentions because of their various neurotoxic effects. Pb(2+) has been proven to induce a conformational change in G-quadruplex (G4) aptamers to form a stabilizing G4/Pb(2+) complex. Based on this principle, an innovative optofluidics-based DNA structure-competitive aptasensor was developed for Pb(2+) detection in an actual aquatic environment. The proposed sensing system has good characteristics, such as high sensitivity and selectivity, reusability, easy operation, rapidity, robustness, portability, use of a small sample volume, and cost effectiveness. A fluorescence-labeled G4 aptamer was utilized as a molecular probe. A DNA probe, a complementary strand of G4 aptamer, was immobilized onto the sensor surface. When the mixture of Pb(2+) solution and G4 aptamer was introduced into the optofluidic cell, Pb(2+) and the DNA probe bound competitively with the G4 aptamer. A high Pb(2+) concentration reduced the binding of the aptamer and the DNA probe; thus, a low-fluorescence signal was detected. A sensitive sensing response to Pb(2+) in the range of 1.0-300.0 nM with a low detection limit of 0.22 nM was exhibited under optimal conditions. The potential interference of the environmental sample matrix was assessed with spiked samples, and the recovery of Pb(2+) ranged from 80 to 105% with a relative standard deviation value of monitoring of other trace analytes. Copyright © 2014 Elsevier B.V. All rights reserved.

  19. The solution structure of ChaB, a putative membrane ion antiporter regulator from Escherichia coli

    Directory of Open Access Journals (Sweden)

    Iannuzzi Pietro

    2004-08-01

    Full Text Available Abstract Background ChaB is a putative regulator of ChaA, a Na+/H+ antiporter that also has Ca+/H+ activity in E. coli. ChaB contains a conserved 60-residue region of unknown function found in other bacteria, archaeabacteria and a series of baculoviral proteins. As part of a structural genomics project, the structure of ChaB was elucidated by NMR spectroscopy. Results The structure of ChaB is composed of 3 α-helices and a small sheet that pack tightly to form a fold that is found in the cyclin-box family of proteins. Conclusion ChaB is distinguished from its putative DNA binding sequence homologues by a highly charged flexible loop region that has weak affinity to Mg2+ and Ca2+ divalent metal ions.

  20. Analysis of Hydraulic Flood Control Structure at Putat Boro River

    OpenAIRE

    Ruzziyatno, Ruhban

    2015-01-01

    Putat Boro River is one of the main drainage systems of Surakarta city which drains into Bengawan Solo river. The primary problem when flood occur is the higher water level of Bengawan Solo than Boro River and then backwater occur and inundates Putat Boro River. The objective of the study is to obtain operational method of Putat Boro River floodgate to control both inflows and outflows not only during flood but also normal condition. It also aims to know the Putat Boro rivers floodgate op...

  1. Transcriptional profiling of putative human epithelial stem cells

    Directory of Open Access Journals (Sweden)

    Koçer Salih S

    2008-07-01

    Full Text Available Abstract Background Human interfollicular epidermis is sustained by the proliferation of stem cells and their progeny, transient amplifying cells. Molecular characterization of these two cell populations is essential for better understanding of self renewal, differentiation and mechanisms of skin pathogenesis. The purpose of this study was to obtain gene expression profiles of alpha 6+/MHCI+, transient amplifying cells and alpha 6+/MHCI-, putative stem cells, and to compare them with existing data bases of gene expression profiles of hair follicle stem cells. The expression of Major Histocompatibility Complex (MHC class I, previously shown to be absent in stem cells in several tissues, and alpha 6 integrin were used to isolate MHCI positive basal cells, and MHCI low/negative basal cells. Results Transcriptional profiles of the two cell populations were determined and comparisons made with published data for hair follicle stem cell gene expression profiles. We demonstrate that presumptive interfollicular stem cells, alpha 6+/MHCI- cells, are enriched in messenger RNAs encoding surface receptors, cell adhesion molecules, extracellular matrix proteins, transcripts encoding members of IFN-alpha family proteins and components of IFN signaling, but contain lower levels of transcripts encoding proteins which take part in energy metabolism, cell cycle, ribosome biosynthesis, splicing, protein translation, degradation, DNA replication, repair, and chromosome remodeling. Furthermore, our data indicate that the cell signaling pathways Notch1 and NF-κB are downregulated/inhibited in MHC negative basal cells. Conclusion This study demonstrates that alpha 6+/MHCI- cells have additional characteristics attributed to stem cells. Moreover, the transcription profile of alpha 6+/MHCI- cells shows similarities to transcription profiles of mouse hair follicle bulge cells known to be enriched for stem cells. Collectively, our data suggests that alpha 6+/MHCI- cells

  2. Putative Enzymes of UV Photoproduct Repair

    Directory of Open Access Journals (Sweden)

    Cynthia J. Sakofsky

    2011-01-01

    Full Text Available In order to determine the biological relevance of two S. acidocaldarius proteins to the repair of UV photoproducts, the corresponding genes (Saci_1227 and Saci_1096 were disrupted, and the phenotypes of the resulting mutants were examined by various genetic assays. The disruption used integration by homologous recombination of a functional but heterologous pyrE gene, promoted by short sequences attached to both ends via PCR. The phenotypic analyses of the disruptants confirmed that ORF Saci_1227 encodes a DNA photolyase which functions in vivo, but they could not implicate ORF Saci_1096 in repair of UV- or other externally induced DNA damage despite its similarity to genes encoding UV damage endonucleases. The success of the gene-disruption strategy, which used 5′ extensions of PCR primers to target cassette integration, suggests potential advantages for routine construction of Sulfolobus strains.

  3. Putative bronchopulmonary flagellated protozoa in immunosuppressed patients.

    Science.gov (United States)

    Kilimcioglu, Ali Ahmet; Havlucu, Yavuz; Girginkardesler, Nogay; Celik, Pınar; Yereli, Kor; Özbilgin, Ahmet

    2014-01-01

    Flagellated protozoa that cause bronchopulmonary symptoms in humans are commonly neglected. These protozoal forms which were presumed to be "flagellated protozoa" have been previously identified in immunosuppressed patients in a number of studies, but have not been certainly classified so far. Since no human cases of bronchopulmonary flagellated protozoa were reported from Turkey, we aimed to investigate these putative protozoa in immunosuppressed patients who are particularly at risk of infectious diseases. Bronchoalveolar lavage fluid samples of 110 immunosuppressed adult patients who were admitted to the Department of Chest Diseases, Hafsa Sultan Hospital of Celal Bayar University, Manisa, Turkey, were examined in terms of parasites by light microscopy. Flagellated protozoal forms were detected in nine (8.2%) of 110 cases. Metronidazole (500 mg b.i.d. for 30 days) was given to all positive cases and a second bronchoscopy was performed at the end of the treatment, which revealed no parasites. In conclusion, immunosuppressed patients with bronchopulmonary symptoms should attentively be examined with regard to flagellated protozoa which can easily be misidentified as epithelial cells.

  4. Toddlers’ Duration of Attention towards Putative Threat

    Science.gov (United States)

    Kiel, Elizabeth J.; Buss, Kristin A.

    2010-01-01

    Although individual differences in reactions to novelty in the toddler years have been consistently linked to risk for developing anxious behavior, toddlers’ attention towards a novel, putatively threatening stimulus while in the presence of other enjoyable activities has rarely been examined as a precursor to such risk. The current study examined how attention towards an angry-looking gorilla mask in a room with alternative opportunities for play in 24-month-old toddlers predicted social inhibition when children entered kindergarten. Analyses examined attention to threat above and beyond and in interaction with both proximity to the mask and fear of novelty observed in other situations. Attention to threat interacted with proximity to the mask to predict social inhibition, such that attention to threat most strongly predicted social inhibition when toddlers stayed furthest from the mask. This relation occurred above and beyond the predictive relation between fear of novelty and social inhibition. Results are discussed within the broader literature of anxiety development and attentional processes in young children. PMID:21373365

  5. Twenty putative palmitoyl-acyl transferase genes with distinct ...

    African Journals Online (AJOL)

    There are 20 genes containing DHHC domain predicted to encode putative palmitoyltransferase in Arabidopsis thaliana genome. However, little is known about their characteristics such as genetic relationship and expression profile. Here, we present an overview of the putative PAT genes in A. thaliana focusing on their ...

  6. Putative radioresistant bacterial isolate from sewage water

    International Nuclear Information System (INIS)

    Ang, April; Chua, Patricia; Perez, Kristine; Rey, April; Rivor Kristel; San Pablo, Czarina; Santos, Ernestine

    2001-01-01

    Sewage water was collected from a stagnant body of water in Balara, Quezon City. approximately 150 ml was aseptically transferred into eight Erlenmeyer flasks. Seven flasks were then subjected to different doses of radiation at the 60 Co irradiation facility, PNRI (Philippine Nuclear Research Institute) which are as follows: 0.01 kGy, 0.1 kGy, 0.5 kGy, 1 kGy, 5 kGy, 10 kGy, and 15 kGy. The remaining flask was used as the control. After irradiation, all the different treatments were subjected to colony count at the culture collection laboratory, NSRI. Results showed that the colonies from sewage water treatments irradiated at 0.01 kGy (treatment A), 0.10 kGy (treatment B), and 0.50 kGy (treatment C) exhibited a decreasing trend with colony counts 4.60 x 10 3 CFU/ml, and 1.30 x 10 3 CFU/ml, and 26 CFU/ml, respectively. Contrastingly, at 1 kGy (treatment D), high colony count of 2.95 x 10 3 CFU/ml was observed which is even higher compared to the control (1.02 x 10 3 CFU/ml). Treatment E that was irradiated at 5 kGy manifested low survival rate (25 CFU/ml) indicating the presence of few putative intermediate radioresistant bacteria. Radiation dose treatments higher than 5 kGy (i.e., 10 kGy and 15 kGy) exhibited no bacterial survival. (Author)

  7. Putative radioresistant bacterial isolate from sewage water

    Energy Technology Data Exchange (ETDEWEB)

    Ang, April; Chua, Patricia; Perez, Kristine; Rey, April; Kristel, Rivor; San Pablo, Czarina; Santos, Ernestine

    2001-01-29

    Sewage water was collected from a stagnant body of water in Balara, Quezon City. approximately 150 ml was aseptically transferred into eight Erlenmeyer flasks. Seven flasks were then subjected to different doses of radiation at the {sup 60}Co irradiation facility, PNRI (Philippine Nuclear Research Institute) which are as follows: 0.01 kGy, 0.1 kGy, 0.5 kGy, 1 kGy, 5 kGy, 10 kGy, and 15 kGy. The remaining flask was used as the control. After irradiation, all the different treatments were subjected to colony count at the culture collection laboratory, NSRI. Results showed that the colonies from sewage water treatments irradiated at 0.01 kGy (treatment A), 0.10 kGy (treatment B), and 0.50 kGy (treatment C) exhibited a decreasing trend with colony counts 4.60 x 10{sup 3} CFU/ml, and 1.30 x 10{sup 3} CFU/ml, and 26 CFU/ml, respectively. Contrastingly, at 1 kGy (treatment D), high colony count of 2.95 x 10{sup 3} CFU/ml was observed which is even higher compared to the control (1.02 x 10{sup 3} CFU/ml). Treatment E that was irradiated at 5 kGy manifested low survival rate (25 CFU/ml) indicating the presence of few putative intermediate radioresistant bacteria. Radiation dose treatments higher than 5 kGy (i.e., 10 kGy and 15 kGy) exhibited no bacterial survival. (Author)

  8. G-Quadruplex Identification in the Genome of Protozoan Parasites Points to Naphthalene Diimide Ligands as New Antiparasitic Agents

    Czech Academy of Sciences Publication Activity Database

    Belmonte-Reche, E.; Martínez-García, M.; Guédin, A.; Zuffo, M.; Arevalo-Ruiz, M.; Doria, F.; Campos-Salinas, J.; Maynadier, M.; Lopez-Rubio, J.J.; Freccero, M.; Mergny, Jean-Louis; Maria Perez-Victoria, J.; Carlos Morales, J.

    2018-01-01

    Roč. 61, č. 3 (2018), s. 1231-1240 ISSN 0022-2623 R&D Projects: GA MŠk EF15_003/0000477 Institutional support: RVO:68081707 Keywords : terminal repeat promoter * plasmodium-falciparum Subject RIV: CE - Biochemistry OBOR OECD: Biochemistry and molecular biology Impact factor: 6.259, year: 2016

  9. Circular Dichroism of G-Quadruplex: A Laboratory Experiment for the Study of Topology and Ligand Binding

    Science.gov (United States)

    Carvalho, Josue´; Queiroz, João A.; Cruz, Carla

    2017-01-01

    Circular dichroism (CD) has emerged as one of the standard biophysical techniques for the study of guaninequadruplex (G4) folding, cation effect, and ligand binding. The utility of this technique is based on its robustness, ease of use, and requirement of only small quantities of nucleic acid. This experiment is also extendable to the classroom…

  10. G-quadruplex aptamer targeting Protein A and its capability to detect Staphylococcus aureus demonstrated by ELONA

    OpenAIRE

    Stoltenburg, Regina; Kraf?ikov?, Petra; V?glask?, Viktor; Strehlitz, Beate

    2016-01-01

    Aptamers for whole cell detection are selected mostly by the Cell-SELEX procedure. Alternatively, the use of specific cell surface epitopes as target during aptamer selections allows the development of aptamers with ability to bind whole cells. In this study, we integrated a formerly selected Protein A-binding aptamer PA#2/8 in an assay format called ELONA (Enzyme-Linked OligoNucleotide Assay) and evaluated the ability of the aptamer to recognise and bind to Staphylococcus aureus presenting P...

  11. Triplex DNA-binding proteins are associated with clinical outcomes revealed by proteomic measurements in patients with colorectal cancer

    Directory of Open Access Journals (Sweden)

    Nelson Laura D

    2012-06-01

    Full Text Available Abstract Background Tri- and tetra-nucleotide repeats in mammalian genomes can induce formation of alternative non-B DNA structures such as triplexes and guanine (G-quadruplexes. These structures can induce mutagenesis, chromosomal translocations and genomic instability. We wanted to determine if proteins that bind triplex DNA structures are quantitatively or qualitatively different between colorectal tumor and adjacent normal tissue and if this binding activity correlates with patient clinical characteristics. Methods Extracts from 63 human colorectal tumor and adjacent normal tissues were examined by gel shifts (EMSA for triplex DNA-binding proteins, which were correlated with clinicopathological tumor characteristics using the Mann-Whitney U, Spearman’s rho, Kaplan-Meier and Mantel-Cox log-rank tests. Biotinylated triplex DNA and streptavidin agarose affinity binding were used to purify triplex-binding proteins in RKO cells. Western blotting and reverse-phase protein array were used to measure protein expression in tissue extracts. Results Increased triplex DNA-binding activity in tumor extracts correlated significantly with lymphatic disease, metastasis, and reduced overall survival. We identified three multifunctional splicing factors with biotinylated triplex DNA affinity: U2AF65 in cytoplasmic extracts, and PSF and p54nrb in nuclear extracts. Super-shift EMSA with anti-U2AF65 antibodies produced a shifted band of the major EMSA H3 complex, identifying U2AF65 as the protein present in the major EMSA band. U2AF65 expression correlated significantly with EMSA H3 values in all extracts and was higher in extracts from Stage III/IV vs. Stage I/II colon tumors (p = 0.024. EMSA H3 values and U2AF65 expression also correlated significantly with GSK3 beta, beta-catenin, and NF- B p65 expression, whereas p54nrb and PSF expression correlated with c-Myc, cyclin D1, and CDK4. EMSA values and expression of all three splicing factors correlated

  12. Molecular detection of a putatively novel cyprinid herpesvirus in sichel (Pelecus cultratus) during a mass mortality event in Hungary.

    Science.gov (United States)

    Doszpoly, Andor; Papp, Melitta; Deákné, Petra P; Glávits, Róbert; Ursu, Krisztina; Dán, Ádám

    2015-05-01

    In the early summer of 2014, mass mortality of sichel (Pelecus cultratus) was observed in Lake Balaton, Hungary. Histological examination revealed degenerative changes within the tubular epithelium, mainly in the distal tubules and collecting ducts in the kidneys and multifocal vacuolisation in the brain stem and cerebellum. Routine molecular investigations showed the presence of the DNA of an unknown alloherpesvirus in some specimens. Subsequently, three genes of the putative herpesviral genome (DNA polymerase, terminase, and helicase) were amplified and partially sequenced. A phylogenetic tree reconstruction based on the concatenated sequence of these three conserved genes implied that the virus belongs to the genus Cyprinivirus within the family Alloherpesviridae. The sequences of the sichel herpesvirus differ markedly from those of the cypriniviruses CyHV-1, CyHV-2 and CyHV-3, putatively representing a fifth species in the genus.

  13. Identification and Characterization of Putative Integron-Like Elements of the Heavy-Metal-Hypertolerant Strains of Pseudomonas spp.

    Science.gov (United States)

    Ciok, Anna; Adamczuk, Marcin; Bartosik, Dariusz; Dziewit, Lukasz

    2016-11-28

    Pseudomonas strains isolated from the heavily contaminated Lubin copper mine and Zelazny Most post-flotation waste reservoir in Poland were screened for the presence of integrons. This analysis revealed that two strains carried homologous DNA regions composed of a gene encoding a DNA_BRE_C domain-containing tyrosine recombinase (with no significant sequence similarity to other integrases of integrons) plus a three-component array of putative integron gene cassettes. The predicted gene cassettes encode three putative polypeptides with homology to (i) transmembrane proteins, (ii) GCN5 family acetyltransferases, and (iii) hypothetical proteins of unknown function (homologous proteins are encoded by the gene cassettes of several class 1 integrons). Comparative sequence analyses identified three structural variants of these novel integron-like elements within the sequenced bacterial genomes. Analysis of their distribution revealed that they are found exclusively in strains of the genus Pseudomonas .

  14. Recombinational DNA repair is regulated by compartmentalization of DNA lesions at the nuclear pore complex

    DEFF Research Database (Denmark)

    Géli, Vincent; Lisby, Michael

    2015-01-01

    and colleagues shows that also physiological threats to genome integrity such as DNA secondary structure-forming triplet repeat sequences relocalize to the NPC during DNA replication. Mutants that fail to reposition the triplet repeat locus to the NPC cause repeat instability. Here, we review the types of DNA...... lesions that relocalize to the NPC, the putative mechanisms of relocalization, and the types of recombinational repair that are stimulated by the NPC, and present a model for NPC-facilitated repair....

  15. Characterization of Putative cis-Regulatory Elements in Genes Preferentially Expressed in Arabidopsis Male Meiocytes

    Directory of Open Access Journals (Sweden)

    Junhua Li

    2014-01-01

    Full Text Available Meiosis is essential for plant reproduction because it is the process during which homologous chromosome pairing, synapsis, and meiotic recombination occur. The meiotic transcriptome is difficult to investigate because of the size of meiocytes and the confines of anther lobes. The recent development of isolation techniques has enabled the characterization of transcriptional profiles in male meiocytes of Arabidopsis. Gene expression in male meiocytes shows unique features. The direct interaction of transcription factors (TFs with DNA regulatory sequences forms the basis for the specificity of transcriptional regulation. Here, we identified putative cis-regulatory elements (CREs associated with male meiocyte-expressed genes using in silico tools. The upstream regions (1 kb of the top 50 genes preferentially expressed in Arabidopsis meiocytes possessed conserved motifs. These motifs are putative binding sites of TFs, some of which share common functions, such as roles in cell division. In combination with cell-type-specific analysis, our findings could be a substantial aid for the identification and experimental verification of the protein-DNA interactions for the specific TFs that drive gene expression in meiocytes.

  16. The adnAB Locus, Encoding a Putative Helicase-Nuclease Activity, Is Essential in Streptomyces

    Science.gov (United States)

    Zhang, Lingli; Nguyen, Hoang Chuong; Chipot, Ludovic; Piotrowski, Emilie; Bertrand, Claire

    2014-01-01

    Homologous recombination is a crucial mechanism that repairs a wide range of DNA lesions, including the most deleterious ones, double-strand breaks (DSBs). This multistep process is initiated by the resection of the broken DNA ends by a multisubunit helicase-nuclease complex exemplified by Escherichia coli RecBCD, Bacillus subtilis AddAB, and newly discovered Mycobacterium tuberculosis AdnAB. Here we show that in Streptomyces, neither recBCD nor addAB homologues could be detected. The only putative helicase-nuclease-encoding genes identified were homologous to M. tuberculosis adnAB genes. These genes are conserved as a single copy in all sequenced genomes of Streptomyces. The disruption of adnAB in Streptomyces ambofaciens and Streptomyces coelicolor could not be achieved unless an ectopic copy was provided, indicating that adnAB is essential for growth. Both adnA and adnB genes were shown to be inducible in response to DNA damage (mitomycin C) and to be independently transcribed. Introduction of S. ambofaciens adnAB genes in an E. coli recB mutant restored viability and resistance to UV light, suggesting that Streptomyces AdnAB could be a functional homologue of RecBCD and be involved in DNA damage resistance. PMID:24837284

  17. Structural organization of DNA in chlorella viruses.

    Directory of Open Access Journals (Sweden)

    Timo Wulfmeyer

    Full Text Available Chlorella viruses have icosahedral capsids with an internal membrane enclosing their large dsDNA genomes and associated proteins. Their genomes are packaged in the particles with a predicted DNA density of ca. 0.2 bp nm(-3. Occasionally infection of an algal cell by an individual particle fails and the viral DNA is dynamically ejected from the capsid. This shows that the release of the DNA generates a force, which can aid in the transfer of the genome into the host in a successful infection. Imaging of ejected viral DNA indicates that it is intimately associated with proteins in a periodic fashion. The bulk of the protein particles detected by atomic force microscopy have a size of ∼60 kDa and two proteins (A278L and A282L of about this size are among 6 basic putative DNA binding proteins found in a proteomic analysis of DNA binding proteins packaged in the virion. A combination of fluorescence images of ejected DNA and a bioinformatics analysis of the DNA reveal periodic patterns in the viral DNA. The periodic distribution of GC rich regions in the genome provides potential binding sites for basic proteins. This DNA/protein aggregation could be responsible for the periodic concentration of fluorescently labeled DNA observed in ejected viral DNA. Collectively the data indicate that the large chlorella viruses have a DNA packaging strategy that differs from bacteriophages; it involves proteins and share similarities to that of chromatin structure in eukaryotes.

  18. Determination of cDNA and genomic DNA sequences of hevamine, a chitinase from the rubber tree Hevea brasiliensis

    NARCIS (Netherlands)

    Bokma, E; Spiering, M; Chow, KS; Mulder, PPMFA; Subroto, T; Beintema, JJ

    Hevamine is a chitinase from the rubber tree Hevea brasiliensis and belongs to the family 18 glycosyl hydrolases. This paper describes the cloning of hevamine DNA and cDNA sequences. Hevamine contains a signal peptide at the N-terminus and a putative vacuolar targeting sequence at the C-terminus

  19. A putative hybrid swarm within Oonopsis foliosa (Asteraceae: Astereae)

    Science.gov (United States)

    Hughes, J.F.; Brown, G.K.

    2004-01-01

    Oo??nopsis foliosa var. foliosa and var. monocephala are endemic to short-grass steppe of southeastern Colorado and until recently were considered geographically disjunct. The only known qualitative feature separating these 2 varieties is floral head type; var. foliosa has radiate heads, whereas var. monocephala heads are discoid. Sympatry between these varieties is restricted to a small area in which a range of parental types and intermediate head morphologies is observed. We used distribution mapping, morphometric analyses, chromosome cytology, and pollen stainability to characterize the sympatric zone. Morphometrics confirms that the only discrete difference between var. foliosa and var. monocephala is radiate versus discoid heads, respectively. The outer florets of putative hybrid individuals ranged from conspicuously elongated yet radially symmetric disc-floret corollas, to elongated radially asymmetric bilabiate- or deeply cleft corollas, to stunted ray florets with appendages remnant of corolla lobes. Chromosome cytology of pollen mother cells from both putative parental varieties and a series of intermediate morphological types collected at the sympatric zone reveal evidence of translocation heterozygosity. Pollen stainability shows no significant differences in viability between the parental varieties and putative hybrids. The restricted distribution of putative hybrids to a narrow zone of sympatry between the parental types and the presence of meiotic chromosome-pairing anomalies in these intermediate plants are consistent with a hybrid origin. The high stainability of putative-hybrid pollen adds to a growing body of evidence that hybrids are not universally unfit.

  20. FBH1 influences DNA replication fork stability and homologous recombination through ubiquitylation of RAD51

    DEFF Research Database (Denmark)

    Chu, Wai Kit; Payne, Miranda J; Beli, Petra

    2015-01-01

    Unscheduled homologous recombination (HR) can lead to genomic instability, which greatly increases the threat of neoplastic transformation in humans. The F-box DNA helicase 1 (FBH1) is a 3'-5' DNA helicase with a putative function as a negative regulator of HR. It is the only known DNA helicase t...

  1. Study on Electrochemical Insulin Sensing Utilizing a DNA Aptamer-Immobilized Gold Electrode

    Directory of Open Access Journals (Sweden)

    Izumi Kubo

    2015-07-01

    Full Text Available We investigated an insulin-sensing method by utilizing an insulin-binding aptamer IGA3, which forms an anti-parallel G-quadruplex with folded single strands. Spectroscopic observation indicates that some anti-parallel G-quadruplex bind hemin and show peroxidase activity. In this study, the peroxidase activity of IGA3 with hemin was confirmed by spectrophotometric measurements, i.e., the activity was three-times higher than hemin itself. IGA3 was then immobilized onto a gold electrode to determine its electrochemical activity. The peroxidase activity of the immobilized IGA3-hemin complex was determined by cyclic voltammetry, and a cathodic peak current of the electrode showed a dependence on the concentration of H2O2. The cathodic peak current of the IGA3-hemin complex decreased by binding it to insulin, and this decrease depended on the concentration of insulin.

  2. A unique dual recognition hairpin probe mediated fluorescence amplification method for sensitive detection of uracil-DNA glycosylase and endonuclease IV activities.

    Science.gov (United States)

    Wu, Yushu; Yan, Ping; Xu, Xiaowen; Jiang, Wei

    2016-03-07

    Uracil-DNA glycosylase (UDG) and endonuclease IV (Endo IV) play cooperative roles in uracil base-excision repair (UBER) and inactivity of either will interrupt the UBER to cause disease. Detection of UDG and Endo IV activities is crucial to evaluate the UBER process in fundamental research and diagnostic application. Here, a unique dual recognition hairpin probe mediated fluorescence amplification method was developed for sensitively and selectively detecting UDG and Endo IV activities. For detecting UDG activity, the uracil base in the probe was excised by the target enzyme to generate an apurinic/apyrimidinic (AP) site, achieving the UDG recognition. Then, the AP site was cleaved by a tool enzyme Endo IV, releasing a primer to trigger rolling circle amplification (RCA) reaction. Finally, the RCA reaction produced numerous repeated G-quadruplex sequences, which interacted with N-methyl-mesoporphyrin IX to generate an enhanced fluorescence signal. Alternatively, for detecting Endo IV activity, the uracil base in the probe was first converted into an AP site by a tool enzyme UDG. Next, the AP site was cleaved by the target enzyme, achieving the Endo IV recognition. The signal was then generated and amplified in the same way as those in the UDG activity assay. The detection limits were as low as 0.00017 U mL(-1) for UDG and 0.11 U mL(-1) for Endo IV, respectively. Moreover, UDG and Endo IV can be well distinguished from their analogs. This method is beneficial for properly evaluating the UBER process in function studies and disease prognoses.

  3. Isolation and characterization of two mitoviruses and a putative alphapartitivirus from Fusarium spp.

    Science.gov (United States)

    Osaki, Hideki; Sasaki, Atsuko; Nomiyama, Koji; Sekiguchi, Hiroyuki; Tomioka, Keisuke; Takehara, Toshiaki

    2015-06-01

    The filamentous fungus Fusarium spp. includes several important plant pathogens. We attempted to reveal presence of double-stranded (ds) RNAs in the genus. Thirty-seven Fusarium spp. at the MAFF collection were analyzed. In the strains of Fusarium coeruleum, Fusarium globosum and Fusarium solani f. sp. pisi, single dsRNA bands were detected. The strains of F. coeruleum and F. solani f. sp. pisi cause potato dry rot and mulberry twig blight, respectively. Sequence analyses revealed that dsRNAs in F. coeruleum and F. globosum consisted of 2423 and 2414 bp, respectively. Using the fungal mitochondrial translation table, the positive strands of these cDNAs were found to contain single open reading frames with the potential to encode a protein of putative 757 and 717 amino acids (molecular mass 88.5 and 84.0 kDa, respectively), similar to RNA-dependent RNA polymerases of members of the genus Mitovirus. These dsRNAs in F. coeruleum and F. globosum were assigned to the genus Mitovirus (family Narnaviridae), and these two mitoviruses were designated as Fusarium coeruleum mitovirus 1 and Fusarium globosum mitovirus 1. On the other hand, a positive strand of cDNA (1950 bp) from dsRNA in F. solani f. sp. pisi contained an ORF potentially encoding a putative RdRp of 608 amino acids (72.0 kDa). The putative RdRp was shown to be related to those of members of the genus of Alphapartitivirus (family Partitiviridae). We coined the name Fusarium solani partitivirus 2 for dsRNA in F. solani f. sp. pisi.

  4. Isolation and characterization of two cDNA clones encoding for glutamate dehydrogenase in Nicotiana plumbaginifolia.

    Science.gov (United States)

    Ficarelli, A; Tassi, F; Restivo, F M

    1999-03-01

    We have isolated two full length cDNA clones encoding Nicotiana plumbaginifolia NADH-glutamate dehydrogenase. Both clones share amino acid boxes of homology corresponding to conserved GDH catalytic domains and putative mitochondrial targeting sequence. One clone shows a putative EF-hand loop. The level of the two transcripts is affected differently by carbon source.

  5. Transcriptome of Aphanomyces euteiches: new oomycete putative pathogenicity factors and metabolic pathways.

    Directory of Open Access Journals (Sweden)

    Elodie Gaulin

    Full Text Available Aphanomyces euteiches is an oomycete pathogen that causes seedling blight and root rot of legumes, such as alfalfa and pea. The genus Aphanomyces is phylogenically distinct from well-studied oomycetes such as Phytophthora sp., and contains species pathogenic on plants and aquatic animals. To provide the first foray into gene diversity of A. euteiches, two cDNA libraries were constructed using mRNA extracted from mycelium grown in an artificial liquid medium or in contact to plant roots. A unigene set of 7,977 sequences was obtained from 18,864 high-quality expressed sequenced tags (ESTs and characterized for potential functions. Comparisons with oomycete proteomes revealed major differences between the gene content of A. euteiches and those of Phytophthora species, leading to the identification of biosynthetic pathways absent in Phytophthora, of new putative pathogenicity genes and of expansion of gene families encoding extracellular proteins, notably different classes of proteases. Among the genes specific of A. euteiches are members of a new family of extracellular proteins putatively involved in adhesion, containing up to four protein domains similar to fungal cellulose binding domains. Comparison of A. euteiches sequences with proteomes of fully sequenced eukaryotic pathogens, including fungi, apicomplexa and trypanosomatids, allowed the identification of A. euteiches genes with close orthologs in these microorganisms but absent in other oomycetes sequenced so far, notably transporters and non-ribosomal peptide synthetases, and suggests the presence of a defense mechanism against oxidative stress which was initially characterized in the pathogenic trypanosomatids.

  6. Biochemical Characterization of Putative Adenylate Dimethylallyltransferase and Cytokinin Dehydrogenase from Nostoc sp. PCC 7120.

    Science.gov (United States)

    Frébortová, Jitka; Greplová, Marta; Seidl, Michael F; Heyl, Alexander; Frébort, Ivo

    2015-01-01

    Cytokinins, a class of phytohormones, are adenine derivatives common to many different organisms. In plants, these play a crucial role as regulators of plant development and the reaction to abiotic and biotic stress. Key enzymes in the cytokinin synthesis and degradation in modern land plants are the isopentyl transferases and the cytokinin dehydrogenases, respectively. Their encoding genes have been probably introduced into the plant lineage during the primary endosymbiosis. To shed light on the evolution of these proteins, the genes homologous to plant adenylate isopentenyl transferase and cytokinin dehydrogenase were amplified from the genomic DNA of cyanobacterium Nostoc sp. PCC 7120 and expressed in Escherichia coli. The putative isopentenyl transferase was shown to be functional in a biochemical assay. In contrast, no enzymatic activity was detected for the putative cytokinin dehydrogenase, even though the principal domains necessary for its function are present. Several mutant variants, in which conserved amino acids in land plant cytokinin dehydrogenases had been restored, were inactive. A combination of experimental data with phylogenetic analysis indicates that adenylate-type isopentenyl transferases might have evolved several times independently. While the Nostoc genome contains a gene coding for protein with characteristics of cytokinin dehydrogenase, the organism is not able to break down cytokinins in the way shown for land plants.

  7. Unique C. elegans telomeric overhang structures reveal the evolutionarily conserved properties of telomeric DNA

    Czech Academy of Sciences Publication Activity Database

    Školáková, Petra; Foldynová-Trantírková, Silvie; Bednářová, Klára; Fiala, R.; Vorlíčková, Michaela; Trantírek, L.

    2015-01-01

    Roč. 43, č. 9 (2015), s. 4733-4745 ISSN 0305-1048 R&D Projects: GA ČR(CZ) GA13-28310S; GA ČR(CZ) GAP205/12/0466 Institutional support: RVO:68081707 ; RVO:60077344 Keywords : NUCLEASE HYPERSENSITIVE ELEMENT * G-QUADRUPLEX STRUCTURES * I-MOTIF Subject RIV: BO - Biophysics Impact factor: 9.202, year: 2015

  8. Molecular characterization of putative Hepatozoon sp. from the sedge warbler (Acrocephalus schoenobaenus).

    Science.gov (United States)

    Biedrzycka, Aleksandra; Kloch, Agnieszka; Migalska, Magdalena; Bielański, Wojciech

    2013-05-01

    We characterized partial sequences of 18S rDNA from sedge warblers infected with a parasite described previously as Hepatozoon kabeeni. Prevalence was 47% in sampled birds.We detected 3 parasite haplotypes in 62 sequenced samples from infected animals. In phylogenetic analyses, 2 of the putative Hepatozoon haplotypes closely resembled Lankesterella minima and L. valsainensis. The third haplotype grouped in a wider clade composed of Caryospora and Eimeria. None of the haplotypes showed resemblance to sequences of Hepatozoon from reptiles and mammals. Molecular detection results were consistent with those from microscopy of stained blood smears, confirming that the primers indeed amplified the parasite sequences. Here we provide evidence that the avian Hepatozoon-like parasites are most likely Lankesterella, supporting the suggestion that the systematic position of avian Hepatozoon-like species needs to be revised.

  9. Putative golden proportions as predictors of facial esthetics in adolescents.

    NARCIS (Netherlands)

    Kiekens, R.M.A.; Kuijpers-Jagtman, A.M.; Hof, M.A. van 't; Hof, B.E. van 't; Maltha, J.C.

    2008-01-01

    INTRODUCTION: In orthodontics, facial esthetics is assumed to be related to golden proportions apparent in the ideal human face. The aim of the study was to analyze the putative relationship between facial esthetics and golden proportions in white adolescents. METHODS: Seventy-six adult laypeople

  10. Exploring universal partnerships and putative marriages as tools for ...

    African Journals Online (AJOL)

    Following upon the Supreme Court of Appeal's judgment in Butters v Mncora 2012 4 SA 1 (SCA), which broadened the criteria and consequences of universal partnerships in cohabitation relationships, this article investigates the potential of universal partnerships and putative marriages to allocate rights to share in ...

  11. Putative Lineage of Novel African Usutu Virus, Central Europe

    Centers for Disease Control (CDC) Podcasts

    2015-10-15

    Sarah Gregory reads an abridged version of "Putative Lineage of Novel African Usutu Virus, Central Europe.".  Created: 10/15/2015 by National Center for Emerging and Zoonotic Infectious Diseases (NCEZID).   Date Released: 10/15/2015.

  12. Computational identification of putative cytochrome P450 genes in ...

    African Journals Online (AJOL)

    In this work, a computational study of expressed sequence tags (ESTs) of soybean was performed by data mining methods and bio-informatics tools and as a result 78 putative P450 genes were identified, including 57 new ones. These genes were classified into five clans and 20 families by sequence similarities and among ...

  13. Differential expressions of putative genes in various floral organs of ...

    African Journals Online (AJOL)

    STORAGESEVER

    2009-06-03

    Jun 3, 2009 ... Full Length Research Paper. Differential expressions of putative genes in various floral organs of the Pigeon orchid (Dendrobium crumenatum) using GeneFishing. Faridah, Q. Z.1, 2, Ng, B. Z.3, Raha, A. R.4, Umi, K. A. B.5 and Khosravi, A. R.2*. 1Department of Biology, Faculty Science, University Putra ...

  14. Inhibitory Synaptic Plasticity - Spike timing dependence and putative network function.

    Directory of Open Access Journals (Sweden)

    Tim P Vogels

    2013-07-01

    Full Text Available While the plasticity of excitatory synaptic connections in the brain has been widely studied, the plasticity of inhibitory connections is much less understood. Here, we present recent experimental and theoretical □ndings concerning the rules of spike timing-dependent inhibitory plasticity and their putative network function. This is a summary of a workshop at the COSYNE conference 2012.

  15. Alkenenitrile Transmissive Olefination: Synthesis of the Putative Lignan "Morinol I"

    Science.gov (United States)

    Fleming, Fraser F.; Liu, Wang; Yao, Lihua; Pitta, Bhaskar; Purzycki, Matthew; Ravikumar, P. C.

    2012-01-01

    Grignard reagents trigger an addition-elimination with α'-hydroxy acrylonitriles to selectively generate Z-alkenenitriles. The modular assembly of Z-alkenenitriles from a Grignard reagent, acrylonitrile, and an aldehyde is ideal for stereoselectively synthesizing alkenes as illustrated in the synthesis of the putative lignan "morinol I." PMID:22545004

  16. Putative Microsatellite DNA Marker-Based Wheat Genomic Resource for Varietal Improvement and Management

    Directory of Open Access Journals (Sweden)

    Sarika Jaiswal

    2017-11-01

    Full Text Available Wheat fulfills 20% of global caloric requirement. World needs 60% more wheat for 9 billion population by 2050 but climate change with increasing temperature is projected to affect wheat productivity adversely. Trait improvement and management of wheat germplasm requires genomic resource. Simple Sequence Repeats (SSRs being highly polymorphic and ubiquitously distributed in the genome, can be a marker of choice but there is no structured marker database with options to generate primer pairs for genotyping on desired chromosome/physical location. Previously associated markers with different wheat trait are also not available in any database. Limitations of in vitro SSR discovery can be overcome by genome-wide in silico mining of SSR. Triticum aestivum SSR database (TaSSRDb is an integrated online database with three-tier architecture, developed using PHP and MySQL and accessible at http://webtom.cabgrid.res.in/wheatssr/. For genotyping, Primer3 standalone code computes primers on user request. Chromosome-wise SSR calling for all the three sub genomes along with choice of motif types is provided in addition to the primer generation for desired marker. We report here a database of highest number of SSRs (476,169 from complex, hexaploid wheat genome (~17 GB along with previously reported 268 SSR markers associated with 11 traits. Highest (116.93 SSRs/Mb and lowest (74.57 SSRs/Mb SSR densities were found on 2D and 3A chromosome, respectively. To obtain homozygous locus, e-PCR was done. Such 30 loci were randomly selected for PCR validation in panel of 18 wheat Advance Varietal Trial (AVT lines. TaSSRDb can be a valuable genomic resource tool for linkage mapping, gene/QTL (Quantitative trait locus discovery, diversity analysis, traceability and variety identification. Varietal specific profiling and differentiation can supplement DUS (Distinctiveness, Uniformity, and Stability testing, EDV (Essentially Derived Variety/IV (Initial Variety disputes, seed purity and hybrid wheat testing. All these are required in germplasm management as well as also in the endeavor of wheat productivity.

  17. Zinc and glutamate dehydrogenase in putative glutamatergic brain structures.

    Science.gov (United States)

    Wolf, G; Schmidt, W

    1983-01-01

    A certain topographic parallelism between the distribution of histochemically (TIMM staining) identified zinc and putative glutamatergic structures in the rat brain was demonstrated. Glutamate dehydrogenase as a zinc containing protein is in consideration to be an enzyme synthesizing transmitter glutamate. In a low concentration range externally added zinc ions (10(-9) to 10(-7) M) induced an increase in the activity of glutamate dehydrogenase (GDH) originating from rat hippocampal formation, neocortex, and cerebellum up to 142.4%. With rising molarity of Zn(II) in the incubation medium, the enzyme of hippocampal formation and cerebellum showed a biphasic course of activation. Zinc ions of a concentration higher than 10(-6) M caused a strong inhibition of GDH. The effect of Zn(II) on GDH originating from spinal ganglia and liver led only to a decrease of enzyme activity. These results are discussed in connection with a functional correlation between zinc and putatively glutamatergic system.

  18. Modeling DNA

    Science.gov (United States)

    Robertson, Carol

    2016-01-01

    Deoxyribonucleic acid (DNA) is life's most amazing molecule. It carries the genetic instructions that almost every organism needs to develop and reproduce. In the human genome alone, there are some three billion DNA base pairs. The most difficult part of teaching DNA structure, however, may be getting students to visualize something as small as a…

  19. Supplementary data: Variation in the PTEN-induced putative kinase ...

    Indian Academy of Sciences (India)

    Variation in the PTEN-induced putative kinase 1 gene associated with the increase risk of type 2 diabetes in northern Chinese. Yanchun Qu, Liang Sun, Ze Yang and Ruifa Han. J. Genet. 90, 125–128. Table 1. Clinical characteristics of cases and controls. Phenotype. T2DM. Controls. P value. Age (years). 49.5 ± 11.1. 50.4 ± ...

  20. Purification and crystallization of a putative transcriptional regulator of the benzoate oxidation pathway in Burkholderia xenovorans LB400

    International Nuclear Information System (INIS)

    Law, Adrienne M.; Bains, Jasleen; Boulanger, Martin J.

    2009-01-01

    The X-ray diffraction and preliminary phasing of the putative transcriptional regulator Bxe-C0898 from B. xenovorans LB400 are reported. Burkholderia xenovorans LB400 harbours two paralogous copies of the recently discovered benzoate oxidation (box) pathway. While both copies are functional, the paralogues are differentially regulated and flanked by putative transcriptional regulators from distinct families. The putative LysR-type transcriptional regulator (LTTR) adjacent to the megaplasmid-encoded box enzymes, Bxe-C0898, has been produced recombinantly in Escherichia coli and purified to homogeneity. Gel-filtration studies show that Bxe-C0898 is a tetramer in solution, consistent with previously characterized LTTRs. Bxe-C0898 crystallized with four molecules in the asymmetric unit of the P4 3 2 1 2/P4 1 2 1 2 unit cell with a solvent content of 61.19%, as indicated by processing of the X-ray diffraction data. DNA-protection assays are currently under way in order to identify potential operator regions for this LTTR and to define its role in regulation of the box pathway

  1. Putative midkine family protein up-regulation in Patella caerulea (Mollusca, Gastropoda) exposed to sublethal concentrations of cadmium

    International Nuclear Information System (INIS)

    Vanucci, Silvana; Minerdi, Daniela; Kadomatsu, Kenji; Mengoni, Alessio; Bazzicalupo, Marco

    2005-01-01

    A cDNA sequence of a putative midkine (MK) family protein was identified and characterised in the mollusc Patella caerulea. The midkine family consists of two members, midkine and pleiotrophin (PTN), and it is one of the recently discovered cytokines. Our results show that this putative midkine protein is up-regulated in specimens of P. caerulea exposed to sublethal cadmium concentrations (i.e. 0.5 and 1 mg l -1 Cd) over a 10-day exposure period. Semiquantitative RT-PCR and quantitative Real time RT-PCR estimations indicate elevated expression of midkine mRNA in exposed specimens compared to controls. Moreover, RT-PCR Real time values were higher in the viscera (here defined as the part of the soft tissue including digestive gland plus gills) than in the foot (i.e. foot plus head plus heart) of the limpets. At present, information on the functional signalling significance of the midkine family proteins suggests that the up-regulation of P. caerulea putative midkine family protein is a distress signal likely with informative value on health status of the organism and with potential prognostic capability

  2. Shell alterations in limpets as putative biomarkers for multi-impacted coastal areas.

    Science.gov (United States)

    Begliomini, Felipe Nincao; Maciel, Daniele Claudino; de Almeida, Sérgio Mendonça; Abessa, Denis Moledo; Maranho, Luciane Alves; Pereira, Camilo Seabra; Yogui, Gilvan Takeshi; Zanardi-Lamardo, Eliete; Castro, Ítalo Braga

    2017-07-01

    During the last years, shell alterations in gastropods have been proposed as tools to be used in monitoring programs. However, no studies were so far performed investigating the relationships among shell parameters and classical biomarkers of damage. The relationship between shell alterations (biometrics, shape and elemental composition) and biomarkers (LPO and DNA strand break) was evaluated in the limpet L. subrugosa sampled along a contamination gradient in a multi-impacted coastal zone from southeastern Brazil. Statistically significant differences were detected among sites under different pollution levels. The occurrence of shell malformations was consistent with environmental levels of several hazardous substances reported for the studied area and related to lipid peroxidation and DNA damage. In addition, considering the low mobility, wide geographic distribution, ease of collection and abundance of limpets in coastal zones, this putative tool may be a cost-effective alternative to traditional biomarkers. Thus, shell alterations in limpets seem to be good proxies for assessing biological adverse effects in multi-impacted coastal zones. Copyright © 2017 Elsevier Ltd. All rights reserved.

  3. ESTs Analysis of Putative Genes Engaged in Polyporus umbellatus Sclerotial Development

    Directory of Open Access Journals (Sweden)

    Chao Song

    2014-09-01

    Full Text Available Polyporus umbellatus is one of the most widely used and precious medicinal fungi and the underground sclerotia are known to be with great medicinal value. However, the molecular mechanisms involved in sclerotial development are poorly understood. In the present study, we constructed a forward suppression subtractive hybridization (SSH cDNA library of Polyporus umbellatus to identify genes expressing differently between mycelium and sclerotia. In this library, a total of 1202 clones were sequenced, assembled into 222 contigs and 524 singletons which were further searched against the NCBI nonredundant (NR protein database (E-value cutoff, 10−5. Based on sequence similarity with known proteins, 378 sequences between mycelium and sclerotial were identified and classified into different functional categories through Gene Ontology (GO, Clusters of orthologous Groups of proteins (COGs. We have finally identified a majority of differentially expressed genes (constituting 5.6% of the present library between the two different periods. An expression level of 32 selected expressed sequence tags (ESTs generated from the above SSH cDNA library was studied through RT-PCR. This study provides the first global overview of genes putatively involved in Polyporus umbellatus sclerotial development and provides a preliminary basis for further functional research in terms of regulated gene expression in sclerotial production.

  4. The structure of KPN03535 (gi|152972051), a novel putative lipoprotein from Klebsiella pneumoniae, reveals an OB-fold

    International Nuclear Information System (INIS)

    Das, Debanu; Kozbial, Piotr; Han, Gye Won; Carlton, Dennis; Jaroszewski, Lukasz; Abdubek, Polat; Astakhova, Tamara; Axelrod, Herbert L.; Bakolitsa, Constantina; Chen, Connie; Chiu, Hsiu-Ju; Chiu, Michelle; Clayton, Thomas; Deller, Marc C.; Duan, Lian; Ellrott, Kyle; Elsliger, Marc-André; Ernst, Dustin; Farr, Carol L.; Feuerhelm, Julie; Grzechnik, Anna; Grant, Joanna C.; Jin, Kevin K.; Johnson, Hope A.; Klock, Heath E.; Knuth, Mark W.; Krishna, S. Sri; Kumar, Abhinav; Marciano, David; McMullan, Daniel; Miller, Mitchell D.; Morse, Andrew T.; Nigoghossian, Edward; Nopakun, Amanda; Okach, Linda; Oommachen, Silvya; Paulsen, Jessica; Puckett, Christina; Reyes, Ron; Rife, Christopher L.; Sefcovic, Natasha; Tien, Henry J.; Trame, Christine B.; Bedem, Henry van den; Weekes, Dana; Wooten, Tiffany; Xu, Qingping; Hodgson, Keith O.; Wooley, John; Deacon, Ashley M.; Godzik, Adam; Lesley, Scott A.; Wilson, Ian A.

    2009-01-01

    KPN03535 is a protein unique to K. pneumoniae. The crystal structure reveals that KPN03535 represents a novel variant of the OB-fold and is likely to be a DNA-binding lipoprotein. KPN03535 (gi|152972051) is a putative lipoprotein of unknown function that is secreted by Klebsiella pneumoniae MGH 78578. The crystal structure reveals that despite a lack of any detectable sequence similarity to known structures, it is a novel variant of the OB-fold and structurally similar to the bacterial Cpx-pathway protein NlpE, single-stranded DNA-binding (SSB) proteins and toxins. K. pneumoniae MGH 78578 forms part of the normal human skin, mouth and gut flora and is an opportunistic pathogen that is linked to about 8% of all hospital-acquired infections in the USA. This structure provides the foundation for further investigations into this divergent member of the OB-fold family

  5. A putative Type IIS restriction endonuclease GeoICI

    Indian Academy of Sciences (India)

    As opposed to the unstable prototype, which cleaves DNA at 30°C, GeoICI is highly active at elevated temperatures, up to 73°C and over a very wide salt concentration range. Recognition/cleavage sites were determined by: (i) digestion of plasmid and bacteriophage lambda DNA (λ); (ii) cleavage of custom PCR substrates, ...

  6. De Novo assembly of the Japanese flounder (Paralichthys olivaceus spleen transcriptome to identify putative genes involved in immunity.

    Directory of Open Access Journals (Sweden)

    Lin Huang

    Full Text Available Japanese flounder (Paralichthys olivaceus is an economically important marine fish in Asia and has suffered from disease outbreaks caused by various pathogens, which requires more information for immune relevant genes on genome background. However, genomic and transcriptomic data for Japanese flounder remain scarce, which limits studies on the immune system of this species. In this study, we characterized the Japanese flounder spleen transcriptome using an Illumina paired-end sequencing platform to identify putative genes involved in immunity.A cDNA library from the spleen of P. olivaceus was constructed and randomly sequenced using an Illumina technique. The removal of low quality reads generated 12,196,968 trimmed reads, which assembled into 96,627 unigenes. A total of 21,391 unigenes (22.14% were annotated in the NCBI Nr database, and only 1.1% of the BLASTx top-hits matched P. olivaceus protein sequences. Approximately 12,503 (58.45% unigenes were categorized into three Gene Ontology groups, 19,547 (91.38% were classified into 26 Cluster of Orthologous Groups, and 10,649 (49.78% were assigned to six Kyoto Encyclopedia of Genes and Genomes pathways. Furthermore, 40,928 putative simple sequence repeats and 47, 362 putative single nucleotide polymorphisms were identified. Importantly, we identified 1,563 putative immune-associated unigenes that mapped to 15 immune signaling pathways.The P. olivaceus transciptome data provides a rich source to discover and identify new genes, and the immune-relevant sequences identified here will facilitate our understanding of the mechanisms involved in the immune response. Furthermore, the plentiful potential SSRs and SNPs found in this study are important resources with respect to future development of a linkage map or marker assisted breeding programs for the flounder.

  7. Isolation and Expression analysis of OsPME1, encoding for a putative Pectin Methyl Esterase from Oryza sativa (subsp. indica)

    OpenAIRE

    Kanneganti, Vydehi; Gupta, Aditya Kumar

    2009-01-01

    Pectin Methyl Esterases (PMEs) play an essential role during plant development by affecting the mechanical properties of the plant cell walls. Recent studies indicated that PMEs play important role in pollen tube development. In this study, we isolated a 1.3 kb cDNA clone from rice panicle cDNA library. It contained a 1038 bp of open reading frame (ORF) encoding for a putative pectin methyl esterase of 345 aminoacids with a 20 aminoacid signal peptide and was hence designated as OsPME1 (Oryza...

  8. Sequence analysis and gene expression of putative exo- and endo-glucanases from oil palm (Elaeis guineensis) during fungal infection.

    Science.gov (United States)

    Yeoh, Keat-Ai; Othman, Abrizah; Meon, Sariah; Abdullah, Faridah; Ho, Chai-Ling

    2012-10-15

    Glucanases are enzymes that hydrolyze a variety β-d-glucosidic linkages. Plant β-1,3-glucanases are able to degrade fungal cell walls; and promote the release of cell-wall derived fungal elicitors. In this study, three full-length cDNA sequences encoding oil palm (Elaeis guineensis) glucanases were analyzed. Sequence analyses of the cDNA sequences suggested that EgGlc1-1 is a putative β-d-glucan exohydolase belonging to glycosyl hydrolase (GH) family 3 while EgGlc5-1 and EgGlc5-2 are putative glucan endo-1,3-β-glucosidases belonging to GH family 17. The transcript abundance of these genes in the roots and leaves of oil palm seedlings treated with Ganoderma boninense and Trichoderma harzianum was profiled to investigate the involvement of these glucanases in oil palm during fungal infection. The gene expression of EgGlc1-1 in the root of oil palm seedlings was increased by T. harzianum but suppressed by G. boninense; while the gene expression of both EgGlc5-1 and EgGlc5-2 in the roots of oil palm seedlings was suppressed by G. boninense or/and T. harzianum. Copyright © 2012 Elsevier GmbH. All rights reserved.

  9. The Bacillus anthracis chromosome contains four conserved, excision-proficient, putative prophages

    Directory of Open Access Journals (Sweden)

    Sozhamannan Shanmuga

    2006-04-01

    Full Text Available Abstract Background Bacillus anthracis is considered to be a recently emerged clone within the Bacillus cereus sensu lato group. The B. anthracis genome sequence contains four putative lambdoid prophages. We undertook this study in order to understand whether the four prophages are unique to B. anthracis and whether they produce active phages. Results More than 300 geographically and temporally divergent isolates of B. anthracis and its near neighbors were screened by PCR for the presence of specific DNA sequences from each prophage region. Every isolate of B. anthracis screened by PCR was found to produce all four phage-specific amplicons whereas none of the non-B. anthracis isolates, produced more than one phage-specific amplicon. Excision of prophages could be detected by a PCR based assay for attP sites on extra-chromosomal phage circles and for attB sites on phage-excised chromosomes. SYBR-green real-time PCR assays indicated that prophage excision occurs at very low frequencies (2 × 10-5 - 8 × 10-8/cell. Induction with mitomycin C increased the frequency of excision of one of the prophages by approximately 250 fold. All four prophages appear to be defective since, mitomycin C induced culture did not release any viable phage particle or lyse the cells or reveal any phage particle under electron microscopic examination. Conclusion The retention of all four putative prophage regions across all tested strains of B. anthracis is further evidence of the very recent emergence of this lineage and the prophage regions may be useful for differentiating the B. anthracis chromosome from that of its neighbors. All four prophages can excise at low frequencies, but are apparently defective in phage production.

  10. The Saccharomyces cerevisiae RAD18 gene encodes a protein that contains potential zinc finger domains for nucleic acid binding and a putative nucleotide binding sequence

    Energy Technology Data Exchange (ETDEWEB)

    Jones, J.S.; Prakash, L. (Univ. of Rochester School of Medicine, NY (USA)); Weber, S. (Kodak Research Park, Rochester, NY (USA))

    1988-07-25

    The RAD18 gene of Saccharomyces cerevisiae is required for postreplication repair of UV damaged DNA. The authors have isolated the RAD18 gene, determined its nucleotide sequence and examined if deletion mutations of this gene show different or more pronounced phenotypic effects than the previously described point mutations. The RAD18 gene open reading frame encodes a protein of 487 amino acids, with a calculated molecular weight of 55,512. The RAD18 protein contains three potential zinc finger domains for nucleic acid binding, and a putative nucleotide binding sequence that is present in many proteins that bind and hydrolyze ATP. The DNA binding and nucleotide binding activities could enable the RAD18 protein to bind damaged sites in the template DNA with high affinity. Alternatively, or in addition, RAD18 protein may be a transcriptional regulator. The RAD18 deletion mutation resembles the previously described point mutations in its effects on viability, DNA repair, UV mutagenesis, and sporulation.

  11. Putative periodontopathic bacteria and herpesviruses in pregnant women: a case-control study

    OpenAIRE

    Lu, Haixia; Zhu, Ce; Li, Fei; Xu, Wei; Tao, Danying; Feng, Xiping

    2016-01-01

    Little is known about herpesvirus and putative periodontopathic bacteria in maternal chronic periodontitis. The present case-control study aimed to explore the potential relationship between putative periodontopathic bacteria and herpesviruses in maternal chronic periodontitis.Saliva samples were collected from 36 pregnant women with chronic periodontitis (cases) and 36 pregnant women with healthy periodontal status (controls). Six putative periodontopathic bacteria (Porphyromonas gingivalis ...

  12. DNA Camouflage

    Science.gov (United States)

    2016-01-08

    1 DNA Camouflage Supplementary Information Bijan Zakeri1,2*, Timothy K. Lu1,2*, Peter A. Carr2,3* 1Department of Electrical Engineering and...ll.mit.edu). Distribution A: Public Release   2 Supplementary Figure 1 DNA camouflage with the 2-state device. (a) In the presence of Cre, DSD-2[α...10 1 + Cre 1 500 1,000 length (bp) chromatogram alignment template − Cre   4 Supplementary Figure 3 DNA camouflage with a switchable

  13. Putative golden proportions as predictors of facial esthetics in adolescents.

    Science.gov (United States)

    Kiekens, Rosemie M A; Kuijpers-Jagtman, Anne Marie; van 't Hof, Martin A; van 't Hof, Bep E; Maltha, Jaap C

    2008-10-01

    In orthodontics, facial esthetics is assumed to be related to golden proportions apparent in the ideal human face. The aim of the study was to analyze the putative relationship between facial esthetics and golden proportions in white adolescents. Seventy-six adult laypeople evaluated sets of photographs of 64 adolescents on a visual analog scale (VAS) from 0 to 100. The facial esthetic value of each subject was calculated as a mean VAS score. Three observers recorded the position of 13 facial landmarks included in 19 putative golden proportions, based on the golden proportions as defined by Ricketts. The proportions and each proportion's deviation from the golden target (1.618) were calculated. This deviation was then related to the VAS scores. Only 4 of the 19 proportions had a significant negative correlation with the VAS scores, indicating that beautiful faces showed less deviation from the golden standard than less beautiful faces. Together, these variables explained only 16% of the variance. Few golden proportions have a significant relationship with facial esthetics in adolescents. The explained variance of these variables is too small to be of clinical importance.

  14. CRYSTAL STRUCTURE ANALYSIS OF A PUTATIVE OXIDOREDUCTASE FROM KLEBSIELLA PNEUMONIAE

    Energy Technology Data Exchange (ETDEWEB)

    Baig, M.; Brown, A.; Eswaramoorthy, S.; Swaminathan, S.

    2009-01-01

    Klebsiella pneumoniae, a gram-negative enteric bacterium, is found in nosocomial infections which are acquired during hospital stays for about 10% of hospital patients in the United States. The crystal structure of a putative oxidoreductase from K. pneumoniae has been determined. The structural information of this K. pneumoniae protein was used to understand its function. Crystals of the putative oxidoreductase enzyme were obtained by the sitting drop vapor diffusion method using Polyethylene glycol (PEG) 3350, Bis-Tris buffer, pH 5.5 as precipitant. These crystals were used to collect X-ray data at beam line X12C of the National Synchrotron Light Source (NSLS) at Brookhaven National Laboratory (BNL). The crystal structure was determined using the SHELX program and refi ned with CNS 1.1. This protein, which is involved in the catalysis of an oxidation-reduction (redox) reaction, has an alpha/beta structure. It utilizes nicotinamide adenine dinucleotide phosphate (NADP) or nicotine adenine dinucleotide (NAD) to perform its function. This structure could be used to determine the active and co-factor binding sites of the protein, information that could help pharmaceutical companies in drug design and in determining the protein’s relationship to disease treatment such as that for pneumonia and other related pathologies.

  15. A new putative deltapartitivirus recovered from Dianthus amurensis.

    Science.gov (United States)

    An, Hongliu; Tan, Guanlin; Xiong, Guihong; Li, Meirong; Fang, Shouguo; Islam, Saif Ul; Zhang, Songbai; Li, Fan

    2017-09-01

    Two double stranded RNAs (dsRNA), likely representing the genome of a novel deltapartitivirus, provisionally named carnation cryptic virus 3 (CCV3), were recovered from Dianthus amurensis. The two dsRNAs were 1,573 (dsRNA1) and 1,561 (dsRNA2) bp in size, each containing a single open reading frame (ORF) encoding a 475- and 411-aa protein, respectively. The 475-aa protein contains a conserved RNA dependent RNA polymerase (RdRp) domain which shows significant homology to RdRps of established or putative partitiviruses, particularly those belonging to the genus Deltapartitivirus. However, it shares an amino acid identity of 75% with its closest relative, the RdRp of the deltapartitivirus beet cryptic virus 2 (BCV2), and is <62% identical to the RdRps of other partitiviruses. In a phylogenetic tree constructed with RdRps of selected partitiviruses, CCV3 clustered with BCV2 and formed a well-supported monophyletic clade with known or putative deltapartitiviruses.

  16. The Putative Chemosignal Androstadienone Makes Women More Generous.

    Science.gov (United States)

    Perrotta, Valentina; Graffeo, Michele; Bonini, Nicolao; Gottfried, Jay A

    2016-06-01

    Putative human chemosignals have been shown to influence mood states and emotional processing, but the connection between these effects and higher-order cognitive processing is not well established. This study utilized an economic game (Dictator Game) to test whether androstadienone (AND), an odorous compound derived from testosterone, impacts on altruistic behavior. We predicted that the female participants would act more generously in the AND condition, exhibiting a significant interaction effect between gender and AND on Dictator Game contributions. We also expected that the presence of AND should increase the positive mood of the female participants, compared to a control odor condition and also compared to the mood of the male participants. The results confirm our hypotheses: for women the subliminal perception of AND led to larger monetary donations, compared to a control odor, and also increased positive mood. These effects were absent or significantly weaker in men. Our findings highlight the capacity of human putative chemosignals to influence emotions and higher cognitive processes - in particular the processes used in the context of economic decisions - in a gender-specific way.

  17. DNA glue

    DEFF Research Database (Denmark)

    Filichev, Vyacheslav V; Astakhova, Irina V.; Malakhov, Andrei D.

    2008-01-01

    Significant alterations in thermal stability of parallel DNA triplexes and antiparallel duplexes were observed upon changing the attachment of ethynylpyrenes from para to ortho in the structure of phenylmethylglycerol inserted as a bulge into DNA (TINA). Insertions of two ortho-TINAs as a pseudo...

  18. Hyperstretching DNA

    NARCIS (Netherlands)

    Schakenraad, Koen; Biebricher, Andreas S.; Sebregts, Maarten; Ten Bensel, Brian; Peterman, Erwin J.G.; Wuite, Gijs J L; Heller, Iddo; Storm, Cornelis; Van Der Schoot, Paul

    2017-01-01

    The three-dimensional structure of DNA is highly susceptible to changes by mechanical and biochemical cues in vivo and in vitro. In particular, large increases in base pair spacing compared to regular B-DNA are effected by mechanical (over)stretching and by intercalation of compounds that are widely

  19. The effect of ancient DNA damage on inferences of demographic histories

    DEFF Research Database (Denmark)

    Axelsson, Erik; Willerslev, Eske; Gilbert, Marcus Thomas Pius

    2008-01-01

    The field of ancient DNA (aDNA) is casting new light on many evolutionary questions. However, problems associated with the postmortem instability of DNA may complicate the interpretation of aDNA data. For example, in population genetic studies, the inclusion of damaged DNA may inflate estimates o...... for a change in effective population size in this data set vanishes once the effects of putative damage are removed. Our results suggest that population genetic analyses of aDNA sequences, which do not accurately account for damage, should be interpreted with great caution....

  20. Supplementary data: Development of nuclear DNA markers for ...

    Indian Academy of Sciences (India)

    Supplementary data: Development of nuclear DNA markers for evolutionary studies in Plasmodium falciparum. Celia Thomas, Sneh Shalini, N. Raghavendra, Meenakshi Choudhary, Anju Verma, Hema Joshi,. A. P. Dash and Aparup Das. J. Genet. 86, 65–68. Primer sequences for amplification of putatively neutral ...

  1. DNA probes

    International Nuclear Information System (INIS)

    Castelino, J.

    1992-01-01

    The creation of DNA probes for detection of specific nucleotide segments differs from ligand detection in that it is a chemical rather than an immunological reaction. Complementary DNA or RNA is used in place of the antibody and is labelled with 32 P. So far, DNA probes have been successfully employed in the diagnosis of inherited disorders, infectious diseases, and for identification of human oncogenes. The latest approach to the diagnosis of communicable and parasitic infections is based on the use of deoxyribonucleic acid (DNA) probes. The genetic information of all cells is encoded by DNA and DNA probe approach to identification of pathogens is unique because the focus of the method is the nucleic acid content of the organism rather than the products that the nucleic acid encodes. Since every properly classified species has some unique nucleotide sequences that distinguish it from every other species, each organism's genetic composition is in essence a finger print that can be used for its identification. In addition to this specificity, DNA probes offer other advantages in that pathogens may be identified directly in clinical specimens

  2. DNA probes

    Energy Technology Data Exchange (ETDEWEB)

    Castelino, J

    1993-12-31

    The creation of DNA probes for detection of specific nucleotide segments differs from ligand detection in that it is a chemical rather than an immunological reaction. Complementary DNA or RNA is used in place of the antibody and is labelled with {sup 32}P. So far, DNA probes have been successfully employed in the diagnosis of inherited disorders, infectious diseases, and for identification of human oncogenes. The latest approach to the diagnosis of communicable and parasitic infections is based on the use of deoxyribonucleic acid (DNA) probes. The genetic information of all cells is encoded by DNA and DNA probe approach to identification of pathogens is unique because the focus of the method is the nucleic acid content of the organism rather than the products that the nucleic acid encodes. Since every properly classified species has some unique nucleotide sequences that distinguish it from every other species, each organism`s genetic composition is in essence a finger print that can be used for its identification. In addition to this specificity, DNA probes offer other advantages in that pathogens may be identified directly in clinical specimens 10 figs, 2 tabs

  3. Molecular characterization of the llama FGF5 gene and identification of putative loss of function mutations.

    Science.gov (United States)

    Daverio, M S; Vidal-Rioja, L; Frank, E N; Di Rocco, F

    2017-12-01

    Llama, the most numerous domestic camelid in Argentina, has good fiber-production ability. Although a few genes related to other productive traits have been characterized, the molecular genetic basis of fiber growth control in camelids is still poorly understood. Fibroblast growth factor 5 (FGF5) is a secreted signaling protein that controls hair growth in humans and other mammals. Mutations in the FGF5 gene have been associated with long-hair phenotypes in several species. Here, we sequenced the llama FGF5 gene, which consists of three exons encoding 813 bp. cDNA analysis from hair follicles revealed the expression of two FGF5 alternative spliced transcripts, in one of which exon 2 is absent. DNA variation analysis showed four polymorphisms in the coding region: a synonymous SNP (c.210A>G), a single base deletion (c.348delA), a 12-bp insertion (c.351_352insCATATAACATAG) and a non-sense mutation (c.499C>T). The deletion was always found together with the insertion forming a haplotype and producing a putative truncated protein of 123 amino acids. The c.499C>T mutation also leads to a premature stop codon at position 168. In both cases, critical functional domains of FGF5, including one heparin binding site, are lost. All animals analyzed were homozygous for one of the deleterious mutations or compound heterozygous for both (i.e. c.348delA, c.351_352insCATATAACATAG/c.499T). Sequencing of guanaco samples showed that the FGF5 gene encodes a full-length 270-amino acid protein. These results suggest that FGF5 is likely functional in short-haired wild species and non-functional in the domestic fiber-producing species, the llama. © 2017 Stichting International Foundation for Animal Genetics.

  4. A sparse regulatory network of copy-number driven gene expression reveals putative breast cancer oncogenes.

    Science.gov (United States)

    Yuan, Yinyin; Curtis, Christina; Caldas, Carlos; Markowetz, Florian

    2012-01-01

    Copy number aberrations are recognized to be important in cancer as they may localize to regions harboring oncogenes or tumor suppressors. Such genomic alterations mediate phenotypic changes through their impact on expression. Both cis- and transacting alterations are important since they may help to elucidate putative cancer genes. However, amidst numerous passenger genes, trans-effects are less well studied due to the computational difficulty in detecting weak and sparse signals in the data, and yet may influence multiple genes on a global scale. We propose an integrative approach to learn a sparse interaction network of DNA copy-number regions with their downstream transcriptional targets in breast cancer. With respect to goodness of fit on both simulated and real data, the performance of sparse network inference is no worse than other state-of-the-art models but with the advantage of simultaneous feature selection and efficiency. The DNA-RNA interaction network helps to distinguish copy-number driven expression alterations from those that are copy-number independent. Further, our approach yields a quantitative copy-number dependency score, which distinguishes cis- versus trans-effects. When applied to a breast cancer data set, numerous expression profiles were impacted by cis-acting copy-number alterations, including several known oncogenes such as GRB7, ERBB2, and LSM1. Several trans-acting alterations were also identified, impacting genes such as ADAM2 and BAGE, which warrant further investigation. An R package named lol is available from www.markowetzlab.org/software/lol.html.

  5. Disparate subcellular location of putative sortase substrates in Clostridium difficile.

    Science.gov (United States)

    Peltier, Johann; Shaw, Helen A; Wren, Brendan W; Fairweather, Neil F

    2017-08-23

    Clostridium difficile is a gastrointestinal pathogen but how the bacterium colonises this niche is still little understood. Sortase enzymes covalently attach specific bacterial proteins to the peptidoglycan cell wall and are often involved in colonisation by pathogens. Here we show C. difficile proteins CD2537 and CD3392 are functional substrates of sortase SrtB. Through manipulation of the C-terminal regions of these proteins we show the SPKTG motif is essential for covalent attachment to the cell wall. Two additional putative substrates, CD0183 which contains an SPSTG motif, and CD2768 which contains an SPQTG motif, are not cleaved or anchored to the cell wall by sortase. Finally, using an in vivo asymmetric cleavage assay, we show that despite containing a conserved SPKTG motif, in the absence of SrtB these proteins are localised to disparate cellular compartments.

  6. Putative benefits of microalgal astaxanthin on exercise and human health

    Directory of Open Access Journals (Sweden)

    Marcelo P. Barros

    2011-04-01

    Full Text Available Astaxanthin (ASTA is a pinkish-orange carotenoid produced by microalgae, but also commonly found in shrimp, lobster and salmon, which accumulate ASTA from the aquatic food chain. Numerous studies have addressed the benefits of ASTA for human health, including the inhibition of LDL oxidation, UV-photoprotection and prophylaxis of bacterial stomach ulcers. ASTA is recognized as a powerful scavenger of reactive oxygen species (ROS, especially those involved in lipid peroxidation. Both aerobic and anaerobic exercise are closely related to overproduction of ROS in muscle tissue. Post-exercise inflammatory processes can even exacerbate the oxidative stress imposed by exercise. Thus, ASTA is suggested here as a putative nutritional alternative/coadjutant for antioxidant therapy to afford additional protection to muscle tissues against oxidative damage induced by exercise, as well as for an (overall integrative redox re-balance and general human health.

  7. Hepatology may have problems with putative surrogate outcome measures

    DEFF Research Database (Denmark)

    Gluud, Christian; Brok, Jesper; Gong, Yan

    2007-01-01

    A surrogate outcome measure is a laboratory measurement, a physical sign, or another intermediate substitute that is able to predict an intervention's effect on a clinically meaningful outcome. A clinical outcome detects how a patient feels, functions, or survives. Surrogate outcome measures occur...... faster or more often, are cheaper, and/or are less invasively achieved than the clinical outcome. In practice, validation is surprisingly often overlooked, especially if a biologic plausible rationale is proposed. Surrogate outcomes must be validated before use. The first step in validation...... predicts the intervention's effect on the clinical outcome. In hepatology a number of putative surrogate outcomes are used both in clinical research and in clinical practice without having been properly validated. Sustained virological response to interferons and ribavirin in patients with chronic...

  8. Basal ganglia calcification as a putative cause for cognitive decline

    Directory of Open Access Journals (Sweden)

    João Ricardo Mendes de Oliveira

    Full Text Available ABSTRACT Basal ganglia calcifications (BGC may be present in various medical conditions, such as infections, metabolic, psychiatric and neurological diseases, associated with different etiologies and clinical outcomes, including parkinsonism, psychosis, mood swings and dementia. A literature review was performed highlighting the main neuropsychological findings of BGC, with particular attention to clinical reports of cognitive decline. Neuroimaging studies combined with neuropsychological analysis show that some patients have shown progressive disturbances of selective attention, declarative memory and verbal perseveration. Therefore, the calcification process might represent a putative cause for dementia syndromes, suggesting a probable link among calcinosis, the aging process and eventually with neuronal death. The increasing number of reports available will foster a necessary discussion about cerebral calcinosis and its role in determining symptomatology in dementia patients

  9. Basal ganglia calcification as a putative cause for cognitive decline.

    Science.gov (United States)

    de Oliveira, João Ricardo Mendes; de Oliveira, Matheus Fernandes

    2013-01-01

    Basal ganglia calcifications (BGC) may be present in various medical conditions, such as infections, metabolic, psychiatric and neurological diseases, associated with different etiologies and clinical outcomes, including parkinsonism, psychosis, mood swings and dementia. A literature review was performed highlighting the main neuropsychological findings of BGC, with particular attention to clinical reports of cognitive decline. Neuroimaging studies combined with neuropsychological analysis show that some patients have shown progressive disturbances of selective attention, declarative memory and verbal perseveration. Therefore, the calcification process might represent a putative cause for dementia syndromes, suggesting a probable link among calcinosis, the aging process and eventually with neuronal death. The increasing number of reports available will foster a necessary discussion about cerebral calcinosis and its role in determining symptomatology in dementia patients.

  10. Screening and identification of putative allergens in berry fruits of the Rosaceae family: technical challenges.

    Science.gov (United States)

    Marzban, Gorji; Maghuly, Fatemeh; Herndl, Anita; Katinger, Hermann; Laimer, Margit

    2008-01-01

    Cross-reactive proteins in small fruits of the Rosaceae family like strawberry, raspberry and blackberry revealed an unexpected complex IgE-reactivity pattern. Several copies of PR-10 and PR-14 proteins were detected by Southern blots in strawberry, raspberry and blackberry. In raspberry, the highest similarity at the DNA level for PR-10 and PR-14 (Rub i 1 and Rub i 3) was detected to strawberry sequences of Fra a 1 and Fra a 3. At the protein level, Rub i 1 and Rub i 3 showed more than 70% identity with homologous proteins of rosaceous fruits. Furthermore, raspberries contained additional putative allergens, e.g. class III acidic chitinases and cyclophilins. Blackberries were shown to share at least two well-known major fruit allergens with other rosaceous fruits, namely PR-10s and PR-14s homologous proteins. However the IgE-reactive proteins of small fruits are still not extensively investigated. The main challenges in studying small fruit allergens are the complexity of the fruit matrix, the diversity of physico-chemical properties of fruit proteins, the lack of appropriate protein extraction procedures and the missing information about the influence of processing treatments on food components.

  11. Low Light Availability Alters Root Exudation and Reduces Putative Beneficial Microorganisms in Seagrass Roots

    Directory of Open Access Journals (Sweden)

    Belinda C. Martin

    2018-01-01

    Full Text Available Seagrass roots host a diverse microbiome that is critical for plant growth and health. Composition of microbial communities can be regulated in part by root exudates, but the specifics of these interactions in seagrass rhizospheres are still largely unknown. As light availability controls primary productivity, reduced light may impact root exudation and consequently the composition of the root microbiome. Hence, we analyzed the influence of light availability on root exudation and community structure of the root microbiome of three co-occurring seagrass species, Halophila ovalis, Halodule uninervis and Cymodocea serrulata. Plants were grown under four light treatments in mesocosms for 2 weeks; control (100% surface irradiance (SI, medium (40% SI, low (20% SI and fluctuating light (10 days 20% and 4 days 100%. 16S rDNA amplicon sequencing revealed that microbial diversity, composition and predicted function were strongly influenced by the presence of seagrass roots, such that root microbiomes were unique to each seagrass species. Reduced light availability altered seagrass root exudation, as characterized using fluorescence spectroscopy, and altered the composition of seagrass root microbiomes with a reduction in abundance of potentially beneficial microorganisms. Overall, this study highlights the potential for above-ground light reduction to invoke a cascade of changes from alterations in root exudation to a reduction in putative beneficial microorganisms and, ultimately, confirms the importance of the seagrass root environment – a critical, but often overlooked space.

  12. Cell-free DNA in a three-dimensional spheroid cell culture model

    DEFF Research Database (Denmark)

    Aucamp, Janine; Calitz, Carlemi; Bronkhorst, Abel J.

    2017-01-01

    Background Investigating the biological functions of cell-free DNA (cfDNA) is limited by the interference of vast numbers of putative sources and causes of DNA release into circulation. Utilization of three-dimensional (3D) spheroid cell cultures, models with characteristics closer to the in vivo...... cultures can serve as effective, simplified in vivo-simulating “closed-circuit” models since putative sources of cfDNA are limited to only the targeted cells. In addition, cfDNA can also serve as an alternative or auxiliary marker for tracking spheroid growth, development and culture stability. Biological...... significance 3D cell cultures can be used to translate “closed-circuit” in vitro model research into data that is relevant for in vivo studies and clinical applications. In turn, the utilization of cfDNA during 3D culture research can optimize sample collection without affecting the stability of the growth...

  13. DNA methylation

    DEFF Research Database (Denmark)

    Williams, Kristine; Christensen, Jesper; Helin, Kristian

    2012-01-01

    DNA methylation is involved in key cellular processes, including X-chromosome inactivation, imprinting and transcriptional silencing of specific genes and repetitive elements. DNA methylation patterns are frequently perturbed in human diseases such as imprinting disorders and cancer. The recent...... discovery that the three members of the TET protein family can convert 5-methylcytosine (5mC) into 5-hydroxymethylcytosine (5hmC) has provided a potential mechanism leading to DNA demethylation. Moreover, the demonstration that TET2 is frequently mutated in haematopoietic tumours suggests that the TET...... proteins are important regulators of cellular identity. Here, we review the current knowledge regarding the function of the TET proteins, and discuss various mechanisms by which they contribute to transcriptional control. We propose that the TET proteins have an important role in regulating DNA methylation...

  14. DNA data

    Data.gov (United States)

    National Oceanic and Atmospheric Administration, Department of Commerce — Raw DNA chromatogram data produced by the ABI 373, 377, 3130 and 3730 automated sequencing machines in ABI format. These are from fish (primarily Sebastes spp.,...

  15. DNA nanotechnology

    Science.gov (United States)

    Seeman, Nadrian C.; Sleiman, Hanadi F.

    2018-01-01

    DNA is the molecule that stores and transmits genetic information in biological systems. The field of DNA nanotechnology takes this molecule out of its biological context and uses its information to assemble structural motifs and then to connect them together. This field has had a remarkable impact on nanoscience and nanotechnology, and has been revolutionary in our ability to control molecular self-assembly. In this Review, we summarize the approaches used to assemble DNA nanostructures and examine their emerging applications in areas such as biophysics, diagnostics, nanoparticle and protein assembly, biomolecule structure determination, drug delivery and synthetic biology. The introduction of orthogonal interactions into DNA nanostructures is discussed, and finally, a perspective on the future directions of this field is presented.

  16. DNA expressions - A formal notation for DNA

    NARCIS (Netherlands)

    Vliet, Rudy van

    2015-01-01

    We describe a formal notation for DNA molecules that may contain nicks and gaps. The resulting DNA expressions denote formal DNA molecules. Different DNA expressions may denote the same molecule. Such DNA expressions are called equivalent. We examine which DNA expressions are minimal, which

  17. Sodicity tolerant polyembryonic mango root stock plants: A putative ...

    African Journals Online (AJOL)

    In this study, we isolated 16 bacterial endophytes through natural selection from saline sodic soils, analysed extracellular enzyme activity, performed molecular profiling and phylogenetic analysis based on 16S rDNA sequences. Results indicate that the isolates belonged to four major phylogenetic groups: low G+C Gram ...

  18. Identification and characterization of a gene encoding a putative ...

    Indian Academy of Sciences (India)

    2012-10-30

    Oct 30, 2012 ... 2008). Recent studies have also shown that the conversion of LPA to PA ... organs including root, stem, leaf, flower, gynophore and developing seeds (15 .... First Strand cDNA Synthesis Kit ReverTra Ace–α–(TOYOBO,. Osaka ...

  19. Markerless deletion of putative alanine dehydrogenase genes in Bacillus licheniformis using a codBA-based counterselection technique.

    Science.gov (United States)

    Kostner, David; Rachinger, Michael; Liebl, Wolfgang; Ehrenreich, Armin

    2017-11-01

    Bacillus licheniformis strains are used for the large-scale production of industrial exoenzymes from proteinaceous substrates, but details of the amino acid metabolism involved are largely unknown. In this study, two chromosomal genes putatively involved in amino acid metabolism of B. licheniformis were deleted to clarify their role. For this, a convenient counterselection system for markerless in-frame deletions was developed for B. licheniformis. A deletion plasmid containing up- and downstream DNA segments of the chromosomal deletion target was conjugated to B. licheniformis and integrated into the genome by homologous recombination. Thereafter, the counterselection was done by using a codBA cassette. The presence of cytosine deaminase and cytosine permease exerted a conditionally lethal phenotype on B. licheniformis cells in the presence of the cytosine analogue 5-fluorocytosine. Thereby clones were selected that lost the integrated vector sequence and the anticipated deletion target after a second recombination step. This method allows the construction of markerless mutants in Bacillus strains in iterative cycles. B. licheniformis MW3 derivatives lacking either one of the ORFs BL03009 or BL00190, encoding a putative alanine dehydrogenase and a similar putative enzyme, respectively, retained the ability to grow in minimal medium supplemented with alanine as the carbon source. In the double deletion mutant MW3 ΔBL03009 ΔBL00190, however, growth on alanine was completely abolished. These data indicate that the two encoded enzymes are paralogues fulfilling mutually replaceable functions in alanine utilization, and suggest that in B. licheniformis MW3 alanine utilization is initiated by direct oxidative transamination to pyruvate and ammonium.

  20. Complete genome sequence of two tomato-infecting begomoviruses in Venezuela: evidence of a putative novel species and a novel recombinant strain.

    Science.gov (United States)

    Romay, Gustavo; Chirinos, Dorys T; Geraud-Pouey, Francis; Gillis, Annika; Mahillon, Jacques; Bragard, Claude

    2018-02-01

    At least six begomovirus species have been reported infecting tomato in Venezuela. In this study the complete genomes of two tomato-infecting begomovirus isolates (referred to as Trujillo-427 and Zulia-1084) were cloned and sequenced. Both isolates showed the typical genome organization of New World bipartite begomoviruses, with DNA-A genomic components displaying 88.8% and 90.3% similarity with established begomoviruses, for isolates Trujillo-427 and Zulia-1084, respectively. In accordance to the guidelines for begomovirus species demarcation, the Trujillo-427 isolate represents a putative new species and the name "Tomato wrinkled mosaic virus" is proposed. Meanwhile, Zulia-1084 represents a putative new strain classifiable within species Tomato chlorotic leaf distortion virus, for which a recombinant origin is suggested.

  1. Isolation and characterization of the dnaA gene of Rickettsia prowazekii

    International Nuclear Information System (INIS)

    Waite, R.T.; Shaw, E.I.; Winkler, H.H.; Wood, D.G.

    1998-01-01

    The dnaA gene encoding the initiator protein of DNA replication was isolated from the obligate intracellular bacterium, Rickettsia prowazekii. Comparison of the deduced amino acid sequence of R. prowazekii DnaA with other bacterial DnaA proteins revealed extensive similarity. However, the rickettsial sequence is unique in the number of basic lysine residues found within a highly conserved portion of the putative DNA binding region, suggesting that the rickettsial protein may recognize a DNA sequence that differs from the consensus DnaA box sequence identified in other bacteria. Consensus DnaA box sequences, found upstream of many bacterial dnaA genes, were not identified upstream of rickettsial dnaA gene. In addition, gene organization within this region differed from that of other bacteria. The putative start of transcription of the rickettsial dnaA gene was localized to a site 522 nucleotides upstream of the DnaA start codon. Key words: Rickettsia prowazekii; dnaA gene; initiator protein (authors)

  2. What Is Mitochondrial DNA?

    Science.gov (United States)

    ... DNA What is mitochondrial DNA? What is mitochondrial DNA? Although most DNA is packaged in chromosomes within ... proteins. For more information about mitochondria and mitochondrial DNA: Molecular Expressions, a web site from the Florida ...

  3. Ion Binding to Quadruplex DNA Stems. Comparison of MM and QM Descriptions Reveals Sizable Polarization Effects Not Included in Contemporary Simulations

    Czech Academy of Sciences Publication Activity Database

    Gkionis, K.; Kruse, H.; Platts, J. A.; Mládek, Arnošt; Koča, J.; Šponer, Jiří

    2014-01-01

    Roč. 10, č. 3 (2014), s. 1326-1340 ISSN 1549-9618 R&D Projects: GA ČR(CZ) GAP208/11/1822; GA MŠk(CZ) ED1.1.00/02.0068 Institutional support: RVO:68081707 Keywords : MOLECULAR-DYNAMICS SIMULATIONS * GAUSSIAN-BASIS SETS * TETRAMOLECULAR G-QUADRUPLEXES Subject RIV: BO - Biophysics Impact factor: 5.498, year: 2014

  4. The two putative comS homologs of the biotechnologically important Bacillus licheniformis do not contribute to competence development.

    Science.gov (United States)

    Jakobs, Mareike; Hoffmann, Kerstin; Liesegang, Heiko; Volland, Sonja; Meinhardt, Friedhelm

    2015-03-01

    In Bacillus subtilis, natural genetic competence is subject to complex genetic regulation and quorum sensing dependent. Upon extracellular accumulation of the peptide-pheromone ComX, the membrane-bound sensor histidine kinase ComP initiates diverse signaling pathways by activating-among others-DegQ and ComS. While DegQ favors the expression of extracellular enzymes rather than competence development, ComS is crucial for competence development as it prevents proteolytic degradation of ComK, the key transcriptional activator of all genes required for the uptake and integration of DNA. In Bacillus licheniformis, ComX/ComP sensed cell density negatively influences competence development, suggesting differences from the quorum-sensing-dependent control mechanism in Bacillus subtilis. Here, we show that each of six investigated strains possesses both of two different, recently identified putative comS genes. When expressed from an inducible promoter, none of the comS candidate genes displayed an impact on competence development neither in B. subtilis nor in B. licheniformis. Moreover, disruption of the genes did not reduce transformation efficiency. While the putative comS homologs do not contribute to competence development, we provide evidence that the degQ gene as for B. subtilis negatively influences genetic competency in B. licheniformis.

  5. Functional Characterization of PaLAX1, a Putative Auxin Permease, in Heterologous Plant Systems1[W][OA

    Science.gov (United States)

    Hoyerová, Klára; Perry, Lucie; Hand, Paul; Laňková, Martina; Kocábek, Tomáš; May, Sean; Kottová, Jana; Pačes, Jan; Napier, Richard; Zažímalová, Eva

    2008-01-01

    We have isolated the cDNA of the gene PaLAX1 from a wild cherry tree (Prunus avium). The gene and its product are highly similar in sequences to both the cDNAs and the corresponding protein products of AUX/LAX-type genes, coding for putative auxin influx carriers. We have prepared and characterized transformed Nicotiana tabacum and Arabidopsis thaliana plants carrying the gene PaLAX1. We have proved that constitutive overexpression of PaLAX1 is accompanied by changes in the content and distribution of free indole-3-acetic acid, the major endogenous auxin. The increase in free indole-3-acetic acid content in transgenic plants resulted in various phenotype changes, typical for the auxin-overproducing plants. The uptake of synthetic auxin, 2,4-dichlorophenoxyacetic acid, was 3 times higher in transgenic lines compared to the wild-type lines and the treatment with the auxin uptake inhibitor 1-naphthoxyacetic acid reverted the changes caused by the expression of PaLAX1. Moreover, the agravitropic response could be restored by expression of PaLAX1 in the mutant aux1 plants, which are deficient in auxin influx carrier activity. Based on our data, we have concluded that the product of the gene PaLAX1 promotes the uptake of auxin into cells, and, as a putative auxin influx carrier, it affects the content and distribution of free endogenous auxin in transgenic plants. PMID:18184737

  6. Multilocus sequence data reveal dozens of putative cryptic species in a radiation of endemic Californian mygalomorph spiders (Araneae, Mygalomorphae, Nemesiidae).

    Science.gov (United States)

    Leavitt, Dean H; Starrett, James; Westphal, Michael F; Hedin, Marshal

    2015-10-01

    We use mitochondrial and multi-locus nuclear DNA sequence data to infer both species boundaries and species relationships within California nemesiid spiders. Higher-level phylogenetic data show that the California radiation is monophyletic and distantly related to European members of the genus Brachythele. As such, we consider all California nemesiid taxa to belong to the genus Calisoga Chamberlin, 1937. Rather than find support for one or two taxa as previously hypothesized, genetic data reveal Calisoga to be a species-rich radiation of spiders, including perhaps dozens of species. This conclusion is supported by multiple mitochondrial barcoding analyses, and also independent analyses of nuclear data that reveal general genealogical congruence. We discovered three instances of sympatry, and genetic data indicate reproductive isolation when in sympatry. An examination of female reproductive morphology does not reveal species-specific characters, and observed male morphological differences for a subset of putative species are subtle. Our coalescent species tree analysis of putative species lays the groundwork for future research on the taxonomy and biogeographic history of this remarkable endemic radiation. Copyright © 2015 Elsevier Inc. All rights reserved.

  7. EST mining identifies proteins putatively secreted by the anthracnose pathogen Colletotrichum truncatum

    Directory of Open Access Journals (Sweden)

    Vandenberg Albert

    2011-06-01

    Full Text Available Abstract Background Colletotrichum truncatum is a haploid, hemibiotrophic, ascomycete fungal pathogen that causes anthracnose disease on many economically important leguminous crops. This pathogen exploits sequential biotrophic- and necrotrophic- infection strategies to colonize the host. Transition from biotrophy to a destructive necrotrophic phase called the biotrophy-necrotrophy switch is critical in symptom development. C. truncatum likely secretes an arsenal of proteins that are implicated in maintaining a compatible interaction with its host. Some of them might be transition specific. Results A directional cDNA library was constructed from mRNA isolated from infected Lens culinaris leaflet tissues displaying the biotrophy-necrotrophy switch of C. truncatum and 5000 expressed sequence tags (ESTs with an average read of > 600 bp from the 5-prime end were generated. Nearly 39% of the ESTs were predicted to encode proteins of fungal origin and among these, 162 ESTs were predicted to contain N-terminal signal peptides (SPs in their deduced open reading frames (ORFs. The 162 sequences could be assembled into 122 tentative unigenes comprising 32 contigs and 90 singletons. Sequence analyses of unigenes revealed four potential groups: hydrolases, cell envelope associated proteins (CEAPs, candidate effectors and other proteins. Eleven candidate effector genes were identified based on features common to characterized fungal effectors, i.e. they encode small, soluble (lack of transmembrane domain, cysteine-rich proteins with a putative SP. For a selected subset of CEAPs and candidate effectors, semiquantitative RT-PCR showed that these transcripts were either expressed constitutively in both in vitro and in planta or induced during plant infection. Using potato virus X (PVX based transient expression assays, we showed that one of the candidate effectors, i. e. contig 8 that encodes a cerato-platanin (CP domain containing protein, unlike CP proteins

  8. Genome sequence and comparative analysis of a putative entomopathogenic Serratia isolated from Caenorhabditis briggsae.

    Science.gov (United States)

    Abebe-Akele, Feseha; Tisa, Louis S; Cooper, Vaughn S; Hatcher, Philip J; Abebe, Eyualem; Thomas, W Kelley

    2015-07-18

    Entomopathogenic associations between nematodes in the genera Steinernema and Heterorhabdus with their cognate bacteria from the bacterial genera Xenorhabdus and Photorhabdus, respectively, are extensively studied for their potential as biological control agents against invasive insect species. These two highly coevolved associations were results of convergent evolution. Given the natural abundance of bacteria, nematodes and insects, it is surprising that only these two associations with no intermediate forms are widely studied in the entomopathogenic context. Discovering analogous systems involving novel bacterial and nematode species would shed light on the evolutionary processes involved in the transition from free living organisms to obligatory partners in entomopathogenicity. We report the complete genome sequence of a new member of the enterobacterial genus Serratia that forms a putative entomopathogenic complex with Caenorhabditis briggsae. Analysis of the 5.04 MB chromosomal genome predicts 4599 protein coding genes, seven sets of ribosomal RNA genes, 84 tRNA genes and a 64.8 KB plasmid encoding 74 genes. Comparative genomic analysis with three of the previously sequenced Serratia species, S. marcescens DB11 and S. proteamaculans 568, and Serratia sp. AS12, revealed that these four representatives of the genus share a core set of ~3100 genes and extensive structural conservation. The newly identified species shares a more recent common ancestor with S. marcescens with 99% sequence identity in rDNA sequence and orthology across 85.6% of predicted genes. Of the 39 genes/operons implicated in the virulence, symbiosis, recolonization, immune evasion and bioconversion, 21 (53.8%) were present in Serratia while 33 (84.6%) and 35 (89%) were present in Xenorhabdus and Photorhabdus EPN bacteria respectively. The majority of unique sequences in Serratia sp. SCBI (South African Caenorhabditis briggsae Isolate) are found in ~29 genomic islands of 5 to 65 genes and are

  9. Discovery of Putative Herbicide Resistance Genes and Its Regulatory Network in Chickpea Using Transcriptome Sequencing

    Directory of Open Access Journals (Sweden)

    Mir A. Iquebal

    2017-06-01

    Full Text Available Background: Chickpea (Cicer arietinum L. contributes 75% of total pulse production. Being cheaper than animal protein, makes it important in dietary requirement of developing countries. Weed not only competes with chickpea resulting into drastic yield reduction but also creates problem of harboring fungi, bacterial diseases and insect pests. Chemical approach having new herbicide discovery has constraint of limited lead molecule options, statutory regulations and environmental clearance. Through genetic approach, transgenic herbicide tolerant crop has given successful result but led to serious concern over ecological safety thus non-transgenic approach like marker assisted selection is desirable. Since large variability in tolerance limit of herbicide already exists in chickpea varieties, thus the genes offering herbicide tolerance can be introgressed in variety improvement programme. Transcriptome studies can discover such associated key genes with herbicide tolerance in chickpea.Results: This is first transcriptomic studies of chickpea or even any legume crop using two herbicide susceptible and tolerant genotypes exposed to imidazoline (Imazethapyr. Approximately 90 million paired-end reads generated from four samples were processed and assembled into 30,803 contigs using reference based assembly. We report 6,310 differentially expressed genes (DEGs, of which 3,037 were regulated by 980 miRNAs, 1,528 transcription factors associated with 897 DEGs, 47 Hub proteins, 3,540 putative Simple Sequence Repeat-Functional Domain Marker (SSR-FDM, 13,778 genic Single Nucleotide Polymorphism (SNP putative markers and 1,174 Indels. Randomly selected 20 DEGs were validated using qPCR. Pathway analysis suggested that xenobiotic degradation related gene, glutathione S-transferase (GST were only up-regulated in presence of herbicide. Down-regulation of DNA replication genes and up-regulation of abscisic acid pathway genes were observed. Study further reveals

  10. Protein preparation and preliminary X-ray crystallographic analysis of a putative glucosamine 6-phosphate deaminase from Streptococcus mutants

    Energy Technology Data Exchange (ETDEWEB)

    Hu, Guan-Jing; Li, Lan-Fen; Li, Dan; Liu, Cong [National Laboratory of Protein Engineering and Plant Genetic Engineering, College of Life Sciences, Peking University, Beijing 100871 (China); Wei, Shi-Cheng, E-mail: kqsc-wei@bjmu.edu.cn [Peking University School of Stomatology, Beijing 100081 (China); Liang, Yu-He, E-mail: kqsc-wei@bjmu.edu.cn; Su, Xiao-Dong [National Laboratory of Protein Engineering and Plant Genetic Engineering, College of Life Sciences, Peking University, Beijing 100871 (China)

    2007-09-01

    A glucosamine 6-phosphate deaminase homologue from S. mutans was expressed, purified and crystallized. Diffraction data have been collected to 2.4 Å resolution. The SMU.636 protein from Streptococcus mutans is a putative glucosamine 6-phosphate deaminase with 233 residues. The smu.636 gene was PCR-amplified from S. mutans genomic DNA and cloned into the expression vector pET-28a(+). The resultant His-tagged fusion protein was expressed in Escherichia coli and purified to homogeneity in two steps. Crystals of the fusion protein were obtained by the hanging-drop vapour-diffusion method. The crystals diffracted to 2.4 Å resolution and belong to space group P2{sub 1}2{sub 1}2{sub 1}, with unit-cell parameters a = 53.83, b = 82.13, c = 134.70 Å.

  11. Protein preparation and preliminary X-ray crystallographic analysis of a putative glucosamine 6-phosphate deaminase from Streptococcus mutants

    International Nuclear Information System (INIS)

    Hu, Guan-Jing; Li, Lan-Fen; Li, Dan; Liu, Cong; Wei, Shi-Cheng; Liang, Yu-He; Su, Xiao-Dong

    2007-01-01

    A glucosamine 6-phosphate deaminase homologue from S. mutans was expressed, purified and crystallized. Diffraction data have been collected to 2.4 Å resolution. The SMU.636 protein from Streptococcus mutans is a putative glucosamine 6-phosphate deaminase with 233 residues. The smu.636 gene was PCR-amplified from S. mutans genomic DNA and cloned into the expression vector pET-28a(+). The resultant His-tagged fusion protein was expressed in Escherichia coli and purified to homogeneity in two steps. Crystals of the fusion protein were obtained by the hanging-drop vapour-diffusion method. The crystals diffracted to 2.4 Å resolution and belong to space group P2 1 2 1 2 1 , with unit-cell parameters a = 53.83, b = 82.13, c = 134.70 Å

  12. Frog virus 3 ORF 53R, a putative myristoylated membrane protein, is essential for virus replication in vitro

    International Nuclear Information System (INIS)

    Whitley, Dexter S.; Yu, Kwang; Sample, Robert C.; Sinning, Allan; Henegar, Jeffrey; Norcross, Erin; Chinchar, V. Gregory

    2010-01-01

    Although previous work identified 12 complementation groups with possible roles in virus assembly, currently only one frog virus 3 protein, the major capsid protein (MCP), has been linked with virion formation. To identify other proteins required for assembly, we used an antisense morpholino oligonucleotide to target 53R, a putative myristoylated membrane protein, and showed that treatment resulted in marked reductions in 53R levels and a 60% drop in virus titers. Immunofluorescence assays confirmed knock down and showed that 53R was found primarily within viral assembly sites, whereas transmission electron microscopy detected fewer mature virions and, in some cells, dense granular bodies that may represent unencapsidated DNA-protein complexes. Treatment with a myristoylation inhibitor (2-hydroxymyristic acid) resulted in an 80% reduction in viral titers. Collectively, these data indicate that 53R is an essential viral protein that is required for replication in vitro and suggest it plays a critical role in virion formation.

  13. Rapid Discrimination Among Putative Mechanistic Models of Biochemical Systems.

    Science.gov (United States)

    Lomnitz, Jason G; Savageau, Michael A

    2016-08-31

    An overarching goal in molecular biology is to gain an understanding of the mechanistic basis underlying biochemical systems. Success is critical if we are to predict effectively the outcome of drug treatments and the development of abnormal phenotypes. However, data from most experimental studies is typically noisy and sparse. This allows multiple potential mechanisms to account for experimental observations, and often devising experiments to test each is not feasible. Here, we introduce a novel strategy that discriminates among putative models based on their repertoire of qualitatively distinct phenotypes, without relying on knowledge of specific values for rate constants and binding constants. As an illustration, we apply this strategy to two synthetic gene circuits exhibiting anomalous behaviors. Our results show that the conventional models, based on their well-characterized components, cannot account for the experimental observations. We examine a total of 40 alternative hypotheses and show that only 5 have the potential to reproduce the experimental data, and one can do so with biologically relevant parameter values.

  14. The inducible CAM plants in putative lunar lander experiments

    Science.gov (United States)

    Burlak, Olexii; Zaetz, Iryna; Soldatkin, Olexii; Rogutskyy, Ivan; Danilchenko, Boris; Mikheev, Olexander; de Vera, Jean-Pierre; Vidmachenko, Anatolii; Foing, Bernard H.; Kozyrovska, Natalia

    Precursory lunar lander experiments on growing plants in locker-based chambers will increase our understanding of effect of lunar conditions on plant physiology. The inducible CAM (Cras-sulacean Acid Metabolism)-plants are reasonable model for a study of relationships between environmental challenges and changes in plant/bacteria gene expression. In inducible CAM-plants the enzymatic machinery for the environmentally activated CAM switches on from a C3-to a full-CAM mode of photosynthesis in response to any stresses (Winter et al., 2008). In our study, Kalanchoe spp. are shown to be promising candidates for putative lunar experiments as resistant to irradiation and desiccation, especially after inoculation with a bacterial consortium (Boorlak et al., 2010). Within frames of the experiment we expect to get information about the functional activity of CAM-plants, in particular, its organogenesis, photosystem, the circadian regulation of plant metabolism on the base of data gaining with instrumental indications from expression of the reporter genes fused to any genes involved in vital functions of the plant (Kozyrovska et al., 2009). References 1. Winter K., Garcia M., Holtum J. (2008) J. Exp. Bot. 59(7):1829-1840 2. Bourlak O., Lar O., Rogutskyy I., Mikheev A., Zaets I., Chervatyuk N., de Vera J.-P., Danilchenko A.B. Foing B.H., zyrovska N. (2010) Space Sci. Technol. 3. Kozyrovska N.O., Vidmachenko A.P., Foing B.H. et al. Exploration/call/estec/ESA. 2009.

  15. Formation of putative chloroplast cytochromes in isolated developing pea chloroplasts

    International Nuclear Information System (INIS)

    Thaver, S.S.; Bhava, D.; Castelfranco, P.A.

    1986-01-01

    In addition to chlorophyll-protein complexes, other proteins were labeled when isolated developing pea chloroplasts were incubated with [ 14 C]-5-aminolevulinic acid [ 14 C]-ALA. The major labeled band (M/sub r/ = 43 kDa by LDS-PAGE) was labeled even in the presence of chloramphenicol. Heme-dependent peroxidase activity (as detected by the tetramethyl benzidine-H 2 O 2 stain) was not visibly associated with this band. The radioactive band was stable to heat, 5% HCl in acetone, and was absent if the incubation with [ 14 C]-5-aminolevulinic acid was carried out in the presence of N-methyl protoporphyrin IX dimethyl ester (a specific inhibitor of ferrochelatase). Organic solvent extraction procedures for the enrichment of cytochrome f from chloroplast membranes also extracted this unknown labeled product. It was concluded that this labeled product was probably a c-type cytochrome. The effect of exogenous iron, iron chelators, gabaculine (an inhibitor of ALA synthesis) and other incubation conditions upon the in vitro formation of putative chloroplast cytochromes will be discussed

  16. G quadruplex-based FRET probes with the thrombin-binding aptamer (TBA) sequence designed for the efficient fluorometric detection of the potassium ion.

    Science.gov (United States)

    Nagatoishi, Satoru; Nojima, Takahiko; Galezowska, Elzbieta; Juskowiak, Bernard; Takenaka, Shigeori

    2006-11-01

    The dual-labeled oligonucleotide derivative, FAT-0, carrying 6- carboxyfluorescein (FAM) and 6-carboxytetramethylrhodamine (TAMRA) labels at the 5' and 3' termini of the thrombin-binding aptamer (TBA) sequence 5'-GGT TGG TGT GGT TGG-3', and its derivatives, FAT-n (n=3, 5, and 7) with a spacer at the 5'-end of a TBA sequence of T(m)A (m=2, 4, and 6) have been designed and synthesized. These fluorescent probes were developed for monitoring K(+) concentrations in living organisms. Circular dichroism, UV-visible absorption, and fluorescence studies revealed that all FAT-n probes could form intramolecular tetraplex structures after binding K(+). Fluorescence resonance energy transfer and quenching results are discussed taking into account dye-dye contact interactions. The relationship between the fluorescence behavior of the probes and the spacer length in FAT-n was studied in detail and is discussed.

  17. Selectivity of major isoquinoline alkaloids from Chelidonium majus towards telomeric G-quadruplex: A study using a transition-FRET (t-FRET) assay

    Czech Academy of Sciences Publication Activity Database

    Noureini, S.K.; Esmaeili, H.; Abachi, F.; Khiali, S.; Islam, Barira; Kuta, M.; Saboury, A.A.; Hoffillann, M.; Šponer, Jiří; Parkinson, G.; Haider, S.

    2017-01-01

    Roč. 1861, č. 8 (2017), s. 2020-2030 ISSN 0304-4165 R&D Projects: GA ČR(CZ) GA16-13721S Institutional support: RVO:68081707 Keywords : prostate-cancer cells * amber force-field * nucleic-acids Subject RIV: CE - Biochemistry OBOR OECD: Biochemistry and molecular biology Impact factor: 4.702, year: 2016

  18. Electrochemical and circular dichroism spectroscopic evidence of two types of interaction between [Ru(NH3)(6)](3+) and an elongated thrombin binding aptamer G-quadruplex

    Czech Academy of Sciences Publication Activity Database

    De Rache, A.; Kejnovská, Iva; Buess-Herman, C.; Doneux, T.

    2015-01-01

    Roč. 179, OCT 2015 (2015), s. 84-92 ISSN 0013-4686 Institutional support: RVO:68081707 Keywords : Biosensors * Thrombin binding aptamer * Hexaammineruthenium Subject RIV: BO - Biophysics Impact factor: 4.803, year: 2015

  19. Identification and phylogenetic analysis of Tityus pachyurus and Tityus obscurus novel putative Na+-channel scorpion toxins.

    Directory of Open Access Journals (Sweden)

    Jimmy A Guerrero-Vargas

    Full Text Available Colombia and Brazil are affected by severe cases of scorpionism. In Colombia the most dangerous accidents are caused by Tityus pachyurus that is widely distributed around this country. In the Brazilian Amazonian region scorpion stings are a common event caused by Tityus obscurus. The main objective of this work was to perform the molecular cloning of the putative Na(+-channel scorpion toxins (NaScTxs from T. pachyurus and T. obscurus venom glands and to analyze their phylogenetic relationship with other known NaScTxs from Tityus species.cDNA libraries from venom glands of these two species were constructed and five nucleotide sequences from T. pachyurus were identified as putative modulators of Na(+-channels, and were named Tpa4, Tpa5, Tpa6, Tpa7 and Tpa8; the latter being the first anti-insect excitatory β-class NaScTx in Tityus scorpion venom to be described. Fifteen sequences from T. obscurus were identified as putative NaScTxs, among which three had been previously described, and the others were named To4 to To15. The peptides Tpa4, Tpa5, Tpa6, To6, To7, To9, To10 and To14 are closely related to the α-class NaScTxs, whereas Tpa7, Tpa8, To4, To8, To12 and To15 sequences are more related to the β-class NaScTxs. To5 is possibly an arthropod specific toxin. To11 and To13 share sequence similarities with both α and β NaScTxs. By means of phylogenetic analysis using the Maximum Parsimony method and the known NaScTxs from Tityus species, these toxins were clustered into 14 distinct groups.This communication describes new putative NaScTxs from T. pachyurus and T. obscurus and their phylogenetic analysis. The results indicate clear geographic separation between scorpions of Tityus genus inhabiting the Amazonian and Mountain Andes regions and those distributed over the Southern of the Amazonian rainforest. Based on the consensus sequences for the different clusters, a new nomenclature for the NaScTxs is proposed.

  20. Differential expression analysis of genic male sterility by cDNA-AFLP in maize

    International Nuclear Information System (INIS)

    Zhang Linbi; Rong Tingzhao; Pan Guangtang; Cao Moju

    2009-01-01

    The differential expression of male sterility induced by space flight with male fertility was studied using cDNA-AFLP technology. Total RNA was isolated from anther of male sterility and male fertility. Nine differential expression cDNA fragments were obtained with 16 primer combinations. The differential cDNA fragments were eluted, cloned and sequenced. Then half-quantitative RT-PCR was used to stuy the differential expressions of 4 development stages between sterility and fertility. Sequencing analysis shown 2 fragments from male sterility might be novel genes. Four fragments from male fertility were homology as chalcone and stilbene synthases, putative acyl CoA dehydrogenase, putative protein kinases and putative glycine decarboxylase. All these proteins might participate in the energy metabolisms, substance metabolisms or signal pollen development, Z8 took on increasing expression during the middle period of pollen development. These results just met the demand of more energy and more substance during the pollen development. (authors)

  1. DNA Vaccines

    Indian Academy of Sciences (India)

    diseases. Keywords. DNA vaccine, immune response, antibodies, infectious diseases. GENERAL .... tein vaccines require expensive virus/protein purification tech- niques as ... sphere continue to remain major health hazards in developing nations. ... significance since it can be produced at a very low cost and can be stored ...

  2. DNA Investigations.

    Science.gov (United States)

    Mayo, Ellen S.; Bertino, Anthony J.

    1991-01-01

    Presents a simulation activity that allow students to work through the exercise of DNA profiling and to grapple with some analytical and ethical questions involving a couple arranging with a surrogate mother to have a baby. Can be used to teach the principles of restriction enzyme digestion, gel electrophoresis, and probe hybridization. (MDH)

  3. Putative Risk Factors in Developmental Dyslexia: A Case-Control Study of Italian Children

    Science.gov (United States)

    Mascheretti, Sara; Marino, Cecilia; Simone, Daniela; Quadrelli, Ermanno; Riva, Valentina; Cellino, Maria Rosaria; Maziade, Michel; Brombin, Chiara; Battaglia, Marco

    2015-01-01

    Although dyslexia runs in families, several putative risk factors that cannot be immediately identified as genetic predict reading disability. Published studies analyzed one or a few risk factors at a time, with relatively inconsistent results. To assess the contribution of several putative risk factors to the development of dyslexia, we conducted…

  4. A novel begomovirus isolated from sida contains putative cis- and trans-acting replication specificity determinants that have evolved independently in several geographical lineages.

    Science.gov (United States)

    Mauricio-Castillo, J A; Torres-Herrera, S I; Cárdenas-Conejo, Y; Pastor-Palacios, G; Méndez-Lozano, J; Argüello-Astorga, G R

    2014-09-01

    A novel begomovirus isolated from a Sida rhombifolia plant collected in Sinaloa, Mexico, was characterized. The genomic components of sida mosaic Sinaloa virus (SiMSinV) shared highest sequence identity with DNA-A and DNA-B components of chino del tomate virus (CdTV), suggesting a vertical evolutionary relationship between these viruses. However, recombination analysis indicated that a short segment of SiMSinV DNA-A encompassing the plus-strand replication origin and the 5´-proximal 43 codons of the Rep gene was derived from tomato mottle Taino virus (ToMoTV). Accordingly, the putative cis- and trans-acting replication specificity determinants of SiMSinV were identical to those of ToMoTV but differed from those of CdTV. Modeling of the SiMSinV and CdTV Rep proteins revealed significant differences in the region comprising the small β1/β5 sheet element, where five putative DNA-binding specificity determinants (SPDs) of Rep (i.e., amino acid residues 5, 8, 10, 69 and 71) were previously identified. Computer-assisted searches of public databases led to identification of 33 begomoviruses from three continents encoding proteins with SPDs identical to those of the Rep encoded by SiMSinV. Sequence analysis of the replication origins demonstrated that all 33 begomoviruses harbor potential Rep-binding sites identical to those of SiMSinV. These data support the hypothesis that the Rep β1/β5 sheet region determines specificity of this protein for DNA replication origin sequences.

  5. Construction of a gene bank and use of the chromosome walking technique for the detection of new putative agrocin genes in Agrobacterium tumefaciens strain D286

    International Nuclear Information System (INIS)

    Herrera, G.

    1987-02-01

    A gene bank of Agrobacterium tumefaciens D286 wt has been constructed by cloning D286 wt DNA partially digested with EcoRI in the cosmid vector pLAFRI. The library; composed of 1750 members with a 27.7 kb average insert size was probed with pCDTn5-3, a cosmid vector carrying a D286:: Tn5 insert from the strain D286:: Tn5 Ag-. One recombinant cosmid of the library, pCDO932, was detected. The insert DNA of pCDO932 has sequences homologous to the D286:: Tn5 insert of pCDTn5-3, therefore it carries putative wt agrocin D286 genes. The insert DNA of pCDO932 was isolated and used to probe the D286 wt gene library. Chromosome walking resulted in the detection of pCD2375. EcoRI restriction digestions and DNA homology studies of pCDO932 and pCD2375 showed that their D286 wt inserts are both composed of 4 EcoRI DNA sub-fragments totalling 21.8 and 24.8 kb respectively, with an overlapping sequence extending 3.5 kb. In order to overcome the failure to detect A. tumefaciens cells transformed with pCDO932. Vectors pSUP204-1 was constructed. Such vector has been derived from pSUP204 which were slightly altered by cloning into it a 700 bp λ DNA SalI fragmet. This resulted in insertion inactivation of the Tc r gene, allows the use of pSUP204-1 as a subcloning vector in conjugations and transformations involving pCDO932 or pCD2375 and strains D286:: Tn5 Ag- and C58 C1G. Two recombinant cosmids bearing D286 wt DNA inserts, at least one of which (pCDO932) contains DNA sequences putatively affecting agrocin D286 production, are now available for further genetic manipulations. pSUP204-1 should prove useful as a subcloning vector for transformations and conjugations involving recombinant cosmids from the D286 wt gene bank and Agrobacterium strains. Future work on the molecular biology of agrocin D286 production is discussed. The DNA probe used in this study was labelled with phosphorus 32

  6. A Functional Assay for Putative Mouse and Human Definitive Endoderm using Chick Whole-Embryo Cultures

    DEFF Research Database (Denmark)

    Johannesson, Martina; Semb, Tor Henrik; Serup, Palle

    2012-01-01

    . Thus, the purpose of this study is to describe a method whereby the in vivo functionality of DE derived from ESCs can be assessed. Methods: By directed differentiation, putative DE was derived from human and mouse ESCs. This putative DE was subsequently transplanted into the endoderm of chick embryos...... to determine any occurrence of integration. Putative DE was analyzed by gene and protein expression prior to transplantation and 48 h post transplantation. Results: Putative DE, derived from mouse and human ESCs, was successfully integrated within the chick endoderm. Endoderm-specific genes were expressed...... result show that putative DE integrates with the chick endoderm and participate in the development of the chicken gut, indicating the generation of functional DE from ESCs. This functional assay can be used to assess the generation of functional DE derived from both human and mouse ESCs and provides...

  7. Identification of putative cis-regulatory elements in Cryptosporidium parvum by de novo pattern finding

    Directory of Open Access Journals (Sweden)

    Kissinger Jessica C

    2007-01-01

    Full Text Available Abstract Background Cryptosporidium parvum is a unicellular eukaryote in the phylum Apicomplexa. It is an obligate intracellular parasite that causes diarrhea and is a significant AIDS-related pathogen. Cryptosporidium parvum is not amenable to long-term laboratory cultivation or classical molecular genetic analysis. The parasite exhibits a complex life cycle, a broad host range, and fundamental mechanisms of gene regulation remain unknown. We have used data from the recently sequenced genome of this organism to uncover clues about gene regulation in C. parvum. We have applied two pattern finding algorithms MEME and AlignACE to identify conserved, over-represented motifs in the 5' upstream regions of genes in C. parvum. To support our findings, we have established comparative real-time -PCR expression profiles for the groups of genes examined computationally. Results We find that groups of genes that share a function or belong to a common pathway share upstream motifs. Different motifs are conserved upstream of different groups of genes. Comparative real-time PCR studies show co-expression of genes within each group (in sub-sets during the life cycle of the parasite, suggesting co-regulation of these genes may be driven by the use of conserved upstream motifs. Conclusion This is one of the first attempts to characterize cis-regulatory elements in the absence of any previously characterized elements and with very limited expression data (seven genes only. Using de novo pattern finding algorithms, we have identified specific DNA motifs that are conserved upstream of genes belonging to the same metabolic pathway or gene family. We have demonstrated the co-expression of these genes (often in subsets using comparative real-time-PCR experiments thus establishing evidence for these conserved motifs as putative cis-regulatory elements. Given the lack of prior information concerning expression patterns and organization of promoters in C. parvum we

  8. Autoradiographic localization of putative nicotinic receptors in the rat brain using 125I-neuronal bungarotoxin

    International Nuclear Information System (INIS)

    Schulz, D.W.; Loring, R.H.; Aizenman, E.; Zigmond, R.E.

    1991-01-01

    Neuronal bungarotoxin (NBT), a snake venom neurotoxin, selectively blocks nicotinic receptors in many peripheral and central neuronal preparations. alpha-Bungarotoxin (alpha BT), on the other hand, a second toxin isolated from the venom of the same snake, is an ineffective nicotinic antagonist in most vertebrate neuronal preparations studied thus far. To examine central nicotinic receptors recognized by NBT, we have characterized the binding of 125I-labeled NBT (125I-NBT) to rat brain membranes and have mapped the distribution of 125I-NBT binding in brain sections using quantitative light microscopic autoradiography. The binding of 125I-NBT was found to be saturable, of high affinity, and heterogeneously distributed in the brain. Pharmacological studies suggested that more than one population of sites is labeled by 125I-NBT. For example, one component of 125I-NBT binding was also recognized by alpha BT, while a second component, not recognized by alpha BT, was recognized by the nicotinic agonist nicotine. The highest densities of these alpha BT-insensitive, nicotine-sensitive sites were found in the fasciculus retroflexus, the lateral geniculate nucleus, the medial terminal nucleus of the accessory optic tract, and the olivary pretectal nucleus. alpha BT-sensitive NBT binding sites were found in highest density in the lateral geniculate nucleus, the subthalamic nucleus, the dorsal tegmental nucleus, and the medial mammillary nucleus (lateral part). The number of brain regions with a high density of 125I-NBT binding sites, blocked either by alpha BT or by nicotine, is low when compared with results obtained using other approaches to studying the central distribution of nicotinic receptors, such as labeling with 3H-nicotine or labeling with cDNA probes to mRNAs coding for putative receptor subunits

  9. Drosophila larvae synthesize the putative oncometabolite L-2-hydroxyglutarate during normal developmental growth.

    Science.gov (United States)

    Li, Hongde; Chawla, Geetanjali; Hurlburt, Alexander J; Sterrett, Maria C; Zaslaver, Olga; Cox, James; Karty, Jonathan A; Rosebrock, Adam P; Caudy, Amy A; Tennessen, Jason M

    2017-02-07

    L-2-hydroxyglutarate (L-2HG) has emerged as a putative oncometabolite that is capable of inhibiting enzymes involved in metabolism, chromatin modification, and cell differentiation. However, despite the ability of L-2HG to interfere with a broad range of cellular processes, this molecule is often characterized as a metabolic waste product. Here, we demonstrate that Drosophila larvae use the metabolic conditions established by aerobic glycolysis to both synthesize and accumulate high concentrations of L-2HG during normal developmental growth. A majority of the larval L-2HG pool is derived from glucose and dependent on the Drosophila estrogen-related receptor (dERR), which promotes L-2HG synthesis by up-regulating expression of the Drosophila homolog of lactate dehydrogenase (dLdh). We also show that dLDH is both necessary and sufficient for directly synthesizing L-2HG and the Drosophila homolog of L-2-hydroxyglutarate dehydrogenase (dL2HGDH), which encodes the enzyme that breaks down L-2HG, is required for stage-specific degradation of the L-2HG pool. In addition, dLDH also indirectly promotes L-2HG accumulation via synthesis of lactate, which activates a metabolic feed-forward mechanism that inhibits dL2HGDH activity and stabilizes L-2HG levels. Finally, we use a genetic approach to demonstrate that dLDH and L-2HG influence position effect variegation and DNA methylation, suggesting that this compound serves to coordinate glycolytic flux with epigenetic modifications. Overall, our studies demonstrate that growing animal tissues synthesize L-2HG in a controlled manner, reveal a mechanism that coordinates glucose catabolism with L-2HG synthesis, and establish the fly as a unique model system for studying the endogenous functions of L-2HG during cell growth and proliferation.

  10. ESTs analysis reveals putative genes involved in symbiotic seed germination in Dendrobium officinale.

    Science.gov (United States)

    Zhao, Ming-Ming; Zhang, Gang; Zhang, Da-Wei; Hsiao, Yu-Yun; Guo, Shun-Xing

    2013-01-01

    Dendrobiumofficinale (Orchidaceae) is one of the world's most endangered plants with great medicinal value. In nature, D. officinale seeds must establish symbiotic relationships with fungi to germinate. However, the molecular events involved in the interaction between fungus and plant during this process are poorly understood. To isolate the genes involved in symbiotic germination, a suppression subtractive hybridization (SSH) cDNA library of symbiotically germinated D. officinale seeds was constructed. From this library, 1437 expressed sequence tags (ESTs) were clustered to 1074 Unigenes (including 902 singletons and 172 contigs), which were searched against the NCBI non-redundant (NR) protein database (E-value cutoff, e(-5)). Based on sequence similarity with known proteins, 579 differentially expressed genes in D. officinale were identified and classified into different functional categories by Gene Ontology (GO), Clusters of orthologous Groups of proteins (COGs) and Kyoto Encyclopedia of Genes and Genomes (KEGG) pathways. The expression levels of 15 selected genes emblematic of symbiotic germination were confirmed via real-time quantitative PCR. These genes were classified into various categories, including defense and stress response, metabolism, transcriptional regulation, transport process and signal transduction pathways. All transcripts were upregulated in the symbiotically germinated seeds (SGS). The functions of these genes in symbiotic germination were predicted. Furthermore, two fungus-induced calcium-dependent protein kinases (CDPKs), which were upregulated 6.76- and 26.69-fold in SGS compared with un-germinated seeds (UGS), were cloned from D. officinale and characterized for the first time. This study provides the first global overview of genes putatively involved in D. officinale symbiotic seed germination and provides a foundation for further functional research regarding symbiotic relationships in orchids.

  11. Drosophila larvae synthesize the putative oncometabolite L-2-hydroxyglutarate during normal developmental growth

    Science.gov (United States)

    Li, Hongde; Chawla, Geetanjali; Hurlburt, Alexander J.; Sterrett, Maria C.; Zaslaver, Olga; Cox, James; Karty, Jonathan A.; Rosebrock, Adam P.; Caudy, Amy A.

    2017-01-01

    L-2-hydroxyglutarate (L-2HG) has emerged as a putative oncometabolite that is capable of inhibiting enzymes involved in metabolism, chromatin modification, and cell differentiation. However, despite the ability of L-2HG to interfere with a broad range of cellular processes, this molecule is often characterized as a metabolic waste product. Here, we demonstrate that Drosophila larvae use the metabolic conditions established by aerobic glycolysis to both synthesize and accumulate high concentrations of L-2HG during normal developmental growth. A majority of the larval L-2HG pool is derived from glucose and dependent on the Drosophila estrogen-related receptor (dERR), which promotes L-2HG synthesis by up-regulating expression of the Drosophila homolog of lactate dehydrogenase (dLdh). We also show that dLDH is both necessary and sufficient for directly synthesizing L-2HG and the Drosophila homolog of L-2-hydroxyglutarate dehydrogenase (dL2HGDH), which encodes the enzyme that breaks down L-2HG, is required for stage-specific degradation of the L-2HG pool. In addition, dLDH also indirectly promotes L-2HG accumulation via synthesis of lactate, which activates a metabolic feed-forward mechanism that inhibits dL2HGDH activity and stabilizes L-2HG levels. Finally, we use a genetic approach to demonstrate that dLDH and L-2HG influence position effect variegation and DNA methylation, suggesting that this compound serves to coordinate glycolytic flux with epigenetic modifications. Overall, our studies demonstrate that growing animal tissues synthesize L-2HG in a controlled manner, reveal a mechanism that coordinates glucose catabolism with L-2HG synthesis, and establish the fly as a unique model system for studying the endogenous functions of L-2HG during cell growth and proliferation. PMID:28115720

  12. ESTs Analysis Reveals Putative Genes Involved in Symbiotic Seed Germination in Dendrobium officinale

    Science.gov (United States)

    Zhao, Ming-Ming; Zhang, Gang; Zhang, Da-Wei; Hsiao, Yu-Yun; Guo, Shun-Xing

    2013-01-01

    Dendrobium officinale (Orchidaceae) is one of the world’s most endangered plants with great medicinal value. In nature, D . officinale seeds must establish symbiotic relationships with fungi to germinate. However, the molecular events involved in the interaction between fungus and plant during this process are poorly understood. To isolate the genes involved in symbiotic germination, a suppression subtractive hybridization (SSH) cDNA library of symbiotically germinated D . officinale seeds was constructed. From this library, 1437 expressed sequence tags (ESTs) were clustered to 1074 Unigenes (including 902 singletons and 172 contigs), which were searched against the NCBI non-redundant (NR) protein database (E-value cutoff, e-5). Based on sequence similarity with known proteins, 579 differentially expressed genes in D . officinale were identified and classified into different functional categories by Gene Ontology (GO), Clusters of orthologous Groups of proteins (COGs) and Kyoto Encyclopedia of Genes and Genomes (KEGG) pathways. The expression levels of 15 selected genes emblematic of symbiotic germination were confirmed via real-time quantitative PCR. These genes were classified into various categories, including defense and stress response, metabolism, transcriptional regulation, transport process and signal transduction pathways. All transcripts were upregulated in the symbiotically germinated seeds (SGS). The functions of these genes in symbiotic germination were predicted. Furthermore, two fungus-induced calcium-dependent protein kinases (CDPKs), which were upregulated 6.76- and 26.69-fold in SGS compared with un-germinated seeds (UGS), were cloned from D . officinale and characterized for the first time. This study provides the first global overview of genes putatively involved in D . officinale symbiotic seed germination and provides a foundation for further functional research regarding symbiotic relationships in orchids. PMID:23967335

  13. ESTs analysis reveals putative genes involved in symbiotic seed germination in Dendrobium officinale.

    Directory of Open Access Journals (Sweden)

    Ming-Ming Zhao

    Full Text Available Dendrobiumofficinale (Orchidaceae is one of the world's most endangered plants with great medicinal value. In nature, D. officinale seeds must establish symbiotic relationships with fungi to germinate. However, the molecular events involved in the interaction between fungus and plant during this process are poorly understood. To isolate the genes involved in symbiotic germination, a suppression subtractive hybridization (SSH cDNA library of symbiotically germinated D. officinale seeds was constructed. From this library, 1437 expressed sequence tags (ESTs were clustered to 1074 Unigenes (including 902 singletons and 172 contigs, which were searched against the NCBI non-redundant (NR protein database (E-value cutoff, e(-5. Based on sequence similarity with known proteins, 579 differentially expressed genes in D. officinale were identified and classified into different functional categories by Gene Ontology (GO, Clusters of orthologous Groups of proteins (COGs and Kyoto Encyclopedia of Genes and Genomes (KEGG pathways. The expression levels of 15 selected genes emblematic of symbiotic germination were confirmed via real-time quantitative PCR. These genes were classified into various categories, including defense and stress response, metabolism, transcriptional regulation, transport process and signal transduction pathways. All transcripts were upregulated in the symbiotically germinated seeds (SGS. The functions of these genes in symbiotic germination were predicted. Furthermore, two fungus-induced calcium-dependent protein kinases (CDPKs, which were upregulated 6.76- and 26.69-fold in SGS compared with un-germinated seeds (UGS, were cloned from D. officinale and characterized for the first time. This study provides the first global overview of genes putatively involved in D. officinale symbiotic seed germination and provides a foundation for further functional research regarding symbiotic relationships in orchids.

  14. Atomistic Molecular Dynamics Simulations of Mitochondrial DNA Polymerase γ

    DEFF Research Database (Denmark)

    Euro, Liliya; Haapanen, Outi; Róg, Tomasz

    2017-01-01

    of replisomal interactions, and functional effects of patient mutations that do not affect direct catalysis have remained elusive. Here we report the first atomistic classical molecular dynamics simulations of the human Pol γ replicative complex. Our simulation data show that DNA binding triggers remarkable......DNA polymerase γ (Pol γ) is a key component of the mitochondrial DNA replisome and an important cause of neurological diseases. Despite the availability of its crystal structures, the molecular mechanism of DNA replication, the switch between polymerase and exonuclease activities, the site...... changes in the enzyme structure, including (1) completion of the DNA-binding channel via a dynamic subdomain, which in the apo form blocks the catalytic site, (2) stabilization of the structure through the distal accessory β-subunit, and (3) formation of a putative transient replisome-binding platform...

  15. Presence of a consensus DNA motif at nearby DNA sequence of the mutation susceptible CG nucleotides.

    Science.gov (United States)

    Chowdhury, Kaushik; Kumar, Suresh; Sharma, Tanu; Sharma, Ankit; Bhagat, Meenakshi; Kamai, Asangla; Ford, Bridget M; Asthana, Shailendra; Mandal, Chandi C

    2018-01-10

    Complexity in tissues affected by cancer arises from somatic mutations and epigenetic modifications in the genome. The mutation susceptible hotspots present within the genome indicate a non-random nature and/or a position specific selection of mutation. An association exists between the occurrence of mutations and epigenetic DNA methylation. This study is primarily aimed at determining mutation status, and identifying a signature for predicting mutation prone zones of tumor suppressor (TS) genes. Nearby sequences from the top five positions having a higher mutation frequency in each gene of 42 TS genes were selected from a cosmic database and were considered as mutation prone zones. The conserved motifs present in the mutation prone DNA fragments were identified. Molecular docking studies were done to determine putative interactions between the identified conserved motifs and enzyme methyltransferase DNMT1. Collective analysis of 42 TS genes found GC as the most commonly replaced and AT as the most commonly formed residues after mutation. Analysis of the top 5 mutated positions of each gene (210 DNA segments for 42 TS genes) identified that CG nucleotides of the amino acid codons (e.g., Arginine) are most susceptible to mutation, and found a consensus DNA "T/AGC/GAGGA/TG" sequence present in these mutation prone DNA segments. Similar to TS genes, analysis of 54 oncogenes not only found CG nucleotides of the amino acid Arg as the most susceptible to mutation, but also identified the presence of similar consensus DNA motifs in the mutation prone DNA fragments (270 DNA segments for 54 oncogenes) of oncogenes. Docking studies depicted that, upon binding of DNMT1 methylates to this consensus DNA motif (C residues of CpG islands), mutation was likely to occur. Thus, this study proposes that DNMT1 mediated methylation in chromosomal DNA may decrease if a foreign DNA segment containing this consensus sequence along with CG nucleotides is exogenously introduced to dividing

  16. DNA repair

    International Nuclear Information System (INIS)

    Setlow, R.

    1978-01-01

    Some topics discussed are as follows: difficulty in extrapolating data from E. coli to mammalian systems; mutations caused by UV-induced changes in DNA; mutants deficient in excision repair; other postreplication mechanisms; kinds of excision repair systems; detection of repair by biochemical or biophysical means; human mutants deficient in repair; mutagenic effects of UV on XP cells; and detection of UV-repair defects among XP individuals

  17. Putative cryomagma interaction with aerosols deposit at Titan's surface

    Science.gov (United States)

    Coll, Patrice; Navarro-Gonzalez, Rafael; Raulin, Francois; Coscia, David; Ramirez, Sandra I.; Buch, Arnaud; Szopa, Cyril; Poch, Olivier; Cabane, Michel; Brassé, Coralie

    The largest moon of Saturn, Titan, is known for its dense, nitrogen-rich atmosphere. The organic aerosols which are produced in Titan’s atmosphere are of great astrobiological interest, particularly because of their potential evolution when they reach the surface and may interact with putative ammonia-water cryomagma [1]. In this context we have followed the evolution of alkaline pH hydrolysis (25wt% ammonia-water) of Titan aerosol analogues, that have been qualified as representative of Titan’s aerosols [2]. Indeed the first results obtained by the ACP experiment onboard Huygens probe revealed that the main products obtained after thermolysis of Titan’s collected aerosols, were ammonia (NH3) and hydrogen cyanide (HCN). Then performing a direct comparison of the volatiles produced after a thermal treatment done in conditions similar to the ones used by the ACP experiment, we may estimate that the tholins we used are relevant to chemical analogues of Titan’s aerosols, and to note free of oxygen. Taking into account recent studies proposing that the subsurface ocean may contain a lower fraction of ammonia (about 5wt% or less [3]), and assuming the presence of specific gas species [4, 5], in particular CO2 and H2S, trapped in likely internal ocean, we determine a new probable composition of the cryomagma which could potentially interact with deposited Titan’s aerosols. We then carried out different hydrolyses, taking into account this composition, and we established the influence of the hydrolysis temperature on the organic molecules production. References: [1] Mitri et al., 2008. Resurfacing of Titan by ammonia-water cryomagma. Icarus. 196, 216-224. [2] Coll et al. 2013, Can laboratory tholins mimic the chemistry producing Titan's aerosols? A review in light of ACP experimental results, Planetary and Space Science 77, 91-103. [3] Tobie et al. 2012. Titan’s Bulk Composition Constrained by Cassini-Huygens: implication for internal outgassing. The

  18. The mimivirus R355 gene product: preliminary crystallographic analysis of a putative ubiquitin-like protein-specific protease

    International Nuclear Information System (INIS)

    Jeudy, Sandra; Lartigue, Audrey; Mansuelle, Pascal; Ogata, Yuki; Abergel, Chantal

    2010-01-01

    The genome sequence of mimivirus, the largest known double-stranded DNA virus, encodes a putative protease: the R355 gene product. Its expression in E. coli, its crystallization and the preliminary phasing of a MAD data set using the selenium signal present in a crystal of recombinant selenomethionine-substituted protein are reported. The complete genome sequence of the largest known double-stranded DNA virus, mimivirus, reveals the presence of a gene (denoted R355) that potentially encodes a cysteine protease that is expressed late (after 6 h) in the infectious cycle of the virus. In order to verify a sequence-based functional prediction and understand its role during the infectious process, the R355 protein was produced to assay its proteolytic activity and solve its three-dimensional structure. Here, the preliminary crystallographic analysis of the recombinant viral protein is reported. The crystals belonged to the orthorhombic space group P2 1 2 1 2 1 , with a monomer in the asymmetric unit. A MAD data set was used for preliminary phasing using the selenium signal from a selenomethionine-substituted protein crystal

  19. An S/T-Q cluster domain census unveils new putative targets under Tel1/Mec1 control

    Directory of Open Access Journals (Sweden)

    Cheung Hannah C

    2012-11-01

    Full Text Available Abstract Background The cellular response to DNA damage is immediate and highly coordinated in order to maintain genome integrity and proper cell division. During the DNA damage response (DDR, the sensor kinases Tel1 and Mec1 in Saccharomyces cerevisiae and ATM and ATR in human, phosphorylate multiple mediators which activate effector proteins to initiate cell cycle checkpoints and DNA repair. A subset of kinase substrates are recognized by the S/T-Q cluster domain (SCD, which contains motifs of serine (S or threonine (T followed by a glutamine (Q. However, the full repertoire of proteins and pathways controlled by Tel1 and Mec1 is unknown. Results To identify all putative SCD-containing proteins, we analyzed the distribution of S/T-Q motifs within verified Tel1/Mec1 targets and arrived at a unifying SCD definition of at least 3 S/T-Q within a stretch of 50 residues. This new SCD definition was used in a custom bioinformatics pipeline to generate a census of SCD-containing proteins in both yeast and human. In yeast, 436 proteins were identified, a significantly larger number of hits than were expected by chance. These SCD-containing proteins did not distribute equally across GO-ontology terms, but were significantly enriched for those involved in processes related to the DDR. We also found a significant enrichment of proteins involved in telophase and cytokinesis, protein transport and endocytosis suggesting possible novel Tel1/Mec1 targets in these pathways. In the human proteome, a wide range of similar proteins were identified, including homologs of some SCD-containing proteins found in yeast. This list also included high concentrations of proteins in the Mediator, spindle pole body/centrosome and actin cytoskeleton complexes. Conclusions Using a bioinformatic approach, we have generated a census of SCD-containing proteins that are involved not only in known DDR pathways but several other pathways under Tel1/Mec1 control suggesting new

  20. Brcal: A Review of Structure and Putative Functions

    Directory of Open Access Journals (Sweden)

    James W.E. Paterson

    1998-01-01

    Full Text Available BRCA1 is a complex gene implicated in familial breast and ovarian cancer. Although it is almost certainly a tumour suppressor, it is also essential for the normal growth and development of embryonic cells. BRCA1 is probably involved in DNA damage and repair, in cell cycle regulation, and in differentiation of celis. It remains to be established whether all these functions are subserved by single mechanism or pathway. Since the cloning of BRCA1 in 1994, much has been learned about the function of the gene. However, a great deal more still has to be uncovered. The size of the protein coded by the BRCA1 gene and the variety of transcripts argues for a complexity of function and regulation that will provide intellectual and technical challenges for years to come.

  1. Complete cDNA sequence of the preproform of human pregnancy-associated plasma protein-A. Evidence for expression in the brain and induction by cAMP

    DEFF Research Database (Denmark)

    Haaning, Jesper; Oxvig, Claus; Overgaard, Michael Toft

    1996-01-01

    A cDNA that encodes the prepropeptide of pregnancy-associated plasma protein-A (preproPAPP-A), a putative metalloproteinase, has been cloned and sequenced. PAPP-A is synthesized in the placenta as a 1627-residue precursor preproprotein with a putative 22-residue signal peptide and a highly basic...

  2. DNA-mediated gene transfer into human diploid fibroblasts derived from normal and ataxia-telangiectasia donors: parameters for DNA transfer and properties of DNA transformants

    International Nuclear Information System (INIS)

    Debenham, P.G.; Webb, M.B.T.; Masson, W.K.; Cox, R.

    1984-01-01

    An investigation was made of the feasibility of DNA-mediated gene transfer into human diploid fibroblasts derived from patients with the radiation sensitive syndrome ataxia-telangiectasia (A-T) and from a normal donor. Although they are markedly different in their growth characteristics, both normal and A-T strains give similar frequencies for DNA transfer in a model system using the recombinant plasmid pSV2-gpt. pSV2-gpt DNA transformants arise with a frequency between 10 -5 and 10 -4 per viable cell. Analysis of such transformants, although possible, is severely handicapped by the limited clonal life span of diploid human cells. Despite these problems it may be concluded that diploid human fibroblasts are competent recipients for DNA-mediated gene transfer and the putative repair deficiency of A-T does not markedly effect the efficiency of this process. (author)

  3. DNA repair

    International Nuclear Information System (INIS)

    Van Zeeland, A.A.

    1984-01-01

    In this chapter a series of DNA repair pathways are discussed which are available to the cell to cope with the problem of DNA damaged by chemical or physical agents. In the case of microorganisms our knowledge about the precise mechanism of each DNA repair pathway and the regulation of it has been improved considerably when mutants deficient in these repair mechanisms became available. In the case of mammalian cells in culture, until recently there were very little repair deficient mutants available, because in almost all mammalian cells in culture at least the diploid number of chromosomes is present. Therefore the frequency of repair deficient mutants in such populations is very low. Nevertheless because replica plating techniques are improving some mutants from Chinese hamsters ovary cells and L5178Y mouse lymphoma cells are now available. In the case of human cells, cultures obtained from patients with certain genetic diseases are available. A number of cells appear to be sensitive to some chemical or physical mutagens. These include cells from patients suffering from xeroderma pigmentosum, Ataxia telangiectasia, Fanconi's anemia, Cockayne's syndrome. However, only in the case of xeroderma pigmentosum cells, has the sensitivity to ultraviolet light been clearly correlated with a deficiency in excision repair of pyrimidine dimers. Furthermore the work with strains obtained from biopsies from man is difficult because these cells generally have low cloning efficiencies and also have a limited lifespan in vitro. It is therefore very important that more repair deficient mutants will become available from established cell lines from human or animal origin

  4. Chromosomal locations of three human nuclear genes (RPSM12, TUFM, and AFG3L1) specifying putative components of the mitochondrial gene expression apparatus.

    Science.gov (United States)

    Shah, Z H; Migliosi, V; Miller, S C; Wang, A; Friedman, T B; Jacobs, H T

    1998-03-15

    We have mapped the chromosomal locations of three human nuclear genes for putative components of the apparatus of mitochondrial gene expression, using a combination of in situ hybridization and interspecies hybrid mapping. The genes RPMS12 (mitoribosomal protein S12, a conserved protein component of the mitoribosomal accuracy center), TUFM (mitochondrial elongation factor EF-Tu), and AFG3L1 (similar to the yeast genes Afg3 and Rca1 involved in the turnover of mistranslated or misfolded mtDNA-encoded polypeptides) were initially characterized by a combination of database sequence analysis, PCR, cloning, and DNA sequencing. RPMS12 maps to chromosome 19q13.1, close to the previously mapped gene for autosomal dominant hearing loss DFNA4. The TUFM gene is located on chromosome 16p11.2, with a putative pseudogene or variant (TUFML) located very close to the centromere of chromosome 17. AFG3L1 is located on chromosome 16q24, very close to the telomere. By virtue of their inferred functions in mitochondria, these genes should be regarded as candidates of disorders sharing features with mitochondrial disease syndromes, such as sensorineural deafness, diabetes, and retinopathy.

  5. Detection of low frequency multi-drug resistance and novel putative maribavir resistance in immunocompromised paediatric patients with cytomegalovirus

    Directory of Open Access Journals (Sweden)

    Charlotte Jane Houldcroft

    2016-09-01

    Full Text Available Human cytomegalovirus (HCMV is a significant pathogen in immunocompromised individuals, with the potential to cause fatal pneumonitis and colitis, as well as increasing the risk of organ rejection in transplant patients. With the advent of new anti-HCMV drugs there is therefore considerable interest in using virus sequence data to monitor emerging resistance to antiviral drugs in HCMV viraemia and disease, including the identification of putative new mutations. We used target-enrichment to deep sequence HCMV DNA from 11 immunosuppressed paediatric patients receiving single or combination anti-HCMV treatment, serially sampled over 1-27 weeks. Changes in consensus sequence and resistance mutations were analysed for three ORFs targeted by anti-HCMV drugs and the frequencies of drug resistance mutations monitored. Targeted-enriched sequencing of clinical material detected mutations occurring at frequencies of 2%. Seven patients showed no evidence of drug resistance mutations. Four patients developed drug resistance mutations a mean of 16 weeks after starting treatment. In two patients, multiple resistance mutations accumulated at frequencies of 20% or less, including putative maribavir and ganciclovir resistance mutations P522Q (UL54 and C480F (UL97. In one patient, resistance was detected 14 days earlier than by PCR. Phylogenetic analysis suggested recombination or superinfection in one patient. Deep sequencing of HCMV enriched from clinical samples excluded resistance in 7 of eleven subjects and identified resistance mutations earlier than conventional PCR-based resistance testing in 2 patients. Detection of multiple low level resistance mutations was associated with poor outcome.

  6. Communities of Putative Ericoid Mycorrhizal Fungi Isolated from Alpine Dwarf Shrubs in Japan: Effects of Host Identity and Microhabitat.

    Science.gov (United States)

    Koizumi, Takahiko; Nara, Kazuhide

    2017-06-24

    Dwarf shrubs of the family Ericaceae are common in arctic and alpine regions. Many of these plants are associated with ericoid mycorrhizal (ERM) fungi, which allow them to take nutrients and water from the soil under harsh environmental conditions and, thus, affect host plant survival. Despite the importance of ERM fungi to alpine plant communities, limited information is available on the effects of microhabitat and host identity on ERM fungal communities. We investigated the communities of putative ERM fungi isolated from five dwarf shrub species (Arcterica nana, Diapensia lapponica, Empetrum nigrum, Loiseleuria procumbens, and Vaccinium vitis-idaea) that co-occur in an alpine region of Japan, with reference to distinct microhabitats provided by large stone pine (Pinus pumila) shrubs (i.e. bare ground, the edge of stone pine shrubs, and the inside of stone pine shrubs). We obtained 703 fungal isolates from 222 individual plants. These isolates were classified into 55 operational taxonomic units (OTUs) based on the sequencing of internal transcribed spacer regions in ribosomal DNA. These putative ERM fungal communities were dominated by Helotiales fungi for all host species. Cistella and Trimmatostroma species, which have rarely been detected in ERM roots in previous studies, were abundant. ERM fungal communities were significantly different among microhabitats (R 2 =0.28), while the host effect explained less variance in the fungal communities after excluding the microhabitat effect (R 2 =0.17). Our results suggest that the host effect on ERM fungal communities is minor and the distributions of hosts and fungal communities may be assessed based on microhabitat conditions.

  7. Extended molecular dynamics of a c-kit promoter quadruplex

    Czech Academy of Sciences Publication Activity Database

    Islam, B.; Stadlbauer, Petr; Krepl, Miroslav; Koča, J.; Neidle, S.; Haider, S.; Šponer, Jiří

    2015-01-01

    Roč. 43, č. 18 (2015), s. 8673-8693 ISSN 0305-1048 R&D Projects: GA ČR(CZ) GAP208/11/1822 Institutional support: RVO:68081707 Keywords : TELOMERIC G-QUADRUPLEX * INTRAMOLECULAR DNA QUADRUPLEXES * GASTROINTESTINAL STROMAL TUMOR Subject RIV: BO - Biophysics Impact factor: 9.202, year: 2015

  8. Amplified biosensing using the horseradish peroxidase-mimicking DNAzyme as an electrocatalyst.

    Science.gov (United States)

    Pelossof, Gilad; Tel-Vered, Ran; Elbaz, Johann; Willner, Itamar

    2010-06-01

    The hemin/G-quadruplex horseradish peroxidase-mimicking DNAzyme is assembled on Au electrodes. It reveals bioelectrocatalytic properties and electrocatalyzes the reduction of H(2)O(2). The bioelectrocatalytic functions of the hemin/G-quadruplex DNAzyme are used to develop electrochemical sensors that follow the activity of glucose oxidase and biosensors for the detection of DNA or low-molecular-weight substrates (adenosine monophosphate, AMP). Hairpin nucleic structures that include the G-quadruplex sequence in a caged configuration and the nucleic acid sequence complementary to the analyte DNA, or the aptamer sequence for AMP, are immobilized on Au-electrode surfaces. In the presence of the DNA analyte, or AMP, the hairpin structures are opened, and the hemin/G-quadruplex horseradish peroxidase-mimicking DNAzyme structures are generated on the electrode surfaces. The bioelectrocatalytic cathodic currents generated by the functionalized electrodes, upon the electrochemical reduction of H(2)O(2), provide a quantitative measure for the detection of the target analytes. The DNA target was analyzed with a detection limit of 1 x 10(-12) M, while the detection limit for analyzing AMP was 1 x 10(-6) M. Methods to regenerate the sensing surfaces are presented.

  9. Aptamer-based turn-on fluorescent four-branched quaternary ammonium pyrazine probe for selective thrombin detection.

    Science.gov (United States)

    Yan, Shengyong; Huang, Rong; Zhou, Yangyang; Zhang, Ming; Deng, Minggang; Wang, Xiaolin; Weng, Xiaocheng; Zhou, Xiang

    2011-01-28

    In this thrombin detection system, the bright fluorescence of TASPI is almost eliminated by the DNA aptamer TBA (turn-off); however, in the presence of thrombin, it specifically binds to TBA by folding unrestricted TBA into an anti-parallel G-quadruplex structure and then releasing TASPI molecules, resulting in vivid and facile fluorescence recovery (turn-on).

  10. Thermodynamic and biological evaluation of a thrombin binding aptamer modified with several unlocked nucleic acid (UNA) monomers and a 2′-C-piperazino-UNA monomer

    DEFF Research Database (Denmark)

    Jensen, Troels B.; Henriksen, Jonas Rosager; Rasmussen, Bjarne E.

    2011-01-01

    Thrombin binding aptamer is a DNA 15-mer which forms a G-quadruplex structure and possess promising anticoagulant properties due to specific interactions with thrombin. Herein we present the influence of a single 2′-C-piperazino-UNA residue and UNA residues incorporated in several positions on th...

  11. Putative tyrosine kinases expressed in K-562 human leukemia cells

    International Nuclear Information System (INIS)

    Partanen, J.; Maekelae, T.P.; Lehvaeslaiho, H.; Alitalo, K.; Alitalo, R.

    1990-01-01

    Tyrosine phosphorylation is important in the transmission of growth and differentiation signals; known tyrosine kinases include several oncoproteins and growth factor receptors. Interestingly, some differentiated cell types, such as erythrocytes and platelets contain high amounts of phosphotyrosine. The authors analyzed tyrosine kinases expressed in the K-562 chronic myelogenous leukemia cell line, which has a bipotential erythroid and megakaryoblastoid differentiation capacity. Analysis of 359 polymerase chain reaction-amplified cDNA clones led to the identification of 14 different tyrosine kinase-related sequences (JTK1-14). Two of the clones (JTK2 and JTK4) represent unusual members of the fibroblast growth factor receptor gene family, and the clones JTK5, JTK11, and JTK14 may also belong to the family of receptor tyrosine kinases but lack a close relationship to any known tyrosine kinase. Each of these different genes has its own characteristic expression pattern in K-562 cells and several other human tumor cell lines. In addition, the JTK11 and JTK14 mRNAs are induced during the megakaryoblastoid differentiation of K-562 cells. These tyrosine kinases may have a role in the differentiation of megakaryoblasts or in the physiology of platelets

  12. SACE_5599, a putative regulatory protein, is involved in morphological differentiation and erythromycin production in Saccharopolyspora erythraea.

    Science.gov (United States)

    Kirm, Benjamin; Magdevska, Vasilka; Tome, Miha; Horvat, Marinka; Karničar, Katarina; Petek, Marko; Vidmar, Robert; Baebler, Spela; Jamnik, Polona; Fujs, Štefan; Horvat, Jaka; Fonovič, Marko; Turk, Boris; Gruden, Kristina; Petković, Hrvoje; Kosec, Gregor

    2013-12-17

    Erythromycin is a medically important antibiotic, biosynthesized by the actinomycete Saccharopolyspora erythraea. Genes encoding erythromycin biosynthesis are organized in a gene cluster, spanning over 60 kbp of DNA. Most often, gene clusters encoding biosynthesis of secondary metabolites contain regulatory genes. In contrast, the erythromycin gene cluster does not contain regulatory genes and regulation of its biosynthesis has therefore remained poorly understood, which has for a long time limited genetic engineering approaches for erythromycin yield improvement. We used a comparative proteomic approach to screen for potential regulatory proteins involved in erythromycin biosynthesis. We have identified a putative regulatory protein SACE_5599 which shows significantly higher levels of expression in an erythromycin high-producing strain, compared to the wild type S. erythraea strain. SACE_5599 is a member of an uncharacterized family of putative regulatory genes, located in several actinomycete biosynthetic gene clusters. Importantly, increased expression of SACE_5599 was observed in the complex fermentation medium and at controlled bioprocess conditions, simulating a high-yield industrial fermentation process in the bioreactor. Inactivation of SACE_5599 in the high-producing strain significantly reduced erythromycin yield, in addition to drastically decreasing sporulation intensity of the SACE_5599-inactivated strains when cultivated on ABSM4 agar medium. In contrast, constitutive overexpression of SACE_5599 in the wild type NRRL23338 strain resulted in an increase of erythromycin yield by 32%. Similar yield increase was also observed when we overexpressed the bldD gene, a previously identified regulator of erythromycin biosynthesis, thereby for the first time revealing its potential for improving erythromycin biosynthesis. SACE_5599 is the second putative regulatory gene to be identified in S. erythraea which has positive influence on erythromycin yield. Like bld

  13. Molecular cloning and characterization of a putative OGG_N domain ...

    African Journals Online (AJOL)

    Molecular cloning and characterization of a putative OGG_N domain from the camel, Camelus dromedarius. Farid Shokry Ataya, Mohammad Saud Alanazi, Dalia Fouad, Hehsam Mahmoud Saeed, Mohammad Bazzi ...

  14. Dynamic regulation of cerebral DNA repair genes by psychological stress

    DEFF Research Database (Denmark)

    Forsberg, Kristin; Aalling, Nadia; Wörtwein, Gitta

    2015-01-01

    Neuronal genotoxic insults from oxidative stress constitute a putative molecular link between stress and depression on the one hand, and cognitive dysfunction and dementia risk on the other. Oxidative modifications to DNA are repaired by specific enzymes; a process that plays a critical role...... restraint stress (6h/day) or daily handling (controls), and sacrificed after 1, 7 or 21 stress sessions. The mRNA expression of seven genes (Ogg1, Ape1, Ung1, Neil1, Xrcc1, Ercc1, Nudt1) involved in the repair of oxidatively damaged DNA was determined by quantitative real time polymerase chain reaction...

  15. Toehold-Mediated Displacement of an Adenosine-Binding Aptamer from a DNA Duplex by its Ligand.

    Science.gov (United States)

    Monserud, Jon H; Macri, Katherine M; Schwartz, Daniel K

    2016-10-24

    DNA is increasingly used to engineer dynamic nanoscale circuits, structures, and motors, many of which rely on DNA strand-displacement reactions. The use of functional DNA sequences (e.g., aptamers, which bind to a wide range of ligands) in these reactions would potentially confer responsiveness on such devices, and integrate DNA computation with highly varied molecular stimuli. By using high-throughput single-molecule FRET methods, we compared the kinetics of a putative aptamer-ligand and aptamer-complement strand-displacement reaction. We found that the ligands actively disrupted the DNA duplex in the presence of a DNA toehold in a similar manner to complementary DNA, with kinetic details specific to the aptamer structure, thus suggesting that the DNA strand-displacement concept can be extended to functional DNA-ligand systems. © 2016 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.

  16. Identification and characterization of the cytosine-5 DNA methyltransferase gene family in Salvia miltiorrhiza

    OpenAIRE

    Jiang Li; Caili Li; Shanfa Lu

    2018-01-01

    Cytosine DNA methylation is highly conserved epigenetic modification involved in a wide range of biological processes in eukaryotes. It was established and maintained by cytosine-5 DNA methyltransferases (C5-MTases) in plants. Through genome-wide identification, eight putative SmC5-MTase genes were identified from the genome of Salvia miltiorrhiza, a well-known traditional Chinese medicine material and an emerging model medicinal plant. Based on conserved domains and phylogenetic analysis, ei...

  17. Identification of EhTIF-IA: The putative E. histolytica orthologue of the human ribosomal RNA transcription initiation factor-IA.

    Science.gov (United States)

    Srivastava, Ankita; Bhattacharya, Alok; Bhattacharya, Sudha; Jhingan, Gagan Deep

    2016-03-01

    Initiation of rDNA transcription requires the assembly of a specific multi-protein complex at the rDNA promoter containing the RNA Pol I with auxiliary factors. One of these factors is known as Rrn3P in yeast and Transcription Initiation Factor IA (TIF-IA) in mammals. Rrn3p/TIF-IA serves as a bridge between RNA Pol I and the pre-initiation complex at the promoter. It is phosphorylated at multiple sites and is involved in regulation of rDNA transcription in a growth-dependent manner. In the early branching parasitic protist Entamoeba histolytica, the rRNA genes are present exclusively on circular extra chromosomal plasmids. The protein factors involved in regulation of rDNA transcription in E. histolytica are not known. We have identified the E. histolytica equivalent of TIF-1A (EhTIF-IA) by homology search within the database and was further cloned and expressed. Immuno-localization studies showed that EhTIF-IA co-localized partially with fibrillarin in the peripherally localized nucleolus. EhTIF-IA was shown to interact with the RNA Pol I-specific subunit RPA12 both in vivo and in vitro. Mass spectroscopy data identified RNA Pol I-specific subunits and other nucleolar proteins to be the interacting partners of EhTIF-IA. Our study demonstrates for the first time a conserved putative RNA Pol I transcription factor TIF-IA in E. histolytica.

  18. The VanE operon in Enterococcus faecalis N00-410 is found on a putative integrative and conjugative element, Tn6202.

    Science.gov (United States)

    Boyd, D A; Mulvey, M R

    2013-02-01

    To date no complete genetic structure of acquired DNA harbouring a d-Ala-d-Ser operon in an Enterococcus is known. We wished to characterize the acquired DNA harbouring the vanE operon located in the Enterococcus faecalis N00-410 chromosome. Whole genome sequencing of E. faecalis N00-410 was conducted by massively parallel sequencing. Two sequence contigs harbouring the vanE region were linked by PCR and the acquired DNA harbouring the vanE operon was completely characterized. Excision/integration of the region was determined by PCR and transfer attempted by conjugation. The regions flanking the vanE operon were analysed and a total of 42 open reading frames were identified in a region flanked by inverted terminal and direct repeats (Tn6202). Tn6202 could be excised from the chromosome, circularized and the target site rejoined, but transfer could not be demonstrated. The vanE operon was found on the putative integrative and conjugative element Tn6202 in the E. faecalis N00-410 chromosome. This represents the first characterization of acquired DNA harbouring a D-Ala-D-Ser operon.

  19. Genetic manipulation in Sulfolobus islandicus and functional analysis of DNA repair genes

    DEFF Research Database (Denmark)

    Zhang, Changyi; Tian, Bin; Li, Suming

    2013-01-01

    Recently, a novel gene-deletion method was developed for the crenarchaeal model Sulfolobus islandicus, which is a suitable tool for addressing gene essentiality in depth. Using this technique, we have investigated functions of putative DNA repair genes by constructing deletion mutants and studying...

  20. Nucleophosmin is required for DNA integrity and p19Arf protein stability

    DEFF Research Database (Denmark)

    Colombo, Emanuela; Bonetti, Paola; Lazzerini Denchi, Eros

    2005-01-01

    , such as mutated Ras or overexpressed Myc. In the absence of NPM, Arf protein is excluded from nucleoli and is markedly less stable. Our data demonstrate that NPM regulates DNA integrity and, through Arf, inhibits cell proliferation and are consistent with a putative tumor-suppressive function of NPM....

  1. Chrysomya putoria, a putative vector of diarrheal diseases.

    Directory of Open Access Journals (Sweden)

    Steven W Lindsay

    Full Text Available Chrysomya spp are common blowflies in Africa, Asia and parts of South America and some species can reproduce in prodigious numbers in pit latrines. Because of their strong association with human feces and their synanthropic nature, we examined whether these flies are likely to be vectors of diarrheal pathogens.Flies were sampled using exit traps placed over the drop holes of latrines in Gambian villages. Odor-baited fly traps were used to determine the relative attractiveness of different breeding and feeding media. The presence of bacteria on flies was confirmed by culture and bacterial DNA identified using PCR. A median of 7.00 flies/latrine/day (IQR = 0.0-25.25 was collected, of which 95% were Chrysomya spp, and of these nearly all were Chrysomya putoria (99%. More flies were collected from traps with feces from young children (median = 3.0, IQR = 1.75-10.75 and dogs (median = 1.50, IQR = 0.0-13.25 than from herbivores (median = 0.0, IQR = 0.0-0.0; goat, horse, cow and calf; p<0.001. Flies were strongly attracted to raw meat (median = 44.5, IQR = 26.25-143.00 compared with fish (median = 0.0, IQR = 0.0-19.75, ns, cooked and uncooked rice, and mangoes (median = 0.0, IQR = 0.0-0.0; p<0.001. Escherichia coli were cultured from the surface of 21% (15/72 agar plates of Chrysomya spp and 10% of these were enterotoxigenic. Enteroaggregative E. coli were identified by PCR in 2% of homogenized Chrysomya spp, Shigella spp in 1.4% and Salmonella spp in 0.6% of samples.The large numbers of C. putoria that can emerge from pit latrines, the presence of enteric pathogens on flies, and their strong attraction to raw meat and fish suggests these flies may be common vectors of diarrheal diseases in Africa.

  2. Properties of non-coding DNA and identification of putative cis-regulatory elements in Theileria parva

    Directory of Open Access Journals (Sweden)

    Guo Xiang

    2008-12-01

    Full Text Available Abstract Background Parasites in the genus Theileria cause lymphoproliferative diseases in cattle, resulting in enormous socio-economic losses. The availability of the genome sequences and annotation for T. parva and T. annulata has facilitated the study of parasite biology and their relationship with host cell transformation and tropism. However, the mechanism of transcriptional regulation in this genus, which may be key to understanding fundamental aspects of its parasitology, remains poorly understood. In this study, we analyze the evolution of non-coding sequences in the Theileria genome and identify conserved sequence elements that may be involved in gene regulation of these parasitic species. Results Intergenic regions and introns in Theileria are short, and their length distributions are considerably right-skewed. Intergenic regions flanked by genes in 5'-5' orientation tend to be longer and slightly more AT-rich than those flanked by two stop codons; intergenic regions flanked by genes in 3'-5' orientation have intermediate values of length and AT composition. Intron position is negatively correlated with intron length, and positively correlated with GC content. Using stringent criteria, we identified a set of high-quality orthologous non-coding sequences between T. parva and T. annulata, and determined the distribution of selective constraints across regions, which are shown to be higher close to translation start sites. A positive correlation between constraint and length in both intergenic regions and introns suggests a tight control over length expansion of non-coding regions. Genome-wide searches for functional elements revealed several conserved motifs in intergenic regions of Theileria genomes. Two such motifs are preferentially located within the first 60 base pairs upstream of transcription start sites in T. parva, are preferentially associated with specific protein functional categories, and have significant similarity to know regulatory motifs in other species. These results suggest that these two motifs are likely to represent transcription factor binding sites in Theileria. Conclusion Theileria genomes are highly compact, with selection seemingly favoring short introns and intergenic regions. Three over-represented sequence motifs were independently identified in intergenic regions of both Theileria species, and the evidence suggests that at least two of them play a role in transcriptional control in T. parva. These are prime candidates for experimental validation of transcription factor binding sites in this single-celled eukaryotic parasite. Sequences similar to two of these Theileria motifs are conserved in Plasmodium hinting at the possibility of common regulatory machinery across the phylum Apicomplexa.

  3. DNA Repair Systems

    Indian Academy of Sciences (India)

    DNA molecule which makes it ideal for storage and propagation of genetic information. ... of these errors are broadly referred to as DNA repair. DNA can ... changes occur in the human genome per day. ..... nails, frequent physical and mental.

  4. Synthesis of DNA

    Science.gov (United States)

    Mariella, Jr., Raymond P.

    2008-11-18

    A method of synthesizing a desired double-stranded DNA of a predetermined length and of a predetermined sequence. Preselected sequence segments that will complete the desired double-stranded DNA are determined. Preselected segment sequences of DNA that will be used to complete the desired double-stranded DNA are provided. The preselected segment sequences of DNA are assembled to produce the desired double-stranded DNA.

  5. Down-regulation of SFRP1 as a putative tumor suppressor gene can contribute to human hepatocellular carcinoma

    International Nuclear Information System (INIS)

    Huang, Jian; Zhang, Yun-Li; Teng, Xiao-Mei; Lin, Yun; Zheng, Da-Li; Yang, Peng-Yuan; Han, Ze-Guang

    2007-01-01

    Hepatocellular carcinoma (HCC) is one of the most common cancers in the world. SFRP1 (the secreted frizzled-related protein 1), a putative tumor suppressor gene mapped onto chromosome 8p12-p11.1, the frequent loss of heterozygosity (LOH) region in human HCC, encodes a Wingless-type (Wnt) signaling antagonist and is frequently inactivated by promoter methylation in many human cancers. However, whether the down-regulation of SFRP1 can contribute to hepatocarcinogenesis still remains unclear. We investigated the expression of SFRP1 through real time RT-PCR and immunohistochemistry staining. The cell growth and colony formation were observed as the overexpression and knockdown of SFRP1. The DNA methylation status within SFRP1 promoter was analyzed through methylation-specific PCR or bisulphate-treated DNA sequencing assays. Loss of heterozygosity was here detected with microsatellite markers. SFRP1 was significantly down-regulated in 76.1% (35/46) HCC specimens at mRNA level and in 30% (30/100) HCCs indicated by immunohistochemistry staining, as compared to adjacent non-cancerous livers. The overexpression of SFRP1 can significantly inhibit the cell growth and colony formation of YY-8103, SMMC7721, and Hep3B cells. The RNA interference against the constitutional SFRP1 in the offspring SMMC7721 cells, which were stably transfected by ectopic SFRP1, can markedly promote cell growth of these cells. LOH of both microsatellite markers D8S532 and D8SAC016868 flanking the gene locus was found in 13% (6 of 46 HCCs) and 6.5% (3 of 46 HCCs) of the informative cases, respectively, where 5 of 8 HCC specimens with LOH showed the down-regulation of SFRP1. DNA hypermethylation within SFRP1 promoter was identified in two of three HCC specimens without SFRP1 expression. Moreover, the DNA methylation of SFRP1 promoter was significantly reduced, along with the re-expression of the gene, in those HCC cell lines, Bel7404, QGY7701, and MHCC-H, as treated by DAC. Our data suggested that the

  6. A wide variety of putative extremophiles and large beta-diversity at the Mars Desert Research Station (Utah)

    Science.gov (United States)

    Direito, Susana O. L.; Ehrenfreund, Pascale; Marees, Andries; Staats, Martijn; Foing, Bernard; Röling, Wilfred F. M.

    2011-07-01

    Humankind's innate curiosity makes us wonder whether life is or was present on other planetary bodies such as Mars. The EuroGeoMars 2009 campaign was organized at the Mars Desert Research Station (MDRS) to perform multidisciplinary astrobiology research. MDRS in southeast Utah is situated in a cold arid desert with mineralogy and erosion processes comparable to those on Mars. Insight into the microbial community composition of this terrestrial Mars analogue provides essential information for the search for life on Mars: including sampling and life detection methodology optimization and what kind of organisms to expect. Soil samples were collected from different locations. Culture-independent molecular analyses directed at ribosomal RNA genes revealed the presence of all three domains of life (Archaea, Bacteria and Eukarya), but these were not detected in all samples. Spiking experiments revealed that this appears to relate to low DNA recovery, due to adsorption or degradation. Bacteria were most frequently detected and showed high alpha- and beta-diversity. Members of the Actinobacteria, Proteobacteria, Bacteroidetes and Gemmatimonadetes phyla were found in the majority of samples. Archaea alpha- and beta-diversity was very low. For Eukarya, a diverse range of organisms was identified, such as fungi, green algae and several phyla of Protozoa. Phylogenetic analysis revealed an extraordinary variety of putative extremophiles, mainly Bacteria but also Archaea and Eukarya. These comprised radioresistant, endolithic, chasmolithic, xerophilic, hypolithic, thermophilic, thermoacidophilic, psychrophilic, halophilic, haloalkaliphilic and alkaliphilic micro-organisms. Overall, our data revealed large difference in occurrence and diversity over short distances, indicating the need for high-sampling frequency at similar sites. DNA extraction methods need to be optimized to improve extraction efficiencies.

  7. Cadmium Exposure as a Putative Risk Factor for the Development of Pancreatic Cancer: Three Different Lines of Evidence

    Directory of Open Access Journals (Sweden)

    Aleksandra Buha

    2017-01-01

    Full Text Available Although profoundly studied, etiology of pancreatic cancer (PC is still rather scant. Exposure to cadmium (Cd, a ubiquitous metal associated with well-established toxic and carcinogenic properties, has been hypothesized to one putative cause of PC. Hence, we analyzed recently published observational studies, meta-analyses, and experimental animal and in vitro studies with the aim of summarizing the evidence of Cd involvement in PC development and describing the possible mechanisms. Consolidation of epidemiological data on PC and exposure to Cd indicated a significant association with an elevated risk of PC among general population exposed to Cd. Cadmium exposure of laboratory animals was showed to cause PC supporting the findings suggested by human studies. The concordance with human and animal studies is buttressed by in vitro studies, although in vitro data interpretation is problematic. In most instances, only significant effects are reported, and the concentrations of Cd are excessive, which would skew interpretation. Previous reports suggest that oxidative stress, apoptotic changes, and DNA cross-linking and hypermethylation are involved in Cd-mediated carcinogenesis. Undoubtedly, a significant amount of work is still needed to achieve a better understanding of the Cd involvement in pancreatic cancer which could facilitate prevention, diagnosis, and therapy of this fatal disease.

  8. Tissue-specific expression of the gene for a putative plasma membrane H(+)-ATPase in a seagrass.

    Science.gov (United States)

    Fukuhara, T; Pak, J Y; Ohwaki, Y; Tsujimura, H; Nitta, T

    1996-01-01

    A cDNA clone corresponding to the gene (ZHA1) for a putative plasma membrane H(+)-ATPase of a seagrass (Zostera marina L.) was isolated and sequenced. Comparison of the amino acid predicted sequence from the nucleotide sequence of ZHA1 with those encoded by known genes for plasma membrane H(+)-ATPases from other plants indicated that ZHA1 is most similar to the gene (PMA4) for a plasma membrane H(+)-ATPase in a tobacco (84.4%). Northern hybridization indicated that ZHA1 was strongly expressed in mature leaves, which are exposed to seawater and have the ability of tolerate salinity; ZHA1 was weakly expressed in immature leaves, which are protected from seawater by tightly enveloping sheaths and are sensitive to salinity. In mature leaves, in situ hybridization revealed that ZHA1 was expressed specifically in epidermal cells, the plasma membranes of which were highly invaginated and morphologically similar to those of typical transfer cells. Therefore, the differentiation of the transfer cell-like structures, accompanied by the high-level expression of ZHA1, in the epidermal cells of mature leaves in particular may be important for the excretion of salt by these cells. PMID:8587992

  9. CLONING, SEQUENCE ANALYSIS, AND CHARACTERIZATION OF PUTATIVE BETA-LACTAMASE OF STENOTROPHOMONAS MALTOPHILIA

    Directory of Open Access Journals (Sweden)

    Chong Seng Shueh

    2012-10-01

    Full Text Available The main objective of current study was to explore the function of chromosomal putative beta-lactamase gene (smlt 0115 in clinical Stenotrophomonas maltophilia. Antibiotic susceptibility test (AST screening for current antimicrobial drugs was done and Minimum Inhibitory Concentration (MIC level towards beta-lactams was determined by E-test. Putative beta-lactamase gene of S. maltophilia was amplified via PCR, with specific primers, then cloned into pET-15 expression plasmid and transformed into Escherichia coli BL21. The gene was sequenced and analyzed. The expressed protein was purified by affinity chromatography and the kinetic assay was performed. S. maltophilia ATCC 13637 was included in this experiment. Besides, a hospital strain which exhibited resistant to a series of beta-lactams including cefepime was identified via AST and MIC, hence it was named as S2 strain and was considered in this study. Sequencing result showed that putative beta-lactamase gene obtained from ATCC 13637 and S2 strains were predicted to have cephalosporinase activity by National Center for Biotechnology Information (NCBI blast program. Differences in the sequences of both ATCC 13637 and S2 strains were found via ClustalW alignment software. Kinetic assay proved a cephalosporinase characteristic produced by E. coli BL21 clone that overexpressed the putative beta-lactamase gene cloned under the control of an external promoter. Yet, expressed protein purified from S2 strain had high catalytic activity against beta-lactam antibiotics which was 14-fold higher than expressed protein purified from ATCC 13637 strain. This study represents the characterization analysis of putative beta-lactamase gene (smlt 0115 of S. maltophilia. The presence of the respective gene in the chromosome of S. maltophilia suggested that putative beta-lactamase gene (smlt 0115 of S. maltophilia plays a role in beta-lactamase resistance.

  10. Influence of putative exopolysaccharide genes on Pseudomonas putida KT2440 biofilm stability

    DEFF Research Database (Denmark)

    Nilsson, Martin; Chiang, Wen-Chi; Fazli, Mustafa

    2011-01-01

    We report a study of the role of putative exopolysaccharide gene clusters in the formation and stability of Pseudomonas putida KT2440 biofilm. Two novel putative exopolysaccharide gene clusters, pea and peb, were identified, and evidence is provided that they encode products that stabilize P....... putida KT2440 biofilm. The gene clusters alg and bcs, which code for proteins mediating alginate and cellulose biosynthesis, were found to play minor roles in P. putida KT2440 biofilm formation and stability under the conditions tested. A P. putida KT2440 derivative devoid of any identifiable...

  11. Molecular analysis of mxbD and mxbM, a putative sensor-regulator pair required for oxidation of methanol in Methylobacterium extorquens AM1.

    Science.gov (United States)

    Springer, A L; Morris, C J; Lidstrom, M E

    1997-05-01

    Five genes are thought to be required for transcription of methanol oxidation genes in Methylobacterium strains. These putative regulatory genes include mxcQE, which encode a putative sensor-regulator pair, and mxbDM and mxaB, whose functions are less well-understood. In this study, mxbDM in Methylobacterium extorquens AM1 were shown to be required for expression of a xylE transcriptional fusion to the structural gene for the large subunit of methanol dehydrogenase (mxaF), confirming the role of these genes in transcriptional regulation of mxaF. The nucleotide sequence suggests that mxbD encodes a histidine protein kinase with two transmembrane domains and that mxbM encodes a DNA-binding response regulator. A xylE transcriptional fusion to the putative mxbD promoter showed low-level expression in wild-type cells grown on one-carbon (C1) compounds and no detectable expression in cells grown on succinate. Deletion analysis of this promoter construct showed that the region 229-129 bp upstream of the start of mxbD is required for expression. The expression of the mxbD-xylE fusion was examined in each of the five known regulatory mutant classes. xylE expression was reduced to non-detectable levels in MxcQ and MxcE mutants, but was not affected in the other regulatory mutants or in non-regulatory mutants defective in methanol oxidation. These results suggest a regulatory hierarchy in which the sensor-regulator pair MxcQE control expression of the sensor-regulator pair MxbDM, and MxbDM in turn control expression of a number of genes involved in methanol oxidation.

  12. Residual DNA-bound proteins are a source of in vitro transcription inhibitor peptides

    International Nuclear Information System (INIS)

    Venanzi, F.M.

    1989-01-01

    Enzymatic breakdown of residual proteins occurs at mild alkaline pH (pH optimum 8.5) as monitored by using radioiodinated, purified genomic DNA from calf thymus. These DNA fibers also possess a differential ability to hydrolyze added exogenous small and linker histones. The results described argue strongly that a putative protease activity, co-purified with DNA, is the source of short chain peptides which inhibit transcription in vitro. Therefore, we propose that RNA repressor peptides must be of higher molecular weight than previously reported

  13. Expression of a maize Myb transcription factor driven by a putative silk-specific promoter significantly enhances resistance to Helicoverpa zea in transgenic maize.

    Science.gov (United States)

    Johnson, Eric T; Berhow, Mark A; Dowd, Patrick F

    2007-04-18

    Hi II maize (Zea mays) plants were engineered to express maize p1 cDNA, a Myb transcription factor, controlled by a putative silk specific promoter, for secondary metabolite production and corn earworm resistance. Transgene expression did not enhance silk color, but about half of the transformed plant silks displayed browning when cut, which indicated the presence of p1-produced secondary metabolites. Levels of maysin, a secondary metabolite with insect toxicity, were highest in newly emerged browning silks. The insect resistance of transgenic silks was also highest at emergence, regardless of maysin levels, which suggests that other unidentified p1-induced molecules likely contributed to larval mortality. Mean survivor weights of corn earworm larvae fed mature browning transgenic silks were significantly lower than weights of those fed mature nonbrowning transgenic silks. Some transgenic pericarps browned with drying and contained similar molecules found in pericarps expressing a dominant p1 allele, suggesting that the promoter may not be silk-specific.

  14. Comparative Transcriptome Analysis Identifies Putative Genes Involved in the Biosynthesis of Xanthanolides in Xanthium strumarium L.

    OpenAIRE

    Li, Yuanjun; Gou, Junbo; Chen, Fangfang; Li, Changfu; Zhang, Yansheng

    2016-01-01

    Xanthium strumarium L. is a traditional Chinese herb belonging to the Asteraceae family. The major bioactive components of this plant are sesquiterpene lactones, which include the xanthanolides. To date, the biogenesis of xanthanolides, especiallytheir downstream pathway, remains largely unknown. In X. strumarium, xanthanolides primarily accumulate in its glandular trichomes. To identify putative gene candidates involved in the biosynthesis of xanthanolides, three X. strumarium transcriptomes...

  15. Asymmetric total synthesis of a putative sex pheromone component from the parasitoid wasp Trichogramma turkestanica

    NARCIS (Netherlands)

    Geerdink, Danny; Buter, Jeffrey; van Beek, Teris A.; Minnaard, Adriaan J.

    2014-01-01

    Virgin females of the parasitoid wasp Trichogramma turkestanica produce minute amounts of a sex pheromone, the identity of which has not been fully established. The enantioselective synthesis of a putative component of this pheromone, (6S,8S,10S)-4,6,8,10-tetramethyltrideca-2E,4E-dien-1-ol (2), is

  16. Crystal structure and putative substrate identification for the Entamoeba histolytica low molecular weight tyrosine phosphatase.

    Science.gov (United States)

    Linford, Alicia S; Jiang, Nona M; Edwards, Thomas E; Sherman, Nicholas E; Van Voorhis, Wesley C; Stewart, Lance J; Myler, Peter J; Staker, Bart L; Petri, William A

    2014-01-01

    Entamoeba histolytica is a eukaryotic intestinal parasite of humans, and is endemic in developing countries. We have characterized the E. histolytica putative low molecular weight protein tyrosine phosphatase (LMW-PTP). The structure for this amebic tyrosine phosphatase was solved, showing the ligand-induced conformational changes necessary for binding of substrate. In amebae, it was expressed at low but detectable levels as detected by immunoprecipitation followed by immunoblotting. A mutant LMW-PTP protein in which the catalytic cysteine in the active site was replaced with a serine lacked phosphatase activity, and was used to identify a number of trapped putative substrate proteins via mass spectrometry analysis. Seven of these putative substrate protein genes were cloned with an epitope tag and overexpressed in amebae. Five of these seven putative substrate proteins were demonstrated to interact specifically with the mutant LMW-PTP. This is the first biochemical study of a small tyrosine phosphatase in Entamoeba, and sets the stage for understanding its role in amebic biology and pathogenesis. Copyright © 2014 Elsevier B.V. All rights reserved.

  17. Search strings for the study of putative occupational determinants of disease

    NARCIS (Netherlands)

    Mattioli, S.; Zanardi, F.; Baldasseroni, A.; Schaafsma, F.; Cooke, R.M.T.; Mancini, G.; Fierro, M.; Santangelo, C.; Farioli, A.; Fucksia, S.; Curti, S.; Violante, F.S.; Verbeek, J.

    2010-01-01

    Objective To identify efficient PubMed search strategies to retrieve articles regarding putative occupational determinants of conditions not generally considered to be work related. Methods Based on MeSH definitions and expert knowledge, we selected as candidate search terms the four MeSH terms

  18. Search strings for the study of putative occupational determinants of disease

    NARCIS (Netherlands)

    Mattioli, Stefano; Zanardi, Francesca; Baldasseroni, Alberto; Schaafsma, Frederieke; Cooke, Robin M. T.; Mancini, Gianpiero; Fierro, Mauro; Santangelo, Chiara; Farioli, Andrea; Fucksia, Serenella; Curti, Stefania; Violante, Francesco S.; Verbeek, Jos

    2010-01-01

    To identify efficient PubMed search strategies to retrieve articles regarding putative occupational determinants of conditions not generally considered to be work related. Based on MeSH definitions and expert knowledge, we selected as candidate search terms the four MeSH terms describing

  19. Putative contact ketoconazole shampoo-triggered pemphigus foliaceus in a dog.

    Science.gov (United States)

    Sung, Hyun-Jeong; Yoon, In-Hwa; Kim, Jung-Hyun

    2017-09-01

    A 10-year-old spayed female cocker spaniel dog was referred for an evaluation of acute-onset generalized pustular cutaneous lesions following application of ketoconazole shampoo. Cytologic and histopathologic examinations of the lesions revealed intra-epidermal pustules with predominantly neutrophils and acantholytic cells. This is the first description of putative contact ketoconazole shampoo-triggered pemphigus foliaceus in a dog.

  20. Gut Microbiome and Putative Resistome of Inca and Italian Nobility Mummies.

    Science.gov (United States)

    Santiago-Rodriguez, Tasha M; Fornaciari, Gino; Luciani, Stefania; Toranzos, Gary A; Marota, Isolina; Giuffra, Valentina; Cano, Raul J

    2017-11-07

    Little is still known about the microbiome resulting from the process of mummification of the human gut. In the present study, the gut microbiota, genes associated with metabolism, and putative resistome of Inca and Italian nobility mummies were characterized by using high-throughput sequencing. The Italian nobility mummies exhibited a higher bacterial diversity as compared to the Inca mummies when using 16S ribosomal (rRNA) gene amplicon sequencing, but both groups showed bacterial and fungal taxa when using shotgun metagenomic sequencing that may resemble both the thanatomicrobiome and extant human gut microbiomes. Identification of sequences associated with plants, animals, and carbohydrate-active enzymes (CAZymes) may provide further insights into the dietary habits of Inca and Italian nobility mummies. Putative antibiotic-resistance genes in the Inca and Italian nobility mummies support a human gut resistome prior to the antibiotic therapy era. The higher proportion of putative antibiotic-resistance genes in the Inca compared to Italian nobility mummies may support the hypotheses that a greater exposure to the environment may result in a greater acquisition of antibiotic-resistance genes. The present study adds knowledge of the microbiome resulting from the process of mummification of the human gut, insights of ancient dietary habits, and the preserved putative human gut resistome prior the antibiotic therapy era.

  1. Cloning and sequence analysis of putative type II fatty acid synthase ...

    Indian Academy of Sciences (India)

    Prakash

    Cloning and sequence analysis of putative type II fatty acid synthase genes from Arachis hypogaea L. ... acyl carrier protein (ACP), malonyl-CoA:ACP transacylase, β-ketoacyl-ACP .... Helix II plays a dominant role in the interaction ... main distinguishing features of plant ACPs in plastids and ..... synthase component; J. Biol.

  2. Gut Microbiome and Putative Resistome of Inca and Italian Nobility Mummies

    Directory of Open Access Journals (Sweden)

    Tasha M. Santiago-Rodriguez

    2017-11-01

    Full Text Available Little is still known about the microbiome resulting from the process of mummification of the human gut. In the present study, the gut microbiota, genes associated with metabolism, and putative resistome of Inca and Italian nobility mummies were characterized by using high-throughput sequencing. The Italian nobility mummies exhibited a higher bacterial diversity as compared to the Inca mummies when using 16S ribosomal (rRNA gene amplicon sequencing, but both groups showed bacterial and fungal taxa when using shotgun metagenomic sequencing that may resemble both the thanatomicrobiome and extant human gut microbiomes. Identification of sequences associated with plants, animals, and carbohydrate-active enzymes (CAZymes may provide further insights into the dietary habits of Inca and Italian nobility mummies. Putative antibiotic-resistance genes in the Inca and Italian nobility mummies support a human gut resistome prior to the antibiotic therapy era. The higher proportion of putative antibiotic-resistance genes in the Inca compared to Italian nobility mummies may support the hypotheses that a greater exposure to the environment may result in a greater acquisition of antibiotic-resistance genes. The present study adds knowledge of the microbiome resulting from the process of mummification of the human gut, insights of ancient dietary habits, and the preserved putative human gut resistome prior the antibiotic therapy era.

  3. Total synthesis of the putative structure of the novel triquinane natural product isocapnellenone

    OpenAIRE

    Mehta, Goverdhan; Murthy, Sai Krishna A; Umarye, Jayant D

    2002-01-01

    A total synthesis of the ‘putative structure’ 7, attributed to the novel triquinane sesquiterpene isolated recently from two Buddelia species has been accomplished. The spectral data for 7 is a complete mismatch with those reported for the natural product and warrants a revision of the assigned structure.

  4. Cloning and characterization of prunus serotina AGAMOUS, a putative flower homeotic gene

    Science.gov (United States)

    Xiaomei Liu; Joseph Anderson; Paula Pijut

    2010-01-01

    Members of the AGAMOUS subfamily of MADS-box transcription factors play an important role in regulating the development of reproductive organs in flowering plants. To help understand the mechanism of floral development in black cherry (Prunus serotina), PsAG (a putative flower homeotic identity gene) was isolated...

  5. Sequence analysis of putative swrW gene required for surfactant ...

    African Journals Online (AJOL)

    owner

    2012-07-17

    Jul 17, 2012 ... These nucleotide and protein sequence analysis of the putative swrW gene provides vital information on the versatility .... chain reaction (PCR) products were stored at 4°C. Presence of ... identical to the same gene with an E-value of 0.0. .... The Prokaryotes-A Handbook on the Biol. of Bacteria:Ecophysiol.

  6. Distribution of putative virulence genes and antimicrobial drug resistance in Vibrio harveyi

    Digital Repository Service at National Institute of Oceanography (India)

    Parvathi, A.; Mendez, D.; Anto, C.

    zonula occludens toxin (Zot) and a hemolysin-coregulated protein gene (hcp) by polymerase chain reaction (PCR). Of the four putative reversible toxin genes, vhh-1 was detected in 31% of the isolates, vhh-2 in 46%, vhh-3 in 23% and vhh-4 was detected in 27...

  7. DETERMINATION OF ROCURONIUM AND ITS PUTATIVE METABOLITES IN BODY-FLUIDS AND TISSUE-HOMOGENATES

    NARCIS (Netherlands)

    KLEEF, UW; PROOST, JH; ROGGEVELD, J

    1993-01-01

    A sensitive and selective HPLC method was developed for the quantification of the neuromuscular blocking agent rocuronium and its putative metabolites (the 17-desacetyl derivative and the N-desallyl derivative of rocuronium) in plasma, urine, bile, tissue homogenates and stoma fluid. Samples were

  8. Complete Genome Sequence of a Putative Densovirus of the Asian Citrus Psyllid, Diaphorina citri.

    Science.gov (United States)

    Nigg, Jared C; Nouri, Shahideh; Falk, Bryce W

    2016-07-28

    Here, we report the complete genome sequence of a putative densovirus of the Asian citrus psyllid, Diaphorina citri Diaphorina citri densovirus (DcDNV) was originally identified through metagenomics, and here, we obtained the complete nucleotide sequence using PCR-based approaches. Phylogenetic analysis places DcDNV between viruses of the Ambidensovirus and Iteradensovirus genera. Copyright © 2016 Nigg et al.

  9. Complete Genome Sequence of a Putative Densovirus of the Asian Citrus Psyllid, Diaphorina citri

    OpenAIRE

    Nigg, Jared C.; Nouri, Shahideh; Falk, Bryce W.

    2016-01-01

    Here, we report the complete genome sequence of a putative densovirus of the Asian citrus psyllid, Diaphorina citri. Diaphorina citri densovirus (DcDNV) was originally identified through metagenomics, and here, we obtained the complete nucleotide sequence using PCR-based approaches. Phylogenetic analysis places DcDNV between viruses of the Ambidensovirus and Iteradensovirus genera.

  10. Identification of DNA repair genes in the human genome

    International Nuclear Information System (INIS)

    Hoeijmakers, J.H.J.; van Duin, M.; Westerveld, A.; Yasui, A.; Bootsma, D.

    1986-01-01

    To identify human DNA repair genes we have transfected human genomic DNA ligated to a dominant marker to excision repair deficient xeroderma pigmentosum (XP) and CHO cells. This resulted in the cloning of a human gene, ERCC-1, that complements the defect of a UV- and mitomycin-C sensitive CHO mutant 43-3B. The ERCC-1 gene has a size of 15 kb, consists of 10 exons and is located in the region 19q13.2-q13.3. Its primary transcript is processed into two mRNAs by alternative splicing of an internal coding exon. One of these transcripts encodes a polypeptide of 297 aminoacids. A putative DNA binding protein domain and nuclear location signal could be identified. Significant AA-homology is found between ERCC-1 and the yeast excision repair gene RAD10. 58 references, 6 figures, 1 table

  11. Two Tetrahymena G-DNA-binding proteins, TGP1 and TGP3, share novel motifs and may play a role in micronuclear division

    OpenAIRE

    Lu, Quan; Henderson, Eric

    2000-01-01

    G-DNA is a four-stranded DNA structure with diverse putative biological roles. We have previously purified and cloned a novel G-DNA-binding protein TGP1 from the ciliate Tetrahymena thermophila. Here we report the molecular cloning of TGP3, an additional G-DNA-binding protein from the same organism. The TGP3 cDNA encodes a 365 amino acid protein that is homologous to TGP1 (34% identity and 44% similarity). The proteins share a sequence pattern that contains two novel repetitive and homologous...

  12. G4-DNA formation in the HRAS promoter and rational design of decoy oligonucleotides for cancer therapy.

    Directory of Open Access Journals (Sweden)

    Alexandro Membrino

    Full Text Available HRAS is a proto-oncogene involved in the tumorigenesis of urinary bladder cancer. In the HRAS promoter we identified two G-rich elements, hras-1 and hras-2, that fold, respectively, into an antiparallel and a parallel quadruplex (qhras-1, qhras-2. When we introduced in sequence hras-1 or hras-2 two point mutations that block quadruplex formation, transcription increased 5-fold, but when we stabilized the G-quadruplexes by guanidinium phthalocyanines, transcription decreased to 20% of control. By ChIP we found that sequence hras-1 is bound only by MAZ, while hras-2 is bound by MAZ and Sp1: two transcription factors recognizing guanine boxes. We also discovered by EMSA that recombinant MAZ-GST binds to both HRAS quadruplexes, while Sp1-GST only binds to qhras-1. The over-expression of MAZ and Sp1 synergistically activates HRAS transcription, while silencing each gene by RNAi results in a strong down-regulation of transcription. All these data indicate that the HRAS G-quadruplexes behave as transcription repressors. Finally, we designed decoy oligonucleotides mimicking the HRAS quadruplexes, bearing (R-1-O-[4-(1-Pyrenylethynyl phenylmethyl] glycerol and LNA modifications to increase their stability and nuclease resistance (G4-decoys. The G4-decoys repressed HRAS transcription and caused a strong antiproliferative effect, mediated by apoptosis, in T24 bladder cancer cells where HRAS is mutated.

  13. Spliced DNA Sequences in the Paramecium Germline: Their Properties and Evolutionary Potential

    Science.gov (United States)

    Catania, Francesco; McGrath, Casey L.; Doak, Thomas G.; Lynch, Michael

    2013-01-01

    Despite playing a crucial role in germline-soma differentiation, the evolutionary significance of developmentally regulated genome rearrangements (DRGRs) has received scant attention. An example of DRGR is DNA splicing, a process that removes segments of DNA interrupting genic and/or intergenic sequences. Perhaps, best known for shaping immune-system genes in vertebrates, DNA splicing plays a central role in the life of ciliated protozoa, where thousands of germline DNA segments are eliminated after sexual reproduction to regenerate a functional somatic genome. Here, we identify and chronicle the properties of 5,286 sequences that putatively undergo DNA splicing (i.e., internal eliminated sequences [IESs]) across the genomes of three closely related species of the ciliate Paramecium (P. tetraurelia, P. biaurelia, and P. sexaurelia). The study reveals that these putative IESs share several physical characteristics. Although our results are consistent with excision events being largely conserved between species, episodes of differential IES retention/excision occur, may have a recent origin, and frequently involve coding regions. Our findings indicate interconversion between somatic—often coding—DNA sequences and noncoding IESs, and provide insights into the role of DNA splicing in creating potentially functional genetic innovation. PMID:23737328

  14. RICD: A rice indica cDNA database resource for rice functional genomics

    Directory of Open Access Journals (Sweden)

    Zhang Qifa

    2008-11-01

    Full Text Available Abstract Background The Oryza sativa L. indica subspecies is the most widely cultivated rice. During the last few years, we have collected over 20,000 putative full-length cDNAs and over 40,000 ESTs isolated from various cDNA libraries of two indica varieties Guangluai 4 and Minghui 63. A database of the rice indica cDNAs was therefore built to provide a comprehensive web data source for searching and retrieving the indica cDNA clones. Results Rice Indica cDNA Database (RICD is an online MySQL-PHP driven database with a user-friendly web interface. It allows investigators to query the cDNA clones by keyword, genome position, nucleotide or protein sequence, and putative function. It also provides a series of information, including sequences, protein domain annotations, similarity search results, SNPs and InDels information, and hyperlinks to gene annotation in both The Rice Annotation Project Database (RAP-DB and The TIGR Rice Genome Annotation Resource, expression atlas in RiceGE and variation report in Gramene of each cDNA. Conclusion The online rice indica cDNA database provides cDNA resource with comprehensive information to researchers for functional analysis of indica subspecies and for comparative genomics. The RICD database is available through our website http://www.ncgr.ac.cn/ricd.

  15. Structural Insight into the interaction of Flavonoids with Human Telomeric Sequence

    Science.gov (United States)

    Tawani, Arpita; Kumar, Amit

    2015-01-01

    Flavonoids are a group of naturally available compounds that are an attractive source for drug discovery. Their potential to act as anti-tumourigenic and anti-proliferative agents has been reported previously but is not yet fully understood. Targeting human telomeric G-quadruplex DNA could be one of the mechanisms by which these flavonoids exert anticancer activity. We have performed detailed biophysical studies for the interaction of four representative flavonoids, Luteolin, Quercetin, Rutin and Genistein, with the human telomeric G-quadruplex sequence tetramolecular d-(T2AG3T) (Tel7). In addition, we used NMR spectroscopy to derive the first model for the complex formed between Quercetin and G-quadruplex sequence. The model showed that Quercetin stabilises the G-quadruplex structure and does not open the G-tetrad. It interacts with the telomeric sequence through π-stacking at two sites: between T1pT2 and between G6pT7. Based on our findings, we suggest that Quercetin could be a potent candidate for targeting the telomere and thus, act as a potent anti-cancer agent. PMID:26627543

  16. Klebsiella pneumoniae asparagine tDNAs are integration hotspots for different genomic islands encoding microcin E492 production determinants and other putative virulence factors present in hypervirulent strains

    Directory of Open Access Journals (Sweden)

    Andrés Esteban Marcoleta

    2016-06-01

    Full Text Available Due to the developing of multi-resistant and invasive hypervirulent strains, Klebsiella pneumoniae has become one of the most urgent bacterial pathogen threats in the last years. Genomic comparison of a growing number of sequenced isolates has allowed the identification of putative virulence factors, proposed to be acquirable mainly through horizontal gene transfer. In particular, those related with synthesizing the antibacterial peptide microcin E492 (MccE492 and salmochelin siderophores were found to be highly prevalent among hypervirulent strains. The determinants for the production of both molecules were first reported as part of a 13-kbp segment of K. pneumoniae RYC492 chromosome, and were cloned and characterized in E. coli. However, the genomic context of this segment in K. pneumoniae remained uncharacterized.In this work we provided experimental and bioinformatics evidence indicating that the MccE492 cluster is part of a highly conserved 23-kbp genomic island (GI named GIE492, that was integrated in a specific asparagine-tRNA gene (asn-tDNA and was found in a high proportion of isolates from liver abscesses sampled around the world. This element resulted to be unstable and its excision frequency increased after treating bacteria with mytomicin C and upon the overexpression of the island-encoded integrase. Besides the MccE492 genetic cluster, it invariably included an integrase-coding gene, at least 7 protein-coding genes of unknown function, and a putative transfer origin that possibly allows this GI to be mobilized through conjugation. In addition, we analyzed the asn-tDNA loci of all the available K. pneumoniae assembled chromosomes to evaluate them as GI-integration sites. Remarkably, 73% of the strains harbored at least one GI integrated in one of the four asn-tDNA present in this species, confirming them as integration hotspots. Each of these tDNAs was occupied with different frequencies, although they were 100% identical. Also, we

  17. Efficient alignment-free DNA barcode analytics.

    Science.gov (United States)

    Kuksa, Pavel; Pavlovic, Vladimir

    2009-11-10

    In this work we consider barcode DNA analysis problems and address them using alternative, alignment-free methods and representations which model sequences as collections of short sequence fragments (features). The methods use fixed-length representations (spectrum) for barcode sequences to measure similarities or dissimilarities between sequences coming from the same or different species. The spectrum-based representation not only allows for accurate and computationally efficient species classification, but also opens possibility for accurate clustering analysis of putative species barcodes and identification of critical within-barcode loci distinguishing barcodes of different sample groups. New alignment-free methods provide highly accurate and fast DNA barcode-based identification and classification of species with substantial improvements in accuracy and speed over state-of-the-art barcode analysis methods. We evaluate our methods on problems of species classification and identification using barcodes, important and relevant analytical tasks in many practical applications (adverse species movement monitoring, sampling surveys for unknown or pathogenic species identification, biodiversity assessment, etc.) On several benchmark barcode datasets, including ACG, Astraptes, Hesperiidae, Fish larvae, and Birds of North America, proposed alignment-free methods considerably improve prediction accuracy compared to prior results. We also observe significant running time improvements over the state-of-the-art methods. Our results show that newly developed alignment-free methods for DNA barcoding can efficiently and with high accuracy identify specimens by examining only few barcode features, resulting in increased scalability and interpretability of current computational approaches to barcoding.

  18. IFI16 and cGAS cooperate in the activation of STING during DNA sensing in human keratinocytes.

    Science.gov (United States)

    Almine, Jessica F; O'Hare, Craig A J; Dunphy, Gillian; Haga, Ismar R; Naik, Rangeetha J; Atrih, Abdelmadjid; Connolly, Dympna J; Taylor, Jordan; Kelsall, Ian R; Bowie, Andrew G; Beard, Philippa M; Unterholzner, Leonie

    2017-02-13

    Many human cells can sense the presence of exogenous DNA during infection though the cytosolic DNA receptor cyclic GMP-AMP synthase (cGAS), which produces the second messenger cyclic GMP-AMP (cGAMP). Other putative DNA receptors have been described, but whether their functions are redundant, tissue-specific or integrated in the cGAS-cGAMP pathway is unclear. Here we show that interferon-γ inducible protein 16 (IFI16) cooperates with cGAS during DNA sensing in human keratinocytes, as both cGAS and IFI16 are required for the full activation of an innate immune response to exogenous DNA and DNA viruses. IFI16 is also required for the cGAMP-induced activation of STING, and interacts with STING to promote STING phosphorylation and translocation. We propose that the two DNA sensors IFI16 and cGAS cooperate to prevent the spurious activation of the type I interferon response.

  19. Development of a Competent and Trouble Free DNA Isolation Protocol for Downstream Genetic Analyses in Glycine Species

    Directory of Open Access Journals (Sweden)

    Muhammad Amjad Nawaz

    2016-08-01

    Full Text Available Extraction of deoxyribose nucleic acid (DNA from plants is preliminary step in molecular biology. Fast and cost effective genomic DNA isolation from Glycine species for downstream application is a major bottleneck. Here we report a high throughput and trouble free method for genomic DNA extraction from leaf and seeds of Glycine species with high quality and quantity. Protocol reports the optimization by employing different concentrations of CTAB and PVP in extraction buffer. Efficiency of optimized protocol was compared with frequently used DNA extraction methods. Wide adoptability and utility of this protocol was confirmed by DNA extraction from leaves as well as seeds of G. max, G. soja, G. tomentella and G. latifolia. Extracted DNA was successfully subjected to PCR amplification of five microsatellite markers and four putative glycosyltransferase genes. DNA extraction protocol is reproducible, trouble free, rapid and can be adopted for plant molecular biology applications.

  20. Heterologous expression of laccase cDNA from Ceriporiopsis subvermispora yields copper-activated apoprotein and complex isoform patterns

    Science.gov (United States)

    Luis F. Larrondo; Marcela Avila; Loreto Salas; Dan Cullen; Rafael Vicuna

    2003-01-01

    Analysis of genomic clones encoding a putative laccase in homokaryon strains of Ceriporiopsis subvermispora led to the identification of an allelic variant of the previously described lcs-1 gene. A cDNA clone corresponding to this gene was expressed in Aspergillus nidulans and in Aspergillus niger. Enzyme assays and Western blots showed that both hosts secreted active...