38 CFR 4.85 - Evaluation of hearing impairment.

Science.gov (United States)

2010-07-01

... impairment. 4.85 Section 4.85 Pensions, Bonuses, and Veterans' Relief DEPARTMENT OF VETERANS AFFAIRS SCHEDULE FOR RATING DISABILITIES Disability Ratings Impairment of Auditory Acuity § 4.85 Evaluation of hearing impairment. (a) An examination for hearing impairment for VA purposes must be conducted by a state-licensed...

Chaperone-client complexes: A dynamic liaison

Science.gov (United States)

Hiller, Sebastian; Burmann, Björn M.

2018-04-01

Living cells contain molecular chaperones that are organized in intricate networks to surveil protein homeostasis by avoiding polypeptide misfolding, aggregation, and the generation of toxic species. In addition, cellular chaperones also fulfill a multitude of alternative functionalities: transport of clients towards a target location, help them fold, unfold misfolded species, resolve aggregates, or deliver clients towards proteolysis machineries. Until recently, the only available source of atomic resolution information for virtually all chaperones were crystal structures of their client-free, apo-forms. These structures were unable to explain details of the functional mechanisms underlying chaperone-client interactions. The difficulties to crystallize chaperones in complexes with clients arise from their highly dynamic nature, making solution NMR spectroscopy the method of choice for their study. With the advent of advanced solution NMR techniques, in the past few years a substantial number of structural and functional studies on chaperone-client complexes have been resolved, allowing unique insight into the chaperone-client interaction. This review summarizes the recent insights provided by advanced high-resolution NMR-spectroscopy to understand chaperone-client interaction mechanisms at the atomic scale.

The Tomato U-Box Type E3 Ligase PUB13 Acts With Group III Ubiquitin E2 Enzymes to Modulate FLS2-Mediated Immune Signaling

Directory of Open Access Journals (Sweden)

Bangjun Zhou

2018-05-01

Full Text Available In Arabidopsis and rice, the ubiquitin ligase PUB13-mediated protein degradation plays a significant role in plant pattern-triggered immunity (PTI and flowering time control. The Arabidopsis PUB13 has been shown to attenuate the pattern recognition receptor FLS2-mediated immune signaling by ubiquitinating FLS2 and consequently promoting its degradation by the 26S proteasome. Nevertheless, the cognate ubiquitin-conjugating enzymes (E2 with which PUB13 acts to modulate FLS2-mediated PTI are unknown. To address this question, we investigate here the tomato (Solanum lycopersicum homolog of PUB13, SlPUB13 by utilizing the recently characterized complete set of tomato E2s. Of the 13 groups of tomato E2s, only members in group III are found to interact and act with SlPUB13. Knocking-down of the group III E2 genes enhances callose deposition and induction of the RbohB gene in the immunity-associated, early oxidative burst after flg22 treatment. The group III E2s are also found to work with SlPUB13 to ubiquitinate FLS2 in vitro and are required for PUB13-mediated degradation of FLS2 in vivo upon flg22 treatment, suggesting an essential role for group III E2s in the modulation of FLS2-mediated immune signaling by PUB13. Additionally, another immunity-associated E3, NtCMPG1 is shown to also work specifically with members of group III E2 in the in vitro ubiquitination assay, which implies the group III E2 enzymes may cooperate with many E3 ligases to regulate different aspects of PTI. Taken together, these data corroborate the notion that group III E2 enzymes play an important role in PTI and build a foundation for further functional and mechanistic characterization of tomato PUB13.

Design Report for Isolated RS-485 Bus Node

Science.gov (United States)

2016-07-01

TERMS Android , RS-485, isolated, USB, smartphone 16. SECURITY CLASSIFICATION OF: 17. LIMITATION OF ABSTRACT UU 18. NUMBER...controlled wired RS-485 network. The Android -based smartphone or tablet is used in conjunction with a USB to serial bridge to operate as the bus master in...the system. The Android device operates in USB Host mode and communicates to the RS-485 bus as if a single peripheral on the USB bus. 15. SUBJECT

Histone chaperone networks shaping chromatin function

DEFF Research Database (Denmark)

Hammond, Colin; Strømme, Caroline Bianchi; Huang, Hongda

2017-01-01

and fate, which affects all chromosomal processes, including gene expression, chromosome segregation and genome replication and repair. Here, we review the distinct structural and functional properties of the expanding network of histone chaperones. We emphasize how chaperones cooperate in the histone...... chaperone network and via co-chaperone complexes to match histone supply with demand, thereby promoting proper nucleosome assembly and maintaining epigenetic information by recycling modified histones evicted from chromatin....

47 CFR 0.485 - Commercial radio operator examinations.

Science.gov (United States)

2010-10-01

... 47 Telecommunication 1 2010-10-01 2010-10-01 false Commercial radio operator examinations. 0.485....485 Commercial radio operator examinations. Generally, written and telegraphy examinations for commercial radio operator licenses shall be conducted at locations and times specified by commercial operator...

System level mechanisms of adaptation, learning, memory formation and evolvability: the role of chaperone and other networks.

Science.gov (United States)

Gyurko, David M; Soti, Csaba; Stetak, Attila; Csermely, Peter

2014-05-01

During the last decade, network approaches became a powerful tool to describe protein structure and dynamics. Here, we describe first the protein structure networks of molecular chaperones, then characterize chaperone containing sub-networks of interactomes called as chaperone-networks or chaperomes. We review the role of molecular chaperones in short-term adaptation of cellular networks in response to stress, and in long-term adaptation discussing their putative functions in the regulation of evolvability. We provide a general overview of possible network mechanisms of adaptation, learning and memory formation. We propose that changes of network rigidity play a key role in learning and memory formation processes. Flexible network topology provides ' learning-competent' state. Here, networks may have much less modular boundaries than locally rigid, highly modular networks, where the learnt information has already been consolidated in a memory formation process. Since modular boundaries are efficient filters of information, in the 'learning-competent' state information filtering may be much smaller, than after memory formation. This mechanism restricts high information transfer to the 'learning competent' state. After memory formation, modular boundary-induced segregation and information filtering protect the stored information. The flexible networks of young organisms are generally in a 'learning competent' state. On the contrary, locally rigid networks of old organisms have lost their 'learning competent' state, but store and protect their learnt information efficiently. We anticipate that the above mechanism may operate at the level of both protein-protein interaction and neuronal networks.

Allosteric mechanism controls traffic in the chaperone/usher pathway.

Science.gov (United States)

Di Yu, Xiao; Dubnovitsky, Anatoly; Pudney, Alex F; Macintyre, Sheila; Knight, Stefan D; Zavialov, Anton V

2012-11-07

Many virulence organelles of Gram-negative bacterial pathogens are assembled via the chaperone/usher pathway. The chaperone transports organelle subunits across the periplasm to the outer membrane usher, where they are released and incorporated into growing fibers. Here, we elucidate the mechanism of the usher-targeting step in assembly of the Yersinia pestis F1 capsule at the atomic level. The usher interacts almost exclusively with the chaperone in the chaperone:subunit complex. In free chaperone, a pair of conserved proline residues at the beginning of the subunit-binding loop form a "proline lock" that occludes the usher-binding surface and blocks usher binding. Binding of the subunit to the chaperone rotates the proline lock away from the usher-binding surface, allowing the chaperone-subunit complex to bind to the usher. We show that the proline lock exists in other chaperone/usher systems and represents a general allosteric mechanism for selective targeting of chaperone:subunit complexes to the usher and for release and recycling of the free chaperone. Copyright © 2012 Elsevier Ltd. All rights reserved.

42 CFR 485.709 - Condition of participation: Administrative management.

Science.gov (United States)

2010-10-01

... Condition of participation: Administrative management. The clinic or rehabilitation agency has an effective... 42 Public Health 5 2010-10-01 2010-10-01 false Condition of participation: Administrative management. 485.709 Section 485.709 Public Health CENTERS FOR MEDICARE & MEDICAID SERVICES, DEPARTMENT OF...

Cross-system excision of chaperone-mediated proteolysis in chaperone-assisted recombinant protein production

Science.gov (United States)

Martínez-Alonso, Mónica; Villaverde, Antonio

2010-01-01

Main Escherichia coli cytosolic chaperones such as DnaK are key components of the control quality network designed to minimize the prevalence of polypeptides with aberrant conformations. This is achieved by both favoring refolding activities but also stimulating proteolytic degradation of folding reluctant species. This last activity is responsible for the decrease of the proteolytic stability of recombinant proteins when co-produced along with DnaK, where an increase in solubility might be associated to a decrease in protein yield. However, when DnaK and its co-chaperone DnaJ are co-produced in cultured insect cells or whole insect larvae (and expectedly, in other heterologous hosts), only positive, folding-related effects of these chaperones are observed, in absence of proteolysis-mediated reduction of recombinant protein yield. PMID:21326941

42 CFR 485.627 - Condition of participation: Organizational structure.

Science.gov (United States)

2010-10-01

... participation: Organizational structure. (a) Standard: Governing body or responsible individual. The CAH has a... 42 Public Health 5 2010-10-01 2010-10-01 false Condition of participation: Organizational structure. 485.627 Section 485.627 Public Health CENTERS FOR MEDICARE & MEDICAID SERVICES, DEPARTMENT OF...

The hepatitis C virus Core protein is a potent nucleic acid chaperone that directs dimerization of the viral (+) strand RNA in vitro.

Science.gov (United States)

Cristofari, Gaël; Ivanyi-Nagy, Roland; Gabus, Caroline; Boulant, Steeve; Lavergne, Jean-Pierre; Penin, François; Darlix, Jean-Luc

2004-01-01

The hepatitis C virus (HCV) is an important human pathogen causing chronic hepatitis, liver cirrhosis and hepatocellular carcinoma. HCV is an enveloped virus with a positive-sense, single-stranded RNA genome encoding a single polyprotein that is processed to generate viral proteins. Several hundred molecules of the structural Core protein are thought to coat the genome in the viral particle, as do nucleocapsid (NC) protein molecules in Retroviruses, another class of enveloped viruses containing a positive-sense RNA genome. Retroviral NC proteins also possess nucleic acid chaperone properties that play critical roles in the structural remodelling of the genome during retrovirus replication. This analogy between HCV Core and retroviral NC proteins prompted us to investigate the putative nucleic acid chaperoning properties of the HCV Core protein. Here we report that Core protein chaperones the annealing of complementary DNA and RNA sequences and the formation of the most stable duplex by strand exchange. These results show that the HCV Core is a nucleic acid chaperone similar to retroviral NC proteins. We also find that the Core protein directs dimerization of HCV (+) RNA 3' untranslated region which is promoted by a conserved palindromic sequence possibly involved at several stages of virus replication.

RS-485 Bus Design of a Missile Simulation Training System

Directory of Open Access Journals (Sweden)

Liu Fang

2013-07-01

Full Text Available In a missile simulation training system with one-master and multi-slaves distributed system structure, a universal controller is necessary due to the system composed with several controllers. In this research, the designed controllers communicate with each other and upper control computer through RS-485 field bus. RS-485 bus including interface circuits, transmission protocol, Cyclic Redundancy Check (CRC method and upper control test software is designed and proposed. The universal controller adopting the designed RS-485 interface circuits is connected through twisted-pair and makes the simulation system, then the controller is tested in line. The results show that the RS-485 bus communicates effectively using the protocol and CRC method, data transmission rates reaches 115.2 kbps, and has a good stability.

RS485 optical router for HIRFL-CSR

International Nuclear Information System (INIS)

Zhang Shuocheng; Wang Dan; Jing Lan; Qiao Weimin

2007-01-01

A communication equipment-RS485 optical router has been developed to satisfy requirements of control system communication network of HIRFL-CSR (Heavy Ion Research Facility at Lanzhou-Cooling Storage Ring). The equipment is compatible with multiple communication protocols, such as Ethernet, RS232 and RS485 standard. It can be used to setup the RS485 communication network quickly and connected to the Ethernet easily. The fiber optical interface is introduced to facilitate the connection with the network of industrial Fiber Optics Communication (FOC), which expands the application field of the equipment in a large extent. This paper introduces the details of the equipment, including the design of the circuit and software, features of the equipment and how it works in the whole control system network. Its application in the HIRFL-CSR control system shows that the equipment is in accordance with the general requirement of automatic control communication system. It could also be used in other industrial automatic control fields. (authors)

Functional Analysis of the Chaperone-Usher Fimbrial Gene Clusters of Salmonella enterica serovar Typhi.

Science.gov (United States)

Dufresne, Karine; Saulnier-Bellemare, Julie; Daigle, France

2018-01-01

The human-specific pathogen Salmonella enterica serovar Typhi causes typhoid, a major public health issue in developing countries. Several aspects of its pathogenesis are still poorly understood. S . Typhi possesses 14 fimbrial gene clusters including 12 chaperone-usher fimbriae ( stg, sth, bcf , fim, saf , sef , sta, stb, stc, std, ste , and tcf ). These fimbriae are weakly expressed in laboratory conditions and only a few are actually characterized. In this study, expression of all S . Typhi chaperone-usher fimbriae and their potential roles in pathogenesis such as interaction with host cells, motility, or biofilm formation were assessed. All S . Typhi fimbriae were better expressed in minimal broth. Each system was overexpressed and only the fimbrial gene clusters without pseudogenes demonstrated a putative major subunits of about 17 kDa on SDS-PAGE. Six of these (Fim, Saf, Sta, Stb, Std, and Tcf) also show extracellular structure by electron microscopy. The impact of fimbrial deletion in a wild-type strain or addition of each individual fimbrial system to an S . Typhi afimbrial strain were tested for interactions with host cells, biofilm formation and motility. Several fimbriae modified bacterial interactions with human cells (THP-1 and INT-407) and biofilm formation. However, only Fim fimbriae had a deleterious effect on motility when overexpressed. Overall, chaperone-usher fimbriae seem to be an important part of the balance between the different steps (motility, adhesion, host invasion and persistence) of S . Typhi pathogenesis.

PhosphoLipid transfer protein (PLTP) exerts a direct pro-inflammatory effect on rheumatoid arthritis (RA) fibroblasts-like-synoviocytes (FLS) independently of its lipid transfer activity

Science.gov (United States)

Deckert, Valérie; Daien, Claire I.; Che, Hélène; Elhmioui, Jamila; Lemaire, Stéphanie; Pais de Barros, Jean-Paul; Desrumaux, Catherine; Combe, Bernard; Hahne, Michael; Lagrost, Laurent; Morel, Jacques

2018-01-01

Rheumatoid arthritis (RA) is a chronic inflammatory rheumatic disease with modification of lipids profile and an increased risk of cardiovascular events related to inflammation. Plasma phospholipid transfer protein (PLTP) exerts a lipid transfer activity through its active form. PLTP can also bind to receptors such as ATP-binding cassette transporter A1 (ABCA1). In addition to its role in lipoprotein metabolism and atherosclerosis, the latest advances came in support of a complex role of PLTP in the regulation of the inflammatory response, both with pro-inflammatory or anti-inflammatory properties. The aim of the present study was to decipher the role of PLTP in joint inflammation and to assess its relevance in the context of RA. PLTP expression was examined by western-blot and by immunochemistry. ABCA1 expression was analyzed by flow cytometry. Lipid transfer activity of PLTP and pro-inflammatory cytokines were measured in sera and synovial fluid (SF) from RA patients and controls (healthy subjects or osteoarthritis patients [OA]). FLS were treated with both lipid-transfer active form and inactive form of recombinant human PLTP. IL-8, IL-6, VEGF and MMP3 produced by FLS were assessed by ELISA, and proliferation by measuring 3H-Thymidine incorporation. RA synovial tissues showed higher PLTP staining than OA and PLTP protein levels were also significantly higher in RA-FLS. In addition, RA, unlike OA patients, displayed elevated levels of PLTP activity in SF, which correlated with pro-inflammatory cytokines. Both lipid-transfer active and inactive forms of PLTP significantly increased the production of cytokines and proliferation of FLS. ABCA1 was expressed on RAFLS and PLTP activated STAT3 pathway. To conclude, PLTP is highly expressed in the joints of RA patients and may directly trigger inflammation and FLS proliferation, independently of its lipid transfer activity. These results suggest a pro-inflammatory role for PLTP in RA. PMID:29565987

Modulation of human IAPP fibrillation: cosolutes, crowders and chaperones.

Science.gov (United States)

Gao, Mimi; Estel, Kathrin; Seeliger, Janine; Friedrich, Ralf P; Dogan, Susanne; Wanker, Erich E; Winter, Roland; Ebbinghaus, Simon

2015-04-07

The cellular environment determines the structure and function of proteins. Marginal changes of the environment can severely affect the energy landscape of protein folding. However, despite the important role of chaperones on protein folding, less is known about chaperonal modulation of protein aggregation and fibrillation considering different classes of chaperones. We find that the pharmacological chaperone O4, the chemical chaperone proline as well as the protein chaperone serum amyloid P component (SAP) are inhibitors of the type 2 diabetes mellitus-related aggregation process of islet amyloid polypeptide (IAPP). By applying biophysical methods such as thioflavin T fluorescence spectroscopy, fluorescence anisotropy, total reflection Fourier-transform infrared spectroscopy, circular dichroism spectroscopy and atomic force microscopy we analyse and compare their inhibition mechanism. We demonstrate that the fibrillation reaction of human IAPP is strongly inhibited by formation of globular, amorphous assemblies by both, the pharmacological and the protein chaperones. We studied the inhibition mechanism under cell-like conditions by using the artificial crowding agents Ficoll 70 and sucrose. Under such conditions the suppressive effect of proline was decreased, whereas the pharmacological chaperone remains active.

42 CFR 485.618 - Condition of participation: Emergency services.

Science.gov (United States)

2010-10-01

... Boards of Medicine and Nursing about issues related to access to and the quality of emergency services in... 42 Public Health 5 2010-10-01 2010-10-01 false Condition of participation: Emergency services. 485.618 Section 485.618 Public Health CENTERS FOR MEDICARE & MEDICAID SERVICES, DEPARTMENT OF HEALTH AND...

42 CFR 485.639 - Condition of participation: Surgical services.

Science.gov (United States)

2010-10-01

... Nursing about issues related to access to and the quality of anesthesia services in the State and has... 42 Public Health 5 2010-10-01 2010-10-01 false Condition of participation: Surgical services. 485.639 Section 485.639 Public Health CENTERS FOR MEDICARE & MEDICAID SERVICES, DEPARTMENT OF HEALTH AND...

27 CFR 70.485 - Closing agreements.

Science.gov (United States)

2010-04-01

... Relating to Alcohol, Tobacco, Firearms, and Explosives Administrative Remedies § 70.485 Closing agreements... disadvantage through consummation of such an agreement. (b) Scope of closing agreement—(1) In general. A...

Information encoded in non-native states drives substrate-chaperone pairing.

Science.gov (United States)

Mapa, Koyeli; Tiwari, Satyam; Kumar, Vignesh; Jayaraj, Gopal Gunanathan; Maiti, Souvik

2012-09-05

Many proteins refold in vitro through kinetic folding intermediates that are believed to be by-products of native-state centric evolution. These intermediates are postulated to play only minor roles, if any, in vivo because they lack any information related to translation-associated vectorial folding. We demonstrate that refolding intermediate of a test protein, generated in vitro, is able to find its cognate chaperone, from the whole complement of Escherichia coli soluble chaperones. Cognate chaperone-binding uniquely alters the conformation of non-native substrate. Importantly, precise chaperone targeting of substrates are maintained as long as physiological molar ratios of chaperones remain unaltered. Using a library of different chaperone substrates, we demonstrate that kinetically trapped refolding intermediates contain sufficient structural features for precise targeting to cognate chaperones. We posit that evolution favors sequences that, in addition to coding for a functional native state, encode folding intermediates with higher affinity for cognate chaperones than noncognate ones. Copyright © 2012 Elsevier Ltd. All rights reserved.

Chemical chaperones exceed the chaperone effects of RIC-3 in promoting assembly of functional α7 AChRs.

Directory of Open Access Journals (Sweden)

Alexander Kuryatov

Full Text Available Functional α7 nicotinic acetylcholine receptors (AChRs do not assemble efficiently in cells transfected with α7 subunits unless the cells are also transfected with the chaperone protein RIC-3. Despite the presence of RIC-3, large amounts of these subunits remain improperly assembled. Thus, additional chaperone proteins are probably required for efficient assembly of α7 AChRs. Cholinergic ligands can act as pharmacological chaperones to promote assembly of mature AChRs and upregulate the amount of functional AChRs. In addition, we have found that the chemical chaperones 4-phenylbutyric acid (PBA and valproic acid (VPA greatly increase the amount of functional α7 AChRs produced in a cell line expressing both α7 and RIC-3. Increased α7 AChR expression allows assay of drug action using a membrane potential-sensitive fluorescent indicator. Both PBA and VPA also increase α7 expression in the SH-SY5Y neuroblastoma cell line that endogenously expresses α7 AChRs. VPA increases expression of endogenous α7 AChRs in hippocampal neurons but PBA does not. RIC-3 is insufficient for optimal assembly of α7 AChRs, but provides assay conditions for detecting additional chaperones. Chemical chaperones are a useful pragmatic approach to express high levels of human α7 AChRs for drug selection and characterization and possibly to increase α7 expression in vivo.

Discovery of novel interacting partners of PSMD9, a proteasomal chaperone: Role of an Atypical and versatile PDZ-domain motif interaction and identification of putative functional modules

Directory of Open Access Journals (Sweden)

Nikhil Sangith

2014-01-01

Full Text Available PSMD9 (Proteasome Macropain non-ATPase subunit 9, a proteasomal assembly chaperone, harbors an uncharacterized PDZ-like domain. Here we report the identification of five novel interacting partners of PSMD9 and provide the first glimpse at the structure of the PDZ-domain, including the molecular details of the interaction. We based our strategy on two propositions: (a proteins with conserved C-termini may share common functions and (b PDZ domains interact with C-terminal residues of proteins. Screening of C-terminal peptides followed by interactions using full-length recombinant proteins, we discovered hnRNPA1 (an RNA binding protein, S14 (a ribosomal protein, CSH1 (a growth hormone, E12 (a transcription factor and IL6 receptor as novel PSMD9-interacting partners. Through multiple techniques and structural insights, we clearly demonstrate for the first time that human PDZ domain interacts with the predicted Short Linear Sequence Motif (SLIM at the C-termini of the client proteins. These interactions are also recapitulated in mammalian cells. Together, these results are suggestive of the role of PSMD9 in transcriptional regulation, mRNA processing and editing, hormone and receptor activity and protein translation. Our proof-of-principle experiments endorse a novel and quick method for the identification of putative interacting partners of similar PDZ-domain proteins from the proteome and for discovering novel functions.

Molecular Dynamics Simulation and Statistics Analysis Reveals the Defense Response Mechanism in Plants

Science.gov (United States)

Liu, Zhichao; Zhao, Yunjie; Zeng, Chen; Computational Biophysics Lab Team

As the main protein of the bacterial flagella, flagellin plays an important role in perception and defense response. The newly discovered locus, FLS2, is ubiquitously expressed. FLS2 encodes a putative receptor kinase and shares many homologies with some plant resistance genes and even with some components of immune system of mammals and insects. In Arabidopsis, FLS2 perception is achieved by the recognition of epitope flg22, which induces FLS2 heteromerization with BAK1 and finally the plant immunity. Here we use both analytical methods such as Direct Coupling Analysis (DCA) and Molecular Dynamics (MD) Simulations to get a better understanding of the defense mechanism of FLS2. This may facilitate a redesign of flg22 or de-novo design for desired specificity and potency to extend the immune properties of FLS2 to other important crops and vegetables.

Insight into the assembly of chaperones

Energy Technology Data Exchange (ETDEWEB)

May, R P [Institut Max von Laue - Paul Langevin (ILL), 38 - Grenoble (France); Stegmann, R; Manakova, E; Roessle, M; Hermann, T; Heumann, H [Max-Planck-Institut fuer Biochemie, Martinsried (Germany); Axmann, S; Plueckthun, A [Zurich Univ. (Switzerland); Wiedenmann, A [HMI, Berlin (Germany)

1997-04-01

Chaperones are proteins that help other proteins (substrate proteins) to acquire a `good` conformation. The folding is a dynamic process and involves repetitive binding and release of the chaperone components and of the substrate protein. Small-angle neutron scattering is used to investigate the structural changes that appear to happen during the folding process. (author). 2 refs.

Chaperoning Roles of Macromolecules Interacting with Proteins in Vivo

Directory of Open Access Journals (Sweden)

Baik L. Seong

2011-03-01

Full Text Available The principles obtained from studies on molecular chaperones have provided explanations for the assisted protein folding in vivo. However, the majority of proteins can fold without the assistance of the known molecular chaperones, and little attention has been paid to the potential chaperoning roles of other macromolecules. During protein biogenesis and folding, newly synthesized polypeptide chains interact with a variety of macromolecules, including ribosomes, RNAs, cytoskeleton, lipid bilayer, proteolytic system, etc. In general, the hydrophobic interactions between molecular chaperones and their substrates have been widely believed to be mainly responsible for the substrate stabilization against aggregation. Emerging evidence now indicates that other features of macromolecules such as their surface charges, probably resulting in electrostatic repulsions, and steric hindrance, could play a key role in the stabilization of their linked proteins against aggregation. Such stabilizing mechanisms are expected to give new insights into our understanding of the chaperoning functions for de novo protein folding. In this review, we will discuss the possible chaperoning roles of these macromolecules in de novo folding, based on their charge and steric features.

Interactive surface in the PapD chaperone cleft is conserved in pilus chaperone superfamily and essential in subunit recognition and assembly.

OpenAIRE

Slonim, L N; Pinkner, J S; Brändén, C I; Hultgren, S J

1992-01-01

The assembly of adhesive pili in Gram-negative bacteria is modulated by specialized periplasmic chaperone systems. PapD is the prototype member of the superfamily of periplasmic pilus chaperones. Previously, the alignment of chaperone sequences superimposed on the three dimensional structure of PapD revealed the presence of invariant, conserved and variable amino acids. Representative residues that protruded into the PapD cleft were targeted for site directed mutagenesis to investigate the pi...

42 CFR 485.705 - Personnel qualifications.

Science.gov (United States)

2010-10-01

... Physical Therapy and Speech-Language Pathology Services § 485.705 Personnel qualifications. (a) General... involved in the furnishing of outpatient physical therapy, occupational therapy, and speech-language...) of the Act and the requirements in part 484 of this chapter. (2) For a speech-language pathologist...

Systems analysis of chaperone networks in the malarial parasite Plasmodium falciparum.

Directory of Open Access Journals (Sweden)

Soundara Raghavan Pavithra

2007-09-01

Full Text Available Molecular chaperones participate in the maintenance of cellular protein homeostasis, cell growth and differentiation, signal transduction, and development. Although a vast body of information is available regarding individual chaperones, few studies have attempted a systems level analysis of chaperone function. In this paper, we have constructed a chaperone interaction network for the malarial parasite, Plasmodium falciparum. P. falciparum is responsible for several million deaths every year, and understanding the biology of the parasite is a top priority. The parasite regularly experiences heat shock as part of its life cycle, and chaperones have often been implicated in parasite survival and growth. To better understand the participation of chaperones in cellular processes, we created a parasite chaperone network by combining experimental interactome data with in silico analysis. We used interolog mapping to predict protein-protein interactions for parasite chaperones based on the interactions of corresponding human chaperones. This data was then combined with information derived from existing high-throughput yeast two-hybrid assays. Analysis of the network reveals the broad range of functions regulated by chaperones. The network predicts involvement of chaperones in chromatin remodeling, protein trafficking, and cytoadherence. Importantly, it allows us to make predictions regarding the functions of hypothetical proteins based on their interactions. It allows us to make specific predictions about Hsp70-Hsp40 interactions in the parasite and assign functions to members of the Hsp90 and Hsp100 families. Analysis of the network provides a rational basis for the anti-malarial activity of geldanamycin, a well-known Hsp90 inhibitor. Finally, analysis of the network provides a theoretical basis for further experiments designed toward understanding the involvement of this important class of molecules in parasite biology.

Involvement of miR-485-5p in hepatocellular carcinoma progression targeting EMMPRIN.

Science.gov (United States)

Sun, Xiangjun; Liu, Yonglei; Li, Ming; Wang, Mingchun; Wang, Yutong

2015-05-01

EMMPRIN plays important roles in cancer development, which includes EMMPRIN 1, 2, 3, and 4 isoforms. EMMPRIN2 is the main component in human cancers, but its regulation by miRNAs is still unclear. In this study, we will investigate the mechanism of EMMPRIN regulation in hepatocellular carcinoma (HCC) by miRNAs. Through RT-PCR, we found that EMMPRIN2 was the main isoform in HCC cells. EMMPRIN2 was down-regulated significantly by predicted miRNAs and miR-485-5p was one of the miRNA that regulated EMMPRIN in HCC cell lines. It was verified that EMMPRIN was a target gene of miR-485-5p by using luciferase analysis assay. We found that miR-485-5p was significantly downregulated in HCC tissues and that its expression was inversely correlated with the TNM stage and metastasis in HCC samples. Results of cellular functions in HCC showed that miR-485-5p could inhibit cell proliferation and metastasis. Additionally, miR-485-5p overexpression suppressed HCC growth in vivo by down-regulation of EMMPRIN. Our study for the first time demonstrated that miR-485-5p represses HCC invasive and metastatic capacities by targeting EMMPRIN expression. Copyright © 2015 Elsevier Masson SAS. All rights reserved.

An overview on molecular chaperones enhancing solubility of expressed recombinant proteins with correct folding.

Science.gov (United States)

Mamipour, Mina; Yousefi, Mohammadreza; Hasanzadeh, Mohammad

2017-09-01

The majority of research topics declared that most of the recombinant proteins have been expressed by Escherichia coli in basic investigations. But the majority of high expressed proteins formed as inactive recombinant proteins that are called inclusion body. To overcome this problem, several methods have been used including suitable promoter, environmental factors, ladder tag to secretion of proteins into the periplasm, gene protein optimization, chemical chaperones and molecular chaperones sets. Co-expression of the interest protein with molecular chaperones is one of the common methods The chaperones are a group of proteins, which are involved in making correct folding of recombinant proteins. Chaperones are divided two groups including; cytoplasmic and periplasmic chaperones. Moreover, periplasmic chaperones and proteases can be manipulated to increase the yields of secreted proteins. In this article, we attempted to review cytoplasmic chaperones such as Hsp families and periplasmic chaperones including; generic chaperones, specialized chaperones, PPIases, and proteins involved in disulfide bond formation. Copyright © 2017 Elsevier B.V. All rights reserved.

Current trends in chaperone use by plastic and reconstructive surgeons.

Science.gov (United States)

Choudry, Umar; Barta, Ruth J; Kim, Nicholas

2013-06-01

There is a paucity of literature regarding the use of chaperones by surgeons when examining patients. Use of a chaperone not only makes the patient comfortable but also potentially protects the surgeon from perceived misconduct. This is especially true for plastic surgeons who examine sensitive areas commonly. The purpose of this study was to determine the current trends in chaperone use by plastic surgeons when examining patients. A 23-question online survey was sent to all members of the American Society of Plastic Surgeons. Data collected online were analyzed using Student t test and Pearson χ test. A P use by plastic surgeons during all examinations of patients was 30%. This rate increased up to 60% while examining sensitive areas. Male surgeons reported a higher frequency of chaperone use than female surgeons (P use compared to reconstructive surgeons (P = 0.001). Similarly, surgeons who had been in practice for more than 20 years reported a higher rate of chaperone use compared to surgeons in practice for less than 20 years (P = 0.032). Sixty-one (7.6%; 56 male and 5 female) surgeons reported being accused of inappropriate behavior by patients, of whom 49 (80%) did not have a chaperone present. There was no significant difference among male and female surgeons in rates of being accused of inappropriate behavior (7.9% vs 4.2%, P = 0.19). There was a higher rate of chaperone use by male plastic surgeons, surgeons with more than 20 years experience, and cosmetic surgeons. Despite the difference in chaperone use between the sexes, both had similar rates of being accused of inappropriate behavior during examinations by patients, and although these incidents were quite low, most had no chaperone present during those examinations.

The use of a chaperone in obstetrical and gynaecological practice.

LENUS (Irish Health Repository)

Afaneh, I

2012-02-01

The aim of this study was to assess the use of a chaperone in obstetrical and gynaecological practice in Ireland and to explore patients\\' opinions. Two questionnaires were designed; one for patients and the other one was sent to 145 gynaecologists in Ireland. One hundred and fifty two women took part in this survey of whom 74 were gynaecological and 78 were obstetric patients. Ninety five (65%) patients felt no need for a chaperone during a vaginal examination (VE) by a male doctor. On the other hand 34 (23%) participating women would request a chaperone if being examined by a female doctor. Among clinicians 116 (80%) responded by returning the questionnaire. Overall 60 (52%) always used a chaperone in public practice, in contrast to 24 (27%) in private practice. The study demonstrated that most patients do not wish to have a chaperone during a VE but a small proportion would still request one regardless of the examiner\\'s gender. Patients should be offered the choice of having a chaperone and their opinion should be respected and documented.

The use of a chaperone in obstetrical and gynaecological practice.

LENUS (Irish Health Repository)

Afaneh, I

2010-05-01

The aim of this study was to assess the use of a chaperone in obstetrical and gynaecological practice in Ireland and to explore patients\\' opinions. Two questionnaires were designed; one for patients and the other one was sent to 145 gynaecologists in Ireland. One hundred and fifty two women took part in this survey of whom 74 were gynaecological and 78 were obstetric patients. Ninety five (65%) patients felt no need for a chaperone during a vaginal examination (VE) by a male doctor. On the other hand 34 (23%) participating women would request a chaperone if being examined by a female doctor. Among clinicians 116 (80%) responded by returning the questionnaire. Overall 60 (52%) always used a chaperone in public practice, in contrast to 24 (27%) in private practice. The study demonstrated that most patients do not wish to have a chaperone during a VE but a small proportion would still request one regardless of the examiner\\'s gender. Patients should be offered the choice of having a chaperone and their opinion should be respected and documented.

Biologic activities of molecular chaperones and pharmacologic chaperone imidazole-containing dipeptide-based compounds: natural skin care help and the ultimate challenge: implication for adaptive responses in the skin.

Science.gov (United States)

Babizhayev, Mark A; Nikolayev, Gennady M; Nikolayeva, Juliana G; Yegorov, Yegor E

2012-03-01

Accumulation of molecular damage and increased molecular heterogeneity are hallmarks of photoaged skin and pathogenesis of human cutaneous disease. Growing evidence demonstrates the ability of molecular chaperone proteins and of pharmacologic chaperones to decrease the environmental stress and ameliorate the oxidation stress-related and glycation disease phenotypes, suggesting that the field of chaperone therapy might hold novel treatments for skin diseases and aging. In this review, we examine the evidence suggesting a role for molecular chaperone proteins in the skin and their inducer and protecting agents: pharmacologic chaperone imidazole dipeptide-based agents (carcinine and related compounds) in cosmetics and dermatology. Furthermore, we discuss the use of chaperone therapy for the treatment of skin photoaging diseases and other skin pathologies that have a component of increased glycation and/or free radical-induced oxidation in their genesis. We examine biologic activities of molecular and pharmacologic chaperones, including strategies for identifying potential chaperone compounds and for experimentally demonstrating chaperone activity in in vitro and in vivo models of human skin disease. This allows the protein to function and traffic to the appropriate location in the skin, thereby increasing protein activity and cellular function and reducing stress on skin cells. The benefits of imidazole dipeptide antioxidants with transglycating activity (such as carcinine) in skin care are that they help protect and repair cell membrane damage and help retain youthful, younger-looking skin. All skin types will benefit from daily, topical application of pharmacologic chaperone antioxidants, anti-irritants, in combination with water-binding protein agents that work to mimic the structure and function of healthy skin. General strategies are presented addressing ground techniques to improve absorption of usually active chaperone proteins and dipeptide compounds, include

Applying chaperones to protein-misfolding disorders: molecular chaperones against α-synuclein in Parkinson's disease.

Science.gov (United States)

Chaari, Ali; Hoarau-Véchot, Jessica; Ladjimi, Moncef

2013-09-01

Parkinson's disease (PD) is a neurodegenerative disorder characterized by the accumulation of a protein called α-synuclein (α-syn) into inclusions known as lewy bodies (LB) within neurons. This accumulation is also due to insufficient formation and activity of dopamine produced in certain neurons within the substantia nigra. Lewy bodies are the pathological hallmark of the idiopathic disorder and the cascade that allows α-synuclein to misfold, aggregate and form these inclusions has been the subject of intensive research. Targeting these early steps of oligomerization is one of the main therapeutic approaches in order to develop neurodegenerative-modifying agents. Because the folding and refolding of alpha synuclein is the key point of this cascade, we are interested in this review to summarize the role of some molecular chaperones proteins such as Hsp70, Hsp90 and small heat shock proteins (sHsp) and Hsp 104. Hsp70 and its co-chaperone, Hsp70 and small heat shock proteins can prevent neurodegeneration by preventing α-syn misfolding, oligomerization and aggregation in vitro and in Parkinson disease animal models. Hsp104 is able to resolve disordered protein aggregates and cross beta amyloid conformers. Together, these chaperones have a complementary effect and can be a target for therapeutic intervention in PD. Published by Elsevier B.V.

Chaperones and the Proteasome System: Regulating the Construction and Demolition of Striated Muscle

Directory of Open Access Journals (Sweden)

Casey Carlisle

2017-12-01

Full Text Available Protein folding factors (chaperones are required for many diverse cellular functions. In striated muscle, chaperones are required for contractile protein function, as well as the larger scale assembly of the basic unit of muscle, the sarcomere. The sarcomere is complex and composed of hundreds of proteins and the number of proteins and processes recognized to be regulated by chaperones has increased dramatically over the past decade. Research in the past ten years has begun to discover and characterize the chaperones involved in the assembly of the sarcomere at a rapid rate. Because of the dynamic nature of muscle, wear and tear damage is inevitable. Several systems, including chaperones and the ubiquitin proteasome system (UPS, have evolved to regulate protein turnover. Much of our knowledge of muscle development focuses on the formation of the sarcomere but recent work has begun to elucidate the requirement and role of chaperones and the UPS in sarcomere maintenance and disease. This review will cover the roles of chaperones in sarcomere assembly, the importance of chaperone homeostasis and the cooperation of chaperones and the UPS in sarcomere integrity and disease.

The Role of Co-chaperones in Synaptic Proteostasis and Neurodegenerative Disease

Directory of Open Access Journals (Sweden)

Erica L. Gorenberg

2017-05-01

Full Text Available Synapses must be preserved throughout an organism's lifespan to allow for normal brain function and behavior. Synapse maintenance is challenging given the long distances between the termini and the cell body, reliance on axonal transport for delivery of newly synthesized presynaptic proteins, and high rates of synaptic vesicle exo- and endocytosis. Hence, synapses rely on efficient proteostasis mechanisms to preserve their structure and function. To this end, the synaptic compartment has specific chaperones to support its functions. Without proper synaptic chaperone activity, local proteostasis imbalances lead to neurotransmission deficits, dismantling of synapses, and neurodegeneration. In this review, we address the roles of four synaptic chaperones in the maintenance of the nerve terminal, as well as their genetic links to neurodegenerative disease. Three of these are Hsp40 co-chaperones (DNAJs: Cysteine String Protein alpha (CSPα; DNAJC5, auxilin (DNAJC6, and Receptor-Mediated Endocytosis 8 (RME-8; DNAJC13. These co-chaperones contain a conserved J domain through which they form a complex with heat shock cognate 70 (Hsc70, enhancing the chaperone's ATPase activity. CSPα is a synaptic vesicle protein known to chaperone the t-SNARE SNAP-25 and the endocytic GTPase dynamin-1, thereby regulating synaptic vesicle exocytosis and endocytosis. Auxilin binds assembled clathrin cages, and through its interactions with Hsc70 leads to the uncoating of clathrin-coated vesicles, a process necessary for the regeneration of synaptic vesicles. RME-8 is a co-chaperone on endosomes and may have a role in clathrin-coated vesicle endocytosis on this organelle. These three co-chaperones maintain client function by preserving folding and assembly to prevent client aggregation, but they do not break down aggregates that have already formed. The fourth synaptic chaperone we will discuss is Heat shock protein 110 (Hsp110, which interacts with Hsc70, DNAJAs, and

Probing the Inhibitor versus Chaperone Properties of sp2-Iminosugars towards Human β-Glucocerebrosidase: A Picomolar Chaperone for Gaucher Disease

Directory of Open Access Journals (Sweden)

Teresa Mena-Barragán

2018-04-01

Full Text Available A series of sp2-iminosugar glycomimetics differing in the reducing or nonreducing character, the configurational pattern (d-gluco or l-ido, the architecture of the glycone skeleton, and the nature of the nonglycone substituent has been synthesized and assayed for their inhibition properties towards commercial glycosidases. On the basis of their affinity and selectivity towards GH1 β-glucosidases, reducing and nonreducing bicyclic derivatives having a hydroxylation profile of structural complementarity with d-glucose and incorporating an N′-octyl-isourea or -isothiourea segment were selected for further evaluation of their inhibitory/chaperoning potential against human glucocerebrosidase (GCase. The 1-deoxynojirimycin (DNJ-related nonreducing conjugates behaved as stronger GCase inhibitors than the reducing counterparts and exhibited potent chaperoning capabilities in Gaucher fibroblasts hosting the neuronopathic G188S/G183W mutation, the isothiourea derivative being indeed one of the most efficient chaperone candidates reported up to date (70% activity enhancement at 20 pM. At their optimal concentration, the four selected compounds promoted mutant GCase activity enhancements over 3-fold; yet, the inhibitor/chaperoning balance became unfavorable at much lower concentration for nonreducing as compared to reducing derivatives.

Chaperone use during intimate examinations in primary care: postal survey of family physicians

Directory of Open Access Journals (Sweden)

Upshur Ross EG

2005-12-01

Full Text Available Abstract Background Physicians have long been advised to have a third party present during certain parts of a physical examination; however, little is known about the frequency of chaperone use for those specific intimate examinations regularly performed in primary care. We aimed to determine the frequency of chaperone use among family physicians across a variety of intimate physical examinations for both male and female patients, and also to identify the factors associated with chaperone use. Methods Questionnaires were mailed to a randomly selected sample of 500 Ontario members of the College of Family Physicians of Canada. Participants were asked about their use of chaperones when performing a variety of intimate examinations, namely female pelvic, breast, and rectal exams and male genital and rectal exams. Results 276 of 500 were returned (56%, of which 257 were useable. Chaperones were more commonly used with female patients than with males (t = 9.09 [df = 249], p Conclusion Clinical practice concerning the use of chaperones during intimate exams continues to be discordant with the recommendations of medical associations and medico-legal societies. Chaperones are used by only a minority of Ontario family physicians. Chaperone use is higher for examinations of female patients than of male patients and is highest for female pelvic exams. The availability of a nurse in the clinic to act as a chaperone is associated with more frequent use of chaperones.

Design of Bus Protocol Intelligent Initiation System Based On RS485

Directory of Open Access Journals (Sweden)

Li Liming

2017-01-01

Full Text Available In order to design an effective and reliable RS485 bus protocol based on RS485 bus, this paper introduces the structure and transmission mode of the command frame and the response frame, and also introduce four control measures and the communication in order to process quality of this system. The communication protocol is open, tolerant, reliable and fast, and can realize ignition more reliable and accurate in the intelligent initiation system.

Endoplasmic reticulum chaperones and their roles in the immunogenicity of cancer vaccines

Directory of Open Access Journals (Sweden)

Michael William Graner

2015-01-01

Full Text Available The endoplasmic reticulum (ER is a major site of passage for proteins en route to other organelles, to the cell surface, and to the extracellular space. It is also the transport route for peptides generated in the cytosol by the proteasome into the ER for loading onto major histocompatibility complex class I (MHC I molecules for eventual antigen presentation at the cell surface. Chaperones within the ER are critical for many of these processes; however, outside the ER certain of those chaperones may play important and direct roles in immune responses. In some cases, particular ER chaperones have been utilized as vaccines against tumors or infectious disease pathogens when purified from tumor tissue or recombinantly generated and loaded with antigen. In other cases, the cell surface location of ER chaperones has implications for immune responses as well as possible tumor resistance. We have produced heat shock protein/chaperone protein-based cancer vaccines called CRCL (Chaperone-Rich Cell Lysate that are conglomerates of chaperones enriched from solid tumors by an isoelectric focusing technique. These preparations have been effective against numerous murine tumors, as well as in a canine with an advanced lung carcinoma treated with autologous CRCL. We also published extensive proteomic analyses of CRCL prepared from human surgically-resected tumor samples. Of note, these preparations contained at least ten ER chaperones and a number of other residents, along with many other chaperones/heat shock proteins. Gene ontology and network analyses utilizing these proteins essentially recapitulate the antigen presentation pathways and interconnections. In conjunction with our current knowledge of cell surface/extracellular ER chaperones, these data collectively suggest that a systems-level view may provide insight into the potent immune stimulatory activities of CRCL with an emphasis on the roles of ER components in those processes.

The crystal structure of the human co-chaperone P58(IPK.

Directory of Open Access Journals (Sweden)

Maria Svärd

Full Text Available P58(IPK is one of the endoplasmic reticulum- (ER- localised DnaJ (ERdj proteins which interact with the chaperone BiP, the mammalian ER ortholog of Hsp70, and are thought to contribute to the specificity and regulation of its diverse functions. P58(IPK, expression of which is upregulated in response to ER stress, has been suggested to act as a co-chaperone, binding un- or misfolded proteins and delivering them to BiP. In order to give further insights into the functions of P58(IPK, and the regulation of BiP by ERdj proteins, we have determined the crystal structure of human P58(IPK to 3.0 Å resolution using a combination of molecular replacement and single wavelength anomalous diffraction. The structure shows the human P58(IPK monomer to have a very elongated overall shape. In addition to the conserved J domain, P58(IPK contains nine N-terminal tetratricopeptide repeat motifs, divided into three subdomains of three motifs each. The J domain is attached to the C-terminal end via a flexible linker, and the structure shows the conserved Hsp70-binding histidine-proline-aspartate (HPD motif to be situated on the very edge of the elongated protein, 100 Å from the putative binding site for unfolded protein substrates. The residues that comprise the surface surrounding the HPD motif are highly conserved in P58(IPK from other organisms but more varied between the human ERdj proteins, supporting the view that their regulation of different BiP functions is facilitated by differences in BiP-binding.

Polypeptide binding properties of the chaperone calreticulin

DEFF Research Database (Denmark)

Jørgensen, C S; Heegaard, N H; Holm, A

2000-01-01

Calreticulin is a highly conserved eukaryotic ubiquitious protein located mainly in the endoplasmic reticulum. Two major characteristics of calreticulin are its chaperone activity and its lectin properties, but its precise function in intracellular protein and peptide processing remains to be elu......Calreticulin is a highly conserved eukaryotic ubiquitious protein located mainly in the endoplasmic reticulum. Two major characteristics of calreticulin are its chaperone activity and its lectin properties, but its precise function in intracellular protein and peptide processing remains...

RNAi-Mediated Reverse Genetic Screen Identified Drosophila Chaperones Regulating Eye and Neuromuscular Junction Morphology

Directory of Open Access Journals (Sweden)

Sandeep Raut

2017-07-01

Full Text Available Accumulation of toxic proteins in neurons has been linked with the onset of neurodegenerative diseases, which in many cases are characterized by altered neuronal function and synapse loss. Molecular chaperones help protein folding and the resolubilization of unfolded proteins, thereby reducing the protein aggregation stress. While most of the chaperones are expressed in neurons, their functional relevance remains largely unknown. Here, using bioinformatics analysis, we identified 95 Drosophila chaperones and classified them into seven different classes. Ubiquitous actin5C-Gal4-mediated RNAi knockdown revealed that ∼50% of the chaperones are essential in Drosophila. Knocking down these genes in eyes revealed that ∼30% of the essential chaperones are crucial for eye development. Using neuron-specific knockdown, immunocytochemistry, and robust behavioral assays, we identified a new set of chaperones that play critical roles in the regulation of Drosophila NMJ structural organization. Together, our data present the first classification and comprehensive analysis of Drosophila chaperones. Our screen identified a new set of chaperones that regulate eye and NMJ morphogenesis. The outcome of the screen reported here provides a useful resource for further elucidating the role of individual chaperones in Drosophila eye morphogenesis and synaptic development.

Hsp100/ClpB Chaperone Function and Mechanism

Energy Technology Data Exchange (ETDEWEB)

Vierling, Elizabeth [Univ. of Massachusetts, Amherst, MA (United States). Dept. of Biochemistry and Molecular Biology

2015-01-27

The supported research investigated the mechanism of action of a unique class of molecular chaperones in higher plants, the Hsp100/ClpB proteins, with the ultimate goal of defining how these chaperones influence plant growth, development, stress tolerance and productivity. Molecular chaperones are essential effectors of cellular “protein quality control”, which comprises processes that ensure the proper folding, localization, activation and turnover of proteins. Hsp100/ClpB proteins are required for temperature acclimation in plants, optimal seed yield, and proper chloroplast development. The model plant Arabidopsis thaliana and genetic and molecular approaches were used to investigate two of the three members of the Hsp100/ClpB proteins in plants, cytosolic AtHsp101 and chloroplast-localized AtClpB-p. Investigating the chaperone activity of the Hsp100/ClpB proteins addresses DOE goals in that this activity impacts how “plants generate and assemble components” as well as “allowing for their self repair”. Additionally, Hsp100/ClpB protein function in plants is directly required for optimal “utilization of biological energy” and is involved in “mechanisms that control the architecture of energy transduction systems”.

Effect of glycation on α-crystallin structure and chaperone-like function

Science.gov (United States)

Kumar, P. Anil; Kumar, M. Satish; Reddy, G. Bhanuprakash

2007-01-01

The chaperone-like activity of α-crystallin is considered to play an important role in the maintenance of the transparency of the eye lens. However, in the case of aging and in diabetes, the chaperone function of α-crystallin is compromized, resulting in cataract formation. Several post-translational modifications, including non-enzymatic glycation, have been shown to affect the chaperone function of α-crystallin in aging and in diabetes. A variety of agents have been identified as the predominant sources for the formation of AGEs (advanced glycation end-products) in various tissues, including the lens. Nevertheless, glycation of α-crystallin with various sugars has resulted in divergent results. In the present in vitro study, we have investigated the effect of glucose, fructose, G6P (glucose 6-phosphate) and MGO (methylglyoxal), which represent the major classes of glycating agents, on the structure and chaperone function of α-crystallin. Modification of α-crystallin with all four agents resulted in the formation of glycated protein, increased AGE fluorescence, protein cross-linking and HMM (high-molecular-mass) aggregation. Interestingly, these glycation-related profiles were found to vary with different glycating agents. For instance, CML [Nϵ-(carboxymethyl)lysine] was the predominant AGE formed upon glycation of α-crystallin with these agents. Although fructose and MGO caused significant conformational changes, there were no significant structural perturbations with glucose and G6P. With the exception of MGO modification, glycation with other sugars resulted in decreased chaperone activity in aggregation assays. However, modification with all four sugars led to the loss of chaperone activity as assessed using an enzyme inactivation assay. Glycation-induced loss of α-crystallin chaperone activity was associated with decreased hydrophobicity. Furthermore, α-crystallin isolated from glycated TSP (total lens soluble protein) had also increased AGE

Structural Bioinformatics and Protein Docking Analysis of the Molecular Chaperone-Kinase Interactions: Towards Allosteric Inhibition of Protein Kinases by Targeting the Hsp90-Cdc37 Chaperone Machinery

Directory of Open Access Journals (Sweden)

Gennady Verkhivker

2013-11-01

Full Text Available A fundamental role of the Hsp90-Cdc37 chaperone system in mediating maturation of protein kinase clients and supporting kinase functional activity is essential for the integrity and viability of signaling pathways involved in cell cycle control and organism development. Despite significant advances in understanding structure and function of molecular chaperones, the molecular mechanisms and guiding principles of kinase recruitment to the chaperone system are lacking quantitative characterization. Structural and thermodynamic characterization of Hsp90-Cdc37 binding with protein kinase clients by modern experimental techniques is highly challenging, owing to a transient nature of chaperone-mediated interactions. In this work, we used experimentally-guided protein docking to probe the allosteric nature of the Hsp90-Cdc37 binding with the cyclin-dependent kinase 4 (Cdk4 kinase clients. The results of docking simulations suggest that the kinase recognition and recruitment to the chaperone system may be primarily determined by Cdc37 targeting of the N-terminal kinase lobe. The interactions of Hsp90 with the C-terminal kinase lobe may provide additional “molecular brakes” that can lock (or unlock kinase from the system during client loading (release stages. The results of this study support a central role of the Cdc37 chaperone in recognition and recruitment of the kinase clients. Structural analysis may have useful implications in developing strategies for allosteric inhibition of protein kinases by targeting the Hsp90-Cdc37 chaperone machinery.

The heat-shock protein/chaperone network and multiple stress resistance.

Science.gov (United States)

Jacob, Pierre; Hirt, Heribert; Bendahmane, Abdelhafid

2017-04-01

Crop yield has been greatly enhanced during the last century. However, most elite cultivars are adapted to temperate climates and are not well suited to more stressful conditions. In the context of climate change, stress resistance is a major concern. To overcome these difficulties, scientists may help breeders by providing genetic markers associated with stress resistance. However, multistress resistance cannot be obtained from the simple addition of single stress resistance traits. In the field, stresses are unpredictable and several may occur at once. Consequently, the use of single stress resistance traits is often inadequate. Although it has been historically linked with the heat stress response, the heat-shock protein (HSP)/chaperone network is a major component of multiple stress responses. Among the HSP/chaperone 'client proteins', many are primary metabolism enzymes and signal transduction components with essential roles for the proper functioning of a cell. HSPs/chaperones are controlled by the action of diverse heat-shock factors, which are recruited under stress conditions. In this review, we give an overview of the regulation of the HSP/chaperone network with a focus on Arabidopsis thaliana. We illustrate the role of HSPs/chaperones in regulating diverse signalling pathways and discuss several basic principles that should be considered for engineering multiple stress resistance in crops through the HSP/chaperone network. © 2016 The Authors. Plant Biotechnology Journal published by Society for Experimental Biology and The Association of Applied Biologists and John Wiley & Sons Ltd.

Chaperones and intimate physical examinations: what do male and female patients want?

Science.gov (United States)

Fan, V C; Choy, H T; Kwok, G Yj; Lam, H G; Lim, Q Y; Man, Y Y; Tang, C K; Wong, C C; Yu, Y F; Leung, G Kk

2017-02-01

Many studies of patients' perception of a medical chaperone have focused on female patients; that of male patients are less well studied. Moreover, previous studies were largely based on patient populations in English-speaking countries. Therefore, this study was conducted to investigate the perception and attitude of male and female Chinese patients to the presence of a chaperone during an intimate physical examination. A cross-sectional guided questionnaire survey was conducted on a convenient sample of 150 patients at a public teaching hospital in Hong Kong. Over 90% of the participants considered the presence of a chaperone appropriate during intimate physical examination, and 84% felt that doctors, irrespective of gender, should always request the presence of a chaperone. The most commonly cited reasons included the availability of an objective account should any legal issue arise, protection against sexual harassment, and to provide psychological support. This contrasted with the experience of those who had previously undergone an intimate physical examination of whom only 72.6% of women and 35.7% of men had reportedly been chaperoned. Among female participants, 75.0% preferred to be chaperoned during an intimate physical examination by a male doctor, and 28.6% would still prefer to be chaperoned when being examined by a female doctor. Among male participants, over 50% indicated no specific preference but a substantial minority reported a preference for chaperoned examination (21.2% for male doctor and 25.8% for female doctor). Patients in Hong Kong have a high degree of acceptance and expectations about the role of a medical chaperone. Both female and male patients prefer such practice regardless of physician gender. Doctors are strongly encouraged to discuss the issue openly with their patients before they conduct any intimate physical examination.

RNA chaperoning and intrinsic disorder in the core proteins of Flaviviridae.

Science.gov (United States)

Ivanyi-Nagy, Roland; Lavergne, Jean-Pierre; Gabus, Caroline; Ficheux, Damien; Darlix, Jean-Luc

2008-02-01

RNA chaperone proteins are essential partners of RNA in living organisms and viruses. They are thought to assist in the correct folding and structural rearrangements of RNA molecules by resolving misfolded RNA species in an ATP-independent manner. RNA chaperoning is probably an entropy-driven process, mediated by the coupled binding and folding of intrinsically disordered protein regions and the kinetically trapped RNA. Previously, we have shown that the core protein of hepatitis C virus (HCV) is a potent RNA chaperone that can drive profound structural modifications of HCV RNA in vitro. We now examined the RNA chaperone activity and the disordered nature of core proteins from different Flaviviridae genera, namely that of HCV, GBV-B (GB virus B), WNV (West Nile virus) and BVDV (bovine viral diarrhoea virus). Despite low-sequence similarities, all four proteins demonstrated general nucleic acid annealing and RNA chaperone activities. Furthermore, heat resistance of core proteins, as well as far-UV circular dichroism spectroscopy suggested that a well-defined 3D protein structure is not necessary for core-induced RNA structural rearrangements. These data provide evidence that RNA chaperoning-possibly mediated by intrinsically disordered protein segments-is conserved in Flaviviridae core proteins. Thus, besides nucleocapsid formation, core proteins may function in RNA structural rearrangements taking place during virus replication.

Improving three-tier environmental assessment model by using a 3D scanning FLS-AM series hyperspectral lidar

Science.gov (United States)

Samberg, Andre; Babichenko, Sergei; Poryvkina, Larisa

2005-05-01

Delay between the time when natural disaster, for example, oil accident in coastal water, occurred and the time when environmental protection actions, for example, water and shoreline clean-up, started is of significant importance. Mostly remote sensing techniques are considered as (near) real-time and suitable for multiple tasks. These techniques in combination with rapid environmental assessment methodologies would form multi-tier environmental assessment model, which allows creating (near) real-time datasets and optimizing sampling scenarios. This paper presents the idea of three-tier environmental assessment model. Here all three tiers are briefly described to show the linkages between them, with a particular focus on the first tier. Furthermore, it is described how large-scale environmental assessment can be improved by using an airborne 3-D scanning FLS-AM series hyperspectral lidar. This new aircraft-based sensor is typically applied for oil mapping on sea/ground surface and extracting optical features of subjects. In general, a sampling network, which is based on three-tier environmental assessment model, can include ship(s) and aircraft(s). The airborne 3-D scanning FLS-AM series hyperspectral lidar helps to speed up the whole process of assessing of area of natural disaster significantly, because this is a real-time remote sensing mean. For instance, it can deliver such information as georeferenced oil spill position in WGS-84, the estimated size of the whole oil spill, and the estimated amount of oil in seawater or on ground. All information is produced in digital form and, thus, can be directly transferred into a customer"s GIS (Geographical Information System) system.

Chaperone activity of human small heat shock protein-GST fusion proteins.

Science.gov (United States)

Arbach, Hannah; Butler, Caley; McMenimen, Kathryn A

2017-07-01

Small heat shock proteins (sHsps) are a ubiquitous part of the machinery that maintains cellular protein homeostasis by acting as molecular chaperones. sHsps bind to and prevent the aggregation of partially folded substrate proteins in an ATP-independent manner. sHsps are dynamic, forming an ensemble of structures from dimers to large oligomers through concentration-dependent equilibrium dissociation. Based on structural studies and mutagenesis experiments, it is proposed that the dimer is the smallest active chaperone unit, while larger oligomers may act as storage depots for sHsps or play additional roles in chaperone function. The complexity and dynamic nature of their structural organization has made elucidation of their chaperone function challenging. HspB1 and HspB5 are two canonical human sHsps that vary in sequence and are expressed in a wide variety of tissues. In order to determine the role of the dimer in chaperone activity, glutathione-S-transferase (GST) was genetically linked as a fusion protein to the N-terminus regions of both HspB1 and HspB5 (also known as Hsp27 and αB-crystallin, respectively) proteins in order to constrain oligomer formation of HspB1 and HspB5, by using GST, since it readily forms a dimeric structure. We monitored the chaperone activity of these fusion proteins, which suggest they primarily form dimers and monomers and function as active molecular chaperones. Furthermore, the two different fusion proteins exhibit different chaperone activity for two model substrate proteins, citrate synthase (CS) and malate dehydrogenase (MDH). GST-HspB1 prevents more aggregation of MDH compared to GST-HspB5 and wild type HspB1. However, when CS is the substrate, both GST-HspB1 and GST-HspB5 are equally effective chaperones. Furthermore, wild type proteins do not display equal activity toward the substrates, suggesting that each sHsp exhibits different substrate specificity. Thus, substrate specificity, as described here for full-length GST

Study of receptor-chaperone interactions using the optical technique of spectroscopic ellipsometry.

Science.gov (United States)

Kriechbaumer, Verena; Tsargorodskaya, Anna; Mustafa, Mohd K; Vinogradova, Tatiana; Lacey, Joanne; Smith, David P; Abell, Benjamin M; Nabok, Alexei

2011-07-20

This work describes a detailed quantitative interaction study between the novel plastidial chaperone receptor OEP61 and isoforms of the chaperone types Hsp70 and Hsp90 using the optical method of total internal reflection ellipsometry (TIRE). The receptor OEP61 was electrostatically immobilized on a gold surface via an intermediate layer of polycations. The TIRE measurements allowed the evaluation of thickness changes in the adsorbed molecular layers as a result of chaperone binding to receptor proteins. Hsp70 chaperone isoforms but not Hsp90 were shown to be capable of binding OEP61. Dynamic TIRE measurements were carried out to evaluate the affinity constants of the above reactions and resulted in clear discrimination between specific and nonspecific binding of chaperones as well as differences in binding properties between the highly similar Hsp70 isoforms. Copyright © 2011 Biophysical Society. Published by Elsevier Inc. All rights reserved.

The RS-485 communication system design of the waste steel radioactivity detector system

International Nuclear Information System (INIS)

Zhang Yongli

2014-01-01

The importance and schematic structure of the waste steel radioactivity detector system is given firstly in this paper, and then the RS-485 communication system design including the circuit and program of the waste steel radioactivity detector system is provided. The test result of RS-485 communication system is also introduced, that shows the design completely meets the requirements of the waste steel radioactivity detector system. (author)

Effect of hesperetin on chaperone activity in selenite-induced cataract

Directory of Open Access Journals (Sweden)

Nakazawa Yosuke

2016-01-01

Full Text Available Background. Chaperone activity of α-crystallin in the lens works to prevent protein aggregation and is important to maintain the lens transparency. This study evaluated the effect of hesperetin on lens chaperone activity in selenite-induced cataracts. Methodology. Thirteen-day-old rats were divided into four groups. Animals were given hesperetin (groups G2 and G4 or vehicle (G1 and G3 on Days 0, 1, and 2. Rats in G3 and G4 were administered selenite subcutaneously 4 hours after the first hesperetin injection. On Days 2, 4, and 6, cataract grades were evaluated using slit-lamp biomicroscopy. The amount of a-crystallin and chaperone activity in water-soluble fraction were measured after animals sacrificed. Results. G3 on day 4 had developed significant cataract, as an average cataract grading of 4.6 ± 0.2. In contrast, G4 had less severe central opacities and lower stage cataracts than G3, as an average cataract grading of 2.4 ± 0.4. The a-crystallin levels in G3 lenses were lower than in G1, but the same as G4. Additionally, chaperone activity was weaker in G3 lenses than G1, but the same as in G4. Conclusions. Our results suggest that hesperetin can prevent the decreasing lens chaperone activity and a-crystallin water solubility by administered of selenite.

Hsp90 molecular chaperone: structure, functions and participation in cardio-vascular pathologies

Directory of Open Access Journals (Sweden)

Kroupskaya I. V.

2009-10-01

Full Text Available The review is devoted to the analysis of structural and functional properties of molecular chaperon Hsp90. Hsp90 is a representative of highly widespread family of heat shock proteins. The protein is found in eubacteria and all branches of eukarya, but it is apparently absent in archaea. It is one of key regulators of numerous signalling pathways, cell growth and development, apoptosis, induction of autoimmunity, and progression of heart failure. The full functional activity of Hsp90 shows up in a complex with other molecular chaperones and co-chaperones. Molecular interactions between chaperones, different signalling proteins and protein-partners are highly crucial for the normal functioning of signalling pathways and their destruction causes an alteration in the cell physiology up to its death.

Transcription Factor SOX5 Promotes the Migration and Invasion of Fibroblast-Like Synoviocytes in Part by Regulating MMP-9 Expression in Collagen-Induced Arthritis

Directory of Open Access Journals (Sweden)

Yumeng Shi

2018-04-01

Full Text Available ObjectivesFibroblast-like synoviocytes (FLS exhibit a unique aggressive phenotype in rheumatoid arthritis (RA. Increased FLS migration and subsequent invasion of the extracellular matrix are essential to joint destruction in RA. Our previous research reported that transcription factor SOX5 was highly expressed in RA-FLS. Here, the effects of SOX5 in RA-FLS migration and invasion will be investigated.MethodsThe migration and invasion of RA-FLS were evaluated using a transwell chamber assay. The expression of several potential SOX5-targeted genes, including matrix metalloproteinases (MMP-1, 2, 3 and 9, chemokines (CCL4, CCL2, CCR5 and CCR2, and pro-inflammatory cytokines (TNF-α and IL-6, were examined in RA-FLS using SOX5 gain- and loss-of-function study. The molecular mechanisms of SOX5-mediated MMP-9 expressions were assayed by luciferase reporter gene and chromatin immunoprecipitation (ChIP studies. The in vivo effect of SOX5 on FLS migration and invasion was examined using collagen-induced arthritis (CIA in DBA/1J mice.ResultsKnockdown SOX5 decreased lamellipodium formation, migration, and invasion of RA-FLS. The expression of MMP-9 was the only gene tested to be concomitantly affected by silencing or overexpressing SOX5. ChIP assay revealed that SOX5 was bound to the MMP-9 promoter in RA-FLS. The overexpression of SOX5 markedly enhanced the MMP-9 promoter activity, and specific deletion of a putative SOX5-binding site in MMP-9 promoter diminished this promoter-driven transcription in FLS. Locally knocked down SOX5 inhibited MMP-9 expression in the joint tissue and reduced pannus migration and invasion into the cartilage in CIA mice.ConclusionSOX5 plays a novel role in mediating migration and invasion of FLS in part by regulating MMP-9 expression in RA.

Transcription Factor SOX5 Promotes the Migration and Invasion of Fibroblast-Like Synoviocytes in Part by Regulating MMP-9 Expression in Collagen-Induced Arthritis.

Science.gov (United States)

Shi, Yumeng; Wu, Qin; Xuan, Wenhua; Feng, Xiaoke; Wang, Fang; Tsao, Betty P; Zhang, Miaojia; Tan, Wenfeng

2018-01-01

Fibroblast-like synoviocytes (FLS) exhibit a unique aggressive phenotype in rheumatoid arthritis (RA). Increased FLS migration and subsequent invasion of the extracellular matrix are essential to joint destruction in RA. Our previous research reported that transcription factor SOX5 was highly expressed in RA-FLS. Here, the effects of SOX5 in RA-FLS migration and invasion will be investigated. The migration and invasion of RA-FLS were evaluated using a transwell chamber assay. The expression of several potential SOX5-targeted genes, including matrix metalloproteinases (MMP-1, 2, 3 and 9), chemokines (CCL4, CCL2, CCR5 and CCR2), and pro-inflammatory cytokines (TNF-α and IL-6), were examined in RA-FLS using SOX5 gain- and loss-of-function study. The molecular mechanisms of SOX5-mediated MMP-9 expressions were assayed by luciferase reporter gene and chromatin immunoprecipitation (ChIP) studies. The in vivo effect of SOX5 on FLS migration and invasion was examined using collagen-induced arthritis (CIA) in DBA/1J mice. Knockdown SOX5 decreased lamellipodium formation, migration, and invasion of RA-FLS. The expression of MMP-9 was the only gene tested to be concomitantly affected by silencing or overexpressing SOX5. ChIP assay revealed that SOX5 was bound to the MMP-9 promoter in RA-FLS. The overexpression of SOX5 markedly enhanced the MMP-9 promoter activity, and specific deletion of a putative SOX5-binding site in MMP-9 promoter diminished this promoter-driven transcription in FLS. Locally knocked down SOX5 inhibited MMP-9 expression in the joint tissue and reduced pannus migration and invasion into the cartilage in CIA mice. SOX5 plays a novel role in mediating migration and invasion of FLS in part by regulating MMP-9 expression in RA.

A study for the structural and functional regulation of chaperon protein by radiation

International Nuclear Information System (INIS)

Lee, Seung Sik; Chung, Byung Yeoup; Kim, Jin Hong

2011-01-01

The purpose of the this project provides new application areas for radiation technology for improvement of protein activities using radiation through the structural changes and functional regulations of molecular chaperon. Research scope includes 1) isolation of molecular chaperon proteins related radiation response from Psedomonads and purification of recombinant protein from E. coli., 2) the establishment of effective irradiation dose for the structural changes of chaperon protein, 3) analysis of the structural and functional changes of molecular chaperon by gamma irradiation. Main results are as follow: the chaperon activities of 2-Cys peroxiredxin show the maximum (about 3 times) at 15-30 kGy of gamma irradiation, but they were reduced greater than 30 kGy of gamma rays: the peroxidase activities show a tendency to decrease with increasing gamma irradiation: the structural change of peroxiredoxin (PP1084 and PA3529) by gamma irradiation (the formation of low molecular weight complexes or fragmentation of peroxiredoxin by gamma irradiation, the increase of beta-sheet and random coil by gamma irradiation and the decrease of alpha-helix and turn by gamma irradiation, and increased chaperon activity is related with increased hydrophobicity)

ATP-dependent molecular chaperones in plastids--More complex than expected.

Science.gov (United States)

Trösch, Raphael; Mühlhaus, Timo; Schroda, Michael; Willmund, Felix

2015-09-01

Plastids are a class of essential plant cell organelles comprising photosynthetic chloroplasts of green tissues, starch-storing amyloplasts of roots and tubers or the colorful pigment-storing chromoplasts of petals and fruits. They express a few genes encoded on their organellar genome, called plastome, but import most of their proteins from the cytosol. The import into plastids, the folding of freshly-translated or imported proteins, the degradation or renaturation of denatured and entangled proteins, and the quality-control of newly folded proteins all require the action of molecular chaperones. Members of all four major families of ATP-dependent molecular chaperones (chaperonin/Cpn60, Hsp70, Hsp90 and Hsp100 families) have been identified in plastids from unicellular algae to higher plants. This review aims not only at giving an overview of the most current insights into the general and conserved functions of these plastid chaperones, but also into their specific plastid functions. Given that chloroplasts harbor an extreme environment that cycles between reduced and oxidized states, that has to deal with reactive oxygen species and is highly reactive to environmental and developmental signals, it can be presumed that plastid chaperones have evolved a plethora of specific functions some of which are just about to be discovered. Here, the most urgent questions that remain unsolved are discussed, and guidance for future research on plastid chaperones is given. This article is part of a Special Issue entitled: Chloroplast Biogenesis. Copyright © 2015 Elsevier B.V. All rights reserved.

Dual inhibition of chaperoning process by taxifolin: molecular dynamics simulation study.

Science.gov (United States)

Verma, Sharad; Singh, Amit; Mishra, Abha

2012-07-01

Hsp90 (heat shock protein 90), a molecular chaperone, stabilizes more than 200 mutated and over expressed oncogenic proteins in cancer development. Cdc37 (cell division cycle protein 37), a co-chaperone of Hsp90, has been found to facilitate the maturation of protein kinases by acting as an adaptor and load these kinases onto the Hsp90 complex. Taxifolin (a natural phytochemical) was found to bind at ATP-binding site of Hsp90 and stabilized the inactive "open" or "lid-up" conformation as evidenced by molecular dynamic simulation. Furthermore, taxifolin was found to bind to interface of Hsp90 and Cdc37 complex and disrupt the interaction of residues of both proteins which were essential for the formation of active super-chaperone complex. Thus, taxifolin was found to act as an inhibitor of chaperoning process and may play a potential role in the cancer chemotherapeutics. Copyright © 2012 Elsevier Inc. All rights reserved.

Contributions of chaperone/usher systems to cell binding, biofilm formation and Yersinia pestis virulence.

Science.gov (United States)

Felek, Suleyman; Jeong, Jenny J; Runco, Lisa M; Murray, Susan; Thanassi, David G; Krukonis, Eric S

2011-03-01

Yersinia pestis genome sequencing projects have revealed six intact uncharacterized chaperone/usher systems with the potential to play roles in plague pathogenesis. We cloned each locus and expressed them in the Δfim Escherichia coli strain AAEC185 to test the assembled Y. pestis surface structures for various activities. Expression of each chaperone/usher locus gave rise to specific novel fibrillar structures on the surface of E. coli. One locus, y0561-0563, was able to mediate attachment to human epithelial cells (HEp-2) and human macrophages (THP-1) but not mouse macrophages (RAW264.7), while several loci were able to facilitate E. coli biofilm formation. When each chaperone/usher locus was deleted in Y. pestis, only deletion of the previously described pH 6 antigen (Psa) chaperone/usher system resulted in decreased adhesion and biofilm formation. Quantitative RT-PCR (qRT-PCR) revealed low expression levels for each novel chaperone/usher system in vitro as well as in mouse tissues following intravenous infection. However, a Y. pestis mutant in the chaperone/usher locus y1858-1862 was attenuated for virulence in mice via the intravenous route of infection, suggesting that expression of this locus is, at some stage, sufficient to affect the outcome of a plague infection. qRT-PCR experiments also indicated that expression of the chaperone/usher-dependent capsule locus, caf1, was influenced by oxygen availability and that the well-described chaperone/usher-dependent pilus, Psa, was strongly induced in minimal medium even at 28 °C rather than 37 °C, a temperature previously believed to be required for Psa expression. These data indicate several potential roles for the novel chaperone/usher systems of Y. pestis in pathogenesis and infection-related functions such as cell adhesion and biofilm formation.

Review: The HSP90 molecular chaperone-an enigmatic ATPase.

Science.gov (United States)

Pearl, Laurence H

2016-08-01

The HSP90 molecular chaperone is involved in the activation and cellular stabilization of a range of 'client' proteins, of which oncogenic protein kinases and nuclear steroid hormone receptors are of particular biomedical significance. Work over the last two decades has revealed a conformational cycle critical to the biological function of HSP90, coupled to an inherent ATPase activity that is regulated and manipulated by many of the co-chaperones proteins with which it collaborates. Pharmacological inhibition of HSP90 ATPase activity results in degradation of client proteins in vivo, and is a promising target for development of new cancer therapeutics. Despite this, the actual function that HSP90s conformationally-coupled ATPase activity provides in its biological role as a molecular chaperone remains obscure. © 2016 Wiley Periodicals, Inc. Biopolymers 105: 594-607, 2016. © 2016 The Authors. Biopolymers Published by Wiley Periodicals, Inc.

Peptide binding specificity of the chaperone calreticulin

DEFF Research Database (Denmark)

Sandhu, N.; Duus, K.; Jorgensen, C.S.

2007-01-01

Calreticulin is a molecular chaperone with specificity for polypeptides and N-linked monoglucosylated glycans. In order to determine the specificity of polypeptide binding, the interaction of calreticulin with polypeptides was investigated using synthetic peptides of different length and composit......Calreticulin is a molecular chaperone with specificity for polypeptides and N-linked monoglucosylated glycans. In order to determine the specificity of polypeptide binding, the interaction of calreticulin with polypeptides was investigated using synthetic peptides of different length...... than 5 amino acids showed binding and a clear correlation with hydrophobicity was demonstrated for oligomers of different hydrophobic amino acids. Insertion of hydrophilic amino acids in a hydrophobic sequence diminished or abolished binding. In conclusion our results show that calreticulin has...

42 CFR 485.56 - Condition of participation: Governing body and administration.

Science.gov (United States)

2010-10-01

...: SPECIALIZED PROVIDERS Conditions of Participation: Comprehensive Outpatient Rehabilitation Facilities § 485.56...: Institutional budget plan. The facility must have an institutional budget plan that meets the following...

The DnaK Chaperone Uses Different Mechanisms To Promote and Inhibit Replication of Vibrio cholerae Chromosome 2

Energy Technology Data Exchange (ETDEWEB)

Jha, Jyoti K.; Li, Mi; Ghirlando, Rodolfo; Miller Jenkins, Lisa M.; Wlodawer, Alexander; Chattoraj, Dhruba; Dunny, Gary M.

2017-04-18

promotes initiation by reducing the initiator’s propensity to dimerize. Dimerization of the initiator of the putative plasmid progenitor of Chr2 is also reduced by DnaK, which promotes initiation. Paradoxically, the DnaK binding also promotes replication inhibition by reducing an autoinhibitory activity of RctB. In the plasmid-to-chromosome transition, it appears that the initiator has acquired an autoinhibitory activity and along with it a new chaperone activity that apparently helps to control replication inhibition independently of replication promotion.

Quantitative analysis of the interplay between hsc70 and its co-chaperone HspBP1

Directory of Open Access Journals (Sweden)

Hicham Mahboubi

2015-12-01

Full Text Available Background. Chaperones and their co-factors are components of a cellular network; they collaborate to maintain proteostasis under normal and harmful conditions. In particular, hsp70 family members and their co-chaperones are essential to repair damaged proteins. Co-chaperones are present in different subcellular compartments, where they modulate chaperone activities.Methods and Results. Our studies assessed the relationship between hsc70 and its co-factor HspBP1 in human cancer cells. HspBP1 promotes nucleotide exchange on hsc70, but has also chaperone-independent functions. We characterized the interplay between hsc70 and HspBP1 by quantitative confocal microscopy combined with automated image analyses and statistical evaluation. Stress and the recovery from insult changed significantly the subcellular distribution of hsc70, but had little effect on HspBP1. Single-cell measurements and regression analysis revealed that the links between the chaperone and its co-factor relied on (i the physiological state of the cell and (ii the subcellular compartment. As such, we identified a linear relationship and strong correlation between hsc70 and HspBP1 distribution in control and heat-shocked cells; this correlation changed in a compartment-specific fashion during the recovery from stress. Furthermore, we uncovered significant stress-induced changes in the colocalization between hsc70 and HspBP1 in the nucleus and cytoplasm.Discussion. Our quantitative approach defined novel properties of the co-chaperone HspBP1 as they relate to its interplay with hsc70. We propose that changes in cell physiology promote chaperone redistribution and thereby stimulate chaperone-independent functions of HspBP1.

Transcription elongation factor GreA has functional chaperone activity.

Science.gov (United States)

Li, Kun; Jiang, Tianyi; Yu, Bo; Wang, Limin; Gao, Chao; Ma, Cuiqing; Xu, Ping; Ma, Yanhe

2012-01-01

Bacterial GreA is an indispensable factor in the RNA polymerase elongation complex. It plays multiple roles in transcriptional elongation, and may be implicated in resistance to various stresses. In this study, we show that Escherichia coli GreA inhibits aggregation of several substrate proteins under heat shock condition. GreA can also effectively promote the refolding of denatured proteins. These facts reveal that GreA has chaperone activity. Distinct from many molecular chaperones, GreA does not form stable complexes with unfolded substrates. GreA overexpression confers the host cells with enhanced resistance to heat shock and oxidative stress. Moreover, GreA expression in the greA/greB double mutant could suppress the temperature-sensitive phenotype, and dramatically alleviate the in vivo protein aggregation. The results suggest that bacterial GreA may act as chaperone in vivo. These results suggest that GreA, in addition to its function as a transcription factor, is involved in protection of cellular proteins against aggregation.

The conformational dynamics of the mitochondrial Hsp70 chaperone.

Science.gov (United States)

Mapa, Koyeli; Sikor, Martin; Kudryavtsev, Volodymyr; Waegemann, Karin; Kalinin, Stanislav; Seidel, Claus A M; Neupert, Walter; Lamb, Don C; Mokranjac, Dejana

2010-04-09

Heat shock proteins 70 (Hsp70) represent a ubiquitous and conserved family of molecular chaperones involved in a plethora of cellular processes. The dynamics of their ATP hydrolysis-driven and cochaperone-regulated conformational cycle are poorly understood. We used fluorescence spectroscopy to analyze, in real time and at single-molecule resolution, the effects of nucleotides and cochaperones on the conformation of Ssc1, a mitochondrial member of the family. We report that the conformation of its ADP state is unexpectedly heterogeneous, in contrast to a uniform ATP state. Substrates are actively involved in determining the conformation of Ssc1. The J protein Mdj1 does not interact transiently with the chaperone, as generally believed, but rather is released slowly upon ATP hydrolysis. Analysis of the major bacterial Hsp70 revealed important differences between highly homologous members of the family, possibly explaining tuning of Hsp70 chaperones to meet specific functions in different organisms and cellular compartments. 2010 Elsevier Inc. All rights reserved.

Chaperones ameliorate beta cell dysfunction associated with human islet amyloid polypeptide overexpression.

Directory of Open Access Journals (Sweden)

Lisa Cadavez

Full Text Available In type 2 diabetes, beta-cell dysfunction is thought to be due to several causes, one being the formation of toxic protein aggregates called islet amyloid, formed by accumulations of misfolded human islet amyloid polypeptide (hIAPP. The process of hIAPP misfolding and aggregation is one of the factors that may activate the unfolded protein response (UPR, perturbing endoplasmic reticulum (ER homeostasis. Molecular chaperones have been described to be important in regulating ER response to ER stress. In the present work, we evaluate the role of chaperones in a stressed cellular model of hIAPP overexpression. A rat pancreatic beta-cell line expressing hIAPP exposed to thapsigargin or treated with high glucose and palmitic acid, both of which are known ER stress inducers, showed an increase in ER stress genes when compared to INS1E cells expressing rat IAPP or INS1E control cells. Treatment with molecular chaperone glucose-regulated protein 78 kDa (GRP78, also known as BiP or protein disulfite isomerase (PDI, and chemical chaperones taurine-conjugated ursodeoxycholic acid (TUDCA or 4-phenylbutyrate (PBA, alleviated ER stress and increased insulin secretion in hIAPP-expressing cells. Our results suggest that the overexpression of hIAPP induces a stronger response of ER stress markers. Moreover, endogenous and chemical chaperones are able to ameliorate induced ER stress and increase insulin secretion, suggesting that improving chaperone capacity can play an important role in improving beta-cell function in type 2 diabetes.

Proteotoxicity is not the reason for the dependence of cancer cells on the major chaperone Hsp70.

Science.gov (United States)

Colvin, Teresa A; Gabai, Vladimir L; Sherman, Michael Y

2014-01-01

Several years ago a hypothesis was proposed that the survival of cancer cells depend on elevated expression of molecular chaperones because these cells are prone to proteotoxic stress. A critical prediction of this hypothesis is that depletion of chaperones in cancer cells should lead to proteotoxicity. Here, using the major chaperone Hsp70 as example, we demonstrate that its depletion does not trigger proteotoxic stress, thus refuting the model. Accordingly, other functions of chaperones, e.g., their role in cell signaling, might define the requirements for chaperones in cancer cells, which is critical for rational targeting Hsp70 in cancer treatment.

The chaperone like function of the nonhistone protein HMGB1

International Nuclear Information System (INIS)

Osmanov, Taner; Ugrinova, Iva; Pasheva, Evdokia

2013-01-01

Highlights: ► The HMGB1 protein strongly enhanced the formation of nucleosome particles. ► The target of HMGB1 action as a chaperone is the DNA not the histone octamer. ► The acetylation of HMGB1 decreases the stimulating effect of the protein. -- Abstract: Almost all essential nuclear processes as replication, repair, transcription and recombination require the chromatin template to be correctly unwound and than repackaged. The major strategy that the cell uses to overcome the nucleosome barrier is the proper removal of the histone octamer and subsequent deposition onto DNA. Important factors in this multi step phenomenon are the histone chaperones that can assemble nucleosome arrays in vitro in the absence of ATP. The nonhistone protein HMGB1 is a good candidate for a chaperone as its molecule consists of two DNA binding motives, Box’s A and B, and a long nonstructured C tail highly negatively charged. HMGB1 protein is known as a nuclear “architectural” factor for its property to bind preferentially to distorted DNA structures and was reported to kink the double helix. Our experiments show that in the classical stepwise dialysis method for nucleosome assembly the addition of HMGB1 protein stimulates more than two times the formation of middle-positioned nucleosomes. The stimulation effect persists in dialysis free experiment when the reconstitution is possible only in the presence of a chaperone. The addition of HMGB1 protein strongly enhanced the formation of a nucleosome in a dose dependant manner. Our results show that the target of HMGB1 action as a chaperone is the DNA fragment not the histone octamer. One possible explanation for the stimulating effect of HMGB1 is the “architectural” property of the protein to associate with the middle of the DNA fragment and to kink it. The acquired V shaped DNA structure is probably conformationals more favorable to wrap around the prefolded histone octamer. We tested also the role of the post

42 CFR 485.715 - Condition of participation: Speech pathology services.

Science.gov (United States)

2010-10-01

... 42 Public Health 5 2010-10-01 2010-10-01 false Condition of participation: Speech pathology... Agencies as Providers of Outpatient Physical Therapy and Speech-Language Pathology Services § 485.715 Condition of participation: Speech pathology services. If speech pathology services are offered, the...

42 CFR 485.713 - Condition of participation: Physical therapy services.

Science.gov (United States)

2010-10-01

... Agencies as Providers of Outpatient Physical Therapy and Speech-Language Pathology Services § 485.713 Condition of participation: Physical therapy services. If the organization offers physical therapy services... 42 Public Health 5 2010-10-01 2010-10-01 false Condition of participation: Physical therapy...

Multiscale Modeling of a Conditionally Disordered pH-Sensing Chaperone

OpenAIRE

Ahlstrom, Logan S.; Law, Sean M.; Dickson, Alex; Brooks, Charles L.

2015-01-01

The pH-sensing chaperone HdeA promotes the survival of enteropathogenic bacteria during transit through the harshly acidic environment of the mammalian stomach. At low pH, HdeA transitions from an inactive, folded, dimer to chaperone-active, disordered, monomers to protect against the acid-induced aggregation of periplasmic proteins. Toward achieving a detailed mechanistic understanding of the pH response of HdeA, we develop a multiscale modeling approach to capture its pH-dependent thermodyn...

Pharmacological chaperoning: a primer on mechanism and pharmacology.

Science.gov (United States)

Leidenheimer, Nancy J; Ryder, Katelyn G

2014-05-01

Approximately forty percent of diseases are attributable to protein misfolding, including those for which genetic mutation produces misfolding mutants. Intriguingly, many of these mutants are not terminally misfolded since native-like folding, and subsequent trafficking to functional locations, can be induced by target-specific, small molecules variably termed pharmacological chaperones, pharmacoperones, or pharmacochaperones (PCs). PC targets include enzymes, receptors, transporters, and ion channels, revealing the breadth of proteins that can be engaged by ligand-assisted folding. The purpose of this review is to provide an integrated primer of the diverse mechanisms and pharmacology of PCs. In this regard, we examine the structural mechanisms that underlie PC rescue of misfolding mutants, including the ability of PCs to act as surrogates for defective intramolecular interactions and, at the intermolecular level, overcome oligomerization deficiencies and dominant negative effects, as well as influence the subunit stoichiometry of heteropentameric receptors. Not surprisingly, PC-mediated structural correction of misfolding mutants normalizes interactions with molecular chaperones that participate in protein quality control and forward-trafficking. A variety of small molecules have proven to be efficacious PCs and the advantages and disadvantages of employing orthostatic antagonists, active-site inhibitors, orthostatic agonists, and allosteric modulator PCs are considered. Also examined is the possibility that several therapeutic agents may have unrecognized activity as PCs, and this chaperoning activity may mediate/contribute to therapeutic action and/or account for adverse effects. Lastly, we explore evidence that pharmacological chaperoning exploits intrinsic ligand-assisted folding mechanisms. Given the widespread applicability of PC rescue of mutants associated with protein folding disorders, both in vitro and in vivo, the therapeutic potential of PCs is vast

Molecular mechanisms used by chaperones to reduce the toxicity of aberrant protein oligomers

NARCIS (Netherlands)

Mannini, Benedetta; Cascella, Roberta; Zampagni, Mariagioia; Van Waarde-Verhagen, Maria; Meehan, Sarah; Roodveldt, Cintia; Campioni, Silvia; Boninsegna, Matilde; Penco, Amanda; Relini, Annalisa; Kampinga, Harm H.; Dobson, Christopher M.; Wilson, Mark R.; Cecchi, Cristina; Chiti, Fabrizio

2012-01-01

Chaperones are the primary regulators of the proteostasis network and are known to facilitate protein folding, inhibit protein aggregation, and promote disaggregation and clearance of misfolded aggregates inside cells. We have tested the effects of five chaperones on the toxicity of misfolded

UBL/BAG-domain co-chaperones cause cellular stress upon overexpression through constitutive activation of Hsf1

DEFF Research Database (Denmark)

Poulsen, Esben Guldahl; Kampmeyer, Caroline; Kriegenburg, Franziska

2017-01-01

of molecular chaperones and other stress-relieving proteins. Here, we show that the fission yeast Schizosaccharomyces pombe orthologues of human BAG-1, Bag101, and Bag102, are Hsp70 co-chaperones that associate with 26S proteasomes. Only a subgroup of Hsp70-type chaperones, including Ssa1, Ssa2, and Sks2...

Progranulin acts as a shared chaperone and regulates multiple lysosomal enzymes

Directory of Open Access Journals (Sweden)

Jinlong Jian

2017-09-01

Full Text Available Multifunctional factor progranulin (PGRN plays an important role in lysosomes, and its mutations and insufficiency are associated with lysosomal storage diseases, including neuronal ceroid lipofuscinosis and Gaucher disease (GD. The first breakthrough in understanding the molecular mechanisms of PGRN as regulator of lysosomal storage diseases came unexpectedly while investigating the role of PGRN in inflammation. Challenged PGRN null mice displayed typical features of GD. In addition, GRN gene variants were identified in GD patients and the serum levels of PGRN were significantly lower in GD patients. PGRN directly binds to and functions as a chaperone of the lysosomal enzyme β-glucocerebrosidase (GCaase, whose mutations cause GD. In addition, its C-terminus containing granulin E domain, termed Pcgin (PGRN C-terminus for GCase Interaction, is required for the association between PGRN and GCase. The concept that PGRN acts as a chaperone of lysosomal enzymes was further supported and extended by a recent article showing that PGRN acts as a chaperone molecule of lysosomal enzyme cathepsin D (CSTD, and the association between PGRN and CSTD is also mediated by PGRN's C-terminal granulin E domain. Collectively, these reports suggest that PGRN may act as a shared chaperone and regulates multiple lysosomal enzymes.

Evidence for alternative quaternary structure in a bacterial Type III secretion system chaperone

Energy Technology Data Exchange (ETDEWEB)

Barta, Michael L.; Zhang, Lingling; Picking, Wendy L.; Geisbrecht, Brian V. (UMKC); (OKLU)

2010-10-05

Type III secretion systems are a common virulence mechanism in many Gram-negative bacterial pathogens. These systems use a nanomachine resembling a molecular needle and syringe to provide an energized conduit for the translocation of effector proteins from the bacterial cytoplasm to the host cell cytoplasm for the benefit of the pathogen. Prior to translocation specialized chaperones maintain proper effector protein conformation. The class II chaperone, Invasion plasmid gene (Ipg) C, stabilizes two pore forming translocator proteins. IpgC exists as a functional dimer to facilitate the mutually exclusive binding of both translocators. In this study, we present the 3.3 {angstrom} crystal structure of an amino-terminally truncated form (residues 10-155, denoted IpgC10-155) of the class II chaperone IpgC from Shigella flexneri. Our structure demonstrates an alternative quaternary arrangement to that previously described for a carboxy-terminally truncated variant of IpgC (IpgC{sup 1-151}). Specifically, we observe a rotationally-symmetric 'head-to-head' dimerization interface that is far more similar to that previously described for SycD from Yersinia enterocolitica than to IpgC1-151. The IpgC structure presented here displays major differences in the amino terminal region, where extended coil-like structures are seen, as opposed to the short, ordered alpha helices and asymmetric dimerization interface seen within IpgC{sup 1-151}. Despite these differences, however, both modes of dimerization support chaperone activity, as judged by a copurification assay with a recombinant form of the translocator protein, IpaB. Conclusions: From primary to quaternary structure, these results presented here suggest that a symmetric dimerization interface is conserved across bacterial class II chaperones. In light of previous data which have described the structure and function of asymmetric dimerization, our results raise the possibility that class II chaperones may

The Putative Son's Attractiveness Alters the Perceived Attractiveness of the Putative Father.

Science.gov (United States)

Prokop, Pavol

2015-08-01

A body of literature has investigated female mate choice in the pre-mating context (pre-mating sexual selection). Humans, however, are long-living mammals forming pair-bonds which sequentially produce offspring. Post-mating evaluations of a partner's attractiveness may thus significantly influence the reproductive success of men and women. I tested herein the theory that the attractiveness of putative sons provides extra information about the genetic quality of fathers, thereby influencing fathers' attractiveness across three studies. As predicted, facially attractive boys were more frequently attributed to attractive putative fathers and vice versa (Study 1). Furthermore, priming with an attractive putative son increased the attractiveness of the putative father with the reverse being true for unattractive putative sons. When putative fathers were presented as stepfathers, the effect of the boy's attractiveness on the stepfather's attractiveness was lower and less consistent (Study 2). This suggests that the presence of an attractive boy has the strongest effect on the perceived attractiveness of putative fathers rather than on non-fathers. The generalized effect of priming with beautiful non-human objects also exists, but its effect is much weaker compared with the effects of putative biological sons (Study 3). Overall, this study highlighted the importance of post-mating sexual selection in humans and suggests that the heritable attractive traits of men are also evaluated by females after mating and/or may be used by females in mate poaching.

The Malarial Exported PFA0660w Is an Hsp40 Co-Chaperone of PfHsp70-x.

Directory of Open Access Journals (Sweden)

Michael O Daniyan

Full Text Available Plasmodium falciparum, the human pathogen responsible for the most dangerous malaria infection, survives and develops in mature erythrocytes through the export of proteins needed for remodelling of the host cell. Molecular chaperones of the heat shock protein (Hsp family are prominent members of the exportome, including a number of Hsp40s and a Hsp70. PFA0660w, a type II Hsp40, has been shown to be exported and possibly form a complex with PfHsp70-x in the infected erythrocyte cytosol. However, the chaperone properties of PFA0660w and its interaction with human and parasite Hsp70s are yet to be investigated. Recombinant PFA0660w was found to exist as a monomer in solution, and was able to significantly stimulate the ATPase activity of PfHsp70-x but not that of a second plasmodial Hsp70 (PfHsp70-1 or a human Hsp70 (HSPA1A, indicating a potential specific functional partnership with PfHsp70-x. Protein binding studies in the presence and absence of ATP suggested that the interaction of PFA0660w with PfHsp70-x most likely represented a co-chaperone/chaperone interaction. Also, PFA0660w alone produced a concentration-dependent suppression of rhodanese aggregation, demonstrating its chaperone properties. Overall, we have provided the first biochemical evidence for the possible role of PFA0660w as a chaperone and as co-chaperone of PfHsp70-x. We propose that these chaperones boost the chaperone power of the infected erythrocyte, enabling successful protein trafficking and folding, and thereby making a fundamental contribution to the pathology of malaria.

Mitochondrial Chaperones in the Brain: Safeguarding Brain Health and Metabolism?

Directory of Open Access Journals (Sweden)

José Pedro Castro

2018-04-01

Full Text Available The brain orchestrates organ function and regulates whole body metabolism by the concerted action of neurons and glia cells in the central nervous system. To do so, the brain has tremendously high energy consumption and relies mainly on glucose utilization and mitochondrial function in order to exert its function. As a consequence of high rate metabolism, mitochondria in the brain accumulate errors over time, such as mitochondrial DNA (mtDNA mutations, reactive oxygen species, and misfolded and aggregated proteins. Thus, mitochondria need to employ specific mechanisms to avoid or ameliorate the rise of damaged proteins that contribute to aberrant mitochondrial function and oxidative stress. To maintain mitochondria homeostasis (mitostasis, cells evolved molecular chaperones that shuttle, refold, or in coordination with proteolytic systems, help to maintain a low steady-state level of misfolded/aggregated proteins. Their importance is exemplified by the occurrence of various brain diseases which exhibit reduced action of chaperones. Chaperone loss (expression and/or function has been observed during aging, metabolic diseases such as type 2 diabetes and in neurodegenerative diseases such as Alzheimer’s (AD, Parkinson’s (PD or even Huntington’s (HD diseases, where the accumulation of damage proteins is evidenced. Within this perspective, we propose that proper brain function is maintained by the joint action of mitochondrial chaperones to ensure and maintain mitostasis contributing to brain health, and that upon failure, alter brain function which can cause metabolic diseases.

Leptospiral outer membrane protein LipL41 is not essential for acute leptospirosis but requires a small chaperone protein, lep, for stable expression.

Science.gov (United States)

King, Amy M; Bartpho, Thanatchaporn; Sermswan, Rasana W; Bulach, Dieter M; Eshghi, Azad; Picardeau, Mathieu; Adler, Ben; Murray, Gerald L

2013-08-01

Leptospirosis is a worldwide zoonosis caused by pathogenic Leptospira spp., but knowledge of leptospiral pathogenesis remains limited. However, the development of mutagenesis systems has allowed the investigation of putative virulence factors and their involvement in leptospirosis. LipL41 is the third most abundant lipoprotein found in the outer membranes of pathogenic leptospires and has been considered a putative virulence factor. LipL41 is encoded on the large chromosome 28 bp upstream of a small open reading frame encoding a hypothetical protein of unknown function. This gene was named lep, for LipL41 expression partner. In this study, lipL41 was found to be cotranscribed with lep. Two transposon mutants were characterized: a lipL41 mutant and a lep mutant. In the lep mutant, LipL41 protein levels were reduced by approximately 90%. Lep was shown through cross-linking and coexpression experiments to bind to LipL41. Lep is proposed to be a molecular chaperone essential for the stable expression of LipL41. The roles of LipL41 and Lep in the pathogenesis of Leptospira interrogans were investigated; surprisingly, neither of these two unique proteins was essential for acute leptospirosis.

Draft genome sequence of Cercospora sojina isolate S9, a fungus causing frogeye leaf spot (FLS disease of soybean

Directory of Open Access Journals (Sweden)

Fanchang Zeng

2017-06-01

Full Text Available Fungi are the causal agents of many of the world's most serious plant diseases causing disastrous consequences for large-scale agricultural production. Pathogenicity genomic basis is complex in fungi as multicellular eukaryotic pathogens. The fungus Cercospora sojina is a plant pathogen that threatens global soybean supplies. Here, we report the genome sequence of C. sojina strain S9 and detect genome features and predicted genomic elements. The genome sequence of C. sojina is a valuable resource with potential in studying the fungal pathogenicity and soybean host resistance to frogeye leaf spot (FLS, which is caused by C. sojina. The C. sojina genome sequence has been deposited and available at DDBJ/EMBL/GenBank under the project accession number AHPQ00000000.

FKBP immunophilins and Alzheimer's disease: A chaperoned affair

Indian Academy of Sciences (India)

2011-07-08

Jul 8, 2011 ... FKBP immunophilins and Alzheimer's disease: A chaperoned affair. Weihuan Cao Mary ... Keywords. Alzheimer's disease; amyloid precursor protein; beta amyloid; FKBP; FK506; immunophilins; tau ... 43 | Issue 1. March 2018.

JBP485 improves gentamicin-induced acute renal failure by regulating the expression and function of Oat1 and Oat3 in rats

Energy Technology Data Exchange (ETDEWEB)

Guo, Xinjin [Department of Clinical Pharmacology, College of Pharmacy, Dalian Medical University, Dalian (China); Meng, Qiang; Liu, Qi; Wang, Changyuan; Sun, Huijun; Peng, Jinyong; Ma, Xiaochi [Department of Clinical Pharmacology, College of Pharmacy, Dalian Medical University, Dalian (China); Provincial Key Laboratory for Pharmacokinetics and Transport, Dalian Medical University, Liaoning (China); Kaku, Taiichi [Japan Bioproducts Industry Co. Ltd., Tomigaya, Shibuya-ku, Tokyo (Japan); Liu, Kexin, E-mail: kexinliu@dlmedu.edu.cn [Department of Clinical Pharmacology, College of Pharmacy, Dalian Medical University, Dalian (China); Provincial Key Laboratory for Pharmacokinetics and Transport, Dalian Medical University, Liaoning (China)

2013-09-01

We investigated the effects of JBP485 (an anti-inflammatory dipeptide and a substrate of OAT) on regulation of the expression and function of renal Oat1 and Oat3, which can accelerate the excretion of accumulated uremic toxins (e.g. indoxyl sulfate) in the kidney to improve gentamicin-induced ARF in rats. JBP485 caused a significant decrease in the accumulation of endogenous substances (creatinine, blood urea nitrogen and indoxyl sulfate) in vivo, an increase in the excretion of exogenous compounds (lisinopril and inulin) into urine, and up-regulation of the expressions of renal Oat1 and Oat3 in the kidney tissues and slices via substrate induction. To determine the effect of JBP485 on the accelerated excretion of uremic toxins mediated by Oat1 and Oat3, the mRNA and protein expression levels of renal basolateral Oats were assessed by quantitative real-time PCR, western blot, immunohistochemical analysis and an immunofluorescence method. Gentamicin down-regulated the expression of Oats mRNA and protein in rat kidney, and these effects were reversed after administration of JBP485. In addition, JBP485 caused a significant decrease in MPO and MDA levels in the kidney, and improved the pathological condition of rat kidney. These results indicated that JBP485 improved acute renal failure by increasing the expression and function of Oat1 and Oat3, and by decreasing overoxidation of the kidney in gentamicin-induced ARF rats. - Highlights: • JBP485 could up-regulate function and expression of Oat1 and Oat3 in kidney. • Effects of JBP485 on ARF are mediated by stimulating excretion of uremic toxins. • JBP485 protected against gentamicin-induced ARF by decreasing MPO and MDA.

Role of Subunit Exchange and Electrostatic Interactions on the Chaperone Activity of Mycobacterium leprae HSP18

Science.gov (United States)

Nandi, Sandip Kumar; Panda, Alok Kumar; Chakraborty, Ayon; Ray, Sougata Sinha; Biswas, Ashis

2015-01-01

Mycobacterium leprae HSP18, a major immunodominant antigen of M. leprae pathogen, is a small heat shock protein. Previously, we reported that HSP18 is a molecular chaperone that prevents aggregation of different chemically and thermally stressed client proteins and assists refolding of denatured enzyme at normal temperature. We also demonstrated that it can efficiently prevent the thermal killing of E. coli at higher temperature. However, molecular mechanism behind the chaperone function of HSP18 is still unclear. Therefore, we studied the structure and chaperone function of HSP18 at normal temperature (25°C) as well as at higher temperatures (31–43°C). Our study revealed that the chaperone function of HSP18 is enhanced significantly with increasing temperature. Far- and near-UV CD experiments suggested that its secondary and tertiary structure remain intact in this temperature range (25–43°C). Besides, temperature has no effect on the static oligomeric size of this protein. Subunit exchange study demonstrated that subunits of HSP18 exchange at 25°C with a rate constant of 0.018 min-1. Both rate of subunit exchange and chaperone activity of HSP18 is found to increase with rise in temperature. However, the surface hydrophobicity of HSP18 decreases markedly upon heating and has no correlation with its chaperone function in this temperature range. Furthermore, we observed that HSP18 exhibits diminished chaperone function in the presence of NaCl at 25°C. At elevated temperatures, weakening of interactions between HSP18 and stressed client proteins in the presence of NaCl results in greater reduction of its chaperone function. The oligomeric size, rate of subunit exchange and structural stability of HSP18 were also found to decrease when electrostatic interactions were weakened. These results clearly indicated that subunit exchange and electrostatic interactions play a major role in the chaperone function of HSP18. PMID:26098662

Role of Subunit Exchange and Electrostatic Interactions on the Chaperone Activity of Mycobacterium leprae HSP18.

Science.gov (United States)

Nandi, Sandip Kumar; Panda, Alok Kumar; Chakraborty, Ayon; Sinha Ray, Sougata; Biswas, Ashis

2015-01-01

Mycobacterium leprae HSP18, a major immunodominant antigen of M. leprae pathogen, is a small heat shock protein. Previously, we reported that HSP18 is a molecular chaperone that prevents aggregation of different chemically and thermally stressed client proteins and assists refolding of denatured enzyme at normal temperature. We also demonstrated that it can efficiently prevent the thermal killing of E. coli at higher temperature. However, molecular mechanism behind the chaperone function of HSP18 is still unclear. Therefore, we studied the structure and chaperone function of HSP18 at normal temperature (25°C) as well as at higher temperatures (31-43°C). Our study revealed that the chaperone function of HSP18 is enhanced significantly with increasing temperature. Far- and near-UV CD experiments suggested that its secondary and tertiary structure remain intact in this temperature range (25-43°C). Besides, temperature has no effect on the static oligomeric size of this protein. Subunit exchange study demonstrated that subunits of HSP18 exchange at 25°C with a rate constant of 0.018 min(-1). Both rate of subunit exchange and chaperone activity of HSP18 is found to increase with rise in temperature. However, the surface hydrophobicity of HSP18 decreases markedly upon heating and has no correlation with its chaperone function in this temperature range. Furthermore, we observed that HSP18 exhibits diminished chaperone function in the presence of NaCl at 25°C. At elevated temperatures, weakening of interactions between HSP18 and stressed client proteins in the presence of NaCl results in greater reduction of its chaperone function. The oligomeric size, rate of subunit exchange and structural stability of HSP18 were also found to decrease when electrostatic interactions were weakened. These results clearly indicated that subunit exchange and electrostatic interactions play a major role in the chaperone function of HSP18.

Structural and Functional Consequences of Chaperone Site Deletion in αA-Crystallin

Science.gov (United States)

Santhoshkumar, Puttur; Karmakar, Srabani; Sharma, Krishna K.

2016-01-01

The chaperone-like activity of αA-crystallin has an important role in maintaining lens transparency. Previously we identified residues 70–88 as a chaperone site in αA-crystallin. In this study, we deleted the chaperone site residues to generate αAΔ70–76 and αAΔ70–88 mutants and investigated if there are additional substrate-binding sites in αA-crystallin. Both mutant proteins when expressed in E. coli formed inclusion bodies, and on solubilizing and refolding, they exhibited similar structural properties, with a 2- to 3-fold increase in molar mass compared to the molar mass of wild-type protein. The deletion mutants were less stable than the wild-type αA-crystallin. Functionally αAΔ70–88 was completely inactive as a chaperone, while αAΔ70–76 demonstrated a 40–50% reduction in anti-aggregation activity against alcohol dehydrogenase (ADH). Deletion of residues 70–88 abolished the ADH binding sites in αA-crystallin at physiological temperature. At 45 °C, cryptic ADH binding site(s) became exposed, which contributed subtly to the chaperone-like activity of αAΔ70–88. Both of the deletion mutants were completely inactive in suppressing aggregation of βL-crystallin at 53 °C. The mutants completely lost the anti-apoptotic property that αA-crystallin exhibits while they protected ARPE-19 (a human retinal pigment epithelial cell line) and primary human lens epithelial (HLE) cells from oxidative stress. Our studies demonstrate that residues 70–88 in αA-crystallin act as a primary substrate binding site and account for the bulk of the total chaperone activity. The β3 and β4 strands in αA-crystallin comprising 70–88 residues play an important role in maintenance of the structure and in preventing aggregation of denaturing proteins. PMID:27524665

The Escherichia coli P and Type 1 Pilus Assembly Chaperones PapD and FimC Are Monomeric in Solution

Energy Technology Data Exchange (ETDEWEB)

Sarowar, Samema; Hu, Olivia J.; Werneburg, Glenn T.; Thanassi, David G.; Li, Huilin; Christie, P. J.

2016-06-27

The chaperone/usher pathway is used by Gram-negative bacteria to assemble adhesive surface structures known as pili or fimbriae. Uropathogenic strains ofEscherichia coliuse this pathway to assemble P and type 1 pili, which facilitate colonization of the kidney and bladder, respectively. Pilus assembly requires a periplasmic chaperone and outer membrane protein termed the usher. The chaperone allows folding of pilus subunits and escorts the subunits to the usher for polymerization into pili and secretion to the cell surface. Based on previous structures of mutant versions of the P pilus chaperone PapD, it was suggested that the chaperone dimerizes in the periplasm as a self-capping mechanism. Such dimerization is counterintuitive because the chaperone G1 strand, important for chaperone-subunit interaction, is buried at the dimer interface. Here, we show that the wild-type PapD chaperone also forms a dimer in the crystal lattice; however, the dimer interface is different from the previously solved structures. In contrast to the crystal structures, we found that both PapD and the type 1 pilus chaperone, FimC, are monomeric in solution. Our findings indicate that pilus chaperones do not sequester their G1 β-strand by forming a dimer. Instead, the chaperones may expose their G1 strand for facile interaction with pilus subunits. We also found that the type 1 pilus adhesin, FimH, is flexible in solution while in complex with its chaperone, whereas the P pilus adhesin, PapGII, is rigid. Our study clarifies a crucial step in pilus biogenesis and reveals pilus-specific differences that may relate to biological function.

IMPORTANCEPili are critical virulence factors for many bacterial pathogens. UropathogenicE. colirelies on P and type 1 pili assembled by the chaperone/usher pathway to

Molecular Chaperones of Leishmania: Central Players in Many Stress-Related and -Unrelated Physiological Processes

Directory of Open Access Journals (Sweden)

Jose M. Requena

2015-01-01

Full Text Available Molecular chaperones are key components in the maintenance of cellular homeostasis and survival, not only during stress but also under optimal growth conditions. Folding of nascent polypeptides is supported by molecular chaperones, which avoid the formation of aggregates by preventing nonspecific interactions and aid, when necessary, the translocation of proteins to their correct intracellular localization. Furthermore, when proteins are damaged, molecular chaperones may also facilitate their refolding or, in the case of irreparable proteins, their removal by the protein degradation machinery of the cell. During their digenetic lifestyle, Leishmania parasites encounter and adapt to harsh environmental conditions, such as nutrient deficiency, hypoxia, oxidative stress, changing pH, and shifts in temperature; all these factors are potential triggers of cellular stress. We summarize here our current knowledge on the main types of molecular chaperones in Leishmania and their functions. Among them, heat shock proteins play important roles in adaptation and survival of this parasite against temperature changes associated with its passage from the poikilothermic insect vector to the warm-blooded vertebrate host. The study of structural features and the function of chaperones in Leishmania biology is providing opportunities (and challenges for drug discovery and improving of current treatments against leishmaniasis.

Endoplasmic reticulum (ER Chaperones and Oxidoreductases: Critical Regulators of Tumor Cell Survival and Immunorecognition

Directory of Open Access Journals (Sweden)

Thomas eSimmen

2014-10-01

Full Text Available Endoplasmic reticulum (ER chaperones and oxidoreductases are abundant enzymes that mediate the production of fully folded secretory and transmembrane proteins. Resisting the Golgi and plasma membrane-directed bulk flow, ER chaperones and oxidoreductases enter retrograde trafficking whenever they are pulled outside of the ER. However, solid tumors are characterized by the increased production of reactive oxygen species (ROS, combined with reduced blood flow that leads to low oxygen supply and ER stress. Under these conditions, hypoxia and the unfolded protein response (UPR upregulate ER chaperones and oxidoreductases. When this occurs, ER oxidoreductases and chaperones become important regulators of tumor growth. However, under these conditions, these proteins not only promote the production of proteins, but also alter the properties of the plasma membrane and hence modulate tumor immune recognition. For instance, high levels of calreticulin serve as an eat-me signal on the surface of tumor cells. Conversely, both intracellular and surface BiP/GRP78 promotes tumor growth. Other ER folding assistants able to modulate the properties of tumor tissue include protein disulfide isomerase (PDI, Ero1α and GRP94. Understanding the roles and mechanisms of ER chaperones in regulating tumor cell functions and immunorecognition will lead to important insight for the development of novel cancer therapies.

Molecular Chaperones of Leishmania: Central Players in Many Stress-Related and -Unrelated Physiological Processes

Science.gov (United States)

Requena, Jose M.; Montalvo, Ana M.; Fraga, Jorge

2015-01-01

Molecular chaperones are key components in the maintenance of cellular homeostasis and survival, not only during stress but also under optimal growth conditions. Folding of nascent polypeptides is supported by molecular chaperones, which avoid the formation of aggregates by preventing nonspecific interactions and aid, when necessary, the translocation of proteins to their correct intracellular localization. Furthermore, when proteins are damaged, molecular chaperones may also facilitate their refolding or, in the case of irreparable proteins, their removal by the protein degradation machinery of the cell. During their digenetic lifestyle, Leishmania parasites encounter and adapt to harsh environmental conditions, such as nutrient deficiency, hypoxia, oxidative stress, changing pH, and shifts in temperature; all these factors are potential triggers of cellular stress. We summarize here our current knowledge on the main types of molecular chaperones in Leishmania and their functions. Among them, heat shock proteins play important roles in adaptation and survival of this parasite against temperature changes associated with its passage from the poikilothermic insect vector to the warm-blooded vertebrate host. The study of structural features and the function of chaperones in Leishmania biology is providing opportunities (and challenges) for drug discovery and improving of current treatments against leishmaniasis. PMID:26167482

Virus-Induced Chaperone-Enriched (VICE domains function as nuclear protein quality control centers during HSV-1 infection.

Directory of Open Access Journals (Sweden)

Christine M Livingston

2009-10-01

Full Text Available Virus-Induced Chaperone-Enriched (VICE domains form adjacent to nuclear viral replication compartments (RC during the early stages of HSV-1 infection. Between 2 and 3 hours post infection at a MOI of 10, host protein quality control machinery such as molecular chaperones (e.g. Hsc70, the 20S proteasome and ubiquitin are reorganized from a diffuse nuclear distribution pattern to sequestration in VICE domains. The observation that VICE domains contain putative misfolded proteins suggests that they may be similar to nuclear inclusion bodies that form under conditions in which the protein quality control machinery is overwhelmed by the presence of misfolded proteins. The detection of Hsc70 in VICE domains, but not in nuclear inclusion bodies, indicates that Hsc70 is specifically reorganized by HSV-1 infection. We hypothesize that HSV-1 infection induces the formation of nuclear protein quality control centers to remodel or degrade aberrant nuclear proteins that would otherwise interfere with productive infection. Detection of proteolytic activity in VICE domains suggests that substrates may be degraded by the 20S proteasome in VICE domains. FRAP analysis reveals that GFP-Hsc70 is dynamically associated with VICE domains, suggesting a role for Hsc70 in scanning the infected nucleus for misfolded proteins. During 42 degrees C heat shock, Hsc70 is redistributed from VICE domains into RC perhaps to remodel viral replication and regulatory proteins that have become insoluble in these compartments. The experiments presented in this paper suggest that VICE domains are nuclear protein quality control centers that are modified by HSV-1 to promote productive infection.

Structure of AscE and Induced Burial Regions in AscE and AscG upon Formation of the Chaperone Needle-subunit Complex of Type III Secretion System in Aeromonas Hydrophila

Energy Technology Data Exchange (ETDEWEB)

Tan, Y.; Yu, H; Leung, K; Sivaraman, J; Mok, Y

2008-01-01

In the type III secretion system (T3SS) of Aeromonas hydrophila, the putative needle complex subunit AscF requires both putative chaperones AscE and AscG for formation of a ternary complex to avoid premature assembly. Here we report the crystal structure of AscE at 2.7 A resolution and the mapping of buried regions of AscE, AscG, and AscF in the AscEG and AscEFG complexes using limited protease digestion. The dimeric AscE is comprised of two helix-turn-helix monomers packed in an antiparallel fashion. The N-terminal 13 residues of AscE are buried only upon binding with AscG, but this region is found to be nonessential for the interaction. AscE functions as a monomer and can be coexpressed with AscG or with both AscG and AscF to form soluble complexes. The AscE binding region of AscG in the AscEG complex is identified to be within the N-terminal 61 residues of AscG. The exposed C-terminal substrate-binding region of AscG in the AscEG complex is induced to be buried only upon binding to AscF. However, the N-terminal 52 residues of AscF remain exposed even in the ternary AscEFG complex. On the other hand, the 35-residue C-terminal region of AscF in the complex is resistant to protease digestion in the AscEFG complex. Site-directed mutagenesis showed that two C-terminal hydrophobic residues, Ile83 and Leu84, of AscF are essential for chaperone binding.

A novel protease activity assay using a protease-responsive chaperone protein

International Nuclear Information System (INIS)

Sao, Kentaro; Murata, Masaharu; Fujisaki, Yuri; Umezaki, Kaori; Mori, Takeshi; Niidome, Takuro; Katayama, Yoshiki; Hashizume, Makoto

2009-01-01

Protease activity assays are important for elucidating protease function and for developing new therapeutic agents. In this study, a novel turbidimetric method for determining the protease activity using a protease-responsive chaperone protein is described. For this purpose, a recombinant small heat-shock protein (sHSP) with an introduced Factor Xa protease recognition site was synthesized in bacteria. This recombinant mutant, FXa-HSP, exhibited chaperone-like activity at high temperatures in cell lysates. However, the chaperone-like activity of FXa-HSP decreased dramatically following treatment with Factor Xa. Protein precipitation was subsequently observed in the cell lysates. The reaction was Factor Xa concentration-dependent and was quantitatively suppressed by a specific inhibitor for Factor Xa. Protein aggregation was detected by a simple method based on turbidimetry. The results clearly demonstrate that this assay is an effective, easy-to-use method for determining protease activities without the requirement of labeling procedures and the use of radioisotopes.

A novel protease activity assay using a protease-responsive chaperone protein

Energy Technology Data Exchange (ETDEWEB)

Sao, Kentaro [Graduate School of Systems Life Sciences, Kyushu University, 744 Motooka Nishi-ku, Fukuoka 819-0395 (Japan); Murata, Masaharu, E-mail: m-murata@dem.med.kyushu-u.ac.jp [Department of Advanced Medical Initiatives, Faculty of Medical Science, Kyushu University, 3-1-1 Maidashi, Higashi-ku Fukuoka 812-8582 (Japan); Fujisaki, Yuri; Umezaki, Kaori [Department of Advanced Medical Initiatives, Faculty of Medical Science, Kyushu University, 3-1-1 Maidashi, Higashi-ku Fukuoka 812-8582 (Japan); Mori, Takeshi; Niidome, Takuro; Katayama, Yoshiki [Graduate School of Systems Life Sciences, Kyushu University, 744 Motooka Nishi-ku, Fukuoka 819-0395 (Japan); Department of Applied Chemistry, Faculty of Engineering, Kyushu University, Nishi-ku Fukuoka 819-0395 (Japan); Center for Future Chemistry, Kyushu University, 744 Motooka, Nishi-ku, Fukuoka 819-0395 (Japan); Hashizume, Makoto [Department of Advanced Medical Initiatives, Faculty of Medical Science, Kyushu University, 3-1-1 Maidashi, Higashi-ku Fukuoka 812-8582 (Japan)

2009-06-05

Protease activity assays are important for elucidating protease function and for developing new therapeutic agents. In this study, a novel turbidimetric method for determining the protease activity using a protease-responsive chaperone protein is described. For this purpose, a recombinant small heat-shock protein (sHSP) with an introduced Factor Xa protease recognition site was synthesized in bacteria. This recombinant mutant, FXa-HSP, exhibited chaperone-like activity at high temperatures in cell lysates. However, the chaperone-like activity of FXa-HSP decreased dramatically following treatment with Factor Xa. Protein precipitation was subsequently observed in the cell lysates. The reaction was Factor Xa concentration-dependent and was quantitatively suppressed by a specific inhibitor for Factor Xa. Protein aggregation was detected by a simple method based on turbidimetry. The results clearly demonstrate that this assay is an effective, easy-to-use method for determining protease activities without the requirement of labeling procedures and the use of radioisotopes.

A Common Structural Motif in the Binding of Virulence Factors to Bacterial Secretion Chaperones

International Nuclear Information System (INIS)

Lilic, M.; Vujanac, M.; Stebbins, C.

2006-01-01

Salmonella invasion protein A (SipA) is translocated into host cells by a type III secretion system (T3SS) and comprises two regions: one domain binds its cognate type III secretion chaperone, InvB, in the bacterium to facilitate translocation, while a second domain functions in the host cell, contributing to bacterial uptake by polymerizing actin. We present here the crystal structures of the SipA chaperone binding domain (CBD) alone and in complex with InvB. The SipA CBD is found to consist of a nonglobular polypeptide as well as a large globular domain, both of which are necessary for binding to InvB. We also identify a structural motif that may direct virulence factors to their cognate chaperones in a diverse range of pathogenic bacteria. Disruption of this structural motif leads to a destabilization of several chaperone-substrate complexes from different species, as well as an impairment of secretion in Salmonella

Comparison of intra-organellar chaperone capacity for dealing with stress-induced protein unfolding.

Science.gov (United States)

Hageman, Jurre; Vos, Michel J; van Waarde, Maria A W H; Kampinga, Harm H

2007-11-23

Molecular chaperones are essential for cells to prevent that partially unfolded proteins form non-functional, toxic aggregates. This requirement is increased when cells experience protein unfolding stresses and such could affect all compartments in the eukaryotic cell. Whether all organelles are equipped with comparable chaperone capacities is largely unknown, mainly due to the lack of suitable reporters that allow such a comparison. Here we describe the development of fluorescent luciferase reporters that are sorted to various cellular locations (nucleus, cytoplasm, endoplasmic reticulum, and peroxisomes) and that differ minimally in their intrinsic thermal stability properties. When heating living cells, the rate of inactivation was most rapid for the nuclear-targeted luciferase, indicating that the nucleus is the most sensitive organelle toward heat-induced denaturing stress. Post-heat re-activation, however, occurred at equal kinetics irrespective of luciferase localization. Also, induction of thermotolerance by a priming heat treatment, that coordinately up-regulates all heat-inducible chaperones, resulted in a transient heat resistance of the luciferase in all organelles in a comparable manner. Overexpression of the main heat-inducible Hsp70 family member, HspA1A, protected only the cytosolic and nuclear, but not the other luciferases. Together, our data suggest that in each compartment investigated, including the peroxisome in which so far no chaperones could be detected, chaperone machines are present and can be induced with activities similar to those present in the cytosolic/nuclear compartment.

Counteracting chemical chaperone effects on the single-molecule α-synuclein structural landscape

OpenAIRE

Ferreon, Allan Chris M.; Moosa, Mahdi Muhammad; Gambin, Yann; Deniz, Ashok A.

2012-01-01

Protein structure and function depend on a close interplay between intrinsic folding energy landscapes and the chemistry of the protein environment. Osmolytes are small-molecule compounds that can act as chemical chaperones by altering the environment in a cellular context. Despite their importance, detailed studies on the role of these chemical chaperones in modulating structure and dimensions of intrinsically disordered proteins have been limited. Here, we used single-molecule Förster reson...

Cytosolic iron chaperones: Proteins delivering iron cofactors in the cytosol of mammalian cells.

Science.gov (United States)

Philpott, Caroline C; Ryu, Moon-Suhn; Frey, Avery; Patel, Sarju

2017-08-04

Eukaryotic cells contain hundreds of metalloproteins that are supported by intracellular systems coordinating the uptake and distribution of metal cofactors. Iron cofactors include heme, iron-sulfur clusters, and simple iron ions. Poly(rC)-binding proteins are multifunctional adaptors that serve as iron ion chaperones in the cytosolic/nuclear compartment, binding iron at import and delivering it to enzymes, for storage (ferritin) and export (ferroportin). Ferritin iron is mobilized by autophagy through the cargo receptor, nuclear co-activator 4. The monothiol glutaredoxin Glrx3 and BolA2 function as a [2Fe-2S] chaperone complex. These proteins form a core system of cytosolic iron cofactor chaperones in mammalian cells. © 2017 by The American Society for Biochemistry and Molecular Biology, Inc.

Analysis of nucleic acid chaperoning by the prion protein and its inhibition by oligonucleotides.

Science.gov (United States)

Guichard, Cécile; Ivanyi-Nagy, Roland; Sharma, Kamal Kant; Gabus, Caroline; Marc, Daniel; Mély, Yves; Darlix, Jean-Luc

2011-10-01

Prion diseases are unique neurodegenerative illnesses associated with the conversion of the cellular prion protein (PrP(C)) into the aggregated misfolded scrapie isoform, named PrP(Sc). Recent studies on the physiological role of PrP(C) revealed that this protein has probably multiple functions, notably in cell-cell adhesion and signal transduction, and in assisting nucleic acid folding. In fact, in vitro findings indicated that the human PrP (huPrP) possesses nucleic acid binding and annealing activities, similarly to nucleic acid chaperone proteins that play essential roles in cellular DNA and RNA metabolism. Here, we show that a peptide, representing the N-terminal domain of huPrP, facilitates nucleic acid annealing by two parallel pathways nucleated through the stem termini. We also show that PrP of human or ovine origin facilitates DNA strand exchange, ribozyme-directed cleavage of an RNA template and RNA trans-splicing in a manner similar to the nucleocapsid protein of HIV-1. In an attempt to characterize inhibitors of PrP-chaperoning in vitro we discovered that the thioaptamer 5'-GACACAAGCCGA-3' was extensively inhibiting the PrP chaperoning activities. At the same time a recently characterized methylated oligoribonucleotide inhibiting the chaperoning activity of the HIV-1 nucleocapsid protein was poorly impairing the PrP chaperoning activities.

Modulation of chaperone-like and membranolytic activities of major ...

Indian Academy of Sciences (India)

C Sudheer Kumar

2017-06-20

Jun 20, 2017 ... Keywords. Capacitation; membranolytic activity; molecular chaperone; oxidative stress ... also shown to extract phospholipids from the membrane resulting ..... Gulcin I 2006 Antioxidant and antiradical activities of L-carnitine.

Multiscale modeling of a conditionally disordered pH-sensing chaperone.

Science.gov (United States)

Ahlstrom, Logan S; Law, Sean M; Dickson, Alex; Brooks, Charles L

2015-04-24

The pH-sensing chaperone HdeA promotes the survival of enteropathogenic bacteria during transit through the harshly acidic environment of the mammalian stomach. At low pH, HdeA transitions from an inactive, folded, dimer to chaperone-active, disordered, monomers to protect against the acid-induced aggregation of periplasmic proteins. Toward achieving a detailed mechanistic understanding of the pH response of HdeA, we develop a multiscale modeling approach to capture its pH-dependent thermodynamics. Our approach combines pK(a) (logarithmic acid dissociation constant) calculations from all-atom constant pH molecular dynamics simulations with coarse-grained modeling and yields new, atomic-level, insights into HdeA chaperone function that can be directly tested by experiment. "pH triggers" that significantly destabilize the dimer are each located near the N-terminus of a helix, suggesting that their neutralization at low pH destabilizes the helix macrodipole as a mechanism of monomer disordering. Moreover, we observe a non-monotonic change in the pH-dependent stability of HdeA, with maximal stability of the dimer near pH5. This affect is attributed to the protonation Glu37, which exhibits an anomalously high pK(a) value and is located within the hydrophobic dimer interface. Finally, the pH-dependent binding pathway of HdeA comprises a partially unfolded, dimeric intermediate that becomes increasingly stable relative to the native dimer at lower pH values and displays key structural features for chaperone-substrate interaction. We anticipate that the insights from our model will help inform ongoing NMR and biochemical investigations. Copyright © 2015 Elsevier Ltd. All rights reserved.

The FKBP51 Glucocorticoid Receptor Co-Chaperone: Regulation, Function, and Implications in Health and Disease.

Science.gov (United States)

Fries, Gabriel R; Gassen, Nils C; Rein, Theo

2017-12-05

Among the chaperones and co-chaperones regulating the glucocorticoid receptor (GR), FK506 binding protein (FKBP) 51 is the most intensely investigated across different disciplines. This review provides an update on the role of the different co-chaperones of Hsp70 and Hsp90 in the regulation of GR function. The development leading to the focus on FKBP51 is outlined. Further, a survey of the vast literature on the mechanism and function of FKBP51 is provided. This includes its structure and biochemical function, its regulation on different levels-transcription, post-transcription, and post-translation-and its function in signaling pathways. The evidence portraying FKBP51 as a scaffolding protein organizing protein complexes rather than a chaperone contributing to the folding of individual proteins is collated. Finally, FKBP51's involvement in physiology and disease is outlined, and the promising efforts in developing drugs targeting FKBP51 are discussed.

Probing molecular mechanisms of the Hsp90 chaperone: biophysical modeling identifies key regulators of functional dynamics.

Directory of Open Access Journals (Sweden)

Anshuman Dixit

Full Text Available Deciphering functional mechanisms of the Hsp90 chaperone machinery is an important objective in cancer biology aiming to facilitate discovery of targeted anti-cancer therapies. Despite significant advances in understanding structure and function of molecular chaperones, organizing molecular principles that control the relationship between conformational diversity and functional mechanisms of the Hsp90 activity lack a sufficient quantitative characterization. We combined molecular dynamics simulations, principal component analysis, the energy landscape model and structure-functional analysis of Hsp90 regulatory interactions to systematically investigate functional dynamics of the molecular chaperone. This approach has identified a network of conserved regions common to the Hsp90 chaperones that could play a universal role in coordinating functional dynamics, principal collective motions and allosteric signaling of Hsp90. We have found that these functional motifs may be utilized by the molecular chaperone machinery to act collectively as central regulators of Hsp90 dynamics and activity, including the inter-domain communications, control of ATP hydrolysis, and protein client binding. These findings have provided support to a long-standing assertion that allosteric regulation and catalysis may have emerged via common evolutionary routes. The interaction networks regulating functional motions of Hsp90 may be determined by the inherent structural architecture of the molecular chaperone. At the same time, the thermodynamics-based "conformational selection" of functional states is likely to be activated based on the nature of the binding partner. This mechanistic model of Hsp90 dynamics and function is consistent with the notion that allosteric networks orchestrating cooperative protein motions can be formed by evolutionary conserved and sparsely connected residue clusters. Hence, allosteric signaling through a small network of distantly connected

Interplay between chaperones and protein disorder promotes the evolution of protein networks.

Directory of Open Access Journals (Sweden)

Sebastian Pechmann

2014-06-01

Full Text Available Evolution is driven by mutations, which lead to new protein functions but come at a cost to protein stability. Non-conservative substitutions are of interest in this regard because they may most profoundly affect both function and stability. Accordingly, organisms must balance the benefit of accepting advantageous substitutions with the possible cost of deleterious effects on protein folding and stability. We here examine factors that systematically promote non-conservative mutations at the proteome level. Intrinsically disordered regions in proteins play pivotal roles in protein interactions, but many questions regarding their evolution remain unanswered. Similarly, whether and how molecular chaperones, which have been shown to buffer destabilizing mutations in individual proteins, generally provide robustness during proteome evolution remains unclear. To this end, we introduce an evolutionary parameter λ that directly estimates the rate of non-conservative substitutions. Our analysis of λ in Escherichia coli, Saccharomyces cerevisiae, and Homo sapiens sequences reveals how co- and post-translationally acting chaperones differentially promote non-conservative substitutions in their substrates, likely through buffering of their destabilizing effects. We further find that λ serves well to quantify the evolution of intrinsically disordered proteins even though the unstructured, thus generally variable regions in proteins are often flanked by very conserved sequences. Crucially, we show that both intrinsically disordered proteins and highly re-wired proteins in protein interaction networks, which have evolved new interactions and functions, exhibit a higher λ at the expense of enhanced chaperone assistance. Our findings thus highlight an intricate interplay of molecular chaperones and protein disorder in the evolvability of protein networks. Our results illuminate the role of chaperones in enabling protein evolution, and underline the

Species-specific activation of Cu/Zn SOD by its CCS copper chaperone in the pathogenic yeast Candida albicans.

Science.gov (United States)

Gleason, Julie E; Li, Cissy X; Odeh, Hana M; Culotta, Valeria C

2014-06-01

Candida albicans is a pathogenic yeast of important public health relevance. Virulence of C. albicans requires a copper and zinc containing superoxide dismutase (SOD1), but the biology of C. albicans SOD1 is poorly understood. To this end, C. albicans SOD1 activation was examined in baker's yeast (Saccharomyces cerevisiae), a eukaryotic expression system that has proven fruitful for the study of SOD1 enzymes from invertebrates, plants, and mammals. In spite of the 80% similarity between S. cerevisiae and C. albicans SOD1 molecules, C. albicans SOD1 is not active in S. cerevisiae. The SOD1 appears incapable of productive interactions with the copper chaperone for SOD1 (CCS1) of S. cerevisiae. C. albicans SOD1 contains a proline at position 144 predicted to dictate dependence on CCS1. By mutation of this proline, C. albicans SOD1 gained activity in S. cerevisiae, and this activity was independent of CCS1. We identified a putative CCS1 gene in C. albicans and created heterozygous and homozygous gene deletions at this locus. Loss of CCS1 resulted in loss of SOD1 activity, consistent with its role as a copper chaperone. C. albicans CCS1 also restored activity to C. albicans SOD1 expressed in S. cerevisiae. C. albicans CCS1 is well adapted for activating its partner SOD1 from C. albicans, but not SOD1 from S. cerevisiae. In spite of the high degree of homology between the SOD1 and CCS1 molecules in these two fungal species, there exists a species-specific barrier in CCS-SOD interactions which may reflect the vastly different lifestyles of the pathogenic versus the noninfectious yeast.

Human Hsp70 molecular chaperone binds two calcium ions within the ATPase domain.

Science.gov (United States)

Sriram, M; Osipiuk, J; Freeman, B; Morimoto, R; Joachimiak, A

1997-03-15

The 70 kDa heat shock proteins (Hsp70) are a family of molecular chaperones, which promote protein folding and participate in many cellular functions. The Hsp70 chaperones are composed of two major domains. The N-terminal ATPase domain binds to and hydrolyzes ATP, whereas the C-terminal domain is required for polypeptide binding. Cooperation of both domains is needed for protein folding. The crystal structure of bovine Hsc70 ATPase domain (bATPase) has been determined and, more recently, the crystal structure of the peptide-binding domain of a related chaperone, DnaK, in complex with peptide substrate has been obtained. The molecular chaperone activity and conformational switch are functionally linked with ATP hydrolysis. A high-resolution structure of the ATPase domain is required to provide an understanding of the mechanism of ATP hydrolysis and how it affects communication between C- and N-terminal domains. The crystal structure of the human Hsp70 ATPase domain (hATPase) has been determined and refined at 1. 84 A, using synchrotron radiation at 120K. Two calcium sites were identified: the first calcium binds within the catalytic pocket, bridging ADP and inorganic phosphate, and the second calcium is tightly coordinated on the protein surface by Glu231, Asp232 and the carbonyl of His227. Overall, the structure of hATPase is similar to bATPase. Differences between them are found in the loops, the sites of amino acid substitution and the calcium-binding sites. Human Hsp70 chaperone is phosphorylated in vitro in the presence of divalent ions, calcium being the most effective. The structural similarity of hATPase and bATPase and the sequence similarity within the Hsp70 chaperone family suggest a universal mechanism of ATP hydrolysis among all Hsp70 molecular chaperones. Two calcium ions have been found in the hATPase structure. One corresponds to the magnesium site in bATPase and appears to be important for ATP hydrolysis and in vitro phosphorylation. Local changes

Application of a Colorimetric Assay to Identify Putative Ribofuranosylaminobenzene 5'-Phosphate Synthase Genes Expressed with Activity in Escherichia coli

Directory of Open Access Journals (Sweden)

Bechard Matthew E.

2003-01-01

Full Text Available Tetrahydromethanopterin (H4MPT is a tetrahydrofolate analog originally discovered in methanogenic archaea, but later found in other archaea and bacteria. The extent to which H4MPT occurs among living organisms is unknown. The key enzyme which distinguishes the biosynthetic pathways of H4MPT and tetrahydrofolate is ribofuranosylaminobenzene 5'-phosphate synthase (RFAP synthase. Given the importance of RFAP synthase in H4MPT biosynthesis, the identification of putative RFAP synthase genes and measurement of RFAP synthase activity would provide an indication of the presence of H4MPT in untested microorganisms. Investigation of putative archaeal RFAP synthase genes has been hampered by the tendency of the resulting proteins to form inactive inclusion bodies in Escherichia coli. The current work describes a colorimetric assay for measuring RFAP synthase activity, and two modified procedures for expressing recombinant RFAP synthase genes to produce soluble, active enzyme. By lowering the incubation temperature during expression, RFAP synthase from Archaeoglobus fulgidus was produced in E. coli and purified to homogeneity. The production of active RFAP synthase from Methanothermobacter thermautotrophicus was achieved by coexpression of the gene MTH0830 with a molecular chaperone. This is the first direct biochemical identification of a methanogen gene that codes for an active RFAP synthase.

Application of a Colorimetric Assay to Identify Putative Ribofuranosylaminobenzene 5'-Phosphate Synthase Genes Expressed with Activity in Escherichia coli.

Science.gov (United States)

Bechard, Matthew E.; Chhatwal, Sonya; Garcia, Rosemarie E.; Rasche, Madeline E.

2003-01-01

Tetrahydromethanopterin (H(4)MPT) is a tetrahydrofolate analog originally discovered in methanogenic archaea, but later found in other archaea and bacteria. The extent to which H(4)MPT occurs among living organisms is unknown. The key enzyme which distinguishes the biosynthetic pathways of H(4)MPT and tetrahydrofolate is ribofuranosylaminobenzene 5'-phosphate synthase (RFAP synthase). Given the importance of RFAP synthase in H(4)MPT biosynthesis, the identification of putative RFAP synthase genes and measurement of RFAP synthase activity would provide an indication of the presence of H(4)MPT in untested microorganisms. Investigation of putative archaeal RFAP synthase genes has been hampered by the tendency of the resulting proteins to form inactive inclusion bodies in Escherichia coli. The current work describes a colorimetric assay for measuring RFAP synthase activity, and two modified procedures for expressing recombinant RFAP synthase genes to produce soluble, active enzyme. By lowering the incubation temperature during expression, RFAP synthase from Archaeoglobus fulgidus was produced in E. coli and purified to homogeneity. The production of active RFAP synthase from Methanothermobacter thermautotrophicus was achieved by coexpression of the gene MTH0830 with a molecular chaperone. This is the first direct biochemical identification of a methanogen gene that codes for an active RFAP synthase.

The fragile X mental retardation protein has nucleic acid chaperone properties.

Science.gov (United States)

Gabus, Caroline; Mazroui, Rachid; Tremblay, Sandra; Khandjian, Edouard W; Darlix, Jean-Luc

2004-01-01

The fragile X syndrome is the most common cause of inherited mental retardation resulting from the absence of the fragile X mental retardation protein (FMRP). FMRP contains two K-homology (KH) domains and one RGG box that are landmarks characteristic of RNA-binding proteins. In agreement with this, FMRP associates with messenger ribonucleoparticles (mRNPs) within actively translating ribosomes, and is thought to regulate translation of target mRNAs, including its own transcript. To investigate whether FMRP might chaperone nucleic acid folding and hybridization, we analysed the annealing and strand exchange activities of DNA oligonucleotides and the enhancement of ribozyme-directed RNA substrate cleavage by FMRP and deleted variants relative to canonical nucleic acid chaperones, such as the cellular YB-1/p50 protein and the retroviral nucleocapsid protein HIV-1 NCp7. FMRP was found to possess all the properties of a potent nucleic acid chaperone, requiring the KH motifs and RGG box for optimal activity. These findings suggest that FMRP may regulate translation by acting on RNA-RNA interactions and thus on the structural status of mRNAs.

Structure of Spa15, a type III secretion chaperone from Shigella flexneri with broad specificity

NARCIS (Netherlands)

Eerde, André van; Hamiaux, Cyril; Pérez, Javier; Parsot, Claude; Dijkstra, Bauke W.

2004-01-01

Type III secretion (TTS) systems are used by many Gram-negative pathogens to inject virulence proteins into the cells of their hosts. Several of these virulence effectors require TTS chaperones that maintain them in a secretion-competent state. Whereas most chaperones bind only one effector, Spa15

Histone H1 chaperone activity of TAF-I is regulated by its subtype-dependent intramolecular interaction.

Science.gov (United States)

Kajitani, Kaori; Kato, Kohsuke; Nagata, Kyosuke

2017-04-01

Linker histone H1 is involved in the regulation of gene activity through the maintenance of higher-order chromatin structure. Previously, we have shown that template activating factor-I (TAF-I or protein SET) is involved in linker histone H1 dynamics as a histone H1 chaperone. In human and murine cells, two TAF-I subtypes exist, namely TAF-Iα and TAF-Iβ. TAF-I has a highly acidic amino acid cluster in its C-terminal region and forms homo- or heterodimers through its dimerization domain. Both dimer formation and the C-terminal region of TAF-I are essential for the histone chaperone activity. TAF-Iα exhibits less histone chaperone activity compared with TAF-Iβ even though TAF-Iα and β differ only in their N-terminal regions. However, it is unclear how subtype-specific TAF-I activities are regulated. Here, we have shown that the N-terminal region of TAF-Iα autoinhibits its histone chaperone activity via intramolecular interaction with its C-terminal region. When the interaction between the N- and C-terminal regions of TAF-Iα is disrupted, TAF-Iα shows a histone chaperone activity similar to that of TAF-Iβ. Taken together, these results provide mechanistic insights into the concept that fine tuning of TAF-I histone H1 chaperone activity relies on the subtype compositions of the TAF-I dimer. © 2017 Molecular Biology Society of Japan and John Wiley & Sons Australia, Ltd.

Presence of chaperones during pelvic examinations in southeast ...

African Journals Online (AJOL)

2012-12-12

Dec 12, 2012 ... preferred male physicians and 88 (38.3%) had no gender preference. ... is recommended as a standard practice by many medical ... Department of Obstetrics and Gynecology, University of Nigeria ... and eliminates postconsultation bias. .... chaperones gave prevention of sexual harassment as a reason.

Implementation of RS-485 Communication between PLC and PC of Distributed Control System Based on VB

Science.gov (United States)

Lian Zhang, Chuan; Da Huang, Zhi; Qing Zhou, Gui; Chong, Kil To

2015-05-01

This paper focuses on achieving RS-485 communication between programmable logical controller (PLC) and PC based on visual basic 6.0 (VB6.0) on an experimental automatic production line. Mitsubishi FX2N PLCs and a PC are chosen as slave stations and main station, respectively. Monitoring software is developed using VB6.0 for data input/output, flow control and online parameters setting. As a result, all functions are fulfilled with robust performance. It is concluded from results that one PC can monitor several PLCs using RS-485 communication.

Crystallization of the FaeE chaperone of Escherichia coli F4 fimbriae

International Nuclear Information System (INIS)

Van Molle, Inge; Buts, Lieven; Coppens, Fanny; Qiang, Liu; Wyns, Lode; Loris, Remy; Bouckaert, Julie; De Greve, Henri

2005-01-01

The periplasmic chaperone FaeE of E. coli F4 fimbriae crystallizes in three crystal forms. F4 (formerly K88) fimbriae from enterotoxigenic Escherichia coli are assembled via the FaeE/FaeD chaperone/usher pathway. The chaperone FaeE crystallizes in three crystal forms, all belonging to space group C2. Crystals of form 1 diffract to 2.3 Å and have unit-cell parameters a = 195.7, b = 78.5, c = 184.6 Å, β = 102.2°. X-ray data for crystal form 2 were collected to 2.7 Å using an SeMet variant of FaeE. The crystals have unit-cell parameters a = 136.4, b = 75.7, c = 69.4 Å, β = 92.8°. Crystals of form 3 were formed in a solution containing the FaeE–FaeG complex and diffract to 2.8 Å. Unit-cell parameters are a = 109.7, b = 78.6, c = 87.8 Å, β = 96.4°

Crystallization of the FaeE chaperone of Escherichia coli F4 fimbriae

Energy Technology Data Exchange (ETDEWEB)

Van Molle, Inge, E-mail: ivmolle@vub.ac.be; Buts, Lieven; Coppens, Fanny; Qiang, Liu; Wyns, Lode; Loris, Remy; Bouckaert, Julie; De Greve, Henri [Laboratorium voor Ultrastructuur, Vlaams Interuniversitair Instituut voor Biotechnologie, Vrije Universiteit Brussel, Pleinlaan 2, 1050 Brussel (Belgium)

2005-04-01

The periplasmic chaperone FaeE of E. coli F4 fimbriae crystallizes in three crystal forms. F4 (formerly K88) fimbriae from enterotoxigenic Escherichia coli are assembled via the FaeE/FaeD chaperone/usher pathway. The chaperone FaeE crystallizes in three crystal forms, all belonging to space group C2. Crystals of form 1 diffract to 2.3 Å and have unit-cell parameters a = 195.7, b = 78.5, c = 184.6 Å, β = 102.2°. X-ray data for crystal form 2 were collected to 2.7 Å using an SeMet variant of FaeE. The crystals have unit-cell parameters a = 136.4, b = 75.7, c = 69.4 Å, β = 92.8°. Crystals of form 3 were formed in a solution containing the FaeE–FaeG complex and diffract to 2.8 Å. Unit-cell parameters are a = 109.7, b = 78.6, c = 87.8 Å, β = 96.4°.

Effects of HSP27 chaperone on THP-1 tumor cell apoptosis.

Science.gov (United States)

Kaigorodova, E V; Ryazantseva, N V; Novitskii, V V; Maroshkina, A N; Belkina, M V

2012-11-01

The role of Hsp27 (heat shock protein 27) chaperone in regulation of THP-1 tumor cell apoptosis was studied. Realization of tumor cell apoptosis under conditions of in vitro culturing with Hsp27 specific inhibitor (KRIBB3) was evaluated by fluorescent microscopy with FITC-labeled annexin V and propidium iodide. Measurements of Bcl-2 family proteins (Bcl-2, Bax, Bad) in tumor cells incubated with Hsp27 inhibitor were carried out by Western blotting. Chaperone Hsp27 acted as apoptosis inhibitor in THP-1 tumor cells modulating the proportion of antiapoptotic (Bcl-2) and proapoptotic (Bax and Bad) proteins.

Agreement between physicians' and nurses' clinical decisions for the management of the fracture liaison service (4iFLS): the Lucky Bone™ program.

Science.gov (United States)

Senay, A; Delisle, J; Raynauld, J P; Morin, S N; Fernandes, J C

2016-04-01

We determined if nurses can manage osteoporotic fractures in a fracture liaison service by asking a rheumatologist and an internist to assess their clinical decisions. Experts agreed on more than 94 % of all nurses' actions for 525 fragility fracture patients, showing that their management is efficient and safe. A major care gap exists in the investigation of bone fragility and initiation of treatment for individuals who have sustained a fragility fracture. The implementation of a fracture liaison service (FLS) managed by nurses could be the key in resolving this problem. The aim of this project was to obtain agreement between physicians' and nurses' clinical decisions and evaluate if the algorithm of care is efficient and reliable for the management of a FLS. Clinical decisions of nurses for 525 subjects in a fracture liaison service between 2010 and 2013 were assessed by two independent physicians with expertise in osteoporosis treatment. Nurses succeeded in identifying all patients at risk and needed to refer 27 % of patients to an MD. Thereby, they managed autonomously 73 % of fragility fracture patients. No needless referrals were made according to assessing physicians. Agreement between each evaluator and nurses was of >97 %. Physicians' decisions were the same in >96 %, and Gwet AC11 coefficient was of >0.960 (almost perfect level of agreement). All major comorbidities were adequately managed. High agreement between nurses' and physicians' clinical decisions indicate that the independent management by nurses of a fracture liaison service is safe and should strongly be recommended in the care of patients with a fragility fracture. This kind of intervention could help resolve the existing care gap in bone fragility care as well as the societal economic burden associated with prevention and treatment of fragility fractures.

Characterization of the recombinant copper chaperone (CCS) from the plant Glycine (G.) max.

Science.gov (United States)

Sagasti, Sara; Yruela, Inmaculada; Bernal, Maria; Lujan, Maria A; Frago, Susana; Medina, Milagros; Picorel, Rafael

2011-02-01

The goal of the present work was to characterize the recombinant copper chaperone (CCS) from soybean. Very little is known about plant copper chaperones, which makes this study of current interest, and allows for a comparison with the better known homologues from yeast and humans. To obtain sizeable amounts of pure protein suitable for spectroscopic characterization, we cloned and overexpressed the G. max CCS chaperone in E. coli in the presence of 0.5 mM CuSO(4) and 0.5 mM ZnSO(4) in the broth. A pure protein preparation was obtained by using two IMAC steps and pH gradient chromatography. Most of the proteins were obtained as apo-form, devoid of copper atoms. The chaperone showed a high content (i.e., over 40%) of loops, turns and random coil as determined both by circular dichroism and homology modelling. The homology 3-D structural model suggests the protein might fold in three structural protein domains. The 3-D model along with the primary structure and spectroscopic data may suggest that copper atoms occupy the two metal binding sites, MKCEGC and CTC, within the N-terminal domain I and C-terminal domain III, respectively. But only one Zn-binding site was obtained spectroscopically.

Endoplasmic reticulum chaperone glucose regulated protein 170-Pokemon complexes elicit a robust antitumor immune response in vivo.

Science.gov (United States)

Yuan, Bangqing; Xian, Ronghua; Wu, Xianqu; Jing, Junjie; Chen, Kangning; Liu, Guojun; Zhou, Zhenhua

2012-07-01

Previous evidence suggested that the stress protein grp170 can function as a highly efficient molecular chaperone, binding to large protein substrates and acting as a potent vaccine against specific tumors when purified from the same tumor. In addition, Pokemon can be found in almost all malignant tumor cells and is regarded to be a promising candidate for the treatment of tumors. However, the potential of the grp170-Pokemon chaperone complex has not been well described. In the present study, the natural chaperone complex between grp170 and the Pokemon was formed by heat shock, and its immunogenicity was detected by ELISPOT and (51)Cr-release assays in vitro and by tumor bearing models in vivo. Our results demonstrated that the grp170-Pokemon chaperone complex could elicit T cell responses as determined by ELISPOT and (51)Cr-release assays. In addition, immunized C57BL/6 mice were challenged with subcutaneous (s.c.) injection of Lewis cancer cells to induce primary tumors. Treatment of mice with the grp170-Pokemon chaperone complex also significantly inhibited tumor growth and prolonged the life span of tumor-bearing mice. Our results indicated that the grp170-Pokemon chaperone complex might represent a powerful approach to tumor immunotherapy and have significant potential for clinical application. Copyright © 2012 Elsevier GmbH. All rights reserved.

Kinetics and thermodynamics of the thermal inactivation and chaperone assisted folding of zebrafish dihydrofolate reductase.

Science.gov (United States)

Thapliyal, Charu; Jain, Neha; Rashid, Naira; Chaudhuri Chattopadhyay, Pratima

2018-01-01

The maintenance of thermal stability is a major issue in protein engineering as many proteins tend to form inactive aggregates at higher temperatures. Zebrafish DHFR, an essential protein for the survival of cells, shows irreversible thermal unfolding transition. The protein exhibits complete unfolding and loss of activity at 50 °C as monitored by UV-Visible, fluorescence and far UV-CD spectroscopy. The heat induced inactivation of zDHFR follows first-order kinetics and Arrhenius law. The variation in the value of inactivation rate constant, k with increasing temperatures depicts faster inactivation at elevated temperatures. We have attempted to study the chaperoning ability of a shorter variant of GroEL (minichaperone) and compared it with that of conventional GroEL-GroES chaperone system. Both the chaperone system prevented the aggregation and assisted in refolding of zDHFR. The rate of thermal inactivation was significantly retarded in the presence of chaperones which indicate that it enhances the thermal stability of the enzyme. As minichaperone is less complex, and does not require high energy co-factors like ATP, for its function as compared to conventional GroEL-GroES system, it can act as a very good in vitro as well as in vivo chaperone model for monitoring assisted protein folding phenomenon. Copyright © 2017 Elsevier Inc. All rights reserved.

Different contributions of HtrA protease and chaperone activities to Campylobacter jejuni stress tolerance and physiology

DEFF Research Database (Denmark)

Bæk, Kristoffer Torbjørn; Vegge, Christina Skovgaard; Skórko-Glonek, Joanna

2011-01-01

activity is sufficient for growth at high temperature or oxidative stress, whereas the HtrA protease activity is only essential at conditions close to the growth limit for C. jejuni. However, the protease activity was required to prevent induction of the cytoplasmic heat-shock response even at optimal......The microaerophilic bacterium Campylobacter jejuni is the most common cause of bacterial food-borne infections in the developed world. Tolerance to environmental stress relies on proteases and chaperones in the cell envelope such as HtrA and SurA. HtrA displays both chaperone and protease activity......, but little is known about how each of these activities contributes to stress tolerance in bacteria. In vitro experiments showed temperature dependent protease and chaperone activities of C. jejuni HtrA. A C. jejuni mutant lacking only the protease activity of HtrA was used to show that the HtrA chaperone...

The HIV-1 transcriptional activator Tat has potent nucleic acid chaperoning activities in vitro.

Science.gov (United States)

Kuciak, Monika; Gabus, Caroline; Ivanyi-Nagy, Roland; Semrad, Katharina; Storchak, Roman; Chaloin, Olivier; Muller, Sylviane; Mély, Yves; Darlix, Jean-Luc

2008-06-01

The human immunodeficiency virus type 1 (HIV-1) is a primate lentivirus that causes the acquired immunodeficiency syndrome (AIDS). In addition to the virion structural proteins and enzyme precursors, that are Gag, Env and Pol, HIV-1 encodes several regulatory proteins, notably a small nuclear transcriptional activator named Tat. The Tat protein is absolutely required for virus replication since it controls proviral DNA transcription to generate the full-length viral mRNA. Tat can also regulate mRNA capping and splicing and was recently found to interfere with the cellular mi- and siRNA machinery. Because of its extensive interplay with nucleic acids, and its basic and disordered nature we speculated that Tat had nucleic acid-chaperoning properties. This prompted us to examine in vitro the nucleic acid-chaperoning activities of Tat and Tat peptides made by chemical synthesis. Here we report that Tat has potent nucleic acid-chaperoning activities according to the standard DNA annealing, DNA and RNA strand exchange, RNA ribozyme cleavage and trans-splicing assays. The active Tat(44-61) peptide identified here corresponds to the smallest known sequence with DNA/RNA chaperoning properties.

Treatment of Fabry's Disease with the Pharmacologic Chaperone Migalastat

DEFF Research Database (Denmark)

Germain, Dominique P; Hughes, Derralynn A; Nicholls, Kathleen

2016-01-01

BACKGROUND: Fabry's disease, an X-linked disorder of lysosomal α-galactosidase deficiency, leads to substrate accumulation in multiple organs. Migalastat, an oral pharmacologic chaperone, stabilizes specific mutant forms of α-galactosidase, increasing enzyme trafficking to lysosomes. METHODS: The...

Rescue of a pathogenic mutant human glucagon receptor by pharmacological chaperones.

Science.gov (United States)

Yu, Run; Chen, Chun-Rong; Liu, Xiaohong; Kodra, János T

2012-10-01

We have previously demonstrated that a homozygous inactivating P86S mutation of the glucagon receptor (GCGR) causes a novel human disease of hyperglucagonemia, pancreatic α-cell hyperplasia, and pancreatic neuroendocrine tumors (Mahvash disease). The mechanisms for the decreased activity of the P86S mutant (P86S) are abnormal receptor localization to the endoplasmic reticulum (ER) and defective interaction with glucagon. To search for targeted therapies for Mahvash disease, we examined whether P86S can be trafficked to the plasma membrane by pharmacological chaperones and whether novel glucagon analogs restore effective receptor interaction. We used enhanced green fluorescent protein-tagged P86S stably expressed in HEK 293 cells to allow fluorescence imaging and western blotting and molecular modeling to design novel glucagon analogs in which alanine 19 was replaced with serine or asparagine. Incubation at 27 °C largely restored normal plasma membrane localization and normal processing of P86S but osmotic chaperones had no effects. The ER stressors thapsigargin and curcumin partially rescued P86S. The lipophilic GCGR antagonist L-168,049 also partially rescued P86S, so did Cpd 13 and 15 to a smaller degree. The rescued P86S led to more glucagon-stimulated cAMP production and was internalized by glucagon. Compared with the native glucagon, the novel glucagon analogs failed to stimulate more cAMP production by P86S. We conclude that the mutant GCGR is partially rescued by several pharmacological chaperones and our data provide proof-of-principle evidence that Mahvash disease can be potentially treated with pharmacological chaperones. The novel glucagon analogs, however, failed to interact with P86S more effectively.

The heat shock protein/chaperone network and multiple stress resistance

KAUST Repository

Jacob, Pierre; Hirt, Heribert; Bendahmane, Abdelhafid

2016-01-01

Crop yield has been greatly enhanced during the last century. However, most elite cultivars are adapted to temperate climates and are not well suited to more stressful conditions. In the context of climate change, stress resistance is a major concern. To overcome these difficulties, scientists may help breeders by providing genetic markers associated with stress resistance. However, multi-stress resistance cannot be obtained from the simple addition of single stress resistance traits. In the field, stresses are unpredictable and several may occur at once. Consequently, the use of single stress resistance traits is often inadequate. Although it has been historically linked with the heat stress response, the heat shock protein (HSP)/chaperone network is a major component of multiple stress responses. Among the HSP/chaperone

The heat shock protein/chaperone network and multiple stress resistance

KAUST Repository

Jacob, Pierre

2016-11-15

Crop yield has been greatly enhanced during the last century. However, most elite cultivars are adapted to temperate climates and are not well suited to more stressful conditions. In the context of climate change, stress resistance is a major concern. To overcome these difficulties, scientists may help breeders by providing genetic markers associated with stress resistance. However, multi-stress resistance cannot be obtained from the simple addition of single stress resistance traits. In the field, stresses are unpredictable and several may occur at once. Consequently, the use of single stress resistance traits is often inadequate. Although it has been historically linked with the heat stress response, the heat shock protein (HSP)/chaperone network is a major component of multiple stress responses. Among the HSP/chaperone

c-Abl Mediated Tyrosine Phosphorylation of Aha1 Activates Its Co-chaperone Function in Cancer Cells

Directory of Open Access Journals (Sweden)

Diana M. Dunn

2015-08-01

Full Text Available The ability of Heat Shock Protein 90 (Hsp90 to hydrolyze ATP is essential for its chaperone function. The co-chaperone Aha1 stimulates Hsp90 ATPase activity, tailoring the chaperone function to specific “client” proteins. The intracellular signaling mechanisms directly regulating Aha1 association with Hsp90 remain unknown. Here, we show that c-Abl kinase phosphorylates Y223 in human Aha1 (hAha1, promoting its interaction with Hsp90. This, consequently, results in an increased Hsp90 ATPase activity, enhances Hsp90 interaction with kinase clients, and compromises the chaperoning of non-kinase clients such as glucocorticoid receptor and CFTR. Suggesting a regulatory paradigm, we also find that Y223 phosphorylation leads to ubiquitination and degradation of hAha1 in the proteasome. Finally, pharmacologic inhibition of c-Abl prevents hAha1 interaction with Hsp90, thereby hypersensitizing cancer cells to Hsp90 inhibitors both in vitro and ex vivo.

Hsp40 function in yeast prion propagation: Amyloid diversity necessitates chaperone functional complexity.

Science.gov (United States)

Sporn, Zachary A; Hines, Justin K

2015-01-01

Yeast prions are heritable protein-based elements, most of which are formed of amyloid aggregates that rely on the action of molecular chaperones for transmission to progeny. Prions can form distinct amyloid structures, known as 'strains' in mammalian systems, that dictate both pathological progression and cross-species infection barriers. In yeast these same amyloid structural polymorphisms, called 'variants', dictate the intensity of prion-associated phenotypes and stability in mitosis. We recently reported that [PSI(+)] prion variants differ in the fundamental domain requirements for one chaperone, the Hsp40/J-protein Sis1, which are mutually exclusive between 2 different yeast prions, demonstrating a functional plurality for Sis1. Here we extend that analysis to incorporate additional data that collectively support the hypothesis that Sis1 has multiple functional roles that can be accomplished by distinct sets of domains. These functions are differentially required by distinct prions and prion variants. We also present new data regarding Hsp104-mediated prion elimination and show that some Sis1 functions, but not all, are conserved in the human homolog Hdj1/DNAJB1. Importantly, of the 10 amyloid-based prions indentified to date in Saccharomyces cerevisiae, the chaperone requirements of only 4 are known, leaving a great diversity of amyloid structures, and likely modes of amyloid-chaperone interaction, largely unexplored.

Disaggregases, molecular chaperones that resolubilize protein aggregates

Directory of Open Access Journals (Sweden)

David Z. Mokry

2015-08-01

Full Text Available The process of folding is a seminal event in the life of a protein, as it is essential for proper protein function and therefore cell physiology. Inappropriate folding, or misfolding, can not only lead to loss of function, but also to the formation of protein aggregates, an insoluble association of polypeptides that harm cell physiology, either by themselves or in the process of formation. Several biological processes have evolved to prevent and eliminate the existence of non-functional and amyloidogenic aggregates, as they are associated with several human pathologies. Molecular chaperones and heat shock proteins are specialized in controlling the quality of the proteins in the cell, specifically by aiding proper folding, and dissolution and clearance of already formed protein aggregates. The latter is a function of disaggregases, mainly represented by the ClpB/Hsp104 subfamily of molecular chaperones, that are ubiquitous in all organisms but, surprisingly, have no orthologs in the cytosol of metazoan cells. This review aims to describe the characteristics of disaggregases and to discuss the function of yeast Hsp104, a disaggregase that is also involved in prion propagation and inheritance.

Oxidative stress induces monocyte necrosis with enrichment of cell-bound albumin and overexpression of endoplasmic reticulum and mitochondrial chaperones.

Directory of Open Access Journals (Sweden)

Haiping Tang

Full Text Available In the present study, monocytes were treated with 5-azacytidine (azacytidine, gossypol or hydrogen peroxide to induce cell death through oxidative stress. A shift from apoptotic to necrotic cell death occurred when monocytes were treated with 100 µM azacytidine for more than 12 hours. Necrotic monocytes exhibited characteristics, including enrichment of cell-bound albumin and up-regulation of endoplasmic reticulum (ER- and mitochondrial-specific chaperones to protect mitochondrial integrity, which were not observed in other necrotic cells, including HUH-7, A2780, A549 and HOC1a. Our results show that the cell-bound albumin originates in the culture medium rather than from monocyte-derived hepatocytes, and that HSP60 is a potential binding partner of the cell-bound albumin. Proteomic analysis shows that HSP60 and protein disulfide isomerase are the most abundant up-regulated mitochondrial and ER-chaperones, and that both HSP60 and calreticulin are ubiquitinated in necrotic monocytes. In contrast, expression levels of the cytosolic chaperones HSP90 and HSP71 were down-regulated in the azacytidine-treated monocytes, concomitant with an increase in the levels of these chaperones in the cell culture medium. Collectively, our results demonstrates that chaperones from different organelles behave differently in necrotic monocytes, ER- and mitochondrial chaperones being retained and cytosolic and nuclear chaperones being released into the cell culture medium through the ruptured cell membrane. HSP60 may serve as a new target for development of myeloid leukemia treatment.

Interplay between Molecular Chaperones and the Ubiquitin-Proteasome System in Targeting of Misfolded Proteins for Degradation

DEFF Research Database (Denmark)

Poulsen, Esben Guldahl

interacting with purified 26S proteasomes, and the subsequent characterization of two novel proteasome interacting proteins. The third study was aimed at analyzing the chaperone-assisted pathway leading to degradation of misfolded kinetochore proteins in S. pombe. In this study chaperones, E2s, E3s and DUBs...

Progress and potential of non-inhibitory small molecule chaperones for the treatment of Gaucher disease and its implications for Parkinson disease.

Science.gov (United States)

Jung, Olive; Patnaik, Samarjit; Marugan, Juan; Sidransky, Ellen; Westbroek, Wendy

2016-05-01

Gaucher disease, caused by pathological mutations GBA1, encodes the lysosome-resident enzyme glucocerebrosidase, which cleaves glucosylceramide into glucose and ceramide. In Gaucher disease, glucocerebrosidase deficiency leads to lysosomal accumulation of substrate, primarily in cells of the reticulo-endothelial system. Gaucher disease has broad clinical heterogeneity, and mutations in GBA1 are a risk factor for the development of different synucleinopathies. Insights into the cell biology and biochemistry of glucocerebrosidase have led to new therapeutic approaches for Gaucher disease including small chemical chaperones. Such chaperones facilitate proper enzyme folding and translocation to lysosomes, thereby preventing premature breakdown of the enzyme in the proteasome. This review discusses recent progress in developing chemical chaperones as a therapy for Gaucher disease, with implications for the treatment of synucleinopathies. It focuses on the development of non-inhibitory glucocerebrosidase chaperones and their therapeutic advantages over inhibitory chaperones, as well as the challenges involved in identifying and validating chemical chaperones.

Heat Shock Proteins: A Review of the Molecular Chaperones for Plant Immunity.

Science.gov (United States)

Park, Chang-Jin; Seo, Young-Su

2015-12-01

As sessile organisms, plants are exposed to persistently changing stresses and have to be able to interpret and respond to them. The stresses, drought, salinity, chemicals, cold and hot temperatures, and various pathogen attacks have interconnected effects on plants, resulting in the disruption of protein homeostasis. Maintenance of proteins in their functional native conformations and preventing aggregation of non-native proteins are important for cell survival under stress. Heat shock proteins (HSPs) functioning as molecular chaperones are the key components responsible for protein folding, assembly, translocation, and degradation under stress conditions and in many normal cellular processes. Plants respond to pathogen invasion using two different innate immune responses mediated by pattern recognition receptors (PRRs) or resistance (R) proteins. HSPs play an indispensable role as molecular chaperones in the quality control of plasma membrane-resident PRRs and intracellular R proteins against potential invaders. Here, we specifically discuss the functional involvement of cytosolic and endoplasmic reticulum (ER) HSPs/chaperones in plant immunity to obtain an integrated understanding of the immune responses in plant cells.

Heat Shock Proteins: A Review of the Molecular Chaperones for Plant Immunity

Directory of Open Access Journals (Sweden)

Chang-Jin Park

2015-12-01

Full Text Available As sessile organisms, plants are exposed to persistently changing stresses and have to be able to interpret and respond to them. The stresses, drought, salinity, chemicals, cold and hot temperatures, and various pathogen attacks have interconnected effects on plants, resulting in the disruption of protein homeostasis. Maintenance of proteins in their functional native conformations and preventing aggregation of non-native proteins are important for cell survival under stress. Heat shock proteins (HSPs functioning as molecular chaperones are the key components responsible for protein folding, assembly, translocation, and degradation under stress conditions and in many normal cellular processes. Plants respond to pathogen invasion using two different innate immune responses mediated by pattern recognition receptors (PRRs or resistance (R proteins. HSPs play an indispensable role as molecular chaperones in the quality control of plasma membrane-resident PRRs and intracellular R proteins against potential invaders. Here, we specifically discuss the functional involvement of cytosolic and endoplasmic reticulum (ER HSPs/chaperones in plant immunity to obtain an integrated understanding of the immune responses in plant cells.

Molecular transformers in the cell: lessons learned from the DegP protease-chaperone.

Science.gov (United States)

Sawa, Justyna; Heuck, Alexander; Ehrmann, Michael; Clausen, Tim

2010-04-01

Structure-function analysis of DegP revealed a novel mechanism for protease and chaperone regulation. Binding of unfolded proteins induces the oligomer reassembly from the resting hexamer (DegP6) into the functional protease-chaperone DegP12/24. The newly formed cage exhibits the characteristics of a proteolytic folding chamber, shredding those proteins that are severely misfolded while stabilizing and protecting proteins present in their native state. Isolation of native DegP complexes with folded outer membrane proteins (OMPs) highlights the importance of DegP in OMP biogenesis. The encapsulated OMP beta-barrel is significantly stabilized in the hydrophobic chamber of DegP12/24 and thus DegP seems to employ a reciprocal mechanism to those chaperones assisting the folding of water soluble proteins via polar interactions. In addition, we discuss in this review similarities to other complex proteolytic machines that, like DegP, are under control of a substrate-induced or stress-induced oligomer conversion.

Decoding Structural Properties of a Partially Unfolded Protein Substrate: En Route to Chaperone Binding.

Science.gov (United States)

Nagpal, Suhani; Tiwari, Satyam; Mapa, Koyeli; Thukral, Lipi

2015-01-01

Many proteins comprising of complex topologies require molecular chaperones to achieve their unique three-dimensional folded structure. The E.coli chaperone, GroEL binds with a large number of unfolded and partially folded proteins, to facilitate proper folding and prevent misfolding and aggregation. Although the major structural components of GroEL are well defined, scaffolds of the non-native substrates that determine chaperone-mediated folding have been difficult to recognize. Here we performed all-atomistic and replica-exchange molecular dynamics simulations to dissect non-native ensemble of an obligate GroEL folder, DapA. Thermodynamics analyses of unfolding simulations revealed populated intermediates with distinct structural characteristics. We found that surface exposed hydrophobic patches are significantly increased, primarily contributed from native and non-native β-sheet elements. We validate the structural properties of these conformers using experimental data, including circular dichroism (CD), 1-anilinonaphthalene-8-sulfonic acid (ANS) binding measurements and previously reported hydrogen-deutrium exchange coupled to mass spectrometry (HDX-MS). Further, we constructed network graphs to elucidate long-range intra-protein connectivity of native and intermediate topologies, demonstrating regions that serve as central "hubs". Overall, our results implicate that genomic variations (or mutations) in the distinct regions of protein structures might disrupt these topological signatures disabling chaperone-mediated folding, leading to formation of aggregates.

In vitro reconstitution of chaperone-mediated human RISC assembly.

Science.gov (United States)

Naruse, Ken; Matsuura-Suzuki, Eriko; Watanabe, Mariko; Iwasaki, Shintaro; Tomari, Yukihide

2018-01-01

To silence target mRNAs, small RNAs and Argonaute (Ago) proteins need to be assembled into RNA-induced silencing complexes (RISCs). Although the assembly of Drosophila melanogaster RISC was recently reconstituted by Ago2, the Dicer-2/R2D2 heterodimer, and five chaperone proteins, the absence of a reconstitution system for mammalian RISC assembly has posed analytical challenges. Here we describe reconstitution of human RISC assembly using Ago2 and five recombinant chaperone proteins: Hsp90β, Hsc70, Hop, Dnaja2, and p23. Our data show that ATP hydrolysis by both Hsp90β and Hsc70 is required for RISC assembly of small RNA duplexes but not for that of single-stranded RNAs. The reconstitution system lays the groundwork for further studies of small RNA-mediated gene silencing in mammals. © 2018 Naruse et al.; Published by Cold Spring Harbor Laboratory Press for the RNA Society.

Possible Function of Molecular Chaperones in Diseases Caused by Propagating Amyloid Aggregates

Directory of Open Access Journals (Sweden)

Vladimir F. Lazarev

2017-05-01

Full Text Available The vast majority of neurodegenerative pathologies stem from the formation of toxic oligomers and aggregates composed of wrongly folded proteins. These protein complexes can be released from pathogenic cells and enthralled by other cells, causing the formation of new aggregates in a prion-like manner. By this mechanism, migrating complexes can transmit a disorder to distant regions of the brain and promote gradually transmitting degenerative processes. Molecular chaperones can counteract the toxicity of misfolded proteins. In this review, we discuss recent data on the possible cytoprotective functions of chaperones in horizontally transmitting neurological disorders.

Investigation of original multivalent iminosugars as pharmacological chaperones for the treatment of Gaucher disease.

Science.gov (United States)

Laigre, Eugénie; Hazelard, Damien; Casas, Josefina; Serra-Vinardell, Jenny; Michelakakis, Helen; Mavridou, Irene; Aerts, Johannes M F G; Delgado, Antonio; Compain, Philippe

2016-06-24

Multivalent iminosugars conjugated with a morpholine moiety and/or designed as prodrugs have been prepared and evaluated as new classes of pharmacological chaperones for the treatment of Gaucher disease. This study further confirms the interest of the prodrug concept and shows that the addition of a lysosome-targeting morpholine unit into iminosugar cluster structures has no significant impact on the chaperone activity on Gaucher cells. Copyright © 2016 Elsevier Ltd. All rights reserved.

Molecular aspects in inflammatory events of temporomandibular joint: Microarray-based identification of mediators

Directory of Open Access Journals (Sweden)

Naomi Ogura

2015-02-01

Full Text Available Synovial inflammation (synovitis frequently accompanies intracapsular pathologic conditions of the temporomandibular joint (TMJ such as internal derangement (ID and/or osteoarthritis (OA, and is suggested to be associated with symptom severity. To identify the putative factors associated with synovitis, we investigated interleukin (IL-1β- and/or tumor necrosis factor (TNF-α-responsive genes of fibroblast-like synoviocytes (FLS from patients with ID and/or OA of TMJ using microarray analysis. In this review, we first summarize the FLS of TMJ and the signaling pathways of IL-1β and TNF-α. Next, we show the up-regulated genes in FLS after stimulation with IL-1β or TNF-α, and summarize the gene functions based on recent studies. Among the top 10 up-regulated factors, molecules such as IL-6 and cycrooxygense-2 have been well characterized and investigated in the inflammatory responses and tissue destruction associated with joint diseases such as RA and OA, but the roles of some molecules remain unclear. The FLS reaction can lead to the synthesis and release of a wide variety of inflammatory mediators. Some of these mediators are detected in joint tissues and synovial fluids under intracapsular pathologic conditions, and may represent potential targets for therapeutic interventions in ID and/or OA of TMJ.

The identification and characterization of nucleic acid chaperone activity of human enterovirus 71 nonstructural protein 3AB.

Science.gov (United States)

Tang, Fenfen; Xia, Hongjie; Wang, Peipei; Yang, Jie; Zhao, Tianyong; Zhang, Qi; Hu, Yuanyang; Zhou, Xi

2014-09-01

Human enterovirus 71 (EV71) belongs to the genus Enterovirus in the family Picornaviridae and has been recognized as one of the most important pathogens that cause emerging infectious disease. Despite of the importance of EV71, the nonstructural protein 3AB from this virus is little understood for its function during EV71 replication. Here we expressed EV71 3AB protein as recombinant protein in a eukaryotic expression system and uncovered that this protein possesses a nucleic acid helix-destabilizing and strand annealing acceleration activity in a dose-dependent manner, indicating that EV71 3AB is a nucleic acid chaperone protein. Moreover, we characterized the RNA chaperone activity of EV71 3AB, and revealed that divalent metal ions, such as Mg(2+) and Zn(2+), were able to inhibit the RNA helix-destabilizing activity of 3AB to different extents. Moreover, we determined that 3B plus the last 7 amino acids at the C-terminal of 3A (termed 3B+7) possess the RNA chaperone activity, and five amino acids, i.e. Lys-80, Phe-82, Phe-85, Tyr-89, and Arg-103, are critical and probably the active sites of 3AB for its RNA chaperone activity. This report reveals that EV71 3AB displays an RNA chaperone activity, adds a new member to the growing list of virus-encoded RNA chaperones, and provides novel knowledge about the virology of EV71. Copyright © 2014 Elsevier Inc. All rights reserved.

Metal chaperones: a holistic approach to the treatment of AD

Directory of Open Access Journals (Sweden)

Paul Anthony Adlard

2012-03-01

Full Text Available As the burden of proof for the role of metal ion dysregulation in the pathogenesis of multiple CNS disorders grows, it has become important to more precisely identify and differentiate the biological effects of various pharmacological modulators of metal ion homeostasis. This is particularly evident in disorders such as Alzheimer’s disease, where the use of metal chaperones (that transport metals, as opposed to chelators (which exclude metals from biological interactions, may prove to be the first truly disease modifying approach for this condition. The purpose of this mini-review is to highlight the emerging notion that metal chaperones, such as PBT2 (Prana Biotechnology, modulate a variety of critical pathways affecting key aspects of the AD cascade to provide a more holistic approach to the treatment of this disease.

Molecular chaperones in targeting misfolded proteins for ubiquitin-dependent degradation

DEFF Research Database (Denmark)

Kriegenburg, Franziska; Ellgaard, Lars; Hartmann-Petersen, Rasmus

2012-01-01

The accumulation of misfolded proteins presents a considerable threat to the health of individual cells and has been linked to severe diseases, including neurodegenerative disorders. Considering that, in nature, cells often are exposed to stress conditions that may lead to aberrant protein...... conformational changes, it becomes clear that they must have an efficient quality control apparatus to refold or destroy misfolded proteins. In general, cells rely on molecular chaperones to seize and refold misfolded proteins. If the native state is unattainable, misfolded proteins are targeted for degradation...... via the ubiquitin-proteasome system. The specificity of this proteolysis is generally provided by E3 ubiquitin-protein ligases, hundreds of which are encoded in the human genome. However, rather than binding the misfolded proteins directly, most E3s depend on molecular chaperones to recognize...

Carcinoid tumour of the appendix: An analysis of 1,485 consecutive emergency appendectomies

NARCIS (Netherlands)

K-H. in 't Hof (Klaas); H.C. van der Wal; G. Kazemier (Geert); J.F. Lange (Johan)

2008-01-01

textabstractAim: The aim of this study is to conduct a retrospective analysis of the incidence and long-term results of carcinoid tumours of the appendix in emergency appendectomies. Methods: A retrospective review of 1,485 appendectomies was performed in two centres from January 2000 until January

A primate specific extra domain in the molecular chaperone Hsp90.

Directory of Open Access Journals (Sweden)

Vishwadeepak Tripathi

Full Text Available Hsp90 (heat shock protein 90 is an essential molecular chaperone that mediates folding and quality control of client proteins. Many of them such as protein kinases, steroid receptors and transcription factors are involved in cellular signaling processes. Hsp90 undergoes an ATP hydrolysis dependent conformational cycle to assist folding of the client protein. The canonical Hsp90 shows a typical composition of three distinct domains and interacts with individual cochaperone partners such as Hop, Cdc37 and Aha1 (activator of Hsp90 ATPase that regulate the reaction cycle of the molecular chaperone. A bioinformatic survey identified an additional domain of 122 amino acids in front of the canonical Hsp90 sequence. This extra domain (E domain is specific to the Catarrhini or drooping nose monkeys, a subdivision of the higher primates that includes man, the great apes and the old world monkeys but is absent from all other species. Our biochemical analysis reveals that Hsp103 associates with cochaperone proteins such as Hop, Cdc37 and Aha1 similar to Hsp90. However, the extra domain reduces the ATP hydrolysis rate to about half when compared to Hsp90 thereby acting as a negative regulator of the molecular chaperonés intrinsic ATPase activity.

Cytosolic chaperones mediate quality control of higher-order septin assembly in budding yeast.

Science.gov (United States)

Johnson, Courtney R; Weems, Andrew D; Brewer, Jennifer M; Thorner, Jeremy; McMurray, Michael A

2015-04-01

Septin hetero-oligomers polymerize into cytoskeletal filaments with essential functions in many eukaryotic cell types. Mutations within the oligomerization interface that encompasses the GTP-binding pocket of a septin (its "G interface") cause thermoinstability of yeast septin hetero-oligomer assembly, and human disease. When coexpressed with its wild-type counterpart, a G interface mutant is excluded from septin filaments, even at moderate temperatures. We show that this quality control mechanism is specific to G interface mutants, operates during de novo septin hetero-oligomer assembly, and requires specific cytosolic chaperones. Chaperone overexpression lowers the temperature permissive for proliferation of cells expressing a G interface mutant as the sole source of a given septin. Mutations that perturb the septin G interface retard release from these chaperones, imposing a kinetic delay on the availability of nascent septin molecules for higher-order assembly. Un-expectedly, the disaggregase Hsp104 contributes to this delay in a manner that does not require its "unfoldase" activity, indicating a latent "holdase" activity toward mutant septins. These findings provide new roles for chaperone-mediated kinetic partitioning of non-native proteins and may help explain the etiology of septin-linked human diseases. © 2015 Johnson et al. This article is distributed by The American Society for Cell Biology under license from the author(s). Two months after publication it is available to the public under an Attribution–Noncommercial–Share Alike 3.0 Unported Creative Commons License (http://creativecommons.org/licenses/by-nc-sa/3.0).

Structure of the human histone chaperone FACT Spt16 N-terminal domain

Energy Technology Data Exchange (ETDEWEB)

Marcianò, G.; Huang, D. T., E-mail: d.huang@beatson.gla.ac.uk [Cancer Research UK Beatson Institute, Garscube Estate, Switchback Road, Glasgow G61 1BD, Scotland (United Kingdom)

2016-01-22

The Spt16–SSRP1 heterodimer is a histone chaperone that plays an important role in regulating chromatin assembly. Here, a crystal structure of the N-terminal domain of human Spt16 is presented and it is shown that this domain may contribute to histone binding. The histone chaperone FACT plays an important role in facilitating nucleosome assembly and disassembly during transcription. FACT is a heterodimeric complex consisting of Spt16 and SSRP1. The N-terminal domain of Spt16 resembles an inactive aminopeptidase. How this domain contributes to the histone chaperone activity of FACT remains elusive. Here, the crystal structure of the N-terminal domain (NTD) of human Spt16 is reported at a resolution of 1.84 Å. The structure adopts an aminopeptidase-like fold similar to those of the Saccharomyces cerevisiae and Schizosaccharomyces pombe Spt16 NTDs. Isothermal titration calorimetry analyses show that human Spt16 NTD binds histones H3/H4 with low-micromolar affinity, suggesting that Spt16 NTD may contribute to histone binding in the FACT complex. Surface-residue conservation and electrostatic analysis reveal a conserved acidic patch that may be involved in histone binding.

Structure of the human histone chaperone FACT Spt16 N-terminal domain

International Nuclear Information System (INIS)

Marcianò, G.; Huang, D. T.

2016-01-01

The Spt16–SSRP1 heterodimer is a histone chaperone that plays an important role in regulating chromatin assembly. Here, a crystal structure of the N-terminal domain of human Spt16 is presented and it is shown that this domain may contribute to histone binding. The histone chaperone FACT plays an important role in facilitating nucleosome assembly and disassembly during transcription. FACT is a heterodimeric complex consisting of Spt16 and SSRP1. The N-terminal domain of Spt16 resembles an inactive aminopeptidase. How this domain contributes to the histone chaperone activity of FACT remains elusive. Here, the crystal structure of the N-terminal domain (NTD) of human Spt16 is reported at a resolution of 1.84 Å. The structure adopts an aminopeptidase-like fold similar to those of the Saccharomyces cerevisiae and Schizosaccharomyces pombe Spt16 NTDs. Isothermal titration calorimetry analyses show that human Spt16 NTD binds histones H3/H4 with low-micromolar affinity, suggesting that Spt16 NTD may contribute to histone binding in the FACT complex. Surface-residue conservation and electrostatic analysis reveal a conserved acidic patch that may be involved in histone binding

PfClpC Is an Essential Clp Chaperone Required for Plastid Integrity and Clp Protease Stability in Plasmodium falciparum

Directory of Open Access Journals (Sweden)

Anat Florentin

2017-11-01

Full Text Available Summary: The deadly malaria parasite Plasmodium falciparum contains a nonphotosynthetic plastid, known as the apicoplast, that functions to produce essential metabolites, and drugs that target the apicoplast are clinically effective. Several prokaryotic caseinolytic protease (Clp genes have been identified in the Plasmodium genome. Using phylogenetic analysis, we focused on the Clp members that may form a regulated proteolytic complex in the apicoplast. We genetically targeted members of this complex and generated conditional mutants of the apicoplast-localized PfClpC chaperone and PfClpP protease. Conditional inhibition of the PfClpC chaperone resulted in growth arrest and apicoplast loss and was rescued by addition of the essential apicoplast-derived metabolite IPP. Using a double-conditional mutant parasite line, we discovered that the chaperone activity is required to stabilize the mature protease, revealing functional interactions. These data demonstrate the essential function of PfClpC in maintaining apicoplast integrity and its role in regulating the proteolytic activity of the Clp complex. : Plasmodium falciparum contains a unique organelle, the apicoplast. Using genetic and phenotypic assays, Florentin et al. characterize the apicoplast Clp chaperone and protease. They find that the chaperone is essential for protease stability and that together they function to maintain organelle integrity and segregation into daughter cells. Keywords: malaria, Plasmodium, apicoplast, IPP, Clp, chaperone, caseinolytic protease

Investigating the Chaperone Properties of a Novel Heat Shock Protein, Hsp70.c, from Trypanosoma brucei

Directory of Open Access Journals (Sweden)

Adélle Burger

2014-01-01

Full Text Available The neglected tropical disease, African Trypanosomiasis, is fatal and has a crippling impact on economic development. Heat shock protein 70 (Hsp70 is an important molecular chaperone that is expressed in response to stress and Hsp40 acts as its co-chaperone. These proteins play a wide range of roles in the cell and they are required to assist the parasite as it moves from a cold blooded insect vector to a warm blooded mammalian host. A novel cytosolic Hsp70, from Trypanosoma brucei, TbHsp70.c, contains an acidic substrate binding domain and lacks the C-terminal EEVD motif. The ability of a cytosolic Hsp40 from Trypanosoma brucei J protein 2, Tbj2, to function as a co-chaperone of TbHsp70.c was investigated. The main objective was to functionally characterize TbHsp70.c to further expand our knowledge of parasite biology. TbHsp70.c and Tbj2 were heterologously expressed and purified and both proteins displayed the ability to suppress aggregation of thermolabile MDH and chemically denatured rhodanese. ATPase assays revealed a 2.8-fold stimulation of the ATPase activity of TbHsp70.c by Tbj2. TbHsp70.c and Tbj2 both demonstrated chaperone activity and Tbj2 functions as a co-chaperone of TbHsp70.c. In vivo heat stress experiments indicated upregulation of the expression levels of TbHsp70.c.

Thermosensitivity of growth is determined by chaperone-mediated proteome reallocation

Science.gov (United States)

Chen, Ke; Gao, Ye; Mih, Nathan; O’Brien, Edward J.; Yang, Laurence; Palsson, Bernhard O.

2017-01-01

Maintenance of a properly folded proteome is critical for bacterial survival at notably different growth temperatures. Understanding the molecular basis of thermoadaptation has progressed in two main directions, the sequence and structural basis of protein thermostability and the mechanistic principles of protein quality control assisted by chaperones. Yet we do not fully understand how structural integrity of the entire proteome is maintained under stress and how it affects cellular fitness. To address this challenge, we reconstruct a genome-scale protein-folding network for Escherichia coli and formulate a computational model, FoldME, that provides statistical descriptions of multiscale cellular response consistent with many datasets. FoldME simulations show (i) that the chaperones act as a system when they respond to unfolding stress rather than achieving efficient folding of any single component of the proteome, (ii) how the proteome is globally balanced between chaperones for folding and the complex machinery synthesizing the proteins in response to perturbation, (iii) how this balancing determines growth rate dependence on temperature and is achieved through nonspecific regulation, and (iv) how thermal instability of the individual protein affects the overall functional state of the proteome. Overall, these results expand our view of cellular regulation, from targeted specific control mechanisms to global regulation through a web of nonspecific competing interactions that modulate the optimal reallocation of cellular resources. The methodology developed in this study enables genome-scale integration of environment-dependent protein properties and a proteome-wide study of cellular stress responses. PMID:29073085

Decoding Structural Properties of a Partially Unfolded Protein Substrate: En Route to Chaperone Binding

Science.gov (United States)

Nagpal, Suhani; Tiwari, Satyam; Mapa, Koyeli; Thukral, Lipi

2015-01-01

Many proteins comprising of complex topologies require molecular chaperones to achieve their unique three-dimensional folded structure. The E.coli chaperone, GroEL binds with a large number of unfolded and partially folded proteins, to facilitate proper folding and prevent misfolding and aggregation. Although the major structural components of GroEL are well defined, scaffolds of the non-native substrates that determine chaperone-mediated folding have been difficult to recognize. Here we performed all-atomistic and replica-exchange molecular dynamics simulations to dissect non-native ensemble of an obligate GroEL folder, DapA. Thermodynamics analyses of unfolding simulations revealed populated intermediates with distinct structural characteristics. We found that surface exposed hydrophobic patches are significantly increased, primarily contributed from native and non-native β-sheet elements. We validate the structural properties of these conformers using experimental data, including circular dichroism (CD), 1-anilinonaphthalene-8-sulfonic acid (ANS) binding measurements and previously reported hydrogen-deutrium exchange coupled to mass spectrometry (HDX-MS). Further, we constructed network graphs to elucidate long-range intra-protein connectivity of native and intermediate topologies, demonstrating regions that serve as central “hubs”. Overall, our results implicate that genomic variations (or mutations) in the distinct regions of protein structures might disrupt these topological signatures disabling chaperone-mediated folding, leading to formation of aggregates. PMID:26394388

Conserved TRAM Domain Functions as an Archaeal Cold Shock Protein via RNA Chaperone Activity

Directory of Open Access Journals (Sweden)

Bo Zhang

2017-08-01

Full Text Available Cold shock proteins (Csps enable organisms to acclimate to and survive in cold environments and the bacterial CspA family exerts the cold protection via its RNA chaperone activity. However, most Archaea do not contain orthologs to the bacterial csp. TRAM, a conserved domain among RNA modification proteins ubiquitously distributed in organisms, occurs as an individual protein in most archaeal phyla and has a structural similarity to Csp proteins, yet its biological functions remain unknown. Through physiological and biochemical studies on four TRAM proteins from a cold adaptive archaeon Methanolobus psychrophilus R15, this work demonstrated that TRAM is an archaeal Csp and exhibits RNA chaperone activity. Three TRAM encoding genes (Mpsy_0643, Mpsy_3043, and Mpsy_3066 exhibited remarkable cold-shock induced transcription and were preferentially translated at lower temperature (18°C, while the fourth (Mpsy_2002 was constitutively expressed. They were all able to complement the cspABGE mutant of Escherichia coli BX04 that does not grow in cold temperatures and showed transcriptional antitermination. TRAM3066 (gene product of Mpsy_3066 and TRAM2002 (gene product of Mpsy_2002 displayed sequence-non-specific RNA but not DNA binding activity, and TRAM3066 assisted RNases in degradation of structured RNA, thus validating the RNA chaperone activity of TRAMs. Given the chaperone activity, TRAM is predicted to function beyond a Csp.

UGC galaxies stronger than 25 mJy at 4.85 GHz

International Nuclear Information System (INIS)

Condon, J.J.; Frayer, D.T.; Broderick, J.J.

1991-01-01

UGC galaxies in the declination band +5 to +75 deg were identified by position coincidence with radio sources stronger than 25 mJy on the Green Bank 4.85 GHz sky maps. Candidate identifications were confirmed or rejected with the aid of published aperture-synthesis maps and new 4.86 GHz VLA maps having 15 or 18 arcsec resolution, resulting in a sample of 347 nearby radio galaxies plus five new quasar-galaxy pairs. The radio energy sources in UGC galaxies were classified as starbursts or monsters on the basis of their infrared-radio flux ratios, infrared spectral indices, and radio morphologies. The rms scatter in the logarithmic infrared-radio ratio q is not more than 0.16 for starburst galaxies selected at 4.85 GHz. Radio spectral indices were obtained for nearly all of the UGC galaxies, and S0 galaxies account for a disproportionate share of the compact flat-spectrum (alpha less than 0.5) radio sources. The extended radio jets and lobes produced by monsters are preferentially, but not exclusively, aligned within about 30 deg of the optical minor axes of their host galaxies. The tendency toward minor-axis ejection appears to be independent of radio-source size and is strongest for elliptical galaxies. 230 refs

Chaperone turns gatekeeper: PCBP2 and DMT1 form an iron-transport pipeline.

Science.gov (United States)

Lane, Darius J R; Richardson, Des R

2014-08-15

How is cellular iron (Fe) uptake and efflux regulated in mammalian cells? In this issue of the Biochemical Journal, Yanatori et al. report for the first time that a member of the emerging PCBP [poly(rC)-binding protein] Fe-chaperone family, PCBP2, physically interacts with the major Fe importer DMT1 (divalent metal transporter 1) and the Fe exporter FPN1 (ferroportin 1). In both cases, the interaction of the Fe transporter with PCBP2 is Fe-dependent. Interestingly, another PCBP Fe-chaperone, PCBP1, does not appear to bind to DMT1. Strikingly, the PCBP2-DMT1 interaction is required for DMT1-dependent cellular Fe uptake, suggesting that, in addition to functioning as an intracellular Fe chaperone, PCBP2 may be a molecular 'gate- keeper' for transmembrane Fe transport. These new data hint at the possibility that PCBP2 may be a component of a yet-to-be-described Fe-transport metabolon that engages in Fe channelling to and from Fe transporters and intracellular sites.

Comparison of the carboxy-terminal DP-repeat region in the co-chaperones Hop and Hip.

Science.gov (United States)

Nelson, Gregory M; Huffman, Holly; Smith, David F

2003-01-01

Functional steroid receptor complexes are assembled and maintained by an ordered pathway of interactions involving multiple components of the cellular chaperone machinery. Two of these components, Hop and Hip, serve as co-chaperones to the major heat shock proteins (Hsps), Hsp70 and Hsp90, and participate in intermediate stages of receptor assembly. In an effort to better understand the functions of Hop and Hip in the assembly process, we focused on a region of similarity located near the C-terminus of each co-chaperone. Contained within this region is a repeated sequence motif we have termed the DP repeat. Earlier mutagenesis studies implicated the DP repeat of either Hop or Hip in Hsp70 binding and in normal assembly of the co-chaperones with progesterone receptor (PR) complexes. We report here that the DP repeat lies within a protease-resistant domain that extends to or is near the C-terminus of both co-chaperones. Point mutations in the DP repeats render the C-terminal regions hypersensitive to proteolysis. In addition, a Hop DP mutant displays altered proteolytic digestion patterns, which suggest that the DP-repeat region influences the folding of other Hop domains. Although the respective DP regions of Hop and Hip share sequence and structural similarities, they are not functionally interchangeable. Moreover, a double-point mutation within the second DP-repeat unit of Hop that converts this to the sequence found in Hip disrupts Hop function; however, the corresponding mutation in Hip does not alter its function. We conclude that the DP repeats are important structural elements within a C-terminal domain, which is important for Hop and Hip function.

A BAG3 chaperone complex maintains cardiomyocyte function during proteotoxic stress.

Science.gov (United States)

Judge, Luke M; Perez-Bermejo, Juan A; Truong, Annie; Ribeiro, Alexandre Js; Yoo, Jennie C; Jensen, Christina L; Mandegar, Mohammad A; Huebsch, Nathaniel; Kaake, Robyn M; So, Po-Lin; Srivastava, Deepak; Pruitt, Beth L; Krogan, Nevan J; Conklin, Bruce R

2017-07-20

Molecular chaperones regulate quality control in the human proteome, pathways that have been implicated in many diseases, including heart failure. Mutations in the BAG3 gene, which encodes a co-chaperone protein, have been associated with heart failure due to both inherited and sporadic dilated cardiomyopathy. Familial BAG3 mutations are autosomal dominant and frequently cause truncation of the coding sequence, suggesting a heterozygous loss-of-function mechanism. However, heterozygous knockout of the murine BAG3 gene did not cause a detectable phenotype. To model BAG3 cardiomyopathy in a human system, we generated an isogenic series of human induced pluripotent stem cells (iPSCs) with loss-of-function mutations in BAG3. Heterozygous BAG3 mutations reduced protein expression, disrupted myofibril structure, and compromised contractile function in iPSC-derived cardiomyocytes (iPS-CMs). BAG3-deficient iPS-CMs were particularly sensitive to further myofibril disruption and contractile dysfunction upon exposure to proteasome inhibitors known to cause cardiotoxicity. We performed affinity tagging of the endogenous BAG3 protein and mass spectrometry proteomics to further define the cardioprotective chaperone complex that BAG3 coordinates in the human heart. Our results establish a model for evaluating protein quality control pathways in human cardiomyocytes and their potential as therapeutic targets and susceptibility factors for cardiac drug toxicity.

Structural basis for inhibition of the histone chaperone activity of SET/TAF-Iβ by cytochrome c.

Science.gov (United States)

González-Arzola, Katiuska; Díaz-Moreno, Irene; Cano-González, Ana; Díaz-Quintana, Antonio; Velázquez-Campoy, Adrián; Moreno-Beltrán, Blas; López-Rivas, Abelardo; De la Rosa, Miguel A

2015-08-11

Chromatin is pivotal for regulation of the DNA damage process insofar as it influences access to DNA and serves as a DNA repair docking site. Recent works identify histone chaperones as key regulators of damaged chromatin's transcriptional activity. However, understanding how chaperones are modulated during DNA damage response is still challenging. This study reveals that the histone chaperone SET/TAF-Iβ interacts with cytochrome c following DNA damage. Specifically, cytochrome c is shown to be translocated into cell nuclei upon induction of DNA damage, but not upon stimulation of the death receptor or stress-induced pathways. Cytochrome c was found to competitively hinder binding of SET/TAF-Iβ to core histones, thereby locking its histone-binding domains and inhibiting its nucleosome assembly activity. In addition, we have used NMR spectroscopy, calorimetry, mutagenesis, and molecular docking to provide an insight into the structural features of the formation of the complex between cytochrome c and SET/TAF-Iβ. Overall, these findings establish a framework for understanding the molecular basis of cytochrome c-mediated blocking of SET/TAF-Iβ, which subsequently may facilitate the development of new drugs to silence the oncogenic effect of SET/TAF-Iβ's histone chaperone activity.

Biology of the Heat Shock Response and Protein Chaperones: Budding Yeast (Saccharomyces cerevisiae) as a Model System

Science.gov (United States)

Verghese, Jacob; Abrams, Jennifer; Wang, Yanyu

2012-01-01

Summary: The eukaryotic heat shock response is an ancient and highly conserved transcriptional program that results in the immediate synthesis of a battery of cytoprotective genes in the presence of thermal and other environmental stresses. Many of these genes encode molecular chaperones, powerful protein remodelers with the capacity to shield, fold, or unfold substrates in a context-dependent manner. The budding yeast Saccharomyces cerevisiae continues to be an invaluable model for driving the discovery of regulatory features of this fundamental stress response. In addition, budding yeast has been an outstanding model system to elucidate the cell biology of protein chaperones and their organization into functional networks. In this review, we evaluate our understanding of the multifaceted response to heat shock. In addition, the chaperone complement of the cytosol is compared to those of mitochondria and the endoplasmic reticulum, organelles with their own unique protein homeostasis milieus. Finally, we examine recent advances in the understanding of the roles of protein chaperones and the heat shock response in pathogenic fungi, which is being accelerated by the wealth of information gained for budding yeast. PMID:22688810

Regulation of the copper chaperone CCS by XIAP-mediated ubiquitination.

Science.gov (United States)

Brady, Graham F; Galbán, Stefanie; Liu, Xuwen; Basrur, Venkatesha; Gitlin, Jonathan D; Elenitoba-Johnson, Kojo S J; Wilson, Thomas E; Duckett, Colin S

2010-04-01

In order to balance the cellular requirements for copper with its toxic properties, an elegant set of mechanisms has evolved to regulate and buffer intracellular copper. The X-linked inhibitor of apoptosis (XIAP) protein was recently identified as a copper-binding protein and regulator of copper homeostasis, although the mechanism by which XIAP binds copper in the cytosol is unclear. Here we describe the identification of the copper chaperone for superoxide dismutase (CCS) as a mediator of copper delivery to XIAP in cells. We also find that CCS is a target of the E3 ubiquitin ligase activity of XIAP, although interestingly, ubiquitination of CCS by XIAP was found to lead to enhancement of its chaperone activity toward its physiologic target, superoxide dismutase 1, rather than proteasomal degradation. Collectively, our results reveal novel links among apoptosis, copper metabolism, and redox regulation through the XIAP-CCS complex.

Hsc70/Hsp90 chaperone machinery mediates ATP-dependent RISC loading of small RNA duplexes.

Science.gov (United States)

Iwasaki, Shintaro; Kobayashi, Maki; Yoda, Mayuko; Sakaguchi, Yuriko; Katsuma, Susumu; Suzuki, Tsutomu; Tomari, Yukihide

2010-07-30

Small silencing RNAs--small interfering RNAs (siRNAs) or microRNAs (miRNAs)--direct posttranscriptional gene silencing of their mRNA targets as guides for the RNA-induced silencing complex (RISC). Both siRNAs and miRNAs are born double stranded. Surprisingly, loading these small RNA duplexes into Argonaute proteins, the core components of RISC, requires ATP, whereas separating the two small RNA strands within Argonaute does not. Here we show that the Hsc70/Hsp90 chaperone machinery is required to load small RNA duplexes into Argonaute proteins, but not for subsequent strand separation or target cleavage. We envision that the chaperone machinery uses ATP and mediates a conformational opening of Ago proteins so that they can receive bulky small RNA duplexes. Our data suggest that the chaperone machinery may serve as the driving force for the RISC assembly pathway. Copyright 2010 Elsevier Inc. All rights reserved.

Chaperone-protease networks in mitochondrial protein homeostasis.

Science.gov (United States)

Voos, Wolfgang

2013-02-01

As essential organelles, mitochondria are intimately integrated into the metabolism of a eukaryotic cell. The maintenance of the functional integrity of the mitochondrial proteome, also termed protein homeostasis, is facing many challenges both under normal and pathological conditions. First, since mitochondria are derived from bacterial ancestor cells, the proteins in this endosymbiotic organelle have a mixed origin. Only a few proteins are encoded on the mitochondrial genome, most genes for mitochondrial proteins reside in the nuclear genome of the host cell. This distribution requires a complex biogenesis of mitochondrial proteins, which are mostly synthesized in the cytosol and need to be imported into the organelle. Mitochondrial protein biogenesis usually therefore comprises complex folding and assembly processes to reach an enzymatically active state. In addition, specific protein quality control (PQC) processes avoid an accumulation of damaged or surplus polypeptides. Mitochondrial protein homeostasis is based on endogenous enzymatic components comprising a diverse set of chaperones and proteases that form an interconnected functional network. This review describes the different types of mitochondrial proteins with chaperone functions and covers the current knowledge of their roles in protein biogenesis, folding, proteolytic removal and prevention of aggregation, the principal reactions of protein homeostasis. This article is part of a Special Issue entitled: Protein Import and Quality Control in Mitochondria and Plastids. Copyright © 2012 Elsevier B.V. All rights reserved.

Similarities and differences in the nucleic acid chaperone activity of HIV-2 and HIV-1 nucleocapsid proteins in vitro.

Science.gov (United States)

Pachulska-Wieczorek, Katarzyna; Stefaniak, Agnieszka K; Purzycka, Katarzyna J

2014-07-03

The nucleocapsid domain of Gag and mature nucleocapsid protein (NC) act as nucleic acid chaperones and facilitate folding of nucleic acids at critical steps of retroviral replication cycle. The basic N-terminus of HIV-1 NC protein was shown most important for the chaperone activity. The HIV-2 NC (NCp8) and HIV-1 NC (NCp7) proteins possess two highly conserved zinc fingers, flanked by basic residues. However, the NCp8 N-terminal domain is significantly shorter and contains less positively charged residues. This study characterizes previously unknown, nucleic acid chaperone activity of the HIV-2 NC protein. We have comparatively investigated the in vitro nucleic acid chaperone properties of the HIV-2 and HIV-1 NC proteins. Using substrates derived from the HIV-1 and HIV-2 genomes, we determined the ability of both proteins to chaperone nucleic acid aggregation, annealing and strand exchange in duplex structures. Both NC proteins displayed comparable, high annealing activity of HIV-1 TAR DNA and its complementary nucleic acid. Interesting differences between the two NC proteins were discovered when longer HIV substrates, particularly those derived from the HIV-2 genome, were used in chaperone assays. In contrast to NCp7, NCp8 weakly facilitates annealing of HIV-2 TAR RNA to its complementary TAR (-) DNA. NCp8 is also unable to efficiently stimulate tRNALys3 annealing to its respective HIV-2 PBS motif. Using truncated NCp8 peptide, we demonstrated that despite the fact that the N-terminus of NCp8 differs from that of NCp7, this domain is essential for NCp8 activity. Our data demonstrate that the HIV-2 NC protein displays reduced nucleic acid chaperone activity compared to that of HIV-1 NC. We found that NCp8 activity is limited by substrate length and stability to a greater degree than that of NCp7. This is especially interesting in light of the fact that the HIV-2 5'UTR is more structured than that of HIV-1. The reduced chaperone activity observed with NCp8 may

DmsD, a Tat system specific chaperone, interacts with other general chaperones and proteins involved in the molybdenum cofactor biosynthesis

OpenAIRE

Li, Haiming; Chang, Limei; Howell, Jenika M.; Turner, Raymond J.

2010-01-01

Many bacterial oxidoreductases depend on the Tat translocase for correct cell localization. Substrates for the Tat translocase possess twin-arginine leaders. System specific chaperones or redox enzyme maturation proteins (REMPs) are a group of proteins implicated in oxidoreductase maturation. DmsD is a REMP discovered in Escherichia coli, which interacts with the twin-arginine leader sequence of DmsA, the catalytic subunit of DMSO reductase. In this study, we identified several potential inte...

Regulation of human Nfu activity in Fe-S cluster delivery-characterization of the interaction between Nfu and the HSPA9/Hsc20 chaperone complex.

Science.gov (United States)

Wachnowsky, Christine; Liu, Yushi; Yoon, Taejin; Cowan, J A

2018-01-01

Iron-sulfur cluster biogenesis is a complex, but highly regulated process that involves de novo cluster formation from iron and sulfide ions on a scaffold protein, and subsequent delivery to final targets via a series of Fe-S cluster-binding carrier proteins. The process of cluster release from the scaffold/carrier for transfer to the target proteins may be mediated by a dedicated Fe-S cluster chaperone system. In human cells, the chaperones include heat shock protein HSPA9 and the J-type chaperone Hsc20. While the role of chaperones has been somewhat clarified in yeast and bacterial systems, many questions remain over their functional roles in cluster delivery and interactions with a variety of human Fe-S cluster proteins. One such protein, Nfu, has recently been recognized as a potential interaction partner of the chaperone complex. Herein, we examined the ability of human Nfu to function as a carrier by interacting with the human chaperone complex. Human Nfu is shown to bind to both chaperone proteins with binding affinities similar to those observed for IscU binding to the homologous HSPA9 and Hsc20, while Nfu can also stimulate the ATPase activity of HSPA9. Additionally, the chaperone complex was able to promote Nfu function by enhancing the second-order rate constants for Fe-S cluster transfer to target proteins and providing directionality in cluster transfer from Nfu by eliminating promiscuous transfer reactions. Together, these data support a hypothesis in which Nfu can serve as an alternative carrier protein for chaperone-mediated cluster release and delivery in Fe-S cluster biogenesis and trafficking. © 2017 Federation of European Biochemical Societies.

Jasmonate signalling in Arabidopsis involves SGT1b-HSP70-HSP90 chaperone complexes.

Science.gov (United States)

Zhang, Xue-Cheng; Millet, Yves A; Cheng, Zhenyu; Bush, Jenifer; Ausubel, Frederick M

Plant hormones play pivotal roles in growth, development and stress responses. Although it is essential to our understanding of hormone signalling, how plants maintain a steady state level of hormone receptors is poorly understood. We show that mutation of the Arabidopsis thaliana co-chaperone SGT1b impairs responses to the plant hormones jasmonate, auxin and gibberellic acid, but not brassinolide and abscisic acid, and that SGT1b and its homologue SGT1a are involved in maintaining the steady state levels of the F-box proteins COI1 and TIR1, receptors for jasmonate and auxin, respectively. The association of SGT1b with COI1 is direct and is independent of the Arabidopsis SKP1 protein, ASK1. We further show that COI1 is a client protein of SGT1b-HSP70-HSP90 chaperone complexes and that the complexes function in hormone signalling by stabilizing the COI1 protein. This study extends the SGT1b-HSP90 client protein list and broadens the functional scope of SGT1b-HSP70-HSP90 chaperone complexes.

Identification and characterization of a type III secretion-associated chaperone in the type III secretion system 1 of Vibrio parahaemolyticus.

Science.gov (United States)

Akeda, Yukihiro; Okayama, Kanna; Kimura, Tomomi; Dryselius, Rikard; Kodama, Toshio; Oishi, Kazunori; Iida, Tetsuya; Honda, Takeshi

2009-07-01

Vibrio parahaemolyticus causes human gastroenteritis. Genomic sequencing of this organism has revealed that it has two sets of type III secretion systems, T3SS1 and T3SS2, both of which are important for its pathogenicity. However, the mechanism of protein secretion via T3SSs is unknown. A characteristic of many effectors is that they require specific chaperones for efficient delivery via T3SSs; however, no chaperone has been experimentally identified in the T3SSs of V. parahaemolyticus. In this study, we identified candidate T3SS1-associated chaperones from genomic sequence data and examined their roles in effector secretion/translocation and binding to their cognate substrates. From these experiments, we concluded that there is a T3S-associated chaperone, VecA, for a cytotoxic T3SS1-dependent effector, VepA. Further analysis using pulldown and secretion assays characterized the chaperone-binding domain encompassing the first 30-100 amino acids and an amino terminal secretion signal encompassing the first 5-20 amino acids on VepA. These findings will provide a strategy to clarify how the T3SS1 of V. parahaemolyticus secretes its specific effectors.

Test documentation for the GENII Software Version 1.485

International Nuclear Information System (INIS)

Rittmann, P.D.

1994-01-01

Version 1.485 of the GENII software was released by the PNL GENII custodian in December of 1990. At that time the WHC GENII custodian performed several tests to verify that the advertised revisions were indeed present and that these changes had not introduced errors in the calculations normally done by WHC. These tests were not documented at that time. The purpose of this document is to summarize suitable acceptance tests of GENII and compare them with a few hand calculations. The testing is not as thorough as that used by the PNL GENII Custodian, but is sufficient to establish that the GENII program appears to work correctly on WHC managed personal computers

Changes in expression of renal Oat1, Oat3 and Mrp2 in cisplatin-induced acute renal failure after treatment of JBP485 in rats

International Nuclear Information System (INIS)

Liu, Tao; Meng, Qiang; Wang, Changyuan; Liu, Qi; Guo, Xinjin; Sun, Huijun; Peng, Jinyong

2012-01-01

The purpose of this study is to investigate whether the effect of cyclo-trans-4-L-hydroxyprolyl-L-serine (JBP485) on acute renal failure (ARF) induced by cisplatin is related to change in expression of renal Oat1, Oat3 and Mrp2 in rats. JBP485 reduced creatinine, blood urea nitrogen (BUN) and indoxyl sulfate (IS) in plasma and malondialdehyde (MDA) in kidney, and recovered the glomerular filtration rate (GFR) and the activity of superoxide dismutase (SOD) in cisplatin-treated rats. The plasma concentration of PAH (para-aminohippurate) determined by LC–MS/MS was increased markedly after intravenous administration of cisplatin, whereas cumulative urinary excretion of PAH and the uptake of PAH in kidney slices were significantly decreased. qRT-PCR and Western-blot showed a decrease in mRNA and protein of Oat1 and Oat3, an increase in mRNA and protein of Mrp2 in cisplatin-treated rats, and an increase in IS (a uremic toxin) after co-treatment with JBP485. It indicated that JBP485 promoted urinary excretion of toxins by upregulating renal Mrp2. This therefore gives in part the explanation about the mechanism by which JBP485 improves ARF induced by cisplatin in rats. -- Highlights: ► Cisplatin induces acute renal failure (ARF). ► The expression of Oat1, Oat3 and Mrp2 were changed during ARF. ► The regulated expression of Oat1, Oat3 and Mrp2 is an adaptive protected response. ► JBP485 could facilitate the adaptive protective action.

Changes in expression of renal Oat1, Oat3 and Mrp2 in cisplatin-induced acute renal failure after treatment of JBP485 in rats

Energy Technology Data Exchange (ETDEWEB)

Liu, Tao, E-mail: liutaomedical@qq.com [Department of Clinical Pharmacology, College of Pharmacy, Dalian Medical University, 9 West Section, Lvshun South Road, Lvshunkou District, Dalian 116044 (China); Meng, Qiang, E-mail: mengq531@yahoo.cn [Department of Clinical Pharmacology, College of Pharmacy, Dalian Medical University, 9 West Section, Lvshun South Road, Lvshunkou District, Dalian 116044 (China); Provincial Key Laboratory for Pharmacokinetics and Transport, Liaoning, Dalian Medical University (China); Wang, Changyuan, E-mail: wangcyuan@163.com [Department of Clinical Pharmacology, College of Pharmacy, Dalian Medical University, 9 West Section, Lvshun South Road, Lvshunkou District, Dalian 116044 (China); Provincial Key Laboratory for Pharmacokinetics and Transport, Liaoning, Dalian Medical University (China); Liu, Qi, E-mail: llaqii@yahoo.com.cn [Department of Clinical Pharmacology, College of Pharmacy, Dalian Medical University, 9 West Section, Lvshun South Road, Lvshunkou District, Dalian 116044 (China); Provincial Key Laboratory for Pharmacokinetics and Transport, Liaoning, Dalian Medical University (China); Guo, Xinjin, E-mail: guo.xinjin@163.com [Department of Clinical Pharmacology, College of Pharmacy, Dalian Medical University, 9 West Section, Lvshun South Road, Lvshunkou District, Dalian 116044 (China); Sun, Huijun, E-mail: sunhuijun@hotmail.com [Department of Clinical Pharmacology, College of Pharmacy, Dalian Medical University, 9 West Section, Lvshun South Road, Lvshunkou District, Dalian 116044 (China); Provincial Key Laboratory for Pharmacokinetics and Transport, Liaoning, Dalian Medical University (China); Peng, Jinyong, E-mail: jinyongpeng2005@163.com [Department of Clinical Pharmacology, College of Pharmacy, Dalian Medical University, 9 West Section, Lvshun South Road, Lvshunkou District, Dalian 116044 (China); Provincial Key Laboratory for Pharmacokinetics and Transport, Liaoning, Dalian Medical University (China); and others

2012-11-01

The purpose of this study is to investigate whether the effect of cyclo-trans-4-L-hydroxyprolyl-L-serine (JBP485) on acute renal failure (ARF) induced by cisplatin is related to change in expression of renal Oat1, Oat3 and Mrp2 in rats. JBP485 reduced creatinine, blood urea nitrogen (BUN) and indoxyl sulfate (IS) in plasma and malondialdehyde (MDA) in kidney, and recovered the glomerular filtration rate (GFR) and the activity of superoxide dismutase (SOD) in cisplatin-treated rats. The plasma concentration of PAH (para-aminohippurate) determined by LC–MS/MS was increased markedly after intravenous administration of cisplatin, whereas cumulative urinary excretion of PAH and the uptake of PAH in kidney slices were significantly decreased. qRT-PCR and Western-blot showed a decrease in mRNA and protein of Oat1 and Oat3, an increase in mRNA and protein of Mrp2 in cisplatin-treated rats, and an increase in IS (a uremic toxin) after co-treatment with JBP485. It indicated that JBP485 promoted urinary excretion of toxins by upregulating renal Mrp2. This therefore gives in part the explanation about the mechanism by which JBP485 improves ARF induced by cisplatin in rats. -- Highlights: ► Cisplatin induces acute renal failure (ARF). ► The expression of Oat1, Oat3 and Mrp2 were changed during ARF. ► The regulated expression of Oat1, Oat3 and Mrp2 is an adaptive protected response. ► JBP485 could facilitate the adaptive protective action.

Human Enterovirus Nonstructural Protein 2CATPase Functions as Both an RNA Helicase and ATP-Independent RNA Chaperone

Science.gov (United States)

Xia, Hongjie; Wang, Peipei; Wang, Guang-Chuan; Yang, Jie; Sun, Xianlin; Wu, Wenzhe; Qiu, Yang; Shu, Ting; Zhao, Xiaolu; Yin, Lei; Qin, Cheng-Feng; Hu, Yuanyang; Zhou, Xi

2015-01-01

RNA helicases and chaperones are the two major classes of RNA remodeling proteins, which function to remodel RNA structures and/or RNA-protein interactions, and are required for all aspects of RNA metabolism. Although some virus-encoded RNA helicases/chaperones have been predicted or identified, their RNA remodeling activities in vitro and functions in the viral life cycle remain largely elusive. Enteroviruses are a large group of positive-stranded RNA viruses in the Picornaviridae family, which includes numerous important human pathogens. Herein, we report that the nonstructural protein 2CATPase of enterovirus 71 (EV71), which is the major causative pathogen of hand-foot-and-mouth disease and has been regarded as the most important neurotropic enterovirus after poliovirus eradication, functions not only as an RNA helicase that 3′-to-5′ unwinds RNA helices in an adenosine triphosphate (ATP)-dependent manner, but also as an RNA chaperone that destabilizes helices bidirectionally and facilitates strand annealing and complex RNA structure formation independently of ATP. We also determined that the helicase activity is based on the EV71 2CATPase middle domain, whereas the C-terminus is indispensable for its RNA chaperoning activity. By promoting RNA template recycling, 2CATPase facilitated EV71 RNA synthesis in vitro; when 2CATPase helicase activity was impaired, EV71 RNA replication and virion production were mostly abolished in cells, indicating that 2CATPase-mediated RNA remodeling plays a critical role in the enteroviral life cycle. Furthermore, the RNA helicase and chaperoning activities of 2CATPase are also conserved in coxsackie A virus 16 (CAV16), another important enterovirus. Altogether, our findings are the first to demonstrate the RNA helicase and chaperoning activities associated with enterovirus 2CATPase, and our study provides both in vitro and cellular evidence for their potential roles during viral RNA replication. These findings increase our

Blocking the chaperone kinome pathway: Mechanistic insights into a novel dual inhibition approach for supra-additive suppression of malignant tumors

Energy Technology Data Exchange (ETDEWEB)

Grover, Abhinav [Department of Biochemical Engineering and Biotechnology, Indian Institute of Technology (IIT) Delhi, Hauz Khas, New Delhi 110016 (India); Shandilya, Ashutosh [Supercomputing Facility for Bioinformatics and Computational Biology, Indian Institute of Technology (IIT) Delhi, Hauz Khas, New Delhi 110016 (India); Agrawal, Vibhuti; Pratik, Piyush; Bhasme, Divya; Bisaria, Virendra S. [Department of Biochemical Engineering and Biotechnology, Indian Institute of Technology (IIT) Delhi, Hauz Khas, New Delhi 110016 (India); Sundar, Durai, E-mail: sundar@dbeb.iitd.ac.in [Department of Biochemical Engineering and Biotechnology, Indian Institute of Technology (IIT) Delhi, Hauz Khas, New Delhi 110016 (India)

2011-01-07

Research highlights: {yields} Withaferin A and 17-DMAG synergistically inhibit the Hsp90-Cdc37 chaperone pair. {yields} Binding of WA to Cdc37 cleft suppresses its kinase binding activity. {yields} 17-DMAG binding to the association complex results in H-bonds with 60% clustering. {yields} The ligands' bound complex was found structurally and thermodynamically stable. -- Abstract: The chaperone Hsp90 is involved in regulating the stability and activation state of more than 200 'client' proteins and takes part in the cancer diseased states. The major clientele-protein kinases depend on Hsp90 for their proper folding and functioning. Cdc37, a kinase targeting co-chaperone of Hsp90, mediates the interactions between Hsp90 and protein kinases. Targeting of Cdc37 has the prospect of delivering predominantly kinase-selective molecular responses as compared to the current pharmacologic Hsp90 inhibitors. The present work reports a bio-computational study carried out with the aim of exploring the dual inhibition of Hsp90/Cdc37 chaperone/co-chaperone association complex by the naturally occurring drug candidates withaferin A and 17-DMAG along with their possible modes of action. Our molecular docking studies reveal that withaferin A in combination with 17-DMAG can act as potent chaperone system inhibitors. The structural and thermodynamic stability of the ligands' bound complex was also observed from molecular dynamics simulations in water. Our results suggest a novel tumor suppressive action mechanism of herbal ligands which can be looked forward for further clinical investigations for possible anticancer drug formulations.

The Hsc/Hsp70 co-chaperone network controls antigen aggregation and presentation during maturation of professional antigen presenting cells.

Directory of Open Access Journals (Sweden)

Nadja Kettern

Full Text Available The maturation of mouse macrophages and dendritic cells involves the transient deposition of ubiquitylated proteins in the form of dendritic cell aggresome-like induced structures (DALIS. Transient DALIS formation was used here as a paradigm to study how mammalian cells influence the formation and disassembly of protein aggregates through alterations of their proteostasis machinery. Co-chaperones that modulate the interplay of Hsc70 and Hsp70 with the ubiquitin-proteasome system (UPS and the autophagosome-lysosome pathway emerged as key regulators of this process. The chaperone-associated ubiquitin ligase CHIP and the ubiquitin-domain protein BAG-1 are essential for DALIS formation in mouse macrophages and bone-marrow derived dendritic cells (BMDCs. CHIP also cooperates with BAG-3 and the autophagic ubiquitin adaptor p62 in the clearance of DALIS through chaperone-assisted selective autophagy (CASA. On the other hand, the co-chaperone HspBP1 inhibits the activity of CHIP and thereby attenuates antigen sequestration. Through a modulation of DALIS formation CHIP, BAG-1 and HspBP1 alter MHC class I mediated antigen presentation in mouse BMDCs. Our data show that the Hsc/Hsp70 co-chaperone network controls transient protein aggregation during maturation of professional antigen presenting cells and in this way regulates the immune response. Similar mechanisms may modulate the formation of aggresomes and aggresome-like induced structures (ALIS in other mammalian cell types.

The molecular chaperone function of α-crystallin is impaired by UV photolysis

International Nuclear Information System (INIS)

Borkman, R.F.; McLaughlin, J.

1995-01-01

Buffer solutions of the lens protein γ-crystallin and the enzymes aldolase and liver alcohol dehydrogenase became turbid and formed solid precipitate upon exposure to an elevated temperature of 63 o C or to UV radiation at 308 nm. When α-crystallin was added to the protein solutions in stoichiometric amounts, heat or UV irradiation did not cause turbidity, or turbidity developed much less rapidly than in the absence of α-crystallin. Hence, normal α-crystallin functioned as a ''molecular chaperone,'' providing protection against both UV and heat-induced protein aggregation. When α-crystallin was preirradiated with UV at 308 nm, its ability to function as a chaperone vis-a-vis both UV and heat-induced aggregation was significantly impaired, but only at relatively high UV doss. (author)

76 FR 25330 - Georgia Power Company; Project No. 485-063-Georgia and Alabama, Bartletts Ferry Hydroelectric...

Science.gov (United States)

2011-05-04

... DEPARTMENT OF ENERGY Federal Energy Regulatory Commission Georgia Power Company; Project No. 485-063--Georgia and Alabama, Bartletts Ferry Hydroelectric Project; Notice of Proposed Restricted Service... Ferry Hydroelectric Project. The Programmatic Agreement, when executed by the Commission, the Georgia...

Computational modeling of allosteric regulation in the hsp90 chaperones: a statistical ensemble analysis of protein structure networks and allosteric communications.

Directory of Open Access Journals (Sweden)

Kristin Blacklock

2014-06-01

Full Text Available A fundamental role of the Hsp90 chaperone in regulating functional activity of diverse protein clients is essential for the integrity of signaling networks. In this work we have combined biophysical simulations of the Hsp90 crystal structures with the protein structure network analysis to characterize the statistical ensemble of allosteric interaction networks and communication pathways in the Hsp90 chaperones. We have found that principal structurally stable communities could be preserved during dynamic changes in the conformational ensemble. The dominant contribution of the inter-domain rigidity to the interaction networks has emerged as a common factor responsible for the thermodynamic stability of the active chaperone form during the ATPase cycle. Structural stability analysis using force constant profiling of the inter-residue fluctuation distances has identified a network of conserved structurally rigid residues that could serve as global mediating sites of allosteric communication. Mapping of the conformational landscape with the network centrality parameters has demonstrated that stable communities and mediating residues may act concertedly with the shifts in the conformational equilibrium and could describe the majority of functionally significant chaperone residues. The network analysis has revealed a relationship between structural stability, global centrality and functional significance of hotspot residues involved in chaperone regulation. We have found that allosteric interactions in the Hsp90 chaperone may be mediated by modules of structurally stable residues that display high betweenness in the global interaction network. The results of this study have suggested that allosteric interactions in the Hsp90 chaperone may operate via a mechanism that combines rapid and efficient communication by a single optimal pathway of structurally rigid residues and more robust signal transmission using an ensemble of suboptimal multiple

Molecular and biochemical characterization of a unique mutation in CCS, the human copper chaperone to superoxide dismutase.

Science.gov (United States)

Huppke, Peter; Brendel, Cornelia; Korenke, Georg Christoph; Marquardt, Iris; Donsante, Anthony; Yi, Ling; Hicks, Julia D; Steinbach, Peter J; Wilson, Callum; Elpeleg, Orly; Møller, Lisbeth Birk; Christodoulou, John; Kaler, Stephen G; Gärtner, Jutta

2012-08-01

Copper (Cu) is a trace metal that readily gains and donates electrons, a property that renders it desirable as an enzyme cofactor but dangerous as a source of free radicals. To regulate cellular Cu metabolism, an elaborate system of chaperones and transporters has evolved, although no human Cu chaperone mutations have been described to date. We describe a child from a consanguineous family who inherited homozygous mutations in the SLC33A1, encoding an acetyl CoA transporter, and in CCS, encoding the Cu chaperone for superoxide dismutase. The CCS mutation, p.Arg163Trp, predicts substitution of a highly conserved arginine residue at position 163, with tryptophan in domain II of CCS, which interacts directly with superoxide dismutase 1 (SOD1). Biochemical analyses of the patient's fibroblasts, mammalian cell transfections, immunoprecipitation assays, and Lys7Δ (CCS homolog) yeast complementation support the pathogenicity of the mutation. Expression of CCS was reduced and binding of CCS to SOD1 impaired. As a result, this mutation causes reduced SOD1 activity and may impair other mechanisms important for normal Cu homeostasis. CCS-Arg163Trp represents the primary example of a human mutation in a gene coding for a Cu chaperone. © 2012 Wiley Periodicals, Inc.

Gene expression and molecular characterization of a chaperone protein HtpG from Bacillus licheniformis.

Science.gov (United States)

Lo, Hui-Fen; Chen, Bo-En; Lin, Min-Guan; Chi, Meng-Chun; Wang, Tzu-Fan; Lin, Long-Liu

2016-04-01

Heat shock protein 90 (Hsp90/HtpG) is a highly abundant and ubiquitous ATP-dependent molecular chaperone consisting of three flexibly linked regions, an N-terminal nucleotide-binding domain, middle domain, and a C-terminal domain. Here the putative htpG gene of Bacillus licheniformis was cloned and heterologously expressed in Escherichia coli M15 cells. Native-gel electrophoresis, size exclusion chromatography, and cross-linking analysis revealed that the recombinant protein probably exists as a mixture of monomer, dimer and other oligomers in solution. The optimal conditions for the ATPase activity of B. licheniformis HtpG (BlHtpG) were 45°C and pH 7.0 in the presence of 0.5mM Mg(2+) ions. The molecular architecture of this protein was stable at higher temperatures with a transition point (Tm) of 45°C at neutral pH, whereas the Tm value was reduced to 40.8°C at pH 10.5. Acrylamide quenching experiment further indicated that the dynamic quenching constant (Ksv) of BlHtpG became larger at higher pH values. BlHtpG also experienced a significant change in the protein conformation upon the addition of ATP and organic solvents. Collectively, our experiment data may provide insights into the molecular properties of BlHtpG and identify the alteration of protein structure to forfeit the ATPase activity at alkaline conditions. Copyright © 2015 Elsevier B.V. All rights reserved.

Roles of silkworm endoplasmic reticulum chaperones in the secretion of recombinant proteins expressed by baculovirus system.

Science.gov (United States)

Imai, Saki; Kusakabe, Takahiro; Xu, Jian; Li, Zhiqing; Shirai, Shintaro; Mon, Hiroaki; Morokuma, Daisuke; Lee, Jae Man

2015-11-01

Baculovirus expression vector system (BEVS) is widely used for production of recombinant eukaryotic proteins in insect larvae or cultured cells. BEVS has advantages over bacterial expression system in producing post-translationally modified secreted proteins. However, for some unknown reason, it is very difficult for insects to secrete sufficiently for certain proteins of interest. To understand the reasons why insect cells fail to secrete some kinds of recombinant proteins, we here employed three mammalian proteins as targets, EPO, HGF, and Wnt3A, with different secretion levels in BEVS and investigated their mRNA transcriptions from the viral genome, subcellular localizations, and interactions with silkworm ER chaperones. Moreover, we observed that no significantly influence on the secretion amounts of all three proteins when depleting or overexpressing most endogenous ER chaperone genes in cultured silkworm cells. However, among all detected ER chaperones, the depletion of BiP severely decreased the recombinant protein secretion in BEVS, indicating the possible central role of Bip in silkworm secretion pathway.

A passive physical model for DnaK chaperoning

Science.gov (United States)

Uhl, Lionel; Dumont, Audrey; Dukan, Sam

2018-03-01

Almost all living organisms use protein chaperones with a view to preventing proteins from misfolding or aggregation either spontaneously or during cellular stress. This work uses a reaction-diffusion stochastic model to describe the dynamic localization of the Hsp70 chaperone DnaK in Escherichia coli cells during transient proteotoxic collapse characterized by the accumulation of insoluble proteins. In the model, misfolded (‘abnormal’) proteins are produced during alcoholic stress and have the propensity to aggregate with a polymerization-like kinetics. When aggregates diffuse more slowly they grow larger. According to Michaelis-Menten-type kinetics, DnaK has the propensity to bind with misfolded proteins or aggregates in order to catalyse refolding. To match experimental fluorescence microscopy data showing clusters of DnaK-GFP localized in multiple foci, the model includes spatial zones with local reduced diffusion rates to generate spontaneous assemblies of DnaK called ‘foci’. Numerical simulations of our model succeed in reproducing the kinetics of DnaK localization experimentally observed. DnaK starts from foci, moves to large aggregates during acute stress, resolves those aggregates during recovery and finally returns to its initial punctate localization pattern. Finally, we compare real biological events with hypothetical repartitions of the protein aggregates or DnaK. We then notice that DnaK action is more efficient on protein aggregates than on protein homogeneously distributed.

The Clp Chaperones and Proteases of the Human Malaria Parasite Plasmodium falciparum

Energy Technology Data Exchange (ETDEWEB)

Bakkouri, Majida El; Pow, Andre; Mulichak, Anne; Cheung, Kevin L.Y.; Artz, Jennifer D.; Amani, Mehrnaz; Fell, Stuart; de Koning-Ward, Tania F.; Goodman, C. Dean; McFadden, Geoffrey I.; Ortega, Joaquin; Hui, Raymond; Houry, Walid A. (McMaster U.); (Melbourne); (Toronto); (Deakin); (HWMRI)

2015-02-09

The Clp chaperones and proteases play an important role in protein homeostasis in the cell. They are highly conserved across prokaryotes and found also in the mitochondria of eukaryotes and the chloroplasts of plants. They function mainly in the disaggregation, unfolding and degradation of native as well as misfolded proteins. Here, we provide a comprehensive analysis of the Clp chaperones and proteases in the human malaria parasite Plasmodium falciparum. The parasite contains four Clp ATPases, which we term PfClpB1, PfClpB2, PfClpC and PfClpM. One PfClpP, the proteolytic subunit, and one PfClpR, which is an inactive version of the protease, were also identified. Expression of all Clp chaperones and proteases was confirmed in blood-stage parasites. The proteins were localized to the apicoplast, a non-photosynthetic organelle that accommodates several important metabolic pathways in P. falciparum, with the exception of PfClpB2 (also known as Hsp101), which was found in the parasitophorous vacuole. Both PfClpP and PfClpR form mostly homoheptameric rings as observed by size-exclusion chromatography, analytical ultracentrifugation and electron microscopy. The X-ray structure of PfClpP showed the protein as a compacted tetradecamer similar to that observed for Streptococcus pneumoniae and Mycobacterium tuberculosis ClpPs. Our data suggest the presence of a ClpCRP complex in the apicoplast of P. falciparum.

Autoregulation of Co-Chaperone BAG3 Gene Transcription

OpenAIRE

Gentilella, Antonio; Khalili, Kamel

2009-01-01

The Bcl-2-associated athanogene, BAG, protein family through their BAG domain associates with the heat shock protein 70 (HSP-70) and modulates its chaperone activity. One member of this family, BAG3, appears to play an important role in protein homeostasis, as its expression promotes cell survival by preventing polyubiquitination of Hsp-70 client proteins. Expression of BAG3 is enhanced by a variety of stress-inducing agents. Here we describe a role for BAG3 to modulate transcription of its o...

Oral pharmacological chaperone migalastat compared with enzyme replacement therapy in Fabry disease

DEFF Research Database (Denmark)

Hughes, Derralynn A.; Nicholls, Kathleen; Shankar, Suma P.

2017-01-01

Background Fabry disease is an X-linked lysosomal storage disorder caused by GLA mutations, resulting in α-galactosidase (α-Gal) deficiency and accumulation of lysosomal substrates. Migalastat, an oral pharmacological chaperone being developed as an alternative to intravenous enzyme replacement t...

Conformational Activation of Argonaute by Distinct yet Coordinated Actions of the Hsp70 and Hsp90 Chaperone Systems.

Science.gov (United States)

Tsuboyama, Kotaro; Tadakuma, Hisashi; Tomari, Yukihide

2018-05-17

Loading of small RNAs into Argonaute, the core protein in RNA silencing, requires the Hsp70/Hsp90 chaperone machinery. This machinery also activates many other clients, including steroid hormone receptors and kinases, but how their structures change during chaperone-dependent activation remains unclear. Here, we utilized single-molecule Förster resonance energy transfer (smFRET) to probe the conformational changes of Drosophila Ago2 mediated by the chaperone machinery. We found that empty Ago2 exists in various closed conformations. The Hsp70 system (Hsp40 and Hsp70) and the Hsp90 system (Hop, Hsp90, and p23) together render Ago2 into an open, active form. The Hsp70 system, but not the Hsp90 system alone, is sufficient for Ago2 to partially populate the open form. Instead, the Hsp90 system is required to extend the dwell time of Ago2 in the open state, which must be transiently primed by the Hsp70 system. Our data uncover distinct and coordinated actions of the chaperone machinery, where the Hsp70 system expands the structural ensembles of Ago2 and the Hsp90 system captures and stabilizes the active form. Copyright © 2018 Elsevier Inc. All rights reserved.

Association of HSP70 and its co-chaperones with Alzheimer's disease

NARCIS (Netherlands)

L. Broer (Linda); M.A. Ikram (Arfan); M. Schuur (Maaike); A.L. DeStefano (Anita); J.C. Bis (Joshua); F. Liu (Fan); F. Rivadeneira Ramirez (Fernando); A.G. Uitterlinden (André); A. Beiser (Alexa); W.T. Longstreth Jr; A. Hofman (Albert); Y.S. Aulchenko (Yurii); S. Seshadri (Sudha); A.L. Fitzpatrick (Annette); B.A. Oostra (Ben); M.M.B. Breteler (Monique); P. Tikka-Kleemola (Päivi)

2011-01-01

textabstractThe heat shock protein (HSP) 70 family has been implicated in the pathology of Alzheimer's disease (AD). In this study, we examined common genetic variations in the 80 genes encoding HSP70 and its co-chaperones. We conducted a study in a series of 462 patients and 5238 unaffected

Design of USB/RS485 converter and its application in slow control data collection system of high energy physics

International Nuclear Information System (INIS)

Chen Xihui; Xie Song; Gao Cuishan; Xie Xiaoxi; Nie Zhendong; Zhang Yinhong; Gao Lu

2005-01-01

Most of traditional data collection systems are based on RS232/485 converter. Such a system can only realize the point-to-point connection and its branches cannot work independently. So it brings on lots of inconvenience in debugging, installing and maintenance. On the other hand, the widely used Universal Serial Bus (USB) has many advantages such as hot-plugging, easy to extend, convenient in installing and occupying less system resources. So if USB could be used in data collection system, it would bring on lots of convenience to the system and its branches could be work independently. The design of USB-485 converter and its application are introduced in this paper. (authors)

Locking the Elbow: Improved Antibody Fab Fragments as Chaperones for Structure Determination.

Science.gov (United States)

Bailey, Lucas J; Sheehy, Kimberly M; Dominik, Pawel K; Liang, Wenguang G; Rui, Huan; Clark, Michael; Jaskolowski, Mateusz; Kim, Yejoon; Deneka, Dawid; Tang, Wei-Jen; Kossiakoff, Anthony A

2018-02-02

Antibody Fab fragments have been exploited with significant success to facilitate the structure determination of challenging macromolecules as crystallization chaperones and as molecular fiducial marks for single particle cryo-electron microscopy approaches. However, the inherent flexibility of the "elbow" regions, which link the constant and variable domains of the Fab, can introduce disorder and thus diminish their effectiveness. We have developed a phage display engineering strategy to generate synthetic Fab variants that significantly reduces elbow flexibility, while maintaining their high affinity and stability. This strategy was validated using previously recalcitrant Fab-antigen complexes where introduction of an engineered elbow region enhanced crystallization and diffraction resolution. Furthermore, incorporation of the mutations appears to be generally portable to other synthetic antibodies and may serve as a universal strategy to enhance the success rates of Fabs as structure determination chaperones. Copyright © 2017 Elsevier Ltd. All rights reserved.

A unique binding mode enables MCM2 to chaperone histones H3-H4 at replication forks

DEFF Research Database (Denmark)

Huang, Hongda; Strømme, Caroline B; Saredi, Giulia

2015-01-01

During DNA replication, chromatin is reassembled by recycling of modified old histones and deposition of new ones. How histone dynamics integrates with DNA replication to maintain genome and epigenome information remains unclear. Here, we reveal how human MCM2, part of the replicative helicase......, chaperones histones H3-H4. Our first structure shows an H3-H4 tetramer bound by two MCM2 histone-binding domains (HBDs), which hijack interaction sites used by nucleosomal DNA. Our second structure reveals MCM2 and ASF1 cochaperoning an H3-H4 dimer. Mutational analyses show that the MCM2 HBD is required...... for MCM2-7 histone-chaperone function and normal cell proliferation. Further, we show that MCM2 can chaperone both new and old canonical histones H3-H4 as well as H3.3 and CENPA variants. The unique histone-binding mode of MCM2 thus endows the replicative helicase with ideal properties for recycling...

Regulatory coiled-coil domains promote head-to-head assemblies of AAA+ chaperones essential for tunable activity control.

Science.gov (United States)

Carroni, Marta; Franke, Kamila B; Maurer, Michael; Jäger, Jasmin; Hantke, Ingo; Gloge, Felix; Linder, Daniela; Gremer, Sebastian; Turgay, Kürşad; Bukau, Bernd; Mogk, Axel

2017-11-22

Ring-forming AAA+ chaperones exert ATP-fueled substrate unfolding by threading through a central pore. This activity is potentially harmful requiring mechanisms for tight repression and substrate-specific activation. The AAA+ chaperone ClpC with the peptidase ClpP forms a bacterial protease essential to virulence and stress resistance. The adaptor MecA activates ClpC by targeting substrates and stimulating ClpC ATPase activity. We show how ClpC is repressed in its ground state by determining ClpC cryo-EM structures with and without MecA. ClpC forms large two-helical assemblies that associate via head-to-head contacts between coiled-coil middle domains (MDs). MecA converts this resting state to an active planar ring structure by binding to MD interaction sites. Loss of ClpC repression in MD mutants causes constitutive activation and severe cellular toxicity. These findings unravel an unexpected regulatory concept executed by coiled-coil MDs to tightly control AAA+ chaperone activity.

A unique binding mode enables MCM2 to chaperone histones H3-H4 at replication forks.

Science.gov (United States)

Huang, Hongda; Strømme, Caroline B; Saredi, Giulia; Hödl, Martina; Strandsby, Anne; González-Aguilera, Cristina; Chen, Shoudeng; Groth, Anja; Patel, Dinshaw J

2015-08-01

During DNA replication, chromatin is reassembled by recycling of modified old histones and deposition of new ones. How histone dynamics integrates with DNA replication to maintain genome and epigenome information remains unclear. Here, we reveal how human MCM2, part of the replicative helicase, chaperones histones H3-H4. Our first structure shows an H3-H4 tetramer bound by two MCM2 histone-binding domains (HBDs), which hijack interaction sites used by nucleosomal DNA. Our second structure reveals MCM2 and ASF1 cochaperoning an H3-H4 dimer. Mutational analyses show that the MCM2 HBD is required for MCM2-7 histone-chaperone function and normal cell proliferation. Further, we show that MCM2 can chaperone both new and old canonical histones H3-H4 as well as H3.3 and CENPA variants. The unique histone-binding mode of MCM2 thus endows the replicative helicase with ideal properties for recycling histones genome wide during DNA replication.

Sigma-1 receptor chaperones at the ER-mitochondrion interface regulate Ca(2+) signaling and cell survival.

Science.gov (United States)

Hayashi, Teruo; Su, Tsung-Ping

2007-11-02

Communication between the endoplasmic reticulum (ER) and mitochondrion is important for bioenergetics and cellular survival. The ER supplies Ca(2+) directly to mitochondria via inositol 1,4,5-trisphosphate receptors (IP3Rs) at close contacts between the two organelles referred to as mitochondrion-associated ER membrane (MAM). We found here that the ER protein sigma-1 receptor (Sig-1R), which is implicated in neuroprotection, carcinogenesis, and neuroplasticity, is a Ca(2+)-sensitive and ligand-operated receptor chaperone at MAM. Normally, Sig-1Rs form a complex at MAM with another chaperone, BiP. Upon ER Ca(2+) depletion or via ligand stimulation, Sig-1Rs dissociate from BiP, leading to a prolonged Ca(2+) signaling into mitochondria via IP3Rs. Sig-1Rs can translocate under chronic ER stress. Increasing Sig-1Rs in cells counteracts ER stress response, whereas decreasing them enhances apoptosis. These results reveal that the orchestrated ER chaperone machinery at MAM, by sensing ER Ca(2+) concentrations, regulates ER-mitochondrial interorganellar Ca(2+) signaling and cell survival.

Counteracting chemical chaperone effects on the single-molecule α-synuclein structural landscape.

Science.gov (United States)

Ferreon, Allan Chris M; Moosa, Mahdi Muhammad; Gambin, Yann; Deniz, Ashok A

2012-10-30

Protein structure and function depend on a close interplay between intrinsic folding energy landscapes and the chemistry of the protein environment. Osmolytes are small-molecule compounds that can act as chemical chaperones by altering the environment in a cellular context. Despite their importance, detailed studies on the role of these chemical chaperones in modulating structure and dimensions of intrinsically disordered proteins have been limited. Here, we used single-molecule Förster resonance energy transfer to test the counteraction hypothesis of counterbalancing effects between the protecting osmolyte trimethylamine-N-oxide (TMAO) and denaturing osmolyte urea for the case of α-synuclein, a Parkinson's disease-linked protein whose monomer exhibits significant disorder. The single-molecule experiments, which avoid complications from protein aggregation, do not exhibit clear solvent-induced cooperative protein transitions for these osmolytes, unlike results from previous studies on globular proteins. Our data demonstrate the ability of TMAO and urea to shift α-synuclein structures towards either more compact or expanded average dimensions. Strikingly, the experiments directly reveal that a 21 [urea][TMAO] ratio has a net neutral effect on the protein's dimensions, a result that holds regardless of the absolute osmolyte concentrations. Our findings shed light on a surprisingly simple aspect of the interplay between urea and TMAO on α-synuclein in the context of intrinsically disordered proteins, with potential implications for the biological roles of such chemical chaperones. The results also highlight the strengths of single-molecule experiments in directly probing the chemical physics of protein structure and disorder in more chemically complex environments.

Counteracting chemical chaperone effects on the single-molecule α-synuclein structural landscape

Science.gov (United States)

Ferreon, Allan Chris M.; Moosa, Mahdi Muhammad; Deniz, Ashok A.

2012-01-01

Protein structure and function depend on a close interplay between intrinsic folding energy landscapes and the chemistry of the protein environment. Osmolytes are small-molecule compounds that can act as chemical chaperones by altering the environment in a cellular context. Despite their importance, detailed studies on the role of these chemical chaperones in modulating structure and dimensions of intrinsically disordered proteins have been limited. Here, we used single-molecule Förster resonance energy transfer to test the counteraction hypothesis of counterbalancing effects between the protecting osmolyte trimethylamine-N-oxide (TMAO) and denaturing osmolyte urea for the case of α-synuclein, a Parkinson’s disease-linked protein whose monomer exhibits significant disorder. The single-molecule experiments, which avoid complications from protein aggregation, do not exhibit clear solvent-induced cooperative protein transitions for these osmolytes, unlike results from previous studies on globular proteins. Our data demonstrate the ability of TMAO and urea to shift α-synuclein structures towards either more compact or expanded average dimensions. Strikingly, the experiments directly reveal that a 2∶1 [urea]∶[TMAO] ratio has a net neutral effect on the protein’s dimensions, a result that holds regardless of the absolute osmolyte concentrations. Our findings shed light on a surprisingly simple aspect of the interplay between urea and TMAO on α-synuclein in the context of intrinsically disordered proteins, with potential implications for the biological roles of such chemical chaperones. The results also highlight the strengths of single-molecule experiments in directly probing the chemical physics of protein structure and disorder in more chemically complex environments. PMID:22826265

Roles of conserved arginines in ATP-binding domains of AAA+ chaperone ClpB from Thermus thermophilus.

Science.gov (United States)

Yamasaki, Takashi; Nakazaki, Yosuke; Yoshida, Masasuke; Watanabe, Yo-hei

2011-07-01

ClpB, a member of the expanded superfamily of ATPases associated with diverse cellular activities (AAA+), forms a ring-shaped hexamer and cooperates with the DnaK chaperone system to reactivate aggregated proteins in an ATP-dependent manner. The ClpB protomer consists of an N-terminal domain, an AAA+ module (AAA-1), a middle domain, and a second AAA+ module (AAA-2). Each AAA+ module contains highly conserved WalkerA and WalkerB motifs, and two arginines (AAA-1) or one arginine (AAA-2). Here, we investigated the roles of these arginines (Arg322, Arg323, and Arg747) of ClpB from Thermus thermophilus in the ATPase cycle and chaperone function by alanine substitution. These mutations did not affect nucleotide binding, but did inhibit the hydrolysis of the bound ATP and slow the threading of the denatured protein through the central pore of the T. thermophilus ClpB ring, which severely impaired the chaperone functions. Previously, it was demonstrated that ATP binding to the AAA-1 module induced motion of the middle domain and stabilized the ClpB hexamer. However, the arginine mutations of the AAA-1 module destabilized the ClpB hexamer, even though ATP-induced motion of the middle domain was not affected. These results indicated that the three arginines are crucial for ATP hydrolysis and chaperone activity, but not for ATP binding. In addition, the two arginines in AAA-1 and the ATP-induced motion of the middle domain independently contribute to the stabilization of the hexamer. © 2011 The Authors Journal compilation © 2011 FEBS.

The chaperone action of bovine milk αS1- and αS2-caseins and their associated form αS-casein.

Science.gov (United States)

Treweek, Teresa M; Thorn, David C; Price, William E; Carver, John A

2011-06-01

α(S)-Casein, the major milk protein, comprises α(S1)- and α(S2)-casein and acts as a molecular chaperone, stabilizing an array of stressed target proteins against precipitation. Here, we report that α(S)-casein acts in a similar manner to the unrelated small heat-shock proteins (sHsps) and clusterin in that it does not preserve the activity of stressed target enzymes. However, in contrast to sHsps and clusterin, α-casein does not bind target proteins in a state that facilitates refolding by Hsp70. α(S)-Casein was also separated into α- and α-casein, and the chaperone abilities of each of these proteins were assessed with amorphously aggregating and fibril-forming target proteins. Under reduction stress, all α-casein species exhibited similar chaperone ability, whereas under heat stress, α-casein was a poorer chaperone. Conversely, α(S2)-casein was less effective at preventing fibril formation by modified κ-casein, whereas α- and α(S1)-casein were comparably potent inhibitors. In the presence of added salt and heat stress, α(S1)-, α- and α(S)-casein were all significantly less effective. We conclude that α(S1)- and α-casein stabilise each other to facilitate optimal chaperone activity of α(S)-casein. This work highlights the interdependency of casein proteins for their structural stability. Copyright © 2011 Elsevier Inc. All rights reserved.

Identification of the Vibrio parahaemolyticus type III secretion system 2-associated chaperone VocC for the T3SS2-specific effector VopC.

Science.gov (United States)

Akeda, Yukihiro; Kodama, Toshio; Saito, Kazunobu; Iida, Tetsuya; Oishi, Kazunori; Honda, Takeshi

2011-11-01

The enteropathogen Vibrio parahaemolyticus possesses two sets of type III secretion systems, T3SS1 and T3SS2. Effector proteins secreted by these T3SSs are delivered into host cells, leading to cell death or diarrhea. However, it is not known how specific effectors are secreted through a specific T3SS when both T3SSs are expressed within bacteria. One molecule thought to determine secretion specificity is a T3SS-associated chaperone; however, no T3SS2-specific chaperone has been identified. Therefore, we screened T3SS2 chaperone candidates by a pull-down assay using T3SS2 effectors fused with glutathione-S-transferase. A secretion assay revealed that the newly identified cognate chaperone VocC for the T3SS2-specific effector VopC was required for the efficient secretion of the substrate through T3SS2. Further experiments determined the chaperone-binding domain and the amino-terminal secretion signal of the cognate effector. These findings, in addition to the previously identified T3SS1-specific chaperone, VecA, provide a strategy to clarify the specificity of effector secretion through T3SSs of V. parahaemolyticus. 2011 Federation of European Microbiological Societies. Published by Blackwell Publishing Ltd. All rights reserved.

42 CFR 485.719 - Condition of participation: Arrangements for physical therapy and speech pathology services to be...

Science.gov (United States)

2010-10-01

... physical therapy and speech pathology services to be performed by other than salaried organization... Agencies as Providers of Outpatient Physical Therapy and Speech-Language Pathology Services § 485.719 Condition of participation: Arrangements for physical therapy and speech pathology services to be performed...

Hsp90 chaperone inhibitor 17-AAG attenuates Aβ-induced synaptic toxicity and memory impairment.

Science.gov (United States)

Chen, Yaomin; Wang, Bin; Liu, Dan; Li, Jing Jing; Xue, Yueqiang; Sakata, Kazuko; Zhu, Ling-qiang; Heldt, Scott A; Xu, Huaxi; Liao, Francesca-Fang

2014-02-12

The excessive accumulation of soluble amyloid peptides (Aβ) plays a crucial role in the pathogenesis of Alzheimer's disease (AD), particularly in synaptic dysfunction. The role of the two major chaperone proteins, Hsp70 and Hsp90, in clearing misfolded protein aggregates has been established. Despite their abundant presence in synapses, the role of these chaperones in synapses remains elusive. Here, we report that Hsp90 inhibition by 17-AAG elicited not only a heat shock-like response but also upregulated presynaptic and postsynaptic proteins, such as synapsin I, synaptophysin, and PSD95 in neurons. 17-AAG treatment enhanced high-frequency stimulation-evoked LTP and protected neurons from synaptic damage induced by soluble Aβ. In AD transgenic mice, the daily administration of 17-AAG over 7 d resulted in a marked increase in PSD95 expression in hippocampi. 17-AAG treatments in wild-type C57BL/6 mice challenged by soluble Aβ significantly improved contextual fear memory. Further, we demonstrate that 17-AAG activated synaptic protein expression via transcriptional mechanisms through the heat shock transcription factor HSF1. Together, our findings identify a novel function of Hsp90 inhibition in regulating synaptic plasticity, in addition to the known neuroprotective effects of the chaperones against Aβ and tau toxicity, thus further supporting the potential of Hsp90 inhibitors in treating neurodegenerative diseases.

Hsp70/Hsp90 organising protein (hop): beyond interactions with chaperones and prion proteins.

Science.gov (United States)

Baindur-Hudson, Swati; Edkins, Adrienne L; Blatch, Gregory L

2015-01-01

The Hsp70/Hsp90 organising protein (Hop), also known as stress-inducible protein 1 (STI1), has received considerable attention for diverse cellular functions in both healthy and diseased states. There is extensive evidence that intracellular Hop is a co-chaperone of the major chaperones Hsp70 and Hsp90, playing an important role in the productive folding of Hsp90 client proteins. Consequently, Hop is implicated in a number of key signalling pathways, including aberrant pathways leading to cancer. However, Hop is also secreted and it is now well established that Hop also serves as a receptor for the prion protein, PrP(C). The intracellular and extracellular forms of Hop most likely represent two different isoforms, although the molecular determinants of these divergent functions are yet to be identified. There is also a growing body of research that reports the involvement of Hop in cellular activities that appear independent of either chaperones or PrP(C). While Hop has been shown to have various cellular functions, its biological function remains elusive. However, recent knockout studies in mammals suggest that Hop has an important role in embryonic development. This review provides a critical overview of the latest molecular, cellular and biological research on Hop, critically evaluating its function in healthy systems and how this function is adapted in diseases states.

Comparison of intra-organellar chaperone capacity for dealing with stress-induced protein unfolding

NARCIS (Netherlands)

Hageman, Jurre; Vos, Michel J.; van Waarde, Maria A. W. H.; Kampinga, Harm H.

2007-01-01

Molecular chaperones are essential for cells to prevent that partially unfolded proteins form non-functional, toxic aggregates. This requirement is increased when cells experience protein unfolding stresses and such could affect all compartments in the eukaryotic cell. Whether all organelles are

Broadening the functionality of a J-protein/Hsp70 molecular chaperone system.

Science.gov (United States)

Schilke, Brenda A; Ciesielski, Szymon J; Ziegelhoffer, Thomas; Kamiya, Erina; Tonelli, Marco; Lee, Woonghee; Cornilescu, Gabriel; Hines, Justin K; Markley, John L; Craig, Elizabeth A

2017-10-01

By binding to a multitude of polypeptide substrates, Hsp70-based molecular chaperone systems perform a range of cellular functions. All J-protein co-chaperones play the essential role, via action of their J-domains, of stimulating the ATPase activity of Hsp70, thereby stabilizing its interaction with substrate. In addition, J-proteins drive the functional diversity of Hsp70 chaperone systems through action of regions outside their J-domains. Targeting to specific locations within a cellular compartment and binding of specific substrates for delivery to Hsp70 have been identified as modes of J-protein specialization. To better understand J-protein specialization, we concentrated on Saccharomyces cerevisiae SIS1, which encodes an essential J-protein of the cytosol/nucleus. We selected suppressors that allowed cells lacking SIS1 to form colonies. Substitutions changing single residues in Ydj1, a J-protein, which, like Sis1, partners with Hsp70 Ssa1, were isolated. These gain-of-function substitutions were located at the end of the J-domain, suggesting that suppression was connected to interaction with its partner Hsp70, rather than substrate binding or subcellular localization. Reasoning that, if YDJ1 suppressors affect Ssa1 function, substitutions in Hsp70 itself might also be able to overcome the cellular requirement for Sis1, we carried out a selection for SSA1 suppressor mutations. Suppressing substitutions were isolated that altered sites in Ssa1 affecting the cycle of substrate interaction. Together, our results point to a third, additional means by which J-proteins can drive Hsp70's ability to function in a wide range of cellular processes-modulating the Hsp70-substrate interaction cycle.

Tah1 helix-swap dimerization prevents mixed Hsp90 co-chaperone complexes

International Nuclear Information System (INIS)

Morgan, Rhodri M. L.; Pal, Mohinder; Roe, S. Mark; Pearl, Laurence H.; Prodromou, Chrisostomos

2015-01-01

A helix swap involving the fifth helix between two adjacently bound Tah1 molecules restores the normal binding environment of the conserved MEEVD peptide of Hsp90. Dimerization also explains how other monomeric TPR-domain proteins are excluded from forming inappropriate mixed co-chaperone complexes with Hsp90 and Tah1. Specific co-chaperone adaptors facilitate the recruitment of client proteins to the Hsp90 system. Tah1 binds the C-terminal conserved MEEVD motif of Hsp90, thus linking an eclectic set of client proteins to the R2TP complex for their assembly and regulation by Hsp90. Rather than the normal complement of seven α-helices seen in other tetratricopeptide repeat (TPR) domains, Tah1 unusually consists of the first five only. Consequently, the methionine of the MEEVD peptide remains exposed to solvent when bound by Tah1. In solution Tah1 appears to be predominantly monomeric, and recent structures have failed to explain how Tah1 appears to prevent the formation of mixed TPR domain-containing complexes such as Cpr6–(Hsp90) 2 –Tah1. To understand this further, the crystal structure of Tah1 in complex with the MEEVD peptide of Hsp90 was determined, which shows a helix swap involving the fifth α-helix between two adjacently bound Tah1 molecules. Dimerization of Tah1 restores the normal binding environment of the bound Hsp90 methionine residue by reconstituting a TPR binding site similar to that in seven-helix-containing TPR domain proteins. Dimerization also explains how other monomeric TPR-domain proteins are excluded from forming inappropriate mixed co-chaperone complexes

Tah1 helix-swap dimerization prevents mixed Hsp90 co-chaperone complexes

Energy Technology Data Exchange (ETDEWEB)

Morgan, Rhodri M. L.; Pal, Mohinder; Roe, S. Mark; Pearl, Laurence H., E-mail: laurence.pearl@sussex.ac.uk; Prodromou, Chrisostomos, E-mail: laurence.pearl@sussex.ac.uk [University of Sussex, Falmer, Brighton BN1 9RQ (United Kingdom)

2015-05-01

A helix swap involving the fifth helix between two adjacently bound Tah1 molecules restores the normal binding environment of the conserved MEEVD peptide of Hsp90. Dimerization also explains how other monomeric TPR-domain proteins are excluded from forming inappropriate mixed co-chaperone complexes with Hsp90 and Tah1. Specific co-chaperone adaptors facilitate the recruitment of client proteins to the Hsp90 system. Tah1 binds the C-terminal conserved MEEVD motif of Hsp90, thus linking an eclectic set of client proteins to the R2TP complex for their assembly and regulation by Hsp90. Rather than the normal complement of seven α-helices seen in other tetratricopeptide repeat (TPR) domains, Tah1 unusually consists of the first five only. Consequently, the methionine of the MEEVD peptide remains exposed to solvent when bound by Tah1. In solution Tah1 appears to be predominantly monomeric, and recent structures have failed to explain how Tah1 appears to prevent the formation of mixed TPR domain-containing complexes such as Cpr6–(Hsp90){sub 2}–Tah1. To understand this further, the crystal structure of Tah1 in complex with the MEEVD peptide of Hsp90 was determined, which shows a helix swap involving the fifth α-helix between two adjacently bound Tah1 molecules. Dimerization of Tah1 restores the normal binding environment of the bound Hsp90 methionine residue by reconstituting a TPR binding site similar to that in seven-helix-containing TPR domain proteins. Dimerization also explains how other monomeric TPR-domain proteins are excluded from forming inappropriate mixed co-chaperone complexes.

Eviction of linker histone H1 by NAP-family histone chaperones enhances activated transcription.

Science.gov (United States)

Zhang, Qian; Giebler, Holli A; Isaacson, Marisa K; Nyborg, Jennifer K

2015-01-01

In the Metazoan nucleus, core histones assemble the genomic DNA to form nucleosome arrays, which are further compacted into dense chromatin structures by the linker histone H1. The extraordinary density of chromatin creates an obstacle for accessing the genetic information. Regulation of chromatin dynamics is therefore critical to cellular homeostasis, and histone chaperones serve as prominent players in these processes. In the current study, we examined the role of specific histone chaperones in negotiating the inherently repressive chromatin structure during transcriptional activation. Using a model promoter, we demonstrate that the human nucleosome assembly protein family members hNap1 and SET/Taf1β stimulate transcription in vitro during pre-initiation complex formation, prior to elongation. This stimulatory effect is dependent upon the presence of activators, p300, and Acetyl-CoA. We show that transcription from our chromatin template is strongly repressed by H1, and that both histone chaperones enhance RNA synthesis by overcoming H1-induced repression. Importantly, both hNap1 and SET/Taf1β directly bind H1, and function to enhance transcription by evicting the linker histone from chromatin reconstituted with H1. In vivo studies demonstrate that SET/Taf1β, but not hNap1, strongly stimulates activated transcription from the chromosomally-integrated model promoter, consistent with the observation that SET/Taf1β is nuclear, whereas hNap1 is primarily cytoplasmic. Together, these observations indicate that SET/Taf1β may serve as a critical regulator of H1 dynamics and gene activation in vivo. These studies uncover a novel function for SET that mechanistically couples transcriptional derepression with H1 dynamics. Furthermore, they underscore the significance of chaperone-dependent H1 displacement as an essential early step in the transition of a promoter from a dense chromatin state into one that is permissive to transcription factor binding and robust

Heat shock protein 90 (Hsp90) chaperone complex. A molecular target for enhancement of thermosensitivity and radiosensitivity

International Nuclear Information System (INIS)

Akimoto, Tetsuo; Nonaka, Tetsuo; Kitamoto, Yoshizumi; Sakurai, Hideyuki

2002-01-01

Heat shock protein 90 (Hsp90) is a highly conserved heat shock protein in animal and plants, and exists abundantly in the cytoplasm in unstressed condition, accounting for 1-2% in cytoplasmic proteins. Main difference of Hsp90 from other Hsps are its substrate that Hsp90 binds to. These substrates include various signal transduction proteins, kinase, steroid receptors and transcription factors, therefore, Hsp90 plays a key role in maintaining cellular signal transduction networks. Many chaperoned proteins (client proteins) of Hsp90 are associated with cellular proliferation or malignant transformation, thus Hsp90 chaperone complex has been focused as targets for cancer therapy. Among the client proteins, there are several molecules that have been defined as targets or factors for determination or enhancement of radiosensitivity or thermosensitivity. Thus, it is easily speculated that Hsp90 chaperone complex inhibitors that disrupt association of Hsp90 and client protein in combination with radiation or/and heat has potential effect on enhancement of radiosensitivity or thermosensitivity. In this paper, possible mechanisms in enhancing radiosensitivity or thermosensitivity according to the client proteins will be summarized. (author)

Drug Development in Conformational Diseases: A Novel Family of Chemical Chaperones that Bind and Stabilise Several Polymorphic Amyloid Structures.

Directory of Open Access Journals (Sweden)

Marquiza Sablón-Carrazana

Full Text Available The increasing prevalence of conformational diseases, including Alzheimer's disease, type 2 Diabetes Mellitus and Cancer, poses a global challenge at many different levels. It has devastating effects on the sufferers as well as a tremendous economic impact on families and the health system. In this work, we apply a cross-functional approach that combines ideas, concepts and technologies from several disciplines in order to study, in silico and in vitro, the role of a novel chemical chaperones family (NCHCHF in processes of protein aggregation in conformational diseases. Given that Serum Albumin (SA is the most abundant protein in the blood of mammals, and Bovine Serum Albumin (BSA is an off-the-shelf protein available in most labs around the world, we compared the ligandability of BSA:NCHCHF with the interaction sites in the Human Islet Amyloid Polypeptide (hIAPP:NCHCHF, and in the amyloid pharmacophore fragments (Aβ17-42 and Aβ16-21:NCHCHF. We posit that the merging of this interaction sites is a meta-structure of pharmacophore which allows the development of chaperones that can prevent protein aggregation at various states from: stabilizing the native state to destabilizing oligomeric state and protofilament. Furthermore to stabilize fibrillar structures, thus decreasing the amount of toxic oligomers in solution, as is the case with the NCHCHF. The paper demonstrates how a set of NCHCHF can be used for studying and potentially treating the various physiopathological stages of a conformational disease. For instance, when dealing with an acute phase of cytotoxicity, what is needed is the recruitment of cytotoxic oligomers, thus chaperone F, which accelerates fiber formation, would be very useful; whereas in a chronic stage it is better to have chaperones A, B, C, and D, which stabilize the native and fibril structures halting self-catalysis and the creation of cytotoxic oligomers as a consequence of fiber formation. Furthermore, all the

Functional interaction of the DNA-binding transcription factor Sp1 through its DNA-binding domain with the histone chaperone TAF-I.

Science.gov (United States)

Suzuki, Toru; Muto, Shinsuke; Miyamoto, Saku; Aizawa, Kenichi; Horikoshi, Masami; Nagai, Ryozo

2003-08-01

Transcription involves molecular interactions between general and regulatory transcription factors with further regulation by protein-protein interactions (e.g. transcriptional cofactors). Here we describe functional interaction between DNA-binding transcription factor and histone chaperone. Affinity purification of factors interacting with the DNA-binding domain of the transcription factor Sp1 showed Sp1 to interact with the histone chaperone TAF-I, both alpha and beta isoforms. This interaction was specific as Sp1 did not interact with another histone chaperone CIA nor did other tested DNA-binding regulatory factors (MyoD, NFkappaB, p53) interact with TAF-I. Interaction of Sp1 and TAF-I occurs both in vitro and in vivo. Interaction with TAF-I results in inhibition of DNA-binding, and also likely as a result of such, inhibition of promoter activation by Sp1. Collectively, we describe interaction between DNA-binding transcription factor and histone chaperone which results in negative regulation of the former. This novel regulatory interaction advances our understanding of the mechanisms of eukaryotic transcription through DNA-binding regulatory transcription factors by protein-protein interactions, and also shows the DNA-binding domain to mediate important regulatory interactions.

Chaperones, but not oxidized proteins, are ubiquitinated after oxidative stress

DEFF Research Database (Denmark)

Kästle, Marc; Reeg, Sandra; Rogowska-Wrzesinska, Adelina

2012-01-01

of these proteins by MALDI tandem mass spectrometry (MALDI MS/MS). As a result we obtained 24 different proteins which can be categorized into the following groups: chaperones, energy metabolism, cytoskeleton/intermediate filaments, and protein translation/ribosome biogenesis. The special set of identified......, ubiquitinated proteins confirm the thesis that ubiquitination upon oxidative stress is no random process to degrade the mass of oxidized proteins, but concerns a special group of functional proteins....

Preliminary X-ray diffraction analysis of CfaA, a molecular chaperone essential for the assembly of CFA/I fimbriae of human enterotoxigenic Escherichia coli.

Science.gov (United States)

Bao, Rui; Esser, Lothar; Poole, Steven; McVeigh, Annette; Chen, Yu Xing; Savarino, Stephen J; Xia, Di

2014-02-01

Understanding of pilus bioassembly in Gram-negative bacteria stems mainly from studies of P pili and type 1 fimbriae of uropathogenic Escherichia coli, which are mediated by the classic chaperone-usher pathway (CUP). However, CFA/I fimbriae, a class 5 fimbria and intestinal colonization factor for enterotoxigenic E. coli (ETEC), are proposed to assemble via the alternate chaperone pathway (ACP). Both CUP and ACP fimbrial bioassembly pathways require the function of a periplasmic chaperone, but their corresponding proteins share very low similarity in primary sequence. Here, the crystallization of the CFA/I periplasmic chaperone CfaA by the hanging-drop vapor-diffusion method is reported. X-ray diffraction data sets were collected from a native CfaA crystal to 2 Å resolution and to 1.8 and 2.8 Å resolution, respectively, from a lead and a platinum derivative. These crystals displayed the symmetry of space group C2, with unit-cell parameters a = 103.6, b = 28.68, c = 90.60 Å, β = 119.7°. Initial phases were derived from multiple isomorphous replacement with anomalous scattering experiments using the data from the platinum and lead derivatives. This resulted in an interpretable electron-density map showing one CfaA molecule in an asymmetric unit. Sequence assignments were aided by anomalous signals from the heavy-atom derivatives. Refinement of the atomic model of CfaA is ongoing, which is expected to further understanding of the essential aspects and allowable variations in tertiary structure of the greater family of chaperones involved in chaperone-usher mediated bioassembly.

Effect of resistance exercise under conditions of reduced blood insulin on AMPKα Ser485/491 inhibitory phosphorylation and AMPK pathway activation.

Science.gov (United States)

Kido, Kohei; Yokokawa, Takumi; Ato, Satoru; Sato, Koji; Fujita, Satoshi

2017-08-01

Insulin stimulates skeletal muscle glucose uptake via activation of the protein kinase B/Akt (Akt) pathway. Recent studies suggest that insulin downregulates AMP-activated protein kinase (AMPK) activity via Ser485/491 phosphorylation of the AMPK α-subunit. Thus lower blood insulin concentrations may induce AMPK signal activation. Acute exercise is one method to stimulate AMPK activation; however, no study has examined the relationship between blood insulin levels and acute resistance exercise-induced AMPK pathway activation. Based on previous findings, we hypothesized that the acute resistance exercise-induced AMPK pathway activation would be augmented by disruptions in insulin secretion through a decrease in AMPKα Ser485/491 inhibitory phosphorylation. To test the hypothesis, 10-wk-old male Sprague-Dawley rats were administered the toxin streptozotocin (STZ; 55 mg/kg) to destroy the insulin secreting β-cells. Three days postinjection, the right gastrocnemius muscle from STZ and control rats was subjected to resistance exercise by percutaneous electrical stimulation. Animals were killed 0, 1, or 3 h later; activation of the Akt/AMPK and downstream pathways in the muscle tissue was analyzed by Western blotting and real-time PCR. Notably, STZ rats showed a significant decrease in basal Akt and AMPKα Ser485/491 phosphorylation, but substantial exercise-induced increases in both AMPKα Thr172 and acetyl-CoA carboxylase (ACC) Ser79 phosphorylation were observed. Although no significant impact on resistance exercise-induced Akt pathway activation or glucose uptake was found, resistance exercise-induced peroxisome proliferator-activated receptor (PPAR)-γ coactivator-1 α (PGC-1α) gene expression was augmented by STZ treatment. Collectively, these data suggest that circulating insulin levels may regulate acute resistance exercise-induced AMPK pathway activation and AMPK-dependent gene expression relating to basal AMPKα Ser485/491 phosphorylation. Copyright © 2017

Sigma-1 receptor chaperones regulate the secretion of brain-derived neurotrophic factor.

Science.gov (United States)

Fujimoto, Michiko; Hayashi, Teruo; Urfer, Roman; Mita, Shiro; Su, Tsung-Ping

2012-07-01

The sigma-1 receptor (Sig-1R) is a novel endoplasmic reticulum (ER) molecular chaperone that regulates protein folding and degradation. The Sig-1R activation by agonists is known to improve memory, promote cell survival, and exert an antidepressant-like action in animals. Cutamesine (SA4503), a selective Sig-1R ligand, was shown to increase BDNF in the hippocampus of rats. How exactly the intracellular chaperone Sig-1R or associated ligand causes the increase of BDNF or any other neurotrophins is unknown. We examined here whether the action of Sig-1Rs may relate to the post-translational processing and release of BDNF in neuroblastoma cell lines. We used in vitro assays and confirmed that cutamesine possesses the bona fide Sig-1R agonist property by causing the dissociation of BiP from Sig-1Rs. The C-terminus of Sig-1Rs exerted robust chaperone activity by completely blocking the aggregation of BDNF and GDNF in vitro. Chronic treatment with cutamesine in rat B104 neuroblastoma caused a time- and dose-dependent potentiation of the secretion of BDNF without affecting the mRNA level of BDNF. Cutamesine decreased the intracellular level of pro-BDNF and mature BDNF whereas increased the extracellular level of mature BDNF. The pulse-chase experiment indicated that the knockdown of Sig-1Rs decreased the secreted mature BDNF in B104 cells without affecting the synthesis of BDNF. Our findings indicate that, in contrast to clinically used antidepressants that promote the transcriptional upregulation of BDNF, the Sig-1R agonist cutamesine potentiates the post-translational processing of neurotrophins. This unique pharmacological profile may provide a novel therapeutic opportunity for the treatment of neuropsychiatric disorders. Copyright © 2012 Wiley Periodicals, Inc.

Quantitative proteomics and network analysis of SSA1 and SSB1 deletion mutants reveals robustness of chaperone HSP70 network in Saccharomyces cerevisiae.

Science.gov (United States)

Jarnuczak, Andrew F; Eyers, Claire E; Schwartz, Jean-Marc; Grant, Christopher M; Hubbard, Simon J

2015-09-01

Molecular chaperones play an important role in protein homeostasis and the cellular response to stress. In particular, the HSP70 chaperones in yeast mediate a large volume of protein folding through transient associations with their substrates. This chaperone interaction network can be disturbed by various perturbations, such as environmental stress or a gene deletion. Here, we consider deletions of two major chaperone proteins, SSA1 and SSB1, from the chaperone network in Sacchromyces cerevisiae. We employ a SILAC-based approach to examine changes in global and local protein abundance and rationalise our results via network analysis and graph theoretical approaches. Although the deletions result in an overall increase in intracellular protein content, correlated with an increase in cell size, this is not matched by substantial changes in individual protein concentrations. Despite the phenotypic robustness to deletion of these major hub proteins, it cannot be simply explained by the presence of paralogues. Instead, network analysis and a theoretical consideration of folding workload suggest that the robustness to perturbation is a product of the overall network structure. This highlights how quantitative proteomics and systems modelling can be used to rationalise emergent network properties, and how the HSP70 system can accommodate the loss of major hubs. © 2015 The Authors. PROTEOMICS published by Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.

The Cryoelectron Microscopy Structure of the Type 1 Chaperone-Usher Pilus Rod.

Science.gov (United States)

Hospenthal, Manuela K; Zyla, Dawid; Costa, Tiago R D; Redzej, Adam; Giese, Christoph; Lillington, James; Glockshuber, Rudi; Waksman, Gabriel

2017-12-05

Adhesive chaperone-usher pili are long, supramolecular protein fibers displayed on the surface of many bacterial pathogens. The type 1 and P pili of uropathogenic Escherichia coli (UPEC) play important roles during urinary tract colonization, mediating attachment to the bladder and kidney, respectively. The biomechanical properties of the helical pilus rods allow them to reversibly uncoil in response to flow-induced forces, allowing UPEC to retain a foothold in the unique and hostile environment of the urinary tract. Here we provide the 4.2-Å resolution cryo-EM structure of the type 1 pilus rod, which together with the previous P pilus rod structure rationalizes the remarkable "spring-like" properties of chaperone-usher pili. The cryo-EM structure of the type 1 pilus rod differs in its helical parameters from the structure determined previously by a hybrid approach. We provide evidence that these structural differences originate from different quaternary structures of pili assembled in vivo and in vitro. Copyright © 2017 The Authors. Published by Elsevier Ltd.. All rights reserved.

Anatomy of RISC: how do small RNAs and chaperones activate Argonaute proteins?

Science.gov (United States)

Nakanishi, Kotaro

2016-09-01

RNA silencing is a eukaryote-specific phenomenon in which microRNAs and small interfering RNAs degrade messenger RNAs containing a complementary sequence. To this end, these small RNAs need to be loaded onto an Argonaute protein (AGO protein) to form the effector complex referred to as RNA-induced silencing complex (RISC). RISC assembly undergoes multiple and sequential steps with the aid of Hsc70/Hsp90 chaperone machinery. The molecular mechanisms for this assembly process remain unclear, despite their significance for the development of gene silencing techniques and RNA interference-based therapeutics. This review dissects the currently available structures of AGO proteins and proposes models and hypotheses for RISC assembly, covering the conformation of unloaded AGO proteins, the chaperone-assisted duplex loading, and the slicer-dependent and slicer-independent duplex separation. The differences in the properties of RISC between prokaryotes and eukaryotes will also be clarified. WIREs RNA 2016, 7:637-660. doi: 10.1002/wrna.1356 For further resources related to this article, please visit the WIREs website. © 2016 The Authors. WIREs RNA published by Wiley Periodicals, Inc.

Degradation of AF1Q by chaperone-mediated autophagy

International Nuclear Information System (INIS)

Li, Peng; Ji, Min; Lu, Fei; Zhang, Jingru; Li, Huanjie; Cui, Taixing; Li Wang, Xing; Tang, Dongqi; Ji, Chunyan

2014-01-01

AF1Q, a mixed lineage leukemia gene fusion partner, is identified as a poor prognostic biomarker for pediatric acute myeloid leukemia (AML), adult AML with normal cytogenetic and adult myelodysplastic syndrome. AF1Q is highly regulated during hematopoietic progenitor differentiation and development but its regulatory mechanism has not been defined clearly. In the present study, we used pharmacological and genetic approaches to influence chaperone-mediated autophagy (CMA) and explored the degradation mechanism of AF1Q. Pharmacological inhibitors of lysosomal degradation, such as chloroquine, increased AF1Q levels, whereas activators of CMA, including 6-aminonicotinamide and nutrient starvation, decreased AF1Q levels. AF1Q interacts with HSPA8 and LAMP-2A, which are core components of the CMA machinery. Knockdown of HSPA8 or LAMP-2A increased AF1Q protein levels, whereas overexpression showed the opposite effect. Using an amino acid deletion AF1Q mutation plasmid, we identified that AF1Q had a KFERQ-like motif which was recognized by HSPA8 for CMA-dependent proteolysis. In conclusion, we demonstrate for the first time that AF1Q can be degraded in lysosomes by CMA. - Highlights: • Chaperone-mediated autophagy (CMA) is involved in the degradation of AF1Q. • Macroautophagy does not contribute to the AF1Q degradation. • AF1Q has a KFERQ-like motif that is recognized by CMA core components

Synthetic cation-selective nanotube: permeant cations chaperoned by anions.

Science.gov (United States)

Hilder, Tamsyn A; Gordon, Dan; Chung, Shin-Ho

2011-01-28

The ability to design ion-selective, synthetic nanotubes which mimic biological ion channels may have significant implications for the future treatment of bacteria, diseases, and as ultrasensitive biosensors. We present the design of a synthetic nanotube made from carbon atoms that selectively allows monovalent cations to move across and rejects all anions. The cation-selective nanotube mimics some of the salient properties of biological ion channels. Before practical nanodevices are successfully fabricated it is vital that proof-of-concept computational studies are performed. With this in mind we use molecular and stochastic dynamics simulations to characterize the dynamics of ion permeation across a single-walled (10, 10), 36 Å long, carbon nanotube terminated with carboxylic acid with an effective radius of 5.08 Å. Although cations encounter a high energy barrier of 7 kT, its height is drastically reduced by a chloride ion in the nanotube. The presence of a chloride ion near the pore entrance thus enables a cation to enter the pore and, once in the pore, it is chaperoned by the resident counterion across the narrow pore. The moment the chaperoned cation transits the pore, the counterion moves back to the entrance to ferry another ion. The synthetic nanotube has a high sodium conductance of 124 pS and shows linear current-voltage and current-concentration profiles. The cation-anion selectivity ratio ranges from 8 to 25, depending on the ionic concentrations in the reservoirs.

Degradation of AF1Q by chaperone-mediated autophagy

Energy Technology Data Exchange (ETDEWEB)

Li, Peng; Ji, Min; Lu, Fei; Zhang, Jingru [Department of Hematology, Key Laboratory of Cardiovascular Remodeling and Function Research, Qilu Hospital, Shandong University, Jinan 250012 (China); Li, Huanjie; Cui, Taixing; Li Wang, Xing [Research Center for Cell Therapy, Key Laboratory of Cardiovascular Remodeling and Function Research, Qilu Hospital, Shandong University, Jinan 250012 (China); Tang, Dongqi, E-mail: tangdq@sdu.edu.cn [Research Center for Cell Therapy, Key Laboratory of Cardiovascular Remodeling and Function Research, Qilu Hospital, Shandong University, Jinan 250012 (China); Center for Stem Cell and Regenerative Medicine, The Second Hospital of Shandong University, Jinan 250033 (China); Ji, Chunyan, E-mail: jichunyan@sdu.edu.cn [Department of Hematology, Key Laboratory of Cardiovascular Remodeling and Function Research, Qilu Hospital, Shandong University, Jinan 250012 (China)

2014-09-10

AF1Q, a mixed lineage leukemia gene fusion partner, is identified as a poor prognostic biomarker for pediatric acute myeloid leukemia (AML), adult AML with normal cytogenetic and adult myelodysplastic syndrome. AF1Q is highly regulated during hematopoietic progenitor differentiation and development but its regulatory mechanism has not been defined clearly. In the present study, we used pharmacological and genetic approaches to influence chaperone-mediated autophagy (CMA) and explored the degradation mechanism of AF1Q. Pharmacological inhibitors of lysosomal degradation, such as chloroquine, increased AF1Q levels, whereas activators of CMA, including 6-aminonicotinamide and nutrient starvation, decreased AF1Q levels. AF1Q interacts with HSPA8 and LAMP-2A, which are core components of the CMA machinery. Knockdown of HSPA8 or LAMP-2A increased AF1Q protein levels, whereas overexpression showed the opposite effect. Using an amino acid deletion AF1Q mutation plasmid, we identified that AF1Q had a KFERQ-like motif which was recognized by HSPA8 for CMA-dependent proteolysis. In conclusion, we demonstrate for the first time that AF1Q can be degraded in lysosomes by CMA. - Highlights: • Chaperone-mediated autophagy (CMA) is involved in the degradation of AF1Q. • Macroautophagy does not contribute to the AF1Q degradation. • AF1Q has a KFERQ-like motif that is recognized by CMA core components.

Mapping the ER Interactome: The P Domains of Calnexin and Calreticulin as Plurivalent Adapters for Foldases and Chaperones.

Science.gov (United States)

Kozlov, Guennadi; Muñoz-Escobar, Juliana; Castro, Karla; Gehring, Kalle

2017-09-05

The lectin chaperones calreticulin (CRT) and calnexin (CNX) contribute to the folding of glycoproteins in the ER by recruiting foldases such as the protein disulfide isomerase ERp57 and the peptidyl prolyl cis-trans isomerase CypB. Recently, CRT was shown to interact with the chaperone ERp29. Here, we show that ERp29 directly binds to the P domain of CNX. Crystal structures of the D domain of ERp29 in complex with the P domains from CRT and calmegin, a tissue-specific CNX homolog, reveal a commonality in the mechanism of binding whereby the tip of the P domain functions as a plurivalent adapter to bind a variety of folding factors. We show that mutation of a single residue, D348 in CNX, abrogates binding to ERp29 as well as ERp57 and CypB. The structural diversity of the accessory factors suggests that these chaperones became specialized for glycoprotein folding through convergent evolution of their P-domain binding sites. Copyright © 2017 Elsevier Ltd. All rights reserved.

The DNLZ/HEP zinc-binding subdomain is critical for regulation of the mitochondrial chaperone HSPA9.

Science.gov (United States)

Vu, Michael T; Zhai, Peng; Lee, Juhye; Guerra, Cecilia; Liu, Shirley; Gustin, Michael C; Silberg, Jonathan J

2012-02-01

Human mitochondrial DNLZ/HEP regulates the catalytic activity and solubility of the mitochondrial hsp70 chaperone HSPA9. Here, we investigate the role that the DNLZ zinc-binding and C-terminal subdomains play in regulating HSPA9. We show that truncations lacking portions of the zinc-binding subdomain (ZBS) do not affect the solubility of HSPA9 or its ATPase domain, whereas those containing the ZBS and at least 10 residues following this subdomain enhance chaperone solubility. Binding measurements further show that DNLZ requires its ZBS to form a stable complex with the HSPA9 ATPase domain, and ATP hydrolysis measurements reveal that the ZBS is critical for full stimulation of HSPA9 catalytic activity. We also examined if DNLZ is active in vivo. We found that DNLZ partially complements the growth of Δzim17 Saccharomyces cerevisiae, and we discovered that a Zim17 truncation lacking a majority of the C-terminal subdomain strongly complements growth like full-length Zim17. These findings provide direct evidence that human DNLZ is a functional ortholog of Zim17. In addition, they implicate the pair of antiparallel β-strands that coordinate zinc in Zim17/DNLZ-type proteins as critical for binding and regulating hsp70 chaperones. Copyright © 2011 The Protein Society.

Spinal Muscular Atrophy: From Defective Chaperoning of snRNP Assembly to Neuromuscular Dysfunction

Directory of Open Access Journals (Sweden)

Maia Lanfranco

2017-06-01

Full Text Available Spinal Muscular Atrophy (SMA is a neuromuscular disorder that results from decreased levels of the survival motor neuron (SMN protein. SMN is part of a multiprotein complex that also includes Gemins 2–8 and Unrip. The SMN-Gemins complex cooperates with the protein arginine methyltransferase 5 (PRMT5 complex, whose constituents include WD45, PRMT5 and pICln. Both complexes function as molecular chaperones, interacting with and assisting in the assembly of an Sm protein core onto small nuclear RNAs (snRNAs to generate small nuclear ribonucleoproteins (snRNPs, which are the operating components of the spliceosome. Molecular and structural studies have refined our knowledge of the key events taking place within the crowded environment of cells and the numerous precautions undertaken to ensure the faithful assembly of snRNPs. Nonetheless, it remains unclear whether a loss of chaperoning in snRNP assembly, considered as a “housekeeping” activity, is responsible for the selective neuromuscular phenotype in SMA. This review thus shines light on in vivo studies that point toward disturbances in snRNP assembly and the consequential transcriptome abnormalities as the primary drivers of the progressive neuromuscular degeneration underpinning the disease. Disruption of U1 snRNP or snRNP assembly factors other than SMN induces phenotypes that mirror aspects of SMN deficiency, and splicing defects, described in numerous SMA models, can lead to a DNA damage and stress response that compromises the survival of the motor system. Restoring the correct chaperoning of snRNP assembly is therefore predicted to enhance the benefit of SMA therapeutic modalities based on augmenting SMN expression.

Off-pathway assembly of fimbria subunits is prevented by chaperone CfaA of CFA/I fimbriae from enterotoxigenic E. coli.

Science.gov (United States)

Bao, Rui; Liu, Yang; Savarino, Stephen J; Xia, Di

2016-12-01

The assembly of the class 5 colonization factor antigen I (CFA/I) fimbriae of enterotoxigenic E. coli was proposed to proceed via the alternate chaperone-usher pathway. Here, we show that in the absence of the chaperone CfaA, CfaB, the major pilin subunit of CFA/I fimbriae, is able to spontaneously refold and polymerize into cyclic trimers. CfaA kinetically traps CfaB to form a metastable complex that can be stabilized by mutations. Crystal structure of the stabilized complex reveals distinctive interactions provided by CfaA to trap CfaB in an assembly competent state through donor-strand complementation (DSC) and cleft-mediated anchorage. Mutagenesis indicated that DSC controls the stability of the chaperone-subunit complex and the cleft-mediated anchorage of the subunit C-terminus additionally assist in subunit refolding. Surprisingly, over-stabilization of the chaperone-subunit complex led to delayed fimbria assembly, whereas destabilizing the complex resulted in no fimbriation. Thus, CfaA acts predominantly as a kinetic trap by stabilizing subunit to avoid its off-pathway self-polymerization that results in energetically favorable trimers and could serve as a driving force for CFA/I pilus assembly, representing an energetic landscape unique to class 5 fimbria assembly. Published 2016. This article is a U.S. Government work and is in the public domain in the USA. Molecular Microbiology published by John Wiley & Sons Ltd.

Hydroimidazolone modification of the conserved Arg12 in small heat shock proteins: studies on the structure and chaperone function using mutant mimics.

Directory of Open Access Journals (Sweden)

Ram H Nagaraj

Full Text Available Methylglyoxal (MGO is an α-dicarbonyl compound present ubiquitously in the human body. MGO reacts with arginine residues in proteins and forms adducts such as hydroimidazolone and argpyrimidine in vivo. Previously, we showed that MGO-mediated modification of αA-crystallin increased its chaperone function. We identified MGO-modified arginine residues in αA-crystallin and found that replacing such arginine residues with alanine residues mimicked the effects of MGO on the chaperone function. Arginine 12 (R12 is a conserved amino acid residue in Hsp27 as well as αA- and αB-crystallin. When treated with MGO at or near physiological concentrations (2-10 µM, R12 was modified to hydroimidazolone in all three small heat shock proteins. In this study, we determined the effect of arginine substitution with alanine at position 12 (R12A to mimic MGO modification on the structure and chaperone function of these proteins. Among the three proteins, the R12A mutation improved the chaperone function of only αA-crystallin. This enhancement in the chaperone function was accompanied by subtle changes in the tertiary structure, which increased the thermodynamic stability of αA-crystallin. This mutation induced the exposure of additional client protein binding sites on αA-crystallin. Altogether, our data suggest that MGO-modification of the conserved R12 in αA-crystallin to hydroimidazolone may play an important role in reducing protein aggregation in the lens during aging and cataract formation.

Structural and Biochemical Characterization of SrcA, a Multi-cargo Type III Secretion Chaperone in Salmonella Required for Pathogenic Association with a Host

Energy Technology Data Exchange (ETDEWEB)

Cooper, C.; Zhang, K; Andres, S; Fnag, Y; Kaniuk, N; Hannemann, M; Brumell, J; Foster, L; Junop, M; Coombes, B

2010-01-01

Many Gram-negative bacteria colonize and exploit host niches using a protein apparatus called a type III secretion system (T3SS) that translocates bacterial effector proteins into host cells where their functions are essential for pathogenesis. A suite of T3SS-associated chaperone proteins bind cargo in the bacterial cytosol, establishing protein interaction networks needed for effector translocation into host cells. In Salmonella enterica serovar Typhimurium, a T3SS encoded in a large genomic island (SPI-2) is required for intracellular infection, but the chaperone complement required for effector translocation by this system is not known. Using a reverse genetics approach, we identified a multi-cargo secretion chaperone that is functionally integrated with the SPI-2-encoded T3SS and required for systemic infection in mice. Crystallographic analysis of SrcA at a resolution of 2.5 {angstrom} revealed a dimer similar to the CesT chaperone from enteropathogenic E. coli but lacking a 17-amino acid extension at the carboxyl terminus. Further biochemical and quantitative proteomics data revealed three protein interactions with SrcA, including two effector cargos (SseL and PipB2) and the type III-associated ATPase, SsaN, that increases the efficiency of effector translocation. Using competitive infections in mice we show that SrcA increases bacterial fitness during host infection, highlighting the in vivo importance of effector chaperones for the SPI-2 T3SS.

Structural and biochemical characterization of SrcA, a multi-cargo type III secretion chaperone in Salmonella required for pathogenic association with a host.

Directory of Open Access Journals (Sweden)

Colin A Cooper

2010-02-01

Full Text Available Many Gram-negative bacteria colonize and exploit host niches using a protein apparatus called a type III secretion system (T3SS that translocates bacterial effector proteins into host cells where their functions are essential for pathogenesis. A suite of T3SS-associated chaperone proteins bind cargo in the bacterial cytosol, establishing protein interaction networks needed for effector translocation into host cells. In Salmonella enterica serovar Typhimurium, a T3SS encoded in a large genomic island (SPI-2 is required for intracellular infection, but the chaperone complement required for effector translocation by this system is not known. Using a reverse genetics approach, we identified a multi-cargo secretion chaperone that is functionally integrated with the SPI-2-encoded T3SS and required for systemic infection in mice. Crystallographic analysis of SrcA at a resolution of 2.5 A revealed a dimer similar to the CesT chaperone from enteropathogenic E. coli but lacking a 17-amino acid extension at the carboxyl terminus. Further biochemical and quantitative proteomics data revealed three protein interactions with SrcA, including two effector cargos (SseL and PipB2 and the type III-associated ATPase, SsaN, that increases the efficiency of effector translocation. Using competitive infections in mice we show that SrcA increases bacterial fitness during host infection, highlighting the in vivo importance of effector chaperones for the SPI-2 T3SS.

Roles of intramolecular and intermolecular interactions in functional regulation of the Hsp70 J-protein co-chaperone Sis1.

Science.gov (United States)

Yu, Hyun Young; Ziegelhoffer, Thomas; Osipiuk, Jerzy; Ciesielski, Szymon J; Baranowski, Maciej; Zhou, Min; Joachimiak, Andrzej; Craig, Elizabeth A

2015-04-10

Unlike other Hsp70 molecular chaperones, those of the eukaryotic cytosol have four residues, EEVD, at their C-termini. EEVD(Hsp70) binds adaptor proteins of the Hsp90 chaperone system and mitochondrial membrane preprotein receptors, thereby facilitating processing of Hsp70-bound clients through protein folding and translocation pathways. Among J-protein co-chaperones functioning in these pathways, Sis1 is unique, as it also binds the EEVD(Hsp70) motif. However, little is known about the role of the Sis1:EEVD(Hsp70) interaction. We found that deletion of EEVD(Hsp70) abolished the ability of Sis1, but not the ubiquitous J-protein Ydj1, to partner with Hsp70 in in vitro protein refolding. Sis1 co-chaperone activity with Hsp70∆EEVD was restored upon substitution of a glutamic acid of the J-domain. Structural analysis revealed that this key glutamic acid, which is not present in Ydj1, forms a salt bridge with an arginine of the immediately adjacent glycine-rich region. Thus, restoration of Sis1 in vitro activity suggests that intramolecular interactions between the J-domain and glycine-rich region control co-chaperone activity, which is optimal only when Sis1 interacts with the EEVD(Hsp70) motif. However, we found that disruption of the Sis1:EEVD(Hsp70) interaction enhances the ability of Sis1 to substitute for Ydj1 in vivo. Our results are consistent with the idea that interaction of Sis1 with EEVD(Hsp70) minimizes transfer of Sis1-bound clients to Hsp70s that are primed for client transfer to folding and translocation pathways by their preassociation with EEVD binding adaptor proteins. These interactions may be one means by which cells triage Ydj1- and Sis1-bound clients to productive and quality control pathways, respectively. Copyright © 2015 Elsevier Ltd. All rights reserved.

Analysis of Hydraulic Flood Control Structure at Putat Boro River

OpenAIRE

Ruzziyatno, Ruhban

2015-01-01

Putat Boro River is one of the main drainage systems of Surakarta city which drains into Bengawan Solo river. The primary problem when flood occur is the higher water level of Bengawan Solo than Boro River and then backwater occur and inundates Putat Boro River. The objective of the study is to obtain operational method of Putat Boro River floodgate to control both inflows and outflows not only during flood but also normal condition. It also aims to know the Putat Boro rivers floodgate op...

Loss-of-function mutations in co-chaperone BAG3 destabilize small HSPs and cause cardiomyopathy.

Science.gov (United States)

Fang, Xi; Bogomolovas, Julius; Wu, Tongbin; Zhang, Wei; Liu, Canzhao; Veevers, Jennifer; Stroud, Matthew J; Zhang, Zhiyuan; Ma, Xiaolong; Mu, Yongxin; Lao, Dieu-Hung; Dalton, Nancy D; Gu, Yusu; Wang, Celine; Wang, Michael; Liang, Yan; Lange, Stephan; Ouyang, Kunfu; Peterson, Kirk L; Evans, Sylvia M; Chen, Ju

2017-08-01

Defective protein quality control (PQC) systems are implicated in multiple diseases. Molecular chaperones and co-chaperones play a central role in functioning PQC. Constant mechanical and metabolic stress in cardiomyocytes places great demand on the PQC system. Mutation and downregulation of the co-chaperone protein BCL-2-associated athanogene 3 (BAG3) are associated with cardiac myopathy and heart failure, and a BAG3 E455K mutation leads to dilated cardiomyopathy (DCM). However, the role of BAG3 in the heart and the mechanisms by which the E455K mutation leads to DCM remain obscure. Here, we found that cardiac-specific Bag3-KO and E455K-knockin mice developed DCM. Comparable phenotypes in the 2 mutants demonstrated that the E455K mutation resulted in loss of function. Further experiments revealed that the E455K mutation disrupted the interaction between BAG3 and HSP70. In both mutants, decreased levels of small heat shock proteins (sHSPs) were observed, and a subset of proteins required for cardiomyocyte function was enriched in the insoluble fraction. Together, these observations suggest that interaction between BAG3 and HSP70 is essential for BAG3 to stabilize sHSPs and maintain cardiomyocyte protein homeostasis. Our results provide insight into heart failure caused by defects in BAG3 pathways and suggest that increasing BAG3 protein levels may be of therapeutic benefit in heart failure.

The heat shock protein-90 co-chaperone, Cyclophilin 40, promotes ALK-positive, anaplastic large cell lymphoma viability and its expression is regulated by the NPM-ALK oncoprotein

International Nuclear Information System (INIS)

Pearson, Joel D; Mohammed, Zubair; Bacani, Julinor T C; Lai, Raymond; Ingham, Robert J

2012-01-01

Anaplastic lymphoma kinase-positive, anaplastic large cell lymphoma (ALK+ ALCL) is a T cell lymphoma defined by the presence of chromosomal translocations involving the ALK tyrosine kinase gene. These translocations generate fusion proteins (e.g. NPM-ALK) with constitutive tyrosine kinase activity, which activate numerous signalling pathways important for ALK+ ALCL pathogenesis. The molecular chaperone heat shock protein-90 (Hsp90) plays a critical role in allowing NPM-ALK and other signalling proteins to function in this lymphoma. Co-chaperone proteins are important for helping Hsp90 fold proteins and for directing Hsp90 to specific clients; however the importance of co-chaperone proteins in ALK+ ALCL has not been investigated. Our preliminary findings suggested that expression of the immunophilin co-chaperone, Cyclophilin 40 (Cyp40), is up-regulated in ALK+ ALCL by JunB, a transcription factor activated by NPM-ALK signalling. In this study we examined the regulation of the immunophilin family of co-chaperones by NPM-ALK and JunB, and investigated whether the immunophilin co-chaperones promote the viability of ALK+ ALCL cell lines. NPM-ALK and JunB were knocked-down in ALK+ ALCL cell lines with siRNA, and the effect on the expression of the three immunophilin co-chaperones: Cyp40, FK506-binding protein (FKBP) 51, and FKBP52 examined. Furthermore, the effect of knock-down of the immunophilin co-chaperones, either individually or in combination, on the viability of ALK+ ALCL cell lines and NPM-ALK levels and activity was also examined. We found that NPM-ALK promoted the transcription of Cyp40 and FKBP52, but only Cyp40 transcription was promoted by JunB. We also observed reduced viability of ALK+ ALCL cell lines treated with Cyp40 siRNA, but not with siRNAs directed against FKBP52 or FKBP51. Finally, we demonstrate that the decrease in the viability of ALK+ ALCL cell lines treated with Cyp40 siRNA does not appear to be due to a decrease in NPM-ALK levels or the

Distinct Prion Domain Sequences Ensure Efficient Amyloid Propagation by Promoting Chaperone Binding or Processing In Vivo.

Directory of Open Access Journals (Sweden)

Christine R Langlois

2016-11-01

Full Text Available Prions are a group of proteins that can adopt a spectrum of metastable conformations in vivo. These alternative states change protein function and are self-replicating and transmissible, creating protein-based elements of inheritance and infectivity. Prion conformational flexibility is encoded in the amino acid composition and sequence of the protein, which dictate its ability not only to form an ordered aggregate known as amyloid but also to maintain and transmit this structure in vivo. But, while we can effectively predict amyloid propensity in vitro, the mechanism by which sequence elements promote prion propagation in vivo remains unclear. In yeast, propagation of the [PSI+] prion, the amyloid form of the Sup35 protein, has been linked to an oligopeptide repeat region of the protein. Here, we demonstrate that this region is composed of separable functional elements, the repeats themselves and a repeat proximal region, which are both required for efficient prion propagation. Changes in the numbers of these elements do not alter the physical properties of Sup35 amyloid, but their presence promotes amyloid fragmentation, and therefore maintenance, by molecular chaperones. Rather than acting redundantly, our observations suggest that these sequence elements make complementary contributions to prion propagation, with the repeat proximal region promoting chaperone binding to and the repeats promoting chaperone processing of Sup35 amyloid.

The histone chaperone ASF1 is essential for sexual development in the filamentous fungus Sordaria macrospora.

Science.gov (United States)

Gesing, Stefan; Schindler, Daniel; Fränzel, Benjamin; Wolters, Dirk; Nowrousian, Minou

2012-05-01

Ascomycetes develop four major types of fruiting bodies that share a common ancestor, and a set of common core genes most likely controls this process. One way to identify such genes is to search for conserved expression patterns. We analysed microarray data of Fusarium graminearum and Sordaria macrospora, identifying 78 genes with similar expression patterns during fruiting body development. One of these genes was asf1 (anti-silencing function 1), encoding a predicted histone chaperone. asf1 expression is also upregulated during development in the distantly related ascomycete Pyronema confluens. To test whether asf1 plays a role in fungal development, we generated an S. macrospora asf1 deletion mutant. The mutant is sterile and can be complemented to fertility by transformation with the wild-type asf1 and its P. confluens homologue. An ASF1-EGFP fusion protein localizes to the nucleus. By tandem-affinity purification/mass spectrometry as well as yeast two-hybrid analysis, we identified histones H3 and H4 as ASF1 interaction partners. Several developmental genes are dependent on asf1 for correct transcriptional expression. Deletion of the histone chaperone genes rtt106 and cac2 did not cause any developmental phenotypes. These data indicate that asf1 of S. macrospora encodes a conserved histone chaperone that is required for fruiting body development. © 2012 Blackwell Publishing Ltd.

Twenty putative palmitoyl-acyl transferase genes with distinct ...

African Journals Online (AJOL)

There are 20 genes containing DHHC domain predicted to encode putative palmitoyltransferase in Arabidopsis thaliana genome. However, little is known about their characteristics such as genetic relationship and expression profile. Here, we present an overview of the putative PAT genes in A. thaliana focusing on their ...

Ssb1 chaperone is a [PSI+] prion-curing factor.

Science.gov (United States)

Chacinska, A; Szczesniak, B; Kochneva-Pervukhova, N V; Kushnirov, V V; Ter-Avanesyan, M D; Boguta, M

2001-04-01

Yeast SUP7' or SUP11 nonsense suppressors have no phenotypic expression in strains deficient in the isopentenylation of A37 in tRNA. Here we show that such strains spontaneously produce cells with a nonsense suppressor phenotype which is related to the cytoplasmically inherited determinant and manifests all the key features of the [PSI+] prion. A screen of a multicopy yeast genomic library for genes that inactivate the [PSI+]-related suppressor phenotype resulted in the isolation of the SSB1 gene. Moreover, we demonstrate that multicopy plasmid encoding the Ssb1 chaperone cures cells of the [PSI+] prion.

Choline Kinase Alpha as an Androgen Receptor Chaperone and Prostate Cancer Therapeutic Target

Science.gov (United States)

Asim, Mohammad; Massie, Charles E.; Orafidiya, Folake; Pértega-Gomes, Nelma; Warren, Anne Y.; Esmaeili, Mohsen; Selth, Luke A.; Zecchini, Heather I.; Luko, Katarina; Qureshi, Arham; Baridi, Ajoeb; Menon, Suraj; Madhu, Basetti; Escriu, Carlos; Lyons, Scott; Vowler, Sarah L.; Zecchini, Vincent R.; Shaw, Greg; Hessenkemper, Wiebke; Russell, Roslin; Mohammed, Hisham; Stefanos, Niki; Lynch, Andy G.; Grigorenko, Elena; D’Santos, Clive; Taylor, Chris; Lamb, Alastair; Sriranjan, Rouchelle; Yang, Jiali; Stark, Rory; Dehm, Scott M.; Rennie, Paul S.; Carroll, Jason S.; Griffiths, John R.; Tavaré, Simon; Mills, Ian G.; McEwan, Iain J.; Baniahmad, Aria; Tilley, Wayne D.; Neal, David E.

2016-01-01

Background: The androgen receptor (AR) is a major drug target in prostate cancer (PCa). We profiled the AR-regulated kinome to identify clinically relevant and druggable effectors of AR signaling. Methods: Using genome-wide approaches, we interrogated all AR regulated kinases. Among these, choline kinase alpha (CHKA) expression was evaluated in benign (n = 195), prostatic intraepithelial neoplasia (PIN) (n = 153) and prostate cancer (PCa) lesions (n = 359). We interrogated how CHKA regulates AR signaling using biochemical assays and investigated androgen regulation of CHKA expression in men with PCa, both untreated (n = 20) and treated with an androgen biosynthesis inhibitor degarelix (n = 27). We studied the effect of CHKA inhibition on the PCa transcriptome using RNA sequencing and tested the effect of CHKA inhibition on cell growth, clonogenic survival and invasion. Tumor xenografts (n = 6 per group) were generated in mice using genetically engineered prostate cancer cells with inducible CHKA knockdown. Data were analyzed with χ2 tests, Cox regression analysis, and Kaplan-Meier methods. All statistical tests were two-sided. Results: CHKA expression was shown to be androgen regulated in cell lines, xenografts, and human tissue (log fold change from 6.75 to 6.59, P = .002) and was positively associated with tumor stage. CHKA binds directly to the ligand-binding domain (LBD) of AR, enhancing its stability. As such, CHKA is the first kinase identified as an AR chaperone. Inhibition of CHKA repressed the AR transcriptional program including pathways enriched for regulation of protein folding, decreased AR protein levels, and inhibited the growth of PCa cell lines, human PCa explants, and tumor xenografts. Conclusions: CHKA can act as an AR chaperone, providing, to our knowledge, the first evidence for kinases as molecular chaperones, making CHKA both a marker of tumor progression and a potential therapeutic target for PCa. PMID:26657335

Role of the HSPA9/HSC20 chaperone pair in promoting directional human iron-sulfur cluster exchange involving monothiol glutaredoxin 5.

Science.gov (United States)

Olive, Joshua A; Cowan, J A

2018-07-01

Iron‑sulfur clusters are essential cofactors found across all domains of life. Their assembly and transfer are accomplished by highly conserved protein complexes and partners. In eukaryotes a [2Fe-2S] cluster is first assembled in the mitochondria on the iron‑sulfur cluster scaffold protein ISCU in tandem with iron, sulfide, and electron donors. Current models suggest that a chaperone pair interacts with a cluster-bound ISCU to facilitate cluster transfer to a monothiol glutaredoxin. In humans this protein is glutaredoxin 5 (GLRX5) and the cluster can then be exchanged with a variety of target apo proteins. By use of circular dichroism spectroscopy, the kinetics of cluster exchange reactivity has been evaluated for human GLRX5 with a variety of cluster donor and acceptor partners, and the role of chaperones determined for several of these. In contrast to the prokaryotic model, where heat-shock type chaperone proteins HscA and HscB are required for successful and efficient transfer of a [2Fe-2S] cluster from the ISCU scaffold to a monothiol glutaredoxin. However, in the human system the chaperone homologs, HSPA9 and HSC20, are not necessary for human ISCU to promote cluster transfer to GLRX5, and appear to promote the reverse transfer. Cluster exchange with the human iron‑sulfur cluster carrier protein NFU1 and ferredoxins (FDX's), and the role of chaperones, has also been evaluated, demonstrating in certain cases control over the directionality of cluster transfer. In contrast to other prokaryotic and eukaryotic organisms, NFU1 is identified as a more likely physiological donor of [2Fe-2S] cluster to human GLRX5 than ISCU. Copyright © 2018 Elsevier Inc. All rights reserved.

Lactic acid induces aberrant amyloid precursor protein processing by promoting its interaction with endoplasmic reticulum chaperone proteins.

Directory of Open Access Journals (Sweden)

Yiwen Xiang

Full Text Available BACKGROUND: Lactic acid, a natural by-product of glycolysis, is produced at excess levels in response to impaired mitochondrial function, high-energy demand, and low oxygen availability. The enzyme involved in the production of β-amyloid peptide (Aβ of Alzheimer's disease, BACE1, functions optimally at lower pH, which led us to investigate a potential role of lactic acid in the processing of amyloid precursor protein (APP. METHODOLOGY/PRINCIPAL FINDINGS: Lactic acid increased levels of Aβ40 and 42, as measured by ELISA, in culture medium of human neuroblastoma cells (SH-SY5Y, whereas it decreased APP metabolites, such as sAPPα. In cell lysates, APP levels were increased and APP was found to interact with ER-chaperones in a perinuclear region, as determined by co-immunoprecipitation and fluorescence microscopy studies. Lactic acid had only a very modest effect on cellular pH, did increase the levels of ER chaperones Grp78 and Grp94 and led to APP aggregate formation reminiscent of aggresomes. CONCLUSIONS/SIGNIFICANCE: These findings suggest that sustained elevations in lactic acid levels could be a risk factor in amyloidogenesis related to Alzheimer's disease through enhanced APP interaction with ER chaperone proteins and aberrant APP processing leading to increased generation of amyloid peptides and APP aggregates.

Promiscuous histone mis-assembly is actively prevented by chaperones | Center for Cancer Research

Science.gov (United States)

About the Cover Chaperone HJURP drives the proper loading of protein CENP-A to the centromere of a chromosome. The effect of HJURP on CENP-A's structural dynamics are observed and explained using dual-resolution in silico simulations, while in vivo experiments demonstrate how CENP-A mutations influence its specific localization in human cells. Abstract

Pharmacological chaperone reshapes the energy landscape for folding and aggregation of the prion protein

Science.gov (United States)

Gupta, Amar Nath; Neupane, Krishna; Rezajooei, Negar; Cortez, Leonardo M.; Sim, Valerie L.; Woodside, Michael T.

2016-06-01

The development of small-molecule pharmacological chaperones as therapeutics for protein misfolding diseases has proven challenging, partly because their mechanism of action remains unclear. Here we study Fe-TMPyP, a tetrapyrrole that binds to the prion protein PrP and inhibits misfolding, examining its effects on PrP folding at the single-molecule level with force spectroscopy. Single PrP molecules are unfolded with and without Fe-TMPyP present using optical tweezers. Ligand binding to the native structure increases the unfolding force significantly and alters the transition state for unfolding, making it more brittle and raising the barrier height. Fe-TMPyP also binds the unfolded state, delaying native refolding. Furthermore, Fe-TMPyP binding blocks the formation of a stable misfolded dimer by interfering with intermolecular interactions, acting in a similar manner to some molecular chaperones. The ligand thus promotes native folding by stabilizing the native state while also suppressing interactions driving aggregation.

Fluorinated Chaperone-β-Cyclodextrin Formulations for β-Glucocerebrosidase Activity Enhancement in Neuronopathic Gaucher Disease.

Science.gov (United States)

García-Moreno, M Isabel; de la Mata, Mario; Sánchez-Fernández, Elena M; Benito, Juan M; Díaz-Quintana, Antonio; Fustero, Santos; Nanba, Eiji; Higaki, Katsumi; Sánchez-Alcázar, José A; García Fernández, José M; Ortiz Mellet, Carmen

2017-03-09

Amphiphilic glycomimetics encompassing a rigid, undistortable nortropane skeleton based on 1,6-anhydro-l-idonojirimycin and a polyfluorinated antenna, when formulated as the corresponding inclusion complexes with β-cyclodextrin (βCD), have been shown to behave as pharmacological chaperones (PCs) that efficiently rescue lysosomal β-glucocerebrosidase mutants associated with the neuronopathic variants of Gaucher disease (GD), including the highly refractory L444P/L444P and L444P/P415R single nucleotide polymorphs, in patient fibroblasts. The body of work here presented includes the design criteria for the PC prototype, the synthesis of a series of candidates, the characterization of the PC:βCD complexes, the determination of the selectivity profiles toward a panel of commercial and human lysosomal glycosidases, the evaluation of the chaperoning activity in type 1 (non-neuronopathic), type 2 (acute neuronopathic), and type 3 (adult neuronopathic) GD fibroblasts, the confirmation of the rescuing mechanism by immunolabeling, and the analysis of the PC:GCase binding mode by docking experiments.

The Role of System-Specific Molecular Chaperones in the Maturation of Molybdoenzymes in Bacteria

Directory of Open Access Journals (Sweden)

Meina Neumann

2011-01-01

Full Text Available Biogenesis of prokaryotic molybdoenzymes is a complex process with the final step representing the insertion of a matured molybdenum cofactor (Moco into a folded apoenzyme. Usually, specific chaperones of the XdhC family are required for the maturation of molybdoenzymes of the xanthine oxidase family in bacteria. Enzymes of the xanthine oxidase family are characterized to contain an equatorial sulfur ligand at the molybdenum center of Moco. This sulfur ligand is inserted into Moco while bound to the XdhC-like protein and before its insertion into the target enzyme. In addition, enzymes of the xanthine oxidase family bind either the molybdopterin (Mo-MPT form of Moco or the modified molybdopterin cytosine dinucleotide cofactor (MCD. In both cases, only the matured cofactor is inserted by a proofreading process of XdhC. The roles of these specific XdhC-like chaperones during the biogenesis of enzymes of the xanthine oxidase family in bacteria are described.

Sp1-mediated transcription regulation of TAF-Ialpha gene encoding a histone chaperone.

Science.gov (United States)

Asaka, Masamitsu N; Murano, Kensaku; Nagata, Kyosuke

2008-11-28

TAF-I, one of histone chaperones, consists of two subtypes, TAF-Ialpha and TAF-Ibeta. The histone chaperone activity of TAF-I is regulated by dimer patterns of these subtypes. TAF-Ibeta is expressed ubiquitously, while the expression level of TAF-Ialpha with less activity than TAF-Ibeta differs among cell types. It is, therefore, assumed that the expression level of TAF-Ialpha in a cell is important for the TAF-I activity level. Here, we found that TAF-Ialpha and TAF-Ibeta genes are under the control of distinct promoters. Reporter assays and gel shift assays demonstrated that Sp1 binds to three regions in the TAF-Ialpha promoter and two or all mutaions of the three Sp1 binding regions reduced the TAF-Ialpha promoter activity. ChIP assays demonstrated that Sp1 binds to the TAF-Ialpha promoter in vivo. Furthermore, the expression level of TAF-Ialpha mRNA was reduced by knockdown of Sp1 using siRNA method. These studies indicated that the TAF-Ialpha promoter is under the control of Sp1.

Human cytoplasmic copper chaperones Atox1 and CCS exchange copper ions in vitro.

Science.gov (United States)

Petzoldt, Svenja; Kahra, Dana; Kovermann, Michael; Dingeldein, Artur P G; Niemiec, Moritz S; Ådén, Jörgen; Wittung-Stafshede, Pernilla

2015-06-01

After Ctr1-mediated copper ion (Cu) entry into the human cytoplasm, chaperones Atox1 and CCS deliver Cu to P1B-type ATPases and to superoxide dismutase, respectively, via direct protein-protein interactions. Although the two Cu chaperones are presumed to work along independent pathways, we here assessed cross-reactivity between Atox1 and the first domain of CCS (CCS1) using biochemical and biophysical methods in vitro. By NMR we show that CCS1 is monomeric although it elutes differently from Atox1 in size exclusion chromatography (SEC). This property allows separation of Atox1 and CCS1 by SEC and, combined with the 254/280 nm ratio as an indicator of Cu loading, we demonstrate that Cu can be transferred from one protein to the other. Cu exchange also occurs with full-length CCS and, as expected, the interaction involves the metal binding sites since mutation of Cu-binding cysteine in Atox1 eliminates Cu transfer from CCS1. Cross-reactivity between CCS and Atox1 may aid in regulation of Cu distribution in the cytoplasm.

Molecular chaperone complexes with antagonizing activities regulate stability and activity of the tumor suppressor LKB1.

Science.gov (United States)

Gaude, H; Aznar, N; Delay, A; Bres, A; Buchet-Poyau, K; Caillat, C; Vigouroux, A; Rogon, C; Woods, A; Vanacker, J-M; Höhfeld, J; Perret, C; Meyer, P; Billaud, M; Forcet, C

2012-03-22

LKB1 is a tumor suppressor that is constitutionally mutated in a cancer-prone condition, called Peutz-Jeghers syndrome, as well as somatically inactivated in a sizeable fraction of lung and cervical neoplasms. The LKB1 gene encodes a serine/threonine kinase that associates with the pseudokinase STRAD (STE-20-related pseudokinase) and the scaffolding protein MO25, the formation of this heterotrimeric complex promotes allosteric activation of LKB1. We have previously reported that the molecular chaperone heat shock protein 90 (Hsp90) binds to and stabilizes LKB1. Combining pharmacological studies and RNA interference approaches, we now provide evidence that the co-chaperone Cdc37 participates to the regulation of LKB1 stability. It is known that the Hsp90-Cdc37 complex recognizes a surface within the N-terminal catalytic lobe of client protein kinases. In agreement with this finding, we found that the chaperones Hsp90 and Cdc37 interact with an LKB1 isoform that differs in the C-terminal region, but not with a novel LKB1 variant that lacks a portion of the kinase N-terminal lobe domain. Reconstitution of the two complexes LKB1-STRAD and LKB1-Hsp90-Cdc37 with recombinant proteins revealed that the former is catalytically active whereas the latter is inactive. Furthermore, consistent with a documented repressor function of Hsp90, LKB1 kinase activity was transiently stimulated upon dissociation of Hsp90. Finally, disruption of the LKB1-Hsp90 complex favors the recruitment of both Hsp/Hsc70 and the U-box dependent E3 ubiquitin ligase CHIP (carboxyl terminus of Hsc70-interacting protein) that triggers LKB1 degradation. Taken together, our results establish that the Hsp90-Cdc37 complex controls both the stability and activity of the LKB1 kinase. This study further shows that two chaperone complexes with antagonizing activities, Hsp90-Cdc37 and Hsp/Hsc70-CHIP, finely control the cellular level of LKB1 protein.

BtcA, A class IA type III chaperone, interacts with the BteA N-terminal domain through a globular/non-globular mechanism.

Directory of Open Access Journals (Sweden)

Chen Guttman

Full Text Available Bordetella pertussis, the etiological agent of "whooping cough" disease, utilizes the type III secretion system (T3SS to deliver a 69 kDa cytotoxic effector protein, BteA, directly into the host cells. As with other T3SS effectors, prior to its secretion BteA binds BtcA, a 13.9 kDa protein predicted to act as a T3SS class IA chaperone. While this interaction had been characterized for such effector-chaperone pairs in other pathogens, it has yet to be fully investigated in Bordetella. Here we provide the first biochemical proof that BtcA is indeed a class IA chaperone, responsible for the binding of BteA's N-terminal domain. We bring forth extensive evidence that BtcA binds its substrate effector through a dual-interface binding mechanism comprising of non-globular and bi-globular interactions at a moderate micromolar level binding affinity. We demonstrate that the non-globular interactions involve the first 31 N-terminal residues of BteA287 and their removal leads to destabilization of the effector-chaperone complex and lower binding affinities to BtcA. These findings represent an important first step towards a molecular understanding of BteA secretion and cell entry.

Chaperone-usher fimbriae in a diverse selection of Gallibacterium genomes

DEFF Research Database (Denmark)

Kudirkiene, Egle; Bager, Ragnhild Jørgensen; Johnson, Timothy J.

2014-01-01

Background Fimbriae are bacterial cell surface organelles involved in the pathogenesis of many bacterial species, including Gallibacterium anatis, in which a F17-like fimbriae of the chaperone-usher (CU) family was recently shown to be an important virulence factor and vaccine candidate. To reveal...... that their expression may require other in vitro or in vivo conditions. Conclusions This is the first approach establishing a systematic fimbria classification system within Gallibacterium spp., which indicates a species-wide distribution of γ4 CU fimbriae among a diverse collection of Gallibacterium isolates...

Low-power millimeter wave radiations do not alter stress-sensitive gene expression of chaperone proteins.

Science.gov (United States)

Zhadobov, M; Sauleau, R; Le Coq, L; Debure, L; Thouroude, D; Michel, D; Le Dréan, Y

2007-04-01

This article reports experimental results on the influence of low-power millimeter wave (MMW) radiation at 60 GHz on a set of stress-sensitive gene expression of molecular chaperones, namely clusterin (CLU) and HSP70, in a human brain cell line. Selection of the exposure frequency is determined by its near-future applications for the new broadband civil wireless communication systems including wireless local area networks (WLAN) for domestic and professional uses. Frequencies around 60 GHz are strongly attenuated in the earth's atmosphere and such radiations represent a new environmental factor. An exposure system operating in V-band (50-75 GHz) was developed for cell exposure. U-251 MG glial cell line was sham-exposed or exposed to MMW radiation for different durations (1-33 h) and two different power densities (5.4 microW/cm(2) or 0.54 mW/cm(2)). As gene expression is a multiple-step process, we analyzed chaperone proteins induction at different levels. First, using luciferase reporter gene, we investigated potential effect of MMWs on the activation of transcription factors (TFs) and gene promoter activity. Next, using RT-PCR and Western blot assays, we verified whether MMW exposure could alter RNA accumulation, translation, or protein stability. Experimental data demonstrated the absence of significant modifications in gene transcription, mRNA, and protein amount for the considered stress-sensitive genes for the exposure durations and power densities investigated. The main results of this study suggest that low-power 60 GHz radiation does not modify stress-sensitive gene expression of chaperone proteins. (c) 2006 Wiley-Liss, Inc.

A S52P mutation in the 'α-crystallin domain' of Mycobacterium leprae HSP18 reduces its oligomeric size and chaperone function.

Science.gov (United States)

Nandi, Sandip K; Rehna, Elengikal A A; Panda, Alok K; Shiburaj, Sugathan; Dharmalingam, Kuppamuthu; Biswas, Ashis

2013-12-01

Mycobacterium leprae HSP18 is a small heat shock protein (sHSP). It is a major immunodominant antigen of M. leprae pathogen. Previously, we have reported the existence of two M. leprae HSP18 variants in various leprotic patients. One of the variants has serine at position 52, whereas the other one has proline at the same position. We have also reported that HSP18 having proline at position 52 (HSP18P(52)) is a nonameric protein and exhibits chaperone function. However, the structural and functional characterization of wild-type HSP18 having serine at position 52 (HSP18S(52)) is yet to be explored. Furthermore, the implications of the S52P mutation on the structure and chaperone function of HSP18 are not well understood. Therefore, we cloned and purified these two HSP18 variants. We found that HSP18S(52) is also a molecular chaperone and an oligomeric protein. Intrinsic tryptophan fluorescence and far-UV CD measurements revealed that the S52P mutation altered the tertiary and secondary structure of HSP18. This point mutation also reduced the oligomeric assembly and decreased the surface hydrophobicity of HSP18, as revealed by HPLC and 4,4'-dianilino-1,1'-binaphthyl-5,5'-disulfonic acid binding studies, respectively. Mutant protein was less stable against thermal and chemical denaturation and was more susceptible towards tryptic cleavage than wild-type HSP18. HSP18P(52) had lower chaperone function and was less effective in protecting thermal killing of Escherichia coli than HSP18S(52). Taken together, our data suggest that serine 52 is important for the larger oligomerization and chaperone function of HSP18. Because both variants differ in stability and function, they may have different roles in the survival of M. leprae in infected hosts. © 2013 FEBS.

The function of the yeast molecular chaperone Sse1 is mechanistically distinct from the closely related hsp70 family.

Science.gov (United States)

Shaner, Lance; Trott, Amy; Goeckeler, Jennifer L; Brodsky, Jeffrey L; Morano, Kevin A

2004-05-21

The Sse1/Hsp110 molecular chaperones are a poorly understood subgroup of the Hsp70 chaperone family. Hsp70 can refold denatured polypeptides via a C-terminal peptide binding domain (PBD), which is regulated by nucleotide cycling in an N-terminal ATPase domain. However, unlike Hsp70, both Sse1 and mammalian Hsp110 bind unfolded peptide substrates but cannot refold them. To test the in vivo requirement for interdomain communication, SSE1 alleles carrying amino acid substitutions in the ATPase domain were assayed for their ability to complement sse1Delta yeast. Surprisingly, all mutants predicted to abolish ATP hydrolysis (D8N, K69Q, D174N, D203N) complemented the temperature sensitivity of sse1Delta and lethality of sse1Deltasse2Delta cells, whereas mutations in predicted ATP binding residues (G205D, G233D) were non-functional. Complementation ability correlated well with ATP binding assessed in vitro. The extreme C terminus of the Hsp70 family is required for substrate targeting and heterocomplex formation with other chaperones, but mutant Sse1 proteins with a truncation of up to 44 C-terminal residues that were not included in the PBD were active. Remarkably, the two domains of Sse1, when expressed in trans, functionally complement the sse1Delta growth phenotype and interact by coimmunoprecipitation analysis. In addition, a functional PBD was required to stabilize the Sse1 ATPase domain, and stabilization also occurred in trans. These data represent the first structure-function analysis of this abundant but ill defined chaperone, and establish several novel aspects of Sse1/Hsp110 function relative to Hsp70.

Sylvie Chaperon, Les origines de la sexologie (1850-1900)

OpenAIRE

Anne-Claire Rebreyend

2008-01-01

Le mot sexologie apparaît seulement au début des années 1910 en France. Mais dès la seconde moitié du XIXe siècle s’affirme un nouveau savoir médical sur la sexualité, une protosexologie dont Sylvie Chaperon retrace l’histoire par le biais de sources médicales et policières, de romans érotiques, de mémoires. « Premier panorama synthétique » (p. 11) d’une histoire de la sexologie encore lacunaire en France, Les origines de la sexologie pointe la lente émergence d’une nouvelle discipline sur la...

Sylvie Chaperon, Les origines de la sexologie (1850-1900

Directory of Open Access Journals (Sweden)

Anne-Claire Rebreyend

2008-07-01

Full Text Available Le mot sexologie apparaît seulement au début des années 1910 en France. Mais dès la seconde moitié du XIXe siècle s’affirme un nouveau savoir médical sur la sexualité, une protosexologie dont Sylvie Chaperon retrace l’histoire par le biais de sources médicales et policières, de romans érotiques, de mémoires. « Premier panorama synthétique » (p. 11 d’une histoire de la sexologie encore lacunaire en France, Les origines de la sexologie pointe la lente émergence d’une nouvelle discipline sur la...

Purification, crystallization and preliminary X-ray diffraction analysis of the Escherichia coli common pilus chaperone EcpB

Energy Technology Data Exchange (ETDEWEB)

Garnett, James A.; Diallo, Mamou; Matthews, Steve J., E-mail: s.j.matthews@imperial.ac.uk [Imperial College London, South Kensington, London SW7 2AZ (United Kingdom)

2015-05-20

In Escherichia coli, the common pilus (Ecp) belongs to an alternative chaperone–usher pathway that plays a major role in both early biofilm formation and host-cell adhesion. Initial attempts at crystallizing the chaperone EcpB using natively purified protein from the bacterial periplasm were not successful; however, after the isolation of EcpB under denaturing conditions and subsequent refolding, crystals were obtained at pH 8.0 using the sitting-drop method of vapour diffusion. This is the first time that this refolding strategy has been used to purify CU chaperones. Pili are key cell-surface components that allow the attachment of bacteria to both biological and abiotic solid surfaces, whilst also mediating interactions between themselves. In Escherichia coli, the common pilus (Ecp) belongs to an alternative chaperone–usher (CU) pathway that plays a major role in both early biofilm formation and host-cell adhesion. The chaperone EcpB is involved in the biogenesis of the filament, which is composed of EcpA and EcpD. Initial attempts at crystallizing EcpB using natively purified protein from the bacterial periplasm were not successful; however, after the isolation of EcpB under denaturing conditions and subsequent refolding, crystals were obtained at pH 8.0 using the sitting-drop method of vapour diffusion. Diffraction data have been processed to 2.4 Å resolution. These crystals belonged to the trigonal space group P3{sub 1}21 or P3{sub 2}21, with unit-cell parameters a = b = 62.65, c = 121.14 Å and one monomer in the asymmetric unit. Molecular replacement was unsuccessful, but selenomethionine-substituted protein and heavy-atom derivatives are being prepared for phasing. The three-dimensional structure of EcpB will provide invaluable information on the subtle mechanistic differences in biogenesis between the alternative and classical CU pathways. Furthermore, this is the first time that this refolding strategy has been used to purify CU chaperones, and it

Purification, crystallization and preliminary X-ray diffraction analysis of the Escherichia coli common pilus chaperone EcpB

International Nuclear Information System (INIS)

Garnett, James A.; Diallo, Mamou; Matthews, Steve J.

2015-01-01

In Escherichia coli, the common pilus (Ecp) belongs to an alternative chaperone–usher pathway that plays a major role in both early biofilm formation and host-cell adhesion. Initial attempts at crystallizing the chaperone EcpB using natively purified protein from the bacterial periplasm were not successful; however, after the isolation of EcpB under denaturing conditions and subsequent refolding, crystals were obtained at pH 8.0 using the sitting-drop method of vapour diffusion. This is the first time that this refolding strategy has been used to purify CU chaperones. Pili are key cell-surface components that allow the attachment of bacteria to both biological and abiotic solid surfaces, whilst also mediating interactions between themselves. In Escherichia coli, the common pilus (Ecp) belongs to an alternative chaperone–usher (CU) pathway that plays a major role in both early biofilm formation and host-cell adhesion. The chaperone EcpB is involved in the biogenesis of the filament, which is composed of EcpA and EcpD. Initial attempts at crystallizing EcpB using natively purified protein from the bacterial periplasm were not successful; however, after the isolation of EcpB under denaturing conditions and subsequent refolding, crystals were obtained at pH 8.0 using the sitting-drop method of vapour diffusion. Diffraction data have been processed to 2.4 Å resolution. These crystals belonged to the trigonal space group P3 1 21 or P3 2 21, with unit-cell parameters a = b = 62.65, c = 121.14 Å and one monomer in the asymmetric unit. Molecular replacement was unsuccessful, but selenomethionine-substituted protein and heavy-atom derivatives are being prepared for phasing. The three-dimensional structure of EcpB will provide invaluable information on the subtle mechanistic differences in biogenesis between the alternative and classical CU pathways. Furthermore, this is the first time that this refolding strategy has been used to purify CU chaperones, and it could be

Phosphorylation-mediated control of histone chaperone ASF1 levels by Tousled-like kinases.

Directory of Open Access Journals (Sweden)

Maxim Pilyugin

Full Text Available Histone chaperones are at the hub of a diverse interaction networks integrating a plethora of chromatin modifying activities. Histone H3/H4 chaperone ASF1 is a target for cell-cycle regulated Tousled-like kinases (TLKs and both proteins cooperate during chromatin replication. However, the precise role of post-translational modification of ASF1 remained unclear. Here, we identify the TLK phosphorylation sites for both Drosophila and human ASF1 proteins. Loss of TLK-mediated phosphorylation triggers hASF1a and dASF1 degradation by proteasome-dependent and independent mechanisms respectively. Consistent with this notion, introduction of phosphorylation-mimicking mutants inhibits hASF1a and dASF1 degradation. Human hASF1b is also targeted for proteasome-dependent degradation, but its stability is not affected by phosphorylation indicating that other mechanisms are likely to be involved in control of hASF1b levels. Together, these results suggest that ASF1 cellular levels are tightly controlled by distinct pathways and provide a molecular mechanism for post-translational regulation of dASF1 and hASF1a by TLK kinases.

Expression levels of chaperones influence biotransformation activity of recombinant Escherichia coli expressing Micrococcus luteus alcohol dehydrogenase and Pseudomonas putida Baeyer-Villiger monooxygenase.

Science.gov (United States)

Baek, A-Hyong; Jeon, Eun-Yeong; Lee, Sun-Mee; Park, Jin-Byung

2015-05-01

We demonstrated for the first time that the archaeal chaperones (i.e., γ-prefoldin and thermosome) can stabilize enzyme activity in vivo. Ricinoleic acid biotransformation activity of recombinant Escherichia coli expressing Micrococcus luteus alcohol dehydrogenase and the Pseudomonas putida KT2440 Baeyer-Villiger monooxygenase improved significantly with co-expression of γ-prefoldin or recombinant themosome originating from the deep-sea hyperthermophile archaea Methanocaldococcus jannaschii. Furthermore, the degree of enhanced activity was dependent on the expression levels of the chaperones. For example, whole-cell biotransformation activity was highest at 12 µmol/g dry cells/min when γ-prefoldin expression level was approximately 46% of the theoretical maximum. This value was approximately two-fold greater than that in E. coli, where the γ-prefoldin expression level was zero or set to the theoretical maximum. Therefore, it was assumed that the expression levels of chaperones must be optimized to achieve maximum biotransformation activity in whole-cell biocatalysts. © 2014 Wiley Periodicals, Inc.

Enhanced Transport Capabilities via Nanotechnologies: Impacting Bioefficacy, Controlled Release Strategies, and Novel Chaperones

Directory of Open Access Journals (Sweden)

Thomai Panagiotou

2011-01-01

side affects and providing improved therapeutic interventions. Innovative nanotechnology applications, such as simultaneous targeting, imaging and delivery to tumors, are now possible through use of novel chaperones. Other examples include nanoparticles attachment to T-cells, release from novel hydrogel implants, and functionalized encapsulants. Difficult tasks such as drug delivery to the brain via the blood brain barrier and/or the cerebrospinal fluid are now easier to accomplish.

Divergent tissue and sex effects of rapamycin on the proteasome-chaperone network of old mice

Directory of Open Access Journals (Sweden)

Karl Andrew Rodriguez

2014-11-01

Full Text Available Rapamycin, an allosteric inhibitor of the mTOR kinase, increases longevity in mice in a sex-specific manner. In contrast to the widely accepted theory that a loss of proteasome activity is detrimental to both life- and healthspan, biochemical studies in vitro reveal that rapamycin inhibits 20S proteasome peptidase activity. We tested if this unexpected finding is also evident after chronic rapamycin treatment in vivo by measuring peptidase activities for both the 26S and 20S proteasome in liver, fat, and brain tissues of old, male and female mice fed encapsulated chow containing 2.24mg/kg (14 ppm rapamycin for 6 months. Further we assessed if rapamycin altered expression of the chaperone proteins known to interact with the proteasome-mediated degradation system (PMDS, heat shock factor 1 (HSF1, and the levels of key mTOR pathway proteins. Rapamycin had little effect on liver proteasome activity in either gender, but increased proteasome activity in female brain lysates and lowered its activity in female fat tissue. Rapamycin-induced changes in molecular chaperone levels were also more substantial in tissues from female animals. Furthermore, mTOR pathway proteins showed more significant changes in female tissues compared to those from males. These data show collectively that there are divergent tissue and sex effects of rapamycin on the proteasome-chaperone network and that these may be linked to the disparate effects of rapamycin on males and females. Further our findings suggest that rapamycin induces indirect regulation of the PMDS/heat-shock response through its modulation of the mTOR pathway rather than via direct interactions between rapamycin and the proteasome.

Chaperone-Mediated Autophagy Protein BAG3 Negatively Regulates Ebola and Marburg VP40-Mediated Egress.

Science.gov (United States)

Liang, Jingjing; Sagum, Cari A; Bedford, Mark T; Sidhu, Sachdev S; Sudol, Marius; Han, Ziying; Harty, Ronald N

2017-01-01

Ebola (EBOV) and Marburg (MARV) viruses are members of the Filoviridae family which cause outbreaks of hemorrhagic fever. The filovirus VP40 matrix protein is essential for virus assembly and budding, and its PPxY L-domain motif interacts with WW-domains of specific host proteins, such as Nedd4 and ITCH, to facilitate the late stage of virus-cell separation. To identify additional WW-domain-bearing host proteins that interact with VP40, we used an EBOV PPxY-containing peptide to screen an array of 115 mammalian WW-domain-bearing proteins. Using this unbiased approach, we identified BCL2 Associated Athanogene 3 (BAG3), a member of the BAG family of molecular chaperone proteins, as a specific VP40 PPxY interactor. Here, we demonstrate that the WW-domain of BAG3 interacts with the PPxY motif of both EBOV and MARV VP40 and, unexpectedly, inhibits budding of both eVP40 and mVP40 virus-like particles (VLPs), as well as infectious VSV-EBOV recombinants. BAG3 is a stress induced protein that regulates cellular protein homeostasis and cell survival through chaperone-mediated autophagy (CMA). Interestingly, our results show that BAG3 alters the intracellular localization of VP40 by sequestering VP40 away from the plasma membrane. As BAG3 is the first WW-domain interactor identified that negatively regulates budding of VP40 VLPs and infectious virus, we propose that the chaperone-mediated autophagy function of BAG3 represents a specific host defense strategy to counteract the function of VP40 in promoting efficient egress and spread of virus particles.

Chaperone-Mediated Autophagy Protein BAG3 Negatively Regulates Ebola and Marburg VP40-Mediated Egress.

Directory of Open Access Journals (Sweden)

Jingjing Liang

2017-01-01

Full Text Available Ebola (EBOV and Marburg (MARV viruses are members of the Filoviridae family which cause outbreaks of hemorrhagic fever. The filovirus VP40 matrix protein is essential for virus assembly and budding, and its PPxY L-domain motif interacts with WW-domains of specific host proteins, such as Nedd4 and ITCH, to facilitate the late stage of virus-cell separation. To identify additional WW-domain-bearing host proteins that interact with VP40, we used an EBOV PPxY-containing peptide to screen an array of 115 mammalian WW-domain-bearing proteins. Using this unbiased approach, we identified BCL2 Associated Athanogene 3 (BAG3, a member of the BAG family of molecular chaperone proteins, as a specific VP40 PPxY interactor. Here, we demonstrate that the WW-domain of BAG3 interacts with the PPxY motif of both EBOV and MARV VP40 and, unexpectedly, inhibits budding of both eVP40 and mVP40 virus-like particles (VLPs, as well as infectious VSV-EBOV recombinants. BAG3 is a stress induced protein that regulates cellular protein homeostasis and cell survival through chaperone-mediated autophagy (CMA. Interestingly, our results show that BAG3 alters the intracellular localization of VP40 by sequestering VP40 away from the plasma membrane. As BAG3 is the first WW-domain interactor identified that negatively regulates budding of VP40 VLPs and infectious virus, we propose that the chaperone-mediated autophagy function of BAG3 represents a specific host defense strategy to counteract the function of VP40 in promoting efficient egress and spread of virus particles.

HDAC6 inhibition enhances 17-AAG--mediated abrogation of hsp90 chaperone function in human leukemia cells.

Science.gov (United States)

Rao, Rekha; Fiskus, Warren; Yang, Yonghua; Lee, Pearl; Joshi, Rajeshree; Fernandez, Pravina; Mandawat, Aditya; Atadja, Peter; Bradner, James E; Bhalla, Kapil

2008-09-01

Histone deacetylase 6 (HDAC6) is a heat shock protein 90 (hsp90) deacetylase. Treatment with pan-HDAC inhibitors or depletion of HDAC6 by siRNA induces hyperacetylation and inhibits ATP binding and chaperone function of hsp90. Treatment with 17-allylamino-demothoxy geldanamycin (17-AAG) also inhibits ATP binding and chaperone function of hsp90, resulting in polyubiquitylation and proteasomal degradation of hsp90 client proteins. In this study, we determined the effect of hsp90 hyperacetylation on the anti-hsp90 and antileukemia activity of 17-AAG. Hyperacetylation of hsp90 increased its binding to 17-AAG, as well as enhanced 17-AAG-mediated attenuation of ATP and the cochaperone p23 binding to hsp90. Notably, treatment with 17-AAG alone also reduced HDAC6 binding to hsp90 and induced hyperacetylation of hsp90. This promoted the proteasomal degradation of HDAC6. Cotreatment with 17-AAG and siRNA to HDAC6 induced more inhibition of hsp90 chaperone function and depletion of BCR-ABL and c-Raf than treatment with either agent alone. In addition, cotreatment with 17-AAG and tubacin augmented the loss of survival of K562 cells and viability of primary acute myeloid leukemia (AML) and chronic myeloid leukemia (CML) samples. These findings demonstrate that HDAC6 is an hsp90 client protein and hyperacetylation of hsp90 augments the anti-hsp90 and antileukemia effects of 17-AAG.

Identification of novel putative-binding proteins for cellular prion protein and a specific interaction with the STIP1 homology and U-Box-containing protein 1

Science.gov (United States)

Gimenez, Ana Paula Lappas; Richter, Larissa Morato Luciani; Atherino, Mariana Campos; Beirão, Breno Castello Branco; Fávaro, Celso; Costa, Michele Dietrich Moura; Zanata, Silvio Marques; Malnic, Bettina; Mercadante, Adriana Frohlich

2015-01-01

ABSTRACT Prion diseases involve the conversion of the endogenous cellular prion protein, PrPC, into a misfolded infectious isoform, PrPSc. Several functions have been attributed to PrPC, and its role has also been investigated in the olfactory system. PrPC is expressed in both the olfactory bulb (OB) and olfactory epithelium (OE) and the nasal cavity is an important route of transmission of diseases caused by prions. Moreover, Prnp−/− mice showed impaired behavior in olfactory tests. Given the high PrPC expression in OE and its putative role in olfaction, we screened a mouse OE cDNA library to identify novel PrPC-binding partners. Ten different putative PrPC ligands were identified, which were involved in functions such as cellular proliferation and apoptosis, cytoskeleton and vesicle transport, ubiquitination of proteins, stress response, and other physiological processes. In vitro binding assays confirmed the interaction of PrPC with STIP1 homology and U-Box containing protein 1 (Stub1) and are reported here for the first time. Stub1 is a co-chaperone with ubiquitin E3-ligase activity, which is associated with neurodegenerative diseases characterized by protein misfolding and aggregation. Physiological and pathological implications of PrPC-Stub1 interaction are under investigation. The PrPC-binding proteins identified here are not exclusive to the OE, suggesting that these interactions may occur in other tissues and play general biological roles. These data corroborate the proposal that PrPC is part of a multiprotein complex that modulates several cellular functions and provide a platform for further studies on the physiological and pathological roles of prion protein. PMID:26237451

Proteomic Data From Human Cell Cultures Refine Mechanisms of Chaperone-Mediated Protein homeostasis

OpenAIRE

Finka, Andrija; Goloubinoff, Andrija Finka and Pierre

2013-01-01

In the crowded environment of human cells, folding of nascent polypeptides and refolding of stress-unfolded proteins is error prone. Accumulation of cytotoxic misfolded and aggregated species may cause cell death, tissue loss, degenerative conformational diseases, and aging. Nevertheless, young cells effectively express a network of molecular chaperones and folding enzymes, termed here “the chaperome,” which can prevent formation of potentially harmful misfolded protein conformers and use the...

The determinants and engagement patterns of chaperones and chauffeurs by Australian doctors in after-hours house-call services

Directory of Open Access Journals (Sweden)

Chris Onyebuchi Ifediora

2017-04-01

Full Text Available Objectives The use of escorts (chauffeurs and chaperones while on duty in after-hours-house-call (AHHC is one key protective option available to doctors in the service, and has been linked to low burnout and increased satisfaction in AHHC. This study aims to explore the patterns of engagement of escorts in Australian AHHC. Method This is a questionnaire-based, electronic survey of all 300 doctors involved in AHHC through the National Home Doctor Service (NHDS, Australia’s largest providers of the service. The survey explored the doctor’s experiences over the 12-month period from October 2013 to September 2014. Results This survey received a total of 168 valid responses, giving a response rate of 56%. Nearly 61% of the doctors involved in AHHC engaged escorts (chauffeurs and chaperones. Of those doctors that engage chauffeurs, three-quarters do so “all or most times”, while only one-quarter engaged chaperones to the same degree of frequency. Hiring escorts is very popular among Brisbane (91.7% and Sydney-based (88.2% practitioners, but is unpopular in the City of Gold Coast (26.1%. There were moderate patronages in Adelaide (52.9% and Melbourne Area (46.4%. Compared to males, females were less likely to drive themselves without escorts (OR 0.20; P < 0.01; CI [0.07–0.57], but more likely to engage chauffeurs (OR 5.87; P = 0.03; CI [1.16–29.77]. Practitioners who were apprehensive were three times more likely to either engage escorts as chauffeurs (OR 3.10; P = 0.04; CI [1.05–9.15] or as an accompanying chaperone if they self-drive (OR 3.03; P = 0.02; CI [1.16–7.89]. Conclusion More needs to be done to increase the engagement of escorts by doctors involved in the Australian AHHC, particularly given their proven benefits in the service. Future studies may be needed to fully explore the real reasons behind the significant associations identified in this study.

Plasmodium falciparum Hsp70-z, an Hsp110 homologue, exhibits independent chaperone activity and interacts with Hsp70-1 in a nucleotide-dependent fashion.

Science.gov (United States)

Zininga, Tawanda; Achilonu, Ikechukwu; Hoppe, Heinrich; Prinsloo, Earl; Dirr, Heini W; Shonhai, Addmore

2016-05-01

The role of molecular chaperones, among them heat shock proteins (Hsps), in the development of malaria parasites has been well documented. Hsp70s are molecular chaperones that facilitate protein folding. Hsp70 proteins are composed of an N-terminal nucleotide binding domain (NBD), which confers them with ATPase activity and a C-terminal substrate binding domain (SBD). In the ADP-bound state, Hsp70 possesses high affinity for substrate and releases the folded substrate when it is bound to ATP. The two domains are connected by a conserved linker segment. Hsp110 proteins possess an extended lid segment, a feature that distinguishes them from canonical Hsp70s. Plasmodium falciparum Hsp70-z (PfHsp70-z) is a member of the Hsp110 family of Hsp70-like proteins. PfHsp70-z is essential for survival of malaria parasites and is thought to play an important role as a molecular chaperone and nucleotide exchange factor of its cytosolic canonical Hsp70 counterpart, PfHsp70-1. Unlike PfHsp70-1 whose functions are fairly well established, the structure-function features of PfHsp70-z remain to be fully elucidated. In the current study, we established that PfHsp70-z possesses independent chaperone activity. In fact, PfHsp70-z appears to be marginally more effective in suppressing protein aggregation than its cytosol-localized partner, PfHsp70-1. Furthermore, based on coimmunoaffinity chromatography and surface plasmon resonance analyses, PfHsp70-z associated with PfHsp70-1 in a nucleotide-dependent fashion. Our findings suggest that besides serving as a molecular chaperone, PfHsp70-z could facilitate the nucleotide exchange function of PfHsp70-1. These dual functions explain why it is essential for parasite survival.

Gamma-irradiation effects to posttranslational modification and chaperon function of bovine α-crystalline

International Nuclear Information System (INIS)

Hiroki, K; Matsumoto, S.; Awakura, M.; Fujii, N.

2001-01-01

The formation of D-asparate (D-Asp) in αA-crystallin of the aged human eye and the cataract crystalline lens has been reported. Crystalline lens keeps the transparency by forming α-crystallin which consists of a high order association of αA-and αB-crystallin. Bovine α-crystallin for investigating a chaperone function which protects the crystalline lens from getting to opaque or disordered agglutination with heat or light, is irradiated by gamma-ray (Co-60) at 0, 1, 2, 3, and 4 kGy, respectively. The irradiated bovine α-crystallin are analyzed with electrophoresis, gel permeation chromatograph, and UV absorption spectrometer for checking on the agglutination and the isomerization of macromolecules. Oxidation of methionine residues (Met-1) and isomerization of asparagine residues (Asp-151) in the αA-crystallin are ascertained in molecular levels with reversed phase liquid chromatography. The Met-1 oxidation and the Asp-151 isomerization depend on gamma-irradiation doses. It is thought that OH radical and H radical in water generated by the irradiation lead to the oxidation and the isomerization. Stereoinversion in the α-crystallin following to such a chemical change are considered to lead to the agglutination of polymer and the reduction of chaperon function. (M. Suetake)

Cost Comparison of Fundamentals of Laparoscopic Surgery Training Completed With Standard Fundamentals of Laparoscopic Surgery Equipment versus Low-Cost Equipment.

Science.gov (United States)

Franklin, Brenton R; Placek, Sarah B; Wagner, Mercy D; Haviland, Sarah M; O'Donnell, Mary T; Ritter, E Matthew

Training for the Fundamentals of Laparoscopic Surgery (FLS) skills test can be expensive. Previous work demonstrated that training on an ergonomically different, low-cost platform does not affect FLS skills test outcomes. This study compares the average training cost with standard FLS equipment and medical-grade consumables versus training on a lower cost platform with non-medical-grade consumables. Subjects were prospectively randomized to either the standard FLS training platform (n = 19) with medical-grade consumables (S-FLS), or the low-cost platform (n = 20) with training-grade products (LC-FLS). Both groups trained to proficiency using previously established mastery learning standards on the 5 FLS tasks. The fixed and consumable cost differences were compared. Training occurred in a surgical simulation center. Laparoscopic novice medical student and resident physician health care professionals who had not completed the national FLS proficiency curriculum and who had performed less than 10 laparoscopic cases. The fixed cost of the platform was considerably higher in the S-FLS group (S-FLS, $3360; LC-FLS, $879), and the average consumable training cost was significantly higher for the S-FLS group (S-FLS, $1384.52; LC-FLS, $153.79; p group had a statistically discernable cost reduction for each consumable (Gauze $9.24 vs. $0.39, p = 0.002; EndoLoop $540.00 vs. $40.60, p group versus $1647.95 in the LC-FLS group. This study shows that the average cost to train a single trainee to proficiency using a lower fixed-cost platform and non-medical-grade equipment results in significant financial savings. A 5-resident program will save approximately $8500 annually. Residency programs should consider adopting this strategy to reduce the cost of FLS training. Published by Elsevier Inc.

A molecular chaperone activity of CCS restores the maturation of SOD1 fALS mutants.

Science.gov (United States)

Luchinat, Enrico; Barbieri, Letizia; Banci, Lucia

2017-12-12

Superoxide dismutase 1 (SOD1) is an important metalloprotein for cellular oxidative stress defence, that is mutated in familiar variants of Amyotrophic Lateral Sclerosis (fALS). Some mutations destabilize the apo protein, leading to the formation of misfolded, toxic species. The Copper Chaperone for SOD1 (CCS) transiently interacts with SOD1 and promotes its correct maturation by transferring copper and catalyzing disulfide bond formation. By in vitro and in-cell NMR, we investigated the role of the SOD-like domain of CCS (CCS-D2). We showed that CCS-D2 forms a stable complex with zinc-bound SOD1 in human cells, that has a twofold stabilizing effect: it both prevents the accumulation of unstructured mutant SOD1 and promotes zinc binding. We further showed that CCS-D2 interacts with apo-SOD1 in vitro, suggesting that in cells CCS stabilizes mutant apo-SOD1 prior to zinc binding. Such molecular chaperone function of CCS-D2 is novel and its implications in SOD-linked fALS deserve further investigation.

A putative hybrid swarm within Oonopsis foliosa (Asteraceae: Astereae)

Science.gov (United States)

Hughes, J.F.; Brown, G.K.

2004-01-01

Oo??nopsis foliosa var. foliosa and var. monocephala are endemic to short-grass steppe of southeastern Colorado and until recently were considered geographically disjunct. The only known qualitative feature separating these 2 varieties is floral head type; var. foliosa has radiate heads, whereas var. monocephala heads are discoid. Sympatry between these varieties is restricted to a small area in which a range of parental types and intermediate head morphologies is observed. We used distribution mapping, morphometric analyses, chromosome cytology, and pollen stainability to characterize the sympatric zone. Morphometrics confirms that the only discrete difference between var. foliosa and var. monocephala is radiate versus discoid heads, respectively. The outer florets of putative hybrid individuals ranged from conspicuously elongated yet radially symmetric disc-floret corollas, to elongated radially asymmetric bilabiate- or deeply cleft corollas, to stunted ray florets with appendages remnant of corolla lobes. Chromosome cytology of pollen mother cells from both putative parental varieties and a series of intermediate morphological types collected at the sympatric zone reveal evidence of translocation heterozygosity. Pollen stainability shows no significant differences in viability between the parental varieties and putative hybrids. The restricted distribution of putative hybrids to a narrow zone of sympatry between the parental types and the presence of meiotic chromosome-pairing anomalies in these intermediate plants are consistent with a hybrid origin. The high stainability of putative-hybrid pollen adds to a growing body of evidence that hybrids are not universally unfit.

Oligomeric structure and chaperone-like activity of Drosophila melanogaster mitochondrial small heat shock protein Hsp22 and arginine mutants in the alpha-crystallin domain.

Science.gov (United States)

Dabbaghizadeh, Afrooz; Finet, Stéphanie; Morrow, Genevieve; Moutaoufik, Mohamed Taha; Tanguay, Robert M

2017-07-01

The structure and chaperone function of DmHsp22WT, a small Hsp of Drosophila melanogaster localized within mitochondria were examined. Mutations of conserved arginine mutants within the alpha-crystallin domain (ACD) domain (R105G, R109G, and R110G) were introduced, and their effects on oligomerization and chaperone function were assessed. Arginine to glycine mutations do not induce significant changes in tryptophan fluorescence, and the mutated proteins form oligomers that are of equal or smaller size than the wild-type protein. They all form oligomer with one single peak as determined by size exclusion chromatography. While all mutants demonstrate the same efficiency as the DmHsp22WT in a DTT-induced insulin aggregation assay, all are more efficient chaperones to prevent aggregation of malate dehydrogenase. Arginine mutants of DmHsp22 are efficient chaperones to retard aggregation of CS and Luc. In summary, this study shows that mutations of arginine to glycine in DmHsp22 ACD induce a number of structural changes, some of which differ from those described in mammalian sHsps. Interestingly, only the R110G-DmHsp22 mutant, and not the expected R109G equivalent to human R140-HspB1, R116-HspB4, and R120-HspB5, showed different structural properties compared with the DmHsp22WT.

A New Glucocerebrosidase Chaperone Reduces α-Synuclein and Glycolipid Levels in iPSC-Derived Dopaminergic Neurons from Patients with Gaucher Disease and Parkinsonism.

Science.gov (United States)

Aflaki, Elma; Borger, Daniel K; Moaven, Nima; Stubblefield, Barbara K; Rogers, Steven A; Patnaik, Samarjit; Schoenen, Frank J; Westbroek, Wendy; Zheng, Wei; Sullivan, Patricia; Fujiwara, Hideji; Sidhu, Rohini; Khaliq, Zayd M; Lopez, Grisel J; Goldstein, David S; Ory, Daniel S; Marugan, Juan; Sidransky, Ellen

2016-07-13

Among the known genetic risk factors for Parkinson disease, mutations in GBA1, the gene responsible for the lysosomal disorder Gaucher disease, are the most common. This genetic link has directed attention to the role of the lysosome in the pathogenesis of parkinsonism. To study how glucocerebrosidase impacts parkinsonism and to evaluate new therapeutics, we generated induced human pluripotent stem cells from four patients with Type 1 (non-neuronopathic) Gaucher disease, two with and two without parkinsonism, and one patient with Type 2 (acute neuronopathic) Gaucher disease, and differentiated them into macrophages and dopaminergic neurons. These cells exhibited decreased glucocerebrosidase activity and stored the glycolipid substrates glucosylceramide and glucosylsphingosine, demonstrating their similarity to patients with Gaucher disease. Dopaminergic neurons from patients with Type 2 and Type 1 Gaucher disease with parkinsonism had reduced dopamine storage and dopamine transporter reuptake. Levels of α-synuclein, a protein present as aggregates in Parkinson disease and related synucleinopathies, were selectively elevated in neurons from the patients with parkinsonism or Type 2 Gaucher disease. The cells were then treated with NCGC607, a small-molecule noninhibitory chaperone of glucocerebrosidase identified by high-throughput screening and medicinal chemistry structure optimization. This compound successfully chaperoned the mutant enzyme, restored glucocerebrosidase activity and protein levels, and reduced glycolipid storage in both iPSC-derived macrophages and dopaminergic neurons, indicating its potential for treating neuronopathic Gaucher disease. In addition, NCGC607 reduced α-synuclein levels in dopaminergic neurons from the patients with parkinsonism, suggesting that noninhibitory small-molecule chaperones of glucocerebrosidase may prove useful for the treatment of Parkinson disease. Because GBA1 mutations are the most common genetic risk factor for

Endoplasmic reticulum proteins SDF2 and SDF2L1 act as components of the BiP chaperone cycle to prevent protein aggregation.

Science.gov (United States)

Fujimori, Tsutomu; Suno, Ryoji; Iemura, Shun-Ichiro; Natsume, Tohru; Wada, Ikuo; Hosokawa, Nobuko

2017-08-01

The folding of newly synthesized proteins in the endoplasmic reticulum (ER) is assisted by ER-resident chaperone proteins. BiP (immunoglobulin heavy-chain-binding protein), a member of the HSP70 family, plays a central role in protein quality control. The chaperone function of BiP is regulated by its intrinsic ATPase activity, which is stimulated by ER-resident proteins of the HSP40/DnaJ family, including ERdj3. Here, we report that two closely related proteins, SDF2 and SDF2L1, regulate the BiP chaperone cycle. Both are ER-resident, but SDF2 is constitutively expressed, whereas SDF2L1 expression is induced by ER stress. Both luminal proteins formed a stable complex with ERdj3 and potently inhibited the aggregation of different types of misfolded ER cargo. These proteins associated with non-native proteins, thus promoting the BiP-substrate interaction cycle. A dominant-negative ERdj3 mutant that inhibits the interaction between ERdj3 and BiP prevented the dissociation of misfolded cargo from the ERdj3-SDF2L1 complex. Our findings indicate that SDF2 and SDF2L1 associate with ERdj3 and act as components in the BiP chaperone cycle to prevent the aggregation of misfolded proteins, partly explaining the broad folding capabilities of the ER under various physiological conditions. © 2017 Molecular Biology Society of Japan and John Wiley & Sons Australia, Ltd.

Coffee enhances the expression of chaperones and antioxidant proteins in rats with nonalcoholic fatty liver disease.

Science.gov (United States)

Salomone, Federico; Li Volti, Giovanni; Vitaglione, Paola; Morisco, Filomena; Fogliano, Vincenzo; Zappalà, Agata; Palmigiano, Angelo; Garozzo, Domenico; Caporaso, Nicola; D'Argenio, Giuseppe; Galvano, Fabio

2014-06-01

Coffee consumption is inversely related to the degree of liver injury in patients with nonalcoholic fatty liver disease (NAFLD). Molecular mediators contributing to coffee's beneficial effects in NAFLD remain to be elucidated. In this study, we administrated decaffeinated espresso coffee or vehicle to rats fed an high-fat diet (HFD) for 12 weeks and examined the effects of coffee on liver injury by using two-dimensional polyacrylamide gel electrophoresis (2D-PAGE) proteomic analysis combined with mass spectrometry. Rats fed an HFD and water developed panacinar steatosis, lobular inflammation, and mild fibrosis, whereas rats fed an HFD and coffee exhibited only mild steatosis. Coffee consumption increased liver expression of the endoplasmic reticulum chaperones glucose-related protein 78 and protein disulfide-isomerase A3; similarly, coffee drinking enhanced the expression of the mitochondrial chaperones heat stress protein 70 and DJ-1. Furthermore, in agreement with reduced hepatic levels of 8-isoprostanes and 8-hydroxy-2'-deoxyguanosine, proteomic analysis showed that coffee consumption induces the expression of master regulators of redox status (i.e., peroxiredoxin 1, glutathione S-transferase α2, and D-dopachrome tautomerase). Last, proteomics revealed an association of coffee intake with decreased expression of electron transfer flavoprotein subunit α, a component of the mitochondrial respiratory chain, involved in de novo lipogenesis. In this study, we were able to identify by proteomic analysis the stress proteins mediating the antioxidant effects of coffee; moreover, we establish for the first time the contribution of specific coffee-induced endoplasmic reticulum and mitochondrial chaperones ensuring correct protein folding and degradation in the liver. Copyright © 2014 Mosby, Inc. All rights reserved.

Molecular and biochemical characterization of a unique mutation in CCS, the human copper chaperone to superoxide dismutase

DEFF Research Database (Denmark)

Huppke, Peter; Brendel, Cornelia; Korenke, Georg Christoph

2012-01-01

chaperone mutations have been described to date. We describe a child from a consanguineous family who inherited homozygous mutations in the SLC33A1, encoding an acetyl CoA transporter, and in CCS, encoding the Cu chaperone for superoxide dismutase. The CCS mutation, p.Arg163Trp, predicts substitution...... of a highly conserved arginine residue at position 163, with tryptophan in domain II of CCS, which interacts directly with superoxide dismutase 1 (SOD1). Biochemical analyses of the patient's fibroblasts, mammalian cell transfections, immunoprecipitation assays, and Lys7Δ (CCS homolog) yeast complementation...... support the pathogenicity of the mutation. Expression of CCS was reduced and binding of CCS to SOD1 impaired. As a result, this mutation causes reduced SOD1 activity and may impair other mechanisms important for normal Cu homeostasis. CCS-Arg163Trp represents the primary example of a human mutation...

Autoinhibition and signaling by the switch II motif in the G-protein chaperone of a radical B12 enzyme.

Science.gov (United States)

Lofgren, Michael; Koutmos, Markos; Banerjee, Ruma

2013-10-25

MeaB is an accessory GTPase protein involved in the assembly, protection, and reactivation of 5'-deoxyadenosyl cobalamin-dependent methylmalonyl-CoA mutase (MCM). Mutations in the human ortholog of MeaB result in methylmalonic aciduria, an inborn error of metabolism. G-proteins typically utilize conserved switch I and II motifs for signaling to effector proteins via conformational changes elicited by nucleotide binding and hydrolysis. Our recent discovery that MeaB utilizes an unusual switch III region for bidirectional signaling with MCM raised questions about the roles of the switch I and II motifs in MeaB. In this study, we addressed the functions of conserved switch II residues by performing alanine-scanning mutagenesis. Our results demonstrate that the GTPase activity of MeaB is autoinhibited by switch II and that this loop is important for coupling nucleotide-sensitive conformational changes in switch III to elicit the multiple chaperone functions of MeaB. Furthermore, we report the structure of MeaB·GDP crystallized in the presence of AlFx(-) to form the putative transition state analog, GDP·AlF4(-). The resulting crystal structure and its comparison with related G-proteins support the conclusion that the catalytic site of MeaB is incomplete in the absence of the GTPase-activating protein MCM and therefore unable to stabilize the transition state analog. Favoring an inactive conformation in the absence of the client MCM protein might represent a strategy for suppressing the intrinsic GTPase activity of MeaB in which the switch II loop plays an important role.

The DnaK Chaperone Uses Different Mechanisms To Promote and Inhibit Replication of Vibrio cholerae Chromosome 2

Directory of Open Access Journals (Sweden)

Jyoti K. Jha

2017-04-01

Full Text Available Replication of Vibrio cholerae chromosome 2 (Chr2 depends on molecular chaperone DnaK to facilitate binding of the initiator (RctB to the replication origin. The binding occurs at two kinds of site, 12-mers and 39-mers, which promote and inhibit replication, respectively. Here we show that DnaK employs different mechanisms to enhance the two kinds of binding. We found that mutations in rctB that reduce DnaK binding also reduce 12-mer binding and initiation. The initiation defect is suppressed by second-site mutations that increase 12-mer binding only marginally. Instead, they reduce replication inhibitory mechanisms: RctB dimerization and 39-mer binding. One suppressing change was in a dimerization domain which is folded similarly to the initiator of an iteron plasmid—the presumed progenitor of Chr2. In plasmids, DnaK promotes initiation by reducing dimerization. A different mutation was in the 39-mer binding domain of RctB and inactivated it, indicating an alternative suppression mechanism. Paradoxically, although DnaK increases 39-mer binding, the increase was also achieved by inactivating the DnaK binding site of RctB. This result suggests that the site inhibits the 39-mer binding domain (via autoinhibition when prevented from binding DnaK. Taken together, our results reveal an important feature of the transition from plasmid to chromosome: the Chr2 initiator retains the plasmid-like dimerization domain and its control by chaperones but uses the chaperones in an unprecedented way to control the inhibitory 39-mer binding.

One out of four: HspL but no other small heat shock protein of Agrobacterium tumefaciens acts as efficient virulence-promoting VirB8 chaperone.

Directory of Open Access Journals (Sweden)

Yun-Long Tsai

Full Text Available Alpha-crystallin-type small heat shock proteins (sHsps are ubiquitously distributed in most eukaryotes and prokaryotes. Four sHsp genes named hspL, hspC, hspAT1, and hspAT2 were identified in Agrobacterium tumefaciens, a plant pathogenic bacterium capable of unique interkingdom DNA transfer via type IV secretion system (T4SS. HspL is highly expressed in virulence-induced growth condition and functions as a VirB8 chaperone to promote T4SS-mediated DNA transfer. Here, we used genetic and biochemical approaches to investigate the involvement of the other three sHsps in T4SS and discovered the molecular basis underlying the dominant function of HspL in promoting T4SS function. While single deletion of hspL but no other sHsp gene reduced T4SS-mediated DNA transfer and tumorigenesis efficiency, additional deletion of other sHsp genes in the hspL deletion background caused synergistic effects in the virulence phenotypes. This is correlated with the high induction of hspL and only modest increase of hspC, hspAT1, and hspAT2 at their mRNA and protein abundance in virulence-induced growth condition. Interestingly, overexpression of any single sHsp gene alone in the quadruple mutant caused increased T4SS-mediated DNA transfer and tumorigenesis. Thermal aggregation protecting assays in vitro indicated that all four sHsps exhibit chaperone activity for the model substrate citrate synthase but only HspL functions as efficient chaperone for VirB8. The higher VirB8 chaperone activity of HspL was also demonstrated in vivo, in which lower amounts of HspL than other sHsps were sufficient in maintaining VirB8 homeostasis in A. tumefaciens. Domain swapping between HspL and HspAT2 indicated that N-terminal, central alpha-crystallin, and C-terminal domains of HspL all contribute to HspL function as an efficient VirB8 chaperone. Taken together, we suggest that the dominant role of HspL in promoting T4SS function is based on its higher expression in virulence

Chemical chaperon 4-phenylbutyrate protects against the endoplasmic reticulum stress-mediated renal fibrosis in vivo and in vitro.

Science.gov (United States)

Liu, Shing-Hwa; Yang, Ching-Chin; Chan, Ding-Cheng; Wu, Cheng-Tien; Chen, Li-Ping; Huang, Jenq-Wen; Hung, Kuan-Yu; Chiang, Chih-Kang

2016-04-19

Renal tubulointerstitial fibrosis is the common and final pathologic change of kidney in end-stage renal disease. Interesting, endoplasmic reticulum (ER) stress is known to contribute to the pathophysiological mechanisms during the development of renal fibrosis. Here, we investigated the effects of chemical chaperon sodium 4-phenylbutyrate (4-PBA) on renal fibrosis in vivo and in vitro. In a rat unilateral ureteral obstruction (UUO) model, 4-PBA mimicked endogenous ER chaperon in the kidneys and significantly reduced glucose regulated protein 78 (GRP78), CCAAT/enhancer binding protein (C/EBP) homologous protein (CHOP), activating transcription factor 4 (ATF4), and phosphorylated JNK protein expressions as well as restored spliced X-box-binding protein 1 (XBP1) expressions in the kidneys of UUO rats. 4-PBA also attenuated the increases of α-smooth muscle actin (α-SMA), connective tissue growth factor (CTGF) protein expressions, tubulointerstitial fibrosis, and apoptosis in the kidneys of UUO rats. Moreover, transforming growth factor (TGF)-β markedly increased ER stress-associated molecules, profibrotic factors, and apoptotic markers in the renal tubular cells (NRK-52E), all of which could be significantly counteracted by 4-PBA treatment. 4-PBA also diminished TGF-β-increased CTGF promoter activity and CTGF mRNA expression in NRK-52E cells. Taken together, our results indicated that 4-PBA acts as an ER chaperone to ameliorate ER stress-induced renal tubular cell apoptosis and renal fibrosis.

The determinants and engagement patterns of chaperones and chauffeurs by Australian doctors in after-hours house-call services.

Science.gov (United States)

Ifediora, Chris Onyebuchi

2017-01-01

The use of escorts (chauffeurs and chaperones) while on duty in after-hours-house-call (AHHC) is one key protective option available to doctors in the service, and has been linked to low burnout and increased satisfaction in AHHC. This study aims to explore the patterns of engagement of escorts in Australian AHHC. This is a questionnaire-based, electronic survey of all 300 doctors involved in AHHC through the National Home Doctor Service (NHDS), Australia's largest providers of the service. The survey explored the doctor's experiences over the 12-month period from October 2013 to September 2014. This survey received a total of 168 valid responses, giving a response rate of 56%. Nearly 61% of the doctors involved in AHHC engaged escorts (chauffeurs and chaperones). Of those doctors that engage chauffeurs, three-quarters do so "all or most times", while only one-quarter engaged chaperones to the same degree of frequency. Hiring escorts is very popular among Brisbane (91.7%) and Sydney-based (88.2%) practitioners, but is unpopular in the City of Gold Coast (26.1%). There were moderate patronages in Adelaide (52.9%) and Melbourne Area (46.4%). Compared to males, females were less likely to drive themselves without escorts (OR 0.20; P  doctors involved in the Australian AHHC, particularly given their proven benefits in the service. Future studies may be needed to fully explore the real reasons behind the significant associations identified in this study.

Comparative Analysis of Two Flavonol Synthases from Different-Colored Onions Provides Insight into Flavonoid Biosynthesis.

Science.gov (United States)

Park, Sangkyu; Kim, Da-Hye; Lee, Jong-Yeol; Ha, Sun-Hwa; Lim, Sun-Hyung

2017-07-05

We isolated cDNAs encoding flavonol synthase (FLS) from the red onion "H6" (AcFLS-H6) and the yellow onion "Hwangryongball" (AcFLS-HRB). We found three amino acid variations between the two sequences. Kinetic analysis with recombinant proteins revealed that AcFLS-HRB exhibited approximately 2-fold higher catalytic efficiencies than AcFLS-H6 for dihydroflavonol substrates and that both proteins preferred dihydroquercetin to dihydrokaempferol. The expression patterns of flavonoid biosynthesis genes corresponded to the accumulation patterns of flavonoid aglycones in both onions. Whereas the other flavonoid biosynthesis genes were weakly expressed in the HRB sheath compared to that of H6, the expression of FLS was similar in both onions. This relatively enhanced FLS expression, along with the higher activity of AcFLS-HRB, could increase the quercetin production in the HRB sheath. The quercetin content was approximately 12-fold higher than the cyanidin content in the H6 sheath, suggesting that FLS has priority in the competition between FLS and dihydroflavonol 4-reductase (DFR) for their substrate dihydroquercetin.

Putative periodontopathic bacteria and herpesviruses in pregnant women: a case-control study

OpenAIRE

Lu, Haixia; Zhu, Ce; Li, Fei; Xu, Wei; Tao, Danying; Feng, Xiping

2016-01-01

Little is known about herpesvirus and putative periodontopathic bacteria in maternal chronic periodontitis. The present case-control study aimed to explore the potential relationship between putative periodontopathic bacteria and herpesviruses in maternal chronic periodontitis.Saliva samples were collected from 36 pregnant women with chronic periodontitis (cases) and 36 pregnant women with healthy periodontal status (controls). Six putative periodontopathic bacteria (Porphyromonas gingivalis ...

Antarctic krill 454 pyrosequencing reveals chaperone and stress transcriptome.

Directory of Open Access Journals (Sweden)

Melody S Clark

Full Text Available BACKGROUND: The Antarctic krill Euphausia superba is a keystone species in the Antarctic food chain. Not only is it a significant grazer of phytoplankton, but it is also a major food item for charismatic megafauna such as whales and seals and an important Southern Ocean fisheries crop. Ecological data suggest that this species is being affected by climate change and this will have considerable consequences for the balance of the Southern Ocean ecosystem. Hence, understanding how this organism functions is a priority area and will provide fundamental data for life history studies, energy budget calculations and food web models. METHODOLOGY/PRINCIPAL FINDINGS: The assembly of the 454 transcriptome of E. superba resulted in 22,177 contigs with an average size of 492bp (ranging between 137 and 8515bp. In depth analysis of the data revealed an extensive catalogue of the cellular chaperone systems and the major antioxidant proteins. Full length sequences were characterised for the chaperones HSP70, HSP90 and the super-oxide dismutase antioxidants, with the discovery of potentially novel duplications of these genes. The sequence data contained 41,470 microsatellites and 17,776 Single Nucleotide Polymorphisms (SNPs/INDELS, providing a resource for population and also gene function studies. CONCLUSIONS: This paper details the first 454 generated data for a pelagic Antarctic species or any pelagic crustacean globally. The classical "stress proteins", such as HSP70, HSP90, ferritin and GST were all highly expressed. These genes were shown to be over expressed in the transcriptomes of Antarctic notothenioid fish and hypothesized as adaptations to living in the cold, with the associated problems of decreased protein folding efficiency and increased vulnerability to damage by reactive oxygen species. Hence, these data will provide a major resource for future physiological work on krill, but in particular a suite of "stress" genes for studies understanding

Chaperone-mediated autophagy and neurodegeneration: connections, mechanisms, and therapeutic implications.

Science.gov (United States)

Liu, Xiaolei; Huang, Sihua; Wang, Xingqin; Tang, Beisha; Li, Wenming; Mao, Zixu

2015-08-01

Lysosomes degrade dysfunctional intracellular components via three pathways: macroautophagy, microautophagy, and chaperone-mediated autophagy (CMA). Unlike the other two, CMA degrades cytosolic proteins with a recognized KFERQ-like motif in lysosomes and is important for cellular homeostasis. CMA activity declines with age and is altered in neurodegenerative diseases. Its impairment leads to the accumulation of aggregated proteins, some of which may be directly tied to the pathogenic processes of neurodegenerative diseases. Its induction may accelerate the clearance of pathogenic proteins and promote cell survival, representing a potential therapeutic approach for the treatment of neurodegenerative diseases. In this review, we summarize the current findings on how CMA is involved in neurodegenerative diseases, especially in Parkinson's disease.

Proteomic data from human cell cultures refine mechanisms of chaperone-mediated protein homeostasis.

Science.gov (United States)

Finka, Andrija; Goloubinoff, Pierre

2013-09-01

In the crowded environment of human cells, folding of nascent polypeptides and refolding of stress-unfolded proteins is error prone. Accumulation of cytotoxic misfolded and aggregated species may cause cell death, tissue loss, degenerative conformational diseases, and aging. Nevertheless, young cells effectively express a network of molecular chaperones and folding enzymes, termed here "the chaperome," which can prevent formation of potentially harmful misfolded protein conformers and use the energy of adenosine triphosphate (ATP) to rehabilitate already formed toxic aggregates into native functional proteins. In an attempt to extend knowledge of chaperome mechanisms in cellular proteostasis, we performed a meta-analysis of human chaperome using high-throughput proteomic data from 11 immortalized human cell lines. Chaperome polypeptides were about 10% of total protein mass of human cells, half of which were Hsp90s and Hsp70s. Knowledge of cellular concentrations and ratios among chaperome polypeptides provided a novel basis to understand mechanisms by which the Hsp60, Hsp70, Hsp90, and small heat shock proteins (HSPs), in collaboration with cochaperones and folding enzymes, assist de novo protein folding, import polypeptides into organelles, unfold stress-destabilized toxic conformers, and control the conformal activity of native proteins in the crowded environment of the cell. Proteomic data also provided means to distinguish between stable components of chaperone core machineries and dynamic regulatory cochaperones.

The role of Vif oligomerization and RNA chaperone activity in HIV-1 replication.

Science.gov (United States)

Batisse, Julien; Guerrero, Santiago; Bernacchi, Serena; Sleiman, Dona; Gabus, Caroline; Darlix, Jean-Luc; Marquet, Roland; Tisné, Carine; Paillart, Jean-Christophe

2012-11-01

The viral infectivity factor (Vif) is essential for the productive infection and dissemination of HIV-1 in non-permissive cells that involve most natural HIV-1 target cells. Vif counteracts the packaging of two cellular cytidine deaminases named APOBEC3G (A3G) and A3F by diverse mechanisms including the recruitment of an E3 ubiquitin ligase complex and the proteasomal degradation of A3G/A3F, the inhibition of A3G mRNA translation or by a direct competition mechanism. In addition, Vif appears to be an active partner of the late steps of viral replication by participating in virus assembly and Gag processing, thus regulating the final stage of virion formation notably genomic RNA dimerization and by inhibiting the initiation of reverse transcription. Vif is a small pleiotropic protein with multiple domains, and recent studies highlighted the importance of Vif conformation and flexibility in counteracting A3G and in binding RNA. In this review, we will focus on the oligomerization and RNA chaperone properties of Vif and show that the intrinsic disordered nature of some Vif domains could play an important role in virus assembly and replication. Experimental evidence demonstrating the RNA chaperone activity of Vif will be presented. Copyright © 2012 Elsevier B.V. All rights reserved.

A genetic screen reveals a periplasmic copper chaperone required for nitrite reductase activity in pathogenic Neisseria.

Science.gov (United States)

Jen, Freda E-C; Djoko, Karrera Y; Bent, Stephen J; Day, Christopher J; McEwan, Alastair G; Jennings, Michael P

2015-09-01

Under conditions of low oxygen availability, Neisseria meningitidis and Neisseria gonorrhoeae are able to respire via a partial denitrification pathway in which nitrite is converted to nitrous oxide. In this process, nitrite reductase (AniA), a copper (Cu)-containing protein converts nitrite to NO, and this product is converted to nitrous oxide by nitric oxide reductase (NorB). NorB also confers protection against toxic NO, and so we devised a conditional lethal screen, using a norB mutant, to identify mutants that were resistant to nitrite-dependent killing. After random-deletion mutagenesis of N. meningitidis, this genetic screen identified a gene encoding a Cu chaperone that is essential for AniA function, AccA. Purified AccA binds one Cu (I) ion and also possesses a second binding site for Cu (II). This novel periplasmic Cu chaperone (AccA) appears to be essential for provision of Cu ions to AniA of pathogenic Neisseria to generate an active nitrite reductase. Apart from the Neisseria genus, AccA is distributed across a wide range of environmental Proteobacteria species. © FASEB.

Induced ER-chaperones regulate a novel receptor-like kinase to mediate a viral innate immune response

Science.gov (United States)

Caplan, Jeffrey L.; Zhu, Xiaohong; Mamillapalli, Padmavathi; Marathe, Rajendra; Anandalakshmi, Radhamani; Dinesh-Kumar, S. P.

2009-01-01

Summary The plant innate immune response requires a rapid, global reprogramming of cellular processes. Here we employed two complementary proteomic methods, two-dimensional differential in-gel electrophoresis (2D-DIGE) and iTRAQ, to identify differentially regulated proteins early during a defense response. Besides defense-related proteins, the constituents of the largest category of up-regulated proteins were cytoplasmic- and endoplasmic reticulum (ER)-residing molecular chaperones. Silencing of ER-resident protein disulfide isomerases, NbERp57 and NbP5, and the calreticulins, NbCRT2 and NbCRT3, lead to a partial loss of N immune receptor-mediated defense against Tobacco mosaic virus (TMV). Furthermore, NbCRT2 and NbCRT3 are required for the expression of a novel induced receptor-like kinase (IRK). IRK is a plasma membrane-localized protein required for the N-mediated hypersensitive response programmed cell death (HR-PCD) and resistance to TMV. These data support a model in which ER-resident chaperones are required for the accumulation of membrane bound or secreted proteins that are necessary for innate immunity. PMID:19917500

Hsp40s specify functions of Hsp104 and Hsp90 protein chaperone machines.

Directory of Open Access Journals (Sweden)

Michael Reidy

2014-10-01

Full Text Available Hsp100 family chaperones of microorganisms and plants cooperate with the Hsp70/Hsp40/NEF system to resolubilize and reactivate stress-denatured proteins. In yeast this machinery also promotes propagation of prions by fragmenting prion polymers. We previously showed the bacterial Hsp100 machinery cooperates with the yeast Hsp40 Ydj1 to support yeast thermotolerance and with the yeast Hsp40 Sis1 to propagate [PSI+] prions. Here we find these Hsp40s similarly directed specific activities of the yeast Hsp104-based machinery. By assessing the ability of Ydj1-Sis1 hybrid proteins to complement Ydj1 and Sis1 functions we show their C-terminal substrate-binding domains determined distinctions in these and other cellular functions of Ydj1 and Sis1. We find propagation of [URE3] prions was acutely sensitive to alterations in Sis1 activity, while that of [PIN+] prions was less sensitive than [URE3], but more sensitive than [PSI+]. These findings support the ideas that overexpressing Ydj1 cures [URE3] by competing with Sis1 for interaction with the Hsp104-based disaggregation machine, and that different prions rely differently on activity of this machinery, which can explain the various ways they respond to alterations in chaperone function.

Effect of leucine-to-methionine substitutions on the diffraction quality of histone chaperone SET/TAF-Iβ/INHAT crystals

International Nuclear Information System (INIS)

Senda, Miki; Muto, Shinsuke; Horikoshi, Masami; Senda, Toshiya

2008-01-01

The combination of leucine-to-methionine substitutions and optimization of cryoconditions improved the resolution of histone chaperone SET/TAF-Iβ/INHAT crystals from around 5.5 to 2.3 Å without changing the crystallization conditions, allowing successful structure determination of SET/TAF-Iβ/INHAT by the multiwavelength anomalous diffraction method. One of the most frequent problems in crystallization is poor quality of the crystals. In order to overcome this obstacle several methods have been utilized, including amino-acid substitutions of the target protein. Here, an example is presented of crystal-quality improvement by leucine-to-methionine substitutions. A variant protein with three amino-acid substitutions enabled improvement of the crystal quality of the histone chaperone SET/TAF-Iβ/INHAT when combined with optimization of the cryoconditions. This procedure improved the resolution of the SET/TAF-Iβ/INHAT crystals from around 5.5 to 2.3 Å without changing the crystallization conditions

Targeting Hsp90-Cdc37: A Promising Therapeutic Strategy by Inhibiting Hsp90 Chaperone Function.

Science.gov (United States)

Wang, Lei; Li, Li; Gu, Kai; Xu, Xiao-Li; Sun, Yuan; You, Qi-Dong

2017-01-01

The Hsp90 chaperone protein regulates the folding, maturation and stability of a wide variety of oncoproteins. In recent years, many Hsp90 inhibitors have entered into the clinical trials while all of them target ATPase showing similar binding capacity and kinds of side-effects so that none have reached to the market. During the regulation progress, numerous protein- protein interactions (PPI) such as Hsp90 and client proteins or cochaperones are involved. With the Hsp90-cochaperones PPI networks being more and more clear, many cancerous proteins have been reported to be tightly correlated to Hsp90-cochaperones PPI. Among them, Hsp90-Cdc37 PPI has been widely reported to associate with numerous protein kinases, making it a novel target for the treatment of cancers. In this paper, we briefly review the strategies and modulators targeting Hsp90-Cdc37 complex including direct and indirect regulation mechanism. Through these discussions we expect to present inspirations for new insights into an alternative way to inhibit Hsp90 chaperone function. Copyright© Bentham Science Publishers; For any queries, please email at epub@benthamscience.org.

The Hsp90 co-chaperones Sti1, Aha1, and P23 regulate adaptive responses to antifungal azoles

Directory of Open Access Journals (Sweden)

Xiaokui Gu

2016-10-01

Full Text Available Heat Shock Protein 90 (Hsp90 is essential for tumor progression in humans and drug resistance in fungi. However, the roles of its many co-chaperones in antifungal resistance are unknown. In this study, by susceptibility test of Neurospora crassa mutants lacking each of 18 Hsp90/Calcineurin system member genes (including 8 Hsp90 co-chaperone genes to antifungal drugs and other stresses, we demonstrate that the Hsp90 co-chaperones Sti1 (Hop1 in yeast, Aha1, and P23 (Sba1 in yeast were required for the basal resistance to antifungal azoles and heat stress. Deletion of any of them resulted in hypersensitivity to azoles and heat. Liquid chromatography–mass spectrometry (LC-MS analysis showed that the toxic sterols eburicol and 14α-methyl-3,6-diol were significantly accumulated in the sti1 and p23 deletion mutants after ketoconazole treatment, which has been shown before to led to cell membrane stress. At the transcriptional level, Aha1, Sti1, and P23 positively regulate responses to ketoconazole stress by erg11 and erg6, key genes in the ergosterol biosynthetic pathway. Aha1, Sti1, and P23 are highly conserved in fungi, and sti1 and p23 deletion also increased the susceptibility to azoles in Fusarium verticillioides. These results indicate that Hsp90-cochaperones Aha1, Sti1, and P23 are critical for the basal azole resistance and could be potential targets for developing new antifungal agents.

The cardiac copper chaperone proteins Sco1 and CCS are up-regulated, but Cox 1 and Cox4 are down-regulated, by copper deficiency.

Science.gov (United States)

Getz, Jean; Lin, Dingbo; Medeiros, Denis M

2011-10-01

Copper is ferried in a cell complexed to chaperone proteins, and in the heart much copper is required for cytochrome c oxidase (Cox). It is not completely understood how copper status affects the levels of these proteins. Here we determined if dietary copper deficiency could up- or down-regulate select copper chaperone proteins and Cox subunits 1 and 4 in cardiac tissue of rats. Sixteen weanling male Long-Evans rats were randomized into treatment groups, one group receiving a copper-deficient diet (CCS, Sco1, Ctr1, Cox17, Cox1, and Cox4 by SDS-PAGE and Western blotting. No changes were observed in the concentrations of CTR1 and Cox17 between copper-adequate and copper-deficient rats. CCS and Sco1 were up-regulated and Cox1 and Cox4 were both down-regulated as a result of copper deficiency. These data suggest that select chaperone proteins and may be up-regulated, and Cox1 and 4 down-regulated, by a dietary copper deficiency, whereas others appear not to be affected by copper status.

Realization of PLC to the Variable Frequency Speed Regulation System of Mine Local Ventilator based on RS-485 Communication

Science.gov (United States)

Ma, Kai; Li, Jian; Yun, Yichong

2018-03-01

The article first introduces the merits of serial communication in the PLC to the variable frequency speed regulation system of mine local ventilator, and then sets up a hardware application development platform of PLC and inverter based on RS-485 communication technology, next presents communication initialization of the PLC and Inverter. Finally according to the control requirements, PLC send run operation & monitoring instruction to Inverter, realizes the serial communication control between the PLC and Inverter.

Cyclic GMP-AMP Synthase Is Required for Cell Proliferation and Inflammatory Responses in Rheumatoid Arthritis Synoviocytes

Directory of Open Access Journals (Sweden)

Yan Wang

2015-01-01

Full Text Available Rheumatoid arthritis (RA is characterized by inflammatory cell infiltration, fibroblast-like synoviocytes (FLS invasive proliferation, and joint destruction. Cyclic GMP-AMP synthase (cGAS is a cytosolic DNA sensor that induces immune activation. In this study, we examined whether cGAS plays a role in RA FLS. In this study, cGAS was overexpressed in RA-FLS compared with OA FLS. TNFα stimulation induced cGAS expression in RA FLS. Overexpression of cGAS promoted the proliferation and knockdown of cGAS inhibited the proliferation of RA FLS. cGAS overexpression enhanced the production of proinflammatory cytokines and matrix metalloproteinases (MMPs as well as AKT and ERK phosphorylation in TNFα-stimulated FLS. In contrast, cGAS silencing inhibited production of proinflammatory cytokines and matrix metalloproteinases (MMPs as well as AKT and ERK phosphorylation in TNFα-stimulated FLS. These results suggest that cGAS activates the AKT and ERK pathways to promote the inflammatory response of RA FLS, and the development of strategies targeting cGAS may have therapeutic potential for human RA.

Cyclic GMP-AMP Synthase Is Required for Cell Proliferation and Inflammatory Responses in Rheumatoid Arthritis Synoviocytes.

Science.gov (United States)

Wang, Yan; Su, Guo-Hua; Zhang, Fang; Chu, Jing-Xue; Wang, Yun-Shan

2015-01-01

Rheumatoid arthritis (RA) is characterized by inflammatory cell infiltration, fibroblast-like synoviocytes (FLS) invasive proliferation, and joint destruction. Cyclic GMP-AMP synthase (cGAS) is a cytosolic DNA sensor that induces immune activation. In this study, we examined whether cGAS plays a role in RA FLS. In this study, cGAS was overexpressed in RA-FLS compared with OA FLS. TNFα stimulation induced cGAS expression in RA FLS. Overexpression of cGAS promoted the proliferation and knockdown of cGAS inhibited the proliferation of RA FLS. cGAS overexpression enhanced the production of proinflammatory cytokines and matrix metalloproteinases (MMPs) as well as AKT and ERK phosphorylation in TNFα-stimulated FLS. In contrast, cGAS silencing inhibited production of proinflammatory cytokines and matrix metalloproteinases (MMPs) as well as AKT and ERK phosphorylation in TNFα-stimulated FLS. These results suggest that cGAS activates the AKT and ERK pathways to promote the inflammatory response of RA FLS, and the development of strategies targeting cGAS may have therapeutic potential for human RA.

A novel putative auxin carrier family regulates intracellular auxin homeostasis in plants

Czech Academy of Sciences Publication Activity Database

Barbez, E.; Kubeš, Martin; Rolčík, Jakub; Béziat, Ch.; Pěnčík, Aleš; Wang, B.; Rosquete, M. R.; Zhu, J.; Dobrev, Petre; Lee, Y.; Zažímalová, Eva; Petrášek, Jan; Geisler, M.; Friml, J.; Kleine-Vehn, J.

2012-01-01

Roč. 485, č. 7396 (2012), s. 119-124 ISSN 0028-0836 R&D Projects: GA MŠk(CZ) LC06034; GA ČR(CZ) GAP305/11/2476; GA ČR(CZ) GAP305/11/0797 Institutional research plan: CEZ:AV0Z50380511 Keywords : auxin * auxin homeostasis * PILS (PIN-likes) Subject RIV: EB - Genetics ; Molecular Biology Impact factor: 38.597, year: 2012

Chaperones CCS, ATOX and COXIV responses to copper supplementation in healthy adults.

Science.gov (United States)

Araya, Magdalena; Andrews, Monica; Pizarro, Fernando; Arredondo, Miguel

2012-04-01

Assessment of proteins in blood and other tissues has failed to identify markers of early copper effects on health. Studies in animal models show that chaperone of SOD (CCS) respond to changes of copper status. Evidence about other copper chaperones (COXIV, ATOX) is not clear. The aim of this study was to assess by means of an in vitro challenge the mRNA relative abundance of ccs, sod1, coxIV, mtIIa and atox in peripheral mononuclear cells (PMNCs) obtained from healthy individuals, acutely and chronically supplemented with small-to-moderate amounts of copper. Healthy participants received 8 mg Cu/d (supplemented group, SG) or placebo, (placebo group, PG) for 2 months. Biochemical indicators were assessed at basal (T0) and after 2 (T2) and 60 days (T60). At these times PMNCs were obtained, challenged with 1, 5 or 20 μM Cu-histidine for 20 h and the mRNA relative abundance of the selected genes assessed by real time PCR. The results showed that at T0, intracellular copper was not different between experimental and control groups. This increased at T2 and T60 when the copper in the media increased (two-way ANOVA, P CCS mRNA transcripts showed no significant changes (two-way ANOVA) at T2 and T60. In SG, CCS changed by treatment, time and interaction (two-way ANOVA, all P CCS but not SOD, ATOX or COXIV responded consistently to controlled changes of copper availability in an in vitro copper challenge.

The mitochondrial PHB complex: roles in mitochondrial respiratory complex assembly, ageing and degenerative disease.

NARCIS (Netherlands)

Nijtmans, L.G.J.; Artal-Sanz, M.; Grivell, L.A.; Coates, P.J.

2002-01-01

Although originally identified as putative negative regulators of the cell cycle, recent studies have demonstrated that the PHB proteins act as a chaperone in the assembly of subunits of mitochondrial respiratory chain complexes. The two PHB proteins, Phblp and Phb2p, are located in the

Severity of murine collagen-induced arthritis correlates with increased CYP7B activity: enhancement of dehydroepiandrosterone metabolism by interleukin-1beta.

Science.gov (United States)

Dulos, John; Verbraak, Evert; Bagchus, Wilma M; Boots, Annemieke M H; Kaptein, Allard

2004-10-01

The endogenous steroid dehydroepiandrosterone (DHEA) has been reported to play a role in rheumatoid arthritis (RA). DHEA is metabolized by the P450 enzyme CYP7B into 7alpha-OH-DHEA, which has immunostimulating properties. This study was undertaken to investigate the putative role of CYP7B in arthritis using murine collagen-induced arthritis (CIA), an interleukin-1beta (IL-1beta)-dependent model. DBA/1J mice were immunized and administered a booster with type II collagen. The presence of 7alpha-OH-DHEA was determined in both arthritic and nonarthritic joints and the serum of CIA mice by radioimmunoassay. CYP7B messenger RNA (mRNA) expression was analyzed in synovial biopsy samples, and in fibroblast-like synoviocytes (FLS) isolated from these synovial biopsy samples, by reverse transcriptase-polymerase chain reaction (RT-PCR). In addition, the regulatory role of IL-1beta on CYP7B activity in FLS was determined using RT-PCR, Western blotting, and high-performance liquid chromatography. In knee joint synovial biopsy samples from arthritic mice, 7alpha-OH-DHEA levels were 5-fold higher than in nonarthritic mice. Elevated levels of 7alpha-OH-DHEA were accompanied by an increase in CYP7B mRNA expression and were positively correlated with disease severity. In serum, no differences in 7alpha-OH-DHEA levels were observed between arthritic and nonarthritic mice. Incubation of FLS with IL-1beta resulted in a dose-dependent increase in 7alpha-OH-DHEA formation. In addition, IL-1beta enhanced CYP7B mRNA and CYP7B protein levels in FLS. Disease progression in CIA is correlated with enhanced CYP7B activity, which leads to locally enhanced 7alpha-OH-DHEA levels. Elevated IL-1beta levels within the arthritic joint may regulate this increase in CYP7B activity. Copyright 2004 American College of Rheumatology

DNAJB6 is a peptide-binding chaperone which can suppress amyloid fibrillation of polyglutamine peptides at substoichiometric molar ratios

NARCIS (Netherlands)

Mansson, Cecilia; Kakkar, Vaishali; Monsellier, Elodie; Sourigues, Yannick; Harmark, Johan; Kampinga, Harm H.; Melki, Ronald; Emanuelsson, Cecilia

Expanded polyglutamine (polyQ) stretches lead to protein aggregation and severe neurodegenerative diseases. A highly efficient suppressor of polyQ aggregation was identified, the DNAJB6, when molecular chaperones from the HSPH, HSPA, and DNAJ families were screened for huntingtin exon 1 aggregation

Streptococcus mutans copper chaperone, CopZ, is critical for biofilm formation and competitiveness.

Science.gov (United States)

Garcia, S S; Du, Q; Wu, H

2016-12-01

The oral cavity is a dynamic environment characterized by hundreds of bacterial species, saliva, and an influx of nutrients and metal ions such as copper. Although there is a physiologic level of copper in the saliva, the oral cavity is often challenged with an influx of copper ions. At high concentrations copper is toxic and must therefore be strictly regulated by pathogens for them to persist and cause disease. The cariogenic pathogen Streptococcus mutans manages excess copper using the copYAZ operon that encodes a negative DNA-binding repressor (CopY), the P1-ATPase copper exporter (CopA), and the copper chaperone (CopZ). These hypothetical roles of the copYAZ operon in regulation and copper transport to receptors led us to investigate their contribution to S. mutans virulence. Mutants defective in the copper chaperone CopZ, but not CopY or CopA, were impaired in biofilm formation and competitiveness against commensal streptococci. Characterization of the CopZ mutant biofilm revealed a decreased secretion of glucosyltransferases and reduced expression of mutacin genes. These data suggest that the function of copZ on biofilm and competitiveness is independent of copper resistance and CopZ is a global regulator for biofilm and other virulence factors. Further characterization of CopZ may lead to the identification of new biofilm pathways. © 2015 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.

Bovine leukemia virus nucleocapsid protein is an efficient nucleic acid chaperone

International Nuclear Information System (INIS)

Qualley, Dominic F.; Sokolove, Victoria L.; Ross, James L.

2015-01-01

Nucleocapsid proteins (NCs) direct the rearrangement of nucleic acids to form the most thermodynamically stable structure, and facilitate many steps throughout the life cycle of retroviruses. NCs bind strongly to nucleic acids (NAs) and promote NA aggregation by virtue of their cationic nature; they also destabilize the NA duplex via highly structured zinc-binding motifs. Thus, they are considered to be NA chaperones. While most retroviral NCs are structurally similar, differences are observed both within and between retroviral genera. In this work, we compare the NA binding and chaperone activity of bovine leukemia virus (BLV) NC to that of two other retroviral NCs: human immunodeficiency virus type 1 (HIV-1) NC, which is structurally similar to BLV NC but from a different retrovirus genus, and human T-cell leukemia virus type 1 (HTLV-1) NC, which possesses several key structural differences from BLV NC but is from the same genus. Our data show that BLV and HIV-1 NCs bind to NAs with stronger affinity in relation to HTLV-1 NC, and that they also accelerate the annealing of complementary stem-loop structures to a greater extent. Analysis of kinetic parameters derived from the annealing data suggests that while all three NCs stimulate annealing by a two-step mechanism as previously reported, the relative contributions of each step to the overall annealing equilibrium are conserved between BLV and HIV-1 NCs but are different for HTLV-1 NC. It is concluded that while BLV and HTLV-1 belong to the same genus of retroviruses, processes that rely on NC may not be directly comparable. - Highlights: • BLV NC binds strongly to DNA and RNA. • BLV NC promotes mini-TAR annealing as well as HIV-1 NC. • Annealing kinetics suggest a low degree of similarity between BLV NC and HTLV-1 NC

Bovine leukemia virus nucleocapsid protein is an efficient nucleic acid chaperone

Energy Technology Data Exchange (ETDEWEB)

Qualley, Dominic F., E-mail: dqualley@berry.edu; Sokolove, Victoria L.; Ross, James L.

2015-03-13

Nucleocapsid proteins (NCs) direct the rearrangement of nucleic acids to form the most thermodynamically stable structure, and facilitate many steps throughout the life cycle of retroviruses. NCs bind strongly to nucleic acids (NAs) and promote NA aggregation by virtue of their cationic nature; they also destabilize the NA duplex via highly structured zinc-binding motifs. Thus, they are considered to be NA chaperones. While most retroviral NCs are structurally similar, differences are observed both within and between retroviral genera. In this work, we compare the NA binding and chaperone activity of bovine leukemia virus (BLV) NC to that of two other retroviral NCs: human immunodeficiency virus type 1 (HIV-1) NC, which is structurally similar to BLV NC but from a different retrovirus genus, and human T-cell leukemia virus type 1 (HTLV-1) NC, which possesses several key structural differences from BLV NC but is from the same genus. Our data show that BLV and HIV-1 NCs bind to NAs with stronger affinity in relation to HTLV-1 NC, and that they also accelerate the annealing of complementary stem-loop structures to a greater extent. Analysis of kinetic parameters derived from the annealing data suggests that while all three NCs stimulate annealing by a two-step mechanism as previously reported, the relative contributions of each step to the overall annealing equilibrium are conserved between BLV and HIV-1 NCs but are different for HTLV-1 NC. It is concluded that while BLV and HTLV-1 belong to the same genus of retroviruses, processes that rely on NC may not be directly comparable. - Highlights: • BLV NC binds strongly to DNA and RNA. • BLV NC promotes mini-TAR annealing as well as HIV-1 NC. • Annealing kinetics suggest a low degree of similarity between BLV NC and HTLV-1 NC.

Cyclic GMP-AMP Synthase Is Required for Cell Proliferation and Inflammatory Responses in Rheumatoid Arthritis Synoviocytes

OpenAIRE

Wang, Yan; Su, Guo-Hua; Zhang, Fang; Chu, Jing-Xue; Wang, Yun-Shan

2015-01-01

Rheumatoid arthritis (RA) is characterized by inflammatory cell infiltration, fibroblast-like synoviocytes (FLS) invasive proliferation, and joint destruction. Cyclic GMP-AMP synthase (cGAS) is a cytosolic DNA sensor that induces immune activation. In this study, we examined whether cGAS plays a role in RA FLS. In this study, cGAS was overexpressed in RA-FLS compared with OA FLS. TNFα stimulation induced cGAS expression in RA FLS. Overexpression of cGAS promoted the proliferation and knockdow...

ATF6α/β-mediated adjustment of ER chaperone levels is essential for development of the notochord in medaka fish.

Science.gov (United States)

Ishikawa, Tokiro; Okada, Tetsuya; Ishikawa-Fujiwara, Tomoko; Todo, Takeshi; Kamei, Yasuhiro; Shigenobu, Shuji; Tanaka, Minoru; Saito, Taro L; Yoshimura, Jun; Morishita, Shinichi; Toyoda, Atsushi; Sakaki, Yoshiyuki; Taniguchi, Yoshihito; Takeda, Shunichi; Mori, Kazutoshi

2013-05-01

ATF6α and ATF6β are membrane-bound transcription factors activated by regulated intramembrane proteolysis in response to endoplasmic reticulum (ER) stress to induce various ER quality control proteins. ATF6α- and ATF6β single-knockout mice develop normally, but ATF6α/β double knockout causes embryonic lethality, the reason for which is unknown. Here we show in medaka fish that ATF6α is primarily responsible for transcriptional induction of the major ER chaperone BiP and that ATF6α/β double knockout, but not ATF6α- or ATF6β single knockout, causes embryonic lethality, as in mice. Analyses of ER stress reporters reveal that ER stress occurs physiologically during medaka early embryonic development, particularly in the brain, otic vesicle, and notochord, resulting in ATF6α- and ATF6β-mediated induction of BiP, and that knockdown of the α1 chain of type VIII collagen reduces such ER stress. The absence of transcriptional induction of several ER chaperones in ATF6α/β double knockout causes more profound ER stress and impaired notochord development, which is partially rescued by overexpression of BiP. Thus ATF6α/β-mediated adjustment of chaperone levels to increased demands in the ER is essential for development of the notochord, which synthesizes and secretes large amounts of extracellular matrix proteins to serve as the body axis before formation of the vertebra.

The co-chaperones Fkbp4/5 control Argonaute2 expression and facilitate RISC assembly.

Science.gov (United States)

Martinez, Natalia J; Chang, Hao-Ming; Borrajo, Jacob de Riba; Gregory, Richard I

2013-11-01

Argonaute2 (Ago2) protein and associated microRNAs (miRNAs) or small interfering RNAs (siRNAs) form the RNA-induced silencing complex (RISC) for target messenger RNA cleavage and post-transcriptional gene silencing. Although Ago2 is essential for RISC activity, the mechanism of RISC assembly is not well understood, and factors controlling Ago2 protein expression are largely unknown. A role for the Hsc70/Hsp90 chaperone complex in loading small RNA duplexes into the RISC has been demonstrated in cell extracts, and unloaded Ago2 is unstable and degraded by the lysosome in mammalian cells. Here we identify the co-chaperones Fkbp4 and Fkbp5 as Ago2-associated proteins in mouse embryonic stem cells. Pharmacological inhibition of this interaction using FK506 or siRNA-mediated Fkbp4/5 depletion leads to decreased Ago2 protein levels. We find FK506 treatment inhibits, whereas Fkbp4/5 overexpression promotes, miRNA-mediated stabilization of Ago2 expression. Simultaneous treatment with a lysosome inhibitor revealed the accumulation of unloaded Ago2 complexes in FK506-treated cells. We find that, consistent with unloaded miRNAs being unstable, FK506 treatment also affects miRNA abundance, particularly nascent miRNAs. Our results support a role for Fkbp4/5 in RISC assembly.

The Escherichia coli thioredoxin homolog YbbN/Trxsc is a chaperone and a weak protein oxidoreductase.

Science.gov (United States)

Caldas, Thérèse; Malki, Abderrahim; Kern, Renée; Abdallah, Jad; Richarme, Gilbert

2006-05-12

Escherichia coli contains two thioredoxins, Trx1 and Trx2, and a thioredoxin-like protein, YbbN, which presents a strong homology in its N-terminal part with thioredoxin 1 and 2. YbbN, however, does not possess the canonical Cys-x-x-Cys active site of thioredoxins, but instead a Ser-x-x-Cys site. In addition to Cys-38, located in the SxxC site, it contains a second cysteine, Cys-63, close to Cys-38 in the 3D model. Cys-38 and Cys-63 undergo an oxidoreduction process, suggesting that YbbN functions with two redox cysteines. Accordingly, YbbN catalyzes the oxidation of reduced RNase and the isomerization of scrambled RNase. Moreover, upon oxidation, its oligomeric state changes from dimers to tetramers and higher oligomers. YbbN also possesses chaperone properties, promoting protein folding after urea denaturation and forming complexes with unfolded proteins. This is the first biochemical characterization of a member of the YbbN class of bacterial thioredoxin-like proteins, and in vivo experiments will allow to determine the importance of its redox and chaperone properties in the cellular physiology.

Engineered disulfide bonds restore chaperone-like function of DJ-1 mutants linked to familial Parkinson's disease.

Science.gov (United States)

Logan, Todd; Clark, Lindsay; Ray, Soumya S

2010-07-13

Loss-of-function mutations such as L166P, A104T, and M26I in the DJ-1 gene (PARK7) have been linked to autosomal-recessive early onset Parkinson's disease (PD). Cellular and structural studies of the familial mutants suggest that these mutations may destabilize the dimeric structure. To look for common dynamical signatures among the DJ-1 mutants, short MD simulations of up to 1000 ps were conducted to identify the weakest region of the protein (residues 38-70). In an attempt to stabilize the protein, we mutated residue Val 51 to cysteine (V51C) to make a symmetry-related disulfide bridge with the preexisting Cys 53 on the opposite subunit. We found that the introduction of this disulfide linkage stabilized the mutants A104T and M26I against thermal denaturation, improved their ability to scavenge reactive oxygen species (ROS), and restored a chaperone-like function of blocking alpha-synuclein aggregation. The L166P mutant was far too unstable to be rescued by introduction of the V51C mutation. The results presented here point to the possible development of pharmacological chaperones, which may eventually lead to PD therapeutics.

Heterologous gln/asn-rich proteins impede the propagation of yeast prions by altering chaperone availability.

Directory of Open Access Journals (Sweden)

Zi Yang

Full Text Available Prions are self-propagating conformations of proteins that can cause heritable phenotypic traits. Most yeast prions contain glutamine (Q/asparagine (N-rich domains that facilitate the accumulation of the protein into amyloid-like aggregates. Efficient transmission of these infectious aggregates to daughter cells requires that chaperones, including Hsp104 and Sis1, continually sever the aggregates into smaller "seeds." We previously identified 11 proteins with Q/N-rich domains that, when overproduced, facilitate the de novo aggregation of the Sup35 protein into the [PSI(+] prion state. Here, we show that overexpression of many of the same 11 Q/N-rich proteins can also destabilize pre-existing [PSI(+] or [URE3] prions. We explore in detail the events leading to the loss (curing of [PSI(+] by the overexpression of one of these proteins, the Q/N-rich domain of Pin4, which causes Sup35 aggregates to increase in size and decrease in transmissibility to daughter cells. We show that the Pin4 Q/N-rich domain sequesters Hsp104 and Sis1 chaperones away from the diffuse cytoplasmic pool. Thus, a mechanism by which heterologous Q/N-rich proteins impair prion propagation appears to be the loss of cytoplasmic Hsp104 and Sis1 available to sever [PSI(+].

The results of investigation and the analysis of the mechanical properties of L485MB steel used for gas-pipelines construction

International Nuclear Information System (INIS)

Wasiak, J.; Szteke, W.; Bilous, W.; Hajewska, E.; Wagner, T.; Przyborska, M.

2001-01-01

In the paper results of mechanical properties investigation carried out on two sectors of the tube made of L485MB steel cutting out from the gas pipeline after stress test are described. The calculation of the critical dimensions of cracks in examined material is given. The diagnostic programme SACC serving to the evaluation of the exploitation safety of elements with cracks was applied. (author)

Regulation of the HscA ATPase reaction cycle by the co-chaperone HscB and the iron-sulfur cluster assembly protein IscU.

Science.gov (United States)

Silberg, Jonathan J; Tapley, Tim L; Hoff, Kevin G; Vickery, Larry E

2004-12-24

The ATPase activity of HscA, a specialized hsp70 molecular chaperone from Escherichia coli, is regulated by the iron-sulfur cluster assembly protein IscU and the J-type co-chaperone HscB. IscU behaves as a substrate for HscA, and HscB enhances the binding of IscU to HscA. To better understand the mechanism by which HscB and IscU regulate HscA, we examined binding of HscB to the different conformational states of HscA and the effects of HscB and IscU on the kinetics of the individual steps of the HscA ATPase reaction cycle. Affinity sensor studies revealed that whereas IscU binds both ADP (R-state) and ATP (T-state) HscA complexes, HscB interacts only with an ATP-bound state. Studies of ATPase activity under single-turnover and rapid mixing conditions showed that both IscU and HscB interact with the low peptide affinity T-state of HscA (HscA++.ATP) and that both modestly accelerate (3-10-fold) the rate-determining steps in the HscA reaction cycle, k(hyd) and k(T-->R). When present together, IscU and HscB synergistically stimulate both k(hyd) (approximately = 500-fold) and k(T-->R) (approximately = 60-fold), leading to enhanced formation of the HscA.ADP-IscU complex (substrate capture). Following ADP/ATP exchange, IscU also stimulates k(R-->T) (approximately = 50-fold) and thereby accelerates the rate at which the low peptide affinity HscA++.ATP T-state is regenerated. Because HscA nucleotide exchange is fast, the overall rate of the chaperone cycle in vivo will be determined by the availability of the IscU-HscB substrate-co-chaperone complex.

Design of automatic control system of temperature in radon chamber controlled by air-condition based on 485 BUS

International Nuclear Information System (INIS)

Man Zaigang; Wang Renbo; Zhang Xiongjie; Zhu Zhifu; Tang Bin

2009-01-01

Radon chamber can be widely used in various radon measurement instruments for calibration, testing and radon environment experiment. According to requisition, radon chamber temperature should be controllable from +10 degree C to +30 degree C, and the temperature control accuracy of the system reaches ±1 degree C. The design of automatic temperature controlled by air-condition based on 485 BUS is introduced. The software and hardware techniques of how the ATMEL89S52 micro controller controls air-condition and communicates with computer are elaborated on. (authors)

Structural biology studies of CagA from Helicobacter pylori and histone chaperone CIA/ASF1

International Nuclear Information System (INIS)

Senda, Toshiya

2015-01-01

Crystal structures of proteins and their complexes have become critical information for molecular-based life science. Biochemical and biological analysis based on tertiary structural information is a powerful tool to unveil complex molecular processes in the cell. Here, we present two examples of the structure-based life science study, structural biology studies of CagA, an effector protein from Helicobacter pylori, and histone chaperone CIA/ASF1, which is involved in transcription initiation. (author)

Factors associated with simulator-assessed laparoscopic surgical skills of veterinary students.

Science.gov (United States)

Kilkenny, Jessica J; Singh, Ameet; Kerr, Carolyn L; Khosa, Deep K; Fransson, Boel A

2017-06-01

OBJECTIVE To determine whether simulator-assessed laparoscopic skills of veterinary students were associated with training level and prior experience performing nonlaparoscopic veterinary surgery and other activities requiring hand-eye coordination and manual dexterity. DESIGN Experiment. SAMPLE 145 students without any prior laparoscopic surgical or fundamentals of laparoscopic surgery (FLS) simulator experience in years 1 (n = 39), 2 (34), 3 (39), and 4 (33) at a veterinary college. PROCEDURES A questionnaire was used to collect data from participants regarding experience performing veterinary surgery, playing video games, and participating in other activities. Participants performed a peg transfer, pattern cutting, and ligature loop-placement task on an FLS simulator, and FLS scores were assigned by an observer. Scores were compared among academic years, and correlations between amounts of veterinary surgical experience and FLS scores were assessed. A general linear model was used to identify predictors of FLS scores. RESULTS Participants were predominantly female (75%), right-hand dominant (92%), and between 20 and 29 years of age (98%). No significant differences were identified among academic years in FLS scores for individual tasks or total FLS score. Scores were not significantly associated with prior surgical or video game experience. Participants reporting no handicraft experience had significantly lower total FLS scores and FLS scores for task 2 than did participants reporting a lot of handicraft experience. CONCLUSIONS AND CLINICAL RELEVANCE Prior veterinary surgical and video game experience had no influence on FLS scores in this group of veterinary students, suggesting that proficiency of veterinary students in FLS may require specific training.

Blinded assessment of operative performance after fundamentals of laparoscopic surgery in gynecology training.

Science.gov (United States)

Antosh, Danielle D; Auguste, Tamika; George, Elizabeth A; Sokol, Andrew I; Gutman, Robert E; Iglesia, Cheryl B; Desale, Sameer Y; Park, Amy J

2013-01-01

To determine the pass rate for the Fundamentals of Laparoscopic Surgery (FLS) examination among senior gynecology residents and fellows and to find whether there is an association between FLS scores and previous laparoscopic experience as well as laparoscopic intraoperative (OR) skills assessment. Prospective cohort study (Canadian Task Force classification II-2). Three gynecology residency training programs. Third- and fourth-year gynecology residents and urogynecology fellows. All participants participated in the FLS curriculum, written and manual skills examination, and completed a survey reporting baseline characteristics and opinions. Fourth-year residents and fellows underwent unblinded and blinded pre- and post-FLS OR assessments. Objective OR assessments of fourth-year residents after FLS were compared with those of fourth-year resident controls who were not FLS trained. Twenty-nine participants were included. The overall pass rate was 76%. The pass rate for third- and fourth-year residents and fellows were 62%, 85%, and 100%, respectively. A trend toward improvement in OR assessments was observed for fourth-year residents and fellows for pre-FLS curriculum compared with post-FLS testing, and FLS-trained fourth-year residents compared with fourth-year resident controls; however, this did not reach statistical significance. Self-report of laparoscopic case load experience of >20 cases was the only baseline factor significantly associated with passing the FLS examination (p = .03). The FLS pass rate for senior residents and fellows was 76%, with higher pass rates associated with increasing levels of training and laparoscopic case experience. Copyright © 2013 AAGL. Published by Elsevier Inc. All rights reserved.

Engineering stable topography in dense bio-mimetic 3D collagen scaffolds

Directory of Open Access Journals (Sweden)

T Alekseeva

2012-01-01

Full Text Available Topographic features are well known to influence cell behaviour and can provide a powerful tool for engineering complex, functional tissues. This study aimed to investigate the mechanisms of formation of a stable micro-topography on plastic compressed (PC collagen gels. The uni-directional fluid flow that accompanies PC of collagen gels creates a fluid leaving surface (FLS and a non-fluid leaving surface (non-FLS. Here we tested the hypothesis that the resulting anisotropy in collagen density and stiffness between FLS and non-FLS would influence the fidelity and stability of micro-grooves patterned on these surfaces. A pattern template of parallel-aligned glass fibres was introduced to the FLS or non-FLS either at the start of the compression or halfway through, when a dense FLS had already formed. Results showed that both early and late patterning of the FLS generated grooves that had depth (25 ±7 µm and 19 ±8 µm, respectively and width (55 ±11 µm and 50 ±12 µm, respectively which matched the glass fibre diameter (50 µm. In contrast, early and late patterning of the non-FLS gave much wider (151 ±50 µm and 89 ±14 µm, respectively and shallower (10 ±2.7 µm and 13 ±3.5 µm, respectively grooves than expected. The depth to width ratio of the grooves generated on the FLS remained unaltered under static culture conditions over 2 weeks, indicating that grooves were stable under long term active cell-mediated matrix remodelling. These results indicate that the FLS, characterised by a higher matrix collagen density and stiffness than the non-FLS, provides the most favourable mechanical surface for precise engineering of a stable micro-topography in 3D collagen hydrogel scaffolds.

Production of 10S-hydroxy-8(E)-octadecenoic acid from oleic acid by whole recombinant Escherichia coli cells expressing 10S-dioxygenase from Nostoc punctiforme PCC 73102 with the aid of a chaperone.

Science.gov (United States)

Kim, Min-Ji; Seo, Min-Ju; Shin, Kyung-Chul; Oh, Deok-Kun

2017-01-01

To increase the production of 10S-hydroxy-8(E)-octadecenoic acid from oleic acid by whole recombinant Escherichia coli cells expressing Nostoc punctiforme 10S-dioxygenase with the aid of a chaperone. The optimal conditions for 10S-hydroxy-8(E)-octadecenoic acid production by recombinant cells co-expressing chaperone plasmid were pH 9, 35 °C, 15 % (v/v) dimethyl sulfoxide, 40 g cells l -1 , and 10 g oleic acid l -1 . Under these conditions, recombinant cells co-expressing chaperone plasmid produced 7.2 g 10S-hydroxy-8(E)-octadecenoic acid l -1 within 30 min, with a conversion yield of 72 % (w/w) and a volumetric productivity of 14.4 g l -1 h -1 . The activity of recombinant cells expressing 10S-dioxygenase was increased by 200 % with the aid of a chaperone, demonstrating the first biotechnological production of 10S-hydroxy-8(E)-octadecenoic acid using recombinant cells expressing 10S-dioxygenase.

Intracellular delivery of poly(I:C) induces apoptosis of fibroblast-like synoviocytes via an unknown dsRNA sensor

Energy Technology Data Exchange (ETDEWEB)

Karpus, Olga N.; Hsiao, Cheng-Chih; Kort, Hanneke de; Tak, Paul P.; Hamann, Jörg, E-mail: j.hamann@amc.uva.nl

2016-08-26

Fibroblast-like synoviocytes (FLS) express functional membranous and cytoplasmic sensors for double-stranded (ds)RNA. Notably, FLS undergo apoptosis upon transfection with the synthetic dsRNA analog poly(I:C). We here studied the mechanism of intracellular poly(I:C) recognition and subsequent cell death in FLS. FLS responded similarly to poly(I:C) or 3pRNA transfection; however, only intracellular delivery of poly(I:C) induced significant cell death, accompanied by upregulation of pro-apoptotic proteins Puma and Noxa, caspase 3 cleavage, and nuclear segregation. Knockdown of the DExD/H-box helicase MDA5 did not affect the response to intracellular poly(I:C); in contrast, knockdown of RIG-I abrogated the response to 3pRNA. Knockdown of the downstream adaptor proteins IPS, STING, and TRIF or inhibition of TBK1 did not affect the response to intracellular poly(I:C), while knockdown of IFNAR blocked intracellular poly(I:C)-mediated signaling and cell death. We conclude that a so far unknown intracellular sensor recognizes linear dsRNA and induces apoptosis in FLS. - Highlights: • Intracellular poly(I:C) and 3pRNA evoke immune responses in FLS. • Only intracellular delivery of poly(I:C) induces FLS apoptosis. • FLS do not require MDA5 for their response to intracellular poly(I:C). • FLS respond to intracellular poly(I:C) independent of IPS and STING. • An unknown intracellular sensor recognizes linear dsRNA in FLS.

Mitochondrial carrier protein biogenesis: role of the chaperones Hsc70 and Hsp90.

Science.gov (United States)

Zara, Vincenzo; Ferramosca, Alessandra; Robitaille-Foucher, Philippe; Palmieri, Ferdinando; Young, Jason C

2009-04-15

Metabolite carrier proteins of the mitochondrial inner membrane share homology in their transmembrane domains, which also carries their targeting information. In addition, some carriers have cleavable presequences which are not essential for targeting, but have some other function before import. The cytosolic chaperones Hsc70 (heat-shock cognate 70) and Hsp90 (heat-shock protein 90) complex with carrier precursors and interact specifically with the Tom (translocase of the mitochondrial outer membrane) 70 import receptor to promote import. We analysed how the presequences of the PiC (phosphate carrier) and CIC (citrate carrier) relate to the mechanisms of chaperone-mediated import. Deletion of the PiC presequence reduced the efficiency of import but, notably, not by causing aggregation. Instead, binding of the protein to Hsc70 was reduced, as well as the dependence on Hsc70 for import. Hsp90 binding and function in import was not greatly affected, but it could not entirely compensate for the lack of Hsc70 interaction. Deletion of the presequence from CIC was shown to cause its aggregation, but had little effect on the contribution to import of either Hsc70 or Hsp90. The presequence of PiC, but not that of CIC, conferred Hsc70 binding to dihydrofolate reductase fusion proteins. In comparison, OGC (oxoglutarate carrier) lacks a presequence and was more soluble, though it is still dependent on both Hsc70 and Hsp90. We propose that carrier presequences evolved to improve targeting competence by different mechanisms, depending on physical properties of the precursors in the cytosolic targeting environment.

Characterization of 17 chaperone-usher fimbriae encoded by Proteus mirabilis reveals strong conservation

Science.gov (United States)

Kuan, Lisa; Schaffer, Jessica N.; Zouzias, Christos D.

2014-01-01

Proteus mirabilis is a Gram-negative enteric bacterium that causes complicated urinary tract infections, particularly in patients with indwelling catheters. Sequencing of clinical isolate P. mirabilis HI4320 revealed the presence of 17 predicted chaperone-usher fimbrial operons. We classified these fimbriae into three groups by their genetic relationship to other chaperone-usher fimbriae. Sixteen of these fimbriae are encoded by all seven currently sequenced P. mirabilis genomes. The predicted protein sequence of the major structural subunit for 14 of these fimbriae was highly conserved (≥95 % identity), whereas three other structural subunits (Fim3A, UcaA and Fim6A) were variable. Further examination of 58 clinical isolates showed that 14 of the 17 predicted major structural subunit genes of the fimbriae were present in most strains (>85 %). Transcription of the predicted major structural subunit genes for all 17 fimbriae was measured under different culture conditions designed to mimic conditions in the urinary tract. The majority of the fimbrial genes were induced during stationary phase, static culture or colony growth when compared to exponential-phase aerated culture. Major structural subunit proteins for six of these fimbriae were detected using MS of proteins sheared from the surface of broth-cultured P. mirabilis, demonstrating that this organism may produce multiple fimbriae within a single culture. The high degree of conservation of P. mirabilis fimbriae stands in contrast to uropathogenic Escherichia coli and Salmonella enterica, which exhibit greater variability in their fimbrial repertoires. These findings suggest there may be evolutionary pressure for P. mirabilis to maintain a large fimbrial arsenal. PMID:24809384

Unfolded Protein Response-regulated Drosophila Fic (dFic) Protein Reversibly AMPylates BiP Chaperone during Endoplasmic Reticulum Homeostasis*

Science.gov (United States)

Ham, Hyeilin; Woolery, Andrew R.; Tracy, Charles; Stenesen, Drew; Krämer, Helmut; Orth, Kim

2014-01-01

Drosophila Fic (dFic) mediates AMPylation, a covalent attachment of adenosine monophosphate (AMP) from ATP to hydroxyl side chains of protein substrates. Here, we identified the endoplasmic reticulum (ER) chaperone BiP as a substrate for dFic and mapped the modification site to Thr-366 within the ATPase domain. The level of AMPylated BiP in Drosophila S2 cells is high during homeostasis, whereas the level of AMPylated BiP decreases upon the accumulation of misfolded proteins in the ER. Both dFic and BiP are transcriptionally activated upon ER stress, supporting the role of dFic in the unfolded protein response pathway. The inactive conformation of BiP is the preferred substrate for dFic, thus endorsing a model whereby AMPylation regulates the function of BiP as a chaperone, allowing acute activation of BiP by deAMPylation during an ER stress response. These findings not only present the first substrate of eukaryotic AMPylator but also provide a target for regulating the unfolded protein response, an emerging avenue for cancer therapy. PMID:25395623

The ribosome-bound chaperones RAC and Ssb1/2p are required for accurate translation in Saccharomyces cerevisiae.

Science.gov (United States)

Rakwalska, Magdalena; Rospert, Sabine

2004-10-01

The chaperone homologs RAC (ribosome-associated complex) and Ssb1/2p are anchored to ribosomes; Ssb1/2p directly interacts with nascent polypeptides. The absence of RAC or Ssb1/2p results in a similar set of phenotypes, including hypersensitivity against the aminoglycoside paromomycin, which binds to the small ribosomal subunit and compromises the fidelity of translation. In order to understand this phenomenon we measured the frequency of translation termination and misincorporation in vivo and in vitro with a novel reporter system. Translational fidelity was impaired in the absence of functional RAC or Ssb1/2p, and the effect was further enhanced by paromomycin. The mutant strains suffered primarily from a defect in translation termination, while misincorporation was compromised to a lesser extent. Consistently, a low level of soluble translation termination factor Sup35p enhanced growth defects in the mutant strains. Based on the combined data we conclude that RAC and Ssb1/2p are crucial in maintaining translational fidelity beyond their postulated role as chaperones for nascent polypeptides.

Arabidopsis COLD SHOCK DOMAIN PROTEIN2 is a RNA chaperone that is regulated by cold and developmental signals

International Nuclear Information System (INIS)

Sasaki, Kentaro; Kim, Myung-Hee; Imai, Ryozo

2007-01-01

Bacterial cold shock proteins (CSPs) are RNA chaperones that unwind RNA secondary structures. Arabidopsis COLD SHOCK DOMAIN PROTEIN2 (AtCSP2) contains a domain that is shared with bacterial CSPs. Here we showed that AtCSP2 binds to RNA and unwinds nucleic acid duplex. Heterologous expression of AtCSP2 complemented cold sensitivity of an Escherichia coli csp quadruple mutant, indicating that AtCSP2 function as a RNA chaperone in E. coli. AtCSP2 mRNA and protein levels increased during cold acclimation, but the protein accumulation was most prominent after 10 days of cold treatment. AtCSP2 promoter::GUS transgenic plants revealed that AtCSP2 is expressed only in root and shoot apical regions during vegetative growth but is expressed in reproductive organs such as pollens, ovules and embryos. These data indicated that AtCSP2 is involved in developmental processes as well as cold adaptation. Localization of AtCSP2::GFP in nucleolus and cytoplasm suggested different nuclear and cytosolic RNA targets

Sigma-1 receptor chaperone at the ER-mitochondrion interface mediates the mitochondrion-ER-nucleus signaling for cellular survival.

Directory of Open Access Journals (Sweden)

Tomohisa Mori

Full Text Available The membrane of the endoplasmic reticulum (ER of a cell forms contacts directly with mitochondria whereby the contact is referred to as the mitochondrion-associated ER membrane or the MAM. Here we found that the MAM regulates cellular survival via an MAM-residing ER chaperone the sigma-1 receptor (Sig-1R in that the Sig-1R chaperones the ER stress sensor IRE1 to facilitate inter-organelle signaling for survival. IRE1 is found in this study to be enriched at the MAM in CHO cells. We found that IRE1 is stabilized at the MAM by Sig-1Rs when cells are under ER stress. Sig-1Rs stabilize IRE1 and thus allow for conformationally correct IRE1 to dimerize into the long-lasting, activated endonuclease. The IRE1 at the MAM also responds to reactive oxygen species derived from mitochondria. Therefore, the ER-mitochondrion interface serves as an important subcellular entity in the regulation of cellular survival by enhancing the stress-responding signaling between mitochondria, ER, and nucleus.

Sigma-1 receptor chaperone at the ER-mitochondrion interface mediates the mitochondrion-ER-nucleus signaling for cellular survival.

Science.gov (United States)

Mori, Tomohisa; Hayashi, Teruo; Hayashi, Eri; Su, Tsung-Ping

2013-01-01

The membrane of the endoplasmic reticulum (ER) of a cell forms contacts directly with mitochondria whereby the contact is referred to as the mitochondrion-associated ER membrane or the MAM. Here we found that the MAM regulates cellular survival via an MAM-residing ER chaperone the sigma-1 receptor (Sig-1R) in that the Sig-1R chaperones the ER stress sensor IRE1 to facilitate inter-organelle signaling for survival. IRE1 is found in this study to be enriched at the MAM in CHO cells. We found that IRE1 is stabilized at the MAM by Sig-1Rs when cells are under ER stress. Sig-1Rs stabilize IRE1 and thus allow for conformationally correct IRE1 to dimerize into the long-lasting, activated endonuclease. The IRE1 at the MAM also responds to reactive oxygen species derived from mitochondria. Therefore, the ER-mitochondrion interface serves as an important subcellular entity in the regulation of cellular survival by enhancing the stress-responding signaling between mitochondria, ER, and nucleus.

Binding Affects the Tertiary and Quaternary Structures of the Shigella Translocator Protein IpaB and its Chaperone IpgC†

Science.gov (United States)

Adam, Philip R.; Patil, Mrinalini K.; Dickenson, Nicholas E.; Choudhari, Shyamal; Barta, Michael; Geisbrecht, Brian V.; Picking, Wendy L.; Picking, William D.

2012-01-01

Shigella flexneri uses its type III secretion system (T3SS) to promote invasion of human intestinal epithelial cells as the first step in causing shigellosis, a life threatening form of dysentery. The Shigella type III secretion apparatus (T3SA) consists of a basal body that spans the bacterial envelope and an exposed needle that injects effector proteins into target cells. The nascent Shigella T3SA needle is topped with a pentamer of the needle tip protein invasion plasmid antigen D (IpaD). Bile salts trigger recruitment of the first hydrophobic translocator protein, IpaB, to the tip complex where it senses contact with a host membrane. In the bacterial cytoplasm, IpaB exists in a complex with its chaperone IpgC. Several structures of IpgC have been solved and we recently reported the 2.1-Å crystal structure of the N-terminal domain (IpaB74.224) of IpaB. Like IpgC, the IpaB N-terminal domain exists as a homodimer in solution. We now report that when the two are mixed, these homodimers dissociate and form heterodimers having a nanomolar dissociation constant. This is consistent with the equivalent complexes co-purified after being co-expressed in E. coli. Fluorescence data presented here also indicate that the N-terminal domain of IpaB possesses two regions that appear to contribute additively to chaperone binding. It is also likely that the IpaB N terminus adopts an alternative conformation as a result of chaperone binding. The importance of these findings within the functional context of these proteins is discussed. PMID:22497344

The chaperone role of the pyridoxal 5'-phosphate and its implications for rare diseases involving B6-dependent enzymes.

Science.gov (United States)

Cellini, Barbara; Montioli, Riccardo; Oppici, Elisa; Astegno, Alessandra; Voltattorni, Carla Borri

2014-02-01

The biologically active form of the B6 vitamers is pyridoxal 5'-phosphate (PLP), which plays a coenzymatic role in several distinct enzymatic activities ranging from the synthesis, interconversion and degradation of amino acids to the replenishment of one-carbon units, synthesis and degradation of biogenic amines, synthesis of tetrapyrrolic compounds and metabolism of amino-sugars. In the catalytic process of PLP-dependent enzymes, the substrate amino acid forms a Schiff base with PLP and the electrophilicity of the PLP pyridine ring plays important roles in the subsequent catalytic steps. While the essential role of PLP in the acquisition of biological activity of many proteins is long recognized, the finding that some PLP-enzymes require the coenzyme for refolding in vitro points to an additional role of PLP as a chaperone in the folding process. Mutations in the genes encoding PLP-enzymes are causative of several rare inherited diseases. Patients affected by some of these diseases (AADC deficiency, cystathionuria, homocystinuria, gyrate atrophy, primary hyperoxaluria type 1, xanthurenic aciduria, X-linked sideroblastic anaemia) can benefit, although at different degrees, from the administration of pyridoxine, a PLP precursor. The effect of the coenzyme is not limited to mutations that affect the enzyme-coenzyme interaction, but also to those that cause folding defects, reinforcing the idea that PLP could play a chaperone role and improve the folding efficiency of misfolded variants. In this review, recent biochemical and cell biology studies highlighting the chaperoning activity of the coenzyme on folding-defective variants of PLP-enzymes associated with rare diseases are presented and discussed. Copyright © 2013 The Canadian Society of Clinical Chemists. Published by Elsevier Inc. All rights reserved.

The chaperone BAG6 captures dislocated glycoproteins in the cytosol.

Directory of Open Access Journals (Sweden)

Jasper H L Claessen

Full Text Available Secretory and membrane (glycoproteins are subject to quality control in the endoplasmic reticulum (ER to ensure that only functional proteins reach their destination. Proteins deemed terminally misfolded and hence functionally defective may be dislocated to the cytosol, where the proteasome degrades them. What we know about this process stems mostly from overexpression of tagged misfolded proteins, or from situations where viruses have hijacked the quality control machinery to their advantage. We know of only very few endogenous substrates of ER quality control, most of which are degraded as part of a signaling pathway, such as Insig-1, but such examples do not necessarily represent terminally misfolded proteins. Here we show that endogenous dislocation clients are captured specifically in association with the cytosolic chaperone BAG6, or retrieved en masse via their glycan handle.

The Arabidopsis histone chaperone FACT is required for stress-induced expression of anthocyanin biosynthetic genes.

Science.gov (United States)

Pfab, Alexander; Breindl, Matthias; Grasser, Klaus D

2018-03-01

The histone chaperone FACT is involved in the expression of genes encoding anthocyanin biosynthetic enzymes also upon induction by moderate high-light and therefore contributes to the stress-induced plant pigmentation. The histone chaperone FACT consists of the SSRP1 and SPT16 proteins and associates with transcribing RNAPII (RNAPII) along the transcribed region of genes. FACT can promote transcriptional elongation by destabilising nucleosomes in the path of RNA polymerase II, thereby facilitating efficient transcription of chromatin templates. Transcript profiling of Arabidopsis plants depleted in SSRP1 or SPT16 demonstrates that only a small subset of genes is differentially expressed relative to wild type. The majority of these genes is either up- or down-regulated in both the ssrp1 and spt16 plants. Among the down-regulated genes, those encoding enzymes of the biosynthetic pathway of the plant secondary metabolites termed anthocyanins (but not regulators of the pathway) are overrepresented. Upon exposure to moderate high-light stress several of these genes are up-regulated to a lesser extent in ssrp1/spt16 compared to wild type plants, and accordingly the mutant plants accumulate lower amounts of anthocyanin pigments. Moreover, the expression of SSRP1 and SPT16 is induced under these conditions. Therefore, our findings indicate that FACT is a novel factor required for the accumulation of anthocyanins in response to light-induction.

Intracellular dynamics of the Hsp90 co-chaperone p23 is dictated by Hsp90

International Nuclear Information System (INIS)

Picard, Didier

2006-01-01

p23 is a component of the Hsp90 molecular chaperone machine. It binds and stabilizes the ATP-bound dimeric form of Hsp90. Since Hsp90 binds protein substrates in the ATP conformation, p23 has been proposed to stabilize Hsp90-substrate complexes. In addition, p23 can also function as a molecular chaperone by itself and even possesses an unrelated enzymatic activity. Whether it fulfills the latter functions in cells while bound to Hsp90 remains unknown and is difficult to extrapolate from cell-free biochemical experiments. Using the 'fluorescence recovery after photobleaching' (FRAP) technology, I have examined the dynamics of human p23, expressed as a fusion protein with the green fluorescent protein (GFP), in living human HeLa cells. GFP-p23 is distributed throughout the cell, and its mobility is identical in the cytoplasm and in the nucleus. When the Hsp90 interaction is disrupted either with the Hsp90 inhibitor geldanamycin or by introduction of point mutations into p23, the mobility of p23 is greatly accelerated. Under these conditions, its intracellular movement may be diffusion-controlled. In contrast, when wild-type p23 is able to bind Hsp90, a more complex FRAP behavior is observed, suggesting that it is quantitatively bound in Hsp90 complexes undergoing a multitude of other interactions

Fab Chaperone-Assisted RNA Crystallography (Fab CARC).

Science.gov (United States)

Sherman, Eileen; Archer, Jennifer; Ye, Jing-Dong

2016-01-01

Recent discovery of structured RNAs such as ribozymes and riboswitches shows that there is still much to learn about the structure and function of RNAs. Knowledge learned can be employed in both biochemical research and clinical applications. X-ray crystallography gives unparalleled atomic-level structural detail from which functional inferences can be deduced. However, the difficulty in obtaining high-quality crystals and their phasing information make it a very challenging task. RNA crystallography is particularly arduous due to several factors such as RNA's paucity of surface chemical diversity, lability, repetitive anionic backbone, and flexibility, all of which are counterproductive to crystal packing. Here we describe Fab chaperone assisted RNA crystallography (CARC), a systematic technique to increase RNA crystallography success by facilitating crystal packing as well as expediting phase determination through molecular replacement of conserved Fab domains. Major steps described in this chapter include selection of a synthetic Fab library displayed on M13 phage against a structured RNA crystallization target, ELISA for initial choice of binding Fabs, Fab expression followed by protein A affinity then cation exchange chromatography purification, final choice of Fab by binding specificity and affinity as determined by a dot blot assay, and lastly gel filtration purification of a large quantity of chosen Fabs for crystallization.

Water-structuring technology with the molecular chaperone proteins: indicated application of the α-crystallin domains and imidazole-containing peptidomimetics in cosmetic skin care systems or dermatological therapeutic drug carrier formulations.

Science.gov (United States)

Babizhayev, Mark A; Nikolayev, Gennady M; Nikolayeva, Juliana G; Yegorov, Yegor E

2011-01-01

Changes in structural proteins and hydration during aging are responsible for altered skin morphologic and mechanical properties manifested as wrinkling, sagging, loss of elasticity, and apparent dryness. Impairment in protein hydration may add to the ultrastructural, mechanical, and biochemical changes in structural proteins in the aged skin. At Innovative Vision Products, Inc., we have pioneered a molecular chaperone protein-activated therapeutic or cosmetic platform to enable simultaneous analysis of water-binding and structuring characteristics for biology-related or skin aging and skin disease-related pathways. This cutting-edge technology has changed the hydration of proteins in photoaged skin which so that they are more compact and interact with water to limited degree. The mechanisms of skin diseases, aging, and cellular and signaling pathways mediated by targeting with molecular chaperone protein(s) are considered. Skin lesions that are growing, spreading, or pigmented, and those that occur on exposed areas of skin are likely to be treated by these emerging pharmacological chaperones that could have cosmetic or dermatological benefits. Examples of such chaperones are anti-/trans-glycation-imidazole-containing peptidomimetic(s) (natural L-carnosine derivatives and mimetics) combined with the molecular chaperone protein α-crystallin derived from a natural source, brine shrimp (Artemia franciscana) cysts, or with recombinant human αA-crystallin. This patented biotechnology represents an efficient tool with which to mitigate the consequences of free radical-induced skin damage. The article is organized to provide in one place all of the relevant technical information, such as high-performance nuclear magnetic resonance and electron spin resonance application tools, and to describe the entire process from sample preparation to data analysis, which is moving from biological studies to biotechnology batches of the product. The proposed biotechnology results in

Study of chaperone-like activity of human haptoglobin: conformational changes under heat shock conditions and localization of interaction sites

Czech Academy of Sciences Publication Activity Database

Ettrich, R.; Brandt, W.; Kopecký ml., V.; Baumruk, V.; Hofbauerová, Kateřina; Pavlíček, Z.

2002-01-01

Roč. 383, č. 10 (2002), s. 1667-1676 ISSN 1431-6730 Grant - others:GA UK(CZ) 220/2000/B-CH; Volkswagen Foundation(DE) I/74679 Institutional research plan: CEZ:AV0Z5011922; CEZ:MSM 113100001 Keywords : chaperone * haptoglobin * molecular modeling Subject RIV: BO - Biophysics Impact factor: 2.548, year: 2002

Mimicking the action of folding chaperones by Hamiltonian replica-exchange molecular dynamics simulations : Application in the refinement of de novo models

NARCIS (Netherlands)

Fan, Hao; Periole, Xavier; Mark, Alan E.

The efficiency of using a variant of Hamiltonian replica-exchange molecular dynamics (Chaperone H-replica-exchange molecular dynamics [CH-REMD]) for the refinement of protein structural models generated de novo is investigated. In CH-REMD, the interaction between the protein and its environment,

HspB8 Participates in Protein Quality Control by a Non-chaperone-like Mechanism That Requires eIF2 alpha Phosphorylation

NARCIS (Netherlands)

Carra, Serena; Brunsting, Jeanette F.; Lambert, Herman; Landry, Jacques; Kampinga, Harm H.

2009-01-01

Aggregation of mutated proteins is a hallmark of many neurodegenerative disorders, including Huntington disease. We previously reported that overexpression of the HspB8 . Bag3 chaperone complex suppresses mutated huntingtin aggregation via autophagy. Classically, HspB proteins are thought to act as

CLONING, SEQUENCE ANALYSIS, AND CHARACTERIZATION OF PUTATIVE BETA-LACTAMASE OF STENOTROPHOMONAS MALTOPHILIA

Directory of Open Access Journals (Sweden)

Chong Seng Shueh

2012-10-01

Full Text Available The main objective of current study was to explore the function of chromosomal putative beta-lactamase gene (smlt 0115 in clinical Stenotrophomonas maltophilia. Antibiotic susceptibility test (AST screening for current antimicrobial drugs was done and Minimum Inhibitory Concentration (MIC level towards beta-lactams was determined by E-test. Putative beta-lactamase gene of S. maltophilia was amplified via PCR, with specific primers, then cloned into pET-15 expression plasmid and transformed into Escherichia coli BL21. The gene was sequenced and analyzed. The expressed protein was purified by affinity chromatography and the kinetic assay was performed. S. maltophilia ATCC 13637 was included in this experiment. Besides, a hospital strain which exhibited resistant to a series of beta-lactams including cefepime was identified via AST and MIC, hence it was named as S2 strain and was considered in this study. Sequencing result showed that putative beta-lactamase gene obtained from ATCC 13637 and S2 strains were predicted to have cephalosporinase activity by National Center for Biotechnology Information (NCBI blast program. Differences in the sequences of both ATCC 13637 and S2 strains were found via ClustalW alignment software. Kinetic assay proved a cephalosporinase characteristic produced by E. coli BL21 clone that overexpressed the putative beta-lactamase gene cloned under the control of an external promoter. Yet, expressed protein purified from S2 strain had high catalytic activity against beta-lactam antibiotics which was 14-fold higher than expressed protein purified from ATCC 13637 strain. This study represents the characterization analysis of putative beta-lactamase gene (smlt 0115 of S. maltophilia. The presence of the respective gene in the chromosome of S. maltophilia suggested that putative beta-lactamase gene (smlt 0115 of S. maltophilia plays a role in beta-lactamase resistance.

Gut Microbiome and Putative Resistome of Inca and Italian Nobility Mummies.

Science.gov (United States)

Santiago-Rodriguez, Tasha M; Fornaciari, Gino; Luciani, Stefania; Toranzos, Gary A; Marota, Isolina; Giuffra, Valentina; Cano, Raul J

2017-11-07

Little is still known about the microbiome resulting from the process of mummification of the human gut. In the present study, the gut microbiota, genes associated with metabolism, and putative resistome of Inca and Italian nobility mummies were characterized by using high-throughput sequencing. The Italian nobility mummies exhibited a higher bacterial diversity as compared to the Inca mummies when using 16S ribosomal (rRNA) gene amplicon sequencing, but both groups showed bacterial and fungal taxa when using shotgun metagenomic sequencing that may resemble both the thanatomicrobiome and extant human gut microbiomes. Identification of sequences associated with plants, animals, and carbohydrate-active enzymes (CAZymes) may provide further insights into the dietary habits of Inca and Italian nobility mummies. Putative antibiotic-resistance genes in the Inca and Italian nobility mummies support a human gut resistome prior to the antibiotic therapy era. The higher proportion of putative antibiotic-resistance genes in the Inca compared to Italian nobility mummies may support the hypotheses that a greater exposure to the environment may result in a greater acquisition of antibiotic-resistance genes. The present study adds knowledge of the microbiome resulting from the process of mummification of the human gut, insights of ancient dietary habits, and the preserved putative human gut resistome prior the antibiotic therapy era.

A Functional Assay for Putative Mouse and Human Definitive Endoderm using Chick Whole-Embryo Cultures

DEFF Research Database (Denmark)

Johannesson, Martina; Semb, Tor Henrik; Serup, Palle

2012-01-01

. Thus, the purpose of this study is to describe a method whereby the in vivo functionality of DE derived from ESCs can be assessed. Methods: By directed differentiation, putative DE was derived from human and mouse ESCs. This putative DE was subsequently transplanted into the endoderm of chick embryos...... to determine any occurrence of integration. Putative DE was analyzed by gene and protein expression prior to transplantation and 48 h post transplantation. Results: Putative DE, derived from mouse and human ESCs, was successfully integrated within the chick endoderm. Endoderm-specific genes were expressed...... result show that putative DE integrates with the chick endoderm and participate in the development of the chicken gut, indicating the generation of functional DE from ESCs. This functional assay can be used to assess the generation of functional DE derived from both human and mouse ESCs and provides...

Sodium 4-phenylbutyrate acts as a chemical chaperone on misfolded myocilin to rescue cells from endoplasmic reticulum stress and apoptosis.

Science.gov (United States)

Yam, Gary Hin-Fai; Gaplovska-Kysela, Katarina; Zuber, Christian; Roth, Jürgen

2007-04-01

To evaluate the effect of chemical chaperones on the trafficking of secretion-incompetent primary open-angle glaucoma-associated mutant myocilin and the possibility to rescue cells coexpressing mutant and wild-type myocilin from endoplasmic reticulum (ER) stress and apoptosis. CHO-K1, HEK293 and human trabecular meshwork cells were transfected to express wild-type or mutant (C245Y, G364V, P370L, Y437H) myocilin-green fluorescent protein fusion protein and were treated or not with various chemical chaperones (glycerol, dimethylsulfoxide, or sodium 4-phenylbutyrate) for different time periods. The secretion, Triton X-100 solubility, and intracellular distribution of wild-type and mutant myocilin were analyzed by immunoprecipitation, Western blotting, and confocal double immunofluorescence. The effect of sodium 4-phenylbutyrate on ER stress proteins and apoptosis was examined in cells coexpressing mutant and wild-type myocilin. Treatment with sodium 4-phenylbutyrate, but not with glycerol or dimethylsulfoxide, reduced the amount of detergent-insoluble myocilin aggregates, diminished myocilin interaction with calreticulin, and restored the secretion of mutant myocilin. Heteromeric complexes formed by mutant and wild-type myocilin induced the ER stress-associated phosphorylated form of ER-localized eukaryotic initiation factor (eIF)-2alpha kinase and the active form of caspase 3, which resulted in an increased rate of apoptosis. Sodium 4-phenylbutyrate treatment of cells coexpressing mutant and wild-type myocilin relieved ER stress and significantly reduced the rate of apoptosis. These findings indicate that sodium 4-phenylbutyrate protects cells from the deleterious effects of ER-retained aggregated mutant myocilin. These data point to the possibility of a chemical chaperone treatment for myocilin-caused primary open-angle glaucoma.

Toddlers' Duration of Attention toward Putative Threat

Science.gov (United States)

Kiel, Elizabeth J.; Buss, Kristin A.

2011-01-01

Although individual differences in reactions to novelty in the toddler years have been consistently linked to risk of developing anxious behavior, toddlers' attention toward a novel, putatively threatening stimulus while in the presence of other enjoyable activities has rarely been examined as a precursor to such risk. The current study examined…

A Proteomic Screen Identified Stress-Induced Chaperone Proteins as Targets of Akt Phosphorylation in Mesangial Cells

OpenAIRE

Barati, Michelle T.; Rane, Madhavi J.; Klein, Jon B.; McLeish, Kenneth R.

2006-01-01

The serine-threonine kinase Akt regulates mesangial cell apoptosis, proliferation, and hypertrophy. To define Akt signaling pathways in mesangial cells, we performed a functional proteomic screen for rat mesangial cell proteins phosphorylated by Akt. A group of chaperone proteins, heat shock protein (Hsp) 70, Hsp90α, Hsp90β, Glucose-regulated protein (Grp) Grp78, Grp94, and protein disulfide isomerase (PDI) were identified as potential Akt substrates by two techniques: (a) in vitro phosphoryl...

Counteraction of urea-induced protein denaturation by trimethylamine N-oxide: A chemical chaperone at atomic resolution

OpenAIRE

Bennion, Brian J.; Daggett, Valerie

2004-01-01

Proteins are very sensitive to their solvent environments. Urea is a common chemical denaturant of proteins, yet some animals contain high concentrations of urea. These animals have evolved an interesting mechanism to counteract the effects of urea by using trimethylamine N-oxide (TMAO). The molecular basis for the ability of TMAO to act as a chemical chaperone remains unknown. Here, we describe molecular dynamics simulations of a small globular protein, chymotrypsin inhibitor 2, in 8 M urea ...

Invasiveness of fibroblast-like synoviocytes is an individual patient characteristic associated with the rate of joint destruction in patients with rheumatoid arthritis.

Science.gov (United States)

Tolboom, Tanja C A; van der Helm-Van Mil, Annette H M; Nelissen, Rob G H H; Breedveld, Ferdinand C; Toes, René E M; Huizinga, Tom W J

2005-07-01

Rheumatoid arthritis (RA) is characterized by inflammation and destruction of synovial joints. Fibroblast-like synoviocytes (FLS) harvested from synovial tissue of patients with RA can invade normal human cartilage in severe combined immunodeficient (SCID) mice and Matrigel basement membrane matrix in vitro. This study was undertaken to investigate the association of these in vitro characteristics with disease characteristics in patients with RA. Synovial tissue samples from 72 RA and 49 osteoarthritis (OA) patients were obtained. Samples of different joints were collected from 7 patients with RA. The FLS invasiveness in Matrigel was studied, and the intraindividual and interindividual differences were compared. From the patients with FLS who exhibited the most extreme differences in in vitro ingrowth (most and least invasive FLS), radiographs of the hands and feet were collected and scored according to the Sharp/van der Heijde method to determine the relationship between in vitro invasion data and estimated yearly joint damage progression. FLS from patients with RA were more invasive than FLS from patients with OA (P patient characteristic. The mean +/- SEM Sharp score on radiographs of the hands or feet divided by the disease duration was 4.4 +/- 1.1 units per year of disease duration in patients with the least invasive FLS (n = 9), which was much lower compared with the 21.8 +/- 3.1 units per year of disease duration in patients with the most invasive FLS (n = 9) (P patient characteristic, given the much smaller intraindividual than interindividual FLS variation.

Sonic Hedgehog Signaling Drives Proliferation of Synoviocytes in Rheumatoid Arthritis: A Possible Novel Therapeutic Target

Directory of Open Access Journals (Sweden)

Mingxia Wang

2014-01-01

Full Text Available Sonic hedgehog (Shh signaling controls many aspects of human development, regulates cell growth and differentiation in adult tissues, and is activated in a number of malignancies. Rheumatoid arthritis (RA is characterized by chronic synovitis and pannus formation associated with activation of fibroblast-like synoviocytes (FLS. We investigated whether Shh signaling plays a role in the proliferation of FLS in RA. Expression of Shh signaling related components (Shh, Ptch1, Smo, and Gli1 in RA synovial tissues was examined by immunohistochemistry (IHC and in FLS by IHC, immunofluorescence (IF, quantitative RT-PCR, and western blotting. Expression of Shh, Smo, and Gli1 in RA synovial tissue was higher than that in control tissue (P<0.05. Cyclopamine (a specific inhibitor of Shh signaling decreased mRNA expression of Shh, Ptch1, Smo, and Gli1 in cultured RA FLS, Shh, and Smo protein expression, and significantly decreased FLS proliferation. Flow cytometry analysis suggested that cyclopamine treatment resulted in cell cycle arrest of FLS in G1 phase. Our data show that Shh signaling is activated in synovium of RA patients in vivo and in cultured FLS form RA patients in vitro, suggesting a role in the proliferation of FLS in RA. It may therefore be a novel therapeutic target in RA.

The S/T-Rich Motif in the DNAJB6 Chaperone Delays Polyglutamine Aggregation and the Onset of Disease in a Mouse Model

NARCIS (Netherlands)

Kakkar, Vaishali; Mansson, Cecilia; de Mattos, Eduardo P.; Bergink, Steven; van der Zwaag, Marianne; van Waarde-Verhagen, M A W H; Kloosterhuis, Niels J.; Melki, Ronald; van Cruchten, Remco T. P.; Al-Karadaghi, Salam; Arosio, Paolo; Dobson, Christopher M.; Knowles, Tuomas P. J.; Bates, Gillian P.; van Deursen, Jan M.; Linse, Sara; van de Sluis, Bart; Emanuelsson, Cecilia; Kampinga, Harm H.

2016-01-01

Expanded CAG repeats lead to debilitating neurodegenerative disorders characterized by aggregation of proteins with expanded polyglutamine (polyQ) tracts. The mechanism of aggregation involves primary and secondary nucleation steps. We show how a noncanonical member of the DNAJ-chaperone family,

Evolutionary Conservation and Emerging Functional Diversity of the Cytosolic Hsp70:J Protein Chaperone Network of Arabidopsis thaliana.

Science.gov (United States)

Verma, Amit K; Diwan, Danish; Raut, Sandeep; Dobriyal, Neha; Brown, Rebecca E; Gowda, Vinita; Hines, Justin K; Sahi, Chandan

2017-06-07

Heat shock proteins of 70 kDa (Hsp70s) partner with structurally diverse Hsp40s (J proteins), generating distinct chaperone networks in various cellular compartments that perform myriad housekeeping and stress-associated functions in all organisms. Plants, being sessile, need to constantly maintain their cellular proteostasis in response to external environmental cues. In these situations, the Hsp70:J protein machines may play an important role in fine-tuning cellular protein quality control. Although ubiquitous, the functional specificity and complexity of the plant Hsp70:J protein network has not been studied. Here, we analyzed the J protein network in the cytosol of Arabidopsis thaliana and, using yeast genetics, show that the functional specificities of most plant J proteins in fundamental chaperone functions are conserved across long evolutionary timescales. Detailed phylogenetic and functional analysis revealed that increased number, regulatory differences, and neofunctionalization in J proteins together contribute to the emerging functional diversity and complexity in the Hsp70:J protein network in higher plants. Based on the data presented, we propose that higher plants have orchestrated their "chaperome," especially their J protein complement, according to their specialized cellular and physiological stipulations. Copyright © 2017 Verma et al.

Identification and characterization of putative conserved IAM ...

African Journals Online (AJOL)

Available putative AMI sequences from a wide array of monocot and dicot plants were identified and the phylogenetic tree was constructed and analyzed. We identified in this tree, a clade that contained sequences from species across the plant kingdom suggesting that AMI is conserved and may have a primary role in plant ...

FOCEX: A fiber-optic extender for a high speed parallel RS485 data cable

International Nuclear Information System (INIS)

Meadows, J.T.; Anderson, J.T.; Cooper, P.S.; Engelfried, J.; Franzen, J.W.; Forster, B.G.; Levinson, F.; Rawls, J.; Haber, S.

1995-05-01

For longer-distant, high speed data links, optical fibre becomes most cost-effective than copper or other hard wire cable systems. Fermilab supplied to Finisar Corp. of Menlo Park, CA., a set of specifications for card functions, sizes and interconnector pin assignments. Finisar designed and assembled a set of fiber optical P.C. cards using 100 megabyte/sec commercial optoelectronics and a serialization and deserialization HOT-ROD chipset designed by GAZELLE Microcircuits, Inc. (A Tri Quint Semiconductors company). The cooperative effort between Fermilab and Finisar has allowed Fermilab to created a reliable 50 Megabytes/sec (40 bit parallel RS485 DART data bus) cable to cable extender using a virtually invisible Fiber Channel point-to-point(FC-0) fiber optical single-simplex system. The system is easily capable of sustaining a 50 megabytes/sec of data, control and status line throughput at distances of 1625 feet (500 meters) using standard multi-mode fiber

The exported chaperone Hsp70-x supports virulence functions for Plasmodium falciparum blood stage parasites

Science.gov (United States)

Charnaud, Sarah C.; Dixon, Matthew W. A.; Nie, Catherine Q.; Chappell, Lia; Sanders, Paul R.; Nebl, Thomas; Hanssen, Eric; Berriman, Matthew; Chan, Jo-Anne; Blanch, Adam J.; Beeson, James G.; Rayner, Julian C.; Przyborski, Jude M.; Tilley, Leann; Crabb, Brendan S.

2017-01-01

Malaria is caused by five different Plasmodium spp. in humans each of which modifies the host erythrocyte to survive and replicate. The two main causes of malaria, P. falciparum and P. vivax, differ in their ability to cause severe disease, mainly due to differences in the cytoadhesion of infected erythrocytes (IE) in the microvasculature. Cytoadhesion of P. falciparum in the brain leads to a large number of deaths each year and is a consequence of exported parasite proteins, some of which modify the erythrocyte cytoskeleton while others such as PfEMP1 project onto the erythrocyte surface where they bind to endothelial cells. Here we investigate the effects of knocking out an exported Hsp70-type chaperone termed Hsp70-x that is present in P. falciparum but not P. vivax. Although the growth of Δhsp70-x parasites was unaffected, the export of PfEMP1 cytoadherence proteins was delayed and Δhsp70-x IE had reduced adhesion. The Δhsp70-x IE were also more rigid than wild-type controls indicating changes in the way the parasites modified their host erythrocyte. To investigate the cause of this, transcriptional and translational changes in exported and chaperone proteins were monitored and some changes were observed. We propose that PfHsp70-x is not essential for survival in vitro, but may be required for the efficient export and functioning of some P. falciparum exported proteins. PMID:28732045

The exported chaperone Hsp70-x supports virulence functions for Plasmodium falciparum blood stage parasites.

Directory of Open Access Journals (Sweden)

Sarah C Charnaud

Full Text Available Malaria is caused by five different Plasmodium spp. in humans each of which modifies the host erythrocyte to survive and replicate. The two main causes of malaria, P. falciparum and P. vivax, differ in their ability to cause severe disease, mainly due to differences in the cytoadhesion of infected erythrocytes (IE in the microvasculature. Cytoadhesion of P. falciparum in the brain leads to a large number of deaths each year and is a consequence of exported parasite proteins, some of which modify the erythrocyte cytoskeleton while others such as PfEMP1 project onto the erythrocyte surface where they bind to endothelial cells. Here we investigate the effects of knocking out an exported Hsp70-type chaperone termed Hsp70-x that is present in P. falciparum but not P. vivax. Although the growth of Δhsp70-x parasites was unaffected, the export of PfEMP1 cytoadherence proteins was delayed and Δhsp70-x IE had reduced adhesion. The Δhsp70-x IE were also more rigid than wild-type controls indicating changes in the way the parasites modified their host erythrocyte. To investigate the cause of this, transcriptional and translational changes in exported and chaperone proteins were monitored and some changes were observed. We propose that PfHsp70-x is not essential for survival in vitro, but may be required for the efficient export and functioning of some P. falciparum exported proteins.

Gut Microbiome and Putative Resistome of Inca and Italian Nobility Mummies

Directory of Open Access Journals (Sweden)

Tasha M. Santiago-Rodriguez

2017-11-01

Full Text Available Little is still known about the microbiome resulting from the process of mummification of the human gut. In the present study, the gut microbiota, genes associated with metabolism, and putative resistome of Inca and Italian nobility mummies were characterized by using high-throughput sequencing. The Italian nobility mummies exhibited a higher bacterial diversity as compared to the Inca mummies when using 16S ribosomal (rRNA gene amplicon sequencing, but both groups showed bacterial and fungal taxa when using shotgun metagenomic sequencing that may resemble both the thanatomicrobiome and extant human gut microbiomes. Identification of sequences associated with plants, animals, and carbohydrate-active enzymes (CAZymes may provide further insights into the dietary habits of Inca and Italian nobility mummies. Putative antibiotic-resistance genes in the Inca and Italian nobility mummies support a human gut resistome prior to the antibiotic therapy era. The higher proportion of putative antibiotic-resistance genes in the Inca compared to Italian nobility mummies may support the hypotheses that a greater exposure to the environment may result in a greater acquisition of antibiotic-resistance genes. The present study adds knowledge of the microbiome resulting from the process of mummification of the human gut, insights of ancient dietary habits, and the preserved putative human gut resistome prior the antibiotic therapy era.

Ten Putative Contributors to the Obesity Epidemic

Science.gov (United States)

McAllister, Emily J.; Dhurandhar, Nikhil V.; Keith, Scott W.; Aronne, Louis J.; Barger, Jamie; Baskin, Monica; Benca, Ruth M.; Biggio, Joseph; Boggiano, Mary M.; Eisenmann, Joe C.; Elobeid, Mai; Fontaine, Kevin R.; Gluckman, Peter; Hanlon, Erin C.; Katzmarzyk, Peter; Pietrobelli, Angelo; Redden, David T.; Ruden, Douglas M.; Wang, Chenxi; Waterland, Robert A.; Wright, Suzanne M.; Allison, David B.

2010-01-01

The obesity epidemic is a global issue and shows no signs of abating, while the cause of this epidemic remains unclear. Marketing practices of energy-dense foods and institutionally-driven declines in physical activity are the alleged perpetrators for the epidemic, despite a lack of solid evidence to demonstrate their causal role. While both may contribute to obesity, we call attention to their unquestioned dominance in program funding and public efforts to reduce obesity, and propose several alternative putative contributors that would benefit from equal consideration and attention. Evidence for microorganisms, epigenetics, increasing maternal age, greater fecundity among people with higher adiposity, assortative mating, sleep debt, endocrine disruptors, pharmaceutical iatrogenesis, reduction in variability of ambient temperatures, and intrauterine and intergenerational effects, as contributing factors to the obesity epidemic are reviewed herein. While the evidence is strong for some contributors such as pharmaceutical-induced weight gain, it is still emerging for other reviewed factors. Considering the role of such putative etiological factors of obesity may lead to comprehensive, cause specific, and effective strategies for prevention and treatment of this global epidemic. PMID:19960394

Christine Bard, Sylvie Chaperon (dirs), Dictionnaire des féministes. France xviiie-

OpenAIRE

Rouch, Marine

2017-01-01

Dix années auront été nécessaires pour la réalisation de cet ouvrage, véritable événement éditorial de l’année 2017 pour celles et ceux qui s’intéressent de près ou de loin au féminisme, à ses figures, à ses groupes. Comme l’indiquent Christine Bard et Sylvie Chaperon, les directrices de publication, il est désormais le premier du genre à alimenter l’« espace mémoriel immatériel du féminisme » (p. IX) et à inviter au « voyage dans le temps et l’espace du féminisme » (p. X). Il faut souligner ...

Putative Risk Factors in Developmental Dyslexia: A Case-Control Study of Italian Children

Science.gov (United States)

Mascheretti, Sara; Marino, Cecilia; Simone, Daniela; Quadrelli, Ermanno; Riva, Valentina; Cellino, Maria Rosaria; Maziade, Michel; Brombin, Chiara; Battaglia, Marco

2015-01-01

Although dyslexia runs in families, several putative risk factors that cannot be immediately identified as genetic predict reading disability. Published studies analyzed one or a few risk factors at a time, with relatively inconsistent results. To assess the contribution of several putative risk factors to the development of dyslexia, we conducted…

MiR-17-5p impairs trafficking of H-ERG K+ channel protein by targeting multiple er stress-related chaperones during chronic oxidative stress.

Directory of Open Access Journals (Sweden)

Qi Wang

Full Text Available BACKGROUND: To investigate if microRNAs (miRNAs play a role in regulating h-ERG trafficking in the setting of chronic oxidative stress as a common deleterious factor for many cardiac disorders. METHODS: We treated neonatal rat ventricular myocytes and HEK293 cells with stable expression of h-ERG with H2O2 for 12 h and 48 h. Expression of miR-17-5p seed miRNAs was quantified by real-time RT-PCR. Protein levels of chaperones and h-ERG trafficking were measured by Western blot analysis. Luciferase reporter gene assay was used to study miRNA and target interactions. Whole-cell patch-clamp techniques were employed to record h-ERG K(+ current. RESULTS: H-ERG trafficking was impaired by H2O2 after 48 h treatment, accompanied by reciprocal changes of expression between miR-17-5p seed miRNAs and several chaperones (Hsp70, Hsc70, CANX, and Golga2, with the former upregulated and the latter downregulated. We established these chaperones as targets for miR-17-5p. Application miR-17-5p inhibitor rescued H2O2-induced impairment of h-ERG trafficking. Upregulation of endogenous by H2O2 or forced miR-17-5p expression either reduced h-ERG current. Sequestration of AP1 by its decoy molecule eliminated the upregulation of miR-17-5p, and ameliorated impairment of h-ERG trafficking. CONCLUSIONS: Collectively, deregulation of the miR-17-5p seed family miRNAs can cause severe impairment of h-ERG trafficking through targeting multiple ER stress-related chaperones, and activation of AP1 likely accounts for the deleterious upregulation of these miRNAs, in the setting of prolonged duration of oxidative stress. These findings revealed the role of miRNAs in h-ERG trafficking, which may contribute to the cardiac electrical disturbances associated with oxidative stress.

MiR-17-5p impairs trafficking of H-ERG K+ channel protein by targeting multiple er stress-related chaperones during chronic oxidative stress.

Science.gov (United States)

Wang, Qi; Hu, Weina; Lei, Mingming; Wang, Yong; Yan, Bing; Liu, Jun; Zhang, Ren; Jin, Yuanzhe

2013-01-01

To investigate if microRNAs (miRNAs) play a role in regulating h-ERG trafficking in the setting of chronic oxidative stress as a common deleterious factor for many cardiac disorders. We treated neonatal rat ventricular myocytes and HEK293 cells with stable expression of h-ERG with H2O2 for 12 h and 48 h. Expression of miR-17-5p seed miRNAs was quantified by real-time RT-PCR. Protein levels of chaperones and h-ERG trafficking were measured by Western blot analysis. Luciferase reporter gene assay was used to study miRNA and target interactions. Whole-cell patch-clamp techniques were employed to record h-ERG K(+) current. H-ERG trafficking was impaired by H2O2 after 48 h treatment, accompanied by reciprocal changes of expression between miR-17-5p seed miRNAs and several chaperones (Hsp70, Hsc70, CANX, and Golga2), with the former upregulated and the latter downregulated. We established these chaperones as targets for miR-17-5p. Application miR-17-5p inhibitor rescued H2O2-induced impairment of h-ERG trafficking. Upregulation of endogenous by H2O2 or forced miR-17-5p expression either reduced h-ERG current. Sequestration of AP1 by its decoy molecule eliminated the upregulation of miR-17-5p, and ameliorated impairment of h-ERG trafficking. Collectively, deregulation of the miR-17-5p seed family miRNAs can cause severe impairment of h-ERG trafficking through targeting multiple ER stress-related chaperones, and activation of AP1 likely accounts for the deleterious upregulation of these miRNAs, in the setting of prolonged duration of oxidative stress. These findings revealed the role of miRNAs in h-ERG trafficking, which may contribute to the cardiac electrical disturbances associated with oxidative stress.

Reply to 'Comments on 'Direct determination of kerma for a d(48.5)+Be therapy beam''

International Nuclear Information System (INIS)

Binns, P.J.; DeLuca, P.M. Jr.; Maughan, R.L.; Kota, C.

1999-01-01

The comments of Green (see above) which have elicited this response appear to be factually incorrect. As a consequence the authors feel obliged to clarify the confusion they might create. Green is mistaken in the assertion that the recent paper by Binns et al (1998) focuses on differences rather than the similarities between the results of Aro et al (1992) and those reported. Nothing could be further from the truth. The differences referred to in the text of the discussion allude to those observed between the microdose spectra associated with carbon and oxygen that were measured in the d(48.5)+Be therapy beam under identical irradiation conditions. They do not refer to any differences due to employing different therapy beams as he purports. (author). Letter-to-the-editor

Management of flu-like syndrome with cetirizine in patients with relapsing-remitting multiple sclerosis during therapy with interferon beta: Results of a randomized, cross-over, placebo-controlled pilot study.

Directory of Open Access Journals (Sweden)

Doriana Landi

Full Text Available Flu-like syndrome (FLS is a common adverse event experienced by patients with relapsing-remitting multiple sclerosis (RRMS treated with interferon beta (IFNβ. FLS can lead to poor treatment adherence and early IFNβ discontinuation. The involvement of interleukin-6 (IL-6 in the occurrence of FLS has been suggested. We hypothesized that cetirizine, a second-generation histamine H1 receptor antagonist able to reduce the levels of IL-6, might improve IFNβ-induced FLS.We conducted a pilot, cross-over, randomized, placebo-controlled, double-blind study to evaluate the efficacy of cetirizine 10 mg added after each IFNβ injection to the standard of care for FLS (acetaminophen or nonsteroidal anti-inflammatory drugs on FLS in patients with RRMS treated with IFNβ. Patients were randomized to two treatment sequences: 1 4-week treatment with placebo added to the standard treatment for FLS, followed by 4-week treatment with cetirizine added to the standard of care, and 2 first addition of cetirizine, then of placebo. The primary efficacy endpoint was the mean change of FLS severity [11-point visual analog scale (VAS] after 4 weeks of treatment within each sequence.Forty-five patients (71.1% female, mean age 39.1 years, mean time from RRMS diagnosis 5.8 years were randomized to treatment sequences 1 and 2. The differences between cetirizine and placebo in the intensity of FLS were not statistically significant: total mean VAS scores at 4 hours from IFNβ injection were 3.57 and 3.42 for cetirizine and placebo, respectively (difference -0.15; 95% confidence interval: from -0.74 to 0.44; p = 0.6029. The two treatments were similar also with regard to other efficacy measures considered and to the safety/tolerability profile.The addition of cetirizine to the standard of care for IFNβ-induced FLS in patients with RRMS does not seem to provide significant benefits compared with placebo. Further effort is required to understand the mechanisms underlying IFN�

The Salmonella type III effector SspH2 specifically exploits the NLR co-chaperone activity of SGT1 to subvert immunity.

Directory of Open Access Journals (Sweden)

Amit P Bhavsar

Full Text Available To further its pathogenesis, S. Typhimurium delivers effector proteins into host cells, including the novel E3 ubiquitin ligase (NEL effector SspH2. Using model systems in a cross-kingdom approach we gained further insight into the molecular function of this effector. Here, we show that SspH2 modulates innate immunity in both mammalian and plant cells. In mammalian cell culture, SspH2 significantly enhanced Nod1-mediated IL-8 secretion when transiently expressed or bacterially delivered. In addition, SspH2 also enhanced an Rx-dependent hypersensitive response in planta. In both of these nucleotide-binding leucine rich repeat receptor (NLR model systems, SspH2-mediated phenotypes required its catalytic E3 ubiquitin ligase activity and interaction with the conserved host protein SGT1. SGT1 has an essential cell cycle function and an additional function as an NLR co-chaperone in animal and plant cells. Interaction between SspH2 and SGT1 was restricted to SGT1 proteins that have NLR co-chaperone function and accordingly, SspH2 did not affect SGT1 cell cycle functions. Mechanistic studies revealed that SspH2 interacted with, and ubiquitinated Nod1 and could induce Nod1 activity in an agonist-independent manner if catalytically active. Interestingly, SspH2 in vitro ubiquitination activity and protein stability were enhanced by SGT1. Overall, this work adds to our understanding of the sophisticated mechanisms used by bacterial effectors to co-opt host pathways by demonstrating that SspH2 can subvert immune responses by selectively exploiting the functions of a conserved host co-chaperone.

Mechanism of Enzyme Repair by the AAA+ Chaperone Rubisco Activase.

Science.gov (United States)

Bhat, Javaid Y; Miličić, Goran; Thieulin-Pardo, Gabriel; Bracher, Andreas; Maxwell, Andrew; Ciniawsky, Susanne; Mueller-Cajar, Oliver; Engen, John R; Hartl, F Ulrich; Wendler, Petra; Hayer-Hartl, Manajit

2017-09-07

How AAA+ chaperones conformationally remodel specific target proteins in an ATP-dependent manner is not well understood. Here, we investigated the mechanism of the AAA+ protein Rubisco activase (Rca) in metabolic repair of the photosynthetic enzyme Rubisco, a complex of eight large (RbcL) and eight small (RbcS) subunits containing eight catalytic sites. Rubisco is prone to inhibition by tight-binding sugar phosphates, whose removal is catalyzed by Rca. We engineered a stable Rca hexamer ring and analyzed its functional interaction with Rubisco. Hydrogen/deuterium exchange and chemical crosslinking showed that Rca structurally destabilizes elements of the Rubisco active site with remarkable selectivity. Cryo-electron microscopy revealed that Rca docks onto Rubisco over one active site at a time, positioning the C-terminal strand of RbcL, which stabilizes the catalytic center, for access to the Rca hexamer pore. The pulling force of Rca is fine-tuned to avoid global destabilization and allow for precise enzyme repair. Copyright © 2017 Elsevier Inc. All rights reserved.

Hypoxia-induced autophagy is inhibited by PADI4 knockdown, which promotes apoptosis of fibroblast-like synoviocytes in rheumatoid arthritis

Science.gov (United States)

Fan, Tingting; Zhang, Changsong; Zong, Ming; Fan, Lieying

2018-01-01

Impaired apoptosis of rheumatoid arthritis (RA)-fibroblast-like synoviocytes (FLS) is pivotal in the process of RA. Peptidyl arginine deiminase type IV (PADI4) is associated with autoantibody regulation via histone citrullination in RA. The present study aimed to investigate the role of PADI4 in the apoptosis of RA-FLS. FLS were isolated from patients with RA and a rat model. The effects of PADI4 on RA-FLS were investigated in vitro and in vivo. Hypoxia-induced autophagy was induced by 1% O2 and was detected by immunohistochemical and immunofluorescence analysis; in addition, apoptosis was detected by flow cytometry. RA-FLS obtained from RA rat model exhibited significant proliferation under severe hypoxia conditions. Hypoxia also significantly induced autophagy and elevated the expression of PADI4. Subsequently, short hairpin RNA-mediated PADI4 knockdown was demonstrated to significantly inhibit hypoxia-induced autophagy and promote apoptosis in RA-FLS. The results of these in vitro and in vivo studies suggested that PADI4 may be closely associated with hypoxia-induced autophagy, and the inhibition of hypoxia-induced autophagy by PADI4 knockdown may contribute to an increase in the apoptosis of RA-FLS. PMID:29393388

A pH Switch Regulates the Inverse Relationship between Membranolytic and Chaperone-like Activities of HSP-1/2, a Major Protein of Horse Seminal Plasma.

Science.gov (United States)

Kumar, C Sudheer; Swamy, Musti J

2016-07-05

HSP-1/2, a major protein of horse seminal plasma binds to choline phospholipids present on the sperm plasma membrane and perturbs its structure by intercalating into the hydrophobic core, which results in an efflux of choline phospholipids and cholesterol, an important event in sperm capacitation. HSP-1/2 also exhibits chaperone-like activity (CLA) in vitro and protects target proteins against various kinds of stress. In the present study we show that HSP-1/2 exhibits destabilizing activity toward model supported and cell membranes. The membranolytic activity of HSP-1/2 is found to be pH dependent, with lytic activity being high at mildly acidic pH (6.0-6.5) and low at mildly basic pH (8.0-8.5). Interestingly, the CLA is also found to be pH dependent, with high activity at mildly basic pH and low activity at mildly acidic pH. Taken together the present studies demonstrate that the membranolytic and chaperone-like activities of HSP-1/2 have an inverse relationship and are regulated via a pH switch, which is reversible. The higher CLA observed at mildly basic pH could be correlated to an increase in surface hydrophobicity of the protein. To the best of our knowledge, this is the first study reporting regulation of two different activities of a chaperone protein by a pH switch.

Clinical Characteristics and Treatment Outcome of 485 Patients with Nonfunctioning Pituitary Macroadenomas

Science.gov (United States)

Vargas, Guadalupe; Ramirez, Claudia; Ferreira, Aldo; Espinosa, Etual; Mendoza, Victoria; Lopez-Felix, Blas; Mercado, Moisés

2015-01-01

Background. Nonfunctioning pituitary adenomas (NFPAs) are the most common benign lesions of the pituitary gland. Objective. To describe our experience with the management of NFPA. Study Design and Methods. Retrospective evaluation of NFPA patients managed between 2008 and 2013. We analyzed data regarding clinical presentation, imaging diagnosis, hormonal status, surgical, radiotherapeutic, and pharmacological treatment, and outcome. Results. 485 patients (54% men, mean age 53 ± 14 years) were followed for a median of 6.5 years. Visual field abnormalities and headaches were the presenting complaints in 87% and 66%, respectively. The diagnosis of NFPA was made incidentally in 6.2%, and 8% presented with clinical evidence of apoplexy. All patients harbored macroadenomas, with a median volume of 10306 mm3; 57.9% had supra- or parasellar invasion and 19.6% had tumors larger than 4 cm. Central hypothyroidism, hypogonadism, and hypocortisolism were present in 47.2%, 35.9%, and 27.4%, respectively. Surgical resection was performed at least once in 85.7%. Tumor persistence was documented in 27% and was related to the size and invasiveness of the lesion. In selected cases, radiotherapy proved to be effective in controlling or preventing tumor growth. Conclusions. The diagnosis and treatment of NFPA are complex and require a multidisciplinary approach. PMID:25737722

A short 2 week dose titration regimen reduces the severity of flu-like symptoms with initial interferon gamma-1b treatment.

Science.gov (United States)

Devane, John G; Martin, Mary L; Matson, Mark A

2014-06-01

Flu-like symptoms (FLS) are commonly experienced by patients receiving interferon gamma-1b which may cause discontinuation or disruption of dosing during initial therapy or on re-initiation following a break in therapy. In contrast to Type I interferons, the impact of dose-titration on FLS has not been reported and is not a practice described or included in the approved prescribing information for interferon gamma-1b.The objective of this study was to assess the effect of a 2 week titration regimen on the severity of FLS during the initial 3 weeks of therapy with three times weekly subcutaneous injections of interferon gamma-1b. Healthy men and women were randomized into a double-blind, two-period, crossover study. Each study period was 3 weeks in duration and there was a minimum 15 day washout between treatment periods. Two treatment regimens were compared: No Titration dosing (full 50 mcg/m(2) subcutaneously [s.c.] three times weekly for 3 weeks) and Titration (15 mcg/m(2) s.c. three times weekly during week 1, 30 mcg/m(2) s.c. three times weekly during week 2 followed by the full dose of 50 mcg/m(2) s.c. three times weekly during week 3). Subjects remained in the clinic for at least 12 hours following each injection. FLS was based on a composite score for fever, chills, tiredness and muscle aches assessed at baseline and 4, 8 and 12 hours following each injection. Acetaminophen was allowed at the discretion of the PI. The primary endpoint was the change from baseline in FLS severity at 8 hours averaged over the 3 weeks of treatment. Additional endpoints included FLS at 4 and 12 hours, individual flu-like symptoms, rates of discontinuation, incidence of FLS and acetaminophen use. NCT 01929382. Of the 40 subjects randomized, there were 15 (37.5%) discontinuations. Titration resulted in a significant reduction in FLS severity at 8 hours (p = 0.023) averaged over the 3 week treatment period. The difference in 3 week FLS severity reflects differences

Foreign languages in advertising as implicit Country-of-Origin cues. Mechanism, associations, and effectiveness

NARCIS (Netherlands)

Hornikx, J.M.A.; Meurs, W.F.J. van

2017-01-01

Brands can position themselves as belonging to a foreign culture by using foreign languages (FLs) in advertising. FLs in ads have been suggested to be implicit country-of-origin (COO) cues. This paper examines the expectations that FLs operate through the COO effect (Study 1), and that they evoke

Sistem Komunikasi Modul Sensor Jamak Berbasiskan Mikrokontroler Menggunakan Serial Rs-485 Mode Multi Processor Communication (Mpc

Directory of Open Access Journals (Sweden)

Suar wibawa

2016-08-01

Full Text Available Multi-sensor communication system uses RS-485 standard communication connecting each microcontroller-based data processing unit to form BUS topology network. The advantages of this  communication system  are:  connectivity  (easy  to  connecting  devices  on  a  network, scalability (flexibility to expand the network, more resistant to noise, and easier maintenance. The System is built using Master-Slave communication approach model. This system need to filter every data packet on communication channel because every device that connect in this network can hear every data packet across this network. Multi Processor Communication (MPC model is applied to reduce processor’s burden in inspecting every data packet, so the processor that work in slave side only need to inspect the message for itself without inspecting every data packet across the communication chanel.

Chemical chaperones reduce ER stress and adipose tissue inflammation in high fat diet-induced mouse model of obesity.

Science.gov (United States)

Chen, Yaqin; Wu, Zhihong; Zhao, Shuiping; Xiang, Rong

2016-06-08

Obesity, which is characteristic by chronic inflammation, is defined as abnormal or excessive fat accumulation in adipose tissues. Endoplasmic reticulum (ER) stress is increased in adipose tissue of obese state and is known to be strongly associated with chronic inflammation. The aim of this study was to investigate the effect of ER stress on adipokine secretion in obese mice and explore the potential mechanisms. In this study, we found high-fat diet induced-obesity contributed to strengthened ER stress and triggered chronic inflammation in adipose tissue. Chemical chaperones, 4-PBA and TUDCA, modified metabolic disorders and decreased the levels of inflammatory cytokines in obese mice fed a high-fat diet. The alleviation of ER stress is in accordance with the decrease of free cholesterol in adipose tissue. Furthermore chemical chaperones suppress NF-κB activity in adipose tissue of obese mice in vivo. In vitro studies showed IKK/NF-κB may be involved in the signal transduction of adipokine secretion dysfunction induced by ER stress. The present study revealed the possibility that inhibition of ER stress may be a novel drug target for metabolic abnormalities associated with obesity. Further studies are now needed to characterize the initial incentive of sustained ER stress in obese.

Localization of MRP-1 to the outer mitochondrial membrane by the chaperone protein HSP90β.

Science.gov (United States)

Roundhill, Elizabeth; Turnbull, Doug; Burchill, Susan

2016-05-01

Overexpression of plasma membrane multidrug resistance-associated protein 1 (MRP-1) in Ewing's sarcoma (ES) predicts poor outcome. MRP-1 is also expressed in mitochondria, and we have examined the submitochondrial localization of MRP-1 and investigated the mechanism of MRP-1 transport and role of this organelle in the response to doxorubicin. The mitochondrial localization of MRP-1 was examined in ES cell lines by differential centrifugation and membrane solubilization by digitonin. Whether MRP-1 is chaperoned by heat shock proteins (HSPs) was investigated by immunoprecipitation, immunofluorescence microscopy, and HSP knockout using small hairpin RNA and inhibitors (apoptozole, 17-AAG, and NVPAUY). The effect of disrupting mitochondrial MRP-1-dependent efflux activity on the cytotoxic effect of doxorubicin was investigated by counting viable cell number. Mitochondrial MRP-1 is glycosylated and localized to the outer mitochondrial membrane, where it is coexpressed with HSP90. MRP-1 binds to both HSP90 and HSP70, although only inhibition of HSP90β decreases expression of MRP-1 in the mitochondria. Disruption of mitochondrial MRP-1-dependent efflux significantly increases the cytotoxic effect of doxorubicin (combination index, MRP-1 is expressed in the outer mitochondrial membrane and is a client protein of HSP90β, where it may play a role in the doxorubicin-induced resistance of ES.-Roundhill, E., Turnbull, D., Burchill, S. Localization of MRP-1 to the outer mitochondrial membrane by the chaperone protein HSP90β. © FASEB.

Beyond genetic factors in familial amyloidotic polyneuropathy: protein glycation and the loss of fibrinogen's chaperone activity.

Directory of Open Access Journals (Sweden)

Gonçalo da Costa

Full Text Available Familial amyloidotic polyneuropathy (FAP is a systemic conformational disease characterized by extracellular amyloid fibril formation from plasma transthyretin (TTR. This is a crippling, fatal disease for which liver transplantation is the only effective therapy. More than 80 TTR point mutations are associated with amyloidotic diseases and the most widely accepted disease model relates TTR tetramer instability with TTR point mutations. However, this model fails to explain two observations. First, native TTR also forms amyloid in systemic senile amyloidosis, a geriatric disease. Second, age at disease onset varies by decades for patients bearing the same mutation and some mutation carrier individuals are asymptomatic throughout their lives. Hence, mutations only accelerate the process and non-genetic factors must play a key role in the molecular mechanisms of disease. One of these factors is protein glycation, previously associated with conformational diseases like Alzheimer's and Parkinson's. The glycation hypothesis in FAP is supported by our previous discovery of methylglyoxal-derived glycation of amyloid fibrils in FAP patients. Here we show that plasma proteins are differentially glycated by methylglyoxal in FAP patients and that fibrinogen is the main glycation target. Moreover, we also found that fibrinogen interacts with TTR in plasma. Fibrinogen has chaperone activity which is compromised upon glycation by methylglyoxal. Hence, we propose that methylglyoxal glycation hampers the chaperone activity of fibrinogen, rendering TTR more prone to aggregation, amyloid formation and ultimately, disease.

Copper transporters and chaperones CTR1, CTR2, ATOX1, and CCS as determinants of cisplatin sensitivity.

Science.gov (United States)

Bompiani, Kristin M; Tsai, Cheng-Yu; Achatz, Felix P; Liebig, Janika K; Howell, Stephen B

2016-09-01

The development of resistance to cisplatin (cDDP) is commonly accompanied by reduced drug uptake or increased efflux. Previous studies in yeast and murine embryonic fibroblasts have reported that the copper (Cu) transporters and chaperones participate in the uptake, efflux, and intracellular distribution of cDDP. However, there is conflicting data from studies in human cells. We used CRISPR-Cas9 genome editing to individually knock out the human copper transporters CTR1 and CTR2 and the copper chaperones ATOX1 and CCS. Isogenic knockout cell lines were generated in both human HEK-293T and ovarian carcinoma OVCAR8 cells. All knockout cell lines had slowed growth compared to parental cells, small changes in basal Cu levels, and varying sensitivities to Cu depending on the gene targeted. However, all of the knockouts demonstrated only modest 2 to 5-fold changes in cDDP sensitivity that did not differ from the range of sensitivities of 10 wild type clones grown from the same parental cell population. We conclude that, under basal conditions, loss of CTR1, CTR2, ATOX1, or CCS does not produce a change in cisplatin sensitivity that exceeds the variance found within the parental population, suggesting that they are not essential to the mechanism by which cDDP enters these cell lines and is transported to the nucleus.

Functional diversification of hsp40: distinct j-protein functional requirements for two prions allow for chaperone-dependent prion selection.

Science.gov (United States)

Harris, Julia M; Nguyen, Phil P; Patel, Milan J; Sporn, Zachary A; Hines, Justin K

2014-07-01

Yeast prions are heritable amyloid aggregates of functional yeast proteins; their propagation to subsequent cell generations is dependent upon fragmentation of prion protein aggregates by molecular chaperone proteins. Mounting evidence indicates the J-protein Sis1 may act as an amyloid specificity factor, recognizing prion and other amyloid aggregates and enabling Ssa and Hsp104 to act in prion fragmentation. Chaperone interactions with prions, however, can be affected by variations in amyloid-core structure resulting in distinct prion variants or 'strains'. Our genetic analysis revealed that Sis1 domain requirements by distinct variants of [PSI+] are strongly dependent upon overall variant stability. Notably, multiple strong [PSI+] variants can be maintained by a minimal construct of Sis1 consisting of only the J-domain and glycine/phenylalanine-rich (G/F) region that was previously shown to be sufficient for cell viability and [RNQ+] prion propagation. In contrast, weak [PSI+] variants are lost under the same conditions but maintained by the expression of an Sis1 construct that lacks only the G/F region and cannot support [RNQ+] propagation, revealing mutually exclusive requirements for Sis1 function between these two prions. Prion loss is not due to [PSI+]-dependent toxicity or dependent upon a particular yeast genetic background. These observations necessitate that Sis1 must have at least two distinct functional roles that individual prions differentially require for propagation and which are localized to the glycine-rich domains of the Sis1. Based on these distinctions, Sis1 plasmid-shuffling in a [PSI+]/[RNQ+] strain permitted J-protein-dependent prion selection for either prion. We also found that, despite an initial report to the contrary, the human homolog of Sis1, Hdj1, is capable of [PSI+] prion propagation in place of Sis1. This conservation of function is also prion-variant dependent, indicating that only one of the two Sis1-prion functions may have

An unexpected role for the yeast nucleotide exchange factor Sil1 as a reductant acting on the molecular chaperone BiP

Science.gov (United States)

Siegenthaler, Kevin D; Pareja, Kristeen A; Wang, Jie; Sevier, Carolyn S

2017-01-01

Unfavorable redox conditions in the endoplasmic reticulum (ER) can decrease the capacity for protein secretion, altering vital cell functions. While systems to manage reductive stress are well-established, how cells cope with an overly oxidizing ER remains largely undefined. In previous work (Wang et al., 2014), we demonstrated that the chaperone BiP is a sensor of overly oxidizing ER conditions. We showed that modification of a conserved BiP cysteine during stress beneficially alters BiP chaperone activity to cope with suboptimal folding conditions. How this cysteine is reduced to reestablish 'normal' BiP activity post-oxidative stress has remained unknown. Here we demonstrate that BiP's nucleotide exchange factor – Sil1 – can reverse BiP cysteine oxidation. This previously unexpected reductant capacity for yeast Sil1 has potential implications for the human ataxia Marinesco-Sjögren syndrome, where it is interesting to speculate that a disruption in ER redox-signaling (due to genetic defects in SIL1) may influence disease pathology. DOI: http://dx.doi.org/10.7554/eLife.24141.001 PMID:28257000

RABA Members Act in Distinct Steps of Subcellular Trafficking of the FLAGELLIN SENSING2 Receptor[W

Science.gov (United States)

Choi, Seung-won; Tamaki, Takayuki; Ebine, Kazuo; Uemura, Tomohiro; Ueda, Takashi; Nakano, Akihiko

2013-01-01

Cell surface proteins play critical roles in the perception of environmental stimuli at the plasma membrane (PM) and ensuing signal transduction. Intracellular localization of such proteins must be strictly regulated, which requires elaborate integration of exocytic and endocytic trafficking pathways. Subcellular localization of Arabidopsis thaliana FLAGELLIN SENSING2 (FLS2), a receptor that recognizes bacterial flagellin, also depends on membrane trafficking. However, our understanding about the mechanisms involved is still limited. In this study, we visualized ligand-induced endocytosis of FLS2 using green fluorescent protein (GFP)-tagged FLS2 expressed in Nicotiana benthamiana. Upon treatment with the flg22 peptide, internalized FLS2-GFP from the PM was transported to a compartment with properties intermediate between the trans-Golgi network (TGN) and the multivesicular endosome. This compartment gradually discarded the TGN characteristics as it continued along the trafficking pathway. We further found that FLS2 endocytosis involves distinct RABA/RAB11 subgroups at different steps. Moreover, we demonstrated that transport of de novo–synthesized FLS2 to the PM also involves a distinct RABA/RAB11 subgroup. Our results demonstrate the complex regulatory system for properly localizing FLS2 and functional differentiation in RABA members in endo- and exocytosis. PMID:23532067

Post-transcriptional silencing of flavonol synthase mRNA in tobacco leads to fruits with arrested seed set.

Directory of Open Access Journals (Sweden)

Monika Mahajan

Full Text Available Flavonoids are synthesized by phenylpropanoid pathway. They are known to participate in large number of physiological and biochemical processes in plants. Parthenocarpy and male sterility has earlier been reported by silencing chalcone synthase (CHS encoding gene. Silencing of CHS has blocked the synthesis of most of useful flavonoids including flavan-3-ols and flavonols. Also, these studies could not identify whether parthenocarpy/male sterility were due to lack of flavan-3-ols or flavonols or both. Flavonol synthase (FLS is an important enzyme of flavonoid pathway that catalyzes the formation of flavonols. In this article, we propose a novel strategy towards the generation of seedless or less-seeded fruits by downregulation of flavonol biosynthesis in tobacco (Nicotiana tabacum cv Xanthi through post-transcriptional gene silencing (PTGS of FLS encoding mRNA. The FLS silenced lines were observed for 20-80% reduction in FLS encoding gene expression and 25-93% reduction in flavonol (quercetin content. Interestingly, these FLS silenced tobacco lines also showed reduction in their anthocyanidins content. While the content of flavan-3-ols (catechin, epi-catechin and epi-gallocatechin was found to be increased in FLS silenced lines. The delayed flowering in FLS silenced lines could be due to decrease in level of indole acetic acid (IAA at apical region of their shoots. Furthermore, the pollen germination was hampered and pollens were unable to produce functional pollen tube in FLS silenced tobacco lines. Pods of FLS silenced lines contained significantly less number of seeds. The in vitro and in vivo studies where 1 µM quercetin was supplied to germination media, documented the restoration of normal pollen germination and pollen tube growth. This finding identified the role of flavonols particularly quercetin in pollen germination as well as in the regulation of plant fertility. Results also suggest a novel approach towards generation of seedless

Putative Lineage of Novel African Usutu Virus, Central Europe

Centers for Disease Control (CDC) Podcasts

2015-10-15

Sarah Gregory reads an abridged version of "Putative Lineage of Novel African Usutu Virus, Central Europe.".  Created: 10/15/2015 by National Center for Emerging and Zoonotic Infectious Diseases (NCEZID).   Date Released: 10/15/2015.

A fuzzy logic-based damage identification method for simply-supported bridge using modal shape ratios

Directory of Open Access Journals (Sweden)

Hanbing Liu

2012-08-01

Full Text Available A fuzzy logic system (FLS is established for damage identification of simply supported bridge. A novel damage indicator is developed based on ratios of mode shape components between before and after damage. Numerical simulation of a simply-supported bridge is presented to demonstrate the memory, inference and anti-noise ability of the proposed method. The bridge is divided into eight elements and nine nodes, the damage indicator vector at characteristic nodes is used as the input measurement of FLS. Results reveal that FLS can detect damage of training patterns with an accuracy of 100%. Aiming at other test patterns, the FLS also possesses favorable inference ability, the identification accuracy for single damage location is up to 93.75%. Tests with noise simulated data show that the FLS possesses favorable anti-noise ability.

Molecular cloning and characterization of a putative OGG_N domain ...

African Journals Online (AJOL)

Molecular cloning and characterization of a putative OGG_N domain from the camel, Camelus dromedarius. Farid Shokry Ataya, Mohammad Saud Alanazi, Dalia Fouad, Hehsam Mahmoud Saeed, Mohammad Bazzi ...

Cyr61 induces IL-6 production by fibroblast-like synoviocytes promoting Th17 differentiation in rheumatoid arthritis.

Science.gov (United States)

Lin, Jinpiao; Zhou, Zhou; Huo, Rongfen; Xiao, Lianbo; Ouyang, Guilin; Wang, Li; Sun, Yue; Shen, Baihua; Li, Dangsheng; Li, Ningli

2012-06-01

Cysteine-rich protein 61 (Cyr61)/CCN1 is a product of an immediate early gene and functions in mediating cell adhesion and inducing cell migration. We previously showed that increased production of Cyr61 by fibroblast-like synoviocytes (FLS) in rheumatoid arthritis (RA) promotes FLS proliferation and participates in RA pathogenesis with the IL-17-dependent pathway. However, whether Cyr61 in turn regulates Th17 cell differentiation and further enhances inflammation of RA remained unknown. In the current study, we explored the potential role of Cyr61 as a proinflammatory factor in RA pathogenesis. We found that Cyr61 treatment dramatically induced IL-6 production in FLS isolated from RA patients. Moreover, IL-6 production was attenuated by Cyr61 knockdown in FLS. Mechanistically, we showed that Cyr61 activated IL-6 production via the αvβ5/Akt/NF-κB signaling pathway. Further, using a coculture system consisting of purified CD4(+) T cells and RA FLS, we found that RA FLS stimulated Th17 differentiation, and the pro-Th17 differentiation effect of RA FLS can be attenuated or stimulated by Cyr61 RNA interference or addition of exogenous Cyr61, respectively. Finally, using the collagen-induced arthritis animal model, we showed that treatment with the anti-Cyr61 mAb led to reduction of IL-6 levels, decrease of Th17 response, and attenuation of inflammation and disease progression in vivo. Taken together, our results reveal a novel role of Cyr61 in promoting Th17 development in RA via upregulation of IL-6 production by FLS, thus adding a new layer into the functional interplay between FLS and Th17 in RA pathogenesis. Our study also suggests that targeting of Cyr61 may represent a novel strategy in RA treatment.

Sensitivity to Flg22 Is Modulated by Ligand-Induced Degradation and de Novo Synthesis of the Endogenous Flagellin-Receptor FLAGELLIN-SENSING2[W][OPEN

Science.gov (United States)

Smith, John M.; Salamango, Daniel J.; Leslie, Michelle E.; Collins, Carina A.; Heese, Antje

2014-01-01

FLAGELLIN-SENSING2 (FLS2) is the plant cell surface receptor that perceives bacterial flagellin or flg22 peptide, initiates flg22-signaling responses, and contributes to bacterial growth restriction. Flg22 elicitation also leads to ligand-induced endocytosis and degradation of FLS2 within 1 h. Why plant cells remove this receptor precisely at the time during which its function is required remains mainly unknown. Here, we assessed in planta flg22-signaling competency in the context of ligand-induced degradation of endogenous FLS2 and chemical interference known to impede flg22-dependent internalization of FLS2 into endocytic vesicles. Within 1 h after an initial flg22 treatment, Arabidopsis (Arabidopsis thaliana) leaf tissue was unable to reelicit flg22 signaling in a ligand-, time-, and dose-dependent manner. These results indicate that flg22-induced degradation of endogenous FLS2 may serve to desensitize cells to the same stimulus (homologous desensitization), likely to prevent continuous signal output upon repetitive flg22 stimulation. In addition to impeding ligand-induced FLS2 degradation, pretreatment with the vesicular trafficking inhibitors Wortmannin or Tyrphostin A23 impaired flg22-elicited reactive oxygen species production that was partially independent of BRASSINOSTEROID INSENSITIVE1-ASSOCIATED KINASE1. Interestingly, these inhibitors did not affect flg22-induced mitogen-activated protein kinase phosphorylation, indicating the ability to utilize vesicular trafficking inhibitors to target different flg22-signaling responses. For Tyrphostin A23, reduced flg22-induced reactive oxygen species could be separated from the defect in FLS2 degradation. At later times (>2 h) after the initial flg22 elicitation, recovery of FLS2 protein levels positively correlated with resensitization to flg22, indicating that flg22-induced new synthesis of FLS2 may prepare cells for a new round of monitoring the environment for flg22. PMID:24220680

Switch I-dependent allosteric signaling in a G-protein chaperone-B12 enzyme complex.

Science.gov (United States)

Campanello, Gregory C; Lofgren, Michael; Yokom, Adam L; Southworth, Daniel R; Banerjee, Ruma

2017-10-27

G-proteins regulate various processes ranging from DNA replication and protein synthesis to cytoskeletal dynamics and cofactor assimilation and serve as models for uncovering strategies deployed for allosteric signal transduction. MeaB is a multifunctional G-protein chaperone, which gates loading of the active 5'-deoxyadenosylcobalamin cofactor onto methylmalonyl-CoA mutase (MCM) and precludes loading of inactive cofactor forms. MeaB also safeguards MCM, which uses radical chemistry, against inactivation and rescues MCM inactivated during catalytic turnover by using the GTP-binding energy to offload inactive cofactor. The conserved switch I and II signaling motifs used by G-proteins are predicted to mediate allosteric regulation in response to nucleotide binding and hydrolysis in MeaB. Herein, we targeted conserved residues in the MeaB switch I motif to interrogate the function of this loop. Unexpectedly, the switch I mutations had only modest effects on GTP binding and on GTPase activity and did not perturb stability of the MCM-MeaB complex. However, these mutations disrupted multiple MeaB chaperone functions, including cofactor editing, loading, and offloading. Hence, although residues in the switch I motif are not essential for catalysis, they are important for allosteric regulation. Furthermore, single-particle EM analysis revealed, for the first time, the overall architecture of the MCM-MeaB complex, which exhibits a 2:1 stoichiometry. These EM studies also demonstrate that the complex exhibits considerable conformational flexibility. In conclusion, the switch I element does not significantly stabilize the MCM-MeaB complex or influence the affinity of MeaB for GTP but is required for transducing signals between MeaB and MCM. © 2017 by The American Society for Biochemistry and Molecular Biology, Inc.

Advanced drug delivery of N-acetylcarnosine (N-acetyl-beta-alanyl-L-histidine), carcinine (beta-alanylhistamine) and L-carnosine (beta-alanyl-L-histidine) in targeting peptide compounds as pharmacological chaperones for use in tissue engineering, human disease management and therapy: from in vitro to the clinic.

Science.gov (United States)

Babizhayev, Mark A; Yegorov, Yegor E

2010-11-01

A pharmacological chaperone is a relatively new concept in the treatment of certain chronic disabling diseases. Cells maintain a complete set of functionally competent proteins normally and in the face of injury or environmental stress with the use of various mechanisms, including systems of proteins called molecular chaperones. Proteins that are denatured by any form of proteotoxic stress are cooperatively recognized by heat shock proteins (HSP) and directed for refolding or degradation. Under non-denaturing conditions HSP have important functions in cell physiology such as in transmembrane protein transport and in enabling assembly and folding of newly synthesized polypeptides. Besides cellular molecular chaperones, which are stress-induced proteins, there have been recently reported chemical, or so-called pharmacological chaperones with demonstrated ability to be effective in preventing misfolding of different disease causing proteins, specifically in the therapeutic management of sight-threatening eye diseases, essentially reducing the severity of several neurodegenerative disorders (such as age-related macular degeneration), cataract and many other protein-misfolding diseases. This work reviews the biological and therapeutic activities protected with the patents of the family of imidazole-containing peptidomimetics Carcinine (β-alanylhistamine), N-acetylcarnosine (N-acetyl-β-alanylhistidine) and Carnosine (β-alanyl-L-histidine) which are essential constituents possessing diverse biological and pharmacological chaperone properties in human tissues.

The Putative Chemosignal Androstadienone Makes Women More Generous.

Science.gov (United States)

Perrotta, Valentina; Graffeo, Michele; Bonini, Nicolao; Gottfried, Jay A

2016-06-01

Putative human chemosignals have been shown to influence mood states and emotional processing, but the connection between these effects and higher-order cognitive processing is not well established. This study utilized an economic game (Dictator Game) to test whether androstadienone (AND), an odorous compound derived from testosterone, impacts on altruistic behavior. We predicted that the female participants would act more generously in the AND condition, exhibiting a significant interaction effect between gender and AND on Dictator Game contributions. We also expected that the presence of AND should increase the positive mood of the female participants, compared to a control odor condition and also compared to the mood of the male participants. The results confirm our hypotheses: for women the subliminal perception of AND led to larger monetary donations, compared to a control odor, and also increased positive mood. These effects were absent or significantly weaker in men. Our findings highlight the capacity of human putative chemosignals to influence emotions and higher cognitive processes - in particular the processes used in the context of economic decisions - in a gender-specific way.

The Hydrophobic Region of the DmsA Twin-Arginine Leader Peptide Determines Specificity with Chaperone DmsD

OpenAIRE

Winstone, Tara M. L.; Tran, Vy A.; Turner, Raymond J.

2013-01-01

The system specific chaperone DmsD plays a role in the maturation of the catalytic subunit of dimethyl sulfoxide (DMSO) reductase, DmsA. Pre-DmsA contains a 45-amino acid twin-arginine leader peptide that is important for targeting and translocation of folded and cofactor-loaded DmsA by the twin-arginine translocase. DmsD has previously been shown to interact with the complete twin-arginine leader peptide of DmsA. In this study, isothermal titration calorimetry was used to investigate the the...

Characteristics of functional enrichment and gene expression level of human putative transcriptional target genes.

Science.gov (United States)

Osato, Naoki

2018-01-19

Transcriptional target genes show functional enrichment of genes. However, how many and how significantly transcriptional target genes include functional enrichments are still unclear. To address these issues, I predicted human transcriptional target genes using open chromatin regions, ChIP-seq data and DNA binding sequences of transcription factors in databases, and examined functional enrichment and gene expression level of putative transcriptional target genes. Gene Ontology annotations showed four times larger numbers of functional enrichments in putative transcriptional target genes than gene expression information alone, independent of transcriptional target genes. To compare the number of functional enrichments of putative transcriptional target genes between cells or search conditions, I normalized the number of functional enrichment by calculating its ratios in the total number of transcriptional target genes. With this analysis, native putative transcriptional target genes showed the largest normalized number of functional enrichments, compared with target genes including 5-60% of randomly selected genes. The normalized number of functional enrichments was changed according to the criteria of enhancer-promoter interactions such as distance from transcriptional start sites and orientation of CTCF-binding sites. Forward-reverse orientation of CTCF-binding sites showed significantly higher normalized number of functional enrichments than the other orientations. Journal papers showed that the top five frequent functional enrichments were related to the cellular functions in the three cell types. The median expression level of transcriptional target genes changed according to the criteria of enhancer-promoter assignments (i.e. interactions) and was correlated with the changes of the normalized number of functional enrichments of transcriptional target genes. Human putative transcriptional target genes showed significant functional enrichments. Functional

Targeting HSP90 and monoclonal protein trafficking modulates the unfolded protein response, chaperone regulation and apoptosis in myeloma cells

International Nuclear Information System (INIS)

Born, E J; Hartman, S V; Holstein, S A

2013-01-01

Multiple myeloma is characterized by the production of substantial quantities of monoclonal protein. We have previously demonstrated that select inhibitors of the isoprenoid biosynthetic pathway (IBP) induce apoptosis of myeloma cells via inhibition of Rab geranylgeranylation, leading to disruption of monoclonal protein trafficking and induction of the unfolded protein response (UPR) pathway. Heat-shock protein 90 (HSP90) inhibitors disrupt protein folding and are currently under clinical investigation in myeloma. The effects of combining IBP and HSP90 inhibitors on cell death, monoclonal protein trafficking, the UPR and chaperone regulation were investigated in monoclonal protein-producing cells. An enhanced induction of cell death was observed following treatment with IBP and HSP90 inhibitors, which occurred through both ER stress and non-ER stress pathways. The HSP90 inhibitor 17-AAG abrogated the effects of the IBP inhibitors on intracellular monoclonal protein levels and localization as well as induction of the UPR in myeloma cells. Disparate effects on chaperone expression were observed in myeloma vs amyloid light chain cells. Here we demonstrate that the novel strategy of targeting MP trafficking in concert with HSP90 enhances myeloma cell death via a complex modulation of ER stress, UPR, and cell death pathways

Preliminary X-ray diffraction analysis of CfaA, a molecular chaperone essential for the assembly of CFA/I fimbriae of human enterotoxigenic Escherichia coli

Energy Technology Data Exchange (ETDEWEB)

Bao, Rui; Esser, Lothar; Poole, Steven; McVeigh, Annette; Chen, Yu-xing; Savarino, Stephen J.; Xia, Di, E-mail: xiad@mail.nih.gov

2014-01-21

The molecular chaperone CfaA plays a critical role in the bioassembly of the surface-adhesive CFA/I fimbriae of enterotoxigenic E. coli. Purified CfaA was crystallized and the phase solution was determined by the multiple isomorphous replacement coupled with anomalous scattering method.

Investigation of novel pharmacological chaperones for Gaucher Disease.

Science.gov (United States)

Yilmazer, Buge; Yagci, Z Begum; Bakar, Emre; Ozden, Burcu; Ulgen, Kutlu; Ozkirimli, Elif

2017-09-01

Beta-Glucocerebrosidase (GBA) is a lysosomal protein that is responsible for the hydrolysis of glycosylceramide into glucose and ceramide. Mutations in GBA lead to the accumulation of glycosylceramide in the lysosome causing an enlargement of the spleen and the liver and skeletal deformations. This disease is called Gaucher Disease. Enzyme replacement therapies and substrate reduction methods that are used to treat Gaucher Disease fail when the disease is neuropathic because they fail to pass the blood brain barrier. In this work, QSAR, virtual screening, docking and molecular dynamics simulations were performed to obtain a set of compounds that might be pharmacological chaperones for GBA. ZINC Database was screened using ligand-based and structure-based pharmacophore hypotheses. After docking of these molecules and filtration based on druglikeness, top ranking ligands were identified and their binding stabilities were examined using MD simulations. As a result, seven new compounds that can potentially cross the blood brain barrier were proposed as GBA inhibitors. Three of the seven compounds have a tricyclic pyrido-thieno-pyrimidine scaffold and one has the dioxino quinolone scaffold. Derivatives of these scaffolds have been reported as antiallergic agents, antibiotic and anticancer compounds. These results offer a new approach for the development of new drugs against neuropathic Gaucher Disease Type 2 and Type 3. Copyright © 2017 Elsevier Inc. All rights reserved.

Augmenting brain metabolism to increase macro- and chaperone-mediated autophagy for decreasing neuronal proteotoxicity and aging.

Science.gov (United States)

Loos, Ben; Klionsky, Daniel J; Wong, Esther

2017-09-01

Accumulation of toxic protein aggregates in the nerve cells is a hallmark of neuronal diseases and brain aging. Mechanisms to enhance neuronal surveillance to improve neuronal proteostasis have a direct impact on promoting neuronal health and forestalling age-related decline in brain function. Autophagy is a lysosomal degradative pathway pivotal for neuronal protein quality control. Different types of autophagic mechanisms participate in protein handling in neurons. Macroautophagy targets misfolded and aggregated proteins in autophagic vesicles to the lysosomes for destruction, while chaperone-mediated autophagy (CMA) degrades specific soluble cytosolic proteins delivered to the lysosomes by chaperones. Dysfunctions in macroautophagy and CMA contribute to proteo- and neuro-toxicity associated with neurodegeneration and aging. Thus, augmenting or preserving both autophagic mechanisms pose significant benefits in delaying physiological and pathological neuronal demises. Recently, life-style interventions that modulate metabolite ketone bodies, energy intake by caloric restriction and energy expenditure by exercise have shown to enhance both autophagy and brain health. However, to what extent these interventions affect neuronal autophagy to promote brain fitness remains largely unclear. Here, we review the functional connections of how macroautophagy and CMA are affected by ketone bodies, caloric restriction and exercise in the context of neurodegeneration. A concomitant assessment of yeast Saccharomyces cerevisiae is performed to reveal the conserved nature of such autophagic responses to substrate perturbations. In doing so, we provide novel insights and integrated evidence for a potential adjuvant therapeutic strategy to intervene in the neuronal decline in neurodegenerative diseases by controlling both macroautophagy and CMA fluxes favorably. Copyright © 2017 Elsevier Ltd. All rights reserved.

Influence of putative exopolysaccharide genes on Pseudomonas putida KT2440 biofilm stability

DEFF Research Database (Denmark)

Nilsson, Martin; Chiang, Wen-Chi; Fazli, Mustafa

2011-01-01

We report a study of the role of putative exopolysaccharide gene clusters in the formation and stability of Pseudomonas putida KT2440 biofilm. Two novel putative exopolysaccharide gene clusters, pea and peb, were identified, and evidence is provided that they encode products that stabilize P....... putida KT2440 biofilm. The gene clusters alg and bcs, which code for proteins mediating alginate and cellulose biosynthesis, were found to play minor roles in P. putida KT2440 biofilm formation and stability under the conditions tested. A P. putida KT2440 derivative devoid of any identifiable...

Temperature-stress phase diagram of strain glass Ti48.5Ni51.5

International Nuclear Information System (INIS)

Wang, Y.; Ren, X.; Otsuka, K.; Saxena, A.

2008-01-01

The temperature and stress dependence of the properties of a recently discovered strain glass Ti 48.5 Ni 51.5 , which is a glass of frozen local lattice strains, was investigated systematically. It was found that the ideal freezing temperature (T 0 ) of the strain glass decreases with increasing stress. When the stress exceeds a critical value σ c (T), the pseudo-B2 strain glass transforms into B19' martensite. However, the stress-strain behavior associated with such a stress-induced transition showed a crossover at a crossover temperature T CR , which is ∼20 K below T 0 . Above T CR , the sample showed superelastic behavior; however, below T CR , the sample demonstrated plastic behavior. More interestingly, the σ c vs. temperature relation for unfrozen strain glass obeys the Clausius-Clapyeron relationship, whereas that for frozen strain glass disobeys this universal thermodynamic law. A phenomenological explanation is provided for all the phenomena observed, and it is shown that all the anomalous effects come from the broken ergodicity of the glass system and a temperature-dependent relative stability of the martensitic phase. Based on experimental observations, a temperature-stress phase diagram is constructed for this strain glass, which may serve as a guide map for understanding and predicting the properties of strain glass

Cloning and Characterization of a Flavonol Synthase Gene From Litchi chinensis and Its Variation Among Litchi Cultivars With Different Fruit Maturation Periods

Directory of Open Access Journals (Sweden)

Wei Liu

2018-04-01

Full Text Available Litchi (Litchi chinensis is an important subtropical fruit tree with high commercial value. However, the short and centralized fruit maturation period of litchi cultivars represents a bottleneck for litchi production. Therefore, the development of novel cultivars with extremely early fruit maturation period is critical. Previously, we showed that the genotypes of extremely early-maturing (EEM, early-maturing (EM, and middle-to-late-maturing (MLM cultivars at a specific locus SNP51 (substitution type C/T were consistent with their respective genetic background at the whole-genome level; a homozygous C/C genotype at SNP51 systematically differentiated EEM cultivars from others. The litchi gene on which SNP51 was located was annotated as flavonol synthase (FLS, which catalyzes the formation of flavonols. Here, we further elucidate the variation of the FLS gene from L. chinensis (LcFLS among EEM, EM, and MLM cultivars. EEM cultivars with a homozygous C/C genotype at SNP51 all contained the same 2,199-bp sequence of the LcFLS gene. For MLM cultivars with a homozygous T/T genotype at SNP51, the sequence lengths of the LcFLS gene were 2,202–2,222 bp. EM cultivars with heterozygous C/T genotypes at SNP51 contained two different alleles of the LcFLS gene: a 2,199-bp sequence identical to that in EEM cultivars and a 2,205-bp sequence identical to that in MLM cultivar ‘Heiye.’ Moreover, the coding regions of LcFLS genes of other MLM cultivars were almost identical to that of ‘Heiye.’ Therefore, the LcFLS gene coding region may be used as a source of diagnostic SNP markers to discriminate or identify genotypes with the EEM trait. The expression pattern of the LcFLS gene and accumulation pattern of flavonol from EEM, EM, and MLM cultivars were analyzed and compared using quantitative real-time PCR (qRT-PCR and high-performance liquid chromatography (HPLC for mature leaves, flower buds, and fruits, 15, 30, 45, and 60 days after anthesis. Flavonol

The Cell Wall Polymer Lipoteichoic Acid Becomes Nonessential in Staphylococcus aureus Cells Lacking the ClpX Chaperone

DEFF Research Database (Denmark)

Baek, Kristoffer T.; Bowman, Lisa; Millership, Charlotte

2016-01-01

Lipoteichoic acid (LTA) is an important cell wall component of Gram-positive bacteria and a promising target for the development of vaccines and antimicrobial compounds against Staphylococcus aureus. Here we demonstrate that mutations in the conditionally essential ltaS (LTA synthase) gene arise...... not produce LTA, and genetic analyses confirmed that LTA becomes nonessential in the absence of the ClpX chaperone. In fact, inactivation of ltaS alleviated the severe growth defect conferred by the clpX deletion. Microscopic analyses showed that the absence of ClpX partly alleviates the septum placement...

Exploring universal partnerships and putative marriages as tools for ...

African Journals Online (AJOL)

Following upon the Supreme Court of Appeal's judgment in Butters v Mncora 2012 4 SA 1 (SCA), which broadened the criteria and consequences of universal partnerships in cohabitation relationships, this article investigates the potential of universal partnerships and putative marriages to allocate rights to share in ...

A new putative deltapartitivirus recovered from Dianthus amurensis.

Science.gov (United States)

An, Hongliu; Tan, Guanlin; Xiong, Guihong; Li, Meirong; Fang, Shouguo; Islam, Saif Ul; Zhang, Songbai; Li, Fan

2017-09-01

Two double stranded RNAs (dsRNA), likely representing the genome of a novel deltapartitivirus, provisionally named carnation cryptic virus 3 (CCV3), were recovered from Dianthus amurensis. The two dsRNAs were 1,573 (dsRNA1) and 1,561 (dsRNA2) bp in size, each containing a single open reading frame (ORF) encoding a 475- and 411-aa protein, respectively. The 475-aa protein contains a conserved RNA dependent RNA polymerase (RdRp) domain which shows significant homology to RdRps of established or putative partitiviruses, particularly those belonging to the genus Deltapartitivirus. However, it shares an amino acid identity of 75% with its closest relative, the RdRp of the deltapartitivirus beet cryptic virus 2 (BCV2), and is <62% identical to the RdRps of other partitiviruses. In a phylogenetic tree constructed with RdRps of selected partitiviruses, CCV3 clustered with BCV2 and formed a well-supported monophyletic clade with known or putative deltapartitiviruses.

Zinc and glutamate dehydrogenase in putative glutamatergic brain structures.

Science.gov (United States)

Wolf, G; Schmidt, W

1983-01-01

A certain topographic parallelism between the distribution of histochemically (TIMM staining) identified zinc and putative glutamatergic structures in the rat brain was demonstrated. Glutamate dehydrogenase as a zinc containing protein is in consideration to be an enzyme synthesizing transmitter glutamate. In a low concentration range externally added zinc ions (10(-9) to 10(-7) M) induced an increase in the activity of glutamate dehydrogenase (GDH) originating from rat hippocampal formation, neocortex, and cerebellum up to 142.4%. With rising molarity of Zn(II) in the incubation medium, the enzyme of hippocampal formation and cerebellum showed a biphasic course of activation. Zinc ions of a concentration higher than 10(-6) M caused a strong inhibition of GDH. The effect of Zn(II) on GDH originating from spinal ganglia and liver led only to a decrease of enzyme activity. These results are discussed in connection with a functional correlation between zinc and putatively glutamatergic system.

Genome-Wide Analysis of Corynespora cassiicola Leaf Fall Disease Putative Effectors.

Science.gov (United States)

Lopez, David; Ribeiro, Sébastien; Label, Philippe; Fumanal, Boris; Venisse, Jean-Stéphane; Kohler, Annegret; de Oliveira, Ricardo R; Labutti, Kurt; Lipzen, Anna; Lail, Kathleen; Bauer, Diane; Ohm, Robin A; Barry, Kerrie W; Spatafora, Joseph; Grigoriev, Igor V; Martin, Francis M; Pujade-Renaud, Valérie

2018-01-01

Corynespora cassiicola is an Ascomycetes fungus with a broad host range and diverse life styles. Mostly known as a necrotrophic plant pathogen, it has also been associated with rare cases of human infection. In the rubber tree, this fungus causes the Corynespora leaf fall (CLF) disease, which increasingly affects natural rubber production in Asia and Africa. It has also been found as an endophyte in South American rubber plantations where no CLF outbreak has yet occurred. The C. cassiicola species is genetically highly diverse, but no clear relationship has been evidenced between phylogenetic lineage and pathogenicity. Cassiicolin, a small glycosylated secreted protein effector, is thought to be involved in the necrotrophic interaction with the rubber tree but some virulent C. cassiicola isolates do not have a cassiicolin gene. This study set out to identify other putative effectors involved in CLF. The genome of a highly virulent C. cassiicola isolate from the rubber tree (CCP) was sequenced and assembled. In silico prediction revealed 2870 putative effectors, comprising CAZymes, lipases, peptidases, secreted proteins and enzymes associated with secondary metabolism. Comparison with the genomes of 44 other fungal species, focusing on effector content, revealed a striking proximity with phylogenetically unrelated species ( Colletotrichum acutatum, Colletotrichum gloesporioides, Fusarium oxysporum, nectria hematococca , and Botrosphaeria dothidea ) sharing life style plasticity and broad host range. Candidate effectors involved in the compatible interaction with the rubber tree were identified by transcriptomic analysis. Differentially expressed genes included 92 putative effectors, among which cassiicolin and two other secreted singleton proteins. Finally, the genomes of 35 C. cassiicola isolates representing the genetic diversity of the species were sequenced and assembled, and putative effectors identified. At the intraspecific level, effector

Genome-Wide Analysis of Corynespora cassiicola Leaf Fall Disease Putative Effectors

Directory of Open Access Journals (Sweden)

David Lopez

2018-03-01

Full Text Available Corynespora cassiicola is an Ascomycetes fungus with a broad host range and diverse life styles. Mostly known as a necrotrophic plant pathogen, it has also been associated with rare cases of human infection. In the rubber tree, this fungus causes the Corynespora leaf fall (CLF disease, which increasingly affects natural rubber production in Asia and Africa. It has also been found as an endophyte in South American rubber plantations where no CLF outbreak has yet occurred. The C. cassiicola species is genetically highly diverse, but no clear relationship has been evidenced between phylogenetic lineage and pathogenicity. Cassiicolin, a small glycosylated secreted protein effector, is thought to be involved in the necrotrophic interaction with the rubber tree but some virulent C. cassiicola isolates do not have a cassiicolin gene. This study set out to identify other putative effectors involved in CLF. The genome of a highly virulent C. cassiicola isolate from the rubber tree (CCP was sequenced and assembled. In silico prediction revealed 2870 putative effectors, comprising CAZymes, lipases, peptidases, secreted proteins and enzymes associated with secondary metabolism. Comparison with the genomes of 44 other fungal species, focusing on effector content, revealed a striking proximity with phylogenetically unrelated species (Colletotrichum acutatum, Colletotrichum gloesporioides, Fusarium oxysporum, nectria hematococca, and Botrosphaeria dothidea sharing life style plasticity and broad host range. Candidate effectors involved in the compatible interaction with the rubber tree were identified by transcriptomic analysis. Differentially expressed genes included 92 putative effectors, among which cassiicolin and two other secreted singleton proteins. Finally, the genomes of 35 C. cassiicola isolates representing the genetic diversity of the species were sequenced and assembled, and putative effectors identified. At the intraspecific level, effector

In vivo functional expression of a screened P. aeruginosa chaperone-dependent lipase in E. coli

Directory of Open Access Journals (Sweden)

Wu Xiangping

2012-09-01

Full Text Available Abstract Background Microbial lipases particularly Pseudomonas lipases are widely used for biotechnological applications. It is a meaningful work to design experiments to obtain high-level active lipase. There is a limiting factor for functional overexpression of the Pseudomonas lipase that a chaperone is necessary for effective folding. As previously reported, several methods had been used to resolve the problem. In this work, the lipase (LipA and its chaperone (LipB from a screened strain named AB which belongs to Pseudomonas aeruginosa were overexpressed in E. coli with two dual expression plasmid systems to enhance the production of the active lipase LipA without in vitro refolding process. Results In this work, we screened a lipase-produced strain named AB through the screening procedure, which was identified as P. aeruginosa on the basis of 16S rDNA. Genomic DNA obtained from the strain was used to isolate the gene lipA (936 bp and lipase specific foldase gene lipB (1023 bp. One single expression plasmid system E. coli BL21/pET28a-lipAB and two dual expression plasmid systems E. coli BL21/pETDuet-lipA-lipB and E. coli BL21/pACYCDuet-lipA-lipB were successfully constructed. The lipase activities of the three expression systems were compared to choose the optimal expression method. Under the same cultured condition, the activities of the lipases expressed by E. coli BL21/pET28a-lipAB and E. coli BL21/pETDuet-lipA-lipB were 1300 U/L and 3200 U/L, respectively, while the activity of the lipase expressed by E. coli BL21/pACYCDuet-lipA-lipB was up to 8500 U/L. The lipase LipA had an optimal temperature of 30°C and an optimal pH of 9 with a strong pH tolerance. The active LipA could catalyze the reaction between fatty alcohols and fatty acids to generate fatty acid alkyl esters, which meant that LipA was able to catalyze esterification reaction. The most suitable fatty acid and alcohol substrates for esterification were octylic acid and hexanol

Triggering of the dsRNA sensors TLR3, MDA5, and RIG-I induces CD55 expression in synovial fibroblasts.

Directory of Open Access Journals (Sweden)

Olga N Karpus

Full Text Available CD55 (decay-accelerating factor is a complement-regulatory protein highly expressed on fibroblast-like synoviocytes (FLS. CD55 is also a ligand for CD97, an adhesion-type G protein-coupled receptor abundantly present on leukocytes. Little is known regarding the regulation of CD55 expression in FLS.FLS isolated from arthritis patients were stimulated with pro-inflammatory cytokines and Toll-like receptor (TLR ligands. Transfection with polyinosinic-polycytidylic acid (poly(I:C and 5'-triphosphate RNA were used to activate the cytoplasmic double-stranded (dsRNA sensors melanoma differentiation-associated gene 5 (MDA5 and retinoic acid-inducible gene-I (RIG-I. CD55 expression, cell viability, and binding of CD97-loaded beads were quantified by flow cytometry.CD55 was expressed at equal levels on FLS isolated from patients with rheumatoid arthritis (RA, osteoarthritis, psoriatic arthritis and spondyloarthritis. CD55 expression in RA FLS was significantly induced by IL-1β and especially by the TLR3 ligand poly(I:C. Activation of MDA5 and RIG-I also enhanced CD55 expression. Notably, activation of MDA5 dose-dependently induced cell death, while triggering of TLR3 or RIG-I had a minor effect on viability. Upregulation of CD55 enhanced the binding capacity of FLS to CD97-loaded beads, which could be blocked by antibodies against CD55.Activation of dsRNA sensors enhances the expression of CD55 in cultured FLS, which increases the binding to CD97. Our findings suggest that dsRNA promotes the interaction between FLS and CD97-expressing leukocytes.

Disequilibrium of flavonol synthase and dihydroflavonol-4-reductase expression associated tightly to white versus red color flower formation in plants

Directory of Open Access Journals (Sweden)

Ping eLuo

2016-01-01

Full Text Available Flower colour is the main character throughout the plant kingdom. Though substantial information exists regarding the structural and regulatory genes involved in anthocyanin and flavonol biosynthesis, little is known that what make a diverse white versus red color flower in natural species. Here, the contents of pigments in seven species from varied phylogenetic location in plants with red and white flowers.were determined. Flavonols could be detected in red and white flowers, but anthocyanins were almost undetectable in the white cultivar. Comparisons of expression patterns of gene related to the flavonoid biosynthesis indicated that disequilibrium expression of flavonol synthase (FLS and dihydroflavonol-4-reductase (DFR genes determined the accumulation of flavonols and anothcyanins in both red and white flowers of seven species. To further investigate the role of such common regulatory patterns in determining flower color, FLS genes were isolated from Rosa rugosa (RrFLS1, Prunus persica (PpFLS and Petunia hybrida (PhFLS, and DFR genes were isolated from Rosa rugosa (RrDFR1 and Petunia hybrida (PhDFR. Heterologous expression of the FLS genes within tobacco host plants demonstrated conservation of function, with the transgenes promoting flavonol biosynthesis and inhibiting anthocyanin accumulation, so resulting in white flowers. Conversely, overexpression of DFR genes in tobacco displayed down-regulation of the endogenous NtFLS gene, and the promotion of anthocyanin synthesis. On this basis, we propose a model in which FLS and DFR gene-products compete for common substrates in order to direct the biosynthesis of flavonols and anthocyanins, respectively, thereby determining white versus red coloration of flowers.

Constitutive upregulation of chaperone-mediated autophagy in Huntington's disease.

Science.gov (United States)

Koga, Hiroshi; Martinez-Vicente, Marta; Arias, Esperanza; Kaushik, Susmita; Sulzer, David; Cuervo, Ana Maria

2011-12-14

Autophagy contributes to the removal of prone-to-aggregate proteins, but in several instances these pathogenic proteins have been shown to interfere with autophagic activity. In the case of Huntington's disease (HD), a congenital neurodegenerative disorder resulting from mutation in the huntingtin protein, we have previously described that the mutant protein interferes with the ability of autophagic vacuoles to recognize cytosolic cargo. Growing evidence supports the existence of cross talk among autophagic pathways, suggesting the possibility of functional compensation when one of them is compromised. In this study, we have identified a compensatory upregulation of chaperone-mediated autophagy (CMA) in different cellular and mouse models of HD. Components of CMA, namely the lysosome-associated membrane protein type 2A (LAMP-2A) and lysosomal-hsc70, are markedly increased in HD models. The increase in LAMP-2A is achieved through both an increase in the stability of this protein at the lysosomal membrane and transcriptional upregulation of this splice variant of the lamp-2 gene. We propose that CMA activity increases in response to macroautophagic dysfunction in the early stages of HD, but that the efficiency of this compensatory mechanism may decrease with age and so contribute to cellular failure and the onset of pathological manifestations.

Evaluating the Intoxicating Degree of Liquor Products with Combinations of Fusel Alcohols, Acids, and Esters.

Science.gov (United States)

Xie, Jia; Tian, Xiao-Fei; He, Song-Gui; Wei, Yun-Lu; Peng, Bin; Wu, Zhen-Qiang

2018-05-23

To investigate the effects of fusel alcohols on the intoxicating degree of liquor products, formulated liquors (FLs) were prepared by blending 1-propanol, isobutanol, and isoamyl alcohol with ethanol, organic acids, and corresponding ethyl esters to simulate the formula of traditional Chinese liquors. The prepared FLs were submitted for evaluation of their intoxicating degree (ID). The results showed that the fusel alcohols had a biphasic effect on the IDs of the FLs, depending on the comprehensive coordination of the characteristic minor components. The importance of the suitable ratio of alcohols/acids/esters (RAAE) on the IDs was also revealed. Under an optimal ratio level, the fusel alcohols exhibited negligible effects on the IDs of the FLs. Moreover, the ratio of isoamyl alcohol to isobutanol (IA/IB) showed a strong positive correlation to the IDs of the FLs. This study lays a foundation for the potential application in producing low-ID liquor.

Deletion of the Mitochondrial Chaperone TRAP-1 Uncovers Global Reprogramming of Metabolic Networks

Directory of Open Access Journals (Sweden)

Sofia Lisanti

2014-08-01

Full Text Available Reprogramming of metabolic pathways contributes to human disease, especially cancer, but the regulators of this process are unknown. Here, we have generated a mouse knockout for the mitochondrial chaperone TRAP-1, a regulator of bioenergetics in tumors. TRAP-1−/− mice are viable and showed reduced incidence of age-associated pathologies, including obesity, inflammatory tissue degeneration, dysplasia, and spontaneous tumor formation. This was accompanied by global upregulation of oxidative phosphorylation and glycolysis transcriptomes, causing deregulated mitochondrial respiration, oxidative stress, impaired cell proliferation, and a switch to glycolytic metabolism in vivo. These data identify TRAP-1 as a central regulator of mitochondrial bioenergetics, and this pathway could contribute to metabolic rewiring in tumors.

Crystal structure and putative substrate identification for the Entamoeba histolytica low molecular weight tyrosine phosphatase.

Science.gov (United States)

Linford, Alicia S; Jiang, Nona M; Edwards, Thomas E; Sherman, Nicholas E; Van Voorhis, Wesley C; Stewart, Lance J; Myler, Peter J; Staker, Bart L; Petri, William A

2014-01-01

Entamoeba histolytica is a eukaryotic intestinal parasite of humans, and is endemic in developing countries. We have characterized the E. histolytica putative low molecular weight protein tyrosine phosphatase (LMW-PTP). The structure for this amebic tyrosine phosphatase was solved, showing the ligand-induced conformational changes necessary for binding of substrate. In amebae, it was expressed at low but detectable levels as detected by immunoprecipitation followed by immunoblotting. A mutant LMW-PTP protein in which the catalytic cysteine in the active site was replaced with a serine lacked phosphatase activity, and was used to identify a number of trapped putative substrate proteins via mass spectrometry analysis. Seven of these putative substrate protein genes were cloned with an epitope tag and overexpressed in amebae. Five of these seven putative substrate proteins were demonstrated to interact specifically with the mutant LMW-PTP. This is the first biochemical study of a small tyrosine phosphatase in Entamoeba, and sets the stage for understanding its role in amebic biology and pathogenesis. Copyright © 2014 Elsevier B.V. All rights reserved.

Chloroplast SRP43 acts as a chaperone for glutamyl-tRNA reductase, the rate-limiting enzyme in tetrapyrrole biosynthesis.

Science.gov (United States)

Wang, Peng; Liang, Fu-Cheng; Wittmann, Daniel; Siegel, Alex; Shan, Shu-Ou; Grimm, Bernhard

2018-04-10

Assembly of light-harvesting complexes requires synchronization of chlorophyll (Chl) biosynthesis with biogenesis of light-harvesting Chl a/b-binding proteins (LHCPs). The chloroplast signal recognition particle (cpSRP) pathway is responsible for transport of nucleus-encoded LHCPs in the stroma of the plastid and their integration into the thylakoid membranes. Correct folding and assembly of LHCPs require the incorporation of Chls, whose biosynthesis must therefore be precisely coordinated with membrane insertion of LHCPs. How the spatiotemporal coordination between the cpSRP machinery and Chl biosynthesis is achieved is poorly understood. In this work, we demonstrate a direct interaction between cpSRP43, the chaperone that mediates LHCP targeting and insertion, and glutamyl-tRNA reductase (GluTR), a rate-limiting enzyme in tetrapyrrole biosynthesis. Concurrent deficiency for cpSRP43 and the GluTR-binding protein (GBP) additively reduces GluTR levels, indicating that cpSRP43 and GBP act nonredundantly to stabilize GluTR. The substrate-binding domain of cpSRP43 binds to the N-terminal region of GluTR, which harbors aggregation-prone motifs, and the chaperone activity of cpSRP43 efficiently prevents aggregation of these regions. Our work thus reveals a function of cpSRP43 in Chl biosynthesis and suggests a striking mechanism for posttranslational coordination of LHCP insertion with Chl biosynthesis.

Chemical chaperones reduce ionizing radiation-induced endoplasmic reticulum stress and cell death in IEC-6 cells

Energy Technology Data Exchange (ETDEWEB)

Lee, Eun Sang; Lee, Hae-June; Lee, Yoon-Jin [Division of Radiation Effects, Korea Institute of Radiological and Medical Sciences, Seoul 139-706 (Korea, Republic of); Jeong, Jae-Hoon [Division of Radiotherapy, Korea Institute of Radiological and Medical Sciences, Seoul 139-706 (Korea, Republic of); Kang, Seongman [Division of Life Sciences, Korea University, Seoul 136-701 (Korea, Republic of); Lim, Young-Bin, E-mail: yblim@kirams.re.kr [Division of Radiation Effects, Korea Institute of Radiological and Medical Sciences, Seoul 139-706 (Korea, Republic of)

2014-07-25

Highlights: • UPR activation precedes caspase activation in irradiated IEC-6 cells. • Chemical ER stress inducers radiosensitize IEC-6 cells. • siRNAs that targeted ER stress responses ameliorate IR-induced cell death. • Chemical chaperons prevent cell death in irradiated IEC-6 cells. - Abstract: Radiotherapy, which is one of the most effective approaches to the treatment of various cancers, plays an important role in malignant cell eradication in the pelvic area and abdomen. However, it also generates some degree of intestinal injury. Apoptosis in the intestinal epithelium is the primary pathological factor that initiates radiation-induced intestinal injury, but the mechanism by which ionizing radiation (IR) induces apoptosis in the intestinal epithelium is not clearly understood. Recently, IR has been shown to induce endoplasmic reticulum (ER) stress, thereby activating the unfolded protein response (UPR) signaling pathway in intestinal epithelial cells. However, the consequences of the IR-induced activation of the UPR signaling pathway on radiosensitivity in intestinal epithelial cells remain to be determined. In this study, we investigated the role of ER stress responses in IR-induced intestinal epithelial cell death. We show that chemical ER stress inducers, such as tunicamycin or thapsigargin, enhanced IR-induced caspase 3 activation and DNA fragmentation in intestinal epithelial cells. Knockdown of Xbp1 or Atf6 with small interfering RNA inhibited IR-induced caspase 3 activation. Treatment with chemical chaperones prevented ER stress and subsequent apoptosis in IR-exposed intestinal epithelial cells. Our results suggest a pro-apoptotic role of ER stress in IR-exposed intestinal epithelial cells. Furthermore, inhibiting ER stress may be an effective strategy to prevent IR-induced intestinal injury.

Activation of CuZn superoxide dismutases from Caenorhabditis elegans does not require the copper chaperone CCS.

Science.gov (United States)

Jensen, Laran T; Culotta, Valeria Cizewski

2005-12-16

Reactive oxygen species are produced as the direct result of aerobic metabolism and can cause damage to DNA, proteins, and lipids. A principal defense against reactive oxygen species involves the superoxide dismutases (SOD) that act to detoxify superoxide anions. Activation of CuZn-SODs in eukaryotic cells occurs post-translationally and is generally dependent on the copper chaperone for SOD1 (CCS), which inserts the catalytic copper cofactor and catalyzes the oxidation of a conserved disulfide bond that is essential for activity. In contrast to other eukaryotes, the nematode Caenorhabditis elegans does not contain an obvious CCS homologue, and we have found that the C. elegans intracellular CuZn-SODs (wSOD-1 and wSOD-5) are not dependent on CCS for activation when expressed in Saccharomyces cerevisiae. CCS-independent activation of CuZn-SODs is not unique to C. elegans; however, this is the first organism identified that appears to exclusively use this alternative pathway. As was found for mammalian SOD1, wSOD-1 exhibits a requirement for reduced glutathione in CCS-independent activation. Unexpectedly, wSOD-1 was inactive even in the presence of CCS when glutathione was depleted. Our investigation of the cysteine residues that form the disulfide bond in wSOD-1 suggests that the ability of wSODs to readily form this disulfide bond may be the key to obtaining high levels of activation through the CCS-independent pathway. Overall, these studies demonstrate that the CuZn-SODs of C. elegans have uniquely evolved to acquire copper without the copper chaperone and this may reflect the lifestyle of this organism.

Lack of the RNA chaperone Hfq attenuates pathogenicity of several Escherichia coli pathotypes towards Caenorhabditis elegans

DEFF Research Database (Denmark)

Bojer, Martin Saxtorph; Jakobsen, Henrik; Struve, Carsten

2012-01-01

as a model for virulence characterization and screening for novel antimicrobial entities. Several E. coli human pathotypes are also pathogenic towards C. elegans, and we show here that lack of the RNA chaperone Hfq significantly reduces pathogenicity of VTEC, EAEC, and UPEC in the nematode model. Thus, Hfq...... is intrinsically essential to pathogenic E. coli for survival and virulence exerted in the C. elegans host.......Escherichia coli is an important agent of Gram-negative bacterial infections worldwide, being one of the leading causes of diarrhoea and urinary tract infections. Strategies to understand pathogenesis and develop therapeutic compounds include the use of the nematode Caenorhabditis elegans...

The Yersinia enterocolitica type three secretion chaperone SycO is integrated into the Yop regulatory network and binds to the Yop secretion protein YscM1

Directory of Open Access Journals (Sweden)

Heesemann Jürgen

2007-07-01

Full Text Available Abstract Background Pathogenic yersiniae (Y. pestis, Y. pseudotuberculosis, Y. enterocolitica share a virulence plasmid encoding a type three secretion system (T3SS. This T3SS comprises more than 40 constituents. Among these are the transport substrates called Yops (Yersinia outer proteins, the specific Yop chaperones (Sycs, and the Ysc (Yop secretion proteins which form the transport machinery. The effectors YopO and YopP are encoded on an operon together with SycO, the chaperone of YopO. The characterization of SycO is the focus of this study. Results We have established the large-scale production of recombinant SycO in its outright form. We confirm that Y. enterocolitica SycO forms homodimers which is typical for Syc chaperones. SycO overproduction in Y. enterocolitica decreases secretion of Yops into the culture supernatant suggesting a regulatory role of SycO in type III secretion. We demonstrate that in vitro SycO interacts with YscM1, a negative regulator of Yop expression in Y. enterocolitica. However, the SycO overproduction phenotype was not mediated by YscM1, YscM2, YopO or YopP as revealed by analysis of isogenic deletion mutants. Conclusion We present evidence that SycO is integrated into the regulatory network of the Yersinia T3SS. Our picture of the Yersinia T3SS interactome is supplemented by identification of the SycO/YscM1 interaction. Further, our results suggest that at least one additional interaction partner of SycO has to be identified.

Putative periodontopathic bacteria and herpesviruses in pregnant women: a case-control study.

Science.gov (United States)

Lu, Haixia; Zhu, Ce; Li, Fei; Xu, Wei; Tao, Danying; Feng, Xiping

2016-06-15

Little is known about herpesvirus and putative periodontopathic bacteria in maternal chronic periodontitis. The present case-control study aimed to explore the potential relationship between putative periodontopathic bacteria and herpesviruses in maternal chronic periodontitis.Saliva samples were collected from 36 pregnant women with chronic periodontitis (cases) and 36 pregnant women with healthy periodontal status (controls). Six putative periodontopathic bacteria (Porphyromonas gingivalis [Pg], Aggregatibacer actinomycetemcomitans [Aa], Fusobacterium nucleatum [Fn], Prevotella intermedia [Pi], Tannerella forsythia [Tf], and Treponema denticola [Td]) and three herpesviruses (Epstein-Barr virus [EBV], human cytomegalovirus [HCMV], and herpes simplex virus [HSV]) were detected. Socio-demographic data and oral health related behaviors, and salivary estradiol and progesterone levels were also collected. The results showed no significant differences in socio-demographic background, oral health related behaviors, and salivary estradiol and progesterone levels between the two groups (all P > 0.05). The detection rates of included periodontopathic microorganisms were not significantly different between the two groups (all P > 0.05), but the coinfection rate of EBV and Pg was significantly higher in the case group than in the control group (P = 0.028). EBV and Pg coinfection may promote the development of chronic periodontitis among pregnant women.

Evaluating the Intoxicating Degree of Liquor Products with Combinations of Fusel Alcohols, Acids, and Esters

Directory of Open Access Journals (Sweden)

Jia Xie

2018-05-01

Full Text Available To investigate the effects of fusel alcohols on the intoxicating degree of liquor products, formulated liquors (FLs were prepared by blending 1-propanol, isobutanol, and isoamyl alcohol with ethanol, organic acids, and corresponding ethyl esters to simulate the formula of traditional Chinese liquors. The prepared FLs were submitted for evaluation of their intoxicating degree (ID. The results showed that the fusel alcohols had a biphasic effect on the IDs of the FLs, depending on the comprehensive coordination of the characteristic minor components. The importance of the suitable ratio of alcohols/acids/esters (RAAE on the IDs was also revealed. Under an optimal ratio level, the fusel alcohols exhibited negligible effects on the IDs of the FLs. Moreover, the ratio of isoamyl alcohol to isobutanol (IA/IB showed a strong positive correlation to the IDs of the FLs. This study lays a foundation for the potential application in producing low-ID liquor.

Fracture liaison service in a non-regional orthopaedic clinic--a cost-effective service.

LENUS (Irish Health Repository)

Ahmed, M

2012-01-01

Fracture liaison services (FLS) aim to provide cost-effective targeting of secondary fracture prevention. It is proposed that a dedicated FLS be available in any hospital to which a patient presents with a fracture. An existing orthopaedic clinic nurse was retrained to deliver a FLS. Proformas were used so that different nurses could assume the fracture liaison nurse (FLN) role, as required. Screening consisted of fracture risk estimation, phlebotomy and DXA scanning. 124 (11%) of all patients attending the orthopaedic fracture clinic were reviewed in the FLS. Upper limb fractures accounted for the majority of fragility fractures screened n=69 (55.6%). Two-thirds of patients (n=69) had reduced bone mineral density (BMD). An evidence based approach to both non-pharmacological and pharmacotherapy was used and most patients (76.6%) receiving pharmacotherapy received an oral bisphosphonate (n=46). The FLS has proven to be an effective way of delivering secondary prevention for osteoporotic fracture in a non-regional fracture clinic, without increasing staff costs.

Breaking BAG: The Co-Chaperone BAG3 in Health and Disease.

Science.gov (United States)

Behl, Christian

2016-08-01

Human BAG (Bcl-2-associated athanogene) proteins form a family of antiapoptotic proteins that currently consists of six members (BAG1-6) all sharing the BAG protein domain from which the name arises. Via this domain, BAG proteins bind to the heat shock protein 70 (Hsp70), thereby acting as a co-chaperone regulating the activity of Hsp70. In addition to their antiapoptotic activity, all human BAG proteins have distinct functions in health and disease, and BAG3 in particular is the focus of many investigations. BAG3 has a modular protein domain composition offering the possibility for manifold interactions with other proteins. Various BAG3 functions are implicated in disorders including cancer, myopathies, and neurodegeneration. The discovery of its role in selective autophagy and the description of BAG3-mediated selective macroautophagy as an adaptive mechanism to maintain cellular homeostasis, under stress as well as during aging, make BAG3 a highly interesting target for future pharmacological interventions. Copyright © 2016 Elsevier Ltd. All rights reserved.

Heat Shock Proteins and Autophagy Pathways in Neuroprotection: from Molecular Bases to Pharmacological Interventions

Directory of Open Access Journals (Sweden)

Botond Penke

2018-01-01

Full Text Available Neurodegenerative diseases (NDDs such as Alzheimer’s disease, Parkinson’s disease and Huntington’s disease (HD, amyotrophic lateral sclerosis, and prion diseases are all characterized by the accumulation of protein aggregates (amyloids into inclusions and/or plaques. The ubiquitous presence of amyloids in NDDs suggests the involvement of disturbed protein homeostasis (proteostasis in the underlying pathomechanisms. This review summarizes specific mechanisms that maintain proteostasis, including molecular chaperons, the ubiquitin-proteasome system (UPS, endoplasmic reticulum associated degradation (ERAD, and different autophagic pathways (chaperon mediated-, micro-, and macro-autophagy. The role of heat shock proteins (Hsps in cellular quality control and degradation of pathogenic proteins is reviewed. Finally, putative therapeutic strategies for efficient removal of cytotoxic proteins from neurons and design of new therapeutic targets against the progression of NDDs are discussed.

Computational identification of putative cytochrome P450 genes in ...

African Journals Online (AJOL)

In this work, a computational study of expressed sequence tags (ESTs) of soybean was performed by data mining methods and bio-informatics tools and as a result 78 putative P450 genes were identified, including 57 new ones. These genes were classified into five clans and 20 families by sequence similarities and among ...

Sylvie Chaperon, La médecine du sexe et les femmes, Paris, La Musardine, 2008, 198 p.

OpenAIRE

Quin, Grégory

2010-01-01

Après un travail fouillé sur les origines de la sexologie, Sylvie Chaperon, historienne spécialiste d’histoire des femmes et du genre, maîtresse de conférences à l’Université de Toulouse 2, propose dans son nouveau livre une anthologie de textes que des médecins du XIXe siècle ont produits sur la sexualité féminine et ses diverses pathologies. L’ouvrage est construit autour d’une cinquantaine de cas de quelques-unes de ces pathologies associées à la sexualité des femmes : l’onanisme, la nymph...

Putative golden proportions as predictors of facial esthetics in adolescents.

NARCIS (Netherlands)

Kiekens, R.M.A.; Kuijpers-Jagtman, A.M.; Hof, M.A. van 't; Hof, B.E. van 't; Maltha, J.C.

2008-01-01

INTRODUCTION: In orthodontics, facial esthetics is assumed to be related to golden proportions apparent in the ideal human face. The aim of the study was to analyze the putative relationship between facial esthetics and golden proportions in white adolescents. METHODS: Seventy-six adult laypeople

Putative Dementia Cases Fluctuate as a Function of Mini-Mental State Examination Cut-Off Points.

Science.gov (United States)

Rosa, Ilka M; Henriques, Ana G; Wiltfang, Jens; da Cruz E Silva, Odete A B

2018-01-01

As the population ages, there is a growing need to quickly and accurately identify putative dementia cases. Many cognitive tests are available; among those commonly used are the Cognitive Dementia Rating (CDR) and the Mini-Mental Status Examination (MMSE). The aim of this work was to compare the validity and reliability of these cognitive tests in a primary care based cohort (pcb-Cohort). The MMSE and the CDR were applied to 568 volunteers in the pcb-Cohort. Distinct cut-off points for the MMSE were considered, namely MMSE 27, MMSE 24, and MMSE PT (adapted for the Portuguese population). The MMSE 27 identified the greatest number of putative dementia cases, and, as determined by the ROC curve, it was the most sensitive and specific of the MMSE cut-offs considered. Putative predictive or risk factors identified included age, literacy, depression, and diabetes mellitus (DM). DM has previously been indicated as a risk factor for dementia and Alzheimer's disease. Comparatively, the MMSE 27 cut-off has the greatest sensibility (94.9%) and specificity (66.3%) when compared to MMSE PT and MMSE 24. Upon comparing MMSE and CDR scores, the latter identified a further 146 putative dementia cases, thus permitting one to propose that in an ideal situation, both tests should be employed. This increases the likelihood of identifying putative dementia cases for subsequent follow up work, thus these cognitive tests represent important tools in patient care. Further, this is a significant study for Portuguese populations, where few of these studies have been carried out.

Heterologous expression and characterization of a putative glycoside hydrolase family 43 arabinofuranosidase from Clostridium thermocellum B8

NARCIS (Netherlands)

Camargo, de Brenda R.; Claassens, Nico J.; Quirino, Betania Ferraz; Noronha, Eliane F.; Kengen, Servé W.M.

2018-01-01

An extensive list of putative cellulosomal enzymes from C. thermocellum is now available in the public databanks, however, most of these remain unvalidated with regard to their activity and expression control mechanisms. This is particularly true of those enzymes putatively involved in hemicellulose

Analysis of the role of the gene bipA, encoding the major endoplasmic reticulum chaperone protein in the secretion of homologous and heterologous proteins in black Aspergilli

NARCIS (Netherlands)

Punt, P.J.; Gemeren, I.A. van; Drint-Kuijvenhoven, J.; Hessing, J.G.M.; Muijlwijk van - Harteveld, G.M.; Beijersbergen, A.; Verrips, C.T.; Hondel, C.A.M.J.J. van den

1998-01-01

The function of the endoplasmic-reticulum-localized chaperone binding protein (BiP) in relation to protein secretion in filamentous fungi was studied. It was shown that the overproduction of several homologous and heterologous recombinant proteins by Aspergillus strains induces the expression of

Chaperone protein HYPK interacts with the first 17 amino acid region of Huntingtin and modulates mutant HTT-mediated aggregation and cytotoxicity

Energy Technology Data Exchange (ETDEWEB)

Choudhury, Kamalika Roy [Crystallography and Molecular Biology Division, Saha Institute of Nuclear Physics, 1/AF Bidhannagar, Kolkata 700064 (India); Centre for Neuroscience, Indian Institute of Science, Bangalore 560012 (India); Bhattacharyya, Nitai P., E-mail: nitai_sinp@yahoo.com [Biomedical Genomics Centre, PG Polyclinic Building, 5, Suburbun Hospital Road, Kolkata 700020 (India)

2015-01-02

Highlights: • HYPK reduces mutant HTT-mediated aggregate formation and cytotoxicity. • Interaction of HYPK with HTT requires N-terminal 17 amino acid of HTT (HTT-N17). • Deletion of HTT-N17 leads to SDS-soluble, smaller, nuclear aggregates. • These smaller aggregates do not associate with HYPK and are more cytotoxic. • Maybe, interaction of HYPK with amphipathic HTT-N17 block HTT aggregate formation. - Abstract: Huntington’s disease is a polyglutamine expansion disorder, characterized by mutant HTT-mediated aggregate formation and cytotoxicity. Many reports suggests roles of N-terminal 17 amino acid domain of HTT (HTT-N17) towards subcellular localization, aggregate formation and subsequent pathogenicity induced by N-terminal HTT harboring polyQ stretch in pathogenic range. HYPK is a HTT-interacting chaperone which can reduce N-terminal mutant HTT-mediated aggregate formation and cytotoxicity in neuronal cell lines. However, how HYPK interacts with N-terminal fragment of HTT remained unknown. Here we report that specific interaction of HYPK with HTT-N17 is crucial for the chaperone activity of HYPK. Deletion of HTT-N17 leads to formation of tinier, SDS-soluble nuclear aggregates formed by N-terminal mutant HTT. The increased cytotoxicity imparted by these tiny aggregates might be contributed due to loss of interaction with HYPK.

1H, 15N and 13C resonance assignments of the J-domain of co-chaperone Sis1 from Saccharomyces cerevisiae.

Science.gov (United States)

Pinheiro, Glaucia M S; Amorim, Gisele C; Iqbal, Anwar; Ramos, C H I; Almeida, Fabio C L

2018-04-30

Protein folding in the cell is usually aided by molecular chaperones, from which the Hsp70 (Hsp = heat shock protein) family has many important roles, such as aiding nascent folding and participating in translocation. Hsp70 has ATPase activity which is stimulated by binding to the J-domain present in co-chaperones from the Hsp40 family. Hsp40s have many functions, as for instance the binding to partially folded proteins to be delivered to Hsp70. However, the presence of the J-domain characterizes Hsp40s or, by this reason, as J-proteins. The J-domain alone can stimulate Hsp70 ATPase activity. Apparently, it also maintains the same conformation as in the whole protein although structural information on full J-proteins is still missing. This work reports the 1 H, 15 N and 13 C resonance assignments of the J-domain of a Hsp40 from Saccharomyces cerevisiae, named Sis1. Secondary structure and order parameter prediction from chemical shifts are also reported. Altogether, the data show that Sis1 J-domain is highly structured and predominantly formed by α-helices, results that are in very good agreement with those previously reported for the crystallographic structure.

Identification of an exported heat shock protein 70 in Plasmodium falciparum

Directory of Open Access Journals (Sweden)

Grover Manish

2013-01-01

Full Text Available Host cell remodelling is a hallmark of malaria pathogenesis. It involves protein folding, unfolding and trafficking events and thus participation of chaperones such as Hsp70s and Hsp40s is well speculated. Until recently, only Hsp40s were thought to be the sole representative of the parasite chaperones in the exportome. However, based on the re-annotated Plasmodium falciparum genome sequence, a putative candidate for exported Hsp70 has been reported, which otherwise was known to be a pseudogene. We raised a specific antiserum against a C-terminal peptide uniquely present in PfHsp70-x. Immunoblotting and immunofluorescence-based approaches in combination with sub-cellular fractionation by saponin and streptolysin-O have been taken to determine the expression and localization of PfHsp70-x in infected erythrocyte. The re-annotated sequence of PfHsp70-x reveals it to be a functional protein with an endoplasmic reticulum signal peptide. It gets maximally expressed at the schizont stage of intra-erythrocytic life cycle. Majority of the protein localizes to the parasitophorous vacuole and some of it gets exported to the erythrocyte compartment where it associates with Maurer’s clefts. The identification of an exported parasite Hsp70 chaperone presents us with the fact that the parasite has evolved customized chaperones which might be playing crucial roles in aspects of trafficking and host cell remodelling.

Sigma-1 receptor chaperone and brain-derived neurotrophic factor: emerging links between cardiovascular disease and depression.

Science.gov (United States)

Hashimoto, Kenji

2013-01-01

Epidemiological studies have demonstrated a close relationship between depression and cardiovascular disease (CVD). Although it is known that the central nervous system (CNS) contributes to this relationship, the detailed mechanisms involved in this process remain unclear. Recent studies suggest that the endoplasmic reticulum (ER) molecular chaperone sigma-1 receptor and brain-derived neurotrophic factor (BDNF) play a role in the pathophysiology of CVD and depression. Several meta-analysis studies have showed that levels of BDNF in the blood of patients with major depressive disorder (MDD) are lower than normal controls, indicating that blood BDNF might be a biomarker for depression. Furthermore, blood levels of BDNF in patients with CVD are also lower than normal controls. A recent study using conditional BDNF knock-out mice in animal models of myocardial infarction highlighted the role of CNS-mediated mechanisms in the cardioprotective effects of BDNF. In addition, a recent study shows that decreased levels of sigma-1 receptor in the mouse brain contribute to the association between heart failure and depression. Moreover, sigma-1 receptor agonists, including the endogenous neurosteroid dehydroepiandosterone (DHEA) and the selective serotonin reuptake inhibitor (SSRI) fluvoxamine, show potent cardioprotective and antidepressive effects in rodents, via sigma-1 receptor stimulation. Interestingly, agonist activation of sigma-1 receptors increased the secretion of mature BDNF from its precursor proBDNF via chaperone activity in the ER. Given the role of ER stress in the pathophysiology of CVD and MDD, the author will discuss the potential link between sigma-1 receptors and BDNF-TrkB pathway in the pathophysiology of these two diseases. Finally, the author will make a case for potent sigma-1 receptor agonists and TrkB agonists as new potential therapeutic drugs for depressive patients with CVD. Copyright © 2012 Elsevier Ltd. All rights reserved.

Supplementary data: Variation in the PTEN-induced putative kinase ...

Indian Academy of Sciences (India)

Variation in the PTEN-induced putative kinase 1 gene associated with the increase risk of type 2 diabetes in northern Chinese. Yanchun Qu, Liang Sun, Ze Yang and Ruifa Han. J. Genet. 90, 125–128. Table 1. Clinical characteristics of cases and controls. Phenotype. T2DM. Controls. P value. Age (years). 49.5 ± 11.1. 50.4 ± ...

Amplification of tumor inducing putative cancer stem cells (CSCs) by vitamin A/retinol from mammary tumors

Energy Technology Data Exchange (ETDEWEB)

Sharma, Rohit B. [Department of Microbiology and Molecular Genetics, University of Pittsburgh, PA 15261 (United States); Wang, Qingde [Department of Surgery, University of Pittsburgh, PA 15261 (United States); Khillan, Jaspal S., E-mail: khillan@pitt.edu [Department of Microbiology and Molecular Genetics, University of Pittsburgh, PA 15261 (United States)

2013-07-12

Highlights: •Vitamin A supports self renewal of putative CSCs from mammary tumors. •These cells exhibit impaired retinol metabolism into retinoic acid. •CSCs from mammary tumors differentiate into mammary specific cell lineages. •The cells express mammary stem cell specific CD29 and CD49f markers. •Putative CSCs form highly metastatic tumors in NOD SCID mouse. -- Abstract: Solid tumors contain a rare population of cancer stem cells (CSCs) that are responsible for relapse and metastasis. The existence of CSC however, remains highly controversial issue. Here we present the evidence for putative CSCs from mammary tumors amplified by vitamin A/retinol signaling. The cells exhibit mammary stem cell specific CD29{sup hi}/CD49f{sup hi}/CD24{sup hi} markers, resistance to radiation and chemo therapeutic agents and form highly metastatic tumors in NOD/SCID mice. The cells exhibit indefinite self renewal as cell lines. Furthermore, the cells exhibit impaired retinol metabolism and do not express enzymes that metabolize retinol into retinoic acid. Vitamin A/retinol also amplified putative CSCs from breast cancer cell lines that form highly aggressive tumors in NOD SCID mice. The studies suggest that high purity putative CSCs can be isolated from solid tumors to establish patient specific cell lines for personalized therapeutics for pre-clinical translational applications. Characterization of CSCs will allow understanding of basic cellular and molecular pathways that are deregulated, mechanisms of tumor metastasis and evasion of therapies that has direct clinical relevance.

Alkenenitrile Transmissive Olefination: Synthesis of the Putative Lignan "Morinol I"

Science.gov (United States)

Fleming, Fraser F.; Liu, Wang; Yao, Lihua; Pitta, Bhaskar; Purzycki, Matthew; Ravikumar, P. C.

2012-01-01

Grignard reagents trigger an addition-elimination with α'-hydroxy acrylonitriles to selectively generate Z-alkenenitriles. The modular assembly of Z-alkenenitriles from a Grignard reagent, acrylonitrile, and an aldehyde is ideal for stereoselectively synthesizing alkenes as illustrated in the synthesis of the putative lignan "morinol I." PMID:22545004

Selective chaperone effect of aminocyclitol derivatives on G202R and other mutant glucocerebrosidases causing Gaucher disease.

Science.gov (United States)

Serra-Vinardell, Jenny; Díaz, Lucía; Gutiérrez-de Terán, Hugo; Sánchez-Ollé, Gessamí; Bujons, Jordi; Michelakakis, Helen; Mavridou, Irene; Aerts, Johannes M F G; Delgado, Antonio; Grinberg, Daniel; Vilageliu, Lluïsa; Casas, Josefina

2014-09-01

Gaucher disease is an autosomal recessive lysosomal disorder characterized by the accumulation of glucosylceramide as a result of a deficiency of the enzyme glucocerebrosidase. Several competitive glucocerebrosidase inhibitors are able to act as pharmacological chaperones for an efficient rescue of the mutated, misfolded forms of the enzyme. Along this line, we report in this work on the ability of several aminocyclitols to increase the residual glucocerebrosidase activity in patient fibroblasts with different genotypes. Some of the compounds were slightly active on fibroblasts bearing some mutations, including the highly prevalent N370S mutation. All compounds were highly active as enzyme activity enhancers on fibroblasts from Gaucher disease patients containing the G202R mutation. Moreover, using the novel tagged sphingolipid ω-azidosphingosine, a reduction in the tagged glucosylceramide accumulation was also observed for selected aminocyclitols. Attempts to explain the activity impairment observed in glucocerebrosidase bearing the G202R mutation by comparative molecular dynamic studies on wild type and the G202R mutated proteins (free and isofagomine-bound, in both cases) were unsuccessful. Under the simulation conditions used, no clear effect of the G202R mutation neither over the global structure of the protein nor on the loops that constitute the glucocerebrosidase active site was observed. Since the G202R residue is located on the protein surface, altered protein-membrane or protein-protein interactions could account for the observed differences. In conclusion, we have tested novel compounds that have shown some chaperone effect on particular glucocerebrosidase mutant enzymes, supporting the enhancement therapy as an alternative approach for Gaucher disease. Copyright © 2014 Elsevier Ltd. All rights reserved.

Chaperone roles for TMAO and HSP70 during hyposmotic stress in the spiny dogfish shark (Squalus acanthias).

Science.gov (United States)

MacLellan, Robyn J; Tunnah, Louise; Barnett, David; Wright, Patricia A; MacCormack, Tyson; Currie, Suzanne

2015-10-01

Salinity decreases are experienced by many marine elasmobranchs. To understand how these fishes cope with hyposmotic stress on a cellular level, we used the spiny dogfish shark (Squalus acanthias) as a model to test whether a reciprocal relationship exists between the cell's two primary protein protection mechanisms, the chemical (e.g., trimethylamine oxide, TMAO) and molecular (e.g., heat shock protein 70, HSP70) chaperone systems. This relationship is interesting given that many elasmobranchs are expected to gain water and lose osmolytes, chemical chaperones, and ions as they osmoconform to new, lowered salinity. Dogfish were cannulated for repeated blood sampling and exposed to 70% seawater (SW) for 48 h. These hyposmotic conditions had no effect on red blood cell (RBC) and white muscle TMAO concentrations, and did not result in HSP70 induction or signs of protein damage (i.e., increased ubiquitin), suggesting that TMAO levels were sufficiently protective in these tissues. However, in the gill, we observed a significant decrease in TMAO concentration and a significant induction of HSP70 as well as signs of protein damage. In the face of this cellular stress response, gill Na(+)/K(+)-ATPase (NKA) activity significantly increased during hyposmotic conditions, as expected. We suggest that this functional preservation in the gill is partly the result of HSP70 induction with lowered salinity. We conclude a reciprocal relationship between TMAO and HSP70 in the gills of dogfish as a result of in vivo hyposmotic stress. When osmotically induced protein damage surpasses the protective capacity of remaining TMAO, HSP70 is induced to preserve tissue and organismal function.

Thymoquinone inhibits TNF-α-induced inflammation and cell adhesion in rheumatoid arthritis synovial fibroblasts by ASK1 regulation

Energy Technology Data Exchange (ETDEWEB)

Umar, Sadiq; Hedaya, Omar; Singh, Anil K.; Ahmed, Salahuddin, E-mail: salah.ahmed@wsu.edu

2015-09-15

Tumor necrosis factor-α (TNF-α) is a pro-inflammatory cytokine produced by monocytes/macrophage that plays a pathological role in rheumatoid arthritis (RA). In this study, we investigate the effect of thymoquinone (TQ), a phytochemical found in Nigella sativa, in regulating TNF-α-induced RA synovial fibroblast (RA-FLS) activation. Treatment with TQ (1–5 μM) had no marked effect on the viability of human RA-FLS. Pre-treatment of TQ inhibited TNF-α-induced interleukin-6 (IL-6) and IL-8 production and ICAM-1, VCAM-1, and cadherin-11 (Cad-11) expression in RA-FLS (p < 0.01). Evaluation of the signaling events showed that TQ inhibited TNF-α-induced phospho-p38 and phospho-JNK expression, but had no inhibitory effect on NF-κB pathway, in RA-FLS (p < 0.05; n = 4). Interestingly, we observed that selective down-regulation of TNF-α-induced phospho-p38 and phospho-JNK activation by TQ is elicited through inhibition of apoptosis-regulated signaling kinase 1 (ASK1). Furthermore, TNF-α selectively induced phosphorylation of ASK1 at Thr845 residue in RA-FLS, which was inhibited by TQ pretreatment in a dose dependent manner (p < 0.01). Pre-treatment of RA-FLS with ASK1 inhibitor (TC ASK10), blocked TNF-α induced expression of ICAM-1, VCAM-1, and Cad-11. Our results suggest that TNF-α-induced ASK1-p38/JNK pathway is an important mediator of cytokine synthesis and enhanced expression of adhesion molecule in RA-FLS and TQ, by selectively inhibiting this pathway, may have a potential therapeutic value in regulating tissue destruction observed in RA. - Highlights: • Evolving evidence suggests that ASK1 plays a central role in rheumatic arthritis (RA). • TNF-α activates ASK1, which regulate downstream signaling through JNK/p38 activation in RA-FLS. • ASK1 may be used as a potential therapeutic target in RA. • Thymoquinone was able to selectively inhibit TNF-α-induced phosphorylation of ASK1 in RA-FLS. • Thymoquinone might serve as a potential small

Development and characterization of membrane surface display system using molecular chaperon, prsA, of Bacillus subtilis

International Nuclear Information System (INIS)

Kim, June-Hyung; Park, In-Suk; Kim, Byung-Gee

2005-01-01

We report a new membrane surface display system based on molecular chaperon, prsA, of Bacillus subtilis. Clostridium thermocellum cellulase, celA, was fused to C-terminal end of PrsA. Cellulase activity of B. subtilis protoplast, which expressed PrsA-CelA was 15 times higher compared to control strain. More than 85% of total cellulase activity was observed in surface displayed format and less than 15% of total cellulase activity was found in supernatant. Flow cytometric analysis of protoplast of PrsA-CelA fusion expressing bacteria provided another proof of uniform expression of fusion protein onto cytoplasmic membrane of B. subtilis. Without lysozyme treatment, only part of cellulase activity (10%) was observed in whole cell fraction

Sylvie Chaperon, La médecine du sexe et les femmes, Paris, La Musardine, 2008, 198 p.

Directory of Open Access Journals (Sweden)

Grégory Quin

2010-07-01

Full Text Available Après un travail fouillé sur les origines de la sexologie, Sylvie Chaperon, historienne spécialiste d’histoire des femmes et du genre, maîtresse de conférences à l’Université de Toulouse 2, propose dans son nouveau livre une anthologie de textes que des médecins du XIXe siècle ont produits sur la sexualité féminine et ses diverses pathologies. L’ouvrage est construit autour d’une cinquantaine de cas de quelques-unes de ces pathologies associées à la sexualité des femmes : l’onanisme, la nymph...

The Intrinsically Disordered Domain of the Antitoxin Phd Chaperones the Toxin Doc against Irreversible Inactivation and Misfolding*

Science.gov (United States)

De Gieter, Steven; Konijnenberg, Albert; Talavera, Ariel; Butterer, Annika; Haesaerts, Sarah; De Greve, Henri; Sobott, Frank; Loris, Remy; Garcia-Pino, Abel

2014-01-01

The toxin Doc from the phd/doc toxin-antitoxin module targets the cellular translation machinery and is inhibited by its antitoxin partner Phd. Here we show that Phd also functions as a chaperone, keeping Doc in an active, correctly folded conformation. In the absence of Phd, Doc exists in a relatively expanded state that is prone to dimerization through domain swapping with its active site loop acting as hinge region. The domain-swapped dimer is not capable of arresting protein synthesis in vitro, whereas the Doc monomer is. Upon binding to Phd, Doc becomes more compact and is secured in its monomeric state with a neutralized active site. PMID:25326388

Effect of leucine-to-methionine substitutions on the diffraction quality of histone chaperone SET/TAF-Ibeta/INHAT crystals.

Science.gov (United States)

Senda, Miki; Muto, Shinsuke; Horikoshi, Masami; Senda, Toshiya

2008-10-01

One of the most frequent problems in crystallization is poor quality of the crystals. In order to overcome this obstacle several methods have been utilized, including amino-acid substitutions of the target protein. Here, an example is presented of crystal-quality improvement by leucine-to-methionine substitutions. A variant protein with three amino-acid substitutions enabled improvement of the crystal quality of the histone chaperone SET/TAF-Ibeta/INHAT when combined with optimization of the cryoconditions. This procedure improved the resolution of the SET/TAF-Ibeta/INHAT crystals from around 5.5 to 2.3 A without changing the crystallization conditions.

Functional analyses of a flavonol synthase–like gene from Camellia ...

Indian Academy of Sciences (India)

ACAATCCAGGGCAAGGTC 172-190. ACAATCAGGGCATTAGGG 815-833. CLoning (JF343560). CnFLS-FL. AGGAGTGAGAAGGGGAAAAA 43-62. CAAGACAATGAAACGAGTGAGT. 1106-1127. Full Length cloing. (JF343560). CnFLS-Q. TGGAAGGCAAGAAAGGATGGG. 407-427. CCACCGGAACAACTTGTCTGC 566-585.

Identification of a putative nuclear export signal motif in human NANOG homeobox domain

International Nuclear Information System (INIS)

Park, Sung-Won; Do, Hyun-Jin; Huh, Sun-Hyung; Sung, Boreum; Uhm, Sang-Jun; Song, Hyuk; Kim, Nam-Hyung; Kim, Jae-Hwan

2012-01-01

Highlights: ► We found the putative nuclear export signal motif within human NANOG homeodomain. ► Leucine-rich residues are important for human NANOG homeodomain nuclear export. ► CRM1-specific inhibitor LMB blocked the potent human NANOG NES-mediated nuclear export. -- Abstract: NANOG is a homeobox-containing transcription factor that plays an important role in pluripotent stem cells and tumorigenic cells. To understand how nuclear localization of human NANOG is regulated, the NANOG sequence was examined and a leucine-rich nuclear export signal (NES) motif ( 125 MQELSNILNL 134 ) was found in the homeodomain (HD). To functionally validate the putative NES motif, deletion and site-directed mutants were fused to an EGFP expression vector and transfected into COS-7 cells, and the localization of the proteins was examined. While hNANOG HD exclusively localized to the nucleus, a mutant with both NLSs deleted and only the putative NES motif contained (hNANOG HD-ΔNLSs) was predominantly cytoplasmic, as observed by nucleo/cytoplasmic fractionation and Western blot analysis as well as confocal microscopy. Furthermore, site-directed mutagenesis of the putative NES motif in a partial hNANOG HD only containing either one of the two NLS motifs led to localization in the nucleus, suggesting that the NES motif may play a functional role in nuclear export. Furthermore, CRM1-specific nuclear export inhibitor LMB blocked the hNANOG potent NES-mediated export, suggesting that the leucine-rich motif may function in CRM1-mediated nuclear export of hNANOG. Collectively, a NES motif is present in the hNANOG HD and may be functionally involved in CRM1-mediated nuclear export pathway.

Interaction of the iron–sulfur cluster assembly protein IscU with the Hsc66/Hsc20 molecular chaperone system of Escherichia coli

Science.gov (United States)

Hoff, Kevin G.; Silberg, Jonathan J.; Vickery, Larry E.

2000-01-01

The iscU gene in bacteria is located in a gene cluster encoding proteins implicated in iron–sulfur cluster assembly and an hsc70-type (heat shock cognate) molecular chaperone system, iscSUA-hscBA. To investigate possible interactions between these systems, we have overproduced and purified the IscU protein from Escherichia coli and have studied its interactions with the hscA and hscB gene products Hsc66 and Hsc20. IscU and its iron–sulfur complex (IscU–Fe/S) stimulated the basal steady-state ATPase activity of Hsc66 weakly in the absence of Hsc20 but, in the presence of Hsc20, increased the ATPase activity up to 480-fold. Hsc20 also decreased the apparent Km for IscU stimulation of Hsc66 ATPase activity, and surface plasmon resonance studies revealed that Hsc20 enhances binding of IscU to Hsc66. Surface plasmon resonance and isothermal titration calorimetry further showed that IscU and Hsc20 form a complex, and Hsc20 may thereby aid in the targeting of IscU to Hsc66. These results establish a direct and specific role for the Hsc66/Hsc20 chaperone system in functioning with isc gene components for the assembly of iron–sulfur cluster proteins. PMID:10869428

Metabolomic Elucidation of the Effects of Curcumin on Fibroblast-Like Synoviocytes in Rheumatoid Arthritis.

Directory of Open Access Journals (Sweden)

Joong Kyong Ahn

Full Text Available Rheumatoid arthritis (RA is a chronic systemic inflammatory disease characterized by synovial inflammation and joint disability. Curcumin is known to be effective in ameliorating joint inflammation in RA. To obtain new insights into the effect of curcumin on primary fibroblast-like synoviocytes (FLS, N = 3, which are key effector cells in RA, we employed gas chromatography/time-of-flight mass spectrometry (GC/TOF-MS-based metabolomics. Metabolomic profiling of tumor necrosis factor (TNF-α-stimulated and curcumin-treated FLS was performed using GC/TOF-MS in conjunction with univariate and multivariate statistical analyses. A total of 119 metabolites were identified. Metabolomic analysis revealed that metabolite profiles were clearly distinct between TNF-α-stimulated vs. the control group (not stimulated by TNF-α or curcumin. Treatment of FLS with curcumin showed that the metabolic perturbation by TNF-α could be reversed to that of the control group to a considerable extent. Curcumin-treated FLS had higher restoration of amino acid and fatty acid metabolism, as indicated by the prominent metabolic restoration of intermediates of amino acid and fatty acid metabolism, compared with that observed in TNF-α-stimulated FLS. In particular, the abundance of glycine, citrulline, arachidonic acid, and saturated fatty acids in TNF-α-stimulated FLS was restored to the control level after treatment with curcumin, suggesting that the effect of curcumin on preventing joint inflammation may be elucidated with the levels of these metabolites. Our results suggest that GC/TOF-MS-based metabolomic investigation using FLS has the potential for discovering the mechanism of action of curcumin and new targets for therapeutic drugs in RA.

Metabolomic Elucidation of the Effects of Curcumin on Fibroblast-Like Synoviocytes in Rheumatoid Arthritis.

Science.gov (United States)

Ahn, Joong Kyong; Kim, Sooah; Hwang, Jiwon; Kim, Jungyeon; Lee, You Sun; Koh, Eun-Mi; Kim, Kyoung Heon; Cha, Hoon-Suk

2015-01-01

Rheumatoid arthritis (RA) is a chronic systemic inflammatory disease characterized by synovial inflammation and joint disability. Curcumin is known to be effective in ameliorating joint inflammation in RA. To obtain new insights into the effect of curcumin on primary fibroblast-like synoviocytes (FLS, N = 3), which are key effector cells in RA, we employed gas chromatography/time-of-flight mass spectrometry (GC/TOF-MS)-based metabolomics. Metabolomic profiling of tumor necrosis factor (TNF)-α-stimulated and curcumin-treated FLS was performed using GC/TOF-MS in conjunction with univariate and multivariate statistical analyses. A total of 119 metabolites were identified. Metabolomic analysis revealed that metabolite profiles were clearly distinct between TNF-α-stimulated vs. the control group (not stimulated by TNF-α or curcumin). Treatment of FLS with curcumin showed that the metabolic perturbation by TNF-α could be reversed to that of the control group to a considerable extent. Curcumin-treated FLS had higher restoration of amino acid and fatty acid metabolism, as indicated by the prominent metabolic restoration of intermediates of amino acid and fatty acid metabolism, compared with that observed in TNF-α-stimulated FLS. In particular, the abundance of glycine, citrulline, arachidonic acid, and saturated fatty acids in TNF-α-stimulated FLS was restored to the control level after treatment with curcumin, suggesting that the effect of curcumin on preventing joint inflammation may be elucidated with the levels of these metabolites. Our results suggest that GC/TOF-MS-based metabolomic investigation using FLS has the potential for discovering the mechanism of action of curcumin and new targets for therapeutic drugs in RA.

The prenyl-binding protein PrBP/δ: a chaperone participating in intracellular trafficking.

Science.gov (United States)

Zhang, Houbin; Constantine, Ryan; Frederick, Jeanne M; Baehr, Wolfgang

2012-12-15

Expressed ubiquitously, PrBP/δ functions as chaperone/co-factor in the transport of a subset of prenylated proteins. PrBP/δ features an immunoglobulin-like β-sandwich fold for lipid binding, and interacts with diverse partners. PrBP/δ binds both C-terminal C15 and C20 prenyl side chains of phototransduction polypeptides and small GTP-binding (G) proteins of the Ras superfamily. PrBP/δ also interacts with the small GTPases, ARL2 and ARL3, which act as release factors (GDFs) for prenylated cargo. Targeted deletion of the mouse Pde6d gene encoding PrBP/δ resulted in impeded trafficking to the outer segments of GRK1 and cone PDE6 which are predicted to be farnesylated and geranylgeranylated, respectively. Rod and cone transducin trafficking was largely unaffected. These trafficking defects produce progressive cone-rod dystrophy in the Pde6d(-/-) mouse. Copyright © 2012 Elsevier Ltd. All rights reserved.

IL-34 Upregulated Th17 Production through Increased IL-6 Expression by Rheumatoid Fibroblast-Like Synoviocytes

OpenAIRE

Wang, Bing; Ma, Zijian; Wang, Miaomiao; Sun, Xiaotong; Tang, Yawei; Li, Ming; Zhang, Yan; Li, Fang; Li, Xia

2017-01-01

Rheumatoid arthritis (RA) is a chronic autoimmune disease which is characterized by synovial inflammation and cartilage damage for which causes articular dysfunction. Activation of fibroblast-like synoviocytes (FLS) is a critical step that promotes disease progression. In this study, we aimed to explore the effect of interleukin-34 (IL-34) on RA FLS as a proinflammatory factor and IL-34-stimulated FLS on the production of Th17. We found that serum IL-34 levels were increased compared to those...

Mouse zygote-specific proteasome assembly chaperone important for maternal-to-zygotic transition

Directory of Open Access Journals (Sweden)

Seung-Wook Shin

2012-11-01

During the maternal-to-zygotic transition (MZT, maternal proteins in oocytes are degraded by the ubiquitin–proteasome system (UPS, and new proteins are synthesized from the zygotic genome. However, the specific mechanisms underlying the UPS at the MZT are not well understood. We identified a molecule named zygote-specific proteasome assembly chaperone (ZPAC that is specifically expressed in mouse gonads, and expression of ZPAC was transiently increased at the mouse MZT. ZPAC formed a complex with Ump1 and associated with precursor forms of 20S proteasomes. Transcription of ZPAC genes was also under the control of an autoregulatory feedback mechanism for the compensation of reduced proteasome activity similar to Ump1 and 20S proteasome subunit gene expression. Knockdown of ZPAC in early embryos caused a significant reduction of proteasome activity and decrease in Ump1 and mature proteasomes, leading to accumulation of proteins that need to be degraded at the MZT and early developmental arrest. Therefore, a unique proteasome assembly pathway mediated by ZPAC is important for progression of the mouse MZT.

Search strings for the study of putative occupational determinants of disease

NARCIS (Netherlands)

Mattioli, Stefano; Zanardi, Francesca; Baldasseroni, Alberto; Schaafsma, Frederieke; Cooke, Robin M. T.; Mancini, Gianpiero; Fierro, Mauro; Santangelo, Chiara; Farioli, Andrea; Fucksia, Serenella; Curti, Stefania; Violante, Francesco S.; Verbeek, Jos

2010-01-01

To identify efficient PubMed search strategies to retrieve articles regarding putative occupational determinants of conditions not generally considered to be work related. Based on MeSH definitions and expert knowledge, we selected as candidate search terms the four MeSH terms describing

Functional analysis of propeptide as an intramolecular chaperone for in vivo folding of subtilisin nattokinase.

Science.gov (United States)

Jia, Yan; Liu, Hui; Bao, Wei; Weng, Meizhi; Chen, Wei; Cai, Yongjun; Zheng, Zhongliang; Zou, Guolin

2010-12-01

Here, we show that during in vivo folding of the precursor, the propeptide of subtilisin nattokinase functions as an intramolecular chaperone (IMC) that organises the in vivo folding of the subtilisin domain. Two residues belonging to β-strands formed by conserved regions of the IMC are crucial for the folding of the subtilisin domain through direct interactions. An identical protease can fold into different conformations in vivo due to the action of a mutated IMC, resulting in different kinetic parameters. Some interfacial changes involving conserved regions, even those induced by the subtilisin domain, blocked subtilisin folding and altered its conformation. Insight into the interaction between the subtilisin and IMC domains is provided by a three-dimensional structural model. Copyright © 2010 Federation of European Biochemical Societies. Published by Elsevier B.V. All rights reserved.

Putative Biomarkers and Targets of Estrogen Receptor Negative Human Breast Cancer

Directory of Open Access Journals (Sweden)

Stephen W. Byers

2011-07-01

Full Text Available Breast cancer is a progressive and potentially fatal disease that affects women of all ages. Like all progressive diseases, early and reliable diagnosis is the key for successful treatment and annihilation. Biomarkers serve as indicators of pathological, physiological, or pharmacological processes. Her2/neu, CA15.3, estrogen receptor (ER, progesterone receptor (PR, and cytokeratins are biomarkers that have been approved by the Food and Drug Administration for disease diagnosis, prognosis, and therapy selection. The structural and functional complexity of protein biomarkers and the heterogeneity of the breast cancer pathology present challenges to the scientific community. Here we review estrogen receptor-related putative breast cancer biomarkers, including those of putative breast cancer stem cells, a minor population of estrogen receptor negative tumor cells that retain the stem cell property of self renewal. We also review a few promising cytoskeleton targets for ER alpha negative breast cancer.

The Exported Chaperone PfHsp70x Is Dispensable for the Plasmodium falciparum Intraerythrocytic Life Cycle.

Science.gov (United States)

Cobb, David W; Florentin, Anat; Fierro, Manuel A; Krakowiak, Michelle; Moore, Julie M; Muralidharan, Vasant

2017-01-01

Export of parasite proteins into the host erythrocyte is essential for survival of Plasmodium falciparum during its asexual life cycle. While several studies described key factors within the parasite that are involved in protein export, the mechanisms employed to traffic exported proteins within the host cell are currently unknown. Members of the Hsp70 family of chaperones, together with their Hsp40 cochaperones, facilitate protein trafficking in other organisms, and are thus likely used by P. falciparum in the trafficking of its exported proteins. A large group of Hsp40 proteins is encoded by the parasite and exported to the host cell, but only one Hsp70, P. falciparum Hsp70x (PfHsp70x), is exported with them. PfHsp70x is absent in most Plasmodium species and is found only in P. falciparum and closely related species that infect apes. Herein, we have utilized clustered regularly interspaced short palindromic repeat (CRISPR)/Cas9 genome editing in P. falciparum to investigate the essentiality of PfHsp70x. We show that parasitic growth was unaffected by knockdown of PfHsp70x using both the dihydrofolate reductase (DHFR)-based destabilization domain and the glmS ribozyme system. Similarly, a complete gene knockout of PfHsp70x did not affect the ability of P. falciparum to proceed through its intraerythrocytic life cycle. The effect of PfHsp70x knockdown/knockout on the export of proteins to the host red blood cell (RBC), including the critical virulence factor P. falciparum erythrocyte membrane protein 1 (PfEMP1), was tested, and we found that this process was unaffected. These data show that although PfHsp70x is the sole exported Hsp70, it is not essential for the asexual development of P. falciparum . IMPORTANCE Half of the world's population lives at risk for malaria. The intraerythrocytic life cycle of Plasmodium spp. is responsible for clinical manifestations of malaria; therefore, knowledge of the parasite's ability to survive within the erythrocyte is

Sequence analysis of putative swrW gene required for surfactant ...

African Journals Online (AJOL)

owner

2012-07-17

Jul 17, 2012 ... These nucleotide and protein sequence analysis of the putative swrW gene provides vital information on the versatility .... chain reaction (PCR) products were stored at 4°C. Presence of ... identical to the same gene with an E-value of 0.0. .... The Prokaryotes-A Handbook on the Biol. of Bacteria:Ecophysiol.

A Proteomics Approach to Identify New Putative Cardiac Intercalated Disk Proteins.

Directory of Open Access Journals (Sweden)

Siddarth Soni

Full Text Available Synchronous beating of the heart is dependent on the efficient functioning of the cardiac intercalated disk (ID. The ID is composed of a complex protein network enabling electrical continuity and chemical communication between individual cardiomyocytes. Recently, several different studies have shed light on increasingly prevalent cardiac diseases involving the ID. Insufficient knowledge of its composition makes it difficult to study these disease mechanisms in more detail and therefore here we aim expand the ID proteome. Here, using a combination of general membrane enrichment, in-depth quantitative proteomics and an intracellular location driven bioinformatics approach, we aim to discover new putative ID proteins in rat ventricular tissue.General membrane isolation, enriched amongst others also with ID proteins as based on presence of the established markers connexin-43 and n-cadherin, was performed using centrifugation. By mass spectrometry, we quantitatively evaluated the level of 3455 proteins in the enriched membrane fraction (EMF and its counterpart, the soluble cytoplasmic fraction. These data were stringently filtered to generate a final set of 97 enriched, putative ID proteins. These included Cx43 and n-cadherin, but also many interesting novel candidates. We selected 4 candidates (Flotillin-2 (FLOT2, Nexilin (NEXN, Popeye-domain-containg-protein 2 (POPDC2 and thioredoxin-related-transmembrane-protein 2 (TMX2 and confirmed their co-localization with n-cadherin in the ID of human and rat heart cryo-sections, and isolated dog cardiomyocytes.The presented proteomics dataset of putative new ID proteins is a valuable resource for future research into this important molecular intersection of the heart.

Loss of function mutation in LARP7, chaperone of 7SK ncRNA, causes a syndrome of facial dysmorphism, intellectual disability, and primordial dwarfism.

Science.gov (United States)

Alazami, Anas M; Al-Owain, Mohammad; Alzahrani, Fatema; Shuaib, Taghreed; Al-Shamrani, Hussain; Al-Falki, Yahya H; Al-Qahtani, Saleh M; Alsheddi, Tarfa; Colak, Dilek; Alkuraya, Fowzan S

2012-10-01

Primordial dwarfism (PD) is a clinically and genetically heterogeneous condition. Various molecular mechanisms are known to underlie the disease including impaired mitotic mechanics, abnormal IGF2 expression, perturbed DNA damage response, defective spliceosomal machinery, and abnormal replication licensing. Here, we describe a syndromic form of PD associated with severe intellectual disability and distinct facial features in a large multiplex Saudi family. Analysis reveals a novel underlying mechanism for PD involving depletion of 7SK, an abundant cellular noncoding RNA (ncRNA), due to mutation of its chaperone LARP7. We show that 7SK levels are tightly linked to LARP7 expression across cell lines, and that this chaperone is ubiquitously expressed in the mouse embryo. The 7SK is known to influence the expression of a wide array of genes through its inhibitory effect on the positive transcription elongation factor b (P-TEFb) as well as its competing role in HMGA1-mediated transcriptional regulation. This study documents a critical role played by ncRNA in human development and adds to the growing list of molecular mechanisms that, when perturbed, converge on the PD phenotype. © 2012 Wiley Periodicals, Inc.

Chaperone-Mediated Regulation of Choline Acetyltransferase Protein Stability and Activity by HSC/HSP70, HSP90, and p97/VCP

Directory of Open Access Journals (Sweden)

Trevor M. Morey

2017-12-01

Full Text Available Choline acetyltransferase (ChAT synthesizes the neurotransmitter acetylcholine in cholinergic neurons, and mutations of this enzyme are linked to the neuromuscular disorder congenital myasthenic syndrome (CMS. One CMS-related mutation, V18M, reduces ChAT enzyme activity and cellular protein levels, and is located within a highly-conserved N-terminal proline-rich motif at residues 14PKLPVPP20. We showed previously that disruption of this proline-rich motif by either proline-to-alanine mutation (P17A/P19A or mutation of residue Val18 (V18M enhances ubiquitination and degradation of these mutant ChAT proteins expressed in cholinergic SN56 cells by an unknown mechanism. In this study, using proximity-dependent biotin identification (BioID, co-immunoprecipitation and in situ proximity-ligation assay (PLA, we identified the heat shock proteins (HSPs HSC/HSP70 and HSP90 as novel ChAT protein-interactors. These molecular chaperones are well-known for promoting the folding and stabilization of cellular proteins. Thus, we found that inhibition of HSPs by treatment of cells with either the HSC/HSP70 inhibitors 2-phenylethynesulfonamide (PES or VER-155008, or the HSP90 inhibitor 17-AAG reduced cellular ChAT activity and solubility, and enhanced the ubiquitination and proteasome-dependent loss of ChAT protein. Importantly, the effects of HSP inhibition were greater for mutant ChAT proteins (P17A/P19A-ChAT and CMS-related V18M- and A513T-ChAT compared to wild-type ChAT. HSPs can promote ubiquitination and degradation of terminally misfolded proteins through cooperative interaction with the E3 ubiquitin ligase CHIP/Stub1, and while we show that ChAT interacts with CHIP in situ, siRNA-mediated knock-down of CHIP had no effect on either wild-type or mutant ChAT protein levels. However, inhibition of the endoplasmic reticulum (ER- and HSP-associated co-chaperone p97/VCP prevented degradation of ubiquitinated ChAT. Together, these results identify novel mechanisms

Putative and unique gene sequence utilization for the design of species specific probes as modeled by Lactobacillus plantarum

Science.gov (United States)

The concept of utilizing putative and unique gene sequences for the design of species specific probes was tested. The abundance profile of assigned functions within the Lactobacillus plantarum genome was used for the identification of the putative and unique gene sequence, csh. The targeted gene (cs...

Search strings for the study of putative occupational determinants of disease

NARCIS (Netherlands)

Mattioli, S.; Zanardi, F.; Baldasseroni, A.; Schaafsma, F.; Cooke, R.M.T.; Mancini, G.; Fierro, M.; Santangelo, C.; Farioli, A.; Fucksia, S.; Curti, S.; Violante, F.S.; Verbeek, J.

2010-01-01

Objective To identify efficient PubMed search strategies to retrieve articles regarding putative occupational determinants of conditions not generally considered to be work related. Methods Based on MeSH definitions and expert knowledge, we selected as candidate search terms the four MeSH terms

Structural and biochemical characterization of phage λ FI protein (gpFI) reveals a novel mechanism of DNA packaging chaperone activity.

Science.gov (United States)

Popovic, Ana; Wu, Bin; Arrowsmith, Cheryl H; Edwards, Aled M; Davidson, Alan R; Maxwell, Karen L

2012-09-14

One of the final steps in the morphogenetic pathway of phage λ is the packaging of a single genome into a preformed empty head structure. In addition to the terminase enzyme, the packaging chaperone, FI protein (gpFI), is required for efficient DNA packaging. In this study, we demonstrate an interaction between gpFI and the major head protein, gpE. Amino acid substitutions in gpFI that reduced the strength of this interaction also decreased the biological activity of gpFI, implying that this head binding activity is essential for the function of gpFI. We also show that gpFI is a two-domain protein, and the C-terminal domain is responsible for the head binding activity. Using nuclear magnetic resonance spectroscopy, we determined the three-dimensional structure of the C-terminal domain and characterized the helical nature of the N-terminal domain. Through structural comparisons, we were able to identify two previously unannotated prophage-encoded proteins with tertiary structures similar to gpFI, although they lack significant pairwise sequence identity. Sequence analysis of these diverse homologues led us to identify related proteins in a variety of myo- and siphophages, revealing that gpFI function has a more highly conserved role in phage morphogenesis than was previously appreciated. Finally, we present a novel model for the mechanism of gpFI chaperone activity in the DNA packaging reaction of phage λ.

Putative contact ketoconazole shampoo-triggered pemphigus foliaceus in a dog.

Science.gov (United States)

Sung, Hyun-Jeong; Yoon, In-Hwa; Kim, Jung-Hyun

2017-09-01

A 10-year-old spayed female cocker spaniel dog was referred for an evaluation of acute-onset generalized pustular cutaneous lesions following application of ketoconazole shampoo. Cytologic and histopathologic examinations of the lesions revealed intra-epidermal pustules with predominantly neutrophils and acantholytic cells. This is the first description of putative contact ketoconazole shampoo-triggered pemphigus foliaceus in a dog.

Differential expressions of putative genes in various floral organs of ...

African Journals Online (AJOL)

STORAGESEVER

2009-06-03

Jun 3, 2009 ... Full Length Research Paper. Differential expressions of putative genes in various floral organs of the Pigeon orchid (Dendrobium crumenatum) using GeneFishing. Faridah, Q. Z.1, 2, Ng, B. Z.3, Raha, A. R.4, Umi, K. A. B.5 and Khosravi, A. R.2*. 1Department of Biology, Faculty Science, University Putra ...

Improved Fab presentation on phage surface with the use of molecular chaperone coplasmid system.

Science.gov (United States)

Loh, Qiuting; Leong, Siew Wen; Tye, Gee Jun; Choong, Yee Siew; Lim, Theam Soon

2015-05-15

The low presentation efficiency of Fab (fragment antigen binding) fragments during phage display is largely due to the complexity of disulphide bond formation. This can result in the presentation of Fab fragments devoid of a light chain during phage display. Here we propose the use of a coplasmid system encoding several molecular chaperones (DsbA, DsbC, FkpA, and SurA) to improve Fab packaging. A comparison was done using the Fab fragment from IgG and IgD. We found that the use of the coplasmid during phage packaging was able to improve the presentation efficiency of the Fab fragment on phage surfaces. A modified version of panning using the coplasmid system was evaluated and was successful at enriching Fab binders. Therefore, the coplasmid system would be an attractive alternative for improved Fab presentation for phage display. Copyright © 2015 Elsevier Inc. All rights reserved.

Retrovirus-specific differences in matrix and nucleocapsid protein-nucleic acid interactions: implications for genomic RNA packaging.

Science.gov (United States)

Sun, Meng; Grigsby, Iwen F; Gorelick, Robert J; Mansky, Louis M; Musier-Forsyth, Karin

2014-01-01

Retroviral RNA encapsidation involves a recognition event between genomic RNA (gRNA) and one or more domains in Gag. In HIV-1, the nucleocapsid (NC) domain is involved in gRNA packaging and displays robust nucleic acid (NA) binding and chaperone functions. In comparison, NC of human T-cell leukemia virus type 1 (HTLV-1), a deltaretrovirus, displays weaker NA binding and chaperone activity. Mutation of conserved charged residues in the deltaretrovirus bovine leukemia virus (BLV) matrix (MA) and NC domains affects virus replication and gRNA packaging efficiency. Based on these observations, we hypothesized that the MA domain may generally contribute to NA binding and genome encapsidation in deltaretroviruses. Here, we examined the interaction between HTLV-2 and HIV-1 MA proteins and various NAs in vitro. HTLV-2 MA displays higher NA binding affinity and better chaperone activity than HIV-1 MA. HTLV-2 MA also binds NAs with higher affinity than HTLV-2 NC and displays more robust chaperone function. Mutation of two basic residues in HTLV-2 MA α-helix II, previously implicated in BLV gRNA packaging, reduces NA binding affinity. HTLV-2 MA binds with high affinity and specificity to RNA derived from the putative packaging signal of HTLV-2 relative to nonspecific NA. Furthermore, an HIV-1 MA triple mutant designed to mimic the basic character of HTLV-2 MA α-helix II dramatically improves binding affinity and chaperone activity of HIV-1 MA in vitro and restores RNA packaging to a ΔNC HIV-1 variant in cell-based assays. Taken together, these results are consistent with a role for deltaretrovirus MA proteins in viral RNA packaging.

Feasibility of adapting the fundamentals of laparoscopic surgery trainer box to endoscopic skills training tool.

Science.gov (United States)

Crespin, Oscar M; Okrainec, Allan; Kwong, Andrea V; Habaz, Ilay; Jimenez, Maria Carolina; Szasz, Peter; Weiss, Ethan; Gonzalez, Cecilia G; Mosko, Jeffrey D; Liu, Louis W C; Swanstrom, Lee L; Perretta, Silvana; Shlomovitz, Eran

2018-06-01

The fundamentals of laparoscopic surgery (FLS) training box is a validated tool, already accessible to surgical trainees to hone their laparoscopic skills. We aim to investigate the feasibility of adapting the FLS box for the practice and assessment of endoscopic skills. This would allow for a highly available, reusable, low-cost, mechanical trainer. The design and development process was based on a user-centered design, which is a combination of the design thinking method and cognitive task analysis. The process comprises four phases: empathy, cognitive, prototyping/adaptation, and end user testing. The underlying idea was to utilize as many of the existing components of FLS training to maintain simplicity and cost effectiveness while allowing for the practice of clinically relevant endoscopic skills. A sample size of 18 participants was calculated to be sufficient to detect performance differences between experts and trainees using a two tailed t test with alpha set at 0.05, standard deviation of 5.5, and a power of 80%. Adaptation to the FLS box included two fundamental attachments: a front panel with an insertion point for an endoscope and a shaft which provides additional support and limits movement of the scope. The panel also allows for mounting of retroflexion tasks. Six endoscopic tasks inspired by FLS were designed (two of which utilize existing FLS components). Pilot testing with 38 participants showed high user's satisfaction and demonstrated that the trainer was robust and reliable. Task performance times was able to discriminate between trainees and experts for all six tasks. A mechanical, reusable, low-cost adaptation of the FLS training box for endoscopic skills is feasible and has high user satisfaction. Preliminary testing shows that the simulator is able to discriminate between trainees and experts. Following further validation, this adaptation may act as a supplement to the FES program.

A hybrid fuzzy logic and extreme learning machine for improving efficiency of circulating water systems in power generation plant

Science.gov (United States)

Aziz, Nur Liyana Afiqah Abdul; Siah Yap, Keem; Afif Bunyamin, Muhammad

2013-06-01

This paper presents a new approach of the fault detection for improving efficiency of circulating water system (CWS) in a power generation plant using a hybrid Fuzzy Logic System (FLS) and Extreme Learning Machine (ELM) neural network. The FLS is a mathematical tool for calculating the uncertainties where precision and significance are applied in the real world. It is based on natural language which has the ability of "computing the word". The ELM is an extremely fast learning algorithm for neural network that can completed the training cycle in a very short time. By combining the FLS and ELM, new hybrid model, i.e., FLS-ELM is developed. The applicability of this proposed hybrid model is validated in fault detection in CWS which may help to improve overall efficiency of power generation plant, hence, consuming less natural recourses and producing less pollutions.

A hybrid fuzzy logic and extreme learning machine for improving efficiency of circulating water systems in power generation plant

International Nuclear Information System (INIS)

Aziz, Nur Liyana Afiqah Abdul; Yap, Keem Siah; Bunyamin, Muhammad Afif

2013-01-01

This paper presents a new approach of the fault detection for improving efficiency of circulating water system (CWS) in a power generation plant using a hybrid Fuzzy Logic System (FLS) and Extreme Learning Machine (ELM) neural network. The FLS is a mathematical tool for calculating the uncertainties where precision and significance are applied in the real world. It is based on natural language which has the ability of c omputing the word . The ELM is an extremely fast learning algorithm for neural network that can completed the training cycle in a very short time. By combining the FLS and ELM, new hybrid model, i.e., FLS-ELM is developed. The applicability of this proposed hybrid model is validated in fault detection in CWS which may help to improve overall efficiency of power generation plant, hence, consuming less natural recourses and producing less pollutions.

Inhibitory Synaptic Plasticity - Spike timing dependence and putative network function.

Directory of Open Access Journals (Sweden)

Tim P Vogels

2013-07-01

Full Text Available While the plasticity of excitatory synaptic connections in the brain has been widely studied, the plasticity of inhibitory connections is much less understood. Here, we present recent experimental and theoretical □ndings concerning the rules of spike timing-dependent inhibitory plasticity and their putative network function. This is a summary of a workshop at the COSYNE conference 2012.

Receptor protein tyrosine phosphatase alpha enhances rheumatoid synovial fibroblast signaling and promotes arthritis in mice

NARCIS (Netherlands)

Stanford, Stephanie M; Svensson, Mattias N D; Sacchetti, Cristiano; Pilo, Caila A; Wu, Dennis J; Kiosses, William B; Hellvard, Annelie; Bergum, Brith; Aleman Muench, German R; Elly, Christian; Liu, Yun-Cai; den Hertog, Jeroen; Elson, Ari; Sap, Jan; Mydel, Piotr; Boyle, David L; Corr, Maripat; Firestein, Gary S; Bottini, Nunzio

2016-01-01

OBJECTIVE: During rheumatoid arthritis (RA), fibroblast-like synoviocytes (FLS) critically promote disease pathogenesis by aggressively invading the joint extracellular matrix. The focal adhesion kinase (FAK) signaling pathway is emerging as a contributor to RA FLS anomalous behavior. The receptor

Cloning, characterization and sequence comparison of the gene coding for IMP dehydrogenase from Pyrococcus furiosus.

Science.gov (United States)

Collart, F R; Osipiuk, J; Trent, J; Olsen, G J; Huberman, E

1996-10-03

We have cloned and characterized the gene encoding inosine monophosphate dehydrogenase (IMPDH) from Pyrococcus furiosus (Pf), a hyperthermophillic archeon. Sequence analysis of the Pf gene indicated an open reading frame specifying a protein of 485 amino acids (aa) with a calculated M(r) of 52900. Canonical Archaea promoter elements, Box A and Box B, are located -49 and -17 nucleotides (nt), respectively, upstream of the putative start codon. The sequence of the putative active-site region conforms to the IMPDH signature motif and contains a putative active-site cysteine. Phylogenetic relationships derived by using all available IMPDH sequences are consistent with trees developed for other molecules; they do not precisely resolve the history of Pf IMPDH but indicate a close similarity to bacterial IMPDH proteins. The phylogenetic analysis indicates that a gene duplication occurred prior to the division between rodents and humans, accounting for the Type I and II isoforms identified in mice and humans.

Receptor Protein Tyrosine Phosphatase α-Mediated Enhancement of Rheumatoid Synovial Fibroblast Signaling and Promotion of Arthritis in Mice

NARCIS (Netherlands)

Stanford, Stephanie M; Svensson, Mattias N D; Sacchetti, Cristiano; Pilo, Caila A; Wu, Dennis J; Kiosses, William B; Hellvard, Annelie; Bergum, Brith; Muench, German R Aleman; Elly, Christian; Liu, Yun-Cai; den Hertog, Jeroen; Elson, Ari; Sap, Jan; Mydel, Piotr; Boyle, David L; Corr, Maripat; Firestein, Gary S; Bottini, Nunzio

OBJECTIVE: During rheumatoid arthritis (RA), fibroblast-like synoviocytes (FLS) critically promote disease pathogenesis by aggressively invading the extracellular matrix of the joint. The focal adhesion kinase (FAK) signaling pathway is emerging as a contributor to the anomalous behavior of RA FLS.

Cloning and sequence analysis of putative type II fatty acid synthase ...

Indian Academy of Sciences (India)

Prakash

Cloning and sequence analysis of putative type II fatty acid synthase genes from Arachis hypogaea L. ... acyl carrier protein (ACP), malonyl-CoA:ACP transacylase, β-ketoacyl-ACP .... Helix II plays a dominant role in the interaction ... main distinguishing features of plant ACPs in plastids and ..... synthase component; J. Biol.

Putative golden proportions as predictors of facial esthetics in adolescents.

Science.gov (United States)

Kiekens, Rosemie M A; Kuijpers-Jagtman, Anne Marie; van 't Hof, Martin A; van 't Hof, Bep E; Maltha, Jaap C

2008-10-01

In orthodontics, facial esthetics is assumed to be related to golden proportions apparent in the ideal human face. The aim of the study was to analyze the putative relationship between facial esthetics and golden proportions in white adolescents. Seventy-six adult laypeople evaluated sets of photographs of 64 adolescents on a visual analog scale (VAS) from 0 to 100. The facial esthetic value of each subject was calculated as a mean VAS score. Three observers recorded the position of 13 facial landmarks included in 19 putative golden proportions, based on the golden proportions as defined by Ricketts. The proportions and each proportion's deviation from the golden target (1.618) were calculated. This deviation was then related to the VAS scores. Only 4 of the 19 proportions had a significant negative correlation with the VAS scores, indicating that beautiful faces showed less deviation from the golden standard than less beautiful faces. Together, these variables explained only 16% of the variance. Few golden proportions have a significant relationship with facial esthetics in adolescents. The explained variance of these variables is too small to be of clinical importance.

Discovery of a novel target for the dysglycemic chromogranin A fragment pancreastatin: interaction with the chaperone GRP78 to influence metabolism.

Directory of Open Access Journals (Sweden)

Nilima Biswas

Full Text Available RATIONALE: The chromogranin A-derived peptide pancreastatin (PST is a dysglycemic, counter-regulatory peptide for insulin action, especially in liver. Although previous evidence for a PST binding protein has been reported, such a receptor has not been identified or sequenced. METHODS AND RESULTS: We used ligand affinity to purify the PST target, with biotinylated human PST (hCHGA273-301-amide as "bait" and mouse liver homogenate as "prey", and identified GRP78 (a.k.a. "78 kDa Glucose Regulated Protein", HSPA5, BIP as a major interacting partner of PST. GRP78 belongs to the family of heat shock proteins (chaperones, involved in several cellular processes including protein folding and glucose metabolism. We analyzed expression of GRP78 in the absence of PST in a mouse knockout model lacking its precursor CHGA: hepatic transcriptome data revealed global over-expression of not only GRP78 but also other heat shock transcripts (of the "adaptive UPR" in CHGA(-/- mice compared to wild-type (+/+. By contrast, we found a global decline in expression of hepatic pro-apoptotic transcripts in CHGA(-/- mice. GRP78's ATPase enzymatic activity was dose-dependently inhibited by PST (IC50∼5.2 µM. PST also inhibited the up-regulation of GRP78 expression during UPR activation (by tunicamycin in hepatocytes. PST inhibited insulin-stimulated glucose uptake in adipocytes, and increased hepatic expression of G6Pase (the final step in gluconeogenesis/glycogenolysis. In hepatocytes not only PST but also other GRP78-ATPase inhibitors (VER-155008 or ADP increased G6Pase expression. GRP78 over-expression inhibited G6Pase expression in hepatocytes, with partial restoration by GRP78-ATPase inhibitors PST, VER-155008, or ADP. CONCLUSIONS: Our results indicate that an unexpected major hepatic target of PST is the adaptive UPR chaperone GRP78. PST not only binds to GRP78 (in pH-dependent fashion, but also inhibits GRP78's ATPase enzymatic activity, and impairs its biosynthetic

Functional and evolutionary analyses of Helicobacter pylori HP0231 (DsbK protein with strong oxidative and chaperone activity characterized by a highly diverged dimerization domain

Directory of Open Access Journals (Sweden)

Katarzyna Marta Bocian-Ostrzycka

2015-10-01

Full Text Available Helicobacter pylori does not encode the classical DsbA/DsbB oxidoreductases that are crucial for oxidative folding of extracytoplasmic proteins. Instead, this microorganism encodes an untypical two proteins playing a role in disulfide bond formation – periplasmic HP0231, which structure resembles that of EcDsbC/DsbG, and its redox partner, a membrane protein HpDsbI (HP0595 with a -propeller structure. The aim of presented work was to assess relations between HP0231 structure and function.We showed that HP0231 is most closely related evolutionarily to the catalytic domain of DsbG, even though it possesses a catalytic motif typical for canonical DsbA proteins. Similarly, the highly diverged N-terminal dimerization domain is homologous to the dimerization domain of DsbG. To better understand the functioning of this atypical oxidoreductase, we examined its activity using in vivo and in vitro experiments. We found that HP0231 exhibits oxidizing and chaperone activities but no isomerizing activity, even though H. pylori does not contain a classical DsbC. We also show that HP0231 is not involved in the introduction of disulfide bonds into HcpC (Helicobacter cysteine-rich protein C, a protein involved in the modulation of the H. pylori interaction with its host. Additionally, we also constructed a truncated version of HP0231 lacking the dimerization domain, denoted HP0231m, and showed that it acts in E. coli cells in a DsbB-dependent manner. In contrast, HP0231m and classical monomeric EcDsbA (Escherichia coli DsbA protein were both unable to complement the lack of HP0231 in H. pylori cells, though they exist in oxidized forms. HP0231m is inactive in the insulin reduction assay and possesses high chaperone activity, in contrast to EcDsbA. In conclusion, HP0231 combines oxidative functions characteristic of DsbA proteins and chaperone activity characteristic of DsbC/DsbG, and it lacks isomerization activity.

Poly(ADP-ribose) polymerase inhibition reduces tumor necrosis factor-induced inflammatory response in rheumatoid synovial fibroblasts

NARCIS (Netherlands)

García, S.; Bodaño, A.; Pablos, J. L.; Gómez-Reino, J. J.; Conde, C.

2008-01-01

To investigate the effect of poly(ADP-ribose) polymerase (PARP) inhibition on the production of inflammatory mediators and proliferation in tumour necrosis factor (TNF)-stimulated fibroblast-like synoviocytes (FLS) from patients with rheumatoid arthritis (RA). Cultured FLS from patients with RA were

ADAM10 missense mutations potentiate β-amyloid accumulation by impairing prodomain chaperone function.

Science.gov (United States)

Suh, Jaehong; Choi, Se Hoon; Romano, Donna M; Gannon, Moira A; Lesinski, Andrea N; Kim, Doo Yeon; Tanzi, Rudolph E

2013-10-16

The generation of Aβ, the main component of senile plaques in Alzheimer's disease (AD), is precluded by α-secretase cleavage within the Aβ domain of the amyloid precursor protein (APP). We identified two rare mutations (Q170H and R181G) in the prodomain of the metalloprotease, ADAM10, that cosegregate with late-onset AD (LOAD). Here, we addressed the pathogenicity of these mutations in transgenic mice expressing human ADAM10 in brain. In Tg2576 AD mice, both mutations attenuated α-secretase activity of ADAM10 and shifted APP processing toward β-secretase-mediated cleavage, while enhancing Aβ plaque load and reactive gliosis. We also demonstrated ADAM10 expression potentiates adult hippocampal neurogenesis, which is reduced by the LOAD mutations. Mechanistically, both LOAD mutations impaired the molecular chaperone activity of ADAM10 prodomain. Collectively, these findings suggest that diminished α-secretase activity, owing to LOAD ADAM10 prodomain mutations, leads to AD-related pathology, strongly supporting ADAM10 as a promising therapeutic target for this devastating disease. Copyright © 2013 Elsevier Inc. All rights reserved.

Oligomerization and chaperone-like activity of Drosophila melanogaster small heat shock protein DmHsp27 and three arginine mutants in the alpha-crystallin domain.

Science.gov (United States)

Moutaoufik, Mohamed Taha; Morrow, Geneviève; Maaroufi, Halim; Férard, Céline; Finet, Stéphanie; Tanguay, Robert M

2017-07-01

The small Hsp DmHsp27 from Drosophila melanogaster is one of the few small heat shock proteins (sHsps) found within the nucleus. We report that its dimerization is independent of disulfide bond formation and seems to rely on salt bridges. Unlike metazoan sHsps, DmHsp27 forms two populations of oligomers not in equilibrium. Mutations at highly conserved arginine residues in mammalian sHsps have been reported to be associated with protein conformational defects and intracellular aggregation. Independent mutation of three highly conserved arginines (R122, R131, and R135) to glycine in DmHsp27 results in only one population of higher molecular weight form. In vitro, the chaperone-like activity of wild-type DmHsp27 was comparable with that of its two isolated populations and to the single population of the R122G, R131G, and R135G using luciferase as substrate. However, using insulin, the chaperone-like activity of wild-type DmHsp27 was lower than that of R122G and R131G mutants. Altogether, the results characterize wild-type DmHsp27 and its alpha-crystallin domain (ACD) arginine mutants and may give insight into protection mechanism of sHsps.

Memory-guided sensory comparisons in the prefrontal cortex: contribution of putative pyramidal cells and interneurons.

Science.gov (United States)

Hussar, Cory R; Pasternak, Tatiana

2012-02-22

Comparing two stimuli that occur at different times demands the coordination of bottom-up and top-down processes. It has been hypothesized that the dorsolateral prefrontal (PFC) cortex, the likely source of top-down cortical influences, plays a key role in such tasks, contributing to both maintenance and sensory comparisons. We examined this hypothesis by recording from the PFC of monkeys comparing directions of two moving stimuli, S1 and S2, separated by a memory delay. We determined the contribution of the two principal cell types to these processes by classifying neurons into broad-spiking (BS) putative pyramidal cells and narrow-spiking (NS) putative local interneurons. During the delay, BS cells were more likely to exhibit anticipatory modulation and represent the remembered direction. While this representation was transient, appearing at different times in different neurons, it weakened when direction was not task relevant, suggesting its utility. During S2, both putative cell types showed comparison-related activity modulations. These modulations were of two types, each carried by different neurons, which either preferred trials with stimuli moving in the same direction or trials with stimuli of different directions. These comparison effects were strongly correlated with choice, suggesting their role in circuitry underlying decision making. These results provide the first demonstration of distinct contributions made by principal cell types to memory-guided perceptual decisions. During sensory stimulation both cell types represent behaviorally relevant stimulus features contributing to comparison and decision-related activity. However in the absence of sensory stimulation, putative pyramidal cells dominated, carrying information about the elapsed time and the preceding direction.

The intrinsically disordered domain of the antitoxin Phd chaperones the toxin Doc against irreversible inactivation and misfolding.

Science.gov (United States)

De Gieter, Steven; Konijnenberg, Albert; Talavera, Ariel; Butterer, Annika; Haesaerts, Sarah; De Greve, Henri; Sobott, Frank; Loris, Remy; Garcia-Pino, Abel

2014-12-05

The toxin Doc from the phd/doc toxin-antitoxin module targets the cellular translation machinery and is inhibited by its antitoxin partner Phd. Here we show that Phd also functions as a chaperone, keeping Doc in an active, correctly folded conformation. In the absence of Phd, Doc exists in a relatively expanded state that is prone to dimerization through domain swapping with its active site loop acting as hinge region. The domain-swapped dimer is not capable of arresting protein synthesis in vitro, whereas the Doc monomer is. Upon binding to Phd, Doc becomes more compact and is secured in its monomeric state with a neutralized active site. © 2014 by The American Society for Biochemistry and Molecular Biology, Inc.

Usefulness of virtual reality in assessment of medical student laparoscopic skill.

Science.gov (United States)

Matzke, Josh; Ziegler, Craig; Martin, Kevin; Crawford, Stuart; Sutton, Erica

2017-05-01

This study evaluates if undergraduate medical trainees' laparoscopic skills acquisition could be assessed using a virtual reality (VR) simulator and how the resultant metrics correlate with performance of Fundamentals of Laparoscopic Surgery (FLS) tasks. Our hypothesis is that the VR simulator metrics will correlate with passing results in a competency-based curriculum (FLS). Twenty-eight fourth-year medical students applying for surgical residency were recruited to participate in a VR training curriculum comprised of camera navigation, hand eye coordination, and FLS tasks: circle cutting (CC), ligating loop (LL), peg transfer (PT), and intracorporeal knot tying (IKT). Students were given 8 wk to achieve proficiency goals, after which they were observed performing FLS tasks. The ability of the VR simulator to detect penalties in each of the FLS tasks and correlations of time taken to complete tasks are reported. Twenty-five students trained in all components of the curriculum. All students were proficient in camera navigation and hand eye coordination tasks. Proficiency was achieved in CC, LL, PT, and IKT by 21, 19, 23, and one student, respectively. VR simulation showed high specificity for predicting zero penalties on the observed CC, LL, and PT tasks (80%, 75%, and 80%, respectively). VR can be used to assess medical student's acquisition of laparoscopic skills. The absence of penalties in the simulator reasonably predicts the absence of penalties in all FLS skills, except IKT. The skills acquired by trainees can be used in residency for further monitoring of progress toward proficiency. Copyright © 2016 Elsevier Inc. All rights reserved.

TU-F-CAMPUS-T-03: Commissioning of a Custom Fetal Lead Shield for Radiotherapy

Energy Technology Data Exchange (ETDEWEB)

Owrangi, A; Roberts, D; Covington, E; Hayman, J; Masi, K; Lee, C; Moran, J; Prisciandaro, J [Univ Michigan Medical Center, Ann Arbor, MI (United States)

2015-06-15

Purpose: To evaluate the peripheral dose (PD) to a fetus during radiation therapy of pregnant patients when using a newly designed fetal lead shield (FLS). Methods: A custom FLS has been designed and fabricated for our department. The FLS (1.1 TVLs for 6 MV) is mounted on a mobile frame and can be adjusted vertically with a motor actuator. PD measurements were acquired for multiple simple square fields and for a variety of potential treatment sites a pregnant patient may be treated for including brain, head and neck (H&N) and thorax. For measurements of the brain, H&N, and thorax, an ionization chamber and OSLDs were positioned on average at a distance of 48, 29 and 26 cm, respectively, from the edge of treatment fields to mimic the approximate position of the fundus. Results: Based on our measurements, applying a 90° collimator rotation and using tertiary MLCs to define the field aperture in combination with jaws resulted in an average dose reduction of 60%. When using these planning strategies in combination with the FLS, on average, the PD was reduced by additional 25% for simple square fields and 20% for clinical plans. Conclusion: The custom FLS is a safe, effective, and relatively easy system to position. Commissioning measurements have demonstrated that the PD to the fetus can be significantly reduced when using the FLS. The comprehensive dataset obviates the need for individual patient pre-treatment dose measurements as long as the geometry falls within the commissioning limits.

Crystallization and preliminary crystallographic analysis of a putative glucokinase/hexokinase from Thermus thermophilus

International Nuclear Information System (INIS)

Nakamura, Tsutomu; Kashima, Yasuhiro; Mine, Shouhei; Oku, Takashi; Uegaki, Koichi

2011-01-01

In this study, a putative glucokinase/hexokinase from T. thermophilus was purified and crystallized. Diffraction data were collected and processed to 2.02 Å resolution. Glucokinase/hexokinase catalyzes the phosphorylation of glucose to glucose 6-phosphate, which is the first step of glycolysis. The open reading frame TTHA0299 of the extreme thermophile Thermus thermophilus encodes a putative glucokinase/hexokinase which contains the consensus sequence for proteins from the repressors, open reading frames and sugar kinases family. In this study, the glucokinase/hexokinase from T. thermophilus was purified and crystallized using polyethylene glycol 8000 as a precipitant. Diffraction data were collected and processed to 2.02 Å resolution. The crystal belonged to space group P2 1 , with unit-cell parameters a = 70.93, b = 138.14, c = 75.16 Å, β = 95.41°

Evaluation of surveillance of dengue fever cases in the public health centre of Putat Jaya based on attribute surveillance

Directory of Open Access Journals (Sweden)

Zumaroh Zumaroh

2015-01-01

Full Text Available Dengue Hemorrhagic Fever (DHF is a public health problem in the village of Putat Jaya which is an endemic area. Surveilans activity in DHF control program is the most important activity in controlling and monitoring disease progression. The program is expected to achieve incidence rate 55/100.000 population. This study aimed to evaluate the implementation of case surveilans in health centre of putat jaya based on attribute surveillance. Attribute surveillance is an indicator that describes the characteristics of the surveillance system. This research was an evaluation research with descriptive study design. As informants were clinic staff who deal specifically with cases of dengue hemorrhagic fever and laboratory workers. The techniques of data collection by interviews and document study. The variables of this study were simplicity, flexibility, acceptability, sensitivity, positive predictive value, representativeness, timeliness, data quality and data stability. It could be seen from Incidence Rate in 2013 has reached 133/100.00 population. The activity of surveilance in the village of Putat Jaya reviewed from disease contol program management was not succeed into decrease incidence rate of DHF. Therefore, dengue control programs in health centers Putat Jaya need to do cross-sector cooperation and cross-program cooperation, strengthening the case reporting system by way increasing in the utilization of information and communication technology electromedia. Keywords: case surveillance, dengue hemorrhagic fever, evaluation, attribute surveillance, Putat Jaya

LAMP-2 deficiency leads to hippocampal dysfunction but normal clearance of neuronal substrates of chaperone-mediated autophagy in a mouse model for Danon disease

OpenAIRE

Rothaug, Michelle; Stroobants, Stijn; Schweizer, Michaela; Peters, Judith; Zunke, Friederike; Allerding, Mirka; D?Hooge, Rudi; Saftig, Paul; Blanz, Judith

2015-01-01

The Lysosomal Associated Membrane Protein type-2 (LAMP-2) is an abundant lysosomal membrane protein with an important role in immunity, macroautophagy (MA) and chaperone-mediated autophagy (CMA). Mutations within the Lamp2 gene cause Danon disease, an X-linked lysosomal storage disorder characterized by (cardio)myopathy and intellectual dysfunction. The pathological hallmark of this disease is an accumulation of glycogen and autophagic vacuoles in cardiac and skeletal muscle that, along with ...