WorldWideScience

Sample records for pubertal development bmi

  1. Pubertal development in Danish children

    DEFF Research Database (Denmark)

    Juul, A; Teilmann, G; Scheike, Thomas Harder

    2006-01-01

    differences between USA and Denmark, as well as to look for possible secular trends in pubertal development. Healthy Caucasian children from public schools in Denmark participated in the study which was carried out in 1991-1993. A total number of 826 boys and 1,100 girls (aged 6.0-19.9 years) were included......, and pubertal stages were assessed by clinical examination according to methods of Tanner. In boys testicular volume was determined using an orchidometer. We found that age at breast development 2 (B2) was 10.88 years, and mean menarcheal age was 13.42 years. Girls with body mass index (BMI) above the median...... genetic polymorphisms, nutrition, physical activity or endocrine disrupting chemicals must therefore also be considered. Therefore, we believe it is crucial to monitor the pubertal development closely in Denmark in the coming decades....

  2. Nutrition and pubertal development

    OpenAIRE

    Soliman, Ashraf; De Sanctis, Vincenzo; Elalaily, Rania

    2014-01-01

    Nutrition is one of the most important factors affecting pubertal development. Puberty entails a progressive nonlinear process starting from prepubescent to full sexual maturity through the interaction and cooperation of biological, physical, and psychological changes. Consuming an adequate and balanced healthy diet during all phases of growth (infancy, childhood and puberty) appears necessary both for proper growth and normal pubertal development. Girls begin puberty at an earlier age compar...

  3. Nutrition and pubertal development

    Directory of Open Access Journals (Sweden)

    Ashraf Soliman

    2014-01-01

    Full Text Available Nutrition is one of the most important factors affecting pubertal development. Puberty entails a progressive nonlinear process starting from prepubescent to full sexual maturity through the interaction and cooperation of biological, physical, and psychological changes. Consuming an adequate and balanced healthy diet during all phases of growth (infancy, childhood and puberty appears necessary both for proper growth and normal pubertal development. Girls begin puberty at an earlier age compared to past decades. Excessive eating of many processed, high-fat foods, may be the cause of this phenomenon. Overweight or obese children are more likely to enter puberty early. Some evidence suggests that obesity can accelerate the onset of puberty in girls and may delay the onset of puberty in boys. Moreover, the progression of puberty is affected by nutrition. On the other hand, puberty triggers a growth spurt, which increases nutritional needs including macro and micronutrients. Increased caloric, protein, iron, calcium, zinc and folate needs have to be provided during this critical period of rapid growth. Severe primary or secondary malnutrition also can delay the onset and progression of puberty. The higher incidence of anorexia nervosa and bulimia in adolescents imposes a nutritional risk on pubertal development. Moreover, many environmental endocrine disruptors (EDs have been identified that can significantly impair the normal course of puberty. This mini-review sums up some important findings in this important complex that link nutrition and pubertal development.

  4. Pubertal development in ICSI children

    NARCIS (Netherlands)

    Belva, F.; Roelants, M.; Painter, R.; Bonduelle, M.; Devroey, P.; de Schepper, J.

    2012-01-01

    To date, information on the pubertal development of adolescents born after ICSI is scarce, since the very first cohort is only now reaching young adulthood. In this study, pubertal development at the age of 14 was characterized in a longitudinally followed cohort of ICSI-conceived teenagers and

  5. BMI percentile-for-age overestimates adiposity in early compared with late maturing pubertal children

    DEFF Research Database (Denmark)

    Sørensen, Kaspar; Juul, Anders

    2015-01-01

    and bioelectric impedance analyses (BIA) were used to estimate adiposity. Clinical pubertal markers (Tanner stages and testicular volume) were evaluated. LH, FSH, estradiol, testosterone, SHBG and IGF1 levels were determined by immunoassays. RESULTS: In all age groups, higher BMI (all 1 year age-groups, P ≤ 0...

  6. Maternal pre-pregnancy body mass index and pubertal development among sons

    DEFF Research Database (Denmark)

    Hounsgaard, M L; Håkonsen, L B; Vested, A

    2014-01-01

    Maternal overweight and obesity in pregnancy has been associated with earlier age of menarche in daughters as well as reduced semen quality in sons. We aimed at investigating pubertal development in sons born by mothers with a high body mass index (BMI). The study included 2522 sons of mothers...... indicators of pubertal development, results also indicated earlier pubertal development among sons of obese mothers. After excluding sons of underweight mothers in a subanalysis, we observed an inverse trend between maternal pre-pregnancy BMI and age at regular shaving, acne and first nocturnal emission....... In conclusion, maternal pre-pregnant obesity may be related to earlier timing of pubertal milestones among sons. More research, preferably based on prospectively collected information about pubertal development, is needed to draw firm conclusions....

  7. Pubertal development in Danish children

    DEFF Research Database (Denmark)

    Juul, A; Teilmann, G; Scheike, Thomas Harder

    2006-01-01

    .0012). In Danish boys we found that age at genital stage 2 (G2) was 11.83 years. Both sexes were significantly taller compared with data from 1964, but timing of pubertal maturation seemed unaltered. Finally, puberty occurred much later in Denmark compared with recent data from USA. We could not detect any...

  8. Pubertal breast development in primary school girls in Sokoto, North ...

    African Journals Online (AJOL)

    Background. There is wide variation in normal pubertal timing among various populations. Objectives. To determine the mean age of pubertal stages of breast development and menarche, and the influence of nutrition and ethnicity on pubertal onset in primary school girls in Sokoto, North-Western Nigeria. Methods.

  9. Pubertal development timing in urban Chinese boys.

    Science.gov (United States)

    Ma, H-M; Chen, S-K; Chen, R-M; Zhu, C; Xiong, F; Li, T; Wang, W; Liu, G-L; Luo, X-P; Liu, L; Du, M-L

    2011-10-01

    We describe current pubertal development in healthy urban Chinese boys. A cross-sectional study of the pubertal development of 18,807 urban Chinese boys aged from 3.50 to 18.49years was conducted between 2003 and 2005. Testicular volume was evaluated with a Prader orchidometer. Pubic hair development was assessed according to the Tanner method. Data on spermarche were collected using the status quo method. Probit analysis was used to calculate the median age and 95% CI at different stages of testicular development, pubic hair development and spermarche. By age 9, 12.99% of the boys had a testicular volume of 4mL or greater. The median age of onset of puberty defined as the age at attainment of testicular volume of 4mL or greater was 10.55 (95% CI 10.27-10.79) years. The median age for onset of pubic hair development (PH(2) ) and spermarche was 12.78 (95%CI 12.67-12.89) years and 14.05 (95%CI 13.80-14.32) years, respectively. Pubertal onset in urban Chinese boys is earlier than currently used clinical norms but their pubic hair development occurs relatively late in comparison with the reported data from numerous other countries. There is also evidence of a secular trend towards an earlier age of spermarche since 1979 in Chinese urban boys. © 2011 The Authors. International Journal of Andrology © 2011 European Academy of Andrology.

  10. The effect of tamoxifen on pubertal bone development in adolescents with pubertal gynecomastia.

    Science.gov (United States)

    Akgül, Sinem; Derman, Orhan; Kanbur, Nuray

    2016-01-01

    During puberty, estrogen has a biphasic effect on epiphyses; at low levels, it leads to an increase in height and bone mass, whereas at high levels, it leads to closure of the epiphysis. Tamoxifen is a selective estrogen receptor modulator that has been used in the treatment of pubertal gynecomastia. Although it has not been approved for this indication, studies have shown it to be both successful and safe. In males, the peak of pubertal bone development occurs during Tanner stage 3-4, which is also when pubertal gynecomastia reaches its highest prevalence. Thus tamoxifen treatment could potentially effect pubertal bone development. The aim of this study was to assess the effects of tamoxifen on bone mineral density (BMD) and skeletal maturation when used for pubertal gynecomastia. We evaluated 20 boys with pubertal gynecomastia receiving tamoxifen for at least 4 months. BMD was measured with dual-energy X-ray absorptiometry. Z-score and absolute BMD (g/cm(2)) was determined at baseline and 2 months after completing tamoxifen treatment. Bone age and height was evaluated before treatment and again one year later. Using absolute BMD (g/cm(2)), the mean difference from baseline was significant between the two groups both at spine (p=0.002) and femur (p=0.001), but not with the Z-score. This result was attributed to the expected increase during puberty according to sex and age. No significant effect on skeletal maturation was found (p=1.112). We conclude that when pubertal bone development is concerned, tamoxifen is safe for the treatment of pubertal gynecomastia as neither bone mineralization nor growth potential was affected.

  11. Pubertal development in The Netherlands 1965-1997

    NARCIS (Netherlands)

    D. Mul (Dick); A.M. Fredriks; S. van Buuren (Stef); W. Oostdijk (Wilma); S.P. Verloove-Vanhorick; J.M. Wit (Jan)

    2001-01-01

    textabstractWe investigated pubertal development of 4019 boys and 3562 girls >8 y of age participating in a cross-sectional survey in The Netherlands and compared the results with those of two previous surveys. Reference curves for all pubertal stages were constructed. The 50th

  12. Pubertal development and prostate cancer risk

    DEFF Research Database (Denmark)

    Bonilla, Carolina; Lewis, Sarah J; Martin, Richard M

    2016-01-01

    , 0.91-1.00) and prostate cancer-specific mortality (hazard ratio amongst cases, per tertile: 0.94; 95 % CI, 0.90-0.98), but not with disease grade. CONCLUSIONS: Older age at sexual maturation is causally linked to a reduced risk of later prostate cancer, especially aggressive disease.......BACKGROUND: Epidemiological studies have observed a positive association between an earlier age at sexual development and prostate cancer, but markers of sexual maturation in boys are imprecise and observational estimates are likely to suffer from a degree of uncontrolled confounding. To obtain...... to a difference of one Tanner stage between pubertal boys of the same age) was associated with a 77 % (95 % CI, 43-91 %) reduced odds of high Gleason prostate cancer. In PRACTICAL, the puberty genetic score was associated with prostate cancer stage (OR of advanced vs. localized cancer, per tertile: 0.95; 95 % CI...

  13. [A survey of pubertal development in children born with assisted reproductive technology].

    Science.gov (United States)

    Liu, Zi-Yuan; Wang, Xin-Li; Han, Tong-Yan; Cui, Yun-Pu; Wang, Xue-Mei; Tong, Xiao-Mei; Song, Yi; Wang, Hai-Jun; Li, Song

    2017-06-01

    To investigate the status of pubertal development in children born with assisted reproductive technology (ART). A retrospective analysis was performed on the pubertal development data of children born with ART in Peking University Third Hospital from 1994 to 2003 (ART group). The data in the cross-sectional study "Reports on the Physical Fitness and Health Research of Chinese School Students in 2010" were used as a control. The age at menarche and the age at spermarche were compared between the two groups. The status of pubertal development in the overweight and obese children in the ART group was evaluated to investigate the correlation between pubertal development and body mass index (BMI). A total of 200 children born with ART were enrolled in this study, and 72 of them (41 males and 31 females) completed the survey (response rate=36.0%). In the ART group, the mean age at spermarche and the mean age at menarche were 13.9 years (95%CI: 13.7-14.3 years) and 12.2 years (95%CI: 11.8-12.6 years), respectively. There were no significant differences in the age at spermarche and the age at menarche between the ART and control groups (P>0.05). In the ART group, there were no significant differences in the age at spermarche and the age at menarche between the overweight and obese children and the normal weight children (P>0.05). There were also no significant differences in overweight rate and obesity rate between the children in the ART group and the adolescents in Beijing (P>0.05). In the ART group, there was no significant correlation between the age at spermarche or menarche and BMI (P>0.05). No delayed or precocious puberty is observed in children born with ART. This is consistent with the normal control data. And there is no significant correlation between pubertal development and BMI in children born with ART.

  14. Exciting fear in adolescence: Does pubertal development alter threat processing?

    OpenAIRE

    Spielberg, JM; Olino, TM; Forbes, EE; Dahl, RE

    2014-01-01

    Adolescent development encompasses an ostensible paradox in threat processing. Risk taking increases dramatically after the onset of puberty, contributing to a 200% increase in mortality. Yet, pubertal maturation is associated with increased reactivity in threat-avoidance systems. In the first part of this paper we propose a heuristic model of adolescent affective development that may help to reconcile aspects of this paradox, which focuses on hypothesized pubertal increases in the capacity t...

  15. Exciting fear in adolescence: Does pubertal development alter threat processing?

    Directory of Open Access Journals (Sweden)

    Jeffrey M. Spielberg

    2014-04-01

    Full Text Available Adolescent development encompasses an ostensible paradox in threat processing. Risk taking increases dramatically after the onset of puberty, contributing to a 200% increase in mortality. Yet, pubertal maturation is associated with increased reactivity in threat-avoidance systems. In the first part of this paper we propose a heuristic model of adolescent affective development that may help to reconcile aspects of this paradox, which focuses on hypothesized pubertal increases in the capacity to experience (some fear-evoking experiences as an exciting thrill. In the second part of this paper, we test key features of this model by examining brain activation to threat cues in a longitudinal study that disentangled pubertal and age effects. Pubertal increases in testosterone predicted increased activation to threat cues, not only in regions associated with threat avoidance (i.e., amygdala, but also regions associated with reward pursuit (i.e., nucleus accumbens. These findings are consistent with our hypothesis that puberty is associated with a maturational shift toward more complex processing of threat cues—which may contribute to adolescent tendencies to explore and enjoy some types of risky experiences.

  16. Exciting fear in adolescence: does pubertal development alter threat processing?

    Science.gov (United States)

    Spielberg, Jeffrey M; Olino, Thomas M; Forbes, Erika E; Dahl, Ronald E

    2014-04-01

    Adolescent development encompasses an ostensible paradox in threat processing. Risk taking increases dramatically after the onset of puberty, contributing to a 200% increase in mortality. Yet, pubertal maturation is associated with increased reactivity in threat-avoidance systems. In the first part of this paper we propose a heuristic model of adolescent affective development that may help to reconcile aspects of this paradox, which focuses on hypothesized pubertal increases in the capacity to experience (some) fear-evoking experiences as an exciting thrill. In the second part of this paper, we test key features of this model by examining brain activation to threat cues in a longitudinal study that disentangled pubertal and age effects. Pubertal increases in testosterone predicted increased activation to threat cues, not only in regions associated with threat avoidance (i.e., amygdala), but also regions associated with reward pursuit (i.e., nucleus accumbens). These findings are consistent with our hypothesis that puberty is associated with a maturational shift toward more complex processing of threat cues--which may contribute to adolescent tendencies to explore and enjoy some types of risky experiences. Copyright © 2014 The Authors. Published by Elsevier Ltd.. All rights reserved.

  17. Pubertal development, personality, and substance use: a 10-year longitudinal study from childhood to adolescence.

    Science.gov (United States)

    Castellanos-Ryan, Natalie; Parent, Sophie; Vitaro, Frank; Tremblay, Richard E; Séguin, Jean R

    2013-08-01

    Most research linking early pubertal development to substance use has focused on the effects of pubertal timing (age at which a certain stage of pubertal development is reached or pubertal status at a particular age--related to the maturation disparity hypothesis), but little research has focused on pubertal tempo (rate of growth through pubertal stages--related to the maturation compression hypothesis). However, both timing and tempo have not only been identified as important components of pubertal development, with different predictors, but have also been shown to be independently associated with other adolescent psychopathologies. Using latent growth-curve modeling, this study examined how pubertal status at age 12 and pubertal tempo (between 11 and 13 years) related to substance use from 15 to 16 years in boys from low socioeconomic backgrounds (N = 871). Results showed that both pubertal status at age 12 and tempo were significant predictors of increased levels of substance use and problems in mid to late adolescence. In an attempt to identify mechanisms that may explain the association between pubertal development and substance use it was found that sensation seeking partially mediated the association between pubertal status at age 12 and substance use behaviors. Impulse control was found to moderate the association sensation seeking had with marijuana use frequency, with high sensation-seeking scores predicting higher marijuana use frequency only at low levels of impulse control. These findings highlight the importance of considering multiple sources of individual variability in the pubertal development of boys and provide support for both the maturational disparity and compression hypotheses. PsycINFO Database Record (c) 2013 APA, all rights reserved.

  18. Pubertal development in children diagnosed with diabetes mellitus type 1 before puberty.

    Science.gov (United States)

    Pereira, K C X; Pugliese, B S; Guimarães, M M; Gama, M P

    2015-02-01

    To investigate an association between pubertal development and timing of menarche with glycemic control, disease duration, and body mass index (BMI) in patients diagnosed with diabetes mellitus type 1 (DM1) before puberty. Retrospective study. The study was performed at the diabetes outpatient clinic of Instituto de Puericultura e Pediatria Martagão Gesteira--IPPMG of the Federal University of Rio de Janeiro--UFRJ. A total of 131 children, 61 girls and 70 boys, diagnosed with DM1 before puberty participated in the study. The study investigated how age at puberty onset relates to mean glycated hemoglobin (HbA1c) before puberty, BMI percentile, and disease duration; how puberty duration relates to mean HbA1c before and during puberty and to disease duration; and how timing of menarche relates to mean HbA1c before puberty, BMI percentile, and disease duration. Age at puberty onset was positively correlated with mean HbA1c before puberty (r = 0.204, R(2) = 0.042; P = .019) and disease duration (r = 0.451, R(2) = 0.203; P puberty later than those diagnosed more recently. Girls in higher BMI percentiles reached menarche sooner.

  19. [Evaluation of the nutrition mode in children during the pubertal period with BMI < or = 5 percentile in the city of Szczecin].

    Science.gov (United States)

    Goluch-Koniuszy, Zuzanna

    2010-01-01

    This research was aimed at evaluation of the method of nutrition in the children aged 13 during the period of pubertal spurt who had their body mass, body weight and this values led to calculation of BMI indicator which was related to centile distribution of children from Warszawa. From the group 1464 children selected 79 persons (5.4% the whole of investigated) with BMI < or = 5 percentile with underweight and considerable underweight. Their menus of three chosen at random weekdays were obtained. Analysis of the nutrition method of children with underweight and considerable underweight showed low energy value of the diet, cellulose, mineral components (K, Ca, Mg) also liquids deficiency at simultaneously occurrent the general and animal protein, the fat, the cholesterol, mineral components (Na, P, Fe, Cu, Zn), vitamins A, C, E (girls) and from the group B. The children have undergone a special pro health education in the form "live" workshop.

  20. Pubertal development, physical self-perception, and motivation toward physical activity in girls.

    Science.gov (United States)

    Labbrozzi, Dina; Robazza, Claudio; Bertollo, Maurizio; Bucci, Ines; Bortoli, Laura

    2013-08-01

    We examined the differences in physical self-perception and motivation toward physical activity in early- and mid-adolescent girls. Body Mass Index (BMI) and pubertal status, assessed by means of the Tanner scale, were collected in 11-year-old (n=74) and 13-year-old girls (n=60). The assessment included six scales from the Physical Self-Description Questionnaire, the Physical Activity Enjoyment Scale, and the Situational Intrinsic Motivation Scale. Age differences emerged, with older girls showing a poorer physical perception and lower scores in intrinsic motivation and enjoyment of physical activity. In the subsample of 11-year-olds, findings showed that more developed girls reported a poorer physical perception on the scales of body fat, global physical self-concept, and appearance, and a lower score in the PACES positive scale. Results underscore the need to promote interventions aimed at encouraging active lifestyles among children and adolescent girls, in order to prevent overweight prior to pubertal onset. Copyright © 2013 The Foundation for Professionals in Services for Adolescents. Published by Elsevier Ltd. All rights reserved.

  1. Patterns and correlates of pubertal development in Canadian youth: effects of family context.

    Science.gov (United States)

    Arim, Rubab G; Shapka, Jennifer D; Dahinten, V Susan; Willms, J Douglas

    2007-01-01

    Current health literature suggests that there has been a decline in the age of pubertal onset, and that pubertal development is influenced by social context. Unfortunately, contemporary Canadian-specific data have not been available. This study examined the odds of having entered puberty at various ages during adolescence, before and after controlling for the effects of family socio-economic status and family structure. Longitudinal data for this study were drawn from the first four cycles of the National Longitudinal Survey of Children and Youth. The final sample consisted of 7977 adolescents ranging in age from 10 to 17. Pubertal status of the participants was identified based on pubic hair, facial hair growth, and voice change, for boys; and pubic hair, breast development, and menstruation, for girls. Trajectories of pubertal development were analyzed with HLM growth curve modelling techniques. The results indicated that, compared to boys, the odds of having entered puberty at age 13 were 6.45 times higher for girls and that girls go through puberty more quickly. Low family socio-economic status and living with a stepfather were found to predict early onset of pubertal development. Contextual factors are related to pubertal development. Additional research is needed to develop a more solid understanding of how psychosocial factors interact to predict gendered patterns of pubertal development.

  2. Putative effects of endocrine disrupters on pubertal development in the human

    DEFF Research Database (Denmark)

    Teilmann, Grete; Juul, Anders; Skakkebaek, Niels E

    2002-01-01

    developing countries to industrialized countries often develop precocious puberty. Not only precocious puberty, but also delayed puberty can, theoretically, be associated with exposure to endocrine disrupters. While it is very plausible that endocrine disrupters may disturb pubertal development...

  3. Sex variations in youth anxiety symptoms: effects of pubertal development and gender role orientation.

    Science.gov (United States)

    Carter, Rona; Silverman, Wendy K; Jaccard, James

    2011-01-01

    This study evaluated whether pubertal development and gender role orientation (i.e., masculinity and femininity) can partially explain sex variations in youth anxiety symptoms among clinic-referred anxious youth (N = 175; ages 9-13 years; 74% Hispanic; 48% female). Using youth and parent ratings of youth anxiety symptoms, structural equation modeling results indicated that youth who reported being more advanced in their pubertal development reported high levels of femininity and anxiety symptoms. Youth who reported high levels of masculinity had low levels of anxiety symptoms as reported by both youths and parents. The estimated effects of pubertal development, femininity, and masculinity on youth and parent ratings of youth anxiety symptoms were not significantly moderated by biological sex. Pubertal development and gender role orientation appear to be important in explaining levels of youth anxiety symptoms among clinic-referred anxious youth.

  4. Pubertal development in healthy children is mirrored by DNA methylation patterns in peripheral blood

    DEFF Research Database (Denmark)

    Almstrup, Kristian; Johansen, Marie Lindhardt; Busch, Alexander S.

    2016-01-01

    Puberty marks numerous physiological processes which are initiated by central activation of the hypothalamic–pituitary–gonadal axis, followed by development of secondary sexual characteristics. To a large extent, pubertal timing is heritable, but current knowledge of genetic polymorphismsonly...... explains few months in the large inter-individual variation in the timing of puberty. We have analysed longitudinal genome-wide changes in DNA methylation in peripheral blood samples (n = 102) obtained from 51 healthy children before and after pubertal onset. We show that changes in single methylation...... sites are tightly associated with physiological pubertal transition and altered reproductive hormone levels. These methylation sites cluster in and around genes enriched for biological functions related to pubertal development. Importantly, we identified that methylation of the genomic region containing...

  5. Endothelial function in pre-pubertal children at risk of developing cardiomyopathy: a new frontier

    Directory of Open Access Journals (Sweden)

    Aline Cristina Tavares

    2012-01-01

    Full Text Available Although it is known that obesity, diabetes, and Kawasaki's disease play important roles in systemic inflammation and in the development of both endothelial dysfunction and cardiomyopathy, there is a lack of data regarding the endothelial function of pre-pubertal children suffering from cardiomyopathy. In this study, we performed a systematic review of the literature on pre-pubertal children at risk of developing cardiomyopathy to assess the endothelial function of pre-pubertal children at risk of developing cardiomyopathy. We searched the published literature indexed in PubMed, Bireme and SciELO using the keywords 'endothelial', 'children', 'pediatric' and 'infant' and then compiled a systematic review. The end points were age, the pubertal stage, sex differences, the method used for the endothelial evaluation and the endothelial values themselves. No studies on children with cardiomyopathy were found. Only 11 papers were selected for our complete analysis, where these included reports on the flow-mediated percentage dilatation, the values of which were 9.80±1.80, 5.90±1.29, 4.50±0.70, and 7.10±1.27 for healthy, obese, diabetic and pre-pubertal children with Kawasaki's disease, respectively. There was no significant difference in the dilatation, independent of the endothelium, either among the groups or between the genders for both of the measurements in children; similar results have been found in adolescents and adults. The endothelial function in cardiomyopathic children remains unclear because of the lack of data; nevertheless, the known dysfunctions in children with obesity, type 1 diabetes and Kawasaki's disease may influence the severity of the cardiovascular symptoms, the prognosis, and the mortality rate. The results of this study encourage future research into the consequences of endothelial dysfunction in pre-pubertal children.

  6. Impact of Pubertal Development and Physical Activity on Heart Rate Variability in Overweight and Obese Children in Taiwan

    Science.gov (United States)

    Chen, Su-Ru; Chiu, Hung-Wen; Lee, Yann-Jinn; Sheen, Tzong-Chi; Jeng, Chii

    2012-01-01

    Child obesity is frequently associated with dysfunction of autonomic nervous system. Children in pubertal development were suggested to be vulnerable to autonomic nervous system problems such as decrease of heart rate variability from dysregulation of metabolic control. This study explored the influence of pubertal development on autonomic nervous…

  7. Pubertal development and fertility in survivors of childhood acute myeloid leukemia treated with chemotherapy only

    DEFF Research Database (Denmark)

    Molgaard-Hansen, Lene; Skou, Anne-Sofie; Juul, Anders

    2013-01-01

    More than 60% of children with acute myeloid leukemia (AML) become long-term survivors. Most are cured using chemotherapy without hematopoietic stem cell transplantation (HSCT). We report on pubertal development and compare self-reported parenthood among AML survivors and their siblings....

  8. Sex Variations in Youth Anxiety Symptoms: Effects of Pubertal Development and Gender Role Orientation

    Science.gov (United States)

    Carter, Rona; Silverman, Wendy K.; Jaccard, James

    2011-01-01

    This study evaluated whether pubertal development and gender role orientation (i.e., masculinity and femininity) can partially explain sex variations in youth anxiety symptoms among clinic-referred anxious youth (N = 175; ages 9-13 years; 74% Hispanic; 48% female). Using youth and parent ratings of youth anxiety symptoms, structural equation…

  9. IPRODIONE DELAYS MALE RAT PUBERTAL DEVELOPMENT, REDUCING SERUM TESTOSTERONE AND EX VIVO TESTOSTERONE PRODUCTION

    Science.gov (United States)

    Iprodione (IPRO) is a dichlorophenyl dicarboximide fungicide similar to the androgen receptor (AR) antagonist vinclozolin. The current studies were designed to determine if IPRO would delay male rat pubertal development like vinclozolin and to identify the mechanism(s) of action...

  10. Putative effects of endocrine disrupters on pubertal development in the human

    DEFF Research Database (Denmark)

    Teilmann, Grete; Juul, Anders; Skakkebaek, Niels E

    2002-01-01

    -called endocrine disrupters. Precocious puberty has been described in several case reports of accidental exposure to oestrogenic compounds in cosmetic products, food and pharmaceuticals. Local epidemics of premature thelarche have also been suggested to be linked to endocrine disrupters. Children adopted from...... developing countries to industrialized countries often develop precocious puberty. Not only precocious puberty, but also delayed puberty can, theoretically, be associated with exposure to endocrine disrupters. While it is very plausible that endocrine disrupters may disturb pubertal development...

  11. Pubertal development among girls with classical congenital adrenal hyperplasia initiated on treatment at different ages

    Directory of Open Access Journals (Sweden)

    Bindu Kulshreshtha

    2012-01-01

    Full Text Available Introduction: Children with congenital adrenal hyperplasia (CAH provide us an opportunity to study the clinical effects of androgen excess in humans. We studied the sequence of pubertal development in girls with congenital adrenal hyperplasia initiated on treatment at different ages, to assess the effects of androgen exposure on the Hypothalamic-Pituitary-Ovarian (HPO axis. Materials and Methods: Girls more than 18 years of age, with CAH, on follow-up at this hospital were the subjects for this study. Details of history, physical findings, laboratory evaluation, and medication were noted from their case records and verified from the patients and their / parents, in addition to assessment of their present health status. Result: We studied 24 patients of classical CAH (SW-2, SV-22, average age - 24.5 ± 6.6 years. All had varying degrees of genital ambiguity (Prader stage 3 (n = 13, Prader stage 2 (n = 10, Prader stage 1 (n = 1. Among them were13 girls, who were started on steroids after eight years of age. Girls who received treatment from infancy and early childhood had normal pubertal development (mean age at menarche 11.4 ± 1.7 years. Hirsutism was not a problem among them. Untreated children had progressive clitoral enlargement throughout childhood, developed pubic hair at around three to six years of age, and facial hair between nine and eleven years. Plasma testosterone ranged from 3 to 6 ng / ml prior to treatment. Six of the 13 untreated CAH girls had subtle breast development starting at ages 11 - 16 years and three had spontaneous infrequent vaginal bleeding starting at ages 11 - 17. Steroid supplementation initiated pubertal changes in older girls in two-to-six months′ time. Conclusion: There was a delay in HPO axis maturation (as evidenced by delayed pubertal development in the absence of treatment in girls with CAH. This could be corrected with steroid supplementation.

  12. Pubertal breast development in primary school girls in Sokoto, North ...

    African Journals Online (AJOL)

    conducted on African children living in Africa.[13,14] The influence of ... breast development and menarche, and to determine the influence of nutrition and ethnicity ... 5 University of Nigeria Teaching Hospital, Enugu, Nigeria. Corresponding ...

  13. Bone mineral density, growth, pubertal development and other parameters in Brazilian children and young adults with sickle cell anaemia.

    Science.gov (United States)

    Meeuwes, M; Souza de Carvalho, T F; Cipolotti, R; Gurgel, R Q; Ferrão, T O; Peters, M; Agyemang, C

    2013-12-01

    To evaluate the occurrence of low bone mineral density (BMD) and its relationship with clinical and laboratorial characteristics in children and young adults with sickle cell anaemia living in Northeast-Brazil, and to assess the role of radiography in diagnosing low BMD. Bone mineral density of lumbar spine was measured by dual energy X-ray absorptiometry (DXA) in 27 patients with Sickle cell anaemia (SCA) aged 7-28 years. Clinical history, calcium and calorie intake, laboratory measurements, anthropometrics and pubertal development were assessed, and X-rays were obtained. Z-scores and T-scores for weight, height, Body Mass Index (BMI) and BMD were calculated using age and gender matched reference data. Mean lumbar spine BMD Z-scores and T-scores were -1.81 SD in boys and -0.80 SD in girls. BMD Z-scores were below -2 SD in 33.3% of girls and in 46.7% of boys. Low BMD (developing low BMD. © 2013 John Wiley & Sons Ltd.

  14. The influence of chronic conditions and the environment on pubertal development. An example from medieval England.

    Science.gov (United States)

    Lewis, M E; Shapland, F; Watts, R

    2016-03-01

    Adolescence is a unique period in human development encompassing sexual maturation (puberty) and the physical and psychological transition into adulthood. It is a crucial time for healthy development and any adverse environmental conditions, poor nutrition, or chronic infection can alter the timing of these physical changes; delaying menarche in girls or the age of peak height velocity in boys. This study explores the impact of chronic illness on the tempo of puberty in 607 adolescent skeletons from medieval England (AD 900-1550). A total of 135 (22.2%) adolescents showed some delay in their pubertal development, and this lag increased with age. Of those with a chronic condition, 40.0% (n=24/60) showed delay compared to only 20.3% (n=111/547) of the non-pathology group. This difference was statistically significant. A binary logistic regression model demonstrated a significant association between increasing delay in pubertal stage attainment with age in the pathology group. This is the first time that chronic conditions have been directly associated with a delay in maturation in the osteological record, using a new method to assess stages of puberty in skeletal remains. Copyright © 2015 Elsevier Inc. All rights reserved.

  15. Impact of socio-emotional context, brain development, and pubertal maturation on adolescent risk-taking.

    Science.gov (United States)

    Smith, Ashley R; Chein, Jason; Steinberg, Laurence

    2013-07-01

    While there is little doubt that risk-taking is generally more prevalent during adolescence than before or after, the underlying causes of this pattern of age differences have long been investigated and debated. One longstanding popular notion is the belief that risky and reckless behavior in adolescence is tied to the hormonal changes of puberty. However, the interactions between pubertal maturation and adolescent decision making remain largely understudied. In the current review, we discuss changes in decision making during adolescence, focusing on the asynchronous development of the affective, reward-focused processing system and the deliberative, reasoned processing system. As discussed, differential maturation in the structure and function of brain systems associated with these systems leaves adolescents particularly vulnerable to socio-emotional influences and risk-taking behaviors. We argue that this asynchrony may be partially linked to pubertal influences on development and specifically on the maturation of the affective, reward-focused processing system. Copyright © 2013 Elsevier Inc. All rights reserved.

  16. Development and Lability in the Parent-Child Relationship During Adolescence: Associations With Pubertal Timing and Tempo

    Science.gov (United States)

    Marceau, Kristine; Ram, Nilam; Susman, Elizabeth

    2014-01-01

    Adolescents' and parents' reactions to pubertal development are hypothesized to contribute to changes in family dynamics. Using 7-year longitudinal data from the NICHD-SECCYD (488 boys, 475 girls) we examined relations between pubertal development (timing, tempo) and trajectories (developmental change and year-to-year lability) of parent-child conflict and closeness from age 8.5 to 15.5 years. Changes were mostly characterized by year-to-year fluctuations – lability. Parent-child conflict increased and closeness decreased some with age. Pubertal timing and tempo were more consistently associated with lability in parent-child relationships than with long-term trends, although faster tempo was associated with steeper decreases in parent-child closeness. Findings provide a platform for examining how puberty contributes to both long-term and transient changes in adolescents' relationships and adjustment. PMID:26321856

  17. Interaction of Pubertal Development and Metabolic Control in Adolescents with Type 1 Diabetes Mellitus

    Directory of Open Access Journals (Sweden)

    M. Plamper

    2017-01-01

    Full Text Available Background. In T1DM, delayed pubertal development and reduced final height are associated with inadequate metabolic control. Objective. To assess whether T1DM affects pubertal growth spurt and whether metabolic control during puberty is gender-related. Methods. Using a large multicentre database, longitudinal data from 1294 patients were analysed. Inclusion criteria: complete records of height and HbA1c from the age of seven to 16 years. Exclusion criteria: other significant chronic diseases and medications, T1DM duration less than three months, and initial BMI 97th percentile. Results. Growth velocity (GV was impaired with a significant reduction of peak GV by 1.2 cm in boys. HbA1c increase during male puberty was lower except for a period of 1.5 years. The highest HbA1c increase in boys coincided with maximum growth spurt. In girls, the highest HbA1c increase was observed during late puberty. Even though there is impaired GV, both sexes reach a height at 16 years of age which corresponds to the background population height. Conclusion. Worsening of metabolic control is sex-discordant and associated with gender-specific alterations of GV. However, the vast majority of boys and girls with T1DM seems to reach normal height at the age of 16 years.

  18. Mobile phone radiation during pubertal development has no effect on testicular histology in rats.

    Science.gov (United States)

    Tumkaya, Levent; Kalkan, Yildiray; Bas, Orhan; Yilmaz, Adnan

    2016-02-01

    Mobile phones are extensively used throughout the world. There is a growing concern about the possible public health hazards posed by electromagnetic radiation emitted from mobile phones. Potential health risk applies particularly to the most intensive mobile phone users-typically, young people. The aim of this study was to investigate the effects of mobile phone exposure to the testes, by assessing the histopathological and biochemical changes in the testicular germ cells of rats during pubertal development. A total of 12 male Sprague Dawley rats were used. The study group (n = 6) was exposed to a mobile phone for 1 h a day for 45 days, while the control group (n = 6) remained unexposed. The testes were processed with routine paraffin histology and sectioned. They were stained with hematoxylin-eosin, caspase 3, and Ki-67 and then photographed. No changes were observed between the groups (p > 0.05). The interstitial connective tissue and cells of the exposed group were of normal morphology. No abnormalities in the histological appearance of the seminiferous tubules, including the spermatogenic cycle stage, were observed. Our study demonstrated that mobile phones with a low specific absorption rate have no harmful effects on pubertal rat testicles. © The Author(s) 2013.

  19. Early Adolescent Friendship Selection Based on Externalizing Behavior: the Moderating Role of Pubertal Development. The SNARE Study.

    Science.gov (United States)

    Franken, Aart; Prinstein, Mitchell J; Dijkstra, Jan Kornelis; Steglich, Christian E G; Harakeh, Zeena; Vollebergh, Wilma A M

    2016-11-01

    This study examined friendship (de-)selection processes in early adolescence. Pubertal development was examined as a potential moderator. It was expected that pubertal development would be associated with an increased tendency for adolescents to select their friends based on their similarities in externalizing behavior engagement (i.e., delinquency, alcohol use, and tobacco use). Data were used from the first three waves of the SNARE (Social Network Analysis of Risk behavior in Early adolescence) study (N = 1144; 50 % boys; M age  = 12.7; SD = 0.47), including students who entered the first year of secondary school. The hypothesis was tested using Stochastic Actor-Based Modeling in SIENA. While taking the network structure into account, and controlling for peer influence effects, the results supported this hypothesis. Early adolescents with higher pubertal development were as likely as their peers to select friends based on similarity in externalizing behavior and especially likely to remain friends with peers who had a similar level of externalizing behavior, and thus break friendship ties with dissimilar friends in this respect. As early adolescents are actively engaged in reorganizing their social context, adolescents with a higher pubertal development are especially likely to lose friendships with peers who do not engage in externalizing behavior, thus losing an important source of adaptive social control (i.e., friends who do not engage in externalizing behavior).

  20. Relationships of Pubertal Development among Early Adolescents to Sexual and Nonsexual Risk Behaviors and Caregivers' Parenting Behaviors

    Science.gov (United States)

    Koo, Helen P.; Rose, Allison; Bhaskar, Brinda; Walker, Leslie R.

    2012-01-01

    Using a school-based sample of fifth graders (mean age = 10.38, SD = 0.66) and their parents (N = 408) from Washington, D.C., the authors examine associations of pubertal development with early adolescents' sexual and nonsexual risk behaviors and their caregivers' parenting behaviors and of these risk behaviors with parenting behaviors. Results…

  1. Mental Health Problems of Iranian Female Adolescents and Its Association with Pubertal Development: A Nationwide Study

    Directory of Open Access Journals (Sweden)

    Aria Sotoudeh

    2012-03-01

    Full Text Available Mental health problems including emotional and behavioral problems during puberty may be under influence of different risk factors including cultures, living in urban or rural areas and ethnic factors which may vary between different countries. The main aim of this study is to investigate the profile of emotional and behavioral problems and the role of factors such as age, stage of puberty, ethnicity, rurality and living in urban area, as risk factors in Iranian girls. As a part of a large national study we evaluated the emotional and behavioral problems in different stages of puberty in a community sample of Iranian adolescent girls from public schools that were selected by clustered random sampling method. In all subjects, demographic characteristics, and pubertal stages were measured. Emotional and behavioral problems were evaluated using Strength and Difficulties Questionnaire (SDQ. The associations of age, pubertal development indices, socioeconomic and demographic factors with the behavioral problems were assessed. A total number of 4576 students enrolled the study and responded to the questions. The mean age of participants was 13.83 2.19 years. The mean total score of difficulties in participants was 14.34 5.81. According to these results 813 (17.8% adolescents had total problem scores higher than Goodmans cutoff points and the most frequent problem domain was conduct problems (20.5%. According to the results the most related variable with the total difficulty score of SDQ were ethnicity, residency in urban areas and development of menstrual cycle respectively. The results of this study showed that the most correlated factors with mental health problems in Iranian girls during puberty are ethnicity, urbanity and development of menstrual cycle.

  2. The longitudinal effects of physical activity and dietary calcium on bone mass accrual across stages of pubertal development.

    Science.gov (United States)

    Lappe, Joan M; Watson, Patrice; Gilsanz, Vicente; Hangartner, Thomas; Kalkwarf, Heidi J; Oberfield, Sharon; Shepherd, John; Winer, Karen K; Zemel, Babette

    2015-01-01

    Childhood and adolescence are critical periods of bone mineral content (BMC) accrual that may have long-term consequences for osteoporosis in adulthood. Adequate dietary calcium intake and weight-bearing physical activity are important for maximizing BMC accrual. However, the relative effects of physical activity and dietary calcium on BMC accrual throughout the continuum of pubertal development in childhood remains unclear. The purpose of this study was to determine the effects of self-reported dietary calcium intake and weight-bearing physical activity on bone mass accrual across the five stages of pubertal development in a large, diverse cohort of US children and adolescents. The Bone Mineral Density in Childhood study was a mixed longitudinal study with 7393 observations on 1743 subjects. Annually, we measured BMC by dual-energy X-ray absorptiometry (DXA), physical activity and calcium intake by questionnaire, and pubertal development (Tanner stage) by examination for up to 7 years. Mixed-effects regression models were used to assess physical activity and calcium intake effects on BMC accrual at each Tanner stage. We found that self-reported weight-bearing physical activity contributed to significantly greater BMC accrual in both sexes and racial subgroups (black and nonblack). In nonblack males, the magnitude of the activity effect on total body BMC accrual varied among Tanner stages after adjustment for calcium intake; the greatest difference between high- and low-activity boys was in Tanner stage 3. Calcium intake had a significant effect on bone accrual only in nonblack girls. This effect was not significantly different among Tanner stages. Our findings do not support differential effects of physical activity or calcium intake on bone mass accrual according to maturational stage. The study demonstrated significant longitudinal effects of weight-bearing physical activity on bone mass accrual through all stages of pubertal development. © 2014 American

  3. Serum AMH levels are lower in healthy boys who develop pubertal gynaecomastia

    DEFF Research Database (Denmark)

    Mieritz, Mikkel G.; Hagen, Casper P.; Almstrup, Kristian

    2015-01-01

    Background: Pubertal gynaecomastia is thought to be a clinical sign of an oestrogen-androgen imbalance, affecting up to 60% of boys. In most cases no underlying endocrinopathy can be identified. In boys, Anti-mullerian hormone (AMH) is produced by immature Sertoli cells and circulating level...... decreases as testosterone increases during pubertal maturation. In a previous cross sectional study we found significant lower levels of AMH in boys with pubertal gynaecomastia (Mieritz et al., Clin Endocrinol, 2013). Objective and hypotheses: To investigate serum AMH levels and genetic polymorphisms...... in boys with or without gynaecomastia. Method: 99 healthy Danish boys (aged 5.8-16.4 years) were followed in a prospective cohort over 8 years with semi-annual examinations (total examinations, n=951), including breast palpations and blood samples. Serum AMH concentrations were analysed by immunoassay...

  4. Comparison of lumbar force between pubertal and post-pubertal adolescents: interference of physical growth, body fat and lifestyle.

    Directory of Open Access Journals (Sweden)

    Mikael Seabra Moraes

    2018-01-01

    Full Text Available Abstract Aim: To compare performance in the lumbar force test in pubertal and post-pubertal adolescents by controlling the interference of physical growth, body fat, screen time and physical activity. Methods: A cross-sectional study with 933 adolescents (492 girls aged 14-19 from the city of São José, Brazil. Lumbar strength was assessed using the isometric lumbar extension test proposed by the Canadian Society of Exercise Physiology. Sexual maturation was classified according to Tanner’s criteria. Physical growth variables (age, body weight, stature, BMI, body fat (triceps and subscapular skinfolds, sedentary behavior based on screen time and overall physical activity were controlled in the Analysis of Covariance (ANCOVA, with a significance level of 5%. Results: Post-pubertal boys presented higher lumbar force compared to pubertal ones only when interference of BMI, body fat, screen time and physical activity was controlled. Pubertal girls presented higher lumbar force compared to post-pubertal ones, both when controlling the analysis for the studied variables and when not controlled by them. Conclusion: BMI, body fat, screen time and physical activity interfere in the difference in lumbar strength of boys, in which post-pubertal boys presented better performance in lumbar force compared to pubertal ones. Regardless of interference or not of these variables, pubertal girls presented better performance in lumbar force when compared to post-pubertal ones.

  5. Normal Pubertal Development in Daughters of Women With PCOS: A Controlled Study.

    Science.gov (United States)

    Legro, Richard S; Kunselman, Allen R; Stetter, Christy M; Gnatuk, Carol L; Estes, Stephanie J; Brindle, Eleanor; Vesper, Hubert W; Botelho, Julianne C; Lee, Peter A; Dodson, William C

    2017-01-01

    Daughters of women with polycystic ovary syndrome (PCOS) are thought to be at increased risk for developing stigmata of the syndrome, but the ontogeny during puberty is uncertain. We phenotyped daughters (n = 76) of mothers with PCOS and daughters (n = 80) from control mothers for reproductive and metabolic parameters characteristic of PCOS. We performed a matched case/control study at Penn State Hershey Medical Center that included non-Hispanic, white girls 4 to 17 years old. We obtained birth history, biometric, ovarian ultrasounds, whole-body dual-energy X-ray absorptiometry scan for body composition, 2-hour glucose challenged salivary insulin levels, and two timed urinary collections (12 hours overnight and 3 hours in the morning) for gonadotropins and sex steroids. We measured integrated urinary levels of adrenal (dehydroepiandrosterone sulfate) and ovarian [testosterone (TT)] steroids. Other endpoints included integrated salivary insulin levels and urinary luteinizing hormone levels. There were no differences in detection rates or mean levels for gonadotropins and sex steroids in timed urinary collections between PCOS daughters and control daughters, nor were there differences in integrated salivary insulin levels. Results showed that 69% of Tanner 4/5 PCOS daughters vs 31% of control daughters had hirsutism defined as a Ferriman-Gallwey score >8 (P = 0.04). There were no differences in body composition as determined by dual-energy X-ray absorptiometry between groups in the three major body contents (i.e., bone, lean body mass, and fat) or in ovarian volume between groups. Matched for pubertal stage, PCOS daughters have similar levels of urinary androgens and gonadotropins as well as glucose-challenged salivary insulin levels. Copyright © 2017 by the Endocrine Society

  6. The Development of Associations Among BMI, Body Dissatisfaction, and Weight and Shape Concern in Adolescent Boys and Girls

    Science.gov (United States)

    Calzo, Jerel P.; Sonneville, Kendrin R.; Haines, Jess; Blood, Emily A.; Field, Alison E.; Austin, S. Bryn

    2012-01-01

    Purpose To examine how the associations among BMI and body dissatisfaction and weight and shape concern evolve from late childhood through late adolescence in boys and girls. Methods We analyze data from 9–18-year-olds from the Growing Up Today Study, a national prospective cohort of U.S. Youth (n= 16,882, yielding 59,750 repeated measures observations during five waves of data collection). Generalized additive models produced curves of association for body dissatisfaction and weight concern across BMI percentiles. Generalized estimating equations (adjusting for correlated within-subject repeated measures, sibling clusters, pubertal maturation, and region of residence) tested main and interactive effects of BMI, age, and gender. Results Girls above the 50th BMI percentile reported greater body dissatisfaction than girls below the 50th percentile. By contrast, boys who reported the most body dissatisfaction were either above the 75th BMI percentile (approaching overweight) or below the 10th percentile (approaching underweight). Body dissatisfaction increased with age for both girls and boys, but the gender-specific patterns of BMI effects remained constant. Male and female participants in the overweight/obese BMI range reported the greatest weight concern, but among older adolescents (particularly girls), healthy weight became increasingly associated with greater weight and shape concern. Conclusions Body dissatisfaction and weight and shape concern intensify across adolescence, but associations between the constructs and BMI remain gender-specific. Findings have important implications for eating disorder risk assessment and prevention. PMID:23084175

  7. Growth hormone mediates pubertal skeletal development independent of hepatic IGF-1 production.

    Science.gov (United States)

    Courtland, Hayden-William; Sun, Hui; Beth-On, Mordechay; Wu, Yingjie; Elis, Sebastien; Rosen, Clifford J; Yakar, Shoshana

    2011-04-01

    Deficiencies in either growth hormone (GH) or insulin-like growth factor 1 (IGF-1) are associated with reductions in bone size during growth in humans and animal models. Liver-specific IGF-1-deficient (LID) mice, which have 75% reductions in serum IGF-1, were created previously to separate the effects of endocrine (serum) IGF-1 from autocrine/paracrine IGF-1. However, LID mice also have two- to threefold increases in GH, and this may contribute to the observed pubertal skeletal phenotype. To clarify the role of GH in skeletal development under conditions of significantly reduced serum IGF-1 levels (but normal tissue IGF-1 levels), we studied the skeletal response of male LID and control mice to GH inhibition by pegvisomant from 4 to 8 weeks of age. Treatment of LID mice with pegvisomant resulted in significant reductions in body weight, femur length (Le), and femur total area (Tt.Ar), as well as further reductions in serum IGF-1 levels by 8 weeks of age, compared with the mean values of vehicle-treated LID mice. Reductions in both Tt.Ar and Le were proportional after treatment with pegvisomant. On the other hand, the relative amount of cortical tissue formed (RCA) in LID mice treated with pegvisomant was significantly less than that in both vehicle-treated LID and control mice, indicating that antagonizing GH action, either directly (through GH receptor signaling inhibition) or indirectly (through further reductions in serum/tissue IGF-1 levels), results in disproportionate reductions in the amount of cortical bone formed. This resulted in bones with significantly reduced mechanical properties (femoral whole-bone stiffness and work to failure were markedly decreased), suggesting that compensatory increases of GH in states of IGF-1 deficiency (LID mice) act to protect against a severe inhibition of bone modeling during growth, which otherwise would result in bones that are too weak for normal and/or extreme loading conditions. Copyright © 2011 American Society for

  8. Elite athletes and pubertal delay.

    Science.gov (United States)

    Kapczuk, Karina

    2017-10-01

    Intensive physical training and participation in competitive sports during childhood and early adolescence may affect athletes' pubertal development. On the other hand, pubertal timing, early or late, may impact on an athlete selection for a particular sport. Genetic predisposition, training load, nutritional status and psychological stress determine athletes' pubertal timing. Athletes that practice esthetic sports, especially gymnasts, are predisposed to a delay in pubertal development. The growing evidence indicates that energy deficiency, not a systemic training per se, plays a crucial role in the pathogenesis of functional hypothalamic hypogonadism in female athletes. Metabolic and psychologic stress activate hypothalamic-pituitary-adrenal axis and suppress hypothalamic-pituitary-ovarian axis. Female athletes who do not begin secondary sexual development by the age of 14 or menstruation by the age of 16 warrant a comprehensive evaluation and a targeted treatment. Somatic growth and sexual maturation of elite female athletes are largely sport-specific since each sport favors a particular somatotype and requires a specific training. Chronic negative energy balance resulting from a systemic physical training and inadequate energy intake may delay pubertal development in elite athletes. Youth athletes, especially those engaged in competitive sports that emphasize prepubertal or lean appearance, are at risk of developing relative energy deficiency in sport associated with disordered eating or eating disorders. Management strategies should address the complex conditions underlying functional hypothalamic hypogonadism.

  9. Genetic regulation of pre-pubertal development of body mass index: a longitudinal study of Japanese twin boys and girls.

    Science.gov (United States)

    Silventoinen, Karri; Kaprio, Jaakko; Yokoyama, Yoshie

    2011-03-01

    We analyzed the genetic architecture of prepubertal development of relative weight to height in 216 monozygotic and 159 dizygotic complete Japanese twin pairs (52% girls). Ponderal index at birth (kg/m(3)) and body mass index (BMI, kg/m(2)) from 1 to 11 years of age were used. Additive genetic factors explained the major proportion (52-74%) of the variation of BMI from 1 to 11 years of age. Environmental factors common to both co-twins also showed some effect (7-28%), but at most ages this was not statistically significant. Strong genetic tracking was found for BMI from 1 to 11 years of age, but there was also evidence for a persistent effect of common environmental factors. Our results suggest that the genetic architecture of BMI development in the Japanese population is generally similar to that found in previous twin studies in Caucasian populations.

  10. Transitions in body and behavior: a meta-analytic study on the relationship between pubertal development and adolescent sexual behavior.

    Science.gov (United States)

    Baams, Laura; Dubas, Judith Semon; Overbeek, Geertjan; van Aken, Marcel A G

    2015-06-01

    The present meta-analysis studies the relations of pubertal timing and status with sexual behavior and sexual risk behavior among youth aged 10.5-22.4 years. We included biological sex, age, and ethnicity as potential moderators. Four databases were searched for studies (published between 1980 and 2012) on the relation between pubertal timing or status and sexual behavior. The outcomes were (1) sexual intercourse; (2) combined sexual behavior; and (3) risky sexual behavior. Earlier pubertal timing or more advanced pubertal status was related to earlier and more sexual behavior, and earlier pubertal timing was related to more risky sexual behavior. Further, the links between (1) pubertal status and combined sexual behavior and (2) pubertal timing and sexual intercourse status, combined sexual behavior, and risky sexual behavior were stronger for girls than boys. Most links between pubertal status, timing, and sexual behavior and sexual risk behavior were stronger for younger adolescents. Moderation by ethnicity did not yield consistent results. There was significant variation in results among studies that was not fully explained by differences in biological sex, age, and ethnicity. Future research is needed to identify moderators that explain the variation in effects and to design sexual health interventions for young adolescents. Copyright © 2015 Society for Adolescent Health and Medicine. Published by Elsevier Inc. All rights reserved.

  11. Lauric Acid Stimulates Mammary Gland Development of Pubertal Mice through Activation of GPR84 and PI3K/Akt Signaling Pathway.

    Science.gov (United States)

    Meng, Yingying; Zhang, Jing; Zhang, Fenglin; Ai, Wei; Zhu, Xiaotong; Shu, Gang; Wang, Lina; Gao, Ping; Xi, Qianyun; Zhang, Yongliang; Liang, Xingwei; Jiang, Qingyan; Wang, Songbo

    2017-01-11

    It has been demonstrated that dietary fat affects pubertal mammary gland development. However, the role of lauric acid (LA) in this process remains unclear. Thus, this study aimed to investigate the effects of LA on mammary gland development in pubertal mice and to explore the underlying mechanism. In vitro, 100 μM LA significantly promoted proliferation of mouse mammary epithelial cell line HC11 by regulating expression of proliferative markers (cyclin D1/3, p21, PCNA). Meanwhile, LA activated the G protein-coupled receptor 84 (GPR84) and PI3K/Akt signaling pathway. In agreement, dietary 1% LA enhanced mammary duct development, increased the expression of GPR84 and cyclin D1, and activated PI3K/Akt in mammary gland of pubertal mice. Furthermore, knockdown of GPR84 or inhibition of PI3K/Akt totally abolished the promotion of HC11 proliferation induced by LA. These results showed that LA stimulated mammary gland development of pubertal mice through activation of GPR84 and PI3K/Akt signaling pathway.

  12. Regulation of gonadal sex ratios and pubertal development by the thyroid endocrine system in zebrafish (Danio rerio).

    Science.gov (United States)

    Sharma, Prakash; Patiño, Reynaldo

    2013-04-01

    We examined associations between thyroid condition, gonadal sex and pubertal development in zebrafish. Seventy-two-hour postfertilization larvae were reared in untreated medium or in the presence of goitrogens (sodium perchlorate, 0.82 mM; methimazole, 0.15 and 0.3 mM) or thyroxine (1 and 10 nM) for 30 days. Thyrocyte height, gonadal sex and gonadal development were histologically determined at 45 and 60 days postfertilization (dpf). Thyrocyte hypertrophy, an index of hypothyroidism, was observed at 45 and 60 dpf in perchlorate-treated but only at 45 dpf in methimazole-treated fish. Similarly, gonadal sex ratios were biased toward ovaries relative to control animals at 45 and 60 dpf in perchlorate-treated fish but only at 45 dpf in methimazole-treated fish. Gonadal sex ratios were biased toward testes at 45 and 60 dpf in thyroxine-treated fish. Spermatogenesis was delayed in testes from goitrogen-treated fish at 60 dpf relative to control values, but was unaffected in testes from thyroxine-treated individuals. Oogenesis seemed to be nonspecifically delayed in all treatments relative to control at 60 dpf. This study confirmed the previously reported association between hypothyroid condition and ovarian-skewed ratios, and hyperthyroid condition and testicular-skewed ratios, and also showed that male pubertal development is specifically delayed by experimental hypothyroidism. The simultaneous recovery from the hypothyroid and ovary-inducing effects of methimazole by 60 dpf (27 days post-treatment) suggests that the ovary-skewing effect of goitrogens is reversible when thyroid conditions return to basal levels before developmental commitment of gonadal sex. Conversely, the masculinizing effect of hyperthyroidism seems to be stable and perhaps permanent. Published by Elsevier Inc.

  13. Regulation of gonadal sex ratios and pubertal development by the thyroid endocrine system in zebrafish (Danio rerio)

    Science.gov (United States)

    Sharma, Prakash; Patino, Reynaldo

    2013-01-01

    We examined associations between thyroid condition, gonadal sex and pubertal development in zebrafish. Seventy-two-hour postfertilization larvae were reared in untreated medium or in the presence of goitrogens (sodium perchlorate, 0.82 mM; methimazole, 0.15 and 0.3 mM) or thyroxine (1 and 10 nM) for 30 days. Thyrocyte height, gonadal sex and gonadal development were histologically determined at 45 and 60 days postfertilization (dpf). Thyrocyte hypertrophy, an index of hypothyroidism, was observed at 45 and 60 dpf in perchlorate-treated but only at 45 dpf in methimazole-treated fish. Similarly, gonadal sex ratios were biased toward ovaries relative to control animals at 45 and 60 dpf in perchlorate-treated fish but only at 45 dpf in methimazole-treated fish. Gonadal sex ratios were biased toward testes at 45 and 60 dpf in thyroxine-treated fish. Spermatogenesis was delayed in testes from goitrogen-treated fish at 60 dpf relative to control values, but was unaffected in testes from thyroxine-treated individuals. Oogenesis seemed to be nonspecifically delayed in all treatments relative to control at 60 dpf. This study confirmed the previously reported association between hypothyroid condition and ovarian-skewed ratios, and hyperthyroid condition and testicular-skewed ratios, and also showed that male pubertal development is specifically delayed by experimental hypothyroidism. The simultaneous recovery from the hypothyroid and ovary-inducing effects of methimazole by 60 dpf (27 days post-treatment) suggests that the ovary-skewing effect of goitrogens is reversible when thyroid conditions return to basal levels before developmental commitment of gonadal sex. Conversely, the masculinizing effect of hyperthyroidism seems to be stable and perhaps permanent.

  14. Pubertal development and fertility in survivors of childhood acute myeloid leukemia treated with chemotherapy only: a NOPHO-AML study.

    Science.gov (United States)

    Molgaard-Hansen, Lene; Skou, Anne-Sofie; Juul, Anders; Glosli, Heidi; Jahnukainen, Kirsi; Jarfelt, Marianne; Jónmundsson, Guðmundur K; Malmros, Johan; Nysom, Karsten; Hasle, Henrik

    2013-12-01

    More than 60% of children with acute myeloid leukemia (AML) become long-term survivors. Most are cured using chemotherapy without hematopoietic stem cell transplantation (HSCT). We report on pubertal development and compare self-reported parenthood among AML survivors and their siblings. We included 137 children treated for AML according to the Nordic Society of Pediatric Hematology and Oncology (NOPHO)-AML-84, -88, and -93 trials, who were alive by June 2007. Patients with relapse or treated with HSCT were excluded. AML survivors participated in a physical and biochemical examination (n = 102) and completed a questionnaire (n = 101). One of their siblings completed an identical questionnaire (n = 84). At a median follow-up of 11 years (range 5-25) after diagnosis of AML the survivors (median age 16 years, range 5-36) were either prepubertal or had entered puberty normally. Serum levels of FSH, LH, testosterone, estradiol, sex hormone binding globulin (SHBG), inhibin A and B, and testicular volumes were within normal ranges. Anti-Müllerian hormone (AMH) levels were decreased in 5 of 40 postpubertal females. Mean reported age at menarche was 13.1 (range 11-17) years. Among survivors 15 years of age or older 31% of females reported pregnancies and 9% of males reported pregnancies in their partners, rates comparable with the frequency reported by their siblings. Most AML survivors treated with chemotherapy had normal pubertal development and fertility, however, AMH levels were decreased in 13% of postpubertal females. Longer follow-up is necessary to evaluate possible risk of premature ovarian failure. © 2013 Wiley Periodicals, Inc.

  15. Induction of a hypothyroid state during juvenile development delays pubertal reactivation of the neuroendocrine system governing luteinising hormone secretion in the male rhesus monkey (Macaca mulatta).

    Science.gov (United States)

    Mann, D R; Bhat, G K; Stah, C D; Pohl, C R; Plant, T M

    2006-09-01

    The present study aimed to determine the influence of thyroid status on the timing of the pubertal resurgence in gonadotrophin-releasing hormone pulse generator activity [tracked by circulating luteinising hormone (LH) levels] in male rhesus monkeys. Six juvenile monkeys were orchidectomised and then treated with the antithyroid drug, methimazole, from 15-19 months until 36 months of age, at which time thyroxine (T(4)) replacement was initiated. Four additional agonadal monkeys served as controls. Blood samples were drawn weekly for hormonal assessments. Body weight, crown-rump length and bone age were monitored at regular intervals. By 8 weeks of methimazole treatment, plasma T(4) had fallen sharply, and the decline was associated with a plasma thyroid-stimulating hormone increase. In controls, plasma LH levels remained undetectable until the pubertal rise occurred at 29.3 +/- 0.2 months of age. This developmental event occurred in only half of the methimazole-treated animals before 36 months of age when T(4) replacement was initiated. The hypothyroid state was associated with a profound arrest of growth and bone maturation, but increased body mass indices and plasma leptin levels. T(4) replacement in methimazole-treated monkeys was associated with the pubertal rise in LH in the remaining three animals and accelerated somatic development in all six animals. Although pubertal resurgence in LH secretion occurred at a later chronological age in methimazole-treated animals compared to controls, bone age, crown-rump length and body weight at that time did not differ between groups. There were no long-term differences in plasma prolactin between groups. We conclude that juvenile hypothyroidism in male primates causes a marked delay in the pubertal resurgence of LH secretion, probably occasioned at the hypothalamic level. Whether this effect is meditated by an action of thyroid hormone directly on the hypothalamus or indirectly as a result of the concomitant deficit in

  16. Understanding the Link Between Pubertal Timing in Girls and the Development of Depressive Symptoms: The Role of Sexual Harassment.

    Science.gov (United States)

    Skoog, Therése; Bayram Özdemir, Sevgi; Stattin, Håkan

    2016-02-01

    The link between sexual maturation, or pubertal timing, in girls and adolescent depressive symptoms is well-documented, but the underlying processes remain unclear. We examined whether sexual harassment, which has previously been linked to both pubertal timing and depressive symptoms, mediates this link, using a two-wave longitudinal study including 454 girls in 7th (M age  = 13.42, SD = .53) and 8th grade (M age  = 14.42, SD = .55). Pubertal timing was linked to depressive symptoms in both age groups, and predicted an increase in depressive symptoms among the 7th graders. Sexual harassment significantly mediated the link between pubertal timing and depressive symptoms among the 7th, but not the 8th grade girls. Together, our findings suggest that one way to prevent depressive symptoms among early-maturing girls could be to address sexual harassment in preventive intervention in early adolescence.

  17. Bone turnover markers during pubertal development: relationships with growth factors and adipocytokines.

    Science.gov (United States)

    Jürimäe, Jaak; Mäestu, Jarek; Jürimäe, Toivo

    2010-01-01

    The rapid increase in skeletal mass that occurs during puberty is caused by increases in longitudinal growth as well as cortical thickness. The measurement of growth changes during puberty using two-dimensional (dual-energy X-ray absorptiometry) and/or three-dimensional (computed tomography, magnetic resonance imaging) measurement devices provides only a static representation of bone tissue parameters. The measurement of bone turnover markers provides a more dynamic picture of the nature of bone tissue that can be repeated at much shorter intervals during puberty. The bone turnover markers are products of osteoblasts and osteoclasts which can be measured in urine or blood. The increase in different markers of bone turnover coincides with the pubertal growth spurt and thereafter markers decline until they converge into adult values. The initiation of puberty is accompanied by increases in androgens and estrogens. The effects of sex hormones on bone mineral accrual are mediated mainly by growth hormone and insulin-like growth factor-1, but they also exert a direct effect on bone metabolism. Important determinants of bone mineral accrual during puberty include optimal nutritional status, body composition parameters and physical activity pattern. All of these determinants are related to the state of energy balance, while peripheral indicators of energy balance, such as different growth factors and adipocytokines, may also have a positive influence of the growing skeleton. Taken together, bone mineral accrual during puberty is a complex interaction between physical activity pattern, various body composition parameters, specific growth factors and adipocytokines, and also sex hormones. Copyright © 2010 S. Karger AG, Basel.

  18. Accuracy of dental development for estimating the pubertal growth spurt in comparison to skeletal development: a systematic review and meta-analysis.

    Science.gov (United States)

    Bittencourt, MarcosAlan Vieira; Cericato, GrazielaOro; Franco, Ademir; Girão, RafaelaSilva; Lima, Anderson Paulo Barbosa; Paranhos, LuizRenato

    2018-05-01

    This study aimed to search for scientific evidence concerning the accuracy of dental development for estimating the pubertal growth spurt. It was conducted according to the statements of PRISMA. An electronic search was performed in six databases, including the grey literature. The PICOS strategy was used to define the eligibility criteria and only observational studies were selected. Out of 1,416 identified citations, 10 articles fulfilled the criteria and were included in this systematic review. The association between dental development and skeletal maturity was considered strong in seven studies, and moderate in two, although the association with the pubertal growth spurt had been verified in only four articles. According to half of the studies, the tooth that provided the greater association with the ossification centres was the lower canine. The meta-analysis performed also indicated a positive association, being stronger in females [0.725 (0.649-0.808)]. However, when the method used for dental evaluation was considered, it was possible to verify greater correlation coefficients for Nolla [0.736 (0.666-0.814)] than for Demirjian [0.631 (0.450-0.884)], at the boys sample. The heterogeneity test reached high values (Q = 51.00), suggesting a potential bias within the studies. Most of individual studies suggested a strong correlation between dental development and skeletal maturation, although the association with the peakof pubertal growth spurtwas clearly cited only in some of them. However, due to the high heterogeneity found among the studies included in this meta-analysis, a pragmatic recommendation about the use of dental stages is not possible.

  19. Longitudinal change in the neural bases of adolescent social self-evaluations: effects of age and pubertal development.

    Science.gov (United States)

    Pfeifer, Jennifer H; Kahn, Lauren E; Merchant, Junaid S; Peake, Shannon J; Veroude, Kim; Masten, Carrie L; Lieberman, Matthew D; Mazziotta, John C; Dapretto, Mirella

    2013-04-24

    Self-evaluations undergo significant transformation during early adolescence, developing in parallel with the heightened complexity of teenagers' social worlds. Intuitive theories of adolescent development, based in part on animal work, suggest that puberty is associated with neural-level changes that facilitate a "social reorientation" (Nelson et al., 2005). However, direct tests of this hypothesis using neuroimaging are limited in humans. This longitudinal fMRI study examined neurodevelopmental trajectories associated with puberty, self-evaluations, and the presumed social reorientation during the transition from childhood to adolescence. Participants (N = 27, mean age = 10.1 and 13.1 years at time points one and two, respectively) engaged in trait evaluations of two targets (the self and a familiar fictional other), across two domains of competence (social and academic). Responses in ventromedial PFC increased with both age and pubertal development during self-evaluations in the social domain, but not in the academic domain. These results suggest that changes in social self-evaluations are intimately connected with biology, not just peer contexts, and provide important empirical support for the relationship between neurodevelopment, puberty, and social functioning.

  20. BMI Development of Normal Weight and Overweight Children in the PIAMA Study

    NARCIS (Netherlands)

    Willers, Saskia M.; Brunekreef, Bert; Smit, Henriette A.; van der Beek, Eline M.; Gehring, Ulrike; de Jongste, Johan C.; Kerkhof, Marjan; Koppelman, Gerard H.; Wijga, Alet H.

    2012-01-01

    Background: There is evidence that rapid weight gain during the first year of life is associated with overweight later in life. However, results from studies exploring other critical periods for the development of overweight are inconsistent. Objective: The objective was to investigate BMI

  1. Pubertal Development and Thyroid Function in Intact Juvenile Rats Exposed to 3-Nitro-1,2,4-Trazol-5-One (NTO), February-June 2012

    Science.gov (United States)

    2014-02-01

    vivo effects on androgen-dependent tissues in young rats (i.e., prochloraz) similar to the effects of NTO in the present study have feminized male...the potential to interact with the endocrine system in vivo by identifying effects on pubertal development and thyroid function in the intact juvenile...estrogen or thyroid active compound under the test conditions. The observed testicular toxicity and the effects on the androgen-dependent reproductive

  2. Hormonal, anthropometric and lipid factors associated with idiopathic pubertal gynecomastia.

    Science.gov (United States)

    Al Alwan, Ibrahim; Al Azkawi, Hanan; Badri, Motasim; Tamim, Hani; Al Dubayee, Mohammed; Tamimi, Waleed

    2013-01-01

    To determine factors associated with pubertal gynecomastia. A cross-sectional study among healthy male school children and adolescents in Riyadh, Saudi Arabia. Subjects were selected from diverse socioeconomic backgrounds. Tanner stage, height, weight, blood hormonal levels (leutilizing hormone [LH], follicle-stimulating hormone [FSH], total testosterone, and estradiol), and anthropometric and lipid parameters (body mass index [BMI], triglycerides, high-density lipoprotein [HDL], and low-density lipoprotein [LDL]), were collected and compared in children with and without gynecomastia. The study included 542 children and adolescents. Median (interquartile range) age in the whole group was 11(8-13) years. The prevalence of gynecomastia was 185/542 (34%), with a peak at age 14. The 2 groups compared had nonsignificant difference in cholesterol (P=.331), LH (P=.215) and FSH (P=.571) levels. Those with gynecomastia were significantly older, had lower gonad stage, had higher anthropometric (height, weight, and BMI), and lipid (triglycerides, HDL, and LDL) values. In multivariate regression analysis, factors significantly associated with gynecomastia were BMI (odds ratio [OR]=1.05; 95%CI 1.00-1.10; P=.013), HDL (OR=0.42; 95%CI 0.19-0.92; P=.03), and gonad (Stage II OR=2.23; 95%CI 1.27-3.92; P=.005, Stage III OR=6.40; 95%CI 2.70-15.0; P gynecomastia tends to increase in mid-puberty. In our setting, BMI, HDL, and gonad stage were the major factors associated with the development of pubertal gynecomastia.

  3. Modulation of mammary gland development in pre-pubertal mice as affected by soya and milk protein supplements.

    Science.gov (United States)

    Alston-Mills, Brenda; Lepri, J J; Martin, C A

    2011-08-01

    The objective of the present study was to determine the effects of soya and whey milk protein, α-lactalbumin (α-LA), on mammary gland morphology and the structural support of the gland, in pre-pubertal mice after 7 d of treatment. In Expt 1, weaned (day 21) CD1 mice were given one of the four treatments, three included dietary supplements: (1) control diet, casein, (2) soya, (3) α-LA and (4) subcutaneous injection of 2·5 μg oestradiol benzoate in 20 μl maize oil and fed the control diet. All diets were isoenergetic with equal protein concentrations. All groups that were not treated with oestradiol received the vehicle. Whole-mount analyses were performed to determine longitudinal ductal growth and terminal end bud development. DNA was extracted from the gland and assessed by spectrophotometry (260/280 nm). Tissue extracts for extracellular matrix (ECM) proteins, matrix metalloproteinase-2 (MMP(2)), tissue inhibitor of MMP(2) (TIMP(2)), and serum oestradiol and mammary tissue epidermal growth factors (EGF) were measured by immunoassays. Expt 2 utilised the Her2/neu transgenic strain, with the same protocols. Statistical significance was determined by one-way ANOVA. From Expt 1 and 2, soya and α-LA significantly increased ductal elongation when compared with the oestrogen and control groups. These results were corroborated by data on total DNA and the ratio of MMP(2):TIMP(2). The ratio of MMP(2):TIMP(2) was affected by α-LA. Serum oestradiol was decreased only in the oestradiol-treated groups in both experiments. Soya is known to be oestrogenic and can act on epithelia directly. The mechanism by which α-LA affects glandular development is by modulating the ECM or by promoting the synthesis/activity of EGF.

  4. Effects of rumen-undegradable protein on intake, performance, and mammary gland development in prepubertal and pubertal dairy heifers.

    Science.gov (United States)

    Silva, A L; Detmann, E; Dijkstra, J; Pedroso, A M; Silva, L H P; Machado, A F; Sousa, F C; Dos Santos, G B; Marcondes, M I

    2018-04-04

    The objective of this study was to evaluate the influence of different amounts of rumen-undegradable protein (RUP) on intake, N balance, performance, mammary gland development, carcass traits, and hormonal status of Holstein heifers at different physiological stages (PS). Sixteen prepubertal (PRE) heifers (initial BW = 106 ± 7.6 kg; age = 4.3 ± 0.46 mo) and 16 pubertal (PUB) heifers (initial BW = 224 ± 7.9 kg; age = 12.6 ± 0.45 mo) were used in an experiment over a period of 84 d. Four diets with increasing RUP contents (38, 44, 51, and 57% of dietary crude protein) and heifers at 2 PS (PRE or PUB) were used in a 4 × 2 factorial arrangement of treatments in a completely randomized design. Throughout the experiment, 2 digestibility trials were performed over 5 consecutive days (starting at d 36 and 78) involving feed and ort sampling and spot collections of feces and urine. At d 0 and 83, body ultrasound images were obtained for real-time carcass trait evaluation. The mammary gland was ultrasonically scanned at d 0 and every 3 wk during the experiment. Blood samples were taken at d 0 and 84 to determine serum concentrations of progesterone, estrogen, insulin-like growth factor I (IGF-I), and insulin. No interaction between PS and the level of RUP was found for any trait. Apparent digestibility of dry matter, organic matter, and neutral detergent fiber corrected for ash and protein was not affected by RUP level but was lower for PRE compared with PUB heifers. Sorting against neutral detergent fiber corrected for ash and protein (tendency only) and for crude protein was greater for PUB than PRE heifers. Pubertal heifers had greater average daily gain (905 vs. 505 g/d) and N retention (25.9 vs. 12.5 g/d) than PRE heifers. In addition, average daily gain and N retention were greatest at 51% RUP of dietary protein. Mammary ultrasonography indicated no effects of RUP amounts on mammary gland composition, whereas PRE heifers had greater pixel values than PUB

  5. Pubertal development in children and adolescents born after IVF and spontaneous conception

    NARCIS (Netherlands)

    Ceelen, M.; van Weissenbruch, M.M.; Vermeiden, J.P.W.; van Leeuwen, F.E.; Delemarre-van d Waal, H.A.

    2008-01-01

    BACKGROUND: Previous studies demonstrated a link between adverse conditions during prenatal life and the development of diseases in adult life. It is still unclear whether IVF conception could permanently affect early prenatal development in humans, with post-natal health consequences. The objective

  6. Long term cortison treatment inhibits pubertal development in male common carp, Cyprinus carpio L.

    NARCIS (Netherlands)

    Consten, D.; Bogerd, J.; Komen, J.; Lambert, J.G.D.; Goos, H.J.Th.

    2001-01-01

    The onset and regulation of puberty is determined by functional development of the brain-pituitary-gonad (BPG) axis. Stress has been shown to interfere with reproduction and the functioning of the BPG axis. The response to chronic and severe stress may require much energy and force the organism to

  7. Profiling of androgen response in rainbow trout pubertal testis: relevance to male gonad development and spermatogenesis.

    Directory of Open Access Journals (Sweden)

    Antoine D Rolland

    Full Text Available The capacity of testicular somatic cells to promote and sustain germ cell differentiation is largely regulated by sexual steroids and notably androgens. In fish species the importance of androgens is emphasized by their ability to induce sex reversal of the developing fries and to trigger spermatogenesis. Here we studied the influence of androgens on testicular gene expression in trout testis using microarrays. Following treatment of immature males with physiological doses of testosterone or 11-ketotestosterone, 418 genes that exhibit changes in expression were identified. Interestingly, the activity of testosterone appeared stronger than that of 11-ketotestosterone. Expression profiles of responsive genes throughout testis development and in isolated germ cells confirmed androgens to mainly affect gene expression in somatic cells. Furthermore, specific clusters of genes that exhibit regulation coincidently with changes in the natural circulating levels of androgens during the reproductive cycle were highlighted, reinforcing the physiological significance of these data. Among somatic genes, a phylogenetic footprinting study identified putative androgen response elements within the proximal promoter regions of 42 potential direct androgen target genes. Finally, androgens were also found to alter the germ line towards meiotic expression profiles, supporting the hypothesis of a role for the somatic responsive genes in driving germ cell fate. This study significantly increases our understanding of molecular pathways regulated by androgens in vertebrates. The highly cyclic testicular development in trout together with functions associated with regulated genes reveal potential mechanisms for androgen actions in tubule formation, steroid production, germ cell development and sperm secretion.

  8. Excess BMI in Childhood: A Modifiable Risk Factor for Type 1 Diabetes Development?

    Science.gov (United States)

    Ferrara, Christine Therese; Geyer, Susan Michelle; Liu, Yuk-Fun; Evans-Molina, Carmella; Libman, Ingrid M; Besser, Rachel; Becker, Dorothy J; Rodriguez, Henry; Moran, Antoinette; Gitelman, Stephen E; Redondo, Maria J

    2017-05-01

    We aimed to determine the effect of elevated BMI over time on the progression to type 1 diabetes in youth. We studied 1,117 children in the TrialNet Pathway to Prevention cohort (autoantibody-positive relatives of patients with type 1 diabetes). Longitudinally accumulated BMI above the 85th age- and sex-adjusted percentile generated a cumulative excess BMI (ceBMI) index. Recursive partitioning and multivariate analyses yielded sex- and age-specific ceBMI thresholds for greatest type 1 diabetes risk. Higher ceBMI conferred significantly greater risk of progressing to type 1 diabetes. The increased diabetes risk occurred at lower ceBMI values in children <12 years of age compared with older subjects and in females versus males. Elevated BMI is associated with increased risk of diabetes progression in pediatric autoantibody-positive relatives, but the effect varies by sex and age. © 2017 by the American Diabetes Association.

  9. Temporal trends in BMI in Argentina by socio-economic position and province-level economic development, 2005-2009.

    Science.gov (United States)

    Christine, Paul J; Diez Roux, Ana V; Wing, Jeffrey J; Alazraqui, Marcio; Spinelli, Hugo

    2015-04-01

    We investigated temporal trends in BMI, and assessed hypothesized predictors of trends including socio-economic position (SEP) and province-level economic development, in Argentina. Using multivariable linear regression, we evaluated cross-sectional patterning and temporal trends in BMI and examined heterogeneity in these associations by SEP and province-level economic development with nationally representative samples from Argentina in 2005 and 2009. We calculated mean annual changes in BMI for men and women to assess secular trends. Women, but not men, exhibited a strong cross-sectional inverse association between SEP and BMI, with the lowest-SEP women having an average BMI 2.55 kg/m(2) greater than the highest-SEP women. Analysis of trends revealed a mean annual increase in BMI of 0.19 kg/m(2) and 0.15 kg/m(2) for women and men, respectively, with slightly greater increases occurring in provinces with greater economic growth. No significant heterogeneity in trends existed by individual SEP. BMI is increasing rapidly over time in Argentina irrespective of various sociodemographic characteristics. Higher BMI remains more common in women of lower SEP compared with those of higher SEP.

  10. Facing changes and changing faces in adolescence: a new model for investigating adolescent-specific interactions between pubertal, brain and behavioral development.

    Science.gov (United States)

    Scherf, K Suzanne; Behrmann, Marlene; Dahl, Ronald E

    2012-04-01

    Adolescence is a time of dramatic physical, cognitive, emotional, and social changes as well as a time for the development of many social-emotional problems. These characteristics raise compelling questions about accompanying neural changes that are unique to this period of development. Here, we propose that studying adolescent-specific changes in face processing and its underlying neural circuitry provides an ideal model for addressing these questions. We also use this model to formulate new hypotheses. Specifically, pubertal hormones are likely to increase motivation to master new peer-oriented developmental tasks, which will in turn, instigate the emergence of new social/affective components of face processing. We also predict that pubertal hormones have a fundamental impact on the re-organization of neural circuitry supporting face processing and propose, in particular, that, the functional connectivity, or temporal synchrony, between regions of the face-processing network will change with the emergence of these new components of face processing in adolescence. Finally, we show how this approach will help reveal why adolescence may be a period of vulnerability in brain development and suggest how it could lead to prevention and intervention strategies that facilitate more adaptive functional interactions between regions within the broader social information processing network. Copyright © 2011 Elsevier Ltd. All rights reserved.

  11. Facing changes and changing faces in adolescence: A new model for investigating adolescent-specific interactions between pubertal, brain and behavioral development

    Science.gov (United States)

    Scherf, K. Suzanne; Behrmann, Marlene; Dahl, Ronald E.

    2015-01-01

    Adolescence is a time of dramatic physical, cognitive, emotional, and social changes as well as a time for the development of many social-emotional problems. These characteristics raise compelling questions about accompanying neural changes that are unique to this period of development. Here, we propose that studying adolescent-specific changes in face processing and its underlying neural circuitry provides an ideal model for addressing these questions. We also use this model to formulate new hypotheses. Specifically, pubertal hormones are likely to increase motivation to master new peer-oriented developmental tasks, which will in turn, instigate the emergence of new social/affective components of face processing. We also predict that pubertal hormones have a fundamental impact on the reorganization of neural circuitry supporting face processing and propose, in particular, that, the functional connectivity, or temporal synchrony, between regions of the face-processing network will change with the emergence of these new components of face processing in adolescence. Finally, we show how this approach will help reveal why adolescence may be a period of vulnerability in brain development and suggest how it could lead to prevention and intervention strategies that facilitate more adaptive functional interactions between regions within the broader social information processing network. PMID:22483070

  12. Pubertal Development and Prepubertal Height and Weight Jointly Predict Young Adult Height and Body Mass Index in a Prospective Study in South Africa.

    Science.gov (United States)

    Stein, Aryeh D; Lundeen, Elizabeth A; Martorell, Reynaldo; Suchdev, Parminder S; Mehta, Neil K; Richter, Linda M; Norris, Shane A

    2016-07-01

    Height and adiposity track over childhood, but few studies, to our knowledge, have longitudinally examined the mediating relation of the timing and progression of puberty. We assessed interrelations between prepubertal height and body mass index, the progression through puberty, and young adult height and adiposity. We analyzed data from the Birth to Twenty Plus study (females, n = 823; males, n = 765). Serial measures of anthropometry and pubertal development were obtained between ages 9 and 16 y. We used latent class growth analysis to categorize pubertal development with respect to pubic hair (females and males), breasts (females), and genitalia (males) development. Adult height and weight were obtained at ages 18 to 20 y. Among females, higher latent class (earlier initiation and faster progression through puberty) was associated with an increased risk of obesity [pubic hair class 3 compared with class 1: RR, 3.41 (95% CI: 1.57, 7.44)] and inconsistent associations with height. Among males, higher latent class was associated with increased adult height [pubic hair development class 3 compared with class 1: 2.43 cm (95% CI: 0.88, 4.00)] and increased risk of overweight/obesity [pubic hair development class 3 compared with class 1: OR, 3.44 (95% CI: 1.44, 8.20)]. In females, the association with adult height became inverse after adjusting for prepubertal height [pubic hair development class 3 compared with class 1: females, -1.31 cm (95% CI: -2.32, -0.31)]; in males, the association with height was attenuated with this adjustment [-0.56 cm (95% CI: -1.63, 0.52)]. Associations with adiposity were attenuated after adjusting for prepubertal adiposity. Progression through puberty modifies the relation between prepubertal and adult anthropometry. Screening for early or rapid progression of puberty might identify children at an increased risk of becoming overweight or obese adults.

  13. The relations of age and pubertal development with cortisol and daily stress in youth at clinical risk for psychosis.

    Science.gov (United States)

    Moskow, Danielle M; Addington, Jean; Bearden, Carrie E; Cadenhead, Kristin S; Cornblatt, Barbara A; Heinssen, Robert; Mathalon, Daniel H; McGlashan, Thomas H; Perkins, Diana O; Seidman, Larry J; Tsuang, Ming T; Cannon, Tyrone D; Woods, Scott W; Walker, Elaine F

    2016-04-01

    Prodromal syndromes often begin in adolescence - a period of neurodevelopmental changes and heightened stress sensitivity. Research has shown elevated stress and cortisol in individuals at clinical high risk (CHR) for psychosis. This cross-sectional study examined relations of age and pubertal status with cortisol and self-reported stress in healthy controls (HCs) and CHR adolescents. It was hypothesized that the relations of age and pubertal stage with cortisol and stress would be more pronounced in CHR youth. Participants were 93 HCs and 348 CHR adolescents from the North American Prodrome Longitudinal Study (NAPLS). At baseline, measures of stress (Daily Stress Inventory - DSI), Tanner stage (TS), and salivary cortisol were obtained. ANCOVA revealed increased DSI scores with age for both groups, and higher DSI scores in CHR adolescents than HCs, with a more pronounced difference for females. Contrary to prediction, with age controlled, HCs showed greater TS-related DSI increases. Analysis of cortisol showed no significant interactions, but a main effect of age and a trend toward higher cortisol in the CHR group. Correlations of cortisol with TS were higher in HC than CHR group. Stress measures increased with age in HC and CHR adolescents, and DSI scores also increased with TS in HCs. The results do not support a more pronounced age or TS increase in stress measures in CHR adolescents, but instead suggest that stress indices tend to be elevated earlier in adolescence in the CHR group. Potential determinants of findings and future directions are discussed. Copyright © 2016 Elsevier B.V. All rights reserved.

  14. Phthalate and bisphenol A exposure during in utero windows of susceptibility in relation to reproductive hormones and pubertal development in girls.

    Science.gov (United States)

    Watkins, Deborah J; Sánchez, Brisa N; Téllez-Rojo, Martha Maria; Lee, Joyce M; Mercado-García, Adriana; Blank-Goldenberg, Clara; Peterson, Karen E; Meeker, John D

    2017-11-01

    Over the past several decades, the age of pubertal onset in girls has shifted downward worldwide. As early pubertal onset is associated with increased risky behavior and psychological issues during adolescence and cardiometabolic disease and cancer in adulthood, this is an important public health concern. Exposure to endocrine disrupting chemicals during critical windows of in utero development may play a role in this trend. Our objective was to investigate trimester-specific phthalate and BPA exposure in relation to pubertal development among girls in the Early Life Exposure in Mexico to Environmental Toxicants (ELEMENT) birth cohort. We measured maternal urinary phthalate metabolites and BPA in samples collected during the first, second, and third trimesters of pregnancy. To assess reproductive development among their female children, we measured serum testosterone, estradiol, dehydroepiandrosterone sulfate (DHEA-S), inhibin B, and sex hormone-binding globulin (SHBG), and assessed sexual maturation, including Tanner staging for breast and pubic hair development and menarche status, at age 8-13 years (n = 120). We used linear and logistic regression to examine measures of trimester-specific in utero exposure as predictors of peripubertal hormone levels and pubertal onset, respectively. In secondary analyses, we evaluated estimated exposure at the midpoint of the first trimester and rates of change in exposure across pregnancy in relation to outcomes. Several phthalate metabolites measured throughout in utero development were associated with higher serum testosterone concentrations, while a number of metabolites measured in the third trimester were associated with higher DHEA-S. For example, an interquartile range (IQR) increase in mean monoethyl phthalate (MEP) levels across pregnancy was associated with 44% higher peripubertal testosterone (95% CI: 13-83%), while an IQR increase in di-2-ethylhexyl phthalate metabolites (ΣDEHP) specifically in the third trimester

  15. Sex, age, pubertal development and use of oral contraceptives in relation to serum concentrations of DHEA, DHEAS, 17α-hydroxyprogesterone, Δ4-androstenedione, testosterone and their ratios in children, adolescents and young adults.

    Science.gov (United States)

    Søeborg, Tue; Frederiksen, Hanne; Mouritsen, Annette; Johannsen, Trine Holm; Main, Katharina Maria; Jørgensen, Niels; Petersen, Jørgen Holm; Andersson, Anna-Maria; Juul, Anders

    2014-11-01

    The influence of sex, age, pubertal development and oral contraceptives on dehydroepiandrosterone (DHEA), DHEA sulfate (DHEAS), 17α-hydroxyprogesterone (17-OHP), Δ4-androstenedione (Adione), testosterone (T), calculated free testosterone (fT), free androgen index (FAI) and selected ratios in 1798 serum samples from healthy children, adolescents and young adults was evaluated. Samples were analyzed by Turboflow-LC-MS/MS. Sex hormone-binding globulin was analyzed by immunoassay. All steroid metabolite concentrations were positively associated with age and pubertal development in both sexes and generally higher in males than in females except for Adione. The pubertal rise in T in males was more pronounced compared to females, reflecting contribution from the testes. Ratios between steroid metabolites varied and depended on sex and age. All ratios were lower during infancy compared to later in life. Use of oral contraceptives significantly lowered serum concentrations of all steroid metabolites, fT, FAI, the 17-OHP/Adione, the Adione/T and the DHEA/Adione ratios, but not the DHEA/DHEAS ratio. We provide reference ranges for DHEA, DHEAS, 17-OHP, Adione, T, fT, FAI and selected ratios in relation to sex, age and pubertal development. Use of oral contraceptives strongly influences adrenal steroidogenesis and should be considered when diagnosing and monitoring treatment of patients with disorders of sex development. Copyright © 2014 Elsevier B.V. All rights reserved.

  16. The role of early life growth development, the FTO gene and exclusive breastfeeding on child BMI trajectories.

    Science.gov (United States)

    Wu, Yan Yan; Lye, Stephen; Briollais, Laurent

    2017-10-01

    Recent studies have implicated the FTO gene in child and adult obesity. A longer duration of exclusive breastfeeding (EXBF) has been shown to reduce body mass index (BMI) and the risk of being overweight in the general population and among FTO gene carriers. However, it remains unclear whether the preventive effect of EXBF could be explained by its impact on early life growth development, e.g. ages at adiposity peak (AP) and adiposity rebound (AR) and BMI velocities in the first years of life, which are major determinants of overweight and obesity later in life. We studied 5590 children from the British Avon Longitudinal Study of Parents and Children (ALSPAC) cohort and modelled their longitudinal BMI profiles with mixed effects models from birth to 16 years of age, as well as their ages at AP, AR and BMI velocities in relation to the FTO gene variant and EXBF. A longer duration of EXBF (i.e. at least 5 months) has substantial impact on BMI growth trajectories among children carrying the FTO adverse variant by modulating the age at AP, age at AR and BMI velocities. EXBF acts antagonistically to the FTO rs9939609 risk allele and by the age of 15, the predicted reduction in BMI after 5 months of EXBF is 0.56 kg/m2 [95% confidence interval (CI) 0.11-1.01; P = 0.003] and 1.14 kg/m2 (95% CI 0.67-1.62; P < 0.0001) in boys and girls, respectively. EXBF influences early life growth development and thus plays a critical role in preventing the risks of overweight and obesity even when those are exacerbated by genetic factors. © The Author 2017; all rights reserved. Published by Oxford University Press on behalf of the International Epidemiological Association

  17. Pubertal timing and adolescent sexual behavior in girls.

    Science.gov (United States)

    Moore, Sarah R; Harden, K Paige; Mendle, Jane

    2014-06-01

    Girls who experience earlier pubertal timing relative to peers also exhibit earlier timing of sexual intercourse and more unstable sexual relationships. Although pubertal development initiates feelings of physical desire, the transition into romantic and sexual relationships involves complex biological and social processes contributing both to physical maturation and to individual interpretations of pubertal experiences. Using a sample of female sibling pairs (n = 923 pairs) from the National Longitudinal Study of Adolescent Health, the present study investigated associations among menarche and perceived pubertal timing, age of first sexual intercourse (AFI), and adolescent dating and sexual behavior using a behavioral genetic approach. Genetic factors influencing age at menarche and perceived pubertal timing predicted AFI through shared genetic pathways, whereas genetic factors related only to perceived pubertal timing predicted engagement in dating, romantic sex, and nonromantic sex in the previous 18 months. These results suggest that a girl's interpretation of her pubertal timing beyond objective timing is important to consider for the timing and the contexts of romantic and reproductive behavior. PsycINFO Database Record (c) 2014 APA, all rights reserved.

  18. Sex, age, pubertal development and use of oral contraceptives in relation to serum concentrations of DHEA, DHEAS, 17α-hydroxyprogesterone, Δ4-androstenedione, testosterone and their ratios in children, adolescents and young adults

    DEFF Research Database (Denmark)

    Søeborg, Tue; Frederiksen, Hanne; Mouritsen, Annette

    2014-01-01

    The influence of sex, age, pubertal development and oral contraceptives on dehydroepiandrosterone (DHEA), DHEA sulfate (DHEAS), 17α-hydroxyprogesterone (17-OHP), Δ4-androstenedione (Adione), testosterone (T), calculated free testosterone (fT), free androgen index (FAI) and selected ratios in 1798...... serum samples from healthy children, adolescents and young adults was evaluated. Samples were analyzed by Turboflow-LC-MS/MS. Sex hormone-binding globulin was analyzed by immunoassay. All steroid metabolite concentrations were positively associated with age and pubertal development in both sexes....... Use of oral contraceptives significantly lowered serum concentrations of all steroid metabolites, fT, FAI, the 17-OHP/Adione, the Adione/T and the DHEA/Adione ratios, but not the DHEA/DHEAS ratio. We provide reference ranges for DHEA, DHEAS, 17-OHP, Adione, T, fT, FAI and selected ratios in relation...

  19. The Role of Polycomb Group Gene BMI1 in the Development of Prostate Cancer

    Science.gov (United States)

    2014-03-01

    8217CTGTGGGAGCAAAGGAAGAC3’ Reverse, 5’AGAAGGAAACGGATCCCCTA3’: BCL2 ( P2 - promoter, TATA site), Forward, 5’CAAGTGTTCCGCG`TGATTG3’ Reverse 5’CCCGGTTA...expression of various proteins. A Kaplan -Meier survival analysis with the corresponding Log-Rank and Linear Regression analysis was used to measure...promoter ( P2 promoter). We found very little or no occupancy by TCF4 on - 3.41Kb and -8.41kb of BCL2 promoter (data not shown). Notably, BMI1-overexpression

  20. Development and evaluation of aerogel-filled BMI sandwich panels for thermal barrier applications

    Directory of Open Access Journals (Sweden)

    A. Dineshkumar

    2016-07-01

    Full Text Available This study details a fabrication methodology envisaged to manufacture Glass/BMI honeycomb core aerogel-filled sandwich panels. Silica aerogel granules are used as core fillers to provide thermal insulation properties with little weight increase. Experimental heat transfer studies are conducted on these panels to study the temperature distribution between their two surfaces. Numerical studies are also carried out to validate the results. Despite exhibiting good thermal shielding capabilities, the Glass/BMI sandwich panels are found to oxidise at 180 ºC if exposed directly to heat. In order to increase the temperature bearing capacity and the operating temperature range for these panels, a way of coating them from outside with high temperature spray paint was tried. With a silicone-based coating, the temperature sustainability of these sandwich panels is found to increase to 350 ºC. This proved the effectiveness of the formed manufacturing process, selected high temperature coating, the coating method as well as the envisaged sandwich panel concept.

  1. THE EFFECT OF ATRAZINE ON PUBERTY IN THE MALE WISTAR RATS: AN EVALUATION IN THE PROTOCOL FOR THE ASSESSMENT OF PUBERTAL DEVELOPMENT AND THYROID FUNCTION

    Science.gov (United States)

    Since atrazine (ATR), a chlorotriazine herbicide, has been shown previously to alter the secretion of luteinizing hormone (LH) and prolactin (PRL) through a direct effect on the central nervous system (CNS), we hypothesized that exposure to ATR in the EDSTAC male pubertal protoco...

  2. Pubertal changes in emotional information processing: pupillary, behavioral, and subjective evidence during emotional word identification.

    Science.gov (United States)

    Silk, Jennifer S; Siegle, Greg J; Whalen, Diana J; Ostapenko, Laura J; Ladouceur, Cecile D; Dahl, Ronald E

    2009-01-01

    This study investigated pupillary and behavioral responses to an emotional word valence identification paradigm among 32 pre-/early pubertal and 34 mid-/late pubertal typically developing children and adolescents. Participants were asked to identify the valence of positive, negative, and neutral words while pupil dilation was assessed using an eyetracker. Mid-/late pubertal children showed greater peak pupillary reactivity to words presented during the emotional word identification task than pre-/early pubertal children, regardless of word valence. Mid-/late pubertal children also showed smaller sustained pupil dilation than pre-/early pubertal children after the word was no longer on screen. These findings were replicated controlling for participants' age. In addition, mid-/late pubertal children had faster reaction times to all words, and rated themselves as more emotional during their laboratory visit compared to pre-/early pubertal children. Greater recall of emotional words following the task was associated with mid-/late pubertal status, and greater recall of emotional words was also associated with higher peak pupil dilation. These results provide physiological, behavioral, and subjective evidence consistent with a model of puberty-specific changes in neurobehavioral systems underpinning emotional reactivity.

  3. Changes in BMI before and during economic development and subsequent risk of cardiovascular disease and total mortality: a 35-year follow-up study in China.

    Science.gov (United States)

    He, Yao; Lam, Tai Hing; Jiang, Bin; Li, Lan Sun; Sun, Dong Ling; Wu, Lei; Liu, Miao; Yang, Shan Shan; Wang, Yi Yan; Tobias, Deirdre K; Sun, Qi; Hu, Frank B

    2014-09-01

    It is unclear whether changes in BMI during rapid economic development influence subsequent mortality. We analyzed whether BMI in 1976 and 1994 and changes in BMI during 1976-1994 predict cardiovascular disease (CVD) and all-cause mortality in a 35-year follow-up cohort of 1,696 Chinese (1,124 men and 572 women, aged 35-65 years) in Xi'an, China. Participants were categorized as underweight (economic development was associated with elevated risks of all-cause and CVD mortality. Higher BMI measured before economic development was associated with lower mortality risk, whereas BMI measured afterward was associated with increased mortality. © 2014 by the American Diabetes Association. Readers may use this article as long as the work is properly cited, the use is educational and not for profit, and the work is not altered.

  4. Ethnicity, Perceived Pubertal Timing, Externalizing Behaviors, and Depressive Symptoms among Black Adolescent Girls

    Science.gov (United States)

    Carter, Rona; Caldwell, Cleopatra Howard; Matusko, Niki; Antonucci, Toni; Jackson, James S.

    2011-01-01

    An accumulation of research evidence suggests that early pubertal timing plays a significant role in girls' behavioral and emotional problems. If early pubertal timing is a problematic event, then early developing Black girls should manifest evidence of this crisis because they tend to be the earliest to develop compared to other girls from…

  5. Role Of Serum Lectin In Derangement Of PUBERTAL Timing In Thalassaemic Patients

    International Nuclear Information System (INIS)

    MOAWAD, A.T.; NASSAR, E.M.; EL-NASHAR, N.A.

    2010-01-01

    The purpose of this study was to investigate the association between serum leptin and pubertal derangement in β-thalassemia major (TM) patients. This study was conducted on forty TM patients (25 males and 15 females) with mean age 15.6 ±1.47 and twenty healthy children with normal pubertal development served as control (10 males and 10 females). Clinical, anthropometric and pubertal assessment using tanner classification were done for all patients and controls in addition to estimation of serum ferritin, leptin, follicle stimulating hormone (FSH), luteinizing hormone (LH), testosterone (T) in boys and estradiol (E 2 ) in girls. Thalassaemic patients were subdivided into 27 patients with normal puberty and 13 delayed puberty patients. The results showed that failure of puberty was confirmed in 70% of boys and in 67% of girls. Body mass index (BMI) was significantly decreased in both patient groups as compared to controls. Mean serum ferritin levels were significantly increased in TM patients with delayed puberty (male: 2865.5±274.7 and female: 2704.5±477.1 ng/ml) than the levels in euogonadal patients (male: 1594.1±408.8 and female: 1524.1±349.6 ng/ml). However, a significant difference in serum ferritin was also detected between euogonadal patients and controls. Although the mean serum leptin levels were significantly higher in normal pubertal patients (male: 3.7± 0.4 and female: 7.6±1.2 ng/ml) comparing to the levels in delayed puberty patients (male: 0.9± 0.4 and female: 2.6±0.9 ng/ml), it was still lower than levels in control group (male: 8.4±2.8 and female: 12.3±1.9 ng/ml). The mean serum levels of FSH and LH were significantly decreased in delayed puberty patients when compared to each of normal puberty patients and controls. However, the comparison between normal patients and controls was non-significant. A close positive correlation was observed between serum leptin and BMI in normal pubertal patients, but such correlation was not obtained in

  6. Associations of Birth Order with Early Adolescent Growth, Pubertal Onset, Blood Pressure and Size: Evidence from Hong Kong's "Children of 1997" Birth Cohort.

    Directory of Open Access Journals (Sweden)

    Man Ki Kwok

    Full Text Available Birth order has been proposed as a cardiovascular risk factor, because the lower birth weight and greater infant weight gain typical of firstborns could programme metabolism detrimentally.We examined the associations of birth order (firstborn or laterborn with birth weight-for-gestational age, length/height and body mass index (BMI z-scores during infancy, childhood, and puberty using generalized estimating equations, with age at pubertal onset using interval-censored regression and with age-, sex- and height-standardized blood pressure, height and BMI z-scores at 13 years using linear regression in a population-representative Chinese birth cohort: "Children of 1997" (n = 8,327.Compared with laterborns, firstborns had lower birth weight-for-gestational age (mean difference = -0.18 z-score, 95% confidence interval (CI -0.23, -0.14, lower infant BMI (-0.09 z-score, 95% CI -0.14, -0.04, greater childhood height (0.10 z-score, 95% CI 0.05, 0.14 and BMI (0.08 z-score, 95% CI 0.03, 0.14, but not greater pubertal BMI (0.05 z-score, 95% CI -0.02, 0.11, adjusted for sex, parental age, birthplace, education and income. Firstborns had earlier onset of pubic hair (time ratio = 0.988, 95% CI 0.980, 0.996, but not breast or genitalia, development. Firstborns had greater BMI (0.07 z-score, 95% CI 0.002, 0.15, but not height (0.05 z-score, 95% CI -0.01, 0.11, at 13 years, but similar blood pressure.Differences by birth order continue into early adolescence with firstborns being heavier with earlier pubic hair development, which could indicate long-term cardiovascular risk.

  7. Associations of Birth Order with Early Adolescent Growth, Pubertal Onset, Blood Pressure and Size: Evidence from Hong Kong's "Children of 1997" Birth Cohort.

    Science.gov (United States)

    Kwok, Man Ki; Leung, Gabriel M; Schooling, C Mary

    2016-01-01

    Birth order has been proposed as a cardiovascular risk factor, because the lower birth weight and greater infant weight gain typical of firstborns could programme metabolism detrimentally. We examined the associations of birth order (firstborn or laterborn) with birth weight-for-gestational age, length/height and body mass index (BMI) z-scores during infancy, childhood, and puberty using generalized estimating equations, with age at pubertal onset using interval-censored regression and with age-, sex- and height-standardized blood pressure, height and BMI z-scores at 13 years using linear regression in a population-representative Chinese birth cohort: "Children of 1997" (n = 8,327). Compared with laterborns, firstborns had lower birth weight-for-gestational age (mean difference = -0.18 z-score, 95% confidence interval (CI) -0.23, -0.14), lower infant BMI (-0.09 z-score, 95% CI -0.14, -0.04), greater childhood height (0.10 z-score, 95% CI 0.05, 0.14) and BMI (0.08 z-score, 95% CI 0.03, 0.14), but not greater pubertal BMI (0.05 z-score, 95% CI -0.02, 0.11), adjusted for sex, parental age, birthplace, education and income. Firstborns had earlier onset of pubic hair (time ratio = 0.988, 95% CI 0.980, 0.996), but not breast or genitalia, development. Firstborns had greater BMI (0.07 z-score, 95% CI 0.002, 0.15), but not height (0.05 z-score, 95% CI -0.01, 0.11), at 13 years, but similar blood pressure. Differences by birth order continue into early adolescence with firstborns being heavier with earlier pubic hair development, which could indicate long-term cardiovascular risk.

  8. Effects of rumen-undegradable protein on intake, performance, and mammary gland development in prepubertal and pubertal dairy heifers

    NARCIS (Netherlands)

    Silva, A.L.; Detmann, E.; Dijkstra, J.; Pedroso, A.M.; Silva, L.H.P.; Machado, A.F.; Sousa, F.C.; Santos, dos G.B.; Marcondes, M.I.

    2018-01-01

    The objective of this study was to evaluate the influence of different amounts of rumen-undegradable protein (RUP) on intake, N balance, performance, mammary gland development, carcass traits, and hormonal status of Holstein heifers at different physiological stages (PS). Sixteen prepubertal (PRE)

  9. Pubertal Onset in Apparently Healthy Indian Boys and Impact of Obesity.

    Science.gov (United States)

    Surana, Vineet; Dabas, Aashima; Khadgawat, Rajesh; Marwaha, Raman Kumar; Sreenivas, V; Ganie, M Ashraf; Gupta, Nandita; Mehan, Neena

    2017-01-01

    Primary - to determine the age of pubertal onset in Indian boys. Secondary - (a) to assess the impact of obesity on pubertal timing, (b) to assess the relationship between gonadotropins and puberty. Cross-sectional. General community-seven schools across New Delhi. Random sample of 1306 school boys, aged 6-17 years. Anthropometric measurement for weight and height and pubertal staging was performed for all subjects. Body mass index (BMI) was calculated to define overweight/obesity. Serum luteinizing hormone (LH), follicle stimulating hormone, and serum testosterone were measured in every sixth subject. Age at pubertal onset-testicular volume ≥4 mL (gonadarche) and pubic hair Stage II. Median age of attaining gonadarche and pubarche was 10.41 years (95% confidence interval [CI]: 10.2-10.6 years) and 13.60 (95% CI: 13.3-14.0 years), respectively. No significant difference in the age of attainment of gonadarche was observed in boys with normal or raised BMI, though pubarche occurred 8 months earlier in the latter group. Serum gonadotropins and testosterone increased with increasing stages of puberty but were unaffected by BMI. Serum LH level of 1.02 mIU/mL and testosterone level of >0.14 ng/mL showed the best prediction for pubertal onset. The study establishes a secular trend of the age of onset of puberty in Indian boys. Pubarche occurred earlier in overweight/obese boys. The cutoff levels of serum LH and testosterone for prediction of pubertal onset have been established.

  10. The impact of anemia and body mass index (BMI on neuromotor development of preschool children

    Directory of Open Access Journals (Sweden)

    Selen Ozakar Akca

    Full Text Available Summary Objective: According to data from the World Health Organization (WHO, anemia is a prevalent health problem that leads to increased morbidity and mortality, especially in preschool children. Anemia is recognized as a major health problem due to its negative effects on the mental and physical development during childhood. The aim of our study was to determine the levels of anemia of children in a kindergarten affiliated to the Directorate of National Education using a non-invasive method, and to investigate the effects of anemia on the physical, mental and neuromotor development of children. Method: The levels of anemia was evaluated by using a non-invasive measurement device. Data collection was performed by means of a questionnaire to evaluate the children’s physical development and set Denver Developmental Screening Test II scores. Results: Our findings show that 21% of non-anemic and 15% of anemic children are in the suspected abnormal group according to their DDST II total score. Furthermore, it has been identified that mild anemia has a positive effect on neuromotor development, while overweight and obesity affect neuromotor development in a negative way. Conclusion: According to the results obtained from the study, mild anemia may have a positive effect on the children’s neuromotor development, while malnutrition could have a negative impact.

  11. Pubertal Timing and Mexican-Origin Girls’ Internalizing and Externalizing Symptoms: The Influence of Harsh Parenting

    Science.gov (United States)

    Deardorff, J.; Cham, H.; Gonzales, NA.; White, R.M.B.; Tein, J.-Y.; Wong, J.; Roosa, M.W.

    2012-01-01

    Early-maturing girls are at risk for internalizing and externalizing problems. Scarce research has examined pubertal timing and mental health among Mexican Americans, or examined the influence of parenting behaviors on these relations. This study addressed these gaps. This was a prospective examination of 362 Mexican-origin girls and their mothers using three waves of data. Measures included girls’ self-report of pubertal development and girls’ and mothers’ report of maternal harsh parenting and daughters’ mental health. Using structural equation modeling, we examined whether pubertal timing in 5th grade predicted girls’ internalizing and externalizing outcomes in 10th grade. We also examined the mediating and moderating effects of harsh parenting on the relations between pubertal timing and internalizing and externalizing behaviors, as well as the influence of mothers’ and daughters’ nativity on these relations. Results differed depending on reporter and maternal nativity. Using daughters’ report, Mexican American mothers’ harsh parenting acted as a moderator. At high levels of harsh parenting, early pubertal timing predicted higher externalizing scores, while at low levels of harsh parenting, early timing predicted lower externalizing scores. For Mexican immigrant mothers, harsh parenting mediated the effects of pubertal timing on girls’ internalizing and externalizing problems. There were no significant pubertal effects for mothers’ report. Findings suggest that maternal harsh parenting plays a key role in the relations between early pubertal timing and behavioral and emotional outcomes among Mexican-origin girls. PMID:23231686

  12. BMI and BMI SDS in childhood: annual increments and conditional change.

    Science.gov (United States)

    Brannsether, Bente; Eide, Geir Egil; Roelants, Mathieu; Bjerknes, Robert; Júlíusson, Pétur Benedikt

    2017-02-01

    Background Early detection of abnormal weight gain in childhood may be important for preventive purposes. It is still debated which annual changes in BMI should warrant attention. Aim To analyse 1-year increments of Body Mass Index (BMI) and standardised BMI (BMI SDS) in childhood and explore conditional change in BMI SDS as an alternative method to evaluate 1-year changes in BMI. Subjects and methods The distributions of 1-year increments of BMI (kg/m 2 ) and BMI SDS are summarised by percentiles. Differences according to sex, age, height, weight, initial BMI and weight status on the BMI and BMI SDS increments were assessed with multiple linear regression. Conditional change in BMI SDS was based on the correlation between annual BMI measurements converted to SDS. Results BMI increments depended significantly on sex, height, weight and initial BMI. Changes in BMI SDS depended significantly only on the initial BMI SDS. The distribution of conditional change in BMI SDS using a two-correlation model was close to normal (mean = 0.11, SD = 1.02, n = 1167), with 3.2% (2.3-4.4%) of the observations below -2 SD and 2.8% (2.0-4.0%) above +2 SD. Conclusion Conditional change in BMI SDS can be used to detect unexpected large changes in BMI SDS. Although this method requires the use of a computer, it may be clinically useful to detect aberrant weight development.

  13. Serum inhibin B in healthy pubertal and adolescent boys

    DEFF Research Database (Denmark)

    Andersson, A M; Juul, A; Petersen, J H

    1997-01-01

    Inhibin B levels were measured in serum from 400 healthy Danish prepubertal, pubertal, and adolescent males, aged 6-20 yr, in a cross-sectional study using a recently developed immunoassay that is specific for inhibin B, the physiologically important inhibin form in men. In addition, serum levels...

  14. Expression and localization of Indian hedgehog (Ihh) and parathyroid hormone related protein (PTHrP) in the human growth plate during pubertal development.

    Science.gov (United States)

    Kindblom, J M; Nilsson, O; Hurme, T; Ohlsson, C; Sävendahl, L

    2002-08-01

    Indian Hedgehog (Ihh) has been reported to control the rate of cartilage differentiation during skeletal morphogenesis in rodents through a negative feedback loop involving parathyroid hormone related protein (PTHrP). The role of Ihh and PTHrP in the regulation of human epiphyseal chondrocytes is unknown. The aim of the current study was to examine the expression and localization of Ihh and PTHrP in the human growth plate at various pubertal stages. Growth plate biopsies were obtained from patients subjected to epiphyseal surgery and the expression of Ihh and PTHrP was detected by immunohistochemistry. We show that Ihh and PTHrP are expressed mainly in early hypertrophic chondrocytes in the human growth plate. The levels of expression of Ihh and PTHrP are higher in early stages of puberty than later. Our results suggest that Ihh and PTHrP are present in the human growth plate and that Ihh and PTHrP may be involved in the regulation of pubertal growth in humans.

  15. [Pubertal growth of 1,453 healthy children according to age at pubertal growth spurt onset. The Barcelona longitudinal growth study].

    Science.gov (United States)

    Carrascosa, Antonio; Yeste, Diego; Moreno-Galdó, Antonio; Gussinyé, Miquel; Ferrández, Ángel; Clemente, María; Fernández-Cancio, Mónica

    2018-02-20

    Pubertal growth pattern differs according to age at pubertal growth spurt onset which occurs over a five years period (girls: 8-13 years, boys: 10-15 years). The need for more than one pubertal reference pattern has been proposed. We aimed to obtain five 1-year-age-interval pubertal patterns. Longitudinal (6 years of age-adult height) growth study of 1,453 healthy children to evaluate height-for-age, growth velocity-for-age and weight-for-age values. According to age at pubertal growth spurt onset girls were considered: very-early matures (8-9 years, n=119), early matures (9-10 years, n=157), intermediate matures (10-11 years, n=238), late matures (11-12 years, n=127) and very-late matures (12-13 years, n=102), and boys: very-early matures (10-11 years, n=110), early matures (11-12 years, n=139), intermediate matures (12-13 years, n=225), late matures (13-14 years, n=133) and very-late matures (14-15 years, n=103). Age at menarche and growth up to adult height were recorded. In both sexes, statistically-significant (P<.0001) and clinically-pertinent differences in pubertal growth pattern (mean height-for-age, mean growth velocity-for-age and mean pubertal height gain, values) were found among the five pubertal maturity groups and between each group and the whole population, despite similar adult height values. The same occurred for age at menarche and growth from menarche to adult height (P<.05). In both sexes, pubertal growth spurt onset is a critical milestone determining pubertal growth and sexual development. The contribution of our data to better clinical evaluation of growth according to the pubertal maturity tempo of each child will obviate the mistakes made when only one pubertal growth reference is used. Copyright © 2018. Publicado por Elsevier España, S.L.U.

  16. About BMI for Adults

    Science.gov (United States)

    ... between the BMI and body fatness is fairly strong 1,2,3,7 , but even if 2 people have the same BMI, their level of body fatness may differ 12 . In general, At the same BMI, women tend to have more body fat than men. At the same BMI, Blacks have less body ...

  17. A Study on Mediation by Offspring BMI in the Association between Maternal Obesity and Child Respiratory Outcomes in the Amsterdam Born and Their Development Study Cohort.

    Science.gov (United States)

    Harskamp-van Ginkel, Margreet W; London, Stephanie J; Magnus, Maria C; Gademan, Maaike G; Vrijkotte, Tanja G

    2015-01-01

    A causal relationship between maternal obesity and offspring asthma is hypothesized to begin during early development, but no underlying mechanism for the found association is identified. We quantitatively examined mediation by offspring body mass index (BMI) in the association of maternal pre-pregnancy BMI on risk of asthma and wheezing during the first 7-8 years of life in a large Amsterdam born birth cohort. For 3185 mother-child pairs, mothers reported maternal pre-pregnancy BMI and offspring outcomes "ever being diagnosed with asthma" and "wheezing in the past 12 months" on questionnaires. We measured offspring height and weight at age 5-6 years. We performed a multivariate log linear regression comparing outcomes in offspring of mothers with different BMI categories. For each category we quantified and tested mediation by offspring BMI and also investigated interaction by parental asthma. At the age of 7-8 years, 8% of the offspring ever had asthma and 7% had current wheezing. Maternal pre-pregnancy obesity was associated with higher risks of asthma (adjusted RR 2.32 (95% CI: 1.49-3.61) and wheezing (adjusted RR 2.16 (95% CI: 1.28-3.64). Offspring BMI was a mediator in the association between maternal BMI and offspring wheezing, but not for asthma. There was no interaction by parental asthma. Maternal pre-pregnancy obesity was associated with higher risks of offspring asthma and wheezing. The association between maternal obesity and offspring wheezing was both direct and indirect (mediated) through the child's own BMI.

  18. Tracking of BMI, fatness and cardiorespiratory fitness from adolescence to middle adulthood: the Zagreb Growth and Development Longitudinal Study.

    Science.gov (United States)

    Sorić, Maroje; Jembrek Gostović, Mirjana; Gostović, Mladen; Hočevar, Marija; Mišigoj-Duraković, Marjeta

    2014-01-01

    Effective intervention strategies aiming to improve cardiorespiratory fitness and to decrease body fatness are needed. However, long-term stability of these traits is not well understood. To assess long-term tracking of cardiorespiratory fitness and body fatness from late adolescence to middle adulthood. The sample consisted of 50 participants (31 boys) from the Zagreb Growth and Development Longitudinal Study who were followed up in adulthood (median age = 43). Fatness was evaluated through BMI and skin-folds, while cardiorespiratory fitness was assessed using a cardiopulmonary exercise test. Inter-age partial correlation coefficients were calculated to evaluate tracking. Body mass index and skin-folds showed moderate tracking from age 15 years to middle adulthood (partial r = 0.55, p < 0.001 and partial r = 0.52, p < 0.001, respectively), while tracking of subcutaneous fat distribution was somewhat lower (partial r = 0.38, p < 0.01). At the same time, the observed tracking of peak oxygen uptake was low-to-moderate (partial r = 0.30, p = 0.03), while ventilatory aerobic and anaerobic thresholds did not show significant tracking. The results of this study indicate that preventive efforts aiming to increase cardiorespiratory fitness should include all adolescents, irrespective of their cardiorespiratory fitness status. Conversely, strategies aiming at obesity prevention should focus on high-risk groups of adolescents.

  19. A Short-Term Longitudinal Study of Pubertal Change, Gender, and Psychological Well-Being of Mexican Early Adolescents.

    Science.gov (United States)

    Benjet, Corina; Hernandez-Guzman, Laura

    2002-01-01

    Studied the role of pubertal development on depression, externalizing behavior problems, self-esteem, and body-image of 951 Mexican early adolescents. Findings show that the acute experience of menarche adversely affected the psychological well-being of girls, specifically in terms of depressive symptomatology. Pubertal change in boys did not…

  20. Adolescents' Increasing Stress Response to Social Evaluation: Pubertal Effects on Cortisol and Alpha-Amylase during Public Speaking

    Science.gov (United States)

    van den Bos, Esther; de Rooij, Mark; Miers, Anne C.; Bokhorst, Caroline L.; Westenberg, P. Michiel

    2014-01-01

    Stress responses to social evaluation are thought to increase during adolescence, which may be due to pubertal maturation. However, empirical evidence is scarce. This study is the first to investigate the relation between pubertal development and biological responses to a social-evaluative stressor longitudinally. Participants performed the Leiden…

  1. Brief communication: a proposed osteological method for the estimation of pubertal stage in human skeletal remains.

    Science.gov (United States)

    Shapland, Fiona; Lewis, Mary E

    2013-06-01

    Puberty forms an important threshold between childhood and adulthood, but this subject has received little attention in bioarchaeology. The new application of clinical methods to assess pubertal stage in adolescent skeletal remains is explored, concentrating on the development of the mandibular canine, hamate, hand phalanges, iliac crest and distal radius. Initial results from the medieval cemetery of St. Peter's Church, Barton-upon-Humber, England suggest that application of these methods may provide insights into aspects of adolescent development. This analysis indicates that adolescents from this medieval site were entering the pubertal growth spurt at a similar age to their modern counterparts, but that the later stages of pubertal maturation were being significantly delayed, perhaps due to environmental stress. Continued testing and refinement of these methods on living adolescents is still necessary to improve our understanding of their significance and accuracy in predicting pubertal stages. Copyright © 2013 Wiley Periodicals, Inc.

  2. Prenatal and pubertal testosterone affect brain lateralization

    NARCIS (Netherlands)

    Beking, T; Geuze, R H; van Faassen, M; Kema, I P; Kreukels, B P C; Groothuis, T G G

    After decades of research, the influence of prenatal testosterone on brain lateralization is still elusive, whereas the influence of pubertal testosterone on functional brain lateralization has not been investigated, although there is increasing evidence that testosterone affects the brain in

  3. Association Between Urinary Phthalates and Pubertal Timing in Chinese Adolescents

    Directory of Open Access Journals (Sweden)

    Huijing Shi

    2015-09-01

    Full Text Available Background: Phthalates are synthetic chemicals and ubiquitous environmental contaminants, with hormonal activity that may alter the course of pubertal development in children. Objectives: To determine whether exposure to phthalate metabolites is associated with timing of pubertal development in a cross-sectional study of a school-based clustered sample of 503 children from a suburban district in Shanghai, China, who were 7–14 years of age at enrollment (2010 October to November. Methods: We analyzed six phthalate metabolites in urine samples by isotope-dilution liquid chromatography tandem mass spectrometry. The associations of exposures to phthalates with pubertal timing of testes, breast, and pubic hair development (represented as Tanner stages were evaluated using an ordered logistic regression model adjusted for chronological age, body fat proportion (BF%, and parental education. Results: In boys, urinary mono-n-butyl phthalate (MBP levels were negatively associated with testicular volume, and mono (2-ethyl-5-hydroxyhexyl phthalate (MEHHP and mono (2-ethyl-5-oxohexyl phthalate (MEOHP levels were negatively associated with pubic hair stages. The odds of being in an advanced stage were decreased by 43%–51%. In girls, mono (2-ethylhexyl phthalate (MEHP, MEHHP, and MEOHP levels, as well as the sum of these levels, were positively associated with breast stages, and the association was much stronger in girls with high BF%; the odds of being in an advanced stage were increase by 29% to 50%. Conclusions: Phthalate metabolites investigated in this study show significant associations with pubertal timing both in boys and in girls, especially among girls with high BF%.

  4. Gene-Environment Interplay in the Association between Pubertal Timing and Delinquency in Adolescent Girls

    Science.gov (United States)

    Harden, K. Paige; Mendle, Jane

    2014-01-01

    Early pubertal timing places girls at elevated risk for a breadth of negative outcomes, including involvement in delinquent behavior. While previous developmental research has emphasized the unique social challenges faced by early maturing girls, this relation is complicated by genetic influences for both delinquent behavior and pubertal timing, which are seldom controlled for in existing research. The current study uses genetically informed data on 924 female-female twin and sibling pairs drawn from the National Longitudinal Study of Adolescent Health to (1) disentangle biological versus environmental mechanisms for the effects of early pubertal timing and (2) test for gene-environment interactions. Results indicate that early pubertal timing influences girls’ delinquency through a complex interplay between biological risk and environmental experiences. Genes related to earlier age at menarche and higher perceived development significantly predict increased involvement in both non-violent and violent delinquency. Moreover, after accounting for this genetic association between pubertal timing and delinquency, the impact of non-shared environmental influences on delinquency are significantly moderated by pubertal timing, such that the non-shared environment is most important among early maturing girls. This interaction effect is particularly evident for non-violent delinquency. Overall, results suggest early maturing girls are vulnerable to an interaction between genetic and environmental risks for delinquent behavior. PMID:21668078

  5. Sex steroids and brain structure in pubertal boys and girls: a mini-review of neuroimaging studies

    NARCIS (Netherlands)

    Peper, J.S.; Hulshoff Pol, H.E.; Crone, E.A.; van Honk, J.

    2011-01-01

    Puberty is an important period during development hallmarked by increases in sex steroid levels. Human neuroimaging studies have consistently reported that in typically developing pubertal children, cortical and subcortical gray matter is decreasing, whereas white matter increases well into

  6. BMI Trajectories Associated With Resolution of Elevated Youth BMI and Incident Adult Obesity.

    Science.gov (United States)

    Buscot, Marie-Jeanne; Thomson, Russell J; Juonala, Markus; Sabin, Matthew A; Burgner, David P; Lehtimäki, Terho; Hutri-Kähönen, Nina; Viikari, Jorma S A; Jokinen, Eero; Tossavainen, Paivi; Laitinen, Tomi; Raitakari, Olli T; Magnussen, Costan G

    2018-01-01

    Youth with high BMI who become nonobese adults have the same cardiovascular risk factor burden as those who were never obese. However, the early-life BMI trajectories for overweight or obese youth who avoid becoming obese adults have not been described. We aimed to determine and compare the young-childhood BMI trajectories of participants according to their BMI status in youth and adulthood. Bayesian hierarchical piecewise regression modeling was used to analyze the BMI trajectories of 2717 young adults who had up to 8 measures of BMI from childhood (ages 3-18 years) to adulthood (ages 34-49 years). Compared with those with persistently high BMI, those who resolved their high youth BMI by adulthood had lower average BMI at age 6 years and slower rates of BMI change from young childhood. In addition, their BMI levels started to plateau at 16 years old for females and 21 years old for males, whereas the BMI of those whose high BMI persisted did not stabilize until 25 years old for male subjects and 27 years for female subjects. Compared with those youth who were not overweight or obese and who remained nonobese in adulthood, those who developed obesity had a higher BMI rate of change from 6 years old, and their BMI continued to increase linearly until age 30 years. Efforts to alter BMI trajectories for adult obesity should ideally commence before age 6 years. The natural resolution of high BMI starts in adolescence for males and early adulthood for females, suggesting a critical window for secondary prevention. Copyright © 2018 by the American Academy of Pediatrics.

  7. Deleterious effects of obesity on physical fitness in pre-pubertal children.

    Science.gov (United States)

    Ceschia, Arianna; Giacomini, Stefano; Santarossa, Simone; Rugo, Miriam; Salvadego, Desy; Da Ponte, Alessandro; Driussi, Caterina; Mihaleje, Martina; Poser, Stefano; Lazzer, Stefano

    2016-01-01

    The prevalence of obesity in children has increased dramatically during the past decades in Europe and understanding physical fitness and its components in children is critical to design and implement effective interventions. The objective of the present study was to analyse the association between physical fitness (aerobic, speed, agility, power, flexibility and balance) and body mass index (BMI) in pre-pubertal children. A total of 2411 healthy schoolchildren (7-11 years) participated in this study. Anthropometric characteristics and body composition were assessed by skinfold thickness. Physical fitness was measured by nine physical fitness tests: endurance running, 20 m running speed, agility, handgrip strength, standing long jump and squat jump, sit and reach, medicine ball forward throw and static balance. No relevant differences were observed between boys and girls regarding anthropometric characteristics, body composition and physical fitness. However, overweight and obese children showed significantly lower physical fitness levels in endurance running, speed and agility (mean: +18.8, +5.5 and +14.5% of time to complete tasks, respectively), lower limb power normalised to body mass (-23.3%) and balance tests (number of falls: +165.5%) than their normal weight counterparts. On the other hand, obesity did not affect handgrip, throwing and flexibility. In conclusion, increased BMI was associated with lower performance capabilities limiting proper motor skill development, which directly affects the ability of children to take on sports skills. Actions undertaken to promote children's wellness and fitness should be prioritised and introduced early in life with the aim of enhancing physical fitness as well as preventing overweight and obesity.

  8. Pubertal Timing and Youth Internalizing Psychopathology: The Role of Relational Aggression.

    Science.gov (United States)

    Pomerantz, Hayley; Parent, Justin; Forehand, Rex; Breslend, Nicole Lafko; Winer, Jeffrey P

    2017-02-01

    The current study examined relational aggression as a potential mechanism that explains the association between off-time pubertal development and internalizing problems in youth. Youth gender was also examined as a moderator for the association between these variables. It was hypothesized that early pubertal maturation would be associated with higher levels of relationally aggressive behavior which, in turn, would be associated with elevated levels of internalizing problems. Parents of 372 children between the ages of 8 and 17 were recruited through Amazon's Mechanical Turk. Parents responded to demographic information about themselves, as well as information about their child's pubertal timing, relationally aggressive behavior, and anxiety and depressive symptoms. Findings indicated that early pubertal timing was associated with higher levels of anxiety directly, and higher levels of both anxiety and depressive symptoms indirectly through higher levels of relational aggression. In all but one of the pathways examined, gender was not found to moderate the associations between the study variables of interest. This study is the first to examine relational aggression as a mechanism by which early pubertal timing leads to internalizing problems. The findings suggest that relational aggression could be a target for intervention among early developing youth who are at risk for internalizing problems.

  9. The influence of pubertal timing and stressful life events on depression and delinquency among Chinese adolescents.

    Science.gov (United States)

    Chen, Jie; Yu, Jing; Wu, Yun; Zhang, Jianxin

    2015-06-01

    This study aimed to investigate the influences of pubertal timing and stressful life events on Chinese adolescents' depression and delinquency. Sex differences in these influences were also examined. A large sample with 4,228 participants aged 12-15 years (53% girls) was recruited in Beijing, China. Participants' pubertal development, stressful life events, depressive symptoms, and delinquency were measured using self-reported questionnaires. Both early maturing girls and boys displayed more delinquency than their same-sex on-time and late maturing peers. Early maturing girls displayed more depressive symptoms than on-time and late maturing girls, but boys in the three maturation groups showed similar levels of depressive symptoms. The interactive effects between early pubertal timing and stressful life events were significant in predicting depression and delinquency, particularly for girls. Early pubertal maturation is an important risk factor for Chinese adolescents' depression and delinquency. Stressful life events intensified the detrimental effects of early pubertal maturation on adolescents' depression and delinquency, particularly for girls. © 2015 The Institute of Psychology, Chinese Academy of Sciences and Wiley Publishing Asia Pty Ltd.

  10. BMI and Lifetime Changes in BMI and Cancer Mortality Risk

    NARCIS (Netherlands)

    Taghizadeh, Niloofar; Boezen, H Marike; Schouten, Jan P; Schröder, Carolien P; de Vries, Elisabeth G. E.; Vonk, Judith M

    2015-01-01

    Body Mass Index (BMI) is known to be associated with cancer mortality, but little is known about the link between lifetime changes in BMI and cancer mortality in both males and females. We studied the association of BMI measurements (at baseline, highest and lowest BMI during the study-period) and

  11. Prenatal androgen excess programs metabolic derangements in pubertal female rats.

    Science.gov (United States)

    Yan, Xiaonan; Dai, Xiaonan; Wang, Jing; Zhao, Nannan; Cui, Yugui; Liu, Jiayin

    2013-04-01

    Owing to the heterogeneity in the clinical symptoms of polycystic ovary syndrome (PCOS), the early pathophysiological mechanisms of PCOS remain unclear. Clinical, experimental, and genetic evidence supports an interaction between genetic susceptibility and the influence of maternal environment in the pathogenesis of PCOS. To determine whether prenatal androgen exposure induced PCOS-related metabolic derangements during pubertal development, we administrated 5α-dihydrotestosterone (DHT) in pregnant rats and observed their female offspring from postnatal 4 to 8 weeks. The prenatally androgenized (PNA) rats exhibited more numerous total follicles, cystic follicles, and atretic follicles than the controls. Fasting glucose, insulin, leptin levels, and homeostatic model assessment for insulin resistance were elevated in the PNA rats at the age of 5-8 weeks. Following intraperitoneal glucose tolerance tests, glucose and insulin levels did not differ between two groups; however, the PNA rats showed significantly higher 30- and 60-min glucose levels than the controls after insulin stimulation during 5-8 weeks. In addition, prenatal DHT treatment significantly decreased insulin-stimulated phosphorylation of AKT in the skeletal muscles of 6-week-old PNA rats. The abundance of IR substrate 1 (IRS1) and IRS2 was decreased in the skeletal muscles and liver after stimulation with insulin in the PNA group, whereas phosphorylation of insulin-signaling proteins was unaltered in the adipose tissue. These findings validate the contribution of prenatal androgen excess to metabolic derangements in pubertal female rats, and the impaired insulin signaling through IRS and AKT may result in the peripheral insulin resistance during pubertal development.

  12. Pubertal status, interaction with significant others, and self-esteem of adolescent girls.

    Science.gov (United States)

    Lacković-Grgin, K; Dekovíc, M; Opacić, G

    1994-01-01

    The aim of this study was to examine the relationship between pubertal status, the quality of interactions with significant others, and the self-esteem of adolescent girls. The model which was tested, hypothesized that pubertal status affects self-esteem through girls' interactions with their parents and friends. Pubertal status was operationalized as the number of months between occurrence of the first menstrual periods and time of the investigation. The measure of self-esteem was the shortened form of the Coopersmith Self-Esteem Inventory. Analyses revealed that girls who begun menstruating six months before the investigation obtained higher scores on the measure of self-esteem than did girls who had been menstruating 13 months or more. The best predictor of self-esteem, however, was the quality of interaction with their mothers. The results support the theoretical view that stresses the importance of interaction with significant others for the development of self-esteem.

  13. The relationship between pubertal gynecomastia, prostate specific antigen, free androgen index, SHBG and sex steroids.

    Science.gov (United States)

    Kilic, Mustafa; Kanbur, Nuray; Derman, Orhan; Akgül, Sinem; Kutluk, Tezer

    2011-01-01

    To investigate the relationships between pubertal gynecomastia, prostate-specific antigen (PSA), free androgen index (FAI), sex hormone-binding globulin (SHBG) and sex steroids. A total of 61 male adolescents (10-17 years old; mean: 13.67 +/- 1.08) with gynecomastia were enrolled into the study group. A total of 65 healthy age-matched adolescents were included in the control group. Body mass index (BMI), Tanner staging, testis volume, stretched penis length (SPL) and bone age were evaluated. Serum follicle-stimulating hormone, luteinizing hormone (LH), estradiol (E2), testosterone, free testosterone, SHBG, PSA levels were determined and FAI was calculated. In the study group, free testosterone (p = 0.012) and FAI (p = 0.05) were significantly lower than the control group. In the control group, SHBG levels decreased (p 0.05). High FAI was found to decrease the risk of gynecomastia (odds ratio: 0.211, 95% confidence interval: 0.064-0.694, p = 0.01). PSA showed a positive correlation with FAI, free testosterone, Tanner staging, testosterone, E2 and LH levels. PSA is a good indicator of androgen activity during puberty. However, owing to FAI remaining as the single significant variable for pubertal gynecomastia, we suggest that it is still the best parameter to elucidate the etiopathogenesis of gynecomastia as well as other pubertal developmental abnormalities in male adolescents, and further longitudinal studies are needed to investigate the relationships between PSA and FAI in puberty.

  14. Forty years trends in timing of pubertal growth spurt in 157,000 Danish school children

    DEFF Research Database (Denmark)

    Aksglæde, Lise; Olsen, Lina Wøhlk; Sørensen, Thorkild I.A.

    2008-01-01

    to 1969 who attended primary school in the Copenhagen Municipality. 135,223 girls and 21,612 boys fulfilled the criteria for determining age at OGS and age at PHV. These physiological events were used as markers of pubertal development in our computerized method in order to evaluate any secular trends...... in pubertal maturation during the study period (year of birth 1930 to 1969). In this period, age at OGS declined statistically significantly by 0.2 and 0.4 years in girls and boys, respectively, whereas age at PHV declined statistically significantly by 0.5 and 0.3 years in girls and boys, respectively...

  15. Pubertal stage and the prevalence of violence and social/relational aggression.

    Science.gov (United States)

    Hemphill, Sheryl A; Kotevski, Aneta; Herrenkohl, Todd I; Toumbourou, John W; Carlin, John B; Catalano, Richard F; Patton, George C

    2010-08-01

    We examined associations between pubertal stage and violent adolescent behavior and social/relational aggression. The International Youth Development Study comprises statewide representative student samples in grades 5, 7, and 9 (N = 5769) in Washington State and Victoria, Australia, drawn as a 2-stage cluster sample in each state. We used a school-administered, self-report student survey to measure previous-year violent behavior (ie, attacking or beating up another person) and social/relational aggression (excluding peers from the group, threatening to spread lies or rumors), as well as risk and protective factors and pubertal development. Cross-sectional data were analyzed. Compared with early puberty, the odds of violent behavior were approximately threefold higher in midpuberty (odds ratio [OR]: 2.87 [95% confidence interval (CI): 1.81-4.55]) and late puberty (OR: 3.79 [95% CI: 2.25-6.39]) after adjustment for demographic factors. For social/relational aggression, there were weaker overall associations after adjustment, but these associations included an interaction between pubertal stage and age, and stronger associations with pubertal stage at younger age were shown (P = .003; midpuberty OR: 1.78 [95% CI: 1.20-2.63]; late puberty OR: 3.00 [95% CI: 1.95-4.63]). Associations between pubertal stage and violent behavior and social/relational aggression remained after the inclusion of social contextual mediators in the analyses. Pubertal stage was associated with higher rates of violent behavior and social/relational aggression, with the latter association seen only at younger ages. Puberty is an important phase at which to implement prevention programs to reduce adolescent violent and antisocial behaviors.

  16. Effects of Di-(2-ethylhexyl Phthalate on the Hypothalamus–Uterus in Pubertal Female Rats

    Directory of Open Access Journals (Sweden)

    Te Liu

    2016-11-01

    Full Text Available The pollution of endocrine disruptors and its impact on human reproductive system have attracted much attention. Di-(2-ethylhexyl phthalate (DEHP, an environmental endocrine disruptor, is widely used in food packages, containers, medical supplies and children’s toys. It can cause diseases such as infertility, sexual precocity and uterine bleeding and thus arouse concerns from the society and scholars. The effect of DEHP on pubertal female reproductive system is still not well-studied. This study was to investigate the effects of DEHP on the hypothalamus–uterus in pubertal female rats, reveal the reproductive toxicity of DEHP on pubertal female rats and its mechanism, and provide scientific evidence for the evaluation of toxicity and toxic mechanism of DEHP on reproductive system. Forty-eight pubertal female rats were randomly divided into four groups and respectively administered via oral gavage 0, 250, 500, or 1000 mg/kg/d DEHP in 0.1 mL corn oil/20 g body weight for up to four weeks. Compared with control rats, the DEHP-treated rats showed: (1 higher gonadotropin-releasing hormone (GnRH level in the hypothalamus; (2 higher protein levels of GnRH in the hypothalamus; and (3 higher mRNA and protein levels of GnRH receptor (GnRHR in the uterus. Our data reveal that DEHP exposure may lead to a disruption in pubertal female rats and an imbalance of hypothalamus–uterus. Meanwhile, DEHP may, through the GnRH in the hypothalamus and its receptor on the uterus, lead to diseases of the uterus. DEHP may impose a negative influence on the development and functioning of the reproductive system in pubertal female rats.

  17. Effects of Di-(2-ethylhexyl) Phthalate on the Hypothalamus–Uterus in Pubertal Female Rats

    Science.gov (United States)

    Liu, Te; Jia, Yiyang; Zhou, Liting; Wang, Qi; Sun, Di; Xu, Jin; Wu, Juan; Chen, Huaiji; Xu, Feng; Ye, Lin

    2016-01-01

    The pollution of endocrine disruptors and its impact on human reproductive system have attracted much attention. Di-(2-ethylhexyl) phthalate (DEHP), an environmental endocrine disruptor, is widely used in food packages, containers, medical supplies and children’s toys. It can cause diseases such as infertility, sexual precocity and uterine bleeding and thus arouse concerns from the society and scholars. The effect of DEHP on pubertal female reproductive system is still not well-studied. This study was to investigate the effects of DEHP on the hypothalamus–uterus in pubertal female rats, reveal the reproductive toxicity of DEHP on pubertal female rats and its mechanism, and provide scientific evidence for the evaluation of toxicity and toxic mechanism of DEHP on reproductive system. Forty-eight pubertal female rats were randomly divided into four groups and respectively administered via oral gavage 0, 250, 500, or 1000 mg/kg/d DEHP in 0.1 mL corn oil/20 g body weight for up to four weeks. Compared with control rats, the DEHP-treated rats showed: (1) higher gonadotropin-releasing hormone (GnRH) level in the hypothalamus; (2) higher protein levels of GnRH in the hypothalamus; and (3) higher mRNA and protein levels of GnRH receptor (GnRHR) in the uterus. Our data reveal that DEHP exposure may lead to a disruption in pubertal female rats and an imbalance of hypothalamus–uterus. Meanwhile, DEHP may, through the GnRH in the hypothalamus and its receptor on the uterus, lead to diseases of the uterus. DEHP may impose a negative influence on the development and functioning of the reproductive system in pubertal female rats. PMID:27845755

  18. Effect of Age, Educational Status, Parity and BMI on Development of Urinary Incontinence - a Cross Sectional Study in Saudi Population

    OpenAIRE

    Saadia, Zaheera

    2015-01-01

    Background: The research article looks at the background of women with urinary incontinence and exposed to different demographic factors. Women who had urinary incontinence and women without urinary incontinence were compared with regards to their demographic features and risk of development of urinary problems. These risk factors can either cause short term or temporary urinary incontinence or they can cause long term or permanent urinary incontinence. This article explores the association o...

  19. Cardiovascular risk factors in pre-pubertal schoolchildren in Angola.

    Science.gov (United States)

    Silva, Amílcar B; Capingana, Daniel P; Magalhães, Pedro; Gonçalves, Mauer A; Molina, Maria Del Carmen B; Rodrigues, Sërgio L; Baldo, Marcelo P; Mateus, Miguel S; Mill, Josë Geraldo

    The incidence of obesity is increasing worldwide, especially in countries with accelerated economic growth. We determined the prevalence of and associations between overweight/obesity and cardiovascular risk factors in pre-pubertal (seven- to 11-year-old) schoolchildren (both genders, n = 198) in Luanda, Angola. Biochemical (fasting blood) and clinical examinations were obtained in a single visit. Data are reported as prevalence (95% confidence intervals) and association (r, Pearson). Prevalence of overweight/obesity was 17.7% (12.4- 23.0%), high blood pressure (BP > 90% percentile) was 14.6% (9.7-19.5%), elevated glucose level was 16.7% (11.5-21.9%) and total cholesterol level > 170 mg/dl (4.4 mmol/l) was 69.2% (62.8-75.6%). Significant associations between body mass index (BMI) and systolic and diastolic BP (r = 0.46 and 0.40, respectively; p Angola and fat accumulation was directly associated with blood pressure increase but not with other cardiovascular risk factors.

  20. Off-Time Pubertal Timing Predicts Physiological Reactivity to Postpuberty Interpersonal Stress

    Science.gov (United States)

    Smith, Anne Emilie; Powers, Sally I.

    2009-01-01

    We investigated associations between retrospectively assessed timing of pubertal development, interpersonal interactions, and hypothalamic-pituitary-adrenal axis reactivity to an interpersonal stress task in 110 young adult women. Participants provided salivary cortisol samples at points prior and subsequent to a video-taped conflict discussion…

  1. Arthrospira (Spirulina) platensis supplementation affects folliculogenesis, progesterone and ghrelin levels in fattening pre-pubertal gilts

    NARCIS (Netherlands)

    Abadjieva, Desislava; Nedeva, Radka; Marchev, Yordan; Jordanova, Gergana; Chervenkov, Mihail; Dineva, Julieta; Shimkus, Almantas; Shimkiene, Aldona; Teerds, Katja; Kistanova, Elena

    2018-01-01

    The aim of the present investigation was to study the effect of Arthrospira (Spirulina) platensis supplemented diet on follicular development and related endocrine parameters, such as estradiol and progesterone levels as well as ghrelin levels in pre-pubertal gilts. Twenty-one 60-day-old Danube

  2. Validity of self-assessment of pubertal maturation

    DEFF Research Database (Denmark)

    Rasmussen, Anna; Wohlfahrt-Veje, Christine; Tefre de Renzy-Martin, Katrine

    2015-01-01

    BACKGROUND AND OBJECTIVES: Studies of adolescents often use self-assessment of pubertal maturation, the reliability of which has shown conflicting results. We aimed to examine the reliability of child and parent assessments of healthy boys and girls. METHODS: A total of 898 children (418 girls, 480...... overestimated older than their peers who made correct assessments. Girls and their parents tended to underestimate, whereas boys overestimated their pubertal stage. CONCLUSIONS: Pubertal assessment by the child or the parents is not a reliable measure of exact pubertal staging and should be augmented...

  3. Effects of prenatal exposure to a low dose atrazine metabolite mixture on pubertal timing and prostate development of male Long-Evans rats

    Energy Technology Data Exchange (ETDEWEB)

    Stanko, Jason [National Institute of Environmental Health Sciences (NIEHS); Enoch, Rolondo [North Carolina Central University, Durham; Rayner, Jennifer L [ORNL; Davis, Christine [U.S. Environmental Protection Agency; Wolf, Douglas [U.S. Environmental Protection Agency; Malarkey, David [University of North Carolina, Chapel Hill; Fenton, Suzanne [National Institute of Environmental Health Sciences (NIEHS)

    2010-12-01

    The present study examines the postnatal reproductive development of male rats following prenatal exposure to an atrazine metabolite mixture (AMM) consisting of the herbicide atrazine and its environmental metabolites diaminochlorotriazine, hydroxyatrazine, deethylatrazine, and deisopropylatrazine. Pregnant Long-Evans rats were treated by gavage with 0.09, 0.87, or 8.73 mg AMM/kg body weight (BW), vehicle, or 100 mg ATR/kg BW positive control, on gestation days 15 19. Preputial separation was significantly delayed in 0.87 mg and 8.73 mg AMM-exposed males. AMM-exposed males demonstrated a significant treatment-related increase in incidence and severity of inflammation in the prostate on postnatal day (PND) 120. A dose-dependent increase in epididymal fat masses and prostate foci were grossly visible in AMM-exposed offspring. These results indicate that a short, late prenatal exposure to mixture of chlorotriazine metabolites can cause chronic prostatitis in male LE rats. The mode of action for these effects is presently unclear.

  4. Peer Exclusion During the Pubertal Transition: The Role of Social Competence.

    Science.gov (United States)

    Carter, Rona; Halawah, Amira; Trinh, Sarah L

    2018-01-01

    For some youth, early puberty is accompanied by peer exclusion. Yet early developers may experience less peer exclusion if they have social competence, which would bolster their ability to develop and maintain positive relationships with their peers. Accordingly, the present study tests whether pubertal timing and tempo predicts decrements in children's social competence and whether decrements in social competence account for associations between puberty (timing and tempo) and peer exclusion over time. Longitudinal data were drawn from 1364 families (48% female; 76% White; M = 9.32 years, SD = .48, at Wave 3) who participated in Waves 3-5 (i.e., grades 4-6) of Phase III of the NICHD-SECCYD. The results from latent growth curve models indicated that earlier pubertal timing and more rapid pubertal tempo among girls were associated with high initial levels of peer exclusion. Moreover, mediation analyses revealed that early developers' susceptibility to peer exclusion was associated with their initial level of social competence. In boys, pubertal timing and tempo were not directly associated with peer exclusion; instead, indirect effects of pubertal timing on peer exclusion (intercept, slope) occurred through initial levels of social competence. On average, early developers' who had low levels of social competence also had high initial levels of peer exclusion but experienced decrements in peer exclusion over time. The association between the intercepts for puberty and peer exclusion and the slopes for social competence and peer exclusion were stronger for boys than girls. Overall, our findings suggest that early developers' susceptibility to and experiences of peer exclusion are associated with their development of social competence.

  5. Neurodevelopmental problems and extremes in BMI

    Directory of Open Access Journals (Sweden)

    Nóra Kerekes

    2015-07-01

    Full Text Available Background. Over the last few decades, an increasing number of studies have suggested a connection between neurodevelopmental problems (NDPs and body mass index (BMI. Attention deficit/hyperactivity disorder (ADHD and autism spectrum disorders (ASD both seem to carry an increased risk for developing extreme BMI. However, the results are inconsistent, and there have been only a few studies of the general population of children.Aims. We had three aims with the present study: (1 to define the prevalence of extreme (low or high BMI in the group of children with ADHD and/or ASDs compared to the group of children without these NDPs; (2 to analyze whether extreme BMI is associated with the subdomains within the diagnostic categories of ADHD or ASD; and (3 to investigate the contribution of genetic and environmental factors to BMI in boys and girls at ages 9 and 12.Method. Parents of 9- or 12-year-old twins (n = 12,496 were interviewed using the Autism—Tics, ADHD and other Comorbidities (A-TAC inventory as part of the Child and Adolescent Twin Study in Sweden (CATSS. Univariate and multivariate generalized estimated equation models were used to analyze associations between extremes in BMI and NDPs.Results. ADHD screen-positive cases followed BMI distributions similar to those of children without ADHD or ASD. Significant association was found between ADHD and BMI only among 12-year-old girls, where the inattention subdomain of ADHD was significantly associated with the high extreme BMI. ASD scores were associated with both the low and the high extremes of BMI. Compared to children without ADHD or ASD, the prevalence of ASD screen-positive cases was three times greater in the high extreme BMI group and double as much in the low extreme BMI group. Stereotyped and repetitive behaviors were significantly associated with high extreme BMIs.Conclusion. Children with ASD, with or without coexisting ADHD, are more prone to have low or high extreme BMIs than

  6. Brain Maturation, Cognition and Voice Pattern in a Gender Dysphoria Case under Pubertal Suppression.

    Science.gov (United States)

    Schneider, Maiko A; Spritzer, Poli M; Soll, Bianca Machado Borba; Fontanari, Anna M V; Carneiro, Marina; Tovar-Moll, Fernanda; Costa, Angelo B; da Silva, Dhiordan C; Schwarz, Karine; Anes, Maurício; Tramontina, Silza; Lobato, Maria I R

    2017-01-01

    Introduction: Gender dysphoria (GD) (DMS-5) is a condition marked by increasing psychological suffering that accompanies the incongruence between one's experienced or expressed gender and one's assigned gender. Manifestation of GD can be seen early on during childhood and adolescence. During this period, the development of undesirable sexual characteristics marks an acute suffering of being opposite to the sex of birth. Pubertal suppression with gonadotropin releasing hormone analogs (GnRHa) has been proposed for these individuals as a reversible treatment for postponing the pubertal development and attenuating psychological suffering. Recently, increased interest has been observed on the impact of this treatment on brain maturation, cognition and psychological performance. Objectives: The aim of this clinical report is to review the effects of puberty suppression on the brain white matter (WM) during adolescence. WM Fractional anisotropy, voice and cognitive functions were assessed before and during the treatment. MRI scans were acquired before, and after 22 and 28 months of hormonal suppression. Methods: We performed a longitudinal evaluation of a pubertal transgender girl undergoing hormonal treatment with GnRH analog. Three longitudinal magnetic resonance imaging (MRI) scans were performed for diffusion tensor imaging (DTI), regarding Fractional Anisotropy (FA) for regions of interest analysis. In parallel, voice samples for acoustic analysis as well as executive functioning with the Wechsler Intelligence Scale (WISC-IV) were performed. Results: During the follow-up, white matter fractional anisotropy did not increase, compared to normal male puberty effects on the brain. After 22 months of pubertal suppression, operational memory dropped 9 points and remained stable after 28 months of follow-up. The fundamental frequency of voice varied during the first year; however, it remained in the female range. Conclusion: Brain white matter fractional anisotropy

  7. Reproductive ability of pubertal male and female rats

    Directory of Open Access Journals (Sweden)

    T. Zemunik

    2003-07-01

    Full Text Available Ten Fisher rats 50 to 55 days of age made up the pubertal group, and ten rats 90 to 95 days of age served as the controls. The testicular and epididymal weights and volumes of the pubertal males were lower than those of the controls (P0.05. At the beginning of gestation, the pubertal dams weighed less than the controls (P<0.001 but following uterectomy the body weights were equal. Pubertal dams delivered fewer pups than the controls (8.1 ± 2.5 vs 10.4 ± 1.3, P<0.05. There was no difference in the body weights of their offspring or in the weights of their placentas. The results suggest that, in contrast to their female counterparts, pubertal male rats are not fully mature and have not reached complete reproductive capacity at 50-55 days of age.

  8. Effects of harsh parenting and positive parenting practices on youth aggressive behavior: The moderating role of early pubertal timing.

    Science.gov (United States)

    Chen, Frances R; Raine, Adrian

    2018-01-01

    Prior research indicates that early pubertal timing is associated with aggressive behavior, particularly in the context of adversity as postulated in the contextual amplification hypothesis. However, few studies have examined harsh parenting as the context for the effect of early pubertal timing. Even fewer studies have tested the interactive effect of early pubertal timing and positive parenting on aggressive behavior. In this study, we tested the proposition that early pubertal timing, contrary to the general conception of it as a vulnerability, indexed susceptibility, and thus early maturing individuals were affected more by their environment in a "for better and for worse" manner. The sample consisted of 411 community-recruited youth aged 11-12 years (51% boys, 80% African Americans). Participants reported Tanner Stages of pubertal development, aggressive behavior and harsh parenting practice of their parents. Puberty scores were standardized with groups of the same age, sex, and ethnicity, and those that scored the top one-third were defined as early maturing individuals. Parents reported youth's aggressive behavior and their parenting practices towards the youth, including harsh parenting and positive parenting. Early pubertal timing significantly moderated the relationship between harsh/positive parenting and aggressive behavior. Specifically, harsh parenting was positively associated with aggressive behavior to a larger degree among early maturing individuals than among on-time/late-maturing individuals. Positive parenting was inversely associated with aggressive behavior but only among early maturing individuals. This study is the first to document support for early pubertal timing as susceptibility to the environmental influences in relation to aggressive behavior. Theoretical and intervention implications are discussed. © 2017 Wiley Periodicals, Inc.

  9. Involvement of Bmi-1 gene in the development of gastrointestinal stromal tumor by regulating p16Ink4A/p14ARF gene expressions: An in vivo and in vitro study.

    Science.gov (United States)

    Wang, Jiang-Li; Wu, Jiang-Hong; Hong, Cai; Wang, Ya-Nong; Zhou, Ye; Long, Zi-Wen; Zhou, Ying; Qin, Hai-Shu

    2017-12-01

    This study was conducted in order to explore the role that Bmi-1 plays during the development of a gastrointestinal stromal tumor (GIST) by regulation of the p16 Ink4A and p14 ARF expressions. Eighty-six patients diagnosed with GIST were selected to take part in this experiment. The Bmi-1 protein expressions in GIST and adjacent normal tissues were detected using immunohistochemistry and further analyzed by using photodensitometry. To monitor and track the progression of the GIST, a 3-year follow-up was conducted for all affected patients. After cell transfection, the GIST cells were assigned into the control group (without transfection), the negative control (NC) group (transfected with Bmi-1-Scramble plasmid), and the Bmi-1 shRNA group (transfected with the pcDNA3.1-Bmi-1 shRNA plasmid). Protein and mRNA expressions collected from Bmi-1, p16 lnk4A , P14 ARF , cyclin D1, and CDK4 were measured using both the RT-qPCR and western blotting methods Cell senescence was assessed and obtained by using the β-Galactosidase (β-Gal) activity assay. The use of a Soft agar colony formation assay and CCK-8 assay were performed in order to detect the cell growth and subsequent proliferation. Cell invasion and migration were analyzed using the Transwell assay and scratch test. Bmi-1 in the GIST tissues was found to be significantly higher and the p16 lnk4A and P14 ARF expressions were lower than those in the adjacent normal tissues. Bmi-1 was negatively correlated with p16 lnk4A and P14 ARF expressions according to the correlation analysis. Bmi-1 expression was associated with the TNM stage, postoperative recurrence, metastasis, tumor size, and the 5-year survival rate. Area under ROC curve was calculated at 0.884, and sensitivity, specificity, and accuracy of Bmi-1 predicting the GIST were 67.44%, 97.67%, and 65.12%, respectively. Patients exhibiting a high Bmi-1 expression in the GIST tissues had lower survival rates than those with low Bmi-1 expression. In comparison with

  10. Adolescents' increasing stress response to social evaluation: pubertal effects on cortisol and alpha-amylase during public speaking.

    Science.gov (United States)

    van den Bos, Esther; de Rooij, Mark; Miers, Anne C; Bokhorst, Caroline L; Westenberg, P Michiel

    2014-01-01

    Stress responses to social evaluation are thought to increase during adolescence, which may be due to pubertal maturation. However, empirical evidence is scarce. This study is the first to investigate the relation between pubertal development and biological responses to a social-evaluative stressor longitudinally. Participants performed the Leiden Public Speaking Task twice, with a 2-year interval (N = 217; age at Time 1: 8-17 years). The results support an increase in sensitivity to social evaluation during adolescence. The overall cortisol and alpha-amylase responses increased-both between and within participants-and were more strongly related to self-reported pubertal development than to age. The cortisol response shifted from speech delivery toward anticipation. The alpha-amylase response increased in both phases. © 2013 The Authors. Child Development © 2013 Society for Research in Child Development, Inc.

  11. Coming of age in Roman Britain: Osteological evidence for pubertal timing.

    Science.gov (United States)

    Arthur, Nichola A; Gowland, Rebecca L; Redfern, Rebecca C

    2016-04-01

    Puberty is a key transitional phase of the human life course, with important biological and social connotations. Novel methods for the identification of the pubertal growth spurt and menarche in skeletal remains have recently been proposed (Shapland and Lewis, 2013, 2014). In this study we applied the methods to two Romano-British cemetery samples (1st-early 5th centuries AD) in order to investigate the timing of puberty during this period and further assess the veracity of the methods. Shapland and Lewis' methods (2013, 2014) were applied to 38 adolescents (aged 8-20 years) from the British cemetery sites of Roman London (1st-early 5th centuries AD) and Queenford Farm, Oxfordshire (4th-early 5th centuries AD). Overall, the Romano-British males and females experienced the onset of puberty at similar ages to modern European adolescents, but subsequently experienced a longer period of pubertal development. Menarche occurred between the ages of 15 and 17 years for these Romano-British females, around 2 to 4 years later than for present-day European females. The observed Romano-British pattern of pubertal timing has various possible explanations, including exposure to environmental stressors in early urban environments. The pattern of pubertal timing is largely congruent with social age transitions alluded to in ancient texts and funerary evidence for this period. While there are limitations to the application of these techniques to archaeological samples, they were successfully applied in this study, and may have important implications for understandings of past life courses, as well as providing a long-term perspective on pubertal timing and biocultural interactions. © 2016 Wiley Periodicals, Inc.

  12. Serum inhibin B in healthy pubertal and adolescent boys

    DEFF Research Database (Denmark)

    Andersson, A M; Juul, A; Petersen, J H

    1997-01-01

    correlated strongly with age, and when the effect of age was taken into account, only the partial correlation between inhibin B and LH/testosterone remained statistically significant. At stage II of puberty, the positive partial correlation between inhibin B and LH/testosterone was still present. At stage......Inhibin B levels were measured in serum from 400 healthy Danish prepubertal, pubertal, and adolescent males, aged 6-20 yr, in a cross-sectional study using a recently developed immunoassay that is specific for inhibin B, the physiologically important inhibin form in men. In addition, serum levels...... of FSH, LH, testosterone, and estradiol levels were measured. Serum levels of inhibin B, FSH, LH, testosterone, and estradiol all increased significantly between stages I and II of puberty. From stage II of puberty the inhibin B level was relatively constant, whereas the FSH level continued to increase...

  13. Associations of Birth Order with Early Adolescent Growth, Pubertal Onset, Blood Pressure and Size: Evidence from Hong Kong?s ?Children of 1997? Birth Cohort

    OpenAIRE

    Kwok, Man Ki; Leung, Gabriel M.; Schooling, C. Mary

    2016-01-01

    Background Birth order has been proposed as a cardiovascular risk factor, because the lower birth weight and greater infant weight gain typical of firstborns could programme metabolism detrimentally. Methods We examined the associations of birth order (firstborn or laterborn) with birth weight-for-gestational age, length/height and body mass index (BMI) z-scores during infancy, childhood, and puberty using generalized estimating equations, with age at pubertal onset using interval-censored re...

  14. Growth trajectory and pubertal tempo from birth till final height in a girl with Wolf-Hirschhorn syndrome.

    Science.gov (United States)

    Siew, Jia Xuan; Yap, Fabian

    2018-01-01

    Growth anomaly is a prominent feature in Wolf-Hirschhorn syndrome (WHS), a rare congenital disorder caused by variable deletion of chromosome 4p. While growth charts have been developed for WHS patients 0-4 years of age and growth data available for Japanese WHS patients 0-17 years, information on pubertal growth and final height among WHS children remain lacking. Growth hormone (GH) therapy has been reported in two GH-sufficient children with WHS, allowing for pre-puberty catch up growth; however, pubertal growth and final height information was also unavailable. We describe the complete growth journey of a GH-sufficient girl with WHS from birth until final height (FH), in relation to her mid parental height (MPH) and target range (TR). Her growth trajectory and pubertal changes during childhood, when she was treated with growth hormone (GH) from 3 years 8 months old till 6 months post-menarche at age 11 years was fully detailed. Pubertal growth characteristics and FH information in WHS is lacking.While pre-pubertal growth may be improved by GH, GH therapy may not translate to improvement in FH in WHS patients.Longitudinal growth, puberty and FH data of more WHS patients may improve the understanding of growth in its various phases (infancy/childhood/puberty).

  15. Physical growth of the shuar: Height, Weight, and BMI references for an indigenous amazonian population.

    Science.gov (United States)

    Urlacher, Samuel S; Blackwell, Aaron D; Liebert, Melissa A; Madimenos, Felicia C; Cepon-Robins, Tara J; Gildner, Theresa E; Snodgrass, J Josh; Sugiyama, Lawrence S

    2016-01-01

    Information concerning physical growth among small-scale populations remains limited, yet such data are critical to local health efforts and to foster basic understandings of human life history and variation in childhood development. Using a large dataset and robust modeling methods, this study aims to describe growth from birth to adulthood among the indigenous Shuar of Amazonian Ecuador. Mixed-longitudinal measures of height, weight, and body mass index (BMI) were collected from Shuar participants (n = 2,463; age: 0-29 years). Centile growth curves and tables were created for each anthropometric variable of interest using Generalized Additive Models for Location, Scale, and Shape (GAMLSS). Pseudo-velocity and Lambda-Mu-Sigma curves were generated to further investigate Shuar patterns of growth and to facilitate comparison with United States Center for Disease Control and Prevention and multinational World Health Organization growth references. The Shuar are small throughout life and exhibit complex patterns of growth that differ substantially from those of international references. Similar to other Amazonians, Shuar growth in weight compares more favorably to references than growth in height, resulting in BMI curves that approximate international medians. Several additional characteristics of Shuar development are noteworthy, including large observed variation in body size early in life, significant infant growth faltering, extended male growth into adulthood, and a markedly early female pubertal growth spurt in height. Phenotypic plasticity and genetic selection in response to local environmental factors may explain many of these patterns. Providing a detailed reference of growth for the Shuar and other Amazonian populations, this study possesses direct clinical application and affords valuable insight into childhood health and the ecology of human growth. © 2015 Wiley Periodicals, Inc.

  16. Ovarian function following pelvic irradiation in prepubertal and pubertal girls and young adult women

    International Nuclear Information System (INIS)

    Schuck, A.; Hamelmann, V.; Braemswig, J.H.

    2005-01-01

    Purpose: To analyze the effect of pelvic radiotherapy on ovarian function in prepubertal and pubertal girls and young adult women. Patients and methods: In a retrospective monoinstitutional analysis, patients 15 Gy to the ovaries developed hormone failure. In one case of a patient receiving an ovarian dose of 15 Gy, hormone failure was not found. In case of pelvic irradiation excluding at least one ovary, approximately half of the patients developed ovarian dysfunction, probably also due to the effects of polychemotherapy. (orig.)

  17. Challenging the role of social norms regarding body weight as an explanation for weight, height, and BMI misreporting biases: Development and application of a new approach to examining misreporting and misclassification bias in surveys

    LENUS (Irish Health Repository)

    Brestoff, Jonathan R

    2011-05-18

    Abstract Background Cultural pressures to be thin and tall are postulated to cause people to misreport their body weight and height towards more socially normative (i.e., desirable) values, but a paucity of direct evidence supports this idea. We developed a novel non-linear approach to examining weight, height, and BMI misreporting biases and used this approach to examine the association between socially non-normative weight and misreporting biases in adults. Methods The Survey of Lifestyles, Attitudes, and Nutrition 2007 (SLÁN 2007), a nationally representative survey of the Republic of Ireland (N = 1942 analyzed) was used. Self-reported weight (height) was classified as under-reported by ≥2.0 kg (2.0 cm), over-reported by ≥2.0 kg (2.0 cm), or accurately reported within 2.0 kg (2.0 cm) to account for technical errors of measurement and short-term fluctuations in measured weight (height). A simulation strategy was used to define self-report-based BMI as under-estimated by more than 1.40 kg\\/m2, over-estimated by more than 1.40 kg\\/m2, or accurately estimated within 1.40 kg\\/m2. Patterns of biases in self-reported weight, height, and BMI were explored. Logistic regression was used to identify factors associated with mis-estimated BMI and to calculate adjusted odds ratios (AOR) and 99% confidence intervals (99%CI). Results The patterns of bias contributing the most to BMI mis-estimation were consistently, in decreasing order of influence, (1) under-reported weight combined with over-reported height, (2) under-reported weight with accurately reported height, and (3) accurately reported weight with over-reported height. Average bias in self-report-based BMI was -1.34 kg\\/m2 overall and -0.49, -1.33, and -2.66 kg\\/m2 in normal, overweight, and obese categories, respectively. Despite the increasing degree of bias with progressively higher BMI categories, persons describing themselves as too heavy were, within any given BMI category, less likely to have under

  18. The association between BMI development among young children and (un)healthy food choices in response to food advertisements: a longitudinal study.

    Science.gov (United States)

    Folkvord, Frans; Anschütz, Doeschka J; Buijzen, Moniek

    2016-02-09

    Previous studies have focused on the acute effects of food advertisements on the caloric intake of children; however, the long-term effects of this food cue reactivity on weight gain have not been examined. The main aim of this study was to explore if reactivity to food cues in an advertisement was associated with weight status two years later. Children wo had previously taken part in an experiment investigating the impact of advergames on food intake had their height and weight re-measured two years later, for assessment of body mass index (BMI). A within-subject design was used to test the associations between food choices and BMI over time. In the previous experiment, children played an advergame that promoted energy-dense snacks, fruit, or nonfood products, or did not play an advergame (control condition). After playing the game, the free intake of energy-dense snacks and fruits was measured. Children who ate more apple after playing an advergame promoting energy-dense snacks had a lower BMI two years later. Consumption of energy-dense snacks after playing an advergame promoting energy-dense snacks was not associated with BMI two years later. In other condition, no association was found between food intake and BMI after two years . The findings suggest that coping with environmental cues that trigger unhealthy eating behavior is associated with the body mass index of young children two years later. This might imply that learning to respond to food cues by choosing healthy options might prevent children from excessive weight gain. This trial was registered at as ISRCTN17013832 .

  19. Effects of programmed physical activity on body composition in post-pubertal schoolchildren

    Directory of Open Access Journals (Sweden)

    Edson dos Santos Farias

    2015-04-01

    Full Text Available OBJECTIVE: To assess body composition modifications in post-pubertal schoolchildren after practice of a physical activity program during one school year. METHODS: The sample consisted of 386 students aged between 15 and 17 years and divided into two groups: the study group (SG comprised 195 students and the control group (CG, 191. The SG was submitted to a physical activity program and the CG attended conventional physical education classes. Body composition was assessed using body mass index (BMI, percentage of body fat (%BF, fat mass (FM, and lean mass (LM. RESULTS: A positive effect of the physical activity program on body composition in the SG (p < 0.001 was observed, as well as on the interaction time x group in all the variables analyzed in both genders. A reduction in %BF (mean of differences = -5.58% and waist circumference (-2.33 cm, as well as an increase in LM (+2.05 kg were observed in the SG for both genders, whereas the opposite was observed in the CG. CONCLUSION: The practice of programmed physical activity promotes significant reduction of body fat in post-pubertal schoolchildren.

  20. Effects of programmed physical activity on body composition in post-pubertal schoolchildren.

    Science.gov (United States)

    Farias, Edson Dos Santos; Gonçalves, Ezequiel Moreira; Morcillo, André Moreno; Guerra-Júnior, Gil; Amancio, Olga Maria Silverio

    2015-01-01

    To assess body composition modifications in post-pubertal schoolchildren after practice of a physical activity program during one school year. The sample consisted of 386 students aged between 15 and 17 years and divided into two groups: the study group (SG) comprised 195 students and the control group (CG), 191. The SG was submitted to a physical activity program and the CG attended conventional physical education classes. Body composition was assessed using body mass index (BMI), percentage of body fat (%BF), fat mass (FM), and lean mass (LM). A positive effect of the physical activity program on body composition in the SG (pgenders. A reduction in %BF (mean of differences = -5.58%) and waist circumference (-2.33 cm), as well as an increase in LM (+2.05 kg) were observed in the SG for both genders, whereas the opposite was observed in the CG. The practice of programmed physical activity promotes significant reduction of body fat in post-pubertal schoolchildren. Copyright © 2013 Sociedade Brasileira de Pediatria. Published by Elsevier Editora Ltda. All rights reserved.

  1. Pubertal stage and the prevalence of violence and social relational aggression

    Science.gov (United States)

    Hemphill, Sheryl A.; Kotevski, Aneta; Herrenkohl, Todd I.; Toumbourou, John W.; Carlin, John B.; Catalano, Richard F.; Patton, George C.

    2010-01-01

    Objective Violence and social relational aggression are global problems that become prominent in early adolescence. This study examines associations between pubertal stage and adolescent violent behavior and social relational aggression. Methods This paper draws on cross-sectional data from the International Youth Development Study (IYDS), which comprised two state-wide representative samples of students in grades 5, 7 and 9 (N = 5,769) in Washington State in the United States and Victoria, Australia, drawn as a 2-stage cluster sample in each state. The study used carefully matched methods to conduct a school-administered, self-report student survey measuring behavioral outcomes including past year violent behavior (measured as attacking or beating up another person) and social relational aggression (excluding peers from the group, threatening to spread lies or rumors), as well as a comprehensive range of risk and protective factors and pubertal development. Results Compared with early puberty, the odds of violent behavior were approximately three-fold higher in mid-puberty (odds ratio [OR]: 2.87; 95% confidence interval [CI]: 1.81,4.55) and late puberty (OR: 3.79; 95% CI: 2.25,6.39), after adjustment for age, gender, state, and state by gender interaction. For social relational aggression, there were weaker overall associations after adjustment but these included an interaction between pubertal stage and age, showing stronger associations with pubertal stage at younger age (p = .003; mid-puberty OR 1.78; 95% CI 1.20,2.63; late puberty OR 3.00; 95% CI 1.95,4.63. Associations between pubertal stage and violent behavior and social relational aggression remained (although the magnitude of effects was reduced), after the inclusion of social contextual mediators in the analyses. Conclusions Pubertal stage was associated with higher rates of violent behavior and social relational aggression, with the latter association seen only at younger ages. Puberty may be an

  2. Recent changes in pubertal timing in healthy Danish boys

    DEFF Research Database (Denmark)

    Sørensen, K; Aksglæde, Lise; Petersen, Jørgen Holm

    2010-01-01

    In the 1990s, the American population-based study NHANES III renewed the focus on possible secular trends in male puberty. However, no conclusions could be made on pubertal onset due to the lack of compatible data.......In the 1990s, the American population-based study NHANES III renewed the focus on possible secular trends in male puberty. However, no conclusions could be made on pubertal onset due to the lack of compatible data....

  3. BMI and Lifetime Changes in BMI and Cancer Mortality Risk

    Science.gov (United States)

    Taghizadeh, Niloofar; Boezen, H. Marike; Schouten, Jan P.; Schröder, Carolien P.; de Vries, E. G. Elisabeth; Vonk, Judith M.

    2015-01-01

    Body Mass Index (BMI) is known to be associated with cancer mortality, but little is known about the link between lifetime changes in BMI and cancer mortality in both males and females. We studied the association of BMI measurements (at baseline, highest and lowest BMI during the study-period) and lifetime changes in BMI (calculated over different time periods (i.e. short time period: annual change in BMI between successive surveys, long time period: annual change in BMI over the entire study period) with mortality from any cancer, and lung, colorectal, prostate and breast cancer in a large cohort study (n=8,645. Vlagtwedde-Vlaardingen, 1965-1990) with a follow-up on mortality status on December 31st 2008. We used multivariate Cox regression models with adjustments for age, smoking, sex, and place of residence. Being overweight at baseline was associated with a higher risk of prostate cancer mortality (hazard ratio (HR) =2.22; 95% CI 1.19-4.17). Obesity at baseline was associated with a higher risk of any cancer mortality [all subjects (1.23 (1.01-1.50)), and females (1.40 (1.07-1.84))]. Chronically obese females (females who were obese during the entire study-period) had a higher risk of mortality from any cancer (2.16 (1.47-3.18), lung (3.22 (1.06-9.76)), colorectal (4.32 (1.53-12.20)), and breast cancer (2.52 (1.15-5.54)). We found no significant association between long-term annual change in BMI and cancer mortality risk. Both short-term annual increase and decrease in BMI were associated with a lower mortality risk from any cancer [all subjects: (0.67 (0.47-0.94)) and (0.73 (0.55-0.97)), respectively]. In conclusion, a higher BMI is associated with a higher cancer mortality risk. This study is the first to show that short-term annual changes in BMI were associated with lower mortality from any type of cancer. PMID:25881129

  4. Pubertal timing and health-related behaviours in adolescence - socio- economic outcomes in a follow-up study from Finland

    Directory of Open Access Journals (Sweden)

    Leena K Koivusilta

    2006-03-01

    Full Text Available

    Background. Pubertal timing is connected with health-related lifestyle in adulthood. We studied whether early or late pubertal timing is predictive of socio-economic outcomes in early adulthood and whether the associations are mediated by health behaviours.

    Methods. Survey data (1981, 1983, 1985, 1987 from samples of 14-year-old Finns (N=4246, response rate 85% were linked with respondents’ attained educational level, socio-economic and labour market position in 2001 (ages 28-34. Ages of menarche and first ejaculation indicated pubertal timing.

    Results. As compared to adolescents with average age pubertal timing, boys and girls maturing at an early age more often participated in health-compromising behaviours, while those maturing at a later age participated less frequently. Pubertal timing was not associated with attained educational level or socioeconomic position in girls and not with labour market position at the time of follow-up in either sex. In boys, independently of health behaviours, early or late onset of puberty predicted low educational level, while late onset predicted low socio-economic position.

    Conclusion. Timing of puberty has a stronger connection with socio-economic outcomes in boys than in girls. Deviance from the normative pace of physical development, especially late maturation, is among boys slightly depicted in the hierarchy of socio-economic positions of the society. As pubertal timing is connected with health-related behaviours – especially with smoking – the pacing of developmental transitions should be considered in planning programmes preventing unhealthy behavioural patterns often linked with negative attitudes towards schooling.

  5. Two organizational effects of pubertal testosterone in male rats: transient social memory and a shift away from long-term potentiation following a tetanus in hippocampal CA1.

    Science.gov (United States)

    Hebbard, Pamela C; King, Rebecca R; Malsbury, Charles W; Harley, Carolyn W

    2003-08-01

    The organizational role of pubertal androgen receptor (AR) activation in synaptic plasticity in hippocampal CA1 and in social memory was assessed. Earlier data suggest pubertal testosterone reduces adult hippocampal synaptic plasticity. Four groups were created following gonadectomy at the onset of puberty: rats given testosterone; rats given testosterone but with the AR antagonist flutamide, present during puberty; rats given testosterone at the end of puberty; and rats given cholesterol at the end of puberty. A tetanus normally inducing long-term potentiation (LTP) was used to stimulate CA1 in the urethane-anesthetized adults during the dark phase of their cycle. Social memory was assessed prior to electrophysiology. Social memory for a juvenile rat at 120 min was seen only in rats not exposed to AR activation during puberty. Pubertal AR activation may induce the reduced social memory of male rats. Early CA1 LTP occurred following tetanus in rats with no pubertal testosterone. Short-term potentiation occurred in rats exposed to pubertal testosterone. Unexpectedly, rats with pubertal AR activation developed long-term depression (LTD). The same pattern was seen in normal male rats. Lack of LTP during the dark phase is consistent with other data on circadian modulation of CA1 LTP. No correlations were seen among social memory scores and CA1 plasticity measures. These data argue for two organizational effects of pubertal testosterone: (1) CA1 synaptic plasticity shifts away from potentiation toward depression; (2) social memory is reduced. Enduring effects of pubertal androgen on limbic circuits may contribute to reorganized behaviors in the postpubertal period.

  6. A Twin Study of Objective and Subjective Pubertal Timing and Peer Influence on Risk-Taking.

    Science.gov (United States)

    Kretsch, Natalie; Mendle, Jane; Harden, K Paige

    2016-03-01

    The current study used a behavioral genetic design to test whether three measures of pubertal timing moderated peer influence on risk-taking in a sample of 248 female adolescent twin pairs ( M age =16.0, SD =1.5) from the National Longitudinal Study of Adolescent Health. Peer influence was operationalized as the quasi-causal association between girls' self-reported risk-taking and the risk-taking reported by their friends. Girls with earlier ages at menarche and who perceived themselves as more developed than peers were more susceptible to peer influence on risk-taking. However, age-standardized ratings of body changes did not moderate peer influence. This study highlights distinctions between multiple measures of pubertal timing, using an innovative synthesis of genetically informative data and peer nomination data.

  7. Serum levels of INSL3, AMH, Inhibin B and Testosterone during pubertal transition in healthy boys

    DEFF Research Database (Denmark)

    Lindhardt Johansen, Marie; Anand-Ivell, Ravinder; Mouritsen, Annette

    2014-01-01

    to luteinizing hormone (LH), follicle-stimulating hormone (FSH), testosterone, inhibin B, and anti-Müllerian hormone (AMH) during puberty in healthy boys.MethodsTen boys were included from the longitudinal part of the COPENHAGEN Puberty Study. Pubertal evaluation, including testicular volume, was performed...... and blood samples drawn every 6 months for 5 years. Serum concentrations of testosterone were determined by a newly developed LC-MS/MS method, and serum concentrations of INSL3, AMH, inhibin B, FSH and LH, respectively, were determined by validated immunoassays.ResultsSerum INSL3 levels increased...... progressively with increasing age, pubertal onset and testicular volume. In six of ten boys, LH increased prior to the first observed increase in INSL3. In the remaining four boys, the increase in LH and INSL3 was observed at the same examination. The increases in serum concentrations of LH, testosterone...

  8. The association of pain and depression in preadolescent girls: moderation by race and pubertal stage.

    Science.gov (United States)

    Keenan, Kate; Hipwell, Alison E; Hinze, Amanda E; Babinski, Dara E

    2009-08-01

    To test whether an association between pain response and depression in females is present during preadolescence using a controlled pain stimulus and a clinically relevant assessment of depressive symptoms. In a sample of 232 girls, pain threshold and tolerance were assessed at age 10 years using the cold pressor task, and a diagnostic interview was used to assess depression symptoms at 10 and 11 years of age. Response to pain at age 10 was associated with depressive symptoms at ages 10 and 11; race and pubertal stage moderated the association. Pain response and depression were more strongly associated among girls who had reached advanced stages of pubertal development and among European American girls. The results add to the existing literature on the co-occurrence of depression and pain by demonstrating modest but consistent concurrent and prospective associations between response to pain and depression among girls during preadolescence.

  9. Early pubertal onset and its relationship with sexual risk taking, substance use and anti-social behaviour: a preliminary cross-sectional study

    Directory of Open Access Journals (Sweden)

    Bellis Mark A

    2009-12-01

    Full Text Available Abstract Background In many countries age at pubertal onset has declined substantially. Relatively little attention has been paid to how this decline may affect adolescent behaviours such as substance use, violence and unprotected sex and consequently impact on public health. Methods In the UK, two opportunistic samples (aged 16-45 years, paper-based (n = 976 and online (n = 1117, examined factors associated with earlier pubertal onset and whether earlier age of onset predicted sexual risk-taking, substance use and anti-social behaviours during early adolescence. Results Overall, 45.6% of females reported menarche ≤ 12 years and 53.3% of males were categorised as having pubertal onset ≤ 11 years. For both sexes earlier pubertal onset was associated with poorer parental socio-economic status. Other pre-pubertal predictors of early onset were being overweight, more childhood illnesses (females and younger age at time of survey (males. For both sexes earlier puberty predicted having drunk alcohol, been drunk, smoked and used drugs Conclusion Results provide sufficient evidence for changes in age of pubertal onset to be further explored as a potential influence on trends in adolescent risk behaviours. Further insight into the relationship between early puberty and both obesity and socio-economic status may help inform early interventions to tackle the development of risk behaviours and health inequalities during early adolescence.

  10. Sexual differentiation of human behavior: effects of prenatal and pubertal organizational hormones.

    Science.gov (United States)

    Berenbaum, Sheri A; Beltz, Adriene M

    2011-04-01

    A key question concerns the extent to which sexual differentiation of human behavior is influenced by sex hormones present during sensitive periods of development (organizational effects), as occurs in other mammalian species. The most important sensitive period has been considered to be prenatal, but there is increasing attention to puberty as another organizational period, with the possibility of decreasing sensitivity to sex hormones across the pubertal transition. In this paper, we review evidence that sex hormones present during the prenatal and pubertal periods produce permanent changes to behavior. There is good evidence that exposure to high levels of androgens during prenatal development results in masculinization of activity and occupational interests, sexual orientation, and some spatial abilities; prenatal androgens have a smaller effect on gender identity, and there is insufficient information about androgen effects on sex-linked behavior problems. There is little good evidence regarding long-lasting behavioral effects of pubertal hormones, but there is some suggestion that they influence gender identity and perhaps some sex-linked forms of psychopathology, and there are many opportunities to study this issue. Copyright © 2011 Elsevier Inc. All rights reserved.

  11. Development of relative body mass (BMI of students from Łódź, depending on the selected environmental, psychological and sociological factors

    Directory of Open Access Journals (Sweden)

    Pruszkowska-Przybylska Paulina

    2016-12-01

    Full Text Available The human height-to-weight ratio is an important parameter of the body homeostasis. Currently, the most popular measurement determining the relationship between body mass and height is the Quetelet II indicator, called Body Mass Index (BMI. The aim of this study is an evaluation of the differences in the height-to-weight ratios, depending on selected environmental, psychological and sociological factors in people studying at higher education institutions in Łódź. The research was conducted among students of higher education institutions in Łódź, by electronic means or with the use of an anonymous survey. It consisted of 28 closed single or multiple choice questions. Statistical analysis was made of complete results of the research involving 135 people, both males and females, aged between 19-26. It was revealed that the factors related to higher BMI values in students are the following: the presence of a tendency in the students to gain weight themselves, and a tendency to gain weight present in their mothers, an evaluation of their own body mass as excessive, regularly smoking cigarettes and rarely undergoing medical check-ups. Among the factors connected with lower BMI values are: regular coffee consumption, perception of their own body mass as being too low, and also obtaining systolic pressure values below 110 mm Hg. Additionally, a positive correlation between taking up physical activity and higher values of systolic blood pressure (p<0.05 was shown. Among the subjects, it was found that 92% of the underweight women declared that their body mass and figure were normal. In the case of women with optimal BMI values, 40% stated that their body mass was excessive. In the case of men the problem was reverse: 50% of the subjects who were either overweight or obese claimed that their body mass was within the norm. The factors that significantly influence body proportion differences among students include the subject’s and the subject

  12. The duration of pubertal growth peak among three skeletal classes

    Directory of Open Access Journals (Sweden)

    Waqar Jeelani

    Full Text Available ABSTRACT Introduction: Pubertal growth peak is closely associated with a rapid increase in mandibular length and offers a wide range of therapeutic modifiability. Objective: The aim of the present study was to determine and compare the mean ages of onset and duration of pubertal growth peak among three skeletal classes. Methods: A retrospective cross-sectional study was conducted using lateral cephalograms of 230 subjects with growth potential (110 males, 120 females. Subjects were categorized into three classes (Class I = 81, Class II = 82, Class III = 67, according to the sagittal relationship established between the maxilla and the mandible. The cervical vertebral maturation stage was recorded by means of Baccetti's method. The mean ages at CS3 and CS4 and the CS3-CS4 age interval were compared between boys and girls and among three skeletal classes. Results: Pubertal growth peak occurred on average four months earlier in girls than boys (p = 0.050. The average duration of pubertal growth peak was 11 months in Class I, seven months in Class II and 17 months in Class III subjects. Interclass differences were highly significant (Cohen's d > 0.08. However, no significant difference was found in the timing of pubertal growth peak onset among three skeletal classes (p = 0.126 in boys, p = 0.262 in girls. Conclusions: Girls enter pubertal growth peak on average four months earlier than boys. Moreover, the duration of pubertal growth peak is on average four months shorter in Class II and six months longer in Class III subjects as compared to Class I subjects.

  13. BMI change during puberty and the risk of heart failure.

    Science.gov (United States)

    Kindblom, J M; Bygdell, M; Sondén, A; Célind, J; Rosengren, A; Ohlsson, C

    2018-03-12

    Hospitalization for heart failure amongst younger men has increased. The reason for this is unknown but it coincides with the obesity epidemic. The aim of this study was to evaluate the association between childhood BMI (Body Mass Index) and BMI change during puberty for risk of adult heart failure in men. Using the BMI Epidemiology Study (BEST), a population-based study in Gothenburg, Sweden, we collected information on childhood BMI at age 8 years and BMI change during puberty (BMI at age 20 - BMI at 8) for men born 1945-1961, followed until December 2013 (n = 37 670). BMI was collected from paediatric growth charts and mandatory military conscription tests. Information on heart failure was retrieved from high-quality national registers (342 first hospitalizations for heart failure). BMI change during puberty was independently of childhood BMI associated with risk of heart failure in a nonlinear J-shaped manner. Subjects in the upper quartile of BMI change during puberty (Q4) had more than twofold increased risk of heart failure compared with subjects in Q1 [HR (Hazard Ratio) = 2.29, 95% CI (Confidence Interval) 1.68-3.12]. Childhood BMI was not independently associated with risk of heart failure. Boys developing overweight during puberty (HR 3.14; 95% CI 2.25-4.38) but not boys with childhood overweight that normalized during puberty (HR 1.12, 95% CI 0.63-2.00) had increased risk of heart failure compared with boys without childhood or young adult overweight. BMI change during puberty is a novel risk factor for adult heart failure in men. © 2018 The Association for the Publication of the Journal of Internal Medicine.

  14. [Craniopharyngioma and Klinefelter syndrome during the pubertal transition: A diagnostic challenge].

    Science.gov (United States)

    Mocarbel, Yamile; Arébalo de Cross, Graciela; Lebrethon, Marie C; Thiry, Albert; Beckersd, Albert; Valdes-Socin, Hernan

    2017-04-01

    Craniopharyngioma is the most common pituitary tumor in childhood. It can compromise the pubertal development because of its evolution or treatment. Syndrome of Klinefelter is the most common cause of hipergonadotrophic hypogonadism in males. The concomitant presentation of both entities is extremely low (1/109) and the pathophysiological association is questionned. We present the case of a 18-year-old Belgian patient. He had a diagnosis of craniopharyngioma in childhood and he presented with panhypopituitarism after radiotherapy and surgical treatment. At the age of 14, he started pubertal induction with gonadotropin therapy without clinical response. Asociación de craneofaringioma y síndrome de Klinefelter en la transición puberal: un desafío diagnóstico Craniopharyngioma and Klinefelter syndrome during the pubertal transition: A diagnostic challenge A genetic evaluation confirmed a homogeneous 47, XXY karyotype. Failure of exogenous gonadotropin therapy revealed the hidden association of primary and secondary hypogonadism, demonstrating the importance of the followup and a multidisciplinary approach in these patients. Sociedad Argentina de Pediatría.

  15. Mutational Analysis of TAC3 and TACR3 Genes in Patients with Idiopathic Central Pubertal Disorders

    Science.gov (United States)

    Tusset, Cintia; Noel, Sekoni D.; Trarbach, Ericka B.; Silveira, Letícia F. G.; Jorge, Alexander A. L.; Brito, Vinicius N.; Cukier, Priscila; Seminara, Stephanie B.; de Mendonça, Berenice B.; Kaiser, Ursula B.; Latronico, Ana Claudia

    2013-01-01

    Aim To investigate the presence of variants in the TAC3 and TACR3 genes, which encode NKB and its receptor (NK3R), respectively, in a large cohort of patients with idiopathic central pubertal disorders. Patients and Methods Two hundred and thirty seven patients were studied: 114 with central precocious puberty (CPP), 73 with normosmic isolated hypogonadotropic hypogonadism (IHH) and 50 with constitutional delay of growth and puberty (CDGP). The control group consisted of 150 Brazilian individuals with normal pubertal development. Genomic DNA was extracted from peripheral blood and the entire coding region of both TAC3 and TACR3 genes were amplified and automatically sequenced. Results We identified one variant (p.A63P) in NKB and four variants, p.G18D, p.L58L (c.172C>T), p.W275* and p.A449S in NK3R, which were absent in the control group. The p.A63P variant was identified in a girl with CPP, and p.A449S in a girl with CDGP. The known p.G18D, p.L58L and p.W275* variants were identified in three unrelated males with normosmic IHH. Conclusion Rare variants in the TAC3 and TACR3 genes were identified in patients with central pubertal disorders. Loss-of-function variants of TACR3 were associated with the normosmic IHH phenotype. PMID:23329188

  16. [Pubertal maturation, physical self-esteem and sexuality in a sample of French adolescents].

    Science.gov (United States)

    Potard, C; Courtois, R; Clarisse, R; Le Floc'h, N; Thomine, M; Réveillère, C

    2016-04-01

    The aim of this study was to explore the links between pubertal maturation, physical self-esteem and sexuality in adolescence, differentiating between boys and girls. The sample was comprised of 312 French secondary school children (seventh and ninth grades); 52.6 % (n=164) of whom were girls. Participants answered three self-evaluation questionnaires: the scale of sexuality (interests, emotions, relationships: IERS) in prime adolescence (12 to 15 years); (b) the self-administered rating scale for pubertal development and (c) the Physical Self-Description Questionnaire (PSDQ). Pubertal maturation was associated with higher scores on "Flirting with the aim of having sexual relations" and "Going out with someone", and a drop in overall and physical self-esteem, mainly in socially valued domains, namely "Body fat" for girls, and "Strength" and "Health" for boys. Overall physical self-esteem was associated with "Going out with someone" and "Flirting with the aim of having sexual relations" in boys. Physical changes at puberty induce two distinct trends in adolescents: sexual exploration and discovery (genitalized body), and self-depreciation (social body). Copyright © 2015 L’Encéphale, Paris. Published by Elsevier Masson SAS. All rights reserved.

  17. School performance in pubertal adolescents with dysmenorrhea

    Directory of Open Access Journals (Sweden)

    Syamsir Alam

    2011-08-01

    Full Text Available Background Dysmenorrhea is a common gynecological symptom reported in adolescent girls. Prevalence of the condition has been reported to be 45 - 75%. Absenteeism from work and school as a result of dysmenorrhea is common (13 - 51% of women have been absent at least once, and 5 - 14% are often absent due to the severity of symptoms. Objective To compare school performance in pubertal adolescent girls with and without dysmenorrhea. Methods This cross-sectional study was conducted in June 2010 in adolescent females aged 12 - 18 years from the Musthafawiyah School, Mandailing Natal district, North Sumatera. Adolescent females with and without dysmenorrhea were recruited for this study. All participants completed questionnaires including age of menarche, length of menstrual cycle, length of bleeding, number of sanitary napkins used daily and school absences. School reports from two consecutive semesters in one year were used to evaluate subjects’ academic performance. An academic score of higher than 7.5 was considered good performance while scores of less than 7.5 were considered poor. We used the chi-square test to analyze differences in school performance between girls with and without dysmenorrhea. Results One hundred and sixteen participants were divided into 2 groups, those with and without dysmenorrhea, of 58 subjects each. We found no significant difference in school performance between the two groups, P=0.176 (95% CI -0.009 to -0.048 and P=0.08 (95%CI -0.052 to 0.024. Conclusion There was no significant difference in school performance of girls with and without dysmenorrhea.

  18. Candidate gene expression in Bos indicus ovarian tissues: pre-pubertal and post-pubertal heifers in diestrus

    Directory of Open Access Journals (Sweden)

    Mayara Morena Del Cambre Amaral Weller

    2016-10-01

    Full Text Available Growth factors such as bone morphogenetic proteins 6, 7, 15 and two isoforms of transforming growth factor-beta (BMP6, BMP7, BMP15, TGFB1 and TGFB2 and insulin-like growth factor system act as local regulators of ovarian follicular development. To elucidate if these factors as well as others candidate genes such as estrogen receptor 1 (ESR1, growth differentiation factor 9 (GDF9, follicle stimulating hormone receptor (FSHR, luteinizing hormone receptor (LHR, bone morphogenetic protein receptor, type 2 (BMPR2, type 1 insulin-like growth factor receptor (IGFR1, and key steroidogenic enzymes cytochrome P450 aromatase and 3-β-hydroxysteroid dehydrogenase (CYP19A1 and HSD3B1 could modulate or influence diestrus on the onset of puberty in Brahman heifers, their ovarian mRNA expression was measured before and after puberty (luteal phase. Six post-pubertal (POST heifers were euthanized on the luteal phase of their second cycle, confirmed by corpus luteum observation, and six pre-pubertal (PRE heifers were euthanized in the same day. Quantitative real-time PCR analysis showed that the expression of FSHR, BMP7, CYP19A1, IGF1 and IGFR1 mRNA was greater in PRE heifers, when contrasted to POST heifers. The expression of LHR and HSD3B1 was lower in PRE heifers. Differential expression of ovarian genes could be associated with changes in follicular dynamics and different cell populations that have emerged as consequence of puberty and the luteal phase. The emerging hypothesis is that BMP7 and IGF1 are co-expressed and may modulate the expression of FSHR, LHR and IGFR1 and CYP19A1. BMP7 could influence the down-regulation of LHR and up-regulation of FSHR and CYP19A1, which mediates the follicular dynamics in heifer ovaries. Up-regulation of IGF1 expression pre-puberty, compared to post-puberty diestrus, correlates with increased levels FSHR and CYP19A1. Thus, BMP7 and IGF1 may play synergic roles and were predicted to interact, from the expression data (P = 0

  19. Pubertal induction in hypogonadism: Current approaches including use of gonadotrophins.

    Science.gov (United States)

    Zacharin, Margaret

    2015-06-01

    Primary disorders of the gonad or those secondary to abnormalities of the hypothalamic pituitary axis result in hypogonadism. The range of health problems of childhood and adolescence that affect this axis has increased, as most children now survive chronic illness, but many have persisting deficits in gonadal function as a result of their underlying condition or its treatment. An integrated approach to hormone replacement is needed to optimize adult hormonal and bone health, and to offer opportunities for fertility induction and preservation that were not considered possible in the past. Timing of presentation ranges from birth, with disorders of sexual development, through adolescent pubertal failure, to adult fertility problems. This review addresses diagnosis and management of hypogonadism and focuses on new management strategies to address current concerns with fertility preservation. These include Turner syndrome, and fertility presevation prior to childhood cancer treatment. New strategies for male hormone replacement therapy that may impinge upon future fertility are emphasized. Copyright © 2015 Elsevier Ltd. All rights reserved.

  20. Association of insulin-like growth factor-1 and IGF binding protein-3 with 25-hydroxy vitamin D in pre-pubertal and adolescent Indian girls.

    Science.gov (United States)

    Marwaha, Ramank K; Garg, M K; Gupta, Sushil; Ganie, Mohd Ashraf; Gupta, Nandita; Narang, Archna; Shukla, Manoj; Arora, Preeti; Singh, Annie; Chadha, Aditi; Mithal, Ambrish

    2018-03-28

    There is a high prevalence of vitamin D deficiency (VDD) in India. Molecular mechanisms suggest a strong relationship between vitamin D and growth factors. However, there is a paucity of literature with regard to a relationship between insulin-like growth factor-1 (IGF-1), insulin-like growth factor binding protein-3 (IGFBP-3) and vitamin D particularly in subjects with VDD. The objective of the study was to assess the relationship between growth factors and serum vitamin D-parathormone (PTH) status in school girls and study the impact of vitamin D supplementation on growth factors in pre-pubertal girls with VDD. Our study subjects were apparently healthy school girls aged 6-18 years. The baseline height, weight, body mass index (BMI), pubertal status, serum 25-hydroxy vitamin D (25OHD), PTH, IGF-1 and IGFBP-3 were assessed in 847 girls aged 6-18 years and in 190 pre-pubertal girls with VDD following supplementation. The mean age, BMI and serum 25OHD of girls were 11.5±3.2 years, 18.7±4.8 kg/m2 and 9.9±5.6 ng/mL, respectively. VDD was observed in 94.6% of girls. Unadjusted serum IGF-1 levels and IGF-1/IGFBP-3 molar ratio were significantly higher in girls with severe VDD as compared to girls with mild-to-moderate VDD. However, these differences disappeared when adjusted for age, height or sexual maturation. The serum IGF-1 and IGFBP-3 levels increased significantly post supplementation with vitamin D. There were no differences in serum IGF-1 levels and the IGF-1/IGFBP-3 molar ratio among VDD categories when adjusted for age, height and sexual maturation in girls. Vitamin D supplementation resulted in a significant increase in serum IGF-1 levels in VDD pre-pubertal girls.

  1. Prediction of basal metabolic rate in obese children and adolescents considering pubertal stages and anthropometric characteristics or body composition.

    Science.gov (United States)

    Lazzer, S; Patrizi, A; De Col, A; Saezza, A; Sartorio, A

    2014-06-01

    To develop and crossvalidate new equations for predicting basal metabolic rate (BMR) in obese children and adolescents in relation to pubertal stages, anthropometric characteristics or body composition. A total of 1696 obese Caucasian children and adolescents (mean body mass index z-score: 3.5±0.8) participated in this study. BMR was determined by indirect calorimetry and fat-free mass (FFM) and fat mass (FM) by bioelectrical impedance analysis. Equations were derived by stepwise multiple regression analysis using a calibration cohort of 848 subjects, and the equations were crossvalidated with a Bland and Altman method in the remaining 848 subjects. Two new specific equations based on gender (1: males; 0: females), pubertal stages (from 1 to 5, assessed according Marshall & Tanner methods) and body weight (BW, kg), stature (m) or body composition (kg) were generated as follows: (1) BMR=(BW × 0.044)+(stature × 2.836)-(pubertal stage × 0.148)+(gender × 0.781)-0.551 (adjusted coefficient of determination (R(2)adj)= 0.69 and root mean squared error (RMSE)=0.954 MJ); (2) BMR=(FFM × 0.082)+(FM × 0.037)-(pubertal stage × 0.125)+(gender × 0.706)+2.528 (R(2)adj= 0.70 and RMSE=0.943 MJ). In the crossvalidation group, mean-predicted BMR was not significantly different from the mean-measured BMR (MBMR) for all children and adolescents, as well as for boys and girls (differenceBMR was predicted accurately (90-110% of MBMR) in 67% of subjects. The new prediction equations considering the pubertal stages allow an accurate and more appropriate (vs equations using chronological age) estimation of BMR in obese children and adolescents.

  2. Sex differences in heritability of BMI

    DEFF Research Database (Denmark)

    Schousboe, Karoline; Willemsen, Gonneke; Kyvik, Kirsten O

    2003-01-01

    pairs (including opposite sex pairs) aged 20-29 and 30-39 from eight different twin registries participating in the GenomEUtwin project. Quantitative genetic analyses were conducted and sex differences were explored. Variation in BMI was greater for women than for men, and in both sexes was primarily...... explained by additive genetic variance in all countries. Sex differences in the variance components were consistently significant. Results from analyses of opposite sex pairs also showed evidence of sex-specific genetic effects suggesting there may be some differences between men and women in the genetic...... factors that influence variation in BMI. These results encourage the continued search for genes of importance to the body composition and the development of obesity. Furthermore, they suggest that strategies to identify predisposing genes may benefit from taking into account potential sex specific effects....

  3. Melatonin and LH secretion patterns in pubertal boys

    International Nuclear Information System (INIS)

    Fevre, M.; Boyar, R.M.; Rollag, M.D.

    1979-01-01

    Plasma melatonin and LH were measured at 20 minute intervals for 24 hours in four normal pubertal boys. All four subjects showed a significant augmentation of LH and melatonin during nocturnal sleep. There was also a significant correlation between the LH and melatonin levels (p [fr

  4. Food brand recognition and BMI in preschoolers.

    Science.gov (United States)

    Harrison, Kristen; Moorman, Jessica; Peralta, Mericarmen; Fayhee, Kally

    2017-07-01

    Children's food brand recognition predicts health-related outcomes such as preference for obesogenic foods and increased risk for overweight. However, it is uncertain to what degree food brand recognition acts as a proxy for other factors such as parental education and income, child vocabulary, child age, child race/ethnicity, parent healthy eating guidance, child commercial TV viewing, and child dietary intake, all of which may influence or be influenced by food brand recognition. U.S. preschoolers (N = 247, average age 56 months) were measured for BMI and completed the Peabody Picture Vocabulary Test plus recognition and recall measures for a selection of U.S. food brands. Parents completed measures of healthy eating guidance, child dietary intake, child commercial TV viewing, parent education, household income, parent BMI, and child age and race/ethnicity. Controlling these variables, child food brand recognition predicted higher child BMI percentile. Further, qualitative examination of children's incorrect answers to recall items demonstrated perceptual confusion between brand mascots and other fantasy characters to which children are exposed during the preschool years, extending theory on child consumer development. Copyright © 2017 Elsevier Ltd. All rights reserved.

  5. Physical activity reduces systemic blood pressure and improves early markers of atherosclerosis in pre-pubertal obese children.

    Science.gov (United States)

    Farpour-Lambert, Nathalie J; Aggoun, Yacine; Marchand, Laetitia M; Martin, Xavier E; Herrmann, François R; Beghetti, Maurice

    2009-12-15

    The aim of this study was to determine the effects of physical activity on systemic blood pressure (BP) and early markers of atherosclerosis in pre-pubertal obese children. Hypertension and endothelial dysfunction are premature complications of obesity. We performed a 3-month randomized controlled trial with a modified crossover design: 44 pre-pubertal obese children (age 8.9 + or - 1.5 years) were randomly assigned (1:1) to an exercise (n = 22) or a control group (n = 22). We recruited 22 lean children (age 8.5 + or - 1.5 years) for baseline comparison. The exercise group trained 60 min 3 times/week during 3 months, whereas control subjects remained relatively inactive. Then, both groups trained twice/week during 3 months. We assessed changes at 3 and 6 months in office and 24-h BP, arterial intima-media thickness (IMT) and stiffness, endothelial function (flow-mediated dilation), body mass index (BMI), body fat, cardiorespiratory fitness (maximal oxygen consumption [VO(2)max]), physical activity, and biological markers. Obese children had higher BP, arterial stiffness, body weight, BMI, abdominal fat, insulin resistance indexes, and C-reactive protein levels, and lower flow-mediated dilation, VO(2)max, physical activity, and high-density lipoprotein cholesterol levels than lean subjects. At 3 months, we observed significant changes in 24-h systolic BP (exercise -6.9 + or - 13.5 mm Hg vs. control 3.8 + or - 7.9 mm Hg, -0.8 + or - 1.5 standard deviation score [SDS] vs. 0.4 + or - 0.8 SDS), diastolic BP (-0.5 + or - 1.0 SDS vs. 0 + or - 1.4 SDS), hypertension rate (-12% vs. -1%), office BP, BMI z-score, abdominal fat, and VO(2)max. At 6 months, change differences in arterial stiffness and IMT were significant. A regular physical activity program reduces BP, arterial stiffness, and abdominal fat; increases cardiorespiratory fitness; and delays arterial wall remodeling in pre-pubertal obese children. (Effects of Aerobic Exercise Training on Arterial Function and

  6. Genome-wide association and longitudinal analyses reveal genetic loci linking pubertal height growth, pubertal timing and childhood adiposity

    NARCIS (Netherlands)

    Cousminer, Diana L.; Berry, Diane J.; Timpson, Nicholas J.; Ang, Wei; Thiering, Elisabeth; Byrne, Enda M.; Taal, H. Rob; Huikari, Ville; Bradfield, Jonathan P.; Kerkhof, Marjan; Groen-Blokhuis, Maria M.; Kreiner-Moller, Eskil; Marinelli, Marcella; Holst, Claus; Leinonen, Jaakko T.; Perry, John R. B.; Surakka, Ida; Pietilainen, Olli; Kettunen, Johannes; Anttila, Verneri; Kaakinen, Marika; Sovio, Ulla; Pouta, Anneli; Das, Shikta; Lagou, Vasiliki; Power, Chris; Prokopenko, Inga; Evans, David M.; Kemp, John P.; St Pourcain, Beate; Ring, Susan; Palotie, Aarno; Kajantie, Eero; Osmond, Clive; Lehtimaki, Terho; Viikari, Jorma S.; Kahonen, Mika; Warrington, Nicole M.; Lye, Stephen J.; Palmer, Lyle J.; Tiesler, Carla M. T.; Flexeder, Claudia; Montgomery, Grant W.; Medland, Sarah E.; Hofman, Albert; Hakonarson, Hakon; Guxens, Monica; Bartels, Meike; Salomaa, Veikko; Koppelman, Gerard H.

    2013-01-01

    The pubertal height growth spurt is a distinctive feature of childhood growth reflecting both the central onset of puberty and local growth factors. Although little is known about the underlying genetics, growth variability during puberty correlates with adult risks for hormone-dependent cancer and

  7. Bmi1 is required for hedgehog pathway-driven medulloblastoma expansion

    NARCIS (Netherlands)

    Michael, Lowell Evan; Westerman, Bart A.; Ermilov, Alexandre N.; Wang, Aiqin; Ferris, Jennifer; Liu, Jianhong; Blom, Marleen; Ellison, David W.; van Lohuizen, Maarten; Dlugosz, Andrzej A.

    2008-01-01

    Inappropriate Hedgehog (Hh) signaling underlies development of a subset of medulloblastomas, and tumors with elevated HH signaling activity express the stem cell self-renewal gene BMI1. To test whether Bmi1 is required for Hh-driven medulloblastoma development, we varied Bmi1 gene dosage in

  8. Perception regarding pubertal changes among rural adolescent boys of Haryana: A school based study

    Directory of Open Access Journals (Sweden)

    Vinod Chayal

    2016-06-01

    Full Text Available Background: Adolescence is a transition phase through which a child matures into an adult. The physical changes in the human body are from infant to child to adolescence to adult to old age.  All phases of life behave like a coin with both good and bad facets attached to each phase of life. Aims & Objectives:  1. To study perception and awareness regarding pubertal changes among school going adolescent boys. 2. To study the association between education and perceived pubertal problems among study subjects. Material & Methods: The study was conducted among male students of senior secondary schools of community development block Beri in one year. The study universe comprised of students in middle and late adolescence (aged 14-18 years studying in 9th to 12th classes of the senior secondary schools in the area. A total of 1000 male students were selected from these schools which were more than the required sample size of 891. Results: The study found that 42.66% students and a half (50% of students of class 9th & 10th and class 11th & 12th respectively considered that pubertal changes as a normal phenomenon. The majority of students admitted practicing masturbation and felt shy and guilty for practicing masturbation, also students felt fatigued after night emission. Conclusions: The study concludes that adolescent’s sexuality which often causes controversy and concern among adults is least discussed with them during adolescence. The reasons for this may be many, including moral grounds or because of concomitant health risks and threats to wellbeing.

  9. Perception regarding pubertal changes among rural adolescent boys of Haryana: A school based study

    Directory of Open Access Journals (Sweden)

    Vinod Chayal

    2016-06-01

    Full Text Available Background: Adolescence is a transition phase through which a child matures into an adult. The physical changes in the human body are from infant to child to adolescence to adult to old age.  All phases of life behave like a coin with both good and bad facets attached to each phase of life. Aims & Objectives:  1. To study perception and awareness regarding pubertal changes among school going adolescent boys. 2. To study the association between education and perceived pubertal problems among study subjects. Material & Methods: The study was conducted among male students of senior secondary schools of community development block Beri in one year. The study universe comprised of students in middle and late adolescence (aged 14-18 years studying in 9th to 12th classes of the senior secondary schools in the area. A total of 1000 male students were selected from these schools which were more than the required sample size of 891. Results: The study found that 42.66% students and a half (50% of students of class 9th & 10th and class 11th & 12th respectively considered that pubertal changes as a normal phenomenon. The majority of students admitted practicing masturbation and felt shy and guilty for practicing masturbation, also students felt fatigued after night emission. Conclusions: The study concludes that adolescent’s sexuality which often causes controversy and concern among adults is least discussed with them during adolescence. The reasons for this may be many, including moral grounds or because of concomitant health risks and threats to wellbeing.

  10. Sex 'n' drugs 'n' rock 'n' roll: the meaning and social consequences of pubertal timing.

    Science.gov (United States)

    Waylen, Andrea; Wolke, Dieter

    2004-11-01

    This is a brief review of the normal changes in adolescent behaviour and the interplay between biology and social factors that occur at and around puberty, in an attempt to explain when this transition may become problematic The onset of puberty is a biological marker for an individual's transition from a non-reproductive to a reproductive state. Adolescence is a normal developmental transition associated with clearly visible physical changes, reorganization and pruning of neuronal circuits in the brain and the occurrence of new behaviours and interests. It is a time when new life tasks (orientation towards peers of the other sex, romantic and sexual involvement and mastering an educational career) need to be mastered. Parent-child conflict increases and becomes more intense as the adolescent struggles for more independence while still requiring support. These normal changes can become problematic if biological and social expectations diverge e.g. entering puberty very early or very late. While early pubertal onset in boys is likely to have beneficial effects, in girls precocious pubertal timing may have a negative impact on body-image, affect (or emotional well-being) and sex-role expectations. Other individual biological predispositions and genetic endowment may interact with social factors (e.g. peers, parenting style, neighbourhood) making adolescence either an adaptive or a challenging transition. There is a lack of sufficiently large longitudinal studies that have been able to study this interaction between genetics, biology and social environment on adolescent development. The Avon Longitudinal Study of Parents and Children (ALSPAC) cohort provides a unique opportunity to investigate the impact of pubertal timing on social behaviour. Planned assessments and concepts are outlined.

  11. Know Your Body Mass Index (BMI)

    Science.gov (United States)

    ... Past Issues Special Section Know Your Body Mass Index (BMI) Past Issues / Winter 2007 Table of Contents ... aging, it pays to understand your body mass index (BMI), a measure of body fat based on ...

  12. BMI and BMI SDS in childhood: annual increments and conditional change

    OpenAIRE

    Brannsether-Ellingsen, Bente; Eide, Geir Egil; Roelants, Mathieu; Bjerknes, Robert; Juliusson, Petur Benedikt

    2016-01-01

    Background: Early detection of abnormal weight gain in childhood may be important for preventive purposes. It is still debated which annual changes in BMI should warrant attention. Aim: To analyse 1-year increments of Body Mass Index (BMI) and standardised BMI (BMI SDS) in childhood and explore conditional change in BMI SDS as an alternative method to evaluate 1-year changes in BMI. Subjects and methods: The distributions of 1-year increments of BMI (kg/m2) and BMI SDS are summarised by...

  13. Exposure to peer delinquency as a mediator between self-report pubertal timing and delinquency: A longitudinal study of mediation

    Science.gov (United States)

    Negriff, Sonya; Ji, Juye; Trickett, Penelope K.

    2013-01-01

    This study examined exposure to peer delinquency as a mediator between pubertal timing and self-reported delinquency longitudinally and whether this mediational model was moderated by either gender or maltreatment experience. Data were obtained from Time 1, 2, and 3 of a longitudinal study of maltreatment and development. At Time 1 the sample comprised 454 children aged 9–13 years. Analyses via structural equation modeling supported full mediation. Gender did not moderate this mediational relationship, but maltreatment experience did. The results show that early maturing males and females are both at risk for being exposed to peers that may draw them into delinquent behavior. Additionally, the mechanism linking early pubertal timing to delinquency differs depending on maltreatment experience. PMID:21262055

  14. Association between infancy BMI peak and body composition and blood pressure at age 5-6 years

    NARCIS (Netherlands)

    Hof, Michel H. P.; Vrijkotte, Tanja G. M.; de Hoog, Marieke L. A.; van Eijsden, Manon; Zwinderman, Aeilko H.

    2013-01-01

    The development of overweight is often measured with the body mass index (BMI). During childhood the BMI curve has two characteristic points: the adiposity rebound at 6 years and the BMI peak at 9 months of age. In this study, the associations between the BMI peak and body composition measures and

  15. Peri-pubertal gonadotropin-releasing hormone agonist treatment affects sex biased gene expression of amygdala in sheep.

    Science.gov (United States)

    Nuruddin, Syed; Krogenæs, Anette; Brynildsrud, Ola Brønstad; Verhaegen, Steven; Evans, Neil P; Robinson, Jane E; Haraldsen, Ira Ronit Hebold; Ropstad, Erik

    2013-12-01

    The nature of hormonal involvement in pubertal brain development has attracted wide interest. Structural changes within the brain that occur during pubertal development appear mainly in regions closely linked with emotion, motivation and cognitive functions. Using a sheep model, we have previously shown that peri-pubertal pharmacological blockade of gonadotropin releasing hormone (GnRH) receptors, results in exaggerated sex-differences in cognitive executive function and emotional control, as well as sex and hemisphere specific patterns of expression of hippocampal genes associated with synaptic plasticity and endocrine signaling. In this study, we explored effects of this treatment regime on the gene expression profile of the ovine amygdala. The study was conducted with 30 same-sex twin lambs (14 female and 16 male), half of which were treated with the GnRH agonist (GnRHa) goserelin acetate every 4th week, beginning before puberty, until approximately 50 weeks of age. Gene expression profiles of the left and right amygdala were measured using 8×15 K Agilent ovine microarrays. Differential expression of selected genes was confirmed by qRT-PCR (Quantitative real time PCR). Networking analyses and Gene Ontology (GO) Term analyses were performed with Ingenuity Pathway Analysis (IPA), version 7.5 and DAVID (Database for Annotation, Visualization and integrated Discovery) version 6.7 software packages, respectively. GnRHa treatment was associated with significant sex- and hemisphere-specific differential patterns of gene expression. GnRHa treatment was associated with differential expression of 432 (|logFC|>0.3, adj. p value expressed as a result of GnRHa treatment in the male animals. The results indicated that GnRH may, directly and/or indirectly, be involved in the regulation of sex- and hemisphere-specific differential expression of genes in the amygdala. This finding should be considered when long-term peri-pubertal GnRHa treatment is used in children. Copyright

  16. The Interaction Between Pubertal Timing and Peer Popularity for Boys and Girls: An Integration of Biological and Interpersonal Perspectives on Adolescent Depression.

    Science.gov (United States)

    Teunissen, Hanneke A; Adelman, Caroline B; Prinstein, Mitchell J; Spijkerman, Renske; Poelen, Evelien A P; Engels, Rutger C M E; Scholte, Ron H J

    2011-04-01

    The transition to adolescence marks a time of sharply increased vulnerability to the development of depression, particularly among girls. Past research has examined isolated risk factors from individual theoretical models (e.g., biological, interpersonal, and cognitive) of depression, but few have examined integrative models. This study investigated the conjoint effects of early pubertal timing and popularity in the longitudinal prediction of depressive symptoms. A total of 319 girls and 294 boys (ages 11-14) provided information on their pubertal status, depressive symptoms, and the social status (i.e., popularity) of their peers. Adolescents completed a second measure of depressive symptoms 11 months after the initial time point. Findings supported an integrated biological-interpersonal model in explaining the development of depressive symptoms during adolescence. Early pubertal development was associated with increase in depressive symptoms only when accompanied by low levels of popularity. High levels of popularity buffered the association between early pubertal development and later depressive symptoms. Unexpectedly, these results were significant both for girls and boys. Results are discussed in terms of dynamic systems theories.

  17. Distributed pubertal growth in girls after acute leukemia: a relative growth hormone insufficiency with late presentation

    Energy Technology Data Exchange (ETDEWEB)

    Moell, C.

    1988-01-01

    Long-term follow-up of growth and development after acute lymphoblastic leukaemia (ALL) in childhood has previously been limited to the prepubertal period. This study describes pubertal growth, final height and the spontaneous secretion of GH in girls treated for ALL, including CNS irradiation with 24 GY. Ten girls, treated earlier for ALL, experienced the menarche at a mean age of 12.2 years. This is significantly earlier than the mean for Swedish girls. Prepubertal growth was near normal after the end of therapy for leukaemia. Mean final height was -1.7 SD, which is 1.5 SD less than at onset and 1.0 SD less than 1 year after the end of treatment. Thirteen other girls had a blunted spontaneous secretion of GH, several years after treatment for ALL; there was no increase in GH secretion during puberty. These results suggest that girls who have been treated for ALL, including CNS irradiation, have a relative GH insufficiency. This insufficiency becomes obvious only when girls cannot respond to the increased need for GH during the pubertal spurt.

  18. Distributed pubertal growth in girls after acute leukemia: a relative growth hormone insufficiency with late presentation

    International Nuclear Information System (INIS)

    Moell, C.

    1988-01-01

    Long-term follow-up of growth and development after acute lymphoblastic leukaemia (ALL) in childhood has previously been limited to the prepubertal period. This study describes pubertal growth, final height and the spontaneous secretion of GH in girls treated for ALL, including CNS irradiation with 24 GY. Ten girls, treated earlier for ALL, experienced the menarche at a mean age of 12.2 years. This is significantly earlier than the mean for Swedish girls. Prepubertal growth was near normal after the end of therapy for leukaemia. Mean final height was -1.7 SD, which is 1.5 SD less than at onset and 1.0 SD less than 1 year after the end of treatment. Thirteen other girls had a blunted spontaneous secretion of GH, several years after treatment for ALL; there was no increase in GH secretion during puberty. These results suggest that girls who have been treated for ALL, including CNS irradiation, have a relative GH insufficiency. This insufficiency becomes obvious only when girls cannot respond to the increased need for GH during the pubertal spurt. (author)

  19. Peer and Individual Risk Factors in Adolescence Explaining the Relationship between Girls' Pubertal Timing and Teenage Childbearing

    Science.gov (United States)

    Hendrick, C. Emily; Cance, Jessica Duncan; Maslowsky, Julie

    2016-01-01

    Girls with early pubertal timing are at elevated risk for teenage childbearing; however, the modifiable mechanisms driving this relationship are not well understood. The objective of the current study was to determine whether substance use, perceived peer substance use, and older first sexual partners mediate the relationships among girls' pubertal timing, sexual debut, and teenage childbearing. Data are from Waves 1 – 15 of the female cohort of the National Longitudinal Surveys of Youth 1997 (NLSY97), a nationwide, ongoing cohort study of U.S. men and women born between 1980 and 1984. The analytic sample (N=2,066) was 12-14 years old in 1997 and ethnically diverse (51% white, 27% black, 22% Latina). Using structural equation modeling, we found substance use in early adolescence and perceived peer substance use each partially mediated the relationships among girls' pubertal timing, sexual debut, and teenage childbearing. Our findings suggest early substance use behavior as one modifiable mechanism to be targeted by interventions aimed at preventing teenage childbearing among early developing girls. PMID:26769576

  20. Pubertal Stress and Nutrition and their Association with Sexual Orientation and Height in the Add Health Data.

    Science.gov (United States)

    Skorska, Malvina N; Bogaert, Anthony F

    2017-01-01

    A number of studies have indicated that gay men tend to be shorter, on average, than heterosexual men. Less evidence exists that lesbian women are taller, on average, than heterosexual women. The most popular explanation of the association between sexual orientation and height involves prenatal factors, such that, for example, gay men may have been exposed to lower than typical androgens during fetal development, which impacts their height and sexual orientation as adults. An alternative explanation involves stress, given that stress has been associated with sexual minority identification and with lower height. Another alternative explanation involves nutrition, although its relationship is less clear with sexual minority identification. Using the Add Health data, which is a large, nationally representative and longitudinal sample of American adolescents (n = 14,786), we tested a mediation model, such that sexual orientation → pubertal stress/nutrition → height. Within men, we found that gay men (n = 126) were shorter, on average, than heterosexual men (n = 6412). None of the 24 pubertal stress-related and 15 pubertal nutrition-related variables assessed in the Add Health data mediated the relationship between sexual orientation and height in men. Within women, lesbians (n = 75) did not differ significantly in stature compared to heterosexual women (n = 6267). Thus, prenatal mechanisms (e.g., hormones, maternal immune response) are likely better candidates for explaining the height difference between gay men and heterosexual men.

  1. Reduced cortical thickness associated with visceral fat and BMI

    Directory of Open Access Journals (Sweden)

    Ralf Veit

    2014-01-01

    Full Text Available Structural brain imaging studies have shown that obesity is associated with widespread reductions in gray matter (GM volume. Although the body mass index (BMI is an easily accessible anthropometric measure, substantial health problems are more related to specific body fat compartments, like visceral adipose tissue (VAT. We investigated cortical thickness measures in a group of 72 healthy subjects (BMI range 20–35 kg/m2, age range 19–50 years. Multiple regression analyses were performed using VAT and BMI as predictors and age, gender, total surface area and education as confounds. BMI and VAT were independently associated with reductions in cortical thickness in clusters comprising the left lateral occipital area, the left inferior temporal cortex, and the left precentral and inferior parietal area, while the right insula, the left fusiform gyrus and the right inferior temporal area showed a negative correlation with VAT only. In addition, we could show significant reductions in cortical thickness with increasing VAT adjusted for BMI in the left temporal cortex. We were able to detect widespread cortical thinning in a young to middle-aged population related to BMI and VAT; these findings show close resemblance to studies focusing on GM volume differences in diabetic patients. This may point to the influence of VAT related adverse effects, like low-grade inflammation, as a potentially harmful factor on brain integrity already in individuals at risk of developing diabetes, metabolic syndromes and arteriosclerosis.

  2. The Report Card on BMI Report Cards.

    Science.gov (United States)

    Thompson, Hannah R; Madsen, Kristine A

    2017-06-01

    Half of states in the USA have legislation requiring that schools conduct body mass index (BMI) screening among students; just under half of these states report results to parents. The effectiveness of school-based BMI screening and reporting in reducing childhood obesity is not established and the practice has raised concerns about the potential for increased weight-based stigmatization. Recent experimental studies of BMI screening and reporting have not demonstrated a positive impact on students' weight status. However, the language and formatting of BMI reports used in studies to date have been suboptimal and have likely limited the potential effectiveness of the practice. This article reviews the recent literature on school-based BMI screening and reporting and highlights important areas for future inquiry. The present review suggests that evidence to date is not sufficient to support definitive conclusions about the value of school-based BMI screening and reporting as a childhood obesity prevention tool.

  3. The mammary gland is a sensitive pubertal target in CD-1 and C57Bl/6 mice following perinatal perfluorooctanoic acid (PFOA) exposure.

    Science.gov (United States)

    Tucker, Deirdre K; Macon, Madisa B; Strynar, Mark J; Dagnino, Sonia; Andersen, Erik; Fenton, Suzanne E

    2015-07-01

    Perfluorooctanoic acid (PFOA) is a developmental toxicant in mice, with varied strain outcomes depending on dose and period of exposure. The impact of PFOA on female mouse pubertal development at low doses (≤1mg/kg) has yet to be determined. Therefore, female offspring from CD-1 and C57Bl/6 dams exposed to PFOA, creating serum concentrations similar to humans, were examined for pubertal onset, including mammary gland development. Pups demonstrated a shorter PFOA elimination half-life than that reported for adult mice. Prenatal exposure to PFOA caused significant mammary developmental delays in female offspring in both strains. Delays started during puberty and persisted into young adulthood; severity was dose-dependent. Also an evaluation of female serum hormone levels and pubertal timing onset revealed no effects of PFOA compared to controls in either strain. These data suggest that the mammary gland is more sensitive to early low level PFOA exposures compared to other pubertal endpoints, regardless of strain. Published by Elsevier Inc.

  4. Effects of age, gender, BMI, and anatomical site on skin thickness in children and adults with diabetes.

    Directory of Open Access Journals (Sweden)

    José G B Derraik

    Full Text Available We aimed to assess the effects of age, sex, body mass index (BMI, and anatomical site on skin thickness in children and adults with diabetes.We studied 103 otherwise healthy children and adolescents with type 1 diabetes aged 5-19 years, and 140 adults with type 1 and type 2 diabetes aged 20-85 years. The thicknesses of both the dermis and subcutis were assessed using ultrasound with a linear array transducer, on abdominal and thigh skin.There was an age-related thickening of both dermis (p<0.0001 and subcutis (p = 0.013 in children and adolescents. Girls displayed a substantial pubertal increase in subcutis of the thigh (+54%; p = 0.048 and abdomen (+68%; p = 0.009. Adults showed an age-related decrease in dermal (p = 0.021 and subcutis (p = 0.009 thicknesses. Pubertal girls had a thicker subcutis than pubertal boys in both thigh (16.7 vs 7.5 mm; p<0.0001 and abdomen (16.7 vs 8.8 mm; p<0.0001. Men had greater thigh dermal thickness than women (1.89 vs 1.65 mm; p = 0.003, while the subcutis was thicker in women in thigh (21.3 vs 17.9 mm; p = 0.012 and abdomen (17.7 vs 9.8 mm; p<0.0001. In boys, men, and women, both dermis and subcutis were thicker on the abdomen compared to thigh; in girls this was only so for dermal thickness. In both children and adults, the skin (dermis and subcutis became steadily thicker with increasing BMI (p<0.0001.Skin thickness is affected by age, pubertal status, gender, BMI, and anatomical site. Such differences may be important when considering appropriate sites for dermal/subcutaneous injections and other transdermal delivery systems.

  5. The Role of BMI1 in CRPC

    Science.gov (United States)

    2017-10-01

    that inhibiting BMI1 decreased prostate cancer tumor growth in VCaP murine xenograft. 15. SUBJECT TERMS: Polycomb, BMI1, Androgen Receptor ...Repressive Complex, Androgen Receptor , Castration- Resistant Prostate Cancer , small molecule inhibitor 4 ACCOMPLISHMENTS A. What were the major...Qi Cao. A Novel Role of BMI1 in Androgen Receptor Pathway. 23rd Prostate Cancer Foundation Annual Scientific Retreat, Oct 26-29, 2016, Carlsbad, CA

  6. Role of amygdala kisspeptin in pubertal timing in female rats.

    Directory of Open Access Journals (Sweden)

    Daniel A Adekunbi

    Full Text Available To investigate the mechanism by which maternal obesity disrupts reproductive function in offspring, we examined Kiss1 expression in the hypothalamic arcuate (ARC and anteroventral periventricular (AVPV nuclei, and posterodorsal medial amygdala (MePD of pre-pubertal and young adult offspring. Sprague-Dawley rats were fed either a standard or energy-dense diet for six weeks prior to mating and throughout pregnancy and lactation. Male and female offspring were weaned onto normal diet on postnatal day (pnd 21. Brains were collected on pnd 30 or 100 for qRT-PCR to determine Kiss1 mRNA levels. Maternal obesity increased Kiss1 mRNA expression in the MePD of pre-pubertal male and female offspring, whereas Kiss1 expression was not affected in the ARC or AVPV at this age. Maternal obesity reduced Kiss1 expression in all three brain regions of 3 month old female offspring, but only in MePD of males. The role of MePD kisspeptin on puberty, estrous cyclicity and preovulatory LH surges was assessed directly in a separate group of post-weanling and young adult female rats exposed to a normal diet throughout their life course. Bilateral intra-MePD cannulae connected to osmotic mini-pumps for delivery of kisspeptin receptor antagonist (Peptide 234 for 14 days were chronically implanted on pnd 21 or 100. Antagonism of MePD kisspeptin delayed puberty onset, disrupted estrous cyclicity and reduced the incidence of LH surges. These data show that the MePD plays a key role in pubertal timing and ovulation and that maternal obesity may act via amygdala kisspeptin signaling to influence reproductive function in the offspring.

  7. Peer substance use as a mediator between early pubertal timing and adolescent substance use: longitudinal associations and moderating effect of maltreatment.

    Science.gov (United States)

    Negriff, Sonya; Trickett, Penelope K

    2012-11-01

    Early pubertal timing has received considerable empirical support as a risk for adolescent substance use. However, few studies have examined the mediators linking these variables. Therefore, the aims of this study were (1) to examine peer substance use as a mediator between pubertal timing and adolescent substance use longitudinally and (2) to test gender and maltreatment experience as moderators of the mediational model. Data were obtained from time 1, 2, and 3 of a longitudinal study of maltreatment and development. At time 1 the sample was comprised of 303 maltreated and 151 comparison children aged 9-13 years (213 females and 241 males). Longitudinal mediation was tested using structural equation modeling and moderating effects were tested using multiple group analysis. Peer substance use mediated the relationship between early pubertal timing and later adolescent substance use for the total sample. Moderation analyses indicated this significant indirect effect did not differ for males and females. However, it did differ for maltreated versus comparison adolescents with the mediational effect only remaining significant for the comparison group. This is one of the first studies to examine peer substance use as a mediator of pubertal timing and adolescent substance use using a longitudinal design. Early maturing males are at equal risk to early maturing females for interacting with peers that may draw them into substance use. Additionally, the findings indicate that while peers are mediators for comparison adolescents a different mechanism may link early puberty to substance use for maltreated adolescents. Copyright © 2012 Elsevier Ireland Ltd. All rights reserved.

  8. The Role of Peer Stress and Pubertal Timing on Symptoms of Psychopathology during Early Adolescence

    Science.gov (United States)

    Sontag, Lisa M.; Graber, Julia A.; Clemans, Katherine H.

    2011-01-01

    Stress is known to amplify the link between pubertal timing and psychopathology. However, few studies have examined the role of peer stress as a context for this link. The present study examined the interaction between perceived pubertal timing and peer stress on symptoms of psychopathology in early adolescence. The sample consisted of 264…

  9. Blood spotting on underpants: Case report of urethral prolapse in a pre-pubertal Chinese girl

    Directory of Open Access Journals (Sweden)

    Hei Yi Wong

    2015-05-01

    Full Text Available Urethral prolapse is a rare urological condition with non-specific clinical manifestations which is mostly seen in pre-pubertal black girls and postmenopausal woman. The exact etiology still remains unknown. We herein present a case report of urethral mucosa prolapse in a 5 year-old Chinese pre-pubertal girl.

  10. Minimizing embarrassment: boys' experiences of pubertal changes.

    Science.gov (United States)

    Flaming, D; Morse, J M

    1991-01-01

    As very little is known about boys' subjective and emotional experiences when going through puberty, the qualitative research method of grounded theory was used in this study to address the question: "What is the experience of the physical maturational changes in male adolescents?" A Basic Social Psychological Process emerged, Minimizing Embarrassment, with four stages: waiting for the change, noticing the change, dealing with the change, and feeling comfortable with the change. Boys developed expectations from listening to others, by looking at older males, and by wondering and imagining what the changes would eventually be like for them. After developing these expectations, they compared their physical changes to others and to their own expectations. If the boys felt they were different from their peers, they worried about this difference. They used strategies such as avoiding, pretending, and joking to avoid embarrassment or to deal with embarrassing situations. If the boys felt they were "normal," they accepted the fact that they were maturing properly.

  11. Gingival crevicular fluid alkaline phosphatase activity in relation to pubertal growth spurt and dental maturation: A multiple regression study

    Directory of Open Access Journals (Sweden)

    Perinetti, G.

    2016-04-01

    Full Text Available Introduction: The identification of the onset of the pubertal growth spurt has major clinical implications when dealing with orthodontic treatment in growing subjects. Aim: Through multivariate methods, this study evaluated possible relationships between the gingival crevicular fluid (GCF alkaline phosphatase (ALP activity and pubertal growth spurt and dentition phase. Materials and methods: One hundred healthy growing subjects (62 females, 38 males; mean age, 11.5±2.4 years were enrolled into this doubleblind, prospective, cross-sectional-design study. Phases of skeletal maturation (pre - pubertal, pubertal, post - pubertal was assessed using the cervical vertebral maturation method. Samples of GCF for the ALP activity determination were collected at the mesial and distal sites of the mandibular central incisors. The phases of the dentition were recorded as intermediate mixed, late mixed, or permanent. A multinomial multiple logistic regression model was used to assess relationships of the enzymatic activity to growth phases and dentition phases. Results: The GCF ALP activity was greater in the pubertal growth phase as compared to the pre - pubertal and post - pubertal growth phases. Significant adjusted odds ratios for the GCF ALP activity for the pre - pubertal and post - pubertal subjects, in relation to the pubertal group, were 0.76 and 0.84, respectively. No significant correlations were seen for the dentition phase. Conclusions: The GCF ALP activity is a valid candidate as a non - invasive biomarker for the identification of the pubertal growth spurt irrespective of the dentition phase.

  12. Granular Vulvovaginitis Syndrome in Nelore pubertal and post pubertal replacement heifers under tropical conditions: role of Mycoplasma spp., Ureaplasma diversum and BHV-1.

    Science.gov (United States)

    Gambarini, M L; Kunz, T L; Oliveira Filho, B D; Porto, R N G; Oliveira, C M G; Brito, W M E D; Viu, M A O

    2009-10-01

    In order to determine the role of Mycoplasma spp, Ureaplasma diversum and BHV-1 as causal agents of Granular Vulvovaginitis Syndrome in Nelore heifers raised under tropical conditions and based on the hypothesis that stressful conditions during puberty or breeding season would be a determinant factor for the infection, 340 heifers not vaccinated against BHV-1 were divided in Post-pubertal, in the beginning of the first breeding season, and Pubertal heifers. The vaginal lesion score (VLS) Grade 1 to 4 was giving according to lesion area and severity. Vaginal mucus was used to isolate Mycoplasma spp., Ureaplasma diversum and BHV-1. The predominant VLS was 2. No sample was positive for BHV-1; 48% were positive for Mycoplasma spp., Ureaplasma diversum, or both, with predominance of Ureaplasma diversum. Serum neutralization for BHV-1 showed more positive animals in pubertal group (23%); 3 of the paired sera demonstrated seroconversion. These data indicated that post-pubertal and pubertal Nelore heifers raised under extensive conditions are more susceptible to Mycoplasma spp. and Ureaplasma diversum. The hypothesis that the stress of pubertal period could lead to an acute vaginal infection by HBV-1 was not proofed.

  13. The Prevalence of Obesity as Indicated by BMI and Waist ...

    African Journals Online (AJOL)

    Background: The prevalence of overweight and obesity in most developed countries and in urban areas of many less developed countries has been increasing markedly over the past twenty years. This study\\'s aims were to determine the prevalence of obesity using BMI and waist circumference among Nigerian adults ...

  14. Change in BMI accurately predicted by social exposure to acquaintances.

    Science.gov (United States)

    Oloritun, Rahman O; Ouarda, Taha B M J; Moturu, Sai; Madan, Anmol; Pentland, Alex Sandy; Khayal, Inas

    2013-01-01

    Research has mostly focused on obesity and not on processes of BMI change more generally, although these may be key factors that lead to obesity. Studies have suggested that obesity is affected by social ties. However these studies used survey based data collection techniques that may be biased toward select only close friends and relatives. In this study, mobile phone sensing techniques were used to routinely capture social interaction data in an undergraduate dorm. By automating the capture of social interaction data, the limitations of self-reported social exposure data are avoided. This study attempts to understand and develop a model that best describes the change in BMI using social interaction data. We evaluated a cohort of 42 college students in a co-located university dorm, automatically captured via mobile phones and survey based health-related information. We determined the most predictive variables for change in BMI using the least absolute shrinkage and selection operator (LASSO) method. The selected variables, with gender, healthy diet category, and ability to manage stress, were used to build multiple linear regression models that estimate the effect of exposure and individual factors on change in BMI. We identified the best model using Akaike Information Criterion (AIC) and R(2). This study found a model that explains 68% (pchange in BMI. The model combined social interaction data, especially from acquaintances, and personal health-related information to explain change in BMI. This is the first study taking into account both interactions with different levels of social interaction and personal health-related information. Social interactions with acquaintances accounted for more than half the variation in change in BMI. This suggests the importance of not only individual health information but also the significance of social interactions with people we are exposed to, even people we may not consider as close friends.

  15. Change in BMI accurately predicted by social exposure to acquaintances.

    Directory of Open Access Journals (Sweden)

    Rahman O Oloritun

    Full Text Available Research has mostly focused on obesity and not on processes of BMI change more generally, although these may be key factors that lead to obesity. Studies have suggested that obesity is affected by social ties. However these studies used survey based data collection techniques that may be biased toward select only close friends and relatives. In this study, mobile phone sensing techniques were used to routinely capture social interaction data in an undergraduate dorm. By automating the capture of social interaction data, the limitations of self-reported social exposure data are avoided. This study attempts to understand and develop a model that best describes the change in BMI using social interaction data. We evaluated a cohort of 42 college students in a co-located university dorm, automatically captured via mobile phones and survey based health-related information. We determined the most predictive variables for change in BMI using the least absolute shrinkage and selection operator (LASSO method. The selected variables, with gender, healthy diet category, and ability to manage stress, were used to build multiple linear regression models that estimate the effect of exposure and individual factors on change in BMI. We identified the best model using Akaike Information Criterion (AIC and R(2. This study found a model that explains 68% (p<0.0001 of the variation in change in BMI. The model combined social interaction data, especially from acquaintances, and personal health-related information to explain change in BMI. This is the first study taking into account both interactions with different levels of social interaction and personal health-related information. Social interactions with acquaintances accounted for more than half the variation in change in BMI. This suggests the importance of not only individual health information but also the significance of social interactions with people we are exposed to, even people we may not consider as

  16. Bmi1 Is Required for Hedgehog Pathway-Driven Medulloblastoma Expansion

    Directory of Open Access Journals (Sweden)

    Lowell Evan Michael

    2008-12-01

    Full Text Available Inappropriate Hedgehog (Hh signaling underlies development of a subset of medulloblastomas, and tumors with elevated HH signaling activity express the stem cell self-renewal gene BMI1. To test whether Bmi1 is required for Hh-driven medulloblastoma development, we varied Bmi1 gene dosage in transgenic mice expressing an oncogenic Hh effector, SmoA1, driven by a glial fibrillary acidic protein (GFAP promoter. Whereas 100% of SmoA1; Bmi1+/+ or SmoA1;Bmi1+/- mice examined between postnatal (P days 14 and 26 had typical medulloblastomas (N = 29, tumors were not detected in any of the SmoA1;Bmi1-/- animals examined (N = 6. Instead, small ectopic collections of cells were present in the region of greatest tumor load in SmoA1 animals, suggesting that medulloblastomas were initiated but failed to undergo expansion into frank tumors. Cells within these Bmi1-/- lesions expressed SmoA1 but were largely nonproliferative, in contrast to cells in Bmi1+/+ tumors (6.2% vs 81.9% PCNA-positive, respectively. Ectopic cells were negative for the progenitor marker nestin, strongly GFAP-positive, and highly apoptotic, relative to Bmi1+/+ tumor cells (29.6% vs 6.3% TUNEL-positive. The alterations in proliferation and apoptosis in SmoA1;Bmi1-/- ectopic cells are associated with reduced levels of Cyclin D1 and elevated expression of cyclin-dependent kinase inhibitor p19Arf, two inversely regulated downstream targets of Bmi1. These data provide the first demonstration that Bmi1 is required for spontaneous de novo development of a solid tumor arising in the brain, suggest a crucial role for Bmi1-dependent, nestin-expressing progenitor cells in medulloblastoma expansion, and implicate Bmi1 as a key factor required for Hh pathway-driven tumorigenesis.

  17. Expression of Bmi-1 is a prognostic marker in bladder cancer

    Directory of Open Access Journals (Sweden)

    Xu Li-Hua

    2009-02-01

    Full Text Available Abstract Background The molecular mechanisms of the development and progression of bladder cancer are poorly understood. The objective of this study was to analyze the expression of Bmi-1 protein and its clinical significance in human bladder cancer. Methods We examined the expression of Bmi-1 mRNA and Bmi-1 protein by RT-PCR and Western blot, respectively in 14 paired bladder cancers and the adjacent normal tissues. The expression of Bmi-1 protein in 137 specimens of bladder cancer and 30 specimens of adjacent normal bladder tissue was determined by immunohistochemistry. Statistical analyses were applied to test the relationship between expression of Bmi-1, and clinicopathologic features and prognosis. Results Expression of Bmi-1 mRNA and protein was higher in bladder cancers than in the adjacent normal tissues in 14 paired samples (P P P P P > 0.5. In superficial bladder cancers, the expression of Bmi-1 protein in recurrent cases was higher than in recurrence-free cases (62.5% versus 13.7%, P P P > 0.05. Five-year survival in the group with higher Bmi-1 expression was 50.8%, while it was 78.5% in the group with lower Bmi-1 expression (P P Conclusion Expression of Bmi-1 was greater in bladder cancers than in the adjacent normal tissues. The examination of Bmi-1 protein expression is potentially valuable in prognostic evaluation of bladder cancer.

  18. Postscreening follow-up of the Finnish Prostate Cancer Screening Trial on putative prostate cancer risk factors: vitamin and mineral use, male pattern baldness, pubertal development and non-steroidal anti-inflammatory drug use.

    Science.gov (United States)

    Sarre, Sami; Määttänen, Liisa; Tammela, Teuvo L J; Auvinen, Anssi; Murtola, Teemu J

    2016-08-01

    Objective The etiology of prostate cancer (PCa) is still unclear. This study aimed to investigate the association between PCa risk and the indicators of endogenous androgen production at puberty, male pattern baldness, over-the-counter use of non-steroidal anti-inflammatory drugs and vitamin supplement use. Materials and methods Participants in the third round of the Finnish Prostate Cancer Screening Trial were sent a survey on possible PCa risk factors and 11,795 out of 12,740 (93%) men returned the questionnaire. PCa cases were identified from the Finnish Cancer Registry. Results During the median follow-up of 6.6 years, 757 PCa cases were diagnosed and 21 men died from PCa. Compared to earlier onset, puberty onset after 15 years of age was associated with a borderline significant decrease in PCa risk [hazard ratio (HR) 0.87, 95% confidence interval (CI) 0.75-1.00] but not with PCa mortality. Weekly use of ibuprofen was associated with an increased risk of PCa overall (HR 1.43, 95% CI 1.08-1.91) and with metastatic PCa (HR 1.49, 95% CI 1.12-1.99) compared to less frequent use. No statistically significant association was found between vitamin use and PCa. Conclusions This study suggests that the timing of initiation of endogenous androgen production at puberty may have importance for later PCa development. Current use of over-the-counter ibuprofen is associated with an increased risk of PCa. There was no evidence of any protective effects of vitamin use on PCa risk.

  19. Vapreotide: BMY 41606, RC 160, Sanvar.

    Science.gov (United States)

    2003-01-01

    Vapreotide [Octastatin, Sanvar, RC 160, BMY 41606] is a somatostatin analogue developed at Tulane University School of Medicine, New Orleans, USA, which holds patent rights for vapreotide. Vapreotide provides a much higher metabolic stability than its parent compound. Vapreotide was licensed to Debiopharm for development in Europe. Vapreotide is usually administered SC although a slow-release IM formulation is also available. Other sustained-release formulations are under development. H3 Pharma plans to sign agreements for all indications in the core markets of North America, Europe and in non-core geographic regions during 2003. H3 Pharma will also seek to obtain registration and early market entry in non-core countries with help from partners. Sanvar Immediate Release (IR) has been submitted for approval within the European Union for the treatment of acute oesophageal variceal bleeding (EVB). Sanvar IR has been awarded orphan drug status in the US for EVB. In July 2003, H3 Pharma received written confirmation from the US FDA that the dossier for Sanvar is fileable for registration in the United States for the treatment of esophageal variceal bleeding (EVB). The Sanvar IR (immediate-release) formulation is expected to enter the US market by late 2004. H3 Pharma expects to file for Latin American registration for this indication in the second half of 2003, with registrations in other regions to follow. Sanvar SR has been submitted for Orphan Drug designation.

  20. Pubertal development of penile Nitric Oxide Synthase (NOS ...

    African Journals Online (AJOL)

    Conclusion: The number of NADPH-positive fibers increases with age; however similar tumescence was recorded following electrostimulation in all age groups. NOS-nerve growth correlates with serum testosterone level. The increase of NADPH-positive fibers was accompanied by a decrease in the delay of onset of penile ...

  1. Pubertal Development and Peer Influence on Risky Decision Making

    Science.gov (United States)

    Kretsch, Natalie; Harden, Kathryn Paige

    2014-01-01

    Adolescents engage in more risky behavior when they are with peers and show, on average, heightened susceptibility to peer influence relative to children and adults. However, individual differences in susceptibility to peer influence are not well understood. The current study examined whether the effect of peers on adolescents' risky decision…

  2. Pubertal Development and Traditional Support Systems in Africa: An ...

    African Journals Online (AJOL)

    ... modèles dynamiques adéquats du développement humain. L'étude se termine en affirmant que l'exigence essentielle qui permettra d'assurer un développement sain de l'adolescent pourra être satisfaite à travers l'effort combiné d'un nombre d'institutions pivotes, à savoir la famille, les institutions traditionnelles et l'école ...

  3. Original Article Pubertal Development of Penile Nitric Oxide ...

    African Journals Online (AJOL)

    mn

    penile tissue in different age groups in the rat and to measure serum testosterone levels ... shaft specimen was taken for nicotinamide adenine dinucleotide phosphate (NADPH) diaphorase ..... The rat as a model for the study of penile erection.

  4. Association between Infancy BMI Peak and Body Composition and Blood Pressure at Age 5–6 Years

    Science.gov (United States)

    Hof, Michel H. P.; Vrijkotte, Tanja G. M.; de Hoog, Marieke L. A.; van Eijsden, Manon; Zwinderman, Aeilko H.

    2013-01-01

    Introduction The development of overweight is often measured with the body mass index (BMI). During childhood the BMI curve has two characteristic points: the adiposity rebound at 6 years and the BMI peak at 9 months of age. In this study, the associations between the BMI peak and body composition measures and blood pressure at age 5–6 years were investigated. Methods Measurements from the Amsterdam Born Children and their Development (ABCD) study were available for this study. Blood pressure (systolic and diastolic) and body composition measures (BMI, waist-to-height ratio, fat percentage) were gathered during a health check at about 6 years of age (n = 2822). All children had multiple BMI measurements between the 0–4 years of age. For boys and girls separately, child-specific BMI peaks were extracted from mixed effect models. Associations between the estimated BMI peak and the health check measurements were analysed with linear models. In addition, we investigated the potential use of the BMI at 9 months as a surrogate measure for the magnitude of the BMI peak. Results After correction for the confounding effect of fetal growth, both timing and magnitude of the BMI peak were significantly and positively associated (pBMI peak showed no direct association with blood pressure at the age 5–6 year, but was mediated by the current BMI. The correlation between the magnitude of the BMI peak and BMI at 9 months was approximately 0.93 and similar associations with the measures at 5–6 years were found. Conclusion The magnitude of the BMI peak was associated with body composition measures at 5–6 years of age. Moreover, the BMI at 9 months could be used as surrogate measure for the magnitude of the BMI peak. PMID:24324605

  5. BMI Trajectories from Birth to Young Adulthood.

    Science.gov (United States)

    McGinty, Shannon M; Osganian, Stavroula K; Feldman, Henry A; Milliren, Carly E; Field, Alison E; Richmond, Tracy K

    2018-04-19

    This study aimed to compare BMI trajectories from childhood to early adulthood in those with overweight and/or obesity versus severe obesity. Longitudinal BMI values (2,542 measurements) were calculated from measured heights and weights for 103 children, adolescents, or young adults with overweight, obesity, or severe obesity. Segmented regression with splines was used to model BMI trajectories. Sixty-nine participants were classified as ever having severe obesity versus 34 who never had severe obesity. Trajectories and slopes did not differ by sex or race/ethnicity. Compared with those who never had severe obesity, BMI was higher in the group with severe obesity at all ages, and BMI slope was higher for those with severe obesity at age 14 (P = 0.002), with peak slope occurring later (18 years vs. 16 years) and higher (4.5 ± 0.5 kg/m 2 /y vs. 2.9 ± 0.5 kg/m 2 /y; P BMI fell below zero by the mid-20s (-0.3 ± 0.6 kg/m 2 /y); in those with severe obesity, BMI slope never reached zero (0.9 ± 0.5 kg/m 2 /y). Youth with severe obesity, compared with their peers without, started with higher BMIs, had more rapid rates of BMI increase beginning at age 14, as well as a higher peak and longer period of increase, and never achieved weight stabilization. © 2018 The Obesity Society.

  6. The Predictive Factors for Diabetic Remission in Chinese Patients with BMI > 30 kg/m2 and BMI < 30 kg/m2 Are Different.

    Science.gov (United States)

    Liang, Hui; Cao, Qing; Liu, Huan; Guan, Wei; Wong, Claudia; Tong, Daniel

    2018-01-15

    Roux-en-Y gastric bypass has been proven to be beneficial for patients with obesity and type 2 diabetes mellitus (T2DM). In less-obese patient (BMI 30-35 kg/m 2 ), surgical treatment is indicated when medication fails to control the T2DM. Asian develops diabetes at a lower BMI. For lower-BMI patients, the rate of diabetes amelioration varies significantly with patients of higher BMI after surgical treatment. The factors that contribute to the post-operative diabetes response rate in lower-BMI patients have not been elucidated. Between 2010 and 2014, a total of 144 patients who underwent gastric bypass for the treatment of T2DM were included for study. Patients were divided into two groups for subgroup analysis, namely BMI > 30 kg/m 2 and BMI BMI group (BMI > 30 kg/m 2 ) was 80% (n = 90) whereas for the lower BMI (BMI BMI group, low HbA1c and high fasting C-peptide are predictive factors whereas for lower-BMI group, along with elevated C-peptide level, disease duration is the positive predictive factor for DM remission. Patients with BMI > 30 kg/m 2 and those with BMI BMI patients while duration of diabetes is for high-low-BMI patients. C-peptide is a predictor of remission in both groups. Further large-scale studies are required to define the predictors of diabetes remission after gastric bypass in low- and high-BMI patients.

  7. Course and forecast of the hypothalamic pubertal syndrome

    International Nuclear Information System (INIS)

    Kayusheva, I.V.

    1987-01-01

    A total of 223 patients with the hypothalamic pubertal syndrome (HPS) were followed up for 1 to 22 years. The course of HPS was regressive, stable , recurrent or progressive and dependent on the initial depth and spread of hypothalamic lesion, repeated unfavourable hypothalamic exposures, and timely and regular treatment. HPS outcomes were followed up in 190 cases. The recovery was complete in 21.05%, obesity alone persisted in 10.53%, vegetovascular dystonia was persistent in 7.36%, and polycystic ovaries in 5.79%. Neuroendocrine hypothalamic syndrome was the most common (50.53%) HPS outcome. Hormone levels in blood were investigated using radioimmunoassay in patients with neuroendocrine form of HPS

  8. Social disparities in body mass index (BMI) trajectories among Chinese adults in 1991-2011.

    Science.gov (United States)

    Fang, Changchun; Liang, Ying

    2017-08-16

    Obesity is a serious public health problem in China. The relationship between obesity and socio-economic status (SES) is changing and affected by uncertainty, particularly, in developing countries. The sex-related differences in body mass index (BMI) trajectories are controversial and require substantial empirical data for updating and enriching. This study examined the relationship between SES and BMI in Chinese adults from a dynamic perspective using longitudinal data (1991-2011) from the China Health and Nutrition Survey (CHNS). Then, sex-related differences were determined. A hierarchical linear model was used. SES positively affected the male BMI changes, with faster BMI growth rates in the high-SES males over the past 20 years. By contrast, female BMI was only affected by BMI baseline and residential area. Specifically, greater BMI baseline led to greater BMI growth rate and earlier BMI decline. In the past 20 years, the BMI growth rate has been greater in the urban females than in the rural females. The relationship between SES and obesity is complex in China, and a substantial sex-related difference exists. We argue that this large sex-related difference is due to the rapid economic and social changes that have affected national health and increased the gender inequality and social role restrictions in females. We provide insights for further research and policy recommendations.

  9. Expression of Bmi-1 is a prognostic marker in bladder cancer

    International Nuclear Information System (INIS)

    Qin, Zi-Ke; Zeng, Mu-Sheng; Yang, Jian-An; Ye, Yun-lin; Zhang, Xing; Xu, Li-Hua; Zhou, Fang-Jian; Han, Hui; Liu, Zuo-Wei; Song, Li-Bing

    2009-01-01

    The molecular mechanisms of the development and progression of bladder cancer are poorly understood. The objective of this study was to analyze the expression of Bmi-1 protein and its clinical significance in human bladder cancer. We examined the expression of Bmi-1 mRNA and Bmi-1 protein by RT-PCR and Western blot, respectively in 14 paired bladder cancers and the adjacent normal tissues. The expression of Bmi-1 protein in 137 specimens of bladder cancer and 30 specimens of adjacent normal bladder tissue was determined by immunohistochemistry. Statistical analyses were applied to test the relationship between expression of Bmi-1, and clinicopathologic features and prognosis. Expression of Bmi-1 mRNA and protein was higher in bladder cancers than in the adjacent normal tissues in 14 paired samples (P < 0.01). By immunohistochemical examination, five of 30 adjacent normal bladder specimens (16.7%) versus 75 of 137 bladder cancers (54.3%) showed Bmi-1 protein expression (P < 0.05). Bmi-1 protein expression was intense in 20.6%, 54.3%, and 78.8% of tumors of histopathological stages G1, G2, and G3, respectively (P < 0.05). Expression of Bmi-1 protein was greater in invasive bladder cancers than in superficial bladder cancers (81.5% versus 32.5%, P < 0.05). In invasive bladder cancers, the expression of Bmi-1 protein in progression-free cancers was similar to that of cancers that have progressed (80.0% versus 82.4%, P > 0.5). In superficial bladder cancers, the expression of Bmi-1 protein in recurrent cases was higher than in recurrence-free cases (62.5% versus 13.7%, P < 0.05). Bmi-1 expression was positively correlated with tumor classification and TNM stage (P < 0.05), but not with tumor number (P > 0.05). Five-year survival in the group with higher Bmi-1 expression was 50.8%, while it was 78.5% in the group with lower Bmi-1 expression (P < 0.05). Patients with higher Bmi-1 expression had shorter survival time, whereas patients with lower Bmi-1 expression had longer

  10. Pubertal-related changes in hypothalamic-pituitary-adrenal axis reactivity and cytokine secretion in response to an immunological stressor.

    Science.gov (United States)

    Goble, K H; Bain, Z A; Padow, V A; Lui, P; Klein, Z A; Romeo, R D

    2011-02-01

    Pubertal development is marked by profound changes in stress reactivity. For example, following a brief stressor, such as foot shock, ether inhalation or restraint, prepubertal rats display a prolonged adrenocorticotrophic hormone (ACTH) and corticosterone response that takes twice as long to return to baseline compared to adults. Pubertal-related differences in the recovery of the hormonal stress response following a more protracted systemic stressor, such as an immunological challenge, have not yet been investigated. Moreover, it is unclear whether an immunological stressor leads to a differential cytokine response in animals before and after pubertal maturation. To examine these issues, we used a single injection of lipopolysaccharide (LPS; 0.1 mg/kg) to induce a hormonal stress and innate immune response and measured plasma ACTH, corticosterone, and the pro-inflammatory cytokines interleukin (IL)-1β and IL-6 in prepubertal and adult male rats 0, 2, 4, 6, 8, or 24 h after LPS exposure. In a follow-up experiment, we assessed neural activation, as indexed by FOS immunohistochemistry, in the paraventricular nucleus of the hypothalamus (PVN) in prepubertal and adult males 0, 4, 8, or 24 h after a 0.1 mg/kg injection of LPS. By contrast to the prolonged response observed in prepubertal animals following a variety of acute stressors, we found that corticosterone and IL-6 responses induced by LPS recover toward baseline faster in prepubertal compared to adult rats. Along with these different peripheral responses, we also found that LPS-induced neural activation in the PVN of prepubertal animals showed a faster return to baseline compared to adults. Together, these data indicate that prepubertal and adult animals react in distinct ways, both peripherally and centrally, to an immunological stressor. © 2011 The Authors. Journal of Neuroendocrinology © 2011 Blackwell Publishing Ltd.

  11. Extensive BMI Gain in Puberty is Associated with Lower Increments in Bone Mineral Density in Estonian Boys with Overweight and Obesity: A 3-Year Longitudinal Study.

    Science.gov (United States)

    Mengel, Eva; Tillmann, Vallo; Remmel, Liina; Kool, Pille; Purge, Priit; Lätt, Evelin; Jürimäe, Jaak

    2017-08-01

    The aim of this 3-year prospective study was to examine changes in bone mineral characteristics during pubertal maturation in boys with different BMI values at the beginning of puberty and with different BMI increments during puberty. 26 boys with overweight and obesity (OWB) and 29 normal weight boys (NWB) were studied yearly for 3 years from the age of 11 years to measure the changes in different bone mineral characteristics. The OWB group was further divided into two subgroups according to extensive or non-extensive BMI increment during 3-year period. OWB had higher (P BMC), TB BMC for height, lumbar spine (LS) BMD, and LS BMC compared to NWB. Throughout the study period, OWB gained more TB BMD (P = 0.0001), TB BMC (P = 0.0048), TB BMC for height (P = 0.0124), LS BMD (P = 0.0029), and LS BMC (P = 0.0022) compared to NWB. Also during the study period, TB BMD (P = 0.0065), TB BMC (P = 0.0141), TB BMC for height (P = 0.0199), LS BMD (P = 0.0066), LS apparent volumetric BMD (BMAD) (P = 0.0075), and LS BMC (P = 0.017) increased significantly less in those OWB whose BMI increased more extensively. Extensive BMI gain is associated with lower increments in bone mineral characteristics in boys with overweight and obesity. Unfavorable increment in total body fat mass and percentage during pubertal years could be one reason for that.

  12. Insulin resistance in obese pre-pubertal children: Relation to body ...

    African Journals Online (AJOL)

    Secondary outcome is to determine the frequency of the metabolic syndrome components. Subjects and methods: Twenty-three pre-pubertal obese children were ... oral glucose tolerance testing (OGTT) and DXA scan for body composition.

  13. Urinary phthalate excretion in 555 healthy Danish boys with and without pubertal gynaecomastia

    DEFF Research Database (Denmark)

    Mieritz, Mikkel G; Frederiksen, Hanne; Sørensen, Kaspar

    2012-01-01

    Pubertal gynaecomastia is a clinical sign of an oestrogen-androgen imbalance, which occurs in 40-60% of adolescent Caucasian boys. In most cases no underlying endocrinopathy can be identified. A recent study reports higher plasma phthalate levels in Turkish boys with pubertal gynaecomastia....... Therefore, we asked whether there was an association between concurrent measures of urinary phthalate metabolites and pubertal timing as well as the presence of gynaecomastia in otherwise healthy boys. We studied a total of 555 healthy boys (age 6.07-19.83 years) as part of the COPENHAGEN Puberty Study....... Anthropometry and pubertal stages (PH1-6 and G1-5) were evaluated, and the presence of gynaecomastia was assessed. Non-fasting blood samples were analysed for serum testosterone and morning urine samples were analysed for the total content of 12 phthalate metabolites (MEP, MnBP, MiBP, MBzP, MEHP, MEHHP, MEOHP...

  14. A pre-pubertal girl with giant juvenile fibroadenoma: A rare case report

    Directory of Open Access Journals (Sweden)

    Kumar Gaurav

    2015-01-01

    Conclusion: Through this case we want to emphasize that these giant benign neoplasms should be suspected in any pre-pubertal girl with breast lump and should always be treated with breast conserving surgery.

  15. Pubertal testosterone influences threat-related amygdala-orbitofrontal cortex coupling.

    Science.gov (United States)

    Spielberg, Jeffrey M; Forbes, Erika E; Ladouceur, Cecile D; Worthman, Carol M; Olino, Thomas M; Ryan, Neal D; Dahl, Ronald E

    2015-03-01

    Growing evidence indicates that normative pubertal maturation is associated with increased threat reactivity, and this developmental shift has been implicated in the increased rates of adolescent affective disorders. However, the neural mechanisms involved in this pubertal increase in threat reactivity remain unknown. Research in adults indicates that testosterone transiently decreases amygdala-orbitofrontal cortex (OFC) coupling. Consequently, we hypothesized that increased pubertal testosterone disrupts amygdala-OFC coupling, which may contribute to developmental increases in threat reactivity in some adolescents. Hypotheses were tested in a longitudinal study by examining the impact of testosterone on functional connectivity. Findings were consistent with hypotheses and advance our understanding of normative pubertal changes in neural systems instantiating affect/motivation. Finally, potential novel insights into the neurodevelopmental pathways that may contribute to adolescent vulnerability to behavioral and emotional problems are discussed. © The Author (2014). Published by Oxford University Press. For Permissions, please email: journals.permissions@oup.com.

  16. Recent changes in pubertal timing in healthy Danish boys: associations with body mass index

    DEFF Research Database (Denmark)

    Sørensen, Kaspar; Aksglaede, Lise; Petersen, Jørgen Holm

    2010-01-01

    In the 1990s, the American population-based study NHANES III renewed the focus on possible secular trends in male puberty. However, no conclusions could be made on pubertal onset due to the lack of compatible data.......In the 1990s, the American population-based study NHANES III renewed the focus on possible secular trends in male puberty. However, no conclusions could be made on pubertal onset due to the lack of compatible data....

  17. GFAP-Cre-mediated transgenic activation of Bmi1 results in pituitary tumors.

    Directory of Open Access Journals (Sweden)

    Bart A Westerman

    Full Text Available Bmi1 is a member of the polycomb repressive complex 1 and plays different roles during embryonic development, depending on the developmental context. Bmi1 over expression is observed in many types of cancer, including tumors of astroglial and neural origin. Although genetic depletion of Bmi1 has been described to result in tumor inhibitory effects partly through INK4A/Arf mediated senescence and apoptosis and also through INK4A/Arf independent effects, it has not been proven that Bmi1 can be causally involved in the formation of these tumors. To see whether this is the case, we developed two conditional Bmi1 transgenic models that were crossed with GFAP-Cre mice to activate transgenic expression in neural and glial lineages. We show here that these mice generate intermediate and anterior lobe pituitary tumors that are positive for ACTH and beta-endorphin. Combined transgenic expression of Bmi1 together with conditional loss of Rb resulted in pituitary tumors but was insufficient to induce medulloblastoma therefore indicating that the oncogenic function of Bmi1 depends on regulation of p16(INK4A/Rb rather than on regulation of p19(ARF/p53. Human pituitary adenomas show Bmi1 overexpression in over 50% of the cases, which indicates that Bmi1 could be causally involved in formation of these tumors similarly as in our mouse model.

  18. Longitudinal association between marital disruption and child BMI and obesity.

    Science.gov (United States)

    Arkes, Jeremy

    2012-08-01

    This research examines whether family disruptions (i.e., divorces and separation) contribute to children's weight problems. The sample consists of 7,299 observations for 2,333 children, aged 5-14, over the 1986-2006 period, from a US representative sample from the Child and Young Adult Survey accompanying the National Longitudinal Survey of Youth (NLSY). The study uses individual-fixed-effects models in a longitudinal framework to compare children's BMI and weight problems before and after a disruption. Furthermore, besides doing a before-after comparison for children, the study also estimates the effects at various periods relative to the disruption in order to examine whether children are affected before the disruption and whether any effects change as time passes from the disruption, as some effects may be temporary or slow to develop. Despite having a larger sample than the previous studies, the results provide no evidence that, on average, children's BMI and BMI percentile scores (measured with continuous outcomes) are affected before the disruption, after the disruption, and as time passes from the disruption, relative to a baseline period a few years before the disruption. However, children experiencing a family disruption do have an increased risk of obesity (having a BMI percentile score of 95 or higher) in the two years leading up to the disruption as well as after the disruption, and as time passes from the disruption.

  19. [Evaluation of nutrition mode and nutritional status and pro health education of children during the period of pubertal spurt in the city of Szczecin].

    Science.gov (United States)

    Goluch-Koniuszy, Zuzanna; Friedrich, Mariola; Radziszewska, Magdalena

    2009-01-01

    This research was aimed at evaluation of the method of nutrition and the state of nutrition in the children aged 13 during the period of pubertal spurt who had their body mass, body height and waist measurement defined. These values led to calculation of BMI, WC, and WHtR indicators, which were related to centile distribution of children from Warszawa and Lódź. Only in 63.6% of girls and 68.9% of boys from Szczecin schools the value of BMI was proper. The problem of accumulation of fat tissue (WC > or = 90 c) around the waist refers to nearly 14% of girls and 9.4% of boys. The value of the indicator WHtR > or = 90 c was found in 11% of the children under research. Children with overweight (BMI 90-97 c) and obesity (BMI > or = 97 c) were selected based on the value of BMI indicator. Their menus of three chosen at random weekdays were obtained. Analysis of the nutrition method of children with overweight and obesity showed low energy value of the diet, general protein, complex carbohydrates, cellulose, mineral components (Ca, Mg, Fe, Cu, Zn), A, E (girls), C (boys), group B vitamins and also liquids deficiency. The children have undergone a special pro health education in the form of "live" workshops and 3 months after an evaluation inquiry was conducted to assess the effects of the workshops. The analysis of the evaluation inquiry showed that the children have included in their diet breakfasts and afternoon snacks and to their main meal menus whole wheat products, larger quantity of vegetables, fruit and water. It has been also established that sweets, meals of fast food types, chips, pizzy and energizing drinks have been limited.

  20. Associations of maternal macronutrient intake during pregnancy with infant BMI peak characteristics and childhood BMI.

    Science.gov (United States)

    Chen, Ling-Wei; Aris, Izzuddin M; Bernard, Jonathan Y; Tint, Mya-Thway; Colega, Marjorelee; Gluckman, Peter D; Tan, Kok Hian; Shek, Lynette Pei-Chi; Chong, Yap-Seng; Yap, Fabian; Godfrey, Keith M; van Dam, Rob M; Chong, Mary Foong-Fong; Lee, Yung Seng

    2017-03-01

    Background: Infant body mass index (BMI) peak characteristics and early childhood BMI are emerging markers of future obesity and cardiometabolic disease risk, but little is known about their maternal nutritional determinants. Objective: We investigated the associations of maternal macronutrient intake with infant BMI peak characteristics and childhood BMI in the Growing Up in Singapore Towards healthy Outcomes study. Design: With the use of infant BMI data from birth to age 18 mo, infant BMI peak characteristics [age (in months) and magnitude (BMI peak ; in kg/m 2 ) at peak and prepeak velocities] were derived from subject-specific BMI curves that were fitted with the use of mixed-effects model with a natural cubic spline function. Associations of maternal macronutrient intake (assessed by using a 24-h recall during late gestation) with infant BMI peak characteristics ( n = 910) and BMI z scores at ages 2, 3, and 4 y were examined with the use of multivariable linear regression. Results: Mean absolute maternal macronutrient intakes (percentages of energy) were 72 g protein (15.6%), 69 g fat (32.6%), and 238 g carbohydrate (51.8%). A 25-g (∼100-kcal) increase in maternal carbohydrate intake was associated with a 0.01/mo (95% CI: 0.0003, 0.01/mo) higher prepeak velocity and a 0.04 (95% CI: 0.01, 0.08) higher BMI peak These associations were mainly driven by sugar intake, whereby a 25-g increment of maternal sugar intake was associated with a 0.02/mo (95% CI: 0.01, 0.03/mo) higher infant prepeak velocity and a 0.07 (95% CI: 0.01, 0.13) higher BMI peak Higher maternal carbohydrate and sugar intakes were associated with a higher offspring BMI z score at ages 2-4 y. Maternal protein and fat intakes were not consistently associated with the studied outcomes. Conclusion: Higher maternal carbohydrate and sugar intakes are associated with unfavorable infancy BMI peak characteristics and higher early childhood BMI. This trial was registered at clinicaltrials.gov as NCT

  1. Duration of the pubertal peak in skeletal Class I and Class III subjects.

    Science.gov (United States)

    Kuc-Michalska, Małgorzata; Baccetti, Tiziano

    2010-01-01

    To estimate and compare the duration of the pubertal growth peak in Class I and Class III subjects. The data examined consisted of pretreatment lateral cephalometric records of 218 skeletal Class I or Class III subjects (93 female and 125 male subjects) of white ancestry. The duration of the pubertal peak was calculated from the average chronological age intervals between stages CS3 and CS4 of the cervical vertebral maturation in Class I vs Class III groups (t-test). In skeletal Class I subjects, the pubertal peak had a mean duration of 11 months, whereas in Class III subjects it lasted 16 months. The average difference (5 months) was statistically significant (P < .001). The growth interval corresponding to the pubertal growth spurt (CS3-CS4) was longer in Class III subjects than in subjects with normal skeletal relationships; the larger increases in mandibular length during the pubertal peak reported in the literature for Class III subjects may be related to the longer duration of the pubertal peak.

  2. The Role of BMI1 in CRPC

    Science.gov (United States)

    2016-10-01

    we discovered that BMI1 directly binds to Androgen Receptor and prevents it from MDM2-mediated protein degradation. We further demonstrated that...lysates. As shown in Fig. 1B, IP with anti-BMI1 pulled down full-length and AR-NTD, but not AR-DBD or AR-LBD. On the other hand , pulldown with Halo...harvested at the indicated time points and immunoblot analysis with anti-AR and anti-β-actin antibodies on the same membrane ( left panel). Density of

  3. Difficulty buying food, BMI, and eating habits in young children.

    Science.gov (United States)

    Fuller, Anne; Maguire, Jonathon L; Carsley, Sarah; Chen, Yang; Lebovic, Gerald; Omand, Jessica; Parkin, Patricia; Birken, Catherine S

    2018-01-22

    To determine whether parent report of difficulty buying food was associated with child body mass index (BMI) z-score or with eating habits in young children. This was a cross-sectional study in primary care offices in Toronto, Ontario. Subjects were children aged 1-5 years and their caregivers, recruited through the TARGet Kids! Research Network from July 2008 to August 2011. Regression models were developed to test the association between parent report of difficulty buying food because of cost and the following outcomes: child BMI z-score, parent's report of child's intake of fruit and vegetables, fruit juice and sweetened beverages, and fast food. Confounders included child's age, sex, birth weight, maternal BMI, education, ethnicity, immigration status, and neighbourhood income. The study sample consisted of 3333 children. Data on difficulty buying food were available for 3099 children, and 431 of these (13.9%) were from households reporting difficulty buying food. There was no association with child BMI z-score (p = 0.86). Children from households reporting difficulty buying food (compared with never having difficulty buying food) had increased odds of consuming three or fewer servings of fruits and vegetables per day (odds ratio [OR]: 1.31, 95% confidence interval [CI]: 1.03-1.69), more than one serving of fruit juice/sweetened beverage per day (OR: 1.60, 95% CI: 1.28-2.00), and, among children 1-2 years old, one or more servings of fast food per week (OR: 2.91, 95% CI: 1.67-5.08). Parental report of difficulty buying food is associated with less optimal eating habits in children but not with BMI z-score.

  4. BMI-1 Promotes Self-Renewal of Radio- and Temozolomide (TMZ)-Resistant Breast Cancer Cells.

    Science.gov (United States)

    Yan, Yanfang; Wang, Ying; Zhao, Pengxin; Ma, Weiyuan; Hu, Zhigang; Zhang, Kaili

    2017-12-01

    Breast cancer is a hormone-dependent malignancy and is the most prevalent cause of cancer-related mortality among females. Radiation therapy and chemotherapy are common treatments of breast cancer. However, tumor relapse and metastasis following therapy are major clinical challenges. The importance of B-lymphoma Moloney murine leukemia virus insertion region-1 (BMI-1) was implicated in cell proliferation, stem cell maintenance, and tumor initiation. We established radio- and temozolomide (TMZ)-resistant (IRC-R) MCF-7 and MDA-MB-231 cell lines to investigate the mechanism involved in therapeutic resistance. Cell proliferation and sphere number were dramatically elevated, and BMI-1 was remarkably upregulated, in IRC-R cells compared to parental cells. Silencing BMI-1 by RNA interference only affected the cell proliferation of IRC-R but not parental cells, suggesting the critical role of BMI-1 in radio- and TMZ resistance. We used a xenograft mice model to elucidate that BMI-1 was necessary in tumor development by assessing tumor volume and Ki67 expression. We found that Hedgehog (Hhg) signaling exerted synergized functions together with BMI-1, implicating the importance of BMI-1 in Hhg signaling. Downregulation of BMI-1 could be an effective strategy to suppress tumor growth, which supports the potential clinical use of targeting BMI-1 in breast cancer treatment.

  5. Longitudinal Effects of Self-Report Pubertal Timing and Menarcheal Age on Adolescent Psychological and Behavioral Outcomes in Female Youths from Northern Taiwan.

    Science.gov (United States)

    Lee, Chih-Ting; Tsai, Meng-Che; Lin, Chung-Ying; Strong, Carol

    2017-08-01

    Early puberty is linked to adverse developmental outcomes in adolescents in Western societies. However, little is known about this relationship in an East Asian context. In addition, whether the impact of subjective pubertal timing (PT) and menarcheal age (MA) on adolescent psychosocial development persists into early adulthood remains unclear and is worthy of investigation. A subset of data was retrieved from the Taiwan Youth Project, which recruited and followed a longitudinal cohort of 7 th - and 9 th -grade female Taiwanese students from 2000 to 2007. Subjective PT was defined using the Pubertal Developmental Scale (PDS), which mainly measures pubertal changes. MA was recalled by participants themselves. Various psychological and behavioral factors were recorded and measured until the age of 20, including the use of alcohol and cigarettes, psychological well-being, sexual activity, and socially problematic behaviors. A χ 2 test for linear-by-linear association and one-way analysis of variance followed by multivariate regression models were used to dissect the differential effects of PT and MA in the association with the outcome variables. In total, 1545 female participants with an average age of 14.5 (±1.1) years were deemed valid for analysis. Among them, 257 (16.6%) participants perceived themselves as having early PT, defined as more than 1 standard deviation above the mean PDS score, and 82 (5.3%) had early MA (occurring before the 4 th grade). In univariate analysis, participants with early PT had higher rates of smoking and sexual activity, and MA was not related to their psychobehavioral outcomes. After multivariate adjustment, only late PT was significantly correlated with lower amounts of cigarette smoking and sexual activity before the age of 20. Conceptual and actual pubertal developments may be differentially associated with psychobehavioral outcomes among young Taiwanese girls. Clinical attention should be given to adolescent self-perception of

  6. Ethnic differences in body fat distribution among Asian pre-pubertal children: A cross-sectional multicenter study

    Directory of Open Access Journals (Sweden)

    Koon Poh Bee

    2011-06-01

    Full Text Available Abstract Background Ethnic differences in body fat distribution contribute to ethnic differences in cardiovascular morbidities and diabetes. However few data are available on differences in fat distribution in Asian children from various backgrounds. Therefore, the current study aimed to explore ethnic differences in body fat distribution among Asian children from four countries. Methods A total of 758 children aged 8-10 y from China, Lebanon, Malaysia and Thailand were recruited using a non-random purposive sampling approach to enrol children encompassing a wide BMI range. Height, weight, waist circumference (WC, fat mass (FM, derived from total body water [TBW] estimation using the deuterium dilution technique and skinfold thickness (SFT at biceps, triceps, subscapular, supraspinale and medial calf were collected. Results After controlling for height and weight, Chinese and Thai children had a significantly higher WC than their Lebanese and Malay counterparts. Chinese and Thais tended to have higher trunk fat deposits than Lebanese and Malays reflected in trunk SFT, trunk/upper extremity ratio or supraspinale/upper extremity ratio after adjustment for age and total body fat. The subscapular/supraspinale skinfold ratio was lower in Chinese and Thais compared with Lebanese and Malays after correcting for trunk SFT. Conclusions Asian pre-pubertal children from different origins vary in body fat distribution. These results indicate the importance of population-specific WC cut-off points or other fat distribution indices to identify the population at risk of obesity-related health problems.

  7. Genetic Influences on Growth Traits of BMI

    DEFF Research Database (Denmark)

    Hjelmborg, Jacob V B; Fagnani, Corrado; Silventoinen, Karri

    2008-01-01

    Objective:To investigate the interplay between genetic factors influencing baseline level and changes in BMI in adulthood.Methods and Procedures:A longitudinal twin study of the cohort of Finnish twins (N = 10,556 twin individuals) aged 20-46 years at baseline was conducted and followed up 15 years....... Data on weight and height were obtained from mailed surveys in 1975, 1981, and 1990.Results:Latent growth models revealed a substantial genetic influence on BMI level at baseline in males and females (heritability (h(2)) 80% (95% confidence interval 0.79-0.80) for males and h(2) = 82% (0.81, 0.......84) for females) and a moderate-to-high influence on rate of change in BMI (h(2) = 58% (0.50, 0.69) for males and h(2) = 64% (0.58, 0.69) for females). Only very weak evidence for genetic pleiotropy was observed; the genetic correlation between baseline and rate of change in BMI was very modest (-0.070 (-0.13, -0...

  8. Attachment, parenting styles and bullying during pubertal years.

    Science.gov (United States)

    van der Watt, Ronél

    2014-01-01

    Research that focuses on combining attachment, parenting styles, bullying and the reciprocal nature thereof in the parent-adolescent and peer relationships is limited. The bio-psychosocial changes that adolescents experience open up broader social realities and are perceived differently by parents and adolescents. Attachment processes and parenting styles may elicit dissimilar perceptions. These processes are also associated with the multifaceted dynamics of bullying. The aim of the article is to advocate for research on the possible link between the implications of attachment, parenting styles and bullying. Exploring the association between attachment, parenting styles and bullying can deepen the understanding of the developmental challenges within the parent-adolescent relationship, add insight to the different perceptions of adolescents and parents, and complement intervention programmes accordingly. Firstly, this article outlines bio-psychosocial changes in the pubertal years as related to the social realities of the adolescent. Secondly, a discussion on the concepts 'attachment', 'parenting styles', 'bullying', and the potential link between these concepts will follow. Thirdly, an outline of the clinical implications of the apparent association between these concepts is given. The article concludes with recommendations that researchers can consider while exploring the relationship between attachment, parenting styles, and bullying and the delineation thereof in the parent-adolescent relationship.

  9. Longitudinal impacts of pubertal timing and weight status on adolescent Internet use: Analysis from a cohort study of Taiwanese youths.

    Directory of Open Access Journals (Sweden)

    Meng-Che Tsai

    Full Text Available To investigate the longitudinal impacts of pubertal timing and weight status on Internet use in adolescents.Three waves of data on a longitudinal cohort of 7th grade students (N = 2430 were retrieved from the Taiwan Youth Project. Univariate and multivariate regression models were applied using crude and adjusted odds ratios (OR with 95% confidence intervals (CI to examine the concomitant impacts of pubertal timing and weight status on adolescent Internet use.The dataset identified 210 (8.7% students using the Internet for more than 20 hours/week, and 81 (3.3% were viewing pornographic material online. Early maturing and thin-weight adolescents were at 35% and 46% increased risks of spending long hours on Internet use, respectively. While early puberty was associated with online pornography viewing among males (adjusted OR 1.84, 95% CI 1.04-3.28, early puberty was contrarily a protective factor against online gaming in females (adjusted OR 0.59, 95% CI 0.36-0.96.Early puberty was found to be positively related to adolescent Internet use. Appropriate health education and guidance regarding Internet use should be provided to those with different developing needs.

  10. Longitudinal impacts of pubertal timing and weight status on adolescent Internet use: Analysis from a cohort study of Taiwanese youths.

    Science.gov (United States)

    Tsai, Meng-Che; Strong, Carol; Chen, Wan-Ting; Lee, Chih-Ting; Lin, Chung-Ying

    2018-01-01

    To investigate the longitudinal impacts of pubertal timing and weight status on Internet use in adolescents. Three waves of data on a longitudinal cohort of 7th grade students (N = 2430) were retrieved from the Taiwan Youth Project. Univariate and multivariate regression models were applied using crude and adjusted odds ratios (OR) with 95% confidence intervals (CI) to examine the concomitant impacts of pubertal timing and weight status on adolescent Internet use. The dataset identified 210 (8.7%) students using the Internet for more than 20 hours/week, and 81 (3.3%) were viewing pornographic material online. Early maturing and thin-weight adolescents were at 35% and 46% increased risks of spending long hours on Internet use, respectively. While early puberty was associated with online pornography viewing among males (adjusted OR 1.84, 95% CI 1.04-3.28), early puberty was contrarily a protective factor against online gaming in females (adjusted OR 0.59, 95% CI 0.36-0.96). Early puberty was found to be positively related to adolescent Internet use. Appropriate health education and guidance regarding Internet use should be provided to those with different developing needs.

  11. Relationships between urinary biomarkers of phytoestrogens, phthalates, phenols, and pubertal stages in girls

    Directory of Open Access Journals (Sweden)

    Chakraborty TR

    2012-01-01

    Full Text Available Tandra R Chakraborty1, Eilliut Alicea1, Sanjoy Chakraborty21Department of Biology, Adelphi University, One South Avenue, Garden City; 2Department of Biological Sciences, New York City College of Technology, New York, NY, USAAbstract: Phytoestrogens, phthalates, and phenols are estrogen-disrupting chemicals that have a pronounced effect at puberty. They are exogenous chemicals that are either plant-derived or man-made, and can alter the functions of the endocrine system and cause various health defects by interfering with the synthesis, metabolism, binding, or cellular responses of natural estrogens. Phytoestrogens, phthalates, and phenols are some of the potent estrogens detectable in urine. Phytoestrogens are plant-derived xenestrogens found in a wide variety of food products, like soy-based food, beverages, several fruits, and vegetables. Exposure to phytoestrogens can delay breast development and further lead to precocious puberty. The effect of phytoestrogens is mediated through estrogen receptors α and β or by binding with early immediate genes, such as jun and fos. Phthalates are multifunctional synthetic chemicals used in plastics, polyvinyl chloride products, cosmetics, hair spray, and children's toys. Phthalates have been shown to cause defeminization, thelarche, precocious puberty, and an increase in breast and pubic hair in pubertal girls. However, reports are also available that show no association of phthalates with precocious puberty in girls. Phthalates can act through a receptor-mediated signaling pathway or affect the production of luteinizing hormone and follicle-stimulating hormone that has a direct effect on estrogen formation. Phenols like bisphenol A are industrial chemicals used mainly in the manufacture of polycarbonates and plastic materials. Bisphenol A has been shown to cause precocious puberty and earlier menarche in pubertal girls. Reports suggest that the neurotoxic effect of bisphenol A can be mediated either by

  12. Maternal swimming exercise during pregnancy attenuates anxiety/depressive-like behaviors and voluntary morphine consumption in the pubertal male and female rat offspring born from morphine dependent mothers.

    Science.gov (United States)

    Torabi, Masoumeh; Pooriamehr, Alireza; Bigdeli, Imanollah; Miladi-Gorji, Hossein

    2017-10-17

    This study was designed to examine whether maternal swimming exercise during pregnancy would attenuate prenatally morphine-induced anxiety, depression and voluntary consumption of morphine in the pubertal male and female rat offspring. Pregnant rats during the development of morphine dependence were allowed to swim (30-45min/d, 3days per a week) on gestational days 11-18. Then, the pubertal male and female rat offspring were tested for the elevated plus-maze (EPM), sucrose preference test (SPT) and voluntary morphine consumption using a two-bottle choice (TBC) paradigm. The results showed that male and female rat offspring born of the swimmer morphine-dependent mothers exhibited an increase in EPM open arm time and entries, higher levels of sucrose preference than their sedentary control mothers. Voluntary consumption of morphine was less in the male and female rat offspring born of the swimmer morphine-dependent mothers as compared with their sedentary control mothers during three periods of the intake of drug. Thus, swimming exercise in pregnant morphine dependent mothers decreased anxiety, depressive-like behavior and also the voluntary morphine consumption in the pubertal male and female offspring, which may prevent prenatally morphine-induced behavioral sensitization in offspring. Copyright © 2017 Elsevier B.V. All rights reserved.

  13. Bmi-1 expression modulates non-small cell lung cancer progression

    Science.gov (United States)

    Xiong, Dan; Ye, Yunlin; Fu, Yujie; Wang, Jinglong; Kuang, Bohua; Wang, Hongbo; Wang, Xiumin; Zu, Lidong; Xiao, Gang; Hao, Mingang; Wang, Jianhua

    2015-01-01

    Previous studies indicate that the role of B lymphoma Mo-MLV insertion region 1 homolog (Bmi-1) is responsible for multiple cancer progression. However, Bmi-1 in controlling gene expression in non-small cell lung cancer (NSCLC) development is not well explored. Here we report that the Bmi-1 level is highly increased in primary NSCLC tissues compared to matched adjacent non-cancerous tissues and required for lung tumor growth in xenograft model. Furthermore, we also demonstrate that Bmi-1 level is lower in matched involved lymph node cancerous tissues than the respective primary NSCLC tissues. We find that Bmi-1 does not affect cell cycle and apoptosis in lung cancer cell lines as it does not affect the expression of p16/p19, Pten, AKT and P-AKT. Mechanistic analyses note that reduction of Bmi-1 expression inversely regulates invasion and metastasis of NSCLC cells in vitro and in vivo, followed by induction of epithelial-mesenchymal transition (EMT). Using genome microarray assays, we find that RNAi-mediated silence of Bmi-1 modulates some important molecular genetics or signaling pathways, potentially associated with NSCLC development. Taken together, our findings disclose for the first time that Bmi-1 level accumulates strongly in early stage and then declines in late stage, which is potentially important for NSCLC cell invasion and metastasis during progression. PMID:25880371

  14. Bmi-1 confers adaptive radioresistance to KYSE-150R esophageal carcinoma cells

    Energy Technology Data Exchange (ETDEWEB)

    Wang, Guanyu [Department of General Surgery, Sir Run Run Shaw Hospital, School of Medicine, Zhejiang University, Hangzhou (China); Liu, Luying [Department of Radiotherapy, Zhejiang Cancer Hospital, Hangzhou (China); Sharma, Sherven [David Geffen School of Medicine at UCLA, and the Department of Veterans Affairs, Los Angeles, CA (United States); Liu, Hai; Yang, Weifang; Sun, Xiaonan [Department of Radiotherapy, Sir Run Run Shaw Hospital, School of Medicine, Zhejiang University, Hangzhou (China); Dong, Qinghua, E-mail: dongqinghua@zju.edu.cn [Biomedical Research Center, Sir Run Run Shaw Hospital, School of Medicine, Zhejiang University, Hangzhou (China)

    2012-08-24

    Highlights: Black-Right-Pointing-Pointer Adaptive radioresistant KYSE-150R cells expressed high level of Bmi-1. Black-Right-Pointing-Pointer Bmi-1 depletion sensitized KYSE-150R cells to RT. Black-Right-Pointing-Pointer Bmi-1 depletion increased the generation of ROS in KYSE-150R cells exposed to radiation. Black-Right-Pointing-Pointer Bmi-1 depletion impaired DNA repair capacities in KYSE-150R cells exposed to radiation. -- Abstract: Radiotherapy (RT) is a major modality of cancer treatment. However, tumors often acquire radioresistance, which causes RT to fail. The exact mechanisms by which tumor cells subjected to fractionated irradiation (FIR) develop an adaptive radioresistance are largely unknown. Using the radioresistant KYSE-150R esophageal squamous cell carcinoma (ESCC) model, which was derived from KYSE-150 parental cells using FIR, the role of Bmi-1 in mediating the radioadaptive response of ESCC cells to RT was investigated. The results showed that the level of Bmi-1 expression was significantly higher in KYSE-150R cells than in the KYSE-150 parental cells. Bmi-1 depletion sensitized the KYSE-150R cells to RT mainly through the induction of apoptosis, partly through the induction of senescence. A clonogenic cell survival assay showed that Bmi-1 depletion significantly decreased the radiation survival fraction in KYSE-150R cells. Furthermore, Bmi-1 depletion increased the generation of reactive oxygen species (ROS) and the expression of oxidase genes (Lpo, Noxo1 and Alox15) in KYSE-150R cells exposed to irradiation. DNA repair capacities assessed by {gamma}-H2AX foci formation were also impaired in the Bmi-1 down-regulated KYSE-150R cells. These results suggest that Bmi-1 plays an important role in tumor radioadaptive resistance under FIR and may be a potent molecular target for enhancing the efficacy of fractionated RT.

  15. Genetic factors modulate the impact of pubertal androgen excess on insulin sensitivity and fertility.

    Directory of Open Access Journals (Sweden)

    Abigail R Dowling

    Full Text Available Polycystic ovary syndrome (PCOS is the most common endocrine disorder of reproductive age women. The syndrome is caused by a combination of environmental influences and genetic predisposition. Despite extensive efforts, the heritable factors contributing to PCOS development are not fully understood. The objective of this study was to test the hypothesis that genetic background contributes to the development of a PCOS-like reproductive and metabolic phenotype in mice exposed to excess DHEA during the pubertal transition. We tested whether the PCOS phenotype would be more pronounced on the diabetes-prone C57BL/6 background than the previously used strain, BALB/cByJ. In addition, we examined strain-dependent upregulation of the expression of ovarian and extra-ovarian candidate genes implicated in human PCOS, genes containing known strain variants, and genes involved with steroidogenesis or insulin sensitivity. These studies show that there are significant strain-related differences in metabolic response to excess androgen exposure during puberty. Additionally, our results suggest the C57BL/6J strain provides a more robust and uniform experimental platform for PCOS research than the BALB/cByJ strain.

  16. Genetic factors modulate the impact of pubertal androgen excess on insulin sensitivity and fertility.

    Science.gov (United States)

    Dowling, Abigail R; Nedorezov, Laura B; Qiu, Xiaoliang; Marino, Joseph S; Hill, Jennifer W

    2013-01-01

    Polycystic ovary syndrome (PCOS) is the most common endocrine disorder of reproductive age women. The syndrome is caused by a combination of environmental influences and genetic predisposition. Despite extensive efforts, the heritable factors contributing to PCOS development are not fully understood. The objective of this study was to test the hypothesis that genetic background contributes to the development of a PCOS-like reproductive and metabolic phenotype in mice exposed to excess DHEA during the pubertal transition. We tested whether the PCOS phenotype would be more pronounced on the diabetes-prone C57BL/6 background than the previously used strain, BALB/cByJ. In addition, we examined strain-dependent upregulation of the expression of ovarian and extra-ovarian candidate genes implicated in human PCOS, genes containing known strain variants, and genes involved with steroidogenesis or insulin sensitivity. These studies show that there are significant strain-related differences in metabolic response to excess androgen exposure during puberty. Additionally, our results suggest the C57BL/6J strain provides a more robust and uniform experimental platform for PCOS research than the BALB/cByJ strain.

  17. BMI in relation to sperm count

    DEFF Research Database (Denmark)

    Sermondade, N; Faure, C; Fezeu, L

    2013-01-01

    BACKGROUND The global obesity epidemic has paralleled a decrease in semen quality. Yet, the association between obesity and sperm parameters remains controversial. The purpose of this report was to update the evidence on the association between BMI and sperm count through a systematic review...... with meta-analysis. METHODS A systematic review of available literature (with no language restriction) was performed to investigate the impact of BMI on sperm count. Relevant studies published until June 2012 were identified from a Pubmed and EMBASE search. We also included unpublished data (n = 717 men...... studies were included in the meta-analysis, resulting in a sample of 13 077 men from the general population and attending fertility clinics. Data were stratified according to the total sperm count as normozoospermia, oligozoospermia and azoospermia. Standardized weighted mean differences in sperm...

  18. Palo Verde Unit 3 BMI nozzle modification

    International Nuclear Information System (INIS)

    Waskey, D.

    2015-01-01

    The 61 BMI (Bottom Mount Instrumentation) nozzles of the unit 3 of the Palo Verde plant have been examined through ASME Code Case N722. The nozzle 3 was the only one with leakage noted. The ultrasound testing results are characteristic of PWSCC (Primary Water Stress Corrosion Cracking). The initiation likely occurred at a weld defect which was exposed to the primary water environment resulting in PWSCC. All other nozzles (60) showed no unacceptable indications. Concerning nozzle 3 one crack in J-groove weld connected large defect to primary water. An environmental model has been used to simulate and optimize the repair. The AREVA crew was on site 18 days after contract award and the job was completed in 12 days, 30 hours ahead of baseline schedule. This series of slides describes the examination of the BMI nozzles, the repair steps, and alternative design concepts

  19. Pubertal timing and early sexual intercourse in the offspring of teenage mothers.

    Science.gov (United States)

    De Genna, Natacha M; Larkby, Cynthia; Cornelius, Marie D

    2011-10-01

    Early puberty is associated with stressful family environments, early sexual intercourse, and teenage pregnancy. We examined pubertal timing and sexual debut among the 14-year-old offspring of teenage mothers. Mothers (71% Black, 29% White) were recruited as pregnant teenagers (12-18 years old). Data were collected during pregnancy and when offspring were 6, 10 and 14 years old (n = 318). Adolescents (50% male) compared the timing of their pubertal maturation to same-sex peers. There was a significant 3-way interaction effect of race, sex, and pubertal timing on sexual debut (n = 305). This effect remained significant in a model controlling for maternal age at first intercourse, substance use, exposure to trauma, authoritative parenting, and peer sexual activity (n = 255). Early maturation was associated with early sex in daughters, and may be one pathway for the inter-generational transfer of risk for teenage pregnancy among daughters of teenage mothers.

  20. Elevated serum IGF-I, but unaltered sex steroid levels, in healthy boys with pubertal gynaecomastia

    DEFF Research Database (Denmark)

    Mieritz, Mikkel G; Sorensen, Kaspar; Aksglaede, Lise

    2014-01-01

    OBJECTIVE: Pubertal gynaecomastia is a very common condition. Although the underlying aetiology is poorly understood, it is generally accepted that excess of oestrogens and deficit of androgens are involved in the pathogenesis. Furthermore, adiposity as well as the GH/IGF-I axis may play a role....... In this study, we elucidate the association of adiposity and levels of follicle-stimulating hormone (FSH), luteinizing hormone (LH), sex hormone-binding globulin (SHBG), testosterone, oestrogen, IGF-I and IGFBP-3 with the presence of pubertal gynaecomastia in a large cohort of healthy boys. PATIENTS: A total...... of 501 healthy Danish school boys (aged 6·1-19·8 year) from the COPENHAGEN Puberty Study. MEASUREMENTS: Anthropometry and pubertal stages (PH1-6 and G1-5) were evaluated, and the presence of gynaecomastia was assessed. Body fat percentage was calculated by means of four skin folds and impedance...

  1. Maths performance as a function of sex, laterality, and age of pubertal onset.

    Science.gov (United States)

    Sappington, John; Topolski, Richard

    2005-07-01

    Sex differences in math/spatial performance demand explanations. Within the biological view, the complexity and number of variables make the explanation difficult at best. Laterality and age of pubertal onset have been investigated prominently in this context but rarely considered as interactions in the same study. Some 468 college subjects with SAT MATH (SAT M) scores were divided into 12 groups defined by sex, laterality, and age (early, middle, and late) of pubertal onset. Significant main effects for sex and age of onset emerged, as did an interaction between lateral preference and pubertal onset. Generally males outperformed females. The combination of maleness, sinistrality, and early maturation was associated with high SAT M scores. Sinistrality and late maturation among females predicted very poor math performance.

  2. Pubertal timing and substance use: associations between and within families across late adolescence.

    Science.gov (United States)

    Dick, D M; Rose, R J; Viken, R J; Kaprio, J

    2000-03-01

    In the present study, between-family analyses of data from adolescent twin girls offer new evidence that early menarche is associated with earlier initiation and greater frequency of smoking and drinking. The role of personality factors and peer relationships in that association was investigated, and little support was found for their involvement. Novel within-family analyses replicating associations of substance use with pubertal timing in contrasts of twin sisters selected for extreme discordance for age at menarche are reported. Within-family replications demonstrated that the association of pubertal timing with substance use cannot be explained solely by between-family confounds. Within-family analyses demonstrated contextual modulation of the influence of pubertal timing: Its impact on drinking frequency is apparent only among girls in urban settings. Sibling comparisons illustrate a promising analytic tool for studying diverse developmental outcomes.

  3. Diagnostic Markers of Primary Infertility in Women of Reproductive Age with Hypothalamic Dysfunction in the Pubertal Period

    Directory of Open Access Journals (Sweden)

    Irina V. Zhukovets

    2017-09-01

    Full Text Available The aim of the study was to assess fertility in women of reproductive age with hypothalamic dysfunction (HD in the pubertal period and to determine the diagnostic significance of pro-inflammatory (TNF-α and IL-1β, anti-inflammatory cytokine (IL-10 and NF-kB activity in the diagnosis of primary infertility in these women. Materials and Methods: Fertility was assessed in 86 women of reproductive age with HD in the pubertal period. A comparative characteristic of fertile women (Group 1, n=46 and primary infertility women (Group 2, n=21 with HD in the pubertal period was performed. FPG and FPI were determined after 8 to 12 hours of fasting. Serum IRI concentrations were measured using an ELISA kit. The levels of TNF-α, IL-1β and IL-10 were determined in the venous blood serum after a 12-hour fasting, as well as in UA on the 21st day of the menstrual cycle using ELISA kits. The activity of NF-kB was determined in UA on the 21st day of the menstrual cycle using an enzyme immunoassay kit. Results: BMI in Group 1 was significantly lower than in Group 2: 22.63±2.68 kg/m2 versus 27.05±4.03kg/m2 (p=0.000. WC in women of Group 1 was 66.11±5.66cm versus 78.52±10.54cm in Group 2 (p = 0.000; WC >80cm was found in 2(4.4% and 14(66.7% women, respectively (p = 0.000. The average levels of FPG and FPI were significantly higher in Group 2. Serum levels of TNF-α and IL-1β in Group 2 were significantly higher than in Group 1. The serum level of anti-inflammatory cytokine IL-10 was significantly lower in Group 2; accordingly, the TNF-α/IL-10 ratio in Group 2 was 1.8 times higher than in Group 1. The IL-1β level in UA (P=0.000 and the TNF-α/IL-10 ratio (P=0.02 were significantly higher in women of Group 2 than Group 1, which indicated the pronounced inflammatory effects of TNF-α in the endometrium. Imbalance in the production of pro-inflammatory and anti-inflammatory factors indicated the activation of the Th-1 immune response with the formation of the

  4. The associations of Bmi-1 with progression of glomerular chronic kidney disease
.

    Science.gov (United States)

    Yang, Xiaoxia; Bai, Ming; Ning, Xiaoxuan; Ma, Feng; Liu, Limin; Liu, Ting; Liu, Minna; Wang, Hanmin; Sun, Shiren

    2018-02-01

    Our previous studies indicated that Bmi-1 plays an important role in hypoxia-induced tubular epithelial-mesenchymal transition and the development of kidney fibrosis in cellular and animal models. However, circulating Bmi-1 levels in human chronic kidney disease (CKD) and their relation to progression remains unknown. We conducted a post-hoc analysis of a prospective cohort study. The blood samples and clinical data of 230 patients with glomerular CKD and 67 healthy adults were prospectively collected between January 2010 and June 2012. Serum Bmi-1 was measured using enzyme-linked immunosorbent assay (ELISA). CKD patients had significantly higher serum Bmi-1 concentrations than the healthy controls (496.4 (363.1 - 675.4) pg/mL compared with 257.3 (235.4 - 303.8) pg/mL, p Bmi-1 level inversely correlated with the estimated glomerular filtration rate (eGFR) (r = -0.346, p Bmi-1 levels and serum creatinine, blood urea nitrogen, cystatin C concentration, and the severity of tubulointerstitial fibrosis (r = 0.248, p Bmi-1 level was associated with a shorter duration of renal survival. Cox multivariate analyses further demonstrated that serum Bmi-1 concentration was an independent prognostic factor for CKD patients (HR = 6.48, p Bmi-1 levels were associated with adverse kidney disease outcome, suggesting that Bmi-1 is a novel biomarker for glomerular CKD progression. More data from larger longitudinal studies are required to validate our findings.
.

  5. Electro convulsive therapy in a pre-pubertal child with severe depression.

    Directory of Open Access Journals (Sweden)

    Russell P

    2002-10-01

    Full Text Available Electro Convulsive Therapy (ECT in pre-pubertal children is a controversial and underreported treatment. Even though the effectiveness and side effects of ECT in adolescents are comparable with those in adults, there is a pervasive reluctance to use ECT in children and adolescents. We report the case of a pre-pubertal child in an episode of severe depression with catatonic features, where a protracted course of ECT proved life-saving in spite of prolonged duration of seizures and delayed response to treatment. The case illustrates the safety and efficacy of ECT in children. Relevant literature is also reviewed along with the case report.

  6. The importance of puberty for adolescent development: conceptualization and measurement.

    Science.gov (United States)

    Berenbaum, Sheri A; Beltz, Adriene M; Corley, Robin

    2015-01-01

    How and why are teenagers different from children and adults? A key question concerns the ways in which pubertal development shapes psychological changes in adolescence directly through changes to the brain and indirectly through the social environment. Empirical work linking pubertal development to adolescent psychological function draws from several different perspectives, often with varying approaches and a focus on different outcomes and mechanisms. The main themes concern effects of atypical pubertal timing on behavior problems during adolescence, effects of pubertal status (and associated hormones) on normative changes in behaviors that can facilitate or hinder development (especially risk-taking, social reorientation, and stress responsivity), and the role of puberty in triggering psychopathology in vulnerable individuals. There is also interest in understanding the ways in which changes in the brain reflect pubertal processes and underlie psychological development in adolescence. In this chapter, we consider the ways that puberty might affect adolescent psychological development, and why this is of importance to developmentalists. We describe the processes of pubertal development; summarize what is known about pubertal influences on adolescent development; consider the assumptions that underlie most work and the methodological issues that affect the interpretation of results; and propose research directions to help understand paths from puberty to behavior. Throughout, we emphasize the importance of pubertal change in all aspects of psychological development, and the ways in which puberty represents an opportunity to study the interplay of biological and social influences. © 2015 Elsevier Inc. All rights reserved.

  7. Ovarian function following pelvic irradiation in prepubertal and pubertal girls and young adult women

    Energy Technology Data Exchange (ETDEWEB)

    Schuck, A.; Hamelmann, V. [University Hospital Muenster (Germany). Dept. of Radiotherapy; Braemswig, J.H. [University Hospital Muenster (DE). Dept. of Pediatrics] [and others

    2005-08-01

    Purpose: To analyze the effect of pelvic radiotherapy on ovarian function in prepubertal and pubertal girls and young adult women. Patients and methods: In a retrospective monoinstitutional analysis, patients <30 years of age at diagnosis were included who had been irradiated between 1979 and 1998. The main tumor types were Hodgkin's disease (38%), Erwing's sarcoma (20%) and nephroblastoma (11%). Patients were classified into three groups according to the position of the ovary in relation to the radiation portals. Group 1 was defined by direct irradiation of both ovaries. Group 2 patients were included with both ovaries potentially located in the radiation portals. In group 3, at least one ovary was not directly irradiated. The median follow-up was 128 months. Results: 16 of 55 analyzed patients were categorized in group 1. In ten of these patients, hormone status was evaluable. The ovarian doses were {>=}15 Gy. Except for one patient treated with 15 Gy all developed hormone failure. Eight of 14 patients of group 2 were evaluable. Seven of these patients developed ovarian failure. 19 of 24 patients in group 3 were evaluable. Nine of these patients developed ovarian failure. The observed difference in the rate of ovarian failure between the groups is statistifcally significant (p=0.045). Conclusion: All patients receiving >15 Gy to the ovaries developed hormone failure. In one case of a patient receiving an ovarian dose of 15 Gy, hormone failure was not found. In case of pelvic irradiation excluding at least one ovary, approximately half of the patients developed ovarian dysfunction, probably also due to the effects of polychemotherapy. (orig.)

  8. Bmi-1 promotes the aggressiveness of glioma via activating the NF-kappaB/MMP-9 signaling pathway

    International Nuclear Information System (INIS)

    Jiang, Lili; Wu, Jueheng; Yang, Yi; Liu, Liping; Song, Libing; Li, Jun; Li, Mengfeng

    2012-01-01

    The prognosis of human glioma is poor, and the highly invasive nature of the disease represents a major impediment to current therapeutic modalities. The oncoprotein B-cell-specific Moloney murine leukemia virus integration site 1 protein (Bmi-1) has been linked to the development and progression of glioma; however, the biological role of Bmi-1 in the invasion of glioma remains unclear. A172 and LN229 glioma cells were engineered to overexpress Bmi-1 via stable transfection or to be silenced for Bmi-1 expression using RNA interfering method. Migration and invasiveness of the engineered cells were assessed using wound healing assay, Transwell migration assay, Transwell matrix penetration assay and 3-D spheroid invasion assay. MMP-9 expression and activity were measured using real-time PCR, ELISA and the gelatin zymography methods. Expression of NF-kappaB target genes was quantified using real-time PCR. NF-kappaB transcriptional activity was assessed using an NF-kappaB luciferase reporter system. Expression of Bmi-1 and MMP-9 in clinical specimens was analyzed using immunohistochemical assay. Ectopic overexpression of Bmi-1 dramatically increased, whereas knockdown of endogenous Bmi-1 reduced, the invasiveness and migration of glioma cells. NF-kappaB transcriptional activity and MMP-9 expression and activity were significantly increased in Bmi-1-overexpressing but reduced in Bmi-1-silenced cells. The reporter luciferase activity driven by MMP-9 promoter in Bmi-1-overexpressing cells was dependent on the presence of a functional NF-kappaB binding site, and blockade of NF-kappaB signaling inhibited the upregulation of MMP-9 in Bmi-1 overexpressing cells. Furthermore, expression of Bmi-1 correlated with NF-kappaB nuclear translocation as well as MMP-9 expression in clinical glioma samples. Bmi-1 may play an important role in the development of aggressive phenotype of glioma via activating the NF-kappaB/MMP-9 pathway and therefore might represent a novel therapeutic

  9. Prospective associations between sedentary lifestyle and BMI in midlife

    DEFF Research Database (Denmark)

    Mortensen, Laust Hvas; Siegler, Ilene C; Barefoot, John C

    2006-01-01

    A strong positive cross-sectional relationship between BMI and a sedentary lifestyle has been consistently observed in numerous studies. However, it has been questioned whether high BMI is a determinant or a consequence of a sedentary lifestyle.......A strong positive cross-sectional relationship between BMI and a sedentary lifestyle has been consistently observed in numerous studies. However, it has been questioned whether high BMI is a determinant or a consequence of a sedentary lifestyle....

  10. Predictors of BMI Vary along the BMI Range of German Adults – Results of the German National Nutrition Survey II

    Science.gov (United States)

    Moon, Kilson; Krems, Carolin; Heuer, Thorsten; Roth, Alexander; Hoffmann, Ingrid

    2017-01-01

    Objective The objective of the study was to identify predictors of BMI in German adults by considering the BMI distribution and to determine whether the association between BMI and its predictors varies along the BMI distribution. Methods The sample included 9,214 adults aged 18–80 years from the German National Nutrition Survey II (NVS II). Quantile regression analyses were conducted to examine the association between BMI and the following predictors: age, sports activities, socio-economic status (SES), healthy eating index-NVS II (HEI-NVS II), dietary knowledge, sleeping duration and energy intake as well as status of smoking, partner relationship and self-reported health. Results Age, SES, self-reported health status, sports activities and energy intake were the strongest predictors of BMI. The important outcome of this study is that the association between BMI and its predictors varies along the BMI distribution. Especially, energy intake, health status and SES were marginally associated with BMI in normal-weight subjects; this relationships became stronger in the range of overweight, and were strongest in the range of obesity. Conclusions Predictors of BMI and the strength of these associations vary across the BMI distribution in German adults. Consequently, to identify predictors of BMI, the entire BMI distribution should be considered. PMID:28219069

  11. p21/Cyclin E pathway modulates anticlastogenic function of Bmi-1 in cancer cells

    Science.gov (United States)

    Deng, Wen; Zhou, Yuan; Tiwari, Agnes FY; Su, Hang; Yang, Jie; Zhu, Dandan; Lau, Victoria Ming Yi; Hau, Pok Man; Yip, Yim Ling; Cheung, Annie LM; Guan, Xin-Yuan; Tsao, Sai Wah

    2015-01-01

    Apart from regulating stem cell self-renewal, embryonic development and proliferation, Bmi-1 has been recently reported to be critical in the maintenance of genome integrity. In searching for novel mechanisms underlying the anticlastogenic function of Bmi-1, we observed, for the first time, that Bmi-1 positively regulates p21 expression. We extended the finding that Bmi-1 deficiency induced chromosome breaks in multiple cancer cell models. Interestingly, we further demonstrated that knockdown of cyclin E or ectopic overexpression of p21 rescued Bmi-1 deficiency-induced chromosome breaks. We therefore conclude that p21/cyclin E pathway is crucial in modulating the anticlastogenic function of Bmi-1. As it is well established that the overexpression of cyclin E potently induces genome instability and p21 suppresses the function of cyclin E, the novel and important implication from our findings is that Bmi-1 plays an important role in limiting genomic instability in cylin E-overexpressing cancer cells by positive regulation of p21. PMID:25131797

  12. Maternal BMI during Pregnancy: Effect on trace elements Status and ...

    African Journals Online (AJOL)

    Maternal BMI was significantly positively related to age, parity and socioeconomic status. While a negative relationship was found between plasma copper and maternal BMI, significantly (p < 0.05) lower zinc levels were found in underweight and obese women when compared to women with normal BMI. Maternal anaemia ...

  13. Pubertal Timing and Early Sexual Intercourse in the Offspring of Teenage Mothers

    Science.gov (United States)

    De Genna, Natacha M.; Larkby, Cynthia; Cornelius, Marie D.

    2011-01-01

    Early puberty is associated with stressful family environments, early sexual intercourse, and teenage pregnancy. We examined pubertal timing and sexual debut among the 14-year-old offspring of teenage mothers. Mothers (71% Black, 29% White) were recruited as pregnant teenagers (12-18 years old). Data were collected during pregnancy and when…

  14. The Effect of Wallow on Growth Performance of Pre-Pubertal Pigs in ...

    African Journals Online (AJOL)

    A study was carried out to determine the influence of wallow on the growth performance of growing pigs. Sixteen (16) pre-pubertal pigs (8 males and 8 females) of large white breed, aged three months were randomly assigned to two treatments. There were eight animals per group designated as treatment A = with wallow ...

  15. Repeatability and accuracy of reproductive tract scoring to determine pubertal status in beef heifers.

    Science.gov (United States)

    Rosenkrans, Kelly S; Hardin, David K

    2003-03-01

    The objective of this study was to compare the repeatability and accuracy of palpation per rectum to transrectal ultrasonography and serum progesterone concentrations for determining pubertal status in beef heifers. One hundred and seventy-four rectal examinations were performed on 29 predominantly Angus heifers by two veterinarians (A and B) and assigned individual reproductive tract scores (RTS) during monthly examinations over a 3-month period. Heifers were examined in the morning by both veterinarians, randomized, and re-examined in the afternoon. The size and location of ovarian structures of each heifer were determined by ultrasonography. Heifers with follicles >10mm in diameter or corpora lutea were classified as pubertal. Serum progesterone concentrations at the time of the examination and 10 days later were determined by radioimmunoassay and used to classify heifers as prepubertal (or=1 ng/ml). Kappa, which describes degree of agreement beyond chance, was used to determine repeatability of the RTS system. Multicategory Kappa for agreement was 0.64 within veterinarian, 0.46 between veterinarian, and 0.35 between palpation per rectum and transrectal ultrasonography. Sensitivity and specificity of palpation per rectum for diagnosis of pubertal status compared to serum progesterone levels were higher (82 and 69%, respectively) than sensitivity and specificity of ultrasonography (79 and 59%, respectively). This study validates the RTS system as a repeatable and accurate screening test to evaluate pubertal status in groups of heifers prior to the onset of the breeding season.

  16. The Interplay between Gaze Following, Emotion Recognition, and Empathy across Adolescence; a Pubertal Dip in Performance?

    NARCIS (Netherlands)

    van Rooijen, R.; Junge, C.M.M.; Kemner, C.

    2018-01-01

    During puberty a dip in face recognition is often observed, possibly caused by heightened levels of gonadal hormones which in turn affects the re-organization of relevant cortical circuitry. In the current study we investigated whether a pubertal dip could be observed in three other abilities

  17. The Relationship among Pubertal Stage, Age, and Drinking in Adolescent Boys and Girls

    Science.gov (United States)

    Faden, Vivian B.; Ruffin, Beverly; Newes-Adeyi, Gabriella; Chen, Chiung

    2010-01-01

    This study used data from the Third National Household and Nutrition Examination Survey (NHANES) to examine the association between pubertal status (Tanner staging for boys and girls and menarche for girls) and alcohol use in a nationally representative sample of youths ages 12 to 17. Logistic regression was used to model the relationship. In…

  18. Insulin resistance in obese pre-pubertal children: Relation to body ...

    African Journals Online (AJOL)

    Heba Elsedfy

    2014-04-16

    Apr 16, 2014 ... of pre-pubertal obese children, and to investigate the relation- .... children P 10 years, HDL-Cholesterol <35 mg/dl) [18]. .... HDL: high density lipoprotein, TG: triglycerides, IFG: impaired fasting glucose, IGT: impaired glucose ...

  19. Pubertal maturation and sex steroids are related to alcohol use in adolescents

    NARCIS (Netherlands)

    Water, E. de; Braams, B.R.; Crone, E.A.; Peper, J.S.

    2013-01-01

    Adolescents often show risk-taking behavior, including experimentation with alcohol. Previous studies have shown that advanced pubertal maturation is related to increased alcohol use in adolescents, even when controlling for age. Little is known about the underlying mechanisms of this relation

  20. Early Adolescent Boys' Exposure to Internet Pornography: Relationships to Pubertal Timing, Sensation Seeking, and Academic Performance

    Science.gov (United States)

    Beyens, Ine; Vandenbosch, Laura; Eggermont, Steven

    2015-01-01

    Research has demonstrated that adolescents regularly use Internet pornography. This two-wave panel study aimed to test an integrative model in early adolescent boys (M[subscript age] = 14.10; N = 325) that (a) explains their exposure to Internet pornography by looking at relationships with pubertal timing and sensation seeking, and (b) explores…

  1. Early adolescent boys’ exposure to Internet pornography: relationships to pubertal timing, sensation seeking, and academic performance

    NARCIS (Netherlands)

    Beyens, I.; Vandenbosch, L.; Eggermont, S.

    2015-01-01

    Research has demonstrated that adolescents regularly use Internet pornography. This two-wave panel study aimed to test an integrative model in early adolescent boys (Mage = 14.10; N = 325) that (a) explains their exposure to Internet pornography by looking at relationships with pubertal timing and

  2. Subjective Age in Early Adolescence: Relationships with Chronological Age, Pubertal Timing, Desired Age, and Problem Behaviors

    Science.gov (United States)

    Hubley, Anita M.; Arim, Rubab G.

    2012-01-01

    Subjective age generally refers to the age that one feels. In a cross-sectional questionnaire study of 245 adolescents ages 10-14 years, we examined (a) whether, and when, a cross-over in subjective age occurs, (b) differences in subjective age among pubertal timing groups, (c) correlations between subjective age and each of desired age and five…

  3. Salivary testosterone concentrations in pubertal ICSI boys compared with spontaneously conceived boys

    NARCIS (Netherlands)

    Belva, F.; Bonduelle, M.; Schiettecatte, J.; Tournaye, H.; Painter, R. C.; Devroey, P.; de Schepper, J.

    2011-01-01

    BACKGROUND: To date, no data exist about Leydig cell function of pubertal boys born after ICSI. To evaluate a potential risk of gonadal dysfunction in children born from fathers with compromised fertility, testicular function was assessed by the measurement of salivary testosterone. METHODS: Morning

  4. Tamoxifen therapy for the management of pubertal gynecomastia: a systematic review

    NARCIS (Netherlands)

    Lapid, Oren; van Wingerden, Jan J.; Perlemuter, Leon

    2013-01-01

    Objective: A systematic review to assess the efficacy of tamoxifen in the management of idiopathic pubertal gynecomastia. Data sources: Searches were conducted using the databases of Medline (search engine PubMed) and Web of Science (R). Study selection: Studies reporting the use of Tamoxifen for

  5. Tamoxifen treatment for pubertal gynecomastia in two siblings with partial androgen insensitivity syndrome.

    Science.gov (United States)

    Saito, Reiko; Yamamoto, Yukiyo; Goto, Motohide; Araki, Shunsuke; Kubo, Kazuyasu; Kawagoe, Rinko; Kawada, Yasusada; Kusuhara, Koichi; Igarashi, Maki; Fukami, Maki

    2014-01-01

    Although tamoxifen has been shown to be fairly safe and effective for idiopathic pubertal gynecomastia, it remains unknown whether it is also beneficial for gynecomastia associated with endocrine disorders. Here, we report the effect of tamoxifen on pubertal gynecomastia in 2 siblings with partial androgen insensitivity syndrome (PAIS). Cases 1 and 2 presented with persistent pubertal gynecomastia at 13 and 16 years of age, respectively. Physical examinations revealed breast of Tanner stage 3 and normal male-type external genitalia in both cases. Clinical features such as female-type pubic hair and borderline small testis indicated mildly impaired masculinization. Molecular analysis identified a previously reported p.Arg789Ser mutation in the androgen receptor gene (AR) in the 2 cases. Two months of oral administration of tamoxifen ameliorated gynecomastia to Tanner stage 2 with no adverse events. Additional treatment with testosterone enanthate showed negligible effects on body hair and penile length. Hormone values of the 2 cases during tamoxifen treatment remained similar to those in previously reported untreated patients with PAIS. The results indicate that tamoxifen was effective in treating pubertal gynecomastia in these 2 patients with PAIS and may be considered as a therapeutic option in this situation pending further studies.

  6. Pubertal Timing and Mexican-Origin Girls' Internalizing and Externalizing Symptoms: The Influence of Harsh Parenting

    Science.gov (United States)

    Deardorff, Julianna; Cham, Heining; Gonzales, Nancy A.; White, Rebecca M. B.; Tein, Jenn-Yun; Wong, Jessie J.; Roosa, Mark W.

    2013-01-01

    Early-maturing girls are at risk for internalizing and externalizing problems. Research concerning pubertal timing and mental health among Mexican Americans or the influence of parenting behaviors on these relations has been scarce. This study addressed these gaps. This was a prospective examination of 362 Mexican-origin girls and their mothers in…

  7. The value of shoe size for prediction of the timing of the pubertal growth spurt.

    NARCIS (Netherlands)

    Busscher, I.; Kingma, I.; Wapstra, F.H.; Bulstra, S.K.; Verkerke, G.J.; Veldhuizen, A.G.

    2011-01-01

    Background: Knowing the timing of the pubertal growth spurt of the spine, represented by sitting height, is essential for the prognosis and therapy of adolescent idiopathic scoliosis. There are several indicators that reflect growth or remaining growth of the patient. For example, distal body parts

  8. EFFECTS OF DIBUTYL PHTHALATE IN MALE RABBITS FOLLOWING IN UTERO, ADOLESCENT OR POST-PUBERTAL EXPOSURE

    Science.gov (United States)

    Effects of dibutyl phthalate in male rabbits following in utero, adolescent, or post-pubertal exposureTy T. Higuchi1, Jennifer S. Palmer1, L. Earl Gray Jr2., and D. N. Rao Veeramachaneni11Animal Reproduction and Biotechnology Laboratory, Colorado State University, Fort

  9. The relationship between income, economic freedom, and BMI.

    Science.gov (United States)

    Lawson, R A; Murphy, R H; Williamson, C R

    2016-05-01

    What explains increases in BMI (and obesity) over time and across countries? Although many microeconomic forces are likely explanations, increasingly scholars are arguing that macroeconomic forces such as market liberalism and globalization are root causes of the obesity epidemic. The purpose of this paper is to examine the impact of economic freedom on obesity conditional on the level of income and other factors. We use an unbalanced pooled cross section of up to 135 countries for 1995 and 2000-2009. Our statistical model specifications include pooled OLS and fixed effects. First, we find that controlling for fixed effects siphons off much of the relationship previously documented between economic freedom and BMI. Second, economic freedom is associated with slightly higher BMIs but only for men in developing nations. Lastly, we show that economic freedom increases life expectancy for both men and women in developing countries. Therefore, policies aimed at reducing obesity that limit economic liberalism may come at the expense of life expectancy in the developing world. Copyright © 2016 The Royal Society for Public Health. Published by Elsevier Ltd. All rights reserved.

  10. Sagittal abdominal diameter shows better correlation with cardiovascular risk factors than waist circumference and BMI

    OpenAIRE

    de Souza, Natalia Cavalheri; de Oliveira, Erick Prado

    2013-01-01

    Background Obesity (abdominal adiposity) is a risk factor for cardiovascular diseases and the most used methods to measure the adiposity are body mass index (BMI), waist circumference (WC), and sagittal abdominal diameter (SAD). Objective To correlate BMI, WC, and SAD with biochemical parameters and blood pressure in adults. Methods A non-experimental exploratory/descriptive and cross sectional study was developed and it was assessed 133 subjects (59 men and 74 women) aging between 18 and 87?...

  11. Cardiorespiratory fitness, BMI, and risk of hypertension: the HYPGENE study.

    Science.gov (United States)

    Rankinen, Tuomo; Church, Timothy S; Rice, Treva; Bouchard, Claude; Blair, Steven N

    2007-10-01

    Cardiorespiratory fitness and regular physical activity are inversely associated with the risk of hypertension, and exercise training has been shown to lower elevated blood pressure (BP). Genetic factors contribute significantly to the interindividual differences in endurance training-induced changes in BP. However, similar data on the genotype-by-fitness interactions on the risk of hypertension are scarce. In 2000, we started a systematic collection of blood samples from all consenting subjects of the Aerobics Center Longitudinal Study (ACLS) with a goal to generate a resource for studies addressing genotype-by-fitness interaction effects on various health-related end points. Here, we introduce the rationale and design of the first study based on the ACLS genetics resource focusing on hypertension as the health outcome (HYPGENE study), and we report the associations of cardiorespiratory fitness and body mass index (BMI) with the risk of hypertension. All HYPGENE subjects (N = 1234) were healthy and normotensive at their first clinic visit. Cases (N = 629) developed hypertension during the follow-up period (mean 8.7 yr), whereas controls (N = 605) remained normotensive (mean follow-up 10.1 yr). Cardiorespiratory fitness was the strongest predictor of the hypertension risk, with each maximal metabolic equivalent unit being associated with a 19% lower risk (95% confidence interval [95% CI], 12-24%). Each baseline BMI unit was associated with a 9% higher hypertension risk (95% CI, 4-13%). However, the association of BMI was greatly attenuated (odds ratio 1.04 [95% CI, 0.99-1.09]) when fitness also was included in the model. The HYPGENE study will provide an excellent resource to address hypotheses regarding the genetic basis of hypertension while taking cardiorespiratory fitness level into account.

  12. Eating behaviour patterns and BMI in Portuguese higher education students.

    Science.gov (United States)

    Poínhos, Rui; Oliveira, Bruno M P M; Correia, Flora

    2013-12-01

    Our aim was to determine prototypical patterns of eating behaviour among Portuguese higher education students, and to relate these patterns with BMI. Data from 280 higher education students (63.2% females) aged between 18 and 27 years were analysed. Several eating behaviour dimensions (emotional and external eating, flexible and rigid restraint, binge eating, and eating self-efficacy) were assessed, and eating styles were derived through cluster analysis. BMI for current, desired and maximum self-reported weights and the differences between desired and current BMI and between maximum and current BMI were calculated. Women scored higher in emotional eating and restraint, whereas men showed higher eating self-efficacy. Men had higher current, desired and maximum BMI. Cluster analysis showed three eating styles in both male and female subsamples: "Overeating", "High self-efficacy" and "High restraint". High self-efficacy women showed lower BMI values than the others, and restrictive women had higher lost BMI. High self-efficacy men showed lower desired BMI than overeaters, and lower maximum and lost BMI than highly restrictive ones. Restrictive women and men differ on important eating behaviour features, which may be the cause of differences in the associations with BMI. Eating self-efficacy seems to be a central variable influencing the relationships between other eating behaviour dimensions and BMI. Copyright © 2013 Elsevier Ltd. All rights reserved.

  13. Analysis list: BMI1 [Chip-atlas[Archive

    Lifescience Database Archive (English)

    Full Text Available BMI1 Blood,Digestive tract,Neural,Prostate + hg19 http://dbarchive.biosciencedbc.jp/kyushu-u/hg19/target/BMI...1.1.tsv http://dbarchive.biosciencedbc.jp/kyushu-u/hg19/target/BMI1.5.tsv http://db...archive.biosciencedbc.jp/kyushu-u/hg19/target/BMI1.10.tsv http://dbarchive.biosciencedbc.jp/kyushu-u/hg19/colo/BMI...1.Blood.tsv,http://dbarchive.biosciencedbc.jp/kyushu-u/hg19/colo/BMI1.Diges...tive_tract.tsv,http://dbarchive.biosciencedbc.jp/kyushu-u/hg19/colo/BMI1.Neural.tsv,http://dbarchive.bioscie

  14. The Role of BMI in Hip Fracture Surgery.

    Science.gov (United States)

    Akinleye, Sheriff D; Garofolo, Garret; Culbertson, Maya Deza; Homel, Peter; Erez, Orry

    2018-01-01

    Obesity is an oft-cited cause of surgical morbidity and many institutions require extensive supplementary screening for obese patients prior to surgical intervention. However, in the elderly patients, obesity has been described as a protective factor. This article set out to examine the effect of body mass index (BMI) on outcomes and morbidity after hip fracture surgery. The National Surgical Quality Improvement Program database was queried for all patients undergoing 1 of 4 surgical procedures to manage hip fracture between 2008 and 2012. Patient demographics, BMI, and known factors that lead to poor surgical outcomes were included as putative predictors for complications that included infectious, cardiac, pulmonary, renal, and neurovascular events. Using χ 2 tests, 30-day postoperative complication rates were compared between 4 patient groups stratified by BMI as low weight (BMI BMI = 20-30), obese (BMI = 30-40), and morbidly obese (BMI > 40). A total of 15 108 patients underwent surgery for hip fracture over the examined 5-year period. Of these, 18% were low weight (BMI BMI = 20-30), 13% were obese (BMI = 30-40), and 2% were morbidly obese (BMI > 40). The low-weight and morbidly obese patients had both the highest mortality rates and the lowest superficial infection rates. There was a significant increase in blood transfusion rates that decreased linearly with increasing BMI. Deep surgical site infection and renal failure increased linearly with increasing BMI, however, these outcomes were confounded by comorbidities. This study demonstrates that patients at either extreme of the BMI spectrum, rather than solely the obese, are at greatest risk of major adverse events following hip fracture surgery. This runs contrary to the notion that obese hip fracture patients automatically require additional preoperative screening and perioperative services, as currently implemented in many institutions.

  15. Cortisol in human milk predicts child BMI.

    Science.gov (United States)

    Hahn-Holbrook, Jennifer; Le, Tran Bao; Chung, Anna; Davis, Elysia Poggi; Glynn, Laura M

    2016-12-01

    Breastfeeding has been linked to lower rates of childhood obesity. Human milk contains cortisol, known to regulate glucose storage and metabolism. The aim of this study was to to test the hypothesis that early exposure to cortisol in human breast milk helps to modulate infant body mass index (BMI) trajectories over the first 2 years of life. Growth curve modeling was used to examine whether infant exposure to cortisol in human milk at 3 months predicted changes in child body mass index percentile (BMIP) at 6, 12, and 24 months of age in 51 breastfeeding mother-child pairs. Infants exposed to higher milk cortisol levels at 3 months were less likely to exhibit BMIP gains over the first 2 years of life, compared with infants exposed to lower milk cortisol. By age 2, infants exposed to higher milk cortisol levels had lower BMIPs than infants exposed to lower milk cortisol. Milk cortisol was a stronger predictor of BMIP change in girls than boys. Cortisol exposure through human milk may help to program metabolic functioning and childhood obesity risk. Further, because infant formula contains only trace amounts of glucocorticoids, these findings suggest that cortisol in milk is a novel biological pathway through which breastfeeding may protect against later obesity. © 2016 The Obesity Society.

  16. Does the cortisol awakening response link childhood adversity to adult BMI?

    Science.gov (United States)

    Miller, Kelly F; Arbel, Reout; Shapiro, Lauren S; Han, Sohyun C; Margolin, Gayla

    2018-04-26

    Childhood adversity is a risk factor for the development of obesity in adulthood. Dysregulated hypothalamic-pituitary-adrenal (HPA) activity, which has been associated separately with both adverse childhood experiences and obesity, has been posited as a mechanism by which stressful experiences influence body mass index (BMI); however, this mechanism has not yet been tested longitudinally. The present study uses multireporter, longitudinal data across three time points to test whether the adolescent cortisol awakening response (CAR), an index of diurnal HPA activity, mediates the association between adversity in childhood and BMI in adulthood. Eighty-two youth, mothers, and fathers reported on adverse childhood experiences from middle childhood to late adolescence. During adolescence, youth provided saliva samples three times each morning across three days, which were assayed for cortisol to calculate CAR. During early adulthood, youth reported height and weight to calculate BMI. Greater adversity predicted flatter CAR and higher young adult BMI. Flatter CAR partially mediated the association between childhood adversity and young adult BMI. Stress-related alterations to HPA activity account in part for the childhood adversity-adult obesity link. Findings are consistent with theoretical models implicating HPA alterations as linking childhood adversity to metabolic and behavioral determinants of BMI in adulthood. (PsycINFO Database Record (c) 2018 APA, all rights reserved).

  17. The Few, the Changing, the Different: Pubertal Onset, Perceived School Climate and Body Image in Ethnically Diverse Sixth Grade Girls

    OpenAIRE

    Morales, Jessica

    2012-01-01

    The present study examined the impact of pubertal onset, race/ethnicity, and school racial/ethnic composition on girls' body image and perceived school climate (school safety, school liking, and loneliness in school) during the middle school transition. The sample (N = 1,626) included 6th grade Black, Mexican American, White, and Asian girls from 20 diverse middle schools. Hierarchical analyses supported both the early-timing and stressful change hypothesis. That is, experiencing pubertal ons...

  18. BMI-1, a promising therapeutic target for human cancer

    Science.gov (United States)

    WANG, MIN-CONG; LI, CHUN-LI; CUI, JIE; JIAO, MIN; WU, TAO; JING, LI; NAN, KE-JUN

    2015-01-01

    BMI-1 oncogene is a member of the polycomb-group gene family and a transcriptional repressor. Overexpression of BMI-1 has been identified in various human cancer tissues and is known to be involved in cancer cell proliferation, cell invasion, distant metastasis, chemosensitivity and patient survival. Accumulating evidence has revealed that BMI-1 is also involved in the regulation of self-renewal, differentiation and tumor initiation of cancer stem cells (CSCs). However, the molecular mechanisms underlying these biological processes remain unclear. The present review summarized the function of BMI-1 in different human cancer types and CSCs, and discussed the signaling pathways in which BMI-1 is potentially involved. In conclusion, BMI-1 may represent a promising target for the prevention and therapy of various cancer types. PMID:26622537

  19. Earlier BMI rebound and lower pre-rebound BMI as risk of obesity among Japanese preschool children.

    Science.gov (United States)

    Kato, N; Isojima, T; Yokoya, S; Tanaka, T; Ono, A; Yokomichi, H; Yamagata, Z; Tanaka, S; Matsubara, H; Ishikuro, M; Kikuya, M; Chida, S; Hosoya, M; Kuriyama, S; Kure, S

    2018-01-01

    Longitudinal growth data of children were analyzed to clarify the relationship between the timing of body mass index (BMI) rebound and obesity risk in later ages. Of 54 558 children born between April 2004 and March 2005 and longitudinally measured in April and October every year in the preschool period, 15 255 children were analyzed wherein no longitudinal measurement is missing after 1 year of age. BMI rebound age was determined as the age with smallest BMI value across longitudinal individual data after 1 year of age. Rebound age was compared between overweight and non-overweight groups. The subjects were divided into groups based on the timing of rebound. The sex- and age-adjusted mean of the BMI, height and weight s.d. scores for age group, along with 6 months weight and height gain, were compared among groups using analysis of covariance. Among those who were overweight at 66-71 months of age, BMI rebound age obtained at approximately 3 years of age was compared with the non-overweight group, whose BMI rebound age was utmost 66 months or later (PBMI age group showed that earlier BMI rebound results in larger BMI (PBMI rebound earlier than 30 months of age, low BMI was observed (PBMI rebound among groups with rebound age earlier than 60 months of age (PBMI rebound timing with pre-rebound low BMI leads to greater childhood obesity risk; hence, early detection and prevention is necessary for such cases.

  20. Prenatal risk factors influencing childhood BMI and overweight independent of birth weight and infancy BMI - a path analysis within the Danish National Birth Cohort

    DEFF Research Database (Denmark)

    Morgen, Camilla Schmidt; Ängquist, Lars; Lynn Baker, Jennifer

    2018-01-01

    BACKGROUND AND OBJECTIVES: Prenatal risk factors for childhood overweight may operate indirectly through development in body size in early life and/or directly independent hereof. We quantified the effects of maternal and paternal body mass index (BMI), maternal age, socioeconomic position (SEP),...... of Obesity advance online publication, 31 October 2017; doi:10.1038/ijo.2017.217....

  1. Predictors of increasing BMI during the course of diabetes in children and adolescents with type 1 diabetes: data from the German/Austrian DPV multicentre survey.

    Science.gov (United States)

    Fröhlich-Reiterer, Elke E; Rosenbauer, Joachim; Bechtold-Dalla Pozza, Susanne; Hofer, Sabine E; Schober, Edith; Holl, Reinhard W

    2014-08-01

    Increased weight gain has been reported prior to disease onset (accelerator hypothesis) and as a side effect of intensified insulin therapy in type 1 diabetes (T1D). Paediatric studies are complicated by the age-dependency and gender-dependency of BMI, and also by a trend towards obesity in the general population. The aim of this study was to evaluate factors related to the increase in BMI during the course of diabetes in children and adolescents with T1D in a large multicentre survey. Within the DPV database (Diabetespatienten Verlaufsdokumentation) a standardised, prospective, computer-based documentation programme, data of 53,108 patients with T1D, aged 12,774 patients (53% male, mean age 13.4±3.9, mean diabetes duration 4.7±3.0 years and mean age at diabetes onset 8.7±4.0 years) were included in this analysis. Population-based German reference data were used to calculate BMI-SDS and define overweight and obesity. 12.5% of T1D patients were overweight and 2.8% were obese. Multiple longitudinal regression analysis revealed that female gender, low BMI at diabetes onset, intensified insulin therapy and higher insulin dose, as well as pubertal diabetes onset, long diabetes duration and onset in earlier calendar years among girls, were related to higher BMI-SDS increase during the course of diabetes (p1; all). Intensified insulin regimen is associated with weight gain during T1D treatment, in addition to demographic variables. Optimisation of diabetes management, especially in females, might limit weight gain in order to reduce overweight and obesity together with comorbidities among paediatric T1D patients. Published by the BMJ Publishing Group Limited. For permission to use (where not already granted under a licence) please go to http://group.bmj.com/group/rights-licensing/permissions.

  2. Trends in BMI of urban Australian adults, 1980-2000

    DEFF Research Database (Denmark)

    Walls, Helen L; Wolfe, Rory; Haby, Michelle M

    2010-01-01

    of 7.4 kg/m2 at the higher end for women aged 55-64 years. While the prevalence of obesity (BMI >or= 30 kg/m2) doubled, the prevalence of obesity class III (BMI >or= 40 kg/m2) increased fourfold. CONCLUSIONS: BMI in urban Australian adults has increased and its distribution has become increasingly...... right-skewed. This has resulted in a large increase in the prevalence of obesity, particularly the more severe levels of obesity. It will be important to monitor changes in the different classes of obesity and the extent to which obesity interventions both shift the BMI distribution leftwards...

  3. Association Between BMI and Recurrence of Primary Spontaneous Pneumothorax.

    Science.gov (United States)

    Tan, Juntao; Yang, Yang; Zhong, Jianhong; Zuo, Chuantian; Tang, Huamin; Zhao, Huimin; Zeng, Guang; Zhang, Jianfeng; Guo, Jianji; Yang, Nuo

    2017-05-01

    Whether body mass index (BMI) is a significant risk factor for recurrence of primary spontaneous pneumothorax (PSP) remains controversial. The purpose of this study was to examine whether BMI and other factors are linked to risk of PSP recurrence. A consecutive cohort of 273 patients was retrospectively evaluated. Patients were divided into those who experienced recurrence (n = 81) and those who did not (n = 192), as well as into those who had low BMI (n = 75) and those who had normal or elevated BMI (n = 198). The two pairs of groups were compared in terms of baseline data, and Cox proportional hazards modeling was used to identify predictors of PSP recurrence. Rates of recurrence among all 273 patients were 20.9% at 1 year, 23.8% at 2 years, and 28.7% at 5 years. Univariate analysis identified the following significant predictors of PSP recurrence: height, weight, BMI, size of pneumothorax, and treatment modality. Multivariate analyses identified several risk factors for PSP recurrence: low BMI, pneumothorax size ≥50%, and non-surgical treatment. Kaplan-Meier survival analysis indicated that patients with low BMI showed significantly lower recurrence-free survival than patients with normal or elevated BMI (P pneumothorax size ≥50%, and non-surgical treatment were risk factors for PSP recurrence in our cohort. Low BMI may be a clinically useful predictor of PSP recurrence.

  4. Fertility of the Small East African goat following pre-pubertal infection with Trypanosoma congolense

    International Nuclear Information System (INIS)

    O'Hara, H.B.; Gombe, S.

    1991-01-01

    Pre-pubertal male and female Small East African goats were infected with Trypanosoma congolense at 4-5 months of age. Changes in body weight and haemogram were monitored weekly. Progesterone and testosterone measurements were made three times weekly until the goats either reached puberty or 18 months of age. Onset of puberty was determined from observation of oestrus behaviour, mating or increase in libidio; this was confirmed by elevation in plasma progesterone or testosterone levels. Trypanosomiasis affected pre-pubertal goats by reducing body weight gain and delaying onset of puberty. Histological examination of the gonads showed pronounced pathological changes. These effects were reversed by treatment with isometamidium chloride (Samorin, May and Baker). It was concluded that early treatment of infected goats before serious gonadal damage could occur allowed full restoration of reproductive function. (author). 6 refs, 4 figs, 1 tab

  5. Giant fibroadenoma of the breast in a pre-pubertal girl: a case report

    Directory of Open Access Journals (Sweden)

    Sunder Goyal

    2014-02-01

    Full Text Available Juvenile fibroadenoma comprises about 4% of the total fibroadenomas. The incidence of giant juvenile fibroadenomas is merely 0.5% of all the fibroadenomas. Bilateral giant juvenile fibroadenomas are extremely rare. We are presenting a case of giant juvenile fibroadenomas in an 11-year-old pre-pubertal girl. The diagnosis was made on fine-needle aspiration cytology which was confirmed on histopathology. As these tumors are mostly benign, breast-conserving surgery is done so that patient can lead a normal life without psychological trauma.-----------------------------------Cite this article as: Goyal S, Garg G, Narang S. Giant fibroadenoma of the breast in a pre-pubertal girl: a case report. Int J Cancer Ther Oncol 2014; 2(1:020113.DOI: http://dx.doi.org/10.14319/ijcto.0201.13

  6. Bmi1 overexpression in the cerebellar granule cell lineage of mice affects cell proliferation and survival without initiating medulloblastoma formation

    Directory of Open Access Journals (Sweden)

    Hourinaz Behesti

    2013-01-01

    BMI1 is a potent inducer of neural stem cell self-renewal and neural progenitor cell proliferation during development and in adult tissue homeostasis. It is overexpressed in numerous human cancers – including medulloblastomas, in which its functional role is unclear. We generated transgenic mouse lines with targeted overexpression of Bmi1 in the cerebellar granule cell lineage, a cell type that has been shown to act as a cell of origin for medulloblastomas. Overexpression of Bmi1 in granule cell progenitors (GCPs led to a decrease in cerebellar size due to decreased GCP proliferation and repression of the expression of cyclin genes, whereas Bmi1 overexpression in postmitotic granule cells improved cell survival in response to stress by altering the expression of genes in the mitochondrial cell death pathway and of Myc and Lef-1. Although no medulloblastomas developed in ageing cohorts of transgenic mice, crosses with Trp53−/− mice resulted in a low incidence of medulloblastoma formation. Furthermore, analysis of a large collection of primary human medulloblastomas revealed that tumours with a BMI1high TP53low molecular profile are significantly enriched in Group 4 human medulloblastomas. Our data suggest that different levels and timing of Bmi1 overexpression yield distinct cellular outcomes within the same cellular lineage. Importantly, Bmi1 overexpression at the GCP stage does not induce tumour formation, suggesting that BMI1 overexpression in GCP-derived human medulloblastomas probably occurs during later stages of oncogenesis and might serve to enhance tumour cell survival.

  7. Longitudinal weight differences, gene expression, and blood biomarkers in BMI discordant identical twins

    Science.gov (United States)

    van Dongen, Jenny; Willemsen, Gonneke; Heijmans, Bastiaan T.; Neuteboom, Jacoline; Kluft, Cornelis; Jansen, Rick; Penninx, Brenda W.J.; Slagboom, P. Eline; de Geus, Eco J.C.; Boomsma, Dorret I.

    2015-01-01

    Background BMI discordant monozygotic (MZ) twins allows an examination of the causes and consequences of adiposity in a genetically controlled design. Few studies have examined longitudinal BMI discordance in MZ pairs. Objectives To study the development over time of BMI discordance in adolescent and adult MZ twin pairs, and to examine lifestyle, metabolic, inflammatory, and gene expression differences associated with concurrent and long-term BMI discordance in MZ pairs. Subjects/Methods BMI data from 2775 MZ twin pairs, collected in eight longitudinal surveys and a biobank project between 1991 and 2011, were analyzed to characterize longitudinal discordance. Lifestyle characteristics were compared within discordant pairs (ΔBMI ≥ 3 kg/m2) and biomarkers (lipids, glucose, insulin, CRP, fibrinogen, IL-6, TNF-α and sIL-6R and liver enzymes AST, ALT and GGT) and gene expression were compared in peripheral blood from discordant pairs who participated in the NTR biobank project. Results The prevalence of discordance ranged from 3.2% in 1991 (mean age=17, SD=2.4) to 17.4% (N=202 pairs) in 2009 (mean age=35, SD=15), and was 16.5% (N=174) among pairs participating in the biobank project (mean age=35, SD=12). Of 699 MZ with BMI data from 3-5 time points, 17 pairs (2.4%) were long-term discordant (at all available time points; mean follow-up range=6.4 years). Concurrently discordant pairs showed significant differences in self-ratings of which twin eats most (p=2.3×10−13), but not in leisure time exercise activity (p=0.28) and smoking (p>0.05). Ten out of 14 biomarkers showed significantly more unfavorable levels in the heavier of twin of the discordant pairs (p-values BMI discordance is uncommon in adolescent identical pairs but increases with higher pair-mean of BMI at older ages, although long-term BMI discordance is rare. In discordant pairs, the heavier twin had a more unfavorable blood biomarker profile than the genetically matched leaner twin, in support of

  8. Longitudinal Analysis of Genetic Susceptibility and BMI Throughout Adult Life.

    Science.gov (United States)

    Song, Mingyang; Zheng, Yan; Qi, Lu; Hu, Frank B; Chan, Andrew T; Giovannucci, Edward L

    2018-02-01

    Little is known about the genetic influence on BMI trajectory throughout adulthood. We created a genetic risk score (GRS) comprising 97 adult BMI-associated variants among 9,971 women and 6,405 men of European ancestry. Serial measures of BMI were assessed from 18 (women) or 21 (men) years to 85 years of age. We also examined BMI change in early (from 18 or 21 to 45 years of age), middle (from 45 to 65 years of age), and late adulthood (from 65 to 80 years of age). GRS was positively associated with BMI across all ages, with stronger associations in women than in men. The associations increased from early to middle adulthood, peaked at 45 years of age in men and at 60 years of age in women (0.91 and 1.35 kg/m 2 per 10-allele increment, respectively) and subsequently declined in late adulthood. For women, each 10-allele increment in the GRS was associated with an average BMI gain of 0.54 kg/m 2 in early adulthood, whereas no statistically significant association was found for BMI change in middle or late adulthood or for BMI change in any life period in men. Our findings indicate that genetic predisposition exerts a persistent effect on adiposity throughout adult life and increases early adulthood weight gain in women. © 2017 by the American Diabetes Association.

  9. BMI may underestimate the socioeconomic gradient in true obesity

    NARCIS (Netherlands)

    van den Berg, G.; van Eijsden, M.; Vrijkotte, T. G. M.; Gemke, R. J. B. J.

    2013-01-01

    Body mass index (BMI) does not make a distinction between fat mass and lean mass. In children, high fat mass appears to be associated with low maternal education, as well as low lean mass because maternal education is associated with physical activity. Therefore, BMI might underestimate true obesity

  10. Secular Trends on Birth Parameters, Growth, and Pubertal Timing in Girls with Turner Syndrome

    Directory of Open Access Journals (Sweden)

    Joachim Woelfle

    2018-02-01

    Full Text Available BackgroundWhether children with chromosomal disorders of growth and puberty are affected by secular trends (STs as observed in the general population remains unanswered, but this question has relevance for expectations of spontaneous development and treatment responses.ObjectivesThe aim of the study was to evaluate STs in birth parameters, growth, and pubertal development in girls with Turner syndrome (TS.Study designRetrospective analysis of KIGS data (Pfizer International Growth Database. We included all TS patients who entered KIGS between 1987 and 2012 and were born from 1975 to 2004, who were prepubertal and growth treatment naïve at first entry (total number: 7,219. Pretreatment height and ages at the start of treatment were compared across 5-year birth year groups, with subgroup analyses stratified by induced or spontaneous puberty start.ResultsWe observed significant STs across the birth year groups for birth weight [+0.18 SD score (SDS, p < 0.001], pretreatment height at mean age 8 years (+0.73 SDS, p < 0.001, height at the start of growth hormone (GH therapy (+0.38 SDS, p < 0.001 and start of puberty (+0.42 SDS, p < 0.001. Spontaneous puberty onset increased from 15 to 30% (p < 0.001. Mean age at the start of GH treatment decreased from 10.8 to 7.4 years (−3.4 years; p < 0.001, and substantial declines were seen in ages at onset of spontaneous and induced puberty (−2.0 years; p < 0.001 and menarche (−2.1 years; p < 0.001.ConclusionEnvironmental changes leading to increased height and earlier and also more common, spontaneous puberty are applicable in TS as in normal girls. In addition, greater awareness for TS may underlie trends to earlier start of GH therapy and induction of puberty at a more physiological age.

  11. Are BMI and Sedentariness Correlated? A Multilevel Study in Children

    Directory of Open Access Journals (Sweden)

    Thayse Natacha Gomes

    2015-07-01

    Full Text Available The purpose of this research was to investigate the relationship between body mass index (BMI and sedentariness (Sed in children and to examine the influence of child and school correlates on their variation. The sample comprises 580 children (337 girls, 9–11 years. Sedentariness was assessed with an accelerometer, and BMI was computed. Child- and school-level covariates were analyzed using multilevel models. No significant correlation between Sed and BMI was found. School context explains 5% and 1.5% of the total variance in Sed and BMI, respectively. At the child level, only moderate-to-vigorous physical activity was associated with both Sed (β = −0.02 ± 0.002 and BMI (β = −0.005 ± 0.002. Sleep time is related to Sed (β = −0.42 ± 0.04, while sex (β = 1.97 ± 0.13, biological maturity (β = 1.25 ± 0.07, media in the bedroom (β = 0.26 ± 0.08 and healthy (β = −0.09 ± 0.03 and unhealthy (β = −0.07 ± 0.04 diet scores were associated with BMI. None of the school-level covariates were related to BMI, but access to cafeteria (β = −0.97 ± 0.25, playground equipment (β = −0.67 ± 0.20 and restaurants (β = 0.16 ± 0.08 were related to Sed. In conclusion, Sed and BMI were not correlated. Further, they have different correlates, while children’s traits seem to play more relevant roles in their differences in Sed and BMI than the school milieu. This information should be taken into account when strategies to reduce Sed and BMI are implemented.

  12. Physical activity, BMI and metabolic risk in Portuguese adolescents

    Directory of Open Access Journals (Sweden)

    Fernanda Karina dos Santos

    2016-03-01

    Full Text Available DOI: http://dx.doi.org/10.5007/1980-0037.2016v18n1p103   It has been reported, in the last decades, a significant decrease in physical activity (PA levels, with a consequent increase in obesity and metabolic risk factors among youth. The aims of this study were to describe PA levels, the prevalence of overweight/obesity and metabolic risk factors, and to examine the association between PA and body mass index (BMI with metabolic risk among Portuguese youth. The sample comprises 212 Portuguese adolescents (12-16 years old. Height and weight were measured. PA was estimated with the Bouchard questionnaire (3 days recall, as well as with the use of a pedometer (used for 5 consecutive days. Metabolic risk factors comprised fasting glucose, triglycerides, HDL-cholesterol, systolic blood pressure and waist circumference. Subjects were classified as normal weight, overweight or obese according to BMI; the maturational status was indirectly estimated with the maturity offset procedure. A continuous metabolic risk score was computed (zMR and PA values were divided into tertiles. Qui-square test, t-test and ANOVA were used in statistical analyses. SPSS 18.0 and WinPepi softwares were used and p<0.05. A moderate to high prevalence of overweight/obesity and HDL-cholesterol was found, as well as a high prevalence of high blood pressure and low to moderate PA levels among Portuguese youth. The relationship between BMI and zMR showed that obese adolescents have higher zMR when compared to normal weight or overweight adolescents. This finding suggests that increased levels of PA and reduction in the prevalence of overweight/obesity may have a positive role against the development of metabolic risk factors.

  13. Trajectories of BMI from early childhood through early adolescence: SES and psychosocial predictors.

    Science.gov (United States)

    Lane, Sean P; Bluestone, Cheryl; Burke, Christopher T

    2013-02-01

    This study examined the ways in which body mass index (BMI) percentile - an identified risk factor for overweight and cardiovascular disease in adulthood - develops from birth through early adolescence. In addition, we examined whether psychosocial factors, such as parenting style and maternal depression, mediated the link between socio-economic status (SES) and BMI growth. Design. Data were obtained from phases 1-3 of the National Institute of Child Health and Human Development (NICHD) Study of Early Child Care and Youth Development (SECCYD) - a longitudinal study that followed children from 10 communities in the United States from birth to age 11. We applied growth mixture models to identify distinct subtypes of BMI development. Within these models, we performed between- and within-class mediation analyses to examine whether SES predicted class membership or differences in development within each class via maternal depression and parenting styles. Results identified three prototypic trajectories of BMI percentile growth, elevated, steady increase, and stable. We found evidence for both between- and within-class mediation, suggesting multiple pathways by which SES can affect BMI development. These findings add to the research that suggests that being in a family with a low SES is associated with falling into patterns of development characterized by early and lasting increases in BMI relative to one's peers, and that this association is partly accounted for by maternal depression and parenting styles. What is already known? Past research has found evidence that patterns of childhood overweight are impacted by socioeconomic status through psychosocial factors like parenting and depression. This evidence is often limited to individual points in time where neglectful, permissive, and authoritarian parenting and higher levels of maternal depression are associated with higher levels of overweight status among children from infancy to adolescence. However, little

  14. Is BMI a valid measure of obesity in postmenopausal women?

    Science.gov (United States)

    Banack, Hailey R; Wactawski-Wende, Jean; Hovey, Kathleen M; Stokes, Andrew

    2018-03-01

    Body mass index (BMI) is a widely used indicator of obesity status in clinical settings and population health research. However, there are concerns about the validity of BMI as a measure of obesity in postmenopausal women. Unlike BMI, which is an indirect measure of obesity and does not distinguish lean from fat mass, dual-energy x-ray absorptiometry (DXA) provides a direct measure of body fat and is considered a gold standard of adiposity measurement. The goal of this study is to examine the validity of using BMI to identify obesity in postmenopausal women relative to total body fat percent measured by DXA scan. Data from 1,329 postmenopausal women participating in the Buffalo OsteoPerio Study were used in this analysis. At baseline, women ranged in age from 53 to 85 years. Obesity was defined as BMI ≥ 30 kg/m and body fat percent (BF%) greater than 35%, 38%, or 40%. We calculated sensitivity, specificity, positive predictive value, and negative predictive value to evaluate the validity of BMI-defined obesity relative BF%. We further explored the validity of BMI relative to BF% using graphical tools, such as scatterplots and receiver-operating characteristic curves. Youden's J index was used to determine the empirical optimal BMI cut-point for each level of BF% defined obesity. The sensitivity of BMI-defined obesity was 32.4% for 35% body fat, 44.6% for 38% body fat, and 55.2% for 40% body fat. Corresponding specificity values were 99.3%, 97.1%, and 94.6%, respectively. The empirical optimal BMI cut-point to define obesity is 24.9 kg/m for 35% BF, 26.49 kg/m for 38% BF, and 27.05 kg/m for 40% BF according to the Youden's index. Results demonstrate that a BMI cut-point of 30 kg/m does not appear to be an appropriate indicator of true obesity status in postmenopausal women. Empirical estimates of the validity of BMI from this study may be used by other investigators to account for BMI-related misclassification in older women.

  15. Relationships between anthropometric features, body composition, and anaerobic alactic power in elite post-pubertal and mature male taekwondo athletes

    Directory of Open Access Journals (Sweden)

    Boraczyński Michał

    2017-12-01

    Full Text Available Purpose. The paper describes the relationships between anthropometric features, body composition, and anaerobic alactic power (AAP in elite post-pubertal and mature male taekwondo athletes. Methods. The sample of 41 taekwondo athletes was divided into two groups: post-pubertal (P-P, n = 19, Mage = 15.6 ± 1.1 years and mature (M, n = 22, Mage = 20.7 ± 2.8 years. Anthropometric features (WB-150, ZPU Tryb-Wag, Poland, body composition (BC-418 MA, Tanita, Japan, maturational status (Pubertal Maturational Observational Scale, and AAP (10-s version of the Wingate Anaerobic Test were assessed. Results. Post-hoc testing revealed significant between-group differences (3.2-20.4%, p < 0.01 in all anthropometric and body composition measures, with effect sizes (ES between −0.79 and −1.25 (p < 0.001, except for fat content and percentage of skeletal muscle mass (SMM (p ≥ 0.05. In group M, the maximal power output (Pmax was greater (ES = −1.15, p < 0.001 and the time of its attainment shorter (ES = 0.59, p < 0.001 than in group P-P. Correlation analyses indicated notably strong associations between body mass (BM and Pmax in group P-P (r = 0.950 [95% CI, 0.85-0.98], p < 0.001 and M (r = 0.926 [95% CI, 0.81-0.97], p < 0.001, and similar-sized strong correlations between fat-free mass (FFM and Pmax in group P-P (r = 0.955 [95% CI, 0.86-0.99], p < 0.001 and M (r = 0.924 [95% CI, 0.82-0.96], p < 0.001. Additionally, a strong correlation was found between body height and Pmax in groups P-P and M (r = 0.805 [95% CI, 0.54-0.92], p < 0.001 and r = 0.819 [95% CI, 0.58-0.93], p < 0.001, respectively. Linear regression analyses demonstrated that FFM, BM, and absolute SMM best explained the variance in Pmax in both groups (r, 0.939-0.951; r2, 0.882-0.909. Conclusions. The strong correlations observed in both groups between BM, FFM, SMM, and Pmax demonstrate the significant effects of body size and composition on AAP. By determining the current levels of these

  16. BMI1 loss delays photoreceptor degeneration in Rd1 mice. Bmi1 loss and neuroprotection in Rd1 mice.

    Science.gov (United States)

    Zencak, Dusan; Crippa, Sylvain V; Tekaya, Meriem; Tanger, Ellen; Schorderet, Daniel E; Munier, Francis L; van Lohuizen, Maarten; Arsenijevic, Yvan

    2006-01-01

    Retinitis pigmentosa (RP) is a heterogeneous group of genetic disorders leading to blindness, which remain untreatable at present. Rd1 mice represent a recognized model of RP, and so far only GDNF treatment provided a slight delay in the retinal degeneration in these mice. Bmi1, a transcriptional repressor, has recently been shown to be essential for neural stem cell (NSC) renewal in the brain, with an increased appearance of glial cells in vivo in Bmi1 knockout (Bmi1-/-) mice. One of the roles of glial cells is to sustain neuronal function and survival. In the view of a role of the retinal Miller glia as a source of neural protection in the retina, the increased astrocytic population in the Bmi1-/- brain led us to investigate the effect of Bmi1 loss in Rd1 mice. We observed an increase of Müller glial cells in Rd1-Bmi1-/- retinas compared to Rd1. Moreover, Rd1-Bmi1-/- mice showed 7-8 rows of photoreceptors at 30 days of age (P30), while in Rd1 littermates there was a complete disruption of the outer nuclear layer (ONL). Preliminary ERG results showed a responsiveness of Rd1-Bmi1-/- mice in scotopic vision at P35. In conclusion, Bmi1 loss prevented, or rescued, photoreceptors from degeneration to an unanticipated extent in Rd1 mice. In this chapter, we will first provide a brief review of our work on the cortical NSCs and introduce the Bmi1 oncogene, thus offering a rational to our observations on the retina.

  17. Prediction of BMI by impulsivity, eating behavior and activity level

    Directory of Open Access Journals (Sweden)

    Jiang Xiaxia

    2016-01-01

    Full Text Available Objective: Discuss the relationship between the impulsivity, eating behavior and activity level and the body mass index (BMI. Method: Test 147 female college students with the impulsivity questionnaire (BIS-11 and BIS/BAS, Dutch Eating Behavior Questionnaire (DBEQ, Sitting Time Scale (STS and Exercising Time Scale (ETS. Results: (1 The correlation analysis indicates that BMI and impulsivity (r = 0.43 and 0.52 have a significant positive correlation with the sitting time (r = 0.61 and a significant negative correlation with the activity level (r= −0.49. (2 The path analysis indicates that the reward sensitivity directly affects BMI and indirectly affects BMI through the activity level as well; the eating behavior has an insignificantly direct impact on BMI, because its impact is generated by the intermediary role of induced diet. Conclusion: (1 The impulsivity, eating behavior and activity level are closely related to BMI; (2 the activity level, sitting time and induced diet play an intermediary role between the impulsivity and BMI.

  18. Bmi-1: At the crossroads of physiological and pathological biology

    Science.gov (United States)

    Bhattacharya, Resham; Mustafi, Soumyajit Banerjee; Street, Mark; Dey, Anindya; Dwivedi, Shailendra Kumar Dhar

    2015-01-01

    Bmi-1 is a member of the Polycomb Repressor Complex1 that mediates gene silencing by regulating chromatin structure and is indispensable for self-renewal of both normal and cancer stem cells. Despite three decades of research that have elucidated the transcriptional regulation, post-translational modifications and functions of Bmi-1 in regulating the DNA damage response, cellular bioenergetics, and pathologies, the entire potential of a protein with such varied function remains to be realized. This review attempts to synthesize the current knowledge on Bmi-1 with an emphasis on its role in both normal physiology and cancer. Additionally, since cancer stem cells are emerging as a new paradigm for therapy resistance, the role of Bmi-1 in this perspective is also highlighted. The wide spectrum of malignancies that implicate Bmi-1 as a signature for stemness and oncogenesis also make it a suitable candidate for therapy. Nonetheless new approaches are vitally needed to further characterize physiological roles of Bmi-1 with the long-term goal of using Bmi-1 as a prognostic marker and a therapeutic target. PMID:26448339

  19. Prospective associations between sedentary lifestyle and BMI in midlife.

    Science.gov (United States)

    Mortensen, Laust H; Siegler, Ilene C; Barefoot, John C; Grønbaek, Morten; Sørensen, Thorkild I A

    2006-08-01

    A strong positive cross-sectional relationship between BMI and a sedentary lifestyle has been consistently observed in numerous studies. However, it has been questioned whether high BMI is a determinant or a consequence of a sedentary lifestyle. Using data from four follow-ups of the University of North Carolina Alumni Heart Study, we examined the prospective associations between BMI and sedentary lifestyle in a cohort of 4595 middle-aged men and women who had responded to questionnaires at the ages of 41 (standard deviation 2.3), 44 (2.3), 46 (2.0), and 54 (2.0). BMI was consistently related to increased risk of becoming sedentary in both men and women. The odds ratios of becoming sedentary as predicted by BMI were 1.04 (95% confidence limits, 1.00, 1.07) per 1 kg/m(2) from ages 41 to 44, 1.10 (1.07, 1.14) from ages 44 to 46, and 1.12 (1.08, 1.17) from ages 46 to 54. Controlling for concurrent changes in BMI marginally attenuated the effects. Sedentary lifestyle did not predict changes in BMI, except when concurrent changes in physical activity were taken into account (p sedentary lifestyle but did not provide unambiguous evidence for an effect of sedentary lifestyle on weight gain.

  20. Parental nonstandard work schedules during infancy and children's BMI trajectories

    Directory of Open Access Journals (Sweden)

    Afshin Zilanawala

    2017-09-01

    Full Text Available Background: Empirical evidence has demonstrated adverse associations between parental nonstandard work schedules (i.e., evenings, nights, or weekends and child developmental outcomes. However, there are mixed findings concerning the relationship between parental nonstandard employment and children's body mass index (BMI, and few studies have incorporated information on paternal work schedules. Objective: This paper investigated BMI trajectories from early to middle childhood (ages 3-11 by parental work schedules at 9 months of age, using nationally representative cohort data from the United Kingdom. This study is the first to examine the link between nonstandard work schedules and children's BMI in the United Kingdom. Methods: We used data from the Millennium Cohort Study (2001‒2013, n = 13,021 to estimate trajectories in BMI, using data from ages 3, 5, 7, and 11 years. Joint parental work schedules and a range of biological, socioeconomic, and psychosocial covariates were assessed in the initial interviews at 9 months. Results: Compared to children in two-parent families where parents worked standard shifts, we found steeper BMI growth trajectories for children in two-parent families where both parents worked nonstandard shifts and children in single-parent families whose mothers worked a standard shift. Fathers' shift work, compared to standard shifts, was independently associated with significant increases in BMI. Conclusions: Future public health initiatives focused on reducing the risk of rapid BMI gain in childhood can potentially consider the disruptions to family processes resulting from working nonstandard hours. Contribution: Children in families in which both parents work nonstandard schedules had steeper BMI growth trajectories across the first decade of life. Fathers' nonstandard shifts were independently associated with increases in BMI.

  1. Bmi-1 promotes the aggressiveness of glioma via activating the NF-kappaB/MMP-9 signaling pathway

    Directory of Open Access Journals (Sweden)

    Jiang Lili

    2012-09-01

    Full Text Available Abstract Background The prognosis of human glioma is poor, and the highly invasive nature of the disease represents a major impediment to current therapeutic modalities. The oncoprotein B-cell-specific Moloney murine leukemia virus integration site 1 protein (Bmi-1 has been linked to the development and progression of glioma; however, the biological role of Bmi-1 in the invasion of glioma remains unclear. Methods A172 and LN229 glioma cells were engineered to overexpress Bmi-1 via stable transfection or to be silenced for Bmi-1 expression using RNA interfering method. Migration and invasiveness of the engineered cells were assessed using wound healing assay, Transwell migration assay, Transwell matrix penetration assay and 3-D spheroid invasion assay. MMP-9 expression and activity were measured using real-time PCR, ELISA and the gelatin zymography methods. Expression of NF-kappaB target genes was quantified using real-time PCR. NF-kappaB transcriptional activity was assessed using an NF-kappaB luciferase reporter system. Expression of Bmi-1 and MMP-9 in clinical specimens was analyzed using immunohistochemical assay. Results Ectopic overexpression of Bmi-1 dramatically increased, whereas knockdown of endogenous Bmi-1 reduced, the invasiveness and migration of glioma cells. NF-kappaB transcriptional activity and MMP-9 expression and activity were significantly increased in Bmi-1-overexpressing but reduced in Bmi-1-silenced cells. The reporter luciferase activity driven by MMP-9 promoter in Bmi-1-overexpressing cells was dependent on the presence of a functional NF-kappaB binding site, and blockade of NF-kappaB signaling inhibited the upregulation of MMP-9 in Bmi-1 overexpressing cells. Furthermore, expression of Bmi-1 correlated with NF-kappaB nuclear translocation as well as MMP-9 expression in clinical glioma samples. Conclusions Bmi-1 may play an important role in the development of aggressive phenotype of glioma via activating the NF

  2. BMI-1 targeting interferes with patient-derived tumor-initiating cell survival and tumor growth in prostate cancer

    Science.gov (United States)

    Yusuff, Shamila; Davis, Stephani; Flaherty, Kathleen; Huselid, Eric; Patrizii, Michele; Jones, Daniel; Cao, Liangxian; Sydorenko, Nadiya; Moon, Young-Choon; Zhong, Hua; Medina, Daniel J.; Kerrigan, John; Stein, Mark N.; Kim, Isaac Y.; Davis, Thomas W.; DiPaola, Robert S.; Bertino, Joseph R.; Sabaawy, Hatem E.

    2016-01-01

    Purpose Current prostate cancer (PCa) management calls for identifying novel and more effective therapies. Self-renewing tumor-initiating cells (TICs) hold intrinsic therapy-resistance and account for tumor relapse and progression. As BMI-1 regulates stem cell self-renewal, impairing BMI-1 function for TICs-tailored therapies appears to be a promising approach. Experimental design We have previously developed a combined immunophenotypic and time-of-adherence assay to identify CD49bhiCD29hiCD44hi cells as human prostate TICs. We utilized this assay with patient derived prostate cancer cells and xenograft models to characterize the effects of pharmacological inhibitors of BMI-1. Results We demonstrate that in cell lines and patient-derived TICs, BMI-1 expression is upregulated and associated with stem cell-like traits. From a screened library, we identified a number of post-transcriptional small molecules that target BMI-1 in prostate TICs. Pharmacological inhibition of BMI-1 in patient-derived cells significantly decreased colony formation in vitro and attenuated tumor initiation in vivo, thereby functionally diminishing the frequency of TICs, particularly in cells resistant to proliferation- and androgen receptor (AR)-directed therapies, without toxic effects on normal tissues. Conclusions Our data offer a paradigm for targeting TICs and support the development of BMI-1-targeting therapy for a more effective PCa treatment. PMID:27307599

  3. Childhood BMI growth trajectories and endometrial cancer risk

    DEFF Research Database (Denmark)

    Aarestrup, Julie; Gamborg, Michael; Tilling, Kate

    2017-01-01

    Previously, we found that excess weight already in childhood has positive associations with endometrial cancer, however, associations with changes in body mass index (BMI) during childhood are not well understood. Therefore, we examined whether growth in childhood BMI is associated with endometrial...... cancer and its sub-types. A cohort of 155,505 girls from the Copenhagen School Health Records Register with measured weights and heights at the ages of 6 to 14 years and born 1930-89 formed the analytical population. BMI was transformed to age-specific z-scores. Using linear spline multilevel models......, each girl's BMI growth trajectory was estimated as the deviance from the average trajectory for three different growth periods (6.25-7.99, 8.0-10.99, 11.0-14.0 years). Via a link to health registers, 1020 endometrial cancer cases were identified, and Cox regressions were performed. A greater gain...

  4. Orthorexia nervosa: Assessment and correlates with gender, BMI, and personality.

    Science.gov (United States)

    Oberle, Crystal D; Samaghabadi, Razieh O; Hughes, Elizabeth M

    2017-01-01

    This study investigated whether orthorexia nervosa (ON; characterized by an obsessive fixation on eating healthy) may be predicted from the demographics variables of gender and BMI, and from the personality variables of self-esteem, narcissism, and perfectionism. Participants were 459 college students, who completed several online questionnaires that assessed these variables. A principal components analysis confirmed that the Eating Habits Questionnaire (Gleaves, Graham, & Ambwani, 2013) assesses three internally-consistent ON components: healthy eating behaviors, problems resulting from those behaviors, and positive feelings associated with those behaviors. A MANOVA and its tests of between subjects effects then revealed significant interactions between gender and BMI, such that for men but not women, a higher BMI was associated with greater symptomatology for all ON components. Partial correlation analyses, after controlling for gender and BMI, revealed that both narcissism and perfectionism were positively correlated with all aspects of ON symptomatology. Copyright © 2016 Elsevier Ltd. All rights reserved.

  5. Education modifies genetic and environmental influences on BMI

    DEFF Research Database (Denmark)

    Johnson, Wendy; Kyvik, Kirsten Ohm; Skytthe, Axel

    2011-01-01

    environmental correlations between education and BMI differed by level of education, analyzing women and men separately. Correlations between education and BMI were -.13 in women, -.15 in men. High BMI's were less frequent among well-educated participants, generating less variance. In women, this was due...... to restriction of all forms of variance, overall by a factor of about 2. In men, genetic variance did not vary with education, but results for shared and nonshared environmental variance were similar to those for women. The contributions of the shared environment to the correlations between education and BMI......Obesity is more common among the less educated, suggesting education-related environmental triggers. Such triggers may act differently dependent on genetic and environmental predisposition to obesity. In a Danish Twin Registry survey, 21,522 twins of same-sex pairs provided zygosity, height, weight...

  6. Genital Involvement In Pre-Pubertal Pediatric Population: A Rare Aspect of Crohn’s Disease

    Directory of Open Access Journals (Sweden)

    Qurratul Ann Warsi

    2016-09-01

    Full Text Available Crohn’s disease is an inflammatory bowel disease (IBD, characterized by chronic intestinal inflammation that causes the loss of immune tolerance leading to bizarre inflammatory signals and disruption of mucosal barriers. Environmental triggers and interaction of genetic determinants also play an indispensible role. In this case report, we present a pre-pubertal girl with intermittent and refractory genital swelling. We emphasize that Crohn’s disease must be considered in the differential diagnosis of recurrent, non-tender, erythematous and edematous lesions of the genital area. We conclude with future directions for diagnosing and managing vulvar Crohn’s disease in pediatric population.

  7. Alternative regression models to assess increase in childhood BMI

    OpenAIRE

    Beyerlein, Andreas; Fahrmeir, Ludwig; Mansmann, Ulrich; Toschke, André M

    2008-01-01

    Abstract Background Body mass index (BMI) data usually have skewed distributions, for which common statistical modeling approaches such as simple linear or logistic regression have limitations. Methods Different regression approaches to predict childhood BMI by goodness-of-fit measures and means of interpretation were compared including generalized linear models (GLMs), quantile regression and Generalized Additive Models for Location, Scale and Shape (GAMLSS). We analyzed data of 4967 childre...

  8. Polymorphisms in JMJD1C are associated with pubertal onset in boys and reproductive function in men

    DEFF Research Database (Denmark)

    Mørup, Nina; Busch, Alexander Siegfried; Bang, Anne Kirstine

    2017-01-01

    single nucleotide polymorphisms (SNPs) nearby JMJD1C are associated with pubertal onset in boys and with male reproduction. 671 peri-pubertal boys, 1,027 young men, 315 fertile men, and 252 infertile men were genotyped for two JMJD1C SNPs (rs7910927 and rs10822184). rs7910927 and rs10822184 showed high...... linkage. Boys with the rs7910927 TT genotype entered puberty 3.6 months earlier than their peers (p = 2.5 × 10-2). In young men, the number of T alleles was associated with decreased levels of SHBG, follicle-stimulating hormone (FSH), testosterone, and testosterone x luteinizing hormone, as well...... on the age at pubertal onset in boys as well as levels of reproductive hormones and testis size in men, emphasizing the relationship between JMJD1C and reproductive functions....

  9. Smoking and Socio-demographic correlates of BMI

    Directory of Open Access Journals (Sweden)

    Peizhi Wang

    2016-06-01

    Full Text Available Abstract Background The aim of the current study was to examine the associations between Body Mass Index (BMI and socio-demographic factors and to examine the relationship between BMI, smoking status and ethnicity. Methods The Singapore Mental Health Study (SMHS surveyed Singapore Residents (Singapore Citizens and Permanent Residents aged 18 years old and above. BMI was calculated using height and weight which were self-reported by respondents. Socio-demographic characteristics and smoking status were recorded in a standardized data collection form. Results Six thousand and six hundred sixteen respondents completed the study (response rate of 75.9 % which constituted a representative sample of the adult resident population in Singapore. Ethnicity, gender and education status were associated with obesity. There was an interaction effect between ethnicity smoking status, and BMI. Indian and Malay smokers were less likely to be obese compared to Chinese smokers. The relationship between ethnicity and BMI was thus reversed when smoking was taken into account. Conclusions The study identified certain subgroups and risk factors that are associated with obesity. There is a need for further research to explore and identify genetic, metabolic and ethnic differences that underlie the interaction between ethnicity and smoking status which affects BMI.

  10. The role of diabetes mellitus and BMI in the surgical treatment of ankle fractures.

    Science.gov (United States)

    Lanzetti, Riccardo Maria; Lupariello, Domenico; Venditto, Teresa; Guzzini, Matteo; Ponzo, Antonio; De Carli, Angelo; Ferretti, Andrea

    2018-02-01

    Open reduction and internal fixation is the standard treatment for displaced ankle fractures. However, the presence of comorbidities such as diabetes mellitus and body mass index (BMI) are associated with poor bone quality, and these factors may predict the development of postoperative complications. The study aim was to assess the role of diabetes mellitus and BMI in wound healing in patients younger than 65 years who were surgically treated for malleoli fractures. Ninety patients, aged from 18 to 65 years old, with surgically treated ankle fracture, were retrospectively enrolled. Patients were classified in two groups: patient with diabetes and patients without diabetes (insulin-dependent and noninsulin dependent). All patients were assessed for wound complications, Visual Analogue Scale and Foot and Ankle Disability Index (FADI) were assessed for all patients. Logistic regression was used to identify the risk of wound complications after surgery using the following factors as explanatory variables: age, gender, duration of surgery, BMI, hypercholesterolemia, smoking history, diabetes mellitus, and high blood pressure. In total, 38.9% of patients showed wound complications. Of them, 17.1% were nondiabetics and 82.9% were diabetics. We observed a significant association between DM and wound complications after surgery (P = .005). Logistic regression analysis revealed that DM (P BMI (P = .03) were associated with wound complications. The odds of having a postoperative wound complication were increased 0.16 times in the presence of diabetes and 1.14 times for increasing BMI. This study showed that diabetes mellitus and higher BMI delay the wound healing and increase the complication rate in young adult patients with surgically treated bimalleolar fractures. Copyright © 2017 John Wiley & Sons, Ltd.

  11. Pubertally born neurons and glia are functionally integrated into limbic and hypothalamic circuits of the male Syrian hamster.

    Science.gov (United States)

    Mohr, Margaret A; Sisk, Cheryl L

    2013-03-19

    During puberty, the brain goes through extensive remodeling, involving the addition of new neurons and glia to brain regions beyond the canonical neurogenic regions (i.e., dentate gyrus and olfactory bulb), including limbic and hypothalamic cell groups associated with sex-typical behavior. Whether these pubertally born cells become functionally integrated into neural circuits remains unknown. To address this question, we gave male Syrian hamsters daily injections of the cell birthdate marker bromodeoxyuridine throughout puberty (postnatal day 28-49). Half of the animals were housed in enriched environments with access to a running wheel to determine whether enrichment increased the survival of pubertally born cells compared with the control environment. At 4 wk after the last BrdU injection, animals were allowed to interact with a receptive female and were then killed 1 h later. Triple-label immunofluorescence for BrdU, the mature neuron marker neuronal nuclear antigen, and the astrocytic marker glial fibrillary acidic protein revealed that a proportion of pubertally born cells in the medial preoptic area, arcuate nucleus, and medial amygdala differentiate into either mature neurons or astrocytes. Double-label immunofluorescence for BrdU and the protein Fos revealed that a subset of pubertally born cells in these regions is activated during sociosexual behavior, indicative of their functional incorporation into neural circuits. Enrichment affected the survival and activation of pubertally born cells in a brain region-specific manner. These results demonstrate that pubertally born cells located outside of the traditional neurogenic regions differentiate into neurons and glia and become functionally incorporated into neural circuits that subserve sex-typical behaviors.

  12. Insulin resistance in obese children and adolescents: HOMA-IR cut-off levels in the prepubertal and pubertal periods.

    Science.gov (United States)

    Kurtoğlu, Selim; Hatipoğlu, Nihal; Mazıcıoğlu, Mümtaz; Kendirici, Mustafa; Keskin, Mehmet; Kondolot, Meda

    2010-01-01

    Childhood obesity is associated with an increased risk for insulin resistance. The underlying mechanism for the physiological increase in insulin levels in puberty is not clearly understood. The aim of the present study was to determine the cut-off values for homeostasis model assessment for insulin resistance (HOMA-IR) in obese children and adolescents according to gender and pubertal status. Two hundred and eight obese children and adolescents (141 girls, 127 boys) aged between 5 and 18 years were included in the study. The children were divided into prepubertal and pubertal groups. A standard oral glucose tolerance test (OGTT) was carried out in all children. A total insulin level exceeding 300 μU/mL in the blood samples, collected during the test period, was taken as the insulin resistance criterion. Cut-off values for HOMA-IR were calculated by receiver operating characteristic (ROC) analysis. In the prepubertal period, the rate of insulin resistance was found to be 37% in boys and 27.8% in girls,while in the pubertal period, this rate was 61.7% in boys and 66.7% in girls. HOMA-IR cut-off values for insulin resistance in the prepubertal period were calculated to be 2.67 (sensitivity 88.2%, specificity 65.5%) in boys and 2.22 (sensitivity 100%, specificity 42.3%) in girls, and in the pubertal period, they were 5.22 (sensitivity 56%, specificity 93.3%) in boys and 3.82 (sensitivity 77.1%, specificity 71.4%) in girls. Since gender, obesity and pubertal status are factors affecting insulin resistance, cut-off values which depend on gender and pubertal status, should be used in evaluation of insulin resistance.

  13. Positive parenting mitigates the effects of poor self-regulation on BMI trajectories from age 4 to 15 years

    Science.gov (United States)

    Connell, Lauren E.; Francis, Lori A.

    2014-01-01

    Objective This study sought to determine whether parenting style moderated the effects of delay of gratification on BMI trajectories from age 4 to 15 years. Methods Longitudinal data were analyzed on 778 children drawn from the Study of Early Child Care and Youth Development. Parenting style (authoritative, authoritarian, permissive, neglectful) was created from measures of mothers’ sensitivity and expectations for self-control when children were age 4 years. Self-regulation was also measured at 4 years using a well-known delay of gratification protocol. BMI was calculated from measured height and weight at each time point. Mixed modeling was used to test the interaction of parenting styles and ability to delay gratification on BMI trajectories from 4 to 15 years. Results There was a significant interaction effect of parenting and ability to delay on BMI growth from 4 to 15 years for boys. Boys who had authoritarian mothers and failed to delay gratification had a significantly steeper rate of growth in BMI from childhood through adolescence than children in any other parenting x delay group. Conclusions Authoritative and permissive parenting styles were protective against more rapid BMI gains for boys who could not delay gratification. Ability to delay gratification was protective against BMI gains for boys who had parents with authoritarian or neglectful parenting styles. PMID:23977874

  14. Gender specific effect of major dietary patterns on the metabolic syndrome risk in Korean pre-pubertal children

    OpenAIRE

    Park, Soo Jin; Lee, Seung Min; Kim, Seon Mee; Lee, Myoungsook

    2013-01-01

    There is a lack of data on metabolic risk factors during pre-puberty, which is important for identifying the subgroups of youth, at whom early interventions should be targeted. In this study, we evaluated the prevalence of metabolic risk factors and its subsequent relations with dietary patterns in Korean pre-pubertal children through a cross-sectional sample (n = 1,008; boys = 513) of pre-pubertal children (aged 8-9 years) from a sub-study of the Korea Metabolic Syndrome Research Initiatives...

  15. BMI at birth and overweight at age four.

    Science.gov (United States)

    Winter, Jonathan D; Taylor, Yhenneko; Mowrer, Lauren; Winter, Katherine M; Dulin, Michael F

    Extensive investigation has established that an elevated weight at birth is associated with subsequent obesity and obesity related negative health outcomes. The significance of overweight at birth, however, remains ill-defined. Historically, it has been difficult to approximate adiposity in infancy in a way that is both simple and meaningful. Body-mass-index (BMI) growth charts for children younger than two years of age only became available in 2006 when published by the WHO. This retrospective cohort analysis utilised anthropometric data extracted from the electronic medical record of a large integrated healthcare system in North Carolina. BMI and weight-for-age (WFA) >85% of WHO growth charts measured newborn overweight and macrosomia respectively. Logistic regression models assessed the associations between newborn macrosomia and overweight and overweight at 4 years of age, as well as associations with maternal BMI. Models included demographic data, gestational age, and maternal diabetes status as covariates. Both BMI and WFA >85% at birth were significantly associated with overweight at age 4 years. However, the greater odds of overweight was associated with newborn BMI >85%, with an adjusted odds ratio (AOR) of 2.08 (95% confidence interval [CI]: 1.4-3.08) versus 1.57 (95% CI: 1.08-2.27). Maternal obesity was also more robustly correlated with newborn BMI >85%, AOR of 4.14 (95% CI: 1.6-10.7), than with newborn WFA >85%, AOR of 3.09 (95% CI: 1.41-6.77). BMI >85% at birth is independently associated with overweight at 4 years. Newborn overweight is perhaps superior to newborn macrosomia in predicting overweight at age 4. Copyright © 2016 Asia Oceania Association for the Study of Obesity. Published by Elsevier Ltd. All rights reserved.

  16. Eating tasty food to cope. Longitudinal association with BMI.

    Science.gov (United States)

    Boggiano, M M; Wenger, L E; Turan, B; Tatum, M M; Morgan, P R; Sylvester, M D

    2015-04-01

    The goals of this study were to determine if a change in certain motives to eat highly palatable food, as measured by the Palatable Eating Motives Scale (PEMS), could predict a change in body mass index (BMI) over time, to assess the temporal stability of these motive scores, and to test the reliability of previously reported associations between eating tasty foods to cope and BMI. BMI, demographics, and scores on the PEMS and the Binge Eating Scale were obtained from 192 college students. Test-retest analysis was performed on the PEMS motives in groups varying in three gap times between tests. Regression analyses determined what PEMS motives predicted a change in BMI over two years. The results replicated previous findings that eating palatable food for Coping motives (e.g., to forget about problems, reduce negative feelings) is associated with BMI. Test-retest correlations revealed that motive scores, while somewhat stable, can change over time. Importantly, among overweight participants, a change in Coping scores predicted a change in BMI over 2 years, such that a 1-point change in Coping predicted a 1.76 change in BMI (equivalent to a 10.5 lb. change in body weight) independent of age, sex, ethnicity, and initial binge-eating status (Cohen's f(2) effect size = 1.44). The large range in change of Coping scores suggests it is possible to decrease frequency of eating to cope by more than 1 scale point to achieve weight losses greater than 10 lbs. in young overweight adults, a group already at risk for rapid weight gain. Hence, treatments aimed specifically at reducing palatable food intake for coping reasons vs. for social, reward, or conformity reasons, should help achieve a healthier body weight and prevent obesity if this motive-type is identified prior to significant weight gain. Copyright © 2015 Elsevier Ltd. All rights reserved.

  17. Comparison of clinical and microbiological features of vulvovaginitis in prepubertal and pubertal girls.

    Science.gov (United States)

    Yilmaz, Ayse E; Celik, Nurullah; Soylu, Gul; Donmez, Ahsen; Yuksel, Cigdem

    2012-07-01

    Vulvovaginitisis the most common gynecological problem of childhood. The aim of the study was to determine and compare clinical and microbiological features of vulvovaginitis in prepubertal and adolescent girls. In this retrospective study, the records of patients who were diagnosed with vulvovaginitis between January 2005 and December 2010 in the pediatric outpatient clinic at Fatih University Hospital were retrieved. Information regarding age, symptoms, history of antibiotic use within 1 month prior to presentation, findings on urinalysis, serum antistreptolysin-O levels, and results of urine/vaginal cultures was collected. The records of 112 patients were evaluated, 72 of which were prepubertal (64.2%) and 40 were pubertal (35.7%) at the time of diagnosis. Thirty-eight prepubertal patients (52.7%) had a positive result on vaginal culture, the most commonly encountered microorganism being group A beta-hemolytic streptococcus (15.2%). Culture positivity rate in the pubertal group was 47.5% (19 patients), with Candida albicans being the most frequently isolated microorganism (27.5%). The etiopathogenesis and culture results differ between prepubertal and adolescent girls with vulvovaginitis, which should be taken into consideration in the treatment approach of this disorder. Copyright © 2012. Published by Elsevier B.V.

  18. Vegetable and Fruit Intakes Are Associated with hs-CRP Levels in Pre-Pubertal Girls

    Directory of Open Access Journals (Sweden)

    Pilar Navarro

    2017-03-01

    Full Text Available The influence of diet on inflammation in children remains unclear. We aimed to analyze the influence of diet on high-sensitivity C-reactive protein (hs-CRP levels in a pre-pubertal population free of other influences that may affect hs-CRP levels. We determined hs-CRP levels in 571 six- to eight-year-old children using an hs-CRP ELISA kit. Information on food and nutrient intake was obtained through a food-frequency questionnaire. Overall dietary quality was assessed using the Healthy Eating Index (HEI. We found that girls in the highest tertile of hs-CRP levels had a higher intake of saturated fatty acid, and lower intakes of fiber and vitamin E and a lower HEI score when compared to those in tertiles 1 and 2. We also observed a significant decrease in fruit and vegetable intakes by hs-CRP tertile. Factor analysis showed that a dietary pattern that was loaded most strongly with vegetable, fruit, fiber and vitamin A and E intakes correlated negatively (−0.132, p < 0.05 with hs-CRP. No such association was found in boys. In conclusion, our data show that girls with a poorer quality diet show higher hs-CRP levels already at a pre-pubertal age.

  19. Diversity of activity participation determines bone mineral content in the lower limbs of pre-pubertal children with developmental coordination disorder.

    Science.gov (United States)

    Fong, S S M; Vackova, D; Choi, A W M; Cheng, Y T Y; Yam, T T T; Guo, X

    2018-04-01

    This study examined the relationships between activity participation and bone mineralization in children with developmental coordination disorder. Limited participation in physical, recreational, social, and skill-based and self-improvement activities contributed to lower bone mineral content. For improved bone health, these children should participate in a variety of activities, not only physical activities. Limited activity participation in children with developmental coordination disorder (DCD) may have a negative impact on bone mineral accrual. The objectives of this study were to compare bone mineralization and activity participation patterns of pre-pubertal children with DCD and those with typical development, and to determine the association between activity participation patterns and bone mineralization in children with DCD. Fifty-two children with DCD (mean age = 7.51 years) and 61 children with typical development (mean age = 7.22 years) participated in the study. Appendicular and total body (less head) bone mineral content (BMC) and bone mineral density (BMD) were evaluated by a whole-body dual-energy X-ray absorptiometry scan. Activity participation patterns were assessed using the Children's Assessment of Participation and Enjoyment (CAPE) questionnaire. Children with DCD had lower appendicular and total body BMCs and BMDs than children with typical development overall (p accounting for the effects of age, sex, height, lean mass, and fat mass, the total activity diversity score remained independently associated with leg BMC in children with DCD, explaining 5.1% of the variance (p = 0.030). However, the physical activity diversity score was no longer associated with leg BMC (p = 0.090). Diversity of activity participation and bone mineralization were lower in pre-pubertal children with DCD. Decreased total activity participation diversity was a contributing factor to lower BMC in the legs of children with DCD.

  20. Work-family life courses and BMI trajectories in three British birth cohorts.

    Science.gov (United States)

    Lacey, R E; Sacker, A; Bell, S; Kumari, M; Worts, D; McDonough, P; Kuh, D; McMunn, A

    2017-02-01

    Combining work and family responsibilities has previously been associated with improved health in mid-life, yet little is known about how these associations change over time (both biographical and historical) and whether this extends to body mass index (BMI) trajectories for British men and women. The purpose of this study was to investigate relationships between work-family life courses and BMI trajectories across adulthood (16-42 years) for men and women in three British birth cohorts. Multiply imputed data from three nationally representative British birth cohorts were used-the MRC National Survey of Health and Development (NSHD; 1946 birth cohort, n=3012), the National Child Development Study (NCDS; 1958 birth cohort, n=9614) and the British Cohort Study (BCS; 1970 birth cohort, n=8140). A typology of work-family life course types was developed using multi-channel sequence analysis, linking annual information on work, partnerships and parenthood from 16 to 42 years. Work-family life courses were related to BMI trajectories using multi-level growth models. Analyses adjusted for indicators of prior health, birthweight, child BMI, educational attainment and socioeconomic position across the life course, and were stratified by gender and cohort. Work-family life courses characterised by earlier transitions to parenthood and weaker long-term links to employment were associated with greater increases in BMI across adulthood. Some of these differences, particularly for work-family groups, which are becoming increasingly non-normative, became more pronounced across cohorts (for example, increases in BMI between 16 and 42 years in long-term homemaking women: NSHD: 4.35 kg m -2 , 95% confidence interval (CI): 3.44, 5.26; NCDS: 5.53 kg m - 2 , 95% CI: 5.18, 5.88; BCS: 6.69 kg m - 2 , 95% CI: 6.36, 7.02). Becoming a parent earlier and weaker long-term ties to employment are associated with greater increases in BMI across adulthood in British men and women.

  1. Socioeconomic differences in childhood BMI trajectories in Belarus.

    Science.gov (United States)

    Patel, Rita; Tilling, Kate; Lawlor, Debbie A; Howe, Laura D; Hughes, Rachael A; Bogdanovich, Natalia; Matush, Lidia; Nicoli, Emily; Oken, Emily; Kramer, Michael S; Martin, Richard M

    2018-02-28

    To examine associations of parental socioeconomic position with early-life offspring body mass index (BMI) trajectories in a middle-income country. Overall, 12,385 Belarusian children born 1996-97 and enrolled in a randomised breastfeeding promotion trial at birth, with 3-14 measurements of BMI from birth to 7 years. Cohort analysis in which exposures were parental education (common secondary or less; advanced secondary or partial university; completed university) and occupation (manual; non-manual) at birth, and the outcome was BMI z-score trajectories estimated using multilevel linear spline models, controlling for trial arm, location, parental BMI, maternal smoking status and number of older siblings. Infants born to university-educated mothers were heavier at birth than those born to secondary school-educated mothers [by 0.13 BMI z-score units (95% confidence interval, CI: 0.07, 0.19) for girls and 0.11 (95% CI: 0.05, 0.17) for boys; equivalent for an infant of average birth length to 43 and 38 g, respectively]. Between the ages of 3-7 years children of the most educated mothers had larger BMI increases than children of the least educated mothers. At age 7 years, after controlling for trial arm and location,  children of university-educated mothers had higher BMIs than those born to secondary school-educated mothers by 0.11 z-score (95% CI: 0.03, 0.19) among girls and 0.18 (95% CI: 0.1, 0.27) among boys, equivalent to differences in BMI for a child of average height of 0.19 and 0.26 kg/m 2 , respectively. After further controlling for parental BMI, these differences attenuated to 0.08 z-score (95% CI: 0, 0.16) and 0.16 z-score (95% CI: 0.07, 0.24), respectively, but changed very little after additional adjustment for number of older siblings and mother's smoking status. Associations were similar when based on paternal educational attainment and highest household occupation. In Belarus, consistent with some middle-income countries, higher socioeconomic

  2. Dinner rituals that correlate with child and adult BMI.

    Science.gov (United States)

    Wansink, Brian; van Kleef, Ellen

    2014-05-01

    What predicts whether a child will be at risk for obesity? Whereas past research has focused on foods, eating habits, feeding styles, and family meal patterns, this study departs from a food-centric approach to examine how various dinner rituals might influence the BMIs of children and adults. In this study of 190 parents (BMI = 29.1 ± 7.2) and 148 children (BMI = 20.3 ± 4.4), the relationship between their BMIs and everyday family dinner rituals was examined using both correlation and regression analysis (controlled for educational level of parents). Families who frequently ate dinner in the kitchen or dining room had significantly lower BMIs for both adults (r = -0.31) and children (r = -0.24) compared to families who ate elsewhere. Additionally, helping cook dinner was associated with higher BMI for girls (r = 0.26), and remaining at the table until everyone is finished with eating was associated with lower BMI for boys (r = -0.31). Dinner tables may be one place where social support and family involvement meet-both of which relate to the BMI of children as well as parents. Family meals and their rituals might be an underappreciated battleground to fight obesity. Copyright © 2013 The Obesity Society.

  3. Relationship between BMI and blood pressure in girls and boys.

    Science.gov (United States)

    Gundogdu, Zuhal

    2008-10-01

    To investigate the relationship between BMI and blood pressure as this is of crucial interest in evaluating both public health and the clinical impact of the so-called obesity epidemic. Data were gathered from 1899 children aged between 6 and 14 years, analysing and evaluating a possible relationship between BMI and systolic and diastolic blood pressure values for both girls and boys. Each child was classified on the basis of age- and sex-specific BMI percentile as normal weight (<85th percentile), overweight (95th percentile). In comparisons among age BMI percentile groups, systolic and diastolic blood pressure values were higher in obese and overweight groups than in normal weight groups for both sexes. Although BMI among girls was higher than among boys in all three percentile groups, there were no significant differences between sexes with respect to blood pressure values. The present findings emphasize the importance of the prevention of obesity in order to prevent future related problems such as hypertension in children and adolescents.

  4. Relationship of glycemic and triglycerides with BMI in diabetic patients

    International Nuclear Information System (INIS)

    Parvez, A.; Ihsanullah; Rafiq, A.; Ahmad, N.; Khan, E.H.

    2010-01-01

    Background: Diabetes mellitus (DM) is a metabolic disorder characterised by chronic hyperglycaemia with disturbances in carbohydrate, fat and protein metabolism arising from defect in insulin secretion or action or both. The clinical guidelines recommend measurement of BMI as vital signs for evaluating the obese and diabetic patients. Methods: This study was carried out on 160 diabetics, which were divided on the basis of BMI into obese (120) and non-obese (40) diabetics from Peshawar district. All patients had their triglycerides and glucose checked after over night fast. Results: The serum triglyceride in diabetics having BMI >30 (obese) was increased as compared to patients having BMI <30 (non-obese). The comparison of serum glucose level in obese diabetics was found to be significantly raised as compared to non-obese diabetics. Conclusions and Recommendations: It was concluded that dyslipidemia is common in all diabetics. The abnormal triglyceride level can improve with good glycemic control, but do not reach the normal state. Good glycaemic control, Reducing BMI, periodic checkups of lipids and blood glucose are recommended for all diabetics in order to avoid complications. (author)

  5. Relationship of glycemic and triglycerides with BMI in diabetic patients

    Energy Technology Data Exchange (ETDEWEB)

    Parvez, A; Ihsanullah,; Rafiq, A; Ahmad, N; Khan, E H [Khyber Teaching Hospital, Peshawar (Pakistan). Department of Pathology

    2010-04-15

    Background: Diabetes mellitus (DM) is a metabolic disorder characterised by chronic hyperglycaemia with disturbances in carbohydrate, fat and protein metabolism arising from defect in insulin secretion or action or both. The clinical guidelines recommend measurement of BMI as vital signs for evaluating the obese and diabetic patients. Methods: This study was carried out on 160 diabetics, which were divided on the basis of BMI into obese (120) and non-obese (40) diabetics from Peshawar district. All patients had their triglycerides and glucose checked after over night fast. Results: The serum triglyceride in diabetics having BMI >30 (obese) was increased as compared to patients having BMI <30 (non-obese). The comparison of serum glucose level in obese diabetics was found to be significantly raised as compared to non-obese diabetics. Conclusions and Recommendations: It was concluded that dyslipidemia is common in all diabetics. The abnormal triglyceride level can improve with good glycemic control, but do not reach the normal state. Good glycaemic control, Reducing BMI, periodic checkups of lipids and blood glucose are recommended for all diabetics in order to avoid complications. (author)

  6. BMI is not a good indicator for metabolic risk in adolescent girls

    Science.gov (United States)

    BMI (kg/m2) does not provide information about body fat percentile.Adolescents with BMI girls with low BMI can have high body fat percentile. We hypothesized that these girls are already insulin resi...

  7. The impact of BMI on sperm parameters and the metabolite changes of seminal plasma concomitantly.

    Science.gov (United States)

    Guo, Dan; Wu, Wei; Tang, Qiuqin; Qiao, Shanlei; Chen, Yiqiu; Chen, Minjian; Teng, Mengying; Lu, Chuncheng; Ding, Hongjuan; Xia, Yankai; Hu, Lingqing; Chen, Daozhen; Sha, Jiahao; Wang, Xinru

    2017-07-25

    The development of male infertility increased rapidly worldwide, which coinciding with the epidemic of obesity. However, the impact of weight abnormalities on sperm quality is still contestable. To assess the correlation between BMI and sperm parameters, we searched relevant articles in PubMed, Embase, Web of science, and Wanfang database published until June 2015 without language restriction. Otherwise, we also recruited some participants who attended fertility clinic as well as some general populations in this report. We performed a systematic review and meta-analysis about BMI and sperm parameters containing total sperm count, concentration, semen volume and sperm motility (overall and progressive). Metabolomic analysis of seminal plasma was performed to explore the mechanism from a new perspective. This study found standardized weighted mean differences (SMD) in sperm parameters (total sperm count, sperm concentration, and semen volume) of abnormal weight groups decreased to different degree compared to normal weight. Dose-response analysis found SMD of sperm count, sperm concentration and semen volume respectively fell 2.4%, 1.3% and 2.0% compared with normal weight for every 5-unit increase in BMI. Metabolomic analysis of seminal plasma showed that spermidine and spermine were likely to play a vital role in the spermatogenesis progress. This systematic review with meta-analysis has confirmed there was a relationship between BMI and sperm quality, suggesting obesity may be a detrimental factor of male infertility.

  8. A BMI-based occupational therapy assist suit: asynchronous control by SSVEP

    Directory of Open Access Journals (Sweden)

    Takeshi eSakurada

    2013-09-01

    Full Text Available A brain-machine interface (BMI is an interface technology that uses neurophysiological signals from the brain to control external machines. Recent invasive BMI technologies have succeeded in the asynchronous control of robot arms for a useful series of actions, such as reaching and grasping. In this study, we developed non-invasive BMI technologies aiming to make such useful movements using the subject's own hands by preparing a BMI-based occupational therapy assist suit (BOTAS. We prepared a pre-recorded series of useful actionsa grasping-a-ball movement and a carrying-the-ball movementand added asynchronous control using steady-state visual evoked potential (SSVEP signals. A SSVEP signal was used to trigger the grasping-a-ball movement and another SSVEP signal was used to trigger the carrying-the-ball movement. A support vector machine was used to classify EEG signals recorded from the visual cortex (Oz in real time. Untrained, able-bodied participants (n = 12 operated the system successfully. Classification accuracy and time required for SSVEP detection were approximately 88% and 3 s, respectively. We further recruited three patients with upper cervical spinal cord injuries; they also succeeded in operating the system without training. These data suggest that our BOTAS system is potentially useful in terms of rehabilitation of patients with upper limb disabilities.

  9. The role of culture in the context of school-based BMI screening.

    Science.gov (United States)

    Fitzgibbon, Marian L; Beech, Bettina M

    2009-09-01

    The high prevalence of overweight and obesity is a significant public health concern in the United States. Minority populations are disproportionately affected, and the impact of obesity on minority children is especially alarming. In this article we discuss school-based BMI reporting, which is intended to increase parental awareness of their children's weight status. This information could potentially lead parents of overweight and obese children to carefully examine and possibly change their children's diet and activity patterns. However, any program related to child weight status must consider culturally defined aspects of body size and shape. In other words, the cultural context in which information on child BMI is presented to and received by parents must be considered. In this article we review parental perceptions of child weight. Multiple studies have shown that parents of overweight or obese children often fail to correctly perceive their children as overweight. Possible reasons for, and implications of, this misperception of child weight status among minority parents are then explored within a cultural framework. The PEN-3 model is used to examine influences on health behaviors and could help inform the development of a culturally sensitive BMI-notification program for minority parents. Reporting materials congruent with the social and cultural values and practices of the target audience are likely to maximize program effectiveness. A culturally based BMI-notification program should be conceptualized as a small step in a comprehensive plan to reduce childhood obesity and improve the current and future health of minority children.

  10. A BMI-based occupational therapy assist suit: asynchronous control by SSVEP.

    Science.gov (United States)

    Sakurada, Takeshi; Kawase, Toshihiro; Takano, Kouji; Komatsu, Tomoaki; Kansaku, Kenji

    2013-01-01

    A brain-machine interface (BMI) is an interface technology that uses neurophysiological signals from the brain to control external machines. Recent invasive BMI technologies have succeeded in the asynchronous control of robot arms for a useful series of actions, such as reaching and grasping. In this study, we developed non-invasive BMI technologies aiming to make such useful movements using the subject's own hands by preparing a BMI-based occupational therapy assist suit (BOTAS). We prepared a pre-recorded series of useful actions-a grasping-a-ball movement and a carrying-the-ball movement-and added asynchronous control using steady-state visual evoked potential (SSVEP) signals. A SSVEP signal was used to trigger the grasping-a-ball movement and another SSVEP signal was used to trigger the carrying-the-ball movement. A support vector machine was used to classify EEG signals recorded from the visual cortex (Oz) in real time. Untrained, able-bodied participants (n = 12) operated the system successfully. Classification accuracy and time required for SSVEP detection were ~88% and 3 s, respectively. We further recruited three patients with upper cervical spinal cord injuries (SCIs); they also succeeded in operating the system without training. These data suggest that our BOTAS system is potentially useful in terms of rehabilitation of patients with upper limb disabilities.

  11. Sex-specific mouse liver gene expression: genome-wide analysis of developmental changes from pre-pubertal period to young adulthood

    Directory of Open Access Journals (Sweden)

    Conforto Tara L

    2012-04-01

    Full Text Available Abstract Background Early liver development and the transcriptional transitions during hepatogenesis are well characterized. However, gene expression changes during the late postnatal/pre-pubertal to young adulthood period are less well understood, especially with regards to sex-specific gene expression. Methods Microarray analysis of male and female mouse liver was carried out at 3, 4, and 8 wk of age to elucidate developmental changes in gene expression from the late postnatal/pre-pubertal period to young adulthood. Results A large number of sex-biased and sex-independent genes showed significant changes during this developmental period. Notably, sex-independent genes involved in cell cycle, chromosome condensation, and DNA replication were down regulated from 3 wk to 8 wk, while genes associated with metal ion binding, ion transport and kinase activity were up regulated. A majority of genes showing sex differential expression in adult liver did not display sex differences prior to puberty, at which time extensive changes in sex-specific gene expression were seen, primarily in males. Thus, in male liver, 76% of male-specific genes were up regulated and 47% of female-specific genes were down regulated from 3 to 8 wk of age, whereas in female liver 67% of sex-specific genes showed no significant change in expression. In both sexes, genes up regulated from 3 to 8 wk were significantly enriched (p p Ihh; female-specific Cdx4, Cux2, Tox, and Trim24 and may contribute to the developmental changes that lead to global acquisition of liver sex-specificity by 8 wk of age. Conclusions Overall, the observed changes in gene expression during postnatal liver development reflect the deceleration of liver growth and the induction of specialized liver functions, with widespread changes in sex-specific gene expression primarily occurring in male liver.

  12. The relation of weight suppression and BMI to bulimic symptoms.

    Science.gov (United States)

    Butryn, Meghan L; Juarascio, Adrienne; Lowe, Michael R

    2011-11-01

    High levels of weight suppression have been associated with greater binge eating and weight gain as well as poorer treatment outcome in bulimia nervosa. This study examined the relationship between weight suppression and bulimia nervosa symptoms and explored how weight suppression might interact with body mass index (BMI) in accounting for level of symptomatology at presentation for treatment. Participants were 64 women with threshold or sub-threshold bulimia nervosa. A clinical interview assessed binge eating and purging. Weight suppression and the interaction between BMI and weight suppression predicted frequency of binge eating such that participants with low BMI and high weight suppression engaged in the most binge eating. High levels of weight suppression also predicted more frequent purging. Additional research is warranted to examine mediators of these relationships. Copyright © 2010 Wiley Periodicals, Inc.

  13. Bmi1 is down-regulated in the aging brain and displays antioxidant and protective activities in neurons.

    Directory of Open Access Journals (Sweden)

    Mohamed Abdouh

    Full Text Available Aging increases the risk to develop several neurodegenerative diseases, although the underlying mechanisms are poorly understood. Inactivation of the Polycomb group gene Bmi1 in mice results in growth retardation, cerebellar degeneration, and development of a premature aging-like phenotype. This progeroid phenotype is characterized by formation of lens cataracts, apoptosis of cortical neurons, and increase of reactive oxygen species (ROS concentrations, owing to p53-mediated repression of antioxidant response (AOR genes. Herein we report that Bmi1 expression progressively declines in the neurons of aging mouse and human brains. In old brains, p53 accumulates at the promoter of AOR genes, correlating with a repressed chromatin state, down-regulation of AOR genes, and increased oxidative damages to lipids and DNA. Comparative gene expression analysis further revealed that aging brains display an up-regulation of the senescence-associated genes IL-6, p19(Arf and p16(Ink4a, along with the pro-apoptotic gene Noxa, as seen in Bmi1-null mice. Increasing Bmi1 expression in cortical neurons conferred robust protection against DNA damage-induced cell death or mitochondrial poisoning, and resulted in suppression of ROS through activation of AOR genes. These observations unveil that Bmi1 genetic deficiency recapitulates aspects of physiological brain aging and that Bmi1 over-expression is a potential therapeutic modality against neurodegeneration.

  14. The Moderating Effects of Pubertal Timing on the Longitudinal Associations between Parent-Child Relationship Quality and Adolescent Substance Use

    Science.gov (United States)

    Shelton, Katherine H.; Van Den Bree, Marianne B. M.

    2010-01-01

    This prospective, longitudinal study investigated the moderating role of pubertal timing on reciprocal links between adolescent appraisals of parent-child relationship quality and girls' (N = 1,335) and boys' (N = 1,203) cigarette and alcohol use across a 12-month period. Reciprocal effects were found between parent-child relations and on-time…

  15. Early Pubertal Maturation and Internalizing Problems in Adolescence: Sex Differences in the Role of Cortisol Reactivity to Interpersonal Stress

    Science.gov (United States)

    Natsuaki, Misaki N.; Klimes-Dougan, Bonnie; Ge, Xiaojia; Shirtcliff, Elizabeth A.; Hastings, Paul D.; Zahn-Waxler, Carolyn

    2009-01-01

    An accumulating body of literature has shown a link between early pubertal maturation and internalizing problems, particularly among girls. Our knowledge is, however, limited with regard to what accounts for this association. Based on a hypothesis that early maturing girls have heightened stress sensitivity that increases the risk of internalizing…

  16. The reliability of dental x-ray film in assessment of MP3 stages of the pubertal growth spurt.

    Science.gov (United States)

    Abdel-Kader, H M

    1998-10-01

    The main object of this clinical study is to provide a simple and practical method to assess the pubertal growth spurt stages of a subject by recording MP3 stages with the dental periapical radiograph and the standard dental x-ray machine.

  17. Alternative regression models to assess increase in childhood BMI

    Directory of Open Access Journals (Sweden)

    Mansmann Ulrich

    2008-09-01

    Full Text Available Abstract Background Body mass index (BMI data usually have skewed distributions, for which common statistical modeling approaches such as simple linear or logistic regression have limitations. Methods Different regression approaches to predict childhood BMI by goodness-of-fit measures and means of interpretation were compared including generalized linear models (GLMs, quantile regression and Generalized Additive Models for Location, Scale and Shape (GAMLSS. We analyzed data of 4967 children participating in the school entry health examination in Bavaria, Germany, from 2001 to 2002. TV watching, meal frequency, breastfeeding, smoking in pregnancy, maternal obesity, parental social class and weight gain in the first 2 years of life were considered as risk factors for obesity. Results GAMLSS showed a much better fit regarding the estimation of risk factors effects on transformed and untransformed BMI data than common GLMs with respect to the generalized Akaike information criterion. In comparison with GAMLSS, quantile regression allowed for additional interpretation of prespecified distribution quantiles, such as quantiles referring to overweight or obesity. The variables TV watching, maternal BMI and weight gain in the first 2 years were directly, and meal frequency was inversely significantly associated with body composition in any model type examined. In contrast, smoking in pregnancy was not directly, and breastfeeding and parental social class were not inversely significantly associated with body composition in GLM models, but in GAMLSS and partly in quantile regression models. Risk factor specific BMI percentile curves could be estimated from GAMLSS and quantile regression models. Conclusion GAMLSS and quantile regression seem to be more appropriate than common GLMs for risk factor modeling of BMI data.

  18. Alternative regression models to assess increase in childhood BMI.

    Science.gov (United States)

    Beyerlein, Andreas; Fahrmeir, Ludwig; Mansmann, Ulrich; Toschke, André M

    2008-09-08

    Body mass index (BMI) data usually have skewed distributions, for which common statistical modeling approaches such as simple linear or logistic regression have limitations. Different regression approaches to predict childhood BMI by goodness-of-fit measures and means of interpretation were compared including generalized linear models (GLMs), quantile regression and Generalized Additive Models for Location, Scale and Shape (GAMLSS). We analyzed data of 4967 children participating in the school entry health examination in Bavaria, Germany, from 2001 to 2002. TV watching, meal frequency, breastfeeding, smoking in pregnancy, maternal obesity, parental social class and weight gain in the first 2 years of life were considered as risk factors for obesity. GAMLSS showed a much better fit regarding the estimation of risk factors effects on transformed and untransformed BMI data than common GLMs with respect to the generalized Akaike information criterion. In comparison with GAMLSS, quantile regression allowed for additional interpretation of prespecified distribution quantiles, such as quantiles referring to overweight or obesity. The variables TV watching, maternal BMI and weight gain in the first 2 years were directly, and meal frequency was inversely significantly associated with body composition in any model type examined. In contrast, smoking in pregnancy was not directly, and breastfeeding and parental social class were not inversely significantly associated with body composition in GLM models, but in GAMLSS and partly in quantile regression models. Risk factor specific BMI percentile curves could be estimated from GAMLSS and quantile regression models. GAMLSS and quantile regression seem to be more appropriate than common GLMs for risk factor modeling of BMI data.

  19. Behavioural patterns only predict concurrent BMI status and not BMI trajectories in a sample of youth in Ontario, Canada.

    Science.gov (United States)

    Laxer, Rachel E; Cooke, Martin; Dubin, Joel A; Brownson, Ross C; Chaurasia, Ashok; Leatherdale, Scott T

    2018-01-01

    Youth are engaging in multiple risky behaviours, increasing their risk of overweight, obesity, and related chronic diseases. The objective of this study was to examine the effect of engaging in unique clusters of unhealthy behaviours on youths' body mass index (BMI) trajectories. This study used a linked-longitudinal sample of Grades 9 and 10 students (13 to 17 years of age) participating in the COMPASS host study. Students reported obesity-related and other risky behaviours at baseline and height and weight (to derive BMI) at baseline (2012/2013) and annually for 2 years post-baseline (2013/14 and 2014/15). Students were grouped into behavioural clusters based on response probabilities. Linear mixed effects models, using BMI as a continuous outcome measure, were used to examine the effect of engaging in clusters of risky behaviours on BMI trajectories. There were significant differences in BMI of the four behavioural clusters at baseline that remained consistent over time. Higher BMI values were found among youth classified at baseline to be Typical High School Athletes (β = 0.232 kg/m2, [confidence interval (CI): 0.03-0.50]), Inactive High Screen-User (β = 0.348 kg/m2, CI: 0.11-0.59) and Moderately Active Substance Users (β = 0.759 kg/m2, CI: 0.36-1.15) compared to students classified as Health Conscious. Despite these baseline differences, BMI appeared to increase across all behavioural clusters annually by the same amount (β = 0.6097 kg/m2, (CI) = 0.57-0.64). Although annual increases in BMI did not differ by behavioural clusters, membership in a particular behavioural cluster was associated with baseline BMI, and these differences remained consistent over time. Results indicate that intervening and modifying unhealthy behaviours earlier might have a greater impact than during adolescence. Health promotion strategies targeting the highest risk youth as they enter secondary school might be promising means to prevent or delay the onset of obesity.

  20. The organizational effects of pubertal testosterone on sexual proficiency in adult male Syrian hamsters.

    Science.gov (United States)

    De Lorme, Kayla C; Sisk, Cheryl L

    2016-10-15

    Social proficiency requires making appropriate behavioral adaptations as a result of social experience. For example, male rodents become sexually proficient with experience as demonstrated by a reduction in ectopic (misdirected) mounts, mount-to-intromission ratio, and latency to ejaculation. We previously found that over a series of timed tests with a receptive female, male hamsters deprived of testosterone specifically during puberty (NoT@P) have overall lower levels of sexual behavior and continue to display high levels of ectopic mounts, compared with males that experienced endogenous testosterone during puberty (T@P). These results suggested that pubertal testosterone programs sexual proficiency in adulthood, but because NoT@P males engaged in less sexual behavior than T@P males in these tests, the amount of sexual experience may have been insufficient to improve sexual proficiency. To more rigorously test the hypothesis that pubertal testosterone is necessary for social proficiency in adulthood, the present study compared the behavior of NoT@P and T@P males in a series of 4 trials with a 48-h interval between each trial. Sexual experience was equated by limiting each trial to 5 intromissions. Sexually-naïve males were either gonadectomized prepubertally (NoT@P) or in adulthood (T@P) and received subcutaneous testosterone capsules four weeks later. Two weeks after testosterone replacement, these groups and a group of adult gonad-intact controls began sexual behavior testing. We found that NoT@P males had more ectopic mounts/min across all four tests compared to gonad-intact and T@P males. Moreover, both gonad-intact and T@P males, but not NoT@P males, showed an increase in the number of mounts and intromissions/min between trials 1 and 3. Unexpectedly, both gonad-intact and T@P, but not NoT@P, males showed a decrease in sexual behaviors during trial 4. Thus, T@P males display multiple behavioral adaptations to sexual experience that are not observed in No

  1. [Study on the pathogens correlated to sexually transmitted diseases in 285 pre-pubertal girls with vulvovaginitis in Beijing].

    Science.gov (United States)

    Liu, Xiao-Yan; Sun, Hong-Mei; Feng, Yan-Ling; Hu, Jin; Zhao, Han-Qing; Zhang, Li-Ya

    2007-08-01

    To study the relationship between vulvovaginitis in pre-pubertal girls and pathogens as Chlamydia trachomatis (Ct), N. gonorrhoeae (Ng), Mycoplasma, Ureaplasma urealyticum (Uu), Mycoplasma hominis (Mh), M. genitalium (Mg), M. fermentans (Mf) and M. penetrans (Mpe), as well as to find out the proportion of mycoplasma which is correlated to sexually transmitted diseases (STD) and AIDS. METHODS Vulvae swab specimens from 285 pre-pubertal girls with vulvovaginitis (case group) and 128 healthy girls (control group) were collected and detected by nested polymerase chain reaction (nPCR) to identify the existence of pathogens as Ct, Ng, Uu, Mh, Mg, Mf and Mpe. nPCR with both high specificity and sensitivity, would not be influenced by the amount of pathogens in specimens or inactivated during the process of storage or transportation. The rate of detection on pathogens was 59.65% in the 285 specimens from case group including 'one kind of pathogen in one specimen' as 37.54% and 'two kinds' as 16.84% and 'three kinds' as 5.26%. However, in the 128 specimens from control group, the detectable rate of pathogen was 6.25%. Relationships were found between Ng (P vulvovaginitis in pre-pubertal girls. In control group the pathogens were detected from 7 specimens including 5 Uu and 2 Mh. Some of the pathogens were correlated to STD and were important in causing vulvovaginitis in pre-pubertal girls. Vulvovaginitis might have been caused by more than one kind of pathogen in pre-pubertal girls. The locations of Mg, Mf and Ng in outer genital tracts were correlated to seasonal change. Macrolide seemed to be quite effective clinically in treating urogenital tract infection caused by mycoplasma and Ct.

  2. Evaluation of apoptotic- and autophagic-related protein expressions before and after IVM of fresh, slow-frozen and vitrified pre-pubertal mouse testicular tissue.

    Science.gov (United States)

    Dumont, L; Chalmel, F; Oblette, A; Berby, B; Rives, A; Duchesne, V; Rondanino, C; Rives, N

    2017-11-01

    Do freezing and in vitro culture procedures enhance the expression of proteins involved in apoptotic or autophagic pathways in murine pre-pubertal testicular tissue? IVM strongly modified apoptosis- and autophagy-related relative protein levels in mice testicular tissue whereas the impact of cryopreservation procedures was minimal at the end of the culture. In vitro spermatogenesis remains a challenging technical issue as it imposes to find a very close balance between survival and death of germ cell natural precursors (i.e. gonocytes and spermatogonia), which will eventually undergo a complete spermatogenesis close to in vivo conditions. The establishment of efficient culture conditions coupled with suitable cryopreservation procedures (e.g. controlled slow freezing [CSF] and solid surface vitrification [SSV]) of pre-pubertal testicular tissue is a crucial step in the fields of fertility preservation and restoration to improve the spermatic yield obtained in vitro. Here, we study cryopreservation procedures (i.e. CSF or SSV) and the impact of culture media compositions. A first set of 66 mouse pre-pubertal testes were directly cultured during 30, 36, 38 and 60 days (D) from 2.5 to 6.5-day-old CD-1 mice to evaluate the impact of time-aspect of culture and to endorse the reverse phase protein microarrays (RPPM) technique as an adapted experimental tool for the field of in vitro spermatogenesis. Ninety others fresh, slow-frozen and vitrified pre-pubertal testes were cultured during 30 days for the principal study to evaluate the impact of cryopreservation procedures before and after culture. Thirty-four testes dissected from 2.5, 6.5, 36.5, 40.5, 42.5 and 62.5 days postpartum (dpp) mice, corresponding to the time frames of spermatogenesis orchestrated in vitro, were used as in vivo controls. After in vitro culture, testicular tissue samples originated from 2.5 or 6.5-day-old CD-1 male mice were analyzed using RPPM. This targeted proteomic technique allowed us to

  3. MPEG-CS/Bmi-1RNAi Nanoparticles Synthesis and Its Targeted Inhibition Effect on CD133+ Laryngeal Stem Cells.

    Science.gov (United States)

    Wei, Xudong; He, Jian; Wang, Jingyu; Wang, Wei

    2018-03-01

    Previous studies have confirmed that CD133+ cells in laryngeal tumor tissue have the characteristics of cancer stem cells. Bmi-1 gene expression is central to the tumorigenicity of CD133+ cells. In this study, we tried to develop a new siRNA carrier system using chitosan-methoxypolyethylene nanoparticles (CS-mPEG-NPs) that exhibit higher tumor-targeting ability and enhanced gene silencing efficacy in CD133+ tumor stem cells. It is hoped to block the self-renewal and kill the stem cells of laryngeal carcinoma. The mPEG-CS-Bmi-1RNAi-NPs were synthesized and their characters were checked. The changes in invasion ability and sensitivity to radiotherapy and chemotherapy of CD133+Hep-2 tumor cells were observed after Bmi-1 gene silencing. The mPEG-CS-Bmi-1RNAi-NPs synthesized in this experiment have a regular spherical form, a mean size of 139.70 ±6.40 nm, an encapsulation efficiency of 85.21 ± 1.94%, with drug loading capacity of 18.47 ± 1.83%, as well as low cytotoxicity, providing good protection to the loaded gene, strong resistance to nuclease degradation and high gene transfection efficiency. After Bmi-1 gene silencing, the invasion ability of CD133+ cells was weakened. Co-cultured with paclitaxel, the survival rates of CD133+Bmi-1RNAi cells were lower. After radiotherapy, the mean growth inhibition rate of CD133+/Bmi-1RNAi cells was significantly lower than CD133+ cells. In conclusion, the mPEG-CS nano-carrier is an ideal vector in gene therapy, while silencing the Bmi-1 gene can enhance the sensitivity of CD133+ tumor stem cells to chemoradiotherapy and abate their invasion ability.

  4. Prepubertal ultra-low-dose estrogen therapy is associated with healthier lipid profile than conventional estrogen replacement for pubertal induction in adolescent girls with Turner syndrome: preliminary results.

    Science.gov (United States)

    Ruszala, Anna; Wojcik, Malgorzata; Zygmunt-Gorska, Agata; Janus, Dominika; Wojtys, Joanna; Starzyk, Jerzy B

    2017-08-01

    The metabolic effects of prepubertal low-dose estrogen replacement (LE) therapy in Turner syndrome (TS) have not been fully investigated to date. The present study aimed to compare glucose and lipids metabolism in adolescents with TS on LE and conventional estrogen replacement (CE). In 14 TS (mean age 13.8), LE (17β-estradiol, 62.5 μg daily) was introduced before age 12 (mean age 10.5), and followed by a pubertal induction regimen after age 12, and in 14 CE was started after age 12 (mean 14, SD 1.96). Before, and 3 years after starting 17β-estradiol growth velocity, bone age, BMI, and selected parameters of glucose and lipids metabolism were assessed. There were no significant differences between LE and CE in the mean levels of any parameter before introduction of 17β-estradiol [total cholesterol (TC): 4.1 vs 4.3 mmol/L, LDL cholesterol (LDLc): 2.2 vs 2.4 mmol/L, HDL cholesterol (HDLc): 1.6 vs 1.4 mmol/L, triglycerides: 0.9 vs 1.0 mmol/L, fasting glucose: 4.2 vs 4.4 mmol/L, post-load glucose: 4.8 vs 5.5 mmol/L; fasting insulin: 6.8 vs 8.0 post-load insulin: 21.3 vs 67.0 μIU/mL, HOMA-IR 1.3 vs 1.6]. After three years of treatment, TC and LDLc levels were significantly lower in LE group (3.8 vs 4.4 mmol/L, p = 0.004; 1.9 vs 2.4 mmol/L, p = 0.03). The other parameters did not differ significantly. There was no negative impact on growth course and bone age advancement nor on BMI in LE group. Prepubertal LE is associated with healthier lipid profile than CE in girls with TS.

  5. Dental health between self-perception, clinical evaluation and body image dissatisfaction - a cross-sectional study in mixed dentition pre-pubertal children.

    Science.gov (United States)

    Banu, Ancuta; Șerban, Costela; Pricop, Marius; Urechescu, Horatiu; Vlaicu, Brigitha

    2018-05-03

    Self-perception of oral health status is a multidimensional construct that includes psychological, psychosocial and functional aspects of oral health. Contemporary concepts suggest that the evaluation of health needs should focus on clinical standards and socio-dental indicators that measure the impact of health/disease on the individual quality of life. Oral health cannot be dissociated from general health. This study evaluates a possible association between oral health status, body size, self-perception of oral health, self-perception of body size and dissatisfaction with body image in prepubertal children with mixed dentition, targeting the completion of children's health status assessment which will further allow the identification of individuals at risk and could be further used as an evaluation of the need for specific interventions. The present study is cross-sectional in design and uses data from 710 pre-pubertal children with mixed dentition. The outcome variables comprised one item self-perception of oral health: dmft/DMFT Index and Dental Aesthetic Index, body size, self-assessed body size and desired body size. Multiple logistic regression analyses were performed. The level of significance was set at 5%. More than a half (53.1%) of the participants with mixed dentition reported that their oral health was excellent or very good. In the unadjusted model, untreated decayed teeth, dmft score and body dissatisfaction levels had a significant contribution to poor self-perception of oral health, but after adjustment for gender, BMI status, dmft score, DMFT score and DAI score, only untreated decayed teeth OR = 1.293, 95%CI (1.120-1.492) and higher body dissatisfaction levels had a significant contribution. It was concluded that the need for dental treatment influenced self-perception of oral health in prepubertal children with mixed dentition, especially with relation to untreated decayed teeth. Since only body dissatisfaction levels, but not BMI, were

  6. Effect of BMI on Knee Joint Torques in Ergometer Rowing

    NARCIS (Netherlands)

    Roemer, Karen; Hortobagyi, Tibor; Richter, Chris; Munoz-Maldonado, Yolanda; Hamilton, Stephanie

    2013-01-01

    Although an authoritative panel recommended the use of ergometer rowing as a non-weight-bearing form of exercise for obese adults, the biomechanical characterization of ergometer rowing is strikingly absent. We examined the interaction between body mass index (BMI) relative to the lower extremity

  7. The link between BMI and waist circumference in northern Iranian ...

    African Journals Online (AJOL)

    Background and Objectives: Waist circumference and not body mass index explains a greater variance in obesity-related health risk. The present study assesses the link between BMI and WC in Iranian adults. Methods: In a population based cross- sectional study on 3600 adults, northern Iran, we investigated the link ...

  8. Maternal Prepregnancy BMI and Risk of Cerebral Palsy in Offspring

    DEFF Research Database (Denmark)

    Forthun, Ingeborg; Wilcox, Allen J; Strandberg-Larsen, Katrine

    2016-01-01

    OBJECTIVES: To investigate the association between maternal pre-pregnancy BMI and risk of cerebral palsy (CP) in offspring. METHODS: The study population consisted of 188 788 children in the Mothers and Babies in Norway and Denmark CP study, using data from 2 population-based, prospective birth...

  9. Differences in the association between childhood trauma and BMI in ...

    African Journals Online (AJOL)

    However,independent of BMI group, there were significant differences in socioeconomic status (SES) between black and white women (P<0.01). Total CTQ score, as well as the sub-scales, physical and emotional neglect, and physical and sexual abuse were higher in black than white women (all P<0.05), but these scores ...

  10. Low birth weight, adult BMI and inflammation in middle age

    DEFF Research Database (Denmark)

    Pedersen, Jolene Lee Masters; Rod, Naja Hulvej; Avlund, Kirsten

    2013-01-01

    This study examines the association between birthweight and adult BMI with inflammation in middle age measured by interleukin 6 (IL- 6), interleukin 10 (IL-10), interleukin 18 (IL-18), high sensitivity Creactive protein (hsCRP) and tumor necrosis factor alpha (tnf-α). The study is based on partic...

  11. Bmi-1 Regulates Extensive Erythroid Self-Renewal

    Directory of Open Access Journals (Sweden)

    Ah Ram Kim

    2015-06-01

    Full Text Available Red blood cells (RBCs, responsible for oxygen delivery and carbon dioxide exchange, are essential for our well-being. Alternative RBC sources are needed to meet the increased demand for RBC transfusions projected to occur as our population ages. We previously have discovered that erythroblasts derived from the early mouse embryo can self-renew extensively ex vivo for many months. To better understand the mechanisms regulating extensive erythroid self-renewal, global gene expression data sets from self-renewing and differentiating erythroblasts were analyzed and revealed the differential expression of Bmi-1. Bmi-1 overexpression conferred extensive self-renewal capacity upon adult bone-marrow-derived self-renewing erythroblasts, which normally have limited proliferative potential. Importantly, Bmi-1 transduction did not interfere with the ability of extensively self-renewing erythroblasts (ESREs to terminally mature either in vitro or in vivo. Bmi-1-induced ESREs can serve to generate in vitro models of erythroid-intrinsic disorders and ultimately may serve as a source of cultured RBCs for transfusion therapy.

  12. Community-Specific BMI Cutoff Points for South Indian Females

    Directory of Open Access Journals (Sweden)

    K. B. Kishore Mohan

    2011-01-01

    Full Text Available Objective. To analyze multiparameters related to total body composition, with specific emphasis on obesity in South Indian females, in order to derive community-specific BMI cutoff points. Patients and Methods. A total number of 87 females (of age 37.33±13.12 years from South Indian Chennai urban population participated in this clinical study. Body composition analysis and anthropometric measurements were acquired after conducting careful clinical examination. Results. BMI demonstrated high significance when normal group (21.02±1.47 kg/m2 was compared with obese group (29.31±3.95 kg/m2, <0.0001. BFM displayed high significance when normal group (14.92±4.28 kg was compared with obese group (29.94 ± 8.1 kg, <0.0001. Conclusion. Community-specific BMI cutoffs are necessary to assess obesity in different ethnic groups, and relying on WHO-based universal BMI cutoff points would be a wrong strategy.

  13. Differences in the association between childhood trauma and BMI in ...

    African Journals Online (AJOL)

    between childhood trauma and BMI in black and white South African women ... finding, including measures of body image and body size satisfaction that may explain these findings. Keywords: Childhood trauma questionnaire; Body fat; Body image; Sexual abuse; Ethnicity, ... Self-reported exposure to childhood trauma was.

  14. A comparative study on different BMI category and physical fitness ...

    African Journals Online (AJOL)

    A comparative study on different BMI category and physical fitness health related component of sedentary male youth in Terengganu. V Eswaramoorthi, M.R. Abdullah, H Juahir, A.B.H.M. Maliki, R.M. Musa, N.A. Kosni, N Alias, N.B. Raj, S.M.M. Rasid, A Adnan ...

  15. An Unexpected Cause of Pelvic Pain in a Pubertal Case: Herlyn-Werner-Wunderlich Syndrome

    Directory of Open Access Journals (Sweden)

    Yasemin Kayadibi

    2014-03-01

    Full Text Available Uterovaginal duplication with imperforated hemivagina is a rare type of Mullerian anomaly. If ipsilateral renal agenesis is associated with this complex genital malformation, it is called Herlyn-Werner-Wunderlich syndrome. Clinical presentations of this syndrome include pelvic pain and mass effect due to obstructed hemivagina in pubertal adolescents and adults. Hematocolpos, even after menstruation period, leads to misdiagnosis. Laparotomy is the gold standard for the diagnosis, however, magnetic resonance imaging has an accuracy upto 100% in evaluating uterovajinal anatomy. In this article, we aimed to present ultrasonographic and magnetic resonance imaging findings in a patient with Herlyn-Werner-Wun derlich syndrome who presented with cyclic pelvic pain. (The Me­di­cal Bul­le­tin of Ha­se­ki 2014; 52: 60-3

  16. Androgenetic Alopecia: A Chronic or Pubertal Onset Disease Retarded by Blood Donation

    Directory of Open Access Journals (Sweden)

    Mohammad Reza Dayer

    2017-09-01

    Full Text Available Background Androgenetic alopecia is the main cause of hair loss and common baldness that affects psychological more than physiological aspects of people’s lives. Studies have shown that this multi factorial disorder is initiated by androgens secretion in pubertal period, minerals limitations, autoimmunity, mental stress, genetic predisposition and some alterations in hematological factors. Objectives The aim of this study was to evaluate the involvement of hematologic parameters in this disease using a case control study design. Methods In this case-controlled study, two groups each of 80 individuals with androgenetic alopecia were voluntarily included in the study based on their medical histories and clinical examinations and subjected to blood tests for routine hematological parameters. The results were then compared and analyzed using SPSS version 16.0. Results Our findings indicated that all the parameters for both groups fall in normal ranges (Mean ± SD but the values for RBC, HGB, MCH, MCHC, WBC, LYM and TIBC were significantly higher in patients than in normal group. The average counts of PLT was significantly lower in patients compared with the normal group. Otherwise, Person’s tests for statistical correlations between two groups indicated that the pattern of correlations were abnormal in patients. Conclusions Our findings indicated the presence of a chronic, immunologic and slowly progressing disorder that causes hair loss, the disease which is in turn triggered in pubertal period upon androgen secretion. We suggest, therefore, that the conditions may be ameliorated by prescription of iron tablet, platelet transfusion and anti-inflammation therapy.

  17. EFFECT OF GnRH AND PHOSPHORUS IN DELAYED PUBERTAL SURTI BUFFALO HEIFERS

    Directory of Open Access Journals (Sweden)

    H.B. Dhamsaniya

    2016-06-01

    Full Text Available The study was conducted on eighteen delayed pubertal Surti buffalo heifers, divided into three equal groups (6 in each to evaluate the efficacy of GnRH alone and in combination of phosphorus. The buffalo heifers in Group-I and Group-II were treated with Buserelin acetate (5 ml, IM. Buffalo heifers in Group-II also received additional injection of Toldimphos sodium (10 ml, IM at 3 day interval for 4 times, while buffalo heifers in Group-III served as control. The percentage of induced estrus was highest (83.33% in each treated groups as compared to control group (50%. The mean estrus induction intervals were significantly (P<0.05 shorter in Group-I (20.20 ± 2.18 days and Group-II (18.80 ± 2.32 days as compared to control group (30.24 ± 0.81 days. The conception rate at induced estrus was highest in Group-II (50% followed by Group-I (33.33%. The plasma progesterone levels being significantly lowest on the day of estrus (less than 0.5 ng/ml as compared to pre-treatment days in all groups. The mean total protein and triglycerides levels were differed significantly between the groups on the day of estrus and being significantly higher in Group-II as compared to Group-I and III on that day. A significantly higher level of cholesterol in both treatment groups as compared to the control group during different intervals and also being higher on the day of estrus as compared to pre-treatment days. The mean plasma glucose levels were differed nonsignificantly between and within the treatment and control groups. It is concluded that estrus can be successfully induced in delayed pubertal heifers with the use of GnRH alone and in combination with phosphorus.

  18. Prenatal androgen excess enhances stimulation of the GNRH pulse in pubertal female rats.

    Science.gov (United States)

    Yan, Xiaonan; Yuan, Chun; Zhao, Nannan; Cui, Yugui; Liu, Jiayin

    2014-07-01

    In adolescent girls with polycystic ovary syndrome (PCOS), neuroendocrine derangements manifest after the onset of puberty, characterized by rapid LH pulse frequency. The early mechanism underlying the pubertal regulation of the GNRH/LH pulsatile release in adolescents with PCOS remains uncertain. To determine the effects of prenatal androgen exposure on the activation of GNRH neurons and generation of LH pulse at puberty, we administrated 5α-dihydrotestosterone to pregnant rats and observed serum LH levels and expression of hypothalamic genes in female offspring from postnatal 4 to 8 weeks. The 6-week-old prenatally androgenized (PNA) female rats exhibited an increase in LH pulse frequency. The hypothalamic expression of neurokinin B (Nkb (Tac2)) and Lepr mRNA levels in PNA rats increased remarkably before puberty and remained high during puberty, whereas elevated Kiss1 mRNA levels were detected only after the onset of puberty. Exogenous kisspeptin, NK3R agonist, and leptin triggered tonic stimulation of GNRH neurons and increased LH secretion in 6-week-old PNA rats. Leptin upregulated Kiss1 mRNA levels in the hypothalamus of pubertal PNA rats; however, pretreatment with a kisspeptin antagonist failed to suppress the elevated serum LH stimulated by leptin, indicating that the stimulatory effects of leptin may be conveyed indirectly to GNRH neurons via other neural components within the GNRH neuronal network, rather than through the kisspeptin-GPR54 pathway. These findings validate the hypotheses that NKB and leptin play an essential role in the activation of GNRH neurons and initiation of increased LH pulse frequency in PNA female rats at puberty and that kisspeptin may coordinate their stimulatory effects on LH release. © 2014 Society for Endocrinology.

  19. Assessing the genetic overlap between BMI and cognitive function

    Science.gov (United States)

    Marioni, R E; Yang, J; Dykiert, D; Mõttus, R; Campbell, A; Ibrahim-Verbaas, Carla A; Bressler, Jan; Debette, Stephanie; Schuur, Maaike; Smith, Albert V; Davies, Gail; Bennett, David A; Deary, Ian J; Ikram, M Arfan; Launer, Lenore J; Fitzpatrick, Annette L; Seshadri, Sudha; van Duijn, Cornelia M; Mosely Jr, Thomas H; Davies, G; Hayward, C; Porteous, D J; Visscher, P M; Deary, I J

    2016-01-01

    Obesity and low cognitive function are associated with multiple adverse health outcomes across the life course. They have a small phenotypic correlation (r=−0.11; high body mass index (BMI)−low cognitive function), but whether they have a shared genetic aetiology is unknown. We investigated the phenotypic and genetic correlations between the traits using data from 6815 unrelated, genotyped members of Generation Scotland, an ethnically homogeneous cohort from five sites across Scotland. Genetic correlations were estimated using the following: same-sample bivariate genome-wide complex trait analysis (GCTA)–GREML; independent samples bivariate GCTA–GREML using Generation Scotland for cognitive data and four other samples (n=20 806) for BMI; and bivariate LDSC analysis using the largest genome-wide association study (GWAS) summary data on cognitive function (n=48 462) and BMI (n=339 224) to date. The GWAS summary data were also used to create polygenic scores for the two traits, with within- and cross-trait prediction taking place in the independent Generation Scotland cohort. A large genetic correlation of −0.51 (s.e. 0.15) was observed using the same-sample GCTA–GREML approach compared with −0.10 (s.e. 0.08) from the independent-samples GCTA–GREML approach and −0.22 (s.e. 0.03) from the bivariate LDSC analysis. A genetic profile score using cognition-specific genetic variants accounts for 0.08% (P=0.020) of the variance in BMI and a genetic profile score using BMI-specific variants accounts for 0.42% (P=1.9 × 10−7) of the variance in cognitive function. Seven common genetic variants are significantly associated with both traits at Pcognitive function. PMID:26857597

  20. Correlation between BMI and motor coordination in children.

    Science.gov (United States)

    Lopes, Vítor P; Stodden, David F; Bianchi, Mafalda M; Maia, Jose A R; Rodrigues, Luis P

    2012-01-01

    To analyze the association between motor coordination (MC) and body mass index (BMI) across childhood and early adolescence. This study is cross-sectional. Data were collected in 7175 children (boys n=3616, girls n=3559), ages 6-14 years. BMI was calculated from measured height and weight [body mass (kg)/height (m(2))]. Motor coordination was evaluated using Kiphard-Schilling's body coordination test (KTK). Spearman's rank correlation was used to study the association between BMI and MC. A Kruskal-Wallis test was used to analyze the differences in MC between children of normal weight, overweight and obese children. Correlations between MC and BMI were negative and varied between 0.05 and 0.49. The highest negative correlations for both boys and girls was at 11 years of age. There was a general pattern of increasing negative correlations in both genders from 6 to 11 years of age and then a decrease in correlation strengths through 14 years of age. In both boys (χ(2)((2))=324.01; p<0.001) and girls (χ(2)((2))=291.20; p<0.001) there were significant differences in MC between the three groups' weight status. Normal weight children of both sexes demonstrated significantly higher MC scores than overweight. Obese children in both sexes had the lowest MC scores among all three groups. Motor coordination demonstrated an inverse relationship with BMI across childhood and into early adolescence. The strength of the inverse relation increased during childhood, but decreased through early adolescence. Overweight and obese children of both sexes demonstrated significantly lower MC than normal weight children. Copyright © 2011 Sports Medicine Australia. Published by Elsevier Ltd. All rights reserved.

  1. Body mass index (BMI) in the Saudi population of Gassim.

    Science.gov (United States)

    Soyannwo, M A; Kurashi, N Y; Gadallah, M; Hams, J; el-Essawi, O; Khan, N A; Singh, R G; Alamri, A; Beyari, T H

    1998-01-01

    In a total cross-sectional population survey of the Faizia East Primary Health District of Buraidah, Gassim region of Saudi Arabia, 6,044 (2727 male and 3317 females) subjects out of a de facto population of 7695 got their BMI computed because infants and restless or bedridden subjects could not be examined. Mean (+/- SD) and percentiles (25th & 75th) were calculated in the conventional 5-year age cohorts as well as in functional age groups, namely, 0-5, 6-12, 13-49, 50-69 and 70+ years. 5th, 10th, 25th, 50th, 75th, 90th and 95th percentiles were computed only for the functional age groups. In general, the trend was for BMI to increase with age in both genders but the curve pattern showed some plateauing from about the age of 50 with slight decline in later life. Females had significantly higher indices than males, this becoming quite prominent from the 10-14 year age cohort. This difference persisted irrespective of the types of age grouping or residential location. Overall means (+/- SD) were 20.14 +/- 5.98 vs 22.22 +/- 7.21 for males and females respectively; df: 5771; p = 0.0000; 95% CI: -2.43, -1.735. Subjects in the urban living environment had significant higher indices than their rural counterpart: (21.666.92 vs 20.446.33: df: 5771; P = 0.0000; 95% CI: 1.595, -0.840). From the age of 15 about one quarter of females are overweight (BMI at the 75th percentile > 25) and from 30 years the same proportion are frankly obese (BMI > 30). Both systolic and diastolic blood pressure were significantly positively correlated with BMI in both genders: male SBP: r = 0.22, P r = 0.21, P r = 0.18, P < 0.00001.

  2. Effects of social mobility from childhood to adolescence on BMI.

    Science.gov (United States)

    Muraro, Ana Paula; Gonçalves-Silva, Regina Maria Veras; Ferreira, Márcia Gonçalves; Sichieri, Rosely

    2016-04-01

    Little is known about the contribution of childhood socio-economic position (SEP) and social mobility to weight change. The present study evaluated the effect of family SEP during the pre-school years and social mobility on BMI between birth and adolescence. Longitudinal. The SEP of each child's family was classified according to an asset-based wealth index as low, medium or high. Four different categories of childhood-adolescence SEP groups were created in order to examine social mobility: low-medium/high, medium-medium, medium-high and high-high/medium. For each of these categories, BMI was tracked from birth to adolescence. Linear mixed-effects models were used to analyse the data. Cuiabá-MT, Brazil. A population-based cohort of children born between 1994 and 1999 was assessed between 1999 and 2000, and again between 2009 and 2011. A total of 1716 adolescents were followed from childhood to adolescence (71·4 % of baseline). The prevalence of overweight/obesity was 20·4 % in childhood and 27·7 % in adolescence. A higher SEP in childhood was associated with a greater prevalence of overweight in adolescence. Expressive upward social mobility occurred, mainly in the lowest SEP group. There was a greater rate of change in BMI between birth and adolescence among children with a higher SEP in childhood and children who remained in the higher SEP from childhood to adolescence. Individuals from a higher SEP in childhood and those who remained in the higher social classes showed greater rate of change in BMI. Thus, initial SEP was the major determinant of changes in BMI.

  3. Process Optimization of Bismaleimide (BMI) Resin Infused Carbon Fiber Composite

    Science.gov (United States)

    Ehrlich, Joshua W.; Tate, LaNetra C.; Cox, Sarah B.; Taylor, Brian J.; Wright, M. Clara; Caraccio, Anne J.; Sampson, Jeffery W.

    2013-01-01

    Bismaleimide (BMI) resins are an attractive new addition to world-wide composite applications. This type of thermosetting polyimide provides several unique characteristics such as excellent physical property retention at elevated temperatures and in wet environments, constant electrical properties over a vast array of temperature settings, and nonflammability properties as well. This makes BMI a popular choice in advance composites and electronics applications [I]. Bismaleimide-2 (BMI-2) resin was used to infuse intermediate modulus 7 (IM7) based carbon fiber. Two panel configurations consisting of 4 plies with [+45deg, 90deg]2 and [0deg]4 orientations were fabricated. For tensile testing, a [90deg]4 configuration was tested by rotating the [0deg]4 configirration to lie orthogonal with the load direction of the test fixture. Curing of the BMI-2/IM7 system utilized an optimal infusion process which focused on the integration of the manufacturer-recommended ramp rates,. hold times, and cure temperatures. Completion of the cure cycle for the BMI-2/IM7 composite yielded a product with multiple surface voids determined through visual and metallographic observation. Although the curing cycle was the same for the three panellayups, the surface voids that remained within the material post-cure were different in abundance, shape, and size. For tensile testing, the [0deg]4 layup had a 19.9% and 21.7% greater average tensile strain performance compared to the [90deg]4 and [+45deg, 90deg, 90deg,-45degg] layups, respectively, at failure. For tensile stress performance, the [0deg]4 layup had a 5.8% and 34.0% greater average performance% than the [90deg]4 and [+45deg, 90deg, 90deg,-45deg] layups.

  4. A Comparison of Perceived and Measured Paternal Weight and BMI, and Relationship to Weight and BMI of his Children

    LENUS (Irish Health Repository)

    Power, RF

    2018-02-01

    Nineteen percent of 9 years old Irish children are overweight; seven percent are obese. Our aims were: to examine whether differences exist between paternal self-reported and measured height, weight and BMI in a population representative sample; and to explore paternal perceptions of their own weight status.\\r\

  5. Slightly increased BMI at young age is a risk factor for future hypertension in Japanese men.

    Directory of Open Access Journals (Sweden)

    Yuki Someya

    Full Text Available Hypertension is developed easily in Asian adults with normal body mass index (BMI (~23 kg/m2, compared with other ethnicities with similar BMI. This study tested the hypothesis that slightly increased BMI at young age is a risk factor for future hypertension in Japanese men by historical cohort study.The study participants were 636 male alumni of the physical education school. They had available data on their physical examination at college age and follow-up investigation between 2007 and 2011. The participants were categorized into six categories: BMI at college age of <20.0 kg/m2, 20.0-21.0kg/m2, 21.0-22.0kg/m2, 22.0-23.0kg/m2, 23.0-24.0kg/m2, and ≥24.0kg/m2, and the incidence of hypertension was compared.This study covered 27-year follow-up period (interquartile range: IQR: 23-31 which included 17,059 person-years of observation. Subjects were 22 (22-22 years old at graduated college, and 49 (45-53 years old at first follow-up investigation. During the period, 120 men developed hypertension. The prevalence rates of hypertension for lowest to highest BMI categories were 9.4%, 14.6%, 16.1%, 17.5%, 30.3%, and 29.3%, respectively (p<0.001 for trend, and their hazard ratios were 1.00 (reference, 1.80 (95%CI: 0.65-4.94, 2.17 (0.83-5.64, 2.29 (0.89-5.92, 3.60 (1.37-9.47 and 4.72 (1.78-12.48, respectively (p<0.001 for trend. This trend was similar after adjustment for age, year of graduation, smoking, current exercise status and current dietary intake.Slightly increased BMI at young age is a risk factor for future hypertension in Japanese men.

  6. Long-term BMI and growth profiles in offspring of women with gestational diabetes.

    Science.gov (United States)

    Hammoud, Nurah M; Visser, Gerard H A; van Rossem, Lenie; Biesma, Douwe H; Wit, Jan M; de Valk, Harold W

    2018-05-01

    , with the LGA counterparts of all three offspring groups in the highest BMI SDS ranges. Until early adolescence, OGDM have a BMI that is 0.5 SDS higher than that of the Dutch background population. LGA OGDM appear to be at particularly higher risk of being overweight in adolescence compared with non-LGA OGDM, putting them also at a higher lifetime risk of being overweight and developing obesity. ODM2 showed the highest BMI SDS values and had an average BMI SDS of +1.6 until the age of 14, when it became +2 SD. These results emphasize the importance of adequate recognition and timely treatment of maternal gestational diabetes to prevent fetal macrosomia in obstetrics.

  7. Maternal prepregnancy waist circumference and BMI in relation to gestational weight gain and breastfeeding behavior

    DEFF Research Database (Denmark)

    Kirkegaard, Helene; Nøhr, Ellen A; Rasmussen, Kathleen M

    2015-01-01

    BACKGROUND: Studies suggest that gestational weight gain (GWG) and breastfeeding behavior may influence long-term maternal abdominal fat mass. However, this could be confounded by abdominal fat mass before pregnancy because it is unknown whether abdominal fat mass, independently of body size......, affects GWG and breastfeeding behavior. OBJECTIVE: We investigated how maternal prepregnancy fat distribution, described by waist circumference (WC) and body mass index (BMI), is associated with GWG and breastfeeding behavior. DESIGN: We analyzed 1371 live births to 1024 women after enrollment...... in the Coronary Artery Risk Development in Young Adults study (1985-1996). For each birth, maternal prepregnancy BMI and WC were measured at year 0 (baseline), 2, 5, or 7 examinations. Recalled GWG and breastfeeding behavior were collected at years 7 and 10. GWG was analyzed by using linear regression...

  8. Low fitness is associated with abdominal adiposity and low-grade inflammation independent of BMI

    DEFF Research Database (Denmark)

    Wedell-Neergaard, Anne-Sophie; Eriksen, Louise; Grønbæk, Morten

    2018-01-01

    OBJECTIVE: Up to 30% of obese individuals are metabolically healthy. Metabolically healthy obese (MHO) individuals are characterized by having low abdominal adiposity, low inflammation level and low risk of developing metabolic comorbidity. In this study, we hypothesize that cardiorespiratory fit...... to be inversely associated with both abdominal adiposity and low-grade inflammation independent of BMI. These data suggest that, in spite of BMI, high fitness levels lead to a reduction in abdominal fat mass and low-grade inflammation.......OBJECTIVE: Up to 30% of obese individuals are metabolically healthy. Metabolically healthy obese (MHO) individuals are characterized by having low abdominal adiposity, low inflammation level and low risk of developing metabolic comorbidity. In this study, we hypothesize that cardiorespiratory...... fitness (fitness) is a determinant factor for the MHO individuals and aim to investigate the associations between fitness, abdominal adiposity and low-grade inflammation within different BMI categories. METHOD: Data from 10,976 individuals from the general population, DANHES 2007-2008, on waist...

  9. To Assess the Effect of Maternal BMI on Obstetrical Outcome

    Science.gov (United States)

    Lakhanpal, Shuchi; Aggarwal, Asha; Kaur, Gurcharan

    2012-06-01

    AIMS: To assess the effect of maternal BMI on complications in pregnancy, mode of delivery, complications of labour and delivery.METHODS:A crossectional study was carried out in the Obst and Gynae department, Kasturba Hospital, Delhi. The study enrolled 100 pregnant women. They were divided into 2 groups based on their BMI, more than or equal to 30.0 kg/m2 were categorized as obese and less than 30 kg/m2 as non obese respectively. Maternal complications in both types of patients were studied.RESULTS:CONCLUSION: As the obstetrical outcome is significantly altered due to obesity, we can improve maternal outcome by overcoming obesity. As obesity is a modifiable risk factor, preconception counseling creating awareness regarding health risk associated with obesity should be encouraged and obstetrical complications reduced.

  10. Trajectories of BMI change impact glucose and insulin metabolism.

    Science.gov (United States)

    Walsh, E I; Shaw, J; Cherbuin, N

    2018-03-01

    The aim of this study was to examine, in a community setting, whether trajectory of weight change over twelve years is associated with glucose and insulin metabolism at twelve years. Participants were 532 community-living middle-aged and elderly adults from the Personality and Total Health (PATH) Through Life study. They spanned the full weight range (underweight/normal/overweight/obese). Latent class analysis and multivariate generalised linear models were used to investigate the association of Body Mass Index (BMI, kg/m 2 ) trajectory over twelve years with plasma insulin (μlU/ml), plasma glucose (mmol/L), and HOMA2 insulin resistance and beta cell function at follow-up. All models were adjusted for age, gender, hypertension, pre-clinical diabetes status (normal fasting glucose or impaired fasting glucose) and physical activity. Four weight trajectories were extracted; constant normal (mean baseline BMI = 25; follow-up BMI = 25), constant high (mean baseline BMI = 36; follow-up BMI = 37), increase (mean baseline BMI = 26; follow-up BMI = 32) and decrease (mean baseline BMI = 34; follow-up BMI = 28). At any given current BMI, individuals in the constant high and increase trajectories had significantly higher plasma insulin, greater insulin resistance, and higher beta cell function than those in the constant normal trajectory. Individuals in the decrease trajectory did not differ from the constant normal trajectory. Current BMI significantly interacted with preceding BMI trajectory in its association with plasma insulin, insulin resistance, and beta cell function. The trajectory of preceding weight has an independent effect on blood glucose metabolism beyond body weight measured at any given point in time. Copyright © 2017 The Italian Society of Diabetology, the Italian Society for the Study of Atherosclerosis, the Italian Society of Human Nutrition, and the Department of Clinical Medicine and Surgery, Federico II University. Published by Elsevier

  11. Effect of inhaled corticosteroid use on weight (BMI) in pediatric patients with moderate-severe asthma.

    Science.gov (United States)

    Han, Jennifer; Nguyen, John; Kim, Yuna; Geng, Bob; Romanowski, Gale; Alejandro, Lawrence; Proudfoot, James; Xu, Ronghui; Leibel, Sydney

    2018-04-19

    Assess the relationship between inhaled corticosteroid use (ICS) and weight (BMI) in pediatric patients with moderate-severe asthma. Assess if the number of emergency department (ED) visits correlates with overall BMI trajectory. Assess the trend of prescribing biologic therapy in pediatric patients with moderate-severe asthma and determine its relationship with weight (BMI). A retrospective chart review was performed on 93 pediatric patients with moderate-severe asthma to determine the relationship between ICS use and weight (BMI), biologic therapy and BMI, and number of ED visits and BMI trajectory. A mixed effects model was employed with the correlation between repeated measures accounted for through the random effects. There is a statistically significant increase of 0.369 kg/m 2 in BMI trajectory per year in subjects on high-dose steroids compared to an increase of 0.195 kg/m 2 in the low dose group (p BMI of subjects initiated on biologic therapy (omalizumab or mepolizumab) had a statistically significant decrease in BMI trajectory of 0.818 kg/m 2 per year (p BMI trajectory (p BMI trajectory; the higher the dose, the greater the projected BMI increase per year. Initiation of biologic therapy decreased BMI trajectory over time. Lastly, those with frequent ED visits had a higher BMI trend. Future prospective studies are warranted that further evaluate the potential metabolic impacts of ICS and assess the effects of biologic therapy on BMI.

  12. Impact of Pre-Pregnancy BMI on B Vitamin and Inflammatory Status in Early Pregnancy: An Observational Cohort Study

    Directory of Open Access Journals (Sweden)

    Anne-Lise Bjørke-Monsen

    2016-11-01

    Full Text Available Maternal nutrition and inflammation have been suggested as mediators in the development of various adverse pregnancy outcomes associated with maternal obesity. We have investigated the relation between pre-pregnancy BMI, B vitamin status, and inflammatory markers in a group of healthy pregnant women. Cobalamin, folate, pyridoxal 5′-phosphate, and riboflavin; and the metabolic markers homocysteine, methylmalonic acid, and 3-hydroxykynurenine/xanthurenic acid ratio (HK/XA; and markers of cellular inflammation, neopterin and kynurenine/tryptophan ratio (KTR were determined in pregnancy week 18 and related to pre-pregnancy body mass index (BMI, in 2797 women from the Norwegian Mother and Child Cohort Study (MoBa. Pre-pregnancy BMI was inversely related to folate, cobalamin, pyridoxal 5′-phosphate (PLP, and riboflavin (p < 0.001, and associated with increased neopterin and KTR levels (p < 0.001. Inflammation seemed to be an independent predictor of low vitamin B6 status, as verified by low PLP and high HK/XA ratio. A high pre-pregnancy BMI is a risk factor for low B vitamin status and increased cellular inflammation. As an optimal micronutrient status is vital for normal fetal development, the observed lower B vitamin levels may contribute to adverse pregnancy outcomes associated with maternal obesity and B vitamin status should be assessed in women with high BMI before they get pregnant.

  13. The effects of puberty on white matter development in boys.

    Science.gov (United States)

    Menzies, Lara; Goddings, Anne-Lise; Whitaker, Kirstie J; Blakemore, Sarah-Jayne; Viner, Russell M

    2015-02-01

    Neuroimaging studies demonstrate considerable changes in white matter volume and microstructure during adolescence. Most studies have focused on age-related effects, whilst puberty-related changes are not well understood. Using diffusion tensor imaging and tract-based spatial statistics, we investigated the effects of pubertal status on white matter mean diffusivity (MD) and fractional anisotropy (FA) in 61 males aged 12.7-16.0 years. Participants were grouped into early-mid puberty (≤Tanner Stage 3 in pubic hair and gonadal development; n=22) and late-post puberty (≥Tanner Stage 4 in pubic hair or gonadal development; n=39). Salivary levels of pubertal hormones (testosterone, DHEA and oestradiol) were also measured. Pubertal stage was significantly related to MD in diverse white matter regions. No relationship was observed between pubertal status and FA. Regression modelling of MD in the significant regions demonstrated that an interaction model incorporating puberty, age and puberty×age best explained our findings. In addition, testosterone was correlated with MD in these pubertally significant regions. No relationship was observed between oestradiol or DHEA and MD. In conclusion, pubertal status was significantly related to MD, but not FA, and this relationship cannot be explained by changes in chronological age alone. Copyright © 2014 The Authors. Published by Elsevier Ltd.. All rights reserved.

  14. Investigation of pre-pubertal sex differences in wheel running and social behavior in three mouse strains

    OpenAIRE

    Gordon, Elizabeth A.; Corbitt, Cynthia

    2015-01-01

    Sex differences in social behaviors exist in mammals during adulthood, and further evidence suggests that sex differences in behavior are present before sexual maturity. In order to model behavioral disorders in animals, it is important to assess baseline sex-related behavioral differences, especially when studying disorders for which sex-related behavioral effects are expected. We investigated the effect of sex on behavior in 3 strains of pre-pubertal mice (C57BL/6, CFW, and CF1) using a whe...

  15. The relationship between physical activity, fitness, physical complaints and BMI in German adults - results of a longitudinal study.

    Science.gov (United States)

    Tittlbach, Susanne A; Jekauc, Darko; Schmidt, Steffen C E; Woll, Alexander; Bös, Klaus

    2017-09-01

    This study's aims were to describe the development of physical activity, physical fitness (PF), subjective (physical complaints (PC)) and objective (Body mass index (BMI)) health measures and to examine the relationship between the development trajectories. In addition, the study also aimed to assess the influence of sociodemographic determinants (age, sex, socioeconomic status (SES)) in German adults over a period of 18 years. The longitudinal study population comprises of 721 men and women, aged 33-76 years over the study period. There was self-report of physical activity and PC and testing of physical fitness and BMI in each study year (1992, 1997, 2002 and 2010). Latent growth curve models were used to analyse the development. Physical activity slightly increased while fitness, PC and BMI worsened over the course of 18 years. Sex, age and SES play important roles concerning physical activity, fitness and health. Several integrative associations could be detected between physical activity, fitness, PC and BMI as well as their trajectories. In particular, high initial levels of physical activity and fitness protect from high PC and BMI.The slope of physical activity was not significantly associated with slopes of fitness, PC and BMI. However, increase of fitness resulted in decrease of PC. A general positive development regarding the amount of physical activity could be detected. However, if it is only an unsystematic increase of physical activity, this is not in itself enough to achieve health benefits. The strengthening of fitness should be focused when increasing physical activity, since only then a health benefit is possible.

  16. Ethnicity influences BMI as evaluated from reported serum lipid values in Inuit and non-Inuit: raised upper limit of BMI in Inuit?

    Science.gov (United States)

    Noahsen, Paneeraq; Andersen, Stig

    2013-01-01

    To identify thresholds of BMI at which similar levels of serum lipids occur in Inuit and in non-Inuit as the impact of obesity on metabolic risk factors differ in Inuit compared to other ethnic groups. Published comparative data among Inuit and non-Inuit whites on BMI and HDL-cholesterol and triglyceride were identified for analysis. A literature search was done for BMI, lipids, Inuit and Greenland or Canada. Studies with data on triglycerides and HDL-cholesterol in Inuit and non-Inuit Caucasians were selected and data were retrieved. Regression equations were computed for BMI and HDL-cholesterol and BMI and triglycerides. BMI for similar levels of lipids in Inuit and non-Inuit and ratios of Inuit/non-Inuit BMI's were calculated. At BMI 25 kg/m2 HDL-cholesterol was 1.7/1.6 mM in Greenland Inuit/non-Inuit women and 1.7/1.5 mM in men in a major comparative study. HDL cholesterol decreased by 0.09 for each 1 kg/m2 increase in BMI. Serum triglycerides were 1.0/1.1 mM for Greenland Inuit/non-Inuit women and 0.9/ 1.4 mM for men at BMI 25 kg/m2. Slopes were around 0.1. A comparative study in Canadian Inuit/non-Inuit gave similar results. The BMI levels required for similar HDL-cholesterol or triglycerides were around 27.5 kg/m2, and Inuit/non-Inuit BMI-ratios were around 1.1. The same degree of dyslipidaemia was seen when Inuit had a 10% higher BMI compared to non-Inuit. This may support the establishment of Inuit-specific BMI cut-offs for the purposes of health screening and population health surveillance.

  17. Changes in blood pressure, bmi and ecg patterns in women using low-dose contraceptives

    International Nuclear Information System (INIS)

    Syed, S.; Rahim, M.; Javed, M.; Qureshi, M.A.

    2008-01-01

    To determine the cardiovascular risk factors in users of second generation contraceptives by recording changes in body mass index, blood pressure and electrocardiogram. Sixty four women volunteered for this study (age range 20-35 years), belonging to low-income group with similar socio-cultural background. The Body Mass Index (BMI) was calculated by measuring height and weight of the subjects, systolic and diastolic blood pressure and ECG recording by standard method. The group means, standard deviations and coefficient correlation for interrelationship among variables in respective groups of subjects were calculated using relevant statistical method and software program. There was no significant difference between BMI of two types of contraceptive users as compared to non users, but BMI was significantly correlated with both systolic and diastolic blood pressures in injectable users as compared to controls. ECG alterations frequently observed in contraceptive users (40%) as compared to controls were normal findings. It was observed that women aged < 30 years and using contraceptives for more than three years had a tendency to gain weight and developed a mild increase in systolic and diastolic blood pressures. (author)

  18. Body Size Estimation from Early to Middle Childhood: Stability of Underestimation, BMI, and Gender Effects

    Directory of Open Access Journals (Sweden)

    Silje Steinsbekk

    2017-11-01

    Full Text Available Individuals who are overweight are more likely to underestimate their body size than those who are normal weight, and overweight underestimators are less likely to engage in weight loss efforts. Underestimation of body size might represent a barrier to prevention and treatment of overweight; thus insight in how underestimation of body size develops and tracks through the childhood years is needed. The aim of the present study was therefore to examine stability in children’s underestimation of body size, exploring predictors of underestimation over time. The prospective path from underestimation to BMI was also tested. In a Norwegian cohort of 6 year olds, followed up at ages 8 and 10 (analysis sample: n = 793 body size estimation was captured by the Children’s Body Image Scale, height and weight were measured and BMI calculated. Overall, children were more likely to underestimate than overestimate their body size. Individual stability in underestimation was modest, but significant. Higher BMI predicted future underestimation, even when previous underestimation was adjusted for, but there was no evidence for the opposite direction of influence. Boys were more likely than girls to underestimate their body size at ages 8 and 10 (age 8: 38.0% vs. 24.1%; Age 10: 57.9% vs. 30.8% and showed a steeper increase in underestimation with age compared to girls. In conclusion, the majority of 6, 8, and 10-year olds correctly estimate their body size (prevalence ranging from 40 to 70% depending on age and gender, although a substantial portion perceived themselves to be thinner than they actually were. Higher BMI forecasted future underestimation, but underestimation did not increase the risk for excessive weight gain in middle childhood.

  19. Association of Rotating Night Shift Work with BMI and Abdominal Obesity among Nurses and Midwives.

    Science.gov (United States)

    Peplonska, Beata; Bukowska, Agnieszka; Sobala, Wojciech

    2015-01-01

    Mounting epidemiological evidence suggests that night shift work may contribute to the etiology of increased body weight. The present study aimed to examine association between rotating night shift work and body mass index (BMI), and abdominal adiposity respectively among nurses and midwives. A cross-sectional study was conducted among 724 female nurses and midwives, aged 40-60 years (354 rotating night shift and 370 daytime workers) in Łódź, Poland, between 2008 and 2011. Information about occupational history and potential confounders was collected during personal interviews. Anthropometric measurements of body weight, height, waist (WC) and hip (HC) circumference were made, and body mass index (BMI), waist to hip ratio (WHR) and waist to height ratio (WHtR) were calculated. GLM regression models and multinomial logit regression models were fitted to explore the association between night shift work and anthropometric parameters, with adjustment for age, body silhouette at age 20, current smoking status, packyears, marital status, and menopausal hormone therapy use. Cumulative night shift work showed significant associations with BMI, WC, HC and WHtR, with BMI increasing by 0.477 kg/m2 per 1000 night duties and by 0.432 kg/m2 per 10000 night shift hours, WC increasing respectively by 1.089 cm and 0.99 cm, and HC by 0.72 cm and WHtR by 0.007 cm for both metrics. Both current and cumulative night work was associated with obesity (BMI≥30kg/m2), with OR=3.9 (95%CI:1.5-9.9), in women reporting eight or more night shifts per month. The results of the study support the previously reported relations between night shift work and development of obesity.

  20. Integrated genomic and BMI analysis for type 2 diabetes risk assessment.

    Directory of Open Access Journals (Sweden)

    Dayanara eLebrón-Aldea

    2015-03-01

    Full Text Available Type 2 Diabetes (T2D is a chronic disease arising from the development of insulin absence or resistance within the body, and a complex interplay of environmental and genetic factors. The incidence of T2D has increased throughout the last few decades, together with the occurrence of the obesity epidemic. The consideration of variants identified by Genome Wide Association Studies (GWAS into risk assessment models for T2D could aid in the identification of at-risk patients who could benefit from preventive medicine. In this study, we build several risk assessment models, and evaluated them with two different classification approaches (Logistic Regression and Neural Networks, to measure the effect of including genetic information in the prediction of T2D. We used data from to the Original and the Offspring cohorts of the Framingham Heart Study, which provides phenotypic and genetic information for 5,245 subjects (4,306 controls and 939 cases. Models were built by using several covariates: gender, exposure time, cohort, body mass index (BMI, and 65 established T2D-associated SNPs. We fitted Logistic Regressions and Bayesian Regularized Neural Network and then assessed their predictive ability by using a ten-fold cross validation. We found that the inclusion of genetic information into the risk assessment models increased the predictive ability by 2%, when compared to the baseline model. Furthermore, the models that included BMI at the onset of diabetes as a possible effector, gave an improvement of 6% in the area under the curve derived from the ROC analysis. The highest AUC achieved (0.75 belonged to the model that included BMI, and a genetic score based on the 65 established T2D-associated SNPs. Finally, the inclusion of SNPs and BMI raised predictive ability in all models as expected; however, results from the AUC in Neural Networks and Logistic Regression did not differ significantly in their prediction accuracy.

  1. The impact of sex and BMI on the clinical course of COPD and bronchial asthma

    Directory of Open Access Journals (Sweden)

    Krzysztof Wytrychowski

    2016-09-01

    Full Text Available Background. Bronchial asthma is a heterogeneous disease, and is one phenotype of asthma with obesity. Chronic obstructive pulmonary disease is the fourth most frequent cause of death in the world. Objectives. The aim of the study was to assess the influence of BMI and sex on the clinical course of uncontrolled asthma and COPD with moderate to severe airflow limitation. Material and methods . The study was performed on 2 groups. Group A: 72 adults suffering from asthma (38 F – females, 34 M – males with at least 1 exacerbation requiring treatment with systemic corticosteroids in the year before the study. Group B: 79 patients (34 F, 45 M with COPD Grades 2 and 3 according to GOLD. Data including age, gender, BMI, disease duration, treatment, concomitant diseases, pack-years, and number of exacerbations in the last year were collected. Asthma Control Questionnaire scores in group A and COPD Assessment Test scores in group B were collected. Pulmonary function tests were performed in both groups. Results . There were no differences between females and males in the analyzed variables in both groups. Obese patients (BMI > 30.0 kg/m2 were selected for analysis from group A (18 F, 10 M and from group B (13 F, 16 M. In group A, the number of exacerbations was significantly lower in males (M 1.3 vs. F 1.9; p = 0.01. In group B the age of obese patients was higher than in patients with BMI ≤ 30.0 (68.3 vs. 62.5; p = 0.002. Conclusion . Poorer control of asthma in obese patients was associated with the female gender. Age is a risk factor for obesity development in patients with COPD.

  2. An unanswered question in pediatric urology: the post pubertal persistence of prepubertal congenital penile curvature correction by tunical plication.

    Science.gov (United States)

    Ozkuvanci, Ünsal; Ziylan, Orhan; Dönmez, M Irfan; Yucel, Omer Baris; Oktar, Tayfun; Ander, Haluk; Nane, Ismet

    2017-01-01

    The aim of this study is to analyze post pubertal results of pre pubertal tunica albuginea plication with non-absorbable sutures in the correction of CPC. The files of patients who underwent tunica albuginea plication without incision (dorsal/lateral) were retrospectively reviewed. Patients younger than 13 years of age at the time of operation and older than 14 years of age in November 2015 were included. Patients with a penile curvature of less than 30 degrees & more than 45 degrees and penile/urethral anomalies were excluded. All of the patients underwent surgery followed by circumcision. The mean age of patients at the time of the operation was 9.7 years (range, 6-13 years). The mean degree of ventral penile curvature measured during the operation was 39 degrees while it was 41 degrees in the lateral curvatures. All of the patients were curvature-free at the end of the operation. At the time of the follow-up examination, the mean age was 16.7 years (range, 14-25 years). Six patients had a straight (0-10 degrees) penis during erection and seven patients had recurrent penile curvatures ranging from 30 to 50 degrees. Pre pubertal tunica albuginea plication of congenital penile curvature (30-45 degrees) with non-absorbable sutures performed without incision is a minimal invasive method especially when performed during circumcision. However, recurrence might be observed in half of the patients after puberty. Copyright® by the International Brazilian Journal of Urology.

  3. An unanswered question in pediatric urology: the post pubertal persistence of prepubertal congenital penile curvature correction by tunical plication

    Directory of Open Access Journals (Sweden)

    Ünsal Ozkuvanci

    Full Text Available ABSTRACT Objective: The aim of this study is to analyze post pubertal results of pre pubertal tunica albuginea plication with non-absorbable sutures in the correction of CPC. Materials and Methods: The files of patients who underwent tunica albuginea plication without incision (dorsal/lateral were retrospectively reviewed. Patients younger than 13 years of age at the time of operation and older than 14 years of age in November 2015 were included. Patients with a penile curvature of less than 30 degrees & more than 45 degrees and penile/urethral anomalies were excluded. All of the patients underwent surgery followed by circumcision. Results: The mean age of patients at the time of the operation was 9.7 years (range, 6-13 years. The mean degree of ventral penile curvature measured during the operation was 39 degrees while it was 41 degrees in the lateral curvatures. All of the patients were curvature-free at the end of the operation. At the time of the follow-up examination, the mean age was 16.7 years (range, 14-25 years. Six patients had a straight (0-10 degrees penis during erection and seven patients had recurrent penile curvatures ranging from 30 to 50 degrees. Conclusion: Pre pubertal tunica albuginea plication of congenital penile curvature (30-45 degrees with non-absorbable sutures performed without incision is a minimal invasive method especially when performed during circumcision. However, recurrence might be observed in half of the patients after puberty.

  4. ERD-based online brain-machine interfaces (BMI) in the context of neurorehabilitation: optimizing BMI learning and performance.

    Science.gov (United States)

    Soekadar, Surjo R; Witkowski, Matthias; Mellinger, Jürgen; Ramos, Ander; Birbaumer, Niels; Cohen, Leonardo G

    2011-10-01

    Event-related desynchronization (ERD) of sensori-motor rhythms (SMR) can be used for online brain-machine interface (BMI) control, but yields challenges related to the stability of ERD and feedback strategy to optimize BMI learning.Here, we compared two approaches to this challenge in 20 right-handed healthy subjects (HS, five sessions each, S1-S5) and four stroke patients (SP, 15 sessions each, S1-S15). ERD was recorded from a 275-sensor MEG system. During daily training,motor imagery-induced ERD led to visual and proprioceptive feedback delivered through an orthotic device attached to the subjects' hand and fingers. Group A trained with a heterogeneous reference value (RV) for ERD detection with binary feedback and Group B with a homogenous RV and graded feedback (10 HS and 2 SP in each group). HS in Group B showed better BMI performance than Group A (p learning was significantly better (p learning relative to use of a heterogeneous RV and binary feedback.

  5. CHARACTERISTICS OF PUBERTAL DEVELOPMENT IN A MULTI-RACIAL/ETHNIC POPULATION OF GIRLS. (R825816)

    Science.gov (United States)

    The perspectives, information and conclusions conveyed in research project abstracts, progress reports, final reports, journal abstracts and journal publications convey the viewpoints of the principal investigator and may not represent the views and policies of ORD and EPA. Concl...

  6. growth development in pre-pubertal female rabbits fed crude oil

    African Journals Online (AJOL)

    OMA

    . (1986) was also given as supplement feed while clean-cool water was provided ad-libitum. All the animals were housed in conventional single-tier wire hutches. On commencement of the crude oil treatment, the forty rabbits were randomly.

  7. Impaired pubertal development and testicular hormone function in males with sickle cell anemia.

    Science.gov (United States)

    Martins, Paulo Roberto Juliano; Kerbauy, José; Moraes-Souza, Helio; Pereira, Gilberto de Araújo; Figueiredo, Maria Stella; Verreschi, Ieda Therezinha

    2015-01-01

    Changes in weight/height ratio, delayed sexual maturation, hypogonadism and impaired fertility have been demonstrated in sickle cell disease (SCD). This study aimed to evaluate the clinical and laboratory views of the Leydig cells function after stimulation with hCG in adults with sickle cell disease. We studied 15 patients with SCD (18 to 40 years; median=27 years old), fourteen homozygous S, and one with SC disease. The control group, composed by adult males, was divided into two groups: I - 10 relatives (18-39 years, median=26 years) with the same socioeconomic level of the patients, and II - 9 normal individuals (23-28, median=31 years) randomly chosen. Clinically it was observed a slight degree of malnutrition, important puberty delay, rarefaction of chest, underarm and pubic hair, and important reduction of the testis and penis size, featuring a mild hypogonadism in patients with SCD. The hormonal level assessment of testosterone at baseline and at 24, 48 and 72 h after hCG stimulation showed no significant differences between the groups studied. We can presume that adult men with SCD showed clinical hypoandrogenism with normal testicular hormonal function, a fact inconsistent with the hypothesis of primary hypogonadism. Copyright © 2014 Elsevier Inc. All rights reserved.

  8. Pubertal Development and Behavior: Hormonal Activation of Social and Motivational Tendencies

    Science.gov (United States)

    Forbes, Erika E.; Dahl, Ronald E.

    2010-01-01

    Adolescence is a time of dramatic changes including rapid physical growth, the onset of sexual maturation, the activation of new drives and motivations, and a wide array of social and affective changes and challenges. This review focuses on behavioral changes in this interval and is organized by the claim that a key set of these adolescent changes…

  9. Bmi-1-targeting suppresses osteosarcoma aggressiveness through the NF-κB signaling pathway

    Science.gov (United States)

    Liu, Jiaguo; Luo, Bin; Zhao, Meng

    2017-01-01

    Bone cancer is one of the most lethal malignancies and the specific causes of tumor initiation are not well understood. B-cell-specific Moloney murine leukemia virus integration site 1 protein (Bmi-1) has been reported to be associated with the initiation and progression of osteosarcoma, and as a prognostic indicator in the clinic. In the current study, a full-length antibody targeting Bmi-1 (AbBmi-1) was produced and the preclinical value of Bmi-1-targeted therapy was evaluated in bone carcinoma cells and tumor xenograft mice. The results indicated that the Bmi-1 expression level was markedly upregulated in bone cancer cell lines, and inhibition of Bmi-1 by AbBmi-1 reduced the invasiveness and migration of osteosarcoma cells. Overexpression of Bmi-1 promoted proliferation and angiogenesis, and increased apoptosis resistance induced by cisplatin via the nuclear factor-κB (NF-κB) signal pathway. In addition, AbBmi-1 treatment inhibited the tumorigenicity of osteosarcoma cells in vivo. Furthermore, AbBmi-1 blocked NF-κB signaling and reduced MMP-9 expression. Furthermore, Bmi-1 promoted osteosarcoma tumor growth, whereas AbBmi-1 significantly inhibited osteosarcoma tumor growth in vitro and in vivo. Notably, AbBmi-1 decreased the percentages of Ki67-positive cells and terminal deoxynucleotidyl transferase dUTP nick end labeling-positive cells in tumors compared with Bmi-1-treated and PBS controls. Notably, MMP-9 and NF-κB expression were downregulated by treatment with AbBmi-1 in MG-63 osteosarcoma cells. In conclusion, the data provides evidence that AbBmi-1 inhibited the progression of osteosarcoma, suggesting that AbBmi-1 may be a novel anti-cancer agent through the inhibition of Bmi-1 via activating the NF-κB pathway in osteosarcoma. PMID:28983587

  10. Waist circumference is a better predictor of risk for frailty than BMI in the community-dwelling elderly in Beijing.

    Science.gov (United States)

    Liao, Qiuju; Zheng, Zheng; Xiu, Shuangling; Chan, Piu

    2018-03-27

    Obesity is found to be associated with frailty. Body mass index (BMI) and waist circumference (WC) are the commonly used measures for obesity, the former is more closely related to general obesity and body weight; the latter can more accurately reflect abdominal obesity and is more closely associated with metabolic disorders. In this study, we intend to study the relationship between frailty, BMI and WC among older people. Data were derived from the Beijing Longitudinal Study on Aging II Cohort, which included 6320 people 65 years or older from three urban districts in Beijing. A Frailty Index derived from 33 items was developed according to Rockwood's cumulative deficits method. A Frailty Index ≥ 0.25 was used as the cut-off criteria. BMI was classified as underweight, normal, overweight, or obese (BMI (≥ 28.0 kg/m 2 , 22.6%) or a larger WC (18.5%) were more likely to be frail. People with normal BMI and overweight people do not suffer from higher prevalence for frailty. In comparison with individuals with normal BMI (18.5-BMI and large WC (odds ratio 1.68; 95% CI 1.33-2.12), have overweight and large WC (odds ratio 1.58; 95% CI 1.23-1.96), or have obesity and large WC (odds ratio 2.28; 95% CI 1.79-2.89). In people with normal WC, only those who are underweight have a higher risk for frailty (odds ratio 1.65, 95% CI 1.08-2.52). In comparison with BMI, the relation of WC with the risk for frailty was much closer. Abdominal obesity is more closely associated with incidence of frailty than general obesity in the elderly. Older adults with large waist circumference are more likely to be frail. Frailty in the elderly might be more closely related to metabolic disorders. WC might be a better measurement to detect frailty than BMI, given its relationship with metabolic disorders.

  11. Concordance between self-reported pre-pregnancy body mass index (BMI) and BMI measured at the first prenatal study contact.

    Science.gov (United States)

    Natamba, Barnabas K; Sanchez, Sixto E; Gelaye, Bizu; Williams, Michelle A

    2016-07-26

    The 2009 Institute of Medicine (IOM) gestational weight recommendations are tailored to women's pre-pregnancy body mass index (BMI). Limited evidence exists on methods for estimating women's pre-pregnancy BMI, particularly for women living in low and middle income countries. Using data from collected among Peruvian pregnant women, we compared the concordance between self-reported pre-pregnancy BMI with BMI measured at the earliest prenatal study visit. Data were from the Pregnancy Outcomes Maternal and Infant Study (PrOMIS), a cohort of pregnant women at the Instituto Nacional Materno Perinatal (INMP) in Lima, Peru. 2605 women aged 18 to 49 years (mean ± SD gestational age = 10.9 ± 3.3 weeks) were included in the study. Self-reported pre-pregnancy weight and height and measured weight and height were collected at the first prenatal study contact. We assessed the concordance between measured and self-reported BMI; and, the agreement among indicators of nutritional status obtained using measured and self-reported BMI. On average, weight measured at the first prenatal study visit was 0.27 kg higher than self-reported pre-pregnancy weight (p overweight or obese BMI categories tended to be lower when using self-reported BMI (38.2 %) than when using measured BMI (47.7 %). Self-reported pre-pregnancy BMI was strongly correlated with BMI measured at the first prenatal study contact. The findings potentially suggest that, in this context, there is minimal change between pre-pregnancy BMI and BMI measured at the first prenatal study contact; or, that women in this study just recalled their most recent measured anthropometrics (including values obtained during the index pregnancy but before enrollment in the PrOMIS study).

  12. Total pubertal growth in patients with juvenile idiopathic arthritis treated with growth hormone: analysis of a single center.

    Science.gov (United States)

    Bechtold, S; Beyerlein, A; Ripperger, P; Roeb, J; Dalla Pozza, R; Häfner, R; Haas, J P; Schmidt, H

    2012-10-01

    Growth failure is a permanent sequelae in juvenile idiopathic arthritis (JIA). The aim of the study was to compare pubertal growth in control and growth hormone (GH) treated JIA subjects. 64 children with JIA at a mean age of 10.38 ± 2.80 years were enrolled and followed until final height (measured in standard deviation (SD) scores). 39 children (20 m) received GH therapy and 24 (9 m) served as controls. GH dose was 0.33 mg/kg/week. Linear regression analysis was performed to identify factors influencing total pubertal growth. Mean total pubertal growth was 21.1 ± 1.3 cm (mean ± SD) in GH treated JIA patients and 13.8 ± 1.5 cm in controls. Final height was significantly higher with GH treatment (-1.67 ± 1.20 SD) compared to controls (-3.20 ± 1.84 SD). Linear regression model identified age at onset of puberty (ß=-4.2,CI: -5.9, -2.6 in controls and ß=-2.3,CI: -3.6, -1.1 in GH treated) as the main factor for total pubertal growth. Final height SDS was determined by the difference to target height at onset of puberty (ß=-0.59;CI: -0.80, -0.37 in controls and ß=-0.30,CI: -0.52, -0.08 in GH treated), age at onset of puberty (ß=0.47;CI:0.02,0.93 in controls and 0.23;CI: -0.00,0.46 in GH treated) and height gain during puberty (ß=0.13;CI:0.05,0.21 in controls and ß=0.11;CI:0.07,0.16 in GH treated). Total pubertal growth in JIA patients treated with GH was increased by a factor of 1.5 greater in comparison to controls leading to a significantly better final height. To maximize final height GH treatment should be initiated early to reduce the height deficit at onset of puberty. Copyright © 2012 Elsevier Ltd. All rights reserved.

  13. The Interplay between Gaze Following, Emotion Recognition, and Empathy across Adolescence; a Pubertal Dip in Performance?

    Directory of Open Access Journals (Sweden)

    Rianne van Rooijen

    2018-02-01

    Full Text Available During puberty a dip in face recognition is often observed, possibly caused by heightened levels of gonadal hormones which in turn affects the re-organization of relevant cortical circuitry. In the current study we investigated whether a pubertal dip could be observed in three other abilities related to social information processing: gaze following, emotion recognition from the eyes, and empathizing abilities. Across these abilities we further explored whether these measurements revealed sex differences as another way to understand how gonadal hormones affect processing of social information. Results show that across adolescence, there are improvements in emotion recognition from the eyes and in empathizing abilities. These improvements did not show a dip, but are more plateau-like. The gaze cueing effect did not change over adolescence. We only observed sex differences in empathizing abilities, with girls showing higher scores than boys. Based on these results it appears that gonadal hormones are not exerting a unified influence on higher levels of social information processing. Further research should also explore changes in (visual information processing around puberty onset to find a more fitted explanation for changes in social behavior across adolescence.

  14. Evaluation of GnRH analogue testing in diagnosis and management of children with pubertal disorders

    Directory of Open Access Journals (Sweden)

    Hemchand K Prasad

    2012-01-01

    Full Text Available Context: Gonadotrophin releasing hormone (GnRH stimulation test is pivotal in the assessment of children with pubertal disorders. However, lack of availability and high cost often result in the test falling into disfavor. We routinely use the GnRH analogue stimulation test as an alternative at our center. Aim: To present the data on children with endocrine disorders who underwent GnRH agonist stimulation test in pediatric endocrine clinic of a tertiary care referral hospital. Setting and Design: Pediatric endocrine clinic of a tertiary care referral hospital. Retrospective analysis of case records. Materials and Methods: The details pertaining to clinical and radiological parameters and hormonal tests were retrieved from case records of 15 children who underwent GnRH agonist stimulation test from May 2010 to April 2011. Results: Indications for testing with GnRH analogue were evaluation of delayed puberty, diagnosis of precocious puberty, assessment of hormonal suppression in treatment of precocious puberty and micropenis in two, nine, three and one cases, respectively. The results of the test and clinical and radiological parameters were in concordance. The test was also crucial in diagnosing the onset of central precocious puberty in two children with congenital adrenal hyperplasia. Conclusion: GnRH agonist test is a convenient, safe test that can be performed on an out-patient basis and can help the clinicians in the correct diagnosis and appropriate treatment of various puberty-related disorders.

  15. Pedometer assessed physical activity in urban pubertal children: first report from India.

    Science.gov (United States)

    Contractor, Aashish; Bhanushali, Aparna; Changrani, Jyotsna; Angadia, Siddharth; Das, Bibhu R

    2014-11-01

    Inadequate physical activity is a risk factor for several lifestyle diseases. In the current study we have tried to evaluate the physical activity levels in urban Indian pubertal children as well as investigate the relationship between step counts and body composition. A total of 1032 children aged 12 to 15 years wore pedometers for 2 weekdays and 2 weekend days, the final cohort included 910 subjects with 467 boys and 443 girls. Mean weekday steps were 11,062 ± 4741 for boys and 9619 ± 4144 for girls; weekend steps were 10,842 ± 5034 for boys and 9146 ± 5159 for girls, which were both significantly different. The weekend steps were consistently lower in both genders. Analysis of children not meeting a cut-off of 10,000 steps indicated that 45% of the boys aged 12; 54% aged 13; 43% to 48% aged 14 and 50% in the aged 15 did not meet the cut-off. In girls higher levels of inactivity were seen with 58% to 65% aged 12; 69% to 73% aged 13; 49% to 58% aged 14 and 50% to 100% in age-group 15 did not meet the cut-off on weekdays and weekends respectively. The high level of physical inactivity in the representative urban Indian children is a cause of grave concern and necessitates urgent intervention strategies to be formulated.

  16. Peripheral markers of serotonergic and noradrenergic function in post-pubertal, caucasian males with autistic disorder.

    Science.gov (United States)

    Croonenberghs, J; Delmeire, L; Verkerk, R; Lin, A H; Meskal, A; Neels, H; Van der Planken, M; Scharpe, S; Deboutte, D; Pison, G; Maes, M

    2000-03-01

    Some studies have suggested that disorders in the peripheral and central metabolism of serotonin (5-HT) and noradrenaline may play a role in the pathophysiology of autistic disorder. This study examines serotonergic and noradrenergic markers in a study group of 13 male, post-pubertal, caucasian autistic patients (age 12-18 y; I.Q. > 55) and 13 matched volunteers. [3H]-paroxetine binding Kd values were significantly higher in patients with autism than in healthy volunteers. Plasma concentrations of tryptophan, the precursor of 5-HT, were significantly lower in autistic patients than in healthy volunteers. There were no significant differences between autistic and normal children in the serum concentrations of 5-HT, or the 24-hr urinary excretion of 5-hydroxy-indoleacetic acid (5-HIAA), adrenaline, noradrenaline, and dopamine. There were no significant differences in [3H]-rauwolscine binding Bmax or Kd values, or in the serum concentrations of tyrosine, the precursor of noradrenaline, between both study groups. There were highly significant positive correlations between age and 24-hr urinary excretion of 5-HIAA and serum tryptophan. The results suggest that: 1) serotonergic disturbances, such as defects in the 5-HT transporter system and lowered plasma tryptophan, may play a role in the pathophysiology of autism; 2) autism is not associated with alterations in the noradrenergic system; and 3) the metabolism of serotonin in humans undergoes significant changes between the ages of 12 and 18 years.

  17. Association between Physical Activity and Cardiovascular Risk in Chinese Youth Independent of Age and Pubertal Stage

    Directory of Open Access Journals (Sweden)

    Lau Joseph TF

    2010-06-01

    Full Text Available Abstract Background Childhood and adolescence are critical periods of habit formation with substantial tracking of lifestyle and cardiovascular risk into adulthood. There are various guidelines on recommended levels of physical activity in youth of school-age. Despite the epidemic of obesity and diabetes in China, there is a paucity of data in this regard in Chinese youth. We examined the association of self-reported level of physical activity and cardiovascular risk in Hong Kong Chinese youth of school-age. Methods This was a cross-sectional study conducted in 2007-8 in a school setting with 2119 Hong Kong Chinese youth aged 6-20 years. Physical activity level was assessed using a validated questionnaire, CUHK-PARCY (The Chinese University of Hong Kong: Physical Activity Rating for Children and Youth. A summary risk score comprising of waist circumference, blood pressure, fasting plasma glucose and lipids was constructed to quantify cardiovascular risk. Results In this cohort, 21.5% reported high level of physical activity with boys being more active than girls (32.1% versus 14.1%, p Conclusion Self-reported level of physical activity is associated with cardiovascular risk factors in Chinese youth after adjusting for sex and pubertal stage.

  18. Secular trends of growth and pubertal maturation of school children in Southern Thailand.

    Science.gov (United States)

    Jaruratanasirikul, Somchit; Sriplung, Hutcha

    2015-01-01

    In Thailand, studies of growth date back to 1975, but there have been no studies examining any trends in increasing/decreasing growth. To determine if there have been any secular trends of increasing/decreasing growth and/or ages at puberty in Thai children. In 2012, a cross-sectional study of growth was conducted in 3460 children. The median heights and weights and the ages of pubertal maturation were compared with previous studies. Correlations between the secular trends and the health statistics indicators were calculated. From 1975-2012, the median final height of boys and girls had increased by 1.32 and 0.86 cm/decade and weight by 2.49 and 1.76 kg/decade, respectively. In girls, the age at thelarche and menarche had declined by 0.39 and 0.12 years/decade, respectively. In boys, the age at testicular enlargement Tanner II had declined by 0.15 years/decade. Increased physical growth was positively correlated to life expectancy, per capita income and prevalence of overweight/obesity was negatively correlated to prevalence of malnutrition and under-five mortality rate. The positive secular trend towards an increase in growth and a decline in the age at onset of puberty of Thai children is correlated with improvements in overall living conditions in Thailand.

  19. Functional state of reproductive system in pubertal girls having autoimmune thyroiditis

    International Nuclear Information System (INIS)

    Leonova, T.A.

    2003-01-01

    Purpose of the present work is to study the condition of reproductive system in pubertal girls with autoimmune thyroiditis (AT), exposed to radiation as a result of the Chernobyl accident, and to study various clinical symptoms of AT in relation to peculiarities of natural course of the disease, age and absorbed thyroid dose. We performed complex clinical investigation of 225 girls from Belarus with AT aged 11-16. We revealed, that girls with AT irradiated at the age of 0-3 had significant changes in gonadotrophic hormones levels in blood serum in lutein phase at the age of 13-14 in comparison with control groups. In spite of the fact that mainly the meaning investigated hormones were in the range of age norm, at the age of 15-16 among girls being irradiated greater percent of increased meaning of factor LG/FSG is revealed. Girls with AT had symptoms of dysfunction in sensitivity of target organs (ovaries and uterus) receptors. At the age of 15-16 among girls with AT, exposed to radiation, direct dependencies are established between the level of absorbed thyroid doze and meaning of LG and prolactin

  20. Intuitive eating: associations with physical activity motivation and BMI.

    Science.gov (United States)

    Gast, Julie; Campbell Nielson, Amy; Hunt, Anne; Leiker, Jason J

    2015-01-01

    To determine whether university women who demonstrated internal motivation related to eating behavior may also be internally motivated to participate in regular physical activity (PA) and have a lower body mass index (BMI) when controlling for age. Traditional approaches for health promotion related to healthy weight include restrictive eating and exercise prescription. Examining motivation for eating and PA may prove an effective alternative for achieving or maintaining healthy weight for university women. Design was a cross-sectional study. Study setting was a large, public university in the western United States. Subjects . Study subjects were 200 undergraduate women with a mean age of 19 years, mostly white (90%) and of healthy weight (69%, with a BMI range of 18.5-24.9). Study measures were the Intuitive Eating Scale and the Behavioral Regulation in Exercise Questionnaire. Correlations and regression models were used. Intuitive eating was examined in the sample as a whole and among subgroups of respondents grouped based on tertile rankings of intuitive eating scores. There was evidence that women who demonstrated internal motivation related to eating were also internally motivated to participate in regular PA. Women who reported being internally motivated to eat were significantly more likely to engage in PA for pleasure and to view PA as part of their self-concept. Women who reported high levels of intuitive eating had significantly lower BMI scores than those reporting medium or low levels when controlling for age. For women to achieve or maintain a healthy weight, it may be best for health professionals to examine motivation for eating and PA rather than the encouragement of restrictive eating and exercise prescriptions.

  1. The Bmi-1 helix–turn and ring finger domains are required for Bmi-1 antagonism of (–) epigallocatechin-3-gallate suppression of skin cancer cell survival

    Science.gov (United States)

    Balasubramanian, Sivaprakasam; Scharadin, Tiffany M.; Han, Bingshe; Xu, Wen; Eckert, Richard L.

    2016-01-01

    The Bmi-1 Polycomb group (PcG) protein is an important epigenetic regulator of chromatin status. Elevated Bmi-1 expression is observed in skin cancer and contributes to cancer cell survival. (–) Epigallocatechin-3-gallate (EGCG), an important green tea-derived cancer prevention agent, reduces Bmi-1 level resulting in reduced skin cancer cell survival. This is associated with increased p21Cip1 and p27Kip1 expression, reduced cyclin, and cyclin dependent kinase expression, and increased cleavage of apoptotic markers. These EGCG-dependent changes are attenuated by vector-mediated maintenance of Bmi-1 expression. In the present study, we identify Bmi-1 functional domains that are required for this response. Bmi-1 expression reverses the EGCG-dependent reduction in SCC-13 cell survival, but Bmi-1 mutants lacking the helix–turn–helix–turn–helix–turn (Bmi-1ΔHT) or ring finger (Bmi-1ΔRF) domains do not reverse the EGCG impact. The reduction in Ring1B ubiquitin ligase activity, observed in the presence of mutant Bmi-1, is associated with reduced ability of these mutants to interact with and activate Ring1B ubiquitin ligase, the major ligase responsible for the ubiquitination of histone H2A during chromatin condensation. This results in less chromatin condensation leading to increased tumor suppressor gene expression and reduced cell survival; thereby making the cells more susceptible to the anti-survival action of EGCG. We further show that these mutants act in a dominant-negative manner to inhibit the action of endogenous Bmi-1. Our results suggest that the HT and RF domains are required for Bmi-1 ability to maintain skin cancer cell survival in response to cancer preventive agents. PMID:25843776

  2. Body Mass Index (BMI) and All-Cause Mortality Pooling Project

    Science.gov (United States)

    The BMI and All-Cause Mortality Pooling Project quantified the risk associated with being overweight and the extent to which the relationship between BMI and all-cause mortality varies by certain factors.

  3. Risk of a venous thromboembolic episode due to caesarean section and BMI

    DEFF Research Database (Denmark)

    Colmorn, Lotte Berdiin; Ladelund, S; Rasmussen, S

    2014-01-01

    BMI significantly influences the risk of venous thromboembolism after emergency caesarean delivery compared with vaginal delivery.......BMI significantly influences the risk of venous thromboembolism after emergency caesarean delivery compared with vaginal delivery....

  4. BMI trajectory groups in veterans of the Iraq and Afghanistan wars.

    Science.gov (United States)

    Rosenberger, Patricia H; Ning, Yuming; Brandt, Cynthia; Allore, Heather; Haskell, Sally

    2011-09-01

    The study sought to determine BMI trajectories in Iraq/Afghanistan veterans over 6 years and to examine sociodemographic factors associated with BMI trajectory membership. Our study sample included 16,656 veterans post-deployment and entering the Veteran Healthcare Administration (VHA) healthcare system. We used national VHA administrative sociodemographic data, tracked veteran BMI for 6 years, and used trajectory modeling to identify BMI trajectories and sociodemographic characteristics associated with trajectory membership. Five trajectory groups determined in the full sample were primarily differentiated by their post-deployment initial BMI: "healthy" (14.1%), "overweight" (36.3%), "borderline obese" (27.9%), "obese" (15.7%), and "severely obese" (6.0). Being female, younger, and white were associated with lower initial BMI trajectory group membership (p'seducation and white female Veterans were associated with the lowest initial BMI group (p'sEducation level and racial status are differentially related to BMI trajectory by gender. Published by Elsevier Inc.

  5. Physical activity reduces the influence of genetic effects on BMI and waist circumference: a study in young adult twins.

    Science.gov (United States)

    Mustelin, L; Silventoinen, K; Pietiläinen, K; Rissanen, A; Kaprio, J

    2009-01-01

    Both obesity and exercise behavior are influenced by genetic and environmental factors. However, whether obesity and physical inactivity share the same genetic vs environmental etiology has rarely been studied. We therefore analyzed these complex relationships, and also examined whether physical activity modifies the degree of genetic influence on body mass index (BMI) and waist circumference (WC). The FinnTwin16 Study is a population-based, longitudinal study of five consecutive birth cohorts (1975-1979) of Finnish twins. Data on height, weight, WC and physical activity of 4343 subjects at the average age of 25 (range, 22-27 years) years were obtained by a questionnaire and self-measurement of WC. Quantitative genetic analyses based on linear structural equations were carried out by the Mx statistical package. The modifying effect of physical activity on genetic and environmental influences was analyzed using gene-environment interaction models. The overall heritability estimates were 79% in males and 78% in females for BMI, 56 and 71% for WC and 55 and 54% for physical activity, respectively. There was an inverse relationship between physical activity and WC in males (r = -0.12) and females (r=-0.18), and between physical activity and BMI in females (r = -0.12). Physical activity significantly modified the heritability of BMI and WC, with a high level of physical activity decreasing the additive genetic component in BMI and WC. Physically active subjects were leaner than sedentary ones, and physical activity reduced the influence of genetic factors to develop high BMI and WC. This suggests that the individuals at greatest genetic risk for obesity would benefit the most from physical activity.

  6. BMI1 and Mel-18 oppositely regulate carcinogenesis and progression of gastric cancer.

    Science.gov (United States)

    Zhang, Xiao-Wei; Sheng, Ya-Ping; Li, Qian; Qin, Wei; Lu, You-Wei; Cheng, Yu-Fan; Liu, Bing-Ya; Zhang, Feng-Chun; Li, Jin; Dimri, Goberdhan P; Guo, Wei-Jian

    2010-02-21

    The BMI1 oncogene is overexpressed in several human malignancies including gastric cancer. In addition to BMI1, mammalian cells also express Mel-18, which is closely related to BMI1. We have reported that Mel-18 functions as a potential tumor suppressor by repressing the expression of BMI1 and consequent downregulation of activated AKT in breast cancer cells. However, the mechanisms of BMI1 overexpression and the role of Mel-18 in other cancers are still not clear. The purpose of this study is to investigate the role of BMI1 and Mel-18 in gastric cancer. BMI1 was found to be overexpressed in gastric cancer cell lines and gastric tumors. Overexpression of BMI1 correlated with advanced clinical stage and lymph node metastasis; while the expression of Mel-18 negatively correlated with BMI1. BMI1 but not Mel-18 was found to be an independent prognostic factor. Downregulation of BMI1 by Mel-18 overexpression or knockdown of BMI1 expression in gastric cancer cell lines led to upregulation of p16 (p16INK4a or CDKN2A) in p16 positive cell lines and reduction of phospho-AKT in both p16-positive and p16-negative cell lines. Downregulation of BMI1 was also accompanied by decreased transformed phenotype and migration in both p16- positive and p16-negative gastric cancer cell lines. In the context of gastric cancer, BMI1 acts as an oncogene and Mel-18 functions as a tumor suppressor via downregulation of BMI1. Mel-18 and BMI1 may regulate tumorigenesis, cell migration and cancer metastasis via both p16- and AKT-dependent growth regulatory pathways.

  7. File list: Oth.Neu.10.BMI1.AllCell [Chip-atlas[Archive

    Lifescience Database Archive (English)

    Full Text Available Oth.Neu.10.BMI1.AllCell hg19 TFs and others BMI1 Neural SRX109477,SRX109480,SRX1094...82,SRX109479 http://dbarchive.biosciencedbc.jp/kyushu-u/hg19/assembled/Oth.Neu.10.BMI1.AllCell.bed ...

  8. File list: Oth.ALL.05.BMI1.AllCell [Chip-atlas[Archive

    Lifescience Database Archive (English)

    Full Text Available Oth.ALL.05.BMI1.AllCell hg19 TFs and others BMI1 All cell types SRX644721,SRX109477...79,SRX149715,SRX359986,SRX644717,SRX644709,SRX644713 http://dbarchive.biosciencedbc.jp/kyushu-u/hg19/assembled/Oth.ALL.05.BMI1.AllCell.bed ...

  9. Associations between Three School-Based Measures of Health: Is BMI Enough?

    Science.gov (United States)

    Morgan, Emily H.; Houser, Robert F.; Au, Lauren E.; Sacheck, Jennifer M.

    2013-01-01

    School-based body mass index (BMI) notification programs are often used to raise parental awareness of childhood overweight and obesity, but how BMI results are associated with physical fitness and diet is less clear. This study examined the relationship between BMI, fitness, and diet quality in a diverse sample of urban schoolchildren…

  10. File list: Oth.ALL.20.BMI1.AllCell [Chip-atlas[Archive

    Lifescience Database Archive (English)

    Full Text Available Oth.ALL.20.BMI1.AllCell hg19 TFs and others BMI1 All cell types SRX109477,SRX109480...17,SRX113591,SRX644729,SRX359986,SRX109479,SRX644721 http://dbarchive.biosciencedbc.jp/kyushu-u/hg19/assembled/Oth.ALL.20.BMI1.AllCell.bed ...

  11. File list: Oth.ALL.10.BMI1.AllCell [Chip-atlas[Archive

    Lifescience Database Archive (English)

    Full Text Available Oth.ALL.10.BMI1.AllCell hg19 TFs and others BMI1 All cell types SRX109477,SRX109480...86,SRX644709,SRX644713,SRX644717,SRX113591,SRX644721 http://dbarchive.biosciencedbc.jp/kyushu-u/hg19/assembled/Oth.ALL.10.BMI1.AllCell.bed ...

  12. File list: Oth.Kid.10.BMI1.AllCell [Chip-atlas[Archive

    Lifescience Database Archive (English)

    Full Text Available Oth.Kid.10.BMI1.AllCell hg19 TFs and others BMI1 Kidney SRX149704,SRX644725,SRX1497...08,SRX644729,SRX149712,SRX644709,SRX644713,SRX644717,SRX113591,SRX644721 http://dbarchive.biosciencedbc.jp/kyushu-u/hg19/assembled/Oth.Kid.10.BMI1.AllCell.bed ...

  13. File list: Oth.ALL.50.BMI1.AllCell [Chip-atlas[Archive

    Lifescience Database Archive (English)

    Full Text Available Oth.ALL.50.BMI1.AllCell hg19 TFs and others BMI1 All cell types SRX109477,SRX109480...08,SRX644729,SRX113591,SRX359986,SRX644717,SRX109479 http://dbarchive.biosciencedbc.jp/kyushu-u/hg19/assembled/Oth.ALL.50.BMI1.AllCell.bed ...

  14. File list: Oth.Neu.05.BMI1.AllCell [Chip-atlas[Archive

    Lifescience Database Archive (English)

    Full Text Available Oth.Neu.05.BMI1.AllCell hg19 TFs and others BMI1 Neural SRX109477,SRX109480,SRX1094...82,SRX109479 http://dbarchive.biosciencedbc.jp/kyushu-u/hg19/assembled/Oth.Neu.05.BMI1.AllCell.bed ...

  15. File list: Oth.Neu.50.BMI1.AllCell [Chip-atlas[Archive

    Lifescience Database Archive (English)

    Full Text Available Oth.Neu.50.BMI1.AllCell hg19 TFs and others BMI1 Neural SRX109477,SRX109480,SRX1094...82,SRX109479 http://dbarchive.biosciencedbc.jp/kyushu-u/hg19/assembled/Oth.Neu.50.BMI1.AllCell.bed ...

  16. File list: Oth.Neu.20.BMI1.AllCell [Chip-atlas[Archive

    Lifescience Database Archive (English)

    Full Text Available Oth.Neu.20.BMI1.AllCell hg19 TFs and others BMI1 Neural SRX109477,SRX109480,SRX1094...82,SRX109479 http://dbarchive.biosciencedbc.jp/kyushu-u/hg19/assembled/Oth.Neu.20.BMI1.AllCell.bed ...

  17. File list: Oth.Kid.20.BMI1.AllCell [Chip-atlas[Archive

    Lifescience Database Archive (English)

    Full Text Available Oth.Kid.20.BMI1.AllCell hg19 TFs and others BMI1 Kidney SRX644725,SRX149704,SRX1497...12,SRX644713,SRX644709,SRX149708,SRX644717,SRX113591,SRX644729,SRX644721 http://dbarchive.biosciencedbc.jp/kyushu-u/hg19/assembled/Oth.Kid.20.BMI1.AllCell.bed ...

  18. File list: Oth.Kid.50.BMI1.AllCell [Chip-atlas[Archive

    Lifescience Database Archive (English)

    Full Text Available Oth.Kid.50.BMI1.AllCell hg19 TFs and others BMI1 Kidney SRX644725,SRX149704,SRX1497...12,SRX644709,SRX644713,SRX644721,SRX149708,SRX644729,SRX113591,SRX644717 http://dbarchive.biosciencedbc.jp/kyushu-u/hg19/assembled/Oth.Kid.50.BMI1.AllCell.bed ...

  19. Relationship between 8/9-yr-old school children BMI, parents' BMI and educational level: a cross sectional survey

    Directory of Open Access Journals (Sweden)

    Pilato Valentina

    2011-07-01

    Full Text Available Abstract Background Parents are responsible not only for the genetic structure of their children, but also for passing onto them their behaviours and attitudes toward life. The aim of this study was to analyse the connection between school-age children's obesity and that of their parents as well as between child obesity and parents' educational level, as a proxy indicator of the socio-economic status (SES of families in Tuscany. Methods The children sample was selected from "OKkio alla Salute 2010" (a cross sectional survey carried out by the Italian Institute of Health and consisted of 1,751 (922 males and 855 females 8-9 year-old school children. Weight and height were measured by ad hoc trained personnel, and Body Mass Index (BMI categories were calculated using Cole et al.'s cut-off. Parents' weight, height and educational level were collected by a self-administered questionnaire. The educational levels were classified as high, medium and low. Results The prevalence of obese children increased along the parents' BMI category: from 1.4% for underweight mothers to 30.3% for obese mothers and from 4% for under-normal-weight fathers to 23.9% for obese fathers (p Conclusion Parents' obesity and the cultural resources of the family, particularly the father's, seem to influence the prevalence of overweight and obesity in Tuscan children.

  20. The attitudes of pregnant women and midwives towards raised BMI in a maternity setting: A discussion of two repertory grid studies.

    Science.gov (United States)

    Hodgkinson, Emma L; Smith, Debbie M; Hare, Dougal J; Wittkowski, Anja

    2017-02-01

    Weight-related stereotypes may have a detrimental impact on interactions between midwives and pregnant women with a body mass index (BMI) outside the recommended range of 18-30kg/m 2 . This paper explores the reciprocal construal of midwives and pregnant women with a raised BMI and considers the clinical implications of these constructs. Ten pregnant women with a BMI≥30kg/m 2 and 11 midwives and from an inner city maternity service were recruited. Participants provided information that allowed for the creation of a repertory grid; generating psychological constructs (perceptions or attitudes) identifying similarities and differences between pregnant women and midwives across a BMI range. Midwives were extremely conscious of being perceived as judgemental. They construed all pregnant women as anxious and vulnerable, but attributed characteristics such as "less health-conscious" and "complacent" to those with a raised BMI. The ideal pregnant woman and ideal midwife were typically construed as more likely to have a BMI of 18-30kg/m 2 . Pregnant women with a BMI≤18kg/m 2 were construed as lacking warmth. While midwives differentiated between the elements based on role, the pregnant women construed the elements according to their BMI. Similarly, they construed those with a BMI≤18kg/m 2 as having an undesirable personality, and acknowledged weight-related stereotypes for those with a raised BMI. It is possible these constructs impact on the way midwives care for and interact with women. Midwives may be supported through reflective clinical supervision and communication skills training to reduce the perceptions of stigma experienced by women with a raised BMI. It may be beneficial to involve pregnant women with a raised BMI in service development to ensure services meet their needs. Copyright © 2016 Elsevier Ltd. All rights reserved.

  1. Interactive Effects of Early Exclusive Breastfeeding and Pre-Pregnancy Maternal Weight Status on Young Children's BMI - A Chinese Birth Cohort.

    Directory of Open Access Journals (Sweden)

    Hong Mei

    Full Text Available To assess if the maternal pre-pregnancy weight status (MPWS alters the association of early infant feeding pattern (at one and third months with infant body mass index (BMI in the first two years of life.A cohort of 2,220 neonates were recruited in a community-based study conducted in China. Body weight and length were measured at birth, at age one and two, with BMI calculated accordingly. The BMI z-scores (BMI-Z were computed according to the World Health Organization Growth Standard (2006. Feeding patterns were classified as exclusive breastfeeding (EBF, mixed feeding (MF, and formula feeding (FF. General linear models (GLM were employed to estimate main and interaction effects of EBF and MPWS on children's BMI-Z.No main effect of MPWS was found on child BMI-Z at ages one and two, nor the feeding patterns. An interaction between MPWS and feeding patterns was detected (p<0.05. For children who were formula fed during the first month, those who were born to overweight/obesity (OW/OB mothers had a significantly greater BMI-Z at ages one and two, compared with those with underweight/normal weight (UW/NW mothers. FF children had greater BMI-Z at ages one and two compared with their EBF and MF counterparts, when they were born to OW/OB mothers.Maternal pre-pregnancy weight control and early initiation of EBF for children are essential for healthy development in children's BMI, hence the prevention of early life obesity.

  2. The role of BMI across the life course in the relationship between age at menarche and diabetes, in a British Birth Cohort

    OpenAIRE

    Pierce, M B; Kuh, D; Hardy, R

    2012-01-01

    Aims Previous research showing an inverse association between age of menarche and adult diabetes relied on recalled age at menarche and did not adjust for BMI across the life course. We investigated the relationship between age at menarche and diabetes, and whether childhood, adolescent or adult BMI attenuates this relationship. Methods We used data from the Medical Research Council National Survey of Health and Development, a British birth cohort study of men and women born in 1946, with con...

  3. Smoking, physical exercise, BMI and late foetal death

    DEFF Research Database (Denmark)

    Morales-Suárez-Varela, Maria; Nohr, Ellen A; Bech, Bodil H

    2016-01-01

    The aim of this paper was to estimate the effect of maternal and paternal smoking on foetal death (miscarriage and stillbirth) and to estimate potential interactions with physical exercise and pre-pregnancy body mass index. We selected 87,930 pregnancies from the population-based Danish National......) for predominantly late foetal death (miscarriage and stillbirth). An interaction contrast ratio was used to assess potential effect measure modification of smoking by physical exercise and body mass index. The adjusted hazard ratio of foetal death was 1.22 (95 % CI 1.02-1.46) for couples where both parents smoked...... with a slightly higher hazard ratio for foetal death if both parents smoked. This study suggests that smoking may increase the negative effect of a high BMI on foetal death, but results were not statistically significant for the interaction between smoking and physical exercise....

  4. Efektivitas Layanan Weekend Banking (Studi BMI KCP PIM .

    Directory of Open Access Journals (Sweden)

    Rifa Farhah

    2014-01-01

    Full Text Available The Effectiveness of Weekend Banking Services (Study at BMI KCP PIM. The aim of this research is to analyze the effectiveness of weekend banking services at Bank Muamalat Indonesia. The method that used in this research is linier regression and. The result shown that the value of adjusted R-squared was 0.313409. It means that customer’s preference (dependent variable was influenced by location, brand image, and, product and services in the amount of 31.34% and the others 68.66% was influenced by the others factor. From the paired sample t-test shown that the weekend banking services still not effective to increase the third party funds  DOI:10.15408/aiq.v6i1.1370

  5. DOES PRESENTING PATIENT'S BMI INCREASE DOCUMENTATION OF OBESITY?

    Directory of Open Access Journals (Sweden)

    Norm Clothier, MD, M. Kim Marvel, PhD, Courtney S. Cruickshank, MS

    2002-09-01

    Full Text Available Purpose: Despite the associated health consequences, obesity is infrequently documented as a problem in medical charts. The purpose of this study is to determine whether a simple intervention (routine listing of the BMI on the medical chart will increase physician documentation of obesity in the medical record. Methods: Participants were resident physicians in a family medicine residency program. Participants were randomly assigned to either an experimental group or a control group. For experimental group physicians, the Body Mass Index was listed alongside other vital signs of patients seen in an ambulatory setting. Physician documentation of patient obesity was assessed by chart review after patient visits. Documentation was defined as inclusion of obesity on the problem list or in the progress note. Results: The intervention did not significantly increase the rate of documentation of obesity in the medical chart. Several reasons for the lack of change are explored, including the difficulty of treating obesity successfully.

  6. The Examination of the Effectiveness of an Educational Intervention based on the Planned Behavior Theory on Improving Pubertal Health Behavior in Female High School Students

    Directory of Open Access Journals (Sweden)

    Farnaz Eslamimehr

    2017-09-01

    Full Text Available Background: Puberty is a period of psychological, physical, mental, emotional and social growth that stability and development of personality occurs in this period. This study aimed to determine the effect of planned behavior theory on improving pubertal health behavior in female first grade high school students. Materials and Methods:  A quasi-experimental intervention was conducted in female high school in Khamir city, Iran in 2015. One of the schools were randomly assigned to the control group and other to the experimental group. Using the formula sample, 60 students were selected from each school. Samples were evaluated in two stages through pre-test and two months later via post-test by administered questionnaire including questions about demographic characteristics and structures of planned behavior theory. The content of training was presented through lecture group discussion with teaching aids such as booklet and pamphlet. The collected data were analyzed using SPSS version 22. Results: The intervention group mean age at first menstrual period was 12.30 ± 0.84 years old and for control group was 12.25 ± 0.79 years old. The results showed that two months after the intervention, health behaviors, subjective norms, behavioral intention, perceived behavioral control, and attitude, were significantly higher than pre- intervention (P

  7. The Effect of Low Monotonic Doses of Zearalenone on Selected Reproductive Tissues in Pre-Pubertal Female Dogs—A Review

    Directory of Open Access Journals (Sweden)

    Magdalena Gajęcka

    2015-11-01

    Full Text Available The growing interest in toxic substances combined with advancements in biological sciences has shed a new light on the problem of mycotoxins contaminating feeds and foods. An interdisciplinary approach was developed by identifying dose-response relationships in key research concepts, including the low dose theory of estrogen-like compounds, hormesis, NOAEL dose, compensatory response and/or food tolerance, and effects of exposure to undesirable substances. The above considerations increased the researchers’ interest in risk evaluation, namely: (i clinical symptoms associated with long-term, daily exposure to low doses of a toxic compound; and (ii dysfunctions at cellular or tissue level that do not produce clinical symptoms. Research advancements facilitate the extrapolation of results and promote the use of novel tools for evaluating the risk of exposure, for example exposure to zearalenone in pre-pubertal female dogs. The arguments presented in this paper suggest that low doses of zearalenone in commercial feeds stimulate metabolic processes and increase weight gains. Those processes are accompanied by lower proliferation rates in the ovaries, neoangiogenesis and vasodilation in the ovaries and the uterus, changes in the steroid hormone profile, and changes in the activity of hydroxysteroid dehydrogenases. All of the above changes result from exogenous hyperestrogenizm.

  8. A longitudinal study of self-control at the transition to secondary school: Considering the role of pubertal status and parenting.

    Science.gov (United States)

    Ng-Knight, Terry; Shelton, Katherine H; Riglin, Lucy; McManus, I C; Frederickson, Norah; Rice, Frances

    2016-07-01

    Higher self-control in children and adolescents is associated with a range of positive outcomes in adulthood. However, little is known about the naturalistic development of self-control during early adolescence and the factors that affect this. We examined the role of puberty and parenting style as theoretically important influences on stability and change in self-control. A longitudinal (3 waves), multiple-informant dataset of children entering early adolescence (M = 11 years) was used to explore longitudinal change in self-control using latent growth curve modelling. Children's self-control declined during the one-year study period and declines were associated with children's behavioural and social functioning. Associations with self-control were found for pubertal status and parental warmth and hostility, but not for parental discipline. The findings suggest that during early adolescence, when children make the transition to secondary school, self-control declines. This is particularly the case for those experiencing puberty earlier than their peers. Parent warmth influences the trajectory of self-control during this period. Copyright © 2016 The Foundation for Professionals in Services for Adolescents. Published by Elsevier Ltd. All rights reserved.

  9. mtDNA copy number in oocytes of different sizes from individual pre- and post-pubertal pigs

    DEFF Research Database (Denmark)

    Pedersen, Hanne Skovsgaard; Løvendahl, Peter; Larsen, Knud Erik

    2014-01-01

    from ovaries of 10 pre- and 10 post-pubertal pigs. Cumulus cells were removed and the oocytes were measured (inside-ZP-diameter). Oocytes were transferred to DNAase-free tubes, snap-frozen, and stored at –80°C. The genes ND1 and COX1 were used to determine the mtDNA copy number. Plasmid preparations...... Reproduction 131, 233–245). However, the correlation between size and mtDNA copy number in single oocytes has not been determined. This study describes the relation between oocytes of defined diameters from individual pre- and postpubertal pigs and mtDNA copy number. Cumulus-oocyte complexes were aspirated...

  10. Isolated torsion of the fallopian tube in a menopausal woman and a pre-pubertal girl: two case reports

    OpenAIRE

    Toyoshima, Masafumi; Mori, Hikaru; Kudo, Kei; Yodogawa, Yuki; Sato, Kazuyo; Kudo, Takako; Igeta, Saori; Makino, Hiromitsu; Shima, Takashi; Matsuura, Rui; Ishigaki, Nobuko; Akagi, Kozo; Takeyama, Yoichi; Iwahashi, Hideki; Yoshinaga, Kosuke

    2015-01-01

    Introduction Isolated torsion of the fallopian tube without an ovarian abnormality is an uncommon event, with an incidence of approximately 1 in 1,500,000 females. Isolated torsion of the fallopian tube occurs mostly in reproductive-aged women, and is thus extremely rare in menopausal women and pre-pubertal girls. Case presentations In case 1, 63-year-old Japanese woman presented with a 2-day history of acute lower abdominal pain. Menopause occurred at 53?years of age. Pelvic ultrasonography ...

  11. Sagittal abdominal diameter shows better correlation with cardiovascular risk factors than waist circumference and BMI.

    Science.gov (United States)

    de Souza, Natalia Cavalheri; de Oliveira, Erick Prado

    2013-01-01

    Obesity (abdominal adiposity) is a risk factor for cardiovascular diseases and the most used methods to measure the adiposity are body mass index (BMI), waist circumference (WC), and sagittal abdominal diameter (SAD). To correlate BMI, WC, and SAD with biochemical parameters and blood pressure in adults. A non-experimental exploratory/descriptive and cross sectional study was developed and it was assessed 133 subjects (59 men and 74 women) aging between 18 and 87 years. It was registered the patients' weight (kg), height (m), BMI (kg/m(2)), WC (cm) and SAD (cm), and these parameters were correlated with glycemia, triglycerides, total cholesterol, HDL-c, LDL-c and blood pressure. After adjustment for gender and age, it was observed a positive correlation between SAD and systolic arterial blood pressure (r = 0.20), glycemia (r = 0.20), triglycerides (r = 0.32), LDL (r = 0.26), total cholesterol (TC) (r = 0.33), and a negative correlation with HDL-c (r = -0.21) (p correlation between WC and systolic arterial blood pressure (r = 0.14), triglycerides (r = 0.31), total cholesterol (r = 0.21), and a negative correlation with HDL-c (r = -0.24) (p correlation with systolic arterial blood pressure (r = 0.22), total cholesterol (r = 0.20), and triglycerides (r = 0.23) (p correlated with almost all the cardiovascular risk factors analyzed and it might be considered the best predictor of abdominal fat and cardiovascular risk.

  12. Coupling of snow and permafrost processes using the Basic Modeling Interface (BMI)

    Science.gov (United States)

    Wang, K.; Overeem, I.; Jafarov, E. E.; Piper, M.; Stewart, S.; Clow, G. D.; Schaefer, K. M.

    2017-12-01

    We developed a permafrost modeling tool based by implementing the Kudryavtsev empirical permafrost active layer depth model (the so-called "Ku" component). The model is specifically set up to have a basic model interface (BMI), which enhances the potential coupling to other earth surface processes model components. This model is accessible through the Web Modeling Tool in Community Surface Dynamics Modeling System (CSDMS). The Kudryavtsev model has been applied for entire Alaska to model permafrost distribution at high spatial resolution and model predictions have been verified by Circumpolar Active Layer Monitoring (CALM) in-situ observations. The Ku component uses monthly meteorological forcing, including air temperature, snow depth, and snow density, and predicts active layer thickness (ALT) and temperature on the top of permafrost (TTOP), which are important factors in snow-hydrological processes. BMI provides an easy approach to couple the models with each other. Here, we provide a case of coupling the Ku component to snow process components, including the Snow-Degree-Day (SDD) method and Snow-Energy-Balance (SEB) method, which are existing components in the hydrological model TOPOFLOW. The work flow is (1) get variables from meteorology component, set the values to snow process component, and advance the snow process component, (2) get variables from meteorology and snow component, provide these to the Ku component and advance, (3) get variables from snow process component, set the values to meteorology component, and advance the meteorology component. The next phase is to couple the permafrost component with fully BMI-compliant TOPOFLOW hydrological model, which could provide a useful tool to investigate the permafrost hydrological effect.

  13. Variations in BMI and prevalence of health risks in diverse racial and ethnic populations.

    Science.gov (United States)

    Stommel, Manfred; Schoenborn, Charlotte A

    2010-09-01

    When examining health risks associated with the BMI, investigators often rely on the customary BMI thresholds of the 1995 World Health Organization report. However, within-interval variations in morbidity and mortality can be substantial, and the thresholds do not necessarily correspond to identifiable risk increases. Comparing the prevalence of hypertension, diabetes, coronary heart disease (CHD), asthma, and arthritis among non-Hispanic whites, blacks, East Asians and Hispanics, we examine differences in the BMI-health-risk relationships for small BMI increments. The analysis is based on 11 years of data of the National Health Interview Survey (NHIS), with a sample size of 337,375 for the combined 1997-2007 Sample Adult. The analysis uses multivariate logistic regression models, employing a nonparametric approach to modeling the BMI-health-risk relationship, while relying on narrowly defined BMI categories. Rising BMI levels are associated with higher levels of chronic disease burdens in four major racial and ethnic groups, even after adjusting for many socio-demographic characteristics and three important health-related behaviors (smoking, physical activity, alcohol consumption). For all population groups, except East Asians, a modestly higher disease risk was noted for persons with a BMI ethnic groups regardless of BMI levels, the evidence presented here does not support the notion that the BMI-health-risk profile of East Asians and others warrants race-specific BMI cutoff points.

  14. Lower Bmi-1 Expression May Predict Longer Survival of Colon Cancer Patients

    Directory of Open Access Journals (Sweden)

    Xiaodong Li

    2016-11-01

    Full Text Available Background: This study aimed to investigate the Bmi-1 expression and the clinical significance in colon cancer (CC. Patients and Methods: Bmi-1 expression in tumor tissue and the corresponding normal tissue was detected using immunohistological staining. The correlations between Bmi-1 expression and clinicopathological characteristics and the overall survival (OS time were analyzed. Results: The median H-scores of Bmi-1 in CC tissues and the corresponding tissues were 80.0 (0-270 and 5.0 (0-90, with no statistically significant difference (Z=-13.7, PP = 0.123. The survival rates of patients with low Bmi-1 expression were higher than those of patients with high Bmi-1 expression but the differences were not statistically significant. Conclusion: Bmi-1 expression in CC tissue is significantly higher than that in corresponding normal tissue. While there may be a trend towards improved survival, this is not statistically significant.

  15. Beyond BMI: the need for new guidelines governing the use of bariatric and metabolic surgery

    Science.gov (United States)

    Cummings, David E; Cohen, Ricardo V

    2014-01-01

    Bariatric surgery use is largely governed worldwide by a 1991 National Institutes of Health consensus statement that advocates BMI as the primary operative criterion and restricts surgery to severely obese patients. These guidelines have been enormously valuable in standardising practice, thereby facilitating accumulation of a copious database of information regarding long-term surgical benefits and risks, from vast clinical experience and research. However, the National Institutes of Health recommendations had important limitations from the outset and are now gravely outdated. They do not account for remarkable advances in minimally invasive surgical techniques or the development of entirely new procedures. In the two decades since they were crafted, we have gained far greater understanding of the dramatic, weight-independent benefits of some operations on metabolic diseases, especially type 2 diabetes, and of the inadequacy of BMI as a primary criterion for surgical selection. Furthermore, there is now a substantial and rapidly burgeoning body of level-1 evidence from randomised trials comparing surgical versus non-surgical approaches to obesity, type 2 diabetes, and other metabolic diseases, including among only mildly obese or merely overweight patients. Herein, we present arguments to impel the development of new guidelines for the use of bariatric and so-called metabolic surgery to inform clinical practice and insurance compensation. PMID:24622721

  16. Prognostic relevance of Bmi-1 expression and autoantibodies in esophageal squamous cell carcinoma

    International Nuclear Information System (INIS)

    Liu, Wan-li; Li, Man-zhi; Song, Li-bing; Zeng, Mu-sheng; Guo, Xian-zhi; Zhang, Lan-jun; Wang, Jun-ye; Zhang, Ge; Guan, Su; Chen, Yu-min; Kong, Qing-li; Xu, Li-hua

    2010-01-01

    Overexpression of Bmi-1 has been observed in a variety of cancers, and it has been suggested to be an independent prognostic marker for the patients. The objective of this study was to determine the level of Bmi-1 expression or its autoantibodies in human esophageal squamous cell carcinoma (ESCC) and to correlate it with clinicopathologic data. We first examined Bmi-1 expression in ESCC cell lines and tumor samples by RT-PCR and Western blot analysis. We then analyzed Bmi-1 protein expression in 171 clinicopathologically characterized ESCC cases by immunohistochemistry. In addition, we detected its autoantibodies in sera of patients with ESCC by ELISA. We found that Bmi-1 expression was higher in the immortalized cells, cancer cell lines and most cancer tissue than in non-tumorous control tissue at both mRNA and protein level. In addition, Bmi-1 expression was observed in 64.3% (110 of 171) archive ESCC specimen by immunohistochemistry analysis, and the location of Bmi-1 in ESCC was in the nuclei instead of cytoplasm of tumor cells. There was a significant difference of Bmi-1 expression in patients categorized according to stage (P = 0.003) and pN classification (P = 0.047). Multivariate analysis suggested that Bmi-1 expression was an independent prognostic marker for ESCC patients. A prognostic significance of Bmi-1 was also found in the subgroup of T3~T4 and N1 tumor classification. Bmi-1 autoantibodies were detected in sera of 39.0% (62 of 159) ESCC patients. The correlations between anti-Bmi-1 antibodies and tumor stage (P = 0.040), or lymph node status (P < 0.001) were significant. Our results suggest that Bmi-1 protein is a valuable marker of ESCC progression. The presence of Bmi-1 autoantibodies in sera from patients with ESCC may have clinical utility in esophageal cancer diagnosis

  17. Postoperative Complications of Total Joint Arthroplasty in Obese Patients Stratified by BMI.

    Science.gov (United States)

    Zusmanovich, Mikhail; Kester, Benjamin S; Schwarzkopf, Ran

    2018-03-01

    High body mass index (BMI) is associated with significant complications in patients undergoing total joint arthroplasty. Many studies have evaluated this trend, but few have looked at the rates of complications based on BMI as a continuous variable. The purpose of this study was to stratify obese patients into 3 BMI categories and evaluate their rates of complications and gauge whether transitioning from higher to lower BMI category lowers complication. Patients undergoing primary total joint arthroplasty were selected from the National Surgical Quality Improvement Program database from 2008-2015 and arranged into 3 groups based on BMI: O1 (BMI 30-34.9 kg/m 2 ), O2 (BMI 35-39.9 kg/m 2 ), and O3 (BMI >40 kg/m 2 ). Thirty-day complications were recorded and evaluated utilizing univariate and multivariate analyses stratified by BMI. A total of 268,663 patients were identified. Patients with a BMI >30 kg/m 2 had more infectious and medical complications compared with nonobese patients. Furthermore, there were increased complications as the BMI categories increased. Patients with a BMI >40 kg/m 2 (O3) had longer operating times, length of stay, higher rates of readmissions, reoperations, deep venous thrombosis, renal insufficiency, superficial infections, deep infections, and wound dehiscence. These trends were present when comparing the O2 with O1 category as well. We have demonstrated increased rates of medical and surgical complications in obese patients. Furthermore, we demonstrated a stepwise increase in complication rates when transitioning to higher BMI groups. Based on our data, we believe that preoperative counseling and interventions to decrease BMI should be explored before offering elective surgery to obese patients. Copyright © 2017 Elsevier Inc. All rights reserved.

  18. The Impact of Waiting List BMI Changes on the Short-term Outcomes of Lung Transplantation.

    Science.gov (United States)

    Jomphe, Valérie; Mailhot, Geneviève; Damphousse, Véronic; Tahir, Muhammad-Ramzan; Receveur, Olivier; Poirier, Charles; Ferraro, Pasquale

    2018-02-01

    Obesity and underweight are associated with a higher postlung transplantation (LTx) mortality. This study aims to assess the impact of the changes in body mass index (BMI) during the waiting period for LTx on early postoperative outcomes. Medical records of 502 consecutive cases of LTx performed at our institution between 1999 and 2015 were reviewed. Patients were stratified per change in BMI category between pre-LTx assessment (candidate BMI) and transplant BMI as follows: A-candidate BMI, less than 18.5 or 18.5 to 29.9 and transplant BMI, less than 18.5; B-candidate BMI, less than 18.5 and transplant BMI, 18.5 to 29.9; C-candidate BMI, 18.5 to 29.9 and transplant BMI, 18.5 to 29.9; D-candidate BMI, 30 or greater and transplant BMI, 18.5 to 29.9; and E-candidate BMI, 30 or greater or 18.5 to 29.9 and transplant BMI, 30 or greater. Our primary outcome was in-hospital mortality and secondary outcomes were length of mechanical ventilation, intensive care unit length of stay (LOS), hospital LOS and postoperative complications. BMI variation during the waiting time was common, as 1/3 of patients experienced a change in BMI category. Length of mechanical ventilation (21 days vs 9 days; P = 0.018), intensive care unit LOS (26 days vs 15 days; P = 0.035), and rates of surgical complications (76% vs 44%; P = 0.018) were significantly worse in patients of group E versus group D. Obese candidates who failed to decrease BMI less than 30 by transplant exhibited an increased risk of postoperative mortality (odds ratio, 2.62; 95% confidence interval, 1.01-6.48) compared with patients in group C. Pre-LTx BMI evolution had no impact on postoperative morbidity and mortality in underweight patients. Our results suggest that obese candidates with an unfavorable pretransplant BMI evolution are at greater risk of worse post-LTx outcomes.

  19. Relationship between 8/9-yr-old school children BMI, parents' BMI and educational level: a cross sectional survey.

    Science.gov (United States)

    Lazzeri, Giacomo; Pammolli, Andrea; Pilato, Valentina; Giacchi, Mariano V

    2011-07-19

    Parents are responsible not only for the genetic structure of their children, but also for passing onto them their behaviours and attitudes toward life. The aim of this study was to analyse the connection between school-age children's obesity and that of their parents as well as between child obesity and parents' educational level, as a proxy indicator of the socio-economic status (SES) of families in Tuscany. The children sample was selected from "OKkio alla Salute 2010" (a cross sectional survey carried out by the Italian Institute of Health) and consisted of 1,751 (922 males and 855 females) 8-9 year-old school children. Weight and height were measured by ad hoc trained personnel, and Body Mass Index (BMI) categories were calculated using Cole et al.'s cut-off. Parents' weight, height and educational level were collected by a self-administered questionnaire. The educational levels were classified as high, medium and low. The prevalence of obese children increased along the parents' BMI category: from 1.4% for underweight mothers to 30.3% for obese mothers and from 4% for under-normal-weight fathers to 23.9% for obese fathers (p parents' educational level and child obesity, the lowest educational level corresponding to the highest prevalence of obese children: 9.3% for mothers with a low educational level compared to 5.8% for mothers with a high educational level (p = 0.15); similarly, the corresponding prevalence for fathers was 9.5% compared to 4.5% (p = 0.03). Parents' obesity and the cultural resources of the family, particularly the father's, seem to influence the prevalence of overweight and obesity in Tuscan children.

  20. Investigation on the effects of geometric variables on the residual stresses and PWSCC growth in the RPV BMI penetration nozzles

    International Nuclear Information System (INIS)

    Kim, Jong Sung; Ra, Myoung Soo; Lee, Kyoung Soo

    2015-01-01

    This study investigated the effects of various geometric variables on the residual stresses and PWSCC growth of RPV BMI penetration nozzles. An FE residual stress analysis procedure was developed and validated from the viewpoint of FFS assessment. The validated FE residual stress analysis procedure and the PWSCC growth assessment procedure in the ASME B and PV Code, Sec.XI were applied to the BMI penetration nozzles with specified ranges of the geometric variables. The total stresses at steady state during normal operation including welding residual stresses increase with increasing inclination angle of the BMI nozzles, and with tilt angle, depth, and root width of the J-groove weld. The lifetime from the assumed initial crack to the acceptance criteria according to the ASME B and PV Code, Sec.XI also decreases under these conditions. The total stresses decrease and the lifetime increases with increasing nozzle thickness, but outer radius of the BMI nozzles has an insignificant effect on both of these factors.

  1. Low prevalence of hypopituitarism after subarachnoid haemorrhage using confirmatory testing and with BMI-specific GH cut-off levels.

    Science.gov (United States)

    Gardner, Chris J; Javadpour, Mohsen; Stoneley, Catherine; Purthuran, Mani; Biswas, Shubhabrata; Daousi, Christina; MacFarlane, Ian A; Cuthbertson, Daniel J

    2013-04-01

    Hypopituitarism following subarachnoid haemorrhage (SAH) has been reported to be a frequent occurrence. However, there is considerable heterogeneity between studies with differing patient populations and treatment modalities and most importantly employing differing endocrine protocols and (normal) reference ranges of GH. We aimed to examine prospectively a cohort of SAH survivors for development of hypopituitarism post-SAH using rigorous endocrine testing and compare GH response to glucagon stimulation with a cohort of healthy controls of a similar BMI. Sixty-four patients were investigated for evidence of hypopituitarism 3 months post-SAH with 50 patients tested again at 12 months. Glucagon stimulation testing (GST), with confirmation of deficiencies by GHRH/arginine testing for GH deficiency (GHD) and short synacthen testing for ACTH deficiency, was used. Basal testing of other hormonal axes was undertaken. Mean age of patients was 53±11.7 years and mean BMI was 27.5±5.7 kg/m(2). After confirmatory testing, the prevalence of hypopituitarism was 12% (GHD 10%, asymptomatic hypocortisolaemia 2%). There was no association between hypopituitarism and post-SAH vasospasm, presence of cerebral infarction, Fisher grade, or clinical grading at presentation. There was a significant correlation between BMI and peak GH to glucagon stimulation in both patients and controls. Identification of 'true' GHD after SAH requires confirmatory testing with an alternative stimulation test and application of BMI-specific cut-offs. Using such stringent criteria, we found a prevalence of hypopituitarism of 12% in our population.

  2. Effect of Aegle marmelos and Murraya koenigii in treatment of delayed pubertal buffaloes heifers

    Directory of Open Access Journals (Sweden)

    Mohan M. Baitule

    2016-12-01

    . koenigii alone, were found effective in fertility improvement in delayed pubertal buffalo heifers by increasing ovulation and conception rate.

  3. Investigation of pre-pubertal sex differences in wheel running and social behavior in three mouse strains.

    Science.gov (United States)

    Gordon, Elizabeth A; Corbitt, Cynthia

    2015-08-01

    Sex differences in social behaviors exist in mammals during adulthood, and further evidence suggests that sex differences in behavior are present before sexual maturity. In order to model behavioral disorders in animals, it is important to assess baseline sex-related behavioral differences, especially when studying disorders for which sex-related behavioral effects are expected. We investigated the effect of sex on behavior in 3 strains of pre-pubertal mice (C57BL/6, CFW, and CF1) using a wheel-running assay. We found no significant sex differences in latency to run on the wheel or total duration of wheel running within each strain. During the social interaction test, there were no differences between sexes in latency or total duration of contact or following between a subject and novel mouse. We also evaluated behavioral patterns of wheel running and stereotypical behaviors, such as burrowing and grooming. Both sexes showed characteristic wheel running behavior, spending the majority of each trial interacting with the wheel when it was free and more time performing other activities ( e.g. , stereotypical behaviors, general locomotion) when it was jammed. These results provide evidence that, among various strains of pre-pubertal mice, baseline sex-related behavioral differences are not strong enough to influence the measured behaviors.

  4. Sulforaphane attenuates di-N-butylphthalate-induced reproductive damage in pubertal mice: Involvement of the Nrf2-antioxidant system.

    Science.gov (United States)

    Jiang, Xu-Ping; Tang, Jing-Yuan; Xu, Zhen; Han, Peng; Qin, Zhi-Qiang; Yang, Cheng-di; Wang, Shang-Qian; Tang, Min; Wang, Wei; Qin, Chao; Xu, Yang; Shen, Bai-Xin; Zhou, Wei-Min; Zhang, Wei

    2017-07-01

    di-N-butylphthalate (DBP) is a ubiquitous environmental pollutant used for plastic coating and in the cosmetics industry. It has toxic effects on body health, especially the male reproductive system. Here, we investigated the effects of DBP on the male reproductive system of pubertal mice and explored the protective role of sulforaphane (SFN). The results showed that DBP significantly reduced the anogenital distance, testicular weight, sperm count and motility, and plasma and testicular testosterone levels and significantly increased the oxidative stress, sperm abnormalities, and testicular cell apoptosis. SFN supplementation ameliorated these effects. After DBP stimulation, the transcription factor nuclear factor erythroid-related factor 2 (Nrf2) was adaptively increased together with its target genes, such as HO-1 and NQO1. Upregulation of Nrf2 by SFN reduced the DBP-mediated intracellular oxidative toxicity and also increased testosterone secretion and spermatogenesis, which were decreased by DBP. These findings indicate that SFN can attenuate DBP-induced reproductive damage in pubertal mice via Nrf2-associated pathways. © 2017 Wiley Periodicals, Inc.

  5. Maternal Metabolic Health Parameters During Pregnancy in Relation to Early Childhood BMI Trajectories.

    Science.gov (United States)

    Montazeri, Parisa; Vrijheid, Martine; Martinez, David; Basterrechea, Mikel; Fernandez-Somoano, Ana; Guxens, Monica; Iñiguez, Carmen; Lertxundi, Aitana; Murcia, Mario; Tardon, Adonina; Sunyer, Jordi; Valvi, Damaskini

    2018-03-01

    The objective of this study was to evaluate the associations between maternal metabolic parameters and early childhood BMI trajectories. Two thousand two hundred fifty-one children born in Spain between 2004 and 2008 were analyzed. Five BMI z score trajectories from birth to age 4 years were identified by using latent class growth analysis. Multinomial regression assessed the associations between maternal metabolic parameters and offspring's BMI trajectories. Children in the reference BMI trajectory had average size at birth followed by a slower BMI gain. Maternal prepregnancy obesity was associated with trajectories of accelerated BMI gain departing from either higher (relative risk ratio [RRR] = 1.77; 95% CI: 1.07-2.91) or lower size at birth (RRR = 1.91; 95% CI: 1.17-3.12). Gestational weight gain (GWG) above clinical guidelines was associated with a trajectory of higher birth size followed by accelerated BMI gain (RRR = 2.14; 95% CI: 1.53-2.97). Maternal serum triglycerides were negatively associated with BMI trajectories departing from lower birth sizes. Gestational diabetes, maternal serum cholesterol, and C-reactive protein were unrelated to children's BMI trajectories. Maternal prepregnancy obesity, GWG, and serum triglycerides are associated with longitudinal BMI trajectories in early childhood that may increase disease risk in later life. Health initiatives should promote healthy weight status before and during pregnancy to improve maternal and child health. © 2018 The Obesity Society.

  6. BMI and WHR Are Reflected in Female Facial Shape and Texture: A Geometric Morphometric Image Analysis.

    Directory of Open Access Journals (Sweden)

    Christine Mayer

    Full Text Available Facial markers of body composition are frequently studied in evolutionary psychology and are important in computational and forensic face recognition. We assessed the association of body mass index (BMI and waist-to-hip ratio (WHR with facial shape and texture (color pattern in a sample of young Middle European women by a combination of geometric morphometrics and image analysis. Faces of women with high BMI had a wider and rounder facial outline relative to the size of the eyes and lips, and relatively lower eyebrows. Furthermore, women with high BMI had a brighter and more reddish skin color than women with lower BMI. The same facial features were associated with WHR, even though BMI and WHR were only moderately correlated. Yet BMI was better predictable than WHR from facial attributes. After leave-one-out cross-validation, we were able to predict 25% of variation in BMI and 10% of variation in WHR by facial shape. Facial texture predicted only about 3-10% of variation in BMI and WHR. This indicates that facial shape primarily reflects total fat proportion, rather than the distribution of fat within the body. The association of reddish facial texture in high-BMI women may be mediated by increased blood pressure and superficial blood flow as well as diet. Our study elucidates how geometric morphometric image analysis serves to quantify the effect of biological factors such as BMI and WHR to facial shape and color, which in turn contributes to social perception.

  7. Combining BMI stimulation and mathematical modeling for acute stroke recovery and neural repair

    Directory of Open Access Journals (Sweden)

    Sara L Gonzalez Andino

    2011-07-01

    Full Text Available Rehabilitation is a neural plasticity-exploiting approach that forces undamaged neural circuits to undertake the functionality of other circuits damaged by stroke. It aims to partial restoration of the neural functions by circuit remodeling rather than by the regeneration of damaged circuits. The core hypothesis of the present paper is that - in stroke - Brain Machine Interfaces can be designed to target neural repair instead of rehabilitation. To support this hypothesis we first review existing evidence on the role of endogenous or externally applied electric fields on all processes involved in CNS repair. We then describe our own results to illustrate the neuroprotective and neuroregenerative effects of BMI- electrical stimulation on sensory deprivation-related degenerative processes of the CNS. Finally, we discuss three of the crucial issues involved in the design of neural repair-oriented BMIs: when to stimulate, where to stimulate and - the particularly important but unsolved issue of - how to stimulate. We argue that optimal parameters for the electrical stimulation can be determined from studying and modeling the dynamics of the electric fields that naturally emerge at the central and peripheral nervous system during spontaneous healing in both, experimental animals and human patients. We conclude that a closed-loop BMI that defines the optimal stimulation parameters from a priori developed experimental models of the dynamics of spontaneous repair and the on-line monitoring of neural activity might place BMIs as an alternative or complement to stem-cell transplantation or pharmacological approaches, intensively pursued nowadays.

  8. Disentangling the associations between parental BMI and offspring body composition using the four‐component model

    Science.gov (United States)

    Grijalva‐Eternod, Carlos; Cortina‐Borja, Mario; Williams, Jane; Fewtrell, Mary; Wells, Jonathan

    2016-01-01

    ABSTRACT Objectives This study sets out to investigate the intergenerational associations between the body mass index (BMI) of parents and the body composition of their offspring. Methods The cross‐sectional data were analyzed for 511 parent–offspring trios from London and south‐east England. The offspring were aged 5–21 years. Parental BMI was obtained by recall and offspring fat mass and lean mass were obtained using the four‐component model. Multivariable regression analysis, with multiple imputation for missing paternal values was used. Sensitivity analyses for levels of non‐paternity were conducted. Results A positive association was seen between parental BMI and offspring BMI, fat mass index (FMI), and lean mass index (LMI). The mother's BMI was positively associated with the BMI, FMI, and LMI z‐scores of both daughters and sons and of a similar magnitude for both sexes. The father's BMI showed similar associations to the mother's BMI, with his son's BMI, FMI, and LMI z‐scores, but no association with his daughter. Sensitivity tests for non‐paternity showed that maternal coefficients remained greater than paternal coefficients throughout but there was no statistical difference at greater levels of non‐paternity. Conclusions We found variable associations between parental BMI and offspring body composition. Associations were generally stronger for maternal than paternal BMI, and paternal associations appeared to differ between sons and daughters. In this cohort, the mother's BMI was statistically significantly associated with her child's body composition but the father's BMI was only associated with the body composition of his sons. Am. J. Hum. Biol. 28:524–533, 2016. © 2016 The Authors American Journal of Human Biology Published by Wiley Periodicals, Inc. PMID:26848813

  9. Physical activity modifies the FTO effect on BMI change in Japanese adolescents.

    Science.gov (United States)

    Shinozaki, Keiko; Okuda, Masayuki; Okayama, Naoko; Kunitsugu, Ichiro

    2018-04-14

    Evidence of the effects of fat mass and obesity-associated (FTO) gene variation and long-term effects of physical activity (PA) on adiposity in adolescents is largely scarce. This study aimed to investigate whether physical activity modulates the effects of the FTO gene on body mass index (BMI) changes in Japanese adolescents between the ages of 13 and 18 years. Data of 343 subjects (156 boys; 187 girls) who were enrolled in 2006 and 2007 from schools on Shunan City, Japan, were collected. Genotyping (rs1558902) was conducted, and anthropometric measurements and blood test results were recorded for subjects in the eighth grade. A second survey involving self-reporting of anthropometric measurements was conducted when the subjects were in the twelfth grade. PA was estimated using the International Physical Activity Questionnaire in this survey. BMI and the standard deviation score for BMI (BMI-SDS) were calculated. BMI changes and BMI-SDS changes were compared among FTO genotypes using a multivariate model. The effect of the interaction between PA and the FTO genotype on BMI changes was significant among boys but not girls. Among boys, PA had a significant negative influence on BMI-SDS changes in those with the AA genotype and a significant positive influence on BMI and BMI-SDS changes in those with the TT genotype. These data suggest that the influence of PA on BMI changes and BMI-SDS changes varied on the basis of genotype. PA modified the effect of the FTO gene on BMI changes in Japanese boys. This article is protected by copyright. All rights reserved. This article is protected by copyright. All rights reserved.

  10. Correction of self-reported BMI based on objective measurements: a Belgian experience.

    Science.gov (United States)

    Drieskens, S; Demarest, S; Bel, S; De Ridder, K; Tafforeau, J

    2018-01-01

    Based on successive Health Interview Surveys (HIS), it has been demonstrated that also in Belgium obesity, measured by means of a self-reported body mass index (BMI in kg/m 2 ), is a growing public health problem that needs to be monitored as accurately as possible. Studies have shown that a self-reported BMI can be biased. Consequently, if the aim is to rely on a self-reported BMI, adjustment is recommended. Data on measured and self-reported BMI, derived from the Belgian Food Consumption Survey (FCS) 2014 offers the opportunity to do so. The HIS and FCS are cross-sectional surveys based on representative population samples. This study focused on adults aged 18-64 years (sample HIS = 6545 and FCS = 1213). Measured and self-reported BMI collected in FCS were used to assess possible misreporting. Using FCS data, correction factors (measured BMI/self-reported BMI) were calculated in function of a combination of background variables (region, gender, educational level and age group). Individual self-reported BMI of the HIS 2013 were then multiplied with the corresponding correction factors to produce a corrected BMI-classification. When compared with the measured BMI, the self-reported BMI in the FCS was underestimated (mean 0.97 kg/m 2 ). 28% of the obese people underestimated their BMI. After applying the correction factors, the prevalence of obesity based on HIS data significantly increased (from 13% based on the original HIS data to 17% based on the corrected HIS data) and approximated the measured one derived from the FCS data. Since self-reported calculations of BMI are underestimated, it is recommended to adjust them to obtain accurate estimates which are important for decision making.

  11. Relationships of the First Trimester Maternal BMI with New-born Anthropometric Characteristics and Visfatin Levels throughout Pregnancy

    Directory of Open Access Journals (Sweden)

    Tahergorabi Zoya

    2017-08-01

    Full Text Available Background: Birth weight has been shown to be influenced by numerous factors including, maternal characteristics such as maternal BMI. In pregnancy, there is increased adipose tissue which can cause to maternal obesity and insulin resistance. There is visfatin expression increase specific to pregnancy. Aim: We planned this study to assess relationships of the first trimester maternal BMI with new-born anthropometric characteristics and visfatin levels throughout pregnancy. Methods and Material: This longitudinal, observational study on 100 nulliparous pregnant women carried out in Birjand, Iran, over three trimesters in 2016. The researcher asked the participants to fill out the Researcher-made questionnaire including demographic and anthropometric characteristics including first trimester BMI and then referred them to laboratory to serum sample taking from mothers and visfatin levels measurement in the three trimesters. Neonate’s anthropometric measures (weight, height, head circumference and sex of new-borns were obtained from hospital reports. Results: Pearson correlation test indicated significant correlation between birth weight and the first trimester maternal BMI (r= 0.27, P=0.02. Also, Spearman’s correlation test showed a weak negative correlation between head circumference with mean visfatin level (r= -0.23, P=0.04. Linear regression showed that birth weight predicts 28% of variation of BMI. Also, there was significant difference between the maternal level of education and the mean of birth weight (P=0.027. Conclusions: Results of the present study showed that the mean of birth weight was comparable with capital cities in Iran, it is necessary to strengthen the existing mother and child health care program and to develop new approaches.

  12. Sugar-sweetened carbonated beverage consumption correlates with BMI, waist circumference, and poor dietary choices in school children

    Directory of Open Access Journals (Sweden)

    Shoukri Mohammed

    2010-05-01

    Full Text Available Abstract Background The prevalence of obesity and overweight is increasing globally. Frequently coexisting with under-nutrition in developing countries, obesity is a major contributor to chronic disease, and will become a serious healthcare burden especially in countries with a larger percentage of youthful population. 35% of the population of Saudi Arabia are under the age of 16, and adult dietary preferences are often established during early childhood years. Our objective was to examine the dietary habits in relation to body-mass-index (BMI and waist circumference (W_C, together with exercise and sleep patterns in a cohort of male and female Saudi school children, in order to ascertain whether dietary patterns are associated with obesity phenotypes in this population. Methods 5033 boys and 4400 girls aged 10 to 19 years old participated in a designed Food Frequency Questionnaire. BMI and W_C measurements were obtained and correlated with dietary intake. Results The overall prevalence of overweight and obesity was 12.2% and 27.0% respectively, with boys having higher obesity rates than girls (P ≤ 0.001. W_C and BMI was positively correlated with sugar-sweetened carbonated beverage (SSCB intake in boys only. The association between male BMI and SSCB consumption was significant in a multivariate regression model (P Conclusions A higher intake of SSCB is associated with poor dietary choices. Male SSCB intake correlates with a higher W_C and BMI. Limiting exposure to SSCB could therefore have a large public health impact.

  13. Height, weight and BMI percentiles and nutritional status relative to the international growth references among Pakistani school-aged children

    Directory of Open Access Journals (Sweden)

    Mushtaq Muhammad Umair

    2012-03-01

    Full Text Available Abstract Background Child growth is internationally recognized as an important indicator of nutritional status and health in populations. This study was aimed to compare age- and gender-specific height, weight and BMI percentiles and nutritional status relative to the international growth references among Pakistani school-aged children. Methods A population-based study was conducted with a multistage cluster sample of 1860 children aged five to twelve years in Lahore, Pakistan. Smoothed height, weight and BMI percentile curves were obtained and comparison was made with the World Health Organization 2007 (WHO and United States' Centers for Disease Control and Prevention 2000 (USCDC references. Over- and under-nutrition were defined according to the WHO and USCDC references, and the International Obesity Task Force (IOTF cut-offs. Simple descriptive statistics were used and statistical significance was considered at P Results Height, weight and BMI percentiles increased with age among both boys and girls, and both had approximately the same height and a lower weight and BMI as compared to the WHO and USCDC references. Mean differences from zero for height-, weight- and BMI-for-age z score values relative to the WHO and USCDC references were significant (P Conclusion Pakistani school-aged children significantly differed from the WHO and USCDC references. However, z score means relative to the WHO reference were closer to zero and the present study as compared to the USCDC reference. Overweight and obesity were significantly higher while underweight and thinness/wasting were significantly lower relative to the WHO reference as compared to the USCDC reference and the IOTF cut-offs. New growth charts for Pakistani children based on a nationally representative sample should be developed. Nevertheless, shifting to use of the 2007 WHO child growth reference might have important implications for child health programs and primary care pediatric clinics.

  14. Sugar-sweetened carbonated beverage consumption correlates with BMI, waist circumference, and poor dietary choices in school children.

    Science.gov (United States)

    Collison, Kate S; Zaidi, Marya Z; Subhani, Shazia N; Al-Rubeaan, Khalid; Shoukri, Mohammed; Al-Mohanna, Futwan A

    2010-05-09

    The prevalence of obesity and overweight is increasing globally. Frequently coexisting with under-nutrition in developing countries, obesity is a major contributor to chronic disease, and will become a serious healthcare burden especially in countries with a larger percentage of youthful population. 35% of the population of Saudi Arabia are under the age of 16, and adult dietary preferences are often established during early childhood years. Our objective was to examine the dietary habits in relation to body-mass-index (BMI) and waist circumference (W_C), together with exercise and sleep patterns in a cohort of male and female Saudi school children, in order to ascertain whether dietary patterns are associated with obesity phenotypes in this population. 5033 boys and 4400 girls aged 10 to 19 years old participated in a designed Food Frequency Questionnaire. BMI and W_C measurements were obtained and correlated with dietary intake. The overall prevalence of overweight and obesity was 12.2% and 27.0% respectively, with boys having higher obesity rates than girls (P sweetened carbonated beverage (SSCB) intake in boys only. The association between male BMI and SSCB consumption was significant in a multivariate regression model (P sweetened hot beverages were higher in older versus younger children (P < 0.001). BMI and W_C were negatively correlated with hours of night-time sleep and exercise in boys, but only with night time sleep in girls, who also showed the lowest frequency of exercise. A higher intake of SSCB is associated with poor dietary choices. Male SSCB intake correlates with a higher W_C and BMI. Limiting exposure to SSCB could therefore have a large public health impact.

  15. Nutritional status (BMI in children suffering from asthma

    Directory of Open Access Journals (Sweden)

    Šćepanović Anđelka

    2013-01-01

    Full Text Available The research encompassed 708 children of both genders, aged 6 to 15. Three hundred and fifty four of the total number had been diagnosed with Asthma bronchiale, whereas the other half of the children were healthy and served as a control group. Their nutritional condition was determined on the basis of the percentile value of their BMI. Recent studies on the level of nutrition and its connection to asthma have shown contradictory results. This paper was aimed at estimating the nutritional level of sick children in relation to healthy ones. The data were analyzed in relation to group, gender and age by means of descriptive methods, univariate (analysis of variance - ANOVA and multivariate (multivariate analysis of variance - MANOVA, whereas the results were tested by Roy’s test (Pearson contingency coefficient χ, coefficient of multiple correlation R. It was determined that male children more frequently suffer from this disease than female children do. Both healthy and sick children were normally nourished. However, as regards the sick, the number of normally nourished was considerably lower, whereas the number of underweight was considerably higher, as well as those that were overweight. Intergroup differences in the distribution of certain levels of nutrition of male and female children occurred in only two non-sequential age groups, being later in boys than in girls. This uneven distribution is probably a consequence of the joint effects of environment factors, sickness and therapy.

  16. The relationship between BMI and insulin resistance and progression from single to multiple autoantibody positivity and type 1 diabetes among TrialNet Pathway to Prevention participants.

    Science.gov (United States)

    Meah, Farah A; DiMeglio, Linda A; Greenbaum, Carla J; Blum, Janice S; Sosenko, Jay M; Pugliese, Alberto; Geyer, Susan; Xu, Ping; Evans-Molina, Carmella

    2016-06-01

    The incidence of type 1 diabetes is increasing at a rate of 3-5% per year. Genetics cannot fully account for this trend, suggesting an influence of environmental factors. The accelerator hypothesis proposes an effect of metabolic factors on type 1 diabetes risk. To test this in the TrialNet Pathway to Prevention (PTP) cohort, we analysed the influence of BMI, weight status and insulin resistance on progression from single to multiple islet autoantibodies (Aab) and progression from normoglycaemia to diabetes. HOMA1-IR was used to estimate insulin resistance in Aab-positive PTP participants. Cox proportional hazards models were used to evaluate the effects of BMI, BMI percentile (BMI%), weight status and HOMA1-IR on the progression of autoimmunity or the development of diabetes. Data from 1,310 single and 1,897 multiple Aab-positive PTP participants were included. We found no significant relationships between BMI, BMI%, weight status or HOMA1-IR and the progression from one to multiple Aabs. Similarly, among all Aab-positive participants, no significant relationships were found between BMI, weight status or HOMA1-IR and progression to diabetes. Diabetes risk was modestly increased with increasing BMI% among the entire cohort, in obese participants 13-20 years of age and with increasing HOMA1-IR in adult Aab-positive participants. Analysis of the accelerator hypothesis in the TrialNet PTP cohort does not suggest a broad influence of metabolic variables on diabetes risk. Efforts to identify other potentially modifiable environmental factors should continue.

  17. Dysregulation of the Bmi-1/p16Ink4a pathway provokes an aging-associated decline of submandibular gland function

    Science.gov (United States)

    Yamakoshi, Kimi; Katano, Satoshi; Iida, Mayu; Kimura, Hiromi; Okuma, Atsushi; Ikemoto-Uezumi, Madoka; Ohtani, Naoko; Hara, Eiji; Maruyama, Mitsuo

    2015-01-01

    Bmi-1 prevents stem cell aging, at least partly, by blocking expression of the cyclin-dependent kinase inhibitor p16Ink4a. Therefore, dysregulation of the Bmi-1/p16Ink4a pathway is considered key to the loss of tissue homeostasis and development of associated degenerative diseases during aging. However, because Bmi-1 knockout (KO) mice die within 20 weeks after birth, it is difficult to determine exactly where and when dysregulation of the Bmi-1/p16Ink4a pathway occurs during aging in vivo. Using real-time in vivo imaging of p16Ink4a expression in Bmi-1-KO mice, we uncovered a novel function of the Bmi-1/p16Ink4a pathway in controlling homeostasis of the submandibular glands (SMGs), which secrete saliva into the oral cavity. This pathway is dysregulated during aging in vivo, leading to induction of p16Ink4a expression and subsequent declined SMG function. These findings will advance our understanding of the molecular mechanisms underlying the aging-related decline of SMG function and associated salivary gland hypofunction, which is particularly problematic among the elderly. PMID:25832744

  18. Childhood maltreatment and BMI trajectories to mid-adult life: follow-up to age 50 y in a British birth cohort.

    Directory of Open Access Journals (Sweden)

    Chris Power

    Full Text Available Childhood maltreatment including abuse and neglect has been associated with adult obesity, but evidence on life-course development of obesity or BMI gain is unclear. We aim to establish whether childhood maltreatments are related to obesity or BMI at different life-stages 7 y-50 y and to identify possible explanations for associations.Childhood physical, psychological and sexual abuse, neglect and BMI at seven ages were recorded in the 1958 birth cohort (n~15,000. Associations of child maltreatments with BMI at separate ages were tested using linear regression or logistic regression for obesity, and with rate of child-to-adult BMI gain using multilevel models. We adjusted for potential covariates.Abuse was reported in ~12% of the population. Abuse was not associated with elevated childhood BMI, but adult associations were observed: i.e. the abused had faster child-adult BMI gain than the non-abused; associations were independent of adult covariates. For physical abuse in both genders there was a positive linear association of ~0.006/y zBMI gain with age after adjustment for all covariates. Similarly, there was a linear association of physical abuse with obesity risk: e.g. among females from a low OR(adjusted of 0.34 (0.16,0.71 at 7 y to 1.67 (1.25,2.24 at 50 y. In females faster zBMI gains with age of ~0.0034/y were observed for sexual abuse and increases in obesity risk were faster: from a low OR(adjusted of 0.23 (0.06,0.84 at 7 y to 1.34 (0.86,2.10 at 50 y. Psychological abuse and neglect associations were less consistent.Childhood maltreatment associations with BMI or obesity varied across life: physical and, in females, sexual abuse were associated with faster lifetime BMI gains, which may have detrimental long-term health consequences.

  19. BMI OF FEMALE STUDENTS NEWLY ENROLLED AT TODOR KABLESHKOV UNIVERSITY OF TRANSPORT

    Directory of Open Access Journals (Sweden)

    Diana Peeva

    2014-06-01

    Full Text Available Introduction: The paper presents the results of a study where besides using the conventional anthropometry, the individual Body Mass Index (BMI or Ketle Index was calculated. Being established in the mid-nineteenth century, Ketle Index gained wide popularity in the 1950s and 1960s when the problem of obesity in the developed countries acquire serious levels. The aim was to prove the relationship between anthropometric parameters and Body Mass Index as well as the possible health risks of the individual. Methods: The study was carried out on 78 first-year female students at the Todor Kableshkov University of Transport (VTU. The indicators examined were: height, weight, skin fold, waist circumference and BMI. Descriptive statistics was used with data processing and different methods were applied to establish the anthropometric parameters: Body Mass Index or Kettle Index; quantitative subcutaneous fat according to the method developed by Deurenberg; comparative analysis of the link between waist circumference; BMI and the state of the individual’s body. Results: The study showed that the average BMI for the entire group of students was 23.1 and subcutaneous fat of 26.6% respectively. Nearly 10% of those being examined are overweight combining high levels of subcutaneous fat and waist circumference, which is a prerequisite for increased risk of disease. Discussion: In the academic year 2011/2012 a study of anthropometric indicators of the newly-enrolled female students was carried out at the Todor Kableshkov University of Transport (VTU. In compliance with some studies (Popov, 1969 a slight increase of size and weight is observed with increasing the age of women during the time of study at university while according to others (Karapetrov, 1978 changes in anthropometric indicators are reported to a later age. According to the research related to introduction of Euro fit tests, BMI as an indicator of general health of the body works in combination

  20. Changes in Adult BMI and Waist Circumference Are Associated with Increased Risk of Advanced Colorectal Neoplasia.

    Science.gov (United States)

    Gathirua-Mwangi, Wambui G; Monahan, Patrick; Song, Yiqing; Zollinger, Terrell W; Champion, Victoria L; Stump, Timothy E; Imperiale, Thomas F

    2017-11-01

    Waist circumference (WC) is a stronger predictor of colon cancer (CRC) risk than body mass index (BMI). However, how well change in either WC or BMI predicts risk of advanced colorectal neoplasia (AN) is unclear. To determine the relationship between change in BMI and WC from early adulthood to later age and the risk of AN and which change measure is a stronger predictor. In 4500 adults, ages 50-80, with no previous neoplasia and undergoing screening colonoscopy, BMI and WC at age 21 and at time of screening were reported. Changes in BMI and WC were defined using universal risk cutoffs. Known CRC risk factors were controlled in the logistic models. Overall, model statistics showed WC change (omnibus test χ 2  = 10.15, 2 DF, p value = 0.006) was a statistically stronger predictor of AN than BMI change (omnibus test χ 2  = 5.66, 5 DF, p value = 0.34). Independent of BMI change, participants who increased WC (OR 1.44; 95% CI 1.05-1.96) or maintained a high-risk WC (OR 2.50; 95% CI 1.38-4.53) at age 21 and at screening had an increased risk of AN compared to those with a low-risk WC. Study participants who were obese at age 21 and at screening had an increased risk of AN (OR 1.87; 95% CI 1.08-3.23) compared to those who maintained a healthy BMI. Maintaining an overweight BMI or increasing BMI was not associated with AN. Maintaining an unhealthy BMI and WC throughout adult life may increase risk of AN. WC change may be a better predictor of AN than BMI change.

  1. Gene-diet interaction effects on BMI levels in the Singapore Chinese population.

    Science.gov (United States)

    Chang, Xuling; Dorajoo, Rajkumar; Sun, Ye; Han, Yi; Wang, Ling; Khor, Chiea-Chuen; Sim, Xueling; Tai, E-Shyong; Liu, Jianjun; Yuan, Jian-Min; Koh, Woon-Puay; van Dam, Rob M; Friedlander, Yechiel; Heng, Chew-Kiat

    2018-02-24

    Recent genome-wide association studies (GWAS) have identified 97 body-mass index (BMI) associated loci. We aimed to evaluate if dietary intake modifies BMI associations at these loci in the Singapore Chinese population. We utilized GWAS information from six data subsets from two adult Chinese population (N = 7817). Seventy-eight genotyped or imputed index BMI single nucleotide polymorphisms (SNPs) that passed quality control procedures were available in all datasets. Alternative Healthy Eating Index (AHEI)-2010 score and ten nutrient variables were evaluated. Linear regression analyses between z score transformed BMI (Z-BMI) and dietary factors were performed. Interaction analyses were performed by introducing the interaction term (diet x SNP) in the same regression model. Analysis was carried out in each cohort individually and subsequently meta-analyzed using the inverse-variance weighted method. Analyses were also evaluated with a weighted gene-risk score (wGRS) contructed by BMI index SNPs from recent large-scale GWAS studies. Nominal associations between Z-BMI and AHEI-2010 and some dietary factors were identified (P = 0.047-0.010). The BMI wGRS was robustly associated with Z-BMI (P = 1.55 × 10 - 15 ) but not with any dietary variables. Dietary variables did not significantly interact with the wGRS to modify BMI associations. When interaction analyses were repeated using individual SNPs, a significant association between cholesterol intake and rs4740619 (CCDC171) was identified (β = 0.077, adjP interaction  = 0.043). The CCDC171 gene locus may interact with cholesterol intake to increase BMI in the Singaporean Chinese population, however most known obesity risk loci were not associated with dietary intake and did not interact with diet to modify BMI levels.

  2. The decline in BMI among Japanese women after World War II.

    Science.gov (United States)

    Maruyama, Shiko; Nakamura, Sayaka

    2015-07-01

    The body mass index (BMI) of the Japanese is significantly lower than is found in other high-income countries. Moreover, the average BMI of Japanese women is lower than that of Japanese men, and the age-specific BMI of Japanese women has decreased over time. The average BMI of Japanese women at age 25 decreased from 21.8 in 1948 to 20.4 in 2010 whereas that of men increased from 21.4 to 22.3 over the same period. We examine the long-term BMI trend in Japan by combining several historical data sources spanning eleven decades, from 1901 to 2012, to determine not only when but also how the BMI decline among women began: whether its inception was period-specific or cohort-specific. Our nonparametric regression analysis generated five findings. First, the BMI of Japanese women peaked with the 1930s birth cohort. This means that the trend is cohort-specific. Second, the BMI of men outpaced that of women in the next cohort. Third, the BMI of Japanese children, boys and girls alike, increased steadily throughout the 20th century. Fourth, the gender difference in the BMI trend is due to a gender difference in the weight trend, not the height trend. Fifth, these BMI trends are observed in urban and rural populations alike. We conclude that the BMI decline among Japanese women began with those who were in their late teens shortly after World War II. Copyright © 2015 Elsevier B.V. All rights reserved.

  3. Expression and clinicopathological significance of Mel-18 and Bmi-1 mRNA in gastric carcinoma.

    Science.gov (United States)

    Lu, You-Wei; Li, Jin; Guo, Wei-Jian

    2010-11-08

    The Polycomb group (PcG) genes are a class of regulators responsible for maintaining homeotic gene expression throughout cell division. PcG expression is deregulated in some types of human cancer. Both Bmi-1 and Mel-18 are of the key PcG proteins. We investigate the expression and clinicopathological roles of Mel-18 and Bmi-1 mRNA in gastric cancer. The expression of Mel-18 and Bmi-1 in a series of 71 gastric cancer tissues and paired normal mucosal tissues distant from the tumorous lesion was assayed by quantitative real time RT-PCR. The correlation between Mel-18 and Bmi-1 mRNA expression, and between Mel-18 or Bmi-1 mRNA level and clinicopathological characteristics were analyzed. Expression of Mel-18 and Bmi-1 genes was variably detected, but overexpression of Bmi-1 mRNA and decreased expression of Mel-18 mRNA were the most frequent alteration. In addition, the expression of Bmi-1 and Mel-18 mRNA inversely correlates in gastric tumors. Moreover, a significant positive correlation between Bmi-1 overexpression and tumor size, depth of invasion, or lymph node metastasis, and a significant negative correlation between Mel-18 low-expression with lymph node metastasis or the clinical stage were observed. Our data suggest that Mel-18 and Bmi-1 may play crucial but opposite roles in gastric cancer. Decreased Mel-18 and increased Bmi-1 mRNA expression was associated with the carcinogenesis and progression of gastric cancer. It is possible to list Bmi-1 and Mel-18 as biomarkers for predicting the prognosis of gastric cancer.

  4. Assessment of circulating sex steroid levels in prepubertal and pubertal boys and girls by a novel ultrasensitive gas chromatography-tandem mass spectrometry method

    DEFF Research Database (Denmark)

    Courant, Frédérique; Aksglæde, Lise; Antignac, Jean-Philippe

    2010-01-01

    Estrogens and androgens play key roles for pubertal onset and sexual maturation. Most currently used immunoassays are not sensitive enough to accurately measure the low circulating levels of sex steroids in children without any signs of puberty. However, this does not exclude that sex steroids ha...

  5. Prediction of BMI at age 11 in a longitudinal sample of the Ulm Birth Cohort Study.

    Directory of Open Access Journals (Sweden)

    Hanna Christiansen

    Full Text Available Obesity is one of the greatest public health challenges in the world with childhood prevalence rates between 20-26% and numerous associated health risks. The aim of the current study was to analyze the 11-year follow-up data of the Ulm Birth Cohort Study (UBCS, to identify whether abnormal eating behavior patterns, especially restrained eating, predict body mass index (BMI at 11 years of age and to explore other factors known to be longitudinally associated with it. Of the original UBCS, n = 422 children (~ 40% of the original sample and their parents participated in the 11-year follow-up. BMI at age 8 and 11 as well as information on restrained eating, psychological problems, depressive symptoms, lifestyle, and IQ at age 8 were assessed. Partial Least Squares Structural Equation Modeling (PLS-SEM was used to predict children's BMI scores at age 11. PLS-SEM explained 68% of the variance of BMI at age 11, with BMI at age 8 being the most important predictor. Restrained eating, via BMI at age 8 as well as parental BMI, had further weak associations with BMI at age 11; no other predictor was statistically significant. Since established overweight at age 8 already predicts BMI scores at age 11 longitudinally, obesity interventions should be implemented in early childhood.

  6. Body size estimation of self and others in females varying in BMI.

    Science.gov (United States)

    Thaler, Anne; Geuss, Michael N; Mölbert, Simone C; Giel, Katrin E; Streuber, Stephan; Romero, Javier; Black, Michael J; Mohler, Betty J

    2018-01-01

    Previous literature suggests that a disturbed ability to accurately identify own body size may contribute to overweight. Here, we investigated the influence of personal body size, indexed by body mass index (BMI), on body size estimation in a non-clinical population of females varying in BMI. We attempted to disentangle general biases in body size estimates and attitudinal influences by manipulating whether participants believed the body stimuli (personalized avatars with realistic weight variations) represented their own body or that of another person. Our results show that the accuracy of own body size estimation is predicted by personal BMI, such that participants with lower BMI underestimated their body size and participants with higher BMI overestimated their body size. Further, participants with higher BMI were less likely to notice the same percentage of weight gain than participants with lower BMI. Importantly, these results were only apparent when participants were judging a virtual body that was their own identity (Experiment 1), but not when they estimated the size of a body with another identity and the same underlying body shape (Experiment 2a). The different influences of BMI on accuracy of body size estimation and sensitivity to weight change for self and other identity suggests that effects of BMI on visual body size estimation are self-specific and not generalizable to other bodies.

  7. Do substantial BMI reduction episodes among Swedish schoolchildren have any impact on their final height?

    Science.gov (United States)

    Nilsen, Bente B; Yngve, Agneta; Werner, Bo

    2018-02-06

    This study investigated whether substantial body mass index (BMI) reductions in Swedish schoolchildren aged seven years to 19 years, caused by disease, healthy or unhealthy behaviour, had any impact on their final height. We used height and weight data on 6572 subjects from two nationally representative longitudinal samples of Swedish children born in 1973 and 1981. These provided information on their final height and any BMI reduction episodes. Of the 6572 subjects (50.9% boys), among individuals with information on final height, 1118 had a BMI reduction of 5% and BMI reduction of 10% or more. On a group level, there was no statistically significant difference in the final height of individuals with BMI reductions of 10% or more and those without. The findings were independent of age and the subject's BMI at the start of the reduction episode. However, there were a number of cases where a substantial BMI reduction probably had an impact on the subject's final height. Our study found no evidence that a substantial BMI reduction had any impact on final height on a group level, but further analyses of specific case studies are necessary to determine whether substantial BMI reduction might have an impact on final height. ©2018 Foundation Acta Paediatrica. Published by John Wiley & Sons Ltd.

  8. The dose-response analysis between BMI and common chronic diseases in northeast China.

    Science.gov (United States)

    Yu, Jianxing; Tao, Yuchun; Dou, Jing; Ye, Junsen; Yu, Yaqin; Jin, Lina

    2018-03-09

    High body mass index (BMI) predisposes to several chronic diseases, but a large-scale systematic and detailed study of dose-response relationship between BMI and chronic diseases has not been reported previously. In this study, we aimed to investigate the relationship between BMI and 3 chronic diseases (hypertension, dyslipidemia and MetS) in northeast China. A sample of 16412 participants aged 18~79 years old were included in Jilin province in 2012. The lambda-mu-sigma (LMS) method was applied to examine the trend of BMI by age, and the restricted cubic splines were used to investigate the non-linear associations (dose-response curve) between BMI and chronic diseases. It was pointed out that BMI increased rapidly when young, then kept steady in middle age, and finally declined slowly in old age, and accordingly age was divided into 3 segments, which were different by gender. The odds ratios (ORs) of BMI for the chronic diseases increased relatively slowly when young, then increased dramatically in middle-age and old population, especially for men. Further, the ORs of BMI among non-smokers were lower than those among smokers, and the same trend was shown to be more apparent among drinkers and non-drinkers. The risk of BMI for common chronic diseases increased dramatically in middle-aged, especially for men with drinking and smoking habits.

  9. Infant BMI peak, breastfeeding, and body composition at age 3 y

    DEFF Research Database (Denmark)

    Jensen, Signe Marie; Ritz, Christian; Ejlerskov, Katrine Tschentscher

    2015-01-01

    BACKGROUND: With the increasing focus on obesity, growth patterns in infancy and early childhood have gained much attention. Although the adiposity rebound has been in focus because of a shown association with adult obesity, not much has been published about the infant peak in body mass index (BMI......) cohort were used to estimate BMI growth curves for the age span from 14 d to 19 mo by using a nonlinear mixed-effects model. BMI growth velocity before peak and age and BMI at peak were derived from the subject-specific models. Information about pregnancy and breastfeeding was assessed from background...

  10. Body size estimation of self and others in females varying in BMI.

    Directory of Open Access Journals (Sweden)

    Anne Thaler

    Full Text Available Previous literature suggests that a disturbed ability to accurately identify own body size may contribute to overweight. Here, we investigated the influence of personal body size, indexed by body mass index (BMI, on body size estimation in a non-clinical population of females varying in BMI. We attempted to disentangle general biases in body size estimates and attitudinal influences by manipulating whether participants believed the body stimuli (personalized avatars with realistic weight variations represented their own body or that of another person. Our results show that the accuracy of own body size estimation is predicted by personal BMI, such that participants with lower BMI underestimated their body size and participants with higher BMI overestimated their body size. Further, participants with higher BMI were less likely to notice the same percentage of weight gain than participants with lower BMI. Importantly, these results were only apparent when participants were judging a virtual body that was their own identity (Experiment 1, but not when they estimated the size of a body with another identity and the same underlying body shape (Experiment 2a. The different influences of BMI on accuracy of body size estimation and sensitivity to weight change for self and other identity suggests that effects of BMI on visual body size estimation are self-specific and not generalizable to other bodies.

  11. Raised BMI cut-off for overweight in Greenland Inuit--a review.

    Science.gov (United States)

    Andersen, Stig; Fleischer Rex, Karsten; Noahsen, Paneeraq; Sørensen, Hans Christian Florian; Mulvad, Gert; Laurberg, Peter

    2013-01-01

    Obesity is associated with increased morbidity and premature death. Obesity rates have increased worldwide and the WHO recommends monitoring. A steep rise in body mass index (BMI), a measure of adiposity, was detected in Greenland from 1963 to 1998. Interestingly, the BMI starting point was in the overweight range. This is not conceivable in a disease-free, physically active, pre-western hunter population. This led us to reconsider the cut-off point for overweight among Inuit in Greenland. We found 3 different approaches to defining the cut-off point of high BMI in Inuit. First, the contribution to the height by the torso compared to the legs is relatively high. This causes relatively more kilograms per centimetre of height that increases the BMI by approximately 10% compared to Caucasian whites. Second, defining the cut-off by the upper 90-percentile of BMI from height and weight in healthy young Inuit surveyed in 1963 estimated the cut-off point to be around 10% higher compared to Caucasians. Third, if similar LDL-cholesterol and triglycerides are assumed for a certain BMI in Caucasians, the corresponding BMI in Inuit in both Greenland and Canada is around 10% higher. However, genetic admixture of Greenland Inuit and Caucasian Danes will influence this difference and hamper a clear distinction with time. Defining overweight according to the WHO cut-off of a BMI above 25 kg/m(2) in Greenland Inuit may overestimate the number of individuals with elevated BMI.

  12. BMI and obesity incidence in relation to food patterns of Polish older people

    DEFF Research Database (Denmark)

    Wadolowska, L.; Danowska-Oziewicz, M.; Niedzwiedzka, E.

    2006-01-01

    BMI differentiation and obesity incidence in relation to food patterns of Polish older people were analysed. The research included 422 people aged 65+ years. 21 food patterns were separated by the factor analysis. On the basis of the self-reported body mass and height, the BMI and percentages...... of overweight or obese people were calculated. The increase of the BMI and overweight and obesity incidence for both sexes was unequivocally connected with eating rye. The increase of the BMI and overweight and obesity incidence depended among women on consuming pork meat and alcoholic beverages. For men...

  13. Puberty and Pubertal Growth in GH-treated SGA Children: Effects of 2 Years of GnRHa Versus No GnRHa.

    Science.gov (United States)

    van der Steen, Manouk; Lem, Annemieke J; van der Kaay, Danielle C M; Hokken-Koèelega, Anita C S

    2016-05-01

    Most studies on puberty in children born small for gestational age (SGA) report height and age at onset of puberty. GH-treated SGA children with an adult height (AH) expectation below -2.5 SDS at onset of puberty can benefit from an additional 2 years of GnRH analog (GnRHa) treatment. There are no data on puberty and growth after discontinuation of GnRHa treatment in GH-treated SGA children. This study aimed to investigate the effects on puberty and pubertal growth of 2 years GnRHa vs no GnRHa in GH-treated SGA children. This was a GH trial involving 76 prepubertal short SGA children (36 girls) treated with GH. Thirty-two children received additional GnRHa for 2 years. Pubertal stages were 3-monthly assessed according to Tanner. Age, bone age, and median height at pubertal onset were lower in girls and boys in the GH/GnRHa group compared with the GH group. In girls and boys treated with GH/GnRHa, pubertal duration after stop of GnRHa treatment was shorter than pubertal duration in those with GH only (40.9 vs 46.7 mo; P = .044; 50.8 vs 57.5 months; P = .006; respectively). Height gain from onset of puberty until AH, including height gain during 2 years of GnRHa treatment, was 25.4 cm in girls and 33.0 cm in boys, which was 6.6 cm more than girls and boys treated with GH only. AH was similar in children treated with GH/GnRHa compared with those with GH only. GH-treated SGA children who start puberty with an AH expectation below -2.5 SDS and are treated with 2 years of GnRHa have a shorter pubertal duration after discontinuation of GnRHa compared with pubertal duration in children treated with GH only. Height gain from onset of puberty until AH is, however, more due to adequate growth during 2 years of GnRHa treatment resulting in a similar AH as children treated with GH only.

  14. Does more education cause lower BMI, or do lower-BMI individuals become more educated? Evidence from the National Longitudinal Survey of Youth 1979.

    Science.gov (United States)

    Benson, Rebecca; von Hippel, Paul T; Lynch, Jamie L

    2017-03-21

    More educated adults have lower average body mass index (BMI). This may be due to selection, if adolescents with lower BMI attain higher levels of education, or it may be due to causation, if higher educational attainment reduces BMI gain in adulthood. We test for selection and causation in the National Longitudinal Survey of Youth 1979, which has followed a representative US cohort from age 14-22 in 1979 through age 47-55 in 2012. Using ordinal logistic regression, we test the selection hypothesis that overweight and obese adolescents were less likely to earn high school diplomas and bachelor's degrees. Then, controlling for selection with individual fixed effects, we estimate the causal effect of degree completion on BMI and obesity status. Among 18-year-old women, but not among men, being overweight or obese predicts lower odds of attaining higher levels of education. At age 47-48, higher education is associated with lower BMI, but 70-90% of the association is due to selection. Net of selection, a bachelor's degree predicts less than a 1 kg reduction in body weight, and a high school credential does not reduce BMI. Copyright © 2017 Elsevier Ltd. All rights reserved.

  15. Gender differentiations of cognitive-motor functioning in prepubertal and pubertal children.

    Science.gov (United States)

    Katić, Ratko; Bala, Gustav; Barović, Zdenka

    2012-06-01

    The aim of this study was to determine cognitive and motor status factors in female and male children aged 10-14, as well as developmental and/or integration functions according to gender. The study included 162 girls and 134 boys aged 10-14, divided into four groups: 84 girls aged 10-12 (mean age 11.26, SD 0.68), 84 boys aged 10-12 (mean age 11.41, SD 0.50), 78 girls aged 13-14 (mean age 13.52, SD 0.63) and 50 boys aged 13-14 (mean age 13.21, SD 0.53). The significance of quantitative differences between boys and girls in the overall system of variables was defined based on the results of canonic discriminant analysis of variance, and within each variable based on the results on univariate analysis of variance (ANOVA). In the younger age group (10-12 years), girls were superior to boys in a test assessing flexibility (Seated straddle stretch), whereas, compared to girls, boys had greater strength of the trunk (Crossed-arm sit-ups), greater explosive strength ofjump and sprint type (Standing broad jump and 20 m dash), and coordination (Obstacle course backwards and Steps laterally). In the older age group (13-14 years) differences in flexibility were even more prominent in favor of girls, whereas the differences in explosive strength increased in favor of boys, especially of the throwing type with better agility (Steps laterally), balance (Board balance) and greater static strength of arms and shoulders (Bent-arm hang). In order to determine qualitative differences between pubertal and prepubertal girls and boys, the matrix of variable inter-correlations was factorized by the procedure of principal components procedure, that were then transformed to promax solution. The results showed that cognitive functioning had a significant role in the motor efficacy of girls and boys aged 10 to 14. In the age group of 10-12 years, in females, cognitive functioning is related to the motor system which integrates the regulation of muscle tone with agility/coordination, whereas

  16. Preschool Participation and BMI at Kindergarten Entry: The Case for Early Behavioral Intervention

    Directory of Open Access Journals (Sweden)

    Meghan E. McGrady

    2010-01-01

    Full Text Available Preschool years (ages 3–5 are a critical period in growth and development. Emerging studies suggest that preschool attendance may be linked to future weight, and perhaps obesity. This study examined relationships between public preschool attendance, demographic variables, and weight at kindergarten entry. Participants included 2,400 children entering kindergarten in 2006. Height and weight were used to calculate a child's BMI category based on CDC norms. At kindergarten entry, 17% of participants were overweight, and 18% were obese. Children attending a public preschool were at an increased risk for overweight (OR=1.06 and obesity (OR=1.34 at kindergarten entry, χ2(2=6.81, P=.03 relative to children who did not attend preschool. No significant trends relationships between demographics and weight status were found, but demographic variables are summarized descriptively. Policy and clinical implications are provided.

  17. Warm Parenting Associated with Decreasing or Stable Child BMI during Treatment.

    Science.gov (United States)

    Rhee, Kyung E; Jelalian, Elissa; Boutelle, Kerri; Dickstein, Susan; Seifer, Ronald; Wing, Rena

    2016-04-01

    While authoritative parenting, which includes high levels of warmth and behavioral control, has been associated with lower risk of obesity, little is known about how general parenting impacts child weight loss during treatment. Our goal was to examine the relationship between several general parenting dimensions and 'decreasing /stable' child BMI during a 16-week family-based behavioral weight control program. Forty-four overweight parent-child dyads (child age 8 to 12 years) enrolled in the program. Families were videotaped at baseline eating dinner in their home. Using the General Parenting Observational Scale (GPOS), meals were coded for several general parenting dimensions. Primary outcome was percent of children whose BMI 'decreased or stayed the same.' Multivariable logistic regression was used to determine the relationship between general parenting and decreasing/stable child BMI. Forty families (91%) completed the program. Children had a mean BMI change of -0.40 (SD 1.57), which corresponds to a -0.15 (SD 0.20) change in BMI z-score (BMI-Z); 75% of children had decreasing/stable BMI. In the unadjusted models, lower parent BMI, higher parent education, and higher levels of parental warmth were significantly associated with decreasing/stable child BMI. In the multivariable model, only higher level of warmth was associated with increased odds of decreasing/stable child BMI (OR = 1.28; 95% CI, 1.01, 1.62). Baseline parental warmth may influence a child's ability to lower/maintain BMI during a standard family-based behavioral weight control program. Efforts to increase parent displays of warmth and emotional support towards their overweight child may help to increase the likelihood of treatment success.

  18. Obesity-risk behaviours and their associations with body mass index (BMI) in Korean American children.

    Science.gov (United States)

    Jang, Myoungock; Grey, Margaret; Sadler, Lois; Jeon, Sangchoon; Nam, Soohyun; Song, Hee-Jung; Whittemore, Robin

    2017-08-03

    To describe obesity-risk behaviours (diet, physical activity and sedentary behaviour) and examine the relationships of the obesity-risk behaviours with body mass index (BMI) in school-aged Korean American children. Korean American children have a risk of becoming overweight or obese and developing obesity-related complications; however, there is limited research about obesity-risk behaviours in Korean American children. A cross-sectional study. Obesity-risk behaviours of children were assessed with well-validated self-report questionnaires (i.e., Elementary-level School-based Nutrition Monitoring Questionnaire) from children and their mothers. Height and weight of children were measured. Data were analysed with bivariate and multivariate analyses using mixed effects models to incorporate the correlation within siblings. A total of 170 Korean American children (mean age 10.9 [2.0] years; 52.4% girls; mean BMI 19.3 [3.2]; 28.7% ≥85 percentiles) participated in the study. Only 38.3% of Korean American children met established recommendations of five fruits/vegetables per day; 56.5% met recommendations for more than 3 days per week of vigorous physical activity; and 40.8% met recommendations for obesity in Korean American children and initiate clinical interventions to improve obesity-risk behaviours, especially sedentary behaviour, in Korean American children. Clinical assessment and management of the risk of developing overweight and obesity as well as obesity-related behaviours are important to improve obesity-related complications in overall Korean Americans. © 2017 John Wiley & Sons Ltd.

  19. No interactions between previously associated 2-hour glucose gene variants and physical activity or BMI on 2-hour glucose levels

    DEFF Research Database (Denmark)

    Scott, Robert A; Chu, Audrey Y; Grarup, Niels

    2012-01-01

    to determine 2-h glucose levels is unknown. We meta-analyzed single nucleotide polymorphism (SNP) × BMI and SNP × physical activity (PA) interaction regression models for five SNPs previously associated with 2-h glucose levels from up to 22 studies comprising 54,884 individuals without diabetes. PA levels were......Gene-lifestyle interactions have been suggested to contribute to the development of type 2 diabetes. Glucose levels 2 h after a standard 75-g glucose challenge are used to diagnose diabetes and are associated with both genetic and lifestyle factors. However, whether these factors interact...... dichotomized, with individuals below the first quintile classified as inactive (20%) and the remainder as active (80%). BMI was considered a continuous trait. Inactive individuals had higher 2-h glucose levels than active individuals (ß = 0.22 mmol/L [95% CI 0.13-0.31], P = 1.63 × 10(-6)). All SNPs were...

  20. BMI, waist circumference at 8 and 12 years of age and FVC and FEV

    NARCIS (Netherlands)

    M.B.M. Bekkers (Marga); A.H. Wijga (Alet); U. Gehring (Ulrike); G.H. Koppelman (Gerard); J.C. de Jongste (Johan); H.A. Smit (Henriëtte); B. Brunekreef (Bert)

    2015-01-01

    textabstractBackground: In adults, overweight is associated with reduced lung function, in children evidence on this association is conflicting. We examined the association of body mass index (BMI) and waist circumference (WC) at age 12, and of persistently (at ages 8 and 12 years) high BMI and

  1. BMI, waist circumference at 8 and 12 years of age and FVC and FEV

    NARCIS (Netherlands)

    Bekkers, Marga B.; Wijga, Alet H.; Gehring, Ulrike; Koppelman, Gerard H.; de Jongste, Johan C.; Smit, Henriette A.; Brunekreef, Bert

    2015-01-01

    Background: In adults, overweight is associated with reduced lung function, in children evidence on this association is conflicting. We examined the association of body mass index (BMI) and waist circumference (WC) at age 12, and of persistently (at ages 8 and 12 years) high BMI and large WC, with

  2. Fedmerelatererede sundhedsomkostninger vurderet ud fra måling af enten BMI eller taljeomkreds--sekundaerpublikation

    DEFF Research Database (Denmark)

    Højgaard, Betina; Olsen, Kim Rose; Søgaard, Jes

    2009-01-01

    circumference (WC) and body mass index (BMI). The analyses show that the combination of BMI and WC does not improve the identification of high-risk individuals compared with the use of WC alone. The health service costs increase by 1.24% in women and 2.08% in men pr. cm increase in WC above the normal range....

  3. Venous and autonomic function in formerly pre-eclamptic women and BMI-matched controls.

    Science.gov (United States)

    Heidema, Wieteke M; van Drongelen, Joris; Spaanderman, Marc E A; Scholten, Ralph R

    2018-03-25

    Pre-pregnancy reduced plasma volume increases the risk on subsequent pre-eclamptic pregnancy. Reduced plasma volume is thought to reflect venous reserve capacity, especially when venous vasculature is constricted and sympathetic tone is elevated. As obesity might affect these variables and also relates to pre-eclampsia, increased body weight may underlie these observations. We hypothesized that the relationship between reduced venous reserve and preeclampsia is independent of body mass index (BMI). We compared the non-pregnant venous reserve capacity in 30 formerly pre-eclamptic women, equally divided in 3 BMI-classes (BMI 19.5-24.9, BMI 25-29.9, BMI ≥30) to 30 controls. Cases and controls were matched for BMI, age and parity. The venous reserve capacity was quantified by assessing plasma volume and venous compliance. The autonomic nervous system regulating the venous capacitance was evaluated with heart rate variability analysis in resting supine position and during positive head-up tilt (HUT). Formerly pre-eclamptic women had in supine position lower plasma volume than controls (1339 ± 79 vs 1547 ± 139 ml/m 2 (pBMI-matched controls, reduced venous reserve capacity. This is reflected by lower plasma volume and venous compliance, the autonomic balance is shifted towards sympathetic dominance and lower baroreceptor sensitivity. This suggests that not BMI, but underlying reduced venous reserve relates to pre-eclampsia. This article is protected by copyright. All rights reserved.

  4. Mother's pre-pregnancy BMI is an important determinant of adverse cardiometabolic risk in childhood

    Science.gov (United States)

    Maternal adiposity is associated with poor offspring cardiometabolic health. We aimed to evaluate the relationship of maternal pre-pregnancy body mass index (BMI) on the BMI, body composition and cardiometabolic characteristics of the offspring. Forty offspring of overweight/obese mothers (O-OW) and...

  5. No seasonality of birth in BMI at 7 years of age

    DEFF Research Database (Denmark)

    Jensen, Camilla Bjørn; Sørensen, Thorkild I.A.; Heitmann, Berit

    2016-01-01

    Seasonal variation in birth weight was found in a previous Danish study. In the present study we investigated if the seasonality in birth weight tracked into BMI at 7 years of age, but found no seasonality of birth in either BMI, overweight, or obesity. © 2016 Elsevier Ireland Ltd...

  6. Fedmerelatererede sundhedsomkostninger vurderet ud fra måling af enten BMI eller taljeomkreds--sekundaerpublikation

    DEFF Research Database (Denmark)

    Højgaard, Betina; Olsen, Kim Rose; Søgaard, Jes

    2009-01-01

    circumference (WC) and body mass index (BMI). The analyses show that the combination of BMI and WC does not improve the identification of high-risk individuals compared with the use of WC alone. The health service costs increase by 1.24% in women and 2.08% in men pr. cm increase in WC above the normal range...

  7. The effects of breastfeeding on childhood BMI: a propensity score matching approach.

    Science.gov (United States)

    Gibson, Laura A; Hernández Alava, Mónica; Kelly, Michael P; Campbell, Michael J

    2017-12-01

    Many studies have found a statistical association between breastfeeding and childhood adiposity. This paper investigates whether breastfeeding has an effect on subsequent childhood body mass index (BMI) using propensity scores to account for confounding. We use data from the Millennium Cohort Study, a nationally representative UK cohort survey, which contains detailed information on infant feeding and childhood BMI. Propensity score matching is used to investigate the mean BMI in children breastfed exclusively and partially for different durations of time. We find statistically significant influences of breastfeeding on childhood BMI, particularly in older children, when breastfeeding is prolonged and exclusive. At 7 years, children who were exclusively breastfed for 16 weeks had a BMI 0.28 kg/m2 (95% confidence interval 0.07 to 0.49) lower than those who were never breastfed, a 2% reduction from the mean BMI of 16.6 kg/m2. For this young cohort, even small effects of breastfeeding on BMI could be important. In order to reduce BMI, breastfeeding should be encouraged as part of wider lifestyle intervention. This evidence could help to inform public health bodies when creating public health guidelines and recommendations. © The Author 2016. Published by Oxford University Press on behalf of Faculty of Public Health.

  8. A comparison of chewing rate between overweight and normal BMI individuals.

    Science.gov (United States)

    White, Amy Kristin; Venn, Bernard; Lu, Louise Weiwei; Rush, Elaine; Gallo, Luigi Maria; Yong, Janet Lee Ching; Farella, Mauro

    2015-06-01

    Previous attempts to identify an 'obese eating style' have led to conflicting findings. This observational study compared the chewing features of overweight or obese young adults with those of normal range BMI. We hypothesised that chewing features are individual-specific and differ between participants of a normal BMI and high BMI. Fourteen overweight to obese participants (BMI≥25.0) were pairwise matched with 14 normal range BMI participants (18.5chewing episodes, including rate, duration, and power. Masticatory performance was assessed by a sieve test and was expressed as the percentage of particles ≤2mm after a standardised chewing test. Regardless of the meal, chewing rate was remarkably consistent among participants (ICC=0.89; 95% CI=0.79-0.94). Chewing rate did not differ between high and normal BMI participants (p>0.05), whereas chewing power was significantly higher in high BMI participants (pchewing characteristics were found between BMI groups. Participants chewed at similar rate in the natural environment (pizza) and in the laboratory (rice) setting (p>0.05). Masticatory performance did not differ significantly (p>0.05) between the high (55.9%) and normal (52.4%) BMI groups. Within the limitations of the present study, chewing characteristics appear to be individual-specific with wide variability. Overweight participants chew at a similar rate to control participants, albeit slightly stronger. Our preliminary findings need to be replicated in larger samples. Copyright © 2015. Published by Elsevier Inc.

  9. Contribution of polycomb homologues Bmi-1 and Mel-18 to medulloblastoma pathogenesis.

    Science.gov (United States)

    Wiederschain, Dmitri; Chen, Lin; Johnson, Brett; Bettano, Kimberly; Jackson, Dowdy; Taraszka, John; Wang, Y Karen; Jones, Michael D; Morrissey, Michael; Deeds, James; Mosher, Rebecca; Fordjour, Paul; Lengauer, Christoph; Benson, John D

    2007-07-01

    Bmi-1 and Mel-18 are structural homologues that belong to the Polycomb group of transcriptional regulators and are believed to stably maintain repression of gene expression by altering the state of chromatin at specific promoters. While a number of clinical and experimental observations have implicated Bmi-1 in human tumorigenesis, the role of Mel-18 in cancer cell growth has not been investigated. We report here that short hairpin RNA-mediated knockdown of either Bmi-1 or Mel-18 in human medulloblastoma DAOY cells results in the inhibition of proliferation, loss of clonogenic survival, anchorage-independent growth, and suppression of tumor formation in nude mice. Furthermore, overexpression of both Bmi-1 and Mel-18 significantly increases the clonogenic survival of Rat1 fibroblasts. In contrast, stable downregulation of Bmi-1 or Mel-18 alone does not affect the growth of normal human WI38 fibroblasts. Proteomics-based characterization of Bmi-1 and Mel-18 protein complexes isolated from cancer cells revealed substantial similarities in their respective compositions. Finally, gene expression analysis identified a number of cancer-relevant pathways that may be controlled by Bmi-1 and Mel-18 and also showed that these Polycomb proteins regulate a set of common gene targets. Taken together, these results suggest that Bmi-1 and Mel-18 may have overlapping functions in cancer cell growth.

  10. BMI1 is expressed in canine osteosarcoma and contributes to cell growth and chemotherapy resistance.

    Directory of Open Access Journals (Sweden)

    Mehdi Hayat Shahi

    Full Text Available BMI1, a stem cell factor and member of the polycomb group of genes, has been shown to contribute to growth and chemoresistance of several human malignancies including primary osteosarcoma (OSA. Naturally occurring OSA in the dog represents a large animal model of human OSA, however the potential role of BMI1 in canine primary and metastatic OSA has not been examined. Immunohistochemical staining of canine primary and metastatic OSA tumors revealed strong nuclear expression of BMI1. An identical staining pattern was found in both primary and metastatic human OSA tissues. Canine OSA cell lines (Abrams, Moresco, and D17 expressed high levels of BMI1 compared with canine osteoblasts and knockdown or inhibition of BMI1 by siRNA or by small molecule BMI1-inhibitor PTC-209 demonstrated a role for BMI1 in canine OSA cell growth and resistance to carboplatin and doxorubicin chemotherapy. These findings suggest that inhibition of BMI1 in primary or metastatic OSA may improve response to chemotherapy and that the dog may serve as a large animal model to evaluate such therapy.

  11. BMI1 is expressed in canine osteosarcoma and contributes to cell growth and chemotherapy resistance.

    Science.gov (United States)

    Shahi, Mehdi Hayat; York, Daniel; Gandour-Edwards, Regina; Withers, Sita S; Holt, Roseline; Rebhun, Robert B

    2015-01-01

    BMI1, a stem cell factor and member of the polycomb group of genes, has been shown to contribute to growth and chemoresistance of several human malignancies including primary osteosarcoma (OSA). Naturally occurring OSA in the dog represents a large animal model of human OSA, however the potential role of BMI1 in canine primary and metastatic OSA has not been examined. Immunohistochemical staining of canine primary and metastatic OSA tumors revealed strong nuclear expression of BMI1. An identical staining pattern was found in both primary and metastatic human OSA tissues. Canine OSA cell lines (Abrams, Moresco, and D17) expressed high levels of BMI1 compared with canine osteoblasts and knockdown or inhibition of BMI1 by siRNA or by small molecule BMI1-inhibitor PTC-209 demonstrated a role for BMI1 in canine OSA cell growth and resistance to carboplatin and doxorubicin chemotherapy. These findings suggest that inhibition of BMI1 in primary or metastatic OSA may improve response to chemotherapy and that the dog may serve as a large animal model to evaluate such therapy.

  12. Meta-analysis of genome-wide linkage studies in BMI and obesity

    NARCIS (Netherlands)

    Saunders, Catherine L.; Chiodini, Benedetta D.; Sham, Pak; Lewis, Cathryn M.; Abkevich, Victor; Adeyemo, Adebowale A.; de Andrade, Mariza; Arya, Rector; Berenson, Gerald S.; Blangero, John; Boehnke, Michael; Borecki, Ingrid B.; Chagnon, Yvon C.; Chen, Wei; Comuzzie, Anthony G.; Deng, Hong-Wen; Duggirala, Ravindranath; Feitosa, Mary F.; Froguel, Philippe; Hanson, Robert L.; Hebebrand, Johannes; Huezo-Dias, Patricia; Kissebah, Ahmed H.; Li, Weidong; Luke, Amy; Martin, Lisa J.; Nash, Matthew; Ohman, Muena; Palmer, Lyle J.; Peltonen, Leena; Perola, Markus; Price, R. Arlen; Redline, Susan; Srinivasan, Sathanur R.; Stern, Michael P.; Stone, Steven; Stringham, Heather; Turner, Stephen; Wijmenga, Cisca; Collier, David A.

    Objective: The objective was to provide an overall assessment of genetic linkage data of BMI and BMI-defined obesity using a nonparametric genome scan meta-analysis. Research Methods and Procedures: We identified 37 published studies containing data on over 31,000 individuals from more than >10,000

  13. Increased genetic variance of BMI with a higher prevalence of obesity

    DEFF Research Database (Denmark)

    Rokholm, Benjamin; Silventoinen, Karri; Ängquist, Lars

    2011-01-01

    populations. Several recent studies suggest that the genetic effects on adiposity may be stronger when combined with presumed risk factors for obesity. We tested the hypothesis that a higher prevalence of obesity and overweight and a higher BMI mean is associated with a larger genetic variation in BMI....

  14. Bmi1 confers resistance to oxidative stress on hematopoietic stem cells.

    Directory of Open Access Journals (Sweden)

    Shunsuke Nakamura

    Full Text Available The polycomb-group (PcG proteins function as general regulators of stem cells. We previously reported that retrovirus-mediated overexpression of Bmi1, a gene encoding a core component of polycomb repressive complex (PRC 1, maintained self-renewing hematopoietic stem cells (HSCs during long-term culture. However, the effects of overexpression of Bmi1 on HSCs in vivo remained to be precisely addressed.In this study, we generated a mouse line where Bmi1 can be conditionally overexpressed under the control of the endogenous Rosa26 promoter in a hematopoietic cell-specific fashion (Tie2-Cre;R26Stop(FLBmi1. Although overexpression of Bmi1 did not significantly affect steady state hematopoiesis, it promoted expansion of functional HSCs during ex vivo culture and efficiently protected HSCs against loss of self-renewal capacity during serial transplantation. Overexpression of Bmi1 had no effect on DNA damage response triggered by ionizing radiation. In contrast, Tie2-Cre;R26Stop(FLBmi1 HSCs under oxidative stress maintained a multipotent state and generally tolerated oxidative stress better than the control. Unexpectedly, overexpression of Bmi1 had no impact on the level of intracellular reactive oxygen species (ROS.Our findings demonstrate that overexpression of Bmi1 confers resistance to stresses, particularly oxidative stress, onto HSCs. This thereby enhances their regenerative capacity and suggests that Bmi1 is located downstream of ROS signaling and negatively regulated by it.

  15. Convergence of BMI1 and CHD7 on ERK Signaling in Medulloblastoma

    Directory of Open Access Journals (Sweden)

    Sara Badodi

    2017-12-01

    Full Text Available Summary: We describe molecular convergence between BMI1 and CHD7 in the initiation of medulloblastoma. Identified in a functional genomic screen in mouse models, a BMI1High;CHD7Low expression signature within medulloblastoma characterizes patients with poor overall survival. We show that BMI1-mediated repression of the ERK1/2 pathway leads to increased proliferation and tumor burden in primary human MB cells and in a xenograft model, respectively. We provide evidence that repression of the ERK inhibitor DUSP4 by BMI1 is dependent on a more accessible chromatin configuration in G4 MB cells with low CHD7 expression. These findings extend current knowledge of the role of BMI1 and CHD7 in medulloblastoma pathogenesis, and they raise the possibility that pharmacological targeting of BMI1 or ERK may be particularly indicated in a subgroup of MB with low expression levels of CHD7. : Badodi et al. find convergence of the chromatin modifiers BMI1 and CHD7 in medulloblastoma pathogenesis, and they show that this pathway regulates tumor proliferation and growth via ERK signaling. Keywords: BMI1, CHD7, DUSP4, ERK, medulloblastoma, PcG genes, mouse models, epigenetics, chromatin

  16. Differences in genetic and environmental variation in adult BMI by sex, age, time period, and region

    DEFF Research Database (Denmark)

    Silventoinen, Karri; Jelenkovic, Aline; Sund, Reijo

    2017-01-01

    Background: Genes and the environment contribute to variation in adult body mass index [BMI (in kg/m(2))], but factors modifying these variance components are poorly understood.Objective: We analyzed genetic and environmental variation in BMI between men and women from young adulthood to old age...

  17. Differences in genetic and environmental variation in adult BMI by sex, age, time period, and region

    DEFF Research Database (Denmark)

    Silventoinen, Karri; Jelenkovic, Aline; Sund, Reijo

    2017-01-01

    Background: Genes and the en