Maternal pre-pregnancy body mass index and pubertal development among sons
DEFF Research Database (Denmark)
Hounsgaard, M L; Håkonsen, L B; Vested, A
2014-01-01
Maternal overweight and obesity in pregnancy has been associated with earlier age of menarche in daughters as well as reduced semen quality in sons. We aimed at investigating pubertal development in sons born by mothers with a high body mass index (BMI). The study included 2522 sons of mothers...... indicators of pubertal development, results also indicated earlier pubertal development among sons of obese mothers. After excluding sons of underweight mothers in a subanalysis, we observed an inverse trend between maternal pre-pregnancy BMI and age at regular shaving, acne and first nocturnal emission....... In conclusion, maternal pre-pregnant obesity may be related to earlier timing of pubertal milestones among sons. More research, preferably based on prospectively collected information about pubertal development, is needed to draw firm conclusions....
Pubertal development in Danish children
DEFF Research Database (Denmark)
Juul, A; Teilmann, G; Scheike, Thomas Harder
2006-01-01
differences between USA and Denmark, as well as to look for possible secular trends in pubertal development. Healthy Caucasian children from public schools in Denmark participated in the study which was carried out in 1991-1993. A total number of 826 boys and 1,100 girls (aged 6.0-19.9 years) were included......, and pubertal stages were assessed by clinical examination according to methods of Tanner. In boys testicular volume was determined using an orchidometer. We found that age at breast development 2 (B2) was 10.88 years, and mean menarcheal age was 13.42 years. Girls with body mass index (BMI) above the median...... genetic polymorphisms, nutrition, physical activity or endocrine disrupting chemicals must therefore also be considered. Therefore, we believe it is crucial to monitor the pubertal development closely in Denmark in the coming decades....
DEFF Research Database (Denmark)
Sørensen, Kaspar; Juul, Anders
2015-01-01
and bioelectric impedance analyses (BIA) were used to estimate adiposity. Clinical pubertal markers (Tanner stages and testicular volume) were evaluated. LH, FSH, estradiol, testosterone, SHBG and IGF1 levels were determined by immunoassays. RESULTS: In all age groups, higher BMI (all 1 year age-groups, P ≤ 0...
[A survey of pubertal development in children born with assisted reproductive technology].
Liu, Zi-Yuan; Wang, Xin-Li; Han, Tong-Yan; Cui, Yun-Pu; Wang, Xue-Mei; Tong, Xiao-Mei; Song, Yi; Wang, Hai-Jun; Li, Song
2017-06-01
To investigate the status of pubertal development in children born with assisted reproductive technology (ART). A retrospective analysis was performed on the pubertal development data of children born with ART in Peking University Third Hospital from 1994 to 2003 (ART group). The data in the cross-sectional study "Reports on the Physical Fitness and Health Research of Chinese School Students in 2010" were used as a control. The age at menarche and the age at spermarche were compared between the two groups. The status of pubertal development in the overweight and obese children in the ART group was evaluated to investigate the correlation between pubertal development and body mass index (BMI). A total of 200 children born with ART were enrolled in this study, and 72 of them (41 males and 31 females) completed the survey (response rate=36.0%). In the ART group, the mean age at spermarche and the mean age at menarche were 13.9 years (95%CI: 13.7-14.3 years) and 12.2 years (95%CI: 11.8-12.6 years), respectively. There were no significant differences in the age at spermarche and the age at menarche between the ART and control groups (P>0.05). In the ART group, there were no significant differences in the age at spermarche and the age at menarche between the overweight and obese children and the normal weight children (P>0.05). There were also no significant differences in overweight rate and obesity rate between the children in the ART group and the adolescents in Beijing (P>0.05). In the ART group, there was no significant correlation between the age at spermarche or menarche and BMI (P>0.05). No delayed or precocious puberty is observed in children born with ART. This is consistent with the normal control data. And there is no significant correlation between pubertal development and BMI in children born with ART.
Directory of Open Access Journals (Sweden)
Mikael Seabra Moraes
2018-01-01
Full Text Available Abstract Aim: To compare performance in the lumbar force test in pubertal and post-pubertal adolescents by controlling the interference of physical growth, body fat, screen time and physical activity. Methods: A cross-sectional study with 933 adolescents (492 girls aged 14-19 from the city of São José, Brazil. Lumbar strength was assessed using the isometric lumbar extension test proposed by the Canadian Society of Exercise Physiology. Sexual maturation was classified according to Tanner’s criteria. Physical growth variables (age, body weight, stature, BMI, body fat (triceps and subscapular skinfolds, sedentary behavior based on screen time and overall physical activity were controlled in the Analysis of Covariance (ANCOVA, with a significance level of 5%. Results: Post-pubertal boys presented higher lumbar force compared to pubertal ones only when interference of BMI, body fat, screen time and physical activity was controlled. Pubertal girls presented higher lumbar force compared to post-pubertal ones, both when controlling the analysis for the studied variables and when not controlled by them. Conclusion: BMI, body fat, screen time and physical activity interfere in the difference in lumbar strength of boys, in which post-pubertal boys presented better performance in lumbar force compared to pubertal ones. Regardless of interference or not of these variables, pubertal girls presented better performance in lumbar force when compared to post-pubertal ones.
Nutrition and pubertal development
Soliman, Ashraf; De Sanctis, Vincenzo; Elalaily, Rania
2014-01-01
Nutrition is one of the most important factors affecting pubertal development. Puberty entails a progressive nonlinear process starting from prepubescent to full sexual maturity through the interaction and cooperation of biological, physical, and psychological changes. Consuming an adequate and balanced healthy diet during all phases of growth (infancy, childhood and puberty) appears necessary both for proper growth and normal pubertal development. Girls begin puberty at an earlier age compar...
Pubertal development in ICSI children
Belva, F.; Roelants, M.; Painter, R.; Bonduelle, M.; Devroey, P.; de Schepper, J.
2012-01-01
To date, information on the pubertal development of adolescents born after ICSI is scarce, since the very first cohort is only now reaching young adulthood. In this study, pubertal development at the age of 14 was characterized in a longitudinally followed cohort of ICSI-conceived teenagers and
The effect of tamoxifen on pubertal bone development in adolescents with pubertal gynecomastia.
Akgül, Sinem; Derman, Orhan; Kanbur, Nuray
2016-01-01
During puberty, estrogen has a biphasic effect on epiphyses; at low levels, it leads to an increase in height and bone mass, whereas at high levels, it leads to closure of the epiphysis. Tamoxifen is a selective estrogen receptor modulator that has been used in the treatment of pubertal gynecomastia. Although it has not been approved for this indication, studies have shown it to be both successful and safe. In males, the peak of pubertal bone development occurs during Tanner stage 3-4, which is also when pubertal gynecomastia reaches its highest prevalence. Thus tamoxifen treatment could potentially effect pubertal bone development. The aim of this study was to assess the effects of tamoxifen on bone mineral density (BMD) and skeletal maturation when used for pubertal gynecomastia. We evaluated 20 boys with pubertal gynecomastia receiving tamoxifen for at least 4 months. BMD was measured with dual-energy X-ray absorptiometry. Z-score and absolute BMD (g/cm(2)) was determined at baseline and 2 months after completing tamoxifen treatment. Bone age and height was evaluated before treatment and again one year later. Using absolute BMD (g/cm(2)), the mean difference from baseline was significant between the two groups both at spine (p=0.002) and femur (p=0.001), but not with the Z-score. This result was attributed to the expected increase during puberty according to sex and age. No significant effect on skeletal maturation was found (p=1.112). We conclude that when pubertal bone development is concerned, tamoxifen is safe for the treatment of pubertal gynecomastia as neither bone mineralization nor growth potential was affected.
Nutrition and pubertal development
Directory of Open Access Journals (Sweden)
Ashraf Soliman
2014-01-01
Full Text Available Nutrition is one of the most important factors affecting pubertal development. Puberty entails a progressive nonlinear process starting from prepubescent to full sexual maturity through the interaction and cooperation of biological, physical, and psychological changes. Consuming an adequate and balanced healthy diet during all phases of growth (infancy, childhood and puberty appears necessary both for proper growth and normal pubertal development. Girls begin puberty at an earlier age compared to past decades. Excessive eating of many processed, high-fat foods, may be the cause of this phenomenon. Overweight or obese children are more likely to enter puberty early. Some evidence suggests that obesity can accelerate the onset of puberty in girls and may delay the onset of puberty in boys. Moreover, the progression of puberty is affected by nutrition. On the other hand, puberty triggers a growth spurt, which increases nutritional needs including macro and micronutrients. Increased caloric, protein, iron, calcium, zinc and folate needs have to be provided during this critical period of rapid growth. Severe primary or secondary malnutrition also can delay the onset and progression of puberty. The higher incidence of anorexia nervosa and bulimia in adolescents imposes a nutritional risk on pubertal development. Moreover, many environmental endocrine disruptors (EDs have been identified that can significantly impair the normal course of puberty. This mini-review sums up some important findings in this important complex that link nutrition and pubertal development.
Pubertal development in The Netherlands 1965-1997
D. Mul (Dick); A.M. Fredriks; S. van Buuren (Stef); W. Oostdijk (Wilma); S.P. Verloove-Vanhorick; J.M. Wit (Jan)
2001-01-01
textabstractWe investigated pubertal development of 4019 boys and 3562 girls >8 y of age participating in a cross-sectional survey in The Netherlands and compared the results with those of two previous surveys. Reference curves for all pubertal stages were constructed. The 50th
Pubertal development in children diagnosed with diabetes mellitus type 1 before puberty.
Pereira, K C X; Pugliese, B S; Guimarães, M M; Gama, M P
2015-02-01
To investigate an association between pubertal development and timing of menarche with glycemic control, disease duration, and body mass index (BMI) in patients diagnosed with diabetes mellitus type 1 (DM1) before puberty. Retrospective study. The study was performed at the diabetes outpatient clinic of Instituto de Puericultura e Pediatria Martagão Gesteira--IPPMG of the Federal University of Rio de Janeiro--UFRJ. A total of 131 children, 61 girls and 70 boys, diagnosed with DM1 before puberty participated in the study. The study investigated how age at puberty onset relates to mean glycated hemoglobin (HbA1c) before puberty, BMI percentile, and disease duration; how puberty duration relates to mean HbA1c before and during puberty and to disease duration; and how timing of menarche relates to mean HbA1c before puberty, BMI percentile, and disease duration. Age at puberty onset was positively correlated with mean HbA1c before puberty (r = 0.204, R(2) = 0.042; P = .019) and disease duration (r = 0.451, R(2) = 0.203; P puberty later than those diagnosed more recently. Girls in higher BMI percentiles reached menarche sooner.
Pubertal Onset in Apparently Healthy Indian Boys and Impact of Obesity.
Surana, Vineet; Dabas, Aashima; Khadgawat, Rajesh; Marwaha, Raman Kumar; Sreenivas, V; Ganie, M Ashraf; Gupta, Nandita; Mehan, Neena
2017-01-01
Primary - to determine the age of pubertal onset in Indian boys. Secondary - (a) to assess the impact of obesity on pubertal timing, (b) to assess the relationship between gonadotropins and puberty. Cross-sectional. General community-seven schools across New Delhi. Random sample of 1306 school boys, aged 6-17 years. Anthropometric measurement for weight and height and pubertal staging was performed for all subjects. Body mass index (BMI) was calculated to define overweight/obesity. Serum luteinizing hormone (LH), follicle stimulating hormone, and serum testosterone were measured in every sixth subject. Age at pubertal onset-testicular volume ≥4 mL (gonadarche) and pubic hair Stage II. Median age of attaining gonadarche and pubarche was 10.41 years (95% confidence interval [CI]: 10.2-10.6 years) and 13.60 (95% CI: 13.3-14.0 years), respectively. No significant difference in the age of attainment of gonadarche was observed in boys with normal or raised BMI, though pubarche occurred 8 months earlier in the latter group. Serum gonadotropins and testosterone increased with increasing stages of puberty but were unaffected by BMI. Serum LH level of 1.02 mIU/mL and testosterone level of >0.14 ng/mL showed the best prediction for pubertal onset. The study establishes a secular trend of the age of onset of puberty in Indian boys. Pubarche occurred earlier in overweight/obese boys. The cutoff levels of serum LH and testosterone for prediction of pubertal onset have been established.
Pubertal development, physical self-perception, and motivation toward physical activity in girls.
Labbrozzi, Dina; Robazza, Claudio; Bertollo, Maurizio; Bucci, Ines; Bortoli, Laura
2013-08-01
We examined the differences in physical self-perception and motivation toward physical activity in early- and mid-adolescent girls. Body Mass Index (BMI) and pubertal status, assessed by means of the Tanner scale, were collected in 11-year-old (n=74) and 13-year-old girls (n=60). The assessment included six scales from the Physical Self-Description Questionnaire, the Physical Activity Enjoyment Scale, and the Situational Intrinsic Motivation Scale. Age differences emerged, with older girls showing a poorer physical perception and lower scores in intrinsic motivation and enjoyment of physical activity. In the subsample of 11-year-olds, findings showed that more developed girls reported a poorer physical perception on the scales of body fat, global physical self-concept, and appearance, and a lower score in the PACES positive scale. Results underscore the need to promote interventions aimed at encouraging active lifestyles among children and adolescent girls, in order to prevent overweight prior to pubertal onset. Copyright © 2013 The Foundation for Professionals in Services for Adolescents. Published by Elsevier Ltd. All rights reserved.
Pubertal breast development in primary school girls in Sokoto, North ...
African Journals Online (AJOL)
Background. There is wide variation in normal pubertal timing among various populations. Objectives. To determine the mean age of pubertal stages of breast development and menarche, and the influence of nutrition and ethnicity on pubertal onset in primary school girls in Sokoto, North-Western Nigeria. Methods.
Goluch-Koniuszy, Zuzanna
2010-01-01
This research was aimed at evaluation of the method of nutrition in the children aged 13 during the period of pubertal spurt who had their body mass, body weight and this values led to calculation of BMI indicator which was related to centile distribution of children from Warszawa. From the group 1464 children selected 79 persons (5.4% the whole of investigated) with BMI < or = 5 percentile with underweight and considerable underweight. Their menus of three chosen at random weekdays were obtained. Analysis of the nutrition method of children with underweight and considerable underweight showed low energy value of the diet, cellulose, mineral components (K, Ca, Mg) also liquids deficiency at simultaneously occurrent the general and animal protein, the fat, the cholesterol, mineral components (Na, P, Fe, Cu, Zn), vitamins A, C, E (girls) and from the group B. The children have undergone a special pro health education in the form "live" workshop.
Pubertal development timing in urban Chinese boys.
Ma, H-M; Chen, S-K; Chen, R-M; Zhu, C; Xiong, F; Li, T; Wang, W; Liu, G-L; Luo, X-P; Liu, L; Du, M-L
2011-10-01
We describe current pubertal development in healthy urban Chinese boys. A cross-sectional study of the pubertal development of 18,807 urban Chinese boys aged from 3.50 to 18.49years was conducted between 2003 and 2005. Testicular volume was evaluated with a Prader orchidometer. Pubic hair development was assessed according to the Tanner method. Data on spermarche were collected using the status quo method. Probit analysis was used to calculate the median age and 95% CI at different stages of testicular development, pubic hair development and spermarche. By age 9, 12.99% of the boys had a testicular volume of 4mL or greater. The median age of onset of puberty defined as the age at attainment of testicular volume of 4mL or greater was 10.55 (95% CI 10.27-10.79) years. The median age for onset of pubic hair development (PH(2) ) and spermarche was 12.78 (95%CI 12.67-12.89) years and 14.05 (95%CI 13.80-14.32) years, respectively. Pubertal onset in urban Chinese boys is earlier than currently used clinical norms but their pubic hair development occurs relatively late in comparison with the reported data from numerous other countries. There is also evidence of a secular trend towards an earlier age of spermarche since 1979 in Chinese urban boys. © 2011 The Authors. International Journal of Andrology © 2011 European Academy of Andrology.
Patterns and correlates of pubertal development in Canadian youth: effects of family context.
Arim, Rubab G; Shapka, Jennifer D; Dahinten, V Susan; Willms, J Douglas
2007-01-01
Current health literature suggests that there has been a decline in the age of pubertal onset, and that pubertal development is influenced by social context. Unfortunately, contemporary Canadian-specific data have not been available. This study examined the odds of having entered puberty at various ages during adolescence, before and after controlling for the effects of family socio-economic status and family structure. Longitudinal data for this study were drawn from the first four cycles of the National Longitudinal Survey of Children and Youth. The final sample consisted of 7977 adolescents ranging in age from 10 to 17. Pubertal status of the participants was identified based on pubic hair, facial hair growth, and voice change, for boys; and pubic hair, breast development, and menstruation, for girls. Trajectories of pubertal development were analyzed with HLM growth curve modelling techniques. The results indicated that, compared to boys, the odds of having entered puberty at age 13 were 6.45 times higher for girls and that girls go through puberty more quickly. Low family socio-economic status and living with a stepfather were found to predict early onset of pubertal development. Contextual factors are related to pubertal development. Additional research is needed to develop a more solid understanding of how psychosocial factors interact to predict gendered patterns of pubertal development.
Hormonal, anthropometric and lipid factors associated with idiopathic pubertal gynecomastia.
Al Alwan, Ibrahim; Al Azkawi, Hanan; Badri, Motasim; Tamim, Hani; Al Dubayee, Mohammed; Tamimi, Waleed
2013-01-01
To determine factors associated with pubertal gynecomastia. A cross-sectional study among healthy male school children and adolescents in Riyadh, Saudi Arabia. Subjects were selected from diverse socioeconomic backgrounds. Tanner stage, height, weight, blood hormonal levels (leutilizing hormone [LH], follicle-stimulating hormone [FSH], total testosterone, and estradiol), and anthropometric and lipid parameters (body mass index [BMI], triglycerides, high-density lipoprotein [HDL], and low-density lipoprotein [LDL]), were collected and compared in children with and without gynecomastia. The study included 542 children and adolescents. Median (interquartile range) age in the whole group was 11(8-13) years. The prevalence of gynecomastia was 185/542 (34%), with a peak at age 14. The 2 groups compared had nonsignificant difference in cholesterol (P=.331), LH (P=.215) and FSH (P=.571) levels. Those with gynecomastia were significantly older, had lower gonad stage, had higher anthropometric (height, weight, and BMI), and lipid (triglycerides, HDL, and LDL) values. In multivariate regression analysis, factors significantly associated with gynecomastia were BMI (odds ratio [OR]=1.05; 95%CI 1.00-1.10; P=.013), HDL (OR=0.42; 95%CI 0.19-0.92; P=.03), and gonad (Stage II OR=2.23; 95%CI 1.27-3.92; P=.005, Stage III OR=6.40; 95%CI 2.70-15.0; P gynecomastia tends to increase in mid-puberty. In our setting, BMI, HDL, and gonad stage were the major factors associated with the development of pubertal gynecomastia.
Castellanos-Ryan, Natalie; Parent, Sophie; Vitaro, Frank; Tremblay, Richard E; Séguin, Jean R
2013-08-01
Most research linking early pubertal development to substance use has focused on the effects of pubertal timing (age at which a certain stage of pubertal development is reached or pubertal status at a particular age--related to the maturation disparity hypothesis), but little research has focused on pubertal tempo (rate of growth through pubertal stages--related to the maturation compression hypothesis). However, both timing and tempo have not only been identified as important components of pubertal development, with different predictors, but have also been shown to be independently associated with other adolescent psychopathologies. Using latent growth-curve modeling, this study examined how pubertal status at age 12 and pubertal tempo (between 11 and 13 years) related to substance use from 15 to 16 years in boys from low socioeconomic backgrounds (N = 871). Results showed that both pubertal status at age 12 and tempo were significant predictors of increased levels of substance use and problems in mid to late adolescence. In an attempt to identify mechanisms that may explain the association between pubertal development and substance use it was found that sensation seeking partially mediated the association between pubertal status at age 12 and substance use behaviors. Impulse control was found to moderate the association sensation seeking had with marijuana use frequency, with high sensation-seeking scores predicting higher marijuana use frequency only at low levels of impulse control. These findings highlight the importance of considering multiple sources of individual variability in the pubertal development of boys and provide support for both the maturational disparity and compression hypotheses. PsycINFO Database Record (c) 2013 APA, all rights reserved.
Exciting fear in adolescence: Does pubertal development alter threat processing?
Spielberg, JM; Olino, TM; Forbes, EE; Dahl, RE
2014-01-01
Adolescent development encompasses an ostensible paradox in threat processing. Risk taking increases dramatically after the onset of puberty, contributing to a 200% increase in mortality. Yet, pubertal maturation is associated with increased reactivity in threat-avoidance systems. In the first part of this paper we propose a heuristic model of adolescent affective development that may help to reconcile aspects of this paradox, which focuses on hypothesized pubertal increases in the capacity t...
Exciting fear in adolescence: Does pubertal development alter threat processing?
Directory of Open Access Journals (Sweden)
Jeffrey M. Spielberg
2014-04-01
Full Text Available Adolescent development encompasses an ostensible paradox in threat processing. Risk taking increases dramatically after the onset of puberty, contributing to a 200% increase in mortality. Yet, pubertal maturation is associated with increased reactivity in threat-avoidance systems. In the first part of this paper we propose a heuristic model of adolescent affective development that may help to reconcile aspects of this paradox, which focuses on hypothesized pubertal increases in the capacity to experience (some fear-evoking experiences as an exciting thrill. In the second part of this paper, we test key features of this model by examining brain activation to threat cues in a longitudinal study that disentangled pubertal and age effects. Pubertal increases in testosterone predicted increased activation to threat cues, not only in regions associated with threat avoidance (i.e., amygdala, but also regions associated with reward pursuit (i.e., nucleus accumbens. These findings are consistent with our hypothesis that puberty is associated with a maturational shift toward more complex processing of threat cues—which may contribute to adolescent tendencies to explore and enjoy some types of risky experiences.
Exciting fear in adolescence: does pubertal development alter threat processing?
Spielberg, Jeffrey M; Olino, Thomas M; Forbes, Erika E; Dahl, Ronald E
2014-04-01
Adolescent development encompasses an ostensible paradox in threat processing. Risk taking increases dramatically after the onset of puberty, contributing to a 200% increase in mortality. Yet, pubertal maturation is associated with increased reactivity in threat-avoidance systems. In the first part of this paper we propose a heuristic model of adolescent affective development that may help to reconcile aspects of this paradox, which focuses on hypothesized pubertal increases in the capacity to experience (some) fear-evoking experiences as an exciting thrill. In the second part of this paper, we test key features of this model by examining brain activation to threat cues in a longitudinal study that disentangled pubertal and age effects. Pubertal increases in testosterone predicted increased activation to threat cues, not only in regions associated with threat avoidance (i.e., amygdala), but also regions associated with reward pursuit (i.e., nucleus accumbens). These findings are consistent with our hypothesis that puberty is associated with a maturational shift toward more complex processing of threat cues--which may contribute to adolescent tendencies to explore and enjoy some types of risky experiences. Copyright © 2014 The Authors. Published by Elsevier Ltd.. All rights reserved.
Carter, Rona; Silverman, Wendy K; Jaccard, James
2011-01-01
This study evaluated whether pubertal development and gender role orientation (i.e., masculinity and femininity) can partially explain sex variations in youth anxiety symptoms among clinic-referred anxious youth (N = 175; ages 9-13 years; 74% Hispanic; 48% female). Using youth and parent ratings of youth anxiety symptoms, structural equation modeling results indicated that youth who reported being more advanced in their pubertal development reported high levels of femininity and anxiety symptoms. Youth who reported high levels of masculinity had low levels of anxiety symptoms as reported by both youths and parents. The estimated effects of pubertal development, femininity, and masculinity on youth and parent ratings of youth anxiety symptoms were not significantly moderated by biological sex. Pubertal development and gender role orientation appear to be important in explaining levels of youth anxiety symptoms among clinic-referred anxious youth.
Pubertal development in healthy children is mirrored by DNA methylation patterns in peripheral blood
DEFF Research Database (Denmark)
Almstrup, Kristian; Johansen, Marie Lindhardt; Busch, Alexander S.
2016-01-01
Puberty marks numerous physiological processes which are initiated by central activation of the hypothalamic–pituitary–gonadal axis, followed by development of secondary sexual characteristics. To a large extent, pubertal timing is heritable, but current knowledge of genetic polymorphismsonly...... explains few months in the large inter-individual variation in the timing of puberty. We have analysed longitudinal genome-wide changes in DNA methylation in peripheral blood samples (n = 102) obtained from 51 healthy children before and after pubertal onset. We show that changes in single methylation...... sites are tightly associated with physiological pubertal transition and altered reproductive hormone levels. These methylation sites cluster in and around genes enriched for biological functions related to pubertal development. Importantly, we identified that methylation of the genomic region containing...
Elite athletes and pubertal delay.
Kapczuk, Karina
2017-10-01
Intensive physical training and participation in competitive sports during childhood and early adolescence may affect athletes' pubertal development. On the other hand, pubertal timing, early or late, may impact on an athlete selection for a particular sport. Genetic predisposition, training load, nutritional status and psychological stress determine athletes' pubertal timing. Athletes that practice esthetic sports, especially gymnasts, are predisposed to a delay in pubertal development. The growing evidence indicates that energy deficiency, not a systemic training per se, plays a crucial role in the pathogenesis of functional hypothalamic hypogonadism in female athletes. Metabolic and psychologic stress activate hypothalamic-pituitary-adrenal axis and suppress hypothalamic-pituitary-ovarian axis. Female athletes who do not begin secondary sexual development by the age of 14 or menstruation by the age of 16 warrant a comprehensive evaluation and a targeted treatment. Somatic growth and sexual maturation of elite female athletes are largely sport-specific since each sport favors a particular somatotype and requires a specific training. Chronic negative energy balance resulting from a systemic physical training and inadequate energy intake may delay pubertal development in elite athletes. Youth athletes, especially those engaged in competitive sports that emphasize prepubertal or lean appearance, are at risk of developing relative energy deficiency in sport associated with disordered eating or eating disorders. Management strategies should address the complex conditions underlying functional hypothalamic hypogonadism.
Role Of Serum Lectin In Derangement Of PUBERTAL Timing In Thalassaemic Patients
International Nuclear Information System (INIS)
MOAWAD, A.T.; NASSAR, E.M.; EL-NASHAR, N.A.
2010-01-01
The purpose of this study was to investigate the association between serum leptin and pubertal derangement in β-thalassemia major (TM) patients. This study was conducted on forty TM patients (25 males and 15 females) with mean age 15.6 ±1.47 and twenty healthy children with normal pubertal development served as control (10 males and 10 females). Clinical, anthropometric and pubertal assessment using tanner classification were done for all patients and controls in addition to estimation of serum ferritin, leptin, follicle stimulating hormone (FSH), luteinizing hormone (LH), testosterone (T) in boys and estradiol (E 2 ) in girls. Thalassaemic patients were subdivided into 27 patients with normal puberty and 13 delayed puberty patients. The results showed that failure of puberty was confirmed in 70% of boys and in 67% of girls. Body mass index (BMI) was significantly decreased in both patient groups as compared to controls. Mean serum ferritin levels were significantly increased in TM patients with delayed puberty (male: 2865.5±274.7 and female: 2704.5±477.1 ng/ml) than the levels in euogonadal patients (male: 1594.1±408.8 and female: 1524.1±349.6 ng/ml). However, a significant difference in serum ferritin was also detected between euogonadal patients and controls. Although the mean serum leptin levels were significantly higher in normal pubertal patients (male: 3.7± 0.4 and female: 7.6±1.2 ng/ml) comparing to the levels in delayed puberty patients (male: 0.9± 0.4 and female: 2.6±0.9 ng/ml), it was still lower than levels in control group (male: 8.4±2.8 and female: 12.3±1.9 ng/ml). The mean serum levels of FSH and LH were significantly decreased in delayed puberty patients when compared to each of normal puberty patients and controls. However, the comparison between normal patients and controls was non-significant. A close positive correlation was observed between serum leptin and BMI in normal pubertal patients, but such correlation was not obtained in
Putative effects of endocrine disrupters on pubertal development in the human
DEFF Research Database (Denmark)
Teilmann, Grete; Juul, Anders; Skakkebaek, Niels E
2002-01-01
developing countries to industrialized countries often develop precocious puberty. Not only precocious puberty, but also delayed puberty can, theoretically, be associated with exposure to endocrine disrupters. While it is very plausible that endocrine disrupters may disturb pubertal development...
Endothelial function in pre-pubertal children at risk of developing cardiomyopathy: a new frontier
Directory of Open Access Journals (Sweden)
Aline Cristina Tavares
2012-01-01
Full Text Available Although it is known that obesity, diabetes, and Kawasaki's disease play important roles in systemic inflammation and in the development of both endothelial dysfunction and cardiomyopathy, there is a lack of data regarding the endothelial function of pre-pubertal children suffering from cardiomyopathy. In this study, we performed a systematic review of the literature on pre-pubertal children at risk of developing cardiomyopathy to assess the endothelial function of pre-pubertal children at risk of developing cardiomyopathy. We searched the published literature indexed in PubMed, Bireme and SciELO using the keywords 'endothelial', 'children', 'pediatric' and 'infant' and then compiled a systematic review. The end points were age, the pubertal stage, sex differences, the method used for the endothelial evaluation and the endothelial values themselves. No studies on children with cardiomyopathy were found. Only 11 papers were selected for our complete analysis, where these included reports on the flow-mediated percentage dilatation, the values of which were 9.80±1.80, 5.90±1.29, 4.50±0.70, and 7.10±1.27 for healthy, obese, diabetic and pre-pubertal children with Kawasaki's disease, respectively. There was no significant difference in the dilatation, independent of the endothelium, either among the groups or between the genders for both of the measurements in children; similar results have been found in adolescents and adults. The endothelial function in cardiomyopathic children remains unclear because of the lack of data; nevertheless, the known dysfunctions in children with obesity, type 1 diabetes and Kawasaki's disease may influence the severity of the cardiovascular symptoms, the prognosis, and the mortality rate. The results of this study encourage future research into the consequences of endothelial dysfunction in pre-pubertal children.
Pubertal development in Danish children
DEFF Research Database (Denmark)
Juul, A; Teilmann, G; Scheike, Thomas Harder
2006-01-01
.0012). In Danish boys we found that age at genital stage 2 (G2) was 11.83 years. Both sexes were significantly taller compared with data from 1964, but timing of pubertal maturation seemed unaltered. Finally, puberty occurred much later in Denmark compared with recent data from USA. We could not detect any...
Kwok, Man Ki; Leung, Gabriel M; Schooling, C Mary
2016-01-01
Birth order has been proposed as a cardiovascular risk factor, because the lower birth weight and greater infant weight gain typical of firstborns could programme metabolism detrimentally. We examined the associations of birth order (firstborn or laterborn) with birth weight-for-gestational age, length/height and body mass index (BMI) z-scores during infancy, childhood, and puberty using generalized estimating equations, with age at pubertal onset using interval-censored regression and with age-, sex- and height-standardized blood pressure, height and BMI z-scores at 13 years using linear regression in a population-representative Chinese birth cohort: "Children of 1997" (n = 8,327). Compared with laterborns, firstborns had lower birth weight-for-gestational age (mean difference = -0.18 z-score, 95% confidence interval (CI) -0.23, -0.14), lower infant BMI (-0.09 z-score, 95% CI -0.14, -0.04), greater childhood height (0.10 z-score, 95% CI 0.05, 0.14) and BMI (0.08 z-score, 95% CI 0.03, 0.14), but not greater pubertal BMI (0.05 z-score, 95% CI -0.02, 0.11), adjusted for sex, parental age, birthplace, education and income. Firstborns had earlier onset of pubic hair (time ratio = 0.988, 95% CI 0.980, 0.996), but not breast or genitalia, development. Firstborns had greater BMI (0.07 z-score, 95% CI 0.002, 0.15), but not height (0.05 z-score, 95% CI -0.01, 0.11), at 13 years, but similar blood pressure. Differences by birth order continue into early adolescence with firstborns being heavier with earlier pubic hair development, which could indicate long-term cardiovascular risk.
Directory of Open Access Journals (Sweden)
Man Ki Kwok
Full Text Available Birth order has been proposed as a cardiovascular risk factor, because the lower birth weight and greater infant weight gain typical of firstborns could programme metabolism detrimentally.We examined the associations of birth order (firstborn or laterborn with birth weight-for-gestational age, length/height and body mass index (BMI z-scores during infancy, childhood, and puberty using generalized estimating equations, with age at pubertal onset using interval-censored regression and with age-, sex- and height-standardized blood pressure, height and BMI z-scores at 13 years using linear regression in a population-representative Chinese birth cohort: "Children of 1997" (n = 8,327.Compared with laterborns, firstborns had lower birth weight-for-gestational age (mean difference = -0.18 z-score, 95% confidence interval (CI -0.23, -0.14, lower infant BMI (-0.09 z-score, 95% CI -0.14, -0.04, greater childhood height (0.10 z-score, 95% CI 0.05, 0.14 and BMI (0.08 z-score, 95% CI 0.03, 0.14, but not greater pubertal BMI (0.05 z-score, 95% CI -0.02, 0.11, adjusted for sex, parental age, birthplace, education and income. Firstborns had earlier onset of pubic hair (time ratio = 0.988, 95% CI 0.980, 0.996, but not breast or genitalia, development. Firstborns had greater BMI (0.07 z-score, 95% CI 0.002, 0.15, but not height (0.05 z-score, 95% CI -0.01, 0.11, at 13 years, but similar blood pressure.Differences by birth order continue into early adolescence with firstborns being heavier with earlier pubic hair development, which could indicate long-term cardiovascular risk.
Chen, Su-Ru; Chiu, Hung-Wen; Lee, Yann-Jinn; Sheen, Tzong-Chi; Jeng, Chii
2012-01-01
Child obesity is frequently associated with dysfunction of autonomic nervous system. Children in pubertal development were suggested to be vulnerable to autonomic nervous system problems such as decrease of heart rate variability from dysregulation of metabolic control. This study explored the influence of pubertal development on autonomic nervous…
Carrascosa, Antonio; Yeste, Diego; Moreno-Galdó, Antonio; Gussinyé, Miquel; Ferrández, Ángel; Clemente, María; Fernández-Cancio, Mónica
2018-02-20
Pubertal growth pattern differs according to age at pubertal growth spurt onset which occurs over a five years period (girls: 8-13 years, boys: 10-15 years). The need for more than one pubertal reference pattern has been proposed. We aimed to obtain five 1-year-age-interval pubertal patterns. Longitudinal (6 years of age-adult height) growth study of 1,453 healthy children to evaluate height-for-age, growth velocity-for-age and weight-for-age values. According to age at pubertal growth spurt onset girls were considered: very-early matures (8-9 years, n=119), early matures (9-10 years, n=157), intermediate matures (10-11 years, n=238), late matures (11-12 years, n=127) and very-late matures (12-13 years, n=102), and boys: very-early matures (10-11 years, n=110), early matures (11-12 years, n=139), intermediate matures (12-13 years, n=225), late matures (13-14 years, n=133) and very-late matures (14-15 years, n=103). Age at menarche and growth up to adult height were recorded. In both sexes, statistically-significant (P<.0001) and clinically-pertinent differences in pubertal growth pattern (mean height-for-age, mean growth velocity-for-age and mean pubertal height gain, values) were found among the five pubertal maturity groups and between each group and the whole population, despite similar adult height values. The same occurred for age at menarche and growth from menarche to adult height (P<.05). In both sexes, pubertal growth spurt onset is a critical milestone determining pubertal growth and sexual development. The contribution of our data to better clinical evaluation of growth according to the pubertal maturity tempo of each child will obviate the mistakes made when only one pubertal growth reference is used. Copyright © 2018. Publicado por Elsevier España, S.L.U.
Pubertal timing and adolescent sexual behavior in girls.
Moore, Sarah R; Harden, K Paige; Mendle, Jane
2014-06-01
Girls who experience earlier pubertal timing relative to peers also exhibit earlier timing of sexual intercourse and more unstable sexual relationships. Although pubertal development initiates feelings of physical desire, the transition into romantic and sexual relationships involves complex biological and social processes contributing both to physical maturation and to individual interpretations of pubertal experiences. Using a sample of female sibling pairs (n = 923 pairs) from the National Longitudinal Study of Adolescent Health, the present study investigated associations among menarche and perceived pubertal timing, age of first sexual intercourse (AFI), and adolescent dating and sexual behavior using a behavioral genetic approach. Genetic factors influencing age at menarche and perceived pubertal timing predicted AFI through shared genetic pathways, whereas genetic factors related only to perceived pubertal timing predicted engagement in dating, romantic sex, and nonromantic sex in the previous 18 months. These results suggest that a girl's interpretation of her pubertal timing beyond objective timing is important to consider for the timing and the contexts of romantic and reproductive behavior. PsycINFO Database Record (c) 2014 APA, all rights reserved.
Calzo, Jerel P.; Sonneville, Kendrin R.; Haines, Jess; Blood, Emily A.; Field, Alison E.; Austin, S. Bryn
2012-01-01
Purpose To examine how the associations among BMI and body dissatisfaction and weight and shape concern evolve from late childhood through late adolescence in boys and girls. Methods We analyze data from 9–18-year-olds from the Growing Up Today Study, a national prospective cohort of U.S. Youth (n= 16,882, yielding 59,750 repeated measures observations during five waves of data collection). Generalized additive models produced curves of association for body dissatisfaction and weight concern across BMI percentiles. Generalized estimating equations (adjusting for correlated within-subject repeated measures, sibling clusters, pubertal maturation, and region of residence) tested main and interactive effects of BMI, age, and gender. Results Girls above the 50th BMI percentile reported greater body dissatisfaction than girls below the 50th percentile. By contrast, boys who reported the most body dissatisfaction were either above the 75th BMI percentile (approaching overweight) or below the 10th percentile (approaching underweight). Body dissatisfaction increased with age for both girls and boys, but the gender-specific patterns of BMI effects remained constant. Male and female participants in the overweight/obese BMI range reported the greatest weight concern, but among older adolescents (particularly girls), healthy weight became increasingly associated with greater weight and shape concern. Conclusions Body dissatisfaction and weight and shape concern intensify across adolescence, but associations between the constructs and BMI remain gender-specific. Findings have important implications for eating disorder risk assessment and prevention. PMID:23084175
Marceau, Kristine; Ram, Nilam; Susman, Elizabeth
2014-01-01
Adolescents' and parents' reactions to pubertal development are hypothesized to contribute to changes in family dynamics. Using 7-year longitudinal data from the NICHD-SECCYD (488 boys, 475 girls) we examined relations between pubertal development (timing, tempo) and trajectories (developmental change and year-to-year lability) of parent-child conflict and closeness from age 8.5 to 15.5 years. Changes were mostly characterized by year-to-year fluctuations – lability. Parent-child conflict increased and closeness decreased some with age. Pubertal timing and tempo were more consistently associated with lability in parent-child relationships than with long-term trends, although faster tempo was associated with steeper decreases in parent-child closeness. Findings provide a platform for examining how puberty contributes to both long-term and transient changes in adolescents' relationships and adjustment. PMID:26321856
Meeuwes, M; Souza de Carvalho, T F; Cipolotti, R; Gurgel, R Q; Ferrão, T O; Peters, M; Agyemang, C
2013-12-01
To evaluate the occurrence of low bone mineral density (BMD) and its relationship with clinical and laboratorial characteristics in children and young adults with sickle cell anaemia living in Northeast-Brazil, and to assess the role of radiography in diagnosing low BMD. Bone mineral density of lumbar spine was measured by dual energy X-ray absorptiometry (DXA) in 27 patients with Sickle cell anaemia (SCA) aged 7-28 years. Clinical history, calcium and calorie intake, laboratory measurements, anthropometrics and pubertal development were assessed, and X-rays were obtained. Z-scores and T-scores for weight, height, Body Mass Index (BMI) and BMD were calculated using age and gender matched reference data. Mean lumbar spine BMD Z-scores and T-scores were -1.81 SD in boys and -0.80 SD in girls. BMD Z-scores were below -2 SD in 33.3% of girls and in 46.7% of boys. Low BMD (developing low BMD. © 2013 John Wiley & Sons Ltd.
Directory of Open Access Journals (Sweden)
José G B Derraik
Full Text Available We aimed to assess the effects of age, sex, body mass index (BMI, and anatomical site on skin thickness in children and adults with diabetes.We studied 103 otherwise healthy children and adolescents with type 1 diabetes aged 5-19 years, and 140 adults with type 1 and type 2 diabetes aged 20-85 years. The thicknesses of both the dermis and subcutis were assessed using ultrasound with a linear array transducer, on abdominal and thigh skin.There was an age-related thickening of both dermis (p<0.0001 and subcutis (p = 0.013 in children and adolescents. Girls displayed a substantial pubertal increase in subcutis of the thigh (+54%; p = 0.048 and abdomen (+68%; p = 0.009. Adults showed an age-related decrease in dermal (p = 0.021 and subcutis (p = 0.009 thicknesses. Pubertal girls had a thicker subcutis than pubertal boys in both thigh (16.7 vs 7.5 mm; p<0.0001 and abdomen (16.7 vs 8.8 mm; p<0.0001. Men had greater thigh dermal thickness than women (1.89 vs 1.65 mm; p = 0.003, while the subcutis was thicker in women in thigh (21.3 vs 17.9 mm; p = 0.012 and abdomen (17.7 vs 9.8 mm; p<0.0001. In boys, men, and women, both dermis and subcutis were thicker on the abdomen compared to thigh; in girls this was only so for dermal thickness. In both children and adults, the skin (dermis and subcutis became steadily thicker with increasing BMI (p<0.0001.Skin thickness is affected by age, pubertal status, gender, BMI, and anatomical site. Such differences may be important when considering appropriate sites for dermal/subcutaneous injections and other transdermal delivery systems.
Franken, Aart; Prinstein, Mitchell J; Dijkstra, Jan Kornelis; Steglich, Christian E G; Harakeh, Zeena; Vollebergh, Wilma A M
2016-11-01
This study examined friendship (de-)selection processes in early adolescence. Pubertal development was examined as a potential moderator. It was expected that pubertal development would be associated with an increased tendency for adolescents to select their friends based on their similarities in externalizing behavior engagement (i.e., delinquency, alcohol use, and tobacco use). Data were used from the first three waves of the SNARE (Social Network Analysis of Risk behavior in Early adolescence) study (N = 1144; 50 % boys; M age = 12.7; SD = 0.47), including students who entered the first year of secondary school. The hypothesis was tested using Stochastic Actor-Based Modeling in SIENA. While taking the network structure into account, and controlling for peer influence effects, the results supported this hypothesis. Early adolescents with higher pubertal development were as likely as their peers to select friends based on similarity in externalizing behavior and especially likely to remain friends with peers who had a similar level of externalizing behavior, and thus break friendship ties with dissimilar friends in this respect. As early adolescents are actively engaged in reorganizing their social context, adolescents with a higher pubertal development are especially likely to lose friendships with peers who do not engage in externalizing behavior, thus losing an important source of adaptive social control (i.e., friends who do not engage in externalizing behavior).
Putative effects of endocrine disrupters on pubertal development in the human
DEFF Research Database (Denmark)
Teilmann, Grete; Juul, Anders; Skakkebaek, Niels E
2002-01-01
-called endocrine disrupters. Precocious puberty has been described in several case reports of accidental exposure to oestrogenic compounds in cosmetic products, food and pharmaceuticals. Local epidemics of premature thelarche have also been suggested to be linked to endocrine disrupters. Children adopted from...... developing countries to industrialized countries often develop precocious puberty. Not only precocious puberty, but also delayed puberty can, theoretically, be associated with exposure to endocrine disrupters. While it is very plausible that endocrine disrupters may disturb pubertal development...
Pubertal development and prostate cancer risk
DEFF Research Database (Denmark)
Bonilla, Carolina; Lewis, Sarah J; Martin, Richard M
2016-01-01
, 0.91-1.00) and prostate cancer-specific mortality (hazard ratio amongst cases, per tertile: 0.94; 95 % CI, 0.90-0.98), but not with disease grade. CONCLUSIONS: Older age at sexual maturation is causally linked to a reduced risk of later prostate cancer, especially aggressive disease.......BACKGROUND: Epidemiological studies have observed a positive association between an earlier age at sexual development and prostate cancer, but markers of sexual maturation in boys are imprecise and observational estimates are likely to suffer from a degree of uncontrolled confounding. To obtain...... to a difference of one Tanner stage between pubertal boys of the same age) was associated with a 77 % (95 % CI, 43-91 %) reduced odds of high Gleason prostate cancer. In PRACTICAL, the puberty genetic score was associated with prostate cancer stage (OR of advanced vs. localized cancer, per tertile: 0.95; 95 % CI...
Meng, Yingying; Zhang, Jing; Zhang, Fenglin; Ai, Wei; Zhu, Xiaotong; Shu, Gang; Wang, Lina; Gao, Ping; Xi, Qianyun; Zhang, Yongliang; Liang, Xingwei; Jiang, Qingyan; Wang, Songbo
2017-01-11
It has been demonstrated that dietary fat affects pubertal mammary gland development. However, the role of lauric acid (LA) in this process remains unclear. Thus, this study aimed to investigate the effects of LA on mammary gland development in pubertal mice and to explore the underlying mechanism. In vitro, 100 μM LA significantly promoted proliferation of mouse mammary epithelial cell line HC11 by regulating expression of proliferative markers (cyclin D1/3, p21, PCNA). Meanwhile, LA activated the G protein-coupled receptor 84 (GPR84) and PI3K/Akt signaling pathway. In agreement, dietary 1% LA enhanced mammary duct development, increased the expression of GPR84 and cyclin D1, and activated PI3K/Akt in mammary gland of pubertal mice. Furthermore, knockdown of GPR84 or inhibition of PI3K/Akt totally abolished the promotion of HC11 proliferation induced by LA. These results showed that LA stimulated mammary gland development of pubertal mice through activation of GPR84 and PI3K/Akt signaling pathway.
Directory of Open Access Journals (Sweden)
Bindu Kulshreshtha
2012-01-01
Full Text Available Introduction: Children with congenital adrenal hyperplasia (CAH provide us an opportunity to study the clinical effects of androgen excess in humans. We studied the sequence of pubertal development in girls with congenital adrenal hyperplasia initiated on treatment at different ages, to assess the effects of androgen exposure on the Hypothalamic-Pituitary-Ovarian (HPO axis. Materials and Methods: Girls more than 18 years of age, with CAH, on follow-up at this hospital were the subjects for this study. Details of history, physical findings, laboratory evaluation, and medication were noted from their case records and verified from the patients and their / parents, in addition to assessment of their present health status. Result: We studied 24 patients of classical CAH (SW-2, SV-22, average age - 24.5 ± 6.6 years. All had varying degrees of genital ambiguity (Prader stage 3 (n = 13, Prader stage 2 (n = 10, Prader stage 1 (n = 1. Among them were13 girls, who were started on steroids after eight years of age. Girls who received treatment from infancy and early childhood had normal pubertal development (mean age at menarche 11.4 ± 1.7 years. Hirsutism was not a problem among them. Untreated children had progressive clitoral enlargement throughout childhood, developed pubic hair at around three to six years of age, and facial hair between nine and eleven years. Plasma testosterone ranged from 3 to 6 ng / ml prior to treatment. Six of the 13 untreated CAH girls had subtle breast development starting at ages 11 - 16 years and three had spontaneous infrequent vaginal bleeding starting at ages 11 - 17. Steroid supplementation initiated pubertal changes in older girls in two-to-six months′ time. Conclusion: There was a delay in HPO axis maturation (as evidenced by delayed pubertal development in the absence of treatment in girls with CAH. This could be corrected with steroid supplementation.
Serum AMH levels are lower in healthy boys who develop pubertal gynaecomastia
DEFF Research Database (Denmark)
Mieritz, Mikkel G.; Hagen, Casper P.; Almstrup, Kristian
2015-01-01
Background: Pubertal gynaecomastia is thought to be a clinical sign of an oestrogen-androgen imbalance, affecting up to 60% of boys. In most cases no underlying endocrinopathy can be identified. In boys, Anti-mullerian hormone (AMH) is produced by immature Sertoli cells and circulating level...... decreases as testosterone increases during pubertal maturation. In a previous cross sectional study we found significant lower levels of AMH in boys with pubertal gynaecomastia (Mieritz et al., Clin Endocrinol, 2013). Objective and hypotheses: To investigate serum AMH levels and genetic polymorphisms...... in boys with or without gynaecomastia. Method: 99 healthy Danish boys (aged 5.8-16.4 years) were followed in a prospective cohort over 8 years with semi-annual examinations (total examinations, n=951), including breast palpations and blood samples. Serum AMH concentrations were analysed by immunoassay...
Iprodione (IPRO) is a dichlorophenyl dicarboximide fungicide similar to the androgen receptor (AR) antagonist vinclozolin. The current studies were designed to determine if IPRO would delay male rat pubertal development like vinclozolin and to identify the mechanism(s) of action...
Farpour-Lambert, Nathalie J; Aggoun, Yacine; Marchand, Laetitia M; Martin, Xavier E; Herrmann, François R; Beghetti, Maurice
2009-12-15
The aim of this study was to determine the effects of physical activity on systemic blood pressure (BP) and early markers of atherosclerosis in pre-pubertal obese children. Hypertension and endothelial dysfunction are premature complications of obesity. We performed a 3-month randomized controlled trial with a modified crossover design: 44 pre-pubertal obese children (age 8.9 + or - 1.5 years) were randomly assigned (1:1) to an exercise (n = 22) or a control group (n = 22). We recruited 22 lean children (age 8.5 + or - 1.5 years) for baseline comparison. The exercise group trained 60 min 3 times/week during 3 months, whereas control subjects remained relatively inactive. Then, both groups trained twice/week during 3 months. We assessed changes at 3 and 6 months in office and 24-h BP, arterial intima-media thickness (IMT) and stiffness, endothelial function (flow-mediated dilation), body mass index (BMI), body fat, cardiorespiratory fitness (maximal oxygen consumption [VO(2)max]), physical activity, and biological markers. Obese children had higher BP, arterial stiffness, body weight, BMI, abdominal fat, insulin resistance indexes, and C-reactive protein levels, and lower flow-mediated dilation, VO(2)max, physical activity, and high-density lipoprotein cholesterol levels than lean subjects. At 3 months, we observed significant changes in 24-h systolic BP (exercise -6.9 + or - 13.5 mm Hg vs. control 3.8 + or - 7.9 mm Hg, -0.8 + or - 1.5 standard deviation score [SDS] vs. 0.4 + or - 0.8 SDS), diastolic BP (-0.5 + or - 1.0 SDS vs. 0 + or - 1.4 SDS), hypertension rate (-12% vs. -1%), office BP, BMI z-score, abdominal fat, and VO(2)max. At 6 months, change differences in arterial stiffness and IMT were significant. A regular physical activity program reduces BP, arterial stiffness, and abdominal fat; increases cardiorespiratory fitness; and delays arterial wall remodeling in pre-pubertal obese children. (Effects of Aerobic Exercise Training on Arterial Function and
Smith, Ashley R; Chein, Jason; Steinberg, Laurence
2013-07-01
While there is little doubt that risk-taking is generally more prevalent during adolescence than before or after, the underlying causes of this pattern of age differences have long been investigated and debated. One longstanding popular notion is the belief that risky and reckless behavior in adolescence is tied to the hormonal changes of puberty. However, the interactions between pubertal maturation and adolescent decision making remain largely understudied. In the current review, we discuss changes in decision making during adolescence, focusing on the asynchronous development of the affective, reward-focused processing system and the deliberative, reasoned processing system. As discussed, differential maturation in the structure and function of brain systems associated with these systems leaves adolescents particularly vulnerable to socio-emotional influences and risk-taking behaviors. We argue that this asynchrony may be partially linked to pubertal influences on development and specifically on the maturation of the affective, reward-focused processing system. Copyright © 2013 Elsevier Inc. All rights reserved.
Effects of programmed physical activity on body composition in post-pubertal schoolchildren.
Farias, Edson Dos Santos; Gonçalves, Ezequiel Moreira; Morcillo, André Moreno; Guerra-Júnior, Gil; Amancio, Olga Maria Silverio
2015-01-01
To assess body composition modifications in post-pubertal schoolchildren after practice of a physical activity program during one school year. The sample consisted of 386 students aged between 15 and 17 years and divided into two groups: the study group (SG) comprised 195 students and the control group (CG), 191. The SG was submitted to a physical activity program and the CG attended conventional physical education classes. Body composition was assessed using body mass index (BMI), percentage of body fat (%BF), fat mass (FM), and lean mass (LM). A positive effect of the physical activity program on body composition in the SG (pgenders. A reduction in %BF (mean of differences = -5.58%) and waist circumference (-2.33 cm), as well as an increase in LM (+2.05 kg) were observed in the SG for both genders, whereas the opposite was observed in the CG. The practice of programmed physical activity promotes significant reduction of body fat in post-pubertal schoolchildren. Copyright © 2013 Sociedade Brasileira de Pediatria. Published by Elsevier Editora Ltda. All rights reserved.
DEFF Research Database (Denmark)
Molgaard-Hansen, Lene; Skou, Anne-Sofie; Juul, Anders
2013-01-01
More than 60% of children with acute myeloid leukemia (AML) become long-term survivors. Most are cured using chemotherapy without hematopoietic stem cell transplantation (HSCT). We report on pubertal development and compare self-reported parenthood among AML survivors and their siblings....
Carter, Rona; Silverman, Wendy K.; Jaccard, James
2011-01-01
This study evaluated whether pubertal development and gender role orientation (i.e., masculinity and femininity) can partially explain sex variations in youth anxiety symptoms among clinic-referred anxious youth (N = 175; ages 9-13 years; 74% Hispanic; 48% female). Using youth and parent ratings of youth anxiety symptoms, structural equation…
Validity of self-assessment of pubertal maturation
DEFF Research Database (Denmark)
Rasmussen, Anna; Wohlfahrt-Veje, Christine; Tefre de Renzy-Martin, Katrine
2015-01-01
BACKGROUND AND OBJECTIVES: Studies of adolescents often use self-assessment of pubertal maturation, the reliability of which has shown conflicting results. We aimed to examine the reliability of child and parent assessments of healthy boys and girls. METHODS: A total of 898 children (418 girls, 480...... overestimated older than their peers who made correct assessments. Girls and their parents tended to underestimate, whereas boys overestimated their pubertal stage. CONCLUSIONS: Pubertal assessment by the child or the parents is not a reliable measure of exact pubertal staging and should be augmented...
Lappe, Joan M; Watson, Patrice; Gilsanz, Vicente; Hangartner, Thomas; Kalkwarf, Heidi J; Oberfield, Sharon; Shepherd, John; Winer, Karen K; Zemel, Babette
2015-01-01
Childhood and adolescence are critical periods of bone mineral content (BMC) accrual that may have long-term consequences for osteoporosis in adulthood. Adequate dietary calcium intake and weight-bearing physical activity are important for maximizing BMC accrual. However, the relative effects of physical activity and dietary calcium on BMC accrual throughout the continuum of pubertal development in childhood remains unclear. The purpose of this study was to determine the effects of self-reported dietary calcium intake and weight-bearing physical activity on bone mass accrual across the five stages of pubertal development in a large, diverse cohort of US children and adolescents. The Bone Mineral Density in Childhood study was a mixed longitudinal study with 7393 observations on 1743 subjects. Annually, we measured BMC by dual-energy X-ray absorptiometry (DXA), physical activity and calcium intake by questionnaire, and pubertal development (Tanner stage) by examination for up to 7 years. Mixed-effects regression models were used to assess physical activity and calcium intake effects on BMC accrual at each Tanner stage. We found that self-reported weight-bearing physical activity contributed to significantly greater BMC accrual in both sexes and racial subgroups (black and nonblack). In nonblack males, the magnitude of the activity effect on total body BMC accrual varied among Tanner stages after adjustment for calcium intake; the greatest difference between high- and low-activity boys was in Tanner stage 3. Calcium intake had a significant effect on bone accrual only in nonblack girls. This effect was not significantly different among Tanner stages. Our findings do not support differential effects of physical activity or calcium intake on bone mass accrual according to maturational stage. The study demonstrated significant longitudinal effects of weight-bearing physical activity on bone mass accrual through all stages of pubertal development. © 2014 American
Pubertal Timing and Youth Internalizing Psychopathology: The Role of Relational Aggression.
Pomerantz, Hayley; Parent, Justin; Forehand, Rex; Breslend, Nicole Lafko; Winer, Jeffrey P
2017-02-01
The current study examined relational aggression as a potential mechanism that explains the association between off-time pubertal development and internalizing problems in youth. Youth gender was also examined as a moderator for the association between these variables. It was hypothesized that early pubertal maturation would be associated with higher levels of relationally aggressive behavior which, in turn, would be associated with elevated levels of internalizing problems. Parents of 372 children between the ages of 8 and 17 were recruited through Amazon's Mechanical Turk. Parents responded to demographic information about themselves, as well as information about their child's pubertal timing, relationally aggressive behavior, and anxiety and depressive symptoms. Findings indicated that early pubertal timing was associated with higher levels of anxiety directly, and higher levels of both anxiety and depressive symptoms indirectly through higher levels of relational aggression. In all but one of the pathways examined, gender was not found to moderate the associations between the study variables of interest. This study is the first to examine relational aggression as a mechanism by which early pubertal timing leads to internalizing problems. The findings suggest that relational aggression could be a target for intervention among early developing youth who are at risk for internalizing problems.
Peer Exclusion During the Pubertal Transition: The Role of Social Competence.
Carter, Rona; Halawah, Amira; Trinh, Sarah L
2018-01-01
For some youth, early puberty is accompanied by peer exclusion. Yet early developers may experience less peer exclusion if they have social competence, which would bolster their ability to develop and maintain positive relationships with their peers. Accordingly, the present study tests whether pubertal timing and tempo predicts decrements in children's social competence and whether decrements in social competence account for associations between puberty (timing and tempo) and peer exclusion over time. Longitudinal data were drawn from 1364 families (48% female; 76% White; M = 9.32 years, SD = .48, at Wave 3) who participated in Waves 3-5 (i.e., grades 4-6) of Phase III of the NICHD-SECCYD. The results from latent growth curve models indicated that earlier pubertal timing and more rapid pubertal tempo among girls were associated with high initial levels of peer exclusion. Moreover, mediation analyses revealed that early developers' susceptibility to peer exclusion was associated with their initial level of social competence. In boys, pubertal timing and tempo were not directly associated with peer exclusion; instead, indirect effects of pubertal timing on peer exclusion (intercept, slope) occurred through initial levels of social competence. On average, early developers' who had low levels of social competence also had high initial levels of peer exclusion but experienced decrements in peer exclusion over time. The association between the intercepts for puberty and peer exclusion and the slopes for social competence and peer exclusion were stronger for boys than girls. Overall, our findings suggest that early developers' susceptibility to and experiences of peer exclusion are associated with their development of social competence.
Baams, Laura; Dubas, Judith Semon; Overbeek, Geertjan; van Aken, Marcel A G
2015-06-01
The present meta-analysis studies the relations of pubertal timing and status with sexual behavior and sexual risk behavior among youth aged 10.5-22.4 years. We included biological sex, age, and ethnicity as potential moderators. Four databases were searched for studies (published between 1980 and 2012) on the relation between pubertal timing or status and sexual behavior. The outcomes were (1) sexual intercourse; (2) combined sexual behavior; and (3) risky sexual behavior. Earlier pubertal timing or more advanced pubertal status was related to earlier and more sexual behavior, and earlier pubertal timing was related to more risky sexual behavior. Further, the links between (1) pubertal status and combined sexual behavior and (2) pubertal timing and sexual intercourse status, combined sexual behavior, and risky sexual behavior were stronger for girls than boys. Most links between pubertal status, timing, and sexual behavior and sexual risk behavior were stronger for younger adolescents. Moderation by ethnicity did not yield consistent results. There was significant variation in results among studies that was not fully explained by differences in biological sex, age, and ethnicity. Future research is needed to identify moderators that explain the variation in effects and to design sexual health interventions for young adolescents. Copyright © 2015 Society for Adolescent Health and Medicine. Published by Elsevier Inc. All rights reserved.
Effects of programmed physical activity on body composition in post-pubertal schoolchildren
Directory of Open Access Journals (Sweden)
Edson dos Santos Farias
2015-04-01
Full Text Available OBJECTIVE: To assess body composition modifications in post-pubertal schoolchildren after practice of a physical activity program during one school year. METHODS: The sample consisted of 386 students aged between 15 and 17 years and divided into two groups: the study group (SG comprised 195 students and the control group (CG, 191. The SG was submitted to a physical activity program and the CG attended conventional physical education classes. Body composition was assessed using body mass index (BMI, percentage of body fat (%BF, fat mass (FM, and lean mass (LM. RESULTS: A positive effect of the physical activity program on body composition in the SG (p < 0.001 was observed, as well as on the interaction time x group in all the variables analyzed in both genders. A reduction in %BF (mean of differences = -5.58% and waist circumference (-2.33 cm, as well as an increase in LM (+2.05 kg were observed in the SG for both genders, whereas the opposite was observed in the CG. CONCLUSION: The practice of programmed physical activity promotes significant reduction of body fat in post-pubertal schoolchildren.
Silk, Jennifer S; Siegle, Greg J; Whalen, Diana J; Ostapenko, Laura J; Ladouceur, Cecile D; Dahl, Ronald E
2009-01-01
This study investigated pupillary and behavioral responses to an emotional word valence identification paradigm among 32 pre-/early pubertal and 34 mid-/late pubertal typically developing children and adolescents. Participants were asked to identify the valence of positive, negative, and neutral words while pupil dilation was assessed using an eyetracker. Mid-/late pubertal children showed greater peak pupillary reactivity to words presented during the emotional word identification task than pre-/early pubertal children, regardless of word valence. Mid-/late pubertal children also showed smaller sustained pupil dilation than pre-/early pubertal children after the word was no longer on screen. These findings were replicated controlling for participants' age. In addition, mid-/late pubertal children had faster reaction times to all words, and rated themselves as more emotional during their laboratory visit compared to pre-/early pubertal children. Greater recall of emotional words following the task was associated with mid-/late pubertal status, and greater recall of emotional words was also associated with higher peak pupil dilation. These results provide physiological, behavioral, and subjective evidence consistent with a model of puberty-specific changes in neurobehavioral systems underpinning emotional reactivity.
Carter, Rona; Caldwell, Cleopatra Howard; Matusko, Niki; Antonucci, Toni; Jackson, James S.
2011-01-01
An accumulation of research evidence suggests that early pubertal timing plays a significant role in girls' behavioral and emotional problems. If early pubertal timing is a problematic event, then early developing Black girls should manifest evidence of this crisis because they tend to be the earliest to develop compared to other girls from…
Bittencourt, MarcosAlan Vieira; Cericato, GrazielaOro; Franco, Ademir; Girão, RafaelaSilva; Lima, Anderson Paulo Barbosa; Paranhos, LuizRenato
2018-05-01
This study aimed to search for scientific evidence concerning the accuracy of dental development for estimating the pubertal growth spurt. It was conducted according to the statements of PRISMA. An electronic search was performed in six databases, including the grey literature. The PICOS strategy was used to define the eligibility criteria and only observational studies were selected. Out of 1,416 identified citations, 10 articles fulfilled the criteria and were included in this systematic review. The association between dental development and skeletal maturity was considered strong in seven studies, and moderate in two, although the association with the pubertal growth spurt had been verified in only four articles. According to half of the studies, the tooth that provided the greater association with the ossification centres was the lower canine. The meta-analysis performed also indicated a positive association, being stronger in females [0.725 (0.649-0.808)]. However, when the method used for dental evaluation was considered, it was possible to verify greater correlation coefficients for Nolla [0.736 (0.666-0.814)] than for Demirjian [0.631 (0.450-0.884)], at the boys sample. The heterogeneity test reached high values (Q = 51.00), suggesting a potential bias within the studies. Most of individual studies suggested a strong correlation between dental development and skeletal maturation, although the association with the peakof pubertal growth spurtwas clearly cited only in some of them. However, due to the high heterogeneity found among the studies included in this meta-analysis, a pragmatic recommendation about the use of dental stages is not possible.
Pubertal stage and the prevalence of violence and social/relational aggression.
Hemphill, Sheryl A; Kotevski, Aneta; Herrenkohl, Todd I; Toumbourou, John W; Carlin, John B; Catalano, Richard F; Patton, George C
2010-08-01
We examined associations between pubertal stage and violent adolescent behavior and social/relational aggression. The International Youth Development Study comprises statewide representative student samples in grades 5, 7, and 9 (N = 5769) in Washington State and Victoria, Australia, drawn as a 2-stage cluster sample in each state. We used a school-administered, self-report student survey to measure previous-year violent behavior (ie, attacking or beating up another person) and social/relational aggression (excluding peers from the group, threatening to spread lies or rumors), as well as risk and protective factors and pubertal development. Cross-sectional data were analyzed. Compared with early puberty, the odds of violent behavior were approximately threefold higher in midpuberty (odds ratio [OR]: 2.87 [95% confidence interval (CI): 1.81-4.55]) and late puberty (OR: 3.79 [95% CI: 2.25-6.39]) after adjustment for demographic factors. For social/relational aggression, there were weaker overall associations after adjustment, but these associations included an interaction between pubertal stage and age, and stronger associations with pubertal stage at younger age were shown (P = .003; midpuberty OR: 1.78 [95% CI: 1.20-2.63]; late puberty OR: 3.00 [95% CI: 1.95-4.63]). Associations between pubertal stage and violent behavior and social/relational aggression remained after the inclusion of social contextual mediators in the analyses. Pubertal stage was associated with higher rates of violent behavior and social/relational aggression, with the latter association seen only at younger ages. Puberty is an important phase at which to implement prevention programs to reduce adolescent violent and antisocial behaviors.
Marwaha, Ramank K; Garg, M K; Gupta, Sushil; Ganie, Mohd Ashraf; Gupta, Nandita; Narang, Archna; Shukla, Manoj; Arora, Preeti; Singh, Annie; Chadha, Aditi; Mithal, Ambrish
2018-03-28
There is a high prevalence of vitamin D deficiency (VDD) in India. Molecular mechanisms suggest a strong relationship between vitamin D and growth factors. However, there is a paucity of literature with regard to a relationship between insulin-like growth factor-1 (IGF-1), insulin-like growth factor binding protein-3 (IGFBP-3) and vitamin D particularly in subjects with VDD. The objective of the study was to assess the relationship between growth factors and serum vitamin D-parathormone (PTH) status in school girls and study the impact of vitamin D supplementation on growth factors in pre-pubertal girls with VDD. Our study subjects were apparently healthy school girls aged 6-18 years. The baseline height, weight, body mass index (BMI), pubertal status, serum 25-hydroxy vitamin D (25OHD), PTH, IGF-1 and IGFBP-3 were assessed in 847 girls aged 6-18 years and in 190 pre-pubertal girls with VDD following supplementation. The mean age, BMI and serum 25OHD of girls were 11.5±3.2 years, 18.7±4.8 kg/m2 and 9.9±5.6 ng/mL, respectively. VDD was observed in 94.6% of girls. Unadjusted serum IGF-1 levels and IGF-1/IGFBP-3 molar ratio were significantly higher in girls with severe VDD as compared to girls with mild-to-moderate VDD. However, these differences disappeared when adjusted for age, height or sexual maturation. The serum IGF-1 and IGFBP-3 levels increased significantly post supplementation with vitamin D. There were no differences in serum IGF-1 levels and the IGF-1/IGFBP-3 molar ratio among VDD categories when adjusted for age, height and sexual maturation in girls. Vitamin D supplementation resulted in a significant increase in serum IGF-1 levels in VDD pre-pubertal girls.
Reproductive ability of pubertal male and female rats
Directory of Open Access Journals (Sweden)
T. Zemunik
2003-07-01
Full Text Available Ten Fisher rats 50 to 55 days of age made up the pubertal group, and ten rats 90 to 95 days of age served as the controls. The testicular and epididymal weights and volumes of the pubertal males were lower than those of the controls (P0.05. At the beginning of gestation, the pubertal dams weighed less than the controls (P<0.001 but following uterectomy the body weights were equal. Pubertal dams delivered fewer pups than the controls (8.1 ± 2.5 vs 10.4 ± 1.3, P<0.05. There was no difference in the body weights of their offspring or in the weights of their placentas. The results suggest that, in contrast to their female counterparts, pubertal male rats are not fully mature and have not reached complete reproductive capacity at 50-55 days of age.
Kilic, Mustafa; Kanbur, Nuray; Derman, Orhan; Akgül, Sinem; Kutluk, Tezer
2011-01-01
To investigate the relationships between pubertal gynecomastia, prostate-specific antigen (PSA), free androgen index (FAI), sex hormone-binding globulin (SHBG) and sex steroids. A total of 61 male adolescents (10-17 years old; mean: 13.67 +/- 1.08) with gynecomastia were enrolled into the study group. A total of 65 healthy age-matched adolescents were included in the control group. Body mass index (BMI), Tanner staging, testis volume, stretched penis length (SPL) and bone age were evaluated. Serum follicle-stimulating hormone, luteinizing hormone (LH), estradiol (E2), testosterone, free testosterone, SHBG, PSA levels were determined and FAI was calculated. In the study group, free testosterone (p = 0.012) and FAI (p = 0.05) were significantly lower than the control group. In the control group, SHBG levels decreased (p 0.05). High FAI was found to decrease the risk of gynecomastia (odds ratio: 0.211, 95% confidence interval: 0.064-0.694, p = 0.01). PSA showed a positive correlation with FAI, free testosterone, Tanner staging, testosterone, E2 and LH levels. PSA is a good indicator of androgen activity during puberty. However, owing to FAI remaining as the single significant variable for pubertal gynecomastia, we suggest that it is still the best parameter to elucidate the etiopathogenesis of gynecomastia as well as other pubertal developmental abnormalities in male adolescents, and further longitudinal studies are needed to investigate the relationships between PSA and FAI in puberty.
Lewis, M E; Shapland, F; Watts, R
2016-03-01
Adolescence is a unique period in human development encompassing sexual maturation (puberty) and the physical and psychological transition into adulthood. It is a crucial time for healthy development and any adverse environmental conditions, poor nutrition, or chronic infection can alter the timing of these physical changes; delaying menarche in girls or the age of peak height velocity in boys. This study explores the impact of chronic illness on the tempo of puberty in 607 adolescent skeletons from medieval England (AD 900-1550). A total of 135 (22.2%) adolescents showed some delay in their pubertal development, and this lag increased with age. Of those with a chronic condition, 40.0% (n=24/60) showed delay compared to only 20.3% (n=111/547) of the non-pathology group. This difference was statistically significant. A binary logistic regression model demonstrated a significant association between increasing delay in pubertal stage attainment with age in the pathology group. This is the first time that chronic conditions have been directly associated with a delay in maturation in the osteological record, using a new method to assess stages of puberty in skeletal remains. Copyright © 2015 Elsevier Inc. All rights reserved.
Association Between Urinary Phthalates and Pubertal Timing in Chinese Adolescents
Directory of Open Access Journals (Sweden)
Huijing Shi
2015-09-01
Full Text Available Background: Phthalates are synthetic chemicals and ubiquitous environmental contaminants, with hormonal activity that may alter the course of pubertal development in children. Objectives: To determine whether exposure to phthalate metabolites is associated with timing of pubertal development in a cross-sectional study of a school-based clustered sample of 503 children from a suburban district in Shanghai, China, who were 7–14 years of age at enrollment (2010 October to November. Methods: We analyzed six phthalate metabolites in urine samples by isotope-dilution liquid chromatography tandem mass spectrometry. The associations of exposures to phthalates with pubertal timing of testes, breast, and pubic hair development (represented as Tanner stages were evaluated using an ordered logistic regression model adjusted for chronological age, body fat proportion (BF%, and parental education. Results: In boys, urinary mono-n-butyl phthalate (MBP levels were negatively associated with testicular volume, and mono (2-ethyl-5-hydroxyhexyl phthalate (MEHHP and mono (2-ethyl-5-oxohexyl phthalate (MEOHP levels were negatively associated with pubic hair stages. The odds of being in an advanced stage were decreased by 43%–51%. In girls, mono (2-ethylhexyl phthalate (MEHP, MEHHP, and MEOHP levels, as well as the sum of these levels, were positively associated with breast stages, and the association was much stronger in girls with high BF%; the odds of being in an advanced stage were increase by 29% to 50%. Conclusions: Phthalate metabolites investigated in this study show significant associations with pubertal timing both in boys and in girls, especially among girls with high BF%.
Gambarini, M L; Kunz, T L; Oliveira Filho, B D; Porto, R N G; Oliveira, C M G; Brito, W M E D; Viu, M A O
2009-10-01
In order to determine the role of Mycoplasma spp, Ureaplasma diversum and BHV-1 as causal agents of Granular Vulvovaginitis Syndrome in Nelore heifers raised under tropical conditions and based on the hypothesis that stressful conditions during puberty or breeding season would be a determinant factor for the infection, 340 heifers not vaccinated against BHV-1 were divided in Post-pubertal, in the beginning of the first breeding season, and Pubertal heifers. The vaginal lesion score (VLS) Grade 1 to 4 was giving according to lesion area and severity. Vaginal mucus was used to isolate Mycoplasma spp., Ureaplasma diversum and BHV-1. The predominant VLS was 2. No sample was positive for BHV-1; 48% were positive for Mycoplasma spp., Ureaplasma diversum, or both, with predominance of Ureaplasma diversum. Serum neutralization for BHV-1 showed more positive animals in pubertal group (23%); 3 of the paired sera demonstrated seroconversion. These data indicated that post-pubertal and pubertal Nelore heifers raised under extensive conditions are more susceptible to Mycoplasma spp. and Ureaplasma diversum. The hypothesis that the stress of pubertal period could lead to an acute vaginal infection by HBV-1 was not proofed.
Pubertal stage and the prevalence of violence and social relational aggression
Hemphill, Sheryl A.; Kotevski, Aneta; Herrenkohl, Todd I.; Toumbourou, John W.; Carlin, John B.; Catalano, Richard F.; Patton, George C.
2010-01-01
Objective Violence and social relational aggression are global problems that become prominent in early adolescence. This study examines associations between pubertal stage and adolescent violent behavior and social relational aggression. Methods This paper draws on cross-sectional data from the International Youth Development Study (IYDS), which comprised two state-wide representative samples of students in grades 5, 7 and 9 (N = 5,769) in Washington State in the United States and Victoria, Australia, drawn as a 2-stage cluster sample in each state. The study used carefully matched methods to conduct a school-administered, self-report student survey measuring behavioral outcomes including past year violent behavior (measured as attacking or beating up another person) and social relational aggression (excluding peers from the group, threatening to spread lies or rumors), as well as a comprehensive range of risk and protective factors and pubertal development. Results Compared with early puberty, the odds of violent behavior were approximately three-fold higher in mid-puberty (odds ratio [OR]: 2.87; 95% confidence interval [CI]: 1.81,4.55) and late puberty (OR: 3.79; 95% CI: 2.25,6.39), after adjustment for age, gender, state, and state by gender interaction. For social relational aggression, there were weaker overall associations after adjustment but these included an interaction between pubertal stage and age, showing stronger associations with pubertal stage at younger age (p = .003; mid-puberty OR 1.78; 95% CI 1.20,2.63; late puberty OR 3.00; 95% CI 1.95,4.63. Associations between pubertal stage and violent behavior and social relational aggression remained (although the magnitude of effects was reduced), after the inclusion of social contextual mediators in the analyses. Conclusions Pubertal stage was associated with higher rates of violent behavior and social relational aggression, with the latter association seen only at younger ages. Puberty may be an
Koo, Helen P.; Rose, Allison; Bhaskar, Brinda; Walker, Leslie R.
2012-01-01
Using a school-based sample of fifth graders (mean age = 10.38, SD = 0.66) and their parents (N = 408) from Washington, D.C., the authors examine associations of pubertal development with early adolescents' sexual and nonsexual risk behaviors and their caregivers' parenting behaviors and of these risk behaviors with parenting behaviors. Results…
Deardorff, J.; Cham, H.; Gonzales, NA.; White, R.M.B.; Tein, J.-Y.; Wong, J.; Roosa, M.W.
2012-01-01
Early-maturing girls are at risk for internalizing and externalizing problems. Scarce research has examined pubertal timing and mental health among Mexican Americans, or examined the influence of parenting behaviors on these relations. This study addressed these gaps. This was a prospective examination of 362 Mexican-origin girls and their mothers using three waves of data. Measures included girls’ self-report of pubertal development and girls’ and mothers’ report of maternal harsh parenting and daughters’ mental health. Using structural equation modeling, we examined whether pubertal timing in 5th grade predicted girls’ internalizing and externalizing outcomes in 10th grade. We also examined the mediating and moderating effects of harsh parenting on the relations between pubertal timing and internalizing and externalizing behaviors, as well as the influence of mothers’ and daughters’ nativity on these relations. Results differed depending on reporter and maternal nativity. Using daughters’ report, Mexican American mothers’ harsh parenting acted as a moderator. At high levels of harsh parenting, early pubertal timing predicted higher externalizing scores, while at low levels of harsh parenting, early timing predicted lower externalizing scores. For Mexican immigrant mothers, harsh parenting mediated the effects of pubertal timing on girls’ internalizing and externalizing problems. There were no significant pubertal effects for mothers’ report. Findings suggest that maternal harsh parenting plays a key role in the relations between early pubertal timing and behavioral and emotional outcomes among Mexican-origin girls. PMID:23231686
Mengel, Eva; Tillmann, Vallo; Remmel, Liina; Kool, Pille; Purge, Priit; Lätt, Evelin; Jürimäe, Jaak
2017-08-01
The aim of this 3-year prospective study was to examine changes in bone mineral characteristics during pubertal maturation in boys with different BMI values at the beginning of puberty and with different BMI increments during puberty. 26 boys with overweight and obesity (OWB) and 29 normal weight boys (NWB) were studied yearly for 3 years from the age of 11 years to measure the changes in different bone mineral characteristics. The OWB group was further divided into two subgroups according to extensive or non-extensive BMI increment during 3-year period. OWB had higher (P BMC), TB BMC for height, lumbar spine (LS) BMD, and LS BMC compared to NWB. Throughout the study period, OWB gained more TB BMD (P = 0.0001), TB BMC (P = 0.0048), TB BMC for height (P = 0.0124), LS BMD (P = 0.0029), and LS BMC (P = 0.0022) compared to NWB. Also during the study period, TB BMD (P = 0.0065), TB BMC (P = 0.0141), TB BMC for height (P = 0.0199), LS BMD (P = 0.0066), LS apparent volumetric BMD (BMAD) (P = 0.0075), and LS BMC (P = 0.017) increased significantly less in those OWB whose BMI increased more extensively. Extensive BMI gain is associated with lower increments in bone mineral characteristics in boys with overweight and obesity. Unfavorable increment in total body fat mass and percentage during pubertal years could be one reason for that.
Harden, K. Paige; Mendle, Jane
2014-01-01
Early pubertal timing places girls at elevated risk for a breadth of negative outcomes, including involvement in delinquent behavior. While previous developmental research has emphasized the unique social challenges faced by early maturing girls, this relation is complicated by genetic influences for both delinquent behavior and pubertal timing, which are seldom controlled for in existing research. The current study uses genetically informed data on 924 female-female twin and sibling pairs drawn from the National Longitudinal Study of Adolescent Health to (1) disentangle biological versus environmental mechanisms for the effects of early pubertal timing and (2) test for gene-environment interactions. Results indicate that early pubertal timing influences girls’ delinquency through a complex interplay between biological risk and environmental experiences. Genes related to earlier age at menarche and higher perceived development significantly predict increased involvement in both non-violent and violent delinquency. Moreover, after accounting for this genetic association between pubertal timing and delinquency, the impact of non-shared environmental influences on delinquency are significantly moderated by pubertal timing, such that the non-shared environment is most important among early maturing girls. This interaction effect is particularly evident for non-violent delinquency. Overall, results suggest early maturing girls are vulnerable to an interaction between genetic and environmental risks for delinquent behavior. PMID:21668078
Deleterious effects of obesity on physical fitness in pre-pubertal children.
Ceschia, Arianna; Giacomini, Stefano; Santarossa, Simone; Rugo, Miriam; Salvadego, Desy; Da Ponte, Alessandro; Driussi, Caterina; Mihaleje, Martina; Poser, Stefano; Lazzer, Stefano
2016-01-01
The prevalence of obesity in children has increased dramatically during the past decades in Europe and understanding physical fitness and its components in children is critical to design and implement effective interventions. The objective of the present study was to analyse the association between physical fitness (aerobic, speed, agility, power, flexibility and balance) and body mass index (BMI) in pre-pubertal children. A total of 2411 healthy schoolchildren (7-11 years) participated in this study. Anthropometric characteristics and body composition were assessed by skinfold thickness. Physical fitness was measured by nine physical fitness tests: endurance running, 20 m running speed, agility, handgrip strength, standing long jump and squat jump, sit and reach, medicine ball forward throw and static balance. No relevant differences were observed between boys and girls regarding anthropometric characteristics, body composition and physical fitness. However, overweight and obese children showed significantly lower physical fitness levels in endurance running, speed and agility (mean: +18.8, +5.5 and +14.5% of time to complete tasks, respectively), lower limb power normalised to body mass (-23.3%) and balance tests (number of falls: +165.5%) than their normal weight counterparts. On the other hand, obesity did not affect handgrip, throwing and flexibility. In conclusion, increased BMI was associated with lower performance capabilities limiting proper motor skill development, which directly affects the ability of children to take on sports skills. Actions undertaken to promote children's wellness and fitness should be prioritised and introduced early in life with the aim of enhancing physical fitness as well as preventing overweight and obesity.
Skoog, Therése; Bayram Özdemir, Sevgi; Stattin, Håkan
2016-02-01
The link between sexual maturation, or pubertal timing, in girls and adolescent depressive symptoms is well-documented, but the underlying processes remain unclear. We examined whether sexual harassment, which has previously been linked to both pubertal timing and depressive symptoms, mediates this link, using a two-wave longitudinal study including 454 girls in 7th (M age = 13.42, SD = .53) and 8th grade (M age = 14.42, SD = .55). Pubertal timing was linked to depressive symptoms in both age groups, and predicted an increase in depressive symptoms among the 7th graders. Sexual harassment significantly mediated the link between pubertal timing and depressive symptoms among the 7th, but not the 8th grade girls. Together, our findings suggest that one way to prevent depressive symptoms among early-maturing girls could be to address sexual harassment in preventive intervention in early adolescence.
Cardiovascular risk factors in pre-pubertal schoolchildren in Angola.
Silva, Amílcar B; Capingana, Daniel P; Magalhães, Pedro; Gonçalves, Mauer A; Molina, Maria Del Carmen B; Rodrigues, Sërgio L; Baldo, Marcelo P; Mateus, Miguel S; Mill, Josë Geraldo
The incidence of obesity is increasing worldwide, especially in countries with accelerated economic growth. We determined the prevalence of and associations between overweight/obesity and cardiovascular risk factors in pre-pubertal (seven- to 11-year-old) schoolchildren (both genders, n = 198) in Luanda, Angola. Biochemical (fasting blood) and clinical examinations were obtained in a single visit. Data are reported as prevalence (95% confidence intervals) and association (r, Pearson). Prevalence of overweight/obesity was 17.7% (12.4- 23.0%), high blood pressure (BP > 90% percentile) was 14.6% (9.7-19.5%), elevated glucose level was 16.7% (11.5-21.9%) and total cholesterol level > 170 mg/dl (4.4 mmol/l) was 69.2% (62.8-75.6%). Significant associations between body mass index (BMI) and systolic and diastolic BP (r = 0.46 and 0.40, respectively; p Angola and fat accumulation was directly associated with blood pressure increase but not with other cardiovascular risk factors.
Shapland, Fiona; Lewis, Mary E
2013-06-01
Puberty forms an important threshold between childhood and adulthood, but this subject has received little attention in bioarchaeology. The new application of clinical methods to assess pubertal stage in adolescent skeletal remains is explored, concentrating on the development of the mandibular canine, hamate, hand phalanges, iliac crest and distal radius. Initial results from the medieval cemetery of St. Peter's Church, Barton-upon-Humber, England suggest that application of these methods may provide insights into aspects of adolescent development. This analysis indicates that adolescents from this medieval site were entering the pubertal growth spurt at a similar age to their modern counterparts, but that the later stages of pubertal maturation were being significantly delayed, perhaps due to environmental stress. Continued testing and refinement of these methods on living adolescents is still necessary to improve our understanding of their significance and accuracy in predicting pubertal stages. Copyright © 2013 Wiley Periodicals, Inc.
Mobile phone radiation during pubertal development has no effect on testicular histology in rats.
Tumkaya, Levent; Kalkan, Yildiray; Bas, Orhan; Yilmaz, Adnan
2016-02-01
Mobile phones are extensively used throughout the world. There is a growing concern about the possible public health hazards posed by electromagnetic radiation emitted from mobile phones. Potential health risk applies particularly to the most intensive mobile phone users-typically, young people. The aim of this study was to investigate the effects of mobile phone exposure to the testes, by assessing the histopathological and biochemical changes in the testicular germ cells of rats during pubertal development. A total of 12 male Sprague Dawley rats were used. The study group (n = 6) was exposed to a mobile phone for 1 h a day for 45 days, while the control group (n = 6) remained unexposed. The testes were processed with routine paraffin histology and sectioned. They were stained with hematoxylin-eosin, caspase 3, and Ki-67 and then photographed. No changes were observed between the groups (p > 0.05). The interstitial connective tissue and cells of the exposed group were of normal morphology. No abnormalities in the histological appearance of the seminiferous tubules, including the spermatogenic cycle stage, were observed. Our study demonstrated that mobile phones with a low specific absorption rate have no harmful effects on pubertal rat testicles. © The Author(s) 2013.
Kwok, Man Ki; Leung, Gabriel M.; Schooling, C. Mary
2016-01-01
Background Birth order has been proposed as a cardiovascular risk factor, because the lower birth weight and greater infant weight gain typical of firstborns could programme metabolism detrimentally. Methods We examined the associations of birth order (firstborn or laterborn) with birth weight-for-gestational age, length/height and body mass index (BMI) z-scores during infancy, childhood, and puberty using generalized estimating equations, with age at pubertal onset using interval-censored re...
BMI and BMI SDS in childhood: annual increments and conditional change.
Brannsether, Bente; Eide, Geir Egil; Roelants, Mathieu; Bjerknes, Robert; Júlíusson, Pétur Benedikt
2017-02-01
Background Early detection of abnormal weight gain in childhood may be important for preventive purposes. It is still debated which annual changes in BMI should warrant attention. Aim To analyse 1-year increments of Body Mass Index (BMI) and standardised BMI (BMI SDS) in childhood and explore conditional change in BMI SDS as an alternative method to evaluate 1-year changes in BMI. Subjects and methods The distributions of 1-year increments of BMI (kg/m 2 ) and BMI SDS are summarised by percentiles. Differences according to sex, age, height, weight, initial BMI and weight status on the BMI and BMI SDS increments were assessed with multiple linear regression. Conditional change in BMI SDS was based on the correlation between annual BMI measurements converted to SDS. Results BMI increments depended significantly on sex, height, weight and initial BMI. Changes in BMI SDS depended significantly only on the initial BMI SDS. The distribution of conditional change in BMI SDS using a two-correlation model was close to normal (mean = 0.11, SD = 1.02, n = 1167), with 3.2% (2.3-4.4%) of the observations below -2 SD and 2.8% (2.0-4.0%) above +2 SD. Conclusion Conditional change in BMI SDS can be used to detect unexpected large changes in BMI SDS. Although this method requires the use of a computer, it may be clinically useful to detect aberrant weight development.
The duration of pubertal growth peak among three skeletal classes
Directory of Open Access Journals (Sweden)
Waqar Jeelani
Full Text Available ABSTRACT Introduction: Pubertal growth peak is closely associated with a rapid increase in mandibular length and offers a wide range of therapeutic modifiability. Objective: The aim of the present study was to determine and compare the mean ages of onset and duration of pubertal growth peak among three skeletal classes. Methods: A retrospective cross-sectional study was conducted using lateral cephalograms of 230 subjects with growth potential (110 males, 120 females. Subjects were categorized into three classes (Class I = 81, Class II = 82, Class III = 67, according to the sagittal relationship established between the maxilla and the mandible. The cervical vertebral maturation stage was recorded by means of Baccetti's method. The mean ages at CS3 and CS4 and the CS3-CS4 age interval were compared between boys and girls and among three skeletal classes. Results: Pubertal growth peak occurred on average four months earlier in girls than boys (p = 0.050. The average duration of pubertal growth peak was 11 months in Class I, seven months in Class II and 17 months in Class III subjects. Interclass differences were highly significant (Cohen's d > 0.08. However, no significant difference was found in the timing of pubertal growth peak onset among three skeletal classes (p = 0.126 in boys, p = 0.262 in girls. Conclusions: Girls enter pubertal growth peak on average four months earlier than boys. Moreover, the duration of pubertal growth peak is on average four months shorter in Class II and six months longer in Class III subjects as compared to Class I subjects.
Pubertal testosterone influences threat-related amygdala-orbitofrontal cortex coupling.
Spielberg, Jeffrey M; Forbes, Erika E; Ladouceur, Cecile D; Worthman, Carol M; Olino, Thomas M; Ryan, Neal D; Dahl, Ronald E
2015-03-01
Growing evidence indicates that normative pubertal maturation is associated with increased threat reactivity, and this developmental shift has been implicated in the increased rates of adolescent affective disorders. However, the neural mechanisms involved in this pubertal increase in threat reactivity remain unknown. Research in adults indicates that testosterone transiently decreases amygdala-orbitofrontal cortex (OFC) coupling. Consequently, we hypothesized that increased pubertal testosterone disrupts amygdala-OFC coupling, which may contribute to developmental increases in threat reactivity in some adolescents. Hypotheses were tested in a longitudinal study by examining the impact of testosterone on functional connectivity. Findings were consistent with hypotheses and advance our understanding of normative pubertal changes in neural systems instantiating affect/motivation. Finally, potential novel insights into the neurodevelopmental pathways that may contribute to adolescent vulnerability to behavioral and emotional problems are discussed. © The Author (2014). Published by Oxford University Press. For Permissions, please email: journals.permissions@oup.com.
Coming of age in Roman Britain: Osteological evidence for pubertal timing.
Arthur, Nichola A; Gowland, Rebecca L; Redfern, Rebecca C
2016-04-01
Puberty is a key transitional phase of the human life course, with important biological and social connotations. Novel methods for the identification of the pubertal growth spurt and menarche in skeletal remains have recently been proposed (Shapland and Lewis, 2013, 2014). In this study we applied the methods to two Romano-British cemetery samples (1st-early 5th centuries AD) in order to investigate the timing of puberty during this period and further assess the veracity of the methods. Shapland and Lewis' methods (2013, 2014) were applied to 38 adolescents (aged 8-20 years) from the British cemetery sites of Roman London (1st-early 5th centuries AD) and Queenford Farm, Oxfordshire (4th-early 5th centuries AD). Overall, the Romano-British males and females experienced the onset of puberty at similar ages to modern European adolescents, but subsequently experienced a longer period of pubertal development. Menarche occurred between the ages of 15 and 17 years for these Romano-British females, around 2 to 4 years later than for present-day European females. The observed Romano-British pattern of pubertal timing has various possible explanations, including exposure to environmental stressors in early urban environments. The pattern of pubertal timing is largely congruent with social age transitions alluded to in ancient texts and funerary evidence for this period. While there are limitations to the application of these techniques to archaeological samples, they were successfully applied in this study, and may have important implications for understandings of past life courses, as well as providing a long-term perspective on pubertal timing and biocultural interactions. © 2016 Wiley Periodicals, Inc.
Directory of Open Access Journals (Sweden)
M. Plamper
2017-01-01
Full Text Available Background. In T1DM, delayed pubertal development and reduced final height are associated with inadequate metabolic control. Objective. To assess whether T1DM affects pubertal growth spurt and whether metabolic control during puberty is gender-related. Methods. Using a large multicentre database, longitudinal data from 1294 patients were analysed. Inclusion criteria: complete records of height and HbA1c from the age of seven to 16 years. Exclusion criteria: other significant chronic diseases and medications, T1DM duration less than three months, and initial BMI 97th percentile. Results. Growth velocity (GV was impaired with a significant reduction of peak GV by 1.2 cm in boys. HbA1c increase during male puberty was lower except for a period of 1.5 years. The highest HbA1c increase in boys coincided with maximum growth spurt. In girls, the highest HbA1c increase was observed during late puberty. Even though there is impaired GV, both sexes reach a height at 16 years of age which corresponds to the background population height. Conclusion. Worsening of metabolic control is sex-discordant and associated with gender-specific alterations of GV. However, the vast majority of boys and girls with T1DM seems to reach normal height at the age of 16 years.
Chen, Jie; Yu, Jing; Wu, Yun; Zhang, Jianxin
2015-06-01
This study aimed to investigate the influences of pubertal timing and stressful life events on Chinese adolescents' depression and delinquency. Sex differences in these influences were also examined. A large sample with 4,228 participants aged 12-15 years (53% girls) was recruited in Beijing, China. Participants' pubertal development, stressful life events, depressive symptoms, and delinquency were measured using self-reported questionnaires. Both early maturing girls and boys displayed more delinquency than their same-sex on-time and late maturing peers. Early maturing girls displayed more depressive symptoms than on-time and late maturing girls, but boys in the three maturation groups showed similar levels of depressive symptoms. The interactive effects between early pubertal timing and stressful life events were significant in predicting depression and delinquency, particularly for girls. Early pubertal maturation is an important risk factor for Chinese adolescents' depression and delinquency. Stressful life events intensified the detrimental effects of early pubertal maturation on adolescents' depression and delinquency, particularly for girls. © 2015 The Institute of Psychology, Chinese Academy of Sciences and Wiley Publishing Asia Pty Ltd.
Pubertal status, interaction with significant others, and self-esteem of adolescent girls.
Lacković-Grgin, K; Dekovíc, M; Opacić, G
1994-01-01
The aim of this study was to examine the relationship between pubertal status, the quality of interactions with significant others, and the self-esteem of adolescent girls. The model which was tested, hypothesized that pubertal status affects self-esteem through girls' interactions with their parents and friends. Pubertal status was operationalized as the number of months between occurrence of the first menstrual periods and time of the investigation. The measure of self-esteem was the shortened form of the Coopersmith Self-Esteem Inventory. Analyses revealed that girls who begun menstruating six months before the investigation obtained higher scores on the measure of self-esteem than did girls who had been menstruating 13 months or more. The best predictor of self-esteem, however, was the quality of interaction with their mothers. The results support the theoretical view that stresses the importance of interaction with significant others for the development of self-esteem.
Serum inhibin B in healthy pubertal and adolescent boys
DEFF Research Database (Denmark)
Andersson, A M; Juul, A; Petersen, J H
1997-01-01
Inhibin B levels were measured in serum from 400 healthy Danish prepubertal, pubertal, and adolescent males, aged 6-20 yr, in a cross-sectional study using a recently developed immunoassay that is specific for inhibin B, the physiologically important inhibin form in men. In addition, serum levels...
Benjet, Corina; Hernandez-Guzman, Laura
2002-01-01
Studied the role of pubertal development on depression, externalizing behavior problems, self-esteem, and body-image of 951 Mexican early adolescents. Findings show that the acute experience of menarche adversely affected the psychological well-being of girls, specifically in terms of depressive symptomatology. Pubertal change in boys did not…
van den Bos, Esther; de Rooij, Mark; Miers, Anne C; Bokhorst, Caroline L; Westenberg, P Michiel
2014-01-01
Stress responses to social evaluation are thought to increase during adolescence, which may be due to pubertal maturation. However, empirical evidence is scarce. This study is the first to investigate the relation between pubertal development and biological responses to a social-evaluative stressor longitudinally. Participants performed the Leiden Public Speaking Task twice, with a 2-year interval (N = 217; age at Time 1: 8-17 years). The results support an increase in sensitivity to social evaluation during adolescence. The overall cortisol and alpha-amylase responses increased-both between and within participants-and were more strongly related to self-reported pubertal development than to age. The cortisol response shifted from speech delivery toward anticipation. The alpha-amylase response increased in both phases. © 2013 The Authors. Child Development © 2013 Society for Research in Child Development, Inc.
[Craniopharyngioma and Klinefelter syndrome during the pubertal transition: A diagnostic challenge].
Mocarbel, Yamile; Arébalo de Cross, Graciela; Lebrethon, Marie C; Thiry, Albert; Beckersd, Albert; Valdes-Socin, Hernan
2017-04-01
Craniopharyngioma is the most common pituitary tumor in childhood. It can compromise the pubertal development because of its evolution or treatment. Syndrome of Klinefelter is the most common cause of hipergonadotrophic hypogonadism in males. The concomitant presentation of both entities is extremely low (1/109) and the pathophysiological association is questionned. We present the case of a 18-year-old Belgian patient. He had a diagnosis of craniopharyngioma in childhood and he presented with panhypopituitarism after radiotherapy and surgical treatment. At the age of 14, he started pubertal induction with gonadotropin therapy without clinical response. Asociación de craneofaringioma y síndrome de Klinefelter en la transición puberal: un desafío diagnóstico Craniopharyngioma and Klinefelter syndrome during the pubertal transition: A diagnostic challenge A genetic evaluation confirmed a homogeneous 47, XXY karyotype. Failure of exogenous gonadotropin therapy revealed the hidden association of primary and secondary hypogonadism, demonstrating the importance of the followup and a multidisciplinary approach in these patients. Sociedad Argentina de Pediatría.
Sexual differentiation of human behavior: effects of prenatal and pubertal organizational hormones.
Berenbaum, Sheri A; Beltz, Adriene M
2011-04-01
A key question concerns the extent to which sexual differentiation of human behavior is influenced by sex hormones present during sensitive periods of development (organizational effects), as occurs in other mammalian species. The most important sensitive period has been considered to be prenatal, but there is increasing attention to puberty as another organizational period, with the possibility of decreasing sensitivity to sex hormones across the pubertal transition. In this paper, we review evidence that sex hormones present during the prenatal and pubertal periods produce permanent changes to behavior. There is good evidence that exposure to high levels of androgens during prenatal development results in masculinization of activity and occupational interests, sexual orientation, and some spatial abilities; prenatal androgens have a smaller effect on gender identity, and there is insufficient information about androgen effects on sex-linked behavior problems. There is little good evidence regarding long-lasting behavioral effects of pubertal hormones, but there is some suggestion that they influence gender identity and perhaps some sex-linked forms of psychopathology, and there are many opportunities to study this issue. Copyright © 2011 Elsevier Inc. All rights reserved.
Effects of Di-(2-ethylhexyl Phthalate on the Hypothalamus–Uterus in Pubertal Female Rats
Directory of Open Access Journals (Sweden)
Te Liu
2016-11-01
Full Text Available The pollution of endocrine disruptors and its impact on human reproductive system have attracted much attention. Di-(2-ethylhexyl phthalate (DEHP, an environmental endocrine disruptor, is widely used in food packages, containers, medical supplies and children’s toys. It can cause diseases such as infertility, sexual precocity and uterine bleeding and thus arouse concerns from the society and scholars. The effect of DEHP on pubertal female reproductive system is still not well-studied. This study was to investigate the effects of DEHP on the hypothalamus–uterus in pubertal female rats, reveal the reproductive toxicity of DEHP on pubertal female rats and its mechanism, and provide scientific evidence for the evaluation of toxicity and toxic mechanism of DEHP on reproductive system. Forty-eight pubertal female rats were randomly divided into four groups and respectively administered via oral gavage 0, 250, 500, or 1000 mg/kg/d DEHP in 0.1 mL corn oil/20 g body weight for up to four weeks. Compared with control rats, the DEHP-treated rats showed: (1 higher gonadotropin-releasing hormone (GnRH level in the hypothalamus; (2 higher protein levels of GnRH in the hypothalamus; and (3 higher mRNA and protein levels of GnRH receptor (GnRHR in the uterus. Our data reveal that DEHP exposure may lead to a disruption in pubertal female rats and an imbalance of hypothalamus–uterus. Meanwhile, DEHP may, through the GnRH in the hypothalamus and its receptor on the uterus, lead to diseases of the uterus. DEHP may impose a negative influence on the development and functioning of the reproductive system in pubertal female rats.
Effects of Di-(2-ethylhexyl) Phthalate on the Hypothalamus–Uterus in Pubertal Female Rats
Liu, Te; Jia, Yiyang; Zhou, Liting; Wang, Qi; Sun, Di; Xu, Jin; Wu, Juan; Chen, Huaiji; Xu, Feng; Ye, Lin
2016-01-01
The pollution of endocrine disruptors and its impact on human reproductive system have attracted much attention. Di-(2-ethylhexyl) phthalate (DEHP), an environmental endocrine disruptor, is widely used in food packages, containers, medical supplies and children’s toys. It can cause diseases such as infertility, sexual precocity and uterine bleeding and thus arouse concerns from the society and scholars. The effect of DEHP on pubertal female reproductive system is still not well-studied. This study was to investigate the effects of DEHP on the hypothalamus–uterus in pubertal female rats, reveal the reproductive toxicity of DEHP on pubertal female rats and its mechanism, and provide scientific evidence for the evaluation of toxicity and toxic mechanism of DEHP on reproductive system. Forty-eight pubertal female rats were randomly divided into four groups and respectively administered via oral gavage 0, 250, 500, or 1000 mg/kg/d DEHP in 0.1 mL corn oil/20 g body weight for up to four weeks. Compared with control rats, the DEHP-treated rats showed: (1) higher gonadotropin-releasing hormone (GnRH) level in the hypothalamus; (2) higher protein levels of GnRH in the hypothalamus; and (3) higher mRNA and protein levels of GnRH receptor (GnRHR) in the uterus. Our data reveal that DEHP exposure may lead to a disruption in pubertal female rats and an imbalance of hypothalamus–uterus. Meanwhile, DEHP may, through the GnRH in the hypothalamus and its receptor on the uterus, lead to diseases of the uterus. DEHP may impose a negative influence on the development and functioning of the reproductive system in pubertal female rats. PMID:27845755
van den Bos, Esther; de Rooij, Mark; Miers, Anne C.; Bokhorst, Caroline L.; Westenberg, P. Michiel
2014-01-01
Stress responses to social evaluation are thought to increase during adolescence, which may be due to pubertal maturation. However, empirical evidence is scarce. This study is the first to investigate the relation between pubertal development and biological responses to a social-evaluative stressor longitudinally. Participants performed the Leiden…
Brain Maturation, Cognition and Voice Pattern in a Gender Dysphoria Case under Pubertal Suppression.
Schneider, Maiko A; Spritzer, Poli M; Soll, Bianca Machado Borba; Fontanari, Anna M V; Carneiro, Marina; Tovar-Moll, Fernanda; Costa, Angelo B; da Silva, Dhiordan C; Schwarz, Karine; Anes, Maurício; Tramontina, Silza; Lobato, Maria I R
2017-01-01
Introduction: Gender dysphoria (GD) (DMS-5) is a condition marked by increasing psychological suffering that accompanies the incongruence between one's experienced or expressed gender and one's assigned gender. Manifestation of GD can be seen early on during childhood and adolescence. During this period, the development of undesirable sexual characteristics marks an acute suffering of being opposite to the sex of birth. Pubertal suppression with gonadotropin releasing hormone analogs (GnRHa) has been proposed for these individuals as a reversible treatment for postponing the pubertal development and attenuating psychological suffering. Recently, increased interest has been observed on the impact of this treatment on brain maturation, cognition and psychological performance. Objectives: The aim of this clinical report is to review the effects of puberty suppression on the brain white matter (WM) during adolescence. WM Fractional anisotropy, voice and cognitive functions were assessed before and during the treatment. MRI scans were acquired before, and after 22 and 28 months of hormonal suppression. Methods: We performed a longitudinal evaluation of a pubertal transgender girl undergoing hormonal treatment with GnRH analog. Three longitudinal magnetic resonance imaging (MRI) scans were performed for diffusion tensor imaging (DTI), regarding Fractional Anisotropy (FA) for regions of interest analysis. In parallel, voice samples for acoustic analysis as well as executive functioning with the Wechsler Intelligence Scale (WISC-IV) were performed. Results: During the follow-up, white matter fractional anisotropy did not increase, compared to normal male puberty effects on the brain. After 22 months of pubertal suppression, operational memory dropped 9 points and remained stable after 28 months of follow-up. The fundamental frequency of voice varied during the first year; however, it remained in the female range. Conclusion: Brain white matter fractional anisotropy
Duration of the pubertal peak in skeletal Class I and Class III subjects.
Kuc-Michalska, Małgorzata; Baccetti, Tiziano
2010-01-01
To estimate and compare the duration of the pubertal growth peak in Class I and Class III subjects. The data examined consisted of pretreatment lateral cephalometric records of 218 skeletal Class I or Class III subjects (93 female and 125 male subjects) of white ancestry. The duration of the pubertal peak was calculated from the average chronological age intervals between stages CS3 and CS4 of the cervical vertebral maturation in Class I vs Class III groups (t-test). In skeletal Class I subjects, the pubertal peak had a mean duration of 11 months, whereas in Class III subjects it lasted 16 months. The average difference (5 months) was statistically significant (P < .001). The growth interval corresponding to the pubertal growth spurt (CS3-CS4) was longer in Class III subjects than in subjects with normal skeletal relationships; the larger increases in mandibular length during the pubertal peak reported in the literature for Class III subjects may be related to the longer duration of the pubertal peak.
Watkins, Deborah J; Sánchez, Brisa N; Téllez-Rojo, Martha Maria; Lee, Joyce M; Mercado-García, Adriana; Blank-Goldenberg, Clara; Peterson, Karen E; Meeker, John D
2017-11-01
Over the past several decades, the age of pubertal onset in girls has shifted downward worldwide. As early pubertal onset is associated with increased risky behavior and psychological issues during adolescence and cardiometabolic disease and cancer in adulthood, this is an important public health concern. Exposure to endocrine disrupting chemicals during critical windows of in utero development may play a role in this trend. Our objective was to investigate trimester-specific phthalate and BPA exposure in relation to pubertal development among girls in the Early Life Exposure in Mexico to Environmental Toxicants (ELEMENT) birth cohort. We measured maternal urinary phthalate metabolites and BPA in samples collected during the first, second, and third trimesters of pregnancy. To assess reproductive development among their female children, we measured serum testosterone, estradiol, dehydroepiandrosterone sulfate (DHEA-S), inhibin B, and sex hormone-binding globulin (SHBG), and assessed sexual maturation, including Tanner staging for breast and pubic hair development and menarche status, at age 8-13 years (n = 120). We used linear and logistic regression to examine measures of trimester-specific in utero exposure as predictors of peripubertal hormone levels and pubertal onset, respectively. In secondary analyses, we evaluated estimated exposure at the midpoint of the first trimester and rates of change in exposure across pregnancy in relation to outcomes. Several phthalate metabolites measured throughout in utero development were associated with higher serum testosterone concentrations, while a number of metabolites measured in the third trimester were associated with higher DHEA-S. For example, an interquartile range (IQR) increase in mean monoethyl phthalate (MEP) levels across pregnancy was associated with 44% higher peripubertal testosterone (95% CI: 13-83%), while an IQR increase in di-2-ethylhexyl phthalate metabolites (ΣDEHP) specifically in the third trimester
Directory of Open Access Journals (Sweden)
Aria Sotoudeh
2012-03-01
Full Text Available Mental health problems including emotional and behavioral problems during puberty may be under influence of different risk factors including cultures, living in urban or rural areas and ethnic factors which may vary between different countries. The main aim of this study is to investigate the profile of emotional and behavioral problems and the role of factors such as age, stage of puberty, ethnicity, rurality and living in urban area, as risk factors in Iranian girls. As a part of a large national study we evaluated the emotional and behavioral problems in different stages of puberty in a community sample of Iranian adolescent girls from public schools that were selected by clustered random sampling method. In all subjects, demographic characteristics, and pubertal stages were measured. Emotional and behavioral problems were evaluated using Strength and Difficulties Questionnaire (SDQ. The associations of age, pubertal development indices, socioeconomic and demographic factors with the behavioral problems were assessed. A total number of 4576 students enrolled the study and responded to the questions. The mean age of participants was 13.83 2.19 years. The mean total score of difficulties in participants was 14.34 5.81. According to these results 813 (17.8% adolescents had total problem scores higher than Goodmans cutoff points and the most frequent problem domain was conduct problems (20.5%. According to the results the most related variable with the total difficulty score of SDQ were ethnicity, residency in urban areas and development of menstrual cycle respectively. The results of this study showed that the most correlated factors with mental health problems in Iranian girls during puberty are ethnicity, urbanity and development of menstrual cycle.
Mann, D R; Bhat, G K; Stah, C D; Pohl, C R; Plant, T M
2006-09-01
The present study aimed to determine the influence of thyroid status on the timing of the pubertal resurgence in gonadotrophin-releasing hormone pulse generator activity [tracked by circulating luteinising hormone (LH) levels] in male rhesus monkeys. Six juvenile monkeys were orchidectomised and then treated with the antithyroid drug, methimazole, from 15-19 months until 36 months of age, at which time thyroxine (T(4)) replacement was initiated. Four additional agonadal monkeys served as controls. Blood samples were drawn weekly for hormonal assessments. Body weight, crown-rump length and bone age were monitored at regular intervals. By 8 weeks of methimazole treatment, plasma T(4) had fallen sharply, and the decline was associated with a plasma thyroid-stimulating hormone increase. In controls, plasma LH levels remained undetectable until the pubertal rise occurred at 29.3 +/- 0.2 months of age. This developmental event occurred in only half of the methimazole-treated animals before 36 months of age when T(4) replacement was initiated. The hypothyroid state was associated with a profound arrest of growth and bone maturation, but increased body mass indices and plasma leptin levels. T(4) replacement in methimazole-treated monkeys was associated with the pubertal rise in LH in the remaining three animals and accelerated somatic development in all six animals. Although pubertal resurgence in LH secretion occurred at a later chronological age in methimazole-treated animals compared to controls, bone age, crown-rump length and body weight at that time did not differ between groups. There were no long-term differences in plasma prolactin between groups. We conclude that juvenile hypothyroidism in male primates causes a marked delay in the pubertal resurgence of LH secretion, probably occasioned at the hypothalamic level. Whether this effect is meditated by an action of thyroid hormone directly on the hypothalamus or indirectly as a result of the concomitant deficit in
BMI Trajectories Associated With Resolution of Elevated Youth BMI and Incident Adult Obesity.
Buscot, Marie-Jeanne; Thomson, Russell J; Juonala, Markus; Sabin, Matthew A; Burgner, David P; Lehtimäki, Terho; Hutri-Kähönen, Nina; Viikari, Jorma S A; Jokinen, Eero; Tossavainen, Paivi; Laitinen, Tomi; Raitakari, Olli T; Magnussen, Costan G
2018-01-01
Youth with high BMI who become nonobese adults have the same cardiovascular risk factor burden as those who were never obese. However, the early-life BMI trajectories for overweight or obese youth who avoid becoming obese adults have not been described. We aimed to determine and compare the young-childhood BMI trajectories of participants according to their BMI status in youth and adulthood. Bayesian hierarchical piecewise regression modeling was used to analyze the BMI trajectories of 2717 young adults who had up to 8 measures of BMI from childhood (ages 3-18 years) to adulthood (ages 34-49 years). Compared with those with persistently high BMI, those who resolved their high youth BMI by adulthood had lower average BMI at age 6 years and slower rates of BMI change from young childhood. In addition, their BMI levels started to plateau at 16 years old for females and 21 years old for males, whereas the BMI of those whose high BMI persisted did not stabilize until 25 years old for male subjects and 27 years for female subjects. Compared with those youth who were not overweight or obese and who remained nonobese in adulthood, those who developed obesity had a higher BMI rate of change from 6 years old, and their BMI continued to increase linearly until age 30 years. Efforts to alter BMI trajectories for adult obesity should ideally commence before age 6 years. The natural resolution of high BMI starts in adolescence for males and early adulthood for females, suggesting a critical window for secondary prevention. Copyright © 2018 by the American Academy of Pediatrics.
Prenatal androgen excess programs metabolic derangements in pubertal female rats.
Yan, Xiaonan; Dai, Xiaonan; Wang, Jing; Zhao, Nannan; Cui, Yugui; Liu, Jiayin
2013-04-01
Owing to the heterogeneity in the clinical symptoms of polycystic ovary syndrome (PCOS), the early pathophysiological mechanisms of PCOS remain unclear. Clinical, experimental, and genetic evidence supports an interaction between genetic susceptibility and the influence of maternal environment in the pathogenesis of PCOS. To determine whether prenatal androgen exposure induced PCOS-related metabolic derangements during pubertal development, we administrated 5α-dihydrotestosterone (DHT) in pregnant rats and observed their female offspring from postnatal 4 to 8 weeks. The prenatally androgenized (PNA) rats exhibited more numerous total follicles, cystic follicles, and atretic follicles than the controls. Fasting glucose, insulin, leptin levels, and homeostatic model assessment for insulin resistance were elevated in the PNA rats at the age of 5-8 weeks. Following intraperitoneal glucose tolerance tests, glucose and insulin levels did not differ between two groups; however, the PNA rats showed significantly higher 30- and 60-min glucose levels than the controls after insulin stimulation during 5-8 weeks. In addition, prenatal DHT treatment significantly decreased insulin-stimulated phosphorylation of AKT in the skeletal muscles of 6-week-old PNA rats. The abundance of IR substrate 1 (IRS1) and IRS2 was decreased in the skeletal muscles and liver after stimulation with insulin in the PNA group, whereas phosphorylation of insulin-signaling proteins was unaltered in the adipose tissue. These findings validate the contribution of prenatal androgen excess to metabolic derangements in pubertal female rats, and the impaired insulin signaling through IRS and AKT may result in the peripheral insulin resistance during pubertal development.
Recent changes in pubertal timing in healthy Danish boys
DEFF Research Database (Denmark)
Sørensen, K; Aksglæde, Lise; Petersen, Jørgen Holm
2010-01-01
In the 1990s, the American population-based study NHANES III renewed the focus on possible secular trends in male puberty. However, no conclusions could be made on pubertal onset due to the lack of compatible data.......In the 1990s, the American population-based study NHANES III renewed the focus on possible secular trends in male puberty. However, no conclusions could be made on pubertal onset due to the lack of compatible data....
Off-Time Pubertal Timing Predicts Physiological Reactivity to Postpuberty Interpersonal Stress
Smith, Anne Emilie; Powers, Sally I.
2009-01-01
We investigated associations between retrospectively assessed timing of pubertal development, interpersonal interactions, and hypothalamic-pituitary-adrenal axis reactivity to an interpersonal stress task in 110 young adult women. Participants provided salivary cortisol samples at points prior and subsequent to a video-taped conflict discussion…
Siew, Jia Xuan; Yap, Fabian
2018-01-01
Growth anomaly is a prominent feature in Wolf-Hirschhorn syndrome (WHS), a rare congenital disorder caused by variable deletion of chromosome 4p. While growth charts have been developed for WHS patients 0-4 years of age and growth data available for Japanese WHS patients 0-17 years, information on pubertal growth and final height among WHS children remain lacking. Growth hormone (GH) therapy has been reported in two GH-sufficient children with WHS, allowing for pre-puberty catch up growth; however, pubertal growth and final height information was also unavailable. We describe the complete growth journey of a GH-sufficient girl with WHS from birth until final height (FH), in relation to her mid parental height (MPH) and target range (TR). Her growth trajectory and pubertal changes during childhood, when she was treated with growth hormone (GH) from 3 years 8 months old till 6 months post-menarche at age 11 years was fully detailed. Pubertal growth characteristics and FH information in WHS is lacking.While pre-pubertal growth may be improved by GH, GH therapy may not translate to improvement in FH in WHS patients.Longitudinal growth, puberty and FH data of more WHS patients may improve the understanding of growth in its various phases (infancy/childhood/puberty).
Søeborg, Tue; Frederiksen, Hanne; Mouritsen, Annette; Johannsen, Trine Holm; Main, Katharina Maria; Jørgensen, Niels; Petersen, Jørgen Holm; Andersson, Anna-Maria; Juul, Anders
2014-11-01
The influence of sex, age, pubertal development and oral contraceptives on dehydroepiandrosterone (DHEA), DHEA sulfate (DHEAS), 17α-hydroxyprogesterone (17-OHP), Δ4-androstenedione (Adione), testosterone (T), calculated free testosterone (fT), free androgen index (FAI) and selected ratios in 1798 serum samples from healthy children, adolescents and young adults was evaluated. Samples were analyzed by Turboflow-LC-MS/MS. Sex hormone-binding globulin was analyzed by immunoassay. All steroid metabolite concentrations were positively associated with age and pubertal development in both sexes and generally higher in males than in females except for Adione. The pubertal rise in T in males was more pronounced compared to females, reflecting contribution from the testes. Ratios between steroid metabolites varied and depended on sex and age. All ratios were lower during infancy compared to later in life. Use of oral contraceptives significantly lowered serum concentrations of all steroid metabolites, fT, FAI, the 17-OHP/Adione, the Adione/T and the DHEA/Adione ratios, but not the DHEA/DHEAS ratio. We provide reference ranges for DHEA, DHEAS, 17-OHP, Adione, T, fT, FAI and selected ratios in relation to sex, age and pubertal development. Use of oral contraceptives strongly influences adrenal steroidogenesis and should be considered when diagnosing and monitoring treatment of patients with disorders of sex development. Copyright © 2014 Elsevier B.V. All rights reserved.
Teunissen, Hanneke A; Adelman, Caroline B; Prinstein, Mitchell J; Spijkerman, Renske; Poelen, Evelien A P; Engels, Rutger C M E; Scholte, Ron H J
2011-04-01
The transition to adolescence marks a time of sharply increased vulnerability to the development of depression, particularly among girls. Past research has examined isolated risk factors from individual theoretical models (e.g., biological, interpersonal, and cognitive) of depression, but few have examined integrative models. This study investigated the conjoint effects of early pubertal timing and popularity in the longitudinal prediction of depressive symptoms. A total of 319 girls and 294 boys (ages 11-14) provided information on their pubertal status, depressive symptoms, and the social status (i.e., popularity) of their peers. Adolescents completed a second measure of depressive symptoms 11 months after the initial time point. Findings supported an integrated biological-interpersonal model in explaining the development of depressive symptoms during adolescence. Early pubertal development was associated with increase in depressive symptoms only when accompanied by low levels of popularity. High levels of popularity buffered the association between early pubertal development and later depressive symptoms. Unexpectedly, these results were significant both for girls and boys. Results are discussed in terms of dynamic systems theories.
Sharma, Prakash; Patiño, Reynaldo
2013-04-01
We examined associations between thyroid condition, gonadal sex and pubertal development in zebrafish. Seventy-two-hour postfertilization larvae were reared in untreated medium or in the presence of goitrogens (sodium perchlorate, 0.82 mM; methimazole, 0.15 and 0.3 mM) or thyroxine (1 and 10 nM) for 30 days. Thyrocyte height, gonadal sex and gonadal development were histologically determined at 45 and 60 days postfertilization (dpf). Thyrocyte hypertrophy, an index of hypothyroidism, was observed at 45 and 60 dpf in perchlorate-treated but only at 45 dpf in methimazole-treated fish. Similarly, gonadal sex ratios were biased toward ovaries relative to control animals at 45 and 60 dpf in perchlorate-treated fish but only at 45 dpf in methimazole-treated fish. Gonadal sex ratios were biased toward testes at 45 and 60 dpf in thyroxine-treated fish. Spermatogenesis was delayed in testes from goitrogen-treated fish at 60 dpf relative to control values, but was unaffected in testes from thyroxine-treated individuals. Oogenesis seemed to be nonspecifically delayed in all treatments relative to control at 60 dpf. This study confirmed the previously reported association between hypothyroid condition and ovarian-skewed ratios, and hyperthyroid condition and testicular-skewed ratios, and also showed that male pubertal development is specifically delayed by experimental hypothyroidism. The simultaneous recovery from the hypothyroid and ovary-inducing effects of methimazole by 60 dpf (27 days post-treatment) suggests that the ovary-skewing effect of goitrogens is reversible when thyroid conditions return to basal levels before developmental commitment of gonadal sex. Conversely, the masculinizing effect of hyperthyroidism seems to be stable and perhaps permanent. Published by Elsevier Inc.
Sharma, Prakash; Patino, Reynaldo
2013-01-01
We examined associations between thyroid condition, gonadal sex and pubertal development in zebrafish. Seventy-two-hour postfertilization larvae were reared in untreated medium or in the presence of goitrogens (sodium perchlorate, 0.82 mM; methimazole, 0.15 and 0.3 mM) or thyroxine (1 and 10 nM) for 30 days. Thyrocyte height, gonadal sex and gonadal development were histologically determined at 45 and 60 days postfertilization (dpf). Thyrocyte hypertrophy, an index of hypothyroidism, was observed at 45 and 60 dpf in perchlorate-treated but only at 45 dpf in methimazole-treated fish. Similarly, gonadal sex ratios were biased toward ovaries relative to control animals at 45 and 60 dpf in perchlorate-treated fish but only at 45 dpf in methimazole-treated fish. Gonadal sex ratios were biased toward testes at 45 and 60 dpf in thyroxine-treated fish. Spermatogenesis was delayed in testes from goitrogen-treated fish at 60 dpf relative to control values, but was unaffected in testes from thyroxine-treated individuals. Oogenesis seemed to be nonspecifically delayed in all treatments relative to control at 60 dpf. This study confirmed the previously reported association between hypothyroid condition and ovarian-skewed ratios, and hyperthyroid condition and testicular-skewed ratios, and also showed that male pubertal development is specifically delayed by experimental hypothyroidism. The simultaneous recovery from the hypothyroid and ovary-inducing effects of methimazole by 60 dpf (27 days post-treatment) suggests that the ovary-skewing effect of goitrogens is reversible when thyroid conditions return to basal levels before developmental commitment of gonadal sex. Conversely, the masculinizing effect of hyperthyroidism seems to be stable and perhaps permanent.
Scherf, K Suzanne; Behrmann, Marlene; Dahl, Ronald E
2012-04-01
Adolescence is a time of dramatic physical, cognitive, emotional, and social changes as well as a time for the development of many social-emotional problems. These characteristics raise compelling questions about accompanying neural changes that are unique to this period of development. Here, we propose that studying adolescent-specific changes in face processing and its underlying neural circuitry provides an ideal model for addressing these questions. We also use this model to formulate new hypotheses. Specifically, pubertal hormones are likely to increase motivation to master new peer-oriented developmental tasks, which will in turn, instigate the emergence of new social/affective components of face processing. We also predict that pubertal hormones have a fundamental impact on the re-organization of neural circuitry supporting face processing and propose, in particular, that, the functional connectivity, or temporal synchrony, between regions of the face-processing network will change with the emergence of these new components of face processing in adolescence. Finally, we show how this approach will help reveal why adolescence may be a period of vulnerability in brain development and suggest how it could lead to prevention and intervention strategies that facilitate more adaptive functional interactions between regions within the broader social information processing network. Copyright © 2011 Elsevier Ltd. All rights reserved.
Scherf, K. Suzanne; Behrmann, Marlene; Dahl, Ronald E.
2015-01-01
Adolescence is a time of dramatic physical, cognitive, emotional, and social changes as well as a time for the development of many social-emotional problems. These characteristics raise compelling questions about accompanying neural changes that are unique to this period of development. Here, we propose that studying adolescent-specific changes in face processing and its underlying neural circuitry provides an ideal model for addressing these questions. We also use this model to formulate new hypotheses. Specifically, pubertal hormones are likely to increase motivation to master new peer-oriented developmental tasks, which will in turn, instigate the emergence of new social/affective components of face processing. We also predict that pubertal hormones have a fundamental impact on the reorganization of neural circuitry supporting face processing and propose, in particular, that, the functional connectivity, or temporal synchrony, between regions of the face-processing network will change with the emergence of these new components of face processing in adolescence. Finally, we show how this approach will help reveal why adolescence may be a period of vulnerability in brain development and suggest how it could lead to prevention and intervention strategies that facilitate more adaptive functional interactions between regions within the broader social information processing network. PMID:22483070
Directory of Open Access Journals (Sweden)
Perinetti, G.
2016-04-01
Full Text Available Introduction: The identification of the onset of the pubertal growth spurt has major clinical implications when dealing with orthodontic treatment in growing subjects. Aim: Through multivariate methods, this study evaluated possible relationships between the gingival crevicular fluid (GCF alkaline phosphatase (ALP activity and pubertal growth spurt and dentition phase. Materials and methods: One hundred healthy growing subjects (62 females, 38 males; mean age, 11.5±2.4 years were enrolled into this doubleblind, prospective, cross-sectional-design study. Phases of skeletal maturation (pre - pubertal, pubertal, post - pubertal was assessed using the cervical vertebral maturation method. Samples of GCF for the ALP activity determination were collected at the mesial and distal sites of the mandibular central incisors. The phases of the dentition were recorded as intermediate mixed, late mixed, or permanent. A multinomial multiple logistic regression model was used to assess relationships of the enzymatic activity to growth phases and dentition phases. Results: The GCF ALP activity was greater in the pubertal growth phase as compared to the pre - pubertal and post - pubertal growth phases. Significant adjusted odds ratios for the GCF ALP activity for the pre - pubertal and post - pubertal subjects, in relation to the pubertal group, were 0.76 and 0.84, respectively. No significant correlations were seen for the dentition phase. Conclusions: The GCF ALP activity is a valid candidate as a non - invasive biomarker for the identification of the pubertal growth spurt irrespective of the dentition phase.
Chen, Frances R; Raine, Adrian
2018-01-01
Prior research indicates that early pubertal timing is associated with aggressive behavior, particularly in the context of adversity as postulated in the contextual amplification hypothesis. However, few studies have examined harsh parenting as the context for the effect of early pubertal timing. Even fewer studies have tested the interactive effect of early pubertal timing and positive parenting on aggressive behavior. In this study, we tested the proposition that early pubertal timing, contrary to the general conception of it as a vulnerability, indexed susceptibility, and thus early maturing individuals were affected more by their environment in a "for better and for worse" manner. The sample consisted of 411 community-recruited youth aged 11-12 years (51% boys, 80% African Americans). Participants reported Tanner Stages of pubertal development, aggressive behavior and harsh parenting practice of their parents. Puberty scores were standardized with groups of the same age, sex, and ethnicity, and those that scored the top one-third were defined as early maturing individuals. Parents reported youth's aggressive behavior and their parenting practices towards the youth, including harsh parenting and positive parenting. Early pubertal timing significantly moderated the relationship between harsh/positive parenting and aggressive behavior. Specifically, harsh parenting was positively associated with aggressive behavior to a larger degree among early maturing individuals than among on-time/late-maturing individuals. Positive parenting was inversely associated with aggressive behavior but only among early maturing individuals. This study is the first to document support for early pubertal timing as susceptibility to the environmental influences in relation to aggressive behavior. Theoretical and intervention implications are discussed. © 2017 Wiley Periodicals, Inc.
Christine, Paul J; Diez Roux, Ana V; Wing, Jeffrey J; Alazraqui, Marcio; Spinelli, Hugo
2015-04-01
We investigated temporal trends in BMI, and assessed hypothesized predictors of trends including socio-economic position (SEP) and province-level economic development, in Argentina. Using multivariable linear regression, we evaluated cross-sectional patterning and temporal trends in BMI and examined heterogeneity in these associations by SEP and province-level economic development with nationally representative samples from Argentina in 2005 and 2009. We calculated mean annual changes in BMI for men and women to assess secular trends. Women, but not men, exhibited a strong cross-sectional inverse association between SEP and BMI, with the lowest-SEP women having an average BMI 2.55 kg/m(2) greater than the highest-SEP women. Analysis of trends revealed a mean annual increase in BMI of 0.19 kg/m(2) and 0.15 kg/m(2) for women and men, respectively, with slightly greater increases occurring in provinces with greater economic growth. No significant heterogeneity in trends existed by individual SEP. BMI is increasing rapidly over time in Argentina irrespective of various sociodemographic characteristics. Higher BMI remains more common in women of lower SEP compared with those of higher SEP.
Forty years trends in timing of pubertal growth spurt in 157,000 Danish school children
DEFF Research Database (Denmark)
Aksglæde, Lise; Olsen, Lina Wøhlk; Sørensen, Thorkild I.A.
2008-01-01
to 1969 who attended primary school in the Copenhagen Municipality. 135,223 girls and 21,612 boys fulfilled the criteria for determining age at OGS and age at PHV. These physiological events were used as markers of pubertal development in our computerized method in order to evaluate any secular trends...... in pubertal maturation during the study period (year of birth 1930 to 1969). In this period, age at OGS declined statistically significantly by 0.2 and 0.4 years in girls and boys, respectively, whereas age at PHV declined statistically significantly by 0.5 and 0.3 years in girls and boys, respectively...
[Pubertal maturation, physical self-esteem and sexuality in a sample of French adolescents].
Potard, C; Courtois, R; Clarisse, R; Le Floc'h, N; Thomine, M; Réveillère, C
2016-04-01
The aim of this study was to explore the links between pubertal maturation, physical self-esteem and sexuality in adolescence, differentiating between boys and girls. The sample was comprised of 312 French secondary school children (seventh and ninth grades); 52.6 % (n=164) of whom were girls. Participants answered three self-evaluation questionnaires: the scale of sexuality (interests, emotions, relationships: IERS) in prime adolescence (12 to 15 years); (b) the self-administered rating scale for pubertal development and (c) the Physical Self-Description Questionnaire (PSDQ). Pubertal maturation was associated with higher scores on "Flirting with the aim of having sexual relations" and "Going out with someone", and a drop in overall and physical self-esteem, mainly in socially valued domains, namely "Body fat" for girls, and "Strength" and "Health" for boys. Overall physical self-esteem was associated with "Going out with someone" and "Flirting with the aim of having sexual relations" in boys. Physical changes at puberty induce two distinct trends in adolescents: sexual exploration and discovery (genitalized body), and self-depreciation (social body). Copyright © 2015 L’Encéphale, Paris. Published by Elsevier Masson SAS. All rights reserved.
Urinary phthalate excretion in 555 healthy Danish boys with and without pubertal gynaecomastia
DEFF Research Database (Denmark)
Mieritz, Mikkel G; Frederiksen, Hanne; Sørensen, Kaspar
2012-01-01
Pubertal gynaecomastia is a clinical sign of an oestrogen-androgen imbalance, which occurs in 40-60% of adolescent Caucasian boys. In most cases no underlying endocrinopathy can be identified. A recent study reports higher plasma phthalate levels in Turkish boys with pubertal gynaecomastia....... Therefore, we asked whether there was an association between concurrent measures of urinary phthalate metabolites and pubertal timing as well as the presence of gynaecomastia in otherwise healthy boys. We studied a total of 555 healthy boys (age 6.07-19.83 years) as part of the COPENHAGEN Puberty Study....... Anthropometry and pubertal stages (PH1-6 and G1-5) were evaluated, and the presence of gynaecomastia was assessed. Non-fasting blood samples were analysed for serum testosterone and morning urine samples were analysed for the total content of 12 phthalate metabolites (MEP, MnBP, MiBP, MBzP, MEHP, MEHHP, MEOHP...
Tucker, Deirdre K; Macon, Madisa B; Strynar, Mark J; Dagnino, Sonia; Andersen, Erik; Fenton, Suzanne E
2015-07-01
Perfluorooctanoic acid (PFOA) is a developmental toxicant in mice, with varied strain outcomes depending on dose and period of exposure. The impact of PFOA on female mouse pubertal development at low doses (≤1mg/kg) has yet to be determined. Therefore, female offspring from CD-1 and C57Bl/6 dams exposed to PFOA, creating serum concentrations similar to humans, were examined for pubertal onset, including mammary gland development. Pups demonstrated a shorter PFOA elimination half-life than that reported for adult mice. Prenatal exposure to PFOA caused significant mammary developmental delays in female offspring in both strains. Delays started during puberty and persisted into young adulthood; severity was dose-dependent. Also an evaluation of female serum hormone levels and pubertal timing onset revealed no effects of PFOA compared to controls in either strain. These data suggest that the mammary gland is more sensitive to early low level PFOA exposures compared to other pubertal endpoints, regardless of strain. Published by Elsevier Inc.
Directory of Open Access Journals (Sweden)
Leena K Koivusilta
2006-03-01
Full Text Available
Background. Pubertal timing is connected with health-related lifestyle in adulthood. We studied whether early or late pubertal timing is predictive of socio-economic outcomes in early adulthood and whether the associations are mediated by health behaviours.
Methods. Survey data (1981, 1983, 1985, 1987 from samples of 14-year-old Finns (N=4246, response rate 85% were linked with respondents’ attained educational level, socio-economic and labour market position in 2001 (ages 28-34. Ages of menarche and first ejaculation indicated pubertal timing.
Results. As compared to adolescents with average age pubertal timing, boys and girls maturing at an early age more often participated in health-compromising behaviours, while those maturing at a later age participated less frequently. Pubertal timing was not associated with attained educational level or socioeconomic position in girls and not with labour market position at the time of follow-up in either sex. In boys, independently of health behaviours, early or late onset of puberty predicted low educational level, while late onset predicted low socio-economic position.
Conclusion. Timing of puberty has a stronger connection with socio-economic outcomes in boys than in girls. Deviance from the normative pace of physical development, especially late maturation, is among boys slightly depicted in the hierarchy of socio-economic positions of the society. As pubertal timing is connected with health-related behaviours – especially with smoking – the pacing of developmental transitions should be considered in planning programmes preventing unhealthy behavioural patterns often linked with negative attitudes towards schooling.
Directory of Open Access Journals (Sweden)
Bellis Mark A
2009-12-01
Full Text Available Abstract Background In many countries age at pubertal onset has declined substantially. Relatively little attention has been paid to how this decline may affect adolescent behaviours such as substance use, violence and unprotected sex and consequently impact on public health. Methods In the UK, two opportunistic samples (aged 16-45 years, paper-based (n = 976 and online (n = 1117, examined factors associated with earlier pubertal onset and whether earlier age of onset predicted sexual risk-taking, substance use and anti-social behaviours during early adolescence. Results Overall, 45.6% of females reported menarche ≤ 12 years and 53.3% of males were categorised as having pubertal onset ≤ 11 years. For both sexes earlier pubertal onset was associated with poorer parental socio-economic status. Other pre-pubertal predictors of early onset were being overweight, more childhood illnesses (females and younger age at time of survey (males. For both sexes earlier puberty predicted having drunk alcohol, been drunk, smoked and used drugs Conclusion Results provide sufficient evidence for changes in age of pubertal onset to be further explored as a potential influence on trends in adolescent risk behaviours. Further insight into the relationship between early puberty and both obesity and socio-economic status may help inform early interventions to tackle the development of risk behaviours and health inequalities during early adolescence.
Cousminer, Diana L.; Berry, Diane J.; Timpson, Nicholas J.; Ang, Wei; Thiering, Elisabeth; Byrne, Enda M.; Taal, H. Rob; Huikari, Ville; Bradfield, Jonathan P.; Kerkhof, Marjan; Groen-Blokhuis, Maria M.; Kreiner-Moller, Eskil; Marinelli, Marcella; Holst, Claus; Leinonen, Jaakko T.; Perry, John R. B.; Surakka, Ida; Pietilainen, Olli; Kettunen, Johannes; Anttila, Verneri; Kaakinen, Marika; Sovio, Ulla; Pouta, Anneli; Das, Shikta; Lagou, Vasiliki; Power, Chris; Prokopenko, Inga; Evans, David M.; Kemp, John P.; St Pourcain, Beate; Ring, Susan; Palotie, Aarno; Kajantie, Eero; Osmond, Clive; Lehtimaki, Terho; Viikari, Jorma S.; Kahonen, Mika; Warrington, Nicole M.; Lye, Stephen J.; Palmer, Lyle J.; Tiesler, Carla M. T.; Flexeder, Claudia; Montgomery, Grant W.; Medland, Sarah E.; Hofman, Albert; Hakonarson, Hakon; Guxens, Monica; Bartels, Meike; Salomaa, Veikko; Koppelman, Gerard H.
2013-01-01
The pubertal height growth spurt is a distinctive feature of childhood growth reflecting both the central onset of puberty and local growth factors. Although little is known about the underlying genetics, growth variability during puberty correlates with adult risks for hormone-dependent cancer and
Prenatal and pubertal testosterone affect brain lateralization
Beking, T; Geuze, R H; van Faassen, M; Kema, I P; Kreukels, B P C; Groothuis, T G G
After decades of research, the influence of prenatal testosterone on brain lateralization is still elusive, whereas the influence of pubertal testosterone on functional brain lateralization has not been investigated, although there is increasing evidence that testosterone affects the brain in
Urlacher, Samuel S; Blackwell, Aaron D; Liebert, Melissa A; Madimenos, Felicia C; Cepon-Robins, Tara J; Gildner, Theresa E; Snodgrass, J Josh; Sugiyama, Lawrence S
2016-01-01
Information concerning physical growth among small-scale populations remains limited, yet such data are critical to local health efforts and to foster basic understandings of human life history and variation in childhood development. Using a large dataset and robust modeling methods, this study aims to describe growth from birth to adulthood among the indigenous Shuar of Amazonian Ecuador. Mixed-longitudinal measures of height, weight, and body mass index (BMI) were collected from Shuar participants (n = 2,463; age: 0-29 years). Centile growth curves and tables were created for each anthropometric variable of interest using Generalized Additive Models for Location, Scale, and Shape (GAMLSS). Pseudo-velocity and Lambda-Mu-Sigma curves were generated to further investigate Shuar patterns of growth and to facilitate comparison with United States Center for Disease Control and Prevention and multinational World Health Organization growth references. The Shuar are small throughout life and exhibit complex patterns of growth that differ substantially from those of international references. Similar to other Amazonians, Shuar growth in weight compares more favorably to references than growth in height, resulting in BMI curves that approximate international medians. Several additional characteristics of Shuar development are noteworthy, including large observed variation in body size early in life, significant infant growth faltering, extended male growth into adulthood, and a markedly early female pubertal growth spurt in height. Phenotypic plasticity and genetic selection in response to local environmental factors may explain many of these patterns. Providing a detailed reference of growth for the Shuar and other Amazonian populations, this study possesses direct clinical application and affords valuable insight into childhood health and the ecology of human growth. © 2015 Wiley Periodicals, Inc.
BMI and BMI SDS in childhood: annual increments and conditional change
Brannsether-Ellingsen, Bente; Eide, Geir Egil; Roelants, Mathieu; Bjerknes, Robert; Juliusson, Petur Benedikt
2016-01-01
Background: Early detection of abnormal weight gain in childhood may be important for preventive purposes. It is still debated which annual changes in BMI should warrant attention. Aim: To analyse 1-year increments of Body Mass Index (BMI) and standardised BMI (BMI SDS) in childhood and explore conditional change in BMI SDS as an alternative method to evaluate 1-year changes in BMI. Subjects and methods: The distributions of 1-year increments of BMI (kg/m2) and BMI SDS are summarised by...
Sex steroids and brain structure in pubertal boys and girls: a mini-review of neuroimaging studies
Peper, J.S.; Hulshoff Pol, H.E.; Crone, E.A.; van Honk, J.
2011-01-01
Puberty is an important period during development hallmarked by increases in sex steroid levels. Human neuroimaging studies have consistently reported that in typically developing pubertal children, cortical and subcortical gray matter is decreasing, whereas white matter increases well into
Silventoinen, Karri; Kaprio, Jaakko; Yokoyama, Yoshie
2011-03-01
We analyzed the genetic architecture of prepubertal development of relative weight to height in 216 monozygotic and 159 dizygotic complete Japanese twin pairs (52% girls). Ponderal index at birth (kg/m(3)) and body mass index (BMI, kg/m(2)) from 1 to 11 years of age were used. Additive genetic factors explained the major proportion (52-74%) of the variation of BMI from 1 to 11 years of age. Environmental factors common to both co-twins also showed some effect (7-28%), but at most ages this was not statistically significant. Strong genetic tracking was found for BMI from 1 to 11 years of age, but there was also evidence for a persistent effect of common environmental factors. Our results suggest that the genetic architecture of BMI development in the Japanese population is generally similar to that found in previous twin studies in Caucasian populations.
BMI and Lifetime Changes in BMI and Cancer Mortality Risk
Taghizadeh, Niloofar; Boezen, H Marike; Schouten, Jan P; Schröder, Carolien P; de Vries, Elisabeth G. E.; Vonk, Judith M
2015-01-01
Body Mass Index (BMI) is known to be associated with cancer mortality, but little is known about the link between lifetime changes in BMI and cancer mortality in both males and females. We studied the association of BMI measurements (at baseline, highest and lowest BMI during the study-period) and
Molgaard-Hansen, Lene; Skou, Anne-Sofie; Juul, Anders; Glosli, Heidi; Jahnukainen, Kirsi; Jarfelt, Marianne; Jónmundsson, Guðmundur K; Malmros, Johan; Nysom, Karsten; Hasle, Henrik
2013-12-01
More than 60% of children with acute myeloid leukemia (AML) become long-term survivors. Most are cured using chemotherapy without hematopoietic stem cell transplantation (HSCT). We report on pubertal development and compare self-reported parenthood among AML survivors and their siblings. We included 137 children treated for AML according to the Nordic Society of Pediatric Hematology and Oncology (NOPHO)-AML-84, -88, and -93 trials, who were alive by June 2007. Patients with relapse or treated with HSCT were excluded. AML survivors participated in a physical and biochemical examination (n = 102) and completed a questionnaire (n = 101). One of their siblings completed an identical questionnaire (n = 84). At a median follow-up of 11 years (range 5-25) after diagnosis of AML the survivors (median age 16 years, range 5-36) were either prepubertal or had entered puberty normally. Serum levels of FSH, LH, testosterone, estradiol, sex hormone binding globulin (SHBG), inhibin A and B, and testicular volumes were within normal ranges. Anti-Müllerian hormone (AMH) levels were decreased in 5 of 40 postpubertal females. Mean reported age at menarche was 13.1 (range 11-17) years. Among survivors 15 years of age or older 31% of females reported pregnancies and 9% of males reported pregnancies in their partners, rates comparable with the frequency reported by their siblings. Most AML survivors treated with chemotherapy had normal pubertal development and fertility, however, AMH levels were decreased in 13% of postpubertal females. Longer follow-up is necessary to evaluate possible risk of premature ovarian failure. © 2013 Wiley Periodicals, Inc.
Influence of the body weight on the onset and progression of puberty in boys.
Tomova, Analia; Robeva, Ralitsa; Kumanov, Philip
2015-07-01
Unlike in girls, the data on the relationship between pubertal development and body weight in boys are controversial. We measured the height, body weight, body mass index (BMI), pubic hair stages, testicular volume, penis length and circumference of 4030 boys, aged between 7 and 19 years. According to their body weight, the investigated children and adolescents were divided in four groups at each age: underweight boys (BMI puberty occurred when the boys' weight gained 40.33±9.03 kg (median 39.00) and BMI was 18.62±3.12 kg/m2 (median 17.80), whereas the late stage was reached at weight of 62.44±10.39 kg (median 61.00) and BMI 21.47±2.84 kg/m2 (median 21.20). Earlier maturing boys were heavier than their coevals, whereas underweight boys developed puberty later. The onset and progression of puberty in boys are in a significant positive relationship with weight and BMI. Moreover, in the overweight boys pubertal development begins and comes to the late stage earlier in comparison with normal weight children, whereas in those who are underweight a delay at every stage of the development is observed.
Maths performance as a function of sex, laterality, and age of pubertal onset.
Sappington, John; Topolski, Richard
2005-07-01
Sex differences in math/spatial performance demand explanations. Within the biological view, the complexity and number of variables make the explanation difficult at best. Laterality and age of pubertal onset have been investigated prominently in this context but rarely considered as interactions in the same study. Some 468 college subjects with SAT MATH (SAT M) scores were divided into 12 groups defined by sex, laterality, and age (early, middle, and late) of pubertal onset. Significant main effects for sex and age of onset emerged, as did an interaction between lateral preference and pubertal onset. Generally males outperformed females. The combination of maleness, sinistrality, and early maturation was associated with high SAT M scores. Sinistrality and late maturation among females predicted very poor math performance.
2014-02-01
vivo effects on androgen-dependent tissues in young rats (i.e., prochloraz) similar to the effects of NTO in the present study have feminized male...the potential to interact with the endocrine system in vivo by identifying effects on pubertal development and thyroid function in the intact juvenile...estrogen or thyroid active compound under the test conditions. The observed testicular toxicity and the effects on the androgen-dependent reproductive
BMI Development of Normal Weight and Overweight Children in the PIAMA Study
Willers, Saskia M.; Brunekreef, Bert; Smit, Henriette A.; van der Beek, Eline M.; Gehring, Ulrike; de Jongste, Johan C.; Kerkhof, Marjan; Koppelman, Gerard H.; Wijga, Alet H.
2012-01-01
Background: There is evidence that rapid weight gain during the first year of life is associated with overweight later in life. However, results from studies exploring other critical periods for the development of overweight are inconsistent. Objective: The objective was to investigate BMI
Directory of Open Access Journals (Sweden)
Titilola M Pedro
Full Text Available This study aims to examine the associations between BMI, disordered eating attitude, body dissatisfaction in female adolescents, and descriptive attributes assigned to silhouettes of varying sizes in male and female adolescents, aged 11 to 15, in rural South Africa. Height and weight were measured to determine BMI. Age and sex-specific cut-offs for underweight and overweight/obesity were determined using the International Obesity Task Force cut-offs. Body image satisfaction using Feel-Ideal Discrepancy (FID scores, Eating Attitudes Test-26 (EAT-26, and perceptual female silhouettes were collected through self-administered questionnaires in 385 adolescents from the Agincourt Health and Socio-Demographic Surveillance System (HSDSS. Participants self-reported their Tanner pubertal stage and were classified as early pubertal ( 2. Mid to post pubertal boys and girls were significantly heavier, taller, and had higher BMI values than their early pubertal counterparts (all p<0.001. The prevalence of overweight and obesity was higher in the girls than the boys in both pubertal stages. The majority (83.5% of the girls demonstrated body dissatisfaction (a desire to be thinner or fatter. The girls who wanted to be fatter had a significantly higher BMI than the girls who wanted to be thinner (p<0.001. There were no differences in EAT-26 scores between pubertal groups, within the same sex, and between boys and girls within the two pubertal groups. The majority of the boys and the girls in both pubertal groups perceived the underweight silhouettes to be "unhappy" and "weak" and the majority of girls in both pubertal groups perceived the normal silhouettes to be the "best". These findings suggest a need for policy intervention that will address a healthy body size among South African adolescents.
Excess BMI in Childhood: A Modifiable Risk Factor for Type 1 Diabetes Development?
Ferrara, Christine Therese; Geyer, Susan Michelle; Liu, Yuk-Fun; Evans-Molina, Carmella; Libman, Ingrid M; Besser, Rachel; Becker, Dorothy J; Rodriguez, Henry; Moran, Antoinette; Gitelman, Stephen E; Redondo, Maria J
2017-05-01
We aimed to determine the effect of elevated BMI over time on the progression to type 1 diabetes in youth. We studied 1,117 children in the TrialNet Pathway to Prevention cohort (autoantibody-positive relatives of patients with type 1 diabetes). Longitudinally accumulated BMI above the 85th age- and sex-adjusted percentile generated a cumulative excess BMI (ceBMI) index. Recursive partitioning and multivariate analyses yielded sex- and age-specific ceBMI thresholds for greatest type 1 diabetes risk. Higher ceBMI conferred significantly greater risk of progressing to type 1 diabetes. The increased diabetes risk occurred at lower ceBMI values in children <12 years of age compared with older subjects and in females versus males. Elevated BMI is associated with increased risk of diabetes progression in pediatric autoantibody-positive relatives, but the effect varies by sex and age. © 2017 by the American Diabetes Association.
A Twin Study of Objective and Subjective Pubertal Timing and Peer Influence on Risk-Taking.
Kretsch, Natalie; Mendle, Jane; Harden, K Paige
2016-03-01
The current study used a behavioral genetic design to test whether three measures of pubertal timing moderated peer influence on risk-taking in a sample of 248 female adolescent twin pairs ( M age =16.0, SD =1.5) from the National Longitudinal Study of Adolescent Health. Peer influence was operationalized as the quasi-causal association between girls' self-reported risk-taking and the risk-taking reported by their friends. Girls with earlier ages at menarche and who perceived themselves as more developed than peers were more susceptible to peer influence on risk-taking. However, age-standardized ratings of body changes did not moderate peer influence. This study highlights distinctions between multiple measures of pubertal timing, using an innovative synthesis of genetically informative data and peer nomination data.
Pubertal timing and early sexual intercourse in the offspring of teenage mothers.
De Genna, Natacha M; Larkby, Cynthia; Cornelius, Marie D
2011-10-01
Early puberty is associated with stressful family environments, early sexual intercourse, and teenage pregnancy. We examined pubertal timing and sexual debut among the 14-year-old offspring of teenage mothers. Mothers (71% Black, 29% White) were recruited as pregnant teenagers (12-18 years old). Data were collected during pregnancy and when offspring were 6, 10 and 14 years old (n = 318). Adolescents (50% male) compared the timing of their pubertal maturation to same-sex peers. There was a significant 3-way interaction effect of race, sex, and pubertal timing on sexual debut (n = 305). This effect remained significant in a model controlling for maternal age at first intercourse, substance use, exposure to trauma, authoritative parenting, and peer sexual activity (n = 255). Early maturation was associated with early sex in daughters, and may be one pathway for the inter-generational transfer of risk for teenage pregnancy among daughters of teenage mothers.
Abadjieva, Desislava; Nedeva, Radka; Marchev, Yordan; Jordanova, Gergana; Chervenkov, Mihail; Dineva, Julieta; Shimkus, Almantas; Shimkiene, Aldona; Teerds, Katja; Kistanova, Elena
2018-01-01
The aim of the present investigation was to study the effect of Arthrospira (Spirulina) platensis supplemented diet on follicular development and related endocrine parameters, such as estradiol and progesterone levels as well as ghrelin levels in pre-pubertal gilts. Twenty-one 60-day-old Danube
Hendrick, C. Emily; Cance, Jessica Duncan; Maslowsky, Julie
2016-01-01
Girls with early pubertal timing are at elevated risk for teenage childbearing; however, the modifiable mechanisms driving this relationship are not well understood. The objective of the current study was to determine whether substance use, perceived peer substance use, and older first sexual partners mediate the relationships among girls' pubertal timing, sexual debut, and teenage childbearing. Data are from Waves 1 – 15 of the female cohort of the National Longitudinal Surveys of Youth 1997 (NLSY97), a nationwide, ongoing cohort study of U.S. men and women born between 1980 and 1984. The analytic sample (N=2,066) was 12-14 years old in 1997 and ethnically diverse (51% white, 27% black, 22% Latina). Using structural equation modeling, we found substance use in early adolescence and perceived peer substance use each partially mediated the relationships among girls' pubertal timing, sexual debut, and teenage childbearing. Our findings suggest early substance use behavior as one modifiable mechanism to be targeted by interventions aimed at preventing teenage childbearing among early developing girls. PMID:26769576
BMI and Lifetime Changes in BMI and Cancer Mortality Risk
Taghizadeh, Niloofar; Boezen, H. Marike; Schouten, Jan P.; Schröder, Carolien P.; de Vries, E. G. Elisabeth; Vonk, Judith M.
2015-01-01
Body Mass Index (BMI) is known to be associated with cancer mortality, but little is known about the link between lifetime changes in BMI and cancer mortality in both males and females. We studied the association of BMI measurements (at baseline, highest and lowest BMI during the study-period) and lifetime changes in BMI (calculated over different time periods (i.e. short time period: annual change in BMI between successive surveys, long time period: annual change in BMI over the entire study period) with mortality from any cancer, and lung, colorectal, prostate and breast cancer in a large cohort study (n=8,645. Vlagtwedde-Vlaardingen, 1965-1990) with a follow-up on mortality status on December 31st 2008. We used multivariate Cox regression models with adjustments for age, smoking, sex, and place of residence. Being overweight at baseline was associated with a higher risk of prostate cancer mortality (hazard ratio (HR) =2.22; 95% CI 1.19-4.17). Obesity at baseline was associated with a higher risk of any cancer mortality [all subjects (1.23 (1.01-1.50)), and females (1.40 (1.07-1.84))]. Chronically obese females (females who were obese during the entire study-period) had a higher risk of mortality from any cancer (2.16 (1.47-3.18), lung (3.22 (1.06-9.76)), colorectal (4.32 (1.53-12.20)), and breast cancer (2.52 (1.15-5.54)). We found no significant association between long-term annual change in BMI and cancer mortality risk. Both short-term annual increase and decrease in BMI were associated with a lower mortality risk from any cancer [all subjects: (0.67 (0.47-0.94)) and (0.73 (0.55-0.97)), respectively]. In conclusion, a higher BMI is associated with a higher cancer mortality risk. This study is the first to show that short-term annual changes in BMI were associated with lower mortality from any type of cancer. PMID:25881129
Hebbard, Pamela C; King, Rebecca R; Malsbury, Charles W; Harley, Carolyn W
2003-08-01
The organizational role of pubertal androgen receptor (AR) activation in synaptic plasticity in hippocampal CA1 and in social memory was assessed. Earlier data suggest pubertal testosterone reduces adult hippocampal synaptic plasticity. Four groups were created following gonadectomy at the onset of puberty: rats given testosterone; rats given testosterone but with the AR antagonist flutamide, present during puberty; rats given testosterone at the end of puberty; and rats given cholesterol at the end of puberty. A tetanus normally inducing long-term potentiation (LTP) was used to stimulate CA1 in the urethane-anesthetized adults during the dark phase of their cycle. Social memory was assessed prior to electrophysiology. Social memory for a juvenile rat at 120 min was seen only in rats not exposed to AR activation during puberty. Pubertal AR activation may induce the reduced social memory of male rats. Early CA1 LTP occurred following tetanus in rats with no pubertal testosterone. Short-term potentiation occurred in rats exposed to pubertal testosterone. Unexpectedly, rats with pubertal AR activation developed long-term depression (LTD). The same pattern was seen in normal male rats. Lack of LTP during the dark phase is consistent with other data on circadian modulation of CA1 LTP. No correlations were seen among social memory scores and CA1 plasticity measures. These data argue for two organizational effects of pubertal testosterone: (1) CA1 synaptic plasticity shifts away from potentiation toward depression; (2) social memory is reduced. Enduring effects of pubertal androgen on limbic circuits may contribute to reorganized behaviors in the postpubertal period.
Saito, Reiko; Yamamoto, Yukiyo; Goto, Motohide; Araki, Shunsuke; Kubo, Kazuyasu; Kawagoe, Rinko; Kawada, Yasusada; Kusuhara, Koichi; Igarashi, Maki; Fukami, Maki
2014-01-01
Although tamoxifen has been shown to be fairly safe and effective for idiopathic pubertal gynecomastia, it remains unknown whether it is also beneficial for gynecomastia associated with endocrine disorders. Here, we report the effect of tamoxifen on pubertal gynecomastia in 2 siblings with partial androgen insensitivity syndrome (PAIS). Cases 1 and 2 presented with persistent pubertal gynecomastia at 13 and 16 years of age, respectively. Physical examinations revealed breast of Tanner stage 3 and normal male-type external genitalia in both cases. Clinical features such as female-type pubic hair and borderline small testis indicated mildly impaired masculinization. Molecular analysis identified a previously reported p.Arg789Ser mutation in the androgen receptor gene (AR) in the 2 cases. Two months of oral administration of tamoxifen ameliorated gynecomastia to Tanner stage 2 with no adverse events. Additional treatment with testosterone enanthate showed negligible effects on body hair and penile length. Hormone values of the 2 cases during tamoxifen treatment remained similar to those in previously reported untreated patients with PAIS. The results indicate that tamoxifen was effective in treating pubertal gynecomastia in these 2 patients with PAIS and may be considered as a therapeutic option in this situation pending further studies.
Pubertal timing and substance use: associations between and within families across late adolescence.
Dick, D M; Rose, R J; Viken, R J; Kaprio, J
2000-03-01
In the present study, between-family analyses of data from adolescent twin girls offer new evidence that early menarche is associated with earlier initiation and greater frequency of smoking and drinking. The role of personality factors and peer relationships in that association was investigated, and little support was found for their involvement. Novel within-family analyses replicating associations of substance use with pubertal timing in contrasts of twin sisters selected for extreme discordance for age at menarche are reported. Within-family replications demonstrated that the association of pubertal timing with substance use cannot be explained solely by between-family confounds. Within-family analyses demonstrated contextual modulation of the influence of pubertal timing: Its impact on drinking frequency is apparent only among girls in urban settings. Sibling comparisons illustrate a promising analytic tool for studying diverse developmental outcomes.
Melatonin and LH secretion patterns in pubertal boys
International Nuclear Information System (INIS)
Fevre, M.; Boyar, R.M.; Rollag, M.D.
1979-01-01
Plasma melatonin and LH were measured at 20 minute intervals for 24 hours in four normal pubertal boys. All four subjects showed a significant augmentation of LH and melatonin during nocturnal sleep. There was also a significant correlation between the LH and melatonin levels (p [fr
Blood spotting on underpants: Case report of urethral prolapse in a pre-pubertal Chinese girl
Directory of Open Access Journals (Sweden)
Hei Yi Wong
2015-05-01
Full Text Available Urethral prolapse is a rare urological condition with non-specific clinical manifestations which is mostly seen in pre-pubertal black girls and postmenopausal woman. The exact etiology still remains unknown. We herein present a case report of urethral mucosa prolapse in a 5 year-old Chinese pre-pubertal girl.
Lazzer, S; Patrizi, A; De Col, A; Saezza, A; Sartorio, A
2014-06-01
To develop and crossvalidate new equations for predicting basal metabolic rate (BMR) in obese children and adolescents in relation to pubertal stages, anthropometric characteristics or body composition. A total of 1696 obese Caucasian children and adolescents (mean body mass index z-score: 3.5±0.8) participated in this study. BMR was determined by indirect calorimetry and fat-free mass (FFM) and fat mass (FM) by bioelectrical impedance analysis. Equations were derived by stepwise multiple regression analysis using a calibration cohort of 848 subjects, and the equations were crossvalidated with a Bland and Altman method in the remaining 848 subjects. Two new specific equations based on gender (1: males; 0: females), pubertal stages (from 1 to 5, assessed according Marshall & Tanner methods) and body weight (BW, kg), stature (m) or body composition (kg) were generated as follows: (1) BMR=(BW × 0.044)+(stature × 2.836)-(pubertal stage × 0.148)+(gender × 0.781)-0.551 (adjusted coefficient of determination (R(2)adj)= 0.69 and root mean squared error (RMSE)=0.954 MJ); (2) BMR=(FFM × 0.082)+(FM × 0.037)-(pubertal stage × 0.125)+(gender × 0.706)+2.528 (R(2)adj= 0.70 and RMSE=0.943 MJ). In the crossvalidation group, mean-predicted BMR was not significantly different from the mean-measured BMR (MBMR) for all children and adolescents, as well as for boys and girls (differenceBMR was predicted accurately (90-110% of MBMR) in 67% of subjects. The new prediction equations considering the pubertal stages allow an accurate and more appropriate (vs equations using chronological age) estimation of BMR in obese children and adolescents.
The Role of Peer Stress and Pubertal Timing on Symptoms of Psychopathology during Early Adolescence
Sontag, Lisa M.; Graber, Julia A.; Clemans, Katherine H.
2011-01-01
Stress is known to amplify the link between pubertal timing and psychopathology. However, few studies have examined the role of peer stress as a context for this link. The present study examined the interaction between perceived pubertal timing and peer stress on symptoms of psychopathology in early adolescence. The sample consisted of 264…
Electro convulsive therapy in a pre-pubertal child with severe depression.
Directory of Open Access Journals (Sweden)
Russell P
2002-10-01
Full Text Available Electro Convulsive Therapy (ECT in pre-pubertal children is a controversial and underreported treatment. Even though the effectiveness and side effects of ECT in adolescents are comparable with those in adults, there is a pervasive reluctance to use ECT in children and adolescents. We report the case of a pre-pubertal child in an episode of severe depression with catatonic features, where a protracted course of ECT proved life-saving in spite of prolonged duration of seizures and delayed response to treatment. The case illustrates the safety and efficacy of ECT in children. Relevant literature is also reviewed along with the case report.
Goluch-Koniuszy, Zuzanna; Friedrich, Mariola; Radziszewska, Magdalena
2009-01-01
This research was aimed at evaluation of the method of nutrition and the state of nutrition in the children aged 13 during the period of pubertal spurt who had their body mass, body height and waist measurement defined. These values led to calculation of BMI, WC, and WHtR indicators, which were related to centile distribution of children from Warszawa and Lódź. Only in 63.6% of girls and 68.9% of boys from Szczecin schools the value of BMI was proper. The problem of accumulation of fat tissue (WC > or = 90 c) around the waist refers to nearly 14% of girls and 9.4% of boys. The value of the indicator WHtR > or = 90 c was found in 11% of the children under research. Children with overweight (BMI 90-97 c) and obesity (BMI > or = 97 c) were selected based on the value of BMI indicator. Their menus of three chosen at random weekdays were obtained. Analysis of the nutrition method of children with overweight and obesity showed low energy value of the diet, general protein, complex carbohydrates, cellulose, mineral components (Ca, Mg, Fe, Cu, Zn), A, E (girls), C (boys), group B vitamins and also liquids deficiency. The children have undergone a special pro health education in the form of "live" workshops and 3 months after an evaluation inquiry was conducted to assess the effects of the workshops. The analysis of the evaluation inquiry showed that the children have included in their diet breakfasts and afternoon snacks and to their main meal menus whole wheat products, larger quantity of vegetables, fruit and water. It has been also established that sweets, meals of fast food types, chips, pizzy and energizing drinks have been limited.
Wu, Yan Yan; Lye, Stephen; Briollais, Laurent
2017-10-01
Recent studies have implicated the FTO gene in child and adult obesity. A longer duration of exclusive breastfeeding (EXBF) has been shown to reduce body mass index (BMI) and the risk of being overweight in the general population and among FTO gene carriers. However, it remains unclear whether the preventive effect of EXBF could be explained by its impact on early life growth development, e.g. ages at adiposity peak (AP) and adiposity rebound (AR) and BMI velocities in the first years of life, which are major determinants of overweight and obesity later in life. We studied 5590 children from the British Avon Longitudinal Study of Parents and Children (ALSPAC) cohort and modelled their longitudinal BMI profiles with mixed effects models from birth to 16 years of age, as well as their ages at AP, AR and BMI velocities in relation to the FTO gene variant and EXBF. A longer duration of EXBF (i.e. at least 5 months) has substantial impact on BMI growth trajectories among children carrying the FTO adverse variant by modulating the age at AP, age at AR and BMI velocities. EXBF acts antagonistically to the FTO rs9939609 risk allele and by the age of 15, the predicted reduction in BMI after 5 months of EXBF is 0.56 kg/m2 [95% confidence interval (CI) 0.11-1.01; P = 0.003] and 1.14 kg/m2 (95% CI 0.67-1.62; P < 0.0001) in boys and girls, respectively. EXBF influences early life growth development and thus plays a critical role in preventing the risks of overweight and obesity even when those are exacerbated by genetic factors. © The Author 2017; all rights reserved. Published by Oxford University Press on behalf of the International Epidemiological Association
DEFF Research Database (Denmark)
Søeborg, Tue; Frederiksen, Hanne; Mouritsen, Annette
2014-01-01
The influence of sex, age, pubertal development and oral contraceptives on dehydroepiandrosterone (DHEA), DHEA sulfate (DHEAS), 17α-hydroxyprogesterone (17-OHP), Δ4-androstenedione (Adione), testosterone (T), calculated free testosterone (fT), free androgen index (FAI) and selected ratios in 1798...... serum samples from healthy children, adolescents and young adults was evaluated. Samples were analyzed by Turboflow-LC-MS/MS. Sex hormone-binding globulin was analyzed by immunoassay. All steroid metabolite concentrations were positively associated with age and pubertal development in both sexes....... Use of oral contraceptives significantly lowered serum concentrations of all steroid metabolites, fT, FAI, the 17-OHP/Adione, the Adione/T and the DHEA/Adione ratios, but not the DHEA/DHEAS ratio. We provide reference ranges for DHEA, DHEAS, 17-OHP, Adione, T, fT, FAI and selected ratios in relation...
Neurodevelopmental problems and extremes in BMI
Directory of Open Access Journals (Sweden)
Nóra Kerekes
2015-07-01
Full Text Available Background. Over the last few decades, an increasing number of studies have suggested a connection between neurodevelopmental problems (NDPs and body mass index (BMI. Attention deficit/hyperactivity disorder (ADHD and autism spectrum disorders (ASD both seem to carry an increased risk for developing extreme BMI. However, the results are inconsistent, and there have been only a few studies of the general population of children.Aims. We had three aims with the present study: (1 to define the prevalence of extreme (low or high BMI in the group of children with ADHD and/or ASDs compared to the group of children without these NDPs; (2 to analyze whether extreme BMI is associated with the subdomains within the diagnostic categories of ADHD or ASD; and (3 to investigate the contribution of genetic and environmental factors to BMI in boys and girls at ages 9 and 12.Method. Parents of 9- or 12-year-old twins (n = 12,496 were interviewed using the Autism—Tics, ADHD and other Comorbidities (A-TAC inventory as part of the Child and Adolescent Twin Study in Sweden (CATSS. Univariate and multivariate generalized estimated equation models were used to analyze associations between extremes in BMI and NDPs.Results. ADHD screen-positive cases followed BMI distributions similar to those of children without ADHD or ASD. Significant association was found between ADHD and BMI only among 12-year-old girls, where the inattention subdomain of ADHD was significantly associated with the high extreme BMI. ASD scores were associated with both the low and the high extremes of BMI. Compared to children without ADHD or ASD, the prevalence of ASD screen-positive cases was three times greater in the high extreme BMI group and double as much in the low extreme BMI group. Stereotyped and repetitive behaviors were significantly associated with high extreme BMIs.Conclusion. Children with ASD, with or without coexisting ADHD, are more prone to have low or high extreme BMIs than
Pfeifer, Jennifer H; Kahn, Lauren E; Merchant, Junaid S; Peake, Shannon J; Veroude, Kim; Masten, Carrie L; Lieberman, Matthew D; Mazziotta, John C; Dapretto, Mirella
2013-04-24
Self-evaluations undergo significant transformation during early adolescence, developing in parallel with the heightened complexity of teenagers' social worlds. Intuitive theories of adolescent development, based in part on animal work, suggest that puberty is associated with neural-level changes that facilitate a "social reorientation" (Nelson et al., 2005). However, direct tests of this hypothesis using neuroimaging are limited in humans. This longitudinal fMRI study examined neurodevelopmental trajectories associated with puberty, self-evaluations, and the presumed social reorientation during the transition from childhood to adolescence. Participants (N = 27, mean age = 10.1 and 13.1 years at time points one and two, respectively) engaged in trait evaluations of two targets (the self and a familiar fictional other), across two domains of competence (social and academic). Responses in ventromedial PFC increased with both age and pubertal development during self-evaluations in the social domain, but not in the academic domain. These results suggest that changes in social self-evaluations are intimately connected with biology, not just peer contexts, and provide important empirical support for the relationship between neurodevelopment, puberty, and social functioning.
Nuruddin, Syed; Krogenæs, Anette; Brynildsrud, Ola Brønstad; Verhaegen, Steven; Evans, Neil P; Robinson, Jane E; Haraldsen, Ira Ronit Hebold; Ropstad, Erik
2013-12-01
The nature of hormonal involvement in pubertal brain development has attracted wide interest. Structural changes within the brain that occur during pubertal development appear mainly in regions closely linked with emotion, motivation and cognitive functions. Using a sheep model, we have previously shown that peri-pubertal pharmacological blockade of gonadotropin releasing hormone (GnRH) receptors, results in exaggerated sex-differences in cognitive executive function and emotional control, as well as sex and hemisphere specific patterns of expression of hippocampal genes associated with synaptic plasticity and endocrine signaling. In this study, we explored effects of this treatment regime on the gene expression profile of the ovine amygdala. The study was conducted with 30 same-sex twin lambs (14 female and 16 male), half of which were treated with the GnRH agonist (GnRHa) goserelin acetate every 4th week, beginning before puberty, until approximately 50 weeks of age. Gene expression profiles of the left and right amygdala were measured using 8×15 K Agilent ovine microarrays. Differential expression of selected genes was confirmed by qRT-PCR (Quantitative real time PCR). Networking analyses and Gene Ontology (GO) Term analyses were performed with Ingenuity Pathway Analysis (IPA), version 7.5 and DAVID (Database for Annotation, Visualization and integrated Discovery) version 6.7 software packages, respectively. GnRHa treatment was associated with significant sex- and hemisphere-specific differential patterns of gene expression. GnRHa treatment was associated with differential expression of 432 (|logFC|>0.3, adj. p value expressed as a result of GnRHa treatment in the male animals. The results indicated that GnRH may, directly and/or indirectly, be involved in the regulation of sex- and hemisphere-specific differential expression of genes in the amygdala. This finding should be considered when long-term peri-pubertal GnRHa treatment is used in children. Copyright
Bmi1 is required for hedgehog pathway-driven medulloblastoma expansion
Michael, Lowell Evan; Westerman, Bart A.; Ermilov, Alexandre N.; Wang, Aiqin; Ferris, Jennifer; Liu, Jianhong; Blom, Marleen; Ellison, David W.; van Lohuizen, Maarten; Dlugosz, Andrzej A.
2008-01-01
Inappropriate Hedgehog (Hh) signaling underlies development of a subset of medulloblastomas, and tumors with elevated HH signaling activity express the stem cell self-renewal gene BMI1. To test whether Bmi1 is required for Hh-driven medulloblastoma development, we varied Bmi1 gene dosage in
Insulin resistance in obese pre-pubertal children: Relation to body ...
African Journals Online (AJOL)
Secondary outcome is to determine the frequency of the metabolic syndrome components. Subjects and methods: Twenty-three pre-pubertal obese children were ... oral glucose tolerance testing (OGTT) and DXA scan for body composition.
Bmi1 Is Required for Hedgehog Pathway-Driven Medulloblastoma Expansion
Directory of Open Access Journals (Sweden)
Lowell Evan Michael
2008-12-01
Full Text Available Inappropriate Hedgehog (Hh signaling underlies development of a subset of medulloblastomas, and tumors with elevated HH signaling activity express the stem cell self-renewal gene BMI1. To test whether Bmi1 is required for Hh-driven medulloblastoma development, we varied Bmi1 gene dosage in transgenic mice expressing an oncogenic Hh effector, SmoA1, driven by a glial fibrillary acidic protein (GFAP promoter. Whereas 100% of SmoA1; Bmi1+/+ or SmoA1;Bmi1+/- mice examined between postnatal (P days 14 and 26 had typical medulloblastomas (N = 29, tumors were not detected in any of the SmoA1;Bmi1-/- animals examined (N = 6. Instead, small ectopic collections of cells were present in the region of greatest tumor load in SmoA1 animals, suggesting that medulloblastomas were initiated but failed to undergo expansion into frank tumors. Cells within these Bmi1-/- lesions expressed SmoA1 but were largely nonproliferative, in contrast to cells in Bmi1+/+ tumors (6.2% vs 81.9% PCNA-positive, respectively. Ectopic cells were negative for the progenitor marker nestin, strongly GFAP-positive, and highly apoptotic, relative to Bmi1+/+ tumor cells (29.6% vs 6.3% TUNEL-positive. The alterations in proliferation and apoptosis in SmoA1;Bmi1-/- ectopic cells are associated with reduced levels of Cyclin D1 and elevated expression of cyclin-dependent kinase inhibitor p19Arf, two inversely regulated downstream targets of Bmi1. These data provide the first demonstration that Bmi1 is required for spontaneous de novo development of a solid tumor arising in the brain, suggest a crucial role for Bmi1-dependent, nestin-expressing progenitor cells in medulloblastoma expansion, and implicate Bmi1 as a key factor required for Hh pathway-driven tumorigenesis.
Recent changes in pubertal timing in healthy Danish boys: associations with body mass index
DEFF Research Database (Denmark)
Sørensen, Kaspar; Aksglaede, Lise; Petersen, Jørgen Holm
2010-01-01
In the 1990s, the American population-based study NHANES III renewed the focus on possible secular trends in male puberty. However, no conclusions could be made on pubertal onset due to the lack of compatible data.......In the 1990s, the American population-based study NHANES III renewed the focus on possible secular trends in male puberty. However, no conclusions could be made on pubertal onset due to the lack of compatible data....
Stein, Aryeh D; Lundeen, Elizabeth A; Martorell, Reynaldo; Suchdev, Parminder S; Mehta, Neil K; Richter, Linda M; Norris, Shane A
2016-07-01
Height and adiposity track over childhood, but few studies, to our knowledge, have longitudinally examined the mediating relation of the timing and progression of puberty. We assessed interrelations between prepubertal height and body mass index, the progression through puberty, and young adult height and adiposity. We analyzed data from the Birth to Twenty Plus study (females, n = 823; males, n = 765). Serial measures of anthropometry and pubertal development were obtained between ages 9 and 16 y. We used latent class growth analysis to categorize pubertal development with respect to pubic hair (females and males), breasts (females), and genitalia (males) development. Adult height and weight were obtained at ages 18 to 20 y. Among females, higher latent class (earlier initiation and faster progression through puberty) was associated with an increased risk of obesity [pubic hair class 3 compared with class 1: RR, 3.41 (95% CI: 1.57, 7.44)] and inconsistent associations with height. Among males, higher latent class was associated with increased adult height [pubic hair development class 3 compared with class 1: 2.43 cm (95% CI: 0.88, 4.00)] and increased risk of overweight/obesity [pubic hair development class 3 compared with class 1: OR, 3.44 (95% CI: 1.44, 8.20)]. In females, the association with adult height became inverse after adjusting for prepubertal height [pubic hair development class 3 compared with class 1: females, -1.31 cm (95% CI: -2.32, -0.31)]; in males, the association with height was attenuated with this adjustment [-0.56 cm (95% CI: -1.63, 0.52)]. Associations with adiposity were attenuated after adjusting for prepubertal adiposity. Progression through puberty modifies the relation between prepubertal and adult anthropometry. Screening for early or rapid progression of puberty might identify children at an increased risk of becoming overweight or obese adults.
... between the BMI and body fatness is fairly strong 1,2,3,7 , but even if 2 people have the same BMI, their level of body fatness may differ 12 . In general, At the same BMI, women tend to have more body fat than men. At the same BMI, Blacks have less body ...
Keenan, Kate; Hipwell, Alison E; Hinze, Amanda E; Babinski, Dara E
2009-08-01
To test whether an association between pain response and depression in females is present during preadolescence using a controlled pain stimulus and a clinically relevant assessment of depressive symptoms. In a sample of 232 girls, pain threshold and tolerance were assessed at age 10 years using the cold pressor task, and a diagnostic interview was used to assess depression symptoms at 10 and 11 years of age. Response to pain at age 10 was associated with depressive symptoms at ages 10 and 11; race and pubertal stage moderated the association. Pain response and depression were more strongly associated among girls who had reached advanced stages of pubertal development and among European American girls. The results add to the existing literature on the co-occurrence of depression and pain by demonstrating modest but consistent concurrent and prospective associations between response to pain and depression among girls during preadolescence.
DEFF Research Database (Denmark)
Ravnborg, Trine L; Jensen, Tina K; Andersson, Anna-Maria
2011-01-01
BACKGROUND Exposure to tobacco smoking prenatally is a risk factor for reduced semen quality, but whether the exposure has adverse effects on reproductive hormones, pubertal development or adult BMI remain largely unexplored. The aim of this study was to investigate the associations between...... these factors while controlling for the effects of current smoking in young adulthood. METHODS This cross-sectional study (1996-2006) included 3486 Danish men (median age: 19 years), participating in a semen-quality study. Data were obtained from questionnaires, physical examinations, semen analyses...... and assessments of reproductive hormones. The main outcome measures were markers of pubertal onset, BMI, reproductive hormones and semen variables. RESULTS Maternal smoking during pregnancy was associated with earlier onset of puberty (e.g. early pubic hair development in 25.2 versus 18.9% of unexposed subjects...
Insulin resistance in obese pre-pubertal children: Relation to body ...
African Journals Online (AJOL)
Heba Elsedfy
2014-04-16
Apr 16, 2014 ... of pre-pubertal obese children, and to investigate the relation- .... children P 10 years, HDL-Cholesterol <35 mg/dl) [18]. .... HDL: high density lipoprotein, TG: triglycerides, IFG: impaired fasting glucose, IGT: impaired glucose ...
Serum levels of INSL3, AMH, Inhibin B and Testosterone during pubertal transition in healthy boys
DEFF Research Database (Denmark)
Lindhardt Johansen, Marie; Anand-Ivell, Ravinder; Mouritsen, Annette
2014-01-01
to luteinizing hormone (LH), follicle-stimulating hormone (FSH), testosterone, inhibin B, and anti-Müllerian hormone (AMH) during puberty in healthy boys.MethodsTen boys were included from the longitudinal part of the COPENHAGEN Puberty Study. Pubertal evaluation, including testicular volume, was performed...... and blood samples drawn every 6 months for 5 years. Serum concentrations of testosterone were determined by a newly developed LC-MS/MS method, and serum concentrations of INSL3, AMH, inhibin B, FSH and LH, respectively, were determined by validated immunoassays.ResultsSerum INSL3 levels increased...... progressively with increasing age, pubertal onset and testicular volume. In six of ten boys, LH increased prior to the first observed increase in INSL3. In the remaining four boys, the increase in LH and INSL3 was observed at the same examination. The increases in serum concentrations of LH, testosterone...
Mohr, Margaret A; Sisk, Cheryl L
2013-03-19
During puberty, the brain goes through extensive remodeling, involving the addition of new neurons and glia to brain regions beyond the canonical neurogenic regions (i.e., dentate gyrus and olfactory bulb), including limbic and hypothalamic cell groups associated with sex-typical behavior. Whether these pubertally born cells become functionally integrated into neural circuits remains unknown. To address this question, we gave male Syrian hamsters daily injections of the cell birthdate marker bromodeoxyuridine throughout puberty (postnatal day 28-49). Half of the animals were housed in enriched environments with access to a running wheel to determine whether enrichment increased the survival of pubertally born cells compared with the control environment. At 4 wk after the last BrdU injection, animals were allowed to interact with a receptive female and were then killed 1 h later. Triple-label immunofluorescence for BrdU, the mature neuron marker neuronal nuclear antigen, and the astrocytic marker glial fibrillary acidic protein revealed that a proportion of pubertally born cells in the medial preoptic area, arcuate nucleus, and medial amygdala differentiate into either mature neurons or astrocytes. Double-label immunofluorescence for BrdU and the protein Fos revealed that a subset of pubertally born cells in these regions is activated during sociosexual behavior, indicative of their functional incorporation into neural circuits. Enrichment affected the survival and activation of pubertally born cells in a brain region-specific manner. These results demonstrate that pubertally born cells located outside of the traditional neurogenic regions differentiate into neurons and glia and become functionally incorporated into neural circuits that subserve sex-typical behaviors.
Perception regarding pubertal changes among rural adolescent boys of Haryana: A school based study
Directory of Open Access Journals (Sweden)
Vinod Chayal
2016-06-01
Full Text Available Background: Adolescence is a transition phase through which a child matures into an adult. The physical changes in the human body are from infant to child to adolescence to adult to old age. All phases of life behave like a coin with both good and bad facets attached to each phase of life. Aims & Objectives: 1. To study perception and awareness regarding pubertal changes among school going adolescent boys. 2. To study the association between education and perceived pubertal problems among study subjects. Material & Methods: The study was conducted among male students of senior secondary schools of community development block Beri in one year. The study universe comprised of students in middle and late adolescence (aged 14-18 years studying in 9th to 12th classes of the senior secondary schools in the area. A total of 1000 male students were selected from these schools which were more than the required sample size of 891. Results: The study found that 42.66% students and a half (50% of students of class 9th & 10th and class 11th & 12th respectively considered that pubertal changes as a normal phenomenon. The majority of students admitted practicing masturbation and felt shy and guilty for practicing masturbation, also students felt fatigued after night emission. Conclusions: The study concludes that adolescent’s sexuality which often causes controversy and concern among adults is least discussed with them during adolescence. The reasons for this may be many, including moral grounds or because of concomitant health risks and threats to wellbeing.
International Nuclear Information System (INIS)
Schuck, A.; Hamelmann, V.; Braemswig, J.H.
2005-01-01
Purpose: To analyze the effect of pelvic radiotherapy on ovarian function in prepubertal and pubertal girls and young adult women. Patients and methods: In a retrospective monoinstitutional analysis, patients 15 Gy to the ovaries developed hormone failure. In one case of a patient receiving an ovarian dose of 15 Gy, hormone failure was not found. In case of pelvic irradiation excluding at least one ovary, approximately half of the patients developed ovarian dysfunction, probably also due to the effects of polychemotherapy. (orig.)
Directory of Open Access Journals (Sweden)
Mayara Morena Del Cambre Amaral Weller
2016-10-01
Full Text Available Growth factors such as bone morphogenetic proteins 6, 7, 15 and two isoforms of transforming growth factor-beta (BMP6, BMP7, BMP15, TGFB1 and TGFB2 and insulin-like growth factor system act as local regulators of ovarian follicular development. To elucidate if these factors as well as others candidate genes such as estrogen receptor 1 (ESR1, growth differentiation factor 9 (GDF9, follicle stimulating hormone receptor (FSHR, luteinizing hormone receptor (LHR, bone morphogenetic protein receptor, type 2 (BMPR2, type 1 insulin-like growth factor receptor (IGFR1, and key steroidogenic enzymes cytochrome P450 aromatase and 3-β-hydroxysteroid dehydrogenase (CYP19A1 and HSD3B1 could modulate or influence diestrus on the onset of puberty in Brahman heifers, their ovarian mRNA expression was measured before and after puberty (luteal phase. Six post-pubertal (POST heifers were euthanized on the luteal phase of their second cycle, confirmed by corpus luteum observation, and six pre-pubertal (PRE heifers were euthanized in the same day. Quantitative real-time PCR analysis showed that the expression of FSHR, BMP7, CYP19A1, IGF1 and IGFR1 mRNA was greater in PRE heifers, when contrasted to POST heifers. The expression of LHR and HSD3B1 was lower in PRE heifers. Differential expression of ovarian genes could be associated with changes in follicular dynamics and different cell populations that have emerged as consequence of puberty and the luteal phase. The emerging hypothesis is that BMP7 and IGF1 are co-expressed and may modulate the expression of FSHR, LHR and IGFR1 and CYP19A1. BMP7 could influence the down-regulation of LHR and up-regulation of FSHR and CYP19A1, which mediates the follicular dynamics in heifer ovaries. Up-regulation of IGF1 expression pre-puberty, compared to post-puberty diestrus, correlates with increased levels FSHR and CYP19A1. Thus, BMP7 and IGF1 may play synergic roles and were predicted to interact, from the expression data (P = 0
Rosenkrans, Kelly S; Hardin, David K
2003-03-01
The objective of this study was to compare the repeatability and accuracy of palpation per rectum to transrectal ultrasonography and serum progesterone concentrations for determining pubertal status in beef heifers. One hundred and seventy-four rectal examinations were performed on 29 predominantly Angus heifers by two veterinarians (A and B) and assigned individual reproductive tract scores (RTS) during monthly examinations over a 3-month period. Heifers were examined in the morning by both veterinarians, randomized, and re-examined in the afternoon. The size and location of ovarian structures of each heifer were determined by ultrasonography. Heifers with follicles >10mm in diameter or corpora lutea were classified as pubertal. Serum progesterone concentrations at the time of the examination and 10 days later were determined by radioimmunoassay and used to classify heifers as prepubertal (or=1 ng/ml). Kappa, which describes degree of agreement beyond chance, was used to determine repeatability of the RTS system. Multicategory Kappa for agreement was 0.64 within veterinarian, 0.46 between veterinarian, and 0.35 between palpation per rectum and transrectal ultrasonography. Sensitivity and specificity of palpation per rectum for diagnosis of pubertal status compared to serum progesterone levels were higher (82 and 69%, respectively) than sensitivity and specificity of ultrasonography (79 and 59%, respectively). This study validates the RTS system as a repeatable and accurate screening test to evaluate pubertal status in groups of heifers prior to the onset of the breeding season.
Kurtoğlu, Selim; Hatipoğlu, Nihal; Mazıcıoğlu, Mümtaz; Kendirici, Mustafa; Keskin, Mehmet; Kondolot, Meda
2010-01-01
Childhood obesity is associated with an increased risk for insulin resistance. The underlying mechanism for the physiological increase in insulin levels in puberty is not clearly understood. The aim of the present study was to determine the cut-off values for homeostasis model assessment for insulin resistance (HOMA-IR) in obese children and adolescents according to gender and pubertal status. Two hundred and eight obese children and adolescents (141 girls, 127 boys) aged between 5 and 18 years were included in the study. The children were divided into prepubertal and pubertal groups. A standard oral glucose tolerance test (OGTT) was carried out in all children. A total insulin level exceeding 300 μU/mL in the blood samples, collected during the test period, was taken as the insulin resistance criterion. Cut-off values for HOMA-IR were calculated by receiver operating characteristic (ROC) analysis. In the prepubertal period, the rate of insulin resistance was found to be 37% in boys and 27.8% in girls,while in the pubertal period, this rate was 61.7% in boys and 66.7% in girls. HOMA-IR cut-off values for insulin resistance in the prepubertal period were calculated to be 2.67 (sensitivity 88.2%, specificity 65.5%) in boys and 2.22 (sensitivity 100%, specificity 42.3%) in girls, and in the pubertal period, they were 5.22 (sensitivity 56%, specificity 93.3%) in boys and 3.82 (sensitivity 77.1%, specificity 71.4%) in girls. Since gender, obesity and pubertal status are factors affecting insulin resistance, cut-off values which depend on gender and pubertal status, should be used in evaluation of insulin resistance.
Elevated serum IGF-I, but unaltered sex steroid levels, in healthy boys with pubertal gynaecomastia
DEFF Research Database (Denmark)
Mieritz, Mikkel G; Sorensen, Kaspar; Aksglaede, Lise
2014-01-01
OBJECTIVE: Pubertal gynaecomastia is a very common condition. Although the underlying aetiology is poorly understood, it is generally accepted that excess of oestrogens and deficit of androgens are involved in the pathogenesis. Furthermore, adiposity as well as the GH/IGF-I axis may play a role....... In this study, we elucidate the association of adiposity and levels of follicle-stimulating hormone (FSH), luteinizing hormone (LH), sex hormone-binding globulin (SHBG), testosterone, oestrogen, IGF-I and IGFBP-3 with the presence of pubertal gynaecomastia in a large cohort of healthy boys. PATIENTS: A total...... of 501 healthy Danish school boys (aged 6·1-19·8 year) from the COPENHAGEN Puberty Study. MEASUREMENTS: Anthropometry and pubertal stages (PH1-6 and G1-5) were evaluated, and the presence of gynaecomastia was assessed. Body fat percentage was calculated by means of four skin folds and impedance...
Negriff, Sonya; Ji, Juye; Trickett, Penelope K.
2013-01-01
This study examined exposure to peer delinquency as a mediator between pubertal timing and self-reported delinquency longitudinally and whether this mediational model was moderated by either gender or maltreatment experience. Data were obtained from Time 1, 2, and 3 of a longitudinal study of maltreatment and development. At Time 1 the sample comprised 454 children aged 9–13 years. Analyses via structural equation modeling supported full mediation. Gender did not moderate this mediational relationship, but maltreatment experience did. The results show that early maturing males and females are both at risk for being exposed to peers that may draw them into delinquent behavior. Additionally, the mechanism linking early pubertal timing to delinquency differs depending on maltreatment experience. PMID:21262055
Chen, Ling-Wei; Aris, Izzuddin M; Bernard, Jonathan Y; Tint, Mya-Thway; Colega, Marjorelee; Gluckman, Peter D; Tan, Kok Hian; Shek, Lynette Pei-Chi; Chong, Yap-Seng; Yap, Fabian; Godfrey, Keith M; van Dam, Rob M; Chong, Mary Foong-Fong; Lee, Yung Seng
2017-03-01
Background: Infant body mass index (BMI) peak characteristics and early childhood BMI are emerging markers of future obesity and cardiometabolic disease risk, but little is known about their maternal nutritional determinants. Objective: We investigated the associations of maternal macronutrient intake with infant BMI peak characteristics and childhood BMI in the Growing Up in Singapore Towards healthy Outcomes study. Design: With the use of infant BMI data from birth to age 18 mo, infant BMI peak characteristics [age (in months) and magnitude (BMI peak ; in kg/m 2 ) at peak and prepeak velocities] were derived from subject-specific BMI curves that were fitted with the use of mixed-effects model with a natural cubic spline function. Associations of maternal macronutrient intake (assessed by using a 24-h recall during late gestation) with infant BMI peak characteristics ( n = 910) and BMI z scores at ages 2, 3, and 4 y were examined with the use of multivariable linear regression. Results: Mean absolute maternal macronutrient intakes (percentages of energy) were 72 g protein (15.6%), 69 g fat (32.6%), and 238 g carbohydrate (51.8%). A 25-g (∼100-kcal) increase in maternal carbohydrate intake was associated with a 0.01/mo (95% CI: 0.0003, 0.01/mo) higher prepeak velocity and a 0.04 (95% CI: 0.01, 0.08) higher BMI peak These associations were mainly driven by sugar intake, whereby a 25-g increment of maternal sugar intake was associated with a 0.02/mo (95% CI: 0.01, 0.03/mo) higher infant prepeak velocity and a 0.07 (95% CI: 0.01, 0.13) higher BMI peak Higher maternal carbohydrate and sugar intakes were associated with a higher offspring BMI z score at ages 2-4 y. Maternal protein and fat intakes were not consistently associated with the studied outcomes. Conclusion: Higher maternal carbohydrate and sugar intakes are associated with unfavorable infancy BMI peak characteristics and higher early childhood BMI. This trial was registered at clinicaltrials.gov as NCT
Perception regarding pubertal changes among rural adolescent boys of Haryana: A school based study
Directory of Open Access Journals (Sweden)
Vinod Chayal
2016-06-01
Full Text Available Background: Adolescence is a transition phase through which a child matures into an adult. The physical changes in the human body are from infant to child to adolescence to adult to old age. All phases of life behave like a coin with both good and bad facets attached to each phase of life. Aims & Objectives: 1. To study perception and awareness regarding pubertal changes among school going adolescent boys. 2. To study the association between education and perceived pubertal problems among study subjects. Material & Methods: The study was conducted among male students of senior secondary schools of community development block Beri in one year. The study universe comprised of students in middle and late adolescence (aged 14-18 years studying in 9th to 12th classes of the senior secondary schools in the area. A total of 1000 male students were selected from these schools which were more than the required sample size of 891. Results: The study found that 42.66% students and a half (50% of students of class 9th & 10th and class 11th & 12th respectively considered that pubertal changes as a normal phenomenon. The majority of students admitted practicing masturbation and felt shy and guilty for practicing masturbation, also students felt fatigued after night emission. Conclusions: The study concludes that adolescent’s sexuality which often causes controversy and concern among adults is least discussed with them during adolescence. The reasons for this may be many, including moral grounds or because of concomitant health risks and threats to wellbeing.
Mutational Analysis of TAC3 and TACR3 Genes in Patients with Idiopathic Central Pubertal Disorders
Tusset, Cintia; Noel, Sekoni D.; Trarbach, Ericka B.; Silveira, Letícia F. G.; Jorge, Alexander A. L.; Brito, Vinicius N.; Cukier, Priscila; Seminara, Stephanie B.; de Mendonça, Berenice B.; Kaiser, Ursula B.; Latronico, Ana Claudia
2013-01-01
Aim To investigate the presence of variants in the TAC3 and TACR3 genes, which encode NKB and its receptor (NK3R), respectively, in a large cohort of patients with idiopathic central pubertal disorders. Patients and Methods Two hundred and thirty seven patients were studied: 114 with central precocious puberty (CPP), 73 with normosmic isolated hypogonadotropic hypogonadism (IHH) and 50 with constitutional delay of growth and puberty (CDGP). The control group consisted of 150 Brazilian individuals with normal pubertal development. Genomic DNA was extracted from peripheral blood and the entire coding region of both TAC3 and TACR3 genes were amplified and automatically sequenced. Results We identified one variant (p.A63P) in NKB and four variants, p.G18D, p.L58L (c.172C>T), p.W275* and p.A449S in NK3R, which were absent in the control group. The p.A63P variant was identified in a girl with CPP, and p.A449S in a girl with CDGP. The known p.G18D, p.L58L and p.W275* variants were identified in three unrelated males with normosmic IHH. Conclusion Rare variants in the TAC3 and TACR3 genes were identified in patients with central pubertal disorders. Loss-of-function variants of TACR3 were associated with the normosmic IHH phenotype. PMID:23329188
Copeptin in obese children and adolescents: relationships to body mass index, cortisol and gender.
Rothermel, Juliane; Kulle, Alexandra; Holterhus, Paul-Martin; Toschke, Christina; Lass, Nina; Reinehr, Thomas
2016-12-01
Copeptin has been reported to be associated with stress, obesity and the metabolic syndrome (MetS) in adults. However, data in childhood are scarce. Therefore, we studied the relationships between copeptin, cortisol, puberty and parameters of the MetS in children. Cross-sectional study. A total of 51 obese children (10·8 ± 3·2 years, 39% male, 45% prepubertal, body mass index standard deviation score (BMI-SDS) 2·77 ± 0·56) and 24 lean children of similar age, gender and pubertal stage. Copeptin, serum cortisol, 24-h urinary free cortisol, BMI-SDS and, as parameters of the MetS, insulin resistance index (HOMA), HbA1c, uric acids, blood pressure and lipids. Copeptin levels were significantly (P = 0·047) higher in obese children (5·8 ± 2·8pmol/l) compared to lean children (4·6 ± 2·2pmol/l). BMI-SDS (β-coefficient 0·38 ± 0·35, P =0·033), but not any parameter of the MetS, was significantly related to copeptin in multiple linear regression analyses adjusted for age, gender and pubertal stage. A 24-h urinary free cortisol (β-coefficient 0·13 ± 0·06, P cortisol, was significantly related to copeptin in multiple linear regression analyses adjusted for age, gender, pubertal stage and BMI-SDS. Pubertal boys (6·6 ± 2·8pmol/l) demonstrated significantly (P = 0·042) higher copeptin levels compared to pubertal girls (4·8 ± 2·6pmol/l), while copeptin concentrations did not differ between prepubertal girls and boys. Copeptin levels are related to 24-h urinary free cortisol in obese children. Pubertal boys, but not prepubertal boys, demonstrated higher copeptin levels than girls, suggesting that sex hormones are involved in the regulation of copeptin levels. Further studies are necessary to understand the relationship between obesity, cortisol, gender, pubertal stage and copeptin levels. © 2016 John Wiley & Sons Ltd.
Role of amygdala kisspeptin in pubertal timing in female rats.
Directory of Open Access Journals (Sweden)
Daniel A Adekunbi
Full Text Available To investigate the mechanism by which maternal obesity disrupts reproductive function in offspring, we examined Kiss1 expression in the hypothalamic arcuate (ARC and anteroventral periventricular (AVPV nuclei, and posterodorsal medial amygdala (MePD of pre-pubertal and young adult offspring. Sprague-Dawley rats were fed either a standard or energy-dense diet for six weeks prior to mating and throughout pregnancy and lactation. Male and female offspring were weaned onto normal diet on postnatal day (pnd 21. Brains were collected on pnd 30 or 100 for qRT-PCR to determine Kiss1 mRNA levels. Maternal obesity increased Kiss1 mRNA expression in the MePD of pre-pubertal male and female offspring, whereas Kiss1 expression was not affected in the ARC or AVPV at this age. Maternal obesity reduced Kiss1 expression in all three brain regions of 3 month old female offspring, but only in MePD of males. The role of MePD kisspeptin on puberty, estrous cyclicity and preovulatory LH surges was assessed directly in a separate group of post-weanling and young adult female rats exposed to a normal diet throughout their life course. Bilateral intra-MePD cannulae connected to osmotic mini-pumps for delivery of kisspeptin receptor antagonist (Peptide 234 for 14 days were chronically implanted on pnd 21 or 100. Antagonism of MePD kisspeptin delayed puberty onset, disrupted estrous cyclicity and reduced the incidence of LH surges. These data show that the MePD plays a key role in pubertal timing and ovulation and that maternal obesity may act via amygdala kisspeptin signaling to influence reproductive function in the offspring.
Kindblom, J M; Nilsson, O; Hurme, T; Ohlsson, C; Sävendahl, L
2002-08-01
Indian Hedgehog (Ihh) has been reported to control the rate of cartilage differentiation during skeletal morphogenesis in rodents through a negative feedback loop involving parathyroid hormone related protein (PTHrP). The role of Ihh and PTHrP in the regulation of human epiphyseal chondrocytes is unknown. The aim of the current study was to examine the expression and localization of Ihh and PTHrP in the human growth plate at various pubertal stages. Growth plate biopsies were obtained from patients subjected to epiphyseal surgery and the expression of Ihh and PTHrP was detected by immunohistochemistry. We show that Ihh and PTHrP are expressed mainly in early hypertrophic chondrocytes in the human growth plate. The levels of expression of Ihh and PTHrP are higher in early stages of puberty than later. Our results suggest that Ihh and PTHrP are present in the human growth plate and that Ihh and PTHrP may be involved in the regulation of pubertal growth in humans.
He, Yao; Lam, Tai Hing; Jiang, Bin; Li, Lan Sun; Sun, Dong Ling; Wu, Lei; Liu, Miao; Yang, Shan Shan; Wang, Yi Yan; Tobias, Deirdre K; Sun, Qi; Hu, Frank B
2014-09-01
It is unclear whether changes in BMI during rapid economic development influence subsequent mortality. We analyzed whether BMI in 1976 and 1994 and changes in BMI during 1976-1994 predict cardiovascular disease (CVD) and all-cause mortality in a 35-year follow-up cohort of 1,696 Chinese (1,124 men and 572 women, aged 35-65 years) in Xi'an, China. Participants were categorized as underweight (economic development was associated with elevated risks of all-cause and CVD mortality. Higher BMI measured before economic development was associated with lower mortality risk, whereas BMI measured afterward was associated with increased mortality. © 2014 by the American Diabetes Association. Readers may use this article as long as the work is properly cited, the use is educational and not for profit, and the work is not altered.
Bmi-1 expression modulates non-small cell lung cancer progression
Xiong, Dan; Ye, Yunlin; Fu, Yujie; Wang, Jinglong; Kuang, Bohua; Wang, Hongbo; Wang, Xiumin; Zu, Lidong; Xiao, Gang; Hao, Mingang; Wang, Jianhua
2015-01-01
Previous studies indicate that the role of B lymphoma Mo-MLV insertion region 1 homolog (Bmi-1) is responsible for multiple cancer progression. However, Bmi-1 in controlling gene expression in non-small cell lung cancer (NSCLC) development is not well explored. Here we report that the Bmi-1 level is highly increased in primary NSCLC tissues compared to matched adjacent non-cancerous tissues and required for lung tumor growth in xenograft model. Furthermore, we also demonstrate that Bmi-1 level is lower in matched involved lymph node cancerous tissues than the respective primary NSCLC tissues. We find that Bmi-1 does not affect cell cycle and apoptosis in lung cancer cell lines as it does not affect the expression of p16/p19, Pten, AKT and P-AKT. Mechanistic analyses note that reduction of Bmi-1 expression inversely regulates invasion and metastasis of NSCLC cells in vitro and in vivo, followed by induction of epithelial-mesenchymal transition (EMT). Using genome microarray assays, we find that RNAi-mediated silence of Bmi-1 modulates some important molecular genetics or signaling pathways, potentially associated with NSCLC development. Taken together, our findings disclose for the first time that Bmi-1 level accumulates strongly in early stage and then declines in late stage, which is potentially important for NSCLC cell invasion and metastasis during progression. PMID:25880371
A pre-pubertal girl with giant juvenile fibroadenoma: A rare case report
Directory of Open Access Journals (Sweden)
Kumar Gaurav
2015-01-01
Conclusion: Through this case we want to emphasize that these giant benign neoplasms should be suspected in any pre-pubertal girl with breast lump and should always be treated with breast conserving surgery.
The importance of puberty for adolescent development: conceptualization and measurement.
Berenbaum, Sheri A; Beltz, Adriene M; Corley, Robin
2015-01-01
How and why are teenagers different from children and adults? A key question concerns the ways in which pubertal development shapes psychological changes in adolescence directly through changes to the brain and indirectly through the social environment. Empirical work linking pubertal development to adolescent psychological function draws from several different perspectives, often with varying approaches and a focus on different outcomes and mechanisms. The main themes concern effects of atypical pubertal timing on behavior problems during adolescence, effects of pubertal status (and associated hormones) on normative changes in behaviors that can facilitate or hinder development (especially risk-taking, social reorientation, and stress responsivity), and the role of puberty in triggering psychopathology in vulnerable individuals. There is also interest in understanding the ways in which changes in the brain reflect pubertal processes and underlie psychological development in adolescence. In this chapter, we consider the ways that puberty might affect adolescent psychological development, and why this is of importance to developmentalists. We describe the processes of pubertal development; summarize what is known about pubertal influences on adolescent development; consider the assumptions that underlie most work and the methodological issues that affect the interpretation of results; and propose research directions to help understand paths from puberty to behavior. Throughout, we emphasize the importance of pubertal change in all aspects of psychological development, and the ways in which puberty represents an opportunity to study the interplay of biological and social influences. © 2015 Elsevier Inc. All rights reserved.
Skorska, Malvina N; Bogaert, Anthony F
2017-01-01
A number of studies have indicated that gay men tend to be shorter, on average, than heterosexual men. Less evidence exists that lesbian women are taller, on average, than heterosexual women. The most popular explanation of the association between sexual orientation and height involves prenatal factors, such that, for example, gay men may have been exposed to lower than typical androgens during fetal development, which impacts their height and sexual orientation as adults. An alternative explanation involves stress, given that stress has been associated with sexual minority identification and with lower height. Another alternative explanation involves nutrition, although its relationship is less clear with sexual minority identification. Using the Add Health data, which is a large, nationally representative and longitudinal sample of American adolescents (n = 14,786), we tested a mediation model, such that sexual orientation → pubertal stress/nutrition → height. Within men, we found that gay men (n = 126) were shorter, on average, than heterosexual men (n = 6412). None of the 24 pubertal stress-related and 15 pubertal nutrition-related variables assessed in the Add Health data mediated the relationship between sexual orientation and height in men. Within women, lesbians (n = 75) did not differ significantly in stature compared to heterosexual women (n = 6267). Thus, prenatal mechanisms (e.g., hormones, maternal immune response) are likely better candidates for explaining the height difference between gay men and heterosexual men.
Polymorphisms in JMJD1C are associated with pubertal onset in boys and reproductive function in men
DEFF Research Database (Denmark)
Mørup, Nina; Busch, Alexander Siegfried; Bang, Anne Kirstine
2017-01-01
single nucleotide polymorphisms (SNPs) nearby JMJD1C are associated with pubertal onset in boys and with male reproduction. 671 peri-pubertal boys, 1,027 young men, 315 fertile men, and 252 infertile men were genotyped for two JMJD1C SNPs (rs7910927 and rs10822184). rs7910927 and rs10822184 showed high...... linkage. Boys with the rs7910927 TT genotype entered puberty 3.6 months earlier than their peers (p = 2.5 × 10-2). In young men, the number of T alleles was associated with decreased levels of SHBG, follicle-stimulating hormone (FSH), testosterone, and testosterone x luteinizing hormone, as well...... on the age at pubertal onset in boys as well as levels of reproductive hormones and testis size in men, emphasizing the relationship between JMJD1C and reproductive functions....
Fröhlich-Reiterer, Elke E; Rosenbauer, Joachim; Bechtold-Dalla Pozza, Susanne; Hofer, Sabine E; Schober, Edith; Holl, Reinhard W
2014-08-01
Increased weight gain has been reported prior to disease onset (accelerator hypothesis) and as a side effect of intensified insulin therapy in type 1 diabetes (T1D). Paediatric studies are complicated by the age-dependency and gender-dependency of BMI, and also by a trend towards obesity in the general population. The aim of this study was to evaluate factors related to the increase in BMI during the course of diabetes in children and adolescents with T1D in a large multicentre survey. Within the DPV database (Diabetespatienten Verlaufsdokumentation) a standardised, prospective, computer-based documentation programme, data of 53,108 patients with T1D, aged 12,774 patients (53% male, mean age 13.4±3.9, mean diabetes duration 4.7±3.0 years and mean age at diabetes onset 8.7±4.0 years) were included in this analysis. Population-based German reference data were used to calculate BMI-SDS and define overweight and obesity. 12.5% of T1D patients were overweight and 2.8% were obese. Multiple longitudinal regression analysis revealed that female gender, low BMI at diabetes onset, intensified insulin therapy and higher insulin dose, as well as pubertal diabetes onset, long diabetes duration and onset in earlier calendar years among girls, were related to higher BMI-SDS increase during the course of diabetes (p1; all). Intensified insulin regimen is associated with weight gain during T1D treatment, in addition to demographic variables. Optimisation of diabetes management, especially in females, might limit weight gain in order to reduce overweight and obesity together with comorbidities among paediatric T1D patients. Published by the BMJ Publishing Group Limited. For permission to use (where not already granted under a licence) please go to http://group.bmj.com/group/rights-licensing/permissions.
Puberty and Pubertal Growth in GH-treated SGA Children: Effects of 2 Years of GnRHa Versus No GnRHa.
van der Steen, Manouk; Lem, Annemieke J; van der Kaay, Danielle C M; Hokken-Koèelega, Anita C S
2016-05-01
Most studies on puberty in children born small for gestational age (SGA) report height and age at onset of puberty. GH-treated SGA children with an adult height (AH) expectation below -2.5 SDS at onset of puberty can benefit from an additional 2 years of GnRH analog (GnRHa) treatment. There are no data on puberty and growth after discontinuation of GnRHa treatment in GH-treated SGA children. This study aimed to investigate the effects on puberty and pubertal growth of 2 years GnRHa vs no GnRHa in GH-treated SGA children. This was a GH trial involving 76 prepubertal short SGA children (36 girls) treated with GH. Thirty-two children received additional GnRHa for 2 years. Pubertal stages were 3-monthly assessed according to Tanner. Age, bone age, and median height at pubertal onset were lower in girls and boys in the GH/GnRHa group compared with the GH group. In girls and boys treated with GH/GnRHa, pubertal duration after stop of GnRHa treatment was shorter than pubertal duration in those with GH only (40.9 vs 46.7 mo; P = .044; 50.8 vs 57.5 months; P = .006; respectively). Height gain from onset of puberty until AH, including height gain during 2 years of GnRHa treatment, was 25.4 cm in girls and 33.0 cm in boys, which was 6.6 cm more than girls and boys treated with GH only. AH was similar in children treated with GH/GnRHa compared with those with GH only. GH-treated SGA children who start puberty with an AH expectation below -2.5 SDS and are treated with 2 years of GnRHa have a shorter pubertal duration after discontinuation of GnRHa compared with pubertal duration in children treated with GH only. Height gain from onset of puberty until AH is, however, more due to adequate growth during 2 years of GnRHa treatment resulting in a similar AH as children treated with GH only.
Negriff, Sonya; Trickett, Penelope K
2012-11-01
Early pubertal timing has received considerable empirical support as a risk for adolescent substance use. However, few studies have examined the mediators linking these variables. Therefore, the aims of this study were (1) to examine peer substance use as a mediator between pubertal timing and adolescent substance use longitudinally and (2) to test gender and maltreatment experience as moderators of the mediational model. Data were obtained from time 1, 2, and 3 of a longitudinal study of maltreatment and development. At time 1 the sample was comprised of 303 maltreated and 151 comparison children aged 9-13 years (213 females and 241 males). Longitudinal mediation was tested using structural equation modeling and moderating effects were tested using multiple group analysis. Peer substance use mediated the relationship between early pubertal timing and later adolescent substance use for the total sample. Moderation analyses indicated this significant indirect effect did not differ for males and females. However, it did differ for maltreated versus comparison adolescents with the mediational effect only remaining significant for the comparison group. This is one of the first studies to examine peer substance use as a mediator of pubertal timing and adolescent substance use using a longitudinal design. Early maturing males are at equal risk to early maturing females for interacting with peers that may draw them into substance use. Additionally, the findings indicate that while peers are mediators for comparison adolescents a different mechanism may link early puberty to substance use for maltreated adolescents. Copyright © 2012 Elsevier Ireland Ltd. All rights reserved.
Sex 'n' drugs 'n' rock 'n' roll: the meaning and social consequences of pubertal timing.
Waylen, Andrea; Wolke, Dieter
2004-11-01
This is a brief review of the normal changes in adolescent behaviour and the interplay between biology and social factors that occur at and around puberty, in an attempt to explain when this transition may become problematic The onset of puberty is a biological marker for an individual's transition from a non-reproductive to a reproductive state. Adolescence is a normal developmental transition associated with clearly visible physical changes, reorganization and pruning of neuronal circuits in the brain and the occurrence of new behaviours and interests. It is a time when new life tasks (orientation towards peers of the other sex, romantic and sexual involvement and mastering an educational career) need to be mastered. Parent-child conflict increases and becomes more intense as the adolescent struggles for more independence while still requiring support. These normal changes can become problematic if biological and social expectations diverge e.g. entering puberty very early or very late. While early pubertal onset in boys is likely to have beneficial effects, in girls precocious pubertal timing may have a negative impact on body-image, affect (or emotional well-being) and sex-role expectations. Other individual biological predispositions and genetic endowment may interact with social factors (e.g. peers, parenting style, neighbourhood) making adolescence either an adaptive or a challenging transition. There is a lack of sufficiently large longitudinal studies that have been able to study this interaction between genetics, biology and social environment on adolescent development. The Avon Longitudinal Study of Parents and Children (ALSPAC) cohort provides a unique opportunity to investigate the impact of pubertal timing on social behaviour. Planned assessments and concepts are outlined.
Tamoxifen therapy for the management of pubertal gynecomastia: a systematic review
Lapid, Oren; van Wingerden, Jan J.; Perlemuter, Leon
2013-01-01
Objective: A systematic review to assess the efficacy of tamoxifen in the management of idiopathic pubertal gynecomastia. Data sources: Searches were conducted using the databases of Medline (search engine PubMed) and Web of Science (R). Study selection: Studies reporting the use of Tamoxifen for
Normal Pubertal Development in Daughters of Women With PCOS: A Controlled Study.
Legro, Richard S; Kunselman, Allen R; Stetter, Christy M; Gnatuk, Carol L; Estes, Stephanie J; Brindle, Eleanor; Vesper, Hubert W; Botelho, Julianne C; Lee, Peter A; Dodson, William C
2017-01-01
Daughters of women with polycystic ovary syndrome (PCOS) are thought to be at increased risk for developing stigmata of the syndrome, but the ontogeny during puberty is uncertain. We phenotyped daughters (n = 76) of mothers with PCOS and daughters (n = 80) from control mothers for reproductive and metabolic parameters characteristic of PCOS. We performed a matched case/control study at Penn State Hershey Medical Center that included non-Hispanic, white girls 4 to 17 years old. We obtained birth history, biometric, ovarian ultrasounds, whole-body dual-energy X-ray absorptiometry scan for body composition, 2-hour glucose challenged salivary insulin levels, and two timed urinary collections (12 hours overnight and 3 hours in the morning) for gonadotropins and sex steroids. We measured integrated urinary levels of adrenal (dehydroepiandrosterone sulfate) and ovarian [testosterone (TT)] steroids. Other endpoints included integrated salivary insulin levels and urinary luteinizing hormone levels. There were no differences in detection rates or mean levels for gonadotropins and sex steroids in timed urinary collections between PCOS daughters and control daughters, nor were there differences in integrated salivary insulin levels. Results showed that 69% of Tanner 4/5 PCOS daughters vs 31% of control daughters had hirsutism defined as a Ferriman-Gallwey score >8 (P = 0.04). There were no differences in body composition as determined by dual-energy X-ray absorptiometry between groups in the three major body contents (i.e., bone, lean body mass, and fat) or in ovarian volume between groups. Matched for pubertal stage, PCOS daughters have similar levels of urinary androgens and gonadotropins as well as glucose-challenged salivary insulin levels. Copyright © 2017 by the Endocrine Society
Liang, Hui; Cao, Qing; Liu, Huan; Guan, Wei; Wong, Claudia; Tong, Daniel
2018-01-15
Roux-en-Y gastric bypass has been proven to be beneficial for patients with obesity and type 2 diabetes mellitus (T2DM). In less-obese patient (BMI 30-35 kg/m 2 ), surgical treatment is indicated when medication fails to control the T2DM. Asian develops diabetes at a lower BMI. For lower-BMI patients, the rate of diabetes amelioration varies significantly with patients of higher BMI after surgical treatment. The factors that contribute to the post-operative diabetes response rate in lower-BMI patients have not been elucidated. Between 2010 and 2014, a total of 144 patients who underwent gastric bypass for the treatment of T2DM were included for study. Patients were divided into two groups for subgroup analysis, namely BMI > 30 kg/m 2 and BMI BMI group (BMI > 30 kg/m 2 ) was 80% (n = 90) whereas for the lower BMI (BMI BMI group, low HbA1c and high fasting C-peptide are predictive factors whereas for lower-BMI group, along with elevated C-peptide level, disease duration is the positive predictive factor for DM remission. Patients with BMI > 30 kg/m 2 and those with BMI BMI patients while duration of diabetes is for high-low-BMI patients. C-peptide is a predictor of remission in both groups. Further large-scale studies are required to define the predictors of diabetes remission after gastric bypass in low- and high-BMI patients.
Earlier BMI rebound and lower pre-rebound BMI as risk of obesity among Japanese preschool children.
Kato, N; Isojima, T; Yokoya, S; Tanaka, T; Ono, A; Yokomichi, H; Yamagata, Z; Tanaka, S; Matsubara, H; Ishikuro, M; Kikuya, M; Chida, S; Hosoya, M; Kuriyama, S; Kure, S
2018-01-01
Longitudinal growth data of children were analyzed to clarify the relationship between the timing of body mass index (BMI) rebound and obesity risk in later ages. Of 54 558 children born between April 2004 and March 2005 and longitudinally measured in April and October every year in the preschool period, 15 255 children were analyzed wherein no longitudinal measurement is missing after 1 year of age. BMI rebound age was determined as the age with smallest BMI value across longitudinal individual data after 1 year of age. Rebound age was compared between overweight and non-overweight groups. The subjects were divided into groups based on the timing of rebound. The sex- and age-adjusted mean of the BMI, height and weight s.d. scores for age group, along with 6 months weight and height gain, were compared among groups using analysis of covariance. Among those who were overweight at 66-71 months of age, BMI rebound age obtained at approximately 3 years of age was compared with the non-overweight group, whose BMI rebound age was utmost 66 months or later (PBMI age group showed that earlier BMI rebound results in larger BMI (PBMI rebound earlier than 30 months of age, low BMI was observed (PBMI rebound among groups with rebound age earlier than 60 months of age (PBMI rebound timing with pre-rebound low BMI leads to greater childhood obesity risk; hence, early detection and prevention is necessary for such cases.
Energy Technology Data Exchange (ETDEWEB)
Moell, C.
1988-01-01
Long-term follow-up of growth and development after acute lymphoblastic leukaemia (ALL) in childhood has previously been limited to the prepubertal period. This study describes pubertal growth, final height and the spontaneous secretion of GH in girls treated for ALL, including CNS irradiation with 24 GY. Ten girls, treated earlier for ALL, experienced the menarche at a mean age of 12.2 years. This is significantly earlier than the mean for Swedish girls. Prepubertal growth was near normal after the end of therapy for leukaemia. Mean final height was -1.7 SD, which is 1.5 SD less than at onset and 1.0 SD less than 1 year after the end of treatment. Thirteen other girls had a blunted spontaneous secretion of GH, several years after treatment for ALL; there was no increase in GH secretion during puberty. These results suggest that girls who have been treated for ALL, including CNS irradiation, have a relative GH insufficiency. This insufficiency becomes obvious only when girls cannot respond to the increased need for GH during the pubertal spurt.
International Nuclear Information System (INIS)
Moell, C.
1988-01-01
Long-term follow-up of growth and development after acute lymphoblastic leukaemia (ALL) in childhood has previously been limited to the prepubertal period. This study describes pubertal growth, final height and the spontaneous secretion of GH in girls treated for ALL, including CNS irradiation with 24 GY. Ten girls, treated earlier for ALL, experienced the menarche at a mean age of 12.2 years. This is significantly earlier than the mean for Swedish girls. Prepubertal growth was near normal after the end of therapy for leukaemia. Mean final height was -1.7 SD, which is 1.5 SD less than at onset and 1.0 SD less than 1 year after the end of treatment. Thirteen other girls had a blunted spontaneous secretion of GH, several years after treatment for ALL; there was no increase in GH secretion during puberty. These results suggest that girls who have been treated for ALL, including CNS irradiation, have a relative GH insufficiency. This insufficiency becomes obvious only when girls cannot respond to the increased need for GH during the pubertal spurt. (author)
Pubertal maturation and sex steroids are related to alcohol use in adolescents
Water, E. de; Braams, B.R.; Crone, E.A.; Peper, J.S.
2013-01-01
Adolescents often show risk-taking behavior, including experimentation with alcohol. Previous studies have shown that advanced pubertal maturation is related to increased alcohol use in adolescents, even when controlling for age. Little is known about the underlying mechanisms of this relation
Liu, Xiao-Yan; Sun, Hong-Mei; Feng, Yan-Ling; Hu, Jin; Zhao, Han-Qing; Zhang, Li-Ya
2007-08-01
To study the relationship between vulvovaginitis in pre-pubertal girls and pathogens as Chlamydia trachomatis (Ct), N. gonorrhoeae (Ng), Mycoplasma, Ureaplasma urealyticum (Uu), Mycoplasma hominis (Mh), M. genitalium (Mg), M. fermentans (Mf) and M. penetrans (Mpe), as well as to find out the proportion of mycoplasma which is correlated to sexually transmitted diseases (STD) and AIDS. METHODS Vulvae swab specimens from 285 pre-pubertal girls with vulvovaginitis (case group) and 128 healthy girls (control group) were collected and detected by nested polymerase chain reaction (nPCR) to identify the existence of pathogens as Ct, Ng, Uu, Mh, Mg, Mf and Mpe. nPCR with both high specificity and sensitivity, would not be influenced by the amount of pathogens in specimens or inactivated during the process of storage or transportation. The rate of detection on pathogens was 59.65% in the 285 specimens from case group including 'one kind of pathogen in one specimen' as 37.54% and 'two kinds' as 16.84% and 'three kinds' as 5.26%. However, in the 128 specimens from control group, the detectable rate of pathogen was 6.25%. Relationships were found between Ng (P vulvovaginitis in pre-pubertal girls. In control group the pathogens were detected from 7 specimens including 5 Uu and 2 Mh. Some of the pathogens were correlated to STD and were important in causing vulvovaginitis in pre-pubertal girls. Vulvovaginitis might have been caused by more than one kind of pathogen in pre-pubertal girls. The locations of Mg, Mf and Ng in outer genital tracts were correlated to seasonal change. Macrolide seemed to be quite effective clinically in treating urogenital tract infection caused by mycoplasma and Ct.
BMI change during puberty and the risk of heart failure.
Kindblom, J M; Bygdell, M; Sondén, A; Célind, J; Rosengren, A; Ohlsson, C
2018-03-12
Hospitalization for heart failure amongst younger men has increased. The reason for this is unknown but it coincides with the obesity epidemic. The aim of this study was to evaluate the association between childhood BMI (Body Mass Index) and BMI change during puberty for risk of adult heart failure in men. Using the BMI Epidemiology Study (BEST), a population-based study in Gothenburg, Sweden, we collected information on childhood BMI at age 8 years and BMI change during puberty (BMI at age 20 - BMI at 8) for men born 1945-1961, followed until December 2013 (n = 37 670). BMI was collected from paediatric growth charts and mandatory military conscription tests. Information on heart failure was retrieved from high-quality national registers (342 first hospitalizations for heart failure). BMI change during puberty was independently of childhood BMI associated with risk of heart failure in a nonlinear J-shaped manner. Subjects in the upper quartile of BMI change during puberty (Q4) had more than twofold increased risk of heart failure compared with subjects in Q1 [HR (Hazard Ratio) = 2.29, 95% CI (Confidence Interval) 1.68-3.12]. Childhood BMI was not independently associated with risk of heart failure. Boys developing overweight during puberty (HR 3.14; 95% CI 2.25-4.38) but not boys with childhood overweight that normalized during puberty (HR 1.12, 95% CI 0.63-2.00) had increased risk of heart failure compared with boys without childhood or young adult overweight. BMI change during puberty is a novel risk factor for adult heart failure in men. © 2018 The Association for the Publication of the Journal of Internal Medicine.
Park, Soo Jin; Lee, Seung Min; Kim, Seon Mee; Lee, Myoungsook
2013-01-01
There is a lack of data on metabolic risk factors during pre-puberty, which is important for identifying the subgroups of youth, at whom early interventions should be targeted. In this study, we evaluated the prevalence of metabolic risk factors and its subsequent relations with dietary patterns in Korean pre-pubertal children through a cross-sectional sample (n = 1,008; boys = 513) of pre-pubertal children (aged 8-9 years) from a sub-study of the Korea Metabolic Syndrome Research Initiatives...
Serum inhibin B in healthy pubertal and adolescent boys
DEFF Research Database (Denmark)
Andersson, A M; Juul, A; Petersen, J H
1997-01-01
correlated strongly with age, and when the effect of age was taken into account, only the partial correlation between inhibin B and LH/testosterone remained statistically significant. At stage II of puberty, the positive partial correlation between inhibin B and LH/testosterone was still present. At stage......Inhibin B levels were measured in serum from 400 healthy Danish prepubertal, pubertal, and adolescent males, aged 6-20 yr, in a cross-sectional study using a recently developed immunoassay that is specific for inhibin B, the physiologically important inhibin form in men. In addition, serum levels...... of FSH, LH, testosterone, and estradiol levels were measured. Serum levels of inhibin B, FSH, LH, testosterone, and estradiol all increased significantly between stages I and II of puberty. From stage II of puberty the inhibin B level was relatively constant, whereas the FSH level continued to increase...
Giant fibroadenoma of the breast in a pre-pubertal girl: a case report
Directory of Open Access Journals (Sweden)
Sunder Goyal
2014-02-01
Full Text Available Juvenile fibroadenoma comprises about 4% of the total fibroadenomas. The incidence of giant juvenile fibroadenomas is merely 0.5% of all the fibroadenomas. Bilateral giant juvenile fibroadenomas are extremely rare. We are presenting a case of giant juvenile fibroadenomas in an 11-year-old pre-pubertal girl. The diagnosis was made on fine-needle aspiration cytology which was confirmed on histopathology. As these tumors are mostly benign, breast-conserving surgery is done so that patient can lead a normal life without psychological trauma.-----------------------------------Cite this article as: Goyal S, Garg G, Narang S. Giant fibroadenoma of the breast in a pre-pubertal girl: a case report. Int J Cancer Ther Oncol 2014; 2(1:020113.DOI: http://dx.doi.org/10.14319/ijcto.0201.13
Belva, F.; Bonduelle, M.; Schiettecatte, J.; Tournaye, H.; Painter, R. C.; Devroey, P.; de Schepper, J.
2011-01-01
BACKGROUND: To date, no data exist about Leydig cell function of pubertal boys born after ICSI. To evaluate a potential risk of gonadal dysfunction in children born from fathers with compromised fertility, testicular function was assessed by the measurement of salivary testosterone. METHODS: Morning
Analysis list: BMI1 [Chip-atlas[Archive
Lifescience Database Archive (English)
Full Text Available BMI1 Blood,Digestive tract,Neural,Prostate + hg19 http://dbarchive.biosciencedbc.jp/kyushu-u/hg19/target/BMI...1.1.tsv http://dbarchive.biosciencedbc.jp/kyushu-u/hg19/target/BMI1.5.tsv http://db...archive.biosciencedbc.jp/kyushu-u/hg19/target/BMI1.10.tsv http://dbarchive.biosciencedbc.jp/kyushu-u/hg19/colo/BMI...1.Blood.tsv,http://dbarchive.biosciencedbc.jp/kyushu-u/hg19/colo/BMI1.Diges...tive_tract.tsv,http://dbarchive.biosciencedbc.jp/kyushu-u/hg19/colo/BMI1.Neural.tsv,http://dbarchive.bioscie
Since atrazine (ATR), a chlorotriazine herbicide, has been shown previously to alter the secretion of luteinizing hormone (LH) and prolactin (PRL) through a direct effect on the central nervous system (CNS), we hypothesized that exposure to ATR in the EDSTAC male pubertal protoco...
GFAP-Cre-mediated transgenic activation of Bmi1 results in pituitary tumors.
Directory of Open Access Journals (Sweden)
Bart A Westerman
Full Text Available Bmi1 is a member of the polycomb repressive complex 1 and plays different roles during embryonic development, depending on the developmental context. Bmi1 over expression is observed in many types of cancer, including tumors of astroglial and neural origin. Although genetic depletion of Bmi1 has been described to result in tumor inhibitory effects partly through INK4A/Arf mediated senescence and apoptosis and also through INK4A/Arf independent effects, it has not been proven that Bmi1 can be causally involved in the formation of these tumors. To see whether this is the case, we developed two conditional Bmi1 transgenic models that were crossed with GFAP-Cre mice to activate transgenic expression in neural and glial lineages. We show here that these mice generate intermediate and anterior lobe pituitary tumors that are positive for ACTH and beta-endorphin. Combined transgenic expression of Bmi1 together with conditional loss of Rb resulted in pituitary tumors but was insufficient to induce medulloblastoma therefore indicating that the oncogenic function of Bmi1 depends on regulation of p16(INK4A/Rb rather than on regulation of p19(ARF/p53. Human pituitary adenomas show Bmi1 overexpression in over 50% of the cases, which indicates that Bmi1 could be causally involved in formation of these tumors similarly as in our mouse model.
Lee, Chih-Ting; Tsai, Meng-Che; Lin, Chung-Ying; Strong, Carol
2017-08-01
Early puberty is linked to adverse developmental outcomes in adolescents in Western societies. However, little is known about this relationship in an East Asian context. In addition, whether the impact of subjective pubertal timing (PT) and menarcheal age (MA) on adolescent psychosocial development persists into early adulthood remains unclear and is worthy of investigation. A subset of data was retrieved from the Taiwan Youth Project, which recruited and followed a longitudinal cohort of 7 th - and 9 th -grade female Taiwanese students from 2000 to 2007. Subjective PT was defined using the Pubertal Developmental Scale (PDS), which mainly measures pubertal changes. MA was recalled by participants themselves. Various psychological and behavioral factors were recorded and measured until the age of 20, including the use of alcohol and cigarettes, psychological well-being, sexual activity, and socially problematic behaviors. A χ 2 test for linear-by-linear association and one-way analysis of variance followed by multivariate regression models were used to dissect the differential effects of PT and MA in the association with the outcome variables. In total, 1545 female participants with an average age of 14.5 (±1.1) years were deemed valid for analysis. Among them, 257 (16.6%) participants perceived themselves as having early PT, defined as more than 1 standard deviation above the mean PDS score, and 82 (5.3%) had early MA (occurring before the 4 th grade). In univariate analysis, participants with early PT had higher rates of smoking and sexual activity, and MA was not related to their psychobehavioral outcomes. After multivariate adjustment, only late PT was significantly correlated with lower amounts of cigarette smoking and sexual activity before the age of 20. Conceptual and actual pubertal developments may be differentially associated with psychobehavioral outcomes among young Taiwanese girls. Clinical attention should be given to adolescent self-perception of
DEFF Research Database (Denmark)
Juul, A; Dalgaard, P; Blum, W F
1995-01-01
index (BMI), and pubertal stage. Therefore, we measured IGFBP-3, IGF-I, IGF-II, IGFBP-1, and IGFBP-2 levels by RIA in 907 healthy children to establish well characterized normative data on IGFBP-3 according to age, sex, and pubertal stage and to study the complex relationship between IGFs and their BPs...
Expression of Bmi-1 is a prognostic marker in bladder cancer
Directory of Open Access Journals (Sweden)
Xu Li-Hua
2009-02-01
Full Text Available Abstract Background The molecular mechanisms of the development and progression of bladder cancer are poorly understood. The objective of this study was to analyze the expression of Bmi-1 protein and its clinical significance in human bladder cancer. Methods We examined the expression of Bmi-1 mRNA and Bmi-1 protein by RT-PCR and Western blot, respectively in 14 paired bladder cancers and the adjacent normal tissues. The expression of Bmi-1 protein in 137 specimens of bladder cancer and 30 specimens of adjacent normal bladder tissue was determined by immunohistochemistry. Statistical analyses were applied to test the relationship between expression of Bmi-1, and clinicopathologic features and prognosis. Results Expression of Bmi-1 mRNA and protein was higher in bladder cancers than in the adjacent normal tissues in 14 paired samples (P P P P P > 0.5. In superficial bladder cancers, the expression of Bmi-1 protein in recurrent cases was higher than in recurrence-free cases (62.5% versus 13.7%, P P P > 0.05. Five-year survival in the group with higher Bmi-1 expression was 50.8%, while it was 78.5% in the group with lower Bmi-1 expression (P P Conclusion Expression of Bmi-1 was greater in bladder cancers than in the adjacent normal tissues. The examination of Bmi-1 protein expression is potentially valuable in prognostic evaluation of bladder cancer.
Moon, Kilson; Krems, Carolin; Heuer, Thorsten; Roth, Alexander; Hoffmann, Ingrid
2017-01-01
Objective The objective of the study was to identify predictors of BMI in German adults by considering the BMI distribution and to determine whether the association between BMI and its predictors varies along the BMI distribution. Methods The sample included 9,214 adults aged 18–80 years from the German National Nutrition Survey II (NVS II). Quantile regression analyses were conducted to examine the association between BMI and the following predictors: age, sports activities, socio-economic status (SES), healthy eating index-NVS II (HEI-NVS II), dietary knowledge, sleeping duration and energy intake as well as status of smoking, partner relationship and self-reported health. Results Age, SES, self-reported health status, sports activities and energy intake were the strongest predictors of BMI. The important outcome of this study is that the association between BMI and its predictors varies along the BMI distribution. Especially, energy intake, health status and SES were marginally associated with BMI in normal-weight subjects; this relationships became stronger in the range of overweight, and were strongest in the range of obesity. Conclusions Predictors of BMI and the strength of these associations vary across the BMI distribution in German adults. Consequently, to identify predictors of BMI, the entire BMI distribution should be considered. PMID:28219069
Pubertal Timing and Early Sexual Intercourse in the Offspring of Teenage Mothers
De Genna, Natacha M.; Larkby, Cynthia; Cornelius, Marie D.
2011-01-01
Early puberty is associated with stressful family environments, early sexual intercourse, and teenage pregnancy. We examined pubertal timing and sexual debut among the 14-year-old offspring of teenage mothers. Mothers (71% Black, 29% White) were recruited as pregnant teenagers (12-18 years old). Data were collected during pregnancy and when…
Natamba, Barnabas K; Sanchez, Sixto E; Gelaye, Bizu; Williams, Michelle A
2016-07-26
The 2009 Institute of Medicine (IOM) gestational weight recommendations are tailored to women's pre-pregnancy body mass index (BMI). Limited evidence exists on methods for estimating women's pre-pregnancy BMI, particularly for women living in low and middle income countries. Using data from collected among Peruvian pregnant women, we compared the concordance between self-reported pre-pregnancy BMI with BMI measured at the earliest prenatal study visit. Data were from the Pregnancy Outcomes Maternal and Infant Study (PrOMIS), a cohort of pregnant women at the Instituto Nacional Materno Perinatal (INMP) in Lima, Peru. 2605 women aged 18 to 49 years (mean ± SD gestational age = 10.9 ± 3.3 weeks) were included in the study. Self-reported pre-pregnancy weight and height and measured weight and height were collected at the first prenatal study contact. We assessed the concordance between measured and self-reported BMI; and, the agreement among indicators of nutritional status obtained using measured and self-reported BMI. On average, weight measured at the first prenatal study visit was 0.27 kg higher than self-reported pre-pregnancy weight (p overweight or obese BMI categories tended to be lower when using self-reported BMI (38.2 %) than when using measured BMI (47.7 %). Self-reported pre-pregnancy BMI was strongly correlated with BMI measured at the first prenatal study contact. The findings potentially suggest that, in this context, there is minimal change between pre-pregnancy BMI and BMI measured at the first prenatal study contact; or, that women in this study just recalled their most recent measured anthropometrics (including values obtained during the index pregnancy but before enrollment in the PrOMIS study).
Moskow, Danielle M; Addington, Jean; Bearden, Carrie E; Cadenhead, Kristin S; Cornblatt, Barbara A; Heinssen, Robert; Mathalon, Daniel H; McGlashan, Thomas H; Perkins, Diana O; Seidman, Larry J; Tsuang, Ming T; Cannon, Tyrone D; Woods, Scott W; Walker, Elaine F
2016-04-01
Prodromal syndromes often begin in adolescence - a period of neurodevelopmental changes and heightened stress sensitivity. Research has shown elevated stress and cortisol in individuals at clinical high risk (CHR) for psychosis. This cross-sectional study examined relations of age and pubertal status with cortisol and self-reported stress in healthy controls (HCs) and CHR adolescents. It was hypothesized that the relations of age and pubertal stage with cortisol and stress would be more pronounced in CHR youth. Participants were 93 HCs and 348 CHR adolescents from the North American Prodrome Longitudinal Study (NAPLS). At baseline, measures of stress (Daily Stress Inventory - DSI), Tanner stage (TS), and salivary cortisol were obtained. ANCOVA revealed increased DSI scores with age for both groups, and higher DSI scores in CHR adolescents than HCs, with a more pronounced difference for females. Contrary to prediction, with age controlled, HCs showed greater TS-related DSI increases. Analysis of cortisol showed no significant interactions, but a main effect of age and a trend toward higher cortisol in the CHR group. Correlations of cortisol with TS were higher in HC than CHR group. Stress measures increased with age in HC and CHR adolescents, and DSI scores also increased with TS in HCs. The results do not support a more pronounced age or TS increase in stress measures in CHR adolescents, but instead suggest that stress indices tend to be elevated earlier in adolescence in the CHR group. Potential determinants of findings and future directions are discussed. Copyright © 2016 Elsevier B.V. All rights reserved.
Morales, Jessica
2012-01-01
The present study examined the impact of pubertal onset, race/ethnicity, and school racial/ethnic composition on girls' body image and perceived school climate (school safety, school liking, and loneliness in school) during the middle school transition. The sample (N = 1,626) included 6th grade Black, Mexican American, White, and Asian girls from 20 diverse middle schools. Hierarchical analyses supported both the early-timing and stressful change hypothesis. That is, experiencing pubertal ons...
Bechtold, S; Beyerlein, A; Ripperger, P; Roeb, J; Dalla Pozza, R; Häfner, R; Haas, J P; Schmidt, H
2012-10-01
Growth failure is a permanent sequelae in juvenile idiopathic arthritis (JIA). The aim of the study was to compare pubertal growth in control and growth hormone (GH) treated JIA subjects. 64 children with JIA at a mean age of 10.38 ± 2.80 years were enrolled and followed until final height (measured in standard deviation (SD) scores). 39 children (20 m) received GH therapy and 24 (9 m) served as controls. GH dose was 0.33 mg/kg/week. Linear regression analysis was performed to identify factors influencing total pubertal growth. Mean total pubertal growth was 21.1 ± 1.3 cm (mean ± SD) in GH treated JIA patients and 13.8 ± 1.5 cm in controls. Final height was significantly higher with GH treatment (-1.67 ± 1.20 SD) compared to controls (-3.20 ± 1.84 SD). Linear regression model identified age at onset of puberty (ß=-4.2,CI: -5.9, -2.6 in controls and ß=-2.3,CI: -3.6, -1.1 in GH treated) as the main factor for total pubertal growth. Final height SDS was determined by the difference to target height at onset of puberty (ß=-0.59;CI: -0.80, -0.37 in controls and ß=-0.30,CI: -0.52, -0.08 in GH treated), age at onset of puberty (ß=0.47;CI:0.02,0.93 in controls and 0.23;CI: -0.00,0.46 in GH treated) and height gain during puberty (ß=0.13;CI:0.05,0.21 in controls and ß=0.11;CI:0.07,0.16 in GH treated). Total pubertal growth in JIA patients treated with GH was increased by a factor of 1.5 greater in comparison to controls leading to a significantly better final height. To maximize final height GH treatment should be initiated early to reduce the height deficit at onset of puberty. Copyright © 2012 Elsevier Ltd. All rights reserved.
Directory of Open Access Journals (Sweden)
Irina V. Zhukovets
2017-09-01
Full Text Available The aim of the study was to assess fertility in women of reproductive age with hypothalamic dysfunction (HD in the pubertal period and to determine the diagnostic significance of pro-inflammatory (TNF-α and IL-1β, anti-inflammatory cytokine (IL-10 and NF-kB activity in the diagnosis of primary infertility in these women. Materials and Methods: Fertility was assessed in 86 women of reproductive age with HD in the pubertal period. A comparative characteristic of fertile women (Group 1, n=46 and primary infertility women (Group 2, n=21 with HD in the pubertal period was performed. FPG and FPI were determined after 8 to 12 hours of fasting. Serum IRI concentrations were measured using an ELISA kit. The levels of TNF-α, IL-1β and IL-10 were determined in the venous blood serum after a 12-hour fasting, as well as in UA on the 21st day of the menstrual cycle using ELISA kits. The activity of NF-kB was determined in UA on the 21st day of the menstrual cycle using an enzyme immunoassay kit. Results: BMI in Group 1 was significantly lower than in Group 2: 22.63±2.68 kg/m2 versus 27.05±4.03kg/m2 (p=0.000. WC in women of Group 1 was 66.11±5.66cm versus 78.52±10.54cm in Group 2 (p = 0.000; WC >80cm was found in 2(4.4% and 14(66.7% women, respectively (p = 0.000. The average levels of FPG and FPI were significantly higher in Group 2. Serum levels of TNF-α and IL-1β in Group 2 were significantly higher than in Group 1. The serum level of anti-inflammatory cytokine IL-10 was significantly lower in Group 2; accordingly, the TNF-α/IL-10 ratio in Group 2 was 1.8 times higher than in Group 1. The IL-1β level in UA (P=0.000 and the TNF-α/IL-10 ratio (P=0.02 were significantly higher in women of Group 2 than Group 1, which indicated the pronounced inflammatory effects of TNF-α in the endometrium. Imbalance in the production of pro-inflammatory and anti-inflammatory factors indicated the activation of the Th-1 immune response with the formation of the
International Nuclear Information System (INIS)
O'Hara, H.B.; Gombe, S.
1991-01-01
Pre-pubertal male and female Small East African goats were infected with Trypanosoma congolense at 4-5 months of age. Changes in body weight and haemogram were monitored weekly. Progesterone and testosterone measurements were made three times weekly until the goats either reached puberty or 18 months of age. Onset of puberty was determined from observation of oestrus behaviour, mating or increase in libidio; this was confirmed by elevation in plasma progesterone or testosterone levels. Trypanosomiasis affected pre-pubertal goats by reducing body weight gain and delaying onset of puberty. Histological examination of the gonads showed pronounced pathological changes. These effects were reversed by treatment with isometamidium chloride (Samorin, May and Baker). It was concluded that early treatment of infected goats before serious gonadal damage could occur allowed full restoration of reproductive function. (author). 6 refs, 4 figs, 1 tab
The Effect of Wallow on Growth Performance of Pre-Pubertal Pigs in ...
African Journals Online (AJOL)
A study was carried out to determine the influence of wallow on the growth performance of growing pigs. Sixteen (16) pre-pubertal pigs (8 males and 8 females) of large white breed, aged three months were randomly assigned to two treatments. There were eight animals per group designated as treatment A = with wallow ...
Growth hormone mediates pubertal skeletal development independent of hepatic IGF-1 production.
Courtland, Hayden-William; Sun, Hui; Beth-On, Mordechay; Wu, Yingjie; Elis, Sebastien; Rosen, Clifford J; Yakar, Shoshana
2011-04-01
Deficiencies in either growth hormone (GH) or insulin-like growth factor 1 (IGF-1) are associated with reductions in bone size during growth in humans and animal models. Liver-specific IGF-1-deficient (LID) mice, which have 75% reductions in serum IGF-1, were created previously to separate the effects of endocrine (serum) IGF-1 from autocrine/paracrine IGF-1. However, LID mice also have two- to threefold increases in GH, and this may contribute to the observed pubertal skeletal phenotype. To clarify the role of GH in skeletal development under conditions of significantly reduced serum IGF-1 levels (but normal tissue IGF-1 levels), we studied the skeletal response of male LID and control mice to GH inhibition by pegvisomant from 4 to 8 weeks of age. Treatment of LID mice with pegvisomant resulted in significant reductions in body weight, femur length (Le), and femur total area (Tt.Ar), as well as further reductions in serum IGF-1 levels by 8 weeks of age, compared with the mean values of vehicle-treated LID mice. Reductions in both Tt.Ar and Le were proportional after treatment with pegvisomant. On the other hand, the relative amount of cortical tissue formed (RCA) in LID mice treated with pegvisomant was significantly less than that in both vehicle-treated LID and control mice, indicating that antagonizing GH action, either directly (through GH receptor signaling inhibition) or indirectly (through further reductions in serum/tissue IGF-1 levels), results in disproportionate reductions in the amount of cortical bone formed. This resulted in bones with significantly reduced mechanical properties (femoral whole-bone stiffness and work to failure were markedly decreased), suggesting that compensatory increases of GH in states of IGF-1 deficiency (LID mice) act to protect against a severe inhibition of bone modeling during growth, which otherwise would result in bones that are too weak for normal and/or extreme loading conditions. Copyright © 2011 American Society for
Expression of Bmi-1 is a prognostic marker in bladder cancer
International Nuclear Information System (INIS)
Qin, Zi-Ke; Zeng, Mu-Sheng; Yang, Jian-An; Ye, Yun-lin; Zhang, Xing; Xu, Li-Hua; Zhou, Fang-Jian; Han, Hui; Liu, Zuo-Wei; Song, Li-Bing
2009-01-01
The molecular mechanisms of the development and progression of bladder cancer are poorly understood. The objective of this study was to analyze the expression of Bmi-1 protein and its clinical significance in human bladder cancer. We examined the expression of Bmi-1 mRNA and Bmi-1 protein by RT-PCR and Western blot, respectively in 14 paired bladder cancers and the adjacent normal tissues. The expression of Bmi-1 protein in 137 specimens of bladder cancer and 30 specimens of adjacent normal bladder tissue was determined by immunohistochemistry. Statistical analyses were applied to test the relationship between expression of Bmi-1, and clinicopathologic features and prognosis. Expression of Bmi-1 mRNA and protein was higher in bladder cancers than in the adjacent normal tissues in 14 paired samples (P < 0.01). By immunohistochemical examination, five of 30 adjacent normal bladder specimens (16.7%) versus 75 of 137 bladder cancers (54.3%) showed Bmi-1 protein expression (P < 0.05). Bmi-1 protein expression was intense in 20.6%, 54.3%, and 78.8% of tumors of histopathological stages G1, G2, and G3, respectively (P < 0.05). Expression of Bmi-1 protein was greater in invasive bladder cancers than in superficial bladder cancers (81.5% versus 32.5%, P < 0.05). In invasive bladder cancers, the expression of Bmi-1 protein in progression-free cancers was similar to that of cancers that have progressed (80.0% versus 82.4%, P > 0.5). In superficial bladder cancers, the expression of Bmi-1 protein in recurrent cases was higher than in recurrence-free cases (62.5% versus 13.7%, P < 0.05). Bmi-1 expression was positively correlated with tumor classification and TNM stage (P < 0.05), but not with tumor number (P > 0.05). Five-year survival in the group with higher Bmi-1 expression was 50.8%, while it was 78.5% in the group with lower Bmi-1 expression (P < 0.05). Patients with higher Bmi-1 expression had shorter survival time, whereas patients with lower Bmi-1 expression had longer
Reduced cortical thickness associated with visceral fat and BMI
Directory of Open Access Journals (Sweden)
Ralf Veit
2014-01-01
Full Text Available Structural brain imaging studies have shown that obesity is associated with widespread reductions in gray matter (GM volume. Although the body mass index (BMI is an easily accessible anthropometric measure, substantial health problems are more related to specific body fat compartments, like visceral adipose tissue (VAT. We investigated cortical thickness measures in a group of 72 healthy subjects (BMI range 20–35 kg/m2, age range 19–50 years. Multiple regression analyses were performed using VAT and BMI as predictors and age, gender, total surface area and education as confounds. BMI and VAT were independently associated with reductions in cortical thickness in clusters comprising the left lateral occipital area, the left inferior temporal cortex, and the left precentral and inferior parietal area, while the right insula, the left fusiform gyrus and the right inferior temporal area showed a negative correlation with VAT only. In addition, we could show significant reductions in cortical thickness with increasing VAT adjusted for BMI in the left temporal cortex. We were able to detect widespread cortical thinning in a young to middle-aged population related to BMI and VAT; these findings show close resemblance to studies focusing on GM volume differences in diabetic patients. This may point to the influence of VAT related adverse effects, like low-grade inflammation, as a potentially harmful factor on brain integrity already in individuals at risk of developing diabetes, metabolic syndromes and arteriosclerosis.
BMI1 loss delays photoreceptor degeneration in Rd1 mice. Bmi1 loss and neuroprotection in Rd1 mice.
Zencak, Dusan; Crippa, Sylvain V; Tekaya, Meriem; Tanger, Ellen; Schorderet, Daniel E; Munier, Francis L; van Lohuizen, Maarten; Arsenijevic, Yvan
2006-01-01
Retinitis pigmentosa (RP) is a heterogeneous group of genetic disorders leading to blindness, which remain untreatable at present. Rd1 mice represent a recognized model of RP, and so far only GDNF treatment provided a slight delay in the retinal degeneration in these mice. Bmi1, a transcriptional repressor, has recently been shown to be essential for neural stem cell (NSC) renewal in the brain, with an increased appearance of glial cells in vivo in Bmi1 knockout (Bmi1-/-) mice. One of the roles of glial cells is to sustain neuronal function and survival. In the view of a role of the retinal Miller glia as a source of neural protection in the retina, the increased astrocytic population in the Bmi1-/- brain led us to investigate the effect of Bmi1 loss in Rd1 mice. We observed an increase of Müller glial cells in Rd1-Bmi1-/- retinas compared to Rd1. Moreover, Rd1-Bmi1-/- mice showed 7-8 rows of photoreceptors at 30 days of age (P30), while in Rd1 littermates there was a complete disruption of the outer nuclear layer (ONL). Preliminary ERG results showed a responsiveness of Rd1-Bmi1-/- mice in scotopic vision at P35. In conclusion, Bmi1 loss prevented, or rescued, photoreceptors from degeneration to an unanticipated extent in Rd1 mice. In this chapter, we will first provide a brief review of our work on the cortical NSCs and introduce the Bmi1 oncogene, thus offering a rational to our observations on the retina.
The Role of BMI in Hip Fracture Surgery.
Akinleye, Sheriff D; Garofolo, Garret; Culbertson, Maya Deza; Homel, Peter; Erez, Orry
2018-01-01
Obesity is an oft-cited cause of surgical morbidity and many institutions require extensive supplementary screening for obese patients prior to surgical intervention. However, in the elderly patients, obesity has been described as a protective factor. This article set out to examine the effect of body mass index (BMI) on outcomes and morbidity after hip fracture surgery. The National Surgical Quality Improvement Program database was queried for all patients undergoing 1 of 4 surgical procedures to manage hip fracture between 2008 and 2012. Patient demographics, BMI, and known factors that lead to poor surgical outcomes were included as putative predictors for complications that included infectious, cardiac, pulmonary, renal, and neurovascular events. Using χ 2 tests, 30-day postoperative complication rates were compared between 4 patient groups stratified by BMI as low weight (BMI BMI = 20-30), obese (BMI = 30-40), and morbidly obese (BMI > 40). A total of 15 108 patients underwent surgery for hip fracture over the examined 5-year period. Of these, 18% were low weight (BMI BMI = 20-30), 13% were obese (BMI = 30-40), and 2% were morbidly obese (BMI > 40). The low-weight and morbidly obese patients had both the highest mortality rates and the lowest superficial infection rates. There was a significant increase in blood transfusion rates that decreased linearly with increasing BMI. Deep surgical site infection and renal failure increased linearly with increasing BMI, however, these outcomes were confounded by comorbidities. This study demonstrates that patients at either extreme of the BMI spectrum, rather than solely the obese, are at greatest risk of major adverse events following hip fracture surgery. This runs contrary to the notion that obese hip fracture patients automatically require additional preoperative screening and perioperative services, as currently implemented in many institutions.
Serum leptin concentration during puberty in healthy nonobese adolescents
Directory of Open Access Journals (Sweden)
Brandão C.M.A.
2003-01-01
Full Text Available Data obtained during the past five years have indicated that there are important age- and gender-based differences in the regulation and action of leptin in humans. To study the physiological changes of leptin during puberty in both sexes, and its relationship with body composition and sexual maturation, we measured leptin concentrations in 175 healthy adolescents (80 girls, 95 boys, 10-18 years of age, representing all pubertal stages. We excluded individuals with a body mass index (BMI below the 5thor above the 95th percentile relative to age. Serum concentrations of leptin were determined by a monoclonal antibody-based immunofluorimetric assay, developed in our laboratory. Body composition was determined by dual-energy X-ray absorptiometry. Pubertal stage was assigned by physical examination, according to Tanner criteria for breast development in females and genital development in males. Leptin concentration in girls (N = 80 presented a positive linear correlation with age (r = 0.35, P = 0.0012, BMI (r = 0.65, P < 0.0001 and %fat mass (r = 0.76, P < 0.0001. In boys (N = 95 there was a positive correlation with BMI (r = 0.49, P < 0.0001 and %fat mass (r = 0.85, P < 0.0001, but a significant negative linear correlation with Tanner stage (r = -0.45, P < 0.0001 and age (r = -0.40, P < 0.0001. The regression equation revealed that %fat mass and BMI are the best parameters to be used to estimate leptin levels in both sexes. Thus, the normal reference ranges for circulating leptin during adolescence should be constructed according to BMI or %fat mass to assure a correct evaluation.
Course and forecast of the hypothalamic pubertal syndrome
International Nuclear Information System (INIS)
Kayusheva, I.V.
1987-01-01
A total of 223 patients with the hypothalamic pubertal syndrome (HPS) were followed up for 1 to 22 years. The course of HPS was regressive, stable , recurrent or progressive and dependent on the initial depth and spread of hypothalamic lesion, repeated unfavourable hypothalamic exposures, and timely and regular treatment. HPS outcomes were followed up in 190 cases. The recovery was complete in 21.05%, obesity alone persisted in 10.53%, vegetovascular dystonia was persistent in 7.36%, and polycystic ovaries in 5.79%. Neuroendocrine hypothalamic syndrome was the most common (50.53%) HPS outcome. Hormone levels in blood were investigated using radioimmunoassay in patients with neuroendocrine form of HPS
The associations of Bmi-1 with progression of glomerular chronic kidney disease .
Yang, Xiaoxia; Bai, Ming; Ning, Xiaoxuan; Ma, Feng; Liu, Limin; Liu, Ting; Liu, Minna; Wang, Hanmin; Sun, Shiren
2018-02-01
Our previous studies indicated that Bmi-1 plays an important role in hypoxia-induced tubular epithelial-mesenchymal transition and the development of kidney fibrosis in cellular and animal models. However, circulating Bmi-1 levels in human chronic kidney disease (CKD) and their relation to progression remains unknown. We conducted a post-hoc analysis of a prospective cohort study. The blood samples and clinical data of 230 patients with glomerular CKD and 67 healthy adults were prospectively collected between January 2010 and June 2012. Serum Bmi-1 was measured using enzyme-linked immunosorbent assay (ELISA). CKD patients had significantly higher serum Bmi-1 concentrations than the healthy controls (496.4 (363.1 - 675.4) pg/mL compared with 257.3 (235.4 - 303.8) pg/mL, p Bmi-1 level inversely correlated with the estimated glomerular filtration rate (eGFR) (r = -0.346, p Bmi-1 levels and serum creatinine, blood urea nitrogen, cystatin C concentration, and the severity of tubulointerstitial fibrosis (r = 0.248, p Bmi-1 level was associated with a shorter duration of renal survival. Cox multivariate analyses further demonstrated that serum Bmi-1 concentration was an independent prognostic factor for CKD patients (HR = 6.48, p Bmi-1 levels were associated with adverse kidney disease outcome, suggesting that Bmi-1 is a novel biomarker for glomerular CKD progression. More data from larger longitudinal studies are required to validate our findings. .
DEFF Research Database (Denmark)
Busch, Alexander S; Hagen, Casper P; Main, Katharina M
2017-01-01
Context: Although genetic factors play a pivotal role in male pubertal timing, genome-wide association studies have identified only a few loci. Genetic variation of follicle-stimulating hormone (FSH) action affects adult reproductive parameters and female pubertal timing. Objective: To investigate...... effective FSH action. Effects explained 1.7% (Denmark) and 1.5% (Chile) of the variance. In addition, BMI z score was negatively associated with pubertal timing (β = -0.35 years in both cohorts), explaining 17.2% (Denmark) and 7.2% (Chile) of the variance. Conclusion: In two ethnically distinct populations...
Sex differences in heritability of BMI
DEFF Research Database (Denmark)
Schousboe, Karoline; Willemsen, Gonneke; Kyvik, Kirsten O
2003-01-01
pairs (including opposite sex pairs) aged 20-29 and 30-39 from eight different twin registries participating in the GenomEUtwin project. Quantitative genetic analyses were conducted and sex differences were explored. Variation in BMI was greater for women than for men, and in both sexes was primarily...... explained by additive genetic variance in all countries. Sex differences in the variance components were consistently significant. Results from analyses of opposite sex pairs also showed evidence of sex-specific genetic effects suggesting there may be some differences between men and women in the genetic...... factors that influence variation in BMI. These results encourage the continued search for genes of importance to the body composition and the development of obesity. Furthermore, they suggest that strategies to identify predisposing genes may benefit from taking into account potential sex specific effects....
Goble, K H; Bain, Z A; Padow, V A; Lui, P; Klein, Z A; Romeo, R D
2011-02-01
Pubertal development is marked by profound changes in stress reactivity. For example, following a brief stressor, such as foot shock, ether inhalation or restraint, prepubertal rats display a prolonged adrenocorticotrophic hormone (ACTH) and corticosterone response that takes twice as long to return to baseline compared to adults. Pubertal-related differences in the recovery of the hormonal stress response following a more protracted systemic stressor, such as an immunological challenge, have not yet been investigated. Moreover, it is unclear whether an immunological stressor leads to a differential cytokine response in animals before and after pubertal maturation. To examine these issues, we used a single injection of lipopolysaccharide (LPS; 0.1 mg/kg) to induce a hormonal stress and innate immune response and measured plasma ACTH, corticosterone, and the pro-inflammatory cytokines interleukin (IL)-1β and IL-6 in prepubertal and adult male rats 0, 2, 4, 6, 8, or 24 h after LPS exposure. In a follow-up experiment, we assessed neural activation, as indexed by FOS immunohistochemistry, in the paraventricular nucleus of the hypothalamus (PVN) in prepubertal and adult males 0, 4, 8, or 24 h after a 0.1 mg/kg injection of LPS. By contrast to the prolonged response observed in prepubertal animals following a variety of acute stressors, we found that corticosterone and IL-6 responses induced by LPS recover toward baseline faster in prepubertal compared to adult rats. Along with these different peripheral responses, we also found that LPS-induced neural activation in the PVN of prepubertal animals showed a faster return to baseline compared to adults. Together, these data indicate that prepubertal and adult animals react in distinct ways, both peripherally and centrally, to an immunological stressor. © 2011 The Authors. Journal of Neuroendocrinology © 2011 Blackwell Publishing Ltd.
Association between infancy BMI peak and body composition and blood pressure at age 5-6 years
Hof, Michel H. P.; Vrijkotte, Tanja G. M.; de Hoog, Marieke L. A.; van Eijsden, Manon; Zwinderman, Aeilko H.
2013-01-01
The development of overweight is often measured with the body mass index (BMI). During childhood the BMI curve has two characteristic points: the adiposity rebound at 6 years and the BMI peak at 9 months of age. In this study, the associations between the BMI peak and body composition measures and
Trajectories of BMI from early childhood through early adolescence: SES and psychosocial predictors.
Lane, Sean P; Bluestone, Cheryl; Burke, Christopher T
2013-02-01
This study examined the ways in which body mass index (BMI) percentile - an identified risk factor for overweight and cardiovascular disease in adulthood - develops from birth through early adolescence. In addition, we examined whether psychosocial factors, such as parenting style and maternal depression, mediated the link between socio-economic status (SES) and BMI growth. Design. Data were obtained from phases 1-3 of the National Institute of Child Health and Human Development (NICHD) Study of Early Child Care and Youth Development (SECCYD) - a longitudinal study that followed children from 10 communities in the United States from birth to age 11. We applied growth mixture models to identify distinct subtypes of BMI development. Within these models, we performed between- and within-class mediation analyses to examine whether SES predicted class membership or differences in development within each class via maternal depression and parenting styles. Results identified three prototypic trajectories of BMI percentile growth, elevated, steady increase, and stable. We found evidence for both between- and within-class mediation, suggesting multiple pathways by which SES can affect BMI development. These findings add to the research that suggests that being in a family with a low SES is associated with falling into patterns of development characterized by early and lasting increases in BMI relative to one's peers, and that this association is partly accounted for by maternal depression and parenting styles. What is already known? Past research has found evidence that patterns of childhood overweight are impacted by socioeconomic status through psychosocial factors like parenting and depression. This evidence is often limited to individual points in time where neglectful, permissive, and authoritarian parenting and higher levels of maternal depression are associated with higher levels of overweight status among children from infancy to adolescence. However, little
The Report Card on BMI Report Cards.
Thompson, Hannah R; Madsen, Kristine A
2017-06-01
Half of states in the USA have legislation requiring that schools conduct body mass index (BMI) screening among students; just under half of these states report results to parents. The effectiveness of school-based BMI screening and reporting in reducing childhood obesity is not established and the practice has raised concerns about the potential for increased weight-based stigmatization. Recent experimental studies of BMI screening and reporting have not demonstrated a positive impact on students' weight status. However, the language and formatting of BMI reports used in studies to date have been suboptimal and have likely limited the potential effectiveness of the practice. This article reviews the recent literature on school-based BMI screening and reporting and highlights important areas for future inquiry. The present review suggests that evidence to date is not sufficient to support definitive conclusions about the value of school-based BMI screening and reporting as a childhood obesity prevention tool.
Directory of Open Access Journals (Sweden)
Koon Poh Bee
2011-06-01
Full Text Available Abstract Background Ethnic differences in body fat distribution contribute to ethnic differences in cardiovascular morbidities and diabetes. However few data are available on differences in fat distribution in Asian children from various backgrounds. Therefore, the current study aimed to explore ethnic differences in body fat distribution among Asian children from four countries. Methods A total of 758 children aged 8-10 y from China, Lebanon, Malaysia and Thailand were recruited using a non-random purposive sampling approach to enrol children encompassing a wide BMI range. Height, weight, waist circumference (WC, fat mass (FM, derived from total body water [TBW] estimation using the deuterium dilution technique and skinfold thickness (SFT at biceps, triceps, subscapular, supraspinale and medial calf were collected. Results After controlling for height and weight, Chinese and Thai children had a significantly higher WC than their Lebanese and Malay counterparts. Chinese and Thais tended to have higher trunk fat deposits than Lebanese and Malays reflected in trunk SFT, trunk/upper extremity ratio or supraspinale/upper extremity ratio after adjustment for age and total body fat. The subscapular/supraspinale skinfold ratio was lower in Chinese and Thais compared with Lebanese and Malays after correcting for trunk SFT. Conclusions Asian pre-pubertal children from different origins vary in body fat distribution. These results indicate the importance of population-specific WC cut-off points or other fat distribution indices to identify the population at risk of obesity-related health problems.
Farnworth, M J; Adams, N J; Seksel, K; Waran, N K; Beausoleil, N J; Stafford, K J
2013-07-01
To compare the attitudes and practices of a sample of veterinarians in New Zealand, Australia and the United Kingdom (UK) towards pre-pubertal gonadectomy of cats. Respondents' demographics were gathered using an electronic questionnaire distributed via professional veterinary associations in the target countries, as were minimum age at gonadectomy and typical age of puberty. Desirability of prepubertal gonadectomy was gauged using three response categories ('yes', 'no' or 'sometimes'), respondents were then able to justify the response given. Two-way Analyses of Variance (ANOVA) followed by post hoc Tukey HSD tests were used to test whether there were differences in minimum ages for gonadectomy within and between countries and between providers and non-providers of services to pounds (or animal welfare centres). Views on the desirability of prepubertal gonadectomy relative to demographics were explored using a Likelihood Ratio Test. The survey received 717 responses. Most respondents believed pre-pubertal gonadectomy was either entirely or 'sometimes' desirable (556/621), few thought it was undesirable (65/621). Minimum age at gonadectomy was significantly affected by country surveyed and provision or non-provision of services for pounds. Post hoc Tukey HSD analysis indicated the mean age of both spaying and castration (4.3 months) in the UK was significantly different from both Australia (spaying: 3.4 months, castration: 3.2 months) and New Zealand (spaying: 3.4 months, castration: 3.2 months) (all ppre- pubertal gonadectomy. Respondents from the UK were more likely to answer 'no' (p = 0.004) or 'sometimes' (p = 0.050) as compared to those from New Zealand or Australia. Females were more likely to respond with 'sometimes' as opposed to 'yes' than males. Reasons for considering pre-pubertal gonadectomy desirable or sometimes desirable focussed on reducing unwanted pregnancies and improving population control, as well as improving rates of adoption, owner
The Relationship among Pubertal Stage, Age, and Drinking in Adolescent Boys and Girls
Faden, Vivian B.; Ruffin, Beverly; Newes-Adeyi, Gabriella; Chen, Chiung
2010-01-01
This study used data from the Third National Household and Nutrition Examination Survey (NHANES) to examine the association between pubertal status (Tanner staging for boys and girls and menarche for girls) and alcohol use in a nationally representative sample of youths ages 12 to 17. Logistic regression was used to model the relationship. In…
Pubertal induction in hypogonadism: Current approaches including use of gonadotrophins.
Zacharin, Margaret
2015-06-01
Primary disorders of the gonad or those secondary to abnormalities of the hypothalamic pituitary axis result in hypogonadism. The range of health problems of childhood and adolescence that affect this axis has increased, as most children now survive chronic illness, but many have persisting deficits in gonadal function as a result of their underlying condition or its treatment. An integrated approach to hormone replacement is needed to optimize adult hormonal and bone health, and to offer opportunities for fertility induction and preservation that were not considered possible in the past. Timing of presentation ranges from birth, with disorders of sexual development, through adolescent pubertal failure, to adult fertility problems. This review addresses diagnosis and management of hypogonadism and focuses on new management strategies to address current concerns with fertility preservation. These include Turner syndrome, and fertility presevation prior to childhood cancer treatment. New strategies for male hormone replacement therapy that may impinge upon future fertility are emphasized. Copyright © 2015 Elsevier Ltd. All rights reserved.
BMI Trajectories from Birth to Young Adulthood.
McGinty, Shannon M; Osganian, Stavroula K; Feldman, Henry A; Milliren, Carly E; Field, Alison E; Richmond, Tracy K
2018-04-19
This study aimed to compare BMI trajectories from childhood to early adulthood in those with overweight and/or obesity versus severe obesity. Longitudinal BMI values (2,542 measurements) were calculated from measured heights and weights for 103 children, adolescents, or young adults with overweight, obesity, or severe obesity. Segmented regression with splines was used to model BMI trajectories. Sixty-nine participants were classified as ever having severe obesity versus 34 who never had severe obesity. Trajectories and slopes did not differ by sex or race/ethnicity. Compared with those who never had severe obesity, BMI was higher in the group with severe obesity at all ages, and BMI slope was higher for those with severe obesity at age 14 (P = 0.002), with peak slope occurring later (18 years vs. 16 years) and higher (4.5 ± 0.5 kg/m 2 /y vs. 2.9 ± 0.5 kg/m 2 /y; P BMI fell below zero by the mid-20s (-0.3 ± 0.6 kg/m 2 /y); in those with severe obesity, BMI slope never reached zero (0.9 ± 0.5 kg/m 2 /y). Youth with severe obesity, compared with their peers without, started with higher BMIs, had more rapid rates of BMI increase beginning at age 14, as well as a higher peak and longer period of increase, and never achieved weight stabilization. © 2018 The Obesity Society.
Know Your Body Mass Index (BMI)
... Past Issues Special Section Know Your Body Mass Index (BMI) Past Issues / Winter 2007 Table of Contents ... aging, it pays to understand your body mass index (BMI), a measure of body fat based on ...
Noahsen, Paneeraq; Andersen, Stig
2013-01-01
To identify thresholds of BMI at which similar levels of serum lipids occur in Inuit and in non-Inuit as the impact of obesity on metabolic risk factors differ in Inuit compared to other ethnic groups. Published comparative data among Inuit and non-Inuit whites on BMI and HDL-cholesterol and triglyceride were identified for analysis. A literature search was done for BMI, lipids, Inuit and Greenland or Canada. Studies with data on triglycerides and HDL-cholesterol in Inuit and non-Inuit Caucasians were selected and data were retrieved. Regression equations were computed for BMI and HDL-cholesterol and BMI and triglycerides. BMI for similar levels of lipids in Inuit and non-Inuit and ratios of Inuit/non-Inuit BMI's were calculated. At BMI 25 kg/m2 HDL-cholesterol was 1.7/1.6 mM in Greenland Inuit/non-Inuit women and 1.7/1.5 mM in men in a major comparative study. HDL cholesterol decreased by 0.09 for each 1 kg/m2 increase in BMI. Serum triglycerides were 1.0/1.1 mM for Greenland Inuit/non-Inuit women and 0.9/ 1.4 mM for men at BMI 25 kg/m2. Slopes were around 0.1. A comparative study in Canadian Inuit/non-Inuit gave similar results. The BMI levels required for similar HDL-cholesterol or triglycerides were around 27.5 kg/m2, and Inuit/non-Inuit BMI-ratios were around 1.1. The same degree of dyslipidaemia was seen when Inuit had a 10% higher BMI compared to non-Inuit. This may support the establishment of Inuit-specific BMI cut-offs for the purposes of health screening and population health surveillance.
Food brand recognition and BMI in preschoolers.
Harrison, Kristen; Moorman, Jessica; Peralta, Mericarmen; Fayhee, Kally
2017-07-01
Children's food brand recognition predicts health-related outcomes such as preference for obesogenic foods and increased risk for overweight. However, it is uncertain to what degree food brand recognition acts as a proxy for other factors such as parental education and income, child vocabulary, child age, child race/ethnicity, parent healthy eating guidance, child commercial TV viewing, and child dietary intake, all of which may influence or be influenced by food brand recognition. U.S. preschoolers (N = 247, average age 56 months) were measured for BMI and completed the Peabody Picture Vocabulary Test plus recognition and recall measures for a selection of U.S. food brands. Parents completed measures of healthy eating guidance, child dietary intake, child commercial TV viewing, parent education, household income, parent BMI, and child age and race/ethnicity. Controlling these variables, child food brand recognition predicted higher child BMI percentile. Further, qualitative examination of children's incorrect answers to recall items demonstrated perceptual confusion between brand mascots and other fantasy characters to which children are exposed during the preschool years, extending theory on child consumer development. Copyright © 2017 Elsevier Ltd. All rights reserved.
Bmi-1 confers adaptive radioresistance to KYSE-150R esophageal carcinoma cells
Energy Technology Data Exchange (ETDEWEB)
Wang, Guanyu [Department of General Surgery, Sir Run Run Shaw Hospital, School of Medicine, Zhejiang University, Hangzhou (China); Liu, Luying [Department of Radiotherapy, Zhejiang Cancer Hospital, Hangzhou (China); Sharma, Sherven [David Geffen School of Medicine at UCLA, and the Department of Veterans Affairs, Los Angeles, CA (United States); Liu, Hai; Yang, Weifang; Sun, Xiaonan [Department of Radiotherapy, Sir Run Run Shaw Hospital, School of Medicine, Zhejiang University, Hangzhou (China); Dong, Qinghua, E-mail: dongqinghua@zju.edu.cn [Biomedical Research Center, Sir Run Run Shaw Hospital, School of Medicine, Zhejiang University, Hangzhou (China)
2012-08-24
Highlights: Black-Right-Pointing-Pointer Adaptive radioresistant KYSE-150R cells expressed high level of Bmi-1. Black-Right-Pointing-Pointer Bmi-1 depletion sensitized KYSE-150R cells to RT. Black-Right-Pointing-Pointer Bmi-1 depletion increased the generation of ROS in KYSE-150R cells exposed to radiation. Black-Right-Pointing-Pointer Bmi-1 depletion impaired DNA repair capacities in KYSE-150R cells exposed to radiation. -- Abstract: Radiotherapy (RT) is a major modality of cancer treatment. However, tumors often acquire radioresistance, which causes RT to fail. The exact mechanisms by which tumor cells subjected to fractionated irradiation (FIR) develop an adaptive radioresistance are largely unknown. Using the radioresistant KYSE-150R esophageal squamous cell carcinoma (ESCC) model, which was derived from KYSE-150 parental cells using FIR, the role of Bmi-1 in mediating the radioadaptive response of ESCC cells to RT was investigated. The results showed that the level of Bmi-1 expression was significantly higher in KYSE-150R cells than in the KYSE-150 parental cells. Bmi-1 depletion sensitized the KYSE-150R cells to RT mainly through the induction of apoptosis, partly through the induction of senescence. A clonogenic cell survival assay showed that Bmi-1 depletion significantly decreased the radiation survival fraction in KYSE-150R cells. Furthermore, Bmi-1 depletion increased the generation of reactive oxygen species (ROS) and the expression of oxidase genes (Lpo, Noxo1 and Alox15) in KYSE-150R cells exposed to irradiation. DNA repair capacities assessed by {gamma}-H2AX foci formation were also impaired in the Bmi-1 down-regulated KYSE-150R cells. These results suggest that Bmi-1 plays an important role in tumor radioadaptive resistance under FIR and may be a potent molecular target for enhancing the efficacy of fractionated RT.
Does the cortisol awakening response link childhood adversity to adult BMI?
Miller, Kelly F; Arbel, Reout; Shapiro, Lauren S; Han, Sohyun C; Margolin, Gayla
2018-04-26
Childhood adversity is a risk factor for the development of obesity in adulthood. Dysregulated hypothalamic-pituitary-adrenal (HPA) activity, which has been associated separately with both adverse childhood experiences and obesity, has been posited as a mechanism by which stressful experiences influence body mass index (BMI); however, this mechanism has not yet been tested longitudinally. The present study uses multireporter, longitudinal data across three time points to test whether the adolescent cortisol awakening response (CAR), an index of diurnal HPA activity, mediates the association between adversity in childhood and BMI in adulthood. Eighty-two youth, mothers, and fathers reported on adverse childhood experiences from middle childhood to late adolescence. During adolescence, youth provided saliva samples three times each morning across three days, which were assayed for cortisol to calculate CAR. During early adulthood, youth reported height and weight to calculate BMI. Greater adversity predicted flatter CAR and higher young adult BMI. Flatter CAR partially mediated the association between childhood adversity and young adult BMI. Stress-related alterations to HPA activity account in part for the childhood adversity-adult obesity link. Findings are consistent with theoretical models implicating HPA alterations as linking childhood adversity to metabolic and behavioral determinants of BMI in adulthood. (PsycINFO Database Record (c) 2018 APA, all rights reserved).
Association between Infancy BMI Peak and Body Composition and Blood Pressure at Age 5–6 Years
Hof, Michel H. P.; Vrijkotte, Tanja G. M.; de Hoog, Marieke L. A.; van Eijsden, Manon; Zwinderman, Aeilko H.
2013-01-01
Introduction The development of overweight is often measured with the body mass index (BMI). During childhood the BMI curve has two characteristic points: the adiposity rebound at 6 years and the BMI peak at 9 months of age. In this study, the associations between the BMI peak and body composition measures and blood pressure at age 5–6 years were investigated. Methods Measurements from the Amsterdam Born Children and their Development (ABCD) study were available for this study. Blood pressure (systolic and diastolic) and body composition measures (BMI, waist-to-height ratio, fat percentage) were gathered during a health check at about 6 years of age (n = 2822). All children had multiple BMI measurements between the 0–4 years of age. For boys and girls separately, child-specific BMI peaks were extracted from mixed effect models. Associations between the estimated BMI peak and the health check measurements were analysed with linear models. In addition, we investigated the potential use of the BMI at 9 months as a surrogate measure for the magnitude of the BMI peak. Results After correction for the confounding effect of fetal growth, both timing and magnitude of the BMI peak were significantly and positively associated (pBMI peak showed no direct association with blood pressure at the age 5–6 year, but was mediated by the current BMI. The correlation between the magnitude of the BMI peak and BMI at 9 months was approximately 0.93 and similar associations with the measures at 5–6 years were found. Conclusion The magnitude of the BMI peak was associated with body composition measures at 5–6 years of age. Moreover, the BMI at 9 months could be used as surrogate measure for the magnitude of the BMI peak. PMID:24324605
Work-family life courses and BMI trajectories in three British birth cohorts.
Lacey, R E; Sacker, A; Bell, S; Kumari, M; Worts, D; McDonough, P; Kuh, D; McMunn, A
2017-02-01
Combining work and family responsibilities has previously been associated with improved health in mid-life, yet little is known about how these associations change over time (both biographical and historical) and whether this extends to body mass index (BMI) trajectories for British men and women. The purpose of this study was to investigate relationships between work-family life courses and BMI trajectories across adulthood (16-42 years) for men and women in three British birth cohorts. Multiply imputed data from three nationally representative British birth cohorts were used-the MRC National Survey of Health and Development (NSHD; 1946 birth cohort, n=3012), the National Child Development Study (NCDS; 1958 birth cohort, n=9614) and the British Cohort Study (BCS; 1970 birth cohort, n=8140). A typology of work-family life course types was developed using multi-channel sequence analysis, linking annual information on work, partnerships and parenthood from 16 to 42 years. Work-family life courses were related to BMI trajectories using multi-level growth models. Analyses adjusted for indicators of prior health, birthweight, child BMI, educational attainment and socioeconomic position across the life course, and were stratified by gender and cohort. Work-family life courses characterised by earlier transitions to parenthood and weaker long-term links to employment were associated with greater increases in BMI across adulthood. Some of these differences, particularly for work-family groups, which are becoming increasingly non-normative, became more pronounced across cohorts (for example, increases in BMI between 16 and 42 years in long-term homemaking women: NSHD: 4.35 kg m -2 , 95% confidence interval (CI): 3.44, 5.26; NCDS: 5.53 kg m - 2 , 95% CI: 5.18, 5.88; BCS: 6.69 kg m - 2 , 95% CI: 6.36, 7.02). Becoming a parent earlier and weaker long-term ties to employment are associated with greater increases in BMI across adulthood in British men and women.
Jürimäe, Jaak; Mäestu, Jarek; Jürimäe, Toivo
2010-01-01
The rapid increase in skeletal mass that occurs during puberty is caused by increases in longitudinal growth as well as cortical thickness. The measurement of growth changes during puberty using two-dimensional (dual-energy X-ray absorptiometry) and/or three-dimensional (computed tomography, magnetic resonance imaging) measurement devices provides only a static representation of bone tissue parameters. The measurement of bone turnover markers provides a more dynamic picture of the nature of bone tissue that can be repeated at much shorter intervals during puberty. The bone turnover markers are products of osteoblasts and osteoclasts which can be measured in urine or blood. The increase in different markers of bone turnover coincides with the pubertal growth spurt and thereafter markers decline until they converge into adult values. The initiation of puberty is accompanied by increases in androgens and estrogens. The effects of sex hormones on bone mineral accrual are mediated mainly by growth hormone and insulin-like growth factor-1, but they also exert a direct effect on bone metabolism. Important determinants of bone mineral accrual during puberty include optimal nutritional status, body composition parameters and physical activity pattern. All of these determinants are related to the state of energy balance, while peripheral indicators of energy balance, such as different growth factors and adipocytokines, may also have a positive influence of the growing skeleton. Taken together, bone mineral accrual during puberty is a complex interaction between physical activity pattern, various body composition parameters, specific growth factors and adipocytokines, and also sex hormones. Copyright © 2010 S. Karger AG, Basel.
The value of shoe size for prediction of the timing of the pubertal growth spurt.
Busscher, I.; Kingma, I.; Wapstra, F.H.; Bulstra, S.K.; Verkerke, G.J.; Veldhuizen, A.G.
2011-01-01
Background: Knowing the timing of the pubertal growth spurt of the spine, represented by sitting height, is essential for the prognosis and therapy of adolescent idiopathic scoliosis. There are several indicators that reflect growth or remaining growth of the patient. For example, distal body parts
Effects of dibutyl phthalate in male rabbits following in utero, adolescent, or post-pubertal exposureTy T. Higuchi1, Jennifer S. Palmer1, L. Earl Gray Jr2., and D. N. Rao Veeramachaneni11Animal Reproduction and Biotechnology Laboratory, Colorado State University, Fort
Directory of Open Access Journals (Sweden)
M. Thomas
2018-01-01
Full Text Available Objectives. Information on the efficacy of GH treatment in short SGA children starting their treatment in adolescence is limited. Therefore, adult height (AH, total height gain, and pubertal height gain were evaluated in short SGA children who started GH treatment at pubertal onset. Patient and Methods. Growth data of 47 short SGA adolescents (22 boys who started GH treatment at pubertal onset (PUB group were compared with results from 27 short SGA patients (11 boys who started GH therapy at least 1 year before pubertal onset (PrePUB group. Results. The PUB group achieved a mean (±SD total height gain of 0.8 ± 0.7 SDS and an AH of −2.5 ± 0.7 SDS after 4.1 ± 1.1 years of GH treatment with a dosage of 41.8 ± 8.4 μg/kg/day. These results were comparable with those in the PrePUB group, which was treated for a longer duration (5.8 ± 2.1 years, resulting in a total height gain of 1.1 ± 0.7 SDS and an AH of −2.1 ± 1.0 SDS. Multiple regression analysis showed a significantly lower height gain in pubertal patients, females, and patients weighing less at start of GH treatment. An AH above −2 SDS and above the parent-specific lower limit of height was, respectively, reached in 28% and 70% of PUB and 44% and 67% of PrePUB patients (NS. AH SDS was positively correlated with the height SDS at start of GH. Conclusions. Short SGA adolescents starting GH therapy at an early pubertal stage have a modest and variable height gain. A normal AH can be expected in one third of the patients, especially in those with a smaller height deficit at onset of GH treatment.
p21/Cyclin E pathway modulates anticlastogenic function of Bmi-1 in cancer cells
Deng, Wen; Zhou, Yuan; Tiwari, Agnes FY; Su, Hang; Yang, Jie; Zhu, Dandan; Lau, Victoria Ming Yi; Hau, Pok Man; Yip, Yim Ling; Cheung, Annie LM; Guan, Xin-Yuan; Tsao, Sai Wah
2015-01-01
Apart from regulating stem cell self-renewal, embryonic development and proliferation, Bmi-1 has been recently reported to be critical in the maintenance of genome integrity. In searching for novel mechanisms underlying the anticlastogenic function of Bmi-1, we observed, for the first time, that Bmi-1 positively regulates p21 expression. We extended the finding that Bmi-1 deficiency induced chromosome breaks in multiple cancer cell models. Interestingly, we further demonstrated that knockdown of cyclin E or ectopic overexpression of p21 rescued Bmi-1 deficiency-induced chromosome breaks. We therefore conclude that p21/cyclin E pathway is crucial in modulating the anticlastogenic function of Bmi-1. As it is well established that the overexpression of cyclin E potently induces genome instability and p21 suppresses the function of cyclin E, the novel and important implication from our findings is that Bmi-1 plays an important role in limiting genomic instability in cylin E-overexpressing cancer cells by positive regulation of p21. PMID:25131797
2017-10-01
that inhibiting BMI1 decreased prostate cancer tumor growth in VCaP murine xenograft. 15. SUBJECT TERMS: Polycomb, BMI1, Androgen Receptor ...Repressive Complex, Androgen Receptor , Castration- Resistant Prostate Cancer , small molecule inhibitor 4 ACCOMPLISHMENTS A. What were the major...Qi Cao. A Novel Role of BMI1 in Androgen Receptor Pathway. 23rd Prostate Cancer Foundation Annual Scientific Retreat, Oct 26-29, 2016, Carlsbad, CA
The effects of puberty on white matter development in boys.
Menzies, Lara; Goddings, Anne-Lise; Whitaker, Kirstie J; Blakemore, Sarah-Jayne; Viner, Russell M
2015-02-01
Neuroimaging studies demonstrate considerable changes in white matter volume and microstructure during adolescence. Most studies have focused on age-related effects, whilst puberty-related changes are not well understood. Using diffusion tensor imaging and tract-based spatial statistics, we investigated the effects of pubertal status on white matter mean diffusivity (MD) and fractional anisotropy (FA) in 61 males aged 12.7-16.0 years. Participants were grouped into early-mid puberty (≤Tanner Stage 3 in pubic hair and gonadal development; n=22) and late-post puberty (≥Tanner Stage 4 in pubic hair or gonadal development; n=39). Salivary levels of pubertal hormones (testosterone, DHEA and oestradiol) were also measured. Pubertal stage was significantly related to MD in diverse white matter regions. No relationship was observed between pubertal status and FA. Regression modelling of MD in the significant regions demonstrated that an interaction model incorporating puberty, age and puberty×age best explained our findings. In addition, testosterone was correlated with MD in these pubertally significant regions. No relationship was observed between oestradiol or DHEA and MD. In conclusion, pubertal status was significantly related to MD, but not FA, and this relationship cannot be explained by changes in chronological age alone. Copyright © 2014 The Authors. Published by Elsevier Ltd.. All rights reserved.
Change in BMI accurately predicted by social exposure to acquaintances.
Oloritun, Rahman O; Ouarda, Taha B M J; Moturu, Sai; Madan, Anmol; Pentland, Alex Sandy; Khayal, Inas
2013-01-01
Research has mostly focused on obesity and not on processes of BMI change more generally, although these may be key factors that lead to obesity. Studies have suggested that obesity is affected by social ties. However these studies used survey based data collection techniques that may be biased toward select only close friends and relatives. In this study, mobile phone sensing techniques were used to routinely capture social interaction data in an undergraduate dorm. By automating the capture of social interaction data, the limitations of self-reported social exposure data are avoided. This study attempts to understand and develop a model that best describes the change in BMI using social interaction data. We evaluated a cohort of 42 college students in a co-located university dorm, automatically captured via mobile phones and survey based health-related information. We determined the most predictive variables for change in BMI using the least absolute shrinkage and selection operator (LASSO) method. The selected variables, with gender, healthy diet category, and ability to manage stress, were used to build multiple linear regression models that estimate the effect of exposure and individual factors on change in BMI. We identified the best model using Akaike Information Criterion (AIC) and R(2). This study found a model that explains 68% (pchange in BMI. The model combined social interaction data, especially from acquaintances, and personal health-related information to explain change in BMI. This is the first study taking into account both interactions with different levels of social interaction and personal health-related information. Social interactions with acquaintances accounted for more than half the variation in change in BMI. This suggests the importance of not only individual health information but also the significance of social interactions with people we are exposed to, even people we may not consider as close friends.
Torabi, Masoumeh; Pooriamehr, Alireza; Bigdeli, Imanollah; Miladi-Gorji, Hossein
2017-10-17
This study was designed to examine whether maternal swimming exercise during pregnancy would attenuate prenatally morphine-induced anxiety, depression and voluntary consumption of morphine in the pubertal male and female rat offspring. Pregnant rats during the development of morphine dependence were allowed to swim (30-45min/d, 3days per a week) on gestational days 11-18. Then, the pubertal male and female rat offspring were tested for the elevated plus-maze (EPM), sucrose preference test (SPT) and voluntary morphine consumption using a two-bottle choice (TBC) paradigm. The results showed that male and female rat offspring born of the swimmer morphine-dependent mothers exhibited an increase in EPM open arm time and entries, higher levels of sucrose preference than their sedentary control mothers. Voluntary consumption of morphine was less in the male and female rat offspring born of the swimmer morphine-dependent mothers as compared with their sedentary control mothers during three periods of the intake of drug. Thus, swimming exercise in pregnant morphine dependent mothers decreased anxiety, depressive-like behavior and also the voluntary morphine consumption in the pubertal male and female offspring, which may prevent prenatally morphine-induced behavioral sensitization in offspring. Copyright © 2017 Elsevier B.V. All rights reserved.
Directory of Open Access Journals (Sweden)
Chakraborty TR
2012-01-01
Full Text Available Tandra R Chakraborty1, Eilliut Alicea1, Sanjoy Chakraborty21Department of Biology, Adelphi University, One South Avenue, Garden City; 2Department of Biological Sciences, New York City College of Technology, New York, NY, USAAbstract: Phytoestrogens, phthalates, and phenols are estrogen-disrupting chemicals that have a pronounced effect at puberty. They are exogenous chemicals that are either plant-derived or man-made, and can alter the functions of the endocrine system and cause various health defects by interfering with the synthesis, metabolism, binding, or cellular responses of natural estrogens. Phytoestrogens, phthalates, and phenols are some of the potent estrogens detectable in urine. Phytoestrogens are plant-derived xenestrogens found in a wide variety of food products, like soy-based food, beverages, several fruits, and vegetables. Exposure to phytoestrogens can delay breast development and further lead to precocious puberty. The effect of phytoestrogens is mediated through estrogen receptors α and β or by binding with early immediate genes, such as jun and fos. Phthalates are multifunctional synthetic chemicals used in plastics, polyvinyl chloride products, cosmetics, hair spray, and children's toys. Phthalates have been shown to cause defeminization, thelarche, precocious puberty, and an increase in breast and pubic hair in pubertal girls. However, reports are also available that show no association of phthalates with precocious puberty in girls. Phthalates can act through a receptor-mediated signaling pathway or affect the production of luteinizing hormone and follicle-stimulating hormone that has a direct effect on estrogen formation. Phenols like bisphenol A are industrial chemicals used mainly in the manufacture of polycarbonates and plastic materials. Bisphenol A has been shown to cause precocious puberty and earlier menarche in pubertal girls. Reports suggest that the neurotoxic effect of bisphenol A can be mediated either by
Laxer, Rachel E; Cooke, Martin; Dubin, Joel A; Brownson, Ross C; Chaurasia, Ashok; Leatherdale, Scott T
2018-01-01
Youth are engaging in multiple risky behaviours, increasing their risk of overweight, obesity, and related chronic diseases. The objective of this study was to examine the effect of engaging in unique clusters of unhealthy behaviours on youths' body mass index (BMI) trajectories. This study used a linked-longitudinal sample of Grades 9 and 10 students (13 to 17 years of age) participating in the COMPASS host study. Students reported obesity-related and other risky behaviours at baseline and height and weight (to derive BMI) at baseline (2012/2013) and annually for 2 years post-baseline (2013/14 and 2014/15). Students were grouped into behavioural clusters based on response probabilities. Linear mixed effects models, using BMI as a continuous outcome measure, were used to examine the effect of engaging in clusters of risky behaviours on BMI trajectories. There were significant differences in BMI of the four behavioural clusters at baseline that remained consistent over time. Higher BMI values were found among youth classified at baseline to be Typical High School Athletes (β = 0.232 kg/m2, [confidence interval (CI): 0.03-0.50]), Inactive High Screen-User (β = 0.348 kg/m2, CI: 0.11-0.59) and Moderately Active Substance Users (β = 0.759 kg/m2, CI: 0.36-1.15) compared to students classified as Health Conscious. Despite these baseline differences, BMI appeared to increase across all behavioural clusters annually by the same amount (β = 0.6097 kg/m2, (CI) = 0.57-0.64). Although annual increases in BMI did not differ by behavioural clusters, membership in a particular behavioural cluster was associated with baseline BMI, and these differences remained consistent over time. Results indicate that intervening and modifying unhealthy behaviours earlier might have a greater impact than during adolescence. Health promotion strategies targeting the highest risk youth as they enter secondary school might be promising means to prevent or delay the onset of obesity.
Yilmaz, Ayse E; Celik, Nurullah; Soylu, Gul; Donmez, Ahsen; Yuksel, Cigdem
2012-07-01
Vulvovaginitisis the most common gynecological problem of childhood. The aim of the study was to determine and compare clinical and microbiological features of vulvovaginitis in prepubertal and adolescent girls. In this retrospective study, the records of patients who were diagnosed with vulvovaginitis between January 2005 and December 2010 in the pediatric outpatient clinic at Fatih University Hospital were retrieved. Information regarding age, symptoms, history of antibiotic use within 1 month prior to presentation, findings on urinalysis, serum antistreptolysin-O levels, and results of urine/vaginal cultures was collected. The records of 112 patients were evaluated, 72 of which were prepubertal (64.2%) and 40 were pubertal (35.7%) at the time of diagnosis. Thirty-eight prepubertal patients (52.7%) had a positive result on vaginal culture, the most commonly encountered microorganism being group A beta-hemolytic streptococcus (15.2%). Culture positivity rate in the pubertal group was 47.5% (19 patients), with Candida albicans being the most frequently isolated microorganism (27.5%). The etiopathogenesis and culture results differ between prepubertal and adolescent girls with vulvovaginitis, which should be taken into consideration in the treatment approach of this disorder. Copyright © 2012. Published by Elsevier B.V.
Social disparities in body mass index (BMI) trajectories among Chinese adults in 1991-2011.
Fang, Changchun; Liang, Ying
2017-08-16
Obesity is a serious public health problem in China. The relationship between obesity and socio-economic status (SES) is changing and affected by uncertainty, particularly, in developing countries. The sex-related differences in body mass index (BMI) trajectories are controversial and require substantial empirical data for updating and enriching. This study examined the relationship between SES and BMI in Chinese adults from a dynamic perspective using longitudinal data (1991-2011) from the China Health and Nutrition Survey (CHNS). Then, sex-related differences were determined. A hierarchical linear model was used. SES positively affected the male BMI changes, with faster BMI growth rates in the high-SES males over the past 20 years. By contrast, female BMI was only affected by BMI baseline and residential area. Specifically, greater BMI baseline led to greater BMI growth rate and earlier BMI decline. In the past 20 years, the BMI growth rate has been greater in the urban females than in the rural females. The relationship between SES and obesity is complex in China, and a substantial sex-related difference exists. We argue that this large sex-related difference is due to the rapid economic and social changes that have affected national health and increased the gender inequality and social role restrictions in females. We provide insights for further research and policy recommendations.
BMI-1 Promotes Self-Renewal of Radio- and Temozolomide (TMZ)-Resistant Breast Cancer Cells.
Yan, Yanfang; Wang, Ying; Zhao, Pengxin; Ma, Weiyuan; Hu, Zhigang; Zhang, Kaili
2017-12-01
Breast cancer is a hormone-dependent malignancy and is the most prevalent cause of cancer-related mortality among females. Radiation therapy and chemotherapy are common treatments of breast cancer. However, tumor relapse and metastasis following therapy are major clinical challenges. The importance of B-lymphoma Moloney murine leukemia virus insertion region-1 (BMI-1) was implicated in cell proliferation, stem cell maintenance, and tumor initiation. We established radio- and temozolomide (TMZ)-resistant (IRC-R) MCF-7 and MDA-MB-231 cell lines to investigate the mechanism involved in therapeutic resistance. Cell proliferation and sphere number were dramatically elevated, and BMI-1 was remarkably upregulated, in IRC-R cells compared to parental cells. Silencing BMI-1 by RNA interference only affected the cell proliferation of IRC-R but not parental cells, suggesting the critical role of BMI-1 in radio- and TMZ resistance. We used a xenograft mice model to elucidate that BMI-1 was necessary in tumor development by assessing tumor volume and Ki67 expression. We found that Hedgehog (Hhg) signaling exerted synergized functions together with BMI-1, implicating the importance of BMI-1 in Hhg signaling. Downregulation of BMI-1 could be an effective strategy to suppress tumor growth, which supports the potential clinical use of targeting BMI-1 in breast cancer treatment.
Smoking and Socio-demographic correlates of BMI
Directory of Open Access Journals (Sweden)
Peizhi Wang
2016-06-01
Full Text Available Abstract Background The aim of the current study was to examine the associations between Body Mass Index (BMI and socio-demographic factors and to examine the relationship between BMI, smoking status and ethnicity. Methods The Singapore Mental Health Study (SMHS surveyed Singapore Residents (Singapore Citizens and Permanent Residents aged 18 years old and above. BMI was calculated using height and weight which were self-reported by respondents. Socio-demographic characteristics and smoking status were recorded in a standardized data collection form. Results Six thousand and six hundred sixteen respondents completed the study (response rate of 75.9 % which constituted a representative sample of the adult resident population in Singapore. Ethnicity, gender and education status were associated with obesity. There was an interaction effect between ethnicity smoking status, and BMI. Indian and Malay smokers were less likely to be obese compared to Chinese smokers. The relationship between ethnicity and BMI was thus reversed when smoking was taken into account. Conclusions The study identified certain subgroups and risk factors that are associated with obesity. There is a need for further research to explore and identify genetic, metabolic and ethnic differences that underlie the interaction between ethnicity and smoking status which affects BMI.
The relationship between income, economic freedom, and BMI.
Lawson, R A; Murphy, R H; Williamson, C R
2016-05-01
What explains increases in BMI (and obesity) over time and across countries? Although many microeconomic forces are likely explanations, increasingly scholars are arguing that macroeconomic forces such as market liberalism and globalization are root causes of the obesity epidemic. The purpose of this paper is to examine the impact of economic freedom on obesity conditional on the level of income and other factors. We use an unbalanced pooled cross section of up to 135 countries for 1995 and 2000-2009. Our statistical model specifications include pooled OLS and fixed effects. First, we find that controlling for fixed effects siphons off much of the relationship previously documented between economic freedom and BMI. Second, economic freedom is associated with slightly higher BMIs but only for men in developing nations. Lastly, we show that economic freedom increases life expectancy for both men and women in developing countries. Therefore, policies aimed at reducing obesity that limit economic liberalism may come at the expense of life expectancy in the developing world. Copyright © 2016 The Royal Society for Public Health. Published by Elsevier Ltd. All rights reserved.
NMR-based metabolomic profiling of overweight adolescents
DEFF Research Database (Denmark)
Zheng, Hong; Yde, Christian C; Arnberg, Karina
2014-01-01
The plasma and urine metabolome of 192 overweight 12-15-year-old adolescents (BMI of 25.4 ± 2.3 kg/m(2)) were examined in order to elucidate gender, pubertal development measured as Tanner stage, physical activity measured as number of steps taken daily, and intra-/interindividual differences...... and the metabolome could be identified. The present study for the first time provides comprehensive information about associations between the metabolome and gender, pubertal development, and physical activity in overweight adolescents, which is an important subject group to approach in the prevention of obesity...... affecting the metabolome detected by proton NMR spectroscopy. Higher urinary excretion of citrate, creatinine, hippurate, and phenylacetylglutamine and higher plasma level of phosphatidylcholine and unsaturated lipid were found for girls compared with boys. The results suggest that gender differences...
Directory of Open Access Journals (Sweden)
Meng-Che Tsai
Full Text Available To investigate the longitudinal impacts of pubertal timing and weight status on Internet use in adolescents.Three waves of data on a longitudinal cohort of 7th grade students (N = 2430 were retrieved from the Taiwan Youth Project. Univariate and multivariate regression models were applied using crude and adjusted odds ratios (OR with 95% confidence intervals (CI to examine the concomitant impacts of pubertal timing and weight status on adolescent Internet use.The dataset identified 210 (8.7% students using the Internet for more than 20 hours/week, and 81 (3.3% were viewing pornographic material online. Early maturing and thin-weight adolescents were at 35% and 46% increased risks of spending long hours on Internet use, respectively. While early puberty was associated with online pornography viewing among males (adjusted OR 1.84, 95% CI 1.04-3.28, early puberty was contrarily a protective factor against online gaming in females (adjusted OR 0.59, 95% CI 0.36-0.96.Early puberty was found to be positively related to adolescent Internet use. Appropriate health education and guidance regarding Internet use should be provided to those with different developing needs.
Tsai, Meng-Che; Strong, Carol; Chen, Wan-Ting; Lee, Chih-Ting; Lin, Chung-Ying
2018-01-01
To investigate the longitudinal impacts of pubertal timing and weight status on Internet use in adolescents. Three waves of data on a longitudinal cohort of 7th grade students (N = 2430) were retrieved from the Taiwan Youth Project. Univariate and multivariate regression models were applied using crude and adjusted odds ratios (OR) with 95% confidence intervals (CI) to examine the concomitant impacts of pubertal timing and weight status on adolescent Internet use. The dataset identified 210 (8.7%) students using the Internet for more than 20 hours/week, and 81 (3.3%) were viewing pornographic material online. Early maturing and thin-weight adolescents were at 35% and 46% increased risks of spending long hours on Internet use, respectively. While early puberty was associated with online pornography viewing among males (adjusted OR 1.84, 95% CI 1.04-3.28), early puberty was contrarily a protective factor against online gaming in females (adjusted OR 0.59, 95% CI 0.36-0.96). Early puberty was found to be positively related to adolescent Internet use. Appropriate health education and guidance regarding Internet use should be provided to those with different developing needs.
Harskamp-van Ginkel, Margreet W; London, Stephanie J; Magnus, Maria C; Gademan, Maaike G; Vrijkotte, Tanja G
2015-01-01
A causal relationship between maternal obesity and offspring asthma is hypothesized to begin during early development, but no underlying mechanism for the found association is identified. We quantitatively examined mediation by offspring body mass index (BMI) in the association of maternal pre-pregnancy BMI on risk of asthma and wheezing during the first 7-8 years of life in a large Amsterdam born birth cohort. For 3185 mother-child pairs, mothers reported maternal pre-pregnancy BMI and offspring outcomes "ever being diagnosed with asthma" and "wheezing in the past 12 months" on questionnaires. We measured offspring height and weight at age 5-6 years. We performed a multivariate log linear regression comparing outcomes in offspring of mothers with different BMI categories. For each category we quantified and tested mediation by offspring BMI and also investigated interaction by parental asthma. At the age of 7-8 years, 8% of the offspring ever had asthma and 7% had current wheezing. Maternal pre-pregnancy obesity was associated with higher risks of asthma (adjusted RR 2.32 (95% CI: 1.49-3.61) and wheezing (adjusted RR 2.16 (95% CI: 1.28-3.64). Offspring BMI was a mediator in the association between maternal BMI and offspring wheezing, but not for asthma. There was no interaction by parental asthma. Maternal pre-pregnancy obesity was associated with higher risks of offspring asthma and wheezing. The association between maternal obesity and offspring wheezing was both direct and indirect (mediated) through the child's own BMI.
Beyens, I.; Vandenbosch, L.; Eggermont, S.
2015-01-01
Research has demonstrated that adolescents regularly use Internet pornography. This two-wave panel study aimed to test an integrative model in early adolescent boys (Mage = 14.10; N = 325) that (a) explains their exposure to Internet pornography by looking at relationships with pubertal timing and
Marceau, Kristine; Ram, Nilam; Houts, Renate M; Grimm, Kevin J; Susman, Elizabeth J
2011-09-01
Pubertal development is a nonlinear process progressing from prepubescent beginnings through biological, physical, and psychological changes to full sexual maturity. To tether theoretical concepts of puberty with sophisticated longitudinal, analytical models capable of articulating pubertal development more accurately, we used nonlinear mixed-effects models to describe both the timing and tempo of pubertal development in the sample of 364 White boys and 373 White girls measured across 6 years as part of the National Institute of Child Health and Human Development Study of Early Child Care and Youth Development. Individual differences in timing and tempo were extracted with models of logistic growth. Differential relations emerged for how boys' and girls' timing and tempo of development were related to physical characteristics (body mass index, height, and weight) and psychological outcomes (internalizing problems, externalizing problems, and risky sexual behavior). Timing and tempo are associated in boys but not girls. Pubertal timing and tempo are particularly important for predicting psychological outcomes in girls but only sparsely related to boys' psychological outcomes. Results highlight the importance of considering the nonlinear nature of puberty and expand the repertoire of possibilities for examining important aspects of how and when pubertal processes contribute to development.
Deardorff, Julianna; Cham, Heining; Gonzales, Nancy A.; White, Rebecca M. B.; Tein, Jenn-Yun; Wong, Jessie J.; Roosa, Mark W.
2013-01-01
Early-maturing girls are at risk for internalizing and externalizing problems. Research concerning pubertal timing and mental health among Mexican Americans or the influence of parenting behaviors on these relations has been scarce. This study addressed these gaps. This was a prospective examination of 362 Mexican-origin girls and their mothers in…
van Rooijen, R.; Junge, C.M.M.; Kemner, C.
2018-01-01
During puberty a dip in face recognition is often observed, possibly caused by heightened levels of gonadal hormones which in turn affects the re-organization of relevant cortical circuitry. In the current study we investigated whether a pubertal dip could be observed in three other abilities
Alston-Mills, Brenda; Lepri, J J; Martin, C A
2011-08-01
The objective of the present study was to determine the effects of soya and whey milk protein, α-lactalbumin (α-LA), on mammary gland morphology and the structural support of the gland, in pre-pubertal mice after 7 d of treatment. In Expt 1, weaned (day 21) CD1 mice were given one of the four treatments, three included dietary supplements: (1) control diet, casein, (2) soya, (3) α-LA and (4) subcutaneous injection of 2·5 μg oestradiol benzoate in 20 μl maize oil and fed the control diet. All diets were isoenergetic with equal protein concentrations. All groups that were not treated with oestradiol received the vehicle. Whole-mount analyses were performed to determine longitudinal ductal growth and terminal end bud development. DNA was extracted from the gland and assessed by spectrophotometry (260/280 nm). Tissue extracts for extracellular matrix (ECM) proteins, matrix metalloproteinase-2 (MMP(2)), tissue inhibitor of MMP(2) (TIMP(2)), and serum oestradiol and mammary tissue epidermal growth factors (EGF) were measured by immunoassays. Expt 2 utilised the Her2/neu transgenic strain, with the same protocols. Statistical significance was determined by one-way ANOVA. From Expt 1 and 2, soya and α-LA significantly increased ductal elongation when compared with the oestrogen and control groups. These results were corroborated by data on total DNA and the ratio of MMP(2):TIMP(2). The ratio of MMP(2):TIMP(2) was affected by α-LA. Serum oestradiol was decreased only in the oestradiol-treated groups in both experiments. Soya is known to be oestrogenic and can act on epithelia directly. The mechanism by which α-LA affects glandular development is by modulating the ECM or by promoting the synthesis/activity of EGF.
Change in BMI accurately predicted by social exposure to acquaintances.
Directory of Open Access Journals (Sweden)
Rahman O Oloritun
Full Text Available Research has mostly focused on obesity and not on processes of BMI change more generally, although these may be key factors that lead to obesity. Studies have suggested that obesity is affected by social ties. However these studies used survey based data collection techniques that may be biased toward select only close friends and relatives. In this study, mobile phone sensing techniques were used to routinely capture social interaction data in an undergraduate dorm. By automating the capture of social interaction data, the limitations of self-reported social exposure data are avoided. This study attempts to understand and develop a model that best describes the change in BMI using social interaction data. We evaluated a cohort of 42 college students in a co-located university dorm, automatically captured via mobile phones and survey based health-related information. We determined the most predictive variables for change in BMI using the least absolute shrinkage and selection operator (LASSO method. The selected variables, with gender, healthy diet category, and ability to manage stress, were used to build multiple linear regression models that estimate the effect of exposure and individual factors on change in BMI. We identified the best model using Akaike Information Criterion (AIC and R(2. This study found a model that explains 68% (p<0.0001 of the variation in change in BMI. The model combined social interaction data, especially from acquaintances, and personal health-related information to explain change in BMI. This is the first study taking into account both interactions with different levels of social interaction and personal health-related information. Social interactions with acquaintances accounted for more than half the variation in change in BMI. This suggests the importance of not only individual health information but also the significance of social interactions with people we are exposed to, even people we may not consider as
BMI-1, a promising therapeutic target for human cancer
WANG, MIN-CONG; LI, CHUN-LI; CUI, JIE; JIAO, MIN; WU, TAO; JING, LI; NAN, KE-JUN
2015-01-01
BMI-1 oncogene is a member of the polycomb-group gene family and a transcriptional repressor. Overexpression of BMI-1 has been identified in various human cancer tissues and is known to be involved in cancer cell proliferation, cell invasion, distant metastasis, chemosensitivity and patient survival. Accumulating evidence has revealed that BMI-1 is also involved in the regulation of self-renewal, differentiation and tumor initiation of cancer stem cells (CSCs). However, the molecular mechanisms underlying these biological processes remain unclear. The present review summarized the function of BMI-1 in different human cancer types and CSCs, and discussed the signaling pathways in which BMI-1 is potentially involved. In conclusion, BMI-1 may represent a promising target for the prevention and therapy of various cancer types. PMID:26622537
Development and evaluation of aerogel-filled BMI sandwich panels for thermal barrier applications
Directory of Open Access Journals (Sweden)
A. Dineshkumar
2016-07-01
Full Text Available This study details a fabrication methodology envisaged to manufacture Glass/BMI honeycomb core aerogel-filled sandwich panels. Silica aerogel granules are used as core fillers to provide thermal insulation properties with little weight increase. Experimental heat transfer studies are conducted on these panels to study the temperature distribution between their two surfaces. Numerical studies are also carried out to validate the results. Despite exhibiting good thermal shielding capabilities, the Glass/BMI sandwich panels are found to oxidise at 180 ºC if exposed directly to heat. In order to increase the temperature bearing capacity and the operating temperature range for these panels, a way of coating them from outside with high temperature spray paint was tried. With a silicone-based coating, the temperature sustainability of these sandwich panels is found to increase to 350 ºC. This proved the effectiveness of the formed manufacturing process, selected high temperature coating, the coating method as well as the envisaged sandwich panel concept.
Eating behaviour patterns and BMI in Portuguese higher education students.
Poínhos, Rui; Oliveira, Bruno M P M; Correia, Flora
2013-12-01
Our aim was to determine prototypical patterns of eating behaviour among Portuguese higher education students, and to relate these patterns with BMI. Data from 280 higher education students (63.2% females) aged between 18 and 27 years were analysed. Several eating behaviour dimensions (emotional and external eating, flexible and rigid restraint, binge eating, and eating self-efficacy) were assessed, and eating styles were derived through cluster analysis. BMI for current, desired and maximum self-reported weights and the differences between desired and current BMI and between maximum and current BMI were calculated. Women scored higher in emotional eating and restraint, whereas men showed higher eating self-efficacy. Men had higher current, desired and maximum BMI. Cluster analysis showed three eating styles in both male and female subsamples: "Overeating", "High self-efficacy" and "High restraint". High self-efficacy women showed lower BMI values than the others, and restrictive women had higher lost BMI. High self-efficacy men showed lower desired BMI than overeaters, and lower maximum and lost BMI than highly restrictive ones. Restrictive women and men differ on important eating behaviour features, which may be the cause of differences in the associations with BMI. Eating self-efficacy seems to be a central variable influencing the relationships between other eating behaviour dimensions and BMI. Copyright © 2013 Elsevier Ltd. All rights reserved.
Association Between BMI and Recurrence of Primary Spontaneous Pneumothorax.
Tan, Juntao; Yang, Yang; Zhong, Jianhong; Zuo, Chuantian; Tang, Huamin; Zhao, Huimin; Zeng, Guang; Zhang, Jianfeng; Guo, Jianji; Yang, Nuo
2017-05-01
Whether body mass index (BMI) is a significant risk factor for recurrence of primary spontaneous pneumothorax (PSP) remains controversial. The purpose of this study was to examine whether BMI and other factors are linked to risk of PSP recurrence. A consecutive cohort of 273 patients was retrospectively evaluated. Patients were divided into those who experienced recurrence (n = 81) and those who did not (n = 192), as well as into those who had low BMI (n = 75) and those who had normal or elevated BMI (n = 198). The two pairs of groups were compared in terms of baseline data, and Cox proportional hazards modeling was used to identify predictors of PSP recurrence. Rates of recurrence among all 273 patients were 20.9% at 1 year, 23.8% at 2 years, and 28.7% at 5 years. Univariate analysis identified the following significant predictors of PSP recurrence: height, weight, BMI, size of pneumothorax, and treatment modality. Multivariate analyses identified several risk factors for PSP recurrence: low BMI, pneumothorax size ≥50%, and non-surgical treatment. Kaplan-Meier survival analysis indicated that patients with low BMI showed significantly lower recurrence-free survival than patients with normal or elevated BMI (P pneumothorax size ≥50%, and non-surgical treatment were risk factors for PSP recurrence in our cohort. Low BMI may be a clinically useful predictor of PSP recurrence.
Prospective associations between sedentary lifestyle and BMI in midlife
DEFF Research Database (Denmark)
Mortensen, Laust Hvas; Siegler, Ilene C; Barefoot, John C
2006-01-01
A strong positive cross-sectional relationship between BMI and a sedentary lifestyle has been consistently observed in numerous studies. However, it has been questioned whether high BMI is a determinant or a consequence of a sedentary lifestyle.......A strong positive cross-sectional relationship between BMI and a sedentary lifestyle has been consistently observed in numerous studies. However, it has been questioned whether high BMI is a determinant or a consequence of a sedentary lifestyle....
The Prevalence of Obesity as Indicated by BMI and Waist ...
African Journals Online (AJOL)
Background: The prevalence of overweight and obesity in most developed countries and in urban areas of many less developed countries has been increasing markedly over the past twenty years. This study\\'s aims were to determine the prevalence of obesity using BMI and waist circumference among Nigerian adults ...
Bmi-1 promotes the aggressiveness of glioma via activating the NF-kappaB/MMP-9 signaling pathway
International Nuclear Information System (INIS)
Jiang, Lili; Wu, Jueheng; Yang, Yi; Liu, Liping; Song, Libing; Li, Jun; Li, Mengfeng
2012-01-01
The prognosis of human glioma is poor, and the highly invasive nature of the disease represents a major impediment to current therapeutic modalities. The oncoprotein B-cell-specific Moloney murine leukemia virus integration site 1 protein (Bmi-1) has been linked to the development and progression of glioma; however, the biological role of Bmi-1 in the invasion of glioma remains unclear. A172 and LN229 glioma cells were engineered to overexpress Bmi-1 via stable transfection or to be silenced for Bmi-1 expression using RNA interfering method. Migration and invasiveness of the engineered cells were assessed using wound healing assay, Transwell migration assay, Transwell matrix penetration assay and 3-D spheroid invasion assay. MMP-9 expression and activity were measured using real-time PCR, ELISA and the gelatin zymography methods. Expression of NF-kappaB target genes was quantified using real-time PCR. NF-kappaB transcriptional activity was assessed using an NF-kappaB luciferase reporter system. Expression of Bmi-1 and MMP-9 in clinical specimens was analyzed using immunohistochemical assay. Ectopic overexpression of Bmi-1 dramatically increased, whereas knockdown of endogenous Bmi-1 reduced, the invasiveness and migration of glioma cells. NF-kappaB transcriptional activity and MMP-9 expression and activity were significantly increased in Bmi-1-overexpressing but reduced in Bmi-1-silenced cells. The reporter luciferase activity driven by MMP-9 promoter in Bmi-1-overexpressing cells was dependent on the presence of a functional NF-kappaB binding site, and blockade of NF-kappaB signaling inhibited the upregulation of MMP-9 in Bmi-1 overexpressing cells. Furthermore, expression of Bmi-1 correlated with NF-kappaB nuclear translocation as well as MMP-9 expression in clinical glioma samples. Bmi-1 may play an important role in the development of aggressive phenotype of glioma via activating the NF-kappaB/MMP-9 pathway and therefore might represent a novel therapeutic
Bmi-1 promotes the aggressiveness of glioma via activating the NF-kappaB/MMP-9 signaling pathway
Directory of Open Access Journals (Sweden)
Jiang Lili
2012-09-01
Full Text Available Abstract Background The prognosis of human glioma is poor, and the highly invasive nature of the disease represents a major impediment to current therapeutic modalities. The oncoprotein B-cell-specific Moloney murine leukemia virus integration site 1 protein (Bmi-1 has been linked to the development and progression of glioma; however, the biological role of Bmi-1 in the invasion of glioma remains unclear. Methods A172 and LN229 glioma cells were engineered to overexpress Bmi-1 via stable transfection or to be silenced for Bmi-1 expression using RNA interfering method. Migration and invasiveness of the engineered cells were assessed using wound healing assay, Transwell migration assay, Transwell matrix penetration assay and 3-D spheroid invasion assay. MMP-9 expression and activity were measured using real-time PCR, ELISA and the gelatin zymography methods. Expression of NF-kappaB target genes was quantified using real-time PCR. NF-kappaB transcriptional activity was assessed using an NF-kappaB luciferase reporter system. Expression of Bmi-1 and MMP-9 in clinical specimens was analyzed using immunohistochemical assay. Results Ectopic overexpression of Bmi-1 dramatically increased, whereas knockdown of endogenous Bmi-1 reduced, the invasiveness and migration of glioma cells. NF-kappaB transcriptional activity and MMP-9 expression and activity were significantly increased in Bmi-1-overexpressing but reduced in Bmi-1-silenced cells. The reporter luciferase activity driven by MMP-9 promoter in Bmi-1-overexpressing cells was dependent on the presence of a functional NF-kappaB binding site, and blockade of NF-kappaB signaling inhibited the upregulation of MMP-9 in Bmi-1 overexpressing cells. Furthermore, expression of Bmi-1 correlated with NF-kappaB nuclear translocation as well as MMP-9 expression in clinical glioma samples. Conclusions Bmi-1 may play an important role in the development of aggressive phenotype of glioma via activating the NF
Genetic Influences on Growth Traits of BMI
DEFF Research Database (Denmark)
Hjelmborg, Jacob V B; Fagnani, Corrado; Silventoinen, Karri
2008-01-01
Objective:To investigate the interplay between genetic factors influencing baseline level and changes in BMI in adulthood.Methods and Procedures:A longitudinal twin study of the cohort of Finnish twins (N = 10,556 twin individuals) aged 20-46 years at baseline was conducted and followed up 15 years....... Data on weight and height were obtained from mailed surveys in 1975, 1981, and 1990.Results:Latent growth models revealed a substantial genetic influence on BMI level at baseline in males and females (heritability (h(2)) 80% (95% confidence interval 0.79-0.80) for males and h(2) = 82% (0.81, 0.......84) for females) and a moderate-to-high influence on rate of change in BMI (h(2) = 58% (0.50, 0.69) for males and h(2) = 64% (0.58, 0.69) for females). Only very weak evidence for genetic pleiotropy was observed; the genetic correlation between baseline and rate of change in BMI was very modest (-0.070 (-0.13, -0...
Beyens, Ine; Vandenbosch, Laura; Eggermont, Steven
2015-01-01
Research has demonstrated that adolescents regularly use Internet pornography. This two-wave panel study aimed to test an integrative model in early adolescent boys (M[subscript age] = 14.10; N = 325) that (a) explains their exposure to Internet pornography by looking at relationships with pubertal timing and sensation seeking, and (b) explores…
van Dongen, Jenny; Willemsen, Gonneke; Heijmans, Bastiaan T.; Neuteboom, Jacoline; Kluft, Cornelis; Jansen, Rick; Penninx, Brenda W.J.; Slagboom, P. Eline; de Geus, Eco J.C.; Boomsma, Dorret I.
2015-01-01
Background BMI discordant monozygotic (MZ) twins allows an examination of the causes and consequences of adiposity in a genetically controlled design. Few studies have examined longitudinal BMI discordance in MZ pairs. Objectives To study the development over time of BMI discordance in adolescent and adult MZ twin pairs, and to examine lifestyle, metabolic, inflammatory, and gene expression differences associated with concurrent and long-term BMI discordance in MZ pairs. Subjects/Methods BMI data from 2775 MZ twin pairs, collected in eight longitudinal surveys and a biobank project between 1991 and 2011, were analyzed to characterize longitudinal discordance. Lifestyle characteristics were compared within discordant pairs (ΔBMI ≥ 3 kg/m2) and biomarkers (lipids, glucose, insulin, CRP, fibrinogen, IL-6, TNF-α and sIL-6R and liver enzymes AST, ALT and GGT) and gene expression were compared in peripheral blood from discordant pairs who participated in the NTR biobank project. Results The prevalence of discordance ranged from 3.2% in 1991 (mean age=17, SD=2.4) to 17.4% (N=202 pairs) in 2009 (mean age=35, SD=15), and was 16.5% (N=174) among pairs participating in the biobank project (mean age=35, SD=12). Of 699 MZ with BMI data from 3-5 time points, 17 pairs (2.4%) were long-term discordant (at all available time points; mean follow-up range=6.4 years). Concurrently discordant pairs showed significant differences in self-ratings of which twin eats most (p=2.3×10−13), but not in leisure time exercise activity (p=0.28) and smoking (p>0.05). Ten out of 14 biomarkers showed significantly more unfavorable levels in the heavier of twin of the discordant pairs (p-values BMI discordance is uncommon in adolescent identical pairs but increases with higher pair-mean of BMI at older ages, although long-term BMI discordance is rare. In discordant pairs, the heavier twin had a more unfavorable blood biomarker profile than the genetically matched leaner twin, in support of
Silva, A L; Detmann, E; Dijkstra, J; Pedroso, A M; Silva, L H P; Machado, A F; Sousa, F C; Dos Santos, G B; Marcondes, M I
2018-04-04
The objective of this study was to evaluate the influence of different amounts of rumen-undegradable protein (RUP) on intake, N balance, performance, mammary gland development, carcass traits, and hormonal status of Holstein heifers at different physiological stages (PS). Sixteen prepubertal (PRE) heifers (initial BW = 106 ± 7.6 kg; age = 4.3 ± 0.46 mo) and 16 pubertal (PUB) heifers (initial BW = 224 ± 7.9 kg; age = 12.6 ± 0.45 mo) were used in an experiment over a period of 84 d. Four diets with increasing RUP contents (38, 44, 51, and 57% of dietary crude protein) and heifers at 2 PS (PRE or PUB) were used in a 4 × 2 factorial arrangement of treatments in a completely randomized design. Throughout the experiment, 2 digestibility trials were performed over 5 consecutive days (starting at d 36 and 78) involving feed and ort sampling and spot collections of feces and urine. At d 0 and 83, body ultrasound images were obtained for real-time carcass trait evaluation. The mammary gland was ultrasonically scanned at d 0 and every 3 wk during the experiment. Blood samples were taken at d 0 and 84 to determine serum concentrations of progesterone, estrogen, insulin-like growth factor I (IGF-I), and insulin. No interaction between PS and the level of RUP was found for any trait. Apparent digestibility of dry matter, organic matter, and neutral detergent fiber corrected for ash and protein was not affected by RUP level but was lower for PRE compared with PUB heifers. Sorting against neutral detergent fiber corrected for ash and protein (tendency only) and for crude protein was greater for PUB than PRE heifers. Pubertal heifers had greater average daily gain (905 vs. 505 g/d) and N retention (25.9 vs. 12.5 g/d) than PRE heifers. In addition, average daily gain and N retention were greatest at 51% RUP of dietary protein. Mammary ultrasonography indicated no effects of RUP amounts on mammary gland composition, whereas PRE heifers had greater pixel values than PUB
Socioeconomic differences in childhood BMI trajectories in Belarus.
Patel, Rita; Tilling, Kate; Lawlor, Debbie A; Howe, Laura D; Hughes, Rachael A; Bogdanovich, Natalia; Matush, Lidia; Nicoli, Emily; Oken, Emily; Kramer, Michael S; Martin, Richard M
2018-02-28
To examine associations of parental socioeconomic position with early-life offspring body mass index (BMI) trajectories in a middle-income country. Overall, 12,385 Belarusian children born 1996-97 and enrolled in a randomised breastfeeding promotion trial at birth, with 3-14 measurements of BMI from birth to 7 years. Cohort analysis in which exposures were parental education (common secondary or less; advanced secondary or partial university; completed university) and occupation (manual; non-manual) at birth, and the outcome was BMI z-score trajectories estimated using multilevel linear spline models, controlling for trial arm, location, parental BMI, maternal smoking status and number of older siblings. Infants born to university-educated mothers were heavier at birth than those born to secondary school-educated mothers [by 0.13 BMI z-score units (95% confidence interval, CI: 0.07, 0.19) for girls and 0.11 (95% CI: 0.05, 0.17) for boys; equivalent for an infant of average birth length to 43 and 38 g, respectively]. Between the ages of 3-7 years children of the most educated mothers had larger BMI increases than children of the least educated mothers. At age 7 years, after controlling for trial arm and location, children of university-educated mothers had higher BMIs than those born to secondary school-educated mothers by 0.11 z-score (95% CI: 0.03, 0.19) among girls and 0.18 (95% CI: 0.1, 0.27) among boys, equivalent to differences in BMI for a child of average height of 0.19 and 0.26 kg/m 2 , respectively. After further controlling for parental BMI, these differences attenuated to 0.08 z-score (95% CI: 0, 0.16) and 0.16 z-score (95% CI: 0.07, 0.24), respectively, but changed very little after additional adjustment for number of older siblings and mother's smoking status. Associations were similar when based on paternal educational attainment and highest household occupation. In Belarus, consistent with some middle-income countries, higher socioeconomic
Prospective associations between sedentary lifestyle and BMI in midlife.
Mortensen, Laust H; Siegler, Ilene C; Barefoot, John C; Grønbaek, Morten; Sørensen, Thorkild I A
2006-08-01
A strong positive cross-sectional relationship between BMI and a sedentary lifestyle has been consistently observed in numerous studies. However, it has been questioned whether high BMI is a determinant or a consequence of a sedentary lifestyle. Using data from four follow-ups of the University of North Carolina Alumni Heart Study, we examined the prospective associations between BMI and sedentary lifestyle in a cohort of 4595 middle-aged men and women who had responded to questionnaires at the ages of 41 (standard deviation 2.3), 44 (2.3), 46 (2.0), and 54 (2.0). BMI was consistently related to increased risk of becoming sedentary in both men and women. The odds ratios of becoming sedentary as predicted by BMI were 1.04 (95% confidence limits, 1.00, 1.07) per 1 kg/m(2) from ages 41 to 44, 1.10 (1.07, 1.14) from ages 44 to 46, and 1.12 (1.08, 1.17) from ages 46 to 54. Controlling for concurrent changes in BMI marginally attenuated the effects. Sedentary lifestyle did not predict changes in BMI, except when concurrent changes in physical activity were taken into account (p sedentary lifestyle but did not provide unambiguous evidence for an effect of sedentary lifestyle on weight gain.
Prediction of BMI by impulsivity, eating behavior and activity level
Directory of Open Access Journals (Sweden)
Jiang Xiaxia
2016-01-01
Full Text Available Objective: Discuss the relationship between the impulsivity, eating behavior and activity level and the body mass index (BMI. Method: Test 147 female college students with the impulsivity questionnaire (BIS-11 and BIS/BAS, Dutch Eating Behavior Questionnaire (DBEQ, Sitting Time Scale (STS and Exercising Time Scale (ETS. Results: (1 The correlation analysis indicates that BMI and impulsivity (r = 0.43 and 0.52 have a significant positive correlation with the sitting time (r = 0.61 and a significant negative correlation with the activity level (r= −0.49. (2 The path analysis indicates that the reward sensitivity directly affects BMI and indirectly affects BMI through the activity level as well; the eating behavior has an insignificantly direct impact on BMI, because its impact is generated by the intermediary role of induced diet. Conclusion: (1 The impulsivity, eating behavior and activity level are closely related to BMI; (2 the activity level, sitting time and induced diet play an intermediary role between the impulsivity and BMI.
The reliability of dental x-ray film in assessment of MP3 stages of the pubertal growth spurt.
Abdel-Kader, H M
1998-10-01
The main object of this clinical study is to provide a simple and practical method to assess the pubertal growth spurt stages of a subject by recording MP3 stages with the dental periapical radiograph and the standard dental x-ray machine.
Moore, Melisa; Kirchner, H Lester; Drotar, Dennis; Johnson, Nathan; Rosen, Carol; Redline, Susan
2011-03-01
Adolescents are predisposed to short sleep duration and irregular sleep patterns due to certain host characteristics (e.g., age, pubertal status, gender, ethnicity, socioeconomic class, and neighborhood distress) and health-related variables (e.g., ADHD, asthma, birth weight, and BMI). The aim of the current study was to investigate the relationship between such variables and actigraphic measures of sleep duration and variability. Cross-sectional study of 247 adolescents (48.5% female, 54.3% ethnic minority, mean age of 13.7years) involved in a larger community-based cohort study. Significant univariate predictors of sleep duration included gender, minority ethnicity, neighborhood distress, parent income, and BMI. In multivariate models, gender, minority status, and BMI were significantly associated with sleep duration (all pminority adolescents, and those of a lower BMI obtaining more sleep. Univariate models demonstrated that age, minority ethnicity, neighborhood distress, parent education, parent income, pubertal status, and BMI were significantly related to variability in total sleep time. In the multivariate model, age, minority status, and BMI were significantly related to variability in total sleep time (all pminority adolescents, and those of a lower BMI obtaining more regular sleep. These data show differences in sleep patterns in population sub-groups of adolescents which may be important in understanding pediatric health risk profiles. Sub-groups that may particularly benefit from interventions aimed at improving sleep patterns include boys, overweight, and minority adolescents. Copyright © 2011 Elsevier B.V. All rights reserved.
Difficulty buying food, BMI, and eating habits in young children.
Fuller, Anne; Maguire, Jonathon L; Carsley, Sarah; Chen, Yang; Lebovic, Gerald; Omand, Jessica; Parkin, Patricia; Birken, Catherine S
2018-01-22
To determine whether parent report of difficulty buying food was associated with child body mass index (BMI) z-score or with eating habits in young children. This was a cross-sectional study in primary care offices in Toronto, Ontario. Subjects were children aged 1-5 years and their caregivers, recruited through the TARGet Kids! Research Network from July 2008 to August 2011. Regression models were developed to test the association between parent report of difficulty buying food because of cost and the following outcomes: child BMI z-score, parent's report of child's intake of fruit and vegetables, fruit juice and sweetened beverages, and fast food. Confounders included child's age, sex, birth weight, maternal BMI, education, ethnicity, immigration status, and neighbourhood income. The study sample consisted of 3333 children. Data on difficulty buying food were available for 3099 children, and 431 of these (13.9%) were from households reporting difficulty buying food. There was no association with child BMI z-score (p = 0.86). Children from households reporting difficulty buying food (compared with never having difficulty buying food) had increased odds of consuming three or fewer servings of fruits and vegetables per day (odds ratio [OR]: 1.31, 95% confidence interval [CI]: 1.03-1.69), more than one serving of fruit juice/sweetened beverage per day (OR: 1.60, 95% CI: 1.28-2.00), and, among children 1-2 years old, one or more servings of fast food per week (OR: 2.91, 95% CI: 1.67-5.08). Parental report of difficulty buying food is associated with less optimal eating habits in children but not with BMI z-score.
Longitudinal association between marital disruption and child BMI and obesity.
Arkes, Jeremy
2012-08-01
This research examines whether family disruptions (i.e., divorces and separation) contribute to children's weight problems. The sample consists of 7,299 observations for 2,333 children, aged 5-14, over the 1986-2006 period, from a US representative sample from the Child and Young Adult Survey accompanying the National Longitudinal Survey of Youth (NLSY). The study uses individual-fixed-effects models in a longitudinal framework to compare children's BMI and weight problems before and after a disruption. Furthermore, besides doing a before-after comparison for children, the study also estimates the effects at various periods relative to the disruption in order to examine whether children are affected before the disruption and whether any effects change as time passes from the disruption, as some effects may be temporary or slow to develop. Despite having a larger sample than the previous studies, the results provide no evidence that, on average, children's BMI and BMI percentile scores (measured with continuous outcomes) are affected before the disruption, after the disruption, and as time passes from the disruption, relative to a baseline period a few years before the disruption. However, children experiencing a family disruption do have an increased risk of obesity (having a BMI percentile score of 95 or higher) in the two years leading up to the disruption as well as after the disruption, and as time passes from the disruption.
Is BMI a valid measure of obesity in postmenopausal women?
Banack, Hailey R; Wactawski-Wende, Jean; Hovey, Kathleen M; Stokes, Andrew
2018-03-01
Body mass index (BMI) is a widely used indicator of obesity status in clinical settings and population health research. However, there are concerns about the validity of BMI as a measure of obesity in postmenopausal women. Unlike BMI, which is an indirect measure of obesity and does not distinguish lean from fat mass, dual-energy x-ray absorptiometry (DXA) provides a direct measure of body fat and is considered a gold standard of adiposity measurement. The goal of this study is to examine the validity of using BMI to identify obesity in postmenopausal women relative to total body fat percent measured by DXA scan. Data from 1,329 postmenopausal women participating in the Buffalo OsteoPerio Study were used in this analysis. At baseline, women ranged in age from 53 to 85 years. Obesity was defined as BMI ≥ 30 kg/m and body fat percent (BF%) greater than 35%, 38%, or 40%. We calculated sensitivity, specificity, positive predictive value, and negative predictive value to evaluate the validity of BMI-defined obesity relative BF%. We further explored the validity of BMI relative to BF% using graphical tools, such as scatterplots and receiver-operating characteristic curves. Youden's J index was used to determine the empirical optimal BMI cut-point for each level of BF% defined obesity. The sensitivity of BMI-defined obesity was 32.4% for 35% body fat, 44.6% for 38% body fat, and 55.2% for 40% body fat. Corresponding specificity values were 99.3%, 97.1%, and 94.6%, respectively. The empirical optimal BMI cut-point to define obesity is 24.9 kg/m for 35% BF, 26.49 kg/m for 38% BF, and 27.05 kg/m for 40% BF according to the Youden's index. Results demonstrate that a BMI cut-point of 30 kg/m does not appear to be an appropriate indicator of true obesity status in postmenopausal women. Empirical estimates of the validity of BMI from this study may be used by other investigators to account for BMI-related misclassification in older women.
Bmi-1 Regulates Extensive Erythroid Self-Renewal
Directory of Open Access Journals (Sweden)
Ah Ram Kim
2015-06-01
Full Text Available Red blood cells (RBCs, responsible for oxygen delivery and carbon dioxide exchange, are essential for our well-being. Alternative RBC sources are needed to meet the increased demand for RBC transfusions projected to occur as our population ages. We previously have discovered that erythroblasts derived from the early mouse embryo can self-renew extensively ex vivo for many months. To better understand the mechanisms regulating extensive erythroid self-renewal, global gene expression data sets from self-renewing and differentiating erythroblasts were analyzed and revealed the differential expression of Bmi-1. Bmi-1 overexpression conferred extensive self-renewal capacity upon adult bone-marrow-derived self-renewing erythroblasts, which normally have limited proliferative potential. Importantly, Bmi-1 transduction did not interfere with the ability of extensively self-renewing erythroblasts (ESREs to terminally mature either in vitro or in vivo. Bmi-1-induced ESREs can serve to generate in vitro models of erythroid-intrinsic disorders and ultimately may serve as a source of cultured RBCs for transfusion therapy.
Vegetable and Fruit Intakes Are Associated with hs-CRP Levels in Pre-Pubertal Girls
Directory of Open Access Journals (Sweden)
Pilar Navarro
2017-03-01
Full Text Available The influence of diet on inflammation in children remains unclear. We aimed to analyze the influence of diet on high-sensitivity C-reactive protein (hs-CRP levels in a pre-pubertal population free of other influences that may affect hs-CRP levels. We determined hs-CRP levels in 571 six- to eight-year-old children using an hs-CRP ELISA kit. Information on food and nutrient intake was obtained through a food-frequency questionnaire. Overall dietary quality was assessed using the Healthy Eating Index (HEI. We found that girls in the highest tertile of hs-CRP levels had a higher intake of saturated fatty acid, and lower intakes of fiber and vitamin E and a lower HEI score when compared to those in tertiles 1 and 2. We also observed a significant decrease in fruit and vegetable intakes by hs-CRP tertile. Factor analysis showed that a dietary pattern that was loaded most strongly with vegetable, fruit, fiber and vitamin A and E intakes correlated negatively (−0.132, p < 0.05 with hs-CRP. No such association was found in boys. In conclusion, our data show that girls with a poorer quality diet show higher hs-CRP levels already at a pre-pubertal age.
Calzo, Jerel P; Sonneville, Kendrin R; Haines, Jess; Blood, Emily A; Field, Alison E; Austin, S Bryn
2012-11-01
To examine how the associations among body mass index (BMI) and body dissatisfaction and weight and shape concern evolve from late childhood through late adolescence in boys and girls. We analyze data from subjects aged 9-18 years from the Growing Up Today Study, a national prospective cohort of U.S. youth (n = 16,882, yielding 59,750 repeated-measures observations during five waves of data collection). Generalized additive models produced curves of association for body dissatisfaction and weight concern across BMI percentiles. Generalized estimating equations (adjusting for correlated within-subject repeated measures, sibling clusters, pubertal maturation, and region of residence) tested main and interactive effects of BMI, age, and gender. Girls above the 50th BMI percentile reported greater body dissatisfaction than girls below the 50th percentile. By contrast, boys who reported the most body dissatisfaction were either above the 75th BMI percentile (approaching overweight) or below the 10th percentile (approaching underweight). Body dissatisfaction increased with age for both girls and boys, but the gender-specific patterns of BMI effects remained constant. Male and female participants in the overweight/obese BMI range reported the greatest weight concern, but among older adolescents (particularly girls), healthy weight became increasingly associated with greater weight and shape concern. Body dissatisfaction and weight and shape concern intensify across adolescence, but associations between the constructs and BMI remain gender specific. Findings have important implications for eating disorder risk assessment and prevention. Copyright © 2012 Society for Adolescent Health and Medicine. Published by Elsevier Inc. All rights reserved.
Trends in BMI of urban Australian adults, 1980-2000
DEFF Research Database (Denmark)
Walls, Helen L; Wolfe, Rory; Haby, Michelle M
2010-01-01
of 7.4 kg/m2 at the higher end for women aged 55-64 years. While the prevalence of obesity (BMI >or= 30 kg/m2) doubled, the prevalence of obesity class III (BMI >or= 40 kg/m2) increased fourfold. CONCLUSIONS: BMI in urban Australian adults has increased and its distribution has become increasingly...... right-skewed. This has resulted in a large increase in the prevalence of obesity, particularly the more severe levels of obesity. It will be important to monitor changes in the different classes of obesity and the extent to which obesity interventions both shift the BMI distribution leftwards...
Directory of Open Access Journals (Sweden)
Morales-Ledesma Leticia
2012-10-01
Full Text Available Abstract In the adult rat, neural signals arriving to the ovary via the superior ovarian nerve (SON modulate progesterone (P4, testosterone (T and estradiol (E2 secretion. The aims of the present study were to analyze if the SON in the pre-pubertal rat also modulates ovarian hormone secretion and the release of follicle stimulating hormone (FSH and luteinizing (LH hormone. P4, T, E2, FSH and LH serum levels were measured 30 or 60 minutes after sectioning the SON of pre-pubertal female rats. Our results indicate that the effects on hormone levels resulting from unilaterally or bilaterally sectioning the SON depends on the analyzed hormone, and the time lapse between surgery and autopsy, and that the treatment yielded asymmetric results. The results also suggest that in the pre-pubertal rat the neural signals arriving to the ovaries via the SON regulate the enzymes participating in P4, T and E2 synthesis in a non-parallel way, indicating that the mechanisms regulating the synthesis of each hormone are not regulated by the same signals. Also, that the changes in the steroids hormones are not explained exclusively by the modifications in gonadotropins secretion. The observed differences in hormone levels between rats sacrificed 30 and 60 min after surgery reflect the onset of the compensatory systems regulating hormones secretion.
Ozkuvanci, Ünsal; Ziylan, Orhan; Dönmez, M Irfan; Yucel, Omer Baris; Oktar, Tayfun; Ander, Haluk; Nane, Ismet
2017-01-01
The aim of this study is to analyze post pubertal results of pre pubertal tunica albuginea plication with non-absorbable sutures in the correction of CPC. The files of patients who underwent tunica albuginea plication without incision (dorsal/lateral) were retrospectively reviewed. Patients younger than 13 years of age at the time of operation and older than 14 years of age in November 2015 were included. Patients with a penile curvature of less than 30 degrees & more than 45 degrees and penile/urethral anomalies were excluded. All of the patients underwent surgery followed by circumcision. The mean age of patients at the time of the operation was 9.7 years (range, 6-13 years). The mean degree of ventral penile curvature measured during the operation was 39 degrees while it was 41 degrees in the lateral curvatures. All of the patients were curvature-free at the end of the operation. At the time of the follow-up examination, the mean age was 16.7 years (range, 14-25 years). Six patients had a straight (0-10 degrees) penis during erection and seven patients had recurrent penile curvatures ranging from 30 to 50 degrees. Pre pubertal tunica albuginea plication of congenital penile curvature (30-45 degrees) with non-absorbable sutures performed without incision is a minimal invasive method especially when performed during circumcision. However, recurrence might be observed in half of the patients after puberty. Copyright® by the International Brazilian Journal of Urology.
Directory of Open Access Journals (Sweden)
Ünsal Ozkuvanci
Full Text Available ABSTRACT Objective: The aim of this study is to analyze post pubertal results of pre pubertal tunica albuginea plication with non-absorbable sutures in the correction of CPC. Materials and Methods: The files of patients who underwent tunica albuginea plication without incision (dorsal/lateral were retrospectively reviewed. Patients younger than 13 years of age at the time of operation and older than 14 years of age in November 2015 were included. Patients with a penile curvature of less than 30 degrees & more than 45 degrees and penile/urethral anomalies were excluded. All of the patients underwent surgery followed by circumcision. Results: The mean age of patients at the time of the operation was 9.7 years (range, 6-13 years. The mean degree of ventral penile curvature measured during the operation was 39 degrees while it was 41 degrees in the lateral curvatures. All of the patients were curvature-free at the end of the operation. At the time of the follow-up examination, the mean age was 16.7 years (range, 14-25 years. Six patients had a straight (0-10 degrees penis during erection and seven patients had recurrent penile curvatures ranging from 30 to 50 degrees. Conclusion: Pre pubertal tunica albuginea plication of congenital penile curvature (30-45 degrees with non-absorbable sutures performed without incision is a minimal invasive method especially when performed during circumcision. However, recurrence might be observed in half of the patients after puberty.
Hubley, Anita M.; Arim, Rubab G.
2012-01-01
Subjective age generally refers to the age that one feels. In a cross-sectional questionnaire study of 245 adolescents ages 10-14 years, we examined (a) whether, and when, a cross-over in subjective age occurs, (b) differences in subjective age among pubertal timing groups, (c) correlations between subjective age and each of desired age and five…
The decline in BMI among Japanese women after World War II.
Maruyama, Shiko; Nakamura, Sayaka
2015-07-01
The body mass index (BMI) of the Japanese is significantly lower than is found in other high-income countries. Moreover, the average BMI of Japanese women is lower than that of Japanese men, and the age-specific BMI of Japanese women has decreased over time. The average BMI of Japanese women at age 25 decreased from 21.8 in 1948 to 20.4 in 2010 whereas that of men increased from 21.4 to 22.3 over the same period. We examine the long-term BMI trend in Japan by combining several historical data sources spanning eleven decades, from 1901 to 2012, to determine not only when but also how the BMI decline among women began: whether its inception was period-specific or cohort-specific. Our nonparametric regression analysis generated five findings. First, the BMI of Japanese women peaked with the 1930s birth cohort. This means that the trend is cohort-specific. Second, the BMI of men outpaced that of women in the next cohort. Third, the BMI of Japanese children, boys and girls alike, increased steadily throughout the 20th century. Fourth, the gender difference in the BMI trend is due to a gender difference in the weight trend, not the height trend. Fifth, these BMI trends are observed in urban and rural populations alike. We conclude that the BMI decline among Japanese women began with those who were in their late teens shortly after World War II. Copyright © 2015 Elsevier B.V. All rights reserved.
Suisman, Jessica L; Thompson, J Kevin; Keel, Pamela K; Burt, S Alexandra; Neale, Michael; Boker, Steven; Sisk, Cheryl; Klump, Kelly L
2014-11-01
Mean-levels of thin-ideal internalization increase during adolescence and pubertal development, but it is unknown whether these phenotypic changes correspond to developmental changes in etiological (i.e., genetic and environmental) risk. Given the limited knowledge on risk for thin-ideal internalization, research is needed to guide the identification of specific types of risk factors during critical developmental periods. The present twin study examined genetic and environmental influences on thin-ideal internalization across adolescent and pubertal development. Participants were 1,064 female twins (ages 8-25 years) from the Michigan State University Twin Registry. Thin-ideal internalization and pubertal development were assessed using self-report questionnaires. Twin moderation models were used to examine if age and/or pubertal development moderate genetic and environmental influences on thin-ideal internalization. Phenotypic analyses indicated significant increases in thin-ideal internalization across age and pubertal development. Twin models suggested no significant differences in etiologic effects across development. Nonshared environmental influences were most important in the etiology of thin-ideal internalization, with genetic, shared environmental, and nonshared environmental accounting for approximately 8%, 15%, and 72%, respectively, of the total variance. Despite mean-level increases in thin-ideal internalization across development, the relative influence of genetic versus environmental risk did not differ significantly across age or pubertal groups. The majority of variance in thin-ideal internalization was accounted for by environmental factors, suggesting that mean-level increases in thin-ideal internalization may reflect increases in the magnitude/strength of environmental risk across this period. Replication is needed, particularly with longitudinal designs that assess thin-ideal internalization across key developmental phases. © 2014 Wiley
Are BMI and Sedentariness Correlated? A Multilevel Study in Children
Directory of Open Access Journals (Sweden)
Thayse Natacha Gomes
2015-07-01
Full Text Available The purpose of this research was to investigate the relationship between body mass index (BMI and sedentariness (Sed in children and to examine the influence of child and school correlates on their variation. The sample comprises 580 children (337 girls, 9–11 years. Sedentariness was assessed with an accelerometer, and BMI was computed. Child- and school-level covariates were analyzed using multilevel models. No significant correlation between Sed and BMI was found. School context explains 5% and 1.5% of the total variance in Sed and BMI, respectively. At the child level, only moderate-to-vigorous physical activity was associated with both Sed (β = −0.02 ± 0.002 and BMI (β = −0.005 ± 0.002. Sleep time is related to Sed (β = −0.42 ± 0.04, while sex (β = 1.97 ± 0.13, biological maturity (β = 1.25 ± 0.07, media in the bedroom (β = 0.26 ± 0.08 and healthy (β = −0.09 ± 0.03 and unhealthy (β = −0.07 ± 0.04 diet scores were associated with BMI. None of the school-level covariates were related to BMI, but access to cafeteria (β = −0.97 ± 0.25, playground equipment (β = −0.67 ± 0.20 and restaurants (β = 0.16 ± 0.08 were related to Sed. In conclusion, Sed and BMI were not correlated. Further, they have different correlates, while children’s traits seem to play more relevant roles in their differences in Sed and BMI than the school milieu. This information should be taken into account when strategies to reduce Sed and BMI are implemented.
BMI at birth and overweight at age four.
Winter, Jonathan D; Taylor, Yhenneko; Mowrer, Lauren; Winter, Katherine M; Dulin, Michael F
Extensive investigation has established that an elevated weight at birth is associated with subsequent obesity and obesity related negative health outcomes. The significance of overweight at birth, however, remains ill-defined. Historically, it has been difficult to approximate adiposity in infancy in a way that is both simple and meaningful. Body-mass-index (BMI) growth charts for children younger than two years of age only became available in 2006 when published by the WHO. This retrospective cohort analysis utilised anthropometric data extracted from the electronic medical record of a large integrated healthcare system in North Carolina. BMI and weight-for-age (WFA) >85% of WHO growth charts measured newborn overweight and macrosomia respectively. Logistic regression models assessed the associations between newborn macrosomia and overweight and overweight at 4 years of age, as well as associations with maternal BMI. Models included demographic data, gestational age, and maternal diabetes status as covariates. Both BMI and WFA >85% at birth were significantly associated with overweight at age 4 years. However, the greater odds of overweight was associated with newborn BMI >85%, with an adjusted odds ratio (AOR) of 2.08 (95% confidence interval [CI]: 1.4-3.08) versus 1.57 (95% CI: 1.08-2.27). Maternal obesity was also more robustly correlated with newborn BMI >85%, AOR of 4.14 (95% CI: 1.6-10.7), than with newborn WFA >85%, AOR of 3.09 (95% CI: 1.41-6.77). BMI >85% at birth is independently associated with overweight at 4 years. Newborn overweight is perhaps superior to newborn macrosomia in predicting overweight at age 4. Copyright © 2016 Asia Oceania Association for the Study of Obesity. Published by Elsevier Ltd. All rights reserved.
Bmi-1: At the crossroads of physiological and pathological biology
Bhattacharya, Resham; Mustafi, Soumyajit Banerjee; Street, Mark; Dey, Anindya; Dwivedi, Shailendra Kumar Dhar
2015-01-01
Bmi-1 is a member of the Polycomb Repressor Complex1 that mediates gene silencing by regulating chromatin structure and is indispensable for self-renewal of both normal and cancer stem cells. Despite three decades of research that have elucidated the transcriptional regulation, post-translational modifications and functions of Bmi-1 in regulating the DNA damage response, cellular bioenergetics, and pathologies, the entire potential of a protein with such varied function remains to be realized. This review attempts to synthesize the current knowledge on Bmi-1 with an emphasis on its role in both normal physiology and cancer. Additionally, since cancer stem cells are emerging as a new paradigm for therapy resistance, the role of Bmi-1 in this perspective is also highlighted. The wide spectrum of malignancies that implicate Bmi-1 as a signature for stemness and oncogenesis also make it a suitable candidate for therapy. Nonetheless new approaches are vitally needed to further characterize physiological roles of Bmi-1 with the long-term goal of using Bmi-1 as a prognostic marker and a therapeutic target. PMID:26448339
Yusuff, Shamila; Davis, Stephani; Flaherty, Kathleen; Huselid, Eric; Patrizii, Michele; Jones, Daniel; Cao, Liangxian; Sydorenko, Nadiya; Moon, Young-Choon; Zhong, Hua; Medina, Daniel J.; Kerrigan, John; Stein, Mark N.; Kim, Isaac Y.; Davis, Thomas W.; DiPaola, Robert S.; Bertino, Joseph R.; Sabaawy, Hatem E.
2016-01-01
Purpose Current prostate cancer (PCa) management calls for identifying novel and more effective therapies. Self-renewing tumor-initiating cells (TICs) hold intrinsic therapy-resistance and account for tumor relapse and progression. As BMI-1 regulates stem cell self-renewal, impairing BMI-1 function for TICs-tailored therapies appears to be a promising approach. Experimental design We have previously developed a combined immunophenotypic and time-of-adherence assay to identify CD49bhiCD29hiCD44hi cells as human prostate TICs. We utilized this assay with patient derived prostate cancer cells and xenograft models to characterize the effects of pharmacological inhibitors of BMI-1. Results We demonstrate that in cell lines and patient-derived TICs, BMI-1 expression is upregulated and associated with stem cell-like traits. From a screened library, we identified a number of post-transcriptional small molecules that target BMI-1 in prostate TICs. Pharmacological inhibition of BMI-1 in patient-derived cells significantly decreased colony formation in vitro and attenuated tumor initiation in vivo, thereby functionally diminishing the frequency of TICs, particularly in cells resistant to proliferation- and androgen receptor (AR)-directed therapies, without toxic effects on normal tissues. Conclusions Our data offer a paradigm for targeting TICs and support the development of BMI-1-targeting therapy for a more effective PCa treatment. PMID:27307599
Balasubramanian, Sivaprakasam; Scharadin, Tiffany M.; Han, Bingshe; Xu, Wen; Eckert, Richard L.
2016-01-01
The Bmi-1 Polycomb group (PcG) protein is an important epigenetic regulator of chromatin status. Elevated Bmi-1 expression is observed in skin cancer and contributes to cancer cell survival. (–) Epigallocatechin-3-gallate (EGCG), an important green tea-derived cancer prevention agent, reduces Bmi-1 level resulting in reduced skin cancer cell survival. This is associated with increased p21Cip1 and p27Kip1 expression, reduced cyclin, and cyclin dependent kinase expression, and increased cleavage of apoptotic markers. These EGCG-dependent changes are attenuated by vector-mediated maintenance of Bmi-1 expression. In the present study, we identify Bmi-1 functional domains that are required for this response. Bmi-1 expression reverses the EGCG-dependent reduction in SCC-13 cell survival, but Bmi-1 mutants lacking the helix–turn–helix–turn–helix–turn (Bmi-1ΔHT) or ring finger (Bmi-1ΔRF) domains do not reverse the EGCG impact. The reduction in Ring1B ubiquitin ligase activity, observed in the presence of mutant Bmi-1, is associated with reduced ability of these mutants to interact with and activate Ring1B ubiquitin ligase, the major ligase responsible for the ubiquitination of histone H2A during chromatin condensation. This results in less chromatin condensation leading to increased tumor suppressor gene expression and reduced cell survival; thereby making the cells more susceptible to the anti-survival action of EGCG. We further show that these mutants act in a dominant-negative manner to inhibit the action of endogenous Bmi-1. Our results suggest that the HT and RF domains are required for Bmi-1 ability to maintain skin cancer cell survival in response to cancer preventive agents. PMID:25843776
Education modifies genetic and environmental influences on BMI
DEFF Research Database (Denmark)
Johnson, Wendy; Kyvik, Kirsten Ohm; Skytthe, Axel
2011-01-01
environmental correlations between education and BMI differed by level of education, analyzing women and men separately. Correlations between education and BMI were -.13 in women, -.15 in men. High BMI's were less frequent among well-educated participants, generating less variance. In women, this was due...... to restriction of all forms of variance, overall by a factor of about 2. In men, genetic variance did not vary with education, but results for shared and nonshared environmental variance were similar to those for women. The contributions of the shared environment to the correlations between education and BMI......Obesity is more common among the less educated, suggesting education-related environmental triggers. Such triggers may act differently dependent on genetic and environmental predisposition to obesity. In a Danish Twin Registry survey, 21,522 twins of same-sex pairs provided zygosity, height, weight...
BMI trajectory groups in veterans of the Iraq and Afghanistan wars.
Rosenberger, Patricia H; Ning, Yuming; Brandt, Cynthia; Allore, Heather; Haskell, Sally
2011-09-01
The study sought to determine BMI trajectories in Iraq/Afghanistan veterans over 6 years and to examine sociodemographic factors associated with BMI trajectory membership. Our study sample included 16,656 veterans post-deployment and entering the Veteran Healthcare Administration (VHA) healthcare system. We used national VHA administrative sociodemographic data, tracked veteran BMI for 6 years, and used trajectory modeling to identify BMI trajectories and sociodemographic characteristics associated with trajectory membership. Five trajectory groups determined in the full sample were primarily differentiated by their post-deployment initial BMI: "healthy" (14.1%), "overweight" (36.3%), "borderline obese" (27.9%), "obese" (15.7%), and "severely obese" (6.0). Being female, younger, and white were associated with lower initial BMI trajectory group membership (p'seducation and white female Veterans were associated with the lowest initial BMI group (p'sEducation level and racial status are differentially related to BMI trajectory by gender. Published by Elsevier Inc.
Timing of Puberty in Overweight Versus Obese Boys.
Lee, Joyce M; Wasserman, Richard; Kaciroti, Niko; Gebremariam, Achamyeleh; Steffes, Jennifer; Dowshen, Steven; Harris, Donna; Serwint, Janet; Abney, Dianna; Smitherman, Lynn; Reiter, Edward; Herman-Giddens, Marcia E
2016-02-01
Studies of the relationship of weight status with timing of puberty in boys have been mixed. This study examined whether overweight and obesity are associated with differences in the timing of puberty in US boys. We reanalyzed recent community-based pubertal data from the American Academy of Pediatrics' Pediatric Research in Office Settings study in which trained clinicians assessed boys 6 to 16 years for height, weight, Tanner stages, testicular volume (TV), and other pubertal variables. We classified children based on BMI as normal weight, overweight, or obese and compared median age at a given Tanner stage or greater by weight class using probit and ordinal probit models and a Bayesian approach. Half of boys (49.9%, n = 1931) were white, 25.8% (n = 1000) were African American, and 24.3% (n = 941) were Hispanic. For genital development in white and African American boys across a variety of Tanner stages, we found earlier puberty in overweight compared with normal weight boys, and later puberty in obese compared with overweight, but no significant differences for Hispanics. For TV (≥3 mL or ≥4 mL), our findings support earlier puberty for overweight compared with normal weight white boys. In a large, racially diverse, community-based sample of US boys, we found evidence of earlier puberty for overweight compared with normal or obese, and later puberty for obese boys compared with normal and overweight boys. Additional studies are needed to understand the possible relationships among race/ethnicity, gender, BMI, and the timing of pubertal development. Copyright © 2016 by the American Academy of Pediatrics.
A BMI-based occupational therapy assist suit: asynchronous control by SSVEP.
Sakurada, Takeshi; Kawase, Toshihiro; Takano, Kouji; Komatsu, Tomoaki; Kansaku, Kenji
2013-01-01
A brain-machine interface (BMI) is an interface technology that uses neurophysiological signals from the brain to control external machines. Recent invasive BMI technologies have succeeded in the asynchronous control of robot arms for a useful series of actions, such as reaching and grasping. In this study, we developed non-invasive BMI technologies aiming to make such useful movements using the subject's own hands by preparing a BMI-based occupational therapy assist suit (BOTAS). We prepared a pre-recorded series of useful actions-a grasping-a-ball movement and a carrying-the-ball movement-and added asynchronous control using steady-state visual evoked potential (SSVEP) signals. A SSVEP signal was used to trigger the grasping-a-ball movement and another SSVEP signal was used to trigger the carrying-the-ball movement. A support vector machine was used to classify EEG signals recorded from the visual cortex (Oz) in real time. Untrained, able-bodied participants (n = 12) operated the system successfully. Classification accuracy and time required for SSVEP detection were ~88% and 3 s, respectively. We further recruited three patients with upper cervical spinal cord injuries (SCIs); they also succeeded in operating the system without training. These data suggest that our BOTAS system is potentially useful in terms of rehabilitation of patients with upper limb disabilities.
Benson, Rebecca; von Hippel, Paul T; Lynch, Jamie L
2017-03-21
More educated adults have lower average body mass index (BMI). This may be due to selection, if adolescents with lower BMI attain higher levels of education, or it may be due to causation, if higher educational attainment reduces BMI gain in adulthood. We test for selection and causation in the National Longitudinal Survey of Youth 1979, which has followed a representative US cohort from age 14-22 in 1979 through age 47-55 in 2012. Using ordinal logistic regression, we test the selection hypothesis that overweight and obese adolescents were less likely to earn high school diplomas and bachelor's degrees. Then, controlling for selection with individual fixed effects, we estimate the causal effect of degree completion on BMI and obesity status. Among 18-year-old women, but not among men, being overweight or obese predicts lower odds of attaining higher levels of education. At age 47-48, higher education is associated with lower BMI, but 70-90% of the association is due to selection. Net of selection, a bachelor's degree predicts less than a 1 kg reduction in body weight, and a high school credential does not reduce BMI. Copyright © 2017 Elsevier Ltd. All rights reserved.
Duchesne, A; Liu, A; Jones, S L; Laplante, D P; King, S
2017-04-01
Early pubertal timing is known to put women at greater risk for adverse physiological and psychological health outcomes. Of the factors that influence girls' pubertal timing, stress experienced during childhood has been found to advance age at menarche (AAM). However, it is not known if stress experienced by mothers during or in the months before conception can be similarly associated with earlier pubertal timing. Prenatal maternal stress (PNMS) is associated with metabolic changes, such as increased childhood adiposity and risk of obesity, that have been associated with earlier menarchal age. Using a prospective longitudinal design, the present study tested whether PNMS induced by a natural disaster is either directly associated with earlier AAM, or whether there is an indirect association mediated through increased girls' body mass index (BMI) during childhood. A total of 31 girls, whose mothers were exposed to the Quebec's January 1998 ice storm during pregnancy were followed from 6 months to 5 1/2 to 5.5 years of age. Mother's stress was measured within 6 months of the storm. BMI was measured at 5.5 years, and AAM was assessed through teen's self-report at 13.5 and 15.5 years of age. Results revealed that greater BMI at 5.5 years mediated the effect of PNMS on decreasing AAM [B=-0.059, 95% confidence intervals (-0.18, -0.0035)]. The present study is the first to demonstrate that maternal experience of stressful conditions during pregnancy reduces AAM in the offspring through its effects on childhood BMI. Future research should consider the impact of AAM on other measures of reproductive ability.
Soekadar, Surjo R; Witkowski, Matthias; Mellinger, Jürgen; Ramos, Ander; Birbaumer, Niels; Cohen, Leonardo G
2011-10-01
Event-related desynchronization (ERD) of sensori-motor rhythms (SMR) can be used for online brain-machine interface (BMI) control, but yields challenges related to the stability of ERD and feedback strategy to optimize BMI learning.Here, we compared two approaches to this challenge in 20 right-handed healthy subjects (HS, five sessions each, S1-S5) and four stroke patients (SP, 15 sessions each, S1-S15). ERD was recorded from a 275-sensor MEG system. During daily training,motor imagery-induced ERD led to visual and proprioceptive feedback delivered through an orthotic device attached to the subjects' hand and fingers. Group A trained with a heterogeneous reference value (RV) for ERD detection with binary feedback and Group B with a homogenous RV and graded feedback (10 HS and 2 SP in each group). HS in Group B showed better BMI performance than Group A (p learning was significantly better (p learning relative to use of a heterogeneous RV and binary feedback.
Directory of Open Access Journals (Sweden)
Chhaya Verma, Lakshmi Subramanium, Vijaya Krishnan
2015-01-01
Full Text Available Background: Plyometric involve high intensity eccentric contraction immediately after a powerful concentric contraction. A vertical leap in basketball also involves rapid & repeated muscle contraction & stretching. Various methods have been used to improve the vertical leap in players, but only few studies mention about plyometrics. Aim: To determine the effect of Plyometric training on vertical jump height in high school basketball players & compare them with their untrained counterparts. Methods and Materials: 144 students were randomly selected & distributed in Group I (Pre-pubertal & Group II (Pubertal which was further divided into Group A (trained players & Group B (untrained students. A gender wise distribution followed this. Plyometric training of 6 weeks was conducted & the vertical jump height pre & post training were recorded & compared. Results: Vertical jump height improved significantly post Plyometric in Group Bcompared to Group A. Boys showed improvement in Group B, however girls were better in Group A. Correlation of BMI with vertical jump height was negative & significant in Group B. Conclusion: Plyometric training brought significant change in untrained students. Boys gained more jump height while girls showed significant increase in jump height during pubertal growth spurt. Also, increased BMI reduced jump height.
Wang, Jiang-Li; Wu, Jiang-Hong; Hong, Cai; Wang, Ya-Nong; Zhou, Ye; Long, Zi-Wen; Zhou, Ying; Qin, Hai-Shu
2017-12-01
This study was conducted in order to explore the role that Bmi-1 plays during the development of a gastrointestinal stromal tumor (GIST) by regulation of the p16 Ink4A and p14 ARF expressions. Eighty-six patients diagnosed with GIST were selected to take part in this experiment. The Bmi-1 protein expressions in GIST and adjacent normal tissues were detected using immunohistochemistry and further analyzed by using photodensitometry. To monitor and track the progression of the GIST, a 3-year follow-up was conducted for all affected patients. After cell transfection, the GIST cells were assigned into the control group (without transfection), the negative control (NC) group (transfected with Bmi-1-Scramble plasmid), and the Bmi-1 shRNA group (transfected with the pcDNA3.1-Bmi-1 shRNA plasmid). Protein and mRNA expressions collected from Bmi-1, p16 lnk4A , P14 ARF , cyclin D1, and CDK4 were measured using both the RT-qPCR and western blotting methods Cell senescence was assessed and obtained by using the β-Galactosidase (β-Gal) activity assay. The use of a Soft agar colony formation assay and CCK-8 assay were performed in order to detect the cell growth and subsequent proliferation. Cell invasion and migration were analyzed using the Transwell assay and scratch test. Bmi-1 in the GIST tissues was found to be significantly higher and the p16 lnk4A and P14 ARF expressions were lower than those in the adjacent normal tissues. Bmi-1 was negatively correlated with p16 lnk4A and P14 ARF expressions according to the correlation analysis. Bmi-1 expression was associated with the TNM stage, postoperative recurrence, metastasis, tumor size, and the 5-year survival rate. Area under ROC curve was calculated at 0.884, and sensitivity, specificity, and accuracy of Bmi-1 predicting the GIST were 67.44%, 97.67%, and 65.12%, respectively. Patients exhibiting a high Bmi-1 expression in the GIST tissues had lower survival rates than those with low Bmi-1 expression. In comparison with
Longitudinal Analysis of Genetic Susceptibility and BMI Throughout Adult Life.
Song, Mingyang; Zheng, Yan; Qi, Lu; Hu, Frank B; Chan, Andrew T; Giovannucci, Edward L
2018-02-01
Little is known about the genetic influence on BMI trajectory throughout adulthood. We created a genetic risk score (GRS) comprising 97 adult BMI-associated variants among 9,971 women and 6,405 men of European ancestry. Serial measures of BMI were assessed from 18 (women) or 21 (men) years to 85 years of age. We also examined BMI change in early (from 18 or 21 to 45 years of age), middle (from 45 to 65 years of age), and late adulthood (from 65 to 80 years of age). GRS was positively associated with BMI across all ages, with stronger associations in women than in men. The associations increased from early to middle adulthood, peaked at 45 years of age in men and at 60 years of age in women (0.91 and 1.35 kg/m 2 per 10-allele increment, respectively) and subsequently declined in late adulthood. For women, each 10-allele increment in the GRS was associated with an average BMI gain of 0.54 kg/m 2 in early adulthood, whereas no statistically significant association was found for BMI change in middle or late adulthood or for BMI change in any life period in men. Our findings indicate that genetic predisposition exerts a persistent effect on adiposity throughout adult life and increases early adulthood weight gain in women. © 2017 by the American Diabetes Association.
Childhood BMI growth trajectories and endometrial cancer risk
DEFF Research Database (Denmark)
Aarestrup, Julie; Gamborg, Michael; Tilling, Kate
2017-01-01
Previously, we found that excess weight already in childhood has positive associations with endometrial cancer, however, associations with changes in body mass index (BMI) during childhood are not well understood. Therefore, we examined whether growth in childhood BMI is associated with endometrial...... cancer and its sub-types. A cohort of 155,505 girls from the Copenhagen School Health Records Register with measured weights and heights at the ages of 6 to 14 years and born 1930-89 formed the analytical population. BMI was transformed to age-specific z-scores. Using linear spline multilevel models......, each girl's BMI growth trajectory was estimated as the deviance from the average trajectory for three different growth periods (6.25-7.99, 8.0-10.99, 11.0-14.0 years). Via a link to health registers, 1020 endometrial cancer cases were identified, and Cox regressions were performed. A greater gain...
Androgenetic Alopecia: A Chronic or Pubertal Onset Disease Retarded by Blood Donation
Directory of Open Access Journals (Sweden)
Mohammad Reza Dayer
2017-09-01
Full Text Available Background Androgenetic alopecia is the main cause of hair loss and common baldness that affects psychological more than physiological aspects of people’s lives. Studies have shown that this multi factorial disorder is initiated by androgens secretion in pubertal period, minerals limitations, autoimmunity, mental stress, genetic predisposition and some alterations in hematological factors. Objectives The aim of this study was to evaluate the involvement of hematologic parameters in this disease using a case control study design. Methods In this case-controlled study, two groups each of 80 individuals with androgenetic alopecia were voluntarily included in the study based on their medical histories and clinical examinations and subjected to blood tests for routine hematological parameters. The results were then compared and analyzed using SPSS version 16.0. Results Our findings indicated that all the parameters for both groups fall in normal ranges (Mean ± SD but the values for RBC, HGB, MCH, MCHC, WBC, LYM and TIBC were significantly higher in patients than in normal group. The average counts of PLT was significantly lower in patients compared with the normal group. Otherwise, Person’s tests for statistical correlations between two groups indicated that the pattern of correlations were abnormal in patients. Conclusions Our findings indicated the presence of a chronic, immunologic and slowly progressing disorder that causes hair loss, the disease which is in turn triggered in pubertal period upon androgen secretion. We suggest, therefore, that the conditions may be ameliorated by prescription of iron tablet, platelet transfusion and anti-inflammation therapy.
Lam, T H; Stewart, Sunita M; Leung, Gabriel M; Lee, Peter W H; Wong, Joy P S; Ho, L M; Youth Sexuality Task Force
2004-10-01
A representative community sample of Hong Kong boys (n = 1,024) and girls (n = 1,403), age 14-18 years, provided information regarding same-sex attraction, gender dissatisfaction, pubertal timing, early experience with sexual intercourse, and depressive symptoms. They also rated the quality of their family and peer relationships and self-perceived attractiveness. Depressive symptoms were higher in youths reporting same-sex attraction, gender dissatisfaction, early pubertal maturation, and early sexual intercourse. Family relationships were less satisfactory for those who reported same-sex attraction, gender dissatisfaction, and early sexual intercourse, and peer relationships were also worse for those who reported gender dissatisfaction. In multivariate analyses, same-sex attraction, early sexual intercourse, and early pubertal maturation were unique and direct contributors to depressive symptoms; however, gender dissatisfaction's association with depressive symptoms was largely accounted for by shared correlations with negative family and peer relationships. The multivariate model explained 11% of the variance of depressive symptoms. These findings offer a preliminary documentation of the prevalence and correlates of atypical sexual self-assessments and behavior among adolescents in Hong Kong. Such information is important if theories of sexual identity and risk factors for depressive symptoms are to have cross-cultural utility. Copyright 2004 Springer Science + Business Media, Inc.
Wang, Xiaofeng; Liu, Xinyang; Huang, Mingzhu; Gan, Lu; Cheng, Yufan; Li, Jin
2016-01-01
Bmi-1 is aberrantly activated in various cancers and plays a vital role in maintaining the self-renewal of stem cells. Our previous research revealed that Bmi-1 was overexpressed in gastric cancer (GC) and it's overexpression was an independent negative prognostic factor, suggesting it can be a therapeutic target. The main purpose of this investigation was to explore the antitumor activity of Bmi-1 interference driven by its own promoter (Ad-Bmi-1i) for GC. In this study, we used adenoviral vector to deliver Bmi-1 shRNA driven by its own promoter to treat GC. Our results revealed that Ad-Bmi-1i could selectively silence Bmi-1 in GC cells which overexpress Bmi-1 and suppress the malignant phenotypes and stem-like properties of GC cells in vitro and in vivo. Moreover, direct injection of Ad-Bmi-1i into xenografts suppressed tumor growth and destroyed cancer cells in vivo. Ad-Bmi-1i inhibited the proliferation of GC cells mainly via inducing senescence in vitro, but it suppressed tumor through inducing senescence and apoptosis, and inhibiting angiogenesis in vivo. Bmi-1 knockdown by Ad-Bmi-1i downregulated VEGF via inhibiting AKT activity. These results suggest that Ad-Bmi-1i not only inhibits tumor growth and stem cell-like phenotype by inducing cellular senescence directly, but also has an indirect anti-tumor activity by anti-angiogenesis effects via regulating PTEN/AKT/VEGF pathway. Transfer of gene interference guided by its own promoter by an adeno-associated virus (AAV) vector might be a potent antitumor approach for cancer therapy. PMID:27009837
Racette, Susan B; Yu, Liyang; DuPont, Nicholas C; Clark, B Ruth
2017-05-24
Severe obesity is an important and distinct weight status classification that is associated with disease risk and is increasing in prevalence among youth. The ability to graphically present population weight status data, ranging from underweight through severe obesity class 3, is novel and applicable to epidemiologic research, intervention studies, case reports, and clinical care. The aim was to create body mass index (BMI) graphing tools to generate sex-specific BMI-for-age graphs that include severe obesity percentile curves. We used the Centers for Disease Control and Prevention youth reference data sets and weight status criteria to generate the percentile curves. The statistical software environments SAS and R were used to create two different graphing options. This article provides graphing tools for creating sex-specific BMI-for-age graphs for males and females ages 2 to obesity classes 2 and 3, the ability to plot individual data for thousands of children and adolescents on a single graph, and the ability to generate cross-sectional and longitudinal graphs. These new BMI graphing tools will enable investigators, public health professionals, and clinicians to view and present youth weight status data in novel and meaningful ways.
Marwaha, Raman K; Garg, M K; Gupta, Sushil; Khurana, A K; Narang, Archna; Shukla, Manoj; Arora, Preeti; Chadha, Aditi; Nayak, Deb Datta; Manchanda, R K
2017-07-26
Population specific data and influence of sub-clinical hypothyroidism on insulin like growth factor-1 (IGF-1) and its binding protein-3 (IGFBP-3) in Indian children is lacking. This study was undertaken to evaluate serum IGF-1 and IGFBP-3 and their correlation with age, gender, pubertal status and thyroid functions. A total of 840 apparently healthy school girls aged 6-18 years, were recruited for the study and underwent assessment of height, weight, body mass index, pubertal status and serum T3, T4, TSH, IGF-1, IGFBP-3 and IGF-1/IGFBP-3 molar ratio. The mean serum levels of IGF-1, IGFBP-3 levels and IGF-1/IGFBP-3 molar ratio were 381.8±240.5 ng/mL, 4.19±2.08 μg/mL and 40.5±37.2%, respectively. The serum IGF-1 and IGF-1/IGFBP-3 molar ratio increased significantly (pIGF-1 and molar ratio of IGF-1/IGFBP-3 increased significantly with pubertal maturation from stage 1 to 3 and were higher in overweight girls compared to normal weight and obese girls. The growth factors were no different in girls with or without subclinical hypothyroidism. There was no significant impact of age on IGF-1 and IGFBP-3 in pre-pubertal girls. A sudden marked increase at 11 years followed by a gradual rise in growth factors till 16 years is indicative of pubertal initiation and maturation. Subclinical hypothyroidism did not influence growth factors in girls.
Maternal BMI during Pregnancy: Effect on trace elements Status and ...
African Journals Online (AJOL)
Maternal BMI was significantly positively related to age, parity and socioeconomic status. While a negative relationship was found between plasma copper and maternal BMI, significantly (p < 0.05) lower zinc levels were found in underweight and obese women when compared to women with normal BMI. Maternal anaemia ...
Parental nonstandard work schedules during infancy and children's BMI trajectories
Directory of Open Access Journals (Sweden)
Afshin Zilanawala
2017-09-01
Full Text Available Background: Empirical evidence has demonstrated adverse associations between parental nonstandard work schedules (i.e., evenings, nights, or weekends and child developmental outcomes. However, there are mixed findings concerning the relationship between parental nonstandard employment and children's body mass index (BMI, and few studies have incorporated information on paternal work schedules. Objective: This paper investigated BMI trajectories from early to middle childhood (ages 3-11 by parental work schedules at 9 months of age, using nationally representative cohort data from the United Kingdom. This study is the first to examine the link between nonstandard work schedules and children's BMI in the United Kingdom. Methods: We used data from the Millennium Cohort Study (2001‒2013, n = 13,021 to estimate trajectories in BMI, using data from ages 3, 5, 7, and 11 years. Joint parental work schedules and a range of biological, socioeconomic, and psychosocial covariates were assessed in the initial interviews at 9 months. Results: Compared to children in two-parent families where parents worked standard shifts, we found steeper BMI growth trajectories for children in two-parent families where both parents worked nonstandard shifts and children in single-parent families whose mothers worked a standard shift. Fathers' shift work, compared to standard shifts, was independently associated with significant increases in BMI. Conclusions: Future public health initiatives focused on reducing the risk of rapid BMI gain in childhood can potentially consider the disruptions to family processes resulting from working nonstandard hours. Contribution: Children in families in which both parents work nonstandard schedules had steeper BMI growth trajectories across the first decade of life. Fathers' nonstandard shifts were independently associated with increases in BMI.
Warm Parenting Associated with Decreasing or Stable Child BMI during Treatment.
Rhee, Kyung E; Jelalian, Elissa; Boutelle, Kerri; Dickstein, Susan; Seifer, Ronald; Wing, Rena
2016-04-01
While authoritative parenting, which includes high levels of warmth and behavioral control, has been associated with lower risk of obesity, little is known about how general parenting impacts child weight loss during treatment. Our goal was to examine the relationship between several general parenting dimensions and 'decreasing /stable' child BMI during a 16-week family-based behavioral weight control program. Forty-four overweight parent-child dyads (child age 8 to 12 years) enrolled in the program. Families were videotaped at baseline eating dinner in their home. Using the General Parenting Observational Scale (GPOS), meals were coded for several general parenting dimensions. Primary outcome was percent of children whose BMI 'decreased or stayed the same.' Multivariable logistic regression was used to determine the relationship between general parenting and decreasing/stable child BMI. Forty families (91%) completed the program. Children had a mean BMI change of -0.40 (SD 1.57), which corresponds to a -0.15 (SD 0.20) change in BMI z-score (BMI-Z); 75% of children had decreasing/stable BMI. In the unadjusted models, lower parent BMI, higher parent education, and higher levels of parental warmth were significantly associated with decreasing/stable child BMI. In the multivariable model, only higher level of warmth was associated with increased odds of decreasing/stable child BMI (OR = 1.28; 95% CI, 1.01, 1.62). Baseline parental warmth may influence a child's ability to lower/maintain BMI during a standard family-based behavioral weight control program. Efforts to increase parent displays of warmth and emotional support towards their overweight child may help to increase the likelihood of treatment success.
1H-MRS Measured Ectopic Fat in Liver and Muscle in Danish Lean and Obese Children and Adolescents.
Fonvig, Cilius Esmann; Chabanova, Elizaveta; Andersson, Ehm Astrid; Ohrt, Johanne Dam; Pedersen, Oluf; Hansen, Torben; Thomsen, Henrik S; Holm, Jens-Christian
2015-01-01
This cross sectional study aims to investigate the associations between ectopic lipid accumulation in liver and skeletal muscle and biochemical measures, estimates of insulin resistance, anthropometry, and blood pressure in lean and overweight/obese children. Fasting plasma glucose, serum lipids, serum insulin, and expressions of insulin resistance, anthropometry, blood pressure, and magnetic resonance spectroscopy of liver and muscle fat were obtained in 327 Danish children and adolescents aged 8-18 years. In 287 overweight/obese children, the prevalences of hepatic and muscular steatosis were 31% and 68%, respectively, whereas the prevalences in 40 lean children were 3% and 10%, respectively. A multiple regression analysis adjusted for age, sex, body mass index z-score (BMI SDS), and pubertal development showed that the OR of exhibiting dyslipidemia was 4.2 (95%CI: [1.8; 10.2], p = 0.0009) when hepatic steatosis was present. Comparing the simultaneous presence of hepatic and muscular steatosis with no presence of steatosis, the OR of exhibiting dyslipidemia was 5.8 (95%CI: [2.0; 18.6], p = 0.002). No significant associations between muscle fat and dyslipidemia, impaired fasting glucose, or blood pressure were observed. Liver and muscle fat, adjusted for age, sex, BMI SDS, and pubertal development, associated to BMI SDS and glycosylated hemoglobin, while only liver fat associated to visceral and subcutaneous adipose tissue and intramyocellular lipid associated inversely to high density lipoprotein cholesterol. Hepatic steatosis is associated with dyslipidemia and liver and muscle fat depositions are linked to obesity-related metabolic dysfunctions, especially glycosylated hemoglobin, in children and adolescents, which suggest an increased cardiovascular disease risk.
Ruszala, Anna; Wojcik, Malgorzata; Zygmunt-Gorska, Agata; Janus, Dominika; Wojtys, Joanna; Starzyk, Jerzy B
2017-08-01
The metabolic effects of prepubertal low-dose estrogen replacement (LE) therapy in Turner syndrome (TS) have not been fully investigated to date. The present study aimed to compare glucose and lipids metabolism in adolescents with TS on LE and conventional estrogen replacement (CE). In 14 TS (mean age 13.8), LE (17β-estradiol, 62.5 μg daily) was introduced before age 12 (mean age 10.5), and followed by a pubertal induction regimen after age 12, and in 14 CE was started after age 12 (mean 14, SD 1.96). Before, and 3 years after starting 17β-estradiol growth velocity, bone age, BMI, and selected parameters of glucose and lipids metabolism were assessed. There were no significant differences between LE and CE in the mean levels of any parameter before introduction of 17β-estradiol [total cholesterol (TC): 4.1 vs 4.3 mmol/L, LDL cholesterol (LDLc): 2.2 vs 2.4 mmol/L, HDL cholesterol (HDLc): 1.6 vs 1.4 mmol/L, triglycerides: 0.9 vs 1.0 mmol/L, fasting glucose: 4.2 vs 4.4 mmol/L, post-load glucose: 4.8 vs 5.5 mmol/L; fasting insulin: 6.8 vs 8.0 post-load insulin: 21.3 vs 67.0 μIU/mL, HOMA-IR 1.3 vs 1.6]. After three years of treatment, TC and LDLc levels were significantly lower in LE group (3.8 vs 4.4 mmol/L, p = 0.004; 1.9 vs 2.4 mmol/L, p = 0.03). The other parameters did not differ significantly. There was no negative impact on growth course and bone age advancement nor on BMI in LE group. Prepubertal LE is associated with healthier lipid profile than CE in girls with TS.
Meng, Xiu-Hong; Liu, Ping; Wang, Hua; Zhao, Xian-Feng; Xu, Zhong-Mei; Chen, Gui-Hai; Xu, De-Xiang
2011-06-24
In human and rodent models, endocrine disrupting chemicals (EDCs) interfere with the development of cognition and behaviors. Fenvalerate is a potential EDC. The purpose of this study was to examine whether pubertal fenvalerate exposure altered behavioral development. Mice were orally administered with either vehicle or fenvalerate (7.5 or 30 mg/kg/day) from postnatal day (PND) 28 to PND56. Learning and memory were assessed by Morris Water Maze. Aggressive performance was evaluated by aggressive behavior test. Anxiety-related activities were detected by three tests: open-field, plus-maze and black-white alley. Sensorimotor function was analyzed using beam walking and tightrope. Results found that the impairment for spatial learning and memory was more severe in fenvalerate-exposed female mice than in male mice. In addition, pubertal fenvalerate exposure inhibited aggressive behavior in males. Moreover, pubertal fenvalerate exposure increased anxiety activities in females. Altogether, these results suggest that pubertal fenvalerate exposure impairs spatial cognition and behavioral development in a gender-dependent manner. These findings identify fenvalerate as candidate environmental risk factors for cognitive and behavioral development, especially in the critical period of development. Copyright © 2011 Elsevier Ireland Ltd. All rights reserved.
Postoperative Complications of Total Joint Arthroplasty in Obese Patients Stratified by BMI.
Zusmanovich, Mikhail; Kester, Benjamin S; Schwarzkopf, Ran
2018-03-01
High body mass index (BMI) is associated with significant complications in patients undergoing total joint arthroplasty. Many studies have evaluated this trend, but few have looked at the rates of complications based on BMI as a continuous variable. The purpose of this study was to stratify obese patients into 3 BMI categories and evaluate their rates of complications and gauge whether transitioning from higher to lower BMI category lowers complication. Patients undergoing primary total joint arthroplasty were selected from the National Surgical Quality Improvement Program database from 2008-2015 and arranged into 3 groups based on BMI: O1 (BMI 30-34.9 kg/m 2 ), O2 (BMI 35-39.9 kg/m 2 ), and O3 (BMI >40 kg/m 2 ). Thirty-day complications were recorded and evaluated utilizing univariate and multivariate analyses stratified by BMI. A total of 268,663 patients were identified. Patients with a BMI >30 kg/m 2 had more infectious and medical complications compared with nonobese patients. Furthermore, there were increased complications as the BMI categories increased. Patients with a BMI >40 kg/m 2 (O3) had longer operating times, length of stay, higher rates of readmissions, reoperations, deep venous thrombosis, renal insufficiency, superficial infections, deep infections, and wound dehiscence. These trends were present when comparing the O2 with O1 category as well. We have demonstrated increased rates of medical and surgical complications in obese patients. Furthermore, we demonstrated a stepwise increase in complication rates when transitioning to higher BMI groups. Based on our data, we believe that preoperative counseling and interventions to decrease BMI should be explored before offering elective surgery to obese patients. Copyright © 2017 Elsevier Inc. All rights reserved.
Bmi-1-targeting suppresses osteosarcoma aggressiveness through the NF-κB signaling pathway
Liu, Jiaguo; Luo, Bin; Zhao, Meng
2017-01-01
Bone cancer is one of the most lethal malignancies and the specific causes of tumor initiation are not well understood. B-cell-specific Moloney murine leukemia virus integration site 1 protein (Bmi-1) has been reported to be associated with the initiation and progression of osteosarcoma, and as a prognostic indicator in the clinic. In the current study, a full-length antibody targeting Bmi-1 (AbBmi-1) was produced and the preclinical value of Bmi-1-targeted therapy was evaluated in bone carcinoma cells and tumor xenograft mice. The results indicated that the Bmi-1 expression level was markedly upregulated in bone cancer cell lines, and inhibition of Bmi-1 by AbBmi-1 reduced the invasiveness and migration of osteosarcoma cells. Overexpression of Bmi-1 promoted proliferation and angiogenesis, and increased apoptosis resistance induced by cisplatin via the nuclear factor-κB (NF-κB) signal pathway. In addition, AbBmi-1 treatment inhibited the tumorigenicity of osteosarcoma cells in vivo. Furthermore, AbBmi-1 blocked NF-κB signaling and reduced MMP-9 expression. Furthermore, Bmi-1 promoted osteosarcoma tumor growth, whereas AbBmi-1 significantly inhibited osteosarcoma tumor growth in vitro and in vivo. Notably, AbBmi-1 decreased the percentages of Ki67-positive cells and terminal deoxynucleotidyl transferase dUTP nick end labeling-positive cells in tumors compared with Bmi-1-treated and PBS controls. Notably, MMP-9 and NF-κB expression were downregulated by treatment with AbBmi-1 in MG-63 osteosarcoma cells. In conclusion, the data provides evidence that AbBmi-1 inhibited the progression of osteosarcoma, suggesting that AbBmi-1 may be a novel anti-cancer agent through the inhibition of Bmi-1 via activating the NF-κB pathway in osteosarcoma. PMID:28983587
Tittlbach, Susanne A; Jekauc, Darko; Schmidt, Steffen C E; Woll, Alexander; Bös, Klaus
2017-09-01
This study's aims were to describe the development of physical activity, physical fitness (PF), subjective (physical complaints (PC)) and objective (Body mass index (BMI)) health measures and to examine the relationship between the development trajectories. In addition, the study also aimed to assess the influence of sociodemographic determinants (age, sex, socioeconomic status (SES)) in German adults over a period of 18 years. The longitudinal study population comprises of 721 men and women, aged 33-76 years over the study period. There was self-report of physical activity and PC and testing of physical fitness and BMI in each study year (1992, 1997, 2002 and 2010). Latent growth curve models were used to analyse the development. Physical activity slightly increased while fitness, PC and BMI worsened over the course of 18 years. Sex, age and SES play important roles concerning physical activity, fitness and health. Several integrative associations could be detected between physical activity, fitness, PC and BMI as well as their trajectories. In particular, high initial levels of physical activity and fitness protect from high PC and BMI.The slope of physical activity was not significantly associated with slopes of fitness, PC and BMI. However, increase of fitness resulted in decrease of PC. A general positive development regarding the amount of physical activity could be detected. However, if it is only an unsystematic increase of physical activity, this is not in itself enough to achieve health benefits. The strengthening of fitness should be focused when increasing physical activity, since only then a health benefit is possible.
A BMI-based occupational therapy assist suit: asynchronous control by SSVEP
Directory of Open Access Journals (Sweden)
Takeshi eSakurada
2013-09-01
Full Text Available A brain-machine interface (BMI is an interface technology that uses neurophysiological signals from the brain to control external machines. Recent invasive BMI technologies have succeeded in the asynchronous control of robot arms for a useful series of actions, such as reaching and grasping. In this study, we developed non-invasive BMI technologies aiming to make such useful movements using the subject's own hands by preparing a BMI-based occupational therapy assist suit (BOTAS. We prepared a pre-recorded series of useful actionsa grasping-a-ball movement and a carrying-the-ball movementand added asynchronous control using steady-state visual evoked potential (SSVEP signals. A SSVEP signal was used to trigger the grasping-a-ball movement and another SSVEP signal was used to trigger the carrying-the-ball movement. A support vector machine was used to classify EEG signals recorded from the visual cortex (Oz in real time. Untrained, able-bodied participants (n = 12 operated the system successfully. Classification accuracy and time required for SSVEP detection were approximately 88% and 3 s, respectively. We further recruited three patients with upper cervical spinal cord injuries; they also succeeded in operating the system without training. These data suggest that our BOTAS system is potentially useful in terms of rehabilitation of patients with upper limb disabilities.
Fong, S S M; Vackova, D; Choi, A W M; Cheng, Y T Y; Yam, T T T; Guo, X
2018-04-01
This study examined the relationships between activity participation and bone mineralization in children with developmental coordination disorder. Limited participation in physical, recreational, social, and skill-based and self-improvement activities contributed to lower bone mineral content. For improved bone health, these children should participate in a variety of activities, not only physical activities. Limited activity participation in children with developmental coordination disorder (DCD) may have a negative impact on bone mineral accrual. The objectives of this study were to compare bone mineralization and activity participation patterns of pre-pubertal children with DCD and those with typical development, and to determine the association between activity participation patterns and bone mineralization in children with DCD. Fifty-two children with DCD (mean age = 7.51 years) and 61 children with typical development (mean age = 7.22 years) participated in the study. Appendicular and total body (less head) bone mineral content (BMC) and bone mineral density (BMD) were evaluated by a whole-body dual-energy X-ray absorptiometry scan. Activity participation patterns were assessed using the Children's Assessment of Participation and Enjoyment (CAPE) questionnaire. Children with DCD had lower appendicular and total body BMCs and BMDs than children with typical development overall (p accounting for the effects of age, sex, height, lean mass, and fat mass, the total activity diversity score remained independently associated with leg BMC in children with DCD, explaining 5.1% of the variance (p = 0.030). However, the physical activity diversity score was no longer associated with leg BMC (p = 0.090). Diversity of activity participation and bone mineralization were lower in pre-pubertal children with DCD. Decreased total activity participation diversity was a contributing factor to lower BMC in the legs of children with DCD.
Physical activity modifies the FTO effect on BMI change in Japanese adolescents.
Shinozaki, Keiko; Okuda, Masayuki; Okayama, Naoko; Kunitsugu, Ichiro
2018-04-14
Evidence of the effects of fat mass and obesity-associated (FTO) gene variation and long-term effects of physical activity (PA) on adiposity in adolescents is largely scarce. This study aimed to investigate whether physical activity modulates the effects of the FTO gene on body mass index (BMI) changes in Japanese adolescents between the ages of 13 and 18 years. Data of 343 subjects (156 boys; 187 girls) who were enrolled in 2006 and 2007 from schools on Shunan City, Japan, were collected. Genotyping (rs1558902) was conducted, and anthropometric measurements and blood test results were recorded for subjects in the eighth grade. A second survey involving self-reporting of anthropometric measurements was conducted when the subjects were in the twelfth grade. PA was estimated using the International Physical Activity Questionnaire in this survey. BMI and the standard deviation score for BMI (BMI-SDS) were calculated. BMI changes and BMI-SDS changes were compared among FTO genotypes using a multivariate model. The effect of the interaction between PA and the FTO genotype on BMI changes was significant among boys but not girls. Among boys, PA had a significant negative influence on BMI-SDS changes in those with the AA genotype and a significant positive influence on BMI and BMI-SDS changes in those with the TT genotype. These data suggest that the influence of PA on BMI changes and BMI-SDS changes varied on the basis of genotype. PA modified the effect of the FTO gene on BMI changes in Japanese boys. This article is protected by copyright. All rights reserved. This article is protected by copyright. All rights reserved.
Low fitness is associated with abdominal adiposity and low-grade inflammation independent of BMI
DEFF Research Database (Denmark)
Wedell-Neergaard, Anne-Sophie; Eriksen, Louise; Grønbæk, Morten
2018-01-01
OBJECTIVE: Up to 30% of obese individuals are metabolically healthy. Metabolically healthy obese (MHO) individuals are characterized by having low abdominal adiposity, low inflammation level and low risk of developing metabolic comorbidity. In this study, we hypothesize that cardiorespiratory fit...... to be inversely associated with both abdominal adiposity and low-grade inflammation independent of BMI. These data suggest that, in spite of BMI, high fitness levels lead to a reduction in abdominal fat mass and low-grade inflammation.......OBJECTIVE: Up to 30% of obese individuals are metabolically healthy. Metabolically healthy obese (MHO) individuals are characterized by having low abdominal adiposity, low inflammation level and low risk of developing metabolic comorbidity. In this study, we hypothesize that cardiorespiratory...... fitness (fitness) is a determinant factor for the MHO individuals and aim to investigate the associations between fitness, abdominal adiposity and low-grade inflammation within different BMI categories. METHOD: Data from 10,976 individuals from the general population, DANHES 2007-2008, on waist...
Directory of Open Access Journals (Sweden)
Mohamed Abdouh
Full Text Available Aging increases the risk to develop several neurodegenerative diseases, although the underlying mechanisms are poorly understood. Inactivation of the Polycomb group gene Bmi1 in mice results in growth retardation, cerebellar degeneration, and development of a premature aging-like phenotype. This progeroid phenotype is characterized by formation of lens cataracts, apoptosis of cortical neurons, and increase of reactive oxygen species (ROS concentrations, owing to p53-mediated repression of antioxidant response (AOR genes. Herein we report that Bmi1 expression progressively declines in the neurons of aging mouse and human brains. In old brains, p53 accumulates at the promoter of AOR genes, correlating with a repressed chromatin state, down-regulation of AOR genes, and increased oxidative damages to lipids and DNA. Comparative gene expression analysis further revealed that aging brains display an up-regulation of the senescence-associated genes IL-6, p19(Arf and p16(Ink4a, along with the pro-apoptotic gene Noxa, as seen in Bmi1-null mice. Increasing Bmi1 expression in cortical neurons conferred robust protection against DNA damage-induced cell death or mitochondrial poisoning, and resulted in suppression of ROS through activation of AOR genes. These observations unveil that Bmi1 genetic deficiency recapitulates aspects of physiological brain aging and that Bmi1 over-expression is a potential therapeutic modality against neurodegeneration.
Correction of self-reported BMI based on objective measurements: a Belgian experience.
Drieskens, S; Demarest, S; Bel, S; De Ridder, K; Tafforeau, J
2018-01-01
Based on successive Health Interview Surveys (HIS), it has been demonstrated that also in Belgium obesity, measured by means of a self-reported body mass index (BMI in kg/m 2 ), is a growing public health problem that needs to be monitored as accurately as possible. Studies have shown that a self-reported BMI can be biased. Consequently, if the aim is to rely on a self-reported BMI, adjustment is recommended. Data on measured and self-reported BMI, derived from the Belgian Food Consumption Survey (FCS) 2014 offers the opportunity to do so. The HIS and FCS are cross-sectional surveys based on representative population samples. This study focused on adults aged 18-64 years (sample HIS = 6545 and FCS = 1213). Measured and self-reported BMI collected in FCS were used to assess possible misreporting. Using FCS data, correction factors (measured BMI/self-reported BMI) were calculated in function of a combination of background variables (region, gender, educational level and age group). Individual self-reported BMI of the HIS 2013 were then multiplied with the corresponding correction factors to produce a corrected BMI-classification. When compared with the measured BMI, the self-reported BMI in the FCS was underestimated (mean 0.97 kg/m 2 ). 28% of the obese people underestimated their BMI. After applying the correction factors, the prevalence of obesity based on HIS data significantly increased (from 13% based on the original HIS data to 17% based on the corrected HIS data) and approximated the measured one derived from the FCS data. Since self-reported calculations of BMI are underestimated, it is recommended to adjust them to obtain accurate estimates which are important for decision making.
Raised BMI cut-off for overweight in Greenland Inuit--a review.
Andersen, Stig; Fleischer Rex, Karsten; Noahsen, Paneeraq; Sørensen, Hans Christian Florian; Mulvad, Gert; Laurberg, Peter
2013-01-01
Obesity is associated with increased morbidity and premature death. Obesity rates have increased worldwide and the WHO recommends monitoring. A steep rise in body mass index (BMI), a measure of adiposity, was detected in Greenland from 1963 to 1998. Interestingly, the BMI starting point was in the overweight range. This is not conceivable in a disease-free, physically active, pre-western hunter population. This led us to reconsider the cut-off point for overweight among Inuit in Greenland. We found 3 different approaches to defining the cut-off point of high BMI in Inuit. First, the contribution to the height by the torso compared to the legs is relatively high. This causes relatively more kilograms per centimetre of height that increases the BMI by approximately 10% compared to Caucasian whites. Second, defining the cut-off by the upper 90-percentile of BMI from height and weight in healthy young Inuit surveyed in 1963 estimated the cut-off point to be around 10% higher compared to Caucasians. Third, if similar LDL-cholesterol and triglycerides are assumed for a certain BMI in Caucasians, the corresponding BMI in Inuit in both Greenland and Canada is around 10% higher. However, genetic admixture of Greenland Inuit and Caucasian Danes will influence this difference and hamper a clear distinction with time. Defining overweight according to the WHO cut-off of a BMI above 25 kg/m(2) in Greenland Inuit may overestimate the number of individuals with elevated BMI.
Modeling Late-Onset Sporadic Alzheimer’s Disease through BMI1 Deficiency
Directory of Open Access Journals (Sweden)
Anthony Flamier
2018-05-01
Full Text Available Late-onset sporadic Alzheimer’s disease (AD is the most prevalent form of dementia, but its origin remains poorly understood. The Bmi1/Ring1 protein complex maintains transcriptional repression of developmental genes through histone H2A mono-ubiquitination, and Bmi1 deficiency in mice results in growth retardation, progeria, and neurodegeneration. Here, we demonstrate that BMI1 is silenced in AD brains, but not in those with early-onset familial AD, frontotemporal dementia, or Lewy body dementia. BMI1 expression was also reduced in cortical neurons from AD patient-derived induced pluripotent stem cells but not in neurons overexpressing mutant APP and PSEN1. BMI1 knockout in human post-mitotic neurons resulted in amyloid beta peptide secretion and deposition, p-Tau accumulation, and neurodegeneration. Mechanistically, BMI1 was required to repress microtubule associated protein tau (MAPT transcription and prevent GSK3beta and p53 stabilization, which otherwise resulted in neurodegeneration. Restoration of BMI1 activity through genetic or pharmaceutical approaches could represent a therapeutic strategy against AD.
BMI1 and Mel-18 oppositely regulate carcinogenesis and progression of gastric cancer.
Zhang, Xiao-Wei; Sheng, Ya-Ping; Li, Qian; Qin, Wei; Lu, You-Wei; Cheng, Yu-Fan; Liu, Bing-Ya; Zhang, Feng-Chun; Li, Jin; Dimri, Goberdhan P; Guo, Wei-Jian
2010-02-21
The BMI1 oncogene is overexpressed in several human malignancies including gastric cancer. In addition to BMI1, mammalian cells also express Mel-18, which is closely related to BMI1. We have reported that Mel-18 functions as a potential tumor suppressor by repressing the expression of BMI1 and consequent downregulation of activated AKT in breast cancer cells. However, the mechanisms of BMI1 overexpression and the role of Mel-18 in other cancers are still not clear. The purpose of this study is to investigate the role of BMI1 and Mel-18 in gastric cancer. BMI1 was found to be overexpressed in gastric cancer cell lines and gastric tumors. Overexpression of BMI1 correlated with advanced clinical stage and lymph node metastasis; while the expression of Mel-18 negatively correlated with BMI1. BMI1 but not Mel-18 was found to be an independent prognostic factor. Downregulation of BMI1 by Mel-18 overexpression or knockdown of BMI1 expression in gastric cancer cell lines led to upregulation of p16 (p16INK4a or CDKN2A) in p16 positive cell lines and reduction of phospho-AKT in both p16-positive and p16-negative cell lines. Downregulation of BMI1 was also accompanied by decreased transformed phenotype and migration in both p16- positive and p16-negative gastric cancer cell lines. In the context of gastric cancer, BMI1 acts as an oncogene and Mel-18 functions as a tumor suppressor via downregulation of BMI1. Mel-18 and BMI1 may regulate tumorigenesis, cell migration and cancer metastasis via both p16- and AKT-dependent growth regulatory pathways.
Eating tasty food to cope. Longitudinal association with BMI.
Boggiano, M M; Wenger, L E; Turan, B; Tatum, M M; Morgan, P R; Sylvester, M D
2015-04-01
The goals of this study were to determine if a change in certain motives to eat highly palatable food, as measured by the Palatable Eating Motives Scale (PEMS), could predict a change in body mass index (BMI) over time, to assess the temporal stability of these motive scores, and to test the reliability of previously reported associations between eating tasty foods to cope and BMI. BMI, demographics, and scores on the PEMS and the Binge Eating Scale were obtained from 192 college students. Test-retest analysis was performed on the PEMS motives in groups varying in three gap times between tests. Regression analyses determined what PEMS motives predicted a change in BMI over two years. The results replicated previous findings that eating palatable food for Coping motives (e.g., to forget about problems, reduce negative feelings) is associated with BMI. Test-retest correlations revealed that motive scores, while somewhat stable, can change over time. Importantly, among overweight participants, a change in Coping scores predicted a change in BMI over 2 years, such that a 1-point change in Coping predicted a 1.76 change in BMI (equivalent to a 10.5 lb. change in body weight) independent of age, sex, ethnicity, and initial binge-eating status (Cohen's f(2) effect size = 1.44). The large range in change of Coping scores suggests it is possible to decrease frequency of eating to cope by more than 1 scale point to achieve weight losses greater than 10 lbs. in young overweight adults, a group already at risk for rapid weight gain. Hence, treatments aimed specifically at reducing palatable food intake for coping reasons vs. for social, reward, or conformity reasons, should help achieve a healthier body weight and prevent obesity if this motive-type is identified prior to significant weight gain. Copyright © 2015 Elsevier Ltd. All rights reserved.
Impact of Carbohydrate Restriction on Healthy Adolescent Development.
Richmond, Hannah M; Duriancik, David M
2017-09-01
Carbohydrate-restricted diets are known for their impact on weight loss; however, research is still required to determine if low-carbohydrate diets are safe for adolescents. Carbohydrates directly stimulate an insulin response, and studies have recently shown that insulin and binding to respective insulin receptors (IRs) are critical in Kisspeptin (Kiss1) neuronal development. These neurons directly stimulate gonadotropin-releasing hormone, which activates the pituitary-gonadal axis during puberty. This information suggests that carbohydrate restriction may delay pubertal development in adolescents due to the impact on insulin and Kiss1 transcription. Studies have observed disturbed insulin metabolism in Type I Diabetics leading to delayed puberty, along with overfeeding stimulating early pubertal onset. Additionally, recent clinical trials bred female mice with IR deletions on Kiss1 neurons and observed delayed vaginal opening and estrus. Current animal research suggests low carbohydrate intake may delay pubertal onset, however additional research is required to determine outcome in human subjects. Copyright© of YS Medical Media ltd.
DEFF Research Database (Denmark)
Morgen, Camilla Schmidt; Ängquist, Lars; Lynn Baker, Jennifer
2018-01-01
BACKGROUND AND OBJECTIVES: Prenatal risk factors for childhood overweight may operate indirectly through development in body size in early life and/or directly independent hereof. We quantified the effects of maternal and paternal body mass index (BMI), maternal age, socioeconomic position (SEP),...... of Obesity advance online publication, 31 October 2017; doi:10.1038/ijo.2017.217....
Jiang, Xu-Ping; Tang, Jing-Yuan; Xu, Zhen; Han, Peng; Qin, Zhi-Qiang; Yang, Cheng-di; Wang, Shang-Qian; Tang, Min; Wang, Wei; Qin, Chao; Xu, Yang; Shen, Bai-Xin; Zhou, Wei-Min; Zhang, Wei
2017-07-01
di-N-butylphthalate (DBP) is a ubiquitous environmental pollutant used for plastic coating and in the cosmetics industry. It has toxic effects on body health, especially the male reproductive system. Here, we investigated the effects of DBP on the male reproductive system of pubertal mice and explored the protective role of sulforaphane (SFN). The results showed that DBP significantly reduced the anogenital distance, testicular weight, sperm count and motility, and plasma and testicular testosterone levels and significantly increased the oxidative stress, sperm abnormalities, and testicular cell apoptosis. SFN supplementation ameliorated these effects. After DBP stimulation, the transcription factor nuclear factor erythroid-related factor 2 (Nrf2) was adaptively increased together with its target genes, such as HO-1 and NQO1. Upregulation of Nrf2 by SFN reduced the DBP-mediated intracellular oxidative toxicity and also increased testosterone secretion and spermatogenesis, which were decreased by DBP. These findings indicate that SFN can attenuate DBP-induced reproductive damage in pubertal mice via Nrf2-associated pathways. © 2017 Wiley Periodicals, Inc.
Culbert, Kristen M; Sinclair, Elaine B; Hildebrandt, Britny A; Klump, Kelly L; Sisk, Cheryl L
2018-02-01
Exposure to testosterone early in life may contribute to sex differences and pubertal changes in risk for eating pathology (i.e., females > males, after pubertal onset). Specifically, perinatal testosterone permanently alters brain structure/function and drives the masculinization of several sex-differentiated behaviors. However, the effects of perinatal testosterone are often not evident until puberty when increases in gonadal hormones activate the expression of sex typical behavior, including eating behaviors (e.g., chow intake; saccharin preference) in rodents. Despite perinatal testosterone's masculinizing effects on general feeding behavior, it remains unknown if perinatal testosterone exposure contributes to sex differences in pathological eating. The current study addressed this gap by examining whether perinatal testosterone exposure decreases risk for binge eating proneness after pubertal onset in male and female rats. Sprague-Dawley rats (n = 40 oil-treated control females; n = 39 testosterone-treated females; n = 40 oil-treated control males) were followed longitudinally across pre-to-early puberty, mid-to-late puberty, and adulthood. The binge eating prone (BEP)/binge eating resistant (BER) rodent model was used to identify individual differences in binge eating proneness across the dimensional spectrum. As expected, testosterone-treated females and control males showed masculinized (i.e., lower) risk for binge eating as compared to control females, but only after midpuberty. These animal data are significant in suggesting that perinatal testosterone exposure may protect against binge eating and underlie sex differences in binge eating prevalence during and after puberty. (PsycINFO Database Record (c) 2018 APA, all rights reserved).
Bidirectional associations between mothers' and fathers' parenting consistency and child BMI.
Jansen, Pauline W; Giallo, Rebecca; Westrupp, Elizabeth M; Wake, Melissa; Nicholson, Jan M
2013-12-01
Research suggests that general parenting dimensions and styles are associated with children's BMI, but directionality in this relationship remains unknown. Moreover, there has been little attention to the influences of both mothers' and fathers' parenting. We aimed to examine reciprocal relationships between maternal and paternal parenting consistency and child BMI. Participants were 4002 children and their parents in the population-based Longitudinal Study of Australian Children. Mothers and fathers self-reported parenting consistency, and children's BMI was measured at 4 biennial waves starting at age 4 to 5 years in 2004. Bidirectionality between parenting and child BMI was examined by using regression analyses in cross-lagged models. The best-fitting models indicated a modest influence from parenting to child BMI, whereas no support was found for bidirectional influences. For mothers, higher levels of parenting consistency predicted lower BMI in children from Waves 1 to 2 and 3 to 4; for example, for every SD increase in mothers' parenting consistency at Wave 1, child BMIz fell by 0.025 in Wave 2 (95% confidence interval: -0.05 to -0.003). For fathers, higher levels of parenting consistency were associated with lower child BMI from Waves 1 to 2 and 2 to 3. Parenting inconsistency of mothers and fathers prospectively predicted small increases in offspring BMI over 2-year periods across middle childhood. However, child BMI did not appear to influence parenting behavior. These findings support recent calls for expanding childhood overweight interventions to address the broad parenting context while involving both mothers and fathers.
Directory of Open Access Journals (Sweden)
Conforto Tara L
2012-04-01
Full Text Available Abstract Background Early liver development and the transcriptional transitions during hepatogenesis are well characterized. However, gene expression changes during the late postnatal/pre-pubertal to young adulthood period are less well understood, especially with regards to sex-specific gene expression. Methods Microarray analysis of male and female mouse liver was carried out at 3, 4, and 8 wk of age to elucidate developmental changes in gene expression from the late postnatal/pre-pubertal period to young adulthood. Results A large number of sex-biased and sex-independent genes showed significant changes during this developmental period. Notably, sex-independent genes involved in cell cycle, chromosome condensation, and DNA replication were down regulated from 3 wk to 8 wk, while genes associated with metal ion binding, ion transport and kinase activity were up regulated. A majority of genes showing sex differential expression in adult liver did not display sex differences prior to puberty, at which time extensive changes in sex-specific gene expression were seen, primarily in males. Thus, in male liver, 76% of male-specific genes were up regulated and 47% of female-specific genes were down regulated from 3 to 8 wk of age, whereas in female liver 67% of sex-specific genes showed no significant change in expression. In both sexes, genes up regulated from 3 to 8 wk were significantly enriched (p p Ihh; female-specific Cdx4, Cux2, Tox, and Trim24 and may contribute to the developmental changes that lead to global acquisition of liver sex-specificity by 8 wk of age. Conclusions Overall, the observed changes in gene expression during postnatal liver development reflect the deceleration of liver growth and the induction of specialized liver functions, with widespread changes in sex-specific gene expression primarily occurring in male liver.
2016-10-01
we discovered that BMI1 directly binds to Androgen Receptor and prevents it from MDM2-mediated protein degradation. We further demonstrated that...lysates. As shown in Fig. 1B, IP with anti-BMI1 pulled down full-length and AR-NTD, but not AR-DBD or AR-LBD. On the other hand , pulldown with Halo...harvested at the indicated time points and immunoblot analysis with anti-AR and anti-β-actin antibodies on the same membrane ( left panel). Density of
Gene-diet interaction effects on BMI levels in the Singapore Chinese population.
Chang, Xuling; Dorajoo, Rajkumar; Sun, Ye; Han, Yi; Wang, Ling; Khor, Chiea-Chuen; Sim, Xueling; Tai, E-Shyong; Liu, Jianjun; Yuan, Jian-Min; Koh, Woon-Puay; van Dam, Rob M; Friedlander, Yechiel; Heng, Chew-Kiat
2018-02-24
Recent genome-wide association studies (GWAS) have identified 97 body-mass index (BMI) associated loci. We aimed to evaluate if dietary intake modifies BMI associations at these loci in the Singapore Chinese population. We utilized GWAS information from six data subsets from two adult Chinese population (N = 7817). Seventy-eight genotyped or imputed index BMI single nucleotide polymorphisms (SNPs) that passed quality control procedures were available in all datasets. Alternative Healthy Eating Index (AHEI)-2010 score and ten nutrient variables were evaluated. Linear regression analyses between z score transformed BMI (Z-BMI) and dietary factors were performed. Interaction analyses were performed by introducing the interaction term (diet x SNP) in the same regression model. Analysis was carried out in each cohort individually and subsequently meta-analyzed using the inverse-variance weighted method. Analyses were also evaluated with a weighted gene-risk score (wGRS) contructed by BMI index SNPs from recent large-scale GWAS studies. Nominal associations between Z-BMI and AHEI-2010 and some dietary factors were identified (P = 0.047-0.010). The BMI wGRS was robustly associated with Z-BMI (P = 1.55 × 10 - 15 ) but not with any dietary variables. Dietary variables did not significantly interact with the wGRS to modify BMI associations. When interaction analyses were repeated using individual SNPs, a significant association between cholesterol intake and rs4740619 (CCDC171) was identified (β = 0.077, adjP interaction = 0.043). The CCDC171 gene locus may interact with cholesterol intake to increase BMI in the Singaporean Chinese population, however most known obesity risk loci were not associated with dietary intake and did not interact with diet to modify BMI levels.
Banu, Ancuta; Șerban, Costela; Pricop, Marius; Urechescu, Horatiu; Vlaicu, Brigitha
2018-05-03
Self-perception of oral health status is a multidimensional construct that includes psychological, psychosocial and functional aspects of oral health. Contemporary concepts suggest that the evaluation of health needs should focus on clinical standards and socio-dental indicators that measure the impact of health/disease on the individual quality of life. Oral health cannot be dissociated from general health. This study evaluates a possible association between oral health status, body size, self-perception of oral health, self-perception of body size and dissatisfaction with body image in prepubertal children with mixed dentition, targeting the completion of children's health status assessment which will further allow the identification of individuals at risk and could be further used as an evaluation of the need for specific interventions. The present study is cross-sectional in design and uses data from 710 pre-pubertal children with mixed dentition. The outcome variables comprised one item self-perception of oral health: dmft/DMFT Index and Dental Aesthetic Index, body size, self-assessed body size and desired body size. Multiple logistic regression analyses were performed. The level of significance was set at 5%. More than a half (53.1%) of the participants with mixed dentition reported that their oral health was excellent or very good. In the unadjusted model, untreated decayed teeth, dmft score and body dissatisfaction levels had a significant contribution to poor self-perception of oral health, but after adjustment for gender, BMI status, dmft score, DMFT score and DAI score, only untreated decayed teeth OR = 1.293, 95%CI (1.120-1.492) and higher body dissatisfaction levels had a significant contribution. It was concluded that the need for dental treatment influenced self-perception of oral health in prepubertal children with mixed dentition, especially with relation to untreated decayed teeth. Since only body dissatisfaction levels, but not BMI, were
Relationship between BMI and blood pressure in girls and boys.
Gundogdu, Zuhal
2008-10-01
To investigate the relationship between BMI and blood pressure as this is of crucial interest in evaluating both public health and the clinical impact of the so-called obesity epidemic. Data were gathered from 1899 children aged between 6 and 14 years, analysing and evaluating a possible relationship between BMI and systolic and diastolic blood pressure values for both girls and boys. Each child was classified on the basis of age- and sex-specific BMI percentile as normal weight (<85th percentile), overweight (95th percentile). In comparisons among age BMI percentile groups, systolic and diastolic blood pressure values were higher in obese and overweight groups than in normal weight groups for both sexes. Although BMI among girls was higher than among boys in all three percentile groups, there were no significant differences between sexes with respect to blood pressure values. The present findings emphasize the importance of the prevention of obesity in order to prevent future related problems such as hypertension in children and adolescents.
De Lorme, Kayla C; Sisk, Cheryl L
2016-10-15
Social proficiency requires making appropriate behavioral adaptations as a result of social experience. For example, male rodents become sexually proficient with experience as demonstrated by a reduction in ectopic (misdirected) mounts, mount-to-intromission ratio, and latency to ejaculation. We previously found that over a series of timed tests with a receptive female, male hamsters deprived of testosterone specifically during puberty (NoT@P) have overall lower levels of sexual behavior and continue to display high levels of ectopic mounts, compared with males that experienced endogenous testosterone during puberty (T@P). These results suggested that pubertal testosterone programs sexual proficiency in adulthood, but because NoT@P males engaged in less sexual behavior than T@P males in these tests, the amount of sexual experience may have been insufficient to improve sexual proficiency. To more rigorously test the hypothesis that pubertal testosterone is necessary for social proficiency in adulthood, the present study compared the behavior of NoT@P and T@P males in a series of 4 trials with a 48-h interval between each trial. Sexual experience was equated by limiting each trial to 5 intromissions. Sexually-naïve males were either gonadectomized prepubertally (NoT@P) or in adulthood (T@P) and received subcutaneous testosterone capsules four weeks later. Two weeks after testosterone replacement, these groups and a group of adult gonad-intact controls began sexual behavior testing. We found that NoT@P males had more ectopic mounts/min across all four tests compared to gonad-intact and T@P males. Moreover, both gonad-intact and T@P males, but not NoT@P males, showed an increase in the number of mounts and intromissions/min between trials 1 and 3. Unexpectedly, both gonad-intact and T@P, but not NoT@P, males showed a decrease in sexual behaviors during trial 4. Thus, T@P males display multiple behavioral adaptations to sexual experience that are not observed in No
Leptin levels in children and adults with classic galactosaemia.
LENUS (Irish Health Repository)
Knerr, Ina
2012-11-07
Among the long-term complications of Classic Galactosaemia (Gal) is premature ovarian insufficiency (POI) in female patients with subtle abnormalities of reproductive function also reported in male patients. Leptin is a circulating hormone which reflects body energy stores and which affects the neuroendocrine reproductive axis and pubertal development.We measured serum leptin in 28 children (10 girls, 18 boys; mean age 7.6 years, range 0.5-17.9 years) and in 22 adults (10 females, 12 males; mean age 23.9 years, range 18-37 years) with Gal on a strict galactose-restricted diet in comparison with control data.Leptin levels (expressed as SDS for gender and pubertal stage) were lower in Gal children than controls (mean leptin-SDS = -0.71 for girls, p < 0.05, -0.97 for boys compared with SDS = 0 for controls, p < 0.05). In an age-related analysis, leptin levels did not correlate with age in children with Gal for both sexes as it did for matched controls.As expected, females had higher leptin levels than males in either group. In adults with Gal, leptin concentrations were within normal limits for both sexes when adjusted for gender and BMI. There was a linear relationship between log-leptin and BMI in children with Gal and in controls. For Gal women, log-leptin was also associated with BMI. However, for Gal men, and hence for the entire group of adult Gal patients, this association between log-leptin and BMI was not detectable. Our findings suggest that leptin dysregulation may play a role in fertility issues in individuals with Gal from an early age.
Self-control mediates the relationship between time perspective and BMI.
Price, Menna; Higgs, Suzanne; Lee, Michelle
2017-01-01
Trait future time perspective measures the extent to which behaviour is dominated by a striving for future goals and rewards. Trait present time perspective measures orientation towards immediate pleasure. Previous research has explored the relationship between future and present time perspective and BMI with mixed findings. In addition, the psychological mechanism underlying this relationship is unclear. Self-control is a likely candidate, as it has been related to both BMI and time perspective, but the relationship between all of these concepts has not been examined in a single study. Therefore, the aim of this study was to examine if trait self-control mediates the relationship between time perspective (future and present) and BMI. Self-report time perspective (ZTPI), self-control (SCS) and height/weight data were collected using an online survey from a mixed student and community sample (N = 218) with wide ranging age (mean 29, SD 11, range 18-73 years) and BMI (mean 24, SD 4, range 15-43). The results of a structural equation model including both facets of time perspective suggested that the traits are related yet distinct measures that independently predict BMI through changes in self-control. Bootstrap mediation analysis showed that self-control mediated the relationship between both future time perspective (95% CI, -0.10 to -0.02) and present time perspective (95% CI, 0.03 to 0.17), and BMI in opposite directions. Participants with higher future time perspective scores (higher present time perspective scores) had higher (lower) self-control, which predicted lower (higher) BMI. These results are consistent with previous research suggesting an important role for time perspective in health outcomes. Self-control likely mediates the relationship between temporal perspectives and BMI, suggesting that time perspective may be a target for individualised interventions. Copyright © 2016 Elsevier Ltd. All rights reserved.
Natsuaki, Misaki N.; Klimes-Dougan, Bonnie; Ge, Xiaojia; Shirtcliff, Elizabeth A.; Hastings, Paul D.; Zahn-Waxler, Carolyn
2009-01-01
An accumulating body of literature has shown a link between early pubertal maturation and internalizing problems, particularly among girls. Our knowledge is, however, limited with regard to what accounts for this association. Based on a hypothesis that early maturing girls have heightened stress sensitivity that increases the risk of internalizing…
Lower Bmi-1 Expression May Predict Longer Survival of Colon Cancer Patients
Directory of Open Access Journals (Sweden)
Xiaodong Li
2016-11-01
Full Text Available Background: This study aimed to investigate the Bmi-1 expression and the clinical significance in colon cancer (CC. Patients and Methods: Bmi-1 expression in tumor tissue and the corresponding normal tissue was detected using immunohistological staining. The correlations between Bmi-1 expression and clinicopathological characteristics and the overall survival (OS time were analyzed. Results: The median H-scores of Bmi-1 in CC tissues and the corresponding tissues were 80.0 (0-270 and 5.0 (0-90, with no statistically significant difference (Z=-13.7, PP = 0.123. The survival rates of patients with low Bmi-1 expression were higher than those of patients with high Bmi-1 expression but the differences were not statistically significant. Conclusion: Bmi-1 expression in CC tissue is significantly higher than that in corresponding normal tissue. While there may be a trend towards improved survival, this is not statistically significant.
Alternative regression models to assess increase in childhood BMI.
Beyerlein, Andreas; Fahrmeir, Ludwig; Mansmann, Ulrich; Toschke, André M
2008-09-08
Body mass index (BMI) data usually have skewed distributions, for which common statistical modeling approaches such as simple linear or logistic regression have limitations. Different regression approaches to predict childhood BMI by goodness-of-fit measures and means of interpretation were compared including generalized linear models (GLMs), quantile regression and Generalized Additive Models for Location, Scale and Shape (GAMLSS). We analyzed data of 4967 children participating in the school entry health examination in Bavaria, Germany, from 2001 to 2002. TV watching, meal frequency, breastfeeding, smoking in pregnancy, maternal obesity, parental social class and weight gain in the first 2 years of life were considered as risk factors for obesity. GAMLSS showed a much better fit regarding the estimation of risk factors effects on transformed and untransformed BMI data than common GLMs with respect to the generalized Akaike information criterion. In comparison with GAMLSS, quantile regression allowed for additional interpretation of prespecified distribution quantiles, such as quantiles referring to overweight or obesity. The variables TV watching, maternal BMI and weight gain in the first 2 years were directly, and meal frequency was inversely significantly associated with body composition in any model type examined. In contrast, smoking in pregnancy was not directly, and breastfeeding and parental social class were not inversely significantly associated with body composition in GLM models, but in GAMLSS and partly in quantile regression models. Risk factor specific BMI percentile curves could be estimated from GAMLSS and quantile regression models. GAMLSS and quantile regression seem to be more appropriate than common GLMs for risk factor modeling of BMI data.
Gordon, Elizabeth A; Corbitt, Cynthia
2015-08-01
Sex differences in social behaviors exist in mammals during adulthood, and further evidence suggests that sex differences in behavior are present before sexual maturity. In order to model behavioral disorders in animals, it is important to assess baseline sex-related behavioral differences, especially when studying disorders for which sex-related behavioral effects are expected. We investigated the effect of sex on behavior in 3 strains of pre-pubertal mice (C57BL/6, CFW, and CF1) using a wheel-running assay. We found no significant sex differences in latency to run on the wheel or total duration of wheel running within each strain. During the social interaction test, there were no differences between sexes in latency or total duration of contact or following between a subject and novel mouse. We also evaluated behavioral patterns of wheel running and stereotypical behaviors, such as burrowing and grooming. Both sexes showed characteristic wheel running behavior, spending the majority of each trial interacting with the wheel when it was free and more time performing other activities ( e.g. , stereotypical behaviors, general locomotion) when it was jammed. These results provide evidence that, among various strains of pre-pubertal mice, baseline sex-related behavioral differences are not strong enough to influence the measured behaviors.
Prognostic relevance of Bmi-1 expression and autoantibodies in esophageal squamous cell carcinoma
International Nuclear Information System (INIS)
Liu, Wan-li; Li, Man-zhi; Song, Li-bing; Zeng, Mu-sheng; Guo, Xian-zhi; Zhang, Lan-jun; Wang, Jun-ye; Zhang, Ge; Guan, Su; Chen, Yu-min; Kong, Qing-li; Xu, Li-hua
2010-01-01
Overexpression of Bmi-1 has been observed in a variety of cancers, and it has been suggested to be an independent prognostic marker for the patients. The objective of this study was to determine the level of Bmi-1 expression or its autoantibodies in human esophageal squamous cell carcinoma (ESCC) and to correlate it with clinicopathologic data. We first examined Bmi-1 expression in ESCC cell lines and tumor samples by RT-PCR and Western blot analysis. We then analyzed Bmi-1 protein expression in 171 clinicopathologically characterized ESCC cases by immunohistochemistry. In addition, we detected its autoantibodies in sera of patients with ESCC by ELISA. We found that Bmi-1 expression was higher in the immortalized cells, cancer cell lines and most cancer tissue than in non-tumorous control tissue at both mRNA and protein level. In addition, Bmi-1 expression was observed in 64.3% (110 of 171) archive ESCC specimen by immunohistochemistry analysis, and the location of Bmi-1 in ESCC was in the nuclei instead of cytoplasm of tumor cells. There was a significant difference of Bmi-1 expression in patients categorized according to stage (P = 0.003) and pN classification (P = 0.047). Multivariate analysis suggested that Bmi-1 expression was an independent prognostic marker for ESCC patients. A prognostic significance of Bmi-1 was also found in the subgroup of T3~T4 and N1 tumor classification. Bmi-1 autoantibodies were detected in sera of 39.0% (62 of 159) ESCC patients. The correlations between anti-Bmi-1 antibodies and tumor stage (P = 0.040), or lymph node status (P < 0.001) were significant. Our results suggest that Bmi-1 protein is a valuable marker of ESCC progression. The presence of Bmi-1 autoantibodies in sera from patients with ESCC may have clinical utility in esophageal cancer diagnosis
Dinner rituals that correlate with child and adult BMI.
Wansink, Brian; van Kleef, Ellen
2014-05-01
What predicts whether a child will be at risk for obesity? Whereas past research has focused on foods, eating habits, feeding styles, and family meal patterns, this study departs from a food-centric approach to examine how various dinner rituals might influence the BMIs of children and adults. In this study of 190 parents (BMI = 29.1 ± 7.2) and 148 children (BMI = 20.3 ± 4.4), the relationship between their BMIs and everyday family dinner rituals was examined using both correlation and regression analysis (controlled for educational level of parents). Families who frequently ate dinner in the kitchen or dining room had significantly lower BMIs for both adults (r = -0.31) and children (r = -0.24) compared to families who ate elsewhere. Additionally, helping cook dinner was associated with higher BMI for girls (r = 0.26), and remaining at the table until everyone is finished with eating was associated with lower BMI for boys (r = -0.31). Dinner tables may be one place where social support and family involvement meet-both of which relate to the BMI of children as well as parents. Family meals and their rituals might be an underappreciated battleground to fight obesity. Copyright © 2013 The Obesity Society.
Directory of Open Access Journals (Sweden)
Abigail R Dowling
Full Text Available Polycystic ovary syndrome (PCOS is the most common endocrine disorder of reproductive age women. The syndrome is caused by a combination of environmental influences and genetic predisposition. Despite extensive efforts, the heritable factors contributing to PCOS development are not fully understood. The objective of this study was to test the hypothesis that genetic background contributes to the development of a PCOS-like reproductive and metabolic phenotype in mice exposed to excess DHEA during the pubertal transition. We tested whether the PCOS phenotype would be more pronounced on the diabetes-prone C57BL/6 background than the previously used strain, BALB/cByJ. In addition, we examined strain-dependent upregulation of the expression of ovarian and extra-ovarian candidate genes implicated in human PCOS, genes containing known strain variants, and genes involved with steroidogenesis or insulin sensitivity. These studies show that there are significant strain-related differences in metabolic response to excess androgen exposure during puberty. Additionally, our results suggest the C57BL/6J strain provides a more robust and uniform experimental platform for PCOS research than the BALB/cByJ strain.
Dowling, Abigail R; Nedorezov, Laura B; Qiu, Xiaoliang; Marino, Joseph S; Hill, Jennifer W
2013-01-01
Polycystic ovary syndrome (PCOS) is the most common endocrine disorder of reproductive age women. The syndrome is caused by a combination of environmental influences and genetic predisposition. Despite extensive efforts, the heritable factors contributing to PCOS development are not fully understood. The objective of this study was to test the hypothesis that genetic background contributes to the development of a PCOS-like reproductive and metabolic phenotype in mice exposed to excess DHEA during the pubertal transition. We tested whether the PCOS phenotype would be more pronounced on the diabetes-prone C57BL/6 background than the previously used strain, BALB/cByJ. In addition, we examined strain-dependent upregulation of the expression of ovarian and extra-ovarian candidate genes implicated in human PCOS, genes containing known strain variants, and genes involved with steroidogenesis or insulin sensitivity. These studies show that there are significant strain-related differences in metabolic response to excess androgen exposure during puberty. Additionally, our results suggest the C57BL/6J strain provides a more robust and uniform experimental platform for PCOS research than the BALB/cByJ strain.
A comparison of chewing rate between overweight and normal BMI individuals.
White, Amy Kristin; Venn, Bernard; Lu, Louise Weiwei; Rush, Elaine; Gallo, Luigi Maria; Yong, Janet Lee Ching; Farella, Mauro
2015-06-01
Previous attempts to identify an 'obese eating style' have led to conflicting findings. This observational study compared the chewing features of overweight or obese young adults with those of normal range BMI. We hypothesised that chewing features are individual-specific and differ between participants of a normal BMI and high BMI. Fourteen overweight to obese participants (BMI≥25.0) were pairwise matched with 14 normal range BMI participants (18.5chewing episodes, including rate, duration, and power. Masticatory performance was assessed by a sieve test and was expressed as the percentage of particles ≤2mm after a standardised chewing test. Regardless of the meal, chewing rate was remarkably consistent among participants (ICC=0.89; 95% CI=0.79-0.94). Chewing rate did not differ between high and normal BMI participants (p>0.05), whereas chewing power was significantly higher in high BMI participants (pchewing characteristics were found between BMI groups. Participants chewed at similar rate in the natural environment (pizza) and in the laboratory (rice) setting (p>0.05). Masticatory performance did not differ significantly (p>0.05) between the high (55.9%) and normal (52.4%) BMI groups. Within the limitations of the present study, chewing characteristics appear to be individual-specific with wide variability. Overweight participants chew at a similar rate to control participants, albeit slightly stronger. Our preliminary findings need to be replicated in larger samples. Copyright © 2015. Published by Elsevier Inc.
Bmi1 confers resistance to oxidative stress on hematopoietic stem cells.
Directory of Open Access Journals (Sweden)
Shunsuke Nakamura
Full Text Available The polycomb-group (PcG proteins function as general regulators of stem cells. We previously reported that retrovirus-mediated overexpression of Bmi1, a gene encoding a core component of polycomb repressive complex (PRC 1, maintained self-renewing hematopoietic stem cells (HSCs during long-term culture. However, the effects of overexpression of Bmi1 on HSCs in vivo remained to be precisely addressed.In this study, we generated a mouse line where Bmi1 can be conditionally overexpressed under the control of the endogenous Rosa26 promoter in a hematopoietic cell-specific fashion (Tie2-Cre;R26Stop(FLBmi1. Although overexpression of Bmi1 did not significantly affect steady state hematopoiesis, it promoted expansion of functional HSCs during ex vivo culture and efficiently protected HSCs against loss of self-renewal capacity during serial transplantation. Overexpression of Bmi1 had no effect on DNA damage response triggered by ionizing radiation. In contrast, Tie2-Cre;R26Stop(FLBmi1 HSCs under oxidative stress maintained a multipotent state and generally tolerated oxidative stress better than the control. Unexpectedly, overexpression of Bmi1 had no impact on the level of intracellular reactive oxygen species (ROS.Our findings demonstrate that overexpression of Bmi1 confers resistance to stresses, particularly oxidative stress, onto HSCs. This thereby enhances their regenerative capacity and suggests that Bmi1 is located downstream of ROS signaling and negatively regulated by it.
Impact of baseline BMI and weight change in CCTG adjuvant breast cancer trials.
Yerushalmi, R; Dong, B; Chapman, J W; Goss, P E; Pollak, M N; Burnell, M J; Levine, M N; Bramwell, V H C; Pritchard, K I; Whelan, T J; Ingle, J N; Shepherd, L E; Parulekar, W R; Han, L; Ding, K; Gelmon, K A
2017-07-01
We hypothesized that increased baseline BMI and BMI change would negatively impact clinical outcomes with adjuvant breast cancer systemic therapy. Data from chemotherapy trials MA.5 and MA.21; endocrine therapy MA.12, MA.14 and MA.27; and trastuzumab HERA/MA.24 were analyzed. The primary objective was to examine the effect of BMI change on breast cancer-free interval (BCFI) landmarked at 5 years; secondary objectives included BMI changes at 1 and 3 years; BMI changes on disease-specific survival (DSS) and overall survival (OS); and effects of baseline BMI. Stratified analyses included trial therapy and composite trial stratification factors. In pre-/peri-/early post-menopausal chemotherapy trials (N = 2793), baseline BMI did not impact any endpoint and increased BMI from baseline did not significantly affect BCFI (P = 0.85) after 5 years although it was associated with worse BCFI (P = 0.03) and DSS (P = 0.07) after 1 year. BMI increase by 3 and 5 years was associated with better DSS (P = 0.01; 0.01) and OS (P = 0.003; 0.05). In pre-menopausal endocrine therapy trial MA.12 (N = 672), patients with higher baseline BMI had worse BCFI (P = 0.02) after 1 year, worse DSS (P = 0.05; 0.004) after 1 and 5 years and worse OS (P = 0.01) after 5 years. Increased BMI did not impact BCFI (P = 0.90) after 5 years, although it was associated with worse BCFI (P = 0.01) after 1 year. In post-menopausal endocrine therapy trials MA.14 and MA.27 (N = 8236), baseline BMI did not significantly impact outcome for any endpoint. BMI change did not impact BCFI or DSS after 1 or 3 years, although a mean increased BMI of 0.3 was associated with better OS (P = 0.02) after 1 year. With the administration of trastuzumab (N = 1395) baseline BMI and BMI change did not significantly impact outcomes. Higher baseline BMI and BMI increases negatively affected outcomes only in pre-/peri-/early post-menopausal trial patients. Otherwise, BMI
The relation between anxiety and BMI - is it all in our curves?
Haghighi, Mohammad; Jahangard, Leila; Ahmadpanah, Mohammad; Bajoghli, Hafez; Holsboer-Trachsler, Edith; Brand, Serge
2016-01-30
The relation between anxiety and excessive weight is unclear. The aims of the present study were three-fold: First, we examined the association between anxiety and Body Mass Index (BMI). Second, we examined this association separately for female and male participants. Next, we examined both linear and non-linear associations between anxiety and BMI. The BMI was assessed of 92 patients (mean age: M=27.52; 57% females) suffering from anxiety disorders. Patients completed the Beck Anxiety Inventory. Both linear and non-linear correlations were computed for the sample as a whole and separately by gender. No gender differences were observed in anxiety scores or BMI. No linear correlation between anxiety scores and BMI was observed. In contrast, a non-linear correlation showed an inverted U-shaped association, with lower anxiety scores both for lower and very high BMI indices, and higher anxiety scores for medium to high BMI indices. Separate computations revealed no differences between males and females. The pattern of results suggests that the association between BMI and anxiety is complex and more accurately captured with non-linear correlations. Copyright © 2015 Elsevier Ireland Ltd. All rights reserved.
Shelton, Katherine H.; Van Den Bree, Marianne B. M.
2010-01-01
This prospective, longitudinal study investigated the moderating role of pubertal timing on reciprocal links between adolescent appraisals of parent-child relationship quality and girls' (N = 1,335) and boys' (N = 1,203) cigarette and alcohol use across a 12-month period. Reciprocal effects were found between parent-child relations and on-time…
Body size estimation of self and others in females varying in BMI.
Directory of Open Access Journals (Sweden)
Anne Thaler
Full Text Available Previous literature suggests that a disturbed ability to accurately identify own body size may contribute to overweight. Here, we investigated the influence of personal body size, indexed by body mass index (BMI, on body size estimation in a non-clinical population of females varying in BMI. We attempted to disentangle general biases in body size estimates and attitudinal influences by manipulating whether participants believed the body stimuli (personalized avatars with realistic weight variations represented their own body or that of another person. Our results show that the accuracy of own body size estimation is predicted by personal BMI, such that participants with lower BMI underestimated their body size and participants with higher BMI overestimated their body size. Further, participants with higher BMI were less likely to notice the same percentage of weight gain than participants with lower BMI. Importantly, these results were only apparent when participants were judging a virtual body that was their own identity (Experiment 1, but not when they estimated the size of a body with another identity and the same underlying body shape (Experiment 2a. The different influences of BMI on accuracy of body size estimation and sensitivity to weight change for self and other identity suggests that effects of BMI on visual body size estimation are self-specific and not generalizable to other bodies.
Body size estimation of self and others in females varying in BMI.
Thaler, Anne; Geuss, Michael N; Mölbert, Simone C; Giel, Katrin E; Streuber, Stephan; Romero, Javier; Black, Michael J; Mohler, Betty J
2018-01-01
Previous literature suggests that a disturbed ability to accurately identify own body size may contribute to overweight. Here, we investigated the influence of personal body size, indexed by body mass index (BMI), on body size estimation in a non-clinical population of females varying in BMI. We attempted to disentangle general biases in body size estimates and attitudinal influences by manipulating whether participants believed the body stimuli (personalized avatars with realistic weight variations) represented their own body or that of another person. Our results show that the accuracy of own body size estimation is predicted by personal BMI, such that participants with lower BMI underestimated their body size and participants with higher BMI overestimated their body size. Further, participants with higher BMI were less likely to notice the same percentage of weight gain than participants with lower BMI. Importantly, these results were only apparent when participants were judging a virtual body that was their own identity (Experiment 1), but not when they estimated the size of a body with another identity and the same underlying body shape (Experiment 2a). The different influences of BMI on accuracy of body size estimation and sensitivity to weight change for self and other identity suggests that effects of BMI on visual body size estimation are self-specific and not generalizable to other bodies.
Associations between Three School-Based Measures of Health: Is BMI Enough?
Morgan, Emily H.; Houser, Robert F.; Au, Lauren E.; Sacheck, Jennifer M.
2013-01-01
School-based body mass index (BMI) notification programs are often used to raise parental awareness of childhood overweight and obesity, but how BMI results are associated with physical fitness and diet is less clear. This study examined the relationship between BMI, fitness, and diet quality in a diverse sample of urban schoolchildren…
Community-Specific BMI Cutoff Points for South Indian Females
Directory of Open Access Journals (Sweden)
K. B. Kishore Mohan
2011-01-01
Full Text Available Objective. To analyze multiparameters related to total body composition, with specific emphasis on obesity in South Indian females, in order to derive community-specific BMI cutoff points. Patients and Methods. A total number of 87 females (of age 37.33±13.12 years from South Indian Chennai urban population participated in this clinical study. Body composition analysis and anthropometric measurements were acquired after conducting careful clinical examination. Results. BMI demonstrated high significance when normal group (21.02±1.47 kg/m2 was compared with obese group (29.31±3.95 kg/m2, <0.0001. BFM displayed high significance when normal group (14.92±4.28 kg was compared with obese group (29.94 ± 8.1 kg, <0.0001. Conclusion. Community-specific BMI cutoffs are necessary to assess obesity in different ethnic groups, and relying on WHO-based universal BMI cutoff points would be a wrong strategy.
EFFECT OF GnRH AND PHOSPHORUS IN DELAYED PUBERTAL SURTI BUFFALO HEIFERS
Directory of Open Access Journals (Sweden)
H.B. Dhamsaniya
2016-06-01
Full Text Available The study was conducted on eighteen delayed pubertal Surti buffalo heifers, divided into three equal groups (6 in each to evaluate the efficacy of GnRH alone and in combination of phosphorus. The buffalo heifers in Group-I and Group-II were treated with Buserelin acetate (5 ml, IM. Buffalo heifers in Group-II also received additional injection of Toldimphos sodium (10 ml, IM at 3 day interval for 4 times, while buffalo heifers in Group-III served as control. The percentage of induced estrus was highest (83.33% in each treated groups as compared to control group (50%. The mean estrus induction intervals were significantly (P<0.05 shorter in Group-I (20.20 ± 2.18 days and Group-II (18.80 ± 2.32 days as compared to control group (30.24 ± 0.81 days. The conception rate at induced estrus was highest in Group-II (50% followed by Group-I (33.33%. The plasma progesterone levels being significantly lowest on the day of estrus (less than 0.5 ng/ml as compared to pre-treatment days in all groups. The mean total protein and triglycerides levels were differed significantly between the groups on the day of estrus and being significantly higher in Group-II as compared to Group-I and III on that day. A significantly higher level of cholesterol in both treatment groups as compared to the control group during different intervals and also being higher on the day of estrus as compared to pre-treatment days. The mean plasma glucose levels were differed nonsignificantly between and within the treatment and control groups. It is concluded that estrus can be successfully induced in delayed pubertal heifers with the use of GnRH alone and in combination with phosphorus.
BMI is not a good indicator for metabolic risk in adolescent girls
BMI (kg/m2) does not provide information about body fat percentile.Adolescents with BMI girls with low BMI can have high body fat percentile. We hypothesized that these girls are already insulin resi...
Young, B E; Patinkin, Z; Palmer, C; de la Houssaye, B; Barbour, L A; Hernandez, T; Friedman, J E; Krebs, N F
2017-09-01
The impact of maternal BMI and insulin sensitivity on bioactive components of human milk (HM) is not well understood. As the prevalence of obesity and diabetes rises, it is increasingly critical that we understand how maternal BMI and hormones associated with metabolic disease relate to concentrations of bioactive components in HM. This longitudinal cohort design followed 48 breastfeeding mothers through the first four months of lactation, collecting fasting morning HM samples at 2-weeks and 1, 2, 3 and 4-months, and fasting maternal blood at 2-weeks and 4-months. Insulin, glucose, adipokines leptin and adiponectin, appetite regulating hormone ghrelin, marker of oxidative stress 8OHdG and inflammatory cytokines (IL-6, IL-8, and TNF-a) were measured in HM and maternal plasma. A total of 26 normal weight (NW) (BMI=21.4±2.0 kg/m 2 ) and 22 overweight/obese (OW/Ob) (BMI=30.4±4.2 kg/m 2 ) were followed. Of all HM analytes measured, only insulin and leptin were different between groups - consistently higher in the OW/Ob group (leptin: P<0.001; insulin: P<0.03). HM insulin was 98% higher than maternal plasma insulin at 2-weeks and 32% higher at 4-months (P<0.001). Maternal fasting plasma insulin and HOMA-IR were positively related to HM insulin at 2-weeks (P<0.001, R 2 ⩾0.38, n=31), and 4-months (P⩽0.005, R 2 ⩾0.20, n=38). The concentrations of insulin in HM are higher than in maternal plasma and are related to maternal BMI and insulin sensitivity. With the exception of leptin, there were minimal other differences observed in HM composition across a wide range in maternal BMI.
Niklowitz, Petra; Rothermel, Juliane; Lass, Nina; Barth, Andre; Reinehr, Thomas
2018-05-01
This study analyzed the relationships between bioactive leptin, conventionally measured leptin, and parameters of fat mass and distribution in obese children before and after weight reduction. We determined bioactive leptin (bioLep), conventional measured leptin (conLep), weight, height, body fat based on skinfold measurements and bioimpedance analyses, waist circumference (wc), and pubertal stage in 88 obese children participating in a lifestyle intervention at baseline and one year later. We identified no child with homozygous or heterozygous status for bioinactive leptin mutations. The baseline associations between bioLep and BMI (r = 0.53), BMI-SDS (r = 0.48), body fat (bioimpedance: r = 0.61, skinfold thickness: r = 0.49), wc (r = 0.42), and waist to height ratio (whr) (r = 0.39) were stronger than the associations between conLep and BMI (r = 0.50), BMI-SDS (r = 0.44), body fat (bioimpedance: r = 0.57, skinfold thickness: r = 0.41), wc (r = 0.41), and whr (r = 0.37). The changes of bioLep were stronger related to changes of BMI-SDS (r = 0.54), body fat (bioimpedance r = 0.59, skinfold thickness: r = 0.37), wc (r = 0.22), and whr (r = 0.21) than the associations between changes of conLep and changes of BMI-SDS (r = 0.48), body fat (bioimpedance: r = 0.56, skinfold thickness: r = 0.43), wc (r = 0.20), and whr (r = 0.20). The same findings were observed in multiple linear regression analyses adjusted to multiple confounders. In contrast to changes of conLep (r = 0.22), the changes of bioLep during intervention were not related to weight regain after the end of intervention. BioLep concentrations did not differ between prepubertal girls and boys, but were higher in pubertal girls compared to pubertal boys (p = 0.031). Bioactive leptin was stronger related to fat mass and distribution compared to conventionally measured leptin. Copyright © 2018 Elsevier B.V. All rights
BMI may underestimate the socioeconomic gradient in true obesity
van den Berg, G.; van Eijsden, M.; Vrijkotte, T. G. M.; Gemke, R. J. B. J.
2013-01-01
Body mass index (BMI) does not make a distinction between fat mass and lean mass. In children, high fat mass appears to be associated with low maternal education, as well as low lean mass because maternal education is associated with physical activity. Therefore, BMI might underestimate true obesity
Relationship of glycemic and triglycerides with BMI in diabetic patients
International Nuclear Information System (INIS)
Parvez, A.; Ihsanullah; Rafiq, A.; Ahmad, N.; Khan, E.H.
2010-01-01
Background: Diabetes mellitus (DM) is a metabolic disorder characterised by chronic hyperglycaemia with disturbances in carbohydrate, fat and protein metabolism arising from defect in insulin secretion or action or both. The clinical guidelines recommend measurement of BMI as vital signs for evaluating the obese and diabetic patients. Methods: This study was carried out on 160 diabetics, which were divided on the basis of BMI into obese (120) and non-obese (40) diabetics from Peshawar district. All patients had their triglycerides and glucose checked after over night fast. Results: The serum triglyceride in diabetics having BMI >30 (obese) was increased as compared to patients having BMI <30 (non-obese). The comparison of serum glucose level in obese diabetics was found to be significantly raised as compared to non-obese diabetics. Conclusions and Recommendations: It was concluded that dyslipidemia is common in all diabetics. The abnormal triglyceride level can improve with good glycemic control, but do not reach the normal state. Good glycaemic control, Reducing BMI, periodic checkups of lipids and blood glucose are recommended for all diabetics in order to avoid complications. (author)
Relationship of glycemic and triglycerides with BMI in diabetic patients
Energy Technology Data Exchange (ETDEWEB)
Parvez, A; Ihsanullah,; Rafiq, A; Ahmad, N; Khan, E H [Khyber Teaching Hospital, Peshawar (Pakistan). Department of Pathology
2010-04-15
Background: Diabetes mellitus (DM) is a metabolic disorder characterised by chronic hyperglycaemia with disturbances in carbohydrate, fat and protein metabolism arising from defect in insulin secretion or action or both. The clinical guidelines recommend measurement of BMI as vital signs for evaluating the obese and diabetic patients. Methods: This study was carried out on 160 diabetics, which were divided on the basis of BMI into obese (120) and non-obese (40) diabetics from Peshawar district. All patients had their triglycerides and glucose checked after over night fast. Results: The serum triglyceride in diabetics having BMI >30 (obese) was increased as compared to patients having BMI <30 (non-obese). The comparison of serum glucose level in obese diabetics was found to be significantly raised as compared to non-obese diabetics. Conclusions and Recommendations: It was concluded that dyslipidemia is common in all diabetics. The abnormal triglyceride level can improve with good glycemic control, but do not reach the normal state. Good glycaemic control, Reducing BMI, periodic checkups of lipids and blood glucose are recommended for all diabetics in order to avoid complications. (author)
Alternative regression models to assess increase in childhood BMI
Directory of Open Access Journals (Sweden)
Mansmann Ulrich
2008-09-01
Full Text Available Abstract Background Body mass index (BMI data usually have skewed distributions, for which common statistical modeling approaches such as simple linear or logistic regression have limitations. Methods Different regression approaches to predict childhood BMI by goodness-of-fit measures and means of interpretation were compared including generalized linear models (GLMs, quantile regression and Generalized Additive Models for Location, Scale and Shape (GAMLSS. We analyzed data of 4967 children participating in the school entry health examination in Bavaria, Germany, from 2001 to 2002. TV watching, meal frequency, breastfeeding, smoking in pregnancy, maternal obesity, parental social class and weight gain in the first 2 years of life were considered as risk factors for obesity. Results GAMLSS showed a much better fit regarding the estimation of risk factors effects on transformed and untransformed BMI data than common GLMs with respect to the generalized Akaike information criterion. In comparison with GAMLSS, quantile regression allowed for additional interpretation of prespecified distribution quantiles, such as quantiles referring to overweight or obesity. The variables TV watching, maternal BMI and weight gain in the first 2 years were directly, and meal frequency was inversely significantly associated with body composition in any model type examined. In contrast, smoking in pregnancy was not directly, and breastfeeding and parental social class were not inversely significantly associated with body composition in GLM models, but in GAMLSS and partly in quantile regression models. Risk factor specific BMI percentile curves could be estimated from GAMLSS and quantile regression models. Conclusion GAMLSS and quantile regression seem to be more appropriate than common GLMs for risk factor modeling of BMI data.
[Effect of anticancer treatment on leptin level, fat body mass (FM) and lean body mass (LBM)].
Krawczyk-Rybak, Maryna; Muszyńska-Rosłan, Katarzyna; Konstantynowicz, Jerzy; Solarz, Elzbieta; Wołczynski, Sławomir; Protas, Piotr
2004-01-01
Leptin plays an important role in the metabolism of adipose tissue. Considering that malignancy and its treatment cans affect normal development in childhood. We analysed the correlations between serum leptin levels and body composition after anticancer treatment. We studied 33 survivors (24 boys and 9 girls) who before our study, have been treated for acute lymphoblastic leukaemia (ALL) (n=23) and Hodgkin disease (n=10) after 7.15+/-3.5 years. Sixteen patients with ALL received cranial irradiation (12Gy). We measured body mass index (BM1) fat mass (FM) and lean body mass (LBM) using dual energy x-ray absorptiometry (DXA). We compared these results to the results obtained from reference values (SD score). Leptin levels were measured with the RIA method. 1. Mean leptin levels were higher in girls after puberty (10.93 ng/mL+/-8.9) than in boys (3.73 ng/mL+/-3. 7). In boys no differences were found in leptin levels between T2-4 and T5 stages. In girls the leptin values increased after puberty. Leptin SD score levels were higher in boys during (1.55 +/-1.0) and after puberty (1.46+/-0.75) and in girls - after puberty (1.19 +/-1.51). We did not find any influence of cranial irradiation (12Gy) or various methotrexate doses (5 g/m(2) vs. 19/m(2)) leptin values. 2. No difference in BMI SD score was found within the whole study group. 3. FM did not change ill boys during and after puberty, although FM SD score were higher during puberty (2.98 +/-4.8). In girls FM and FM SD score were higher after puberty. In boys and girls LBM augmented with pubertal development but LBM SD score in boys were lower after puberty (-1.67 +/-1.7) in comparison to puberty (0.2 +/-1.7). No differences were found between LBM SD score in girls during and after puberty. 4. We found a correlation between leptin levels and BMI (r=0.59 p=0.001) and FM (r=0.77 p=0.0001). 5. Relation of FM to LBM in boys remained unchanged, however in girls it increased within pubertal development. l. Anticancer
Body Mass Index (BMI) and All-Cause Mortality Pooling Project
The BMI and All-Cause Mortality Pooling Project quantified the risk associated with being overweight and the extent to which the relationship between BMI and all-cause mortality varies by certain factors.
Maternal depression and child BMI: longitudinal findings from a US sample.
Duarte, C S; Shen, S; Wu, P; Must, A
2012-04-01
To examine the association between maternal depression and child body mass index (BMI) from Kindergarten (K) to fifth grade. Analysis of four waves of data from the Early Childhood Longitudinal Study - Kindergarten spanning K to fifth grade. Maternal depressive symptoms (MDSs) were measured by a brief version of the Center for Epidemiological Studies Depression scale. Data were analyzed using multiple regression analyses, adjusting for key covariates and potential confounders. The analytic sample was restricted to children of normal birth weight. The relationship between MDS and child BMI varies by child gender and age. Among girls, severe MDS at K was related to lower BMI at third grade (but not later at fifth grade) and to an increase in BMI from K to third and K to fifth grades. Among boys, severe MDS at K was related to higher boys' BMI at fifth grade. When severe MDS occurred at third grade, it was related to higher BMI at fifth grade among girls whereas no statistically significant relationship was found for boys. Low levels of physical activity in comparison to peers at fifth grade and more screen time on weekends at third grade are likely mediators of the relationship between MDS and child BMI among girls, while among boys the relationship appears to be mediated by unhealthy eating habits. Our findings, indicating developmental and gender differences in the relationship between maternal depression and child BMI, if confirmed, suggest that interventions addressing maternal depression may have concomitant impact on childhood obesity. © 2012 The Authors. Pediatric Obesity © 2012 International Association for the Study of Obesity.
Infant BMI peak, breastfeeding, and body composition at age 3 y
DEFF Research Database (Denmark)
Jensen, Signe Marie; Ritz, Christian; Ejlerskov, Katrine Tschentscher
2015-01-01
BACKGROUND: With the increasing focus on obesity, growth patterns in infancy and early childhood have gained much attention. Although the adiposity rebound has been in focus because of a shown association with adult obesity, not much has been published about the infant peak in body mass index (BMI......) cohort were used to estimate BMI growth curves for the age span from 14 d to 19 mo by using a nonlinear mixed-effects model. BMI growth velocity before peak and age and BMI at peak were derived from the subject-specific models. Information about pregnancy and breastfeeding was assessed from background...
Differential models of twin correlations in skew for body-mass index (BMI).
Tsang, Siny; Duncan, Glen E; Dinescu, Diana; Turkheimer, Eric
2018-01-01
Body Mass Index (BMI), like most human phenotypes, is substantially heritable. However, BMI is not normally distributed; the skew appears to be structural, and increases as a function of age. Moreover, twin correlations for BMI commonly violate the assumptions of the most common variety of the classical twin model, with the MZ twin correlation greater than twice the DZ correlation. This study aimed to decompose twin correlations for BMI using more general skew-t distributions. Same sex MZ and DZ twin pairs (N = 7,086) from the community-based Washington State Twin Registry were included. We used latent profile analysis (LPA) to decompose twin correlations for BMI into multiple mixture distributions. LPA was performed using the default normal mixture distribution and the skew-t mixture distribution. Similar analyses were performed for height as a comparison. Our analyses are then replicated in an independent dataset. A two-class solution under the skew-t mixture distribution fits the BMI distribution for both genders. The first class consists of a relatively normally distributed, highly heritable BMI with a mean in the normal range. The second class is a positively skewed BMI in the overweight and obese range, with lower twin correlations. In contrast, height is normally distributed, highly heritable, and is well-fit by a single latent class. Results in the replication dataset were highly similar. Our findings suggest that two distinct processes underlie the skew of the BMI distribution. The contrast between height and weight is in accord with subjective psychological experience: both are under obvious genetic influence, but BMI is also subject to behavioral control, whereas height is not.
Associations between parity and maternal BMI in a population-based cohort study.
Iversen, Ditte S; Kesmodel, Ulrik S; Ovesen, Per G
2018-02-07
We aimed to investigate the change in prevalence of overweight and obesity in pregnant Danish women from 2004 to 2012, and investigate whether increasing parity was associated with a change in body mass index (BMI) prevalence. We obtained a population-based cohort from the Danish Medical Birth Registry consisting of all Danish women giving birth in 2004-2012 (n = 572 321). This registry contains information on 99.8% of all births in Denmark. We calculated the overall change in prepregnancy BMI status among pregnant women in Denmark, and a multiple linear regression model with adjustment for several potential confounders was used to examine the change in prepregnancy BMI with increasing parity. In 2004, the prevalence of prepregnancy overweight and obesity (BMI ≥ 25) and obesity alone (BMI ≥ 30) was 31.9 and 11%, respectively. In 2012, the prevalence had reached 34.2 and 12.8%. The mean BMI increased for every additional parity from 23.80 (95% CI 23.77-23.82) in parity group 1 to 26.70 (26.52-26.90) in parity group 5+. A multiple linear regression adjusted for potential confounders showed that women on average gained 0.62 (0.58-0.65) BMI units after every additional birth. This study showed a 7.2% increase in overweight and obesity (BMI ≥ 25) and a 16.4% increase in obesity alone (BMI ≥ 30) for pregnant women in Denmark from 2004 to 2012. In addition, an increase in interpregnancy BMI was seen at every additional delivery, suggesting that obesity is an increasing challenge in obstetrics. © 2018 Nordic Federation of Societies of Obstetrics and Gynecology.
The effects of breastfeeding on childhood BMI: a propensity score matching approach.
Gibson, Laura A; Hernández Alava, Mónica; Kelly, Michael P; Campbell, Michael J
2017-12-01
Many studies have found a statistical association between breastfeeding and childhood adiposity. This paper investigates whether breastfeeding has an effect on subsequent childhood body mass index (BMI) using propensity scores to account for confounding. We use data from the Millennium Cohort Study, a nationally representative UK cohort survey, which contains detailed information on infant feeding and childhood BMI. Propensity score matching is used to investigate the mean BMI in children breastfed exclusively and partially for different durations of time. We find statistically significant influences of breastfeeding on childhood BMI, particularly in older children, when breastfeeding is prolonged and exclusive. At 7 years, children who were exclusively breastfed for 16 weeks had a BMI 0.28 kg/m2 (95% confidence interval 0.07 to 0.49) lower than those who were never breastfed, a 2% reduction from the mean BMI of 16.6 kg/m2. For this young cohort, even small effects of breastfeeding on BMI could be important. In order to reduce BMI, breastfeeding should be encouraged as part of wider lifestyle intervention. This evidence could help to inform public health bodies when creating public health guidelines and recommendations. © The Author 2016. Published by Oxford University Press on behalf of Faculty of Public Health.
Convergence of BMI1 and CHD7 on ERK Signaling in Medulloblastoma
Directory of Open Access Journals (Sweden)
Sara Badodi
2017-12-01
Full Text Available Summary: We describe molecular convergence between BMI1 and CHD7 in the initiation of medulloblastoma. Identified in a functional genomic screen in mouse models, a BMI1High;CHD7Low expression signature within medulloblastoma characterizes patients with poor overall survival. We show that BMI1-mediated repression of the ERK1/2 pathway leads to increased proliferation and tumor burden in primary human MB cells and in a xenograft model, respectively. We provide evidence that repression of the ERK inhibitor DUSP4 by BMI1 is dependent on a more accessible chromatin configuration in G4 MB cells with low CHD7 expression. These findings extend current knowledge of the role of BMI1 and CHD7 in medulloblastoma pathogenesis, and they raise the possibility that pharmacological targeting of BMI1 or ERK may be particularly indicated in a subgroup of MB with low expression levels of CHD7. : Badodi et al. find convergence of the chromatin modifiers BMI1 and CHD7 in medulloblastoma pathogenesis, and they show that this pathway regulates tumor proliferation and growth via ERK signaling. Keywords: BMI1, CHD7, DUSP4, ERK, medulloblastoma, PcG genes, mouse models, epigenetics, chromatin
Correlation between BMI and motor coordination in children.
Lopes, Vítor P; Stodden, David F; Bianchi, Mafalda M; Maia, Jose A R; Rodrigues, Luis P
2012-01-01
To analyze the association between motor coordination (MC) and body mass index (BMI) across childhood and early adolescence. This study is cross-sectional. Data were collected in 7175 children (boys n=3616, girls n=3559), ages 6-14 years. BMI was calculated from measured height and weight [body mass (kg)/height (m(2))]. Motor coordination was evaluated using Kiphard-Schilling's body coordination test (KTK). Spearman's rank correlation was used to study the association between BMI and MC. A Kruskal-Wallis test was used to analyze the differences in MC between children of normal weight, overweight and obese children. Correlations between MC and BMI were negative and varied between 0.05 and 0.49. The highest negative correlations for both boys and girls was at 11 years of age. There was a general pattern of increasing negative correlations in both genders from 6 to 11 years of age and then a decrease in correlation strengths through 14 years of age. In both boys (χ(2)((2))=324.01; p<0.001) and girls (χ(2)((2))=291.20; p<0.001) there were significant differences in MC between the three groups' weight status. Normal weight children of both sexes demonstrated significantly higher MC scores than overweight. Obese children in both sexes had the lowest MC scores among all three groups. Motor coordination demonstrated an inverse relationship with BMI across childhood and into early adolescence. The strength of the inverse relation increased during childhood, but decreased through early adolescence. Overweight and obese children of both sexes demonstrated significantly lower MC than normal weight children. Copyright © 2011 Sports Medicine Australia. Published by Elsevier Ltd. All rights reserved.
Prenatal androgen excess enhances stimulation of the GNRH pulse in pubertal female rats.
Yan, Xiaonan; Yuan, Chun; Zhao, Nannan; Cui, Yugui; Liu, Jiayin
2014-07-01
In adolescent girls with polycystic ovary syndrome (PCOS), neuroendocrine derangements manifest after the onset of puberty, characterized by rapid LH pulse frequency. The early mechanism underlying the pubertal regulation of the GNRH/LH pulsatile release in adolescents with PCOS remains uncertain. To determine the effects of prenatal androgen exposure on the activation of GNRH neurons and generation of LH pulse at puberty, we administrated 5α-dihydrotestosterone to pregnant rats and observed serum LH levels and expression of hypothalamic genes in female offspring from postnatal 4 to 8 weeks. The 6-week-old prenatally androgenized (PNA) female rats exhibited an increase in LH pulse frequency. The hypothalamic expression of neurokinin B (Nkb (Tac2)) and Lepr mRNA levels in PNA rats increased remarkably before puberty and remained high during puberty, whereas elevated Kiss1 mRNA levels were detected only after the onset of puberty. Exogenous kisspeptin, NK3R agonist, and leptin triggered tonic stimulation of GNRH neurons and increased LH secretion in 6-week-old PNA rats. Leptin upregulated Kiss1 mRNA levels in the hypothalamus of pubertal PNA rats; however, pretreatment with a kisspeptin antagonist failed to suppress the elevated serum LH stimulated by leptin, indicating that the stimulatory effects of leptin may be conveyed indirectly to GNRH neurons via other neural components within the GNRH neuronal network, rather than through the kisspeptin-GPR54 pathway. These findings validate the hypotheses that NKB and leptin play an essential role in the activation of GNRH neurons and initiation of increased LH pulse frequency in PNA female rats at puberty and that kisspeptin may coordinate their stimulatory effects on LH release. © 2014 Society for Endocrinology.
LENUS (Irish Health Repository)
Brestoff, Jonathan R
2011-05-18
Abstract Background Cultural pressures to be thin and tall are postulated to cause people to misreport their body weight and height towards more socially normative (i.e., desirable) values, but a paucity of direct evidence supports this idea. We developed a novel non-linear approach to examining weight, height, and BMI misreporting biases and used this approach to examine the association between socially non-normative weight and misreporting biases in adults. Methods The Survey of Lifestyles, Attitudes, and Nutrition 2007 (SLÁN 2007), a nationally representative survey of the Republic of Ireland (N = 1942 analyzed) was used. Self-reported weight (height) was classified as under-reported by ≥2.0 kg (2.0 cm), over-reported by ≥2.0 kg (2.0 cm), or accurately reported within 2.0 kg (2.0 cm) to account for technical errors of measurement and short-term fluctuations in measured weight (height). A simulation strategy was used to define self-report-based BMI as under-estimated by more than 1.40 kg\\/m2, over-estimated by more than 1.40 kg\\/m2, or accurately estimated within 1.40 kg\\/m2. Patterns of biases in self-reported weight, height, and BMI were explored. Logistic regression was used to identify factors associated with mis-estimated BMI and to calculate adjusted odds ratios (AOR) and 99% confidence intervals (99%CI). Results The patterns of bias contributing the most to BMI mis-estimation were consistently, in decreasing order of influence, (1) under-reported weight combined with over-reported height, (2) under-reported weight with accurately reported height, and (3) accurately reported weight with over-reported height. Average bias in self-report-based BMI was -1.34 kg\\/m2 overall and -0.49, -1.33, and -2.66 kg\\/m2 in normal, overweight, and obese categories, respectively. Despite the increasing degree of bias with progressively higher BMI categories, persons describing themselves as too heavy were, within any given BMI category, less likely to have under
de Souza, Natalia Cavalheri; de Oliveira, Erick Prado
2013-01-01
Background Obesity (abdominal adiposity) is a risk factor for cardiovascular diseases and the most used methods to measure the adiposity are body mass index (BMI), waist circumference (WC), and sagittal abdominal diameter (SAD). Objective To correlate BMI, WC, and SAD with biochemical parameters and blood pressure in adults. Methods A non-experimental exploratory/descriptive and cross sectional study was developed and it was assessed 133 subjects (59 men and 74 women) aging between 18 and 87?...
Directory of Open Access Journals (Sweden)
Hourinaz Behesti
2013-01-01
BMI1 is a potent inducer of neural stem cell self-renewal and neural progenitor cell proliferation during development and in adult tissue homeostasis. It is overexpressed in numerous human cancers – including medulloblastomas, in which its functional role is unclear. We generated transgenic mouse lines with targeted overexpression of Bmi1 in the cerebellar granule cell lineage, a cell type that has been shown to act as a cell of origin for medulloblastomas. Overexpression of Bmi1 in granule cell progenitors (GCPs led to a decrease in cerebellar size due to decreased GCP proliferation and repression of the expression of cyclin genes, whereas Bmi1 overexpression in postmitotic granule cells improved cell survival in response to stress by altering the expression of genes in the mitochondrial cell death pathway and of Myc and Lef-1. Although no medulloblastomas developed in ageing cohorts of transgenic mice, crosses with Trp53−/− mice resulted in a low incidence of medulloblastoma formation. Furthermore, analysis of a large collection of primary human medulloblastomas revealed that tumours with a BMI1high TP53low molecular profile are significantly enriched in Group 4 human medulloblastomas. Our data suggest that different levels and timing of Bmi1 overexpression yield distinct cellular outcomes within the same cellular lineage. Importantly, Bmi1 overexpression at the GCP stage does not induce tumour formation, suggesting that BMI1 overexpression in GCP-derived human medulloblastomas probably occurs during later stages of oncogenesis and might serve to enhance tumour cell survival.
The role of diabetes mellitus and BMI in the surgical treatment of ankle fractures.
Lanzetti, Riccardo Maria; Lupariello, Domenico; Venditto, Teresa; Guzzini, Matteo; Ponzo, Antonio; De Carli, Angelo; Ferretti, Andrea
2018-02-01
Open reduction and internal fixation is the standard treatment for displaced ankle fractures. However, the presence of comorbidities such as diabetes mellitus and body mass index (BMI) are associated with poor bone quality, and these factors may predict the development of postoperative complications. The study aim was to assess the role of diabetes mellitus and BMI in wound healing in patients younger than 65 years who were surgically treated for malleoli fractures. Ninety patients, aged from 18 to 65 years old, with surgically treated ankle fracture, were retrospectively enrolled. Patients were classified in two groups: patient with diabetes and patients without diabetes (insulin-dependent and noninsulin dependent). All patients were assessed for wound complications, Visual Analogue Scale and Foot and Ankle Disability Index (FADI) were assessed for all patients. Logistic regression was used to identify the risk of wound complications after surgery using the following factors as explanatory variables: age, gender, duration of surgery, BMI, hypercholesterolemia, smoking history, diabetes mellitus, and high blood pressure. In total, 38.9% of patients showed wound complications. Of them, 17.1% were nondiabetics and 82.9% were diabetics. We observed a significant association between DM and wound complications after surgery (P = .005). Logistic regression analysis revealed that DM (P BMI (P = .03) were associated with wound complications. The odds of having a postoperative wound complication were increased 0.16 times in the presence of diabetes and 1.14 times for increasing BMI. This study showed that diabetes mellitus and higher BMI delay the wound healing and increase the complication rate in young adult patients with surgically treated bimalleolar fractures. Copyright © 2017 John Wiley & Sons, Ltd.
Slightly increased BMI at young age is a risk factor for future hypertension in Japanese men.
Directory of Open Access Journals (Sweden)
Yuki Someya
Full Text Available Hypertension is developed easily in Asian adults with normal body mass index (BMI (~23 kg/m2, compared with other ethnicities with similar BMI. This study tested the hypothesis that slightly increased BMI at young age is a risk factor for future hypertension in Japanese men by historical cohort study.The study participants were 636 male alumni of the physical education school. They had available data on their physical examination at college age and follow-up investigation between 2007 and 2011. The participants were categorized into six categories: BMI at college age of <20.0 kg/m2, 20.0-21.0kg/m2, 21.0-22.0kg/m2, 22.0-23.0kg/m2, 23.0-24.0kg/m2, and ≥24.0kg/m2, and the incidence of hypertension was compared.This study covered 27-year follow-up period (interquartile range: IQR: 23-31 which included 17,059 person-years of observation. Subjects were 22 (22-22 years old at graduated college, and 49 (45-53 years old at first follow-up investigation. During the period, 120 men developed hypertension. The prevalence rates of hypertension for lowest to highest BMI categories were 9.4%, 14.6%, 16.1%, 17.5%, 30.3%, and 29.3%, respectively (p<0.001 for trend, and their hazard ratios were 1.00 (reference, 1.80 (95%CI: 0.65-4.94, 2.17 (0.83-5.64, 2.29 (0.89-5.92, 3.60 (1.37-9.47 and 4.72 (1.78-12.48, respectively (p<0.001 for trend. This trend was similar after adjustment for age, year of graduation, smoking, current exercise status and current dietary intake.Slightly increased BMI at young age is a risk factor for future hypertension in Japanese men.
Raised BMI cut-off for overweight in Greenland Inuit – a review
Andersen, Stig; Fleischer Rex, Karsten; Noahsen, Paneeraq; Sørensen, Hans Christian Florian; Mulvad, Gert; Laurberg, Peter
2013-01-01
Background Obesity is associated with increased morbidity and premature death. Obesity rates have increased worldwide and the WHO recommends monitoring. A steep rise in body mass index (BMI), a measure of adiposity, was detected in Greenland from 1963 to 1998. Interestingly, the BMI starting point was in the overweight range. This is not conceivable in a disease-free, physically active, pre-western hunter population. Objective This led us to reconsider the cut-off point for overweight among Inuit in Greenland. Design and findings We found 3 different approaches to defining the cut-off point of high BMI in Inuit. First, the contribution to the height by the torso compared to the legs is relatively high. This causes relatively more kilograms per centimetre of height that increases the BMI by approximately 10% compared to Caucasian whites. Second, defining the cut-off by the upper 90-percentile of BMI from height and weight in healthy young Inuit surveyed in 1963 estimated the cut-off point to be around 10% higher compared to Caucasians. Third, if similar LDL-cholesterol and triglycerides are assumed for a certain BMI in Caucasians, the corresponding BMI in Inuit in both Greenland and Canada is around 10% higher. However, genetic admixture of Greenland Inuit and Caucasian Danes will influence this difference and hamper a clear distinction with time. Conclusion Defining overweight according to the WHO cut-off of a BMI above 25 kg/m2 in Greenland Inuit may overestimate the number of individuals with elevated BMI. PMID:23986904
Raised BMI cut-off for overweight in Greenland Inuit – a review
Directory of Open Access Journals (Sweden)
Stig Andersen
2013-08-01
Full Text Available Background. Obesity is associated with increased morbidity and premature death. Obesity rates have increased worldwide and the WHO recommends monitoring. A steep rise in body mass index (BMI, a measure of adiposity, was detected in Greenland from 1963 to 1998. Interestingly, the BMI starting point was in the overweight range. This is not conceivable in a disease-free, physically active, pre-western hunter population. Objective. This led us to reconsider the cut-off point for overweight among Inuit in Greenland. Design and findings. We found 3 different approaches to defining the cut-off point of high BMI in Inuit. First, the contribution to the height by the torso compared to the legs is relatively high. This causes relatively more kilograms per centimetre of height that increases the BMI by approximately 10% compared to Caucasian whites. Second, defining the cut-off by the upper 90-percentile of BMI from height and weight in healthy young Inuit surveyed in 1963 estimated the cut-off point to be around 10% higher compared to Caucasians. Third, if similar LDL-cholesterol and triglycerides are assumed for a certain BMI in Caucasians, the corresponding BMI in Inuit in both Greenland and Canada is around 10% higher. However, genetic admixture of Greenland Inuit and Caucasian Danes will influence this difference and hamper a clear distinction with time. Conclusion. Defining overweight according to the WHO cut-off of a BMI above 25 kg/m2 in Greenland Inuit may overestimate the number of individuals with elevated BMI.
File list: Oth.Neu.10.BMI1.AllCell [Chip-atlas[Archive
Lifescience Database Archive (English)
Full Text Available Oth.Neu.10.BMI1.AllCell hg19 TFs and others BMI1 Neural SRX109477,SRX109480,SRX1094...82,SRX109479 http://dbarchive.biosciencedbc.jp/kyushu-u/hg19/assembled/Oth.Neu.10.BMI1.AllCell.bed ...
File list: Oth.Neu.05.BMI1.AllCell [Chip-atlas[Archive
Lifescience Database Archive (English)
Full Text Available Oth.Neu.05.BMI1.AllCell hg19 TFs and others BMI1 Neural SRX109477,SRX109480,SRX1094...82,SRX109479 http://dbarchive.biosciencedbc.jp/kyushu-u/hg19/assembled/Oth.Neu.05.BMI1.AllCell.bed ...
File list: Oth.Neu.50.BMI1.AllCell [Chip-atlas[Archive
Lifescience Database Archive (English)
Full Text Available Oth.Neu.50.BMI1.AllCell hg19 TFs and others BMI1 Neural SRX109477,SRX109480,SRX1094...82,SRX109479 http://dbarchive.biosciencedbc.jp/kyushu-u/hg19/assembled/Oth.Neu.50.BMI1.AllCell.bed ...
File list: Oth.Neu.20.BMI1.AllCell [Chip-atlas[Archive
Lifescience Database Archive (English)
Full Text Available Oth.Neu.20.BMI1.AllCell hg19 TFs and others BMI1 Neural SRX109477,SRX109480,SRX1094...82,SRX109479 http://dbarchive.biosciencedbc.jp/kyushu-u/hg19/assembled/Oth.Neu.20.BMI1.AllCell.bed ...
Contribution of polycomb homologues Bmi-1 and Mel-18 to medulloblastoma pathogenesis.
Wiederschain, Dmitri; Chen, Lin; Johnson, Brett; Bettano, Kimberly; Jackson, Dowdy; Taraszka, John; Wang, Y Karen; Jones, Michael D; Morrissey, Michael; Deeds, James; Mosher, Rebecca; Fordjour, Paul; Lengauer, Christoph; Benson, John D
2007-07-01
Bmi-1 and Mel-18 are structural homologues that belong to the Polycomb group of transcriptional regulators and are believed to stably maintain repression of gene expression by altering the state of chromatin at specific promoters. While a number of clinical and experimental observations have implicated Bmi-1 in human tumorigenesis, the role of Mel-18 in cancer cell growth has not been investigated. We report here that short hairpin RNA-mediated knockdown of either Bmi-1 or Mel-18 in human medulloblastoma DAOY cells results in the inhibition of proliferation, loss of clonogenic survival, anchorage-independent growth, and suppression of tumor formation in nude mice. Furthermore, overexpression of both Bmi-1 and Mel-18 significantly increases the clonogenic survival of Rat1 fibroblasts. In contrast, stable downregulation of Bmi-1 or Mel-18 alone does not affect the growth of normal human WI38 fibroblasts. Proteomics-based characterization of Bmi-1 and Mel-18 protein complexes isolated from cancer cells revealed substantial similarities in their respective compositions. Finally, gene expression analysis identified a number of cancer-relevant pathways that may be controlled by Bmi-1 and Mel-18 and also showed that these Polycomb proteins regulate a set of common gene targets. Taken together, these results suggest that Bmi-1 and Mel-18 may have overlapping functions in cancer cell growth.
Evaluation of the thyroid blood flow with Doppler ultrasonography in healthy school-aged children
International Nuclear Information System (INIS)
Yazici, Burhan; Simsek, Enver; Erdogmus, Besir; Bahcebasi, Talat; Aktas, Alev; Buyukkaya, Ramazan; Uzun, Hakan; Safak, Alp Alper
2007-01-01
Objective: To determine the relationship between thyroid blood flow and anthropometric measurements, pubertal stage, and thyroid and gonadotropic hormones. Materials and methods: We examined 123 healthy school-aged children prospectively (69 boys (56.1%) and 54 girls (43.9%), 7-17 years old). Their sex, age, body weight, height, body mass index (BMI), and pubertal stage were determined. Serum thyrotropin, free thyroxine, luteinizing hormone, and follicle stimulating hormone were measured in both genders, along with testosterone in boys and estradiol in girls. The peak systolic velocity (PSV), resistance index (RI), and pulsatility index (PI) of the superior thyroid artery were determined. The correlations between the Doppler parameters and these factors were investigated. Results: There were no differences in age, weight, height, BMI, thyroid volume, PSV, RI, or PI between boys and girls (P > 0.05). The PSV and PI showed strong correlations with age, height, weight, puberty stage, thyroid volume, and BMI. The RI showed a strong inverse correlation with age, height, weight, puberty stage, and thyroid volume and a weak inverse correlation with the BMI. Conclusion: Determination of the thyroid arterial flow in normal healthy children is important during a Doppler ultrasound (US) examination. Doppler US parameters and their percentiles should be described in healthy children from different age groups, and these percentiles will aid in interpreting Doppler US in children
Evaluation of the thyroid blood flow with Doppler ultrasonography in healthy school-aged children
Energy Technology Data Exchange (ETDEWEB)
Yazici, Burhan [Department of Radiology, Duzce University School of Medicine, Konuralp, Duzce 81620 (Turkey)], E-mail: dryazici@yahoo.com; Simsek, Enver [Department of Pediatrics, Duzce University School of Medicine, Konuralp, Duzce (Turkey); Erdogmus, Besir [Department of Radiology, Duzce University School of Medicine, Konuralp, Duzce 81620 (Turkey); Bahcebasi, Talat [Department of Public Health, Duzce University School of Medicine, Konuralp, Duzce (Turkey); Aktas, Alev [Department of Pediatrics, Duzce University School of Medicine, Konuralp, Duzce (Turkey); Buyukkaya, Ramazan [Department of Radiology, Duzce University School of Medicine, Konuralp, Duzce 81620 (Turkey); Uzun, Hakan [Department of Pediatrics, Duzce University School of Medicine, Konuralp, Duzce (Turkey); Safak, Alp Alper [Department of Radiology, Duzce University School of Medicine, Konuralp, Duzce 81620 (Turkey)
2007-08-15
Objective: To determine the relationship between thyroid blood flow and anthropometric measurements, pubertal stage, and thyroid and gonadotropic hormones. Materials and methods: We examined 123 healthy school-aged children prospectively (69 boys (56.1%) and 54 girls (43.9%), 7-17 years old). Their sex, age, body weight, height, body mass index (BMI), and pubertal stage were determined. Serum thyrotropin, free thyroxine, luteinizing hormone, and follicle stimulating hormone were measured in both genders, along with testosterone in boys and estradiol in girls. The peak systolic velocity (PSV), resistance index (RI), and pulsatility index (PI) of the superior thyroid artery were determined. The correlations between the Doppler parameters and these factors were investigated. Results: There were no differences in age, weight, height, BMI, thyroid volume, PSV, RI, or PI between boys and girls (P > 0.05). The PSV and PI showed strong correlations with age, height, weight, puberty stage, thyroid volume, and BMI. The RI showed a strong inverse correlation with age, height, weight, puberty stage, and thyroid volume and a weak inverse correlation with the BMI. Conclusion: Determination of the thyroid arterial flow in normal healthy children is important during a Doppler ultrasound (US) examination. Doppler US parameters and their percentiles should be described in healthy children from different age groups, and these percentiles will aid in interpreting Doppler US in children.
Associations between BMI Change and Cardiometabolic Risk in Retired Football Players.
Trexler, Eric T; Smith-Ryan, Abbie E; Defreese, J D; Marshall, Stephen W; Guskiewicz, Kevin M; Kerr, Zachary Y
2018-04-01
Elevated rates of cardiometabolic diseases have been observed in former American football players. The current study sought to determine whether change in body mass index (ΔBMI) after retirement influences the prevalence of CHD, diabetes, or high blood pressure (HBP) in former professional football players. Retired professional football players (n = 3729) were sent a survey with questions regarding health status, playing history, and demographic information. Self-reported BMI at the time of retirement was subtracted from current self-reported BMI to calculate ΔBMI. Prevalence of CHD, diabetes, and HBP were determined by asking participants if they had ever been diagnosed by a health care professional. Binomial regression with a Poisson residual and robust variance estimation was used to compute crude prevalence ratios (PR) and 95% confidence intervals (CI) for each outcome. Adjusted PR values were calculated by adjusting for BMI at the time of retirement, age, years of football experience, race, exercise habits, alcohol use, steroid history, smoking history, and playing position. Complete data were available for 2062 respondents. Prevalence of CHD increased 25%-31% for each five-point increase in ΔBMI after retirement (crude PR = 1.25, 95% CI = 1.03-1.52, P = 0.026; adjusted PR = 1.31, 95% CI = 1.11-1.55, P = 0.001). Diabetes prevalence increased 69%-88% for each five-point ΔBMI increase (crude = 1.88, 95% CI = 1.45-2.44, P football players.
Montazeri, Parisa; Vrijheid, Martine; Martinez, David; Basterrechea, Mikel; Fernandez-Somoano, Ana; Guxens, Monica; Iñiguez, Carmen; Lertxundi, Aitana; Murcia, Mario; Tardon, Adonina; Sunyer, Jordi; Valvi, Damaskini
2018-03-01
The objective of this study was to evaluate the associations between maternal metabolic parameters and early childhood BMI trajectories. Two thousand two hundred fifty-one children born in Spain between 2004 and 2008 were analyzed. Five BMI z score trajectories from birth to age 4 years were identified by using latent class growth analysis. Multinomial regression assessed the associations between maternal metabolic parameters and offspring's BMI trajectories. Children in the reference BMI trajectory had average size at birth followed by a slower BMI gain. Maternal prepregnancy obesity was associated with trajectories of accelerated BMI gain departing from either higher (relative risk ratio [RRR] = 1.77; 95% CI: 1.07-2.91) or lower size at birth (RRR = 1.91; 95% CI: 1.17-3.12). Gestational weight gain (GWG) above clinical guidelines was associated with a trajectory of higher birth size followed by accelerated BMI gain (RRR = 2.14; 95% CI: 1.53-2.97). Maternal serum triglycerides were negatively associated with BMI trajectories departing from lower birth sizes. Gestational diabetes, maternal serum cholesterol, and C-reactive protein were unrelated to children's BMI trajectories. Maternal prepregnancy obesity, GWG, and serum triglycerides are associated with longitudinal BMI trajectories in early childhood that may increase disease risk in later life. Health initiatives should promote healthy weight status before and during pregnancy to improve maternal and child health. © 2018 The Obesity Society.
Folkvord, Frans; Anschütz, Doeschka J; Buijzen, Moniek
2016-02-09
Previous studies have focused on the acute effects of food advertisements on the caloric intake of children; however, the long-term effects of this food cue reactivity on weight gain have not been examined. The main aim of this study was to explore if reactivity to food cues in an advertisement was associated with weight status two years later. Children wo had previously taken part in an experiment investigating the impact of advergames on food intake had their height and weight re-measured two years later, for assessment of body mass index (BMI). A within-subject design was used to test the associations between food choices and BMI over time. In the previous experiment, children played an advergame that promoted energy-dense snacks, fruit, or nonfood products, or did not play an advergame (control condition). After playing the game, the free intake of energy-dense snacks and fruits was measured. Children who ate more apple after playing an advergame promoting energy-dense snacks had a lower BMI two years later. Consumption of energy-dense snacks after playing an advergame promoting energy-dense snacks was not associated with BMI two years later. In other condition, no association was found between food intake and BMI after two years . The findings suggest that coping with environmental cues that trigger unhealthy eating behavior is associated with the body mass index of young children two years later. This might imply that learning to respond to food cues by choosing healthy options might prevent children from excessive weight gain. This trial was registered at as ISRCTN17013832 .
Genital Involvement In Pre-Pubertal Pediatric Population: A Rare Aspect of Crohn’s Disease
Directory of Open Access Journals (Sweden)
Qurratul Ann Warsi
2016-09-01
Full Text Available Crohn’s disease is an inflammatory bowel disease (IBD, characterized by chronic intestinal inflammation that causes the loss of immune tolerance leading to bizarre inflammatory signals and disruption of mucosal barriers. Environmental triggers and interaction of genetic determinants also play an indispensible role. In this case report, we present a pre-pubertal girl with intermittent and refractory genital swelling. We emphasize that Crohn’s disease must be considered in the differential diagnosis of recurrent, non-tender, erythematous and edematous lesions of the genital area. We conclude with future directions for diagnosing and managing vulvar Crohn’s disease in pediatric population.
BMI in relation to sperm count
DEFF Research Database (Denmark)
Sermondade, N; Faure, C; Fezeu, L
2013-01-01
BACKGROUND The global obesity epidemic has paralleled a decrease in semen quality. Yet, the association between obesity and sperm parameters remains controversial. The purpose of this report was to update the evidence on the association between BMI and sperm count through a systematic review...... with meta-analysis. METHODS A systematic review of available literature (with no language restriction) was performed to investigate the impact of BMI on sperm count. Relevant studies published until June 2012 were identified from a Pubmed and EMBASE search. We also included unpublished data (n = 717 men...... studies were included in the meta-analysis, resulting in a sample of 13 077 men from the general population and attending fertility clinics. Data were stratified according to the total sperm count as normozoospermia, oligozoospermia and azoospermia. Standardized weighted mean differences in sperm...
Han, Jennifer; Nguyen, John; Kim, Yuna; Geng, Bob; Romanowski, Gale; Alejandro, Lawrence; Proudfoot, James; Xu, Ronghui; Leibel, Sydney
2018-04-19
Assess the relationship between inhaled corticosteroid use (ICS) and weight (BMI) in pediatric patients with moderate-severe asthma. Assess if the number of emergency department (ED) visits correlates with overall BMI trajectory. Assess the trend of prescribing biologic therapy in pediatric patients with moderate-severe asthma and determine its relationship with weight (BMI). A retrospective chart review was performed on 93 pediatric patients with moderate-severe asthma to determine the relationship between ICS use and weight (BMI), biologic therapy and BMI, and number of ED visits and BMI trajectory. A mixed effects model was employed with the correlation between repeated measures accounted for through the random effects. There is a statistically significant increase of 0.369 kg/m 2 in BMI trajectory per year in subjects on high-dose steroids compared to an increase of 0.195 kg/m 2 in the low dose group (p BMI of subjects initiated on biologic therapy (omalizumab or mepolizumab) had a statistically significant decrease in BMI trajectory of 0.818 kg/m 2 per year (p BMI trajectory (p BMI trajectory; the higher the dose, the greater the projected BMI increase per year. Initiation of biologic therapy decreased BMI trajectory over time. Lastly, those with frequent ED visits had a higher BMI trend. Future prospective studies are warranted that further evaluate the potential metabolic impacts of ICS and assess the effects of biologic therapy on BMI.
The Impact of Waiting List BMI Changes on the Short-term Outcomes of Lung Transplantation.
Jomphe, Valérie; Mailhot, Geneviève; Damphousse, Véronic; Tahir, Muhammad-Ramzan; Receveur, Olivier; Poirier, Charles; Ferraro, Pasquale
2018-02-01
Obesity and underweight are associated with a higher postlung transplantation (LTx) mortality. This study aims to assess the impact of the changes in body mass index (BMI) during the waiting period for LTx on early postoperative outcomes. Medical records of 502 consecutive cases of LTx performed at our institution between 1999 and 2015 were reviewed. Patients were stratified per change in BMI category between pre-LTx assessment (candidate BMI) and transplant BMI as follows: A-candidate BMI, less than 18.5 or 18.5 to 29.9 and transplant BMI, less than 18.5; B-candidate BMI, less than 18.5 and transplant BMI, 18.5 to 29.9; C-candidate BMI, 18.5 to 29.9 and transplant BMI, 18.5 to 29.9; D-candidate BMI, 30 or greater and transplant BMI, 18.5 to 29.9; and E-candidate BMI, 30 or greater or 18.5 to 29.9 and transplant BMI, 30 or greater. Our primary outcome was in-hospital mortality and secondary outcomes were length of mechanical ventilation, intensive care unit length of stay (LOS), hospital LOS and postoperative complications. BMI variation during the waiting time was common, as 1/3 of patients experienced a change in BMI category. Length of mechanical ventilation (21 days vs 9 days; P = 0.018), intensive care unit LOS (26 days vs 15 days; P = 0.035), and rates of surgical complications (76% vs 44%; P = 0.018) were significantly worse in patients of group E versus group D. Obese candidates who failed to decrease BMI less than 30 by transplant exhibited an increased risk of postoperative mortality (odds ratio, 2.62; 95% confidence interval, 1.01-6.48) compared with patients in group C. Pre-LTx BMI evolution had no impact on postoperative morbidity and mortality in underweight patients. Our results suggest that obese candidates with an unfavorable pretransplant BMI evolution are at greater risk of worse post-LTx outcomes.
Gordon, Elizabeth A.; Corbitt, Cynthia
2015-01-01
Sex differences in social behaviors exist in mammals during adulthood, and further evidence suggests that sex differences in behavior are present before sexual maturity. In order to model behavioral disorders in animals, it is important to assess baseline sex-related behavioral differences, especially when studying disorders for which sex-related behavioral effects are expected. We investigated the effect of sex on behavior in 3 strains of pre-pubertal mice (C57BL/6, CFW, and CF1) using a whe...
Variations in BMI and prevalence of health risks in diverse racial and ethnic populations.
Stommel, Manfred; Schoenborn, Charlotte A
2010-09-01
When examining health risks associated with the BMI, investigators often rely on the customary BMI thresholds of the 1995 World Health Organization report. However, within-interval variations in morbidity and mortality can be substantial, and the thresholds do not necessarily correspond to identifiable risk increases. Comparing the prevalence of hypertension, diabetes, coronary heart disease (CHD), asthma, and arthritis among non-Hispanic whites, blacks, East Asians and Hispanics, we examine differences in the BMI-health-risk relationships for small BMI increments. The analysis is based on 11 years of data of the National Health Interview Survey (NHIS), with a sample size of 337,375 for the combined 1997-2007 Sample Adult. The analysis uses multivariate logistic regression models, employing a nonparametric approach to modeling the BMI-health-risk relationship, while relying on narrowly defined BMI categories. Rising BMI levels are associated with higher levels of chronic disease burdens in four major racial and ethnic groups, even after adjusting for many socio-demographic characteristics and three important health-related behaviors (smoking, physical activity, alcohol consumption). For all population groups, except East Asians, a modestly higher disease risk was noted for persons with a BMI ethnic groups regardless of BMI levels, the evidence presented here does not support the notion that the BMI-health-risk profile of East Asians and others warrants race-specific BMI cutoff points.
The dose-response analysis between BMI and common chronic diseases in northeast China.
Yu, Jianxing; Tao, Yuchun; Dou, Jing; Ye, Junsen; Yu, Yaqin; Jin, Lina
2018-03-09
High body mass index (BMI) predisposes to several chronic diseases, but a large-scale systematic and detailed study of dose-response relationship between BMI and chronic diseases has not been reported previously. In this study, we aimed to investigate the relationship between BMI and 3 chronic diseases (hypertension, dyslipidemia and MetS) in northeast China. A sample of 16412 participants aged 18~79 years old were included in Jilin province in 2012. The lambda-mu-sigma (LMS) method was applied to examine the trend of BMI by age, and the restricted cubic splines were used to investigate the non-linear associations (dose-response curve) between BMI and chronic diseases. It was pointed out that BMI increased rapidly when young, then kept steady in middle age, and finally declined slowly in old age, and accordingly age was divided into 3 segments, which were different by gender. The odds ratios (ORs) of BMI for the chronic diseases increased relatively slowly when young, then increased dramatically in middle-age and old population, especially for men. Further, the ORs of BMI among non-smokers were lower than those among smokers, and the same trend was shown to be more apparent among drinkers and non-drinkers. The risk of BMI for common chronic diseases increased dramatically in middle-aged, especially for men with drinking and smoking habits.
Maternal and offspring intelligence in relation to BMI across childhood and adolescence.
Wraw, Christina; Deary, Ian J; Der, Geoff; Gale, Catharine R
2018-01-30
The present study tested the association between both mothers' and offspring's intelligence and offspring's body mass index (BMI) in youth. Participants were members of the National Longitudinal Survey of Youth 1979 (NLSY-79) Children and Young Adults cohort (n = 11,512) and their biological mothers who were members of the NLSY-79 (n = 4932). Offspring's IQ was measured with the Peabody Individual Achievement Test (PIAT). Mothers' IQ was measured with the Armed Forces Qualification Test (AFQT). A series of regression analyses tested the association between IQ and offspring's BMI by age group, while adjusting for pre-pregnancy BMI and family SES. The analyses were stratified by sex and ethnicity (non-Black and non-Hispanic, Black, and Hispanic). The following associations were observed in the fully adjusted analyses. For the non-Blacks and non-Hispanics, a SD increment in mothers' IQ was negatively associated with daughters' BMI across all age-groups, ranging from β = -0.12 (95% CI -0.22 to -0.02, p = 0.021) in late childhood, to β = -0.17 (95% C.I. -0.27 to -0.07, p = 0001), in early adolescence and a SD increment in boys' IQ was positively associated with their BMI in early adolescence β = 0.09 (95% CI 0.01-0.18, p = 0.031). For Blacks, there was a non-linear relationship between mothers' IQ and daughters' BMI across childhood and between girls' IQ and BMI across adolescence. There was a positive association between mothers' IQ and sons' BMI in early adolescence (β = 0.17, 95% CI 0.02-0.32, p = 0.030). For Hispanic boys, there was a positive IQ-BMI association in late childhood (β = 0.19, 95% CI 0.05-0.33, p = 0.008) and early adolescence (β = 0.17, 95% CI 0.04-0.31, p = 0.014). Mothers' IQ and offspring's IQ were associated with offspring's BMI. The relationships varied in direction and strength across ethnicity, age group and sex. Obesity interventions may benefit from acknowledging the heterogeneous
[Testis volume, pubic hair development and spermarcheal age in urban Chinese boys].
Hua-mei, M A
2010-06-01
There is a trend that puberty is starting earlier in the 21st century, which is primarily based on studies of girls. The assessment of pubertal stages in the individual child is useful only if recent and reliable reference data from the same population are available for comparison. However, nationally representative pubertal data for Chinese boys in China are lacking. The aim of this study was to investigate the current pubertal development in healthy urban Chinese boys. A cross-sectional study of the pubertal development of a sample of 19,054 urban Chinese boys aged 3 - 19.83 years was conducted between 2003 and 2005. Testicular volume was determined with a Prader orchidometer. Pubic hair development was assessed according to the Tanner method. Data on spermarche were collected by the status quo method. Probit analysis was used to calculate the median age and 95% CI for onset of testicular and pubic hair development and spermarche. A testicular volume greater than or equal to 4 ml was taken as a definite sign of the onset of puberty. Mean ages for sexual development in boys were compared with other published series, while the spermarcheal age was compared to those in the similar population of the five National Surveys on Students Constitution and Health undertaken since 1979 in China. At the age of 9 years, 12.99% of the boys had a testicular volume 4 ml or more. The median age of onset of puberty as indicated by a testicular volume of 4 ml or more was 10.55 (95% CI 10.27 - 10.79) years. The median age for onset of pubic hair development (PH(2)) and spermarche was 12.78 (95% CI 12.67 - 12.89) years and 14.05 (95%CI 13.80 - 14.32) years, respectively. There was a highly significant downward secular trend for spermarcheal age of Chinese boys since 1979. Pubertal onset as indicated by testicular development in urban Chinese boys is earlier than currently used norms. Age of testicular development is among the earliest medians recorded in the world population, while
Gene expression during testis development in Duroc boars
DEFF Research Database (Denmark)
Lervik, Siri; Kristoffersen, Anja Bråthen; Conley, Lene
2015-01-01
. Nine clusters of genes with significant differential expression over time and 49 functional charts were found in the analysed testis samples. Prominent pathways in the prepubertal testis were associated with tissue renewal, cell respiration and increased endocytocis. E-cadherines may be associated...... with the onset of pubertal development. With elevated steroidogenesis (weeks 16 to 27), there was an increase in the expression of genes in the MAPK pathway, STAR and its analogue STARD6. A pubertal shift in genes coding for cellular cholesterol transport was observed. Increased expression of meiotic pathways...
The Role of Polycomb Group Gene BMI1 in the Development of Prostate Cancer
2014-03-01
8217CTGTGGGAGCAAAGGAAGAC3’ Reverse, 5’AGAAGGAAACGGATCCCCTA3’: BCL2 ( P2 - promoter, TATA site), Forward, 5’CAAGTGTTCCGCG`TGATTG3’ Reverse 5’CCCGGTTA...expression of various proteins. A Kaplan -Meier survival analysis with the corresponding Log-Rank and Linear Regression analysis was used to measure...promoter ( P2 promoter). We found very little or no occupancy by TCF4 on - 3.41Kb and -8.41kb of BCL2 promoter (data not shown). Notably, BMI1-overexpression
File list: Oth.ALL.05.BMI1.AllCell [Chip-atlas[Archive
Lifescience Database Archive (English)
Full Text Available Oth.ALL.05.BMI1.AllCell hg19 TFs and others BMI1 All cell types SRX644721,SRX109477...79,SRX149715,SRX359986,SRX644717,SRX644709,SRX644713 http://dbarchive.biosciencedbc.jp/kyushu-u/hg19/assembled/Oth.ALL.05.BMI1.AllCell.bed ...
File list: Oth.ALL.20.BMI1.AllCell [Chip-atlas[Archive
Lifescience Database Archive (English)
Full Text Available Oth.ALL.20.BMI1.AllCell hg19 TFs and others BMI1 All cell types SRX109477,SRX109480...17,SRX113591,SRX644729,SRX359986,SRX109479,SRX644721 http://dbarchive.biosciencedbc.jp/kyushu-u/hg19/assembled/Oth.ALL.20.BMI1.AllCell.bed ...
File list: Oth.ALL.10.BMI1.AllCell [Chip-atlas[Archive
Lifescience Database Archive (English)
Full Text Available Oth.ALL.10.BMI1.AllCell hg19 TFs and others BMI1 All cell types SRX109477,SRX109480...86,SRX644709,SRX644713,SRX644717,SRX113591,SRX644721 http://dbarchive.biosciencedbc.jp/kyushu-u/hg19/assembled/Oth.ALL.10.BMI1.AllCell.bed ...
File list: Oth.ALL.50.BMI1.AllCell [Chip-atlas[Archive
Lifescience Database Archive (English)
Full Text Available Oth.ALL.50.BMI1.AllCell hg19 TFs and others BMI1 All cell types SRX109477,SRX109480...08,SRX644729,SRX113591,SRX359986,SRX644717,SRX109479 http://dbarchive.biosciencedbc.jp/kyushu-u/hg19/assembled/Oth.ALL.50.BMI1.AllCell.bed ...
Long-term BMI and growth profiles in offspring of women with gestational diabetes.
Hammoud, Nurah M; Visser, Gerard H A; van Rossem, Lenie; Biesma, Douwe H; Wit, Jan M; de Valk, Harold W
2018-05-01
, with the LGA counterparts of all three offspring groups in the highest BMI SDS ranges. Until early adolescence, OGDM have a BMI that is 0.5 SDS higher than that of the Dutch background population. LGA OGDM appear to be at particularly higher risk of being overweight in adolescence compared with non-LGA OGDM, putting them also at a higher lifetime risk of being overweight and developing obesity. ODM2 showed the highest BMI SDS values and had an average BMI SDS of +1.6 until the age of 14, when it became +2 SD. These results emphasize the importance of adequate recognition and timely treatment of maternal gestational diabetes to prevent fetal macrosomia in obstetrics.
Maternal Pre-pregnancy BMI and Reproductive Health of Daughters in Young Adulthood
DEFF Research Database (Denmark)
Mariansdatter, Saga Elise; Ernst, Andreas; Toft, Gunnar
2016-01-01
Objective To investigate the possible associations between maternal pre-pregnancy body mass index (BMI) and daughters' age of menarche and subsequent markers of reproductive health. Methods Nine hundred eighty-five pregnant women (80 %) were enrolled at their routine 30th week examinations in 1988...... dehydroepiandrosterone-sulphate (DHEAS), estradiol, and free estrogen index (FEI), compared to the middle BMI tertile. This was supported by a sub-analysis using the WHO classification (underweight, BMI obese, BMI ≥ 25.00 kg/m2) as exposure groups, in which daughters...... of overweight mothers had lower levels of DHEAS and estradiol, and lower FEI compared to daughters of normal weight mothers. No associations were found for ovarian follicle count in any of the groups. Conclusions for Practice We found that higher maternal BMI is associated with earlier age of menarche...
Connell, Lauren E.; Francis, Lori A.
2014-01-01
Objective This study sought to determine whether parenting style moderated the effects of delay of gratification on BMI trajectories from age 4 to 15 years. Methods Longitudinal data were analyzed on 778 children drawn from the Study of Early Child Care and Youth Development. Parenting style (authoritative, authoritarian, permissive, neglectful) was created from measures of mothers’ sensitivity and expectations for self-control when children were age 4 years. Self-regulation was also measured at 4 years using a well-known delay of gratification protocol. BMI was calculated from measured height and weight at each time point. Mixed modeling was used to test the interaction of parenting styles and ability to delay gratification on BMI trajectories from 4 to 15 years. Results There was a significant interaction effect of parenting and ability to delay on BMI growth from 4 to 15 years for boys. Boys who had authoritarian mothers and failed to delay gratification had a significantly steeper rate of growth in BMI from childhood through adolescence than children in any other parenting x delay group. Conclusions Authoritative and permissive parenting styles were protective against more rapid BMI gains for boys who could not delay gratification. Ability to delay gratification was protective against BMI gains for boys who had parents with authoritarian or neglectful parenting styles. PMID:23977874
Directory of Open Access Journals (Sweden)
Anne-Lise Bjørke-Monsen
2016-11-01
Full Text Available Maternal nutrition and inflammation have been suggested as mediators in the development of various adverse pregnancy outcomes associated with maternal obesity. We have investigated the relation between pre-pregnancy BMI, B vitamin status, and inflammatory markers in a group of healthy pregnant women. Cobalamin, folate, pyridoxal 5′-phosphate, and riboflavin; and the metabolic markers homocysteine, methylmalonic acid, and 3-hydroxykynurenine/xanthurenic acid ratio (HK/XA; and markers of cellular inflammation, neopterin and kynurenine/tryptophan ratio (KTR were determined in pregnancy week 18 and related to pre-pregnancy body mass index (BMI, in 2797 women from the Norwegian Mother and Child Cohort Study (MoBa. Pre-pregnancy BMI was inversely related to folate, cobalamin, pyridoxal 5′-phosphate (PLP, and riboflavin (p < 0.001, and associated with increased neopterin and KTR levels (p < 0.001. Inflammation seemed to be an independent predictor of low vitamin B6 status, as verified by low PLP and high HK/XA ratio. A high pre-pregnancy BMI is a risk factor for low B vitamin status and increased cellular inflammation. As an optimal micronutrient status is vital for normal fetal development, the observed lower B vitamin levels may contribute to adverse pregnancy outcomes associated with maternal obesity and B vitamin status should be assessed in women with high BMI before they get pregnant.
Duckham, Rachel L; Rantalainen, Timo; Ducher, Gaele; Hill, Briony; Telford, Richard D; Telford, Rohan M; Daly, Robin M
2016-07-01
Targeted weight-bearing activities during the pre-pubertal years can improve cortical bone mass, structure and distribution, but less is known about the influence of habitual physical activity (PA) and fitness. This study examined the effects of contrasting habitual PA and fitness levels on cortical bone density, geometry and mass distribution in pre-pubertal children. Boys (n = 241) and girls (n = 245) aged 7-9 years had a pQCT scan to measure tibial mid-shaft total, cortical and medullary area, cortical thickness, density, polar strength strain index (SSIpolar) and the mass/density distribution through the bone cortex (radial distribution divided into endo-, mid- and pericortical regions) and around the centre of mass (polar distribution). Four contrasting PA and fitness groups (inactive-unfit, inactive-fit, active-unfit, active-fit) were generated based on daily step counts (pedometer, 7-days) and fitness levels (20-m shuttle test and vertical jump) for boys and girls separately. Active-fit boys had 7.3-7.7 % greater cortical area and thickness compared to inactive-unfit boys (P girls, but active-fit girls had 6.1 % (P girls, which was likely due to their 6.7 % (P active-fit girls. Higher levels of habitual PA-fitness were associated with small regional-specific gains in 66 % tibial cortical bone mass in pre-pubertal children, particularly boys.
Orthorexia nervosa: Assessment and correlates with gender, BMI, and personality.
Oberle, Crystal D; Samaghabadi, Razieh O; Hughes, Elizabeth M
2017-01-01
This study investigated whether orthorexia nervosa (ON; characterized by an obsessive fixation on eating healthy) may be predicted from the demographics variables of gender and BMI, and from the personality variables of self-esteem, narcissism, and perfectionism. Participants were 459 college students, who completed several online questionnaires that assessed these variables. A principal components analysis confirmed that the Eating Habits Questionnaire (Gleaves, Graham, & Ambwani, 2013) assesses three internally-consistent ON components: healthy eating behaviors, problems resulting from those behaviors, and positive feelings associated with those behaviors. A MANOVA and its tests of between subjects effects then revealed significant interactions between gender and BMI, such that for men but not women, a higher BMI was associated with greater symptomatology for all ON components. Partial correlation analyses, after controlling for gender and BMI, revealed that both narcissism and perfectionism were positively correlated with all aspects of ON symptomatology. Copyright © 2016 Elsevier Ltd. All rights reserved.
Growth & development of Indian children adopted in Sweden.
Proos, Lemm A
2009-11-01
More than 6800 children from India have been adopted in Sweden over the last four decades. At arrival many were undernourished and suffered from infectious diseases. Catch-up growth was common. Unexpectedly, cases of early pubertal development were subsequently reported. In order to investigate the growth and development of adopted children more in detail we studied 114 children adopted from India prospectively during two years. The majority were stunted at arrival and caught up in height and weight after two years. Psychomotor retardation and common infections diminished fairly soon. Those that were stunted did not attain the higher catch-up levels of those not stunted at arrival. Low birthweight also limited the degree of catch-up growth. 107 girls were analysed retrospectively in another study. The median menarcheal age was 11.6 yr (range 7.3-14.6 yr) which is significantly earlier than the mean in Swedish and privileged Indian girls (13.0 and 12.4-12.9 yr, respectively). The pubertal linear growth component was normal in duration and magnitude but likewise started 1.5 yr earlier. The final height/age was 154 cm (-1.4 SDS) and the weight/age 46.9 kg (-1.1 SDS) 8 per cent were 145 cm or shorter. Stunting limited catch-up growth and final height. Those that were most stunted at arrival, and had the fastest catch-up growth, had the earliest menarche. Good maternal and child nutrition is necessary for full expression of a child's growth potential. What is lost in growth early in life can only partially be recovered by catch-up growth. Such growth is associated with risk for early pubertal development which abbreviates the childhood growth period and limits final height. The mechanism underlying the early pubertal development, and the optimal management of nutrition rehabilitation after chronic malnutrition, need to be clarified by further studies.
File list: Oth.Kid.10.BMI1.AllCell [Chip-atlas[Archive
Lifescience Database Archive (English)
Full Text Available Oth.Kid.10.BMI1.AllCell hg19 TFs and others BMI1 Kidney SRX149704,SRX644725,SRX1497...08,SRX644729,SRX149712,SRX644709,SRX644713,SRX644717,SRX113591,SRX644721 http://dbarchive.biosciencedbc.jp/kyushu-u/hg19/assembled/Oth.Kid.10.BMI1.AllCell.bed ...
File list: Oth.Kid.20.BMI1.AllCell [Chip-atlas[Archive
Lifescience Database Archive (English)
Full Text Available Oth.Kid.20.BMI1.AllCell hg19 TFs and others BMI1 Kidney SRX644725,SRX149704,SRX1497...12,SRX644713,SRX644709,SRX149708,SRX644717,SRX113591,SRX644729,SRX644721 http://dbarchive.biosciencedbc.jp/kyushu-u/hg19/assembled/Oth.Kid.20.BMI1.AllCell.bed ...
File list: Oth.Kid.50.BMI1.AllCell [Chip-atlas[Archive
Lifescience Database Archive (English)
Full Text Available Oth.Kid.50.BMI1.AllCell hg19 TFs and others BMI1 Kidney SRX644725,SRX149704,SRX1497...12,SRX644709,SRX644713,SRX644721,SRX149708,SRX644729,SRX113591,SRX644717 http://dbarchive.biosciencedbc.jp/kyushu-u/hg19/assembled/Oth.Kid.50.BMI1.AllCell.bed ...
Directory of Open Access Journals (Sweden)
Boraczyński Michał
2017-12-01
Full Text Available Purpose. The paper describes the relationships between anthropometric features, body composition, and anaerobic alactic power (AAP in elite post-pubertal and mature male taekwondo athletes. Methods. The sample of 41 taekwondo athletes was divided into two groups: post-pubertal (P-P, n = 19, Mage = 15.6 ± 1.1 years and mature (M, n = 22, Mage = 20.7 ± 2.8 years. Anthropometric features (WB-150, ZPU Tryb-Wag, Poland, body composition (BC-418 MA, Tanita, Japan, maturational status (Pubertal Maturational Observational Scale, and AAP (10-s version of the Wingate Anaerobic Test were assessed. Results. Post-hoc testing revealed significant between-group differences (3.2-20.4%, p < 0.01 in all anthropometric and body composition measures, with effect sizes (ES between −0.79 and −1.25 (p < 0.001, except for fat content and percentage of skeletal muscle mass (SMM (p ≥ 0.05. In group M, the maximal power output (Pmax was greater (ES = −1.15, p < 0.001 and the time of its attainment shorter (ES = 0.59, p < 0.001 than in group P-P. Correlation analyses indicated notably strong associations between body mass (BM and Pmax in group P-P (r = 0.950 [95% CI, 0.85-0.98], p < 0.001 and M (r = 0.926 [95% CI, 0.81-0.97], p < 0.001, and similar-sized strong correlations between fat-free mass (FFM and Pmax in group P-P (r = 0.955 [95% CI, 0.86-0.99], p < 0.001 and M (r = 0.924 [95% CI, 0.82-0.96], p < 0.001. Additionally, a strong correlation was found between body height and Pmax in groups P-P and M (r = 0.805 [95% CI, 0.54-0.92], p < 0.001 and r = 0.819 [95% CI, 0.58-0.93], p < 0.001, respectively. Linear regression analyses demonstrated that FFM, BM, and absolute SMM best explained the variance in Pmax in both groups (r, 0.939-0.951; r2, 0.882-0.909. Conclusions. The strong correlations observed in both groups between BM, FFM, SMM, and Pmax demonstrate the significant effects of body size and composition on AAP. By determining the current levels of these
The role of culture in the context of school-based BMI screening.
Fitzgibbon, Marian L; Beech, Bettina M
2009-09-01
The high prevalence of overweight and obesity is a significant public health concern in the United States. Minority populations are disproportionately affected, and the impact of obesity on minority children is especially alarming. In this article we discuss school-based BMI reporting, which is intended to increase parental awareness of their children's weight status. This information could potentially lead parents of overweight and obese children to carefully examine and possibly change their children's diet and activity patterns. However, any program related to child weight status must consider culturally defined aspects of body size and shape. In other words, the cultural context in which information on child BMI is presented to and received by parents must be considered. In this article we review parental perceptions of child weight. Multiple studies have shown that parents of overweight or obese children often fail to correctly perceive their children as overweight. Possible reasons for, and implications of, this misperception of child weight status among minority parents are then explored within a cultural framework. The PEN-3 model is used to examine influences on health behaviors and could help inform the development of a culturally sensitive BMI-notification program for minority parents. Reporting materials congruent with the social and cultural values and practices of the target audience are likely to maximize program effectiveness. A culturally based BMI-notification program should be conceptualized as a small step in a comprehensive plan to reduce childhood obesity and improve the current and future health of minority children.
Alternative regression models to assess increase in childhood BMI
Beyerlein, Andreas; Fahrmeir, Ludwig; Mansmann, Ulrich; Toschke, André M
2008-01-01
Abstract Background Body mass index (BMI) data usually have skewed distributions, for which common statistical modeling approaches such as simple linear or logistic regression have limitations. Methods Different regression approaches to predict childhood BMI by goodness-of-fit measures and means of interpretation were compared including generalized linear models (GLMs), quantile regression and Generalized Additive Models for Location, Scale and Shape (GAMLSS). We analyzed data of 4967 childre...
Cardiac Bmi1(+) cells contribute to myocardial renewal in the murine adult heart.
Valiente-Alandi, Iñigo; Albo-Castellanos, Carmen; Herrero, Diego; Arza, Elvira; Garcia-Gomez, Maria; Segovia, José C; Capecchi, Mario; Bernad, Antonio
2015-10-26
The mammalian adult heart maintains a continuous, low cardiomyocyte turnover rate throughout life. Although many cardiac stem cell populations have been studied, the natural source for homeostatic repair has not yet been defined. The Polycomb protein BMI1 is the most representative marker of mouse adult stem cell systems. We have evaluated the relevance and role of cardiac Bmi1 (+) cells in cardiac physiological homeostasis. Bmi1 (CreER/+);Rosa26 (YFP/+) (Bmi1-YFP) mice were used for lineage tracing strategy. After tamoxifen (TM) induction, yellow fluorescent protein (YFP) is expressed under the control of Rosa26 regulatory sequences in Bmi1 (+) cells. These cells and their progeny were tracked by FACS, immunofluorescence and RT-qPCR techniques from 5 days to 1 year. FACS analysis of non-cardiomyocyte compartment from TM-induced Bmi1-YFP mice showed a Bmi1 (+)-expressing cardiac progenitor cell (Bmi1-CPC: B-CPC) population, SCA-1 antigen-positive (95.9 ± 0.4 %) that expresses some stemness-associated genes. B-CPC were also able to differentiate in vitro to the three main cardiac lineages. Pulse-chase analysis showed that B-CPC remained quite stable for extended periods (up to 1 year), which suggests that this Bmi1 (+) population contains cardiac progenitors with substantial self-maintenance potential. Specific immunostaining of Bmi1-YFP hearts serial sections 5 days post-TM induction indicated broad distribution of B-CPC, which were detected in variably sized clusters, although no YFP(+) cardiomyocytes (CM) were detected at this time. Between 2 to 12 months after TM induction, YFP(+) CM were clearly identified (3 ± 0.6 % to 6.7 ± 1.3 %) by immunohistochemistry of serial sections and by flow cytometry of total freshly isolated CM. B-CPC also contributed to endothelial and smooth muscle (SM) lineages in vivo. High Bmi1 expression identifies a non-cardiomyocyte resident cardiac population (B-CPC) that contributes to the main lineages of the heart in
Higher BMI Is Associated with Reduced Cognitive Performance in Division I Athletes
Directory of Open Access Journals (Sweden)
Andrew Fedor
2013-04-01
Full Text Available Objective: Poor cardiovascular fitness has been implicated as a possible mechanism for obesity-related cognitive decline, though no study has examined whether BMI is associated with poorer cognitive function in persons with excellent fitness levels. The current study examined the relationship between BMI and cognitive function by the Immediate Post Concussion and Cognitive Test (ImPACT in Division I collegiate athletes. Methods: Participants had an average age of 20.14 ± 1.78 years, were 31.3% female, and 53.9% football players. BMI ranged from 19.04 to 41.14 and averaged 26.72 ± 4.62. Results: Regression analyses revealed that BMI incrementally predicted performance on visual memory (R2 change = 0.015, p = 0.026 beyond control variables. Follow-up partial correlation analyses revealed small but significant negative correlations between BMI and verbal memory (r = -0.17, visual memory (r = -0.16, and visual motor speed (r = -0.12. Conclusions: These results suggest that higher BMI is associated with reduced cognitive function, even in a sample expected to have excellent levels of cardiovascular fitness. Further work is needed to better understand mechanisms for these associations.
Higher BMI is associated with reduced cognitive performance in division I athletes.
Fedor, Andrew; Gunstad, John
2013-01-01
Poor cardiovascular fitness has been implicated as a possible mechanism for obesity-related cognitive decline, though no study has examined whether BMI is associated with poorer cognitive function in persons with excellent fitness levels. The current study examined the relationship between BMI and cognitive function by the Immediate Post Concussion and Cognitive Test (ImPACT) in Division I collegiate athletes. Participants had an average age of 20.14 ± 1.78 years, were 31.3% female, and 53.9% football players. BMI ranged from 19.04 to 41.14 and averaged 26.72 ± 4.62. Regression analyses revealed that BMI incrementally predicted performance on visual memory (R(2) change = 0.015, p = 0.026) beyond control variables. Follow-up partial correlation analyses revealed small but significant negative correlations between BMI and verbal memory (r = -0.17), visual memory (r = -0.16), and visual motor speed (r = -0.12). These results suggest that higher BMI is associated with reduced cognitive function, even in a sample expected to have excellent levels of cardiovascular fitness. Further work is needed to better understand mechanisms for these associations. Copyright © 2013 S. Karger GmbH, Freiburg.
Venous and autonomic function in formerly pre-eclamptic women and BMI-matched controls.
Heidema, Wieteke M; van Drongelen, Joris; Spaanderman, Marc E A; Scholten, Ralph R
2018-03-25
Pre-pregnancy reduced plasma volume increases the risk on subsequent pre-eclamptic pregnancy. Reduced plasma volume is thought to reflect venous reserve capacity, especially when venous vasculature is constricted and sympathetic tone is elevated. As obesity might affect these variables and also relates to pre-eclampsia, increased body weight may underlie these observations. We hypothesized that the relationship between reduced venous reserve and preeclampsia is independent of body mass index (BMI). We compared the non-pregnant venous reserve capacity in 30 formerly pre-eclamptic women, equally divided in 3 BMI-classes (BMI 19.5-24.9, BMI 25-29.9, BMI ≥30) to 30 controls. Cases and controls were matched for BMI, age and parity. The venous reserve capacity was quantified by assessing plasma volume and venous compliance. The autonomic nervous system regulating the venous capacitance was evaluated with heart rate variability analysis in resting supine position and during positive head-up tilt (HUT). Formerly pre-eclamptic women had in supine position lower plasma volume than controls (1339 ± 79 vs 1547 ± 139 ml/m 2 (pBMI-matched controls, reduced venous reserve capacity. This is reflected by lower plasma volume and venous compliance, the autonomic balance is shifted towards sympathetic dominance and lower baroreceptor sensitivity. This suggests that not BMI, but underlying reduced venous reserve relates to pre-eclampsia. This article is protected by copyright. All rights reserved.
Zhang, Hui-Jie; Han, Peng; Sun, Su-Yun; Wang, Li-Ying; Yan, Bing; Zhang, Jin-Hua; Zhang, Wei; Yang, Shu-Yu; Li, Xue-Jun
2013-01-01
Obesity is related to hyperlipidemia and risk of cardiovascular disease. Health benefits of vegetarian diets have well-documented in the Western countries where both obesity and hyperlipidemia were prevalent. We studied the association between BMI and various lipid/lipoprotein measures, as well as between BMI and predicted coronary heart disease probability in lean, low risk populations in Southern China. The study included 170 Buddhist monks (vegetarians) and 126 omnivore men. Interaction between BMI and vegetarian status was tested in the multivariable regression analysis adjusting for age, education, smoking, alcohol drinking, and physical activity. Compared with omnivores, vegetarians had significantly lower mean BMI, blood pressures, total cholesterol, low density lipoprotein cholesterol, high density lipoprotein cholesterol, total cholesterol to high density lipoprotein ratio, triglycerides, apolipoprotein B and A-I, as well as lower predicted probability of coronary heart disease. Higher BMI was associated with unfavorable lipid/lipoprotein profile and predicted probability of coronary heart disease in both vegetarians and omnivores. However, the associations were significantly diminished in Buddhist vegetarians. Vegetarian diets not only lower BMI, but also attenuate the BMI-related increases of atherogenic lipid/ lipoprotein and the probability of coronary heart disease.
Attachment, parenting styles and bullying during pubertal years.
van der Watt, Ronél
2014-01-01
Research that focuses on combining attachment, parenting styles, bullying and the reciprocal nature thereof in the parent-adolescent and peer relationships is limited. The bio-psychosocial changes that adolescents experience open up broader social realities and are perceived differently by parents and adolescents. Attachment processes and parenting styles may elicit dissimilar perceptions. These processes are also associated with the multifaceted dynamics of bullying. The aim of the article is to advocate for research on the possible link between the implications of attachment, parenting styles and bullying. Exploring the association between attachment, parenting styles and bullying can deepen the understanding of the developmental challenges within the parent-adolescent relationship, add insight to the different perceptions of adolescents and parents, and complement intervention programmes accordingly. Firstly, this article outlines bio-psychosocial changes in the pubertal years as related to the social realities of the adolescent. Secondly, a discussion on the concepts 'attachment', 'parenting styles', 'bullying', and the potential link between these concepts will follow. Thirdly, an outline of the clinical implications of the apparent association between these concepts is given. The article concludes with recommendations that researchers can consider while exploring the relationship between attachment, parenting styles, and bullying and the delineation thereof in the parent-adolescent relationship.
Optimum BMI cut points to screen asian americans for type 2 diabetes.
Araneta, Maria Rosario G; Kanaya, Alka M; Hsu, William C; Chang, Healani K; Grandinetti, Andrew; Boyko, Edward J; Hayashi, Tomoshige; Kahn, Steven E; Leonetti, Donna L; McNeely, Marguerite J; Onishi, Yukiko; Sato, Kyoko K; Fujimoto, Wilfred Y
2015-05-01
Asian Americans manifest type 2 diabetes at low BMI levels but may not undergo diagnostic testing for diabetes if the currently recommended BMI screening cut point of ≥25 kg/m(2) is followed. We aimed to ascertain an appropriate lower BMI cut point among Asian-American adults without a prior diabetes diagnosis. We consolidated data from 1,663 participants, ages ≥45 years, without a prior diabetes diagnosis, from population- and community-based studies, including the Mediators of Atherosclerosis in South Asians Living in America study, the North Kohala Study, the Seattle Japanese American Community Diabetes Study, and the University of California San Diego Filipino Health Study. Clinical measures included a 2-h 75-g oral glucose tolerance test, BMI, and glycosylated hemoglobin (HbA1c). Mean age was 59.7 years, mean BMI was 25.4 kg/m(2), 58% were women, and type 2 diabetes prevalence (American Diabetes Association 2010 criteria) was 16.9%. At BMI ≥25 kg/m(2), sensitivity (63.7%), specificity (52.8%), and Youden index (0.16) values were low; limiting screening to BMI ≥25 kg/m(2) would miss 36% of Asian Americans with type 2 diabetes. For screening purposes, higher sensitivity is desirable to minimize missing cases, especially if the diagnostic test is relatively simple and inexpensive. At BMI ≥23 kg/m(2), sensitivity (84.7%) was high in the total sample and by sex and Asian-American subgroup and would miss only ∼15% of Asian Americans with diabetes. The BMI cut point for identifying Asian Americans who should be screened for undiagnosed type 2 diabetes should be <25 kg/m(2), and ≥23 kg/m(2) may be the most practical. © 2015 by the American Diabetes Association. Readers may use this article as long as the work is properly cited, the use is educational and not for profit, and the work is not altered.
Meta-analysis of genome-wide linkage studies in BMI and obesity.
Saunders, Catherine L; Chiodini, Benedetta D; Sham, Pak; Lewis, Cathryn M; Abkevich, Victor; Adeyemo, Adebowale A; de Andrade, Mariza; Arya, Rector; Berenson, Gerald S; Blangero, John; Boehnke, Michael; Borecki, Ingrid B; Chagnon, Yvon C; Chen, Wei; Comuzzie, Anthony G; Deng, Hong-Wen; Duggirala, Ravindranath; Feitosa, Mary F; Froguel, Philippe; Hanson, Robert L; Hebebrand, Johannes; Huezo-Dias, Patricia; Kissebah, Ahmed H; Li, Weidong; Luke, Amy; Martin, Lisa J; Nash, Matthew; Ohman, Miina; Palmer, Lyle J; Peltonen, Leena; Perola, Markus; Price, R Arlen; Redline, Susan; Srinivasan, Sathanur R; Stern, Michael P; Stone, Steven; Stringham, Heather; Turner, Stephen; Wijmenga, Cisca; Collier, David A
2007-09-01
The objective was to provide an overall assessment of genetic linkage data of BMI and BMI-defined obesity using a nonparametric genome scan meta-analysis. We identified 37 published studies containing data on over 31,000 individuals from more than >10,000 families and obtained genome-wide logarithm of the odds (LOD) scores, non-parametric linkage (NPL) scores, or maximum likelihood scores (MLS). BMI was analyzed in a pooled set of all studies, as a subgroup of 10 studies that used BMI-defined obesity, and for subgroups ascertained through type 2 diabetes, hypertension, or subjects of European ancestry. Bins at chromosome 13q13.2- q33.1, 12q23-q24.3 achieved suggestive evidence of linkage to BMI in the pooled analysis and samples ascertained for hypertension. Nominal evidence of linkage to these regions and suggestive evidence for 11q13.3-22.3 were also observed for BMI-defined obesity. The FTO obesity gene locus at 16q12.2 also showed nominal evidence for linkage. However, overall distribution of summed rank p values <0.05 is not different from that expected by chance. The strongest evidence was obtained in the families ascertained for hypertension at 9q31.1-qter and 12p11.21-q23 (p < 0.01). Despite having substantial statistical power, we did not unequivocally implicate specific loci for BMI or obesity. This may be because genes influencing adiposity are of very small effect, with substantial genetic heterogeneity and variable dependence on environmental factors. However, the observation that the FTO gene maps to one of the highest ranking bins for obesity is interesting and, while not a validation of this approach, indicates that other potential loci identified in this study should be investigated further.
Mechanism by which BMI influences leisure-time physical activity behavior.
Godin, Gaston; Bélanger-Gravel, Ariane; Nolin, Bertrand
2008-06-01
The objective of this prospective study was to clarify the mechanism by which BMI influences leisure-time physical activity. This was achieved in accordance with the assumptions underlying the Theory of Planned Behavior (TPB), considered as one of the most useful theories to predict behavior adoption. At baseline, a sample of 1,530 respondents completed a short questionnaire to measure intention and perceived behavioral control (PBC), the two proximal determinants of behavior of TPB. Past behavior, sociodemographic variables, and weight and height were also assessed. The dependent variable, leisure-time physical activity was assessed 3 months later. Hierarchical multiple regression analyses revealed that BMI is a direct predictor of future leisure-time physical activity, not mediated by the variables of TPB. Additional hierarchical analyses indicated that BMI was not a moderator of the intention-behavior and PBC-behavior relationships. The results of this study suggest that high BMI is a significant negative determinant of leisure-time physical activity. This observation reinforces the importance of preventing weight gain as a health promotion strategy for avoiding a sedentary lifestyle.
Directory of Open Access Journals (Sweden)
Chris Power
Full Text Available Childhood maltreatment including abuse and neglect has been associated with adult obesity, but evidence on life-course development of obesity or BMI gain is unclear. We aim to establish whether childhood maltreatments are related to obesity or BMI at different life-stages 7 y-50 y and to identify possible explanations for associations.Childhood physical, psychological and sexual abuse, neglect and BMI at seven ages were recorded in the 1958 birth cohort (n~15,000. Associations of child maltreatments with BMI at separate ages were tested using linear regression or logistic regression for obesity, and with rate of child-to-adult BMI gain using multilevel models. We adjusted for potential covariates.Abuse was reported in ~12% of the population. Abuse was not associated with elevated childhood BMI, but adult associations were observed: i.e. the abused had faster child-adult BMI gain than the non-abused; associations were independent of adult covariates. For physical abuse in both genders there was a positive linear association of ~0.006/y zBMI gain with age after adjustment for all covariates. Similarly, there was a linear association of physical abuse with obesity risk: e.g. among females from a low OR(adjusted of 0.34 (0.16,0.71 at 7 y to 1.67 (1.25,2.24 at 50 y. In females faster zBMI gains with age of ~0.0034/y were observed for sexual abuse and increases in obesity risk were faster: from a low OR(adjusted of 0.23 (0.06,0.84 at 7 y to 1.34 (0.86,2.10 at 50 y. Psychological abuse and neglect associations were less consistent.Childhood maltreatment associations with BMI or obesity varied across life: physical and, in females, sexual abuse were associated with faster lifetime BMI gains, which may have detrimental long-term health consequences.
Grijalva‐Eternod, Carlos; Cortina‐Borja, Mario; Williams, Jane; Fewtrell, Mary; Wells, Jonathan
2016-01-01
ABSTRACT Objectives This study sets out to investigate the intergenerational associations between the body mass index (BMI) of parents and the body composition of their offspring. Methods The cross‐sectional data were analyzed for 511 parent–offspring trios from London and south‐east England. The offspring were aged 5–21 years. Parental BMI was obtained by recall and offspring fat mass and lean mass were obtained using the four‐component model. Multivariable regression analysis, with multiple imputation for missing paternal values was used. Sensitivity analyses for levels of non‐paternity were conducted. Results A positive association was seen between parental BMI and offspring BMI, fat mass index (FMI), and lean mass index (LMI). The mother's BMI was positively associated with the BMI, FMI, and LMI z‐scores of both daughters and sons and of a similar magnitude for both sexes. The father's BMI showed similar associations to the mother's BMI, with his son's BMI, FMI, and LMI z‐scores, but no association with his daughter. Sensitivity tests for non‐paternity showed that maternal coefficients remained greater than paternal coefficients throughout but there was no statistical difference at greater levels of non‐paternity. Conclusions We found variable associations between parental BMI and offspring body composition. Associations were generally stronger for maternal than paternal BMI, and paternal associations appeared to differ between sons and daughters. In this cohort, the mother's BMI was statistically significantly associated with her child's body composition but the father's BMI was only associated with the body composition of his sons. Am. J. Hum. Biol. 28:524–533, 2016. © 2016 The Authors American Journal of Human Biology Published by Wiley Periodicals, Inc. PMID:26848813
Pre-pregnancy BMI-specific optimal gestational weight gain for women in Japan
Directory of Open Access Journals (Sweden)
Naho Morisaki
2017-09-01
Full Text Available Background: The Institute of Medicine (IOM guidelines are the most widely used guidelines on gestational weight gain; however, accumulation of evidence that body composition in Asians differs from other races has brought concern regarding whether their direct application is appropriate. We aimed to study to what extent optimal gestational weight gain among women in Japan differs by pre-pregnancy body mass index (BMI and to compare estimated optimal gestational weight gain to current Japanese and Institute of Medicine (IOM recommendations. Methods: We retrospectively studied 104,070 singleton pregnancies among nulliparous women in 2005–2011 using the Japanese national perinatal network database. In five pre-pregnancy BMI sub-groups (17.0–18.4, 18.5–19.9, 20–22.9, 23–24.9, and 25–27.4 kg/m2, we estimated the association of the rate of gestational weight gain with pregnancy outcomes (fetal growth, preterm delivery, and delivery complications using multivariate regression. Results: Weight gain rate associated with the lowest risk of adverse outcomes decreased with increasing BMI (12.2 kg, 10.9 kg, 9.9 kg, 7.7 kg, and 4.3 kg/40 weeks for the five BMI categories as described above, respectively. Current Japanese guidelines were lower than optimal gains, with the lowest risk of adverse outcomes for women with BMI below 18.5 kg/m2, and current IOM recommendations were higher than optimal gains for women with BMI over 23 kg/m2. Conclusion: Optimal weight gain during pregnancy varies largely by pre-pregnancy BMI, and defining those with BMI over 23 kg/m2 as overweight, as proposed by the World Health Organization, may be useful when applying current IOM recommendations to Japanese guidelines.
Pre-pregnancy BMI-specific optimal gestational weight gain for women in Japan.
Morisaki, Naho; Nagata, Chie; Jwa, Seung Chik; Sago, Haruhiko; Saito, Shigeru; Oken, Emily; Fujiwara, Takeo
2017-10-01
The Institute of Medicine (IOM) guidelines are the most widely used guidelines on gestational weight gain; however, accumulation of evidence that body composition in Asians differs from other races has brought concern regarding whether their direct application is appropriate. We aimed to study to what extent optimal gestational weight gain among women in Japan differs by pre-pregnancy body mass index (BMI) and to compare estimated optimal gestational weight gain to current Japanese and Institute of Medicine (IOM) recommendations. We retrospectively studied 104,070 singleton pregnancies among nulliparous women in 2005-2011 using the Japanese national perinatal network database. In five pre-pregnancy BMI sub-groups (17.0-18.4, 18.5-19.9, 20-22.9, 23-24.9, and 25-27.4 kg/m 2 ), we estimated the association of the rate of gestational weight gain with pregnancy outcomes (fetal growth, preterm delivery, and delivery complications) using multivariate regression. Weight gain rate associated with the lowest risk of adverse outcomes decreased with increasing BMI (12.2 kg, 10.9 kg, 9.9 kg, 7.7 kg, and 4.3 kg/40 weeks) for the five BMI categories as described above, respectively. Current Japanese guidelines were lower than optimal gains, with the lowest risk of adverse outcomes for women with BMI below 18.5 kg/m 2 , and current IOM recommendations were higher than optimal gains for women with BMI over 23 kg/m 2 . Optimal weight gain during pregnancy varies largely by pre-pregnancy BMI, and defining those with BMI over 23 kg/m 2 as overweight, as proposed by the World Health Organization, may be useful when applying current IOM recommendations to Japanese guidelines. Copyright © 2017 The Authors. Production and hosting by Elsevier B.V. All rights reserved.
DEFF Research Database (Denmark)
Courant, Frédérique; Aksglæde, Lise; Antignac, Jean-Philippe
2010-01-01
Estrogens and androgens play key roles for pubertal onset and sexual maturation. Most currently used immunoassays are not sensitive enough to accurately measure the low circulating levels of sex steroids in children without any signs of puberty. However, this does not exclude that sex steroids ha...
Physical Activity, BMI, and Blood Pressure in US Youth: NHANES 2003-2006.
Betz, Heather Hayes; Eisenmann, Joey C; Laurson, Kelly R; DuBose, Katrina D; Reeves, Mathew J; Carlson, Joseph J; Pfeiffer, Karin A
2018-03-15
The objective of this study was to examine the independent and combined association of physical activity and body mass index (BMI) with blood pressure in youth. Youth aged 8-18 years from the 2003-2006 National Health and Nutrition Examination Survey (NHANES) with BMI, blood pressure, and physical activity (accelerometer) were included in the analyses. A total of 2585 subjects (1303 males; 47% of all 8- to 18-year-olds) met these criteria. Obese youth had a systolic blood pressure that was 8 mm Hg higher than normal weight youth. A significant interaction between BMI and physical activity on blood pressure was found (P < .001), and group differences among the BMI/activity groups showed that the 3 obese groups and the overweight/least active group had significantly higher systolic blood pressure than the normal weight/active group across all analyses. The overweight/least active and normal weight/least active groups had significantly higher diastolic blood pressure than the normal weight/active group as well. This study showed a significant independent and combined association of BMI and physical activity with blood pressure in youth. Interventions need to focus on the reduction of fatness/BMI as a way to reduce the cardiovascular risk in youth.
Assessing the genetic overlap between BMI and cognitive function
Marioni, R E; Yang, J; Dykiert, D; Mõttus, R; Campbell, A; Ibrahim-Verbaas, Carla A; Bressler, Jan; Debette, Stephanie; Schuur, Maaike; Smith, Albert V; Davies, Gail; Bennett, David A; Deary, Ian J; Ikram, M Arfan; Launer, Lenore J; Fitzpatrick, Annette L; Seshadri, Sudha; van Duijn, Cornelia M; Mosely Jr, Thomas H; Davies, G; Hayward, C; Porteous, D J; Visscher, P M; Deary, I J
2016-01-01
Obesity and low cognitive function are associated with multiple adverse health outcomes across the life course. They have a small phenotypic correlation (r=−0.11; high body mass index (BMI)−low cognitive function), but whether they have a shared genetic aetiology is unknown. We investigated the phenotypic and genetic correlations between the traits using data from 6815 unrelated, genotyped members of Generation Scotland, an ethnically homogeneous cohort from five sites across Scotland. Genetic correlations were estimated using the following: same-sample bivariate genome-wide complex trait analysis (GCTA)–GREML; independent samples bivariate GCTA–GREML using Generation Scotland for cognitive data and four other samples (n=20 806) for BMI; and bivariate LDSC analysis using the largest genome-wide association study (GWAS) summary data on cognitive function (n=48 462) and BMI (n=339 224) to date. The GWAS summary data were also used to create polygenic scores for the two traits, with within- and cross-trait prediction taking place in the independent Generation Scotland cohort. A large genetic correlation of −0.51 (s.e. 0.15) was observed using the same-sample GCTA–GREML approach compared with −0.10 (s.e. 0.08) from the independent-samples GCTA–GREML approach and −0.22 (s.e. 0.03) from the bivariate LDSC analysis. A genetic profile score using cognition-specific genetic variants accounts for 0.08% (P=0.020) of the variance in BMI and a genetic profile score using BMI-specific variants accounts for 0.42% (P=1.9 × 10−7) of the variance in cognitive function. Seven common genetic variants are significantly associated with both traits at Pcognitive function. PMID:26857597
Directory of Open Access Journals (Sweden)
Hong Mei
Full Text Available To assess if the maternal pre-pregnancy weight status (MPWS alters the association of early infant feeding pattern (at one and third months with infant body mass index (BMI in the first two years of life.A cohort of 2,220 neonates were recruited in a community-based study conducted in China. Body weight and length were measured at birth, at age one and two, with BMI calculated accordingly. The BMI z-scores (BMI-Z were computed according to the World Health Organization Growth Standard (2006. Feeding patterns were classified as exclusive breastfeeding (EBF, mixed feeding (MF, and formula feeding (FF. General linear models (GLM were employed to estimate main and interaction effects of EBF and MPWS on children's BMI-Z.No main effect of MPWS was found on child BMI-Z at ages one and two, nor the feeding patterns. An interaction between MPWS and feeding patterns was detected (p<0.05. For children who were formula fed during the first month, those who were born to overweight/obesity (OW/OB mothers had a significantly greater BMI-Z at ages one and two, compared with those with underweight/normal weight (UW/NW mothers. FF children had greater BMI-Z at ages one and two compared with their EBF and MF counterparts, when they were born to OW/OB mothers.Maternal pre-pregnancy weight control and early initiation of EBF for children are essential for healthy development in children's BMI, hence the prevention of early life obesity.
Universal equation for estimating ideal body weight and body weight at any BMI.
Peterson, Courtney M; Thomas, Diana M; Blackburn, George L; Heymsfield, Steven B
2016-05-01
Ideal body weight (IBW) equations and body mass index (BMI) ranges have both been used to delineate healthy or normal weight ranges, although these 2 different approaches are at odds with each other. In particular, past IBW equations are misaligned with BMI values, and unlike BMI, the equations have failed to recognize that there is a range of ideal or target body weights. For the first time, to our knowledge, we merged the concepts of a linear IBW equation and of defining target body weights in terms of BMI. With the use of calculus and approximations, we derived an easy-to-use linear equation that clinicians can use to calculate both IBW and body weight at any target BMI value. We measured the empirical accuracy of the equation with the use of NHANES data and performed a comparative analysis with past IBW equations. Our linear equation allowed us to calculate body weights for any BMI and height with a mean empirical accuracy of 0.5-0.7% on the basis of NHANES data. Moreover, we showed that our body weight equation directly aligns with BMI values for both men and women, which avoids the overestimation and underestimation problems at the upper and lower ends of the height spectrum that have plagued past IBW equations. Our linear equation increases the sophistication of IBW equations by replacing them with a single universal equation that calculates both IBW and body weight at any target BMI and height. Therefore, our equation is compatible with BMI and can be applied with the use of mental math or a calculator without the need for an app, which makes it a useful tool for both health practitioners and the general public. © 2016 American Society for Nutrition.
Expression and clinicopathological significance of Mel-18 and Bmi-1 mRNA in gastric carcinoma.
Lu, You-Wei; Li, Jin; Guo, Wei-Jian
2010-11-08
The Polycomb group (PcG) genes are a class of regulators responsible for maintaining homeotic gene expression throughout cell division. PcG expression is deregulated in some types of human cancer. Both Bmi-1 and Mel-18 are of the key PcG proteins. We investigate the expression and clinicopathological roles of Mel-18 and Bmi-1 mRNA in gastric cancer. The expression of Mel-18 and Bmi-1 in a series of 71 gastric cancer tissues and paired normal mucosal tissues distant from the tumorous lesion was assayed by quantitative real time RT-PCR. The correlation between Mel-18 and Bmi-1 mRNA expression, and between Mel-18 or Bmi-1 mRNA level and clinicopathological characteristics were analyzed. Expression of Mel-18 and Bmi-1 genes was variably detected, but overexpression of Bmi-1 mRNA and decreased expression of Mel-18 mRNA were the most frequent alteration. In addition, the expression of Bmi-1 and Mel-18 mRNA inversely correlates in gastric tumors. Moreover, a significant positive correlation between Bmi-1 overexpression and tumor size, depth of invasion, or lymph node metastasis, and a significant negative correlation between Mel-18 low-expression with lymph node metastasis or the clinical stage were observed. Our data suggest that Mel-18 and Bmi-1 may play crucial but opposite roles in gastric cancer. Decreased Mel-18 and increased Bmi-1 mRNA expression was associated with the carcinogenesis and progression of gastric cancer. It is possible to list Bmi-1 and Mel-18 as biomarkers for predicting the prognosis of gastric cancer.
Changes in blood pressure, bmi and ecg patterns in women using low-dose contraceptives
International Nuclear Information System (INIS)
Syed, S.; Rahim, M.; Javed, M.; Qureshi, M.A.
2008-01-01
To determine the cardiovascular risk factors in users of second generation contraceptives by recording changes in body mass index, blood pressure and electrocardiogram. Sixty four women volunteered for this study (age range 20-35 years), belonging to low-income group with similar socio-cultural background. The Body Mass Index (BMI) was calculated by measuring height and weight of the subjects, systolic and diastolic blood pressure and ECG recording by standard method. The group means, standard deviations and coefficient correlation for interrelationship among variables in respective groups of subjects were calculated using relevant statistical method and software program. There was no significant difference between BMI of two types of contraceptive users as compared to non users, but BMI was significantly correlated with both systolic and diastolic blood pressures in injectable users as compared to controls. ECG alterations frequently observed in contraceptive users (40%) as compared to controls were normal findings. It was observed that women aged < 30 years and using contraceptives for more than three years had a tendency to gain weight and developed a mild increase in systolic and diastolic blood pressures. (author)
2-Year BMI Changes of Children Referred for Multidisciplinary Weight Management
Directory of Open Access Journals (Sweden)
Jennifer K. Cheng
2014-01-01
Full Text Available Objective. To examine body mass index (BMI changes among pediatric multidisciplinary weight management participants and nonparticipants. Design. In this retrospective database analysis, we used multivariable mixed effect models to compare 2-year BMI z-score trajectories among 583 eligible overweight or obese children referred to the One Step Ahead program at the Boston Children’s Primary Care Center between 2003 and 2009. Results. Of the referred children, 338 (58% attended the program; 245 (42% did not participate and were instead followed by their primary care providers within the group practice. The mean BMI z-score of program participants decreased modestly over a 2-year period and was lower than that of nonparticipants. The group-level difference in the rate of change in BMI z-score between participants and nonparticipants was statistically significant for 0–6 months (P=0.001 and 19–24 months (P=0.008; it was marginally significant for 13–18 months (P=0.051 after referral. Younger participants (<5 years had better outcomes across all time periods examined. Conclusion. Children attending a multidisciplinary program experienced greater BMI z-score reductions compared with usual primary care in a real world practice; younger participants had significantly better outcomes. Future research should consider early intervention and cost-effectiveness analyses.
Fitness differences according to BMI categories: a new point of view.
Lovecchio, Nicola; Zago, Matteo
2018-03-06
Many studies have reported negative association between fitness level and BMI categories but the lack of body weight correction and and the systematic use of physical endurance test made these differences controversial. Thus, the aim of this study was the assessment of physical fitness level associated to BMI using alternative tests. BMI was calculated as body mass/stature2 while fitness level was assessed using field test. In particular, Sit and Reach (SAR), Standing Broad Jump (SBJ), Shuttle Run Test 5mx 10 (SHR), Sit ups (SUP), Bent arm hang (BAH) were assessed in 2545 students. Subsequently, normal weight/overweight/obesity/underweight/thinness students were classified according to the cut-off points defined in literature and then the relative fitness results. The performances in SBJ showed very low differences between BMI categories such as for SUP test. The effects size in SHR were low or close to moderate while in BAH thin students revealed high performance than normal/overweight peers. In SAR test no clear trends in the BMI categories were observed. All test (exluding BAH) were similar for normal, overweight and thin students. This finding can be useful to teachers to encourage over/under-weighted students to adopt active life style because they are close to normal weight counterparts.
Wei, Xudong; He, Jian; Wang, Jingyu; Wang, Wei
2018-03-01
Previous studies have confirmed that CD133+ cells in laryngeal tumor tissue have the characteristics of cancer stem cells. Bmi-1 gene expression is central to the tumorigenicity of CD133+ cells. In this study, we tried to develop a new siRNA carrier system using chitosan-methoxypolyethylene nanoparticles (CS-mPEG-NPs) that exhibit higher tumor-targeting ability and enhanced gene silencing efficacy in CD133+ tumor stem cells. It is hoped to block the self-renewal and kill the stem cells of laryngeal carcinoma. The mPEG-CS-Bmi-1RNAi-NPs were synthesized and their characters were checked. The changes in invasion ability and sensitivity to radiotherapy and chemotherapy of CD133+Hep-2 tumor cells were observed after Bmi-1 gene silencing. The mPEG-CS-Bmi-1RNAi-NPs synthesized in this experiment have a regular spherical form, a mean size of 139.70 ±6.40 nm, an encapsulation efficiency of 85.21 ± 1.94%, with drug loading capacity of 18.47 ± 1.83%, as well as low cytotoxicity, providing good protection to the loaded gene, strong resistance to nuclease degradation and high gene transfection efficiency. After Bmi-1 gene silencing, the invasion ability of CD133+ cells was weakened. Co-cultured with paclitaxel, the survival rates of CD133+Bmi-1RNAi cells were lower. After radiotherapy, the mean growth inhibition rate of CD133+/Bmi-1RNAi cells was significantly lower than CD133+ cells. In conclusion, the mPEG-CS nano-carrier is an ideal vector in gene therapy, while silencing the Bmi-1 gene can enhance the sensitivity of CD133+ tumor stem cells to chemoradiotherapy and abate their invasion ability.
Yamakoshi, Kimi; Katano, Satoshi; Iida, Mayu; Kimura, Hiromi; Okuma, Atsushi; Ikemoto-Uezumi, Madoka; Ohtani, Naoko; Hara, Eiji; Maruyama, Mitsuo
2015-01-01
Bmi-1 prevents stem cell aging, at least partly, by blocking expression of the cyclin-dependent kinase inhibitor p16Ink4a. Therefore, dysregulation of the Bmi-1/p16Ink4a pathway is considered key to the loss of tissue homeostasis and development of associated degenerative diseases during aging. However, because Bmi-1 knockout (KO) mice die within 20 weeks after birth, it is difficult to determine exactly where and when dysregulation of the Bmi-1/p16Ink4a pathway occurs during aging in vivo. Using real-time in vivo imaging of p16Ink4a expression in Bmi-1-KO mice, we uncovered a novel function of the Bmi-1/p16Ink4a pathway in controlling homeostasis of the submandibular glands (SMGs), which secrete saliva into the oral cavity. This pathway is dysregulated during aging in vivo, leading to induction of p16Ink4a expression and subsequent declined SMG function. These findings will advance our understanding of the molecular mechanisms underlying the aging-related decline of SMG function and associated salivary gland hypofunction, which is particularly problematic among the elderly. PMID:25832744
BMI and obesity incidence in relation to food patterns of Polish older people
DEFF Research Database (Denmark)
Wadolowska, L.; Danowska-Oziewicz, M.; Niedzwiedzka, E.
2006-01-01
BMI differentiation and obesity incidence in relation to food patterns of Polish older people were analysed. The research included 422 people aged 65+ years. 21 food patterns were separated by the factor analysis. On the basis of the self-reported body mass and height, the BMI and percentages...... of overweight or obese people were calculated. The increase of the BMI and overweight and obesity incidence for both sexes was unequivocally connected with eating rye. The increase of the BMI and overweight and obesity incidence depended among women on consuming pork meat and alcoholic beverages. For men...
Meta-analysis of genome-wide linkage studies in BMI and obesity
Saunders, Catherine L.; Chiodini, Benedetta D.; Sham, Pak; Lewis, Cathryn M.; Abkevich, Victor; Adeyemo, Adebowale A.; de Andrade, Mariza; Arya, Rector; Berenson, Gerald S.; Blangero, John; Boehnke, Michael; Borecki, Ingrid B.; Chagnon, Yvon C.; Chen, Wei; Comuzzie, Anthony G.; Deng, Hong-Wen; Duggirala, Ravindranath; Feitosa, Mary F.; Froguel, Philippe; Hanson, Robert L.; Hebebrand, Johannes; Huezo-Dias, Patricia; Kissebah, Ahmed H.; Li, Weidong; Luke, Amy; Martin, Lisa J.; Nash, Matthew; Ohman, Muena; Palmer, Lyle J.; Peltonen, Leena; Perola, Markus; Price, R. Arlen; Redline, Susan; Srinivasan, Sathanur R.; Stern, Michael P.; Stone, Steven; Stringham, Heather; Turner, Stephen; Wijmenga, Cisca; Collier, David A.
Objective: The objective was to provide an overall assessment of genetic linkage data of BMI and BMI-defined obesity using a nonparametric genome scan meta-analysis. Research Methods and Procedures: We identified 37 published studies containing data on over 31,000 individuals from more than >10,000
Desirable factors for maintaining normal BMI of urban affluent women of Delhi.
Gupta, Anu Taneja; Siddhu, Anupa
2015-01-01
The study aimed to identify desirable social, familial, reproductive, dietary, and lifestyle factors for maintaining normal body mass index (BMI) of urban affluent women (25-45 years) in Delhi, India. A total of 387 urban affluent women with at least one living child participated in this cross-sectional study conducted from March 2008 to April 2010. Women were classified into four BMI categories on the basis of World Health Organization (WHO; 2004) classification for Asians. Significant factors for maintaining normal BMI were: Younger age, less parity, nuclear family, normal weight status of parents, postpartum weight gain between 2 and 3 kg, regularity in taking meals, fixed meal size, self-perceived normal weight, and shorter sitting time and television viewing time. Multivariate regression analysis identified five determining factors for maintaining BMI, which are normal weight of father, self-perceived normal weight, fixed meal size, sitting time less than 6 h/day, and television viewing time less than 1 h/day. By small lifestyle modifications, normal BMI can be maintained.
Risk of a venous thromboembolic episode due to caesarean section and BMI
DEFF Research Database (Denmark)
Colmorn, Lotte Berdiin; Ladelund, S; Rasmussen, S
2014-01-01
BMI significantly influences the risk of venous thromboembolism after emergency caesarean delivery compared with vaginal delivery.......BMI significantly influences the risk of venous thromboembolism after emergency caesarean delivery compared with vaginal delivery....
Dorenbos, Elke; Drummen, Mathijs; Rijks, Jesse; Adam, Tanja; Stouthart, Pauline; Alfredo Martínez, J; Navas-Carretero, Santiago; Stratton, Gareth; Swindell, Nils; Fogelholm, Mikael; Raben, Anne; Westerterp-Plantenga, Margriet; Vreugdenhil, Anita
2018-05-01
Insulin resistance (IR) in adolescence is associated with type 2 diabetes mellitus [T2DM]. The PREVIEW (Prevention of Diabetes Through Lifestyle Intervention and Population Studies in Europe and Around the World) study assessed the effectiveness of a high-protein, low-glycaemic-index diet and a moderate-protein, moderate-glycaemic-index diet to decrease IR in insulin-resistant children who were overweight or obese. Inclusion criteria were age 10 to 17 years, homeostatic model assessment of IR (HOMA-IR) ≥2.0 and overweight/obesity. In 126 children (mean ± SD age 13.6 ± 2.2 years, body mass index [BMI] z-score 3.04 ± 0.66, HOMA-IR 3.48 ± 2.28) anthropometrics, fat mass percentage (FM%), metabolic characteristics, physical activity, food intake and sleep were measured. Baseline characteristics did not differ between the groups. IR was higher in pubertal children with morbid obesity than in prepubertal children with morbid obesity (5.41 ± 1.86 vs 3.23 ± 1.86; P = .007) and prepubertal and pubertal children with overweight/obesity (vs 3.61 ± 1.60, P = .004, and vs 3.40 ± 1.50, P < .001, respectively). IR was associated with sex, Tanner stage, BMI z-score and FM%. Fasting glucose concentrations were negatively associated with Baecke sport score (r = -0.223, P = .025) and positively with daytime sleepiness (r = 0.280, P = .016) independent of sex, Tanner stage, BMI z-score and FM%. In conclusion, IR was most severe in pubertal children with morbid obesity. The associations between fasting glucose concentration and Baecke sport score and sleepiness suggest these might be possible targets for diabetes prevention. © 2018 John Wiley & Sons Ltd.
The Association between BMI and Different Frailty Domains: A U-Shaped Curve?
Rietman, M L; van der A, D L; van Oostrom, S H; Picavet, H S J; Dollé, M E T; van Steeg, H; Verschuren, W M M; Spijkerman, A M W
2018-01-01
Previous studies showed a U-shaped association between BMI and (physical) frailty. We studied the association between BMI and physical, cognitive, psychological, and social frailty. Furthermore, the overlap between and prevalence of these frailty domains was examined. Cross-sectional study. The Doetinchem Cohort Study is a longitudinal population-based study starting in 1987-1991 examining men and women aged 20-59 with follow-up examinations every 5 yrs. For the current analyses, we used data from round 5 (2008-2012) with 4019 participants aged 41-81 yrs. Physical frailty was defined as having ≥ 2 of 4 frailty criteria from the Frailty Phenotype (unintentional weight loss, exhaustion, physical activity, handgrip strength). Cognitive frailty was defined as the BMI was divided into four classes. Analyses were adjusted for sex, age, level of education, and smoking. A U-shaped association was observed between BMI and physical frailty, a small linear association for BMI and cognitive frailty and no association between BMI and psychological and social frailty. The four frailty domains showed only a small proportion of overlap. The prevalence of physical, cognitive and social frailty increased with age, whereas psychological frailty did not. We confirm that not only underweight but also obesity is associated with physical frailty. Obesity also seems to be associated with cognitive frailty. Further, frailty prevention should focus on multiple domains and target individuals at a younger age (<65yrs).
BMI1 is expressed in canine osteosarcoma and contributes to cell growth and chemotherapy resistance.
Shahi, Mehdi Hayat; York, Daniel; Gandour-Edwards, Regina; Withers, Sita S; Holt, Roseline; Rebhun, Robert B
2015-01-01
BMI1, a stem cell factor and member of the polycomb group of genes, has been shown to contribute to growth and chemoresistance of several human malignancies including primary osteosarcoma (OSA). Naturally occurring OSA in the dog represents a large animal model of human OSA, however the potential role of BMI1 in canine primary and metastatic OSA has not been examined. Immunohistochemical staining of canine primary and metastatic OSA tumors revealed strong nuclear expression of BMI1. An identical staining pattern was found in both primary and metastatic human OSA tissues. Canine OSA cell lines (Abrams, Moresco, and D17) expressed high levels of BMI1 compared with canine osteoblasts and knockdown or inhibition of BMI1 by siRNA or by small molecule BMI1-inhibitor PTC-209 demonstrated a role for BMI1 in canine OSA cell growth and resistance to carboplatin and doxorubicin chemotherapy. These findings suggest that inhibition of BMI1 in primary or metastatic OSA may improve response to chemotherapy and that the dog may serve as a large animal model to evaluate such therapy.
Increased genetic variance of BMI with a higher prevalence of obesity
DEFF Research Database (Denmark)
Rokholm, Benjamin; Silventoinen, Karri; Ängquist, Lars
2011-01-01
populations. Several recent studies suggest that the genetic effects on adiposity may be stronger when combined with presumed risk factors for obesity. We tested the hypothesis that a higher prevalence of obesity and overweight and a higher BMI mean is associated with a larger genetic variation in BMI....
Nilsen, Bente B; Yngve, Agneta; Werner, Bo
2018-02-06
This study investigated whether substantial body mass index (BMI) reductions in Swedish schoolchildren aged seven years to 19 years, caused by disease, healthy or unhealthy behaviour, had any impact on their final height. We used height and weight data on 6572 subjects from two nationally representative longitudinal samples of Swedish children born in 1973 and 1981. These provided information on their final height and any BMI reduction episodes. Of the 6572 subjects (50.9% boys), among individuals with information on final height, 1118 had a BMI reduction of 5% and BMI reduction of 10% or more. On a group level, there was no statistically significant difference in the final height of individuals with BMI reductions of 10% or more and those without. The findings were independent of age and the subject's BMI at the start of the reduction episode. However, there were a number of cases where a substantial BMI reduction probably had an impact on the subject's final height. Our study found no evidence that a substantial BMI reduction had any impact on final height on a group level, but further analyses of specific case studies are necessary to determine whether substantial BMI reduction might have an impact on final height. ©2018 Foundation Acta Paediatrica. Published by John Wiley & Sons Ltd.
The relation of weight suppression and BMI to bulimic symptoms.
Butryn, Meghan L; Juarascio, Adrienne; Lowe, Michael R
2011-11-01
High levels of weight suppression have been associated with greater binge eating and weight gain as well as poorer treatment outcome in bulimia nervosa. This study examined the relationship between weight suppression and bulimia nervosa symptoms and explored how weight suppression might interact with body mass index (BMI) in accounting for level of symptomatology at presentation for treatment. Participants were 64 women with threshold or sub-threshold bulimia nervosa. A clinical interview assessed binge eating and purging. Weight suppression and the interaction between BMI and weight suppression predicted frequency of binge eating such that participants with low BMI and high weight suppression engaged in the most binge eating. High levels of weight suppression also predicted more frequent purging. Additional research is warranted to examine mediators of these relationships. Copyright © 2010 Wiley Periodicals, Inc.
Cardiorespiratory fitness, BMI, and risk of hypertension: the HYPGENE study.
Rankinen, Tuomo; Church, Timothy S; Rice, Treva; Bouchard, Claude; Blair, Steven N
2007-10-01
Cardiorespiratory fitness and regular physical activity are inversely associated with the risk of hypertension, and exercise training has been shown to lower elevated blood pressure (BP). Genetic factors contribute significantly to the interindividual differences in endurance training-induced changes in BP. However, similar data on the genotype-by-fitness interactions on the risk of hypertension are scarce. In 2000, we started a systematic collection of blood samples from all consenting subjects of the Aerobics Center Longitudinal Study (ACLS) with a goal to generate a resource for studies addressing genotype-by-fitness interaction effects on various health-related end points. Here, we introduce the rationale and design of the first study based on the ACLS genetics resource focusing on hypertension as the health outcome (HYPGENE study), and we report the associations of cardiorespiratory fitness and body mass index (BMI) with the risk of hypertension. All HYPGENE subjects (N = 1234) were healthy and normotensive at their first clinic visit. Cases (N = 629) developed hypertension during the follow-up period (mean 8.7 yr), whereas controls (N = 605) remained normotensive (mean follow-up 10.1 yr). Cardiorespiratory fitness was the strongest predictor of the hypertension risk, with each maximal metabolic equivalent unit being associated with a 19% lower risk (95% confidence interval [95% CI], 12-24%). Each baseline BMI unit was associated with a 9% higher hypertension risk (95% CI, 4-13%). However, the association of BMI was greatly attenuated (odds ratio 1.04 [95% CI, 0.99-1.09]) when fitness also was included in the model. The HYPGENE study will provide an excellent resource to address hypotheses regarding the genetic basis of hypertension while taking cardiorespiratory fitness level into account.
Energy Technology Data Exchange (ETDEWEB)
Schuck, A.; Hamelmann, V. [University Hospital Muenster (Germany). Dept. of Radiotherapy; Braemswig, J.H. [University Hospital Muenster (DE). Dept. of Pediatrics] [and others
2005-08-01
Purpose: To analyze the effect of pelvic radiotherapy on ovarian function in prepubertal and pubertal girls and young adult women. Patients and methods: In a retrospective monoinstitutional analysis, patients <30 years of age at diagnosis were included who had been irradiated between 1979 and 1998. The main tumor types were Hodgkin's disease (38%), Erwing's sarcoma (20%) and nephroblastoma (11%). Patients were classified into three groups according to the position of the ovary in relation to the radiation portals. Group 1 was defined by direct irradiation of both ovaries. Group 2 patients were included with both ovaries potentially located in the radiation portals. In group 3, at least one ovary was not directly irradiated. The median follow-up was 128 months. Results: 16 of 55 analyzed patients were categorized in group 1. In ten of these patients, hormone status was evaluable. The ovarian doses were {>=}15 Gy. Except for one patient treated with 15 Gy all developed hormone failure. Eight of 14 patients of group 2 were evaluable. Seven of these patients developed ovarian failure. 19 of 24 patients in group 3 were evaluable. Nine of these patients developed ovarian failure. The observed difference in the rate of ovarian failure between the groups is statistifcally significant (p=0.045). Conclusion: All patients receiving >15 Gy to the ovaries developed hormone failure. In one case of a patient receiving an ovarian dose of 15 Gy, hormone failure was not found. In case of pelvic irradiation excluding at least one ovary, approximately half of the patients developed ovarian dysfunction, probably also due to the effects of polychemotherapy. (orig.)
Relation between BMI and diabetes mellitus and its complications among US older adults.
Gray, Natallia; Picone, Gabriel; Sloan, Frank; Yashkin, Arseniy
2015-01-01
This study examined relations between elevated body mass index (BMI) and time to diagnosis with type 2 diabetes mellitus and its complications among older adults in the United States. Data came from the Medicare Current Beneficiary Survey, 1991-2010. A Cox proportional hazard model was used to assess relations between excess BMI at the first Medicare Current Beneficiary Survey interview and time to diabetes mellitus diagnosis, complications, and insulin dependence among Medicare beneficiaries, older than 65 years of age with no prior diabetes mellitus diagnosis, and who were not enrolled in Medicare Advantage (N = 14,657). Among individuals diagnosed as having diabetes mellitus, elevated BMIs were associated with a progressively higher risk of complications from diabetes mellitus. For women with a BMI ≥40, the risk of insulin dependence (hazard ratio [HR] 3.57; 95% confidence interval [CI] 2.36-5.39) was twice that for women with 25 ≤ BMI diabetes mellitus. For men, the increased risk of these complications occurred at higher BMI levels than in women. Ocular complications occurred at higher BMI levels than other complication types in both men and women.
No seasonality of birth in BMI at 7 years of age
DEFF Research Database (Denmark)
Jensen, Camilla Bjørn; Sørensen, Thorkild I.A.; Heitmann, Berit
2016-01-01
Seasonal variation in birth weight was found in a previous Danish study. In the present study we investigated if the seasonality in birth weight tracked into BMI at 7 years of age, but found no seasonality of birth in either BMI, overweight, or obesity. © 2016 Elsevier Ireland Ltd...
Berkey, Catherine S; Willett, Walter C; Frazier, A Lindsay; Rosner, Bernard; Tamimi, Rulla M; Colditz, Graham A
2011-04-15
In adult women with retrospective data, childhood adiposity, pubertal growth and development were associated with benign breast disease (BBD) and/or breast cancer. The authors prospectively evaluated these childhood/adolescent characteristics and BBD risk. The Growing Up Today Study (GUTS) included females, aged 9-15 years in 1996, who completed annual questionnaires through 2001, then 2003, 2005, and 2007. Participants annually/biennially provided information on menarche, height, and weight, from which the authors derived body mass index (BMI in kg/m(2) ). Peak height growth velocity (PHV in cm/year) was estimated from longitudinal data. On 2005-2007 surveys, 6899 females (18-27 years of age) reported whether a healthcare provider ever diagnosed BBD (n = 147), and whether it was confirmed by biopsy (n = 67). Logistic models investigated risk factors adjusted for age, alcohol, pregnancy, and maternal history. More childhood adiposity (odds ratio [OR], 0.91/[kg/m(2) ]; P = .04) and shorter adult height (OR, 0.93/inch shorter; P = .07) were associated with lower risk of biopsy-confirmed BBD. Girls with most rapid height growth were at increased risk (OR, 2.12; P = .09) relative to those with the slowest growth. Age at menarche was not associated (OR, 1.11/year; P = .32) nor was adult BMI (adjusted for childhood BMI: OR, 1.01/[kg/m(2) ]; P = .98); larger BMI increases (childhood to adulthood) were not protective (OR + 1.04/[kg/m(2) ]; P = .37). Among girls with maternal breast cancer, those with more rapid growth had higher risk (OR, 1.47/[cm/year]; P = .02). All estimates were age-adjusted. Increased BBD risk (likely evolving to elevated breast cancer risk) was observed in thinner girls, girls with the most rapid growth, and taller women. Contrary to expectations, later menarche age was not protective against BBD, consistent with studies that found BBD patients are not protected against breast cancer by later menarche. Copyright © 2011 American Cancer Society.
Integrated genomic and BMI analysis for type 2 diabetes risk assessment.
Directory of Open Access Journals (Sweden)
Dayanara eLebrón-Aldea
2015-03-01
Full Text Available Type 2 Diabetes (T2D is a chronic disease arising from the development of insulin absence or resistance within the body, and a complex interplay of environmental and genetic factors. The incidence of T2D has increased throughout the last few decades, together with the occurrence of the obesity epidemic. The consideration of variants identified by Genome Wide Association Studies (GWAS into risk assessment models for T2D could aid in the identification of at-risk patients who could benefit from preventive medicine. In this study, we build several risk assessment models, and evaluated them with two different classification approaches (Logistic Regression and Neural Networks, to measure the effect of including genetic information in the prediction of T2D. We used data from to the Original and the Offspring cohorts of the Framingham Heart Study, which provides phenotypic and genetic information for 5,245 subjects (4,306 controls and 939 cases. Models were built by using several covariates: gender, exposure time, cohort, body mass index (BMI, and 65 established T2D-associated SNPs. We fitted Logistic Regressions and Bayesian Regularized Neural Network and then assessed their predictive ability by using a ten-fold cross validation. We found that the inclusion of genetic information into the risk assessment models increased the predictive ability by 2%, when compared to the baseline model. Furthermore, the models that included BMI at the onset of diabetes as a possible effector, gave an improvement of 6% in the area under the curve derived from the ROC analysis. The highest AUC achieved (0.75 belonged to the model that included BMI, and a genetic score based on the 65 established T2D-associated SNPs. Finally, the inclusion of SNPs and BMI raised predictive ability in all models as expected; however, results from the AUC in Neural Networks and Logistic Regression did not differ significantly in their prediction accuracy.
Toyoshima, Masafumi; Mori, Hikaru; Kudo, Kei; Yodogawa, Yuki; Sato, Kazuyo; Kudo, Takako; Igeta, Saori; Makino, Hiromitsu; Shima, Takashi; Matsuura, Rui; Ishigaki, Nobuko; Akagi, Kozo; Takeyama, Yoichi; Iwahashi, Hideki; Yoshinaga, Kosuke
2015-01-01
Introduction Isolated torsion of the fallopian tube without an ovarian abnormality is an uncommon event, with an incidence of approximately 1 in 1,500,000 females. Isolated torsion of the fallopian tube occurs mostly in reproductive-aged women, and is thus extremely rare in menopausal women and pre-pubertal girls. Case presentations In case 1, 63-year-old Japanese woman presented with a 2-day history of acute lower abdominal pain. Menopause occurred at 53?years of age. Pelvic ultrasonography ...
Effect of body weight and BMI on the efficacy of levonorgestrel emergency contraception.
Kapp, Nathalie; Abitbol, Jean Louis; Mathé, Henri; Scherrer, Bruno; Guillard, Hélène; Gainer, Erin; Ulmann, André
2015-02-01
To further evaluate the effect of weight and body mass index (BMI) on the efficacy of levonorgestrel emergency contraception. Data from two large, multicenter, randomized controlled trials designed to assess emergency contraceptive efficacy were pooled to evaluate the effect of weight and BMI on pregnancy rates among women who received levonorgestrel. Descriptive methods (comparison of means and distributions according to pregnancy status and pregnancy rates across weight and BMI categories) as well as cubic spline modeling were used to describe the relationship between pregnancy risk and weight/BMI. The analysis population comprised 1731 women, among whom 38 pregnancies were reported. Women for whom levonorgestrel was not effective in preventing pregnancy had a significantly higher mean body weight and BMI than women who did not become pregnant (76.7 vs. 66.4 kg, p85 kg groups, respectively. Statistical modeling demonstrated a steep increase in pregnancy risk starting from a weight near 70-75 kg to reach a risk of pregnancy of 6% or greater around 80 kg. Similar results were obtained for statistical modeling of BMI as well as when the two studies were analyzed individually. All analyses showed a significant drop in the efficacy of levonorgestrel emergency contraception with increasing body weight, with pregnancy risk in the higher weight categories similar to expected rates in the absence of contraception. Like body weight, increasing BMI was highly correlated with increased pregnancy risk. Copyright © 2015 Elsevier Inc. All rights reserved.
BMI1 is expressed in canine osteosarcoma and contributes to cell growth and chemotherapy resistance.
Directory of Open Access Journals (Sweden)
Mehdi Hayat Shahi
Full Text Available BMI1, a stem cell factor and member of the polycomb group of genes, has been shown to contribute to growth and chemoresistance of several human malignancies including primary osteosarcoma (OSA. Naturally occurring OSA in the dog represents a large animal model of human OSA, however the potential role of BMI1 in canine primary and metastatic OSA has not been examined. Immunohistochemical staining of canine primary and metastatic OSA tumors revealed strong nuclear expression of BMI1. An identical staining pattern was found in both primary and metastatic human OSA tissues. Canine OSA cell lines (Abrams, Moresco, and D17 expressed high levels of BMI1 compared with canine osteoblasts and knockdown or inhibition of BMI1 by siRNA or by small molecule BMI1-inhibitor PTC-209 demonstrated a role for BMI1 in canine OSA cell growth and resistance to carboplatin and doxorubicin chemotherapy. These findings suggest that inhibition of BMI1 in primary or metastatic OSA may improve response to chemotherapy and that the dog may serve as a large animal model to evaluate such therapy.
Are associations between electronic media use and BMI different across levels of physical activity?
DEFF Research Database (Denmark)
Melkevik, Ole; Haug, Ellen; Rasmussen, Mette
2015-01-01
and girls who did not comply with physical activity guidelines. Among physically active adolescents, EM was found to be significantly associated with BMI or odds for overweight among girls, but not among boys. CONCLUSION: While the usage of EM appear to be inconsequential for BMI and the risk of overweight...... among physically active boys, we find evidence indicating that EM use is associated with BMI and risk for overweight among girls, including those who report complying with MVPA guidelines.......BACKGROUND: The use of electronic media has been found to be a risk factor for higher BMI and for being overweight. Physical activity has been found to be associated with lower BMI and lower risk for being overweight. Little is known about whether the associations between physical activity...
The association of plasma cysteine and gamma-glutamyltransferase with BMI and obesity.
LENUS (Irish Health Repository)
Elshorbagy, Amany K
2009-07-01
We recently reported a strong positive association of plasma total cysteine (tCys) with fat mass in over 5,000 subjects. As gamma-glutamyltransferase (GGT) enzyme increases cysteine availability by catalyzing glutathione breakdown and is positively associated with BMI and adiposity, we hypothesized that GGT might explain the association of tCys with adiposity. To study whether the associations of tCys and serum GGT with BMI and obesity were interrelated we conducted a cross-sectional study using data from 1,550 subjects recruited from nine European countries in the COMAC project. Multiple linear and logistic regression models and concentration-response curves were used. In age and sex-adjusted analyses, tCys showed strong positive associations with BMI (partial r = 0.19, P < 0.001), and obesity (odds ratio (OR) for 4th vs. 1st tCys quartile: 2.8; 95% confidence interval: 1.6-5.0, P < 0.001), both of which remained robust after adjustment for GGT and other metabolic and lifestyle confounders. Serum GGT was also a positive predictor of BMI (partial r = 0.17, P < 0.001) and obesity (OR for 4th vs. 1st GGT quartile: 4.8; 95% confidence interval: 2.5-9.2, P < 0.001), independent of tCys. However, the associations of GGT with BMI and obesity were weakened by adjustment for obesity-related factors such as serum lipids and blood pressure. These results indicate that tCys is a strong positive predictor of BMI and obesity, independent of GGT and other obesity-related factors. We also suggest that the association of serum GGT with BMI and obesity is unrelated to the role of GGT in cysteine turnover. The potential link between cysteine and fat metabolism should be further evaluated.
Effects of social mobility from childhood to adolescence on BMI.
Muraro, Ana Paula; Gonçalves-Silva, Regina Maria Veras; Ferreira, Márcia Gonçalves; Sichieri, Rosely
2016-04-01
Little is known about the contribution of childhood socio-economic position (SEP) and social mobility to weight change. The present study evaluated the effect of family SEP during the pre-school years and social mobility on BMI between birth and adolescence. Longitudinal. The SEP of each child's family was classified according to an asset-based wealth index as low, medium or high. Four different categories of childhood-adolescence SEP groups were created in order to examine social mobility: low-medium/high, medium-medium, medium-high and high-high/medium. For each of these categories, BMI was tracked from birth to adolescence. Linear mixed-effects models were used to analyse the data. Cuiabá-MT, Brazil. A population-based cohort of children born between 1994 and 1999 was assessed between 1999 and 2000, and again between 2009 and 2011. A total of 1716 adolescents were followed from childhood to adolescence (71·4 % of baseline). The prevalence of overweight/obesity was 20·4 % in childhood and 27·7 % in adolescence. A higher SEP in childhood was associated with a greater prevalence of overweight in adolescence. Expressive upward social mobility occurred, mainly in the lowest SEP group. There was a greater rate of change in BMI between birth and adolescence among children with a higher SEP in childhood and children who remained in the higher SEP from childhood to adolescence. Individuals from a higher SEP in childhood and those who remained in the higher social classes showed greater rate of change in BMI. Thus, initial SEP was the major determinant of changes in BMI.
School performance in pubertal adolescents with dysmenorrhea
Directory of Open Access Journals (Sweden)
Syamsir Alam
2011-08-01
Full Text Available Background Dysmenorrhea is a common gynecological symptom reported in adolescent girls. Prevalence of the condition has been reported to be 45 - 75%. Absenteeism from work and school as a result of dysmenorrhea is common (13 - 51% of women have been absent at least once, and 5 - 14% are often absent due to the severity of symptoms. Objective To compare school performance in pubertal adolescent girls with and without dysmenorrhea. Methods This cross-sectional study was conducted in June 2010 in adolescent females aged 12 - 18 years from the Musthafawiyah School, Mandailing Natal district, North Sumatera. Adolescent females with and without dysmenorrhea were recruited for this study. All participants completed questionnaires including age of menarche, length of menstrual cycle, length of bleeding, number of sanitary napkins used daily and school absences. School reports from two consecutive semesters in one year were used to evaluate subjects’ academic performance. An academic score of higher than 7.5 was considered good performance while scores of less than 7.5 were considered poor. We used the chi-square test to analyze differences in school performance between girls with and without dysmenorrhea. Results One hundred and sixteen participants were divided into 2 groups, those with and without dysmenorrhea, of 58 subjects each. We found no significant difference in school performance between the two groups, P=0.176 (95% CI -0.009 to -0.048 and P=0.08 (95%CI -0.052 to 0.024. Conclusion There was no significant difference in school performance of girls with and without dysmenorrhea.
The impact of BMI on sperm parameters and the metabolite changes of seminal plasma concomitantly.
Guo, Dan; Wu, Wei; Tang, Qiuqin; Qiao, Shanlei; Chen, Yiqiu; Chen, Minjian; Teng, Mengying; Lu, Chuncheng; Ding, Hongjuan; Xia, Yankai; Hu, Lingqing; Chen, Daozhen; Sha, Jiahao; Wang, Xinru
2017-07-25
The development of male infertility increased rapidly worldwide, which coinciding with the epidemic of obesity. However, the impact of weight abnormalities on sperm quality is still contestable. To assess the correlation between BMI and sperm parameters, we searched relevant articles in PubMed, Embase, Web of science, and Wanfang database published until June 2015 without language restriction. Otherwise, we also recruited some participants who attended fertility clinic as well as some general populations in this report. We performed a systematic review and meta-analysis about BMI and sperm parameters containing total sperm count, concentration, semen volume and sperm motility (overall and progressive). Metabolomic analysis of seminal plasma was performed to explore the mechanism from a new perspective. This study found standardized weighted mean differences (SMD) in sperm parameters (total sperm count, sperm concentration, and semen volume) of abnormal weight groups decreased to different degree compared to normal weight. Dose-response analysis found SMD of sperm count, sperm concentration and semen volume respectively fell 2.4%, 1.3% and 2.0% compared with normal weight for every 5-unit increase in BMI. Metabolomic analysis of seminal plasma showed that spermidine and spermine were likely to play a vital role in the spermatogenesis progress. This systematic review with meta-analysis has confirmed there was a relationship between BMI and sperm quality, suggesting obesity may be a detrimental factor of male infertility.
Metabolic health across the BMI spectrum in HIV-infected and HIV-uninfected men.
Lake, Jordan E; Li, Xiuhong; Palella, Frank J; Erlandson, Kristine M; Wiley, Dorothy; Kingsley, Lawrence; Jacobson, Lisa P; Brown, Todd T
2018-01-02
In the general population, metabolic health often declines as BMI increases. However, some obese individuals maintain metabolic health. HIV and antiretroviral therapy have been associated with metabolic disturbances. We hypothesized that HIV-infected (HIV) men on suppressive antiretroviral therapy experience less metabolic health than HIV-uninfected (HIV) men across all BMI categories. In a cross-sectional analysis of 1018 HIV and 1092 HIV men enrolled in the multicenter AIDS cohort study, Poisson regression with robust variance determined associations between HIV serostatus and metabolic health prevalence (defined as meeting ≤2 of 5 National Cholesterol Education Program Adult Treatment Panel III metabolic syndrome criteria), adjusting for age, race, BMI category, smoking, and hepatitis C virus infection status. HIV men were younger (54 vs. 59 years) and had lower median BMI (25 vs. 27 kg/m). Nonobese HIV men had lower metabolic health prevalence than HIV men (BMI ≤25 kg/m: 80 vs. 94%, P BMI 25-29 kg/m: 64 vs. 71%, P = 0.05), but metabolic health prevalence among obese men did not differ by HIV serostatus (BMI 30-34 kg/m: 35 vs. 39%, P = 0.48; BMI ≥35 kg/m: 27 vs. 25%, P = 0.79). In the adjusted model, nonobese HIV men were less likely to demonstrate metabolic health than nonobese HIV men. Among HIV men, per year darunavir, zidovudine, and stavudine use were associated with lower metabolic health likelihood. Metabolically healthy obesity prevalence does not differ by HIV serostatus. However, among nonobese men, HIV infection is associated with lower metabolic health prevalence, with associations between lack of metabolic health and darunavir and thymidine analog nucleoside reverse transcriptase inhibitor exposure observed.
BMI and waist circumference as indicators of health among Samoan women.
Novotny, Rachel; Nabokov, Vanessa; Derauf, Christopher; Grove, John; Vijayadeva, Vinutha
2007-08-01
High rates of obesity and chronic disease make establishment of effective indicators of risk for chronic disease important. The objective was to examine adequacy of anthropometric cut-off points as indicators of risk for chronic disease among Samoan women in Hawaii. A cross-sectional survey of 55 Samoan women 18 to 28 years of age that included blood lipids, cholesterol, and glucose (including after a 2-hour oral glucose test); anthropometry (weight, height, waist circumference); and DXA of body composition. Using the Centers for Disease Control and Prevention (CDC)/World Health Organization (WHO) cut-off points for BMI, 22% of women were overweight and 58% were obese. Cholesterol, lipid, and glucose values were all linearly related to DXA body fat, BMI, and waist circumference. BMI and waist circumference at WHO/NIH cut-off points predicted levels of blood lipids and glucose that indicate elevated risk for disease. WHO/NIH cut-off points for BMI and waist circumference reflect risk indicators of chronic disease among young Samoan women in Hawaii.
DEFF Research Database (Denmark)
Kloppenborg, Julie T; Gamborg, Michael; Fonvig, Cilius E
2017-01-01
and adolescents from the Children's Obesity Clinic, Holbaek, Denmark. Anthropometrics, pubertal development, socioeconomic status (SES), and fasting concentrations of plasma glucose, serum insulin, serum C-peptide, and whole blood glycosylated hemoglobin (HbA1c) were collected at treatment entry and at follow......OBJECTIVE: To investigate whether children and adolescents exhibiting an impaired glucose metabolism are more obese at treatment entry and less likely to reduce their degree of obesity during treatment. METHODS: The present study is a longitudinal observational study, including children...... mass index (BMI) z-score 2.94 (range 1.34-5.54) were included. The mean BMI z-score reduction was 0.31 (±0.46) after 13 months (range 6-18) of treatment. At treatment entry, patients with impaired estimates of glucose metabolism were more obese than normoglycemic patients. Baseline concentration of C...
Dumont, L; Chalmel, F; Oblette, A; Berby, B; Rives, A; Duchesne, V; Rondanino, C; Rives, N
2017-11-01
Do freezing and in vitro culture procedures enhance the expression of proteins involved in apoptotic or autophagic pathways in murine pre-pubertal testicular tissue? IVM strongly modified apoptosis- and autophagy-related relative protein levels in mice testicular tissue whereas the impact of cryopreservation procedures was minimal at the end of the culture. In vitro spermatogenesis remains a challenging technical issue as it imposes to find a very close balance between survival and death of germ cell natural precursors (i.e. gonocytes and spermatogonia), which will eventually undergo a complete spermatogenesis close to in vivo conditions. The establishment of efficient culture conditions coupled with suitable cryopreservation procedures (e.g. controlled slow freezing [CSF] and solid surface vitrification [SSV]) of pre-pubertal testicular tissue is a crucial step in the fields of fertility preservation and restoration to improve the spermatic yield obtained in vitro. Here, we study cryopreservation procedures (i.e. CSF or SSV) and the impact of culture media compositions. A first set of 66 mouse pre-pubertal testes were directly cultured during 30, 36, 38 and 60 days (D) from 2.5 to 6.5-day-old CD-1 mice to evaluate the impact of time-aspect of culture and to endorse the reverse phase protein microarrays (RPPM) technique as an adapted experimental tool for the field of in vitro spermatogenesis. Ninety others fresh, slow-frozen and vitrified pre-pubertal testes were cultured during 30 days for the principal study to evaluate the impact of cryopreservation procedures before and after culture. Thirty-four testes dissected from 2.5, 6.5, 36.5, 40.5, 42.5 and 62.5 days postpartum (dpp) mice, corresponding to the time frames of spermatogenesis orchestrated in vitro, were used as in vivo controls. After in vitro culture, testicular tissue samples originated from 2.5 or 6.5-day-old CD-1 male mice were analyzed using RPPM. This targeted proteomic technique allowed us to
Puberty development among children and adolescents with chronic disease in Saudi Arabia.
AlBuhairan, Fadia; Tamimi, Waleed; Tamim, Hani; Al Mutair, Angham; Felimban, Naila; Altwaijri, Yasmin; Shoukri, Mohamed; Al Alwan, Ibrahim
2012-01-01
Increasing numbers of children with chronic health conditions are now surviving into adolescence and adulthood because of advancing health care. These chronic health conditions are generally known to impact a child's growth and development, including pubertal development. In Saudi Arabia, chronic diseases are prevalent, yet no reports of pubertal onset and its relation to chronic illness are available. The aim of this study was to explore pubertal development among Saudi children and adolescents with a chronic illness. Cross-sectional study conducted at schools in Riyadh, Saudi Arabia in 2006. Those students whose parents reported that their son/daughter had a chronic illness and/or was taking a long-term medication underwent a physical examination to determine sexual maturity rating and growth parameters. Of 1371 students who participated in the study, 155 (11.3%) had a chronic illness. Of those, 79 (51%) were male, and the mean SD age of all the students was 11.4 (2.4) years. Ninety (58%) students were taking medication for their health condition. Bronchial asthma was reported to be the most common chronic condition (n=66; 42.6%), followed by blood disorders (n=41; 26.5%). Fifty-three (34%) students were overweight or obese. For male gonadal (G) development, the mean age of boys with G stage 2 was 11.7 years; stage 3: 13.5 years; stage 4: 14.1 years; and stage 5: 14.6 years. For female breast (B) development, the mean age of girls with B stage 2 was 10.7 years; stage 3: 11.3 years; stage 4: 12.4 years; and stage 5: 14.1 years. The pubic hair development for both boys and girls was similar to the corresponding gonadal or breast development, respectively. The age of onset of pubertal development for both boys and girls with a chronic illness are within normal limits. The high prevalence of overweight and obesity may contribute to this phenomenon, yet further studies should consider the effects of disease severity and chronicity and medication use as possible
Bhaskaran, Krishnan; Forbes, Harriet J; Douglas, Ian; Leon, David A; Smeeth, Liam
2013-01-01
Objectives To assess the completeness and representativeness of body mass index (BMI) data in the Clinical Practice Research Datalink (CPRD), and determine an optimal strategy for their use. Design Descriptive study. Setting Electronic healthcare records from primary care. Participants A million patient random sample from the UK CPRD primary care database, aged ≥16 years. Primary and secondary outcome measures BMI completeness in CPRD was evaluated by age, sex and calendar period. CPRD-based summary BMI statistics for each calendar year (2003–2010) were age-standardised and sex-standardised and compared with equivalent statistics from the Health Survey for England (HSE). Results BMI completeness increased over calendar time from 37% in 1990–1994 to 77% in 2005–2011, was higher among females and increased with age. When BMI at specific time points was assigned based on the most recent record, calendar–year-specific mean BMI statistics underestimated equivalent HSE statistics by 0.75–1.1 kg/m2. Restriction to those with a recent (≤3 years) BMI resulted in mean BMI estimates closer to HSE (≤0.28 kg/m2 underestimation), but excluded up to 47% of patients. An alternative strategy of imputing up-to-date BMI based on modelled changes in BMI over time since the last available record also led to mean BMI estimates that were close to HSE (≤0.37 kg/m2 underestimation). Conclusions Completeness of BMI in CPRD increased over time and varied by age and sex. At a given point in time, a large proportion of the most recent BMIs are unlikely to reflect current BMI; consequent BMI misclassification might be reduced by employing model-based imputation of current BMI. PMID:24038008
Exercise mitigates cumulative associations between stress and BMI in girls age 10–19
Prather, Aric A.; Epel, Elissa S.; Loharuka, Sheila; Adler, Nancy E.; Laraia, Barbara
2015-01-01
Objective Long-term psychological stress is associated with BMI increases in children as they transition to adulthood, while long-term maintenance of physical activity can slow excess weight gain. We hypothesized that in addition to these main effects, long-term physical activity mitigates the relationship between long-term stress and BMI increase. Methods The NHLBI Growth and Health Study enrolled 2,379 10-year-old Black and White girls, following them annually for 10 measurement points. Growth curve modeling captured the dynamics of BMI, measured yearly, and stress and physical activity, measured every other year. Results At average levels of activity and stress, with all covariates remaining fixed, average BMI at baseline was 19.74 (SE = 0.38) and increased 0.64 BMI (SE= 0.01, p psychological stress. PMID:26301595
Liao, Qiuju; Zheng, Zheng; Xiu, Shuangling; Chan, Piu
2018-03-27
Obesity is found to be associated with frailty. Body mass index (BMI) and waist circumference (WC) are the commonly used measures for obesity, the former is more closely related to general obesity and body weight; the latter can more accurately reflect abdominal obesity and is more closely associated with metabolic disorders. In this study, we intend to study the relationship between frailty, BMI and WC among older people. Data were derived from the Beijing Longitudinal Study on Aging II Cohort, which included 6320 people 65 years or older from three urban districts in Beijing. A Frailty Index derived from 33 items was developed according to Rockwood's cumulative deficits method. A Frailty Index ≥ 0.25 was used as the cut-off criteria. BMI was classified as underweight, normal, overweight, or obese (BMI (≥ 28.0 kg/m 2 , 22.6%) or a larger WC (18.5%) were more likely to be frail. People with normal BMI and overweight people do not suffer from higher prevalence for frailty. In comparison with individuals with normal BMI (18.5-BMI and large WC (odds ratio 1.68; 95% CI 1.33-2.12), have overweight and large WC (odds ratio 1.58; 95% CI 1.23-1.96), or have obesity and large WC (odds ratio 2.28; 95% CI 1.79-2.89). In people with normal WC, only those who are underweight have a higher risk for frailty (odds ratio 1.65, 95% CI 1.08-2.52). In comparison with BMI, the relation of WC with the risk for frailty was much closer. Abdominal obesity is more closely associated with incidence of frailty than general obesity in the elderly. Older adults with large waist circumference are more likely to be frail. Frailty in the elderly might be more closely related to metabolic disorders. WC might be a better measurement to detect frailty than BMI, given its relationship with metabolic disorders.
Palo Verde Unit 3 BMI nozzle modification
International Nuclear Information System (INIS)
Waskey, D.
2015-01-01
The 61 BMI (Bottom Mount Instrumentation) nozzles of the unit 3 of the Palo Verde plant have been examined through ASME Code Case N722. The nozzle 3 was the only one with leakage noted. The ultrasound testing results are characteristic of PWSCC (Primary Water Stress Corrosion Cracking). The initiation likely occurred at a weld defect which was exposed to the primary water environment resulting in PWSCC. All other nozzles (60) showed no unacceptable indications. Concerning nozzle 3 one crack in J-groove weld connected large defect to primary water. An environmental model has been used to simulate and optimize the repair. The AREVA crew was on site 18 days after contract award and the job was completed in 12 days, 30 hours ahead of baseline schedule. This series of slides describes the examination of the BMI nozzles, the repair steps, and alternative design concepts
BMI modulates calorie-dependent dopamine changes in accumbens from glucose intake.
Directory of Open Access Journals (Sweden)
Gene-Jack Wang
Full Text Available Dopamine mediates the rewarding effects of food that can lead to overeating and obesity, which then trigger metabolic neuroadaptations that further perpetuate excessive food consumption. We tested the hypothesis that the dopamine response to calorie intake (independent of palatability in striatal brain regions is attenuated with increases in weight.We used positron emission tomography with [11C]raclopride to measure dopamine changes triggered by calorie intake by contrasting the effects of an artificial sweetener (sucralose devoid of calories to that of glucose to assess their association with body mass index (BMI in nineteen healthy participants (BMI range 21-35.Neither the measured blood glucose concentrations prior to the sucralose and the glucose challenge days, nor the glucose concentrations following the glucose challenge vary as a function of BMI. In contrast the dopamine changes in ventral striatum (assessed as changes in non-displaceable binding potential of [11C]raclopride triggered by calorie intake (contrast glucose - sucralose were significantly correlated with BMI (r = 0.68 indicating opposite responses in lean than in obese individuals. Specifically whereas in normal weight individuals (BMI <25 consumption of calories was associated with increases in dopamine in the ventral striatum in obese individuals it was associated with decreases in dopamine.These findings show reduced dopamine release in ventral striatum with calorie consumption in obese subjects, which might contribute to their excessive food intake to compensate for the deficit between the expected and the actual response to food consumption.
Xu, Fan; Li, Xiao; Liu, Lanfang; Xiao, Xu; Zhang, Li; Zhang, Shenglin; Lin, Pingping; Wang, Xiaojie; Wang, Yongwei; Li, Qingshan
2017-09-01
The protective effects and mechanisms of esculetin on doxorubicin (DOX)-induced injury of H9c2 cells were investigated. H9c2 cells were cultured and the logarithmic growth phase of the cells was divided into a control group, a DOX group and an esculetin + DOX group. Cell viability was detected by MTT assay. Annexin V-PI (AV-PI) double staining flow cytometry was carried out to detect cell apoptosis. Intracellular reactive oxygen species (ROS) were detected by flow cytometry. Transmission electron microscope (TEM) was used to evaluate cell ultrastructure. Cleaved caspase-3, cleaved PARP, Bcl-2, Bid and Bmi-1 proteins levels were investigated by western blot analysis. Bmi-1 siRNA was used to detect the role of Bmi-1 in the protective effects of esculetin against DOX-induced toxicity in H9c2 cells. The MTT and AV-PI double staining results showed that esculetin significantly increased H9c2 cell viability. Compared with the control group, the levels of cleaved caspase-3, cleaved PARP, Bid and ROS levels were significantly decreased, but the expression of Bcl-2 and Bmi-1 were significantly increased in the esculetin + DOX group. TEM showed that the cell structure of the mitochondria was protected by esculetin. The results of Bmi-1 siRNA showed that esculetin could protect DOX-induced cardiotoxicity by modulating Bmi-1 expression. Esculetin can protect DOX-induced cardiotoxicity and the effects may be attributable to modulation of Bmi-1 expression, provoking intracellular ROS accumulation, protecting the structure of mitochondria and reducing cell apoptosis.
Prognostic Significance of BMI-1 But Not MEL-18 Expression in Pulmonary Squamous Cell Carcinoma.
Abe, Sosei; Yamashita, Shin-Ichi; Miyahara, S O; Wakahara, Junichi; Yamamoto, Leona; Mori, Ryo; Imamura, Naoko; Yoshida, Yasuhiro; Waseda, Ryuichi; Hiratsuka, Masafumi; Shiraishi, Takeshi; Nabeshima, Kazuki; Iwasaki, Akinori
2017-04-01
We investigated the possibility of BMI-1 and MEL-18 to predict survival in patients with pulmonary squamous cell carcinoma. One hundred and ninety-nine patients underwent surgery in our Institute between 1995 and 2005. We used immunohistochemical (IHC) analysis to determine the expressions of BMI-1 and MEL-18 and compared them with clinicopathological factors and survival. Forty-one of 199 cases (21%) were BMI-1-positive. No correlation was found between BMI-1 and MEL-18 expression by IHC and clinicopathological factors. Five-year overall survival in the BMI-1-positive group (66.8%), but not MEL-18, was significantly better than that in the negative group (45.5%, p=0.04). In multivariate analysis, positive BMI-1 was a better prognostic factor of overall survival (hazard ratio (HR)=0.561, 95% confidence interval (CI)=0.271-1.16, p=0.12). BMI-1 expression, but not MEL-18, is associated with a favorable prognosis and is a possible prognostic factor of pulmonary squamous cell carcinoma. Copyright© 2017, International Institute of Anticancer Research (Dr. George J. Delinasios), All rights reserved.
BMI OF FEMALE STUDENTS NEWLY ENROLLED AT TODOR KABLESHKOV UNIVERSITY OF TRANSPORT
Directory of Open Access Journals (Sweden)
Diana Peeva
2014-06-01
Full Text Available Introduction: The paper presents the results of a study where besides using the conventional anthropometry, the individual Body Mass Index (BMI or Ketle Index was calculated. Being established in the mid-nineteenth century, Ketle Index gained wide popularity in the 1950s and 1960s when the problem of obesity in the developed countries acquire serious levels. The aim was to prove the relationship between anthropometric parameters and Body Mass Index as well as the possible health risks of the individual. Methods: The study was carried out on 78 first-year female students at the Todor Kableshkov University of Transport (VTU. The indicators examined were: height, weight, skin fold, waist circumference and BMI. Descriptive statistics was used with data processing and different methods were applied to establish the anthropometric parameters: Body Mass Index or Kettle Index; quantitative subcutaneous fat according to the method developed by Deurenberg; comparative analysis of the link between waist circumference; BMI and the state of the individual’s body. Results: The study showed that the average BMI for the entire group of students was 23.1 and subcutaneous fat of 26.6% respectively. Nearly 10% of those being examined are overweight combining high levels of subcutaneous fat and waist circumference, which is a prerequisite for increased risk of disease. Discussion: In the academic year 2011/2012 a study of anthropometric indicators of the newly-enrolled female students was carried out at the Todor Kableshkov University of Transport (VTU. In compliance with some studies (Popov, 1969 a slight increase of size and weight is observed with increasing the age of women during the time of study at university while according to others (Karapetrov, 1978 changes in anthropometric indicators are reported to a later age. According to the research related to introduction of Euro fit tests, BMI as an indicator of general health of the body works in combination
Characteristics of screen media use associated with higher BMI in young adolescents.
Bickham, David S; Blood, Emily A; Walls, Courtney E; Shrier, Lydia A; Rich, Michael
2013-05-01
This study investigates how characteristics of young adolescents' screen media use are associated with their BMI. By examining relationships between BMI and both time spent using each of 3 screen media and level of attention allocated to use, we sought to contribute to the understanding of mechanisms linking media use and obesity. We measured heights and weights of 91 13- to 15-year-olds and calculated their BMIs. Over 1 week, participants completed a weekday and a Saturday 24-hour time-use diary in which they reported the amount of time they spent using TV, computers, and video games. Participants carried handheld computers and responded to 4 to 7 random signals per day by completing onscreen questionnaires reporting activities to which they were paying primary, secondary, and tertiary attention. Higher proportions of primary attention to TV were positively associated with higher BMI. The difference between 25th and 75th percentiles of attention to TV corresponded to an estimated +2.4 BMI points. Time spent watching television was unrelated to BMI. Neither duration of use nor extent of attention paid to video games or computers was associated with BMI. These findings support the notion that attention to TV is a key element of the increased obesity risk associated with TV viewing. Mechanisms may include the influence of TV commercials on preferences for energy-dense, nutritionally questionable foods and/or eating while distracted by TV. Interventions that interrupt these processes may be effective in decreasing obesity among screen media users.
The influence of puberty on subcortical brain development.
Goddings, Anne-Lise; Mills, Kathryn L; Clasen, Liv S; Giedd, Jay N; Viner, Russell M; Blakemore, Sarah-Jayne
2014-03-01
Puberty is characterized by hormonal, physical and psychological transformation. The human brain undergoes significant changes between childhood and adulthood, but little is known about how puberty influences its structural development. Using a longitudinal sample of 711 magnetic resonance imaging scans from 275 individuals aged 7-20years, we examined how subcortical brain regions change in relation to puberty. Our regions of interest included the amygdala, hippocampus and corpus striatum including the nucleus accumbens (NA), caudate, putamen and globus pallidus (GP). Pubertal development was significantly related to structural volume in all six regions in both sexes. Pubertal development and age had both independent and interactive influences on volume for the amygdala, hippocampus and putamen in both sexes, and the caudate in females. There was an interactive puberty-by-age effect on volume for the NA and GP in both sexes, and the caudate in males. These findings suggest a significant role for puberty in structural brain development. © 2013. Published by Elsevier Inc. All rights reserved.
Predictors of Success in Bariatric Surgery: the Role of BMI and Pre-operative Comorbidities.
da Cruz, Magda Rosa Ramos; Branco-Filho, Alcides José; Zaparolli, Marília Rizzon; Wagner, Nathalia Farinha; de Paula Pinto, José Simão; Campos, Antônio Carlos Ligocki; Taconeli, Cesar Augusto
2017-11-10
This is a retrospective review of 204 patients who underwent bariatric surgery. The impact of weight regain (WR), pre-operative comorbidities and BMI values on the recurrence of comorbidities was evaluated, and an equation was elaborated to estimate BMI at 5 years of bariatric surgery. Pre-operative data, after 1 year and after 5 years, was collected from the medical records. Descriptive analyses and bivariate hypothesis tests were performed first, and then, a generalised linear regression model with Tweedie distribution was adjusted. The hit rate and the Kendall coefficient of concordance (Kendall's W) of the equation were calculated. At the end, the Mann-Whitney test was performed between the BMI, WR and the presence of comorbidities, after a post-operative period of 5 years. The adjustment of the model resulted in an equation that estimates the mean value of BMI 5 years after surgery. The hit rate was 82.35% and the value of Kendall's W was 0.85 for the equation. It was found that patients with comorbidities presented a higher median WR (10.13%) and a higher mean BMI (30.09 kg/m 2 ) 5 years after the surgery. It is concluded that the equation is useful for estimating the mean BMI at 5 years of surgery and that patients with low pre-operative HDL and folic acid levels, with depression and/or anxiety and a higher BMI, have a higher BMI at 5 years of surgery and higher incidence of comorbid return and dissatisfaction with post-operative results.
International Nuclear Information System (INIS)
Zafar, S.; Haq, I.U.; Butt, A.R.; Shafiq, F.; Huda, G.; Mirza, G.; Rehman, A.U.
2007-01-01
To assess the correlation of endoscopic severity of Gastroesophageal Reflux Disease (GERD) with Body Mass Index (BMI). This study was conducted on 203 patients, who presented with upper GI symptoms. Patients who fulfilled the symptom criteria were referred for endoscopy. Classification of GERD was done according to LA Grading classification system. Body mass index (BMI) was calculated as Body Weight (BW) in kilograms (kg) divided by the square of the body height (BH) in meter (m2). Patient data was analyzed using SPSS 12 software. Statistical evaluation was done using non-parametric Wilcoxon's-sign Rank test. P-value <0.05 was considered to be statistically significant. Distribution of GERD was as follows: GERD-A subjects 65 (32%), GERD B subjects 72 (35.4%), GERD-C subjects 23 (11.3%), GERD-D subjects 10 (4.92%), while Non-Erosive Reflux Disease (NERD) was present in 33 subjects (16.2%). Mean BMI was 27+5.02SD (range of 18.2-38.3). BMI of patients having NERD was in normal range but patients who were having advanced disease i.e. Grade C-D were in obese range of BMI, while those who were having LA grade A-B were in overweight BMI range. When regrouped as mild GERD (grade A-B) and NERD versus severe GERD (grade C-D), there was a strong significant correlation between severity of GERD and BMI, as detected by Wilcoxon's signed Rank test (p=0.001). Higher BMI seems to be associated with higher degree of endoscopic GERD severity. (author)
Body mass index (BMI) in the Saudi population of Gassim.
Soyannwo, M A; Kurashi, N Y; Gadallah, M; Hams, J; el-Essawi, O; Khan, N A; Singh, R G; Alamri, A; Beyari, T H
1998-01-01
In a total cross-sectional population survey of the Faizia East Primary Health District of Buraidah, Gassim region of Saudi Arabia, 6,044 (2727 male and 3317 females) subjects out of a de facto population of 7695 got their BMI computed because infants and restless or bedridden subjects could not be examined. Mean (+/- SD) and percentiles (25th & 75th) were calculated in the conventional 5-year age cohorts as well as in functional age groups, namely, 0-5, 6-12, 13-49, 50-69 and 70+ years. 5th, 10th, 25th, 50th, 75th, 90th and 95th percentiles were computed only for the functional age groups. In general, the trend was for BMI to increase with age in both genders but the curve pattern showed some plateauing from about the age of 50 with slight decline in later life. Females had significantly higher indices than males, this becoming quite prominent from the 10-14 year age cohort. This difference persisted irrespective of the types of age grouping or residential location. Overall means (+/- SD) were 20.14 +/- 5.98 vs 22.22 +/- 7.21 for males and females respectively; df: 5771; p = 0.0000; 95% CI: -2.43, -1.735. Subjects in the urban living environment had significant higher indices than their rural counterpart: (21.666.92 vs 20.446.33: df: 5771; P = 0.0000; 95% CI: 1.595, -0.840). From the age of 15 about one quarter of females are overweight (BMI at the 75th percentile > 25) and from 30 years the same proportion are frankly obese (BMI > 30). Both systolic and diastolic blood pressure were significantly positively correlated with BMI in both genders: male SBP: r = 0.22, P r = 0.21, P r = 0.18, P < 0.00001.
Process Optimization of Bismaleimide (BMI) Resin Infused Carbon Fiber Composite
Ehrlich, Joshua W.; Tate, LaNetra C.; Cox, Sarah B.; Taylor, Brian J.; Wright, M. Clara; Caraccio, Anne J.; Sampson, Jeffery W.
2013-01-01
Bismaleimide (BMI) resins are an attractive new addition to world-wide composite applications. This type of thermosetting polyimide provides several unique characteristics such as excellent physical property retention at elevated temperatures and in wet environments, constant electrical properties over a vast array of temperature settings, and nonflammability properties as well. This makes BMI a popular choice in advance composites and electronics applications [I]. Bismaleimide-2 (BMI-2) resin was used to infuse intermediate modulus 7 (IM7) based carbon fiber. Two panel configurations consisting of 4 plies with [+45deg, 90deg]2 and [0deg]4 orientations were fabricated. For tensile testing, a [90deg]4 configuration was tested by rotating the [0deg]4 configirration to lie orthogonal with the load direction of the test fixture. Curing of the BMI-2/IM7 system utilized an optimal infusion process which focused on the integration of the manufacturer-recommended ramp rates,. hold times, and cure temperatures. Completion of the cure cycle for the BMI-2/IM7 composite yielded a product with multiple surface voids determined through visual and metallographic observation. Although the curing cycle was the same for the three panellayups, the surface voids that remained within the material post-cure were different in abundance, shape, and size. For tensile testing, the [0deg]4 layup had a 19.9% and 21.7% greater average tensile strain performance compared to the [90deg]4 and [+45deg, 90deg, 90deg,-45degg] layups, respectively, at failure. For tensile stress performance, the [0deg]4 layup had a 5.8% and 34.0% greater average performance% than the [90deg]4 and [+45deg, 90deg, 90deg,-45deg] layups.
Gathirua-Mwangi, Wambui G; Monahan, Patrick; Song, Yiqing; Zollinger, Terrell W; Champion, Victoria L; Stump, Timothy E; Imperiale, Thomas F
2017-11-01
Waist circumference (WC) is a stronger predictor of colon cancer (CRC) risk than body mass index (BMI). However, how well change in either WC or BMI predicts risk of advanced colorectal neoplasia (AN) is unclear. To determine the relationship between change in BMI and WC from early adulthood to later age and the risk of AN and which change measure is a stronger predictor. In 4500 adults, ages 50-80, with no previous neoplasia and undergoing screening colonoscopy, BMI and WC at age 21 and at time of screening were reported. Changes in BMI and WC were defined using universal risk cutoffs. Known CRC risk factors were controlled in the logistic models. Overall, model statistics showed WC change (omnibus test χ 2 = 10.15, 2 DF, p value = 0.006) was a statistically stronger predictor of AN than BMI change (omnibus test χ 2 = 5.66, 5 DF, p value = 0.34). Independent of BMI change, participants who increased WC (OR 1.44; 95% CI 1.05-1.96) or maintained a high-risk WC (OR 2.50; 95% CI 1.38-4.53) at age 21 and at screening had an increased risk of AN compared to those with a low-risk WC. Study participants who were obese at age 21 and at screening had an increased risk of AN (OR 1.87; 95% CI 1.08-3.23) compared to those who maintained a healthy BMI. Maintaining an overweight BMI or increasing BMI was not associated with AN. Maintaining an unhealthy BMI and WC throughout adult life may increase risk of AN. WC change may be a better predictor of AN than BMI change.
Maternal BMI at the start of pregnancy and offspring epigenome-wide DNA methylation
DEFF Research Database (Denmark)
Sharp, Gemma C; Salas, Lucas A; Monnereau, Claire
2017-01-01
-analysed the association between pre-pregnancy maternal BMI and methylation at over 450,000 sites in newborn blood DNA, across 19 cohorts (9,340 mother-newborn pairs). We attempted to infer causality by comparing the effects of maternal versus paternal BMI and incorporating genetic variation. In four additional cohorts (1......,817 mother-child pairs), we meta-analysed the association between maternal BMI at the start of pregnancy and blood methylation in adolescents. In newborns, maternal BMI was associated with small (.... Adjustment for estimated cell proportions greatly attenuated the number of significant CpGs to 104, including 86 sites common to the unadjusted model. At 72/86 sites, the direction of the association was the same in newborns and adolescents, suggesting persistence of signals. However, we found evidence...
Impact of non-physician health professionals' BMI on obesity care and beliefs.
Bleich, Sara N; Bandara, Sachini; Bennett, Wendy L; Cooper, Lisa A; Gudzune, Kimberly A
2014-12-01
Examine the impact of non-physician health professional body mass index (BMI) on obesity care, self-efficacy, and perceptions of patient trust in weight loss advice. A national cross-sectional Internet-based survey of 500 US non-physician health professionals specializing in nutrition, nursing, behavioral/mental health, exercise, and pharmacy collected between January 20 and February 5, 2014 was analyzed. Normal-BMI professionals were more likely than overweight/obese professionals to report success in helping patients achieve clinically significant weight loss (52% vs. 29%, P = 0.01). No differences by health professional BMI about the appropriate patient body weight for weight-related care (initiate weight loss discussions and success in helping patients lose weight), confidence in ability to help patients lose weight, or in perceived patient trust in their advice were observed. Most health professionals (71%) do not feel successful in helping patients lose weight until they are morbidly obese, regardless of BMI. Normal-BMI non-physician health professionals report being more successful than overweight and obese health professionals at helping obese patients lose weight. More research is needed to understand how to improve self-efficacy for delivering obesity care, particularly among overweight and class I obese patients. © 2014 The Obesity Society.
Zhao, Yangfei; Zhao, Jun; Wang, Jinming; Wang, Jundong
2017-10-01
Previous studies have indicated that fluoride exposure damaged the male reproductive function; however, the cellular mechanism of fluoride-induced testicular toxicity is still unclear. In this study, twenty-two female pregnant Wistar rats were allotted randomly to two groups: control (deionized water) and sodium fluoride (NaF, contain F - : 67.86 mg/L) groups. After delivery, the dosage was continued for 15 weeks for puppies. Twelve rats in each group were tested at 6 and 9 (pubertal); 12 and 15 (mature) weeks of age. Our results suggested that organ coefficient of epididymis was significantly decreased in the mature (12 and 15 week-old) rats. Epididymal sperm abnormality and femur fluoride concentration were increased with the concomitant decrease in sperm motility and concentration in these experimental periods. Compared to the control, in the NaF group, the seminiferous tubules of each age were reduced in terms of diameter and thickness. The sperm cells were lost and shedding and finally disappeared after 9 weeks. mRNA and protein levels of HSP27 and 90 were decreased with a concomitant increase in HSP70 and HSF mRNA and protein levels in NaF exposed rats. The mRNA and protein levels of HSP27 and HSF (only mRNA) were significantly increased in NaF treated rats at 9 and 15 weeks of age, respectively. In summary, these results emphasize that NaF induces testicular and sperm abnormalities through the involvement of HSPs especially during the pubertal period. Copyright © 2017 Elsevier Ltd. All rights reserved.
Physical Activity, Sleep, and BMI Percentile in Rural and Urban Ugandan Youth.
Christoph, Mary J; Grigsby-Toussaint, Diana S; Baingana, Rhona; Ntambi, James M
Uganda is experiencing a dual burden of over- and undernutrition, with overweight prevalence increasing while underweight remains common. Potential weight-related factors, particularly physical activity, sleep, and rural/urban status, are not currently well understood or commonly assessed in Ugandan youth. The purpose of this study was to pilot test a survey measuring weight-related factors in rural and urban Ugandan schoolchildren. A cross-sectional survey measured sociodemographics, physical activity, sleep patterns, and dietary factors in 148 rural and urban schoolchildren aged 11-16 in central Uganda. Height and weight were objectively measured. Rural and urban youth were compared on these factors using χ 2 and t tests. Regression was used to identify correlates of higher body mass index (BMI) percentile in the full sample and nonstunted youth. Youth were on average 12.1 ± 1.1 years old; underweight (10%) was more common than overweight (1.4%). Self-reported sleep duration and subjective sleep quality did not differ by rural/urban residence. Rural children overall had higher BMI percentile and marginally higher stunting prevalence. In adjusted analyses in both the full and nonstunted samples, higher BMI percentile was related to living in a rural area, higher frequency of physical activity, and higher subjective sleep quality; it was negatively related to being active on weekends. In the full sample, higher BMI percentile was also related to female gender, whereas in nonstunted youth, higher BMI was related to age. BMI percentile was unrelated to sedentary time, performance of active chores and sports, and dietary factors. This study is one of the first to pilot test a survey assessing weight-related factors, particularly physical activity and sleep, in Ugandan schoolchildren. BMI percentile was related to several sociodemographic, sleep, and physical activity factors among primarily normal-weight school children in Uganda, providing a basis for
mtDNA copy number in oocytes of different sizes from individual pre- and post-pubertal pigs
DEFF Research Database (Denmark)
Pedersen, Hanne Skovsgaard; Løvendahl, Peter; Larsen, Knud Erik
2014-01-01
from ovaries of 10 pre- and 10 post-pubertal pigs. Cumulus cells were removed and the oocytes were measured (inside-ZP-diameter). Oocytes were transferred to DNAase-free tubes, snap-frozen, and stored at –80°C. The genes ND1 and COX1 were used to determine the mtDNA copy number. Plasmid preparations...... Reproduction 131, 233–245). However, the correlation between size and mtDNA copy number in single oocytes has not been determined. This study describes the relation between oocytes of defined diameters from individual pre- and postpubertal pigs and mtDNA copy number. Cumulus-oocyte complexes were aspirated...