WorldWideScience

Sample records for pseudouridine synthases leaves

  1. Functional Disruption of a Chloroplast Pseudouridine Synthase Desensitizes Arabidopsis Plants to Phosphate Starvation

    Directory of Open Access Journals (Sweden)

    Shan Lu

    2017-08-01

    Full Text Available Phosphate (Pi deficiency is a common nutritional stress of plants in both agricultural and natural ecosystems. Plants respond to Pi starvation in the environment by triggering a suite of biochemical, physiological, and developmental changes that increase survival and growth. The key factors that determine plant sensitivity to Pi starvation, however, are unclear. In this research, we identified an Arabidopsis mutant, dps1, with greatly reduced sensitivity to Pi starvation. The dps1 phenotypes are caused by a mutation in the previously characterized SVR1 (SUPPRESSION OF VARIAGATION 1 gene, which encodes a chloroplast-localized pseudouridine synthase. The mutation of SVR1 results in defects in chloroplast rRNA biogenesis, which subsequently reduces chloroplast translation. Another mutant, rps5, which contains a mutation in the chloroplast ribosomal protein RPS5 and has reduced chloroplast translation, also displayed decreased sensitivity to Pi starvation. Furthermore, wild type plants treated with lincomycin, a chemical inhibitor of chloroplast translation, showed similar growth phenotypes and Pi starvation responses as dps1 and rps5. These results suggest that impaired chloroplast translation desensitizes plants to Pi starvation. Combined with previously published results showing that enhanced leaf photosynthesis augments plant responses to Pi starvation, we propose that the decrease in responses to Pi starvation in dps1, rps5, and lincomycin-treated plants is due to their reduced demand for Pi input from the environment.

  2. In human pseudouridine synthase 1 (hPus1), a C-terminal helical insert blocks tRNA from binding in the same orientation as in the Pus1 bacterial homologue TruA, consistent with their different target selectivities.

    Science.gov (United States)

    Czudnochowski, Nadine; Wang, Amy Liya; Finer-Moore, Janet; Stroud, Robert M

    2013-10-23

    Human pseudouridine (Ψ) synthase Pus1 (hPus1) modifies specific uridine residues in several non-coding RNAs: tRNA, U2 spliceosomal RNA, and steroid receptor activator RNA. We report three structures of the catalytic core domain of hPus1 from two crystal forms, at 1.8Å resolution. The structures are the first of a mammalian Ψ synthase from the set of five Ψ synthase families common to all kingdoms of life. hPus1 adopts a fold similar to bacterial Ψ synthases, with a central antiparallel β-sheet flanked by helices and loops. A flexible hinge at the base of the sheet allows the enzyme to open and close around an electropositive active-site cleft. In one crystal form, a molecule of Mes [2-(N-morpholino)ethane sulfonic acid] mimics the target uridine of an RNA substrate. A positively charged electrostatic surface extends from the active site towards the N-terminus of the catalytic domain, suggesting an extensive binding site specific for target RNAs. Two α-helices C-terminal to the core domain, but unique to hPus1, extend along the back and top of the central β-sheet and form the walls of the RNA binding surface. Docking of tRNA to hPus1 in a productive orientation requires only minor conformational changes to enzyme and tRNA. The docked tRNA is bound by the electropositive surface of the protein employing a completely different binding mode than that seen for the tRNA complex of the Escherichia coli homologue TruA. Copyright © 2013 Elsevier Ltd. All rights reserved.

  3. The archaeal COG1901/DUF358 SPOUT-methyltransferase members, together with pseudouridine synthase Pus10, catalyze the formation of 1-methylpseudouridine at position 54 of tRNA

    Science.gov (United States)

    Chatterjee, Kunal; Blaby, Ian K.; Thiaville, Patrick C.; Majumder, Mrinmoyee; Grosjean, Henri; Yuan, Y. Adam; Gupta, Ramesh; de Crécy-Lagard, Valérie

    2012-01-01

    The methylation of pseudouridine (Ψ) at position 54 of tRNA, producing m1Ψ, is a hallmark of many archaeal species, but the specific methylase involved in the formation of this modification had yet to be characterized. A comparative genomics analysis had previously identified COG1901 (DUF358), part of the SPOUT superfamily, as a candidate for this missing methylase family. To test this prediction, the COG1901 encoding gene, HVO_1989, was deleted from the Haloferax volcanii genome. Analyses of modified base contents indicated that while m1Ψ was present in tRNA extracted from the wild-type strain, it was absent from tRNA extracted from the mutant strain. Expression of the gene encoding COG1901 from Halobacterium sp. NRC-1, VNG1980C, complemented the m1Ψ minus phenotype of the ΔHVO_1989 strain. This in vivo validation was extended with in vitro tests. Using the COG1901 recombinant enzyme from Methanocaldococcus jannaschii (Mj1640), purified enzyme Pus10 from M. jannaschii and full-size tRNA transcripts or TΨ-arm (17-mer) fragments as substrates, the sequential pathway of m1Ψ54 formation in Archaea was reconstituted. The methylation reaction is AdoMet dependent. The efficiency of the methylase reaction depended on the identity of the residue at position 55 of the TΨ-loop. The presence of Ψ55 allowed the efficient conversion of Ψ54 to m1Ψ54, whereas in the presence of C55, the reaction was rather inefficient and no methylation reaction occurred if a purine was present at this position. These results led to renaming the Archaeal COG1901 members as TrmY proteins. PMID:22274953

  4. Characterization and partial purification of beta-1,3-D-glucan (callose) synthase from barley (Hordeum vulgare) leaves

    DEFF Research Database (Denmark)

    Pedersen, L.H.; Jacobsen, S.; Hejgaard, J.

    1993-01-01

    The plasma membrane bound beta-1,3-D-glucan (callose) synthase. assumed to be involved in the resistance to the powdery mildew fungus (Erysiphe graminis f.sp. hordei), was partially purified from a microsomal fraction of green barley leaves (Hordeum vulgare L.). Plasma membranes were enriched...

  5. [Study on the seasonal variations of the active components in Acer truncatum leaves and the inhibitory ability on fatty acid synthase].

    Science.gov (United States)

    Fan, Yuan-Jie; Ye, Yan-Bin; Gao, Wen; Zhang, Feng; Zhang, Ying-Xia

    2010-11-01

    To study the dynamic variations of the contents of total polyphenols, flvonoids and chlorogenic acid from Acer truncatum leaves in different months, and their inhibitory activities on fatty acid synthase. Spectrophotometry was used to determine the contents of total polyphenols, flavonoids and chlorogenic acid in extracts and the extracts' inhibitory effects were also investigated. All Leaves picked from May to November have inhibitory effect. But the contents of polyphenols in leaves of July appeared to be higher than other months', and consequently exhibited stronger inhibition against FAS. A positive correlation between the content of polyphenols in leaves extract and the inhibitory efficacy on FAS could be established.

  6. Constitutive expression of feedback-insensitive cystathionine γ-synthase increases methionine levels in soybean leaves and seeds

    Institute of Scientific and Technical Information of China (English)

    YU Yang; HOU Wen-sheng; YaeI Hacham; SUN Shi; WU Cun-xiang; Ifat Matityahu; SONG Shikui; RacheI Amir; HAN Tian-fu

    2018-01-01

    Soybean (Glycine max (L.) Merr.) is a major crop that provides plant-origin protein and oil for humans and livestock. Although the soybean vegetative tissues and seeds provide a major source of high-quality protein, they suffer from low concentration of an essential sulfur-containing amino acid, methionine, which significantly limits their nutritional quality. The level of methionine is mainly controlled by the first unique enzyme of methionine synthesis, cystathione γ-synthase (CGS). Aiming to elevate methionine level in vegetative tissues and seeds, we constitutively over-expressed a feedback-insensitive Arabidopsis CGS (AtD-CGS) in soybean cultivars, Zigongdongdou (ZD) and Jilinxiaoli 1 (JX). The levels of soluble methionine increased remarkably in leaves of transgenic soybeans compared to wild-type plants (6.6- and 7.3-fold in two transgenic ZD lines, and 3.7-fold in one transgenic JX line). Furthermore, the total methionine contents were significantly increased in seeds of the transgenic ZD lines (1.5- to 4.8-fold increase) and the transgenic JX lines (1.3- to 2.3-fold increase) than in the wild type. The protein contents of the transgenic soybean seeds were significantly elevated compared to the wild type, suggesting that the scarcity of methionine in soybeans may limit protein accumulation in soybean seeds. The increased protein content did not alter the profile of major storage proteins in the seeds. Generally, this study provides a promising strategy to increase the levels of methionine and protein in soybean through the breeding programs.

  7. Identification of the enzyme responsible for N1-methylation of pseudouridine 54 in archaeal tRNAs.

    Science.gov (United States)

    Wurm, Jan Philip; Griese, Marco; Bahr, Ute; Held, Martin; Heckel, Alexander; Karas, Michael; Soppa, Jörg; Wöhnert, Jens

    2012-03-01

    tRNAs from all three kingdoms of life contain a variety of modified nucleotides required for their stability, proper folding, and accurate decoding. One prominent example is the eponymous ribothymidine (rT) modification at position 54 in the T-arm of eukaryotic and bacterial tRNAs. In contrast, in most archaea this position is occupied by another hypermodified nucleotide: the isosteric N1-methylated pseudouridine. While the enzyme catalyzing pseudouridine formation at this position is known, the pseudouridine N1-specific methyltransferase responsible for this modification has not yet been experimentally identified. Here, we present biochemical and genetic evidence that the two homologous proteins, Mja_1640 (COG 1901, Pfam DUF358) and Hvo_1989 (Pfam DUF358) from Methanocaldococcus jannaschii and Haloferax volcanii, respectively, are representatives of the methyltransferase responsible for this modification. However, the in-frame deletion of the pseudouridine N1-methyltransferase gene in H. volcanii did not result in a discernable phenotype in line with similar observations for knockouts of other T-arm methylating enzymes.

  8. In Situ Dark Adaptation Enhances the Efficiency of DNA Extraction from Mature Pin Oak (Quercus palustris Leaves, Facilitating the Identification of Partial Sequences of the 18S rRNA and Isoprene Synthase (IspS Genes

    Directory of Open Access Journals (Sweden)

    Csengele E. Barta

    2017-10-01

    Full Text Available Mature oak (Quercus spp. leaves, although abundantly available during the plants’ developmental cycle, are rarely exploited as viable sources of genomic DNA. These leaves are rich in metabolites difficult to remove during standard DNA purification, interfering with downstream molecular genetics applications. The current work assessed whether in situ dark adaptation, to deplete sugar reserves and inhibit secondary metabolite synthesis could compensate for the difficulties encountered when isolating DNA from mature leaves rich in secondary metabolites. We optimized a rapid, commercial kit based method to extract genomic DNA from dark- and light-adapted leaves. We demonstrated that in situ dark adaptation increases the yield and quality of genomic DNA obtained from mature oak leaves, yielding templates of sufficiently high quality for direct downstream applications, such as PCR amplification and gene identification. The quality of templates isolated from dark-adapted pin oak leaves particularly improved the amplification of larger fragments in our experiments. From DNA extracts prepared with our optimized method, we identified for the first time partial segments of the genes encoding 18S rRNA and isoprene synthase (IspS from pin oak (Quercus palustris, whose full genome has not yet been sequenced.

  9. Benzalacetone Synthase

    Directory of Open Access Journals (Sweden)

    Ikuro eAbe

    2012-03-01

    Full Text Available Benzalacetone synthase, from the medicinal plant Rheum palmatum (Polygonaceae (RpBAS, is a plant-specific chalcone synthase (CHS superfamily of type III polyketide synthase (PKS. RpBAS catalyzes the one-step, decarboxylative condensation of 4-coumaroyl-CoA with malonyl-CoA to produce the C6-C4 benzalacetone scaffold. The X-ray crystal structures of RpBAS confirmed that the diketide-forming activity is attributable to the characteristic substitution of the conserved active-site "gatekeeper" Phe with Leu. Furthermore, the crystal structures suggested that RpBAS employs novel catalytic machinery for the thioester bond cleavage of the enzyme-bound diketide intermediate and the final decarboxylation reaction to produce benzalacetone. Finally, by exploiting the remarkable substrate tolerance and catalytic versatility of RpBAS, precursor-directed biosynthesis efficiently generated chemically and structurally divergent, unnatural novel polyketide scaffolds. These findings provided a structural basis for the functional diversity of the type III PKS enzymes.

  10. Expression of chalcone synthase genes in coleoptiles and primary leaves of Secale cereale L. after induction by UV radiation: evidence for a UV-protective role of the coleoptile

    International Nuclear Information System (INIS)

    Haussühl, K.; Rohde, W.; Weissenböck, G.

    1996-01-01

    Four chalcone synthase (CHS; EC 2.3.1.74) clones from rye were isolated and characterized. Two of these clones were used for analysis of CHS gene activities in response to ultraviolet and visible radiation in the coleoptile and the primary leaf of the rye seedling. The time-dependence of CHS gene activation and the spatial distribution of CHS were studied by investigation of enzyme activities and CHS mRNA levels, including in situ RNA hybridization. In the primary leaf strong induction of CHS gene activity was localized in the epidermal layers and only marginally found in the mesophyll. The coleoptile showed an even higher response to UV irradiation, but CHS gene activity was evenly distributed throughout the tissues. It is suggested that, in addition to its function as a mechanical protection for the primary leaf during seed germination and seedling emergence through the soil, the coleoptile may also protect the emerging seedling from harmful radiation

  11. Taking Leave?

    CERN Multimedia

    2000-01-01

    Planning a holiday? Then if you're a member of the personnel, you'll need to use the Laboratory's new leave system that will be put in place on 1 October. Leave allocations don't change - you are entitled to just as much holiday as before - but instead of being credited annually, your leave will be credited on a monthly basis, and this information will be communicated on your salary slip. The reason for the change is that with the various new leave schemes such as Recruitment by Saved Leave (RSL) and the Progressive Retirement Programme (PRP), a streamlined procedure was required for dealing with all kinds of leave. In the new system, each member of the personnel will have leave accounts to which leave will be credited monthly from the payroll and debited each time an absence is registered in the CERN Electronic Document Handling system (EDH). Leave balances will appear on monthly pay slips, and full details of leave transactions and balances will be available through EDH at all times. As the leave will be c...

  12. Molecular cloning and characterization of strictosidine synthase, a ...

    African Journals Online (AJOL)

    Mitragynine is one of the most dominant indole alkaloids present in the leaves of Mitragyna speciosa, a species of Rubiaceae. This alkaloid is believed to be synthesized via condensation of the amino acid derivative, tryptamine and secologanine by the action of strictosidine synthase (STR). The cDNA clone encoding STR ...

  13. Genomic Analysis of Terpene Synthase Family and Functional Characterization of Seven Sesquiterpene Synthases from Citrus sinensis

    Directory of Open Access Journals (Sweden)

    Berta Alquézar

    2017-08-01

    Full Text Available Citrus aroma and flavor, chief traits of fruit quality, are derived from their high content in essential oils of most plant tissues, including leaves, stems, flowers, and fruits. Accumulated in secretory cavities, most components of these oils are volatile terpenes. They contribute to defense against herbivores and pathogens, and perhaps also protect tissues against abiotic stress. In spite of their importance, our understanding of the physiological, biochemical, and genetic regulation of citrus terpene volatiles is still limited. The availability of the sweet orange (Citrus sinensis L. Osbeck genome sequence allowed us to characterize for the first time the terpene synthase (TPS family in a citrus type. CsTPS is one of the largest angiosperm TPS families characterized so far, formed by 95 loci from which just 55 encode for putative functional TPSs. All TPS angiosperm families, TPS-a, TPS-b, TPS-c, TPS-e/f, and TPS-g were represented in the sweet orange genome, with 28, 18, 2, 2, and 5 putative full length genes each. Additionally, sweet orange β-farnesene synthase, (Z-β-cubebene/α-copaene synthase, two β-caryophyllene synthases, and three multiproduct enzymes yielding β-cadinene/α-copaene, β-elemene, and β-cadinene/ledene/allo-aromandendrene as major products were identified, and functionally characterized via in vivo recombinant Escherichia coli assays.

  14. Hybrid polyketide synthases

    Energy Technology Data Exchange (ETDEWEB)

    Fortman, Jeffrey L.; Hagen, Andrew; Katz, Leonard; Keasling, Jay D.; Poust, Sean; Zhang, Jingwei; Zotchev, Sergey

    2016-05-10

    The present invention provides for a polyketide synthase (PKS) capable of synthesizing an even-chain or odd-chain diacid or lactam or diamine. The present invention also provides for a host cell comprising the PKS and when cultured produces the even-chain diacid, odd-chain diacid, or KAPA. The present invention also provides for a host cell comprising the PKS capable of synthesizing a pimelic acid or KAPA, and when cultured produces biotin.

  15. Molecular cloning and functional expression of geranylgeranyl pyrophosphate synthase from Coleus forskohlii Briq

    Directory of Open Access Journals (Sweden)

    Kawamukai Makoto

    2004-11-01

    Full Text Available Abstract Background Isopentenyl diphosphate (IPP, a common biosynthetic precursor to the labdane diterpene forskolin, has been biosynthesised via a non-mevalonate pathway. Geranylgeranyl diphosphate (GGPP synthase is an important branch point enzyme in terpenoid biosynthesis. Therefore, GGPP synthase is thought to be a key enzyme in biosynthesis of forskolin. Herein we report the first confirmation of the GGPP synthase gene in Coleus forskohlii Briq. Results The open reading frame for full-length GGPP synthase encodes a protein of 359 amino acids, in which 1,077 nucleotides long with calculated molecular mass of 39.3 kDa. Alignments of C. forskohlii GGPP synthase amino acid sequences revealed high homologies with other plant GGPP synthases. Several highly conserved regions, including two aspartate-rich motifs were identified. Transient expression of the N-terminal region of C. forskohlii GGPP synthase-GFP fusion protein in tobacco cells demonstrated subcellular localization in the chloroplast. Carotenoid production was observed in Escherichia coli harboring pACCAR25ΔcrtE from Erwinia uredovora and plasmid carrying C. forskohlii GGPP synthase. These results suggested that cDNA encoded functional GGPP synthase. Furthermore, C. forskohlii GGPP synthase expression was strong in leaves, decreased in stems and very little expression was observed in roots. Conclusion This investigation proposed that forskolin was synthesised via a non-mevalonate pathway. GGPP synthase is thought to be involved in the biosynthesis of forskolin, which is primarily synthesised in the leaves and subsequently accumulates in the stems and roots.

  16. An Arabidopsis callose synthase

    DEFF Research Database (Denmark)

    Ostergaard, Lars; Petersen, Morten; Mattsson, Ole

    2002-01-01

    in the Arabidopsis mpk4 mutant which exhibits systemic acquired resistance (SAR), elevated beta-1,3-glucan synthase activity, and increased callose levels. In addition, AtGsl5 is a likely target of salicylic acid (SA)-dependent SAR, since AtGsl5 mRNA accumulation is induced by SA in wild-type plants, while...... expression of the nahG salicylate hydroxylase reduces AtGsl5 mRNA levels in the mpk4 mutant. These results indicate that AtGsl5 is likely involved in callose synthesis in flowering tissues and in the mpk4 mutant....

  17. Monoterpene synthases from common sage (Salvia officinalis)

    Energy Technology Data Exchange (ETDEWEB)

    Croteau, Rodney Bruce (Pullman, WA); Wise, Mitchell Lynn (Pullman, WA); Katahira, Eva Joy (Pullman, WA); Savage, Thomas Jonathan (Christchurch 5, NZ)

    1999-01-01

    cDNAs encoding (+)-bornyl diphosphate synthase, 1,8-cineole synthase and (+)-sabinene synthase from common sage (Salvia officinalis) have been isolated and sequenced, and the corresponding amino acid sequences has been determined. Accordingly, isolated DNA sequences (SEQ ID No:1; SEQ ID No:3 and SEQ ID No:5) are provided which code for the expression of (+)-bornyl diphosphate synthase (SEQ ID No:2), 1,8-cineole synthase (SEQ ID No:4) and (+)-sabinene synthase SEQ ID No:6), respectively, from sage (Salvia officinalis). In other aspects, replicable recombinant cloning vehicles are provided which code for (+)-bornyl diphosphate synthase, 1,8-cineole synthase or (+)-sabinene synthase, or for a base sequence sufficiently complementary to at least a portion of (+)-bornyl diphosphate synthase, 1,8-cineole synthase or (+)-sabinene synthase DNA or RNA to enable hybridization therewith. In yet other aspects, modified host cells are provided that have been transformed, transfected, infected and/or injected with a recombinant cloning vehicle and/or DNA sequence encoding (+)-bornyl diphosphate synthase, 1,8-cineole synthase or (+)-sabinene synthase. Thus, systems and methods are provided for the recombinant expression of the aforementioned recombinant monoterpene synthases that may be used to facilitate their production, isolation and purification in significant amounts. Recombinant (+)-bornyl diphosphate synthase, 1,8-cineole synthase and (+)-sabinene synthase may be used to obtain expression or enhanced expression of (+)-bornyl diphosphate synthase, 1,8-cineole synthase and (+)-sabinene synthase in plants in order to enhance the production of monoterpenoids, or may be otherwise employed for the regulation or expression of (+)-bornyl diphosphate synthase, 1,8-cineole synthase and (+)-sabinene synthase, or the production of their products.

  18. Isolation and functional characterization of a τ-cadinol synthase, a new sesquiterpene synthase from Lavandula angustifolia.

    Science.gov (United States)

    Jullien, Frédéric; Moja, Sandrine; Bony, Aurélie; Legrand, Sylvain; Petit, Cécile; Benabdelkader, Tarek; Poirot, Kévin; Fiorucci, Sébastien; Guitton, Yann; Nicolè, Florence; Baudino, Sylvie; Magnard, Jean-Louis

    2014-01-01

    In this paper we characterize three sTPSs: a germacrene D (LaGERDS), a (E)-β-caryophyllene (LaCARS) and a τ-cadinol synthase (LaCADS). τ-cadinol synthase is reported here for the first time and its activity was studied in several biological models including transiently or stably transformed tobacco species. Three dimensional structure models of LaCADS and Ocimum basilicum γ-cadinene synthase were built by homology modeling using the template structure of Gossypium arboreum δ-cadinene synthase. The depiction of their active site organization provides evidence of the global influence of the enzymes on the formation of τ-cadinol: instead of a unique amino-acid, the electrostatic properties and solvent accessibility of the whole active site in LaCADS may explain the stabilization of the cadinyl cation intermediate. Quantitative PCR performed from leaves and inflorescences showed two patterns of expression. LaGERDS and LaCARS were mainly expressed during early stages of flower development and, at these stages, transcript levels paralleled the accumulation of the corresponding terpene products (germacrene D and (E)-β-caryophyllene). By contrast, the expression level of LaCADS was constant in leaves and flowers. Phylogenetic analysis provided informative results on potential duplication process leading to sTPS diversification in lavender.

  19. Functional Characterization of Sesquiterpene Synthase from Polygonum minus

    Directory of Open Access Journals (Sweden)

    Su-Fang Ee

    2014-01-01

    Full Text Available Polygonum minus is an aromatic plant, which contains high abundance of terpenoids, especially the sesquiterpenes C15H24. Sesquiterpenes were believed to contribute to the many useful biological properties in plants. This study aimed to functionally characterize a full length sesquiterpene synthase gene from P. minus. P. minus sesquiterpene synthase (PmSTS has a complete open reading frame (ORF of 1689 base pairs encoding a 562 amino acid protein. Similar to other sesquiterpene synthases, PmSTS has two large domains: the N-terminal domain and the C-terminal metal-binding domain. It also consists of three conserved motifs: the DDXXD, NSE/DTE, and RXR. A three-dimensional protein model for PmSTS built clearly distinguished the two main domains, where conserved motifs were highlighted. We also constructed a phylogenetic tree, which showed that PmSTS belongs to the angiosperm sesquiterpene synthase subfamily Tps-a. To examine the function of PmSTS, we expressed this gene in Arabidopsis thaliana. Two transgenic lines, designated as OE3 and OE7, were further characterized, both molecularly and functionally. The transgenic plants demonstrated smaller basal rosette leaves, shorter and fewer flowering stems, and fewer seeds compared to wild type plants. Gas chromatography-mass spectrometry analysis of the transgenic plants showed that PmSTS was responsible for the production of β-sesquiphellandrene.

  20. Identification, Functional Characterization, and Evolution of Terpene Synthases from a Basal Dicot1[OPEN

    Science.gov (United States)

    Yahyaa, Mosaab; Matsuba, Yuki; Brandt, Wolfgang; Doron-Faigenboim, Adi; Bar, Einat; McClain, Alan; Davidovich-Rikanati, Rachel; Lewinsohn, Efraim; Pichersky, Eran; Ibdah, Mwafaq

    2015-01-01

    Bay laurel (Laurus nobilis) is an agriculturally and economically important dioecious tree in the basal dicot family Lauraceae used in food and drugs and in the cosmetics industry. Bay leaves, with their abundant monoterpenes and sesquiterpenes, are used to impart flavor and aroma to food, and have also drawn attention in recent years because of their potential pharmaceutical applications. To identify terpene synthases (TPSs) involved in the production of these volatile terpenes, we performed RNA sequencing to profile the transcriptome of L. nobilis leaves. Bioinformatic analysis led to the identification of eight TPS complementary DNAs. We characterized the enzymes encoded by three of these complementary DNAs: a monoterpene synthase that belongs to the TPS-b clade catalyzes the formation of mostly 1,8-cineole; a sesquiterpene synthase belonging to the TPS-a clade catalyzes the formation of mainly cadinenes; and a diterpene synthase of the TPS-e/f clade catalyzes the formation of geranyllinalool. Comparison of the sequences of these three TPSs indicated that the TPS-a and TPS-b clades of the TPS gene family evolved early in the evolution of the angiosperm lineage, and that geranyllinalool synthase activity is the likely ancestral function in angiosperms of genes belonging to an ancient TPS-e/f subclade that diverged from the kaurene synthase gene lineages before the split of angiosperms and gymnosperms. PMID:26157114

  1. Seasonal influence on gene expression of monoterpene synthases in Salvia officinalis (Lamiaceae).

    Science.gov (United States)

    Grausgruber-Gröger, Sabine; Schmiderer, Corinna; Steinborn, Ralf; Novak, Johannes

    2012-03-01

    Garden sage (Salvia officinalis L., Lamiaceae) is one of the most important medicinal and aromatic plants and possesses antioxidant, antimicrobial, spasmolytic, astringent, antihidrotic and specific sensorial properties. The essential oil of the plant, formed mainly in very young leaves, is in part responsible for these activities. It is mainly composed of the monoterpenes 1,8-cineole, α- and β-thujone and camphor synthesized by the 1,8-cineole synthase, the (+)-sabinene synthase and the (+)-bornyl diphosphate synthase, respectively, and is produced and stored in epidermal glands. In this study, the seasonal influence on the formation of the main monoterpenes in young, still expanding leaves of field-grown sage plants was studied in two cultivars at the level of mRNA expression, analyzed by qRT-PCR, and at the level of end-products, analyzed by gas chromatography. All monoterpene synthases and monoterpenes were significantly influenced by cultivar and season. 1,8-Cineole synthase and its end product 1,8-cineole remained constant until August and then decreased slightly. The thujones increased steadily during the vegetative period. The transcript level of their corresponding terpene synthase, however, showed its maximum in the middle of the vegetative period and declined afterwards. Camphor remained constant until August and then declined, exactly correlated with the mRNA level of the corresponding terpene synthase. In summary, terpene synthase mRNA expression and respective end product levels were concordant in the case of 1,8-cineole (r=0.51 and 0.67 for the two cultivars, respectively; p<0.05) and camphor (r=0.75 and 0.82; p<0.05) indicating basically transcriptional control, but discordant for α-/β-thujone (r=-0.05 and 0.42; p=0.87 and 0.13, respectively). Copyright © 2011 Elsevier GmbH. All rights reserved.

  2. Parental Leave in Denmark

    DEFF Research Database (Denmark)

    Rostgaard, Tine; Christoffersen, Mogens; Weise, Hanne

    This artcle considders the political aims for different leave schemes and reviews studies af these schemes. The use of parental leave is sensitive to the financial loss involved in taking leave: a decrease in the benefit payments has had a significant influence on take-up, while, in general, fami......, families'' loss of income is less if leave is taken up by the mothers. Only few fathers participate in parental leave....

  3. Protein (Cyanobacteria): 69154 [PGDBj - Ortholog DB

    Lifescience Database Archive (English)

    Full Text Available YP_007109048.1 1117:1269 1150:280 63132:1363 1173025:1363 pseudouridine synthase Geit...AEALAQLQQGVTIQDYRTKPAIARLLPEEPPLPPREPPIRYRKEIPTAWLEITLTEGRNRQVRRMTAAVGFPTLRLVRFAIGDLRLEGLAPGQWRDLSAPELAALKSLGKRPVSRARGSRPRGDRS ...

  4. Isolation, characterization, and mechanistic studies of (-)-alpha-gurjunene synthase from Solidago canadensis.

    Science.gov (United States)

    Schmidt, C O; Bouwmeester, H J; Bülow, N; König, W A

    1999-04-15

    The leaves of the composite Solidago canadensis (goldenrod) were shown to contain (-)-alpha-gurjunene synthase activity. This sesquiterpene is likely to be the precursor for cyclocolorenone, a sesquiterpene ketone present in high amounts in S. canadensis leaves. (-)-alpha-Gurjunene synthase was purified to apparent homogeneity (741-fold) by anion-exchange chromatography (on several matrices), dye ligand chromatography, hydroxylapatite chromatography, and gel filtration. Chromatography on a gel filtration matrix indicated a native molecular mass of 48 kDa, and SDS-PAGE showed the enzyme to be composed of one subunit with a denatured mass of 60 kDa. Its maximum activity was observed at pH 7.8 in the presence of 10 mM Mg2+ and the KM value for the substrate farnesyl diphosphate was 5.5 microM. Over a range of purification steps (-)-alpha-gurjunene and (+)-gamma-gurjunene synthase activities copurified. In addition, the product ratio of the enzyme activity under several different assay conditions was always 91% (-)-alpha-gurjunene and 9% (+)-gamma-gurjunene. This suggests that the formation of these two structurally related products is catalyzed by one enzyme. For further confirmation, we carried out a number of mechanistic studies with (-)-alpha-gurjunene synthase, in which an enzyme preparation was incubated with deuterated substrate analogues. Based on mass spectrometry analysis of the products formed, a cyclization mechanism was postulated which makes it plausible that the synthase catalyzes the formation of both sesquiterpenes. Copyright 1999 Academic Press.

  5. Monoterpene synthase from Dracocephalum kotschyi and SPME-GC-MS analysis of its aroma profile

    Directory of Open Access Journals (Sweden)

    S. Saeidnia

    2014-04-01

    Full Text Available Dracocephalum kotschyi (Lamiaceae, as one of the remarkable aromatic plants, widely grows and also is cultivated in various temperate regions of Iran. There are diverse reports about the composition of the oil of this plant representing limonene derivatives as its major compounds. There is no report on cloning of mono- or sesquiterpene synthases from this plant. In the present study, the aroma profile of D. kotschyi has been extracted and analyzed via Headspace Solid-Phase Microextraction technique coupled with Gas Chromatography- Mass Spectroscopy. In order to determine the sequence of the active terpene synthase in this plant, first mRNA was prepared and cloning was performed by 3’ and 5’-RACEs-PCR method, then cDNA was sequenced and finally aligned with other recognized terpene synthases. The results showed that the plant leaves mainly comprised geranial (37.2%, limonene-10-al (28.5%, limonene (20.1% and 1,1-dimethoxy decane (14.5%. Sequencing the cDNA cloned from this plant revealed the presence of a monoterpene synthase absolutely similar to limonene synthase, responsible in formation of limonene, terpinolene, camphene and some other cyclic monoterpenes in its young leaves.

  6. The Eucalyptus terpene synthase gene family.

    Science.gov (United States)

    Külheim, Carsten; Padovan, Amanda; Hefer, Charles; Krause, Sandra T; Köllner, Tobias G; Myburg, Alexander A; Degenhardt, Jörg; Foley, William J

    2015-06-11

    Terpenoids are abundant in the foliage of Eucalyptus, providing the characteristic smell as well as being valuable economically and influencing ecological interactions. Quantitative and qualitative inter- and intra- specific variation of terpenes is common in eucalypts. The genome sequences of Eucalyptus grandis and E. globulus were mined for terpene synthase genes (TPS) and compared to other plant species. We investigated the relative expression of TPS in seven plant tissues and functionally characterized five TPS genes from E. grandis. Compared to other sequenced plant genomes, Eucalyptus grandis has the largest number of putative functional TPS genes of any sequenced plant. We discovered 113 and 106 putative functional TPS genes in E. grandis and E. globulus, respectively. All but one TPS from E. grandis were expressed in at least one of seven plant tissues examined. Genomic clusters of up to 20 genes were identified. Many TPS are expressed in tissues other than leaves which invites a re-evaluation of the function of terpenes in Eucalyptus. Our data indicate that terpenes in Eucalyptus may play a wider role in biotic and abiotic interactions than previously thought. Tissue specific expression is common and the possibility of stress induction needs further investigation. Phylogenetic comparison of the two investigated Eucalyptus species gives insight about recent evolution of different clades within the TPS gene family. While the majority of TPS genes occur in orthologous pairs some clades show evidence of recent gene duplication, as well as loss of function.

  7. Diterpene synthases of the biosynthetic system of medicinally active diterpenoids in Marrubium vulgare

    DEFF Research Database (Denmark)

    Zerbe, Philipp; Chiang, Angela; Dullat, Harpreet

    2014-01-01

    Marrubium vulgare (Lamiaceae) is a medicinal plant whose major bioactive compounds, marrubiin and other labdane-related furanoid diterpenoids, have potential applications as anti-diabetics, analgesics or vasorelaxants. Metabolite and transcriptome profiling of M. vulgare leaves identified five...... different candidate diterpene synthases (diTPSs) of the TPS-c and TPS-e/f clades. We describe the in vitro and in vivo functional characterization of the M. vulgare diTPS family. In addition to MvEKS ent-kaurene synthase of general metabolism, we identified three diTPSs of specialized metabolism: MvCPS3...

  8. Isolation and characterization of terpene synthases in cotton (Gossypium hirsutum).

    Science.gov (United States)

    Yang, Chang-Qing; Wu, Xiu-Ming; Ruan, Ju-Xin; Hu, Wen-Li; Mao, Yin-Bo; Chen, Xiao-Ya; Wang, Ling-Jian

    2013-12-01

    Cotton plants accumulate gossypol and related sesquiterpene aldehydes, which function as phytoalexins against pathogens and feeding deterrents to herbivorous insects. However, to date little is known about the biosynthesis of volatile terpenes in this crop. Herein is reported that 5 monoterpenes and 11 sesquiterpenes from extracts of a glanded cotton cultivar, Gossypium hirsutum cv. CCRI12, were detected by gas chromatography-mass spectrometry (GC-MS). By EST data mining combined with Rapid Amplification of cDNA Ends (RACE), full-length cDNAs of three terpene synthases (TPSs), GhTPS1, GhTPS2 and GhTPS3 were isolated. By in vitro assays of the recombinant proteins, it was found that GhTPS1 and GhTPS2 are sesquiterpene synthases: the former converted farnesyl pyrophosphate (FPP) into β-caryophyllene and α-humulene in a ratio of 2:1, whereas the latter produced several sesquiterpenes with guaia-1(10),11-diene as the major product. By contrast, GhTPS3 is a monoterpene synthase, which produced α-pinene, β-pinene, β-phellandrene and trace amounts of other monoterpenes from geranyl pyrophosphate (GPP). The TPS activities were also supported by Virus Induced Gene Silencing (VIGS) in the cotton plant. GhTPS1 and GhTPS3 were highly expressed in the cotton plant overall, whereas GhTPS2 was expressed only in leaves. When stimulated by mechanical wounding, Verticillium dahliae (Vde) elicitor or methyl jasmonate (MeJA), production of terpenes and expression of the corresponding synthase genes were induced. These data demonstrate that the three genes account for the biosynthesis of volatile terpenes of cotton, at least of this Upland cotton. Copyright © 2013 Elsevier Ltd. All rights reserved.

  9. Goodbye, Mandatory Maternity Leaves

    Science.gov (United States)

    Nation's Schools, 1972

    1972-01-01

    In precedent-setting decrees, courts and federal and State authorities have branded compulsory maternity leaves either unconstitutional or illegal. School administrators are urged to prod boards of education to adopt more lenient maternity leave policies -- now. (Author)

  10. Leaving home in Denmark

    DEFF Research Database (Denmark)

    Nielsen, Rikke Skovgaard

    2015-01-01

    The paper focuses on ethnic differences in the timing and patterns of leaving the parental home. Leaving home is a key transition in the life course of the individual, and extensive research has been conducted on the timing and patterns of leaving it. However, ethnic differences in these patterns...... of leaving home. Results showed that while some differences disappeared when controlling for covariates, others persisted, thus indicating ethnic differences in home-leaving patterns. A strong link between leaving home and marriage was substantiated for Turks, but not for Somalis. The home-leaving patterns...... of Somalis were much more similar to those of Danes. Overall, Turkish descendants were similar to Turkish immigrants but with some differentiation. The analyses identified the existence of ethnic differences in home-leaving patterns but also found evidence of a shift towards less traditional patterns, i...

  11. Structural Basis of Catalysis in the Bacterial Monoterpene Synthases Linalool Synthase and 1,8-Cineole Synthase

    OpenAIRE

    Karuppiah, Vijaykumar; Ranaghan, Kara E.; Leferink, Nicole G. H.; Johannissen, Linus O.; Shanmugam, Muralidharan; Ní Cheallaigh, Aisling; Bennett, Nathan J.; Kearsey, Lewis J.; Takano, Eriko; Gardiner, John M.; van der Kamp, Marc W.; Hay, Sam; Mulholland, Adrian J.; Leys, David; Scrutton, Nigel S.

    2017-01-01

    Terpenoids form the largest and stereochemically most diverse class of natural products, and there is considerable interest in producing these by biocatalysis with whole cells or purified enzymes, and by metabolic engineering. The monoterpenes are an important class of terpenes and are industrially important as flavors and fragrances. We report here structures for the recently discovered Streptomyces clavuligerus monoterpene synthases linalool synthase (bLinS) and 1,8-cineole synthase (bCinS)...

  12. Bornyl-diphosphate synthase from Lavandula angustifolia: A major monoterpene synthase involved in essential oil quality.

    Science.gov (United States)

    Despinasse, Yolande; Fiorucci, Sébastien; Antonczak, Serge; Moja, Sandrine; Bony, Aurélie; Nicolè, Florence; Baudino, Sylvie; Magnard, Jean-Louis; Jullien, Frédéric

    2017-05-01

    Lavender essential oils (EOs) of higher quality are produced by a few Lavandula angustifolia cultivars and mainly used in the perfume industry. Undesirable compounds such as camphor and borneol are also synthesized by lavender leading to a depreciated EO. Here, we report the cloning of bornyl diphosphate synthase of lavender (LaBPPS), an enzyme that catalyzes the production of bornyl diphosphate (BPP) and then by-products such as borneol or camphor, from an EST library. Compared to the BPPS of Salvia officinalis, the functional characterization of LaBPPS showed several differences in amino acid sequence, and the distribution of catalyzed products. Molecular modeling of the enzyme's active site suggests that the carbocation intermediates are more stable in LaBPPS than in SoBPPS leading probably to a lower efficiency of LaBPPS to convert GPP into BPP. Quantitative RT-PCR performed from leaves and flowers at different development stages of L. angustifolia samples show a clear correlation between transcript level of LaBPPS and accumulation of borneol/camphor, suggesting that LaBPPS is mainly responsible of in vivo biosynthesis of borneol/camphor in fine lavender. A phylogenetic analysis of terpene synthases (TPS) pointed out the basal position of LaBPPS in the TPSb clade, suggesting that LaBPPS could be an ancestor of others lavender TPSb. Finally, borneol could be one of the first monoterpenes to be synthesized in the Lavandula subgenus. Knowledge gained from these experiments will facilitate future studies to improve the lavender oils through metabolic engineering or plant breeding. Accession numbers: LaBPPS: KM015221. Copyright © 2017. Published by Elsevier Ltd.

  13. Increased and Altered Fragrance of Tobacco Plants after Metabolic Engineering Using Three Monoterpene Synthases from Lemon

    Science.gov (United States)

    Lücker, Joost; Schwab, Wilfried; van Hautum, Bianca; Blaas, Jan; van der Plas, Linus H. W.; Bouwmeester, Harro J.; Verhoeven, Harrie A.

    2004-01-01

    Wild-type tobacco (Nicotiana tabacum) plants emit low levels of terpenoids, particularly from the flowers. By genetic modification of tobacco cv Petit Havana SR1 using three different monoterpene synthases from lemon (Citrus limon L. Burm. f.) and the subsequent combination of these three into one plant by crossings, we show that it is possible to increase the amount and alter the composition of the blend of monoterpenoids produced in tobacco plants. The transgenic tobacco plant line with the three introduced monoterpene synthases is emitting β-pinene, limonene, and γ-terpinene and a number of side products of the introduced monoterpene synthases, from its leaves and flowers, in addition to the terpenoids emitted by wild-type plants. The results show that there is a sufficiently high level of substrate accessible for the introduced enzymes. PMID:14718674

  14. Modified cellulose synthase gene from Arabidopsis thaliana confers herbicide resistance to plants

    Science.gov (United States)

    Somerville, Chris R [Portola Valley, CA; Scheible, Wolf [Golm, DE

    2007-07-10

    Cellulose synthase ("CS"), a key enzyme in the biosynthesis of cellulose in plants is inhibited by herbicides comprising thiazolidinones such as 5-tert-butyl-carbamoyloxy-3-(3-trifluromethyl)phenyl-4-thiazolidinone (TZ), isoxaben and 2,6-dichlorobenzonitrile (DCB). Two mutant genes encoding isoxaben and TZ-resistant cellulose synthase have been isolated from isoxaben and TZ-resistant Arabidopsis thaliana mutants. When compared with the gene coding for isoxaben or TZ-sensitive cellulose synthase, one of the resistant CS genes contains a point mutation, wherein glycine residue 998 is replaced by an aspartic acid. The other resistant mutation is due to a threonine to isoleucine change at amino acid residue 942. The mutant CS gene can be used to impart herbicide resistance to a plant; thereby permitting the utilization of the herbicide as a single application at a concentration which ensures the complete or substantially complete killing of weeds, while leaving the transgenic crop plant essentially undamaged.

  15. Occurrence of theobromine synthase genes in purine alkaloid-free species of Camellia plants.

    Science.gov (United States)

    Ishida, Mariko; Kitao, Naoko; Mizuno, Kouichi; Tanikawa, Natsu; Kato, Misako

    2009-02-01

    Caffeine (1,3,7-trimethylxanthine) and theobromine (3,7-dimethylxanthine) are purine alkaloids that are present in high concentrations in plants of some species of Camellia. However, most members of the genus Camellia contain no purine alkaloids. Tracer experiments using [8-(14)C]adenine and [8-(14)C]theobromine showed that the purine alkaloid pathway is not fully functional in leaves of purine alkaloid-free species. In five species of purine alkaloid-free Camellia plants, sufficient evidence was obtained to show the occurrence of genes that are homologous to caffeine synthase. Recombinant enzymes derived from purine alkaloid-free species showed only theobromine synthase activity. Unlike the caffeine synthase gene, these genes were expressed more strongly in mature tissue than in young tissue.

  16. Producing biofuels using polyketide synthases

    Science.gov (United States)

    Katz, Leonard; Fortman, Jeffrey L; Keasling, Jay D

    2013-04-16

    The present invention provides for a non-naturally occurring polyketide synthase (PKS) capable of synthesizing a carboxylic acid or a lactone, and a composition such that a carboxylic acid or lactone is included. The carboxylic acid or lactone, or derivative thereof, is useful as a biofuel. The present invention also provides for a recombinant nucleic acid or vector that encodes such a PKS, and host cells which also have such a recombinant nucleic acid or vector. The present invention also provides for a method of producing such carboxylic acids or lactones using such a PKS.

  17. Identification and characterization of two bisabolene synthases from linear glandular trichomes of sunflower (Helianthus annuus L., Asteraceae).

    Science.gov (United States)

    Aschenbrenner, Anna-Katharina; Kwon, Moonhyuk; Conrad, Jürgen; Ro, Dae-Kyun; Spring, Otmar

    2016-04-01

    Sunflower is known to produce a variety of bisabolene-type sesquiterpenes and accumulates these substances in trichomes of leaves, stems and flowering parts. A bioinformatics approach was used to identify the enzyme responsible for the initial step in the biosynthesis of these compounds from its precursor farnesyl pyrophosphate. Based on sequence similarity with a known bisabolene synthases from Arabidopsis thaliana AtTPS12, candidate genes of Helianthus were searched in EST-database and used to design specific primers. PCR experiments identified two candidates in the RNA pool of linear glandular trichomes of sunflower. Their sequences contained the typical motifs of sesquiterpene synthases and their expression in yeast functionally characterized them as bisabolene synthases. Spectroscopic analysis identified the stereochemistry of the product of both enzymes as (Z)-γ-bisabolene. The origin of the two sunflower bisabolene synthase genes from the transcripts of linear trichomes indicates that they may be involved in the synthesis of sesquiterpenes produced in these trichomes. Comparison of the amino acid sequences of the sunflower bisabolene synthases showed high similarity with sesquiterpene synthases from other Asteracean species and indicated putative evolutionary origin from a β-farnesene synthase. Copyright © 2016 Elsevier Ltd. All rights reserved.

  18. Negative leave balances

    CERN Multimedia

    Human Resources Department

    2005-01-01

    Members of the personnel entitled to annual leave and, where appropriate, saved leave and/or compensatory leave are requested to take note of the new arrangements described below, which were recommended by the Standing Concertation Committee (SCC) at its meeting on 1Â September 2005 and subsequently approved by the Director-General. The changes do not apply to members of the personnel participating in the Progressive Retirement Programme (PRP) or the Part-time Work as a pre-retirement measure, for whom the specific provisions communicated at the time of joining will continue to apply. Â Negative balances in annual leave, saved leave and/or compensatory leave accounts at the end of the leave year (30th September) and on the date on which bonuses are credited to the saved leave account (31st December): Where members of the personnel have a leave account with a negative balance on 30Â September and/or 31Â December, leave will automatically be transferred from one account to another on the relevant dates i...

  19. Negative leave balances

    CERN Multimedia

    Human Resources Department

    2005-01-01

    Members of the personnel entitled to annual leave and, where appropriate, saved leave and/or compensatory leave are requested to take note of the new arrangements described below, which were recommended by the Standing Concertation Committee (SCC) at its meeting on 1 September 2005 and subsequently approved by the Director-General. The changes do not apply to members of the personnel participating in the Progressive Retirement Programme (PRP) or the Part-time Work as a pre-retirement measure, for whom the specific provisions communicated at the time of joining will continue to apply.  Negative balances in annual leave, saved leave and/or compensatory leave accounts at the end of the leave year (30th September) and on the date on which bonuses are credited to the saved leave account (31st December): Where members of the personnel have a leave account with a negative balance on 30 September and/or 31 December, leave will automatically be transferred from one account to another on the relevant dates in or...

  20. Antisense repression of sucrose phosphate synthase in transgenic muskmelon alters plant growth and fruit development

    International Nuclear Information System (INIS)

    Tian, Hongmei; Ma, Leyuan; Zhao, Cong; Hao, Hui; Gong, Biao; Yu, Xiyan; Wang, Xiufeng

    2010-01-01

    To unravel the roles of sucrose phosphate synthase (SPS) in muskmelon (Cucumis melo L.), we reduced its activity in transgenic muskmelon plants by an antisense approach. For this purpose, an 830 bp cDNA fragment of muskmelon sucrose phosphate synthase was expressed in antisense orientation behind the 35S promoter of the cauliflower mosaic virus. The phenotype of the antisense plants clearly differed from that of control plants. The transgenic plant leaves were markedly smaller, and the plant height and stem diameter were obviously shorter and thinner. Transmission electron microscope observation revealed that the membrane degradation of chloroplast happened in transgenic leaves and the numbers of grana and grana lamella in the chloroplast were significantly less, suggesting that the slow growth and weaker phenotype of transgenic plants may be due to the damage of the chloroplast ultrastructure, which in turn results in the decrease of the net photosynthetic rate. The sucrose concentration and levels of sucrose phosphate synthase decreased in transgenic mature fruit, and the fruit size was smaller than the control fruit. Together, our results suggest that sucrose phosphate synthase may play an important role in regulating the muskmelon plant growth and fruit development.

  1. Antisense repression of sucrose phosphate synthase in transgenic muskmelon alters plant growth and fruit development

    Energy Technology Data Exchange (ETDEWEB)

    Tian, Hongmei; Ma, Leyuan; Zhao, Cong; Hao, Hui; Gong, Biao [College of Horticulture Science and Engineering, State Key Laboratory of Crop Biology, Shandong Agricultural University, Tai' an, Shandong 271018 (China); Yu, Xiyan, E-mail: yuxiyan@sdau.edu.cn [College of Horticulture Science and Engineering, State Key Laboratory of Crop Biology, Shandong Agricultural University, Tai' an, Shandong 271018 (China); Wang, Xiufeng, E-mail: xfwang@sdau.edu.cn [College of Horticulture Science and Engineering, State Key Laboratory of Crop Biology, Shandong Agricultural University, Tai' an, Shandong 271018 (China)

    2010-03-12

    To unravel the roles of sucrose phosphate synthase (SPS) in muskmelon (Cucumis melo L.), we reduced its activity in transgenic muskmelon plants by an antisense approach. For this purpose, an 830 bp cDNA fragment of muskmelon sucrose phosphate synthase was expressed in antisense orientation behind the 35S promoter of the cauliflower mosaic virus. The phenotype of the antisense plants clearly differed from that of control plants. The transgenic plant leaves were markedly smaller, and the plant height and stem diameter were obviously shorter and thinner. Transmission electron microscope observation revealed that the membrane degradation of chloroplast happened in transgenic leaves and the numbers of grana and grana lamella in the chloroplast were significantly less, suggesting that the slow growth and weaker phenotype of transgenic plants may be due to the damage of the chloroplast ultrastructure, which in turn results in the decrease of the net photosynthetic rate. The sucrose concentration and levels of sucrose phosphate synthase decreased in transgenic mature fruit, and the fruit size was smaller than the control fruit. Together, our results suggest that sucrose phosphate synthase may play an important role in regulating the muskmelon plant growth and fruit development.

  2. Cloning and functional characterization of three terpene synthases from lavender (Lavandula angustifolia).

    Science.gov (United States)

    Landmann, Christian; Fink, Barbara; Festner, Maria; Dregus, Márta; Engel, Karl-Heinz; Schwab, Wilfried

    2007-09-15

    The essential oil of lavender (Lavandula angustifolia) is mainly composed of mono- and sesquiterpenes. Using a homology-based PCR strategy, two monoterpene synthases (LaLIMS and LaLINS) and one sesquiterpene synthase (LaBERS) were cloned from lavender leaves and flowers. LaLIMS catalyzed the formation of (R)-(+)-limonene, terpinolene, (1R,5S)-(+)-camphene, (1R,5R)-(+)-alpha-pinene, beta-myrcene and traces of alpha-phellandrene. The proportions of these products changed significantly when Mn(2+) was supplied as the cofactor instead of Mg(2+). The second enzyme LaLINS produced exclusively (R)-(-)-linalool, the main component of lavender essential oil. LaBERS transformed farnesyl diphosphate and represents the first reported trans-alpha-bergamotene synthase. It accepted geranyl diphosphate with higher affinity than farnesyl diphosphate and also produced monoterpenes, albeit at low rates. LaBERS is probably derived from a parental monoterpene synthase by the loss of the plastidial signal peptide and by broadening its substrate acceptance spectrum. The identification and description of the first terpene synthases from L. angustifolia forms the basis for the biotechnological modification of essential oil composition in lavender.

  3. The Temporary Leave Dilemma -

    DEFF Research Database (Denmark)

    Amilon, Anna

    2010-01-01

    Lone mothers have to take care of a sick child with little or no help from the child’s other parent and have to carry all costs connected to leave-taking. This paper empirically tests whether lone mothers take more temporary parental leave to care for sick children than partnered mothers...... and whether parental leave is associated with a signaling cost. The results from this study of Swedish mothers show that lone mothers use more temporary parental leave than partnered mothers. Further, within the group of lone mothers, those with higher socioeconomic status take less temporary parental leave...... than those with lower socioeconomic status, whereas no such differences are found within the group of partnered mothers. One possible interpretation is that signaling costs negatively influence the utilization of temporary parental leave for lone mothers....

  4. Heterooligomeric phosphoribosyl diphosphate synthase of Saccharomyces cerevisiae

    DEFF Research Database (Denmark)

    Hove-Jensen, Bjarne

    2004-01-01

    The yeast Saccharomyces cerevisiae contains five phosphoribosyl diphosphate (PRPP) synthase-homologous genes (PRS1-5), which specify PRPP synthase subunits 1-5. Expression of the five S. cerevisiae PRS genes individually in an Escherichia coli PRPP-less strain (Deltaprs) showed that a single PRS...

  5. Chrysanthemum expressing a linalool synthase gene 'smells good', but 'tastes bad' to western flower thrips

    DEFF Research Database (Denmark)

    Yang, Ting; Stoopen, Geert; Thoen, Manus

    2013-01-01

    Herbivore-induced plant volatiles are often involved in direct and indirect plant defence against herbivores. Linalool is a common floral scent and found to be released from leaves by many plants after herbivore attack. In this study, a linalool/nerolidol synthase, FaNES1, was overexpressed...... less preferred by WFT. Considering the common occurrence of linalool and its glycosides in plant tissues, it suggests that plants may balance attractive fragrance with 'poor taste' using the same precursor compound....

  6. Threonine phosphorylation of rat liver glycogen synthase

    International Nuclear Information System (INIS)

    Arino, J.; Arro, M.; Guinovart, J.J.

    1985-01-01

    32 P-labeled glycogen synthase specifically immunoprecipitated from 32 P-phosphate incubated rat hepatocytes contains, in addition to [ 32 P] phosphoserine, significant levels of [ 32 P] phosphothreonine. When the 32 P-immunoprecipitate was cleaved with CNBr, the [ 32 P] phosphothreonine was recovered in the large CNBr fragment (CB-2, Mapp 28 Kd). Homogeneous rat liver glycogen synthase was phosphorylated by all the protein kinases able to phosphorylate CB-2 in vitro. After analysis of the immunoprecipitated enzyme for phosphoaminoacids, it was observed that only casein kinase II was able to phosphorylate on threonine and 32 P-phosphate was only found in CB-2. These results demonstrate that rat liver glycogen synthase is phosphorylated at threonine site(s) contained in CB-2 and strongly indicate that casein kinase II may play a role in the ''in vivo'' phosphorylation of liver glycogen synthase. This is the first protein kinase reported to phosphorylate threonine residues in liver glycogen synthase

  7. Glycogen Synthase Kinase-3β

    DEFF Research Database (Denmark)

    Munkholm, Klaus; Lenskjold, Toke; Jacoby, Anne Sophie

    2016-01-01

    cells were quantitated using enzyme immunometric assays. The activity of GSK-3β (serine-9-phosphorylated GSK-3β/total GSK-3β) was lower at baseline compared with follow-up. No significant mean change over time was observed in levels of total GSK-3β and serine-9-phosphorylated GSK-3β. Exploratory......Evidence indicates a role for glycogen synthase kinase-3β (GSK-3β) in the pathophysiology of mood disorders and in cognitive disturbances; however, the natural variation in GSK-3β activity over time is unknown. We aimed to investigate GSK-3β activity over time and its possible correlation...... with emotional lability, subjective mood fluctuations and cognitive function in healthy individuals. Thirty-seven healthy subjects were evaluated with neuropsychological tests and blood samples at baseline and 12-week follow-up. Total GSK-3β and serine-9-phosphorylated GSK-3β in peripheral blood mononuclear...

  8. Box H/ACA snoRNAs are preferred substrates for the trimethylguanosine synthase in the divergent unicellular eukaryote Trichomonas vaginalis

    Science.gov (United States)

    Simoes-Barbosa, Augusto; Chakrabarti, Kausik; Pearson, Michael; Benarroch, Delphine; Shuman, Stewart; Johnson, Patricia J.

    2012-01-01

    The 2,2,7-trimethylguanosine caps of eukaryal snRNAs and snoRNA are formed by the enzyme Tgs1, which catalyzes sequential guanine-N2 methylations of m7G caps. Atypically, in the divergent unicellular eukaryote Trichomonas vaginalis, spliceosomal snRNAs lack a guanosine cap and the recombinant T. vaginalis trimethylguanosine synthase (TvTgs) produces only m2,7G in vitro. Here, we show by direct metabolic labeling that endogenous T. vaginalis RNAs contain m7G, m2,7G, and m2,2,7G caps. Immunodepletion of TvTgs from cell extracts and TvTgs add-back experiments demonstrate that TvTgs produces m2,7G and m2,2,7G caps. Expression of TvTgs in yeast tgs1Δ cells leads to the formation of m2,7G and m2,2,7G caps and complementation of the lethality of a tgs1Δ mud2Δ strain. Whereas TvTgs is present in the nucleus and cytosol of T. vaginalis cells, TMG-containing RNAs are localized primarily in the nucleolus. Molecular cloning of anti-TMG affinity-purified T. vaginalis RNAs identified 16 box H/ACA snoRNAs, which are implicated in guiding RNA pseudouridylation. The ensemble of new T. vaginalis H/ACA snoRNAs allowed us to predict and partially validate an extensive map of pseudouridines in T. vaginalis rRNA. PMID:22847815

  9. Crystal structure of riboflavin synthase

    Energy Technology Data Exchange (ETDEWEB)

    Liao, D.-I.; Wawrzak, Z.; Calabrese, J.C.; Viitanen, P.V.; Jordan, D.B. (DuPont); (NWU)

    2010-03-05

    Riboflavin synthase catalyzes the dismutation of two molecules of 6,7-dimethyl-8-(1'-D-ribityl)-lumazine to yield riboflavin and 4-ribitylamino-5-amino-2,6-dihydroxypyrimidine. The homotrimer of 23 kDa subunits has no cofactor requirements for catalysis. The enzyme is nonexistent in humans and is an attractive target for antimicrobial agents of organisms whose pathogenicity depends on their ability to biosynthesize riboflavin. The first three-dimensional structure of the enzyme was determined at 2.0 {angstrom} resolution using the multiwavelength anomalous diffraction (MAD) method on the Escherichia coli protein containing selenomethionine residues. The homotrimer consists of an asymmetric assembly of monomers, each of which comprises two similar {beta} barrels and a C-terminal {alpha} helix. The similar {beta} barrels within the monomer confirm a prediction of pseudo two-fold symmetry that is inferred from the sequence similarity between the two halves of the protein. The {beta} barrels closely resemble folds found in phthalate dioxygenase reductase and other flavoproteins. The three active sites of the trimer are proposed to lie between pairs of monomers in which residues conserved among species reside, including two Asp-His-Ser triads and dyads of Cys-Ser and His-Thr. The proposed active sites are located where FMN (an analog of riboflavin) is modeled from an overlay of the {beta} barrels of phthalate dioxygenase reductase and riboflavin synthase. In the trimer, one active site is formed, and the other two active sites are wide open and exposed to solvent. The nature of the trimer configuration suggests that only one active site can be formed and be catalytically competent at a time.

  10. Prostaglandin E(2) synthase inhibition as a therapeutic target.

    Science.gov (United States)

    Iyer, Jitesh P; Srivastava, Punit K; Dev, Rishabh; Dastidar, Sunanda G; Ray, Abhijit

    2009-07-01

    Most NSAIDs function by inhibiting biosynthesis of PGE(2) by inhibition of COX-1 and/or COX-2. Since COX-1 has a protective function in the gastro-intestinal tract (GIT), non-selective inhibition of both cycloxy genases leads to moderate to severe gastro-intestinal intolerance. Attempts to identify selective inhibitors of COX-2, led to the identification of celecoxib and rofecoxib. However, long-term use of these drugs has serious adverse effects of sudden myocardial infarction and thrombosis. Drug-mediated imbalance in the levels of prostaglandin I(2) (PGI(2)) and thromboxane A(2) (TXA(2)) with a bias towards TXA(2) may be the primary reason for these events. This resulted in the drugs being withdrawn from the market, leaving a need for an effective and safe anti-inflammatory drug. Recently, the focus of research has shifted to enzymes downstream of COX in the prosta glandin biosynthetic pathway such as prostaglandin E(2) synthases. Microsomal prostaglandin E(2) synthase-1 (mPGES-1) specifically isomerizes PGH(2) to PGE(2), under inflammatory conditions. In this review, we examine the biology of mPGES-1 and its role in disease. Progress in designing molecules that can selectively inhibit mPGES-1 is reviewed. mPGES-1 has the potential to be a target for anti-inflammatory therapy, devoid of adverse GIT and cardiac effects and warrants further investigation.

  11. Characterization of Sugar Contents and Sucrose Metabolizing Enzymes in Developing Leaves of Hevea brasiliensis

    Directory of Open Access Journals (Sweden)

    Jinheng Zhu

    2018-02-01

    Full Text Available Sucrose-metabolizing enzymes in plant leaves have hitherto been investigated mainly in temperate plants, and rarely conducted in tandem with gene expression and sugar analysis. Here, we investigated the sugar content, gene expression, and the activity of sucrose-metabolizing enzymes in the leaves of Hevea brasiliensis, a tropical tree widely cultivated for natural rubber. Sucrose, fructose and glucose were the major sugars detected in Hevea leaves at four developmental stages (I to IV, with starch and quebrachitol as minor saccharides. Fructose and glucose contents increased until stage III, but decreased strongly at stage IV (mature leaves. On the other hand, sucrose increased continuously throughout leaf development. Activities of all sucrose-cleaving enzymes decreased markedly at maturation, consistent with transcript decline for most of their encoding genes. Activity of sucrose phosphate synthase (SPS was low in spite of its high transcript levels at maturation. Hence, the high sucrose content in mature leaves was not due to increased sucrose-synthesizing activity, but more to the decline in sucrose cleavage. Gene expression and activities of sucrose-metabolizing enzymes in Hevea leaves showed striking differences compared with other plants. Unlike in most other species where vacuolar invertase predominates in sucrose cleavage in developing leaves, cytoplasmic invertase and sucrose synthase (cleavage direction also featured prominently in Hevea. Whereas SPS is normally responsible for sucrose synthesis in plant leaves, sucrose synthase (synthesis direction was comparable or higher than that of SPS in Hevea leaves. Mature Hevea leaves had an unusually high sucrose:starch ratio of about 11, the highest reported to date in plants.

  12. Geranylgeranyl diphosphate synthase from Scoparia dulcis and Croton sublyratus. Plastid localization and conversion to a farnesyl diphosphate synthase by mutagenesis.

    Science.gov (United States)

    Sitthithaworn, W; Kojima, N; Viroonchatapan, E; Suh, D Y; Iwanami, N; Hayashi, T; Noji, M; Saito, K; Niwa, Y; Sankawa, U

    2001-02-01

    cDNAs encoding geranylgeranyl diphosphate synthase (GGPPS) of two diterpene-producing plants, Scoparia dulcis and Croton sublyratus, have been isolated using the homology-based polymerase chain reaction (PCR) method. Both clones contained highly conserved aspartate-rich motifs (DDXX(XX)D) and their N-terminal residues exhibited the characteristics of chloroplast targeting sequence. When expressed in Escherichia coli, both the full-length and truncated proteins in which the putative targeting sequence was deleted catalyzed the condensation of farnesyl diphosphate and isopentenyl diphosphate to produce geranylgeranyl diphosphate (GGPP). The structural factors determining the product length in plant GGPPSs were investigated by constructing S. dulcis GGPPS mutants on the basis of sequence comparison with the first aspartate-rich motif (FARM) of plant farnesyl diphosphate synthase. The result indicated that in plant GGPPSs small amino acids, Met and Ser, at the fourth and fifth positions before FARM and Pro and Cys insertion in FARM play essential roles in determination of product length. Further, when a chimeric gene comprised of the putative transit peptide of the S. dulcis GGPPS gene and a green fluorescent protein was introduced into Arabidopsis leaves by particle gun bombardment, the chimeric protein was localized in chloroplasts, indicating that the cloned S. dulcis GGPPS is a chloroplast protein.

  13. Riboflavin accumulation and characterization of cDNAs encoding lumazine synthase and riboflavin synthase in bitter melon (Momordica charantia).

    Science.gov (United States)

    Tuan, Pham Anh; Kim, Jae Kwang; Lee, Sanghyun; Chae, Soo Cheon; Park, Sang Un

    2012-12-05

    Riboflavin (vitamin B2) is the universal precursor of the coenzymes flavin mononucleotide and flavin adenine dinucleotide--cofactors that are essential for the activity of a wide variety of metabolic enzymes in animals, plants, and microbes. Using the RACE PCR approach, cDNAs encoding lumazine synthase (McLS) and riboflavin synthase (McRS), which catalyze the last two steps in the riboflavin biosynthetic pathway, were cloned from bitter melon (Momordica charantia), a popular vegetable crop in Asia. Amino acid sequence alignments indicated that McLS and McRS share high sequence identity with other orthologous genes and carry an N-terminal extension, which is reported to be a plastid-targeting sequence. Organ expression analysis using quantitative real-time RT PCR showed that McLS and McRS were constitutively expressed in M. charantia, with the strongest expression levels observed during the last stage of fruit ripening (stage 6). This correlated with the highest level of riboflavin content, which was detected during ripening stage 6 by HPLC analysis. McLS and McRS were highly expressed in the young leaves and flowers, whereas roots exhibited the highest accumulation of riboflavin. The cloning and characterization of McLS and McRS from M. charantia may aid the metabolic engineering of vitamin B2 in crops.

  14. The cellulose synthase companion proteins act non-redundantly with CELLULOSE SYNTHASE INTERACTING1/POM2 and CELLULOSE SYNTHASE 6

    OpenAIRE

    Endler, Anne; Schneider, Rene; Kesten, Christopher; Lampugnani, Edwin R.; Persson, Staffan

    2016-01-01

    Cellulose is a cell wall constituent that is essential for plant growth and development, and an important raw material for a range of industrial applications. Cellulose is synthesized at the plasma membrane by massive cellulose synthase (CesA) complexes that track along cortical microtubules in elongating cells of Arabidopsis through the activity of the protein CELLULOSE SYNTHASE INTERACTING1 (CSI1). In a recent study we identified another family of proteins that also are associated with the ...

  15. Endothelial nitric oxide synthase gene polymorphisms associated ...

    African Journals Online (AJOL)

    STORAGESEVER

    2010-05-24

    May 24, 2010 ... chronic periodontitis (CP), 31 with gingivitis (G) and 50 healthy controls. Probing depth ..... Periodontal disease in pregnancy I. Prevalence and severity. ... endothelial nitric oxide synthase gene in premenopausal women with.

  16. Falling for Clay Leaves.

    Science.gov (United States)

    Kernan, Christine

    2002-01-01

    Describes an art project that integrated science and art education. Explains that students create ceramic bowls by using real leaves. Discusses the process of creating the ceramic bowls, including how to glaze the bowls. Includes a list of materials. (CMK)

  17. Maternity Leave Policies

    Science.gov (United States)

    Strang, Lucy; Broeks, Miriam

    2017-01-01

    Abstract Over recent years many European Union countries have made changes to the design of the maternity leave provision. These policy developments reflect calls for greater gender equality in the workforce and more equal share of childcare responsibilities. However, while research shows that long period of leave can have negative effects on women's labour market attachment and career advancements, early return to work can be seen as a factor preventing exclusive breastfeeding, and therefore, potentially having negative health impacts for babies. Indeed, the World Health Organisation recommends exclusive breastfeeding up to 6 months of age to provide babies with the nutrition for healthy growth and brain development, protection from life-threatening ailments, obesity and non-communicable diseases such as asthma and diabetes. Therefore, labour market demands on women may be at odds with the health benefits for children gained by longer periods of maternity leave. The aim of this article is to examine the relationship between leave provision and health benefits for children. We examine maternity and parental leave provision across European countries and its potential impact on the breastfeeding of very young babies (up to 6-months of age). We also consider economic factors of potential extension of maternity leave provision to 6 months, such as costs to businesses, effects on the female labour market attachment, and wider consequences (benefits and costs) for individuals, families, employers and the wider society. PMID:28983432

  18. Terpene synthases from Cannabis sativa.

    Directory of Open Access Journals (Sweden)

    Judith K Booth

    Full Text Available Cannabis (Cannabis sativa plants produce and accumulate a terpene-rich resin in glandular trichomes, which are abundant on the surface of the female inflorescence. Bouquets of different monoterpenes and sesquiterpenes are important components of cannabis resin as they define some of the unique organoleptic properties and may also influence medicinal qualities of different cannabis strains and varieties. Transcriptome analysis of trichomes of the cannabis hemp variety 'Finola' revealed sequences of all stages of terpene biosynthesis. Nine cannabis terpene synthases (CsTPS were identified in subfamilies TPS-a and TPS-b. Functional characterization identified mono- and sesqui-TPS, whose products collectively comprise most of the terpenes of 'Finola' resin, including major compounds such as β-myrcene, (E-β-ocimene, (--limonene, (+-α-pinene, β-caryophyllene, and α-humulene. Transcripts associated with terpene biosynthesis are highly expressed in trichomes compared to non-resin producing tissues. Knowledge of the CsTPS gene family may offer opportunities for selection and improvement of terpene profiles of interest in different cannabis strains and varieties.

  19. Terpene synthases from Cannabis sativa.

    Science.gov (United States)

    Booth, Judith K; Page, Jonathan E; Bohlmann, Jörg

    2017-01-01

    Cannabis (Cannabis sativa) plants produce and accumulate a terpene-rich resin in glandular trichomes, which are abundant on the surface of the female inflorescence. Bouquets of different monoterpenes and sesquiterpenes are important components of cannabis resin as they define some of the unique organoleptic properties and may also influence medicinal qualities of different cannabis strains and varieties. Transcriptome analysis of trichomes of the cannabis hemp variety 'Finola' revealed sequences of all stages of terpene biosynthesis. Nine cannabis terpene synthases (CsTPS) were identified in subfamilies TPS-a and TPS-b. Functional characterization identified mono- and sesqui-TPS, whose products collectively comprise most of the terpenes of 'Finola' resin, including major compounds such as β-myrcene, (E)-β-ocimene, (-)-limonene, (+)-α-pinene, β-caryophyllene, and α-humulene. Transcripts associated with terpene biosynthesis are highly expressed in trichomes compared to non-resin producing tissues. Knowledge of the CsTPS gene family may offer opportunities for selection and improvement of terpene profiles of interest in different cannabis strains and varieties.

  20. [Study on the weight-reducing effect of Acer truncatum leave extract in alimentary obesity rat].

    Science.gov (United States)

    Gao, Lifang; Cao, Lige; Tian, Mi; Chen, Zhenliang

    2012-07-01

    To investigate the weight-reducing effect of Acer truncatum leave extract on alimentary obesity rats and its effect on fatty acid synthase (FAS). SPF-grade adult male Wistar rats were fed with high-fat diet and Acer truncatum leave extract (10, 30 and 100 mg/kg BW) was given by gavage once a day for 31 days. Body weight (BW), adipose weight and food consumption were recorded, and the activity of hepatic fatty acid synthase (FAS) was measured. Compared with the model-control group, body weight, adipose weight and the ratio of adipose weight to body weight were obviously lower in 30 mg/kg BW and 100 mg/kg BW groups (P Acer truncatum leave extract on reducing body weight.

  1. Characterization of three chalcone synthase-like genes from apple (Malus x domestica Borkh.).

    Science.gov (United States)

    Yahyaa, Mosaab; Ali, Samah; Davidovich-Rikanati, Rachel; Ibdah, Muhammad; Shachtier, Alona; Eyal, Yoram; Lewinsohn, Efraim; Ibdah, Mwafaq

    2017-08-01

    Apple (Malus x domestica Brokh.) is a widely cultivated deciduous tree species of significant economic importance. Apple leaves accumulate high levels of flavonoids and dihydrochalcones, and their formation is dependent on enzymes of the chalcone synthase family. Three CHS genes were cloned from apple leaves and expressed in Escherichia coli. The encoded recombinant enzymes were purified and functionally characterized. In-vitro activity assays indicated that MdCHS1, MdCHS2 and MdCHS3 code for proteins exhibiting polyketide synthase activity that accepted either p-dihydrocoumaroyl-CoA, p-coumaroyl-CoA, or cinnamoyl-CoA as starter CoA substrates in the presence of malonyl-CoA, leading to production of phloretin, naringenin chalcone, and pinocembrin chalcone. MdCHS3 coded a chalcone-dihydrochalcone synthase enzyme with narrower substrate specificity than the previous ones. The apparent Km values of MdCHS3 for p-dihydrocoumaryl-CoA and p-coumaryl-CoA were both 5.0 μM. Expression analyses of MdCHS genes varied according to tissue type. MdCHS1, MdCHS2 and MdCHS3 expression levels were associated with the levels of phloretin accumulate in the respective tissues. Copyright © 2017 Elsevier Ltd. All rights reserved.

  2. TRAVEL AND HOME LEAVE

    CERN Multimedia

    Human Resources Division

    2002-01-01

    Administrative procedures for : Travel to the home station and home leave (hl) Additional travel to the home station (at) Travel to the home station and home leave for family reasons (hlf) As part of the process of simplifying administrative procedures, HR and AS Divisions have devised a new, virtually automatic procedure for payment of travel expenses to the home station. The changes are aimed at rationalising administrative procedures and not at reducing benefits. The conditions of eligibility are unchanged. The new procedure, which will be operational with effect from 1st June 2002, will greatly simplify the administrative processing of claims for travel expenses and the recording of home leaves. Currently, requests for payment are introduced manually into the Advances and Claims system (AVCL) by divisional secretariats. All travel to the home station starting prior to 1st June 2002 will be processed according to the existing system whereas that starting on 1st June and after will be processed accordi...

  3. Functional identification of a Lippia dulcis bornyl diphosphate synthase that contains a duplicated, inhibitory arginine-rich motif.

    Science.gov (United States)

    Hurd, Matthew C; Kwon, Moonhyuk; Ro, Dae-Kyun

    2017-08-26

    Lippia dulcis (Aztec sweet herb) contains the potent natural sweetener hernandulcin, a sesquiterpene ketone found in the leaves and flowers. Utilizing the leaves for agricultural application is challenging due to the presence of the bitter-tasting and toxic monoterpene, camphor. To unlock the commercial potential of L. dulcis leaves, the first step of camphor biosynthesis by a bornyl diphosphate synthase needs to be elucidated. Two putative monoterpene synthases (LdTPS3 and LdTPS9) were isolated from L. dulcis leaf cDNA. To elucidate their catalytic functions, E. coli-produced recombinant enzymes with truncations of their chloroplast transit peptides were assayed with geranyl diphosphate (GPP). In vitro enzyme assays showed that LdTPS3 encodes bornyl diphosphate synthase (thus named LdBPPS) while LdTPS9 encodes linalool synthase. Interestingly, the N-terminus of LdBPPS possesses two arginine-rich (RRX 8 W) motifs, and enzyme assays showed that the presence of both RRX 8 W motifs completely inhibits the catalytic activity of LdBPPS. Only after the removal of the putative chloroplast transit peptide and the first RRX 8 W, LdBPPS could react with GPP to produce bornyl diphosphate. LdBPPS is distantly related to the known bornyl diphosphate synthase from sage in a phylogenetic analysis, indicating a converged evolution of camphor biosynthesis in sage and L. dulcis. The discovery of LdBPPS opens up the possibility of engineering L. dulcis to remove the undesirable product, camphor. Copyright © 2017 Elsevier Inc. All rights reserved.

  4. Expression of Clarkia S-linalool synthase in transgenic petunia plant results in the accumulation of S-linalyl-b-D-glucopyranoside

    NARCIS (Netherlands)

    Lücker, J.; Bouwmeester, H.J.; Schwab, W.; Blaas, J.; Plas, van der L.H.W.; Verhoeven, H.A.

    2001-01-01

    Petunia hybrida W115 was transformed with a Clarkia breweri S-linalool synthase cDNA (lis). Lis was expressed in all tissues analysed, and linalool was detected in leaves, sepals, corolla, stem and ovary, but not in nectaries, roots, pollen and style. However, the S-linalool produced by the plant in

  5. Does Leave Work?

    NARCIS (Netherlands)

    Heleen van Luijn; Saskia Keuzenkamp

    2004-01-01

    More and more people have to combine work and care responsibilities, and work part-time or use daycare and after-school care facilities to help them do so. The Work and Care Act, which came into force on 1 December 2001, combined all the existing schemes - such as parental and maternity leave -

  6. Maternity Leave in Taiwan

    Science.gov (United States)

    Feng, Joyce Yen; Han, Wen-Jui

    2010-01-01

    Using the first nationally representative birth cohort study in Taiwan, this paper examines the role that maternity leave policy in Taiwan plays in the timing of mothers returning to work after giving birth, as well as the extent to which this timing is linked to the amount of time mothers spend with their children and their use of breast milk…

  7. Bacillus caldolyticus prs gene encoding phosphoribosyldiphosphate synthase

    DEFF Research Database (Denmark)

    Krath, Britta N.; Hove-Jensen, Bjarne

    1996-01-01

    The prs gene, encoding phosphoribosyl-diphosphate (PRPP) synthase, as well as the flanking DNA sequences were cloned and sequenced from the Gram-positive thermophile, Bacillus caldolyticus. Comparison with the homologous sequences from the mesophile, Bacillus subtilis, revealed a gene (gca......D) encoding N-acetylglucosamine-l-phosphate uridyltransferase upstream of prs, and a gene homologous to ctc downstream of prs. cDNA synthesis with a B. caldolyticus gcaD-prs-ctc-specified mRNA as template, followed by amplification utilising the polymerase chain reaction indicated that the three genes are co......-transcribed. Comparison of amino acid sequences revealed a high similarity among PRPP synthases across a wide phylogenetic range. An E. coli strain harbouring the B. caldolyticus prs gene in a multicopy plasmid produced PRPP synthase activity 33-fold over the activity of a haploid B. caldolyticus strain. B. caldolyticus...

  8. REMINDER: Saved Leave Scheme (SLS)

    CERN Multimedia

    2003-01-01

    Transfer of leave to saved leave accounts Under the provisions of the voluntary saved leave scheme (SLS), a maximum total of 10 days'* annual and compensatory leave (excluding saved leave accumulated in accordance with the provisions of Administrative Circular No 22B) can be transferred to the saved leave account at the end of the leave year (30 September). We remind you that unused leave of all those taking part in the saved leave scheme at the closure of the leave year accounts is transferred automatically to the saved leave account on that date. Therefore, staff members have no administrative steps to take. In addition, the transfer, which eliminates the risk of omitting to request leave transfers and rules out calculation errors in transfer requests, will be clearly shown in the list of leave transactions that can be consulted in EDH from October 2003 onwards. Furthermore, this automatic leave transfer optimizes staff members' chances of benefiting from a saved leave bonus provided that they ar...

  9. Molecular and biochemical characterization of caffeine synthase and purine alkaloid concentration in guarana fruit.

    Science.gov (United States)

    Schimpl, Flávia Camila; Kiyota, Eduardo; Mayer, Juliana Lischka Sampaio; Gonçalves, José Francisco de Carvalho; da Silva, José Ferreira; Mazzafera, Paulo

    2014-09-01

    Guarana seeds have the highest caffeine concentration among plants accumulating purine alkaloids, but in contrast with coffee and tea, practically nothing is known about caffeine metabolism in this Amazonian plant. In this study, the levels of purine alkaloids in tissues of five guarana cultivars were determined. Theobromine was the main alkaloid that accumulated in leaves, stems, inflorescences and pericarps of fruit, while caffeine accumulated in the seeds and reached levels from 3.3% to 5.8%. In all tissues analysed, the alkaloid concentration, whether theobromine or caffeine, was higher in young/immature tissues, then decreasing with plant development/maturation. Caffeine synthase activity was highest in seeds of immature fruit. A nucleotide sequence (PcCS) was assembled with sequences retrieved from the EST database REALGENE using sequences of caffeine synthase from coffee and tea, whose expression was also highest in seeds from immature fruit. The PcCS has 1083bp and the protein sequence has greater similarity and identity with the caffeine synthase from cocoa (BTS1) and tea (TCS1). A recombinant PcCS allowed functional characterization of the enzyme as a bifunctional CS, able to catalyse the methylation of 7-methylxanthine to theobromine (3,7-dimethylxanthine), and theobromine to caffeine (1,3,7-trimethylxanthine), respectively. Among several substrates tested, PcCS showed higher affinity for theobromine, differing from all other caffeine synthases described so far, which have higher affinity for paraxanthine. When compared to previous knowledge on the protein structure of coffee caffeine synthase, the unique substrate affinity of PcCS is probably explained by the amino acid residues found in the active site of the predicted protein. Copyright © 2014 Elsevier Ltd. All rights reserved.

  10. SUMO-fusion, purification, and characterization of a (+)-zizaene synthase from Chrysopogon zizanioides

    International Nuclear Information System (INIS)

    Hartwig, S.; Frister, T.; Alemdar, S.; Li, Z.; Scheper, T.; Beutel, S.

    2015-01-01

    An uncharacterized plant cDNA coding for a polypeptide presumably having sesquiterpene synthase activity, was expressed in soluble and active form. Two expression strategies were evaluated in Escherichia coli. The enzyme was fused to a highly soluble SUMO domain, in addition to being produced in an unfused form by a cold-shock expression system. Yields up to ∼325 mg/L −1 were achieved in batch cultivations. The 6x-His-tagged enzyme was purified employing an Ni 2+ -IMAC-based procedure. Identity of the protein was established by Western Blot analysis as well as peptide mass fingerprinting. A molecular mass of 64 kDa and an isoelectric point of pI 4.95 were determined by 2D gel electrophoresis. Cleavage of the fusion domain was possible by digestion with specific SUMO protease. The synthase was active in Mg 2+ containing buffer and catalyzed the production of (+)-zizaene (syn. khusimene), a precursor of khusimol, from farnesyl diphosphate. Product identity was confirmed by GC–MS and comparison of retention indices. Enzyme kinetics were determined by measuring initial reaction rates for the product, using varying substrate concentrations. By assuming a Michaelis–Menten model, kinetic parameters of K M  = 1.111 μM (±0.113), v max  = 0.3245 μM min −1 (±0.0035), k cat  = 2.95 min −1 , as well as a catalytic efficiency k cat /K M  = 4.43 × 10 4  M −1 s −1 were calculated. Fusion to a SUMO moiety can substantially increase soluble expression levels of certain hard to express terpene synthases in E. coli. The kinetic data determined for the recombinant synthase are comparable to other described plant sesquiterpene synthases and in the typical range of enzymes belonging to the secondary metabolism. This leaves potential for optimizing catalytic parameters through methods like directed evolution. - Highlights: • Uncharacterized (+)-zizaene synthase from C. zizanoides was cloned and expressed. • Fusion to SUMO and cold-shock induction

  11. SUMO-fusion, purification, and characterization of a (+)-zizaene synthase from Chrysopogon zizanioides

    Energy Technology Data Exchange (ETDEWEB)

    Hartwig, S.; Frister, T.; Alemdar, S.; Li, Z.; Scheper, T.; Beutel, S., E-mail: beutel@iftc.uni-hannover.de

    2015-03-20

    An uncharacterized plant cDNA coding for a polypeptide presumably having sesquiterpene synthase activity, was expressed in soluble and active form. Two expression strategies were evaluated in Escherichia coli. The enzyme was fused to a highly soluble SUMO domain, in addition to being produced in an unfused form by a cold-shock expression system. Yields up to ∼325 mg/L{sup −1} were achieved in batch cultivations. The 6x-His-tagged enzyme was purified employing an Ni{sup 2+}-IMAC-based procedure. Identity of the protein was established by Western Blot analysis as well as peptide mass fingerprinting. A molecular mass of 64 kDa and an isoelectric point of pI 4.95 were determined by 2D gel electrophoresis. Cleavage of the fusion domain was possible by digestion with specific SUMO protease. The synthase was active in Mg{sup 2+} containing buffer and catalyzed the production of (+)-zizaene (syn. khusimene), a precursor of khusimol, from farnesyl diphosphate. Product identity was confirmed by GC–MS and comparison of retention indices. Enzyme kinetics were determined by measuring initial reaction rates for the product, using varying substrate concentrations. By assuming a Michaelis–Menten model, kinetic parameters of K{sub M} = 1.111 μM (±0.113), v{sub max} = 0.3245 μM min{sup −1} (±0.0035), k{sub cat} = 2.95 min{sup −1}, as well as a catalytic efficiency k{sub cat}/K{sub M} = 4.43 × 10{sup 4} M{sup −1} s{sup −1} were calculated. Fusion to a SUMO moiety can substantially increase soluble expression levels of certain hard to express terpene synthases in E. coli. The kinetic data determined for the recombinant synthase are comparable to other described plant sesquiterpene synthases and in the typical range of enzymes belonging to the secondary metabolism. This leaves potential for optimizing catalytic parameters through methods like directed evolution. - Highlights: • Uncharacterized (+)-zizaene synthase from C. zizanoides was cloned

  12. Cloning and expression of pineapple sucrosephosphate synthase ...

    African Journals Online (AJOL)

    A 1132-base pairs (bp) polymerase-chain-reaction product of sucrose-phosphate synthase (SPS) (EC 2.3.1.14) from pineapple (Ananas comosus cv. Comte de paris) fruit was cloned and nominated as Ac- SPS1. The sequence encodes a putative 377 amino acids protein containing two serine conserved features that had ...

  13. Endothelial nitric oxide synthase gene polymorphisms associated ...

    African Journals Online (AJOL)

    Endothelial nitric oxide synthase (NOS3) is involved in key steps of immune response. Genetic factors predispose individuals to periodontal disease. This study's aim was to explore the association between NOS3 gene polymorphisms and clinical parameters in patients with periodontal disease. Genomic DNA was obtained ...

  14. HAEM SYNTHASE AND COBALT PORPHYRIN SYNTHASE IN VARIOUS MICRO-ORGANISMS.

    Science.gov (United States)

    PORRA, R J; ROSS, B D

    1965-03-01

    1. The preparation of a crude extract of Clostridium tetanomorphum containing cobalt porphyrin synthase but little haem-synthase activity is described. 2. The properties of cobalt porphyrin synthase in the clostridial extracts is compared with the properties of a haem synthase present in crude extracts of the yeast Torulopsis utilis. 3. Cobalt porphyrin synthase in extracts of C. tetanomorphum inserts Co(2+) ions into the following dicarboxylic porphyrins in descending order of rate of insertion: meso-, deutero- and proto-porphyrins. Esterification renders meso- and deutero-porphyrins inactive as substrates. Neither the tetracarboxylic (coproporphyrin III) nor the octacarboxylic (uroporphyrin III) compounds are converted into cobalt porphyrins by the extract, but the non-enzymic incorporation of Co(2+) ions into these two porphyrins is rapid. These extracts are unable to insert Mn(2+), Zn(2+), Mg(2+) or Cu(2+) ions into mesoporphyrin. 4. Crude extracts of T. utilis readily insert both Co(2+) and Fe(2+) ions into deutero-, meso, and proto-porphyrins. Unlike the extracts of C. tetanomorphum, these preparations catalyse the insertion of Co(2+) ions into deuteroporphyrin more rapidly than into mesoporphyrin. This parallels the formation of haems by the T. utilis extract. 5. Cobalt porphyrin synthase is present in the particulate fraction of the extracts of C. tetanomorphum but requires a heat-stable factor present in the soluble fraction. This soluble factor can be replaced by GSH. 6. Cobalt porphyrin synthase in the clostridial extract is inhibited by iodoacetamide and to a smaller extent by p-chloromercuribenzoate and N-ethylmaleimide. The haem synthases of T. utilis and Micrococcus denitrificans are also inhibited by various thiol reagents.

  15. Employer Provisions for Parental Leave.

    Science.gov (United States)

    Meisenheimer, Joseph R., II

    1989-01-01

    Slightly more than one-third of full-time employees in medium and large firms in private industry were covered by maternity- or paternity-leave policies; days off were usually leave without pay. (Author)

  16. REMINDER Saved Leave Scheme (SLS) : Transfer of leave to saved leave accounts

    CERN Multimedia

    HR Division

    2002-01-01

    Under the provisions of the voluntary saved leave scheme (SLS), a maximum total of 10 days'*) annual and compensatory leave (excluding saved leave accumulated in accordance with the provisions of Administrative Circular No. 22B) can be transferred to the saved leave account at the end of the leave year (30 September). We remind you that, since last year, unused leave of all those taking part in the saved leave scheme at the closure of the leave-year accounts is transferred automatically to the saved leave account on that date. Therefore, staff members have no administrative steps to take. In addition, the transfer, which eliminates the risk of omitting to request leave transfers and rules out calculation errors in transfer requests, will be clearly shown in the list of leave transactions that can be consulted in EDH from October 2002 onwards. Furthermore, this automatic leave transfer optimizes staff members' chances of benefiting from a saved leave bonus provided that they are still participants in the schem...

  17. Saved Leave Scheme (SLS) : Simplified procedure for the transfer of leave to saved leave accounts

    CERN Multimedia

    HR Division

    2001-01-01

    As part of the process of streamlining procedures, the HR and AS Divisions have jointly developed a system whereby annual and compensatory leave will henceforth be automatically transferred1) to saved leave accounts. Under the provisions of the voluntary saved leave scheme (SLS), a maximum total of 10 days'2) annual and compensatory leave (excluding saved leave accumulated in accordance with the provisions of Administrative Circular No. 22 B) can be transferred to the saved leave account at the end of the leave year (30 September). Previously, every person taking part in the scheme has been individually issued with a form for the purposes of requesting the transfer of leave to the leave account and the transfer has then had to be done manually by HR Division. To streamline the procedure, unused leave of all those taking part in the saved leave scheme at the closure of of the leave-year accounts will henceforth be transferred automatically to the saved leave account on that date. This simplification is in the ...

  18. Modified cellulose synthase gene from 'Arabidopsis thaliana' confers herbicide resistance to plants

    Energy Technology Data Exchange (ETDEWEB)

    Somerville, Chris R.; Scieble, Wolf

    2000-10-11

    Cellulose synthase ('CS'), a key enzyme in the biosynthesis of cellulose in plants is inhibited by herbicides comprising thiazolidinones such as 5-tert-butyl-carbamoyloxy-3-(3-trifluromethyl) phenyl-4-thiazolidinone (TZ), isoxaben and 2,6-dichlorobenzonitrile (DCB). Two mutant genes encoding isoxaben and TZ-resistant cellulose synthase have been isolated from isoxaben and TZ-resistant Arabidopsis thaliana mutants. When compared with the gene coding for isoxaben or TZ-sensitive cellulose synthase, one of the resistant CS genes contains a point mutation, wherein glycine residue 998 is replaced by an aspartic acid. The other resistant mutation is due to a threonine to isoleucine change at amino acid residue 942. The mutant CS gene can be used to impart herbicide resistance to a plant; thereby permitting the utilization of the herbicide as a single application at a concentration which ensures the complete or substantially complete killing of weeds, while leaving the transgenic crop plant essentially undamaged.

  19. Parental leave and child health.

    Science.gov (United States)

    Ruhm, C J

    2000-11-01

    This study investigates whether rights to parental leave improve pediatric health. Aggregate data are used for 16 European countries over the 1969 through 1994 period. More generous paid leave is found to reduce deaths of infants and young children. The magnitudes of the estimated effects are substantial, especially where a causal effect of leave is most plausible. In particular, there is a much stronger negative relationship between leave durations and post-neonatal or child fatalities than for perinatal mortality, neonatal deaths, or low birth weight. The evidence further suggests that parental leave may be a cost-effective method of bettering child health.

  20. Chlorophyll Synthase under Epigenetic Surveillance Is Critical for Vitamin E Synthesis, and Altered Expression Affects Tocopherol Levels in Arabidopsis.

    Science.gov (United States)

    Zhang, Chunyu; Zhang, Wei; Ren, Guodong; Li, Delin; Cahoon, Rebecca E; Chen, Ming; Zhou, Yongming; Yu, Bin; Cahoon, Edgar B

    2015-08-01

    Chlorophyll synthase catalyzes the final step in chlorophyll biosynthesis: the esterification of chlorophyllide with either geranylgeranyl diphosphate or phytyl diphosphate (PDP). Recent studies have pointed to the involvement of chlorophyll-linked reduction of geranylgeranyl by geranylgeranyl reductase as a major pathway for the synthesis of the PDP precursor of tocopherols. This indirect pathway of PDP synthesis suggests a key role of chlorophyll synthase in tocopherol production to generate the geranylgeranyl-chlorophyll substrate for geranylgeranyl reductase. In this study, contributions of chlorophyll synthase to tocopherol formation in Arabidopsis (Arabidopsis thaliana) were explored by disrupting and altering expression of the corresponding gene CHLOROPHYLL SYNTHASE (CHLSYN; At3g51820). Leaves from the homozygous chlysyn1-1 null mutant were nearly devoid of tocopherols, whereas seeds contained only approximately 25% of wild-type tocopherol levels. Leaves of RNA interference lines with partial suppression of CHLSYN displayed marked reductions in chlorophyll but up to a 2-fold increase in tocopherol concentrations. Cauliflower mosaic virus35S-mediated overexpression of CHLSYN unexpectedly caused a cosuppression phenotype at high frequencies accompanied by strongly reduced chlorophyll content and increased tocopherol levels. This phenotype and the associated detection of CHLSYN-derived small interfering RNAs were reversed with CHLSYN overexpression in rna-directed rna polymerase6 (rdr6), which is defective in RNA-dependent RNA polymerase6, a key enzyme in sense transgene-induced small interfering RNA production. CHLSYN overexpression in rdr6 had little effect on chlorophyll content but resulted in up to a 30% reduction in tocopherol levels in leaves. These findings show that altered CHLSYN expression impacts tocopherol levels and also, show a strong epigenetic surveillance of CHLSYN to control chlorophyll and tocopherol synthesis. © 2015 American Society of

  1. The prevalence of sick leave

    DEFF Research Database (Denmark)

    Backhausen, Mette; Damm, Peter; Bendix, Jane

    2018-01-01

    of long-term sick leave. Method Data from 508 employed pregnant women seeking antenatal care was collected by questionnaires from August 2015 to March 2016. The questionnaires, which were filled in at 20 and 32 weeks of gestation, provided information on maternal characteristics, the number of days spent...... on sick leave and the associated reasons. Descriptive statistics and logistic regression analysis were applied. Results The prevalence of sick leave was 56% of employed pregnant women in the first 32 weeks of gestation and more than one in four reported long-term sick leave (>20 days, continuous...... was a negative predictor. Conclusions The prevalence of sick leave was 56% in the first 32 weeks of gestation and more than one in four women reported long-term sick leave. The majority of reasons for sick leave were pregnancy-related and low back pain was the most frequently given reason....

  2. The influence of altered gravity on carbohydrate metabolism in excised wheat leaves

    Science.gov (United States)

    Obenland, D. M.; Brown, C. S.

    1994-01-01

    We developed a system to study the influence of altered gravity on carbohydrate metabolism in excised wheat leaves by means of clinorotation. The use of excised leaves in our clinostat studies offered a number of advantages over the use of whole plants, most important of which were minimization of exogenous mechanical stress and a greater amount of carbohydrate accumulation during the time of treatment. We found that horizontal clinorotation of excised wheat leaves resulted in significant reductions in the accumulation of fructose, sucrose, starch and fructan relative to control, vertically clinorotated leaves. Photosynthesis, dark respiration and the extractable activities of ADP glucose pyrophosphorylase (EC 2.7.7.27), sucrose phosphate synthase (EC 2.4.4.14), sucrose sucrose fructosyltransferase (EC 2.4.1.99), and fructan hydrolase (EC 3.2.1.80) were unchanged due to altered gravity treatment.

  3. Paid Family Leave, Fathers' Leave-Taking, and Leave-Sharing in Dual-Earner Households

    OpenAIRE

    Bartel, Ann P.; Rossin-Slater, Maya; Ruhm, Christopher J.; Stearns, Jenna; Waldfogel, Jane

    2015-01-01

    This paper provides quasi-experimental evidence on the impact of paid leave legislation on fathers' leave-taking, as well as on the division of leave between mothers and fathers in dual-earner households. Using difference-in-difference and difference-in-difference-in-difference designs, we study California's Paid Family Leave (CA-PFL) program, which is the first source of government-provided paid parental leave available to fathers in the United States. Our results show that fathers in Califo...

  4. CTP synthase forms cytoophidia in the cytoplasm and nucleus

    International Nuclear Information System (INIS)

    Gou, Ke-Mian; Chang, Chia-Chun; Shen, Qing-Ji; Sung, Li-Ying; Liu, Ji-Long

    2014-01-01

    CTP synthase is an essential metabolic enzyme responsible for the de novo synthesis of CTP. Multiple studies have recently showed that CTP synthase protein molecules form filamentous structures termed cytoophidia or CTP synthase filaments in the cytoplasm of eukaryotic cells, as well as in bacteria. Here we report that CTP synthase can form cytoophidia not only in the cytoplasm, but also in the nucleus of eukaryotic cells. Both glutamine deprivation and glutamine analog treatment promote formation of cytoplasmic cytoophidia (C-cytoophidia) and nuclear cytoophidia (N-cytoophidia). N-cytoophidia are generally shorter and thinner than their cytoplasmic counterparts. In mammalian cells, both CTP synthase 1 and CTP synthase 2 can form cytoophidia. Using live imaging, we have observed that both C-cytoophidia and N-cytoophidia undergo multiple rounds of fusion upon glutamine analog treatment. Our study reveals the coexistence of cytoophidia in the cytoplasm and nucleus, therefore providing a good opportunity to investigate the intracellular compartmentation of CTP synthase. - Highlights: • CTP synthase forms cytoophidia not only in the cytoplasm but also in the nucleus. • Glutamine deprivation and Glutamine analogs promotes cytoophidium formation. • N-cytoophidia exhibit distinct morphology when compared to C-cytoophidia. • Both CTP synthase 1 and CTP synthase 2 form cytoophidia in mammalian cells. • Fusions of cytoophidia occur in the cytoplasm and nucleus

  5. CTP synthase forms cytoophidia in the cytoplasm and nucleus

    Energy Technology Data Exchange (ETDEWEB)

    Gou, Ke-Mian [MRC Functional Genomics Unit, Department of Physiology, Anatomy and Genetics, University of Oxford, Oxford OX1 3PT (United Kingdom); State Key Laboratory for Agrobiotechnology, College of Biological Sciences, China Agricultural University, Beijing 100193 (China); Chang, Chia-Chun [Institute of Biotechnology, National Taiwan University, Taipei, Taiwan, ROC (China); Shen, Qing-Ji [MRC Functional Genomics Unit, Department of Physiology, Anatomy and Genetics, University of Oxford, Oxford OX1 3PT (United Kingdom); Sung, Li-Ying, E-mail: liyingsung@ntu.edu.tw [Institute of Biotechnology, National Taiwan University, Taipei, Taiwan, ROC (China); Agricultural Biotechnology Research Center, Academia Sinica, Taipei 115, Taiwan, ROC (China); Liu, Ji-Long, E-mail: jilong.liu@dpag.ox.ac.uk [MRC Functional Genomics Unit, Department of Physiology, Anatomy and Genetics, University of Oxford, Oxford OX1 3PT (United Kingdom)

    2014-04-15

    CTP synthase is an essential metabolic enzyme responsible for the de novo synthesis of CTP. Multiple studies have recently showed that CTP synthase protein molecules form filamentous structures termed cytoophidia or CTP synthase filaments in the cytoplasm of eukaryotic cells, as well as in bacteria. Here we report that CTP synthase can form cytoophidia not only in the cytoplasm, but also in the nucleus of eukaryotic cells. Both glutamine deprivation and glutamine analog treatment promote formation of cytoplasmic cytoophidia (C-cytoophidia) and nuclear cytoophidia (N-cytoophidia). N-cytoophidia are generally shorter and thinner than their cytoplasmic counterparts. In mammalian cells, both CTP synthase 1 and CTP synthase 2 can form cytoophidia. Using live imaging, we have observed that both C-cytoophidia and N-cytoophidia undergo multiple rounds of fusion upon glutamine analog treatment. Our study reveals the coexistence of cytoophidia in the cytoplasm and nucleus, therefore providing a good opportunity to investigate the intracellular compartmentation of CTP synthase. - Highlights: • CTP synthase forms cytoophidia not only in the cytoplasm but also in the nucleus. • Glutamine deprivation and Glutamine analogs promotes cytoophidium formation. • N-cytoophidia exhibit distinct morphology when compared to C-cytoophidia. • Both CTP synthase 1 and CTP synthase 2 form cytoophidia in mammalian cells. • Fusions of cytoophidia occur in the cytoplasm and nucleus.

  6. Paid Family Leave, Fathers' Leave-Taking, and Leave-Sharing in Dual-Earner Households.

    Science.gov (United States)

    Bartel, Anne P; Rossin-Slater, Maya; Ruhm, Christopher J; Stearns, Jenna; Waldfogel, Jane

    Using difference-in-difference and difference-in-difference-in-difference designs, we study California's Paid Family Leave (CA-PFL) program, the first source of government-provided paid parental leave available to fathers in the Unites States. Relative to the pre-treatment mean, fathers of infants in California are 46 percent more likely to be on leave when CA-PFL is available. In households where both parents work, we find suggestive evidence that CA-PFL increases both father-only leave-taking (i.e., father on leave while mother is at work) and joint leave-taking (i.e., both parents on leave at the same time). Effects are larger for fathers of first-born children than for fathers of later-born children.

  7. Regulation of Anthocyanin Biosynthesis in Purple Leaves of Zijuan Tea (Camellia sinensis var. kitamura

    Directory of Open Access Journals (Sweden)

    Lingxia Wang

    2017-04-01

    Full Text Available Plant anthocyanin biosynthesis is well understood, but the regulatory mechanism in purple foliage tea remains unclear. Using isobaric tag for relative and absolute quantification (iTRAQ, 815 differential proteins were identified in the leaves of Zijuan tea, among which 20 were associated with the regulation of anthocyanin metabolism. We found that the abundances of anthocyanin synthesis-related enzymes such as chalcone synthase, chalcone isomerase, dihydroflavonol 4-reductase and anthocyanin synthetase, as well as anthocyanin accumulation-related UDP-glucosyl transferase and ATP-binding cassette (ABC transporters in the purple leaves were all significantly higher than those in the green leaves. The abundances of the transcription factors bHLH and HY5, regulating anthocyanin biosynthesis at transcriptional level were also obviously higher in purple leaves than those in green leaves. In addition, bifunctional 3-dehydroquinate dehydratase and chorismate mutase in purple leaves were distinctly higher in abundance compared to green leaves, which provided sufficient phenylalanine substrate for anthocyanin synthesis. Furthermore, lignin synthesis was found to be reduced due to the lower abundances of cinnamoyl-CoA reductase 1, peroxidase 15 and laccase-6, which resulted in increase of intermediates flow into anthocyanin synthesis pathway. The physiological data were consistent with proteomic results. These four aspects of biosynthetic regulation contribute to anthocyanin accumulation in purple leaves of Zijuan tea.

  8. [Precautionary maternity leave in Tirol].

    Science.gov (United States)

    Ludescher, K; Baumgartner, E; Roner, A; Brezinka, C

    1998-01-01

    Under Austrian law, precautionary maternity leave is a decree issued by the district public health physician. It forbids a pregnant woman to work and mandates immediate maternity leave. Regular maternity leave for all women employed in all jobs begins at 32 weeks of gestation. Women who work in workplaces deemed dangerous and women with a history of obstetric problems such as premature or growth-retarded babies from previous pregnancies are regularly 'sent' into precautionary maternity leave. The public health physicians of Tirol's nine administrative districts were interviewed and supplied data on precautionary maternity leave from their districts. In 100 women who attended the clinic for pregnancies at risk of the Obstetrics/Gynecology Department of Innsbruck University Hospital and who had already obtained precautionary maternity leave, the medical/administrative procedure was studied in each case and correlated with pregnancy outcome. The town district of Innsbruck and the district that comprises the suburbs of the provincial capital had the highest rates of precautionary maternity leave. The town district of Innsbruck had a rate of 24.3% of all pregnant women (employed and not employed) in precautionary maternity leave in 1997, whereas the whole province of Tirol had 13.4%. More than 80% of decrees for precautionary maternity leave are issued by district public health physicians on the basis of written recommendations from gynecologists. One third of women who are sent into precautionary maternity leave are issued the decree prior to 12 weeks of gestation - mostly cases of multiple pregnancies and women with previous miscarriages. The present system of precautionary maternity leave appears to work in the sense that most working pregnant women with risk factors are correctly identified - with most errors on the side of caution. As the system also helps employers - the employee's pay is paid from the federal family support fund and state insurance once she is in

  9. Parental Leave Policies and Parents' Employment and Leave-Taking

    Science.gov (United States)

    Han, Wen-Jui; Ruhm, Christopher; Waldfogel, Jane

    2009-01-01

    We describe trends in maternal employment and leave-taking after birth of a newborn and analyze the extent to which these behaviors are influenced by parental leave policies. Data are from the June Current Population Survey (CPS) Fertility Supplements, merged with other months of the CPS, and cover the period 1987 to 1994. This time span is one…

  10. Clinical significance of Phosphatidyl Inositol Synthase overexpression in oral cancer

    International Nuclear Information System (INIS)

    Kaur, Jatinder; Sawhney, Meenakshi; DattaGupta, Siddartha; Shukla, Nootan K; Srivastava, Anurag; Ralhan, Ranju

    2010-01-01

    We reported increased levels of Phosphatidyl Inositol synthase (PI synthase), (enzyme that catalyses phosphatidyl inositol (PI) synthesis-implicated in intracellular signaling and regulation of cell growth) in smokeless tobacco (ST) exposed oral cell cultures by differential display. This study determined the clinical significance of PI synthase overexpression in oral squamous cell carcinoma (OSCC) and premalignant lesions (leukoplakia), and identified the downstream signaling proteins in PI synthase pathway that are perturbed by smokeless tobacco (ST) exposure. Tissue microarray (TMA) Immunohistochemistry, Western blotting, Confocal laser scan microscopy, RT-PCR were performed to define the expression of PI synthase in clinical samples and in oral cell culture systems. Significant increase in PI synthase immunoreactivity was observed in premalignant lesions and OSCCs as compared to oral normal tissues (p = 0.000). Further, PI synthase expression was significantly associated with de-differentiation of OSCCs, (p = 0.005) and tobacco consumption (p = 0.03, OR = 9.0). Exposure of oral cell systems to smokeless tobacco (ST) in vitro confirmed increase in PI synthase, Phosphatidylinositol 3-kinase (PI3K) and cyclin D1 levels. Collectively, increased PI synthase expression was found to be an early event in oral cancer and a target for smokeless tobacco

  11. REMINDER Saved Leave Scheme (SLS) : Simplified procedure for the transfer of leave to saved leave accounts

    CERN Multimedia

    HR Division

    2001-01-01

    As part of the process of streamlining procedures, the HR and AS Divisions have jointly developed a system whereby annual and compensatory leave will henceforth be automatically transferred1) to saved leave accounts. Under the provisions of the voluntary saved leave scheme (SLS), a maximum total of 10 days'2)Previously, every person taking part in the scheme has been individually issued with a form for the purposes of requesting the transfer of leave to the leave account and the transfer has then had to be done manually by HR Division. To streamline the procedure, unused leave of all those taking part in the saved leave scheme at the closure of the leave-year accounts will henceforth be transferred automatically to the saved leave account on that date. This simplification is in the interest of all parties concerned. This automatic transfer procedure has a number of advantages for participants in the SLS scheme. First, staff members will no longer have to take any administrative steps. Secondly, the new proced...

  12. Chrysanthemyl diphosphate synthase operates in planta as a bifunctional enzyme with chrysanthemol synthase activity

    DEFF Research Database (Denmark)

    Yang, Ting; Gao, Liping; Hu, Hao

    2014-01-01

    Chrysanthemyl diphosphate synthase (CDS) is the first path-way-specific enzyme in the biosynthesis of pyrethrins, the most widely used plant-derived pesticide. CDS catalyzes c1′-2-3 cyclopropanation reactions of two molecules of dimethylallyl diphosphate (DMAPP) to yield chrysanthemyl diphosphate...

  13. Cloning and functional characterization of β-phellandrene synthase from Lavandula angustifolia.

    Science.gov (United States)

    Demissie, Zerihun A; Sarker, Lukman S; Mahmoud, Soheil S

    2011-04-01

    En route to building genomics resources for Lavandula, we have obtained over 14,000 ESTs for leaves and flowers of L. angustifolia, a major essential oil crop, and identified a number of previously uncharacterized terpene synthase (TPS) genes. Here we report the cloning, expression in E. coli, and functional characterization of β-phellandrene synthase, LaβPHLS. The ORF--excluding the transit peptide--for this gene encoded a 62.3 kDa protein that contained all conserved motifs present in plant TPSs. Expression in bacteria resulted in the production of a soluble protein that was purified by Ni-NTA agarose affinity chromatography. While the recombinant LaβPHLS did not utilize FPP as a substrate, it converted GPP (the preferred substrate) and NPP into β-phellandrene as the major product, with K (m) and k (cat) of 6.55 μM and 1.75 × 10(-2) s(-1), respectively, for GPP. The LaβPHLS transcripts were highly abundant in young leaves where β-phellandrene is produced, but were barely detectable in flowers and older leaves, where β-phellandrene is not synthesized in significant quantities. This data indicate that β-phellandrene biosynthesis is transcriptionally and developmentally regulated. We also cloned and expressed in E. coli a second TPS-like protein, LaTPS-I, that lacks an internal stretch of 73 amino acids, including the signature DDxxD divalent metal binding motif, compared to other plant TPSs. The recombinant LaTPS-I did not produce detectable products in vitro when assayed with GPP, NPP or FPP as substrates. The lack of activity is most likely due to the absence of catalytically important amino acid residues within the missing region.

  14. Negotiating leave in the workplace

    DEFF Research Database (Denmark)

    Bloksgaard, Lotte

    In Denmark leave entitlement is not only regulated by law but is also part of the various collective agreements established in the respective occupational sectors and at the local workplace level. Consequently, Danish fathers have very different leave entitlements, depending on the sector, branch...

  15. Negotiating leave in the workplace

    DEFF Research Database (Denmark)

    Bloksgaard, Lotte

    2014-01-01

    In Denmark leave entitlement is not only regulated by law but is also part of the various collective agreements established in the respective occupational sectors and at the local workplace level. Consequently, Danish fathers have very different leave entitlements, depending on the sector, branch...

  16. Molecular cloning and expression levels of the monoterpene synthase gene (ZMM1 in Cassumunar ginger (Zingiber montanum (Koenig Link ex Dietr.

    Directory of Open Access Journals (Sweden)

    Bua-In Saowaluck

    2014-01-01

    Full Text Available Cassumunar ginger (Zingiber montanum (Koenig Link ex Dietr. is a native Thai herb with a high content and large variety of terpenoids in its essential oil. Improving the essential oil content and quality of cassumunar ginger is difficult for a breeder due to its clonally propagated nature. In this research, we describe the isolation and expression level of the monoterpene synthase gene that controls the key step of essential oil synthesis in this plant and evaluate the mechanical wounding that may influence the transcription level of the monoterpene synthase gene. To isolate the gene, the selected clones from DNA derived from young leaves were sequenced and analyzed and the monoterpene synthase gene from cassumunar ginger (ZMM1 was identified. The ZMM1 CDS containing 1 773 bp (KF500399 is predicted to encode a protein of 590 amino acids. The deduced amino acid sequence is 40-74% identical with known sequences of other angiosperm monoterpene synthases belonging to the isoprenoid biosynthesis C1 superfamily. A transcript of ZMM1 was detected almost exclusively in the leaves and was related to leaf wounding. The results of this research offer insight into the control of monoterpene synthesis in this plant. This finding can be applied to breeding programs or crop management of cassumunar ginger for better yield and quality of essential oil.

  17. Transcriptome profiling of the Australian arid-land plant Eremophila serrulata (A.DC.) Druce (Scrophulariaceae) for the identification of monoterpene synthases.

    Science.gov (United States)

    Kracht, Octavia Natascha; Ammann, Ann-Christin; Stockmann, Julia; Wibberg, Daniel; Kalinowski, Jörn; Piotrowski, Markus; Kerr, Russell; Brück, Thomas; Kourist, Robert

    2017-04-01

    Plant terpenoids are a large and highly diverse class of metabolites with an important role in the immune defense. They find wide industrial application as active pharmaceutical ingredients, aroma and fragrance compounds. Several Eremophila sp. derived terpenoids have been documented. To elucidate the terpenoid metabolism, the transcriptome of juvenile and mature Eremophila serrulata (A.DC.) Druce (Scrophulariaceae) leaves was sequenced and a transcript library was generated. We report on the first transcriptomic dataset of an Eremophila plant. IlluminaMiSeq sequencing (2 × 300 bp) revealed 7,093,266 paired reads, which could be assembled to 34,505 isogroups. To enable detection of terpene biosynthetic genes, leaves were separately treated with methyl jasmonate, a well-documented inducer of plant secondary metabolites. In total, 21 putative terpene synthase genes were detected in the transcriptome data. Two terpene synthase isoenzymatic genes, termed ES01 and ES02, were successfully expressed in E. coli. The resulting proteins catalyzed the conversion of geranyl pyrophosphate, the universal substrate of monoterpene synthases to myrcene and Z-(b)-ocimene, respectively. The transcriptomic data and the discovery of the first terpene synthases from Eremophila serrulata are the initial step for the understanding of the terpene metabolism in this medicinally important plant genus. Copyright © 2017 Elsevier Ltd. All rights reserved.

  18. 5 CFR 630.1204 - Intermittent leave or reduced leave schedule.

    Science.gov (United States)

    2010-01-01

    ... insurance, health benefits, retirement coverage, and leave accrual). (e) The agency shall determine the... REGULATIONS ABSENCE AND LEAVE Family and Medical Leave § 630.1204 Intermittent leave or reduced leave schedule... reduced leave schedule unless the employee and the agency agree to do so. (b) Leave under § 630.1203(a) (3...

  19. Sequence analysis of cereal sucrose synthase genes and isolation ...

    African Journals Online (AJOL)

    SERVER

    2007-10-18

    Oct 18, 2007 ... sequencing of sucrose synthase gene fragment from sor- ghum using primers designed at their conserved exons. MATERIALS AND METHODS. Multiple sequence alignment. Sucrose synthase gene sequences of various cereals like rice, maize, and barley were accessed from NCBI Genbank database.

  20. Prostaglandin H synthase immunoreactivity in human gut. An immunohistochemical study

    DEFF Research Database (Denmark)

    Mikkelsen, H B; Rumessen, J J; Qvortrup, Klaus

    1991-01-01

    Prostaglandins exhibit a variety of actions on intestinal smooth muscle depending upon the type, dose and muscle layer studied. As the cellular origin of prostaglandin H (PGH) synthase has not been established with certainty in the human gut wall, we studied the localization of PGH synthase...

  1. Localization of nitric oxide synthase in human skeletal muscle

    DEFF Research Database (Denmark)

    Frandsen, Ulrik; Lopez-Figueroa, M.; Hellsten, Ylva

    1996-01-01

    The present study investigated the cellular localization of the neuronal type I and endothelial type III nitric oxide synthase in human skeletal muscle. Type I NO synthase immunoreactivity was found in the sarcolemma and the cytoplasm of all muscle fibres. Stronger immunoreactivity was expressed...

  2. Metabolism of organic acids, nitrogen and amino acids in chlorotic leaves of 'Honeycrisp' apple (Malus domestica Borkh) with excessive accumulation of carbohydrates.

    Science.gov (United States)

    Wang, Huicong; Ma, Fangfang; Cheng, Lailiang

    2010-07-01

    Metabolite profiles and activities of key enzymes in the metabolism of organic acids, nitrogen and amino acids were compared between chlorotic leaves and normal leaves of 'Honeycrisp' apple to understand how accumulation of non-structural carbohydrates affects the metabolism of organic acids, nitrogen and amino acids. Excessive accumulation of non-structural carbohydrates and much lower CO(2) assimilation were found in chlorotic leaves than in normal leaves, confirming feedback inhibition of photosynthesis in chlorotic leaves. Dark respiration and activities of several key enzymes in glycolysis and tricarboxylic acid (TCA) cycle, ATP-phosphofructokinase, pyruvate kinase, citrate synthase, aconitase and isocitrate dehydrogenase were significantly higher in chlorotic leaves than in normal leaves. However, concentrations of most organic acids including phosphoenolpyruvate (PEP), pyruvate, oxaloacetate, 2-oxoglutarate, malate and fumarate, and activities of key enzymes involved in the anapleurotic pathway including PEP carboxylase, NAD-malate dehydrogenase and NAD-malic enzyme were significantly lower in chlorotic leaves than in normal leaves. Concentrations of soluble proteins and most free amino acids were significantly lower in chlorotic leaves than in normal leaves. Activities of key enzymes in nitrogen assimilation and amino acid synthesis, including nitrate reductase, glutamine synthetase, ferredoxin and NADH-dependent glutamate synthase, and glutamate pyruvate transaminase were significantly lower in chlorotic leaves than in normal leaves. It was concluded that, in response to excessive accumulation of non-structural carbohydrates, glycolysis and TCA cycle were up-regulated to "consume" the excess carbon available, whereas the anapleurotic pathway, nitrogen assimilation and amino acid synthesis were down-regulated to reduce the overall rate of amino acid and protein synthesis.

  3. New statement of leave format

    CERN Multimedia

    HR Department

    2009-01-01

    Following the communication of the Standing Concertation Committee published in Weekly Bulletin No. 18-19 of 27 April 2009, the current statement of leave on monthly pay slips has been replaced with the EDH Leave Transactions report that displays the up-to-date situation of individual leave balances at all times. The report is available on EDH. Additionally, the layout of the pay slip has been modernised. The new version of the pay slip will be send out from September 2009 onwards. Finance and Purchasing Department, Personnel Accounting Human Resources Department, Organisation and Procedures General Infrastructure Services Department, Administrative Information Services

  4. Leaves of Absence. School Law Summary.

    Science.gov (United States)

    National Education Association, Washington, DC. Research Div.

    This report contains State-by-State statutory summaries on three types of leaves of absence relating to teachers -- sick leave, maternity leave, and sabbatical leave. Only State laws that have specific reference to one of these three types of leaves of absence are included. Not included are those statutes granting boards of education the general…

  5. A Comparison of the Effects of Neuronal Nitric Oxide Synthase and Inducible Nitric Oxide Synthase Inhibition on Cartilage Damage

    Directory of Open Access Journals (Sweden)

    Nevzat Selim Gokay

    2016-01-01

    Full Text Available The objective of this study was to investigate the effects of selective inducible nitric oxide synthase and neuronal nitric oxide synthase inhibitors on cartilage regeneration. The study involved 27 Wistar rats that were divided into five groups. On Day 1, both knees of 3 rats were resected and placed in a formalin solution as a control group. The remaining 24 rats were separated into 4 groups, and their right knees were surgically damaged. Depending on the groups, the rats were injected with intra-articular normal saline solution, neuronal nitric oxide synthase inhibitor 7-nitroindazole (50 mg/kg, inducible nitric oxide synthase inhibitor amino-guanidine (30 mg/kg, or nitric oxide precursor L-arginine (200 mg/kg. After 21 days, the right and left knees of the rats were resected and placed in formalin solution. The samples were histopathologically examined by a blinded evaluator and scored on 8 parameters. Although selective neuronal nitric oxide synthase inhibition exhibited significant (P=0.044 positive effects on cartilage regeneration following cartilage damage, it was determined that inducible nitric oxide synthase inhibition had no statistically significant effect on cartilage regeneration. It was observed that the nitric oxide synthase activation triggered advanced arthrosis symptoms, such as osteophyte formation. The fact that selective neuronal nitric oxide synthase inhibitors were observed to have mitigating effects on the severity of the damage may, in the future, influence the development of new agents to be used in the treatment of cartilage disorders.

  6. Chitinase from phaseolus vulgaris leaves

    International Nuclear Information System (INIS)

    Boller, T.; Gehri, A.; Mauch, F.; Vogeli, V.

    1988-01-01

    This paper examines the effect of ethylene on chitinase activity in bean leaves. The authors have purified the enzyme in the course of their work. The purification method is detailed and the colorimetric and radiochemical assays are compared

  7. Homospermidine synthase, the first pathway-specific enzyme of pyrrolizidine alkaloid biosynthesis, evolved from deoxyhypusine synthase

    Science.gov (United States)

    Ober, Dietrich; Hartmann, Thomas

    1999-01-01

    Pyrrolizidine alkaloids are preformed plant defense compounds with sporadic phylogenetic distribution. They are thought to have evolved in response to the selective pressure of herbivory. The first pathway-specific intermediate of these alkaloids is the rare polyamine homospermidine, which is synthesized by homospermidine synthase (HSS). The HSS gene from Senecio vernalis was cloned and shown to be derived from the deoxyhypusine synthase (DHS) gene, which is highly conserved among all eukaryotes and archaebacteria. DHS catalyzes the first step in the activation of translation initiation factor 5A (eIF5A), which is essential for eukaryotic cell proliferation and which acts as a cofactor of the HIV-1 Rev regulatory protein. Sequence comparison provides direct evidence for the evolutionary recruitment of an essential gene of primary metabolism (DHS) for the origin of the committing step (HSS) in the biosynthesis of pyrrolizidine alkaloids. PMID:10611289

  8. The Problems of Parental Leave.

    Science.gov (United States)

    Price, Sean

    2017-10-01

    The United States is the only major industrialized country in the world to not require paid parental leave. Numerous studies have shown that allowing parents time with a newborn makes the child and the parents healthier, both physically and mentally. Many physicians, especially those who work in practices with five or fewer doctors, worry about how to pay for parental leave for themselves and their staff.

  9. Nitric oxide synthase gene G298 allele

    International Nuclear Information System (INIS)

    Nagib El-Kilany, Galal E.; Nayel, Ehab; Hazzaa, Sahar

    2004-01-01

    Background: Nitric oxide (NO) has an important effect on blood pressure, arterial wall, and the basal release of endothelial NO in hypertension (HPN) may be reduced. Until now, there is no solid data revealing the potential role of the polymorphism of the nitric oxide synthase gene (NOS) in patients with HPN and microvascular angina. Aim: The aim of the present study is to investigate the gene of endothelial nitric oxide synthase (eNOS), as the polymorphism of this gene may be a putative candidate for HPN and initiate the process of atherosclerosis. Methods: Sixty participants were recruited for this study; 50 were hypertensive patients complaining of chest pain [30 of them have electrocardiogram (EKG) changes of ischemia], 20 had isolated HPN, and 10 healthy volunteers served as control. All patients underwent stress myocardial perfusion imaging (MPI) and coronary angiography. Genotyping of eNOS for all patients and controls was performed. The linkages between HPN, microvascular angina and eNOS gene polymorphism were investigated. Results: MPI and coronary angiography revealed that 15 patients had chest pain with true ischemia and reversible myocardial perfusion defects (multiple and mild) but normal epicardial coronary arteries (microvascular angina), while 15 patients had significant coronary artery disease (CAD), and 20 hypertensive patients showed normal perfusion scan and coronary angiography. The prevalence of the NOS G 298 allele was higher in the hypertensive group with microvascular angina (documented by MPI) than it was among the control participants (P<.005). The eNOS allele was significantly higher in the hypertensive group than in the control participants, but there was no significant difference in homozygote mutants among hypertensive participants, x-syndrome and patients with CAD. Conclusion: eNOS gene polymorphism is proved to be an important etiology in microvascular angina (x-syndrome) among hypertensive patients. In addition, the eNOS mutant

  10. [Disability leave and sick leave in Spain. 2016 legislative update].

    Science.gov (United States)

    Vicente-Herrero, María Teófila; Terradillos-García, María Jesús; Capdevila-García, Luisa M; Ramírez-Íñiguez de la Torre, María Victoria; Aguilar-Jiménez, Encarna; Aguado-Benedí, María José; López-González, Angel Arturo; Torres-Alberich, José Ignacio

    2018-01-01

    In Spanish, the concepts of discapacidad (disability leave) and incapacidad (sick leave) jointly refer to the impairment of a person due to injuries, diseases or deficiencies that limit their activity in a social, personal or occupational field. However, this common link does not imply that both concepts are the same. Statistical data from INE (Instituto Nacional de Estadística: Statistic National Institute) show that Spain had in 2015 3.85 million persons with a disability (59.8% were women). Statistical data from 2015 from INSS (Instituto Nacional de Seguridad Social: Social Security National Institute) show high levels in the number of processes and in workers affected by temporary sick leave, with social costs to the social security system. Both concepts have been updated: about disability leave, Law 39/2006 adjusted terminology by avoiding the use of concepts with discriminating or pejorative connotation. Regarding sick leave, the Ley General de Seguridad Social (General Social Security Law)has been amended and came into effect in January, 2016. It is necessary to know and distinguish these aspects for a better administrative management, and a more oriented information to the affected patient.

  11. Cloning of a sesquiterpene synthase from Lavandula x intermedia glandular trichomes.

    Science.gov (United States)

    Sarker, Lukman S; Demissie, Zerihun A; Mahmoud, Soheil S

    2013-11-01

    The essential oil (EO) of Lavandula is dominated by monoterpenes, but can also contain small amounts of sesquiterpenes, depending on species and environmental conditions. For example, the sesquiterpene 9-epi-caryophyllene can make up to 8 % of the EO in a few species, including those commercially propagated for EO production. Here, we report the cloning and functional characterization of 9-epi-caryophyllene synthase (LiCPS) from the glandular trichomes of Lavandula x intermedia, cv. Grosso. The 1,617 bp open reading frame of LiCPS, which did not encode a transit peptide, was expressed in Escherichia coli and the recombinant protein purified by Ni-NTA agarose affinity chromatography. The ca. 60 kDa recombinant protein specifically converted farnesyl diphosphate to 9-epi-caryophyllene. LiCPS also produced a few monoterpenes when assayed with the monoterpene precursor geranyl diphosphate (GPP), but--unlike most monoterpene synthases--was not able to derive detectable amounts of any products from the cis isomer of GPP, neryl diphosphate. The LiCPS transcripts accumulated in developing L. x intermedia flowers and were highly enriched in glandular trichomes, but were not detected in leaves suggesting that the transcriptional expression of this gene is spatially and developmentally regulated.

  12. Alliinase and cysteine synthase transcription in developing garlic (Allium sativum L.) over time.

    Science.gov (United States)

    Mitrová, Katarina; Svoboda, Pavel; Milella, Luigi; Ovesná, Jaroslava

    2018-06-15

    Garlic is a valuable source of healthy compounds, including secondary metabolites rich in sulphur such as cysteine sulphoxides (CSOs). Here, we present new qRT-PCR assays analysing the transcription of two genes encoding key enzymes in CSO biosynthetic pathways (cysteine synthase and alliinase) in developing garlic. We also identified a set of genes (ACT I, GAPDH, and TUB) to use as transcription normalisation controls. We showed that the (normalised) transcription of both enzymes was highest during sprouting and decreased significantly in fully developed leaves, which are the major CSO-producing organs. Transcriptional activity further declined at the end of the growing season. Different cultivars show similar sulphur metabolism gene expression when European garlics were compared to Chinese and American genotypes. The qRT-PCR assays presented are also suitable for investigating the effects of agricultural practices on CSO formation in garlic to satisfy consumer demands. Copyright © 2017. Published by Elsevier Ltd.

  13. [Cellulose synthase genes that control the fiber formation of flax (Linum usitatissimum L.)].

    Science.gov (United States)

    Galinovskiĭ, D V; Anisimova, N V; Raĭskiĭ, A P; Leont'ev, V N; Titok, V V; Hotyleva, L V

    2014-01-01

    Four cellulose synthase genes were identified by analysis of their class-specific regions (CSRII) in plants of fiber flax during the "rapid growth" stage. These genes were designated as LusCesA1, LusCesA4, LusCesA7 and LusCesA9. LusCesA4, LusCesA7, and LusCesA9 genes were expressed in the stem; LusCesA1 and LusCesA4 genes were expressed in the apex part of plants, and the LusCesA4 gene was expressed in the leaves of fiber flax. The expression of the LusCesA7 and LusCesA9 genes was specific to the stems of fiber flax. These genes may influence the quality of the flax fiber.

  14. Glycogen synthase activation by sugars in isolated hepatocytes.

    Science.gov (United States)

    Ciudad, C J; Carabaza, A; Bosch, F; Gòmez I Foix, A M; Guinovart, J J

    1988-07-01

    We have investigated the activation by sugars of glycogen synthase in relation to (i) phosphorylase a activity and (ii) changes in the intracellular concentration of glucose 6-phosphate and adenine nucleotides. All the sugars tested in this work present the common denominator of activating glycogen synthase. On the other hand, phosphorylase a activity is decreased by mannose and glucose, unchanged by galactose and xylitol, and increased by tagatose, glyceraldehyde, and fructose. Dihydroxyacetone exerts a biphasic effect on phosphorylase. These findings provide additional evidence proving that glycogen synthase can be activated regardless of the levels of phosphorylase a, clearly establishing that a nonsequential mechanism for the activation of glycogen synthase occurs in liver cells. The glycogen synthase activation state is related to the concentrations of glucose 6-phosphate and adenine nucleotides. In this respect, tagatose, glyceraldehyde, and fructose deplete ATP and increase AMP contents, whereas glucose, mannose, galactose, xylitol, and dihydroxyacetone do not alter the concentration of these nucleotides. In addition, all these sugars, except glyceraldehyde, increase the intracellular content of glucose 6-phosphate. The activation of glycogen synthase by sugars is reflected in decreases on both kinetic constants of the enzyme, M0.5 (for glucose 6-phosphate) and S0.5 (for UDP-glucose). We propose that hepatocyte glycogen synthase is activated by monosaccharides by a mechanism triggered by changes in glucose 6-phosphate and adenine nucleotide concentrations which have been described to modify glycogen synthase phosphatase activity. This mechanism represents a metabolite control of the sugar-induced activation of hepatocyte glycogen synthase.

  15. Generation and Functional Evaluation of Designer Monoterpene Synthases.

    Science.gov (United States)

    Srividya, N; Lange, I; Lange, B M

    2016-01-01

    Monoterpene synthases are highly versatile enzymes that catalyze the first committed step in the pathways toward terpenoids, the structurally most diverse class of plant natural products. Recent advancements in our understanding of the reaction mechanism have enabled engineering approaches to develop mutant monoterpene synthases that produce specific monoterpenes. In this chapter, we are describing protocols to introduce targeted mutations, express mutant enzyme catalysts in heterologous hosts, and assess their catalytic properties. Mutant monoterpene synthases have the potential to contribute significantly to synthetic biology efforts aimed at producing larger amounts of commercially attractive monoterpenes. © 2016 Elsevier Inc. All rights reserved.

  16. Geranylfarnesyl diphosphate synthase from Methanosarcina mazei: Different role, different evolution

    International Nuclear Information System (INIS)

    Ogawa, Takuya; Yoshimura, Tohru; Hemmi, Hisashi

    2010-01-01

    The gene of (all-E) geranylfarnesyl diphosphate synthase that is responsible for the biosynthesis of methanophenazine, an electron carrier utilized for methanogenesis, was cloned from a methanogenic archaeon Methanosarcina mazei Goe1. The properties of the recombinant enzyme and the results of phylogenetic analysis suggest that the enzyme is closely related to (all-E) prenyl diphosphate synthases that are responsible for the biosynthesis of respiratory quinones, rather than to the enzymes involved in the biosynthesis of archaeal membrane lipids, including (all-E) geranylfarnesyl diphosphate synthase from a thermophilic archaeon.

  17. Genes up-regulated during red coloration in UV-B irradiated lettuce leaves.

    Science.gov (United States)

    Park, Jong-Sug; Choung, Myoung-Gun; Kim, Jung-Bong; Hahn, Bum-Soo; Kim, Jong-Bum; Bae, Shin-Chul; Roh, Kyung-Hee; Kim, Yong-Hwan; Cheon, Choong-Ill; Sung, Mi-Kyung; Cho, Kang-Jin

    2007-04-01

    Molecular analysis of gene expression differences between green and red lettuce leaves was performed using the SSH method. BlastX comparisons of subtractive expressed sequence tags (ESTs) indicated that 7.6% of clones encoded enzymes involved in secondary metabolism. Such clones had a particularly high abundance of flavonoid-metabolism proteins (6.5%). Following SSH, 566 clones were rescreened for differential gene expression using dot-blot hybridization. Of these, 53 were found to overexpressed during red coloration. The up-regulated expression of six genes was confirmed by Northern blot analyses. The expression of chalcone synthase (CHS), flavanone 3-hydroxylase (F3H), and dihydroflavonol 4-reductase (DFR) genes showed a positive correlation with anthocyanin accumulation in UV-B-irradiated lettuce leaves; flavonoid 3',5'-hydroxylase (F3',5'H) and anthocyanidin synthase (ANS) were expressed continuously in both samples. These results indicated that the genes CHS, F3H, and DFR coincided with increases in anthocyanin accumulation during the red coloration of lettuce leaves. This study show a relationship between red coloration and the expression of up-regulated genes in lettuce. The subtractive cDNA library and EST database described in this study represent a valuable resource for further research for secondary metabolism in the vegetable crops.

  18. Why People Leave Their Jobs?

    Directory of Open Access Journals (Sweden)

    Luis R. Domínguez A.

    2014-12-01

    Full Text Available This article aims to show the results of the review of literature of relevant studies of the causal elements of intention to leave in the last five years (2009-2013. The method used to evaluate the literature was based on the seven steps for research synthesis: problem formulation, literature search, obtaining information from studies, quality assessment studies, analysis and integration of results, interpretation of evidence and presentation of results. 48 studies from 15 different countries with a sample of 35804 employees of different companies were evaluated. The findings suggest the existence of 89 different variables influencing the intention to leave of employees in an organization. The results of this study will allow researchers to better understand the variables that can be studied to verify the impact of variables such as causal elements, but also see those that have a mediating effect between them for predicting intention to leave as an element of employee turnover. This study makes three important contributions to literature of turnover. First, in this study all the parameters associated with the intention to leave were checked. Second, this study categorizes and displays in proportion relevant interests to the scientific community whom studying employee turnover across the intention to leave. And thirdly provides clues organizations to improve some of its structural and contextual features to control turnover.

  19. An In Planta-Expressed Polyketide Synthase Produces (R)-Mellein in the Wheat Pathogen Parastagonospora nodorum

    Science.gov (United States)

    Krill, Christian; Barrow, Russell A.; Chen, Shasha; Trengove, Robert; Oliver, Richard P.; Solomon, Peter S.

    2014-01-01

    Parastagonospora nodorum is a pathogen of wheat that affects yields globally. Previous transcriptional analysis identified a partially reducing polyketide synthase (PR-PKS) gene, SNOG_00477 (SN477), in P. nodorum that is highly upregulated during infection of wheat leaves. Disruption of the corresponding SN477 gene resulted in the loss of production of two compounds, which we identified as (R)-mellein and (R)-O-methylmellein. Using a Saccharomyces cerevisiae yeast heterologous expression system, we successfully demonstrated that SN477 is the only enzyme required for the production of (R)-mellein. This is the first identification of a fungal PKS that is responsible for the synthesis of (R)-mellein. The P. nodorum ΔSN477 mutant did not show any significant difference from the wild-type strain in its virulence against wheat. However, (R)-mellein at 200 μg/ml inhibited the germination of wheat (Triticum aestivum) and barrel medic (Medicago truncatula) seeds. Comparative sequence analysis identified the presence of mellein synthase (MLNS) homologues in several Dothideomycetes and two sodariomycete genera. Phylogenetic analysis suggests that the MLNSs in fungi and bacteria evolved convergently from fungal and bacterial 6-methylsalicylic acid synthases. PMID:25326302

  20. Expression of an (E-β-farnesene synthase gene from Asian peppermint in tobacco affected aphid infestation

    Directory of Open Access Journals (Sweden)

    Xiudao Yu

    2013-10-01

    Full Text Available Aphids are major agricultural pests that cause significant yield losses in crop plants each year. (E-β-farnesene (EβF is the main or only component of an alarm pheromone involved in chemical communication within aphid species and particularly in the avoidance of predation. EβF also occurs in the essential oil of some plant species, and is catalyzed by EβF synthase. By using oligonucleotide primers designed from the known sequence of an EβF synthase gene from black peppermint (Mentha × piperita, two cDNA sequences, MaβFS1 and MaβFS2, were isolated from Asian peppermint (Mentha asiatica. Expression pattern analysis showed that the MaβFS1 gene exhibited higher expression in flowers than in roots, stems and leaves at the transcriptional level. Overexpression of MaβFS1 in tobacco plants resulted in emission of pure EβF ranging from 2.62 to 4.85 ng d− 1 g− 1 of fresh tissue. Tritrophic interactions involving peach aphids (Myzus persicae, and predatory lacewing (Chrysopa septempunctata larvae demonstrated that transgenic tobacco expressing MaβFS1 had lower aphid infestation. This result suggested that the EβF synthase gene from Asian peppermint could be a good candidate for genetic engineering of agriculturally important crop plants.

  1. CHARACTERIZATION OF 0.58 kb DNA STILBENE SYNTHASE ENCODING GENE FRAGMENT FROM MELINJO PLANT (Gnetum gnemon

    Directory of Open Access Journals (Sweden)

    Tri Joko Raharjo

    2011-12-01

    Full Text Available Resveratrol is a potent anticancer agent resulted as the main product of enzymatic reaction between common precursor in plants and Stilbene Synthase enzyme, which is expressed by sts gene. Characterization of internal fragment of Stilbene Synthase (STS encoding gene from melinjo plant (Gnetum gnemon L. has been carried out as part of a larger work to obtain a full length of Stilbene Synthase encoding gene of the plant. RT-PCR (Reverse Transcriptase Polymerase Chain Reaction was performed using two degenerated primers to amplify the gene fragment. Ten published STS conserved amino acid sequences from various plant species from genebank were utilized to construct a pair of GGF2 (5' GTTCCACCTGCGAAGCAGCC 3' and GGR2 (5' CTGGATCGCACATCC TGGTG 3' primers. Both designed primers were predicted to be in the position of 334-354 and 897-916 kb of the gene respectively. Total RNA isolated from melinjo leaves was used as template for the RT-PCR amplification process using two-step technique. A collection of 0.58 DNA fragments was generated from RT-PCR amplification and met the expected results. The obtained DNA fragments were subsequently isolated, refined and sequenced. A nucleotide sequence analysis was accomplished by comparing it to the existed sts genes available in genebank. Homology analysis of the DNA fragments with Arachis hypogaea L00952 sts gene showed high similarity level. Taken together, the results are evidence that the amplified fragment obtained in this study is part of melinjo sts gene

  2. Parental leave: the impact of recent legislation on parents' leave taking.

    Science.gov (United States)

    Han, Wen-Jui; Waldfogel, Jane

    2003-02-01

    We use data from the Survey of Income and Program Participation to examine the impact of leave entitlements on unpaid leave usage by men and women after the birth of a child from 1991 to 1999. The results indicate that legislation providing the right to unpaid leave has not affected men's leave usage. The results for women are mixed: in some specifications, leave entitlements are associated with increased leave taking or longer leaves, but the results depend on how we define leave coverage. Our results point to the limited impact of unpaid leave policies and the potential importance of paid-leave policies.

  3. Chlorophyll Synthase under Epigenetic Surveillance Is Critical for Vitamin E Synthesis, and Altered Expression Affects Tocopherol Levels in Arabidopsis1[OPEN

    Science.gov (United States)

    Zhang, Chunyu; Zhang, Wei; Ren, Guodong; Li, Delin; Cahoon, Rebecca E.; Chen, Ming; Zhou, Yongming; Yu, Bin

    2015-01-01

    Chlorophyll synthase catalyzes the final step in chlorophyll biosynthesis: the esterification of chlorophyllide with either geranylgeranyl diphosphate or phytyl diphosphate (PDP). Recent studies have pointed to the involvement of chlorophyll-linked reduction of geranylgeranyl by geranylgeranyl reductase as a major pathway for the synthesis of the PDP precursor of tocopherols. This indirect pathway of PDP synthesis suggests a key role of chlorophyll synthase in tocopherol production to generate the geranylgeranyl-chlorophyll substrate for geranylgeranyl reductase. In this study, contributions of chlorophyll synthase to tocopherol formation in Arabidopsis (Arabidopsis thaliana) were explored by disrupting and altering expression of the corresponding gene CHLOROPHYLL SYNTHASE (CHLSYN; At3g51820). Leaves from the homozygous chlysyn1-1 null mutant were nearly devoid of tocopherols, whereas seeds contained only approximately 25% of wild-type tocopherol levels. Leaves of RNA interference lines with partial suppression of CHLSYN displayed marked reductions in chlorophyll but up to a 2-fold increase in tocopherol concentrations. Cauliflower mosaic virus35S-mediated overexpression of CHLSYN unexpectedly caused a cosuppression phenotype at high frequencies accompanied by strongly reduced chlorophyll content and increased tocopherol levels. This phenotype and the associated detection of CHLSYN-derived small interfering RNAs were reversed with CHLSYN overexpression in rna-directed rna polymerase6 (rdr6), which is defective in RNA-dependent RNA polymerase6, a key enzyme in sense transgene-induced small interfering RNA production. CHLSYN overexpression in rdr6 had little effect on chlorophyll content but resulted in up to a 30% reduction in tocopherol levels in leaves. These findings show that altered CHLSYN expression impacts tocopherol levels and also, show a strong epigenetic surveillance of CHLSYN to control chlorophyll and tocopherol synthesis. PMID:26048882

  4. Isolation of developing secondary xylem specific cellulose synthase ...

    Indian Academy of Sciences (India)

    The present study aimed at identifying developing secondary xylem specific cellulose synthase genes from .... the First strand cDNA synthesis kit (Fermentas, Pittsburgh,. USA). .... ing height of the rooted cutting, girth of the stem, leaf area.

  5. Cloning and expression of pineapple sucrose- phosphate synthase ...

    African Journals Online (AJOL)

    hope&shola

    2010-12-06

    Dec 6, 2010 ... phosphate; EDTA, ethylene diamine tetraacetic acid; Ivr, invertase; SS .... phenolics, tannins and artifacts due to differences of tissue composition ..... Banana sucrose-phosphate synthase gene expression during fruit ripening.

  6. Germacrene A Synthase in Yarrow (Achillea millefolium Is an Enzyme with Mixed Substrate Specificity: Gene Cloning, Functional Characterization and Expression Analysis

    Directory of Open Access Journals (Sweden)

    Leila ePazouki

    2015-03-01

    Full Text Available Terpenoid synthases constitute a highly diverse gene family producing a wide range of cyclic and acyclic molecules consisting of isoprene (C5 residues. Often a single terpene synthase produces a spectrum of molecules of given chain length, but some terpene synthases can use multiple substrates, producing products of different chain length. Only a few such enzymes has been characterized, but the capacity for multiple-substrate use can be more widespread than previously thought. Here we focused on germacrene A synthase (GAS that is a key cytosolic enzyme in the sesquiterpene lactone biosynthesis pathway in the important medicinal plant Achillea millefolium (AmGAS. The full length encoding gene was heterologously expressed in Escherichia coli BL21 (DE3, functionally characterized, and its in vivo expression was analyzed. The recombinant protein catalyzed formation of germacrene A with the C15 substrate farnesyl diphosphate (FDP, while acyclic monoterpenes were formed with the C10 substrate geranyl diphosphate (GDP and cyclic monoterpenes with the C10 substrate neryl diphosphate (NDP. Although monoterpene synthesis has been assumed to be confined exclusively to plastids, AmGAS can potentially synthesize monoterpenes in cytosol when GDP or NDP become available. AmGAS enzyme had high homology with GAS sequences from other Asteraceae species, suggesting that multi-substrate use can be more widespread among germacrene A synthases than previously thought. Expression studies indicated that AmGAS was expressed in both autotrophic and heterotrophic plant compartments with the highest expression levels in leaves and flowers. To our knowledge, this is the first report on the cloning and characterization of germacrene A synthase coding gene in A. millefolium, and multi-substrate use of GAS enzymes.

  7. An Evaluation of Paid Leave

    DEFF Research Database (Denmark)

    Albæk, Karsten

    This paper analyzes a labor market program which enables workers to leave employment temporarily with a compensation financed by the taxpayers. The main aim of the program was to increase the chances of the unemployed finding a job. However, the empirical analysis reveals a clear negative...... relationship between the unemployment rate and transition rates from employment into the paid leave scheme. Program participation is low, precisely in those labor market states, where the scheme has a potential to perform as a remedy by increasing the transition rate from unemployment to employment. Several...

  8. Modulation of hyaluronan synthase activity in cellular membrane fractions

    OpenAIRE

    Vigetti, Davide; Genasetti, A; Karousou, Evgenia; Viola, Manuela; Clerici, M; Bartolini, B; Moretto, Paola; DE LUCA, Giancarlo; Hascall, Vc; Passi, Alberto

    2009-01-01

    Hyaluronan (HA), the only non-sulfated glycosaminoglycan, is involved in morphogenesis, wound healing, inflammation, angiogenesis, and cancer. In mammals, HA is synthesized by three homologous HA synthases, HAS1, HAS2, and HAS3, that polymerize the HA chain using UDP-glucuronic acid and UDP-N-acetylglucosamine as precursors. Since the amount of HA is critical in several pathophysiological conditions, we developed a non-radioactive assay for measuring the activity of HA synthases (HASs) in euk...

  9. Inhibitors of Fatty Acid Synthase for Prostate Cancer. Revision

    Science.gov (United States)

    2013-05-01

    acetyl- cholinesterase inhibitors have been developed, many with femtomolar binding affinities (7). This body of literature also confirms that the...AD_________________ Award Number: W81XWH-09-1-0204 TITLE: Inhibitors of Fatty Acid Synthase for...May 2013 2. REPORT TYPE Revised Final 3. DATES COVERED 01 May 2009-30 Apr 2013 4. TITLE AND SUBTITLE Inhibitors of Fatty Acid Synthase for

  10. Inhibitors of Fatty Acid Synthase for Prostate Cancer

    Science.gov (United States)

    2012-05-01

    compounds. For example, numerous classes of acetyl- cholinesterase inhibitors have been developed, m any with fe mtomolar binding affinities (7). This...AD_________________ Award Number: W81XWH-09-1-0204 TITLE: Inhibitors of Fatty Acid Synthase for...CONTRACT NUMBER Inhibitors of Fatty Acid Synthase for Prostate Cancer 5b. GRANT NUMBER W81XWH-09-1-0204 5c. PROGRAM ELEMENT NUMBER 6. AUTHOR

  11. Promotion of flavonoid biosynthesis in leaves and calli of ornamental crabapple (Malus sp.) by high carbon to nitrogen ratios.

    Science.gov (United States)

    Wan, Huihua; Zhang, Jie; Song, Tingting; Tian, Ji; Yao, Yuncong

    2015-01-01

    Flavonoids are secondary metabolites that play important roles in plant physiology. Despite numerous studies examined the effects of available carbon (C) or nitrogen (N) on flavonoid biosynthesis, the mechanism of C/N interactive effects on flavonoid metabolism is still unclear. In this study, we analyzed the composition of flavonoids and the expression levels of flavonoid-related genes in leaves and calli of crabapple (Malus sp.) cultivars with different leaf colors grown on media with different C/N ratios. Our results show that high C/N ratios induce anthocyanin pigmentation in leaves of the ever-red cultivar 'Royalty' and the spring-red cultivar 'Prairifire,' as well as in three types of calli derived from the ever-green cultivar 'Spring Snow,' but not in the leaves of the ever-green cultivar 'Flame.' This phenomenon therefore correlated with anthocyanin content in these different samples. In addition, high C/N ratios in the growth media resulted in an increase in the concentration of flavones and flavonols in the leaves of the three crabapple cultivars. The transcript levels of the general flavonoid pathway genes [from chalcone synthase (CHS) to uridine diphosphat-glucose: flavonoid 3-O-glycosyltransferase (UFGT) and flavonol synthase (FLS)] increased in response to high C/N ratios, and this in turn was correlated with the concentration of anthocyanins, flavones and flavonols in the leaves and calli. Expression of the late flavonoid/anthocyanin biosynthetic genes, anthocyanidin synthase (ANS), UFGT and FLS in particular, was more strongly influenced by C/N ratios than other structural genes, and the increased expression of the structural genes under high C/N ratios coincided with a coordinated increase in transcript levels of a MYB transcription factor, MYB10. These results are likely to be useful for future generation of plants with an optimized flavonoid/anthocyanin content or desirable organ coloration.

  12. Promotion of flavonoid biosynthesis in leaves and calli of ornamental crabapple (Malus spp. by high carbon to nitrogen ratios

    Directory of Open Access Journals (Sweden)

    Huihua eWan

    2015-09-01

    Full Text Available Flavonoids are secondary metabolites that play important roles in plant physiology. Despite numerous studies examined the effects of available carbon (C or nitrogen (N on flavonoid biosynthesis, the mechanism of C/N interactive effects on flavonoid metabolism is still unclear. In this study, we analyzed the composition of flavonoids and the expression levels of flavonoid-related genes in leaves and calli of crabapple (Malus spp. cultivars with different leaf colors grown on media with different C/N ratios. Our results show that high C/N ratios induce anthocyanin pigmentation in leaves of the ever-red cultivar ‘Royalty’ and the spring-red cultivar ‘Prairifire’, as well as in three types of calli derived from the ever-green cultivar ‘Spring Snow’, but not in the leaves of the ever-green cultivar ‘Flame’. This phenomenon therefore correlated with anthocyanin content in these different samples. In addition, high C/N ratios in the growth media resulted in an increase in the concentration of flavones and flavonols in the leaves of the three crabapple cultivars. The transcript levels of the general flavonoid pathway genes [from chalcone synthase (CHS to uridine diphosphate (UDP-glucose: flavonoid 3-O-glycosyltransferase (UFGT and flavonol synthase (FLS] increased in response to high C/N ratios, and this in turn was correlated with the concentration of anthocyanin, flavone and flavonol in the leaves and calli. Expression of the late flavonoid/anthocyanin biosynthetic genes, anthocyanidin synthase (ANS, UFGT and FLS in particular, was more strongly influenced by C/N ratios than other structural genes, and the increased expression of the structural genes under high C/N ratios coincided with a coordinated increase in transcript levels of a MYB transcription factor, MYB10. These results are likely to be useful for future generation of plants with an optimized flavonoid/anthocyanin content or desirable organ coloration.

  13. Homocystinuria due to cystathionine beta synthase deficiency

    Directory of Open Access Journals (Sweden)

    Rao T

    2008-01-01

    Full Text Available A two year-old male child presented with cutis marmorata congenita universalis, brittle hair, mild mental retardation, and finger spasms. Biochemical findings include increased levels of homocysteine in the blood-106.62 µmol/L (normal levels: 5.90-16µmol/L. Biochemical tests such as the silver nitroprusside and nitroprusside tests were positive suggesting homocystinuria. The patient was treated with oral pyridoxine therapy for three months. The child responded well to this therapy and the muscle spasms as well as skin manifestations such as cutis marmorata subsided. The treatment is being continued; the case is reported here because of its rarity. Homocysteinuria arising due to cystathionine beta-synthase (CBS deficiency is an autosomal recessive disorder of methionine metabolism that produces increased levels of urinary homocysteine and methionine It manifests itself in vascular, central nervous system, cutaneous, and connective tissue disturbances and phenotypically resembles Marfan′s syndrome. Skin manifestations include malar flush, thin hair, and cutis reticulata / marmorata.

  14. Watch out for the leaves!

    CERN Multimedia

    HSE Unit

    2013-01-01

    Now that autumn is here, dead leaves falling from the trees form a colourful carpet that is pleasing to the eye. However, the reality is less pleasant for pedestrians, since these leaves increase the risk of slipping and falling, especially when the ground is wet.   These conditions are also hazardous for two- and four-wheeled vehicles, whose grip on the ground can be severely reduced, thereby increasing the risk of them skidding out of control. Cyclists are among the most vulnerable road users when faced with these hazards. It is therefore essential to be alert to the dangers, which can be lessened by taking a few simple precautions such as moderating your speed and wearing suitable shoes. We also invite you to notify the Service Desk if you notice a road or pavement where there is a high concentration of dead leaves. The CERN Roads and Drainage Service will then ensure that the leaves are cleared in order to reduce the risk of accidents in the area.

  15. Nutrient resorption from seagrass leaves

    NARCIS (Netherlands)

    Stapel, J.; Hemminga, M.A.

    1997-01-01

    The resorption of nutrients (C, N and P) from senescent leaves of six seagrass species from nine different locations in tropical (Indonesia and Kenya), Mediterranean (Spain) and temperate (The Netherlands) regions has been investigated. Resorption was quantitatively assessed by calculating the

  16. Physiological Characterization and Comparative Transcriptome Analysis of White and Green Leaves of Ananas comosus var. bracteatus.

    Directory of Open Access Journals (Sweden)

    Xia Li

    Full Text Available Leaf coloration is one of the most important and attractive characteristics of Ananas comosus var. bracteatus. The chimeric character is not stable during the in vitro tissue culturing. Many regenerated plants lost economic values for the loss of the chimeric character of leaves. In order to reveal the molecular mechanisms involved in the albino phenotype of the leaf cells, the physiological and transcriptional differences between complete white (CWh and green (CGr leaf cells of A. comosus var. bracteatus were analyzed. A total of 1,431 differentially expressed unigenes (DEGs in CGr and CWh leaves were identified using RNA-seq. A comparison to the COG, GO and KEGG annotations revealed DEGs involved in chlorophyll biosynthesis, chloroplast development and photosynthesis. Furthermore, the measurement of main precursors of chlorophyll in the CWh leaves confirmed that the rate-limiting step in chlorophyll biosynthesis, and thus the cause of the albino phenotype of the white cells, was the conversion of pyrrole porphobilinogen (PBG to uroporphyrinogen III (Uro III. The enzyme activity of porphobilinogen deaminase (PBGD and uroporporphyrinogn III synthase (UROS, which catalyze the transition of PBG to Uro III, was significantly decreased in the CWh leaves. Our data showed the transcriptional differences between the CWh and CGr plants and characterized key steps in chlorophyll biosynthesis of the CWh leaves. These results contribute to our understanding of the mechanisms and regulation of pigment biosynthesis in the CWh leaf cells of A. comosus var. bracteatus.

  17. Converting S-limonene synthase to pinene or phellandrene synthases reveals the plasticity of the active site.

    Science.gov (United States)

    Xu, Jinkun; Ai, Ying; Wang, Jianhui; Xu, Jingwei; Zhang, Yongkang; Yang, Dong

    2017-05-01

    S-limonene synthase is a model monoterpene synthase that cyclizes geranyl pyrophosphate (GPP) to form S-limonene. It is a relatively specific enzyme as the majority of its products are composed of limonene. In this study, we converted it to pinene or phellandrene synthases after introducing N345A/L423A/S454A or N345I mutations. Further studies on N345 suggest the polarity of this residue plays a critical role in limonene production by stabilizing the terpinyl cation intermediate. If it is mutated to a non-polar residue, further cyclization or hydride shifts occurs so the carbocation migrates towards the pyrophosphate, leading to the production of pinene or phellandrene. On the other hand, mutant enzymes that still possess a polar residue at this position produce limonene as the major product. N345 is not the only polar residue that may stabilize the terpinyl cation because it is not strictly conserved among limonene synthases across species and there are also several other polar residues in this area. These residues could form a "polar pocket" that may collectively play this stabilizing role. Our study provides important insights into the catalytic mechanism of limonene synthases. Furthermore, it also has wider implications on the evolution of terpene synthases. Copyright © 2017 Elsevier Ltd. All rights reserved.

  18. 29 CFR 825.202 - Intermittent leave or reduced leave schedule.

    Science.gov (United States)

    2010-07-01

    ... leave schedule is a leave schedule that reduces an employee's usual number of working hours per workweek, or hours per workday. A reduced leave schedule is a change in the employee's schedule for a period of... 29 Labor 3 2010-07-01 2010-07-01 false Intermittent leave or reduced leave schedule. 825.202...

  19. Molecular cloning and characterization of (+)-epi-α-bisabolol synthase, catalyzing the first step in the biosynthesis of the natural sweetener, hernandulcin, in Lippia dulcis.

    Science.gov (United States)

    Attia, Mohamed; Kim, Soo-Un; Ro, Dae-Kyun

    2012-11-01

    Hernandulcin, a C15 sesquiterpene ketone, is a natural sweetener isolated from the leaves of Lippia dulcis. It is a promising sugar substitute due to its safety and low caloric potential. However, the biosynthesis of hernandulcin in L. dulcis remains unknown. The first biochemical step of hernandulcin is the synthesis of (+)-epi-α-bisabolol from farnesyl diphosphate, which is presumed to be catalyzed by a unique sesquiterpene synthase in L. dulcis. In order to decipher hernandulcin biosynthesis, deep transcript sequencings (454 and Illumina) were performed, which facilitated the molecular cloning of five new sesquiterpene synthase cDNAs from L. dulcis. In vivo activity evaluation of these cDNAs in yeast identified them as the sesquiterpene synthases for α-copaene/δ-cadinene, bicyclogermacrene, β-caryophyllene, trans-α-bergamotene, and α-bisabolol. The engineered yeast could synthesize a significant amount (~0.3 mg per mL) of α-bisabolol in shake-flask cultivation. This efficient in vivo production was congruent with the competent kinetic properties of recombinant α-bisabolol synthase (K(m) 4.8 μM and k(cat) 0.04 s(-1)). Detailed chemical analyses of the biosynthesized α-bisabolol confirmed its configuration to be (+)-epi-α-bisabolol, the core skeleton of hernandulcin. These results demonstrated that enzymatic, stereoselective synthesis of (+)-epi-α-bisabolol can be achieved, promising the heterologous production of a natural sweetener, hernandulcin. Copyright © 2012 Elsevier Inc. All rights reserved.

  20. Phenotypic changes associated with RNA interference silencing of chalcone synthase in apple (Malus × domestica).

    Science.gov (United States)

    Dare, Andrew P; Tomes, Sumathi; Jones, Midori; McGhie, Tony K; Stevenson, David E; Johnson, Ross A; Greenwood, David R; Hellens, Roger P

    2013-05-01

    We have identified in apple (Malus × domestica) three chalcone synthase (CHS) genes. In order to understand the functional redundancy of this gene family RNA interference knockout lines were generated where all three of these genes were down-regulated. These lines had no detectable anthocyanins and radically reduced concentrations of dihydrochalcones and flavonoids. Surprisingly, down-regulation of CHS also led to major changes in plant development, resulting in plants with shortened internode lengths, smaller leaves and a greatly reduced growth rate. Microscopic analysis revealed that these phenotypic changes extended down to the cellular level, with CHS-silenced lines showing aberrant cellular organisation in the leaves. Fruit collected from one CHS-silenced line was smaller than the 'Royal Gala' controls, lacked flavonoids in the skin and flesh and also had changes in cell morphology. Auxin transport experiments showed increased rates of auxin transport in a CHS-silenced line compared with the 'Royal Gala' control. As flavonoids are well known to be key modulators of auxin transport, we hypothesise that the removal of almost all flavonoids from the plant by CHS silencing creates a vastly altered environment for auxin transport to occur and results in the observed changes in growth and development. © 2013 The Authors The Plant Journal © 2013 Blackwell Publishing Ltd.

  1. Sphingomyelin synthases regulate protein trafficking and secretion.

    Directory of Open Access Journals (Sweden)

    Marimuthu Subathra

    Full Text Available Sphingomyelin synthases (SMS1 and 2 represent a class of enzymes that transfer a phosphocholine moiety from phosphatidylcholine onto ceramide thus producing sphingomyelin and diacylglycerol (DAG. SMS1 localizes at the Golgi while SMS2 localizes both at the Golgi and the plasma membrane. Previous studies from our laboratory showed that modulation of SMS1 and, to a lesser extent, of SMS2 affected the formation of DAG at the Golgi apparatus. As a consequence, down-regulation of SMS1 and SMS2 reduced the localization of the DAG-binding protein, protein kinase D (PKD, to the Golgi. Since PKD recruitment to the Golgi has been implicated in cellular secretion through the trans golgi network (TGN, the effect of down-regulation of SMSs on TGN-to-plasma membrane trafficking was studied. Down regulation of either SMS1 or SMS2 significantly retarded trafficking of the reporter protein vesicular stomatitis virus G protein tagged with GFP (VSVG-GFP from the TGN to the cell surface. Inhibition of SMSs also induced tubular protrusions from the trans Golgi network reminiscent of inhibited TGN membrane fission. Since a recent study demonstrated the requirement of PKD activity for insulin secretion in beta cells, we tested the function of SMS in this model. Inhibition of SMS significantly reduced insulin secretion in rat INS-1 cells. Taken together these results provide the first direct evidence that both enzymes (SMS1 and 2 are capable of regulating TGN-mediated protein trafficking and secretion, functions that are compatible with PKD being a down-stream target for SMSs in the Golgi.

  2. The Tomato Terpene Synthase Gene Family1[W][OA

    Science.gov (United States)

    Falara, Vasiliki; Akhtar, Tariq A.; Nguyen, Thuong T.H.; Spyropoulou, Eleni A.; Bleeker, Petra M.; Schauvinhold, Ines; Matsuba, Yuki; Bonini, Megan E.; Schilmiller, Anthony L.; Last, Robert L.; Schuurink, Robert C.; Pichersky, Eran

    2011-01-01

    Compounds of the terpenoid class play numerous roles in the interactions of plants with their environment, such as attracting pollinators and defending the plant against pests. We show here that the genome of cultivated tomato (Solanum lycopersicum) contains 44 terpene synthase (TPS) genes, including 29 that are functional or potentially functional. Of these 29 TPS genes, 26 were expressed in at least some organs or tissues of the plant. The enzymatic functions of eight of the TPS proteins were previously reported, and here we report the specific in vitro catalytic activity of 10 additional tomato terpene synthases. Many of the tomato TPS genes are found in clusters, notably on chromosomes 1, 2, 6, 8, and 10. All TPS family clades previously identified in angiosperms are also present in tomato. The largest clade of functional TPS genes found in tomato, with 12 members, is the TPS-a clade, and it appears to encode only sesquiterpene synthases, one of which is localized to the mitochondria, while the rest are likely cytosolic. A few additional sesquiterpene synthases are encoded by TPS-b clade genes. Some of the tomato sesquiterpene synthases use z,z-farnesyl diphosphate in vitro as well, or more efficiently than, the e,e-farnesyl diphosphate substrate. Genes encoding monoterpene synthases are also prevalent, and they fall into three clades: TPS-b, TPS-g, and TPS-e/f. With the exception of two enzymes involved in the synthesis of ent-kaurene, the precursor of gibberellins, no other tomato TPS genes could be demonstrated to encode diterpene synthases so far. PMID:21813655

  3. Characterization of the human gene (TBXAS1) encoding thromboxane synthase.

    Science.gov (United States)

    Miyata, A; Yokoyama, C; Ihara, H; Bandoh, S; Takeda, O; Takahashi, E; Tanabe, T

    1994-09-01

    The gene encoding human thromboxane synthase (TBXAS1) was isolated from a human EMBL3 genomic library using human platelet thromboxane synthase cDNA as a probe. Nucleotide sequencing revealed that the human thromboxane synthase gene spans more than 75 kb and consists of 13 exons and 12 introns, of which the splice donor and acceptor sites conform to the GT/AG rule. The exon-intron boundaries of the thromboxane synthase gene were similar to those of the human cytochrome P450 nifedipine oxidase gene (CYP3A4) except for introns 9 and 10, although the primary sequences of these enzymes exhibited 35.8% identity each other. The 1.2-kb of the 5'-flanking region sequence contained potential binding sites for several transcription factors (AP-1, AP-2, GATA-1, CCAAT box, xenobiotic-response element, PEA-3, LF-A1, myb, basic transcription element and cAMP-response element). Primer-extension analysis indicated the multiple transcription-start sites, and the major start site was identified as an adenine residue located 142 bases upstream of the translation-initiation site. However, neither a typical TATA box nor a typical CAAT box is found within the 100-b upstream of the translation-initiation site. Southern-blot analysis revealed the presence of one copy of the thromboxane synthase gene per haploid genome. Furthermore, a fluorescence in situ hybridization study revealed that the human gene for thromboxane synthase is localized to band q33-q34 of the long arm of chromosome 7. A tissue-distribution study demonstrated that thromboxane synthase mRNA is widely expressed in human tissues and is particularly abundant in peripheral blood leukocyte, spleen, lung and liver. The low but significant levels of mRNA were observed in kidney, placenta and thymus.

  4. Highly divergent mitochondrial ATP synthase complexes in Tetrahymena thermophila.

    Directory of Open Access Journals (Sweden)

    Praveen Balabaskaran Nina

    2010-07-01

    Full Text Available The F-type ATP synthase complex is a rotary nano-motor driven by proton motive force to synthesize ATP. Its F(1 sector catalyzes ATP synthesis, whereas the F(o sector conducts the protons and provides a stator for the rotary action of the complex. Components of both F(1 and F(o sectors are highly conserved across prokaryotes and eukaryotes. Therefore, it was a surprise that genes encoding the a and b subunits as well as other components of the F(o sector were undetectable in the sequenced genomes of a variety of apicomplexan parasites. While the parasitic existence of these organisms could explain the apparent incomplete nature of ATP synthase in Apicomplexa, genes for these essential components were absent even in Tetrahymena thermophila, a free-living ciliate belonging to a sister clade of Apicomplexa, which demonstrates robust oxidative phosphorylation. This observation raises the possibility that the entire clade of Alveolata may have invented novel means to operate ATP synthase complexes. To assess this remarkable possibility, we have carried out an investigation of the ATP synthase from T. thermophila. Blue native polyacrylamide gel electrophoresis (BN-PAGE revealed the ATP synthase to be present as a large complex. Structural study based on single particle electron microscopy analysis suggested the complex to be a dimer with several unique structures including an unusually large domain on the intermembrane side of the ATP synthase and novel domains flanking the c subunit rings. The two monomers were in a parallel configuration rather than the angled configuration previously observed in other organisms. Proteomic analyses of well-resolved ATP synthase complexes from 2-D BN/BN-PAGE identified orthologs of seven canonical ATP synthase subunits, and at least 13 novel proteins that constitute subunits apparently limited to the ciliate lineage. A mitochondrially encoded protein, Ymf66, with predicted eight transmembrane domains could be a

  5. Sucrose Phosphate Synthase and Sucrose Accumulation at Low Temperature 1

    Science.gov (United States)

    Guy, Charles L.; Huber, Joan L. A.; Huber, Steven C.

    1992-01-01

    The influence of growth temperature on the free sugar and sucrose phosphate synthase content and activity of spinach (Spinacia oleracea) leaf tissue was studied. When plants were grown at 25°C for 3 weeks and then transferred to a constant 5°C, sucrose, glucose, and fructose accumulated to high levels during a 14-d period. Predawn sugar levels increased from 14- to 20-fold over the levels present at the outset of the low-temperature treatment. Sucrose was the most abundant free sugar before, during, and after exposure to 5°C. Leaf sucrose phosphate synthase activity was significantly increased by the low-temperature treatment, whereas sucrose synthase and invertases were not. Synthesis of the sucrose phosphate synthase subunit was increased during and after low-temperature exposure and paralleled an increase in the steady-state level of the subunit. The increases in sucrose and its primary biosynthetic enzyme, sucrose phosphate synthase, are discussed in relation to adjustment of metabolism to low nonfreezing temperature and freezing stress tolerance. Images Figure 1 Figure 2 Figure 3 PMID:16652990

  6. Leaving the hospital - your discharge plan

    Science.gov (United States)

    ... patientinstructions/000867.htm Leaving the hospital - your discharge plan To use the sharing features on this page, ... once you leave. This is called a discharge plan. Your health care providers at the hospital will ...

  7. Sesquiterpene Synthase-3-Hydroxy-3-Methylglutaryl Coenzyme A Synthase Fusion Protein Responsible for Hirsutene Biosynthesis in Stereum hirsutum.

    Science.gov (United States)

    Flynn, Christopher M; Schmidt-Dannert, Claudia

    2018-06-01

    The wood-rotting mushroom Stereum hirsutum is a known producer of a large number of namesake hirsutenoids, many with important bioactivities. Hirsutenoids form a structurally diverse and distinct class of sesquiterpenoids. No genes involved in hirsutenoid biosynthesis have yet been identified or their enzymes characterized. Here, we describe the cloning and functional characterization of a hirsutene synthase as an unexpected fusion protein of a sesquiterpene synthase (STS) with a C-terminal 3-hydroxy-3-methylglutaryl-coenzyme A (3-hydroxy-3-methylglutaryl-CoA) synthase (HMGS) domain. Both the full-length fusion protein and truncated STS domain are highly product-specific 1,11-cyclizing STS enzymes with kinetic properties typical of STSs. Complementation studies in Saccharomyces cerevisiae confirmed that the HMGS domain is also functional in vivo Phylogenetic analysis shows that the hirsutene synthase domain does not form a clade with other previously characterized sesquiterpene synthases from Basidiomycota. Comparative gene structure analysis of this hirsutene synthase with characterized fungal enzymes reveals a significantly higher intron density, suggesting that this enzyme may be acquired by horizontal gene transfer. In contrast, the HMGS domain is clearly related to other fungal homologs. This STS-HMGS fusion protein is part of a biosynthetic gene cluster that includes P450s and oxidases that are expressed and could be cloned from cDNA. Finally, this unusual fusion of a terpene synthase to an HMGS domain, which is not generally recognized as a key regulatory enzyme of the mevalonate isoprenoid precursor pathway, led to the identification of additional HMGS duplications in many fungal genomes, including the localization of HMGSs in other predicted sesquiterpenoid biosynthetic gene clusters. IMPORTANCE Hirsutenoids represent a structurally diverse class of bioactive sesquiterpenoids isolated from fungi. Identification of their biosynthetic pathways will provide

  8. Virus-induced gene silencing of Withania somnifera squalene synthase negatively regulates sterol and defence-related genes resulting in reduced withanolides and biotic stress tolerance.

    Science.gov (United States)

    Singh, Anup Kumar; Dwivedi, Varun; Rai, Avanish; Pal, Shaifali; Reddy, Sajjalavarahalli Gangireddy Eswara; Rao, Dodaghatta Krishnarao Venkata; Shasany, Ajit Kumar; Nagegowda, Dinesh A

    2015-12-01

    Withania somnifera (L.) Dunal is an important Indian medicinal plant that produces withanolides, which are triterpenoid steroidal lactones having diverse biological activities. To enable fast and efficient functional characterization of genes in this slow-growing and difficult-to-transform plant, a virus-induced gene silencing (VIGS) was established by silencing phytoene desaturase (PDS) and squalene synthase (SQS). VIGS of the gene encoding SQS, which provides precursors for triterpenoids, resulted in significant reduction of squalene and withanolides, demonstrating its application in studying withanolides biosynthesis in W. somnifera leaves. A comprehensive analysis of gene expression and sterol pathway intermediates in WsSQS-vigs plants revealed transcriptional modulation with positive feedback regulation of mevalonate pathway genes, and negative feed-forward regulation of downstream sterol pathway genes including DWF1 (delta-24-sterol reductase) and CYP710A1 (C-22-sterol desaturase), resulting in significant reduction of sitosterol, campesterol and stigmasterol. However, there was little effect of SQS silencing on cholesterol, indicating the contribution of sitosterol, campesterol and stigmasterol, but not of cholesterol, towards withanolides formation. Branch-point oxidosqualene synthases in WsSQS-vigs plants exhibited differential regulation with reduced CAS (cycloartenol synthase) and cycloartenol, and induced BAS (β-amyrin synthase) and β-amyrin. Moreover, SQS silencing also led to the down-regulation of brassinosteroid-6-oxidase-2 (BR6OX2), pathogenesis-related (PR) and nonexpressor of PR (NPR) genes, resulting in reduced tolerance to bacterial and fungal infection as well as to insect feeding. Taken together, SQS silencing negatively regulated sterol and defence-related genes leading to reduced phytosterols, withanolides and biotic stress tolerance, thus implicating the application of VIGS for functional analysis of genes related to withanolides

  9. Childcare and the division of parental leave

    OpenAIRE

    Norén, Anna

    2015-01-01

    Despite several policies aimed at increasing fathers' participation in the caring of children, Swedish mothers still use the bulk of the paid parental leave which may have several negative consequences for the family e.g. in terms of weaker labor market attachment for the mother. Division of parental leave is likely affected by how parents value the costs associated with parental leave. I investigate whether a reduction in the care burden, or a decreased non-monetary cost, of parental leave t...

  10. Impaired glycogen synthase activity and mitochondrial dysfunction in skeletal muscle

    DEFF Research Database (Denmark)

    Højlund, Kurt; Beck-Nielsen, Henning

    2006-01-01

    Insulin resistance in skeletal muscle is a major hallmark of type 2 diabetes and an early detectable abnormality in the development of this disease. The cellular mechanisms of insulin resistance include impaired insulin-mediated muscle glycogen synthesis and increased intramyocellular lipid content......, whereas impaired insulin activation of muscle glycogen synthase represents a consistent, molecular defect found in both type 2 diabetic and high-risk individuals. Despite several studies of the insulin signaling pathway believed to mediate dephosphorylation and hence activation of glycogen synthase......, the molecular mechanisms responsible for this defect remain unknown. Recently, the use of phospho-specific antibodies in human diabetic muscle has revealed hyperphosphorylation of glycogen synthase at sites not regulated by the classical insulin signaling pathway. In addition, novel approaches such as gene...

  11. Class II recombinant phosphoribosyl diphosphate synthase from spinach

    DEFF Research Database (Denmark)

    Krath, B N; Hove-Jensen, B

    2001-01-01

    to other PRPP synthases the activity of spinach PRPP synthase isozyme 3 is independent of P(i), and the enzyme is inhibited by ribonucleoside diphosphates in a purely competitive manner, which indicates a lack of allosteric inhibition by these compounds. In addition spinach PRPP synthase isozyme 3 shows...... an unusual low specificity toward diphosphoryl donors by accepting dATP, GTP, CTP, and UTP in addition to ATP. The kinetic mechanism of the enzyme is an ordered steady state Bi Bi mechanism with K(ATP) and K(Rib-5-P) values of 170 and 110 micrometer, respectively, and a V(max) value of 13.1 micromol (min x...... mg of protein)(-1). The enzyme has an absolute requirement for magnesium ions, and maximal activity is obtained at 40 degrees C at pH 7.6....

  12. The CCCTB Rules on Leaving a Group

    NARCIS (Netherlands)

    van de Streek, J.

    2012-01-01

    The consolidation system proposed in the draft of the CCCTB Directive puts relationships between Member States on edge. This is clearly apparent in the rules that apply when a company leaves a group. In this article the leaving rules are examined. Although the leaving rules are claimed to be

  13. Sugar beet leaves for functional ingredients

    NARCIS (Netherlands)

    Tamayo Tenorio, Angelica

    2017-01-01

    Plant leaves are recognised as a potential source for food applications based on their nutritional profile and interesting technological properties of leaf components, and based on the large availability of plant leaves in agricultural waste streams. Besides proteins, leaves have a rich

  14. Compassionate Care Leave & Benefits. CAUT Briefing Note

    Science.gov (United States)

    Canadian Association of University Teachers, 2016

    2016-01-01

    Compassionate care leave and benefits were introduced in 2003/04 to help employees cope with this difficult work-life balance challenge. Employment Standards legislation and the Employment Insurance program (EI) were amended to provide leave without pay, with payment of EI benefits for compassionate care leave. Collective agreements have been…

  15. On the Sharing of Temporary Parental Leave

    DEFF Research Database (Denmark)

    Amilon, Anna

    2007-01-01

    This paper views temporary parental leave (leave from work to take care of a sick child) as a household public good, produced with time inputs of the parents as the only input. Assuming equal productivities in the production of temporary parental leave and equal utility functions of the spouses...

  16. Nicotianamine synthase overexpression positively modulates iron homeostasis-related genes in high iron rice

    Directory of Open Access Journals (Sweden)

    Meng eWang

    2013-05-01

    Full Text Available Nearly one-third of the world population, mostly women and children, suffer from iron malnutrition and its consequences, such as anemia or impaired mental development. Biofortification of rice, which is a staple crop for nearly half of the world’s population, can significantly contribute in alleviating iron deficiency. NFP rice (transgenic rice expressing nicotianamine synthase, ferritin and phytase genes has a more than six-fold increase in iron content in polished rice grains, resulting from the synergistic action of nicotianamine synthase (NAS and ferritin transgenes. We investigated iron homeostasis in NFP plants by analyzing the expression of 28 endogenous rice genes known to be involved in the homeostasis of iron and other metals, in iron-deficient and iron-sufficient conditions. RNA was collected from different tissues (roots, flag leaves, grains and at three developmental stages during grain filling. NFP plants showed increased sensitivity to iron-deficiency conditions and changes in the expression of endogenous genes involved in nicotianamine (NA metabolism, in comparison to their non-transgenic siblings. Elevated transcript levels were detected in NFP plants for several iron transporters. In contrast, expression of OsYSL2, which encodes a member of Yellow Stripe-like protein family, and a transporter of the NA-Fe(II complex was reduced in NFP plants under low iron conditions, indicating that expression of OsYSL2 is regulated by the endogenous iron status. Expression of the transgenes did not significantly affect overall iron homeostasis in NFP plants, which establishes the engineered push-pull mechanism as a suitable strategy to increase rice endosperm iron content.

  17. Resource capture by single leaves

    Energy Technology Data Exchange (ETDEWEB)

    Long, S.P.

    1992-05-01

    Leaves show a variety of strategies for maximizing CO{sub 2} and light capture. These are more meaningfully explained if they are considered in the context of maximizing capture relative to the utilization of water, nutrients and carbohydrates reserves. There is considerable variation between crops in their efficiency of CO{sub 2} and light capture at the leaf level. Understanding of these mechanisms indicate some ways in which efficiency of resource capture could be level cannot be meaningfully considered without simultaneous understanding of implications at the canopy level. 36 refs., 5 figs., 1 tab.

  18. Examining the Evolution of Paid Parental Leave.

    Science.gov (United States)

    Sladek, Carol

    While the United States continues to be the only developed nation without mandated paid maternity leave, U.S. employers are blazing their own trail for new parents. This article defines parental leave, explains what's driving the increased interest in paid parental leave among employers offering it and discusses how paid parental leave can benefit employers and employees alike. Finally, the author discusses why not all employers are offering these benefits as well as considerations for employers contemplating whether paid parental leave is right for them.

  19. 5 CFR 630.1015 - Movement between voluntary leave bank and leave transfer programs.

    Science.gov (United States)

    2010-01-01

    ... 5 Administrative Personnel 1 2010-01-01 2010-01-01 false Movement between voluntary leave bank and leave transfer programs. 630.1015 Section 630.1015 Administrative Personnel OFFICE OF PERSONNEL MANAGEMENT CIVIL SERVICE REGULATIONS ABSENCE AND LEAVE Voluntary Leave Bank Program § 630.1015 Movement...

  20. 5 CFR 630.1104 - Donations from a leave bank to an emergency leave transfer program.

    Science.gov (United States)

    2010-01-01

    ... 5 Administrative Personnel 1 2010-01-01 2010-01-01 false Donations from a leave bank to an emergency leave transfer program. 630.1104 Section 630.1104 Administrative Personnel OFFICE OF PERSONNEL MANAGEMENT CIVIL SERVICE REGULATIONS ABSENCE AND LEAVE Emergency Leave Transfer Program § 630.1104 Donations...

  1. 29 CFR 825.205 - Increments of FMLA leave for intermittent or reduced schedule leave.

    Science.gov (United States)

    2010-07-01

    ... intermittent leave or working a reduced leave schedule to commence or end work mid-way through a shift, such as... per week, but works only 20 hours a week under a reduced leave schedule, the employee's ten hours of... 29 Labor 3 2010-07-01 2010-07-01 false Increments of FMLA leave for intermittent or reduced...

  2. Virtual Screening of Novel Glucosamine-6-Phosphate Synthase Inhibitors.

    Science.gov (United States)

    Lather, Amit; Sharma, Sunil; Khatkar, Anurag

    2018-01-01

    Infections caused by microorganisms are the major cause of death today. The tremendous and improper use of antimicrobial agents leads to antimicrobial resistance. Various currently available antimicrobial drugs are inadequate to control the infections and lead to various adverse drug reactions. Efforts based on computer-aided drug design (CADD) can excavate a large number of databases to generate new, potent hits and minimize the requirement of time as well as money for the discovery of newer antimicrobials. Pharmaceutical sciences also have made development with advances in drug designing concepts. The current research article focuses on the study of various G-6-P synthase inhibitors from literature cited molecular database. Docking analysis was conducted and ADMET data of various molecules was evaluated by Schrodinger Glide and PreADMET software, respectively. Here, the results presented efficacy of various inhibitors towards enzyme G-6-P synthase. Docking scores, binding energy and ADMET data of various molecules showed good inhibitory potential toward G-6-P synthase as compared to standard antibiotics. This novel antimicrobial drug target G-6-P synthase has not so extensively been explored for its application in antimicrobial therapy, so the work done so far proved highly essential. This article has helped the drug researchers and scientists to intensively explore about this wonderful antimicrobial drug target. The Schrodinger, Inc. (New York, USA) software was utilized to carry out the computational calculations and docking studies. The hardware configuration was Intel® core (TM) i5-4210U CPU @ 2.40GHz, RAM memory 4.0 GB under 64-bit window operating system. The ADMET data was calculated by using the PreADMET tool (PreADMET ver. 2.0). All the computational work was completed in the Laboratory for Enzyme Inhibition Studies, Department of Pharmaceutical Sciences, M.D. University, Rohtak, INDIA. Molecular docking studies were carried out to identify the binding

  3. Structure and mechanism of the diterpene cyclase ent-copalyl diphosphate synthase

    Energy Technology Data Exchange (ETDEWEB)

    Köksal, Mustafa; Hu, Huayou; Coates, Robert M.; Peters, Reuben J.; Christianson, David W. (UIUC); (Iowa State); (Penn)

    2011-09-20

    The structure of ent-copalyl diphosphate synthase reveals three {alpha}-helical domains ({alpha}, {beta} and {gamma}), as also observed in the related diterpene cyclase taxadiene synthase. However, active sites are located at the interface of the {beta}{gamma} domains in ent-copalyl diphosphate synthase but exclusively in the {alpha} domain of taxadiene synthase. Modular domain architecture in plant diterpene cyclases enables the evolution of alternative active sites and chemical strategies for catalyzing isoprenoid cyclization reactions.

  4. The Balance of Expression of Dihydroflavonol 4-reductase and Flavonol Synthase Regulates Flavonoid Biosynthesis and Red Foliage Coloration in Crabapples.

    Science.gov (United States)

    Tian, Ji; Han, Zhen-yun; Zhang, Jie; Hu, YuJing; Song, Tingting; Yao, Yuncong

    2015-07-20

    Red leaf color is an attractive trait of Malus families, including crabapple (Malus spp.); however, little is known about the molecular mechanisms that regulate the coloration. Dihydroflavonols are intermediates in the production of both colored anthocyanins and colorless flavonols, and this current study focused on the gene expression balance involved in the relative accumulation of these compounds in crabapple leaves. Levels of anthocyanins and the transcript abundances of the anthocyanin biosynthetic gene, dihydroflavonol 4-reductase (McDFR) and the flavonol biosynthetic gene, flavonol synthase (McFLS), were assessed during the leaf development in two crabapple cultivars, 'Royalty' and 'Flame'. The concentrations of anthocyanins and flavonols correlated with leaf color and we propose that the expression of McDFR and McFLS influences their accumulation. Further studies showed that overexpression of McDFR, or silencing of McFLS, increased anthocyanin production, resulting in red-leaf and red fruit peel phenotypes. Conversely, elevated flavonol production and green phenotypes in crabapple leaves and apple peel were observed when McFLS was overexpressed or McDFR was silenced. These results suggest that the relative activities of McDFR and McFLS are important determinants of the red color of crabapple leaves, via the regulation of the metabolic fate of substrates that these enzymes have in common.

  5. Highly Divergent Mitochondrial ATP Synthase Complexes in Tetrahymena thermophila

    NARCIS (Netherlands)

    Nina, Praveen Balabaskaran; Dudkina, Natalya V.; Kane, Lesley A.; van Eyk, Jennifer E.; Boekema, Egbert J.; Mather, Michael W.; Vaidya, Akhil B.; Eisen, Jonathan A.

    The F-type ATP synthase complex is a rotary nano-motor driven by proton motive force to synthesize ATP. Its F(1) sector catalyzes ATP synthesis, whereas the F(o) sector conducts the protons and provides a stator for the rotary action of the complex. Components of both F(1) and F(o) sectors are

  6. Predicting the catalytic sites of isopenicillin N synthase (IPNS ...

    African Journals Online (AJOL)

    Isopenicillin N synthase (IPNS) related Non-haem iron-dependent oxygenases and oxidases (NHIDOX) demonstrated a striking structural conservativeness, even with low protein sequence homology. It is evident that these enzymes have an architecturally similar catalytic centre with active ligands lining the reactive pocket.

  7. Studies on the Active Site of Deacetoxycephalosporin C Synthase

    NARCIS (Netherlands)

    Lloyd, Matthew D.; Lee, Hwei-Jen; Harlos, Karl; Zhang, Zhi-Hong; Baldwin, Jack E.; Schofield, Christopher J.; Charnock, John M.; Garner, C. David; Hara, Takane; Terwisscha van Scheltinga, Anke C.; Valegård, Karin; Viklund, Jenny A.C.; Hajdu, Janos; Andersson, Inger; Danielsson, Åke; Bhikhabhai, Rama

    1999-01-01

    The Fe(II) and 2-oxoglutarate-dependent dioxygenase deacetoxycephalosporin C synthase (DAOCS) from Streptomyces clavuligerus was expressed at ca 25% of total soluble protein in Escherichia coli and purified by an efficient large-scale procedure. Purified protein catalysed the conversions of

  8. Beta-Glucan Synthase Gene Expression in Pleurotus sp

    International Nuclear Information System (INIS)

    Azhar Mohamad; Nie, H.J.

    2016-01-01

    Pleurotus sp. is a popular edible mushroom, containing various functional component, in particular, Beta-glucan. Beta-glucans is a part of glucan family of polysaccharides and supposedly contribute to medicinal and nutritional value of Pleurotus.sp. In order to understand the distribution of Beta-glucan in Pleurotus.sp, the Beta-glucan synthase gene expression was determined and compared in different part of Pleurotus, namely mycelium, stripe and cap. The Pleurotus.sp RNA was extracted using commercial kit, employing Tissuelyser ll (Qiagen, USA) to disrupt the cell walls. Then the RNA was quantified by Nano drop (Thermo Fisher, USA) and visualized using denaturing agarose gel. RNA with good OD 260.280 reading (∼2.0) was chosen and converted to cDNA. Using Laccase synthase gene as home keeping gene, Beta-glucan synthase gene expression was quantified using CFX 96 Real Time PCR detection system (Biorad, USA). Preliminary result shows that Beta-glucan synthase was relatively expressed the most in stripe, followed by mycelium and barely in cap. (author)

  9. Isolation and expression of the Pneumocystis carinii thymidylate synthase gene

    DEFF Research Database (Denmark)

    Edman, U; Edman, J C; Lundgren, B

    1989-01-01

    The thymidylate synthase (TS) gene from Pneumocystis carinii has been isolated from complementary and genomic DNA libraries and expressed in Escherichia coli. The coding sequence of TS is 891 nucleotides, encoding a 297-amino acid protein of Mr 34,269. The deduced amino acid sequence is similar...

  10. Insight into Biochemical Characterization of Plant Sesquiterpene Synthases

    DEFF Research Database (Denmark)

    Manczak, Tom; Simonsen, Henrik Toft

    2016-01-01

    A fast and reproducible protocol was established for enzymatic characterization of plant sesquiterpene synthases that can incorporate radioactivity in their products. The method utilizes the 96-well format in conjunction with cluster tubes and enables processing of >200 samples a day. Along...... with reduced reagent usage, it allows further reduction in the use of radioactive isotopes and flammable organic solvents. The sesquiterpene synthases previously characterized were expressed in yeast, and the plant-derived Thapsia garganica kunzeaol synthase TgTPS2 was tested in this method. KM for TgTPS2...... was found to be 0.55 μM; the turnover number, kcat, was found to be 0.29 s-1, kcat for TgTPS2 is in agreement with that of terpene synthases of other plants, and kcat/KM was found to be 0.53 s-1 μM-1 for TgTPS2. The kinetic parameters were in agreement with previously published data....

  11. Endothelial nitric oxide synthase polymorphism G298T in ...

    Indian Academy of Sciences (India)

    Supplementary data: Endothelial nitric oxide synthase polymorphism G298T in association with oxidative DNA damage in coronary atherosclerosis. Rajesh G. Kumar, Mrudula K. Spurthi, Kishore G. Kumar, Sanjib K. Sahu and Surekha H. Rani. J. Genet. 91, 349–352. Table 1. The demographic and clinical data of the CHD ...

  12. ATP synthase--a marvellous rotary engine of the cell.

    Science.gov (United States)

    Yoshida, M; Muneyuki, E; Hisabori, T

    2001-09-01

    ATP synthase can be thought of as a complex of two motors--the ATP-driven F1 motor and the proton-driven Fo motor--that rotate in opposite directions. The mechanisms by which rotation and catalysis are coupled in the working enzyme are now being unravelled on a molecular scale.

  13. Contribution of granule bound starch synthase in kernel modification ...

    African Journals Online (AJOL)

    The role of gbssI and gbssII genes, encoding granule bound starch synthase enzyme I and II, respectively, in quality protein maize (QPM) were studied at different days after pollination (DAP). Total RNA was used for first strand cDNA synthesis using the ImpromIISriptTM reverse transcriptase. No detectable levels of gbssI ...

  14. Dihydropteroate synthase gene mutations in Pneumocystis and sulfa resistance

    DEFF Research Database (Denmark)

    Huang, Laurence; Crothers, Kristina; Atzori, Chiara

    2004-01-01

    in the dihydropteroate synthase (DHPS) gene. Similar mutations have been observed in P. jirovecii. Studies have consistently demonstrated a significant association between the use of sulfa drugs for PCP prophylaxis and DHPS gene mutations. Whether these mutations confer resistance to TMP-SMX or dapsone plus trimethoprim...

  15. Analysis of genetic variation of inducible nitric oxide synthase and ...

    African Journals Online (AJOL)

    The genetic diversity of 100 Malaysian native chickens was investigated using polymerase chain reaction-restriction fragment polymorphism (PCR-RFLP) for two candidate genes: inducible nitric oxide synthase (INOS) and natural resistance-associated macrophage protein 1 (NRAMP1). The two genes were selected ...

  16. Characterising the cellulose synthase complexes of cell walls

    NARCIS (Netherlands)

    Mansoori Zangir, N.

    2012-01-01

    One of the characteristics of the plant kingdom is the presence of a structural cell wall. Cellulose is a major component in both the primary and secondary cell walls of plants. In higher plants cellulose is synthesized by so called rosette protein complexes with cellulose synthases (CESAs) as

  17. RECRUITMENT FINANCED BY SAVED LEAVE (RSL PROGRAMME)

    CERN Multimedia

    Division du Personnel; Tel. 73903

    1999-01-01

    Transfer to the saved leave account and saved leave bonusStaff members participating in the RSL programme may opt to transfer up to 10 days of unused annual leave or unused compensatory leave into their saved leave account, at the end of the leave year, i.e. 30 September (as set out in the implementation procedure dated 27 August 1997).A leave transfer request form, which you should complete, sign and return, if you wish to use this possibility, has been addressed you. To allow the necessary time for the processing of your request, you should return it without delay.As foreseen in the implementation procedure, an additional day of saved leave will be granted for each full period of 20 days remaining in the saved leave account on 31 December 1999, for any staff member participating in the RSL programme until that date.For part-time staff members participating in the RSL programme, the above-mentioned days of leave (annual, compensatory and saved) are adjusted proportionally to their contractual working week as...

  18. Identifying the catalytic components of cellulose synthase and the maize mixed-linkage beta-glucan synthase

    Energy Technology Data Exchange (ETDEWEB)

    Nicholas C Carpita

    2009-04-20

    Five specific objectives of this project are to develop strategies to identify the genes that encode the catalytic components of "mixed-linkage" (1→3),(1→4)-beta-D-glucans in grasses, to determine the protein components of the synthase complex, and determine the biochemical mechanism of synthesis. We have used proteomic approaches to define intrinsic and extrinsic polypeptides of Golgi membranes that are associated with polysaccharide synthesis and trafficking. We were successful in producing recombinant catalytic domains of cellulose synthase genes and discovered that they dimerize upon concentration, indicating that two CesA proteins form the catalytic unit. We characterized a brittle stalk2 mutant as a defect in a COBRA-like protein that results in compromised lignin-cellulose interactions that decrease tissue flexibility. We used virus-induced gene silencing of barley cell wall polysaccharide synthesis by BSMV in an attempt to silence specific members of the cellulose synthase-like gene family. However, we unexpectedly found that regardless of the specificity of the target gene, whole gene interaction networks were silenced. We discovered the cause to be an antisense transcript of the cellulose synthase gene initiated small interfering RNAs that spread silencing to related genes.

  19. Emission and Accumulation of Monoterpene and the Key Terpene Synthase (TPS) Associated with Monoterpene Biosynthesis in Osmanthus fragrans Lour

    Science.gov (United States)

    Zeng, Xiangling; Liu, Cai; Zheng, Riru; Cai, Xuan; Luo, Jing; Zou, Jingjing; Wang, Caiyun

    2016-01-01

    Osmanthus fragrans is an ornamental and economically important plant known for its magnificent aroma, and the most important aroma-active compounds in flowers are monoterpenes, mainly β-ocimene, linalool and linalool derivatives. To understand the molecular mechanism of monoterpene production, we analyzed the emission and accumulation patterns of these compounds and the transcript levels of the genes involved in their biosynthesis in two O. fragrans cultivars during flowering stages. The results showed that both emission and accumulation of monoterpenes varied with flower development and glycosylation had an important impact on floral linalool emission during this process. Gene expression demonstrated that the transcript levels of terpene synthase (TPS) genes probably played a key role in monoterpene production, compared to the genes in the MEP pathway. Phylogenetic analysis showed that OfTPS1 and OfTPS2 belonged to a TPS-g subfamily, and OfTPS3 and OfTPS4 clustered into a TPS-b subfamily. Their transient and stable expression in tobacco leaves suggested that OfTPS1 and OfTPS2 exclusively produced β-linalool, and trans-β-ocimene was the sole product from OfTPS3, while OfTPS4, a predictive sesquiterpene synthase, produced α-farnesene. These results indicate that OfTPS1, OfTPS2, and OfTPS3 could account for the major floral monoterpenes, linalool and trans-β-ocimene, produced in O. fragrans flowers. PMID:26793212

  20. Emission and accumulation of monoterpene and the key terpene synthase (TPS associated with monoterpene biosynthesis in Osmanthus fragrans Lour.

    Directory of Open Access Journals (Sweden)

    Xaingling eZeng

    2016-01-01

    Full Text Available Osmanthus fragrans is an ornamental and economically important plant known for its magnificent aroma, and the most important aroma-active compounds in flowers are monoterpenes, mainly β-ocimene, linalool and linalool derivatives. To understand the molecular mechanism of monoterpene production, we analyzed the emission and accumulation patterns of these compounds and the transcript levels of the genes involved in their biosynthesis in two O. fragrans cultivars during flowering stages. The results showed that both emission and accumulation of monoterpenes varied with flower development and glycosylation had an important impact on floral linalool emission during this process. Gene expression demonstrated that the transcript levels of terpene synthase (TPS genes probably played a key role in monoterpene production, compared to the genes in the MEP pathway. Phylogenetic analysis showed that OfTPS1 and OfTPS2 belonged to a TPS-g subfamily, and OfTPS3 and OfTPS4 clustered into a TPS-b subfamily. Their transient and stable expression in tobacco leaves suggested that OfTPS1 and OfTPS2 exclusively produced β-linalool, and trans-β-ocimene was the sole product from OfTPS3, while OfTPS4, a predictive sesquiterpene synthase, produced α-farnesene. These results indicate that OfTPS1, OfTPS2 and OfTPS3 could account for the major floral monoterpenes, linalool and trans-β-ocimene, produced in O. fragrans flowers.

  1. ExpI and PhzI are descendants of the long lost cognate signal synthase for SdiA.

    Directory of Open Access Journals (Sweden)

    Anice Sabag-Daigle

    Full Text Available SdiA of E. coli and Salmonella is a LuxR homolog that detects N-acyl homoserine lactones (AHLs. Most LuxR homologs function together with a cognate AHL synthase (a LuxI homolog, but SdiA does not. Instead, SdiA detects AHLs produced by other bacterial species. In this report, we performed a phylogenetic analysis of SdiA. The results suggest that one branch of the Enterobacteriaceae obtained a rhlR/rhlI pair by horizontal transfer. The Erwinia and Pantoea branches still contain the complete pair where it is known as expR/expI and phzR/phzI, respectively. A deletion event removed the luxI homolog from the remainder of the group, leaving just the luxR homolog known as sdiA. Thus ExpR and PhzR are SdiA orthologs and ExpI and PhzI are descendants of the long lost cognate signal synthase of SdiA.

  2. The effect of inoculation with mycorrhizal arbuscular fungi on expression of limonene synthase in Mentha spicata L. genotypes

    Directory of Open Access Journals (Sweden)

    Leila Shabani

    2015-03-01

    Full Text Available Spearmint (Mentha spicata L. is an important economical and medicinal plant from Lamiaceae family, which has gained research attraction as a model for biosynthesis of essential oils due to its high capability for synthesis of monoterpenes. Limonene is a simple monoterpene and its biosynthesis is catalyzed by limonene synthase a key regulatory enzyme in the biosynthesis pathway of monoterpenes in spearmint plant. This study was concerned with the effect of colonization of roots with Funneliformis mosseae and F. etunicatum fungi on spearmint plant growth indices, leaf essential oils and changes in the expression of limonene synthase (LS gene. This study also explained the application of GADPH gene as the internal standard for real-time quantitative PCR (RTqPCR analysis of LS in spearmints. Our results showed that essential oil content of leaf in spearmint genotype Meybod inoculated with F. etunicatum was higher than that of genotypes from populations Kashan and Bojnourd and was 130% higher than the control. According to the results of this study, increase in transcript accumulation of the LS gene in leaves of spearmint plants inoculated with F. etunicatum was concordant with the increased essential oil contents and was dependent on the plant genotype.

  3. Paternity leave experiences of NHS doctors.

    Science.gov (United States)

    Gordon, Hannah; Szram, Joanna

    2013-10-01

    This study assesses NHS doctors' experiences of paternity leave and evaluates whether practices have changed since the introduction of additional paternity leave (APL) in April 2011. An anonymised online survey designed to discover experiences and uptake of APL and ordinary paternity leave (OPL) was distributed to all members of the London Deanery Synapse® network. In total, 364 fathers responded. Their seniority ranged from foundation trainees to consultants. Following the formal introduction of OPL in 2003, the number of fathers taking any paternity leave increased (from 50% to 95.6%). The majority of respondents (76.7%) felt well supported by their employer. Since the introduction of APL, 3% of respondents took additional leave. Reasons for the low uptake of APL included the impracticalities of the law, poor awareness and perceived attitudes and implications for training. Problems with OPL included the inadequate provision of cover and difficulties in timing the leave appropriately.

  4. Evolutionary and mechanistic insights from the reconstruction of α-humulene synthases from a modern (+)-germacrene A synthase.

    Science.gov (United States)

    Gonzalez, Veronica; Touchet, Sabrina; Grundy, Daniel J; Faraldos, Juan A; Allemann, Rudolf K

    2014-10-15

    Germacrene A synthase (GAS) from Solidago canadensis catalyzes the conversion of farnesyl diphosphate (FDP) to the plant sesquiterpene (+)-germacrene A. After diphosphate expulsion, farnesyl cation reacts with the distal 10,11-double bond to afford germacrene A (>96%) and <2% α-humulene, which arises from 1,11-cyclization of FDP. The origin of the 1,11-activity of GAS was investigated by amino acid sequence alignments of 1,10- and 1,11-synthases and comparisons of X-ray crystal structures with the homology model of GAS; a triad [Thr 401-Gly 402-Gly 403] that might be responsible for the predominant 1,10-cyclization activity of GAS was identified. Replacement of Gly 402 with residues of increasing size led to a progressive increase of 1,11-cyclization. The catalytic robustness of these 1,10- /1,11-GAS variants point to Gly 402 as a functional switch of evolutionary significance and suggests that enzymes with strict functionalities have evolved from less specific ancestors through a small number of substitutions. Similar results were obtained with germacrene D synthase (GDS) upon replacement of the homologous active-site residue Gly 404: GDS-G404V generated approximately 20% bicyclogermacrene, a hydrocarbon with a cyclopropane ring that underlines the dual 1,10-/1,11-cyclization activity of this mutant. This suggests that the reaction pathways to germacrenes and humulenes might be connected through a bridged 1,10,11-carbocation intermediate or transition state that resembles bicyclogermacrene. Mechanistic studies using [1-(3)H1]-10-fluorofarnesyl diphosphate and deuterium-labeling experiments with [12,13-(2)H6]-FDP support a germacrene-humulene rearrangement linking 1,10- and 1,11-pathways. These results support the bioinformatics proposal that modern 1,10-synthases could have evolved from promiscuous 1,11-sesquiterpene synthases.

  5. Paid Maternity Leave and Breastfeeding Outcomes.

    Science.gov (United States)

    Mirkovic, Kelsey R; Perrine, Cria G; Scanlon, Kelley S

    2016-09-01

    Despite the benefits of breastfeeding, rates in the United States are low. Shorter maternity leave is associated with lower initiation and shorter durations of breastfeeding; however, little is known about how paid maternity leave may influence breastfeeding rates. We used data from the 2006-2010 U.S. National Survey of Family Growth on the most recent birth to employed women who delivered a child within the previous 5 years. Separate multivariable logistic regression models were used to describe the associations between paid leave duration (0, 1-5, 6-11, ≥ 12 weeks, maternity leave not taken) and three outcomes: 1) breastfeeding initiation, 2) 6-month duration, and 3) 6-month duration among initiators. Twenty-eight percent of prenatally employed women received no paid leave. Women who received 12 or more weeks of paid leave were more likely to initiate breastfeeding compared to women with no paid leave (87.3% vs 66.7%, adjusted odds ratio [aOR] 2.83 [95% confidence interval {CI} 1.23-6.48]). Similarly, women with 12 or more weeks of paid leave were more likely to breastfeed at 6 months, compared to women with no paid leave (24.9% vs 50.1%, aOR 2.26 [95% CI 1.20-4.26]). Among women who initiated breastfeeding, having received 12 or more weeks' paid leave increased the odds of breastfeeding for 6 or more months; however, the association was not statistically significant in the adjusted model (aOR 1.81 [95% CI 0.93-3.52]). Employed women who received 12 or more weeks of paid maternity leave were more likely to initiate breastfeeding and be breastfeeding their child at 6 months than those without paid leave. Published 2016. This article is a U.S. Government work and is in the public domain in the USA.

  6. [New cerebroside from leaves of pineapple].

    Science.gov (United States)

    Wang, Jin-Ping; Wang, Hong-Ying; Du, Li-Jun; Ding, Yi; Xing, Dong-Ming; Wang, Wei

    2007-03-01

    To study the chemical constituents of the leaves of pineapple. Chromatographic methods were used to isolate compounds from the leaves of pineapple and spectral methods were used to identify the structures of the isolated compounds. Compound 1 was isolated from the leaves of pineapple. It was identified as 1-O-beta-D-glucopyranosyl-(2S, 3R, 4E, 11E)-2-[(2(R)-hydroxydocosanoyl) amido]-4, 11-hexadecanediene-1, 3-diol. Compound 1 was a new compound.

  7. Nurses' leaving intentions: antecedents and mediating factors.

    Science.gov (United States)

    Takase, Miyuki; Yamashita, Noriko; Oba, Keiko

    2008-05-01

    This paper is a report of a study to investigate how nurses' work values, perceptions of environmental characteristics, and organizational commitment are related to their leaving intentions. Nurse leaving is a serious international problem as it contributes to the nursing shortage that threatens the welfare of society. The characteristics of nurses, the work environment and nurses' feelings towards their jobs (or organizations) have an impact on their leaving intentions. A convenience sample of 849 Registered Nurses was recruited from three public hospitals in the central-west region of Japan during 2006 and 319 completed questionnaires were returned (response rate 39%). Data were analysed using regression analysis. Nurses' work values and their perceptions of their workplace environment interacted to influence leaving intentions. When there was a match between the importance nurses placed on being able to challenge current clinical practices and the number of the actual opportunities to do so, leaving intentions were low. When there was a mismatch, intention to quit the job became stronger. In addition, organizational commitment intervened between nurses' perceptions of the match in clinical challenges and leaving intention. Nurses' leaving intentions, deserve extensive exploration of their causes. Such exploration should include attending to both nurses' needs and organizational characteristics, investigating how the match between them could affect nurses' leaving intention, and exploring factors that intervene between nurses' perceptions of the match and leaving intention.

  8. Monoterpene engineering in a woody plant Eucalyptus camaldulensis using a limonene synthase cDNA.

    Science.gov (United States)

    Ohara, Kazuaki; Matsunaga, Etsuko; Nanto, Kazuya; Yamamoto, Kyoko; Sasaki, Kanako; Ebinuma, Hiroyasu; Yazaki, Kazufumi

    2010-01-01

    Metabolic engineering aimed at monoterpene production has become an intensive research topic in recent years, although most studies have been limited to herbal plants including model plants such as Arabidopsis. The genus Eucalyptus includes commercially important woody plants in terms of essential oil production and the pulp industry. This study attempted to modify the production of monoterpenes, which are major components of Eucalyptus essential oil, by introducing two expression constructs containing Perilla frutescens limonene synthase (PFLS) cDNA, whose gene products were designed to be localized in either the plastid or cytosol, into Eucalyptus camaldulensis. The expression of the plastid-type and cytosol-type PFLS cDNA in transgenic E. camaldulensis was confirmed by real-time polymerase chain reaction (PCR). Gas chromatography with a flame ionization detector analyses of leaf extracts revealed that the plastidic and cytosolic expression of PFLS yielded 2.6- and 4.5-times more limonene than that accumulated in wild-type E. camaldulensis, respectively, while the ectopic expression of PFLS had only a small effect on the emission of limonene from the leaves of E. camaldulensis. Surprisingly, the high level of PFLS in Eucalyptus was accompanied by a synergistic increase in the production of 1,8-cineole and alpha-pinene, two major components of Eucalyptus monoterpenes. This genetic engineering of monoterpenes demonstrated a new potential for molecular breeding in woody plants.

  9. Galactinol synthase transcriptional profile in two genotypes of Coffea canephora with contrasting tolerance to drought

    Directory of Open Access Journals (Sweden)

    Tiago Benedito Dos Santos

    2015-06-01

    Full Text Available Increased synthesis of galactinol and raffinose family oligosaccharides (RFOs has been reported in vegetative tissues in response to a range of abiotic stresses. In this work, we evaluated the transcriptional profile of a Coffea canephora galactinol synthase gene (CcGolS1 in two clones that differed in tolerance to water deficit in order to assess the contribution of this gene to drought tolerance. The expression of CcGolS1 in leaves was differentially regulated by water deficit, depending on the intensity of stress and the genotype. In clone 109A (drought-susceptible, the abundance of CcGolS1 transcripts decreased upon exposure to drought, reaching minimum values during recovery from severe water deficit and stress. In contrast, CcGolS1 gene expression in clone 14 (drought-tolerant was stimulated by water deficit. Changes in galactinol and RFO content did not correlate with variation in the steady-state transcript level. However, the magnitude of increase in RFO accumulation was higher in the tolerant cultivar, mainly under severe water deficit. The finding that the drought-tolerant coffee clone showed enhanced accumulation of CcGolS1 transcripts and RFOs under water deficit suggests the possibility of using this gene to improve drought tolerance in this important crop.

  10. Cloning and Characterization of Two Iridoid Synthase Homologs from Swertia Mussotii

    Directory of Open Access Journals (Sweden)

    Beibei Xiang

    2017-08-01

    Full Text Available Swertia mussotii is an important medicinal plant found on the Qinghai Tibetan Plateau that has great economic and medicinal value. This plant has enjoyed a long history of use as a curative for hepatitis. The biological activity of secoiridoids, including gentiopicroside and swertiamarin, has been mainly tested for its anti-hepatitis effects. Here, we identify two candidate genes (SmIS1 and SmIS2 that are homologues of iridoid synthase and that are components of the secoiridoid pathway in S. mussotii. Using sequencing and phylogenetic analyses, we confirm that SmIS1 and SmIS2 contain six conserved short-chain dehydrogenases/reductase (SDR motifs and thus belong to the P5βRs group. The two purified Escherichia coli-expressed proteins reduced 8-oxogeranial to both nepetalactol and iridodials. A comparison of the kinetic parameters of SmIS1 and SmIS2 recombinant proteins revealed that SmIS2 has a lower affinity than SmIS1 for 8-oxogeranial. Transcript levels of the two genes were analysed in three different tissues of S. mussotii using semi-quantitative RT-PCR and RT-qPCR. SmIS1 and SmIS2 expression levels were more abundant in leaves and stems. This investigation adds to our knowledge of P5βRs genes in the secoiridoid synthesis pathway and provides candidate genes for genetically improving S. mussotii by enhancing secondary metabolite production.

  11. Chalcone synthase genes from milk thistle (Silybum marianum ...

    Indian Academy of Sciences (India)

    In the current research, fragments of CHS genes were amplified ... transcript level in petals in the early flowering stage and in the stem of five upper leaves, followed by five upper leaves in the ..... First strand cDNA was amplified by 1 μg of.

  12. In vitro biochemical characterization of all barley endosperm starch synthases

    DEFF Research Database (Denmark)

    Cuesta-Seijo, Jose A.; Nielsen, Morten M.; Ruzanski, Christian

    2016-01-01

    Starch is the main storage polysaccharide in cereals and the major source of calories in the human diet. It is synthesized by a panel of enzymes including five classes of starch synthases (SSs). While the overall starch synthase (SS) reaction is known, the functional differences between the five SS....... Here we provide a detailed biochemical study of the activity of all five classes of SSs in barley endosperm. Each enzyme was produced recombinantly in E. coli and the properties and modes of action in vitro were studied in isolation from other SSs and other substrate modifying activities. Our results...... define the mode of action of each SS class in unprecedented detail; we analyze their substrate selection, temperature dependence and stability, substrate affinity and temporal abundance during barley development. Our results are at variance with some generally accepted ideas about starch biosynthesis...

  13. ATP Synthase, a Target for Dementia and Aging?

    Science.gov (United States)

    Larrick, James W; Larrick, Jasmine W; Mendelsohn, Andrew R

    2018-02-01

    Advancing age is the biggest risk factor for development for the major life-threatening diseases in industrialized nations accounting for >90% of deaths. Alzheimer's dementia (AD) is among the most devastating. Currently approved therapies fail to slow progression of the disease, providing only modest improvements in memory. Recently reported work describes mechanistic studies of J147, a promising therapeutic molecule previously shown to rescue the severe cognitive deficits exhibited by aged, transgenic AD mice. Apparently, J147 targets the mitochondrial alpha-F1-ATP synthase (ATP5A). Modest inhibition of the ATP synthase modulates intracellular calcium to activate AMP-activated protein kinase to inhibit mammalian target of rapamycin, a known mechanism of lifespan extension from worms to mammals.

  14. Nitric oxide synthase isoforms in spontaneous and salt hypertension

    Czech Academy of Sciences Publication Activity Database

    Hojná, Silvie; Kuneš, Jaroslav; Zicha, Josef

    2007-01-01

    Roč. 25, Suppl. 2 (2007), S 338-S 338 ISSN 0263-6352. [European Meeting on Hypertension /17./. 15.06.2007-19.06.2007, Milan] R&D Projects: GA MŠk(CZ) 1M0510 Institutional research plan: CEZ:AV0Z50110509 Keywords : nitric oxide synthase isoforms * spontaneous and salt hypertension Subject RIV: FA - Cardiovascular Diseases incl. Cardiotharic Surgery

  15. Use of linalool synthase in genetic engineering of scent production

    Science.gov (United States)

    Pichersky, Eran

    1998-01-01

    A purified S-linalool synthase polypeptide from Clarkia breweri is disclosed as is the recombinant polypeptide and nucleic acid sequences encoding the polypeptide. Also disclosed are antibodies immunoreactive with the purified peptide and with recombinant versions of the polypeptide. Methods of using the nucleic acid sequences, as well as methods of enhancing the smell and the flavor of plants expressing the nucleic acid sequences are also disclosed.

  16. Trypanosoma brucei solanesyl-diphosphate synthase localizes to the mitochondrion

    Czech Academy of Sciences Publication Activity Database

    Lai, D.-H.; Bontempi, E. J.; Lukeš, Julius

    2012-01-01

    Roč. 183, č. 2 (2012), s. 189-192 ISSN 0166-6851 R&D Projects: GA ČR(CZ) GAP305/11/2179 Institutional support: RVO:60077344 Keywords : Trypanosoma brucei * Sleeping sickness * Ubiquinone * Solanesyl-diphosphate synthase * Digitonin permeabilization * In situ tagging Subject RIV: EB - Genetics ; Molecular Biology Impact factor: 2.734, year: 2012 http://www.sciencedirect.com/science/article/pii/S0166685112000539

  17. INTRODUCTION OF A NEW LEAVE MANAGEMENT SYSTEM

    CERN Multimedia

    DIVISION HR

    2000-01-01

    The introduction of new leave rules (arising from the RSL, PRP and other programs) has made the present leave management system rather complicated and difficult to manage. It has therefore been decided to replace it with a more flexible and adaptable system, which will come into force on 1st October 2000. Henceforth, days of leave will be credited monthly instead of annually. Members of the personnel will have round-the-clock direct access to more detailed, confidential information regarding their various kinds of leave. They will also receive a personal monthly statement with their pay slips. The new system does not require any amendment of the regulations, except with respect to the frequency of leave calculations (monthly instead of annual). I. Main characteristics of the new leave system1. The main feature of the new system is the creation of accounts to which leave will be credited or debited as appropriate. Depending on their circumstances, members of the personnel may have up to four individual leave a...

  18. INTRODUCTION OF A NEW LEAVE MANAGEMENT SYSTEM

    CERN Document Server

    HR Division

    2000-01-01

    The introduction of new leave rules (arising from the RSL, PRP and other programmes) has made the present leave management system rather complicated and difficult to manage. It has therefore been decided to replace it with a more flexible and adaptable system, which will come into force on 1st October 2000. Henceforth, days of leave will be credited monthly instead of annually. Members of the personnel will have round-the-clock direct access to more detailed, confidential information regarding their various kinds of leave.They will also receive a personal monthly statement with their pay slips. The new system does not require any amendment of the regulations, except with respect to the frequency of leave calculations (monthly instead of annual). I. Main characteristics of the new leave system 1. The main feature of the new system is the creation of accounts to which leave will be credited or debited as appropriate. Depending on their circumstances, members of the personnel may have up to four individual leave...

  19. Antioxidant activity of Arbutus unedo leaves.

    Science.gov (United States)

    Pabuçcuoğlu, A; Kivçak, B; Baş, M; Mert, T

    2003-09-01

    The ethanol and methanol extracts of Arbutus unedo leaves were screened for antioxidant activity. The antioxidant activity was determined by an improved assay based on the decolorization of the radical monocation of [2,2'-azinobis-(3-ethylbenzothiazoline-6-sulfonic acid)] (ABTS). The ethanol and methanol extract of A. unedo leaves displayed potent antioxidant activity.

  20. Grass leaves as potential hominin dietary resources.

    Science.gov (United States)

    Paine, Oliver C C; Koppa, Abigale; Henry, Amanda G; Leichliter, Jennifer N; Codron, Daryl; Codron, Jacqueline; Lambert, Joanna E; Sponheimer, Matt

    2018-04-01

    Discussions about early hominin diets have generally excluded grass leaves as a staple food resource, despite their ubiquity in most early hominin habitats. In particular, stable carbon isotope studies have shown a prevalent C 4 component in the diets of most taxa, and grass leaves are the single most abundant C 4 resource in African savannas. Grass leaves are typically portrayed as having little nutritional value (e.g., low in protein and high in fiber) for hominins lacking specialized digestive systems. It has also been argued that they present mechanical challenges (i.e., high toughness) for hominins with bunodont dentition. Here, we compare the nutritional and mechanical properties of grass leaves with the plants growing alongside them in African savanna habitats. We also compare grass leaves to the leaves consumed by other hominoids and demonstrate that many, though by no means all, compare favorably with the nutritional and mechanical properties of known primate foods. Our data reveal that grass leaves exhibit tremendous variation and suggest that future reconstructions of hominin dietary ecology take a more nuanced approach when considering grass leaves as a potential hominin dietary resource. Copyright © 2017. Published by Elsevier Ltd.

  1. When and Why Dropouts Leave High School

    Science.gov (United States)

    Stearns, Elizabeth; Glennie, Elizabeth J.

    2006-01-01

    Teens may leave school because of academic failure, disciplinary problems, or employment opportunities. In this article, the authors test whether the reasons dropouts leave school differ by grade level and age. We compare dropout rates and reasons across grade levels and ages for all high school students, ethnic groups, and gender groups. Across…

  2. Multi-substrate terpene synthases: their occurrence and physiological significance

    Directory of Open Access Journals (Sweden)

    Leila Pazouki

    2016-07-01

    Full Text Available Terpene synthases are responsible for synthesis of a large number of terpenes in plants using substrates provided by two distinct metabolic pathways, the mevalonate-dependent pathway that is located in cytosol and has been suggested to be responsible for synthesis of sesquiterpenes (C15, and 2-C-methyl-D-erythritol-4-phosphate pathway located in plastids and suggested to be responsible for the synthesis of hemi- (C5, mono- (C10 and diterpenes (C20. Recent advances in characterization of genes and enzymes responsible for substrate and end product biosynthesis as well as efforts in metabolic engineering have demonstrated existence of a number of multi-substrate terpene synthases. This review summarizes the progress in the characterization of such multi-substrate terpene synthases and suggests that the presence of multi-substrate use might have been significantly underestimated. Multi-substrate use could lead to important changes in terpene product profiles upon substrate profile changes under perturbation of metabolism in stressed plants as well as under certain developmental stages. We therefore argue that multi-substrate use can be significant under physiological conditions and can result in complicate modifications in terpene profiles.

  3. From bacterial to human dihydrouridine synthase: automated structure determination

    Energy Technology Data Exchange (ETDEWEB)

    Whelan, Fiona, E-mail: fiona.whelan@york.ac.uk; Jenkins, Huw T., E-mail: fiona.whelan@york.ac.uk [The University of York, Heslington, York YO10 5DD (United Kingdom); Griffiths, Samuel C. [University of Oxford, Headington, Oxford OX3 7BN (United Kingdom); Byrne, Robert T. [Ludwig-Maximilians-University Munich, Feodor-Lynen-Strasse 25, 81377 Munich (Germany); Dodson, Eleanor J.; Antson, Alfred A., E-mail: fiona.whelan@york.ac.uk [The University of York, Heslington, York YO10 5DD (United Kingdom)

    2015-06-30

    The crystal structure of a human dihydrouridine synthase, an enzyme associated with lung cancer, with 18% sequence identity to a T. maritima enzyme, has been determined at 1.9 Å resolution by molecular replacement after extensive molecular remodelling of the template. The reduction of uridine to dihydrouridine at specific positions in tRNA is catalysed by dihydrouridine synthase (Dus) enzymes. Increased expression of human dihydrouridine synthase 2 (hDus2) has been linked to pulmonary carcinogenesis, while its knockdown decreased cancer cell line viability, suggesting that it may serve as a valuable target for therapeutic intervention. Here, the X-ray crystal structure of a construct of hDus2 encompassing the catalytic and tRNA-recognition domains (residues 1–340) determined at 1.9 Å resolution is presented. It is shown that the structure can be determined automatically by phenix.mr-rosetta starting from a bacterial Dus enzyme with only 18% sequence identity and a significantly divergent structure. The overall fold of the human Dus2 is similar to that of bacterial enzymes, but has a larger recognition domain and a unique three-stranded antiparallel β-sheet insertion into the catalytic domain that packs next to the recognition domain, contributing to domain–domain interactions. The structure may inform the development of novel therapeutic approaches in the fight against lung cancer.

  4. From bacterial to human dihydrouridine synthase: automated structure determination

    International Nuclear Information System (INIS)

    Whelan, Fiona; Jenkins, Huw T.; Griffiths, Samuel C.; Byrne, Robert T.; Dodson, Eleanor J.; Antson, Alfred A.

    2015-01-01

    The crystal structure of a human dihydrouridine synthase, an enzyme associated with lung cancer, with 18% sequence identity to a T. maritima enzyme, has been determined at 1.9 Å resolution by molecular replacement after extensive molecular remodelling of the template. The reduction of uridine to dihydrouridine at specific positions in tRNA is catalysed by dihydrouridine synthase (Dus) enzymes. Increased expression of human dihydrouridine synthase 2 (hDus2) has been linked to pulmonary carcinogenesis, while its knockdown decreased cancer cell line viability, suggesting that it may serve as a valuable target for therapeutic intervention. Here, the X-ray crystal structure of a construct of hDus2 encompassing the catalytic and tRNA-recognition domains (residues 1–340) determined at 1.9 Å resolution is presented. It is shown that the structure can be determined automatically by phenix.mr-rosetta starting from a bacterial Dus enzyme with only 18% sequence identity and a significantly divergent structure. The overall fold of the human Dus2 is similar to that of bacterial enzymes, but has a larger recognition domain and a unique three-stranded antiparallel β-sheet insertion into the catalytic domain that packs next to the recognition domain, contributing to domain–domain interactions. The structure may inform the development of novel therapeutic approaches in the fight against lung cancer

  5. Dynamics of meso and thermo citrate synthases with implicit solvation

    Science.gov (United States)

    Cordeiro, J. M. M.

    The dynamics of hydration of meso and thermo citrate synthases has been investigated using the EEF1 methodology implemented with the CHARMM program. The native enzymes are composed of two identical subunits, each divided into a small and large domain. The dynamics behavior of both enzymes at 30°C and 60°C has been compared. The results of simulations show that during the hydration process, each subunit follows a different pathway of hydration, in spite of the identical sequence. The hydrated structures were compared with the crystalline structure, and the root mean square deviation (RMSD) of each residue along the trajectory was calculated. The regions with larger and smaller mobility were identified. In particular, helices belonging to the small domain are more mobile than those of the large domain. In contrast, the residues that constitute the active site show a much lower displacement compared with the crystalline structure. Hydration free energy calculations point out that Thermoplasma acidophilum citrate synthase (TCS) is more stable than chicken citrate synthase (CCS), at high temperatures. Such result has been ascribed to the higher number of superficial charges in the thermophilic homologue, which stabilizes the enzyme, while the mesophilic homologue denatures. These results are in accord with the experimental found that TCS keeps activity at temperatures farther apart from the catalysis regular temperature than the CCS.

  6. Mechanism of Action and Inhibition of dehydrosqualene Synthase

    Energy Technology Data Exchange (ETDEWEB)

    F Lin; C Liu; Y Liu; Y Zhang; K Wang; W Jeng; T Ko; R Cao; A Wang; E Oldfield

    2011-12-31

    'Head-to-head' terpene synthases catalyze the first committed steps in sterol and carotenoid biosynthesis: the condensation of two isoprenoid diphosphates to form cyclopropylcarbinyl diphosphates, followed by ring opening. Here, we report the structures of Staphylococcus aureus dehydrosqualene synthase (CrtM) complexed with its reaction intermediate, presqualene diphosphate (PSPP), the dehydrosqualene (DHS) product, as well as a series of inhibitors. The results indicate that, on initial diphosphate loss, the primary carbocation so formed bends down into the interior of the protein to react with C2,3 double bond in the prenyl acceptor to form PSPP, with the lower two-thirds of both PSPP chains occupying essentially the same positions as found in the two farnesyl chains in the substrates. The second-half reaction is then initiated by the PSPP diphosphate returning back to the Mg{sup 2+} cluster for ionization, with the resultant DHS so formed being trapped in a surface pocket. This mechanism is supported by the observation that cationic inhibitors (of interest as antiinfectives) bind with their positive charge located in the same region as the cyclopropyl carbinyl group; that S-thiolo-diphosphates only inhibit when in the allylic site; activity results on 11 mutants show that both DXXXD conserved domains are essential for PSPP ionization; and the observation that head-to-tail isoprenoid synthases as well as terpene cyclases have ionization and alkene-donor sites which spatially overlap those found in CrtM.

  7. Phytochelatin synthase activity as a marker of metal pollution

    Energy Technology Data Exchange (ETDEWEB)

    Zitka, Ondrej; Krystofova, Olga; Sobrova, Pavlina [Department of Chemistry and Biochemistry, Faculty of Agronomy, Mendel University in Brno, Zemedelska 1, CZ-613 00 Brno (Czech Republic); Adam, Vojtech [Department of Chemistry and Biochemistry, Faculty of Agronomy, Mendel University in Brno, Zemedelska 1, CZ-613 00 Brno (Czech Republic); Central European Institute of Technology, Brno University of Technology, Technicka 3058/10, CZ-616 00 Brno (Czech Republic); Zehnalek, Josef; Beklova, Miroslava [Department of Chemistry and Biochemistry, Faculty of Agronomy, Mendel University in Brno, Zemedelska 1, CZ-613 00 Brno (Czech Republic); Kizek, Rene, E-mail: kizek@sci.muni.cz [Department of Chemistry and Biochemistry, Faculty of Agronomy, Mendel University in Brno, Zemedelska 1, CZ-613 00 Brno (Czech Republic); Central European Institute of Technology, Brno University of Technology, Technicka 3058/10, CZ-616 00 Brno (Czech Republic)

    2011-08-30

    Highlights: {yields} New tool for determination of phytochelatin synthase activity. {yields} The optimization of experimental condition for determination of the enzyme activity. {yields} First evaluation of K{sub m} for the enzyme. {yields} The effects of cadmium (II) not only on the activity of the enzyme but also on K{sub m}. -- Abstract: The synthesis of phytochelatins is catalyzed by {gamma}-Glu-Cys dipeptidyl transpeptidase called phytochelatin synthase (PCS). Aim of this study was to suggest a new tool for determination of phytochelatin synthase activity in the tobacco BY-2 cells treated with different concentrations of the Cd(II). After the optimization steps, an experiment on BY-2 cells exposed to different concentrations of Cd(NO{sub 3}){sub 2} for 3 days was performed. At the end of the experiment, cells were harvested and homogenized. Reduced glutathione and cadmium (II) ions were added to the cell suspension supernatant. These mixtures were incubated at 35 {sup o}C for 30 min and analysed using high performance liquid chromatography coupled with electrochemical detector (HPLC-ED). The results revealed that PCS activity rises markedly with increasing concentration of cadmium (II) ions. The lowest concentration of the toxic metal ions caused almost three fold increase in PCS activity as compared to control samples. The activity of PCS (270 fkat) in treated cells was more than seven times higher in comparison to control ones. K{sub m} for PCS was estimated as 2.3 mM.

  8. Phytochelatin synthase activity as a marker of metal pollution

    International Nuclear Information System (INIS)

    Zitka, Ondrej; Krystofova, Olga; Sobrova, Pavlina; Adam, Vojtech; Zehnalek, Josef; Beklova, Miroslava; Kizek, Rene

    2011-01-01

    Highlights: → New tool for determination of phytochelatin synthase activity. → The optimization of experimental condition for determination of the enzyme activity. → First evaluation of K m for the enzyme. → The effects of cadmium (II) not only on the activity of the enzyme but also on K m . -- Abstract: The synthesis of phytochelatins is catalyzed by γ-Glu-Cys dipeptidyl transpeptidase called phytochelatin synthase (PCS). Aim of this study was to suggest a new tool for determination of phytochelatin synthase activity in the tobacco BY-2 cells treated with different concentrations of the Cd(II). After the optimization steps, an experiment on BY-2 cells exposed to different concentrations of Cd(NO 3 ) 2 for 3 days was performed. At the end of the experiment, cells were harvested and homogenized. Reduced glutathione and cadmium (II) ions were added to the cell suspension supernatant. These mixtures were incubated at 35 o C for 30 min and analysed using high performance liquid chromatography coupled with electrochemical detector (HPLC-ED). The results revealed that PCS activity rises markedly with increasing concentration of cadmium (II) ions. The lowest concentration of the toxic metal ions caused almost three fold increase in PCS activity as compared to control samples. The activity of PCS (270 fkat) in treated cells was more than seven times higher in comparison to control ones. K m for PCS was estimated as 2.3 mM.

  9. Longevity in vivo of primary cell wall cellulose synthases.

    Science.gov (United States)

    Hill, Joseph Lee; Josephs, Cooper; Barnes, William J; Anderson, Charles T; Tien, Ming

    2018-02-01

    Our work focuses on understanding the lifetime and thus stability of the three main cellulose synthase (CESA) proteins involved in primary cell wall synthesis of Arabidopsis. It had long been thought that a major means of CESA regulation was via their rapid degradation. However, our studies here have uncovered that AtCESA proteins are not rapidly degraded. Rather, they persist for an extended time in the plant cell. Plant cellulose is synthesized by membrane-embedded cellulose synthase complexes (CSCs). The CSC is composed of cellulose synthases (CESAs), of which three distinct isozymes form the primary cell wall CSC and another set of three isozymes form the secondary cell wall CSC. We determined the stability over time of primary cell wall (PCW) CESAs in Arabidopsis thaliana seedlings, using immunoblotting after inhibiting protein synthesis with cycloheximide treatment. Our work reveals very slow turnover for the Arabidopsis PCW CESAs in vivo. Additionally, we show that the stability of all three CESAs within the PCW CSC is altered by mutations in individual CESAs, elevated temperature, and light conditions. Together, these results suggest that CESA proteins are very stable in vivo, but that their lifetimes can be modulated by intrinsic and environmental cues.

  10. The primary defect in glycogen synthase activity is not based on increased glycogen synthase kinase-3a activity in diabetic myotubes

    DEFF Research Database (Denmark)

    Gaster, Michael; Brusgaard, Klaus; Handberg, Aa.

    2004-01-01

    The mechanism responsible for the diminished activation of glycogen synthase (GS) in diabetic myotubes remains unclear, but may involve increased activity and/or expression of glycogen synthase kinase-3 (GSK-3). In myotubes established from type 2 diabetic and healthy control subjects we determined...

  11. [Beneficial effect of maternity leave on delivery].

    Science.gov (United States)

    Xu, Qian; Séguin, Louise; Goulet, Lise

    2002-01-01

    To identify the contribution of the duration of the prenatal maternity leave on term delivery. Characteristics of the prenatal maternity leave and delivery among 363 working women who had delivered a full-term infant at 1 of 4 hospitals in Montreal during 1996 were studied. The presence of an intervention or complication during delivery was observed in 68.9% of the participants. The average duration of the prenatal maternity leave was about 8 weeks (SD = 7). The adjusted risk of a difficult delivery decreased significantly with the duration of the prenatal maternity leave (OR = 0.96; 95% CI: 0.93-0.99). The duration of the maternity leave before delivery is associated with an easier term delivery for working women.

  12. Suites of Terpene Synthases Explain Differential Terpenoid Production in Ginger and Turmeric Tissues

    Science.gov (United States)

    Koo, Hyun Jo; Gang, David R.

    2012-01-01

    The essential oils of ginger (Zingiber officinale) and turmeric (Curcuma longa) contain a large variety of terpenoids, some of which possess anticancer, antiulcer, and antioxidant properties. Despite their importance, only four terpene synthases have been identified from the Zingiberaceae family: (+)-germacrene D synthase and (S)-β-bisabolene synthase from ginger rhizome, and α-humulene synthase and β-eudesmol synthase from shampoo ginger (Zingiber zerumbet) rhizome. We report the identification of 25 mono- and 18 sesquiterpene synthases from ginger and turmeric, with 13 and 11, respectively, being functionally characterized. Novel terpene synthases, (−)-caryolan-1-ol synthase and α-zingiberene/β-sesquiphellandrene synthase, which is responsible for formation of the major sesquiterpenoids in ginger and turmeric rhizomes, were also discovered. These suites of enzymes are responsible for formation of the majority of the terpenoids present in these two plants. Structures of several were modeled, and a comparison of sets of paralogs suggests how the terpene synthases in ginger and turmeric evolved. The most abundant and most important sesquiterpenoids in turmeric rhizomes, (+)-α-turmerone and (+)-β-turmerone, are produced from (−)-α-zingiberene and (−)-β-sesquiphellandrene, respectively, via α-zingiberene/β-sesquiphellandrene oxidase and a still unidentified dehydrogenase. PMID:23272109

  13. [BIOINFORMATIC SEARCH AND PHYLOGENETIC ANALYSIS OF THE CELLULOSE SYNTHASE GENES OF FLAX (LINUM USITATISSIMUM)].

    Science.gov (United States)

    Pydiura, N A; Bayer, G Ya; Galinousky, D V; Yemets, A I; Pirko, Ya V; Podvitski, T A; Anisimova, N V; Khotyleva, L V; Kilchevsky, A V; Blume, Ya B

    2015-01-01

    A bioinformatic search of sequences encoding cellulose synthase genes in the flax genome, and their comparison to dicots orthologs was carried out. The analysis revealed 32 cellulose synthase gene candidates, 16 of which are highly likely to encode cellulose synthases, and the remaining 16--cellulose synthase-like proteins (Csl). Phylogenetic analysis of gene products of cellulose synthase genes allowed distinguishing 6 groups of cellulose synthase genes of different classes: CesA1/10, CesA3, CesA4, CesA5/6/2/9, CesA7 and CesA8. Paralogous sequences within classes CesA1/10 and CesA5/6/2/9 which are associated with the primary cell wall formation are characterized by a greater similarity within these classes than orthologous sequences. Whereas the genes controlling the biosynthesis of secondary cell wall cellulose form distinct clades: CesA4, CesA7, and CesA8. The analysis of 16 identified flax cellulose synthase gene candidates shows the presence of at least 12 different cellulose synthase gene variants in flax genome which are represented in all six clades of cellulose synthase genes. Thus, at this point genes of all ten known cellulose synthase classes are identify in flax genome, but their correct classification requires additional research.

  14. Suites of terpene synthases explain differential terpenoid production in ginger and turmeric tissues.

    Directory of Open Access Journals (Sweden)

    Hyun Jo Koo

    Full Text Available The essential oils of ginger (Zingiber officinale and turmeric (Curcuma longa contain a large variety of terpenoids, some of which possess anticancer, antiulcer, and antioxidant properties. Despite their importance, only four terpene synthases have been identified from the Zingiberaceae family: (+-germacrene D synthase and (S-β-bisabolene synthase from ginger rhizome, and α-humulene synthase and β-eudesmol synthase from shampoo ginger (Zingiber zerumbet rhizome. We report the identification of 25 mono- and 18 sesquiterpene synthases from ginger and turmeric, with 13 and 11, respectively, being functionally characterized. Novel terpene synthases, (--caryolan-1-ol synthase and α-zingiberene/β-sesquiphellandrene synthase, which is responsible for formation of the major sesquiterpenoids in ginger and turmeric rhizomes, were also discovered. These suites of enzymes are responsible for formation of the majority of the terpenoids present in these two plants. Structures of several were modeled, and a comparison of sets of paralogs suggests how the terpene synthases in ginger and turmeric evolved. The most abundant and most important sesquiterpenoids in turmeric rhizomes, (+-α-turmerone and (+-β-turmerone, are produced from (--α-zingiberene and (--β-sesquiphellandrene, respectively, via α-zingiberene/β-sesquiphellandrene oxidase and a still unidentified dehydrogenase.

  15. Structure of the human beta-ketoacyl [ACP] synthase from the mitochondrial type II fatty acid synthase

    DEFF Research Database (Denmark)

    Christensen, Caspar Elo; Kragelund, Birthe B; von Wettstein-Knowles, Penny

    2007-01-01

    Two distinct ways of organizing fatty acid biosynthesis exist: the multifunctional type I fatty acid synthase (FAS) of mammals, fungi, and lower eukaryotes with activities residing on one or two polypeptides; and the dissociated type II FAS of prokaryotes, plastids, and mitochondria with individual...... activities encoded by discrete genes. The beta-ketoacyl [ACP] synthase (KAS) moiety of the mitochondrial FAS (mtKAS) is targeted by the antibiotic cerulenin and possibly by the other antibiotics inhibiting prokaryotic KASes: thiolactomycin, platensimycin, and the alpha-methylene butyrolactone, C75. The high...... degree of structural similarity between mitochondrial and prokaryotic KASes complicates development of novel antibiotics targeting prokaryotic KAS without affecting KAS domains of cytoplasmic FAS. KASes catalyze the C(2) fatty acid elongation reaction using either a Cys-His-His or Cys-His-Asn catalytic...

  16. Tryptanthrin content in Isatis tinctoria leaves--a comparative study of selected strains and post-harvest treatments.

    Science.gov (United States)

    Oberthür, Christine; Hamburger, Matthias

    2004-07-01

    Tryptanthrin is a pharmacologically active compound in the anti-inflammatory herb Isatis tinctoria, with potent inhibitory activity on prostaglandin and leukotriene synthesis and on inducible NO synthase. The tryptanthrin content of five defined woad strains was analyzed in dependence of the time of harvest and post-harvest treatment. Tryptanthrin was determined by a validated ESI-LC-MS isotope dilution assay with d(8)-tryptanthrin as internal standard. The tryptanthrin concentration in freeze-dried leaf samples was low. Drying at ambient temperature led to a significant increase of tryptanthrin concentration, but the highest concentrations were found when leaves were dried at 40 degrees C. Tryptanthrin content in fermented woad leaves was below the limit of quantification. Tryptanthrin appears thus to be a product of post-harvest processes, but details of its formation remain to be elucidated.

  17. Cloning and characterization of indole synthase (INS) and a putative tryptophan synthase α-subunit (TSA) genes from Polygonum tinctorium.

    Science.gov (United States)

    Jin, Zhehao; Kim, Jin-Hee; Park, Sang Un; Kim, Soo-Un

    2016-12-01

    Two cDNAs for indole-3-glycerol phosphate lyase homolog were cloned from Polygonum tinctorium. One encoded cytosolic indole synthase possibly in indigoid synthesis, whereas the other encoded a putative tryptophan synthase α-subunit. Indigo is an old natural blue dye produced by plants such as Polygonum tinctorium. Key step in plant indigoid biosynthesis is production of indole by indole-3-glycerol phosphate lyase (IGL). Two tryptophan synthase α-subunit (TSA) homologs, PtIGL-short and -long, were isolated by RACE PCR from P. tinctorium. The genome of the plant contained two genes coding for IGL. The short and the long forms, respectively, encoded 273 and 316 amino acid residue-long proteins. The short form complemented E. coli ΔtnaA ΔtrpA mutant on tryptophan-depleted agar plate signifying production of free indole, and thus was named indole synthase gene (PtINS). The long form, either intact or without the transit peptide sequence, did not complement the mutant and was tentatively named PtTSA. PtTSA was delivered into chloroplast as predicted by 42-residue-long targeting sequence, whereas PtINS was localized in cytosol. Genomic structure analysis suggested that a TSA duplicate acquired splicing sites during the course of evolution toward PtINS so that the targeting sequence-containing pre-mRNA segment was deleted as an intron. PtINS had about two to fivefolds higher transcript level than that of PtTSA, and treatment of 2,1,3-benzothiadiazole caused the relative transcript level of PtINS over PtTSA was significantly enhanced in the plant. The results indicate participation of PtINS in indigoid production.

  18. Exogenous Melatonin Application Delays Senescence of Kiwifruit Leaves by Regulating the Antioxidant Capacity and Biosynthesis of Flavonoids

    Directory of Open Access Journals (Sweden)

    Dong Liang

    2018-04-01

    Full Text Available Melatonin, a multiple signal molecule, plays important roles in delaying senescence during the development of plants. Because few species have been studied for the effect of exogenous melatonin on anti-aging, the plausible mechanism of melatonin of anti-aging effects on other plant species has remained largely unknown. In the present study, the effects of exogenous melatonin on leaf senescence in kiwifruit were examined during natural aging after melatonin (200 μM or water (Control pretreatment. The decreased membrane damage and lower hydrogen peroxide (H2O2 content due to the enhanced scavenging activity of antioxidant enzymes peroxidase (POD, superoxide dismutase (SOD, and catalase (CAT demonstrated that melatonin effectively delayed the aging of kiwifruit leaves. Likewise, owing to up-regulated expression of chlorophyll a/b-binding protein (CAB gene in the sampled leaves pretreated with melatonin, chlorophyll degradation decreased. Therefore, osmoregulatory substances in sampled leaves accumulated (e.g., soluble sugar and soluble protein and seedling cell environment stability was maintained. Simultaneously, melatonin decreased H2O2 concentration owing to increased glutathione (GSH and ascorbate (AsA content, and the expression levels of glutathione reductase (GR, ascorbate peroxidase (APX, monodehydroascorbate reductase (MDAR, dehydroascorbate reductase (DHAR were up-regulated by melatonin application, indicating that the increase of GSH and AsA was attributed to the expression of these genes. In addition, a large amount of flavonoids accumulated in seedlings pretreated with melatonin, and transcript levels of eight genes involved in flavonoid synthesis, including phenylalanine ammonia-lyase (PAL, cinnamate-4-hydroxymate (C4H, chalcone synthase (CHS, flavanone 3-hydroxylase (F3H, flavonol synthase (FNS, leucoanthocyanin reductase (LAR, anthocyanin reductase (ANR, flavonoid 3-O-glucosyltransferase (UFGT were enhanced in response to melatonin

  19. [Modeling polarimetric BRDF of leaves surfaces].

    Science.gov (United States)

    Xie, Dong-Hui; Wang, Pei-Juan; Zhu, Qi-Jiang; Zhou, Hong-Min

    2010-12-01

    The purpose of the present paper is to model a physical polarimetric bidirectional reflectance distribution function (pBRDF), which can character not only the non-Lambertian but also the polarized features in order that the pBRDF can be applied to analyze the relationship between the degree of polarization and the physiological and biochemical parameters of leaves quantitatively later. Firstly, the bidirectional polarized reflectance distributions from several leaves surfaces were measured by the polarized goniometer developed by Changchun Institute of Optics, Fine Mechanics and Physics, Chinese Academy of Sciences. The samples of leaves include two pieces of zea mays L. leaves (young leaf and mature leaf) and a piece of E. palcherrima wild leaf. Non-Lambertian characteristics of directional reflectance from the surfaces of these three leaves are obvious. A Cook-Torrance model was modified by coupling the polarized Fresnel equations to simulate the bidirectional polarized reflectance properties of leaves surfaces. The three parameters in the modified pBRDF model, such as diffuse reflectivity, refractive index and roughness of leaf surface were inversed with genetic algorithm (GA). It was found that the pBRDF model can fit with the measured data well. In addition, these parameters in the model are related with both the physiological and biochemical properties and the polarized characteristics of leaves, therefore it is possible to build the relationships between them later.

  20. Coordinated responses of phytochelatin synthase and metallothionein genes in black mangrove, Avicennia germinans, exposed to cadmium and copper

    Energy Technology Data Exchange (ETDEWEB)

    Gonzalez-Mendoza, Daniel [Departamento de Recursos del Mar, Cinvestav-Unidad Merida, Merida, Yucatan (Mexico); Moreno, Adriana Quiroz [Unidad de biotecnologia, CICY, Merida, Yucatan (Mexico); Zapata-Perez, Omar [Departamento de Recursos del Mar, Cinvestav-Unidad Merida, Merida, Yucatan (Mexico)]. E-mail: ozapata@mda.cinvestav.mx

    2007-08-01

    To evaluate the role of phytochelatins and metallothioneins in heavy metal tolerance of black mangrove Avicennia germinans, 3-month-old seedlings were exposed to cadmium or copper for 30 h, under hydroponic conditions. Degenerate Mt2 and PCS primers were synthesized based on amino acid and nucleotide alignment sequences reported for Mt2 and PCS in other plant species found in GenBank. Total RNA was isolated from A. germinans leaves and two partial fragments of metallothionein and phytochelatin synthase genes were isolated. Gene expression was evaluated with reverse transcripatase-polymerase chain reaction (RT-PCR) amplification technique. Temporal analysis showed that low Cd{sup 2+} and Cu{sup 2+} concentrations caused a slight (but not significant) increase in AvMt2 expression after a 16 h exposure time, while AvPCS expression showed a significant increase under the same conditions but only after 4 h. Results strongly suggest that the rapid increase in AvPCS expression may contribute to Cd{sup 2+} and Cu{sup 2+} detoxification. Moreover, we found that A. germinans has the capacity to over-express both genes (AvMt2 and AvPCS), which may constitute a coordinated detoxification response mechanism targeting non-essential metals. Nonetheless, our results confirm that AvPCS was the most active gene involved in the regulation of essential metals (e.g., Cu{sup 2+}) in A. germinans leaves.

  1. Low concentrations of salicylic acid delay methyl jasmonate-induced leaf senescence by up-regulating nitric oxide synthase activity.

    Science.gov (United States)

    Ji, Yingbin; Liu, Jian; Xing, Da

    2016-09-01

    In plants, extensive efforts have been devoted to understanding the crosstalk between salicylic acid (SA) and jasmonic acid (JA) signaling in pathogen defenses, but this crosstalk has scarcely been addressed during senescence. In this study, the effect of SA application on methyl jasmonate (MeJA)-induced leaf senescence was assessed. We found that low concentrations of SA (1-50 μM) played a delayed role against the senescence promoted by MeJA. Furthermore, low concentrations of SA enhanced plant antioxidant defenses and restricted reactive oxygen species (ROS) accumulation in MeJA-treated leaves. When applied simultaneously with MeJA, low concentrations of SA triggered a nitric oxide (NO) burst, and the elevated NO levels were linked to the nitric oxide associated 1 (NOA1)-dependent pathway via nitric oxide synthase (NOS) activity. The ability of SA to up-regulate plant antioxidant defenses, reduce ROS accumulation, and suppress leaf senescence was lost in NO-deficient Atnoa1 plants. In a converse manner, exogenous addition of NO donors increased the plant antioxidant capacity and lowered the ROS levels in MeJA-treated leaves. Taken together, the results indicate that SA at low concentrations counteracts MeJA-induced leaf senescence through NOA1-dependent NO signaling and strengthening of the antioxidant defense. © The Author 2016. Published by Oxford University Press on behalf of the Society for Experimental Biology. All rights reserved. For permissions, please email: journals.permissions@oup.com.

  2. Influence of maternity leave on exclusive breastfeeding.

    Science.gov (United States)

    Monteiro, Fernanda R; Buccini, Gabriela Dos S; Venâncio, Sônia I; da Costa, Teresa H M

    To describe the profile of women with children aged under 4 months living in the Brazilian state capitals and in the Federal District according to their working status and to analyze the influence of maternity leave on exclusive breastfeeding (EBF) among working women. This was a cross-sectional study with data extracted from the II National Maternal Breastfeeding Prevalence Survey carried out in 2008. Initially, a descriptive analysis of the profile of 12,794 women was performed, according to their working status and maternity leave and the frequency of maternity leave in the Brazilian regions and capitals. The study used a multiple model to identify the influence of maternity leave on EBF interruption, including 3766 women who declared they were working and were on maternity leave at the time of the interview. The outcome assessed in the study was the interruption of the EBF, classified by the WHO. Regarding the working status of the mothers, 63.4% did not work outside of their homes and among those who worked, 69.8% were on maternity leave. The largest prevalence among workers was of women older than 35 years of age, with more than 12 years of schooling, primiparous and from the Southeast and South regions. The lack of maternity leave increased by 23% the chance of EBF interruption. Maternity leave contributed to increase the prevalence of EBF in the Brazilian states capitals, supporting the importance of increasing the maternity leave period from four to six months. Copyright © 2017 Sociedade Brasileira de Pediatria. Published by Elsevier Editora Ltda. All rights reserved.

  3. Influence of maternity leave on exclusive breastfeeding

    Directory of Open Access Journals (Sweden)

    Fernanda R. Monteiro

    Full Text Available Abstract Objectives: To describe the profile of women with children aged under 4 months living in the Brazilian state capitals and in the Federal District according to their working status and to analyze the influence of maternity leave on exclusive breastfeeding (EBF among working women. Methods: This was a cross-sectional study with data extracted from the II National Maternal Breastfeeding Prevalence Survey carried out in 2008. Initially, a descriptive analysis of the profile of 12,794 women was performed, according to their working status and maternity leave and the frequency of maternity leave in the Brazilian regions and capitals. The study used a multiple model to identify the influence of maternity leave on EBF interruption, including 3766 women who declared they were working and were on maternity leave at the time of the interview. The outcome assessed in the study was the interruption of the EBF, classified by the WHO. Results: Regarding the working status of the mothers, 63.4% did not work outside of their homes and among those who worked, 69.8% were on maternity leave. The largest prevalence among workers was of women older than 35 years of age, with more than 12 years of schooling, primiparous and from the Southeast and South regions. The lack of maternity leave increased by 23% the chance of EBF interruption. Conclusion: Maternity leave contributed to increase the prevalence of EBF in the Brazilian states capitals, supporting the importance of increasing the maternity leave period from four to six months.

  4. Drought-Induced Effects on Nitrate Reductase Activity and mRNA and on the Coordination of Nitrogen and Carbon Metabolism in Maize Leaves1

    Science.gov (United States)

    Foyer, Christine H.; Valadier, Marie-Hélène; Migge, Andrea; Becker, Thomas W.

    1998-01-01

    Maize (Zea mays L.) plants were grown to the nine-leaf stage. Despite a saturating N supply, the youngest mature leaves (seventh position on the stem) contained little NO3− reserve. Droughted plants (deprived of nutrient solution) showed changes in foliar enzyme activities, mRNA accumulation, photosynthesis, and carbohydrate and amino acid contents. Total leaf water potential and CO2 assimilation rates, measured 3 h into the photoperiod, decreased 3 d after the onset of drought. Starch, glucose, fructose, and amino acids, but not sucrose (Suc), accumulated in the leaves of droughted plants. Maximal extractable phosphoenolpyruvate carboxylase activities increased slightly during water deficit, whereas the sensitivity of this enzyme to the inhibitor malate decreased. Maximal extractable Suc phosphate synthase activities decreased as a result of water stress, and there was an increase in the sensitivity to the inhibitor orthophosphate. A correlation between maximal extractable foliar nitrate reductase (NR) activity and the rate of CO2 assimilation was observed. The NR activation state and maximal extractable NR activity declined rapidly in response to drought. Photosynthesis and NR activity recovered rapidly when nutrient solution was restored at this point. The decrease in maximal extractable NR activity was accompanied by a decrease in NR transcripts, whereas Suc phosphate synthase and phosphoenolpyruvate carboxylase mRNAs were much less affected. The coordination of N and C metabolism is retained during drought conditions via modulation of the activities of Suc phosphate synthase and NR commensurate with the prevailing rate of photosynthesis. PMID:9576798

  5. Maternity and family leave policies in rural family practices.

    Science.gov (United States)

    Mainguy, S; Crouse, B J

    1998-09-01

    To help recruit and retain physicians, especially women, rural family practice groups need to establish policies regarding maternity and other family leaves. Also important are policies regarding paternity leave, adoptive leave, and leave to care for elderly parents. We surveyed members of the American Academy of Family Physicians in rural practice in 1995 to assess the prevalence of leave policies, the degree to which physicians are taking family leave, and the characteristics of ideal policies. Currently, both men and women physicians are taking family leaves of absence, which indicates a need for leave policies. Furthermore, a lack of family leave policies may deter women from entering rural practice.

  6. Labour Supply Responses to Paid Parental Leave

    OpenAIRE

    Karimi, Arizo; Lindahl, Erica; Skogman Thoursie, Peter

    2012-01-01

    Women account for the majority of parental leave take-up, which is likely one of the major reasons for the gender gap in income and wages. Consequently, many countries exert effort to promote a more gender equal division of parental leave. Indeed, the last decades have seen an increase in fathers' take-up of parental leave benefits, but the gender earnings gap has remained fairly constant. In this paper we re-evaluate the labour supply responses of both mothers and fathers to three major refo...

  7. Late adolescents' conceptualizations of home-leaving.

    Science.gov (United States)

    Moore, D; Hotch, D F

    1981-02-01

    Separation from the family, a key developmental task, has received scant attention from developmentalists. In this study, college students' dissimilarity ratings and ratings on 22 bipolar adjective scales were obtained for a set of 20 definitions of home-leaving. Results of a cluster analysis revealed that conceptualizations of the definitions are organized in terms of eight clusters. Ratings on the 22 adjective scales provided an empirical means for interpreting the typological structure of the home-leaving definitions. Convergence the results of this inductive study of home-leaving and elements of ego development theory was noted.

  8. Laser induced fluorescence of some plant leaves

    International Nuclear Information System (INIS)

    Helmi, M.S.; Mohamed, M.M.; Amer, R.; Elshazly, O.; Elraey, M.

    1992-01-01

    Laser induced fluorescence (LIF) is successfully used as a technique for remote detection of spectral characteristics of some plants. A pulsed nitrogen laser at 337.1 nm is used to excite cotton, corn and rice leaves. The fluorescence spectrum is detected in the range from 340 nm to 820 nm. It is found that, these plant leaves have common fluorescence maxima at 440 nm, 685 nm and 740 nm. plant leaves are also found to be identifiable by the ratio of the fluorescence intensity at 440 nm to that at 685 nm. The present technique can be further used as a means of assessing, remotely, plant stresses. 5 fig

  9. Fathers' Leave, Fathers' Involvement and Child Development

    DEFF Research Database (Denmark)

    del Carmen Huerta, Maria; Lausten, Mette; Baxter, Jennifer

    involved’ perform better during the early years than their peers with less involved fathers. This paper analyses data of four OECD countries — Australia; Denmark; United Kingdom; United States — to describe how leave policies may influence father’s behaviours when children are young and whether...... their involvement translates into positive child cognitive and behavioural outcomes. This analysis shows that fathers’ leave, father’s involvement and child development are related. Fathers who take leave, especially those taking two weeks or more, are more likely to carry out childcare related activities when...

  10. 78 FR 8833 - The Family and Medical Leave Act

    Science.gov (United States)

    2013-02-06

    ... creates a new qualifying exigency leave category for parental care. In military caregiver leave, the Final... covered employers to take job- protected, unpaid leave, or to substitute appropriate accrued paid leave... CFR Part 825 The Family and Medical Leave Act; Final Rule #0;#0;Federal Register / Vol. 78 , No. 25...

  11. 5 CFR 630.906 - Transfer of annual leave.

    Science.gov (United States)

    2010-01-01

    ... employing agency may not be sufficient to meet the needs of the leave recipient; or (3) In the judgment of... specified leave recipient. Except as provided in paragraph (f) of this section, annual leave may be transferred only to a leave recipient employed by the leave donor's employing agency. (b) Except as provided...

  12. Enhanced levels of S-linalool by metabolic engineering of the terpenoid pathway in spike lavender leaves.

    Science.gov (United States)

    Mendoza-Poudereux, Isabel; Muñoz-Bertomeu, Jesús; Navarro, Alicia; Arrillaga, Isabel; Segura, Juan

    2014-05-01

    Transgenic Lavandula latifolia plants overexpressing the linalool synthase (LIS) gene from Clarkia breweri, encoding the LIS enzyme that catalyzes the synthesis of linalool were generated. Most of these plants increased significantly their linalool content as compared to controls, especially in the youngest leaves, where a linalool increase up to a 1000% was observed. The phenotype of increased linalool content observed in young leaves was maintained in those T1 progenies that inherit the LIS transgene, although this phenotype was less evident in the flower essential oil. Cross-pollination of transgenic spike lavender plants allowed the generation of double transgenic plants containing the DXS (1-deoxy-d-xylulose-5-P synthase), coding for the first enzyme of the methyl-d-erythritol-4-phosphate pathway, and LIS genes. Both essential oil yield and linalool content in double DXS-LIS transgenic plants were lower than that of their parentals, which could be due to co-suppression effects linked to the structures of the constructs used. Copyright © 2014 International Metabolic Engineering Society. Published by Elsevier Inc. All rights reserved.

  13. Transcriptional expression of Stilbene synthase genes are regulated developmentally and differentially in response to powdery mildew in Norton and Cabernet Sauvignon grapevine.

    Science.gov (United States)

    Dai, Ru; Ge, Hui; Howard, Susanne; Qiu, Wenping

    2012-12-01

    Stilbenic compounds are natural phytoalexins that have antimicrobial activities in plant defense against pathogens. Stilbene synthase (STS) is the key enzyme that catalyzes the biosynthesis of stilbenic compounds. Grapevine genome contains a family of preliminarily annotated 35 STS genes, the regulation of each STS gene needs to be studied to define their roles. In this study, we selected eight STS genes, STS8, STS27/31, STS16/22, STS13/17/23, and applied quantitative polymerase chain reaction (qPCR) to characterize their transcriptional expression profiles in leaf tissues upon infection by the powdery mildew fungus (PM), Erysiphe necator (Schw.) Burr. Their transcripts were also compared in young and old leaves as well as in the berry skin at five developmental stages in Vitis vinifera 'Cabernet Sauvignon' and Vitis aestivalis 'Norton'. The results showed that transcripts of selected STS genes increased significantly in Cabernet Sauvignon leaves at 24 and 48 h post inoculation with PM spores and remained unchanged in Norton leaves in response to the PM infection. Transcripts of STS8, STS27/31 and STS13/17/23 were more abundant in the old leaves of Norton than in Cabernet Sauvignon. STS genes showed lower expression levels in young leaves than in old leaves. Transcript levels of the eight STS genes increased drastically in the berry skin of Cabernet Sauvignon and Norton post véraison. In addition, the content of trans-resveratrol in the berry skin rapidly increased post véraison and reached the highest level at harvest. These assays demonstrated that individual STS genes are regulated differentially in response to PM infection and during development in the two grape varieties. The present study yields basic knowledge for further investigation of the regulation and function of each STS gene in grapevine and provides experimental evidences for the functional annotation of the STS gene family in the grapevine genome. Copyright © 2012 Elsevier Ireland Ltd. All

  14. Monoterpene and sesquiterpene synthases and the origin of terpene skeletal diversity in plants.

    Science.gov (United States)

    Degenhardt, Jörg; Köllner, Tobias G; Gershenzon, Jonathan

    2009-01-01

    The multitude of terpene carbon skeletons in plants is formed by enzymes known as terpene synthases. This review covers the monoterpene and sesquiterpene synthases presenting an up-to-date list of enzymes reported and evidence for their ability to form multiple products. The reaction mechanisms of these enzyme classes are described, and information on how terpene synthase proteins mediate catalysis is summarized. Correlations between specific amino acid motifs and terpene synthase function are described, including an analysis of the relationships between active site sequence and cyclization type and a discussion of whether specific protein features might facilitate multiple product formation.

  15. Maternity leave, women's employment, and marital incompatibility.

    Science.gov (United States)

    Hyde, J S; Essex, M J; Clark, R; Klein, M H

    2001-09-01

    This research investigated the relationship between the length of women's maternity leave and marital incompatibility, in the context of other variables including the woman's employment, her dissatisfaction with the division of household labor, and her sense of role overload. Length of leave, work hours, and family salience were associated with several forms of dissatisfaction, which in turn predicted role overload. Role overload predicted increased marital incompatibility for experienced mothers but did not for first-time mothers, for whom discrepancies between preferred and actual child care were more important. Length of maternity leave showed significant interactions with other variables, supporting the hypothesis that a short leave is a risk factor that, when combined with another risk factor, contributes to personal and marital distress.

  16. Tomato leaves methanol extract possesses anti- inflammatory ...

    African Journals Online (AJOL)

    GREGORY

    2011-12-16

    Dec 16, 2011 ... demonstrated, the anti-inflammatory effect of tomato leaves and its associated molecular mechanisms have not yet .... dissolved in 10% of culture-grade dimethylsulfoxide (DMSO; Sigma-. Aldrich .... In Vitro Cell. Dev. Biol.

  17. 5 CFR 630.1111 - Limitation on the amount of donated annual leave received by an emergency leave recipient.

    Science.gov (United States)

    2010-01-01

    ... needs of individual emergency leave recipients, an employing agency may allow an employee to receive... annual leave received by an emergency leave recipient. 630.1111 Section 630.1111 Administrative Personnel... recipient. An emergency leave recipient may receive a maximum of 240 hours of donated annual leave at any...

  18. Transcriptome Analysis Reveals Molecular Signatures of Luteoloside Accumulation in Senescing Leaves of Lonicera macranthoides

    Directory of Open Access Journals (Sweden)

    Zexiong Chen

    2018-03-01

    Full Text Available Lonicera macranthoides is an important medicinal plant widely used in traditional Chinese medicine. Luteoloside is a critical bioactive compound in L. macranthoides. To date, the molecular mechanisms underlying luteoloside biosynthesis are still largely unknown. In this work, high performance liquid chromatography (HPLC was employed to determine the luteoloside contents in leaves, stems, and flowers at different developmental stages. Results showed that senescing leaves can accumulate large amounts of luteoloside, extremely higher than that in young and semi-lignified leaves and other tissues. RNA-Seq analysis identified that twenty-four differentially expressed unigenes (DEGs associated with luteoloside biosynthesis were significantly up-regulated in senescing leaves, which are positively correlated with luteoloside accumulation. These DEGs include phenylalanine ammonia lyase 2, cinnamate 4-hydroxylase 2, thirteen 4-coumarate-CoA ligases, chalcone synthase 2, six flavonoid 3′-monooxygenase (F3′H and two flavone 7-O-β-glucosyltransferase (UFGT genes. Further analysis demonstrated that two F3′Hs (CL11828.Contig1 and CL11828.Contig2 and two UFGTs (Unigene2918 and Unigene97915 might play vital roles in luteoloside generation. Furthermore, several transcription factors (TFs related to flavonoid biosynthesis including MYB, bHLH and WD40, were differentially expressed during leaf senescence. Among these TFs, MYB12, MYB75, bHLH113 and TTG1 were considered to be key factors involved in the regulation of luteoloside biosynthesis. These findings provide insights for elucidating the molecular signatures of luteoloside accumulation in L. macranthoides.

  19. On the Motion of Falling Leaves

    OpenAIRE

    Razavi, Pedram

    2010-01-01

    This paper investigates the motion of falling leaves through modeling using papers and the corresponding data collected from more than four thousands experiments. Two series of experiments were designed in order to study the relationship between different parameters which can affect different paths of motion in leaves. In the first series of experiments, the shapes of the potential paths that falling papers can take were investigated as a whole. A new classification scheme was derived from th...

  20. Do parents leave a smaller carbon footprint?

    DEFF Research Database (Denmark)

    Nordström, Leif Jonas; Shogren, Jason F.; Thunström, Linda

    Do parents leave a smaller carbon footprint? While becoming a parent is transformational as one focuses more on the future, the time constraints are more binding right now. Using a unique data set that allows us to compare CO2 emissions from Swedish two-adult households with and without children......, we find becoming a Swedish parent causes a person to leave a larger carbon ootprint—due to changes in transportation patterns and food consumption choices....

  1. Intra-Household Allocation of Parental Leave

    OpenAIRE

    Gobbi, Paula Eugenia; Parys, Juliane; Schwerhoff, Gregor

    2015-01-01

    We introduce childcare sharing in a collective model of household behavior to investigate which factors make spouses increase or decrease their share of parental leave. The concern about future consumption motivates parents to invest in their human capital and to limit their leave duration. Using relative income and the age difference between spouses as distribution factors, we cannot reject Pareto efficiency in childcare sharing. Higher relative incomes and larger age differences shift the c...

  2. Enhancement of vascular targeting by inhibitors of nitric oxide synthase

    International Nuclear Information System (INIS)

    Davis, Peter D.; Tozer, Gillian M.; Naylor, Matthew A.; Thomson, Peter; Lewis, Gemma; Hill, Sally A.

    2002-01-01

    Purpose: This study investigates the enhancement of the vascular targeting activity of the tubulin-binding agent combretastatin A4 phosphate (CA4P) by various inhibitors of nitric oxide synthases. Methods and Materials: The syngeneic tumors CaNT and SaS growing in CBA mice were used for this study. Reduction in perfused vascular volume was measured by injection of Hoechst 33342 24 h after drug administration. Necrosis (hematoxylin and eosin stain) was assessed also at 24 h after treatment. Combretastatin A4 phosphate was synthesized by a modification of the published procedure and the nitric oxide synthase inhibitors L-NNA, L-NMMA, L-NIO, L-NIL, S-MTC, S-EIT, AMP, AMT, and L-TC, obtained from commercial sources. Results: A statistically significant augmentation of the reduction in perfused vascular volume by CA4P in the CaNT tumor was observed with L-NNA, AMP, and AMT. An increase in CA4P-induced necrosis in the same tumor achieved significance with L-NNA, L-NMMA, L-NIL, and AMT. CA4P induced little necrosis in the SaS tumor, but combination with the inhibitors L-NNA, L-NMMA, L-NIO, S-EIT, and L-TC was effective. Conclusions: Augmentation of CA4P activity by nitric oxide synthase inhibitors of different structural classes supports a nitric oxide-related mechanism for this effect. L-NNA was the most effective inhibitor studied

  3. Incorporation of phosphate into glycogen by glycogen synthase.

    Science.gov (United States)

    Contreras, Christopher J; Segvich, Dyann M; Mahalingan, Krishna; Chikwana, Vimbai M; Kirley, Terence L; Hurley, Thomas D; DePaoli-Roach, Anna A; Roach, Peter J

    2016-05-01

    The storage polymer glycogen normally contains small amounts of covalently attached phosphate as phosphomonoesters at C2, C3 and C6 atoms of glucose residues. In the absence of the laforin phosphatase, as in the rare childhood epilepsy Lafora disease, the phosphorylation level is elevated and is associated with abnormal glycogen structure that contributes to the pathology. Laforin therefore likely functions in vivo as a glycogen phosphatase. The mechanism of glycogen phosphorylation is less well-understood. We have reported that glycogen synthase incorporates phosphate into glycogen via a rare side reaction in which glucose-phosphate rather than glucose is transferred to a growing polyglucose chain (Tagliabracci et al. (2011) Cell Metab13, 274-282). We proposed a mechanism to account for phosphorylation at C2 and possibly at C3. Our results have since been challenged (Nitschke et al. (2013) Cell Metab17, 756-767). Here we extend the evidence supporting our conclusion, validating the assay used for the detection of glycogen phosphorylation, measurement of the transfer of (32)P from [β-(32)P]UDP-glucose to glycogen by glycogen synthase. The (32)P associated with the glycogen fraction was stable to ethanol precipitation, SDS-PAGE and gel filtration on Sephadex G50. The (32)P-signal was not affected by inclusion of excess unlabeled UDP before analysis or by treatment with a UDPase, arguing against the signal being due to contaminating [β-(32)P]UDP generated in the reaction. Furthermore, [(32)P]UDP did not bind non-covalently to glycogen. The (32)P associated with glycogen was released by laforin treatment, suggesting that it was present as a phosphomonoester. The conclusion is that glycogen synthase can mediate the introduction of phosphate into glycogen, thereby providing a possible mechanism for C2, and perhaps C3, phosphorylation. Copyright © 2016 Elsevier Inc. All rights reserved.

  4. Properties of leaves particleboard for sheathing application

    Science.gov (United States)

    Nuryawan, Arif; Rahmawaty

    2018-03-01

    Manufacturing particleboard (PB) made of leaves was carried out to make non-structural building components, such as insulation, partition, wall, and sheathing. Raw materials used dry leaves originated from plantation (palm oil leaves) and forest plantation (magahony leaves). The adhesive used was interior type thermosetting commercial resins, namely 10% urea-formaldehyde (UF) based on oven dry leaves. Hardener used for UF resin was 1% and 3% ammonium chloride (NH4Cl) 20% (w/w), respectively. Technically, the target density of PB was 0.8 g/cm3 with the dimension’s size of (250 x 250 x 10) mm3. The pressure, temperature, and time of pressing of the hot press were 25 kgf/cm2, 120C, and 10 minutes, respectively. After conditioning for one week, the PB then was evaluated their physical and mechanical properties according to Japanese Industrial Standard (JIS) A 5908 (2003). Results of this work showed: 1) Both types of PB (palm oil and mahagony leaves) were feasible to be produced for non-structural applications; 2) Addition of hardener enhanced the physical and mechanical properties of PB; 3) It was recommended to enhance the performance of the PB by manipulation of the raw materials and the design.

  5. Short-Term Saved Leave Scheme

    CERN Multimedia

    2007-01-01

    As announced at the meeting of the Standing Concertation Committee (SCC) on 26 June 2007 and in http://Bulletin No. 28/2007, the existing Saved Leave Scheme will be discontinued as of 31 December 2007. Staff participating in the Scheme will shortly receive a contract amendment stipulating the end of financial contributions compensated by save leave. Leave already accumulated on saved leave accounts can continue to be taken in accordance with the rules applicable to the current scheme. A new system of saved leave will enter into force on 1 January 2008 and will be the subject of a new implementation procedure entitled "Short-term saved leave scheme" dated 1 January 2008. At its meeting on 4 December 2007, the SCC agreed to recommend the Director-General to approve this procedure, which can be consulted on the HR Department’s website at the following address: https://cern.ch/hr-services/services-Ben/sls_shortterm.asp All staff wishing to participate in the new scheme a...

  6. Short-Term Saved Leave Scheme

    CERN Multimedia

    HR Department

    2007-01-01

    As announced at the meeting of the Standing Concertation Committee (SCC) on 26 June 2007 and in http://Bulletin No. 28/2007, the existing Saved Leave Scheme will be discontinued as of 31 December 2007. Staff participating in the Scheme will shortly receive a contract amendment stipulating the end of financial contributions compensated by save leave. Leave already accumulated on saved leave accounts can continue to be taken in accordance with the rules applicable to the current scheme. A new system of saved leave will enter into force on 1 January 2008 and will be the subject of a new im-plementation procedure entitled "Short-term saved leave scheme" dated 1 January 2008. At its meeting on 4 December 2007, the SCC agreed to recommend the Director-General to approve this procedure, which can be consulted on the HR Department’s website at the following address: https://cern.ch/hr-services/services-Ben/sls_shortterm.asp All staff wishing to participate in the new scheme ...

  7. Office design's impact on sick leave rates.

    Science.gov (United States)

    Bodin Danielsson, Christina; Chungkham, Holendro Singh; Wulff, Cornelia; Westerlund, Hugo

    2014-01-01

    The effect of office type on sickness absence among office employees was studied prospectively in 1852 employees working in (1) cell-offices; (2) shared-room offices; (3) small, (4) medium-sized and (5) large open-plan offices; (6) flex-offices and (7) combi-offices. Sick leaves were self-reported two years later as number of (a) short and (b) long (medically certified) sick leave spells as well as (c) total number of sick leave days. Multivariate logistic regression analysis was used, with adjustment for background factors. A significant excess risk for sickness absence was found only in terms of short sick leave spells in the three open-plan offices. In the gender separate analysis, this remained for women, whereas men had a significantly increased risk in flex-offices. For long sick leave spells, a significantly higher risk was found among women in large open-plan offices and for total number of sick days among men in flex-offices. A prospective study of the office environment's effect on employees is motivated by the high rates of sick leaves in the workforce. The results indicate differences between office types, depending on the number of people sharing workspace and the opportunity to exert personal control as influenced by the features that define the office types.

  8. Microsomal prostaglandin E synthase-1 in rheumatic diseases

    Directory of Open Access Journals (Sweden)

    Marina eKorotkova

    2011-01-01

    Full Text Available Microsomal prostaglandin E synthase-1 (mPGES-1 is a well recognized target for the development of novel anti-inflammatory drugs that can reduce symptoms of inflammation in rheumatic diseases and other inflammatory conditions. In this review, we focus on mPGES-1 in rheumatic diseases with the aim to cover the most recent advances in the understanding of mPGES-1 in rheumatoid arthritis, osteoarthritis and inflammatory myopathies. Novel findings regarding regulation of mPGES1 cell expression as well as enzyme inhibitors are also summarized.

  9. Nitric oxide synthase expression and enzymatic activity in multiple sclerosis

    DEFF Research Database (Denmark)

    Broholm, H; Andersen, B; Wanscher, B

    2004-01-01

    We used post-mortem magnetic resonance imaging (MRI) guidance to obtain paired biopsies from the brains of four patients with clinical definite multiple sclerosis (MS). Samples were analyzed for the immunoreactivity (IR) of the three nitric oxide (NO) synthase isoforms [inducible, neuronal......NOS expressing cells in active lesions. NOS IR expressing cells were widely distributed in plaques, in white and gray matter that appeared normal macroscopically, and on MR. Endothelial NOS (eNOS) was highly expressed in intraparenchymal vascular endothelial cells of MS patients. A control group matched for age...

  10. Fatty acid synthase inhibitors isolated from Punica granatum L

    Energy Technology Data Exchange (ETDEWEB)

    Jiang, He-Zhong [School of Life Science and Engineering, Southwest Jiaotong University, Chengdu, (China); Ma, Qing-Yun; Liang, Wen-Juan; Huang, Sheng-Zhuo; Dai, Hao-Fu; Wang, Peng-Cheng; Zhao, You-Xing, E-mail: zhaoyx1011@163.com [Institute of Tropical Bioscience and Biotechnology, Chinese Academy of Tropical Agricultural Sciences, Haikou (China); Fan, Hui-Jin; Ma, Xiao-Feng, E-mail: maxiaofeng@gucas.ac.cn [College of Life Sciences, Graduate University of Chinese Academy of Sciences, Beijing (China)

    2012-05-15

    The aim of this work is the isolation of fatty acid synthase (FAS) inhibitors from the ethyl acetate extracts of fruit peels of Punica granatum L. Bioassay-guided chemical investigation of the fruit peels resulted in the isolation of seventeen compounds mainly including triterpenoids and phenolic compounds, from which one new oleanane-type triterpene (punicaone) along with fourteen known compounds were isolated for the first time from this plant. Seven isolates were evaluated for inhibitory activities of FAS and two compounds showed to be active. Particularly, flavogallonic acid exhibited strong FAS inhibitory activity with IC{sub 50} value of 10.3 {mu}mol L{sup -1}. (author)

  11. Fatty acid synthase inhibitors isolated from Punica granatum L

    International Nuclear Information System (INIS)

    Jiang, He-Zhong; Ma, Qing-Yun; Liang, Wen-Juan; Huang, Sheng-Zhuo; Dai, Hao-Fu; Wang, Peng-Cheng; Zhao, You-Xing; Fan, Hui-Jin; Ma, Xiao-Feng

    2012-01-01

    The aim of this work is the isolation of fatty acid synthase (FAS) inhibitors from the ethyl acetate extracts of fruit peels of Punica granatum L. Bioassay-guided chemical investigation of the fruit peels resulted in the isolation of seventeen compounds mainly including triterpenoids and phenolic compounds, from which one new oleanane-type triterpene (punicaone) along with fourteen known compounds were isolated for the first time from this plant. Seven isolates were evaluated for inhibitory activities of FAS and two compounds showed to be active. Particularly, flavogallonic acid exhibited strong FAS inhibitory activity with IC 50 value of 10.3 μmol L -1 . (author)

  12. Heteromeric and homomeric geranyl diphosphate synthases from Catharanthus roseus and their role in monoterpene indole alkaloid biosynthesis.

    Science.gov (United States)

    Rai, Avanish; Smita, Shachi S; Singh, Anup Kumar; Shanker, Karuna; Nagegowda, Dinesh A

    2013-09-01

    Catharanthus roseus is the sole source of two most important monoterpene indole alkaloid (MIA) anti-cancer agents: vinblastine and vincristine. MIAs possess a terpene and an indole moiety derived from terpenoid and shikimate pathways, respectively. Geranyl diphosphate (GPP), the entry point to the formation of terpene moiety, is a product of the condensation of isopentenyl diphosphate (IPP) and dimethylallyl diphosphate (DMAPP) by GPP synthase (GPPS). Here, we report three genes encoding proteins with sequence similarity to large subunit (CrGPPS.LSU) and small subunit (CrGPPS.SSU) of heteromeric GPPSs, and a homomeric GPPSs. CrGPPS.LSU is a bifunctional enzyme producing both GPP and geranyl geranyl diphosphate (GGPP), CrGPPS.SSU is inactive, whereas CrGPPS is a homomeric enzyme forming GPP. Co-expression of both subunits in Escherichia coli resulted in heteromeric enzyme with enhanced activity producing only GPP. While CrGPPS.LSU and CrGPPS showed higher expression in older and younger leaves, respectively, CrGPPS.SSU showed an increasing trend and decreased gradually. Methyl jasmonate (MeJA) treatment of leaves significantly induced the expression of only CrGPPS.SSU. GFP localization indicated that CrGPPS.SSU is plastidial whereas CrGPPS is mitochondrial. Transient overexpression of AmGPPS.SSU in C. roseus leaves resulted in increased vindoline, immediate monomeric precursor of vinblastine and vincristine. Although C. roseus has both heteromeric and homomeric GPPS enzymes, our results implicate the involvement of only heteromeric GPPS with CrGPPS.SSU regulating the GPP flux for MIA biosynthesis.

  13. A MODELING METHOD OF FLUTTERING LEAVES BASED ON POINT CLOUD

    OpenAIRE

    J. Tang; Y. Wang; Y. Zhao; Y. Zhao; W. Hao; X. Ning; K. Lv; Z. Shi; M. Zhao

    2017-01-01

    Leaves falling gently or fluttering are common phenomenon in nature scenes. The authenticity of leaves falling plays an important part in the dynamic modeling of natural scenes. The leaves falling model has a widely applications in the field of animation and virtual reality. We propose a novel modeling method of fluttering leaves based on point cloud in this paper. According to the shape, the weight of leaves and the wind speed, three basic trajectories of leaves falling are defined, which ar...

  14. Glycogen synthase from the parabasalian parasite Trichomonas vaginalis: An unusual member of the starch/glycogen synthase family.

    Science.gov (United States)

    Wilson, Wayne A; Pradhan, Prajakta; Madhan, Nayasha; Gist, Galen C; Brittingham, Andrew

    2017-07-01

    Trichomonas vaginalis, a parasitic protist, is the causative agent of the common sexually-transmitted infection trichomoniasis. The organism has long been known to synthesize substantial glycogen as a storage polysaccharide, presumably mobilizing this compound during periods of carbohydrate limitation, such as might be encountered during transmission between hosts. However, little is known regarding the enzymes of glycogen metabolism in T. vaginalis. We had previously described the identification and characterization of two forms of glycogen phosphorylase in the organism. Here, we measure UDP-glucose-dependent glycogen synthase activity in cell-free extracts of T. vaginalis. We then demonstrate that the TVAG_258220 open reading frame encodes a glycosyltransferase that is presumably responsible for this synthetic activity. We show that expression of TVAG_258220 in a yeast strain lacking endogenous glycogen synthase activity is sufficient to restore glycogen accumulation. Furthermore, when TVAG_258220 is expressed in bacteria, the resulting recombinant protein has glycogen synthase activity in vitro, transferring glucose from either UDP-glucose or ADP-glucose to glycogen and using both substrates with similar affinity. This protein is also able to transfer glucose from UDP-glucose or ADP-glucose to maltose and longer oligomers of glucose but not to glucose itself. However, with these substrates, there is no evidence of processivity and sugar transfer is limited to between one and three glucose residues. Taken together with our earlier work on glycogen phosphorylase, we are now well positioned to define both how T. vaginalis synthesizes and utilizes glycogen, and how these processes are regulated. Copyright © 2017 Elsevier B.V. and Société Française de Biochimie et Biologie Moléculaire (SFBBM). All rights reserved.

  15. ["Paternity leave"? Retrospective view on a delayed reform of maternity leave in Austria].

    Science.gov (United States)

    Munz, R

    1984-01-01

    Only 1 of 3 Austrian fathers involves himself daily in child rearing, and the younger the children, the less likely he is to be involved. Austria is among those European countries with the greatest pregnancy benefits. New mothers may take up to 1 year of paid maternity leave without fear of losing their jobs. This article uses 1982 Institute of Demography survey data to determine support for similar paternity leave for fathers. In the last few years, both Social Democrat and Conservative women have worked for this leave, although the movement has also found opposition by women in trade unions, as well as from conservative groups. Survey results show that 46% of married Austrian women, under age 40, favor paternity leave; 1 or 4 women can imagine their husbands taking such leave. Among husbands, 34% favored the leave option, and 1 of 4 could imagine taking the leave for a least part of the baby's first year. The study attempts to identify those husbands most likely to take advantage of paternity leave. At present, most men will not choose to stay with their children at the expense of earnings reduction. Compensation reforms for both mothers and fathers must first occur before men and women in a position to make real decisions on maternity and paternity leave.

  16. Stereochemical course of enzyme-catalyzed aminopropyl transfer: spermidine synthase

    International Nuclear Information System (INIS)

    Kullberg, D.W.; Orr, G.R.; Coward, J.K.

    1986-01-01

    The R and S enantionmers of S-adenosyl-3-[ 2 H]3-(methylthio)-1-propylamine (decarboxylated S-adenosylmethionine), previously synthesized in this laboratory, were incubated with [1,4- 2 H 4 ]-putrescine in the presence of spermidine synthase from E. coli. The resulting chiral [ 2 H 5 ]spermidines were isolated and converted to their N 1 ,N 7 -dibocspermidine-N 4 -(1S,4R)-camphanamides. The derivatives were analyzed by 500 MHz 1 H-NMR and the configuration of the chiral center assigned by correlation with the spectra of synthetic chiral [ 2 H 3 ]dibocspermidine camphanamide standards. The enzyme-catalyzed aminopropyl transfer was shown to occur with net retention of configuration, indicative of a double-displacement mechanism. This result concurs with that of a previous steady-state kinetics study of spermidine synthase isolated from E. coli, but contradicts the single-displacement mechanism suggested by a stereochemical analysis of chiral spermidines biosynthesized in E. coli treated with chirally deuterated methionines. It also indicates that this aminopropyltransferase is mechanistically distinct from the methyltransferases, which have been shown to act via a single-displacement mechanism (net inversion at -CH 3 ) in all cases studied to date

  17. In Vitro Biochemical Characterization of All Barley Endosperm Starch Synthases

    Directory of Open Access Journals (Sweden)

    Jose Antonio Cuesta-Seijo

    2016-01-01

    Full Text Available Starch is the main storage polysaccharide in cereals and the major source of calories in the human diet. It is synthesized by a panel of enzymes including five classes of starch synthases (SSs. While the overall starch synthase (SS reaction is known, the functional differences between the five SS classes are poorly understood. Much of our knowledge comes from analyzing mutant plants with altered SS activities, but the resulting data are often difficult to interpret as a result of pleitropic effects, competition between enzymes, overlaps in enzyme activity and disruption of multi-enzyme complexes. Here we provide a detailed biochemical study of the activity of all five classes of SSs in barley endosperm. Each enzyme was produced recombinantly in E. coli and the properties and modes of action in vitro were studied in isolation from other SSs and other substrate modifying activities. Our results define the mode of action of each SS class in unprecedented detail; we analyze their substrate selection, temperature dependence and stability, substrate affinity and temporal abundance during barley development. Our results are at variance with some generally accepted ideas about starch biosynthesis and might lead to the reinterpretation of results obtained in planta. In particular, they indicate that granule bound SS is capable of processive action even in the absence of a starch matrix, that SSI has no elongation limit, and that SSIV, believed to be critical for the initiation of starch granules, has maltoligosaccharides and not polysaccharides as its preferred substrates.

  18. Modulation of hyaluronan synthase activity in cellular membrane fractions.

    Science.gov (United States)

    Vigetti, Davide; Genasetti, Anna; Karousou, Evgenia; Viola, Manuela; Clerici, Moira; Bartolini, Barbara; Moretto, Paola; De Luca, Giancarlo; Hascall, Vincent C; Passi, Alberto

    2009-10-30

    Hyaluronan (HA), the only non-sulfated glycosaminoglycan, is involved in morphogenesis, wound healing, inflammation, angiogenesis, and cancer. In mammals, HA is synthesized by three homologous HA synthases, HAS1, HAS2, and HAS3, that polymerize the HA chain using UDP-glucuronic acid and UDP-N-acetylglucosamine as precursors. Since the amount of HA is critical in several pathophysiological conditions, we developed a non-radioactive assay for measuring the activity of HA synthases (HASs) in eukaryotic cells and addressed the question of HAS activity during intracellular protein trafficking. We prepared three cellular fractions: plasma membrane, cytosol (containing membrane proteins mainly from the endoplasmic reticulum and Golgi), and nuclei. After incubation with UDP-sugar precursors, newly synthesized HA was quantified by polyacrylamide gel electrophoresis of fluorophore-labeled saccharides and high performance liquid chromatography. This new method measured HAS activity not only in the plasma membrane fraction but also in the cytosolic membranes. This new technique was used to evaluate the effects of 4-methylumbeliferone, phorbol 12-myristate 13-acetate, interleukin 1beta, platelet-derived growth factor BB, and tunicamycin on HAS activities. We found that HAS activity can be modulated by post-translational modification, such as phosphorylation and N-glycosylation. Interestingly, we detected a significant increase in HAS activity in the cytosolic membrane fraction after tunicamycin treatment. Since this compound is known to induce HA cable structures, this result links HAS activity alteration with the capability of the cell to promote HA cable formation.

  19. Glycogen synthase kinase 3: more than a namesake.

    Science.gov (United States)

    Rayasam, Geetha Vani; Tulasi, Vamshi Krishna; Sodhi, Reena; Davis, Joseph Alex; Ray, Abhijit

    2009-03-01

    Glycogen synthase kinase 3 (GSK3), a constitutively acting multi-functional serine threonine kinase is involved in diverse physiological pathways ranging from metabolism, cell cycle, gene expression, development and oncogenesis to neuroprotection. These diverse multiple functions attributed to GSK3 can be explained by variety of substrates like glycogen synthase, tau protein and beta catenin that are phosphorylated leading to their inactivation. GSK3 has been implicated in various diseases such as diabetes, inflammation, cancer, Alzheimer's and bipolar disorder. GSK3 negatively regulates insulin-mediated glycogen synthesis and glucose homeostasis, and increased expression and activity of GSK3 has been reported in type II diabetics and obese animal models. Consequently, inhibitors of GSK3 have been demonstrated to have anti-diabetic effects in vitro and in animal models. However, inhibition of GSK3 poses a challenge as achieving selectivity of an over achieving kinase involved in various pathways with multiple substrates may lead to side effects and toxicity. The primary concern is developing inhibitors of GSK3 that are anti-diabetic but do not lead to up-regulation of oncogenes. The focus of this review is the recent advances and the challenges surrounding GSK3 as an anti-diabetic therapeutic target.

  20. Polyketide synthases from poison hemlock (Conium maculatum L.).

    Science.gov (United States)

    Hotti, Hannu; Seppänen-Laakso, Tuulikki; Arvas, Mikko; Teeri, Teemu H; Rischer, Heiko

    2015-11-01

    Coniine is a toxic alkaloid, the biosynthesis of which is not well understood. A possible route, supported by evidence from labelling experiments, involves a polyketide formed by the condensation of one acetyl-CoA and three malonyl-CoAs catalysed by a polyketide synthase (PKS). We isolated PKS genes or their fragments from poison hemlock (Conium maculatum L.) by using random amplification of cDNA ends (RACE) and transcriptome analysis, and characterized three full-length enzymes by feeding different starter-CoAs in vitro. On the basis of our in vitro experiments, two of the three characterized PKS genes in poison hemlock encode chalcone synthases (CPKS1 and CPKS2), and one encodes a novel type of PKS (CPKS5). We show that CPKS5 kinetically favours butyryl-CoA as a starter-CoA in vitro. Our results suggest that CPKS5 is responsible for the initiation of coniine biosynthesis by catalysing the synthesis of the carbon backbone from one butyryl-CoA and two malonyl-CoAs. © 2015 FEBS.

  1. Amaryllidaceae Alkaloids as Potential Glycogen Synthase Kinase-3β Inhibitors

    Directory of Open Access Journals (Sweden)

    Daniela Hulcová

    2018-03-01

    Full Text Available Glycogen synthase kinase-3β (GSK-3β is a multifunctional serine/threonine protein kinase that was originally identified as an enzyme involved in the control of glycogen metabolism. It plays a key role in diverse physiological processes including metabolism, the cell cycle, and gene expression by regulating a wide variety of well-known substances like glycogen synthase, tau-protein, and β-catenin. Recent studies have identified GSK-3β as a potential therapeutic target in Alzheimer´s disease, bipolar disorder, stroke, more than 15 types of cancer, and diabetes. GSK-3β is one of the most attractive targets for medicinal chemists in the discovery, design, and synthesis of new selective potent inhibitors. In the current study, twenty-eight Amaryllidaceae alkaloids of various structural types were studied for their potency to inhibit GSK-3β. Promising results have been demonstrated by alkaloids of the homolycorine-{9-O-demethylhomolycorine (IC50 = 30.00 ± 0.71 µM, masonine (IC50 = 27.81 ± 0.01 μM}, and lycorine-types {caranine (IC50 = 30.75 ± 0.04 μM}.

  2. The crystal structure of human GDP-L-fucose synthase.

    Science.gov (United States)

    Zhou, Huan; Sun, Lihua; Li, Jian; Xu, Chunyan; Yu, Feng; Liu, Yahui; Ji, Chaoneng; He, Jianhua

    2013-09-01

    Human GDP-l-fucose synthase, also known as FX protein, synthesizes GDP-l-fucose from its substrate GDP-4-keto-6-deoxy-d-mannose. The reaction involves epimerization at both C-3 and C-5 followed by an NADPH-dependent reduction of the carbonyl at C-4. In this paper, the first crystal structure of human FX protein was determined at 2.37 Å resolution. The asymmetric unit of the crystal structure contains four molecules which form two homodimers. Each molecule consists of two domains, a Rossmann-fold NADPH-binding motif and a carboxyl terminal domain. Compared with the Escherichia coli GDP-l-fucose synthase, the overall structures of these two enzymes have four major differences. There are four loops in the structure of human FX protein corresponding to two α-helices and two β-sheets in that of the E. coli enzyme. Besides, there are seven different amino acid residues binding with NAPDH comparing human FX protein with that from E. coli. The structure of human FX reveals the key catalytic residues and could be useful for the design of drugs for the treatment of inflammation, auto-immune diseases, and possibly certain types of cancer.

  3. Chromosomal localization of the human and mouse hyaluronan synthase genes

    Energy Technology Data Exchange (ETDEWEB)

    Spicer, A.P.; McDonald, J.A. [Mayo Clinic Scottsdale, AZ (United States); Seldin, M.F. [Univ. of California Davis, CA (United States)] [and others

    1997-05-01

    We have recently identified a new vertebrate gene family encoding putative hyaluronan (HA) synthases. Three highly conserved related genes have been identified, designated HAS1, HAS2, and HAS3 in humans and Has1, Has2, and Has3 in the mouse. All three genes encode predicted plasma membrane proteins with multiple transmembrane domains and approximately 25% amino acid sequence identity to the Streptococcus pyogenes HA synthase, HasA. Furthermore, expression of any one HAS gene in transfected mammalian cells leads to high levels of HA biosynthesis. We now report the chromosomal localization of the three HAS genes in human and in mouse. The genes localized to three different positions within both the human and the mouse genomes. HAS1 was localized to the human chromosome 19q13.3-q13.4 boundary and Has1 to mouse Chr 17. HAS2 was localized to human chromosome 8q24.12 and Has2 to mouse Chr 15. HAS3 was localized to human chromosome 16q22.1 and Has3 to mouse Chr 8. The map position for HAS1 reinforces the recently reported relationship between a small region of human chromosome 19q and proximal mouse chromosome 17. HAS2 mapped outside the predicted critical region delineated for the Langer-Giedion syndrome and can thus be excluded as a candidate gene for this genetic syndrome. 33 refs., 2 figs.

  4. Involvement of an ent-copalyl diphosphate synthase in tissue-specific accumulation of specialized diterpenes in Andrographis paniculata.

    Science.gov (United States)

    Misra, Rajesh Chandra; Garg, Anchal; Roy, Sudeep; Chanotiya, Chandan Singh; Vasudev, Prema G; Ghosh, Sumit

    2015-11-01

    Ent-labdane-related diterpene (ent-LRD) specialized (i.e. secondary) metabolites of the medicinal plant kalmegh (Andrographis paniculata) have long been known for several pharmacological activities. However, our understanding of the ent-LRD biosynthetic pathway has remained largely incomplete. Since ent-LRDs accumulate in leaves, we carried out a comparative transcriptional analysis using leaf and root tissues, and identified 389 differentially expressed transcripts, including 223 transcripts that were preferentially expressed in leaf tissue. Analysis of the transcripts revealed various specialized metabolic pathways, including transcripts of the ent-LRD biosynthetic pathway. Two class II diterpene synthases (ApCPS1 and ApCPS2) along with one (ApCPS1') and two (ApCPS2' and ApCPS2″) transcriptional variants that were the outcomes of alternative splicing of the precursor mRNA and alternative transcriptional termination, respectively, were identified. ApCPS1 and ApCPS2 encode for 832- and 817-amino acids proteins, respectively, and are phylogenetically related to the dicotyledons ent-copalyl diphosphate synthases (ent-CPSs). The spatio-temporal patterns of ent-LRD metabolites accumulation and gene expression suggested a likely role for ApCPS1 in general (i.e. primary) metabolism, perhaps by providing precursor for the biosynthesis of phytohormone gibberellin (GA). However, ApCPS2 is potentially involved in tissue-specific accumulation of ent-LRD specialized metabolites. Bacterially expressed recombinant ApCPS2 catalyzed the conversion of (E,E,E)-geranylgeranyl diphosphate (GGPP), the general precursor of diterpenes to ent-copalyl diphosphate (ent-CPP), the precursor of ent-LRDs. Taken together, these results advance our understanding of the tissue-specific accumulation of specialized ent-LRDs of medicinal importance. Copyright © 2015 Elsevier Ireland Ltd. All rights reserved.

  5. Isolation and functional characterization of a methyl jasmonate-responsive 3-carene synthase from Lavandula x intermedia.

    Science.gov (United States)

    Adal, Ayelign M; Sarker, Lukman S; Lemke, Ashley D; Mahmoud, Soheil S

    2017-04-01

    A methyl jasmonate responsive 3-carene synthase (Li3CARS) gene was isolated from Lavandula x intermedia and functionally characterized in vitro. Lavenders produce essential oils consisting mainly of monoterpenes, including the potent antimicrobial and insecticidal monoterpene 3-carene. In this study we isolated and functionally characterized a leaf-specific, methyl jasmonate (MeJA)-responsive monoterpene synthase (Li3CARS) from Lavandula x intermedia. The ORF excluding transit peptides encoded a 64.9 kDa protein that was expressed in E. coli, and purified with Ni-NTA agarose affinity chromatography. The recombinant Li3CARS converted GPP into 3-carene as the major product, with K m and k cat of 3.69 ± 1.17 µM and 2.01 s -1 respectively. Li3CARS also accepted NPP as a substrate to produce multiple products including a small amount of 3-carene. The catalytic efficiency of Li3CARS to produce 3-carene was over ten fold higher for GPP (k cat /K m = 0.56 µM -1 s -1 ) than NPP (k cat /K m = 0.044 µM -1 s -1 ). Production of distinct end product profiles from different substrates (GPP versus NPP) by Li3CARS indicates that monoterpene metabolism may be controlled in part through substrate availability. Li3CARS transcripts were found to be highly abundant in leaves (16-fold) as compared to flower tissues. The transcriptional activity of Li3CARS correlated with 3-carene production, and was up-regulated (1.18- to 3.8-fold) with MeJA 8-72 h post-treatment. The results suggest that Li3CARS may have a defensive role in Lavandula.

  6. Two solanesyl diphosphate synthases with different subcellular localizations and their respective physiological roles in Oryza sativa.

    Science.gov (United States)

    Ohara, Kazuaki; Sasaki, Kanako; Yazaki, Kazufumi

    2010-06-01

    Long chain prenyl diphosphates are crucial biosynthetic precursors of ubiquinone (UQ) in many organisms, ranging from bacteria to humans, as well as precursors of plastoquinone in photosynthetic organisms. The cloning and characterization of two solanesyl diphosphate synthase genes, OsSPS1 and OsSPS2, in Oryza sativa is reported here. OsSPS1 was highly expressed in root tissue whereas OsSPS2 was found to be high in both leaves and roots. Enzymatic characterization using recombinant proteins showed that both OsSPS1 and OsSPS2 could produce solanesyl diphosphates as their final product, while OsSPS1 showed stronger activity than OsSPS2. However, an important biological difference was observed between the two genes: OsSPS1 complemented the yeast coq1 disruptant, which does not form UQ, whereas OsSPS2 only very weakly complemented the growth defect of the coq1 mutant. HPLC analyses showed that both OsSPS1 and OsSPS2 yeast transformants produced UQ9 instead of UQ6, which is the native yeast UQ. According to the complementation study, the UQ9 levels in OsSPS2 transformants were much lower than that of OsSPS1. Green fluorescent protein fusion analyses showed that OsSPS1 localized to mitochondria, while OsSPS2 localized to plastids. This suggests that OsSPS1 is involved in the supply of solanesyl diphosphate for ubiquinone-9 biosynthesis in mitochondria, whereas OsSPS2 is involved in providing solanesyl diphosphate for plastoquinone-9 formation. These findings indicate that O. sativa has a different mechanism for the supply of isoprenoid precursors in UQ biosynthesis from Arabidopsis thaliana, in which SPS1 provides a prenyl moiety for UQ9 at the endoplasmic reticulum.

  7. Proanthocyanidin synthesis in Theobroma cacao: genes encoding anthocyanidin synthase, anthocyanidin reductase, and leucoanthocyanidin reductase.

    Science.gov (United States)

    Liu, Yi; Shi, Zi; Maximova, Siela; Payne, Mark J; Guiltinan, Mark J

    2013-12-05

    The proanthocyanidins (PAs), a subgroup of flavonoids, accumulate to levels of approximately 10% total dry weight of cacao seeds. PAs have been associated with human health benefits and also play important roles in pest and disease defense throughout the plant. To dissect the genetic basis of PA biosynthetic pathway in cacao (Theobroma cacao), we have isolated three genes encoding key PA synthesis enzymes, anthocyanidin synthase (ANS), anthocyanidin reductase (ANR) and leucoanthocyanidin reductase (LAR). We measured the expression levels of TcANR, TcANS and TcLAR and PA content in cacao leaves, flowers, pod exocarp and seeds. In all tissues examined, all three genes were abundantly expressed and well correlated with PA accumulation levels, suggesting their active roles in PA synthesis. Overexpression of TcANR in an Arabidopsis ban mutant complemented the PA deficient phenotype in seeds and resulted in reduced anthocyanidin levels in hypocotyls. Overexpression of TcANS in tobacco resulted in increased content of both anthocyanidins and PAs in flower petals. Overexpression of TcANS in an Arabidopsis ldox mutant complemented its PA deficient phenotype in seeds. Recombinant TcLAR protein converted leucoanthocyanidin to catechin in vitro. Transgenic tobacco overexpressing TcLAR had decreased amounts of anthocyanidins and increased PAs. Overexpressing TcLAR in Arabidopsis ldox mutant also resulted in elevated synthesis of not only catechin but also epicatechin. Our results confirm the in vivo function of cacao ANS and ANR predicted based on sequence homology to previously characterized enzymes from other species. In addition, our results provide a clear functional analysis of a LAR gene in vivo.

  8. Sunflower (Helianthus annuus) fatty acid synthase complex: enoyl-[acyl carrier protein]-reductase genes.

    Science.gov (United States)

    González-Thuillier, Irene; Venegas-Calerón, Mónica; Garcés, Rafael; von Wettstein-Knowles, Penny; Martínez-Force, Enrique

    2015-01-01

    Enoyl-[acyl carrier protein]-reductases from sunflower. A major factor contributing to the amount of fatty acids in plant oils are the first steps of their synthesis. The intraplastidic fatty acid biosynthetic pathway in plants is catalysed by type II fatty acid synthase (FAS). The last step in each elongation cycle is carried out by the enoyl-[ACP]-reductase, which reduces the dehydrated product of β-hydroxyacyl-[ACP] dehydrase using NADPH or NADH. To determine the mechanisms involved in the biosynthesis of fatty acids in sunflower (Helianthus annuus) seeds, two enoyl-[ACP]-reductase genes have been identified and cloned from developing seeds with 75 % identity: HaENR1 (GenBank HM021137) and HaENR2 (HM021138). The two genes belong to the ENRA and ENRB families in dicotyledons, respectively. The genetic duplication most likely originated after the separation of di- and monocotyledons. RT-qPCR revealed distinct tissue-specific expression patterns. Highest expression of HaENR1 was in roots, stems and developing cotyledons whereas that of H a ENR2 was in leaves and early stages of seed development. Genomic DNA gel blot analyses suggest that both are single-copy genes. In vivo activity of the ENR enzymes was tested by complementation experiments with the JP1111 fabI(ts) E. coli strain. Both enzymes were functional demonstrating that they interacted with the bacterial FAS components. That different fatty acid profiles resulted infers that the two Helianthus proteins have different structures, substrate specificities and/or reaction rates. The latter possibility was confirmed by in vitro analysis with affinity-purified heterologous-expressed enzymes that reduced the crotonyl-CoA substrate using NADH with different V max.

  9. Selectable tolerance to herbicides by mutated acetolactate synthase genes integrated into the chloroplast genome of tobacco.

    Science.gov (United States)

    Shimizu, Masanori; Goto, Maki; Hanai, Moeko; Shimizu, Tsutomu; Izawa, Norihiko; Kanamoto, Hirosuke; Tomizawa, Ken-Ichi; Yokota, Akiho; Kobayashi, Hirokazu

    2008-08-01

    Strategies employed for the production of genetically modified (GM) crops are premised on (1) the avoidance of gene transfer in the field; (2) the use of genes derived from edible organisms such as plants; (3) preventing the appearance of herbicide-resistant weeds; and (4) maintaining transgenes without obstructing plant cell propagation. To this end, we developed a novel vector system for chloroplast transformation with acetolactate synthase (ALS). ALS catalyzes the first step in the biosynthesis of the branched amino acids, and its enzymatic activity is inhibited by certain classes of herbicides. We generated a series of Arabidopsis (Arabidopsis thaliana) mutated ALS (mALS) genes and introduced constructs with mALS and the aminoglycoside 3'-adenyltransferase gene (aadA) into the tobacco (Nicotiana tabacum) chloroplast genome by particle bombardment. Transplastomic plants were selected using their resistance to spectinomycin. The effects of herbicides on transplastomic mALS activity were examined by a colorimetric assay using the leaves of transplastomic plants. We found that transplastomic G121A, A122V, and P197S plants were specifically tolerant to pyrimidinylcarboxylate, imidazolinon, and sulfonylurea/pyrimidinylcarboxylate herbicides, respectively. Transplastomic plants possessing mALSs were able to grow in the presence of various herbicides, thus affirming the relationship between mALSs and the associated resistance to herbicides. Our results show that mALS genes integrated into the chloroplast genome are useful sustainable markers that function to exclude plants other than those that are GM while maintaining transplastomic crops. This investigation suggests that the resistance management of weeds in the field amid growing GM crops is possible using (1) a series of mALSs that confer specific resistance to herbicides and (2) a strategy that employs herbicide rotation.

  10. Deciphering the genomic structure, function and evolution of carotenogenesis related phytoene synthases in grasses

    Directory of Open Access Journals (Sweden)

    Dibari Bianca

    2012-06-01

    Full Text Available Abstract Background Carotenoids are isoprenoid pigments, essential for photosynthesis and photoprotection in plants. The enzyme phytoene synthase (PSY plays an essential role in mediating condensation of two geranylgeranyl diphosphate molecules, the first committed step in carotenogenesis. PSY are nuclear enzymes encoded by a small gene family consisting of three paralogous genes (PSY1-3 that have been widely characterized in rice, maize and sorghum. Results In wheat, for which yellow pigment content is extremely important for flour colour, only PSY1 has been extensively studied because of its association with QTLs reported for yellow pigment whereas PSY2 has been partially characterized. Here, we report the isolation of bread wheat PSY3 genes from a Renan BAC library using Brachypodium as a model genome for the Triticeae to develop Conserved Orthologous Set markers prior to gene cloning and sequencing. Wheat PSY3 homoeologous genes were sequenced and annotated, unravelling their novel structure associated with intron-loss events and consequent exonic fusions. A wheat PSY3 promoter region was also investigated for the presence of cis-acting elements involved in the response to abscisic acid (ABA, since carotenoids also play an important role as precursors of signalling molecules devoted to plant development and biotic/abiotic stress responses. Expression of wheat PSYs in leaves and roots was investigated during ABA treatment to confirm the up-regulation of PSY3 during abiotic stress. Conclusions We investigated the structural and functional determinisms of PSY genes in wheat. More generally, among eudicots and monocots, the PSY gene family was found to be associated with differences in gene copy numbers, allowing us to propose an evolutionary model for the entire PSY gene family in Grasses.

  11. Molecular characterization of Als1, an acetohydroxyacid synthase mutation conferring resistance to sulfonylurea herbicides in soybean.

    Science.gov (United States)

    Ghio, Cecilia; Ramos, María Laura; Altieri, Emiliano; Bulos, Mariano; Sala, Carlos A

    2013-12-01

    The AHAS gene family in soybean was characterized. The locus Als1 for sulfonylurea resistance was mapped and the resistant allele was characterized at the molecular level. Sulfonylurea (SU) resistance in soybean is controlled by Als1, a semi-dominant allele obtained by EMS mutagenesis over the cultivar Williams 82. The overall objective of this research was to map Als1 in the soybean genome and to determine the nucleotidic changes conferring resistance to SU. Four nucleotide sequences (GmAhas1-4) showing high homology with the Arabidopsis thaliana acetohydroxyacid synthase (AHAS, EC 4.1.3.18) gene sequence were identified by in silico analysis, PCR-amplified from the SU-resistant line BTK323STS and sequenced. Expression analysis showed that GmAhas1, located on chromosome 4 by in silico analysis, is the most expressed sequence in true leaves. F2:3 families derived from the cross between susceptible and resistant lines were evaluated for SU resistance. Mapping results indicate that the locus als1 is located on chromosome 4. Sequence comparison of GmAhas1 between BTK323STS and Williams 82 showed a single nucleotide change from cytosine to thymine at position 532. This transversion generates an amino acid change from proline to serine at position 197 (A. thaliana nomenclature) of the AHAS catalytic subunit. An allele-specific marker developed for the GmAhas1 mutant sequence cosegregated with SU resistance in the F2 population. Taking together, the mapping, expression and sequencing results indicate that the GmAhas1 sequence corresponds to the Als1 gene sequence controlling SU resistance in soybean. The molecular breeding tools described herein create the basis to speed up the identification of new mutations in soybean AHAS leading to enhanced levels of resistance to SU or to other families of AHAS inhibitor herbicides.

  12. Selectivity of the surface binding site (SBS) on barley starch synthase I

    DEFF Research Database (Denmark)

    Wilkens, Casper; Cuesta-Seijo, Jose A.; Palcic, Monica

    2014-01-01

    Starch synthase I (SSI) from various sources has been shown to preferentially elongate branch chains of degree of polymerisation (DP) from 6–7 to produce chains of DP 8–12. In the recently determined crystal structure of barley starch synthase I (HvSSI) a so-called surface binding site (SBS) was ...

  13. Inhibition of the ATP Synthase Eliminates the Intrinsic Resistance of Staphylococcus aureus towards Polymyxins

    DEFF Research Database (Denmark)

    Vestergaard, Martin; Nøhr-Meldgaard, Katrine; Bojer, Martin Saxtorph

    2017-01-01

    , linezolid, daptomycin, and oxacillin were unchanged. ATP synthase activity is known to be inhibited by oligomycin A, and the presence of this compound increased polymyxin B-mediated killing of S. aureus Our results demonstrate that the ATP synthase contributes to intrinsic resistance of S. aureus towards...

  14. Creation of a high-amylose durum wheat through mutagenesis of starch synthase II (SSIIa)

    Science.gov (United States)

    In cereal seeds mutations in one or more starch synthases lead to decreased amylopectin and increased amylose content. Here, the impact of starch synthase IIa (SSIIa or SGP-1) mutations upon durum starch was investigated. A screen of durum accessions identified two lines lacking SGP-A1, the A geno...

  15. Cytidine triphosphate synthase activity and mRNA expression in normal human blood cells

    NARCIS (Netherlands)

    Verschuur, A. C.; van Gennip, A. H.; Muller, E. J.; Voûte, P. A.; Vreken, P.; van Kuilenburg, A. B.

    1999-01-01

    Cytidine triphosphate (CTP) synthase is one of the key enzymes in pyrimidine nucleotide anabolic pathways. The activity of this enzyme is elevated in various malignancies including acute lymphocytic leukemia (ALL). In this study we investigated the activity of CTP synthase in various human blood

  16. Cloning and sequence analysis of putative type II fatty acid synthase ...

    Indian Academy of Sciences (India)

    Prakash

    Cloning and sequence analysis of putative type II fatty acid synthase genes from Arachis hypogaea L. ... acyl carrier protein (ACP), malonyl-CoA:ACP transacylase, β-ketoacyl-ACP .... Helix II plays a dominant role in the interaction ... main distinguishing features of plant ACPs in plastids and ..... synthase component; J. Biol.

  17. Reduced methylation of the thromboxane synthase gene is correlated with its increased vascular expression in preeclampsia.

    Science.gov (United States)

    Mousa, Ahmad A; Strauss, Jerome F; Walsh, Scott W

    2012-06-01

    Preeclampsia is characterized by increased thromboxane and decreased prostacyclin levels, which predate symptoms, and can explain some of the clinical manifestations of preeclampsia, including hypertension and thrombosis. In this study, we examined DNA methylation of the promoter region of the thromboxane synthase gene (TBXAS1) and the expression of thromboxane synthase in systemic blood vessels of normal pregnant and preeclamptic women. Thromboxane synthase is responsible for the synthesis of thromboxane A(2), a potent vasoconstrictor and activator of platelets. We also examined the effect of experimentally induced DNA hypomethylation on the expression of thromboxane synthase in a neutrophil-like cell line (HL-60 cells) and in cultured vascular smooth muscle and endothelial cells. We found that DNA methylation of the TBXAS1 promoter was decreased and thromboxane synthase expression was increased in omental arteries of preeclamptic women as compared with normal pregnant women. Increased thromboxane synthase expression was observed in vascular smooth muscles cells, endothelial cells, and infiltrating neutrophils. Experimentally induced DNA hypomethylation only increased expression of thromboxane synthase in the neutrophil-like cell line, whereas tumor necrosis factor-α, a neutrophil product, increased its expression in cultured vascular smooth muscle cells. Our study suggests that epigenetic mechanisms and release of tumor necrosis factor-α by infiltrating neutrophils could contribute to the increased expression of thromboxane synthase in maternal systemic blood vessels, contributing to the hypertension and coagulation abnormalities associated with preeclampsia.

  18. Analysis of Clonostachys rosea-induced resistance to tomato gray mold disease in tomato leaves.

    Directory of Open Access Journals (Sweden)

    Liana Dalcantara Ongouya Mouekouba

    Full Text Available Tomato gray mold disease, caused by Botrytis cinerea, is a serious disease in tomato. Clonostachys rosea is an antagonistic microorganism to B. cinerea. To investigate the induced resistance mechanism of C. rosea, we examined the effects of these microorganisms on tomato leaves, along with changes in the activities of three defense enzymes (PAL, PPO, GST, second messengers (NO, H2O2, O2(- and phytohormones (IAA, ABA, GA3, ZT, MeJA, SA and C2H4. Compared to the control, all treatments induced higher levels of PAL, PPO and GST activity in tomato leaves and increased NO, SA and GA3 levels. The expression of WRKY and MAPK, two important transcription factors in plant disease resistance, was upregulated in C. rosea- and C. rosea plus B. cinerea-treated samples. Two-dimensional gel electrophoresis analysis showed that two abundant proteins were present in the C. rosea plus B. cinerea-treated samples but not in the other samples. These proteins were determined (by mass spectrum analysis to be LEXYL2 (β-xylosidase and ATP synthase CF1 alpha subunit. Therefore, C. rosea plus B. cinerea treatment induces gray mold resistance in tomato. This study provides a basis for elucidating the mechanism of C. rosea as a biocontrol agent.

  19. Tissue-Specific Apocarotenoid Glycosylation Contributes to Carotenoid Homeostasis in Arabidopsis Leaves1

    Science.gov (United States)

    Hübner, Michaela; Matsubara, Shizue; Beyer, Peter

    2015-01-01

    Attaining defined steady-state carotenoid levels requires balancing of the rates governing their synthesis and metabolism. Phytoene formation mediated by phytoene synthase (PSY) is rate limiting in the biosynthesis of carotenoids, whereas carotenoid catabolism involves a multitude of nonenzymatic and enzymatic processes. We investigated carotenoid and apocarotenoid formation in Arabidopsis (Arabidopsis thaliana) in response to enhanced pathway flux upon PSY overexpression. This resulted in a dramatic accumulation of mainly β-carotene in roots and nongreen calli, whereas carotenoids remained unchanged in leaves. We show that, in chloroplasts, surplus PSY was partially soluble, localized in the stroma and, therefore, inactive, whereas the membrane-bound portion mediated a doubling of phytoene synthesis rates. Increased pathway flux was not compensated by enhanced generation of long-chain apocarotenals but resulted in higher levels of C13 apocarotenoid glycosides (AGs). Using mutant lines deficient in carotenoid cleavage dioxygenases (CCDs), we identified CCD4 as being mainly responsible for the majority of AGs formed. Moreover, changed AG patterns in the carotene hydroxylase mutants lutein deficient1 (lut1) and lut5 exhibiting altered leaf carotenoids allowed us to define specific xanthophyll species as precursors for the apocarotenoid aglycons detected. In contrast to leaves, carotenoid hyperaccumulating roots contained higher levels of β-carotene-derived apocarotenals, whereas AGs were absent. These contrasting responses are associated with tissue-specific capacities to synthesize xanthophylls, which thus determine the modes of carotenoid accumulation and apocarotenoid formation. PMID:26134165

  20. Functional specificity of cardiolipin synthase revealed by the identification of a cardiolipin synthase CrCLS1 in Chlamydomonas reinhardtii

    Directory of Open Access Journals (Sweden)

    Chun-Hsien eHung

    2016-01-01

    Full Text Available Phosphatidylglycerol (PG and cardiolipin (CL are two essential classes of phospholipid in plants and algae. Phosphatidylglycerophosphate synthase (PGPS and cardiolipin synthase (CLS involved in the biosynthesis of PG and CL belong to CDP-alcohol phosphotransferase and share overall amino acid sequence homology. However, it remains elusive whether PGPS and CLS are functionally distinct in vivo. Here, we report identification of a gene encoding CLS in Chlamydomonas reinhardtii, CrCLS1, and its functional compatibility. Whereas CrCLS1 did not complement the growth phenotype of a PGPS mutant of Synechocystis sp. PCC 6803, it rescued the temperature-sensitive growth phenotype, growth profile with different carbon sources, phospholipid composition and enzyme activity of ∆crd1, a CLS mutant of Saccharomyces cerevisiae. These results suggest that CrCLS1 encodes a functional CLS of C. reinhardtii as the first identified algal CLS, whose enzyme function is distinct from that of PGPSs from C. reinhardtii. Comparison of CDP-alcohol phosphotransferase motif between PGPS and CLS among different species revealed a possible additional motif that might define the substrate specificity of these closely related enzymes.

  1. University Students Leaving Relationships (USLR): Scale Development and Gender Differences in Decisions to Leave Romantic Relationships

    Science.gov (United States)

    Hendy, Helen M.; Can, S. Hakan; Joseph, Lauren J.; Scherer, Cory R.

    2013-01-01

    The University Students Leaving Relationships scale was developed to identify student concerns when contemplating dissolution of romantic relationships. Participants included 1,106 students who rated the importance of issues when deciding to leave relationships. Factor analysis produced three dimensions: Missing the Relationship, Social…

  2. Application of a Colorimetric Assay to Identify Putative Ribofuranosylaminobenzene 5'-Phosphate Synthase Genes Expressed with Activity in Escherichia coli

    OpenAIRE

    Bechard, Matthew E.; Chhatwal, Sonya; Garcia, Rosemarie E.; Rasche, Madeline E.

    2003-01-01

    Tetrahydromethanopterin (H4MPT) is a tetrahydrofolate analog originally discovered in methanogenic archaea, but later found in other archaea and bacteria. The extent to which H4MPT occurs among living organisms is unknown. The key enzyme which distinguishes the biosynthetic pathways of H4MPT and tetrahydrofolate is ribofuranosylaminobenzene 5'-phosphate synthase (RFAP synthase). Given the importance of RFAP synthase in H4MPT biosynthesis, the identification of putative RFAP synthase genes and...

  3. Occupational exposures and sick leave during pregnancy

    DEFF Research Database (Denmark)

    Hansen, Mette Lausten; Thulstrup, Ane Marie; Juhl, Mette

    2015-01-01

    OBJECTIVE: This study aimed to investigate associations between work postures, lifting at work, shift work, work hours, and job strain and the risk of sick leave during pregnancy from 10-29 completed pregnancy weeks in a large cohort of Danish pregnant women. METHODS: Data from 51 874 pregnancies...... in the Danish National Birth Cohort collected between 1996-2002 were linked to the Danish Register for Evaluation of Marginalization. Exposure information was based on telephone interviews. Hazard ratios (HR) with 95% confidence intervals (95% CI) were calculated by Cox regression analysis, using time of first...... episode of sick leave as the primary outcome. RESULTS: We found statistically significant associations between all the predictors and risk of sick leave; for non-sitting work postures (HRrange 1.55-2.79), cumulative lifting HRtrend 1.29, 95% CI 1.26-1.31, shift work (HRevening 1.90, 95% CI 1...

  4. The dewetting properties of lotus leaves.

    Science.gov (United States)

    Zhang, Jihua; Sheng, Xianliang; Jiang, Lei

    2009-02-03

    The high dewetting abilities of lotus leaves can be transited to a complete wetting state by soaking the leaves in water at a depth of 50 cm for 2 h. However, after being dried by N2 gas, the high dewetting behavior of lotus leaves may be mostly restored. This indicates that experimental procedure might considerably affect the dewetting abilities of lotus leaves. To discover the mechanism underlying this interesting dewetting phenomena, the dewetting force was used to characterize the dewetting abilities of surfaces, and model studies to mimic the papillae were done. Surface hydrophobicity, sizes, rise angles, and secondary structures of the models' sides affected their dewetting force with water. So we suggested that the dewetting states, Cassie or Wenzel's state, of lotus surfaces depend much on the depth of water, i.e., the hydraulic pressure. On the other hand, the primary structures of papillae in Cassie's state led to a high receding angle with respect to the plane of the leaf during the dewetting measurement. The secondary structures and micro/nano arrays of papillae increased the dewetting abilities of lotus leaves, since no water intruded between papillae. However, the structures of papillae in Wenzle's state significantly reduced the dewetting abilities of lotus leaves after being soaked at a depth of 50 cm for 2 h. Therefore, as for novel designs of microdevices floating on water, including the use of the high dewetting properties of suphydrophobic materials, surface (primary or secondary) microstructure and external pressure, such as static hydraulic pressure, must be taken into account.

  5. Arabidopsis thickvein mutation affects vein thickness and organ vascularization, and resides in a provascular cell-specific spermine synthase involved in vein definition and in polar auxin transport.

    Science.gov (United States)

    Clay, Nicole K; Nelson, Timothy

    2005-06-01

    Polar auxin transport has been implicated in the induction of vascular tissue and in the definition of vein positions. Leaves treated with chemical inhibitors of polar auxin transport exhibited vascular phenotypes that include increased vein thickness and vascularization. We describe a recessive mutant, thickvein (tkv), which develops thicker veins in leaves and in inflorescence stems. The increased vein thickness is attributable to an increased number of vascular cells. Mutant plants have smaller leaves and shorter inflorescence stems, and this reduction in organ size and height is accompanied by an increase in organ vascularization, which appears to be attributable to an increase in the recruitment of cells into veins. Furthermore, although floral development is normal, auxin transport in the inflorescence stem is significantly reduced in the mutant, suggesting that the defect in auxin transport is responsible for the vascular phenotypes. In the primary root, the veins appear morphologically normal, but root growth in the tkv mutant is hypersensitive to exogenous cytokinin. The tkv mutation was found to reside in the ACL5 gene, which encodes a spermine synthase and whose expression is specific to provascular cells. We propose that ACL5/TKV is involved in vein definition (defining the boundaries between veins and nonvein regions) and in polar auxin transport, and that polyamines are involved in this process.

  6. Expression of the multimeric and highly immunogenic Brucella spp. lumazine synthase fused to bovine rotavirus VP8d as a scaffold for antigen production in tobacco chloroplasts

    Directory of Open Access Journals (Sweden)

    Edgardo Federico Alfano

    2015-12-01

    Full Text Available Lumazine synthase from Brucella spp. (BLS is a highly immunogenic decameric protein which can accommodate foreign polypeptides or protein domains fused to its N-termini, markedly increasing their immunogenicity.The inner core domain (VP8d of VP8 spike protein from bovine rotavirus (BRV is responsible for viral adhesion to sialic acid residues and infection. It also displays neutralizing epitopes, making it a good candidate for vaccination.In this work, the BLS scaffold was assessed for the first time in plants for recombinant vaccine development by N-terminally fusing BLS to VP8d and expressing the resulting fusion (BLSVP8d in tobacco chloroplasts. Transplastomic plants were obtained and characterized by Southern, northern and western blot. BLSVP8d was highly expressed, representing 40% of total soluble protein (TSP (4.85 mg/g fresh tissue. BLSVP8d remained soluble and stable during all stages of plant development and even in lyophilized leaves stored at room temperature. Soluble protein extracts from fresh and lyophilized leaves were able to induce specific neutralizing IgY antibodies in a laying hen model. This work presents BLS as an interesting platform for highly immunogenic injectable, or even oral, subunit vaccines. Lyophilization of transplastomic leaves expressing stable antigenic fusions to BLS would further reduce costs and simplify downstream processing, purification and storage, allowing for more practical vaccines.

  7. Maternal Employment Effects of Paid Parental Leave

    OpenAIRE

    Bergemann, Annette; Riphahn, Regina T.

    2015-01-01

    We study the short, medium, and longer run employment effects of a substantial change in the parental leave benefit program in Germany. In 2007, a means-tested parental leave transfer program that had paid benefits for up to two years was replaced by an earnings related transfer which paid benefits for up to one year. The reform generated winners and losers with heterogeneous response incentives. We find that the reform speeds up the labor market return of both groups of mothers after benefit...

  8. Does paternity leave affect mothers’ sickness absence

    OpenAIRE

    Bratberg, Espen; Naz, Ghazala

    2009-01-01

    Female labour force participation is high in Norway but sickness absence rates are higher for women than for men. This may be partly a result of unequal sharing of childcare in the family. In this paper, we consider the effect of paternity leave on sickness absence among women who have recently given birth. We draw on a six-year panel taken from full population data from administrative sources. We find that in the 6% of families where fathers take out leave more than the standard quota (gende...

  9. Preparing Apigenin from Leaves of Adinandra nitida

    Directory of Open Access Journals (Sweden)

    Zhengxiang Ning

    2008-01-01

    Full Text Available Leaves of Adinandra nitida were used as raw material, and a new industrially significant method of preparing apigenin was established by hydrolyzing a water extract and recrystallizing it with ethanol in order to obtain a new source for the production of this flavone. A yield of about 2.5 % (dry mass was obtained with the purity of 93.05 %, determined by high performance liquid chromatography (HPLC. Moreover, the main flavonoids in leaves of Adinandra nitida and the product after acid hydrolysis were identified as camellianin A and apigenin, respectively, by ultraviolet-visible spectrometry (UV/VIS and electrospray ionization mass spectrometry (ESI-MS.

  10. Cloning and heterologous expression of a novel subgroup of class IV polyhydroxyalkanoate synthase genes from the genus Bacillus.

    Science.gov (United States)

    Mizuno, Kouhei; Kihara, Takahiro; Tsuge, Takeharu; Lundgren, Benjamin R; Sarwar, Zaara; Pinto, Atahualpa; Nomura, Christopher T

    2017-01-01

    Many microorganisms harbor genes necessary to synthesize biodegradable plastics known as polyhydroxyalkanoates (PHAs). We surveyed a genomic database and discovered a new cluster of class IV PHA synthase genes (phaRC). These genes are different in sequence and operon structure from any previously reported PHA synthase. The newly discovered PhaRC synthase was demonstrated to produce PHAs in recombinant Escherichia coli.

  11. Altering the expression of two chitin synthase genes differentially affects the growth and morphology of Aspergillus oryzae

    DEFF Research Database (Denmark)

    Müller, Christian; Hjort, C.M.; Hansen, K.

    2002-01-01

    In Aspergillus oryzae, one full-length chitin synthase (chsB) and fragments of two other chitin synthases (csmA and chsC) were identified. The deduced amino acid sequence of chsB was similar (87% identity) to chsB from Aspergillus nidulans, which encodes a class III chitin synthase. The sequence...

  12. 38 CFR 21.342 - Leave accounting policy.

    Science.gov (United States)

    2010-07-01

    ... 38 Pensions, Bonuses, and Veterans' Relief 2 2010-07-01 2010-07-01 false Leave accounting policy. 21.342 Section 21.342 Pensions, Bonuses, and Veterans' Relief DEPARTMENT OF VETERANS AFFAIRS.... Chapter 31 Leaves of Absence § 21.342 Leave accounting policy. (a) Amount of leave. A veteran pursuing one...

  13. 29 CFR 825.120 - Leave for pregnancy or birth.

    Science.gov (United States)

    2010-07-01

    ... Regulations Relating to Labor (Continued) WAGE AND HOUR DIVISION, DEPARTMENT OF LABOR OTHER LAWS THE FAMILY AND MEDICAL LEAVE ACT OF 1993 Coverage Under the Family and Medical Leave Act § 825.120 Leave for... of a child as follows: (1) Both the mother and father are entitled to FMLA leave for the birth of...

  14. 77 FR 8959 - The Family and Medical Leave Act

    Science.gov (United States)

    2012-02-15

    ...; and extends FMLA military caregiver leave to family members of certain veterans with serious injuries... Medical Leave Act of 1993, Final Rule on November 17, 2008 (2008 final rule). 73 FR 67934. A. What the... covered servicemember (referred to as ``military caregiver leave''). These two leave entitlements are...

  15. Corn silk induces nitric oxide synthase in murine macrophages.

    Science.gov (United States)

    Kim, Kyung A; Choi, Sang Kyu; Choi, Hye Seon

    2004-12-31

    Corn silk has been purified as an anticoagulant previously and the active component is a polysaccharide with a molecular mass of 135 kDa. It activates murine macrophages to induce nitric oxide synthase (NOS) and generate substantial amounts of NO in time and dose-dependent manners. It was detectable first at 15 h after stimulation by corn silk, peaked at 24 h, and undetectable by 48 h. Induction of NOS is inhibited by pyrolidine dithiocarbamate (PDTC) and genistein, an inhibitor of nuclear factor kappa B (NF-kappaB) and tyrosine kinase, respectively, indicating that iNOS stimulated by corn silk is associated with tyrosine kinase and NF-kappaB signaling pathways. IkappaB-alpha degradation was detectible at 10 min, and the level was restored at 120 min after treatment of corn silk. Corn silk induced nuclear translocation of NF-kappaB by phosphorylation and degradation of IkappaB-alpha.

  16. CTP synthase forms the cytoophidium in human hepatocellular carcinoma.

    Science.gov (United States)

    Chang, Chia-Chun; Jeng, Yung-Ming; Peng, Min; Keppeke, Gerson Dierley; Sung, Li-Ying; Liu, Ji-Long

    2017-12-15

    CTP synthase (CTPS) can aggregate into an intracellular macrostructure, the cytoophidium, in various organisms including human cells. Previous studies have shown that assembly of human CTPS cytoophidia may be correlated with the cellular metabolic status, and is able to promote the activity of CTPS. A correlation between the cytoophidium and cancer metabolism has been proposed but not yet been revealed. In the current study we provide clear evidence of the presence of CTPS cytoophidia in various human cancers and some non-cancerous tissues. Moreover, among 203 tissue samples of hepatocellular carcinoma, 56 (28%) samples exhibited many cytoophidia, whereas no cytoophidia were detected in adjacent non-cancerous hepatocytes for all samples. Our findings suggest that the CTPS cytoophidium may participate in the adaptive metabolism of human hepatocellular carcinoma. Copyright © 2017. Published by Elsevier Inc.

  17. Reduced ceramide synthase 2 activity causes progressive myoclonic epilepsy

    DEFF Research Database (Denmark)

    Mosbech, Mai-Britt; Olsen, Anne S B; Neess, Ditte

    2014-01-01

    between genes involved in SL metabolism and epilepsy. METHODS: We used quantitative real-time PCR, Western blotting, and enzymatic assays to determine the mRNA, protein, and activity levels of ceramide synthase 2 (CERS2) in fiibroblasts isolated from parental control subjects and from a patient diagnosed...... with progressive myoclonic epilepsy (PME). Mass spectrometry and fluorescence microscopy were used to examine the effects of reduced CERS2 activity on cellular lipid composition and plasma membrane functions. RESULTS: We identify a novel 27 kb heterozygous deletion including the CERS2 gene in a proband diagnosed...... with PME. Compared to parental controls, levels of CERS2 mRNA, protein, and activity were reduced by ˜50% in fibroblasts isolated from this proband, resulting in significantly reduced levels of ceramides and sphingomyelins containing the very long-chain fatty acids C24:0 and C26:0. The change in SL...

  18. Sphingomyelin Synthase 1 Is Essential for Male Fertility in Mice.

    Directory of Open Access Journals (Sweden)

    Anke Wittmann

    Full Text Available Sphingolipids and the derived gangliosides have critical functions in spermatogenesis, thus mutations in genes involved in sphingolipid biogenesis are often associated with male infertility. We have generated a transgenic mouse line carrying an insertion in the sphingomyelin synthase gene Sms1, the enzyme which generates sphingomyelin species in the Golgi apparatus. We describe the spermatogenesis defect of Sms1-/- mice, which is characterized by sloughing of spermatocytes and spermatids, causing progressive infertility of male homozygotes. Lipid profiling revealed a reduction in several long chain unsaturated phosphatidylcholins, lysophosphatidylcholins and sphingolipids in the testes of mutants. Multi-Spectral Optoacoustic Tomography indicated blood-testis barrier dysfunction. A supplementary diet of the essential omega-3 docosahexaenoic acid and eicosapentaenoic acid diminished germ cell sloughing from the seminiferous epithelium and restored spermatogenesis and fertility in 50% of previously infertile mutants. Our findings indicate that SMS1 has a wider than anticipated role in testis polyunsaturated fatty acid homeostasis and for male fertility.

  19. Cellulose synthases: new insights from crystallography and modeling.

    Science.gov (United States)

    Slabaugh, Erin; Davis, Jonathan K; Haigler, Candace H; Yingling, Yaroslava G; Zimmer, Jochen

    2014-02-01

    Detailed information about the structure and biochemical mechanisms of cellulose synthase (CelS) proteins remained elusive until a complex containing the catalytic subunit (BcsA) of CelS from Rhodobacter sphaeroides was crystalized. Additionally, a 3D structure of most of the cytosolic domain of a plant CelS (GhCESA1 from cotton, Gossypium hirsutum) was produced by computational modeling. This predicted structure contributes to our understanding of how plant CelS proteins may be similar and different as compared with BcsA. In this review, we highlight how these structures impact our understanding of the synthesis of cellulose and other extracellular polysaccharides. We show how the structures can be used to generate hypotheses for experiments testing mechanisms of glucan synthesis and translocation in plant CelS. Copyright © 2013 Elsevier Ltd. All rights reserved.

  20. The variability of sesquiterpenes emitted from two Zea mays cultivars is controlled by allelic variation of two terpene synthase genes encoding stereoselective multiple product enzymes.

    Science.gov (United States)

    Köllner, Tobias G; Schnee, Christiane; Gershenzon, Jonathan; Degenhardt, Jörg

    2004-05-01

    The mature leaves and husks of Zea mays release a complex blend of terpene volatiles after anthesis consisting predominantly of bisabolane-, sesquithujane-, and bergamotane-type sesquiterpenes. The varieties B73 and Delprim release the same volatile constituents but in significantly different proportions. To study the molecular genetic and biochemical mechanisms controlling terpene diversity and distribution in these varieties, we isolated the closely related terpene synthase genes terpene synthase4 (tps4) and tps5 from both varieties. The encoded enzymes, TPS4 and TPS5, each formed the same complex mixture of sesquiterpenes from the precursor farnesyl diphosphate but with different proportions of products. These mixtures correspond to the sesquiterpene blends observed in the varieties B73 and Delprim, respectively. The differences in the stereoselectivity of TPS4 and TPS5 are determined by four amino acid substitutions with the most important being a Gly instead of an Ala residue at position 409 at the catalytic site of the enzyme. Although both varieties contain tps4 and tps5 alleles, their differences in terpene composition result from the fact that B73 has only a single functional allele of tps4 and no functional alleles of tps5, whereas Delprim has only a functional allele of tps5 and no functional alleles of tps4. Lack of functionality was shown to be attributable to frame-shift mutations or amino acid substitutions that greatly reduce the activity of their encoded proteins. Therefore, the diversity of sesquiterpenes in these two maize cultivars is strongly influenced by single nucleotide changes in the alleles of two terpene synthase genes.

  1. Two Cycloartenol Synthases for Phytosterol Biosynthesis in Polygala tenuifolia Willd.

    Science.gov (United States)

    Jin, Mei Lan; Lee, Woo Moon; Kim, Ok Tae

    2017-11-15

    Oxidosqualene cyclases (OSCs) are enzymes that play a key role in control of the biosynthesis of phytosterols and triterpene saponins. In order to uncover OSC genes from Polygala tenuifolia seedlings induced by methyl jasmonate (MeJA), RNA-sequencing analysis was performed using the Illumina sequencing platform. A total of 148,488,632 high-quality reads from two samples (control and the MeJA treated) were generated. We screened genes related to phytosterol and triterpene saponin biosynthesis and analyzed the transcriptional changes of differentially expressed unigene (DEUG) values calculated by fragments per kilobase million (FPKM). In our datasets, two full-length cDNAs of putative OSC genes, PtCAS1 , and PtCAS2 , were found, in addition to the PtBS (β-amyrin synthase) gene reported in our previous studies and the two cycloartenol synthase genes of P. tenuifolia . All genes were isolated and characterized in yeast cells. The functional expression of the two PtCAS genes in yeast cells showed that the genes all produce a cycloartenol as the sole product. When qRT-PCR analysis from different tissues was performed, the expressions of PtCAS1 and PtCAS2 were highest in flowers and roots, respectively. After MeJA treatment, the transcripts of PtCAS1 and PtCAS2 genes increased by 1.5- and 2-fold, respectively. Given these results, we discuss the potential roles of the two PtCAS genes in relation to triterpenoid biosynthesis.

  2. Two Cycloartenol Synthases for Phytosterol Biosynthesis in Polygala tenuifolia Willd

    Directory of Open Access Journals (Sweden)

    Mei Lan Jin

    2017-11-01

    Full Text Available Oxidosqualene cyclases (OSCs are enzymes that play a key role in control of the biosynthesis of phytosterols and triterpene saponins. In order to uncover OSC genes from Polygala tenuifolia seedlings induced by methyl jasmonate (MeJA, RNA-sequencing analysis was performed using the Illumina sequencing platform. A total of 148,488,632 high-quality reads from two samples (control and the MeJA treated were generated. We screened genes related to phytosterol and triterpene saponin biosynthesis and analyzed the transcriptional changes of differentially expressed unigene (DEUG values calculated by fragments per kilobase million (FPKM. In our datasets, two full-length cDNAs of putative OSC genes, PtCAS1, and PtCAS2, were found, in addition to the PtBS (β-amyrin synthase gene reported in our previous studies and the two cycloartenol synthase genes of P. tenuifolia. All genes were isolated and characterized in yeast cells. The functional expression of the two PtCAS genes in yeast cells showed that the genes all produce a cycloartenol as the sole product. When qRT-PCR analysis from different tissues was performed, the expressions of PtCAS1 and PtCAS2 were highest in flowers and roots, respectively. After MeJA treatment, the transcripts of PtCAS1 and PtCAS2 genes increased by 1.5- and 2-fold, respectively. Given these results, we discuss the potential roles of the two PtCAS genes in relation to triterpenoid biosynthesis.

  3. The evolution of function in strictosidine synthase-like proteins.

    Science.gov (United States)

    Hicks, Michael A; Barber, Alan E; Giddings, Lesley-Ann; Caldwell, Jenna; O'Connor, Sarah E; Babbitt, Patricia C

    2011-11-01

    The exponential growth of sequence data provides abundant information for the discovery of new enzyme reactions. Correctly annotating the functions of highly diverse proteins can be difficult, however, hindering use of this information. Global analysis of large superfamilies of related proteins is a powerful strategy for understanding the evolution of reactions by identifying catalytic commonalities and differences in reaction and substrate specificity, even when only a few members have been biochemically or structurally characterized. A comparison of >2500 sequences sharing the six-bladed β-propeller fold establishes sequence, structural, and functional links among the three subgroups of the functionally diverse N6P superfamily: the arylesterase-like and senescence marker protein-30/gluconolactonase/luciferin-regenerating enzyme-like (SGL) subgroups, representing enzymes that catalyze lactonase and related hydrolytic reactions, and the so-called strictosidine synthase-like (SSL) subgroup. Metal-coordinating residues were identified as broadly conserved in the active sites of all three subgroups except for a few proteins from the SSL subgroup, which have been experimentally determined to catalyze the quite different strictosidine synthase (SS) reaction, a metal-independent condensation reaction. Despite these differences, comparison of conserved catalytic features of the arylesterase-like and SGL enzymes with the SSs identified similar structural and mechanistic attributes between the hydrolytic reactions catalyzed by the former and the condensation reaction catalyzed by SS. The results also suggest that despite their annotations, the great majority of these >500 SSL sequences do not catalyze the SS reaction; rather, they likely catalyze hydrolytic reactions typical of the other two subgroups instead. This prediction was confirmed experimentally for one of these proteins. Copyright © 2011 Wiley-Liss, Inc.

  4. Intestinal nitric oxide synthase activity changes during experimental colon obstruction.

    Science.gov (United States)

    Palásthy, Zsolt; Kaszaki, József; Lázár, György; Nagy, Sándor; Boros, Mihály

    2006-08-01

    The experiments in this study were designed to follow the time course of nitric oxide (NO) synthesis in the large bowel during acute mechanical ileus. Occlusion of the mid-transverse colon was maintained for 420 min in anesthetized dogs. Strain-gauge transducers were used to analyze motility changes on the hepatic and lienal flexures, respectively. Constitutive NO synthase (cNOS) and inducible NOS (iNOS) activities were determined in tissue biopsies, and plasma nitrite/nitrate (NOx) level was measured in the portal blood. Following completion of the baseline studies, the animals were treated with either 7-nitroindazole (7-NI, selective neuronal NOS inhibitor), or N-nitro-L-arginine (NNA, non-selective NOS inhibitor). In the sham-operated group the cNOS activities differed significantly in the oral and aboral tissue samples (oral: 102.9; versus aboral: 62.1 fmol/mg protein/min). The obstruction elicited a significant increase in portal NOx and elevated tissue inducible NO synthase (iNOS) activity. NNA treatment decreased the motility index in both intestinal segments for 60 min, but 120 min later the motility index was significantly elevated (2.5-fold increase in the oral part, and 1.8-fold enhancement in the aboral segment, respectively). Treatment with 7-NI decreased the cNOS activity in the oral and aboral parts by approximately 40% and 70%, respectively, and suppressed the motility increase in the aboral colon segment. The motility of the colon was either significantly increased or decreased, depending on the type and selectivity of the NOS inhibitor compounds applied. NO of neuronal origin is a transmitter that stimulates peristaltic activity; but an increased iNOS/nNOS ratio significantly moderates the obstruction-induced motility increase.

  5. Glycogen Synthase in Sertoli Cells: More Than Glycogenesis?

    Science.gov (United States)

    Maldonado, Rodrigo; Mancilla, Héctor; Villarroel-Espíndola, Franz; Slebe, Felipe; Slebe, Juan Carlos; Méndez, Raúl; Guinovart, Joan J; Concha, Ilona I

    2016-11-01

    Sertoli cell metabolism actively maintains the nutritional needs of germ cells. It has been described that after glucose incorporation in Sertoli cells, less than 1% is converted to glycogen suggesting low levels of glycogen synthase activity. Phosphorylation of muscle glycogen synthase (MGS) at serine 640 (pS640MGS) decreases its activity, and this form of the enzyme was discovered as a non-ribosomal protein that modulates the translation of a subset of transcripts in HeLa cells. The aim of our study was to functionally characterize MGS in cultured Sertoli cells, as well as to explore this new feature related to RNA molecules. We detected MGS in the cytoplasm of Sertoli cells as well as in the nuclei. The activity rates of the enzyme were extremely low indicating that MGS is expressed but almost inactive. Protein targeting to glycogen (PTG) overexpression was performed to activate MGS by dephosphorylation. PTG induced glycogen synthesis massively, confirming that this enzyme is present but inactive. This finding correlates with high levels of pS640MGS, which were assayed by phosphatase treatment. To explore a putative new function for MGS in Sertoli cells, we performed RNA immunoprecipitation coupled to microarray studies. The results revealed that MGS co-immunoprecipitated with the several mRNAs and also rRNAs. These findings indicate that MGS is expressed Sertoli cells but in an inactive form, and also support a possibly novel feature of this metabolic enzyme associated with RNA-related molecules. J. Cell. Biochem. 117: 2597-2607, 2016. © 2016 Wiley Periodicals, Inc. © 2016 Wiley Periodicals, Inc.

  6. Mutational, Phylogeny and Evolution Analyses of Salvia Copalyl Diphosphate Synthase

    International Nuclear Information System (INIS)

    Hao, D. C.; Thimmappa, R. B.; Xiao, P. G.

    2016-01-01

    The cyclization of geranylgeranyl diphosphate (GGPP) is catalyzed by copalyl diphosphate synthase (CPS), a class II diterpene synthase (diTPS), to form copalyl diphosphate (CPP), which is an essential substrate of a variety of diterpenes in secondary metabolism of angiosperm including Salvia medicinal plants. The protein environment of the N-terminal class II active site stabilizes the carbocation intermediates and maintains the catalytic activity of angiosperm class II diTPS. The virtual modeling and mutagenesis of the class II diTPS of Salvia miltiorrhiza (SmCPS) were accomplished to illuminate the catalytic activity of SmCPS. Terminal truncations and point mutations established the role of the Beta-Gamma domain and Alpha domain, i.e., they facilitate the flexible conformational change of the class II active site after substrate binding. E203 and K238 in the N-ter Gamma domain of SmCPS1 are functional in the substrate binding and conformational transition and might be essential in catalysis. Similar to other CPSs, the ensuing protonation of the GGPP substrate and coordination of the diphosphate group are governed by highly conserved residues in the DxDD motif of SmCPS, e.g., D372 of CPS1. Moreover, F256 and Y505 stabilize the carbocation and control the enzymatic activity during CPP formation. The amino acids of the predicted active sites, despite under purifying selection, vary greatly, corresponding to the functional flexibility of angiosperm CPSs. Molecular phylogeny and evolution analyses suggest early and ongoing evolution of labdane-related diterpenoid metabolism in angiosperm. (author)

  7. Paid maternity and paternity leave: rights and choices.

    Science.gov (United States)

    Jordan, Claire

    2007-01-01

    From April 2007 onwards, maternity leave will be raised to nine months Paid maternity leave is associated with significant health benefits for babies, including reduced infant mortality The Government proposes to increase paid maternity leave to one year and introduce additional paternity leave by around 2009 The U.K's provision for maternity leave and child care is more generous than the U.S.A. or Australia but less than in the Scandinavian countries

  8. An Internatioal Comparison and Assessment of Maternity Leave Regulation

    OpenAIRE

    Dorothea Alewell, Kerstin Pull

    2001-01-01

    Provisions for maternity leave are common among industrialized countries, but their institutional design varies distinctly from country to country. Developing our theory on the impact on maternity leave regulations on women's labor market situation, we argue that a woman on leave creates a re-organization problem for her employer. The costs of re-organization will not simply increase with the duration of maternity leave, but display a hump-shaped curvature which peeks at medium-leave duration...

  9. (annonaceae) leaves-a potential antimalarial drug

    African Journals Online (AJOL)

    Xylopia species are widely available in West Africa. Xylopia parviflora (Benth) plant is used in folk medicine in the management of a number of ailments, one of these is the use of the leaves in the treatment of malaria fever for which a number of patients have reported its beneficial effects. This study was designed to ...

  10. leaves extract on mild steel in acid

    African Journals Online (AJOL)

    ADOWIE PERE

    The volume of the cathodic hydrogen gas evolved was also plotted as a .... prevent the escape of hydrogen gas. The volume .... Clivia nobilis leaves extract on the flow of current ... behaviour of ethanol extract of Piper guinensis as a green ...

  11. Borneol from Leaves of Blumea balsamifera

    African Journals Online (AJOL)

    and organic solvent of low boiling-point extract. At present ... localized at 800 m altitude, 25° 04´ N and 106°. 28´ E. The ... In HDSE, leaves and water were used in similar amounts .... rate of (–)-borneol did not increase significantly. (p > 0.05) ...

  12. Thaumatococcus daniellii leaves: its chemical compositions ...

    African Journals Online (AJOL)

    Methanol extract of the plant exhibited low 1,1-diphenyl-2-picrylhydrazyl (DPPH) radical scavenging activity with IC50 of 615.14 μg/ml. Gas chromatography-mass spectrometry (GC-MS) characterization of n-hexane, ethylacetate and methanol extracts of T. daniellii leaves identified , thirteen and fifteen compounds, with ...

  13. Fungi colonizing dead leaves of herbs

    Directory of Open Access Journals (Sweden)

    Maria Kowalik

    2013-04-01

    Full Text Available The material was collected from the Botanical Garden and the Collegium Medicum Medicinal Plant Garden of the Jagiellonian University in Krakow. The investigated species were: lemon balm (Mellisa officinalis L., common lavender (Lavendula angustifolia Mill., horsemint (Mentha longifolia L., sage (Salvia officinalis L., sweet basil (Ocimum basilicum L., and wild marjoram (Origanum vulgare L.. The aim of the investigation was to identify fungi causing the death of leaf tissues of herbs from the mint family Lamiaceae. In mycological investigations, 180 fragments of each plant leaves (1,080 dead leaf fragments in total were placed in a 2% PDA medium. Over 970 colonies of fungi belonging to 48 species were isolated from the dead leaf tissues of the six herb species. Alternaria alternata (toxin-producing, Epicoccum nigrum and Sordaria fimicola were the most frequently isolated. The largest numbers of colonies and species of fungi were isolated from horsemint, while the lowest numbers were from wild marjoram leaves. It was shown that the death of leaves of selected herb species from the Lamiaceae family was caused by various fungi. The results of the mycological analysis confirmed the diversity of species colonizing the leaves of the herbs.

  14. Comparative morphology on leaves of Daphniphyllum (Daphniphyllaceae)

    NARCIS (Netherlands)

    Tang, M.-S.; Yang, Y.-P.; Sheue, C.-R.

    2009-01-01

    A comparative anatomical study on the leaves of nine out of 29 species of the genus Daphniphyllum was performed to seek support for the present infrageneric classification. Daphniphyllum is composed of two sections, Lunata (with one subsection Lunata) and Daphniphyllum (with two subsections,

  15. Fathers on Parental Leave in Denmark

    DEFF Research Database (Denmark)

    Reinicke, Kenneth; Cybulski, Franz Wilhelm; Drews, Lea Vedel

    2005-01-01

    In the article it is argued that contemporary fatherhood and masculinity differ increasingly from hegemonic masculinity according to which men are primarily responsible for ensuring the financial basis of the family. The article “Fathers on Parental Leave in Denmark”, based on interviews with 15...

  16. Ladybugs and Lettuce Leaves. Teachers' Manual.

    Science.gov (United States)

    Barnes, Tracy; And Others

    This is a guide for use with "Ladybugs and Lettuce Leaves" activity cards which are activities for elementary school students (grades 4 to 6) focusing on gardening. It includes educational objectives for each topic as well as lists of vocabulary words, comments, questions for discussion, additional activities, and resources. An interdisciplinary…

  17. Tomato leaves methanol extract possesses antiinflammatory activity ...

    African Journals Online (AJOL)

    Recently, the leaves of tomato plant that contained several active compounds including alkaloid, steroid and flavanoid has been used for the treatment of variety of diseases and as anti-cancer, antioxidant and anti-gout. Although, a number of pharmacological properties have already been demonstrated, the ...

  18. Leave no trace in the outdoors

    Science.gov (United States)

    Marion, Jeffrey L.

    2014-01-01

    The essential guide for enjoying the outdoors without harming the environment. - Details the seven core principles of Leave No Trace ethics and practices - Covers hiking, campfires, food storage, and personal hygiene - Endorsed by the USDI National Park Service, Bureau of Land Management, Fish & Wildlife Service, U.S. Geological Survey, and the USDA Forest Service

  19. Isolation of chlorophyll a from spinach leaves

    Directory of Open Access Journals (Sweden)

    E.D. Dikio

    2008-08-01

    Full Text Available An efficient method for separating chlorophyll a from spinach leaves by column chromatography and solvent extraction techniques has been developed. The purity and identity of the chlorophyll a have been confirmed by UV-Vis, IR and mass spectrometry. Yields from 100 g of freeze-dried spinach were 23 – 24 mg of chlorophyll a.

  20. Why Nannies Leave Their Employing Families.

    Science.gov (United States)

    Olsen, Glenn

    The position of nanny as a career option for child care/child development/early childhood education graduates is examined. This study surveyed nannies randomly selected from the 1991 International Nanny Association Directory to determine why nannies leave their employing families. Surveys were mailed to 160 nannies; 62 (39%) nannies responded.…

  1. Talking Leaves, Volume 4, No. 4

    OpenAIRE

    Center for Research on Education, Diversity & Excellence

    2000-01-01

    Talking Leaves, Spring 2000, Articles: Classroom and Schoolwide Observation Under the Microscope Observing School Restructuring in Multicultural, Multilingual Contexts From the Other Side of the Classroom Looking for Findings in all the Right Places The Classroom Observation Schedule and the Teacher Roles Observation Schedule The Standards Performance Continuum: Measuring CREDE's Standards for Effective Pedagogy The Kentu...

  2. Extraction of radioactive cesium from tea leaves

    International Nuclear Information System (INIS)

    Yano, Yukiko; Kubo, M. Kenya; Higaki, Shogo; Hirota, Masahiro; Nomura, Kiyoshi

    2011-01-01

    Radioactive contamination of foodstuffs attributed to the Fukushima Daiichi nuclear disaster has become a social problem. This study investigated the extraction of radioactive cesium from the contaminated leaves to the tea. The green tea was brewed twice reusing the same leaves to study the difference in extraction of cesium between the first and second brew. Moreover, the extraction of cesium was studied in correlation to brewing time. The concentration of radioactive cesium was determined with gamma spectrometry, and the concentration of caffeine was determined with absorption spectrometry. About 40% of cesium was extracted from leaves in the first brew, and about 80% was extracted in the second brew. The extraction of cesium increased over time, and it reached about 80% after 10 minutes brew. The ratio of radioactive cesium to caffeine decreased linearly over time. This study revealed that the extraction of cesium was higher for the second brew, and a rapid increase in extraction was seen as the tea was brewed for 6 minutes and more. Therefore, the first brew of green tea, which was brewed within 5 minutes, contained the least extraction of radioactive cesium from the contaminated leaves. (author)

  3. Maternity leave duration and postpartum mental and physical health: implications for leave policies.

    Science.gov (United States)

    Dagher, Rada K; McGovern, Patricia M; Dowd, Bryan E

    2014-04-01

    This study examines the association of leave duration with depressive symptoms, mental health, physical health, and maternal symptoms in the first postpartum year, using a prospective cohort design. Eligible employed women, eighteen years or older, were interviewed in person at three Minnesota hospitals while hospitalized for childbirth in 2001. Telephone interviews were conducted at six weeks (N = 716), twelve weeks (N = 661), six months (N = 625), and twelve months (N = 575) after delivery. Depressive symptoms (Edinburgh Postnatal Depression Scale), mental and physical health (SF-12 Health Survey), and maternal childbirth-related symptoms were measured at each time period. Two-stage least squares analysis showed that the relationship between leave duration and postpartum depressive symptoms is U-shaped, with a minimum at six months. In the first postpartum year, an increase in leave duration is associated with a decrease in depressive symptoms until six months postpartum. Moreover, ordinary least squares analysis showed a marginally significant linear positive association between leave duration and physical health. Taking leave from work provides time for mothers to rest and recover from pregnancy and childbirth. Findings indicate that the current leave duration provided by the Family and Medical Leave Act, twelve weeks, may not be sufficient for mothers at risk for or experiencing postpartum depression.

  4. Access to paid parental leave for academic surgeons.

    Science.gov (United States)

    Itum, Dina S; Oltmann, Sarah C; Choti, Michael A; Piper, Hannah G

    2018-01-31

    Parental leave is linked to health benefits for both child and parent. It is unclear whether surgeons at academic centers have access to paid parental leave. The aim of this study was to determine parental leave policies at the top academic medical centers in the United States to identify trends among institutions. The top academic medical centers were identified (US News & World Report 2016). Institutional websites were reviewed, or human resource departments were contacted to determine parental leave policies. "Paid leave" was defined as leave without the mandated use of personal time off. Institutions were categorized based on geographical region, funding, and ranking to determine trends regarding availability and duration of paid parental leave. Among the top 91 ranked medical schools, 48 (53%) offer paid parental leave. Availability of a paid leave policy differed based on private versus public institutions (70% versus 38%, P leaves (>6 wk) than public institutions (67% versus 33%; P = 0.02). No difference in paid leave duration was noted based on region (P = 0.60) or rank (P = 0.81). Approximately, 50% of top academic medical centers offer paid parental leave. Private institutions are more likely to offer paid leave and leave of longer duration. There is considerable variability in access to paid parenteral leave for academic surgeons. Copyright © 2018 Elsevier Inc. All rights reserved.

  5. Analysis of MaACS2, a stress-inducible ACC Synthase Gene in Musa acuminata AAA Group Cultivar Pisang Ambon

    Directory of Open Access Journals (Sweden)

    Resnanti Utami Handayani

    2014-07-01

    Full Text Available Ethylene has an important function in plant growth and development. Ethylene production generally increases in response to pathogen attacks and other environmental stress conditions. The synthesis of this phytohormone is regulated by two enzymes, ACC synthase (ACS and ACC oxidase (ACO. ACC synthase is encoded by a multigene that regulates the production of ACC, after which this precursor is converted into ethylene by ACO. Pisang Ambon (Musa sp. AAA group, a banana cultivar originating from Indonesia, has nine ACS genes (MaACS 1-9 and one ACO gene (MaACO. One of the banana ACS genes, MaACS2, is stress-inducible. In this research, we have investigated the expression profile of MaACS2 in the roots and leaf tissues of infected tissue culture plants. Quantification of gene expression was analyzed using Real-Time PCR (qPCR using Ma18srRNA and MaGAPDH as reference genes. The results showed nine-to ten fold higher MaACS2 expression levels in the infected roots tissues compared to the uninfected roots tissues. However, MaACS2 expression in the leaves was only detected in infected tissue.

  6. Isolation and functional effects of monoclonal antibodies binding to thymidylate synthase.

    Science.gov (United States)

    Jastreboff, M M; Todd, M B; Malech, H L; Bertino, J R

    1985-01-29

    Monoclonal antibodies against electrophoretically pure thymidylate synthase from HeLa cells have been produced. Antibodies (M-TS-4 and M-TS-9) from hybridoma clones were shown by enzyme-linked immunoassay to recognize thymidylate synthase from a variety of human cell lines, but they did not bind to thymidylate synthase from mouse cell lines. The strongest binding of antibodies was observed to enzyme from HeLa cells. These two monoclonal antibodies bind simultaneously to different antigenic sites on thymidylate synthase purified from HeLa cells, as reflected by a high additivity index and results of cross-linked radioimmunoassay. Both monoclonal antibodies inhibit the activity of thymidylate synthase from human cell lines. The strongest inhibition was observed with thymidylate synthase from HeLa cells. Monoclonal antibody M-TS-9 (IgM subclass) decreased the rate of binding of [3H]FdUMP to thymidylate synthase in the presence of 5,10-methylenetetrahydrofolate while M-TS-4 (IgG1) did not change the rate of ternary complex formation. These data indicate that the antibodies recognize different epitopes on the enzyme molecule.

  7. Engineering of the aspartate family biosynthetic pathway in barley (Hordeum vulgare L.) by transformation with heterologous genes encoding feed-back-insensitive aspartate kinase and dihydrodipicolinate synthase

    DEFF Research Database (Denmark)

    Brinch-Pedersen, H.; Galili, G.; Sørensen, K.

    1996-01-01

    In prokaryotes and plants the synthesis of the essential amino acids lysine and threonine is predominantly regulated by feed-back inhibition of aspartate kinase (AK) and dihydrodipicolinate synthase (DHPS). In order to modify the flux through the aspartate family pathway in barley and enhance...... the accumulation of the corresponding amino acids, we have generated transgenic barley plants that constitutively express mutant Escherichia coli genes encoding lysine feed-back insensitive forms of AK and DHPS. As a result, leaves of primary transformants (T0) exhibited a 14-fold increase of free lysine and an 8......, no differences were observed in the composition of total amino acids. The introduced genes were inherited in the T1 generation where enzymic activities revealed a 2.3-fold increase of AK activity and a 4.0-9.5-fold increase for DHPS. T1 seeds of DHPS transformants showed the same changes in free amino acids...

  8. Causes and Consequences of a Father's Child Leave: Evidence from a Reform of Leave Schemes

    DEFF Research Database (Denmark)

    Nielsen, Helena Skyt

    are the most progressive when it comes to family-friendly policies. An extensive reform of child leave schemes in Denmark affected couples differently depending on whether the parents where employed in the same or in different parts of the public sector. Based on a difference-in-differences strategy, I find...... that economic incentives are very important for intra-household leave-sharing. Increasing the couples' after tax income by $9 per day of leave which is transferred from the mother to the father is found to lead to a one day transfer. This corresponds to a supply elasticity close to unity....

  9. Transcriptomic analysis of grape (Vitis vinifera L. leaves after exposure to ultraviolet C irradiation.

    Directory of Open Access Journals (Sweden)

    Huifen Xi

    Full Text Available BACKGROUND: Only a small amount of solar ultraviolet C (UV-C radiation reaches the Earth's surface. This is because of the filtering effects of the stratospheric ozone layer. Artificial UV-C irradiation is used on leaves and fruits to stimulate different biological processes in plants. Grapes are a major fruit crop and are grown in many parts of the world. Research has shown that UV-C irradiation induces the biosynthesis of phenols in grape leaves. However, few studies have analyzed the overall changes in gene expression in grape leaves exposed to UV-C. METHODOLOGY/PRINCIPAL FINDINGS: In the present study, transcriptional responses were investigated in grape (Vitis vinifera L. leaves before and after exposure to UV-C irradiation (6 W·m-2 for 10 min using an Affymetrix Vitis vinifera (Grape Genome Array (15,700 transcripts. A total of 5274 differentially expressed probe sets were defined, including 3564 (67.58% probe sets that appeared at both 6 and 12 h after exposure to UV-C irradiation but not before exposure. A total of 468 (8.87% probe sets and 1242 (23.55% probe sets were specifically expressed at these times. The probe sets were associated with a large number of important traits and biological pathways, including cell rescue (i.e., antioxidant enzymes, protein fate (i.e., HSPs, primary and secondary metabolism, and transcription factors. Interestingly, some of the genes involved in secondary metabolism, such as stilbene synthase, responded intensely to irradiation. Some of the MYB and WRKY family transcription factors, such as VvMYBPA1, VvMYB14, VvMYB4, WRKY57-like, and WRKY 65, were also strongly up-regulated (about 100 to 200 fold. CONCLUSIONS: UV-C irridiation has an important role in some biology processes, especially cell rescue, protein fate, secondary metabolism, and regulation of transcription.These results opened up ways of exploring the molecular mechanisms underlying the effects of UV-C irradiation on grape leaves and have

  10. Transcriptomic analysis of grape (Vitis vinifera L.) leaves after exposure to ultraviolet C irradiation.

    Science.gov (United States)

    Xi, Huifen; Ma, Ling; Liu, Guotian; Wang, Nian; Wang, Junfang; Wang, Lina; Dai, Zhanwu; Li, Shaohua; Wang, Lijun

    2014-01-01

    Only a small amount of solar ultraviolet C (UV-C) radiation reaches the Earth's surface. This is because of the filtering effects of the stratospheric ozone layer. Artificial UV-C irradiation is used on leaves and fruits to stimulate different biological processes in plants. Grapes are a major fruit crop and are grown in many parts of the world. Research has shown that UV-C irradiation induces the biosynthesis of phenols in grape leaves. However, few studies have analyzed the overall changes in gene expression in grape leaves exposed to UV-C. In the present study, transcriptional responses were investigated in grape (Vitis vinifera L.) leaves before and after exposure to UV-C irradiation (6 W·m-2 for 10 min) using an Affymetrix Vitis vinifera (Grape) Genome Array (15,700 transcripts). A total of 5274 differentially expressed probe sets were defined, including 3564 (67.58%) probe sets that appeared at both 6 and 12 h after exposure to UV-C irradiation but not before exposure. A total of 468 (8.87%) probe sets and 1242 (23.55%) probe sets were specifically expressed at these times. The probe sets were associated with a large number of important traits and biological pathways, including cell rescue (i.e., antioxidant enzymes), protein fate (i.e., HSPs), primary and secondary metabolism, and transcription factors. Interestingly, some of the genes involved in secondary metabolism, such as stilbene synthase, responded intensely to irradiation. Some of the MYB and WRKY family transcription factors, such as VvMYBPA1, VvMYB14, VvMYB4, WRKY57-like, and WRKY 65, were also strongly up-regulated (about 100 to 200 fold). UV-C irridiation has an important role in some biology processes, especially cell rescue, protein fate, secondary metabolism, and regulation of transcription.These results opened up ways of exploring the molecular mechanisms underlying the effects of UV-C irradiation on grape leaves and have great implications for further studies.

  11. Structure of the dimeric form of CTP synthase from Sulfolobus solfataricus

    DEFF Research Database (Denmark)

    Lauritsen, Iben; Willemoës, Martin; Jensen, Kaj Frank

    2011-01-01

    CTP synthase catalyzes the last committed step in de novo pyrimidine-nucleotide biosynthesis. Active CTP synthase is a tetrameric enzyme composed of a dimer of dimers. The tetramer is favoured in the presence of the substrate nucleotides ATP and UTP; when saturated with nucleotide, the tetramer...... completely dominates the oligomeric state of the enzyme. Furthermore, phosphorylation has been shown to regulate the oligomeric states of the enzymes from yeast and human. The crystal structure of a dimeric form of CTP synthase from Sulfolobus solfataricus has been determined at 2.5 Å resolution...

  12. Site-directed mutagenesis of serine 158 demonstrates its role in spinach leaf sucrose-phosphate synthase modulation

    Science.gov (United States)

    Toroser, D.; McMichael, R. Jr; Krause, K. P.; Kurreck, J.; Sonnewald, U.; Stitt, M.; Huber, S. C.; Davies, E. (Principal Investigator)

    1999-01-01

    Site-directed mutagenesis of spinach sucrose-phosphate synthase (SPS) was performed to investigate the role of Ser158 in the modulation of spinach leaf SPS. Tobacco plants expressing the spinach wild-type (WT), S158A, S158T and S157F/S158E SPS transgenes were produced. Expression of transgenes appeared not to reduce expression of the tobacco host SPS. SPS activity in the WT and the S158T SPS transgenics showed light/dark modulation, whereas the S158A and S157F/S158E mutants were not similarly light/dark modulated: the S158A mutant enzyme was not inactivated in the dark, and the S157F/S158E was not activated in the light. The inability to modulate the activity of the S158A mutant enzyme by protein phosphorylation was demonstrated in vitro. The WT spinach enzyme immunopurified from dark transgenic tobacco leaves had a low initial activation state, and could be activated by PP2A and subsequently inactivated by SPS-kinase plus ATP. Rapid purification of the S158A mutant enzyme from dark leaves of transgenic plants using spinach-specific monoclonal antibodies yielded enzyme that had a high initial activation state, and pre-incubation with leaf PP2A or ATP plus SPS-kinase (the PKIII enzyme) caused little modulation of activity. The results demonstrate the regulatory significance of Ser158 as the major site responsible for dark inactivation of spinach SPS in vivo, and indicate that the significance of phosphorylation is the introduction of a negative charge at the Ser158 position.

  13. Distinct cell-specific expression of homospermidine synthase involved in pyrrolizidine alkaloid biosynthesis in three species of the boraginales.

    Science.gov (United States)

    Niemüller, Daniel; Reimann, Andreas; Ober, Dietrich

    2012-07-01

    Homospermidine synthase (HSS) is the first specific enzyme in pyrrolizidine alkaloid (PA) biosynthesis, a pathway involved in the plant's chemical defense. HSS has been shown to be recruited repeatedly by duplication of a gene involved in primary metabolism. Within the lineage of the Boraginales, only one gene duplication event gave rise to HSS. Here, we demonstrate that the tissue-specific expression of HSS in three boraginaceous species, Heliotropium indicum, Symphytum officinale, and Cynoglossum officinale, is unique with respect to plant organ, tissue, and cell type. Within H. indicum, HSS is expressed exclusively in nonspecialized cells of the lower epidermis of young leaves and shoots. In S. officinale, HSS expression has been detected in the cells of the root endodermis and in leaves directly underneath developing inflorescences. In young roots of C. officinale, HSS is detected only in cells of the endodermis, but in a later developmental stage, additionally in the pericycle. The individual expression patterns are compared with those within the Senecioneae lineage (Asteraceae), where HSS expression is reproducibly found in specific cells of the endodermis and the adjacent cortex parenchyma of the roots. The individual expression patterns within the Boraginales species are discussed as being a requirement for the successful recruitment of HSS after gene duplication. The diversity of HSS expression within this lineage adds a further facet to the already diverse patterns of expression that have been observed for HSS in other PA-producing plant lineages, making this PA-specific enzyme one of the most diverse expressed proteins described in the literature.

  14. Characterization of two geraniol synthases from Valeriana officinalis and Lippia dulcis: similar activity but difference in subcellular localization.

    Science.gov (United States)

    Dong, Lemeng; Miettinen, Karel; Goedbloed, Miriam; Verstappen, Francel W A; Voster, Alessandra; Jongsma, Maarten A; Memelink, Johan; van der Krol, Sander; Bouwmeester, Harro J

    2013-11-01

    Two geraniol synthases (GES), from Valeriana officinalis (VoGES) and Lippia dulcis (LdGES), were isolated and were shown to have geraniol biosynthetic activity with Km values of 32 µM and 51 µM for GPP, respectively, upon expression in Escherichia coli. The in planta enzymatic activity and sub-cellular localization of VoGES and LdGES were characterized in stable transformed tobacco and using transient expression in Nicotiana benthamiana. Transgenic tobacco expressing VoGES or LdGES accumulate geraniol, oxidized geraniol compounds like geranial, geranic acid and hexose conjugates of these compounds to similar levels. Geraniol emission of leaves was lower than that of flowers, which could be related to higher levels of competing geraniol-conjugating activities in leaves. GFP-fusions of the two GES proteins show that VoGES resides (as expected) predominantly in the plastids, while LdGES import into to the plastid is clearly impaired compared to that of VoGES, resulting in both cytosolic and plastidic localization. Geraniol production by VoGES and LdGES in N. benthamiana was nonetheless very similar. Expression of a truncated version of VoGES or LdGES (cytosolic targeting) resulted in the accumulation of 30% less geraniol glycosides than with the plastid targeted VoGES and LdGES, suggesting that the substrate geranyl diphosphate is readily available, both in the plastids as well as in the cytosol. The potential role of GES in the engineering of the TIA pathway in heterologous hosts is discussed. © 2013 The Authors. Published by Elsevier Inc. All rights reserved.

  15. Application of a Colorimetric Assay to Identify Putative Ribofuranosylaminobenzene 5'-Phosphate Synthase Genes Expressed with Activity in Escherichia coli

    Directory of Open Access Journals (Sweden)

    Bechard Matthew E.

    2003-01-01

    Full Text Available Tetrahydromethanopterin (H4MPT is a tetrahydrofolate analog originally discovered in methanogenic archaea, but later found in other archaea and bacteria. The extent to which H4MPT occurs among living organisms is unknown. The key enzyme which distinguishes the biosynthetic pathways of H4MPT and tetrahydrofolate is ribofuranosylaminobenzene 5'-phosphate synthase (RFAP synthase. Given the importance of RFAP synthase in H4MPT biosynthesis, the identification of putative RFAP synthase genes and measurement of RFAP synthase activity would provide an indication of the presence of H4MPT in untested microorganisms. Investigation of putative archaeal RFAP synthase genes has been hampered by the tendency of the resulting proteins to form inactive inclusion bodies in Escherichia coli. The current work describes a colorimetric assay for measuring RFAP synthase activity, and two modified procedures for expressing recombinant RFAP synthase genes to produce soluble, active enzyme. By lowering the incubation temperature during expression, RFAP synthase from Archaeoglobus fulgidus was produced in E. coli and purified to homogeneity. The production of active RFAP synthase from Methanothermobacter thermautotrophicus was achieved by coexpression of the gene MTH0830 with a molecular chaperone. This is the first direct biochemical identification of a methanogen gene that codes for an active RFAP synthase.

  16. Application of a Colorimetric Assay to Identify Putative Ribofuranosylaminobenzene 5'-Phosphate Synthase Genes Expressed with Activity in Escherichia coli.

    Science.gov (United States)

    Bechard, Matthew E.; Chhatwal, Sonya; Garcia, Rosemarie E.; Rasche, Madeline E.

    2003-01-01

    Tetrahydromethanopterin (H(4)MPT) is a tetrahydrofolate analog originally discovered in methanogenic archaea, but later found in other archaea and bacteria. The extent to which H(4)MPT occurs among living organisms is unknown. The key enzyme which distinguishes the biosynthetic pathways of H(4)MPT and tetrahydrofolate is ribofuranosylaminobenzene 5'-phosphate synthase (RFAP synthase). Given the importance of RFAP synthase in H(4)MPT biosynthesis, the identification of putative RFAP synthase genes and measurement of RFAP synthase activity would provide an indication of the presence of H(4)MPT in untested microorganisms. Investigation of putative archaeal RFAP synthase genes has been hampered by the tendency of the resulting proteins to form inactive inclusion bodies in Escherichia coli. The current work describes a colorimetric assay for measuring RFAP synthase activity, and two modified procedures for expressing recombinant RFAP synthase genes to produce soluble, active enzyme. By lowering the incubation temperature during expression, RFAP synthase from Archaeoglobus fulgidus was produced in E. coli and purified to homogeneity. The production of active RFAP synthase from Methanothermobacter thermautotrophicus was achieved by coexpression of the gene MTH0830 with a molecular chaperone. This is the first direct biochemical identification of a methanogen gene that codes for an active RFAP synthase.

  17. Father's Rights to Paid Parental Leave in the Nordic Countries

    DEFF Research Database (Denmark)

    Rostgaard, Tine; Haas, L.

    2011-01-01

    to what extent government-provided, paid parental leave and quotas for fathers could bring about equality in the division of leave between men and women by focusing on the pioneers in the field, the Nordic countries – the first nations to offer fathers parental leave and introduce quotas. First, we......European Union policy encourages men and women to share parental leave to balance work and family life and promote gender equality in the labor market. A new directive extends parental leave to four months and introduces a quota, so one month is reserved for each parent. This article explores...... describe the extent to which parental leave policies have been established and implemented in a way that is likely to promote equal sharing of leave. Next, we evaluate the impact of particular configurations of gender equality incentives in present parental leave policies for the actual division of leave...

  18. Women's Reasons for Leaving the Engineering Field.

    Science.gov (United States)

    Fouad, Nadya A; Chang, Wen-Hsin; Wan, Min; Singh, Romila

    2017-01-01

    Among the different Science, Technology, Engineering, and Math fields, engineering continues to have one of the highest rates of attrition (Hewlett et al., 2008). The turnover rate for women engineers from engineering fields is even higher than for men (Frehill, 2010). Despite increased efforts from researchers, there are still large gaps in our understanding of the reasons that women leave engineering. This study aims to address this gap by examining the reasons why women leave engineering. Specifically, we analyze the reasons for departure given by national sample of 1,464 women engineers who left the profession after having worked in the engineering field. We applied a person-environment fit theoretical lens, in particular, the Theory of Work Adjustment (TWA) (Dawis and Lofquist, 1984) to understand and categorize the reasons for leaving the engineering field. According to the TWA, occupations have different "reinforcer patterns," reflected in six occupational values, and a mismatch between the reinforcers provided by the work environment and individuals' needs may trigger departure from the environment. Given the paucity of literature in this area, we posed research questions to explore the reinforcer pattern of values implicated in women's decisions to leave the engineering field. We used qualitative analyses to understand, categorize, and code the 1,863 statements that offered a glimpse into the myriad reasons that women offered in describing their decisions to leave the engineering profession. Our results revealed the top three sets of reasons underlying women's decision to leave the jobs and engineering field were related to: first, poor and/or inequitable compensation, poor working conditions, inflexible and demanding work environment that made work-family balance difficult; second, unmet achievement needs that reflected a dissatisfaction with effective utilization of their math and science skills, and third, unmet needs with regard to lack of recognition

  19. The Class II trehalose 6-phosphate synthase gene PvTPS9 modulates trehalose metabolism in Phaseolus vulgaris nodules.

    Directory of Open Access Journals (Sweden)

    Aarón Barraza

    2016-11-01

    Full Text Available Legumes form symbioses with rhizobia, producing nitrogen-fixing nodules on the roots of the plant host. The network of plant signaling pathways affecting carbon metabolism may determine the final number of nodules. The trehalose biosynthetic pathway regulates carbon metabolism and plays a fundamental role in plant growth and development, as well as in plant-microbe interactions. The expression of genes for trehalose synthesis during nodule development suggests that this metabolite may play a role in legume-rhizobia symbiosis. In this work, PvTPS9, which encodes a Class II trehalose-6-phosphate synthase (TPS of common bean (Phaseolus vulgaris, was silenced by RNA interference in transgenic nodules. The silencing of PvTPS9 in root nodules resulted in a reduction of 85% (± 1% of its transcript, which correlated with a 30% decrease in trehalose contents of transgenic nodules and in untransformed leaves. Composite transgenic plants with PvTPS9 silenced in the roots showed no changes in nodule number and nitrogen fixation, but a severe reduction in plant biomass and altered transcript profiles of all Class II TPS genes. Our data suggest that PvTPS9 plays a key role in modulating trehalose metabolism in the symbiotic nodule and, therefore, in the whole plant.

  20. Growth of Cucurbita maxima L. plants in the presence of the cycloartenol synthase inhibitor U18666A.

    Science.gov (United States)

    Fenner, G P; Raphiou, I

    1995-03-01

    Squash, like other Cucurbitaceae, have unique sterol profiles that offer an excellent opportunity to examine the relationship between sterol biosynthesis and plant growth. To determine the effect of sterol biosynthesis inhibition on squash growth, Cucurbita maxima seedlings with and without cotyledons were subjected to increasing concentrations of the cycloarternol synthase (EC 5.4.99.8) inhibitor 3 beta-(2-diethylaminoethoxy)androstenone (U18666A). Inhibition of shoot growth was concentration-dependent (from 0, 2, 5, 10, and 20 microM); plants with intact cotyledons grew to 26.4, 23.7, 21.6, 20.0, and 15.6 cm, respectively, at the above inhibitor concentrations, compared to 25.5, 19.4, 17.0, 12.0, and 11 cm for plants with severed cotyledons. In plants with severed cotyledons, 10 and 20 microM U18666A caused rapid necrosis of the first two, newly emerged, primary leaves, and halted new leaf formation. Secondary root formation was initially affected at all inhibitor concentrations regardless of whether cotyledons were present or not. Vegetative tissue showed a decrease in the accumulation of the major squash sterol, 7,22-stigmastadienol, accompanied by increased accumulation of minor sterol components. Sterol profiles in cotyledons were unaltered. The data show that sterols are crucial for maintaining plant growth and viability, but do not address the cotyledonary effect on growth with respect to sterol biosynthesis.

  1. A novel 5-enolpyruvylshikimate-3-phosphate synthase shows high glyphosate tolerance in Escherichia coli and tobacco plants.

    Directory of Open Access Journals (Sweden)

    Gaoyi Cao

    Full Text Available A key enzyme in the shikimate pathway, 5-enolpyruvylshikimate-3-phosphate synthase (EPSPS is the primary target of the broad-spectrum herbicide glyphosate. Identification of new aroA genes coding for EPSPS with a high level of glyphosate tolerance is essential for the development of glyphosate-tolerant crops. In the present study, the glyphosate tolerance of five bacterial aroA genes was evaluated in the E. coli aroA-defective strain ER2799 and in transgenic tobacco plants. All five aroA genes could complement the aroA-defective strain ER2799, and AM79 aroA showed the highest glyphosate tolerance. Although glyphosate treatment inhibited the growth of both WT and transgenic tobacco plants, transgenic plants expressing AM79 aroA tolerated higher concentration of glyphosate and had a higher fresh weight and survival rate than plants expressing other aroA genes. When treated with high concentration of glyphosate, lower shikimate content was detected in the leaves of transgenic plants expressing AM79 aroA than transgenic plants expressing other aroA genes. These results suggest that AM79 aroA could be a good candidate for the development of transgenic glyphosate-tolerant crops.

  2. Detection and molecular cloning of CYP74Q1 gene: identification of Ranunculus acris leaf divinyl ether synthase.

    Science.gov (United States)

    Gorina, Svetlana S; Toporkova, Yana Y; Mukhtarova, Lucia S; Chechetkin, Ivan R; Khairutdinov, Bulat I; Gogolev, Yuri V; Grechkin, Alexander N

    2014-09-01

    Enzymes of the CYP74 family, including the divinyl ether synthase (DES), play important roles in plant cell signalling and defence. The potent DES activities have been detected before in the leaves of the meadow buttercup (Ranunculus acris L.) and few other Ranunculaceae species. The nature of these DESs and their genes remained unrevealed. The PCR with degenerate primers enabled to detect the transcript of unknown P450 gene assigned as CYP74Q1. Besides, two more CYP74Q1 isoforms with minimal sequence variations have been found. The full length recombinant CYP74Q1 protein was expressed in Escherichia coli. The preferred substrates of this enzyme are the 13-hydroperoxides of α-linolenic and linoleic acids, which are converted to the divinyl ether oxylipins (ω5Z)-etherolenic acid, (9Z,11E)-12-[(1'Z,3'Z)-hexadienyloxy]-9,11-dodecadienoic acid, and (ω5Z)-etheroleic acid, (9Z,11E)-12-[(1'Z)-hexenyloxy]-9,11-dodecadienoic acid, respectively, as revealed by the data of mass spectrometry, NMR and UV spectroscopy. Thus, CYP74Q1 protein was identified as the R. acris DES (RaDES), a novel DES type and the opening member of new CYP74Q subfamily. Copyright © 2014 Elsevier B.V. All rights reserved.

  3. Japanese tea leaves: a possible biological standard reference material

    International Nuclear Information System (INIS)

    Fuwa, Keiichiro; Notsu, Kenji; Tsunoda, Kin-ichi; Kato, Hideaki; Yamamoto, Yuko.

    1978-01-01

    Japanese Tea Leaves, prepared by pulverizing with an agate ball mill and sieving with a Saran fiber sieve (50 mesh) were assessed as a possible biological standard reference material for elemental analysis. The metal content of the tea leaves was determined independently at two laboratories using atomic absorption and flame emission spectrometry. Neutron activation analysis was also performed to determine the content (21 elements) of Tea Leaves. For some elements the result from the various methods were compared. The characteristics of Tea Leaves are discussed and the elemental composition is compared to that of Orchard Leaves (NBS SRM, 1571). The most significant characteristic of Tea Leaves was the high manganese content. (auth.)

  4. Don’t leave your baggage unattended

    CERN Multimedia

    2016-01-01

    “Don’t leave your baggage unattended” is a familiar request to anyone who travels by air, but it’s good advice wherever you may be.    At CERN, if an unattended bag is found anywhere on the site, the Fire and Rescue service will be called to evacuate the area, maintain a security perimeter for as long as necessary, and attempt to identify the owner. If the owner cannot be found in a reasonable amount of time, there’s a very strong chance that the bag will be destroyed. You can take two simple steps to avoid this fate: Don’t leave your baggage unattended;   Make sure that your contact details are clearly visible on the bag or suitcase so that, should you find yourself separated from it, you can easily be reunited.

  5. ANTIANAPHYLACTIC ACTIVITY OF HELIOTROPIUM INDICUM LEAVES

    OpenAIRE

    M Shenoy Ashoka; C. Shastry Shashidhar

    2011-01-01

    The alcoholic extract of Heliotropium indicum leaves was evaluated using Wistar rats and Duncan Hartley guinea pigs. The antianaphylactic activity was investigated in rats using the active anaphylaxis model. The effect on mast cell stabilization was performed by ex vivo challenge of antigen in sensitized rat intestinal mesenteries. Antihistaminic activity was studied in guinea pigs using histamine-induced bronchospasm where preconvulsive dyspnea was used as an end point following exposure to ...

  6. Texture and wettability of metallic lotus leaves

    Science.gov (United States)

    Frankiewicz, C.; Attinger, D.

    2016-02-01

    Superhydrophobic surfaces with the self-cleaning behavior of lotus leaves are sought for drag reduction and phase change heat transfer applications. These superrepellent surfaces have traditionally been fabricated by random or deterministic texturing of a hydrophobic material. Recently, superrepellent surfaces have also been made from hydrophilic materials, by deterministic texturing using photolithography, without low-surface energy coating. Here, we show that hydrophilic materials can also be made superrepellent to water by chemical texturing, a stochastic rather than deterministic process. These metallic surfaces are the first analog of lotus leaves, in terms of wettability, texture and repellency. A mechanistic model is also proposed to describe the influence of multiple tiers of roughness on wettability and repellency. This demonstrated ability to make hydrophilic materials superrepellent without deterministic structuring or additional coatings opens the way to large scale and robust manufacturing of superrepellent surfaces.Superhydrophobic surfaces with the self-cleaning behavior of lotus leaves are sought for drag reduction and phase change heat transfer applications. These superrepellent surfaces have traditionally been fabricated by random or deterministic texturing of a hydrophobic material. Recently, superrepellent surfaces have also been made from hydrophilic materials, by deterministic texturing using photolithography, without low-surface energy coating. Here, we show that hydrophilic materials can also be made superrepellent to water by chemical texturing, a stochastic rather than deterministic process. These metallic surfaces are the first analog of lotus leaves, in terms of wettability, texture and repellency. A mechanistic model is also proposed to describe the influence of multiple tiers of roughness on wettability and repellency. This demonstrated ability to make hydrophilic materials superrepellent without deterministic structuring or additional

  7. Genome-wide analysis of the grapevine stilbene synthase multigenic family: genomic organization and expression profiles upon biotic and abiotic stresses

    Directory of Open Access Journals (Sweden)

    Vannozzi Alessandro

    2012-08-01

    Full Text Available Abstract Background Plant stilbenes are a small group of phenylpropanoids, which have been detected in at least 72 unrelated plant species and accumulate in response to biotic and abiotic stresses such as infection, wounding, UV-C exposure and treatment with chemicals. Stilbenes are formed via the phenylalanine/polymalonate-route, the last step of which is catalyzed by the enzyme stilbene synthase (STS, a type III polyketide synthase (PKS. Stilbene synthases are closely related to chalcone synthases (CHS, the key enzymes of the flavonoid pathway, as illustrated by the fact that both enzymes share the same substrates. To date, STSs have been cloned from peanut, pine, sorghum and grapevine, the only stilbene-producing fruiting-plant for which the entire genome has been sequenced. Apart from sorghum, STS genes appear to exist as a family of closely related genes in these other plant species. Results In this study a complete characterization of the STS multigenic family in grapevine has been performed, commencing with the identification, annotation and phylogenetic analysis of all members and integration of this information with a comprehensive set of gene expression analyses including healthy tissues at differential developmental stages and in leaves exposed to both biotic (downy mildew infection and abiotic (wounding and UV-C exposure stresses. At least thirty-three full length sequences encoding VvSTS genes were identified, which, based on predicted amino acid sequences, cluster in 3 principal groups designated A, B and C. The majority of VvSTS genes cluster in groups B and C and are located on chr16 whereas the few gene family members in group A are found on chr10. Microarray and mRNA-seq expression analyses revealed different patterns of transcript accumulation between the different groups of VvSTS family members and between VvSTSs and VvCHSs. Indeed, under certain conditions the transcriptional response of VvSTS and VvCHS genes appears to be

  8. Molecular size estimation of plasma membrane β-glucan synthase from red beet root

    International Nuclear Information System (INIS)

    Sloan, M.E.; Eiberger, L.L.; Wasserman, B.P.

    1986-01-01

    Cellulose and cell wall β-D-glucans in higher plants are thought to be synthesized by the plasma membrane enzyme, β-glucan synthase. This enzyme has never been purified to homogeneity, hence its subunit composition is unknown. Partial purification of red beet root glucan synthase by glycerol density gradient centrifugation followed by SDS-PAGE yielded a highly enriched subunit of 68 kDa. Radiation inactivation of plasma membranes gave a molecular size the 450 kDa for the holoenzyme complex. This suggests that glucan synthase consists of 6 to 7 subunits and confirms electron microscope studies showing that glucan synthases exist as multi-subunit complexes embedded within the membrane

  9. SCREENING OF 6-PYRUVOYL-TETRAHYDROPTERIN SYNTHASE ACTIVITY DEFICIENCY AMONG HYPERP HENYLALANINEMIC PATIENTS

    Directory of Open Access Journals (Sweden)

    DURDI QUJEQ

    1999-10-01

    Full Text Available A deficiency of the phenylalanine hydroxylase activity or its cofactor tetrahydrobiopterin may"nlead to hyperphenylalamnemia and as a result, loss of IQ, poor school performance, and"nbehavior problems occurs. Deficiency in 6-pyruvoyl-tetrahydropterin synthase activity is the"nmajor cause of tetrahydrobiopterin deficient phenylketonuria. In this study, blood specimens"nfrom 165 healthy volunteers and 127 children with phenylketonuria were used to determine"nthe 6-pyruvoyl-tetrahydropterin synthase activity. It was found that the activity of 6-"npyruvoyl- tetrahydropterin synthase was decreased in comparison with control [23.46 +/-"n2.94, (mean +/- SD, mmol/ ml/h, n=I27 vs. 127.63 +/- 4.52, n=165, p<0.05]. Results of"nthis study indicate that examination of 6-pyruvoyl-tetrahydropterin synthase activity is helpful"nand may lead to the diagnosis cause of hyperphenylalaninemia.

  10. Mechanical Control of ATP Synthase Function: Activation Energy Difference between Tight and Loose Binding Sites

    KAUST Repository

    Beke-Somfai, Tamás; Lincoln, Per; Nordén, Bengt

    2010-01-01

    Despite exhaustive chemical and crystal structure studies, the mechanistic details of how FoF1-ATP synthase can convert mechanical energy to chemical, producing ATP, are still not fully understood. On the basis of quantum mechanical calculations

  11. Eukaryotic beta-alanine synthases are functionally related but have a high degree of structural diversity

    DEFF Research Database (Denmark)

    Gojkovic, Zoran; Sandrini, Michael; Piskur, Jure

    2001-01-01

    no pyrimidine catabolic pathway, it enabled growth on N-carbamyl- beta -alanine as the sole nitrogen source. The D. discoideum and D. melanogaster PYD3 gene products are similar to mammalian beta -alanine synthases. In contrast, the S. kluyveri protein is quite different from these and more similar to bacterial......beta -Alanine synthase (EC 3.5.1.6), which catalyzes the final step of pyrimidine catabolism, has only been characterized in mammals. A Saccharomyces kluyveri pyd3 mutant that is unable to grow on N-carbamy-beta -alanine as the sole nitrogen source and exhibits diminished beta -alanine synthase...... N- carbamyl amidohydrolases. All three beta -alanine synthases are to some degree related to various aspartate transcarbamylases, which catalyze the second step of the de novo pyrimidine biosynthetic pathway. PYD3 expression in yeast seems to be inducible by dihydrouracil and N...

  12. Citric acid production and citrate synthase genes in distinct strains of ...

    African Journals Online (AJOL)

    SAM

    2014-05-28

    May 28, 2014 ... synthase in lactic acid production by A. niger and with the ... A number of microorganisms, including both bacteria and fungi, possess the capacity ..... citric acid production by solid-state fermentation from cassava bagasse and ...

  13. Structure of an RNA dimer of a regulatory element from human thymidylate synthase mRNA

    OpenAIRE

    Dibrov, Sergey; McLean, Jaime; Hermann, Thomas

    2011-01-01

    An oligonucleotide representing a regulatory element of human thymidylate synthase mRNA has been crystallized as a dimer. The structure of the asymmetric dimer has been determined at 1.97 Å resolution.

  14. Sickness presence, sick leave and adjustment latitude

    Directory of Open Access Journals (Sweden)

    Joachim Gerich

    2014-10-01

    Full Text Available Objectives: Previous research on the association between adjustment latitude (defined as the opportunity to adjust work efforts in case of illness and sickness absence and sickness presence has produced inconsistent results. In particular, low adjustment latitude has been identified as both a risk factor and a deterrent of sick leave. The present study uses an alternative analytical strategy with the aim of joining these results together. Material and Methods: Using a cross-sectional design, a random sample of employees covered by the Upper Austrian Sickness Fund (N = 930 was analyzed. Logistic and ordinary least square (OLS regression models were used to examine the association between adjustment latitude and days of sickness absence, sickness presence, and an estimator for the individual sickness absence and sickness presence propensity. Results: A high level of adjustment latitude was found to be associated with a reduced number of days of sickness absence and sickness presence, but an elevated propensity for sickness absence. Conclusions: Employees with high adjustment latitude experience fewer days of health complaints associated with lower rates of sick leave and sickness presence compared to those with low adjustment latitude. In case of illness, however, high adjustment latitude is associated with a higher pro­bability of taking sick leave rather than sickness presence.

  15. Acute Toxicity of Justicia gendarussa Burm. Leaves

    Directory of Open Access Journals (Sweden)

    Juheini Amin

    2010-11-01

    Full Text Available Acute Toxicity of Justicia gendarussa Burm. Leaves. Preminelary experiment showed that ethanolic extract ofgandarusa leaves (Justicia gendarussa Burm. could decreased uric acid blood level on rats. The aim of this experimentwas to determine of the value LD50 and liver function based on activities of aminotransferase. Animals test which wereused in this experiment were 50 males and 50 females white mice. They were divided into 5 groups. Group 1 as controlgroup was given aquadest. Group 2-5 were treated by ethanolic extract of gandarusa leaves with dosage 4, 8, 16, and 32g/kg bw. The LD50 value was determined by the amount of death in group during 24 hours after giving a single dose oftest substance. The result showed that the highest dose was practically non toxic with LD50 value of 31.99 g/kg bw(male groups and 27.85 g/kg bw (female groups. Measurement of aminotransferase activity was done by usingcolorimetric method. The result of ANOVA analysis for liver function showed that the giving test substance 4 g/kg bw–16 g/kg bw was not significantly different between treated groups and control group.

  16. Improvement in the quality of hematopoietic prostaglandin D synthase crystals in a microgravity environment

    International Nuclear Information System (INIS)

    Tanaka, Hiroaki; Tsurumura, Toshiharu; Aritake, Kosuke; Furubayashi, Naoki; Takahashi, Sachiko; Yamanaka, Mari; Hirota, Erika; Sano, Satoshi; Sato, Masaru; Kobayashi, Tomoyuki; Tanaka, Tetsuo; Inaka, Koji; Urade, Yoshihiro

    2011-01-01

    Crystals of hematopoietic prostaglandin D synthase grown in microgravity show improved quality. Human hematopoietic prostaglandin synthase, one of the better therapeutic target enzymes for allergy and inflammation, was crystallized with 22 inhibitors and in three inhibitor-free conditions in microgravity. Most of the space-grown crystals showed better X-ray diffraction patterns than the terrestrially grown ones, indicating the advantage of a microgravity environment on protein crystallization, especially in the case of this protein

  17. Use of octaketide synthases to produce kermesic acid and flavokermesic acid

    DEFF Research Database (Denmark)

    2017-01-01

    A method for producing an octaketide derived aromatic compound of interest (e.g. carminic acid), wherein the method comprises (I): heterologous expression of a recombinantly introduced Type III polyketide synthase (PKS) gene encoding an octaketide synthase (OKS) to obtain non-reduced octaketide...... in vivo within the recombinant host cell and (II): converting in vivo the non-reduced octaketide of step (I) into a C14-C34 aromatic compound of interest (e.g. carminic acid)....

  18. Use of heterologous expressed polyketide synthase and small molecule foldases to make aromatic and cyclic compounds

    DEFF Research Database (Denmark)

    2016-01-01

    A method for producing individual or libraries of tri- to pentadecaketide-derived aromatic compounds of interest by heterologous expression of polyketide synthase and aromatase/cyclase in a recombinant host cell.......A method for producing individual or libraries of tri- to pentadecaketide-derived aromatic compounds of interest by heterologous expression of polyketide synthase and aromatase/cyclase in a recombinant host cell....

  19. Use of octaketide synthases to produce kermesic acid and flavokermesic acid

    DEFF Research Database (Denmark)

    2016-01-01

    A method for producing an octaketide derived aromatic compound of interest (e.g. carminic acid), wherein the method comprises (I): heterologous expression of a recombinantly introduced Type III polyketide synthase (PKS) gene encoding an octaketide synthase (OKS) to obtain non-reduced octaketide...... in vivo within the recombinant host cell and (II): converting in vivo the non-reduced octaketide of step (I) into a C14-C34 aromatic compound of interest (e.g. carminic acid)....

  20. The subcellular localization of yeast glycogen synthase is dependent upon glycogen content

    OpenAIRE

    Wilson, Wayne A.; Boyer, Michael P.; Davis, Keri D.; Burke, Michael; Roach, Peter J.

    2010-01-01

    The budding yeast, Saccharomyces cerevisiae, accumulates the storage polysaccharide glycogen in response to nutrient limitation. Glycogen synthase, the major form of which is encoded by the GSY2 gene, catalyzes the key regulated step in glycogen storage. Here, we utilize Gsy2p fusions to green fluorescent protein (GFP) to determine where glycogen synthase is located within cells. We demonstrate that the localization pattern of Gsy2-GFP depends upon the glycogen content of the cell. When glyco...

  1. The polyketide components of waxes and the Cer-cqu gene cluster encoding a novel polyketide synthase, the β-diketone synthase, DKS

    DEFF Research Database (Denmark)

    von Wettstein, Penny

    2017-01-01

    The primary function of the outermost, lipophilic layer of plant aerial surfaces, called the cuticle, is preventing non-stomatal water loss. Its exterior surface is often decorated with wax crystals, imparting a blue-grey color. Identification of the barley Cer-c, -q and -u genes forming the 101 kb...... Cer-cqu gene cluster encoding a novel polyketide synthase-the β-diketone synthase (DKS), a lipase/carboxyl transferase, and a P450 hydroxylase, respectively, establishes a new, major pathway for the synthesis of plant waxes. The major product is a β-diketone (14,16-hentriacontane) aliphatic that forms...

  2. Protein modelling of triterpene synthase genes from mangrove plants using Phyre2 and Swiss-model

    Science.gov (United States)

    Basyuni, M.; Wati, R.; Sulistiyono, N.; Hayati, R.; Sumardi; Oku, H.; Baba, S.; Sagami, H.

    2018-03-01

    Molecular cloning of five oxidosqualene cyclases (OSC) genes from Bruguiera gymnorrhiza, Kandelia candel, and Rhizophora stylosa had previously been cloned, characterized, and encoded mono and -multi triterpene synthases. The present study analyzed protein modelling of triterpene synthase genes from mangrove using Phyre2 and Swiss-model. The diversity was noted within protein modelling of triterpene synthases using Phyre2 from sequence identity (38-43%) and residue (696-703). RsM2 was distinguishable from others for template structure; it used lanosterol synthase as a template (PDB ID: w6j.1.A). By contrast, other genes used human lanosterol synthase (1w6k.1.A). The predicted bind sites were correlated with the product of triterpene synthase, the product of BgbAS was β-amyrin, while RsM1 contained a significant amount of β-amyrin. Similarly BgLUS and KcMS, both main products was lupeol, on the other hand, RsM2 with the outcome of taraxerol. Homology modelling revealed that 696 residues of BgbAS, BgLUS, RsM1, and RsM2 (91-92% of the amino acid sequence) had been modelled with 100% confidence by the single highest scoring template using Phyre2. This coverage was higher than Swiss-model (85-90%). The present study suggested that molecular cloning of triterpene genes provides useful tools for studying the protein modelling related regulation of isoprenoids biosynthesis in mangrove forests.

  3. Aspirin inhibits interleukin 1-induced prostaglandin H synthase expression in cultured endothelial cells

    International Nuclear Information System (INIS)

    Wu, K.K.; Sanduja, R.; Tsai, A.L.; Ferhanoglu, B.; Loose-Mitchell, D.S.

    1991-01-01

    Prostaglandin H (PGH) synthase is a key enzyme in the biosynthesis of prostaglandins, thromboxane, and prostacyclin. In cultured human umbilical vein endothelial cells, interleukin 1 (IL-1) is known to induce the synthesis of this enzyme, thereby raising the level of PGH synthase protein severalfold over the basal level. Pretreatment with aspirin at low concentrations inhibited more than 60% of the enzyme mass and also the cyclooxygenase activity in IL-1-induced cells with only minimal effects on the basal level of the synthase enzyme in cells without IL-1. Sodium salicylate exhibited a similar inhibitory action whereas indomethacin had no apparent effect. Similarly low levels of aspirin inhibited the increased L-[ 35 S]methionine incorporation into PGH synthase that was induced by IL0-1 and also suppressed expression of the 2.7-kilobase PGH synthase mRNA. These results suggest that in cultured endothelial cells a potent inhibition of eicosanoid biosynthetic capacity can be effected by aspirin or salicylate at the level of PGH synthase gene expression. The aspirin effect may well be due to degradation of salicylate

  4. A high-throughput colorimetric screening assay for terpene synthase activity based on substrate consumption.

    Directory of Open Access Journals (Sweden)

    Maiko Furubayashi

    Full Text Available Terpene synthases catalyze the formation of a variety of terpene chemical structures. Systematic mutagenesis studies have been effective in providing insights into the characteristic and complex mechanisms of C-C bond formations and in exploring the enzymatic potential for inventing new chemical structures. In addition, there is growing demand to increase terpene synthase activity in heterologous hosts, given the maturation of metabolic engineering and host breeding for terpenoid synthesis. We have developed a simple screening method for the cellular activities of terpene synthases by scoring their substrate consumption based on the color loss of the cell harboring carotenoid pathways. We demonstrate that this method can be used to detect activities of various terpene synthase or prenyltransferase genes in a high-throughput manner, irrespective of the product type, enabling the mutation analysis and directed evolution of terpene synthases. We also report the possibility for substrate-specific screening system of terpene synthases by taking advantage of the substrate-size specificity of C30 and C40 carotenoid pathways.

  5. Optimization of ATP synthase function in mitochondria and chloroplasts via the adenylate kinase equilibrium

    Directory of Open Access Journals (Sweden)

    Abir U Igamberdiev

    2015-01-01

    Full Text Available The bulk of ATP synthesis in plants is performed by ATP synthase, the main bioenergetics engine of cells, operating both in mitochondria and in chloroplasts. The reaction mechanism of ATP synthase has been studied in detail for over half a century; however, its optimal performance depends also on the steady delivery of ATP synthase substrates and the removal of its products. For mitochondrial ATP synthase, we analyze here the provision of stable conditions for (i the supply of ADP and Mg2+, supported by adenylate kinase (AK equilibrium in the intermembrane space, (ii the supply of phosphate via membrane transporter in symport with H+, and (iii the conditions of outflow of ATP by adenylate transporter carrying out the exchange of free adenylates. We also show that, in chloroplasts, AK equilibrates adenylates and governs Mg2+ contents in the stroma, optimizing ATP synthase and Calvin cycle operation, and affecting the import of inorganic phosphate in exchange with triose phosphates. It is argued that chemiosmosis is not the sole component of ATP synthase performance, which also depends on AK-mediated equilibrium of adenylates and Mg2+, adenylate transport and phosphate release and supply.

  6. Effects and mechanism of acid rain on plant chloroplast ATP synthase.

    Science.gov (United States)

    Sun, Jingwen; Hu, Huiqing; Li, Yueli; Wang, Lihong; Zhou, Qing; Huang, Xiaohua

    2016-09-01

    Acid rain can directly or indirectly affect plant physiological functions, especially photosynthesis. The enzyme ATP synthase is the key in photosynthetic energy conversion, and thus, it affects plant photosynthesis. To clarify the mechanism by which acid rain affects photosynthesis, we studied the effects of acid rain on plant growth, photosynthesis, chloroplast ATP synthase activity and gene expression, chloroplast ultrastructure, intracellular H(+) level, and water content of rice seedlings. Acid rain at pH 4.5 remained the chloroplast structure unchanged but increased the expression of six chloroplast ATP synthase subunits, promoted chloroplast ATP synthase activity, and increased photosynthesis and plant growth. Acid rain at pH 4.0 or less decreased leaf water content, destroyed chloroplast structure, inhibited the expression of six chloroplast ATP synthase subunits, decreased chloroplast ATP synthase activity, and reduced photosynthesis and plant growth. In conclusion, acid rain affected the chloroplast ultrastructure, chloroplast ATPase transcription and activity, and P n by changing the acidity in the cells, and thus influencing the plant growth and development. Finally, the effects of simulated acid rain on the test indices were found to be dose-dependent.

  7. Valencene synthase from the heartwood of Nootka cypress (Callitropsis nootkatensis) for biotechnological production of valencene.

    Science.gov (United States)

    Beekwilder, Jules; van Houwelingen, Adèle; Cankar, Katarina; van Dijk, Aalt D J; de Jong, René M; Stoopen, Geert; Bouwmeester, Harro; Achkar, Jihane; Sonke, Theo; Bosch, Dirk

    2014-02-01

    Nootkatone is one of the major terpenes in the heartwood of the Nootka cypress Callitropsis nootkatensis. It is an oxidized sesquiterpene, which has been postulated to be derived from valencene. Both valencene and nootkatone are used for flavouring citrus beverages and are considered among the most valuable terpenes used at commercial scale. Functional evaluation of putative terpene synthase genes sourced by large-scale EST sequencing from Nootka cypress wood revealed a valencene synthase gene (CnVS). CnVS expression in different tissues from the tree correlates well with nootkatone content, suggesting that CnVS represents the first dedicated gene in the nootkatone biosynthetic pathway in C. nootkatensis The gene belongs to the gymnosperm-specific TPS-d subfamily of terpenes synthases and its protein sequence has low similarity to known citrus valencene synthases. In vitro, CnVS displays high robustness under different pH and temperature regimes, potentially beneficial properties for application in different host and physiological conditions. Biotechnological production of sesquiterpenes has been shown to be feasible, but productivity of microbial strains expressing valencene synthase from Citrus is low, indicating that optimization of valencene synthase activity is needed. Indeed, expression of CnVS in Saccharomyces cerevisiae indicated potential for higher yields. In an optimized Rhodobacter sphaeroides strain, expression of CnVS increased valencene yields 14-fold to 352 mg/L, bringing production to levels with industrial potential. © 2013 Society for Experimental Biology, Association of Applied Biologists and John Wiley & Sons Ltd.

  8. Platelet-derived growth factor (PDGF) stimulates glycogen synthase activity in 3T3 cells

    International Nuclear Information System (INIS)

    Chan, C.P.; Bowen-Pope, D.F.; Ross, R.; Krebs, E.G.

    1986-01-01

    Hormonal regulation of glycogen synthase, an enzyme that can be phosphorylated on multiple sites, is often associated with changes in its phosphorylation state. Enzyme activation is conventionally monitored by determining the synthase activity ratio [(activity in the absence of glucose 6-P)/(activity in the presence of glucose 6-P)]. Insulin causes an activation of glycogen synthase with a concomitant decrease in its phosphate content. In a previous report, the authors showed that epidermal growth factor (EGF) increases the glycogen synthase activity ratio in Swiss 3T3 cells. The time and dose-dependency of this response was similar to that of insulin. Their recent results indicate that PDGF also stimulates glycogen synthase activity. Enzyme activation was maximal after 30 min. of incubation with PDGF; the time course observed was very similar to that with insulin and EGF. At 1 ng/ml (0.03nM), PDGF caused a maximal stimulation of 4-fold in synthase activity ratio. Half-maximal stimulation was observed at 0.2 ng/ml (6 pM). The time course of changes in enzyme activity ratio closely followed that of 125 I-PDGF binding. The authors data suggest that PDGF, as well as EFG and insulin, may be important in regulating glycogen synthesis through phosphorylation/dephosphorylation mechanisms

  9. Substrate specificity of Arabidopsis 3-ketoacyl-CoA synthases

    International Nuclear Information System (INIS)

    Blacklock, Brenda J.; Jaworski, Jan G.

    2006-01-01

    The very long chain fatty acids (VLCFA) incorporated into plant lipids are derived from the iterative addition of C2 units provided by malonyl-CoA to an acyl-CoA by the 3-ketoacyl-CoA synthase (KCS) component of a fatty acid elongase (FAE) complex. Mining of the Arabidopsis genome sequence database revealed 20 genes with homology to seed-specific FAE1 KCS. Eight of the 20 putative KCSs were cloned, expressed in yeast, and isolated as (His) 6 fusion proteins. Five of the eight (At1g71160, At1g19440, At1g07720, At5g04530, and At4g34250) had little or no activity with C16 to C20 substrates while three demonstrated activity with C16, C18, and C20 saturated acyl-CoA substrates. At1g01120 KCS (KCS1) and At2g26640 KCS had broad substrate specificities when assayed with saturated and mono-unsaturated C16 to C24 acyl-CoAs while At4g34510 KCS was specific for saturated fatty acyl-CoA substrates

  10. Kinetics and equilibria of cyanide binding to prostaglandin H synthase.

    Science.gov (United States)

    MacDonald, I D; Dunford, H B

    1989-09-01

    Cyanide binding to prostaglandin H (PGH) synthase results in a spectral shift in the Soret region. This shift was exploited to determine equilibrium and kinetic parameters of the cyanide binding process. At pH 8.0, ionic strength 0.22 M, 4 degrees C, the cyanide dissociation constant, determined from equilibrium experiments, is (65 +/- 10) microM. The binding rate constant is (2.8 +/- 0.2) x 10(3) M-1 s-1, and the dissociation rate constant is zero within experimental error. Through a kinetic study of the binding process as a function of pH, from pH 3.96 to 8.00, it was possible to determine the pKa of a heme-linked acid group on the enzyme of 4.15 +/- 0.10 with citrate buffer. An apparent pKa of 4.75 +/- 0.03 was determined with acetate buffer; this different value is attributed to complexation of the enzyme with one of the components of the acetate buffer.

  11. Circulation of Pneumocystis dihydropteroate synthase mutants in France.

    Science.gov (United States)

    Le Gal, Solène; Damiani, Céline; Perrot, Maëla; Rouillé, Amélie; Virmaux, Michèle; Quinio, Dorothée; Moalic, Elodie; Saliou, Philippe; Berthou, Christian; Le Meur, Yann; Totet, Anne; Nevez, Gilles

    2012-10-01

    Data on the prevalence of Pneumocystis jirovecii (P. jirovecii) dihydropteroate synthase (DHPS) mutants in France are still limited. In this study, mutant prevalence in the Brest region (western France) was determined. Archival pulmonary specimens from 85 patients infected with P. jirovecii and admitted to our institution (University Hospital, Brest) from October 2007 to February 2010 were retrospectively typed at the DHPS locus using a polymerase chain reaction-restriction fragment length polymorphism assay. Type identification was successful in 66 of 85 patients. Sixty-four patients were infected with a wild type, whereas mutants were found in 2 patients (2/66, 3%). Medical chart analysis revealed that these 2 patients usually lived in Paris. Another patient usually lived on the French Riviera, whereas 63 patients were from the city of Brest. Thus, the corrected prevalence of mutants in patients who effectively lived in our geographic area was 0% (0/63). Taking into account that i) Paris is characterized by a high prevalence of mutants from 18.5% to 40%, ii) infection diagnoses were performed in the 2 Parisians during their vacation Paris to Brest through infected vacationers. The study shows that the usual city of patient residence, rather than the city of infection diagnosis, is a predictor of mutants and that P. jirovecii infections involving mutants do not represent a public health issue in western France. Copyright © 2012 Elsevier Inc. All rights reserved.

  12. Inhibition of fatty acid synthase prevents preadipocyte differentiation

    International Nuclear Information System (INIS)

    Schmid, Bernhard; Rippmann, Joerg F.; Tadayyon, Moh; Hamilton, Bradford S.

    2005-01-01

    Inhibition of fatty acid synthase (FAS) reduces food intake in rodents. As adipose tissue expresses FAS, we sought to investigate the effect of reduced FAS activity on adipocyte differentiation. FAS activity was suppressed either pharmacologically or by siRNA during differentiation of 3T3-L1 cells. Cerulenin (10 μM), triclosan (50 μM), and C75 (50 μM) reduced dramatically visible lipid droplet accumulation, while incorporation of [1- 14 C]acetate into lipids was reduced by 75%, 70%, and 90%, respectively. Additionally, the substances reduced FAS, CEBPα, and PPARγ mRNA by up to 85% compared to that of control differentiated cells. Transient transfection with FAS siRNA suppressed FAS mRNA and FAS activity, and this was accompanied by reduction of CEBPα and PPARγ mRNA levels, and complete prevention of lipid accumulation. CD36, a late marker of differentiation, was also reduced. Together, these results suggest that FAS generated signals may be essential to support preadipocyte differentiation

  13. Enzymatic properties of Staphylococcus aureus adenosine synthase (AdsA)

    Science.gov (United States)

    2011-01-01

    Background Staphylococcus aureus is a human pathogen that produces extracellular adenosine to evade clearance by the host immune system, an activity attributed to the 5'-nucleotidase activity of adenosine synthase (AdsA). In mammals, conversion of adenosine triphosphate to adenosine is catalyzed in a two-step process: ecto-nucleoside triphosphate diphosphohydrolases (ecto-NTDPases) hydrolyze ATP and ADP to AMP, whereas 5'-nucleotidases hydrolyze AMP to adenosine. NTPDases harbor apyrase conserved regions (ACRs) that are critical for activity. Results NTPDase ACR motifs are absent in AdsA, yet we report here that recombinant AdsA hydrolyzes ADP and ATP in addition to AMP. Competition assays suggest that hydrolysis occurs following binding of all three substrates at a unique site. Alanine substitution of two amino acids, aspartic acid 127 and histidine 196 within the 5'-nucleotidase signature sequence, leads to reduced AMP or ADP hydrolysis but does not affect the binding of these substrates. Conclusion Collectively, these results provide insight into the unique ability of AdsA to produce adenosine through the consecutive hydrolysis of ATP, ADP and AMP, thereby endowing S. aureus with the ability to modulate host immune responses. PMID:22035583

  14. Differential modulation of nitric oxide synthases in aging: therapeutic opportunities

    Directory of Open Access Journals (Sweden)

    Stêfany Bruno De Assis Cau

    2012-06-01

    Full Text Available Vascular aging is the term that describes the structural and functional disturbances of the vasculature with advancing aging. The molecular mechanisms of aging-associated endothelial dysfunction are complex, but reduced nitric oxide (NO bioavailability and altered vascular expression and activity of NO synthase (NOS enzymes have been implicated as major players. Impaired vascular relaxation in aging has been attributed to reduced endothelial NOS (eNOS-derived NO, while increased inducible NOS (iNOS expression seems to account for nitrosative stress and disrupted vascular homeostasis. Although eNOS is considered the main source of NO in the vascular endothelium, neuronal NOS (nNOS also contributes to endothelial cells-derived NO, a mechanism that is reduced in aging. Pharmacological modulation of NO generation and expression/activity of NOS isoforms may represent a therapeutic alternative to prevent the progression of cardiovascular diseases. Accordingly, this review will focus on drugs that modulate NO bioavailability, such as nitrite anions and NO-releasing non-steroidal anti-inflammatory drugs, hormones (dehydroepiandrosterone and estrogen, statins, resveratrol and folic acid, since they may be useful to treat/to prevent aging-associated vascular dysfunction. The impact of these therapies on life quality in elderly and longevity will be discussed.

  15. Hyperbaric oxygen upregulates cochlear constitutive nitric oxide synthase

    Directory of Open Access Journals (Sweden)

    Kao Ming-Ching

    2011-02-01

    Full Text Available Abstract Background Hyperbaric oxygen therapy (HBOT is a known adjuvant for treating ischemia-related inner ear diseases. Controversies still exist in the role of HBOT in cochlear diseases. Few studies to date have investigated the cellular changes that occur in inner ears after HBOT. Nitric oxide, which is synthesized by nitric oxide synthase (NOS, is an important signaling molecule in cochlear physiology and pathology. Here we investigated the effects of hyperbaric oxygen on eardrum morphology, cochlear function and expression of NOS isoforms in cochlear substructures after repetitive HBOT in guinea pigs. Results Minor changes in the eardrum were observed after repetitive HBOT, which did not result in a significant hearing threshold shift by tone burst auditory brainstem responses. A differential effect of HBOT on the expression of NOS isoforms was identified. Upregulation of constitutive NOS (nNOS and eNOS was found in the substructures of the cochlea after HBOT, but inducible NOS was not found in normal or HBOT animals, as shown by immunohistochemistry. There was no obvious DNA fragmentation present in this HBOT animal model. Conclusions The present evidence indicates that the customary HBOT protocol may increase constitutive NOS expression but such upregulation did not cause cell death in the treated cochlea. The cochlear morphology and auditory function are consequently not changed through the protocol.

  16. Comparative study of Chalcone synthase promoters across plant families

    Directory of Open Access Journals (Sweden)

    Francisco Buitrago

    2009-07-01

    Full Text Available En la era post-genómica, el entendimiento de la regulación génica se ha convertido en un reto y una prioridad de investigación. En este trabajo realizamos un estudio comparativo de las secuencias reguladoras del gen de la chalcón sintetasa de varias familias botánicas. Veintidós secuencias de promotores de Chalcone Synthase fueron comparados teniendo en cuenta tres elementos Cis reguladores: Caja-G, Caja-H y Caja-TATA, que podrían estar actuando como una sola unidad cooperativa. Nuestra comparación muestra que estos elementos puede que se conserven en algunas especies e inclusive que se conserven a nivel de familia. Sin embargo, en algunas especies no todos los elementos Cis fueron encontrados, mostrando que no todas las especies se regulan bajo los mismos parámetros. Adicionalmente, una comparación entre promotores de una misma especie con una familia de multigenes Chs, mostró que los genes duplicados son variables en la composición del elemento Cis, sugiriendo que estos genes pueden estarse expresando de maneras diferentes.

  17. Library of Norcoclaurine Synthases and Their Immobilization for Biocatalytic Transformations.

    Science.gov (United States)

    Lechner, Horst; Soriano, Pablo; Poschner, Roman; Hailes, Helen C; Ward, John M; Kroutil, Wolfgang

    2018-03-01

    Norcoclaurine synthases (NCS), catalyzing a Pictet-Spengler reaction in plants as one of the first enzymes in the biosynthetic benzylisoquinoline pathway, are investigated for biocatalytic transformations. The library of NCS available is extended by two novel NCSs from Argemone mexicana (AmNCS1, AmNCS2) and one new NCS from Corydalis saxicola (CsNCS); furthermore, it is shown that the NCS from Papaver bracteatum (PbNCS) is a highly productive catalyst leading to the isoquinoline product with up to >99% e.e. Under certain conditions lyophilized whole Escherichia coli cells containing the various overexpressed NCS turned out to be suitable catalysts. The reaction using dopamine as substrate bears several challenges such as the spontaneous non-stereoselective background reaction and side reactions. The PbNCS enzyme is successfully immobilized on various carriers whereby EziG3 proved to be the best suited for biotransformations. Dopamine showed limited stability in solution resulting in the coating of the catalyst over time, which could be solved by the addition of ascorbic acid (e.g., 1 mg ml -1 ) as antioxidant. © 2017 The Authors. Biotechnology Journal Published by Wiley-VCH Verlag GmbH &Co. KGaA.

  18. Identification and Functional Characterization of Sesquiterpene Synthases from Xanthium strumarium.

    Science.gov (United States)

    Li, Yuanjun; Chen, Fangfang; Li, Zhenqiu; Li, Changfu; Zhang, Yansheng

    2016-03-01

    Xanthium strumarium synthesizes various pharmacologically active sesquiterpenes. The molecular characterization of sesquiterpene biosynthesis in X. strumarium has not been reported so far. In this study, the cDNAs coding for three sesquiterpene synthases (designated as XsTPS1, XsTPS2 and XsTPS3) were isolated using the X. strumarium transcriptome that we recently constructed. XsTPS1, XsTPS2 and XsTPS3 were revealed to have primary activities forming germacrene D, guaia-4,6-diene and germacrene A, respectively, by either ectopic expression in yeast cells or purified recombinant protein-based in vitro assays. Quantitative real-time PCRs and metabolite analysis for the different plant parts showed that the transcript abundance of XsTPS1-XsTPS3 is consistent with the accumulation pattern of their enzymatic products, supporting their biochemical functions in vivo. In particular, we discovered that none of the XsTPS2 product, guaia-4,6-diene, can be detected in one of the X. strumarium cultivars used in this study (it was named the Hubei-cultivar), in which a natural deletion of two A bases in the XsTPS2 cDNA disrupts its activity, which further confirmed the proposed biochemical role of XsTPS2 in X. strumarium in vivo. © The Author 2016. Published by Oxford University Press on behalf of Japanese Society of Plant Physiologists. All rights reserved. For permissions, please email: journals.permissions@oup.com.

  19. Brain phenotype of transgenic mice overexpressing cystathionine β-synthase.

    Directory of Open Access Journals (Sweden)

    Vinciane Régnier

    Full Text Available The cystathionine β-synthase (CBS gene, located on human chromosome 21q22.3, is a good candidate for playing a role in the Down Syndrome (DS cognitive profile: it is overexpressed in the brain of individuals with DS, and it encodes a key enzyme of sulfur-containing amino acid (SAA metabolism, a pathway important for several brain physiological processes.Here, we have studied the neural consequences of CBS overexpression in a transgenic mouse line (60.4P102D1 expressing the human CBS gene under the control of its endogenous regulatory regions. These mice displayed a ∼2-fold increase in total CBS proteins in different brain areas and a ∼1.3-fold increase in CBS activity in the cerebellum and the hippocampus. No major disturbance of SAA metabolism was observed, and the transgenic mice showed normal behavior in the rotarod and passive avoidance tests. However, we found that hippocampal synaptic plasticity is facilitated in the 60.4P102D1 line.We demonstrate that CBS overexpression has functional consequences on hippocampal neuronal networks. These results shed new light on the function of the CBS gene, and raise the interesting possibility that CBS overexpression might have an advantageous effect on some cognitive functions in DS.

  20. Plasmodium falciparum dolichol phosphate mannose synthase represents a novel clade

    International Nuclear Information System (INIS)

    Shams-Eldin, Hosam; Santos de Macedo, Cristiana; Niehus, Sebastian; Dorn, Caroline; Kimmel, Juergen; Azzouz, Nahid; Schwarz, Ralph T.

    2008-01-01

    Dolichol phosphate mannose synthase (DPM) catalyzes the reaction between dolichol phosphate (Dol-P) and guanosine diphosphate mannose (GDP-Man) to form dolichol-phosphate-mannose (Dol-P-Man). This molecule acts as mannose donor for N-glycosylation and glycosylphosphatidylinositol (GPI) biosynthesis. The Plasmodium falciparum DPM1 (Pfdpm1) possesses a single predicted transmembrane region near the N-, but not the C-terminus. Here we show that the cloned Pfdpm1 gene failed to complement a Saccharomyces cerevisiae mutant indicating that the parasite gene does not belong to the baker's yeast group, as was previously assumed. Furthermore, Pfdpm1 was unable to complement a mouse mutant deficient in DPM but efficiently complements the Schizosaccharomyces pombe fission yeast mutant, indicating a difference between fission yeast and mammalian DPM genes. Therefore, we reanalyzed the hydrophobicity scales of all known DPMs and consequently reclassify the DPM clade into six major novel subgroups. Furthermore, we show that Pfdpm1 represents a unique enzyme among these subgroups

  1. Inducible expression of trehalose synthase in Bacillus licheniformis.

    Science.gov (United States)

    Li, Youran; Gu, Zhenghua; Zhang, Liang; Ding, Zhongyang; Shi, Guiyang

    2017-02-01

    Trehalose synthase (TreS) could transform maltose into trehalose via isomerization. It is a crucial enzyme in the process of trehalose enzymatical transformation. In this study, plasmid-based inducible expression systems were constructed to produce Thermomonospora curvata TreS in B. licheniformis. Xylose operons from B. subtilis, B. licheniformis and B. megaterium were introduced to regulate the expression of the gene encoding TreS. It was functionally expressed, and the BlsTs construct yielded the highest enzyme activity (12.1 U/mL). Furthermore, the effect of different cultural conditions on the inducible expression of BlsTs was investigated, and the optimal condition was as follows: 4% maltodextrin, 0.4% soybean powder, 1% xylose added after 10 h of growth and an induction time of 12 h at 37 °C. As a result, the maximal yield reached 24.7 U/mL. This study contributes to the industrial application of B. licheniformis, a GRAS workhorse for enzyme production. Copyright © 2016 Elsevier Inc. All rights reserved.

  2. Phylogenomic and functional domain analysis of polyketide synthases in Fusarium

    Energy Technology Data Exchange (ETDEWEB)

    Brown, Daren W.; Butchko, Robert A.; Baker, Scott E.; Proctor, Robert H.

    2012-02-01

    Fusarium species are ubiquitous in nature, cause a range of plant diseases, and produce a variety of chemicals often referred to as secondary metabolites. Although some fungal secondary metabolites affect plant growth or protect plants from other fungi and bacteria, their presence in grain based food and feed is more often associated with a variety of diseases in plants and in animals. Many of these structurally diverse metabolites are derived from a family of related enzymes called polyketide synthases (PKSs). A search of genomic sequence of Fusarium verticillioides, F. graminearum, F. oxysporum and Nectria haematococca (anamorph F. solani) identified a total of 58 PKS genes. To gain insight into how this gene family evolved and to guide future studies, we conducted a phylogenomic and functional domain analysis. The resulting genealogy suggested that Fusarium PKSs represent 34 different groups responsible for synthesis of different core metabolites. The analyses indicate that variation in the Fusarium PKS gene family is due to gene duplication and loss events as well as enzyme gain-of-function due to the acquisition of new domains or of loss-of-function due to nucleotide mutations. Transcriptional analysis indicate that the 16 F. verticillioides PKS genes are expressed under a range of conditions, further evidence that they are functional genes that confer the ability to produce secondary metabolites.

  3. Conservation and Role of Electrostatics in Thymidylate Synthase.

    Science.gov (United States)

    Garg, Divita; Skouloubris, Stephane; Briffotaux, Julien; Myllykallio, Hannu; Wade, Rebecca C

    2015-11-27

    Conservation of function across families of orthologous enzymes is generally accompanied by conservation of their active site electrostatic potentials. To study the electrostatic conservation in the highly conserved essential enzyme, thymidylate synthase (TS), we conducted a systematic species-based comparison of the electrostatic potential in the vicinity of its active site. Whereas the electrostatics of the active site of TS are generally well conserved, the TSs from minimal organisms do not conform to the overall trend. Since the genomes of minimal organisms have a high thymidine content compared to other organisms, the observation of non-conserved electrostatics was surprising. Analysis of the symbiotic relationship between minimal organisms and their hosts, and the genetic completeness of the thymidine synthesis pathway suggested that TS from the minimal organism Wigglesworthia glossinidia (W.g.b.) must be active. Four residues in the vicinity of the active site of Escherichia coli TS were mutated individually and simultaneously to mimic the electrostatics of W.g.b TS. The measured activities of the E. coli TS mutants imply that conservation of electrostatics in the region of the active site is important for the activity of TS, and suggest that the W.g.b. TS has the minimal activity necessary to support replication of its reduced genome.

  4. Expression, Purification, and Characterisation of Dehydroquinate Synthase from Pyrococcus furiosus

    Directory of Open Access Journals (Sweden)

    Leonardo Negron

    2011-01-01

    Full Text Available Dehydroquinate synthase (DHQS catalyses the second step of the shikimate pathway to aromatic compounds. DHQS from the archaeal hyperthermophile Pyrococcus furiosus was insoluble when expressed in Escherichia coli but was partially solubilised when KCl was included in the cell lysis buffer. A purification procedure was developed, involving lysis by sonication at 30∘C followed by a heat treatment at 70∘C and anion exchange chromatography. Purified recombinant P. furiosus DHQS is a dimer with a subunit Mr of 37,397 (determined by electrospray ionisation mass spectrometry and is active over broad pH and temperature ranges. The kinetic parameters are KM (3-deoxy-D-arabino-heptulosonate 7-phosphate 3.7 μM and kcat 3.0 sec-1 at 60∘C and pH 6.8. EDTA inactivates the enzyme, and enzyme activity is restored by several divalent metal ions including (in order of decreasing effectiveness Cd2+, Co2+, Zn2+, and Mn2+. High activity of a DHQS in the presence of Cd2+ has not been reported for enzymes from other sources, and may be related to the bioavailability of Cd2+ for P. furiosus. This study is the first biochemical characterisation of a DHQS from a thermophilic source. Furthermore, the characterisation of this hyperthermophilic enzyme was carried out at elevated temperatures using an enzyme-coupled assay.

  5. SUCROSE SYNTHASE: ELUCIDATION OF COMPLEX POST-TRANSLATIONAL REGULATORY MECHANISMS

    Energy Technology Data Exchange (ETDEWEB)

    Steven C. Huber

    2009-05-12

    Studies have focused on the enzyme sucrose synthase, which plays an important role in the metabolism of sucrose in seeds and tubers. There are three isoforms of SUS in maize, referred to as SUS1, SUS-SH1, and SUS2. SUS is generally considered to be tetrameric protein but recent evidence suggests that SUS can also occur as a dimeric protein. The formation of tetrameric SUS is regulated by sucrose concentration in vitro and this could also be an important factor in the cellular localization of the protein. We found that high sucrose concentrations, which promote tetramer formation, also inhibit the binding of SUS1 to actin filaments in vitro. Previously, high sucrose concentrations were shown to promote SUS association with the plasma membrane. The specific regions of the SUS molecule involved in oligomerization are not known, but we identified a region of the SUS1 moelcule by bioinformatic analysis that was predicted to form a coiled coil. We demonstrated that this sequence could, in fact, self-associate as predicted for a coiled coil, but truncation analysis with the full-length recombinant protein suggested that it was not responsible for formation of dimers or tetramers. However, the coiled coil may function in binding of other proteins to SUS1. Overall, sugar availability may differentially influence the binding of SUS to cellular structures, and these effects may be mediated by changes in the oligomeric nature of the enzyme.

  6. Glycogen synthase kinase-3 regulation of urinary concentrating ability.

    Science.gov (United States)

    Rao, Reena

    2012-09-01

    Glycogen synthase kinase-3 (GSK3) is an enzyme that is gaining prominence as a critical signaling molecule in the epithelial cells of renal tubules. This review will focus on recent findings exploring the role of GSK3 in renal collecting ducts, especially its role in urine concentration involving vasopressin signaling. Recent studies using inhibition or tissue-specific gene deletion of GSK3 revealed the mechanism by which GSK3 regulates aquaporin 2 water channels via adenylate cyclase or the prostaglandin-E2 pathway. In other studies, postnatal treatment with lithium, an inhibitor of GSK3, increased cell proliferation and led to microcyst formation in rat kidneys. These studies suggest that loss of GSK3 activity could interfere with renal water transport at two levels. In the short term, it could disrupt vasopressin signaling in collecting duct cells and in the long term it could alter the structure of the collecting ducts, making them less responsive to the hydro-osmotic effects of vasopressin. Ongoing studies reveal the crucial role played by GSK3 in the regulation of vasopressin action in the renal collecting ducts and suggest a possible use of GSK3 inhibitors in disease conditions associated with disrupted vasopressin signaling.

  7. Glycogen synthase kinase-3 regulates inflammatory tolerance in astrocytes

    Science.gov (United States)

    Beurel, Eléonore; Jope, Richard S.

    2010-01-01

    Inflammatory tolerance is the down-regulation of inflammation upon repeated stimuli, which is well-established to occur in peripheral immune cells. However, less is known about inflammatory tolerance in the brain although it may provide an important protective mechanism from detrimental consequences of prolonged inflammation, which appears to occur in many psychiatric and neurodegenerative conditions. Array analysis of 308 inflammatory molecules produced by mouse primary astrocytes after two sequential stimulations with lipopolysaccharide (LPS) distinguished three classes, tolerant, sensitized and unaltered groups. For many of these inflammatory molecules, inhibition of glycogen synthase kinase-3 (GSK3) increased tolerance and reduced sensitization. Focusing on LPS-tolerance in interleukin-6 (IL-6) production, we found that microglia exhibited a strong tolerance response that matched that of macrophages, whereas astrocytes exhibited only partial tolerance. The astrocyte semi-tolerance was found to be regulated by GSK3. GSK3 inhibitors or knocking down GSK3 levels promoted LPS-tolerance and astrocytes expressing constitutively active GSK3 did not develop LPS-tolerance. These findings identify the critical role of GSK3 in counteracting IL-6 inflammatory tolerance in cells of the CNS, supporting the therapeutic potential of GSK3 inhibitors to reduce neuroinflammation by promoting tolerance. PMID:20553816

  8. Oxide Synthase Expression by p38 MAP Kinase

    Directory of Open Access Journals (Sweden)

    Tuija Turpeinen

    2011-01-01

    Full Text Available The role of dual specificity phosphatase 1 (DUSP1 in inducible nitric oxide synthase (iNOS expression in A549 human pulmonary epithelial cells, J774 mouse macrophages and primary mouse bone marrow-derived macrophages (BMMs was investigated. iNOS expression was induced by a cytokine mixture (TNF, IFNγ and IL-1β in A549 cells and by LPS in J774 cells, and it was inhibited by p38 MAPK inhibitors SB202190 and BIRB 796. Stimulation with cytokine mixture or LPS enhanced also DUSP1 expression. Down-regulation of DUSP1 by siRNA increased p38 MAPK phosphorylation and iNOS expression in A549 and J774 cells. In addition, LPS-induced iNOS expression was enhanced in BMMs from DUSP1(−/− mice as compared to that in BMMs from wild-type mice. The results indicate that DUSP1 suppresses iNOS expression by limiting p38 MAPK activity in human and mouse cells. Compounds that enhance DUSP1 expression or modulate its function may be beneficial in diseases complicated with increased iNOS-mediated NO production.

  9. Brain phenotype of transgenic mice overexpressing cystathionine β-synthase.

    Science.gov (United States)

    Régnier, Vinciane; Billard, Jean-Marie; Gupta, Sapna; Potier, Brigitte; Woerner, Stéphanie; Paly, Evelyne; Ledru, Aurélie; David, Sabrina; Luilier, Sabrina; Bizot, Jean-Charles; Vacano, Guido; Kraus, Jan P; Patterson, David; Kruger, Warren D; Delabar, Jean M; London, Jaqueline

    2012-01-01

    The cystathionine β-synthase (CBS) gene, located on human chromosome 21q22.3, is a good candidate for playing a role in the Down Syndrome (DS) cognitive profile: it is overexpressed in the brain of individuals with DS, and it encodes a key enzyme of sulfur-containing amino acid (SAA) metabolism, a pathway important for several brain physiological processes. Here, we have studied the neural consequences of CBS overexpression in a transgenic mouse line (60.4P102D1) expressing the human CBS gene under the control of its endogenous regulatory regions. These mice displayed a ∼2-fold increase in total CBS proteins in different brain areas and a ∼1.3-fold increase in CBS activity in the cerebellum and the hippocampus. No major disturbance of SAA metabolism was observed, and the transgenic mice showed normal behavior in the rotarod and passive avoidance tests. However, we found that hippocampal synaptic plasticity is facilitated in the 60.4P102D1 line. We demonstrate that CBS overexpression has functional consequences on hippocampal neuronal networks. These results shed new light on the function of the CBS gene, and raise the interesting possibility that CBS overexpression might have an advantageous effect on some cognitive functions in DS.

  10. Mechanics of Cellulose Synthase Complexes in Living Plant Cells

    Science.gov (United States)

    Zehfroosh, Nina; Liu, Derui; Ramos, Kieran P.; Yang, Xiaoli; Goldner, Lori S.; Baskin, Tobias I.

    The polymer cellulose is one of the major components of the world's biomass with unique and fascinating characteristics such as its high tensile strength, renewability, biodegradability, and biocompatibility. Because of these distinctive aspects, cellulose has been the subject of enormous scientific and industrial interest, yet there are still fundamental open questions about cellulose biosynthesis. Cellulose is synthesized by a complex of transmembrane proteins called ``Cellulose Synthase A'' (CESA) in the plasma membrane. Studying the dynamics and kinematics of the CESA complex will help reveal the mechanism of cellulose synthesis and permit the development and validation of models of CESA motility. To understand what drives these complexes through the cell membrane, we used total internal reflection fluorescence microscopy (TIRFM) and variable angle epi-fluorescence microscopy to track individual, fluorescently-labeled CESA complexes as they move in the hypocotyl and root of living plants. A mean square displacement analysis will be applied to distinguish ballistic, diffusional, and other forms of motion. We report on the results of these tracking experiments. This work was funded by NSF/PHY-1205989.

  11. CTP limitation increases expression of CTP synthase in Lactococcus lactis

    DEFF Research Database (Denmark)

    Jørgensen, C.M.; Hammer, Karin; Martinussen, Jan

    2003-01-01

    CTP synthase is encoded by the pyrG gene and catalyzes the conversion of UTP to CTP. A Lactococcus lactis pyrG mutant with a cytidine requirement was constructed, in which beta-galactosidase activity in a pyrG-lacLM transcriptional fusion was used to monitor gene expression of pyrG. A 10-fold...... decrease in the CTP pool induced by cytidine limitation was found to immediately increase expression of the L. lactis pyrG gene. The final level of expression of pyrG is 37-fold higher than the uninduced level. CTP limitation has pronounced effects on central cellular metabolism, and both RNA and protein...... for regulation of the pyrG gene. It is possible to fold the pyrG leader in an alternative structure that would prevent the formation of the terminator. We suggest a model for pyrG regulation in L. lactis, and probably in other gram-positive bacteria as well, in which pyrG expression is directly dependent...

  12. Hydroxychavicol, a Piper betle leaf component, induces apoptosis of CML cells through mitochondrial reactive oxygen species-dependent JNK and endothelial nitric oxide synthase activation and overrides imatinib resistance.

    Science.gov (United States)

    Chakraborty, Jayashree B; Mahato, Sanjit K; Joshi, Kalpana; Shinde, Vaibhav; Rakshit, Srabanti; Biswas, Nabendu; Choudhury Mukherjee, Indrani; Mandal, Labanya; Ganguly, Dipyaman; Chowdhury, Avik A; Chaudhuri, Jaydeep; Paul, Kausik; Pal, Bikas C; Vinayagam, Jayaraman; Pal, Churala; Manna, Anirban; Jaisankar, Parasuraman; Chaudhuri, Utpal; Konar, Aditya; Roy, Siddhartha; Bandyopadhyay, Santu

    2012-01-01

    Alcoholic extract of Piper betle (Piper betle L.) leaves was recently found to induce apoptosis of CML cells expressing wild type and mutated Bcr-Abl with imatinib resistance phenotype. Hydroxy-chavicol (HCH), a constituent of the alcoholic extract of Piper betle leaves, was evaluated for anti-CML activity. Here, we report that HCH and its analogues induce killing of primary cells in CML patients and leukemic cell lines expressing wild type and mutated Bcr-Abl, including the T315I mutation, with minimal toxicity to normal human peripheral blood mononuclear cells. HCH causes early but transient increase of mitochondria-derived reactive oxygen species. Reactive oxygen species-dependent persistent activation of JNK leads to an increase in endothelial nitric oxide synthase-mediated nitric oxide generation. This causes loss of mitochondrial membrane potential, release of cytochrome c from mitochondria, cleavage of caspase 9, 3 and poly-adenosine diphosphate-ribose polymerase leading to apoptosis. One HCH analogue was also effective in vivo in SCID mice against grafts expressing the T315I mutation, although to a lesser extent than grafts expressing wild type Bcr-Abl, without showing significant bodyweight loss. Our data describe the role of JNK-dependent endothelial nitric oxide synthase-mediated nitric oxide for anti-CML activity of HCH and this molecule merits further testing in pre-clinical and clinical settings. © 2011 Japanese Cancer Association.

  13. Turning palm leaves into wood: Opportunities for Egypt's rural ...

    International Development Research Centre (IDRC) Digital Library (Canada)

    2016-04-27

    Apr 27, 2016 ... Bedouin women weave handmade baskets, hats, and lamps using dried palm leaves. ... palm tree leaves into hardwood and high-quality wooden products, ... of wood and open doors to job opportunities for rural communities.

  14. The Length of Maternity Leave and Family Health

    OpenAIRE

    Beuchert, Louise Voldby; Humlum, Maria Knoth; Vejlin, Rune Majlund

    2014-01-01

    We study the relationship between the length of maternity leave and the physical and psychological health of the family. Using a reform of the parental leave scheme in Denmark that increased the number of weeks of leave with full benefit compensation,we estimate the effect of the length of maternity leave on a range of health indicators including the number of hospital admissions for both mother and child and the probability of the mother receiving antidepressants. The reform led to an increa...

  15. Transcriptomic analysis of grape (Vitis vinifera L.) leaves during and after recovery from heat stress.

    Science.gov (United States)

    Liu, Guo-Tian; Wang, Jun-Fang; Cramer, Grant; Dai, Zhan-Wu; Duan, Wei; Xu, Hong-Guo; Wu, Ben-Hong; Fan, Pei-Ge; Wang, Li-Jun; Li, Shao-Hua

    2012-09-28

    , antioxidant enzymes (i.e., ascorbate peroxidase), and galactinol synthase may be important to thermotolerance of grape. HSF30 may be a key regulator for heat stress and recovery, while HSF7 and HSF1 may only be specific to recovery. The identification of heat stress or recovery responsive genes in this study provides novel insights into the molecular basis for heat tolerance in grape leaves.

  16. Transcriptomic analysis of grape (Vitis vinifera L. leaves during and after recovery from heat stress

    Directory of Open Access Journals (Sweden)

    Liu Guo-Tian

    2012-09-01

    . The results indicated HSPs, especially small HSPs, antioxidant enzymes (i.e., ascorbate peroxidase, and galactinol synthase may be important to thermotolerance of grape. HSF30 may be a key regulator for heat stress and recovery, while HSF7 and HSF1 may only be specific to recovery. The identification of heat stress or recovery responsive genes in this study provides novel insights into the molecular basis for heat tolerance in grape leaves.

  17. Influence of maternity leave on exclusive breastfeeding

    Directory of Open Access Journals (Sweden)

    Fernanda R. Monteiro

    2017-09-01

    Full Text Available Objectives: To describe the profile of women with children aged under 4 months living in the Brazilian state capitals and in the Federal District according to their working status and to analyze the influence of maternity leave on exclusive breastfeeding (EBF among working women. Methods: This was a cross-sectional study with data extracted from the II National Maternal Breastfeeding Prevalence Survey carried out in 2008. Initially, a descriptive analysis of the profile of 12,794 women was performed, according to their working status and maternity leave and the frequency of maternity leave in the Brazilian regions and capitals. The study used a multiple model to identify the influence of maternity leave on EBF interruption, including 3766 women who declared they were working and were on maternity leave at the time of the interview. The outcome assessed in the study was the interruption of the EBF, classified by the WHO. Results: Regarding the working status of the mothers, 63.4% did not work outside of their homes and among those who worked, 69.8% were on maternity leave. The largest prevalence among workers was of women older than 35 years of age, with more than 12 years of schooling, primiparous and from the Southeast and South regions. The lack of maternity leave increased by 23% the chance of EBF interruption. Conclusion: Maternity leave contributed to increase the prevalence of EBF in the Brazilian states capitals, supporting the importance of increasing the maternity leave period from four to six months. Resumo: Objetivos: Descrever perfil das mulheres com filhos menores de 4 meses residentes nas capitais brasileiras e no Distrito Federal segundo situação de trabalho e analisar a influência da licença-maternidade sobre o aleitamento materno exclusivo entre as mulheres trabalhadoras. Métodos: Trata-se de um estudo transversal com dados extraídos da II Pesquisa Nacional de Prevalência do Aleitamento Materno realizada em 2008

  18. STUDY OF ORGANIC ACIDS IN ALMOND LEAVES

    Directory of Open Access Journals (Sweden)

    Lenchyk L.V.

    2015-05-01

    Full Text Available Introduction. Almond (Amygdalus communis is a stone fruit, from the Rosaceae family, closest to the peach. It is spread throughout the entire Mediterranean region and afterwards to the Southwestern USA, Northern Africa, Turkey, Iran, Australia and South Africa. It is sensitive to wet conditions, and therefore is not grown in wet climates. Iran is located in the semi-arid region of the world. Because of its special tolerance to water stress, almond is one of the main agricultural products in rainfed condition in Iran. Almond leaves have been investigated for their phenolic content and antioxidant activity. It was found that total antioxidant activity and phenolic compounds exhibited variations according to season, plant organ (leaf and stem and variety. Analysis of previous research on almonds focused on investigating compounds mostly in seeds and phenolic compounds in leaves, but organic acids in leaves have not been studied. Aim of this study was investigation of organic acids in leaves of almond variety which is distributed in Razavi Khorasan province of Iran. Materials and Methods. In August 2012 almond leaves were collected in Iran, dried and grinded. The study of qualitative composition and quantitative determination of carboxylic acids in almond leaves was carried out by gas chromatography with mass spectrometric detection. For determination organic acids content, to 50 mg of dried plant material in 2 ml vial internal standard (50 μg of tridecane in hexane was added and filled up with 1.0 ml of methylating agent (14 % BCl3 in methanol, Supelco 3-3033. The mixture was kept in a sealed vial during 8 hours at 65 °C. At this time fatty oil was fully extracted, and hydrolyzed into its constituent fatty acids and their methylation was done. At the same time free organic and phenolcarbonic acids were methylated too. The reaction mixture was poured from the plant material sediment and was diluted with 1 ml of distilled water. To extract methyl

  19. 5 CFR 630.1206 - Notice of leave.

    Science.gov (United States)

    2010-01-01

    ... medical treatment, the employee shall provide notice to the agency of his or her intention to take leave... placement or planned medical treatment requires leave to begin within 30 calendar days, the employee shall... 5 Administrative Personnel 1 2010-01-01 2010-01-01 false Notice of leave. 630.1206 Section 630...

  20. 48 CFR 752.7031 - Leave and holidays.

    Science.gov (United States)

    2010-10-01

    ... States (less language training) and the actual days overseas beginning on the date of departure from the.... (e) Military leave. Military leave of not more than 15 calendar days in any calendar year may be... such military leave has been approved in advance by the cognizant Mission Director or Assistant...

  1. Determinants of sick-leave duration : A tool for managers?

    NARCIS (Netherlands)

    Flach, P.A.; Krol, B.; Groothoff, J.W.

    AIMS: To provide managers with tools to manage episodes of sick-leave of their employees, the influence of factors such as age, gender, duration of tenure, working full-time or part-time, cause and history of sick-leave, salary and education on sick-leave duration was studied. METHOD: In a

  2. 77 FR 22519 - The Family and Medical Leave Act

    Science.gov (United States)

    2012-04-16

    ... Family and Medical Leave Act AGENCY: Wage and Hour Division, Department of Labor. ACTION: Extension of... on the proposed revisions to certain regulations of the Family and Medical Leave Act of 1993 (FMLA... Family and Medical Act (FMLA) regulations to implement amendments to the military leave provisions of the...

  3. Self-Funded Leave and Life Role Development

    Science.gov (United States)

    Furbish, Dale S.

    2009-01-01

    Self-funded leave is an employee benefit that provides a time resource to those who wish to develop interests and other life roles. Semistructured interviews were used for this qualitative study to explore the motivations for enrolling in the self-funded leave program, how the leave contributed to work-life balance through development of other…

  4. Konference Fathers and Paternity Leave: Men Do It

    Czech Academy of Sciences Publication Activity Database

    Maříková, Hana

    2006-01-01

    Roč. 42, č. 14 (2006), s. 833-835 ISSN 0038-0288. [Fathers and Paternity Leave: Men Do It] R&D Projects: GA AV ČR IAA700280504 Institutional research plan: CEZ:AV0Z70280505 Keywords : parental leave * paternity leave * fathering Subject RIV: AO - Sociology, Demography Impact factor: 0.128, year: 2006

  5. Maternity Leave Provisions for Classroom Teachers in Larger School Systems.

    Science.gov (United States)

    Educational Research Service Circular, 1966

    1966-01-01

    Maternity leave provisions for classroom teachers in 129 school systems having enrollments of 25,000 or more are reported for 1965-66 in this national survey. Tables contain information on compulsory absence prior to anticipated date of birth and earliest permissible return from maternity leaves. Brief descriptions of maternity leave practices are…

  6. Structural basis for substrate activation and regulation by cystathionine beta-synthase (CBS) domains in cystathionine [beta]-synthase

    Energy Technology Data Exchange (ETDEWEB)

    Koutmos, Markos; Kabil, Omer; Smith, Janet L.; Banerjee, Ruma (Michigan-Med)

    2011-08-17

    The catalytic potential for H{sub 2}S biogenesis and homocysteine clearance converge at the active site of cystathionine {beta}-synthase (CBS), a pyridoxal phosphate-dependent enzyme. CBS catalyzes {beta}-replacement reactions of either serine or cysteine by homocysteine to give cystathionine and water or H{sub 2}S, respectively. In this study, high-resolution structures of the full-length enzyme from Drosophila in which a carbanion (1.70 {angstrom}) and an aminoacrylate intermediate (1.55 {angstrom}) have been captured are reported. Electrostatic stabilization of the zwitterionic carbanion intermediate is afforded by the close positioning of an active site lysine residue that is initially used for Schiff base formation in the internal aldimine and later as a general base. Additional stabilizing interactions between active site residues and the catalytic intermediates are observed. Furthermore, the structure of the regulatory 'energy-sensing' CBS domains, named after this protein, suggests a mechanism for allosteric activation by S-adenosylmethionine.

  7. Ceramide synthases expression and role of ceramide synthase-2 in the lung: insight from human lung cells and mouse models.

    Directory of Open Access Journals (Sweden)

    Irina Petrache

    Full Text Available Increases in ceramide levels have been implicated in the pathogenesis of both acute or chronic lung injury models. However, the role of individual ceramide species, or of the enzymes that are responsible for their synthesis, in lung health and disease has not been clarified. We now show that C24- and C16-ceramides are the most abundant lung ceramide species, paralleled by high expression of their synthetic enzymes, ceramide synthase 2 (CerS2 and CerS5, respectively. Furthermore, the ceramide species synthesis in the lung is homeostatically regulated, since mice lacking very long acyl chain C24-ceramides due to genetic deficiency of CerS2 displayed a ten-fold increase in C16-ceramides and C16-dihydroceramides along with elevation of acid sphingomyelinase and CerS5 activities. Despite relatively preserved total lung ceramide levels, inhibition of de novo sphingolipid synthesis at the level of CerS2 was associated with significant airflow obstruction, airway inflammation, and increased lung volumes. Our results suggest that ceramide species homeostasis is crucial for lung health and that CerS2 dysfunction may predispose to inflammatory airway and airspace diseases.

  8. Hybrid Sequencing of Full-Length cDNA Transcripts of Stems and Leaves in Dendrobium officinale

    Directory of Open Access Journals (Sweden)

    Liu He

    2017-10-01

    Full Text Available Dendrobium officinale is an extremely valuable orchid used in traditional Chinese medicine, so sought after that it has a higher market value than gold. Although the expression profiles of some genes involved in the polysaccharide synthesis have previously been investigated, little research has been carried out on their alternatively spliced isoforms in D. officinale. In addition, information regarding the translocation of sugars from leaves to stems in D. officinale also remains limited. We analyzed the polysaccharide content of D. officinale leaves and stems, and completed in-depth transcriptome sequencing of these two diverse tissue types using second-generation sequencing (SGS and single-molecule real-time (SMRT sequencing technology. The results of this study yielded a digital inventory of gene and mRNA isoform expressions. A comparative analysis of both transcriptomes uncovered a total of 1414 differentially expressed genes, including 844 that were up-regulated and 570 that were down-regulated in stems. Of these genes, one sugars will eventually be exported transporter (SWEET and one sucrose transporter (SUT are expressed to a greater extent in D. officinale stems than in leaves. Two glycosyltransferase (GT and four cellulose synthase (Ces genes undergo a distinct degree of alternative splicing. In the stems, the content of polysaccharides is twice as much as that in the leaves. The differentially expressed GT and transcription factor (TF genes will be the focus of further study. The genes DoSWEET4 and DoSUT1 are significantly expressed in the stem, and are likely to be involved in sugar loading in the phloem.

  9. Identification of a Fungal 1,8-Cineole Synthase from Hypoxylon sp. with Specificity Determinants in Common with the Plant Synthases*

    Science.gov (United States)

    Shaw, Jeffrey J.; Berbasova, Tetyana; Sasaki, Tomoaki; Jefferson-George, Kyra; Spakowicz, Daniel J.; Dunican, Brian F.; Portero, Carolina E.; Narváez-Trujillo, Alexandra; Strobel, Scott A.

    2015-01-01

    Terpenes are an important and diverse class of secondary metabolites widely produced by fungi. Volatile compound screening of a fungal endophyte collection revealed a number of isolates in the family Xylariaceae, producing a series of terpene molecules, including 1,8-cineole. This compound is a commercially important component of eucalyptus oil used in pharmaceutical applications and has been explored as a potential biofuel additive. The genes that produce terpene molecules, such as 1,8-cineole, have been little explored in fungi, providing an opportunity to explore the biosynthetic origin of these compounds. Through genome sequencing of cineole-producing isolate E7406B, we were able to identify 11 new terpene synthase genes. Expressing a subset of these genes in Escherichia coli allowed identification of the hyp3 gene, responsible for 1,8-cineole biosynthesis, the first monoterpene synthase discovered in fungi. In a striking example of convergent evolution, mutational analysis of this terpene synthase revealed an active site asparagine critical for water capture and specificity during cineole synthesis, the same mechanism used in an unrelated plant homologue. These studies have provided insight into the evolutionary relationship of fungal terpene synthases to those in plants and bacteria and further established fungi as a relatively untapped source of this important and diverse class of compounds. PMID:25648891

  10. Early school leaving and lifelong guidance

    DEFF Research Database (Denmark)

    Plant, Peter; Oomen, Annemarie

    Early school leaving (ESL) is costly for the individual, for society and for the economy. Not just in economic terms, but also in terms of low self esteem, and the risk of social exclusion. More, and, in particular, better education can lead to positive outcomes, in relation to employment, level...... of salaries, better health, less crime, higher social cohesion, lower public and social costs and higher productivity. This is why ESL is a policy focal point. In these terms, lifelong guidance has a key role to play in terms of both prevention, intervention, and of compensation strategies....

  11. Impact of Ozone Gradient on Grapevine Leaves

    Science.gov (United States)

    Alebic-Juretic, Ana; Bokan-Vucelic, Itana; Mifka, Boris; Zatezalo, Marija; Zubak, Velimir

    2017-04-01

    Due to complex orography and air mass circulation, the Rijeka Bay area is characterized by O3 gradient, with concentrations risen with the altitude (1). Therefore AOT40 values were often exceeded and should result in harmful effects on vegetation. Based on previous controlled experiments (2), we examined the possible effect of atmospheric ozone on grape leaves under natural O3 gradient. Grapevine leaves (2-5) were collected from May to September 2016 at two sampling points in the proximity of two AQM stations: Site 1 in the city centre (20m asl) and Site 2 (186m asl) in the suburban settlement. Subsequent to weighing and determination of surface area, the leaves (0,5 g) were extracted in 95% ethanol and analysed on chlorophyl a (Chla), chlorophyl b (Chlb) and carotene (Car) content by UV-VIS spectrometry on 3 wavelengths (664, 649, 470 nm) (3) In summer 2016 O3 gradient was not that pronounced as usual (1), but stil the concentrations differed by approx. 20%, exceeding national AOT40 value at both sites (22.360 and 28.061 μg m-3 h, respectively, at Sites 1 and 2). The concentrations of other pollutants were bellow limit values (LV). The Cha and Chb in a sample leaves collected at the end of May at Site 2 are equal to that with filtered O3 in control experiment (2), i.e. without damage caused by ozone, while the Car content is lower approx. 50% and is kept at the same level. The con-centrations of pigments obtained in July prooved the possible damage by O3, while in subsequent months could speed up natural ageing. This is the first evidence of O3 damage on plants in the Rijeka Bay area, in spite of weaker O3 gradient and lacking visible signs of damage. Preliminary results indicate the need for more frequent sampling, particularly in the period included in AOT40 (May-July). References: 1. Alebić-Juretić A (2012) Int J Remote Sensing, 33(2): 335-345 2. Britvec M, Reichenauer T, Soja G., Ljubešić N, Pećina M (2001) Biologia (Bratislava),56/4: 417-424 3. Sumanata

  12. Gender codes why women are leaving computing

    CERN Document Server

    Misa, Thomas J

    2010-01-01

    The computing profession is facing a serious gender crisis. Women are abandoning the computing field at an alarming rate. Fewer are entering the profession than anytime in the past twenty-five years, while too many are leaving the field in mid-career. With a maximum of insight and a minimum of jargon, Gender Codes explains the complex social and cultural processes at work in gender and computing today. Edited by Thomas Misa and featuring a Foreword by Linda Shafer, Chair of the IEEE Computer Society Press, this insightful collection of essays explores the persisting gender imbalance in computing and presents a clear course of action for turning things around.

  13. Take It, Leave It, Fold It

    DEFF Research Database (Denmark)

    Elias, Camelia

    2008-01-01

    This introduction to the volume sets the tone for a reading experience of Federman's works. Since the early 60s, Raymond Federman has been one of the most important American writers. In his highly experimental fictions, in works that bear such titles as Take It or Leave It, Double or Nothing......, and The Twofold Vibrations, he has explored cultural and personal memory, invented intricate narrative strategies, and above all has given readers an experience that exceeds the ordinary. Creating situations that make one really think and really laugh is a tall order for any writer. But Federman did it. He is one...

  14. Flavonoids from the Leaves of Impatiens bicolor

    OpenAIRE

    TAHIR, Aurangzeb HASAN and Muhammad Nawaz

    2005-01-01

    Three new flavanone glycosides, naringenin 4'-O-b-D-glucuronopyranoside, naringenin 4'-O-a-L rham\\-nopyranoside and naringenin 4'-O-b-D-xylopyranoside, were characterized from the leaves of Impatiens bicolor, together with 6 known glycosides: naringenin 4'-O-b-D-glucopyranoside, kaempferol 7-O-b-D-glucuronopyranoside, quercetin 3-O-b-D-glucopyranoside, kaempferol 5-O-b-D-xylopyranoside, kaempferol 3-O-b-D-galactopyranoside and kaempferol 7-O-b-D-xylopyranoside. The...

  15. Flavonoids from the Leaves of Impatiens bicolor

    OpenAIRE

    TAHIR, Aurangzeb HASAN and Muhammad Nawaz; HASAN, Aurangzeb

    2014-01-01

    Three new flavanone glycosides, naringenin 4'-O-b-D-glucuronopyranoside, naringenin 4'-O-a-L rham\\-nopyranoside and naringenin 4'-O-b-D-xylopyranoside, were characterized from the leaves of Impatiens bicolor, together with 6 known glycosides: naringenin 4'-O-b-D-glucopyranoside, kaempferol 7-O-b-D-glucuronopyranoside, quercetin 3-O-b-D-glucopyranoside, kaempferol 5-O-b-D-xylopyranoside, kaempferol 3-O-b-D-galactopyranoside and kaempferol 7-O-b-D-xylo...

  16. Terpenoid constituents from leaves of Guarea kunthiana

    International Nuclear Information System (INIS)

    Garcez, Fernanda R.; Garcez, Walmir S.; Bazzo, Rita de Cassia; Silva, Ana Francisca G. da; Resende, Ubirazilda M.

    2004-01-01

    From leaves of Guarea kunthiana one new kaurene diterpene (ent-kaur-16-en-2-one) was isolated along with eight known diterpenes (ent-kaur-16-ene, ent-3α- and 3β-hydroxykaur-16-ene, kolavelool, kolavenol, kolavenal, ent-13-epi-manoyloxide and (-)-nephthenol), four sesquiterpenes (alismol, alismoxide, spathulenol and 4β,10α-aromadendranediol), polyprenol-12 and α- and δ-tocopherols. Kolavenal is reported for the first time as a natural product, as well as the occurrence of cembrane- and ent-kaurane-type diterpenes in the Meliaceae. (author)

  17. Flavones from the leaves of Ficus gomelleira

    Directory of Open Access Journals (Sweden)

    Amaral Daniel F.

    2001-01-01

    Full Text Available Two new flavones, 5 -hydroxy -7,5' -dimethoxy -3',4' -methylenedioxyflavone and 5 -hydroxy -7,3',5' -trimethoxy -4' -(3,3 -dimethylallyloxy flavone, as well as three known flavones: 5,6,7,3',4',5' -hexamethoxyflavone, 5 -hydroxy -8,3',4' -trimethoxy -2'',2'' -dimethylpyrano (5",6":6,7 -flavone and 5 -hydroxy -8,3',4',5' -tetramethoxy -2'',2'' -dimethylpyrano (5",6":6,7 -flavone were isolated from the leaves of Ficus gomelleira. Their structures were elucidated by spectroscopic methods and comparison with literature data.

  18. Arabidopsis ketoacyl-CoA synthase 16 (KCS16) forms C36 /C38 acyl precursors for leaf trichome and pavement surface wax.

    Science.gov (United States)

    Hegebarth, Daniela; Buschhaus, Christopher; Joubès, Jérôme; Thoraval, Didier; Bird, David; Jetter, Reinhard

    2017-09-01

    The aliphatic waxes sealing plant surfaces against environmental stress are generated by fatty acid elongase complexes, each containing a β-ketoacyl-CoA synthase (KCS) enzyme that catalyses a crucial condensation forming a new C─C bond to extend the carbon backbone. The relatively high abundance of C 35 and C 37 alkanes derived from C 36 and C 38 acyl-CoAs in Arabidopsis leaf trichomes (relative to other epidermis cells) suggests differences in the elongation machineries of different epidermis cell types, possibly involving KCS16, a condensing enzyme expressed preferentially in trichomes. Here, KCS16 was found expressed primarily in Arabidopsis rosette leaves, flowers and siliques, and the corresponding protein was localized to the endoplasmic reticulum. The cuticular waxes on young leaves and isolated leaf trichomes of ksc16 loss-of-function mutants were depleted of C 35 and C 37 alkanes and alkenes, whereas expression of Arabidopsis KCS16 in yeast and ectopic overexpression in Arabidopsis resulted in accumulation of C 36 and C 38 fatty acid products. Taken together, our results show that KCS16 is the sole enzyme catalysing the elongation of C 34 to C 38 acyl-CoAs in Arabidopsis leaf trichomes and that it contributes to the formation of extra-long compounds in adjacent pavement cells. © 2017 John Wiley & Sons Ltd.

  19. Sick Leave and Factors Influencing Sick Leave in Adult Patients with Atopic Dermatitis : A Cross-Sectional Study

    NARCIS (Netherlands)

    van Os-Medendorp, Harmieke; Appelman-Noordermeer, Simone; Bruijnzeel-Koomen, Carla A.F.M.; de Bruin-Weller, MS

    2015-01-01

    BACKGROUND: Little is known about the prevalence of sick leave due to atopic dermatitis (AD). The current literature on factors influencing sick leave is mostly derived from other chronic inflammatory diseases. This study aimed to determine the prevalence of sick leave due to AD and to identify

  20. Work-family balance after childbirth: the association between employer-offered leave characteristics and maternity leave duration.

    Science.gov (United States)

    Guendelman, Sylvia; Goodman, Julia; Kharrazi, Martin; Lahiff, Maureen

    2014-01-01

    Early return to work after childbirth has been increasing among working mothers in the US. We assessed the relationship between access to employer-offered maternity leave (EOML) (both paid and unpaid) and uptake and duration of maternity leave following childbirth in a socio-economically diverse sample of full-time working women. We focus on California, a state that has long provided more generous maternity leave benefits than those offered by federal maternity leave policies through the State Disability Insurance program. The sample included 691 mothers who gave birth in Southern California in 2002-2003. Using weighted logistic regression, we examined the EOML-maternity leave duration relationship, controlling for whether the leave was paid, as well as other occupational, personality and health-related covariates. Compared with mothers who were offered more than 12 weeks of maternity leave, mothers with leave had six times higher odds of an early return. These relationships were similar after controlling for whether the leave was paid and after controlling for other occupational and health characteristics. Access to and duration of employer-offered maternity leave significantly determine timing of return to work following childbirth, potentially affecting work-family balance. Policy makers should recognize the pivotal role of employers in offering job security during and after maternity leave and consider widening the eligibility criteria of the Family and Medical Leave Act.

  1. Parental Leave and Children's Schooling Outcomes: Quasi-Experimental Evidence from a Large Parental Leave Reform

    OpenAIRE

    Natalia Danzer; Victor Lavy

    2013-01-01

    This paper investigates the question whether long-term human capital outcomes are affected by the duration of maternity leave, i.e. by the time mothers spend at home with their newborn before returning to work. Employing RD and difference-in-difference approaches, this paper exploits an unanticipated reform in Austria which extended the maximum duration of paid and job protected parental leave from 12 to 24 months for children born on July 1, 1990 or later. We use test scores from the Austria...

  2. Absorption and translocation of phosphorus-32 in guava leaves

    International Nuclear Information System (INIS)

    Natale, William

    1997-01-01

    Phosphorus is easily absorbed by the leaves and translocated. The objective of this work was to evaluate the absorption and translocation of P by guava leaves, with time. When a solution containing 2% MAP and specific activity 0.15 μCi/ml was applied. MAP labelled with 32 P was applied in the 3 rd pair of leaves. These and other leaves, roots and stem were collected separately and analyzed accordingly. The results showed that 20 days after application 12% of the applied P was absorbed by the guava leaves. The translocation of P started immediately after its absorption reaching 20% 2fter 20 days. (author). 19 refs., 4 tabs

  3. Ozone injury and infection of potato leaves by Botrytis cinerea

    Energy Technology Data Exchange (ETDEWEB)

    Manning, W.J.; Feder, W.A.; Perkins, I.; Glickman, M.

    1969-09-01

    Symptoms of ozone injury were observed on older leaves of potato cultivars Norland and Katahdin under experimental conditions. This symptom expression closely resembled flecks observed on potato leaves also blighted by Botrytis cinerea in the field. Inoculation of ozone-injured and noninjured potato leaves with B. cinerea showed that infection was more rapid and disease development more severe on ozone-injured leaves. Infection was frequently observed to originate in ozone-injured leaf areas. Ozone injury, under experimental conditions, appeared to increase the susceptibility of potato leaves to infection by B. cinerea. 6 references.

  4. Maternity leave policies in academic and private radiology practices

    International Nuclear Information System (INIS)

    Spirt, B.A.; Rauth, V.; Price, A.P.F.; Pagani, A.H.

    1988-01-01

    In 1987, the American Association of Women Radiologists surveyed both academic and private radiology departments regarding pregnancy and maternity leave policies. One hundred academic institutions (70% response), 30 radiotherapy departments (38% response), and 31 private practices responded. Details were obtained regarding maternity leave policy for residents and attending physicians; availability of paternity leave; policies regarding on-call time, fluoroscopy time and intracavitary/interstitial applications during pregnancy; and problems that occurred during resident or attending physician pregnancies. There was a wide range of responses regarding paid leave time, availability of additional time, and the use of vacation time during maternity leave

  5. Cellulose synthase complex organization and cellulose microfibril structure.

    Science.gov (United States)

    Turner, Simon; Kumar, Manoj

    2018-02-13

    Cellulose consists of linear chains of β-1,4-linked glucose units, which are synthesized by the cellulose synthase complex (CSC). In plants, these chains associate in an ordered manner to form the cellulose microfibrils. Both the CSC and the local environment in which the individual chains coalesce to form the cellulose microfibril determine the structure and the unique physical properties of the microfibril. There are several recent reviews that cover many aspects of cellulose biosynthesis, which include trafficking of the complex to the plasma membrane and the relationship between the movement of the CSC and the underlying cortical microtubules (Bringmann et al. 2012 Trends Plant Sci. 17 , 666-674 (doi:10.1016/j.tplants.2012.06.003); Kumar & Turner 2015 Phytochemistry 112 , 91-99 (doi:10.1016/j.phytochem.2014.07.009); Schneider et al. 2016 Curr. Opin. Plant Biol. 34 , 9-16 (doi:10.1016/j.pbi.2016.07.007)). In this review, we will focus on recent advances in cellulose biosynthesis in plants, with an emphasis on our current understanding of the structure of individual catalytic subunits together with the local membrane environment where cellulose synthesis occurs. We will attempt to relate this information to our current knowledge of the structure of the cellulose microfibril and propose a model in which variations in the structure of the CSC have important implications for the structure of the cellulose microfibril produced.This article is part of a discussion meeting issue 'New horizons for cellulose nanotechnology'. © 2017 The Author(s).

  6. On the function of chitin synthase extracellular domains in biomineralization.

    Science.gov (United States)

    Weiss, Ingrid M; Lüke, Florian; Eichner, Norbert; Guth, Christina; Clausen-Schaumann, Hauke

    2013-08-01

    Molluscs with various shell architectures evolved around 542-525 million years ago, as part of a larger phenomenon related to the diversification of metazoan phyla. Molluscs deposit minerals in a chitin matrix. The mollusc chitin is synthesized by transmembrane enzymes that contain several unique extracellular domains. Here we investigate the assembly mechanism of the chitin synthase Ar-CS1 via its extracellular domain ArCS1_E22. The corresponding transmembrane protein ArCS1_E22TM accumulates in membrane fractions of the expression host Dictyostelium discoideum. Soluble recombinant ArCS1_E22 proteins can be purified as monomers only at basic pH. According to confocal fluorescence microscopy experiments, immunolabeled ArCS1_E22 proteins adsorb preferably to aragonitic nacre platelets at pH 7.75. At pH 8.2 or pH 9.0 the fluorescence signal is less intense, indicating that protein-mineral interaction is reduced with increasing pH. Furthermore, ArCS1_E22 forms regular nanostructures on cationic substrates as revealed by atomic force microscopy (AFM) experiments on modified mica cleavage planes. These experiments suggest that the extracellular domain ArCS1_E22 is involved in regulating the multiple enzyme activities of Ar-CS1 such as chitin synthesis and myosin movements by interaction with mineral surfaces and eventually by protein assembly. The protein complexes could locally probe the status of mineralization according to pH unless ions and pCO2 are balanced with suitable buffer substances. Taking into account that the intact enzyme could act as a force sensor, the results presented here provide further evidence that shell formation is coordinated physiologically with precise adjustment of cellular activities to the structure, topography and stiffness at the mineralizing interface. Copyright © 2013 Elsevier Inc. All rights reserved.

  7. Nitric oxide synthase-3 promotes embryonic development of atrioventricular valves.

    Directory of Open Access Journals (Sweden)

    Yin Liu

    Full Text Available Nitric oxide synthase-3 (NOS3 has recently been shown to promote endothelial-to-mesenchymal transition (EndMT in the developing atrioventricular (AV canal. The present study was aimed to investigate the role of NOS3 in embryonic development of AV valves. We hypothesized that NOS3 promotes embryonic development of AV valves via EndMT. To test this hypothesis, morphological and functional analysis of AV valves were performed in wild-type (WT and NOS3(-/- mice at postnatal day 0. Our data show that the overall size and length of mitral and tricuspid valves were decreased in NOS3(-/- compared with WT mice. Echocardiographic assessment showed significant regurgitation of mitral and tricuspid valves during systole in NOS3(-/- mice. These phenotypes were all rescued by cardiac specific NOS3 overexpression. To assess EndMT, immunostaining of Snail1 was performed in the embryonic heart. Both total mesenchymal and Snail1(+ cells in the AV cushion were decreased in NOS3(-/- compared with WT mice at E10.5 and E12.5, which was completely restored by cardiac specific NOS3 overexpression. In cultured embryonic hearts, NOS3 promoted transforming growth factor (TGFβ, bone morphogenetic protein (BMP2 and Snail1expression through cGMP. Furthermore, mesenchymal cell formation and migration from cultured AV cushion explants were decreased in the NOS3(-/- compared with WT mice. We conclude that NOS3 promotes AV valve formation during embryonic heart development and deficiency in NOS3 results in AV valve insufficiency.

  8. Discriminating the reaction types of plant type III polyketide synthases.

    Science.gov (United States)

    Shimizu, Yugo; Ogata, Hiroyuki; Goto, Susumu

    2017-07-01

    Functional prediction of paralogs is challenging in bioinformatics because of rapid functional diversification after gene duplication events combined with parallel acquisitions of similar functions by different paralogs. Plant type III polyketide synthases (PKSs), producing various secondary metabolites, represent a paralogous family that has undergone gene duplication and functional alteration. Currently, there is no computational method available for the functional prediction of type III PKSs. We developed a plant type III PKS reaction predictor, pPAP, based on the recently proposed classification of type III PKSs. pPAP combines two kinds of similarity measures: one calculated by profile hidden Markov models (pHMMs) built from functionally and structurally important partial sequence regions, and the other based on mutual information between residue positions. pPAP targets PKSs acting on ring-type starter substrates, and classifies their functions into four reaction types. The pHMM approach discriminated two reaction types with high accuracy (97.5%, 39/40), but its accuracy decreased when discriminating three reaction types (87.8%, 43/49). When combined with a correlation-based approach, all 49 PKSs were correctly discriminated, and pPAP was still highly accurate (91.4%, 64/70) even after adding other reaction types. These results suggest pPAP, which is based on linear discriminant analyses of similarity measures, is effective for plant type III PKS function prediction. pPAP is freely available at ftp://ftp.genome.jp/pub/tools/ppap/. goto@kuicr.kyoto-u.ac.jp. Supplementary data are available at Bioinformatics online. © The Author(s) 2017. Published by Oxford University Press.

  9. Pharmacological modulation of human platelet leukotriene C4-synthase.

    Science.gov (United States)

    Sala, A; Folco, G; Henson, P M; Murphy, R C

    1997-03-21

    The aim of this study was to test if human platelet leukotriene C4-synthase (LTC4-S) is pharmacologically different from cloned and expressed LTC4-S and, in light of the significant homologies between 5-lipoxygenase activating protein (FLAP) and LTC4-S, if different potencies of leukotriene synthesis inhibitors acting through binding with FLAP (FLAP inhibitors) reflect in different potencies as LTC4-S inhibitors. Leukotriene C4 (LTC4) synthesis by washed human platelets supplemented with synthetic leukotriene A4 (LTA4) was studied in the absence and presence of two different, structurally unrelated FLAP inhibitors (MK-886 and BAY-X1005) as well as a direct 5-lipoxygenase inhibitor (zileuton). LTC4 production was analyzed by RP-HPLC coupled to diode array detection. We report that human platelet LTC4-S was inhibited by MK-886 and BAY-X1005 (IC50 of 4.7 microM and 91.2 microM, respectively), but not by zileuton (inactive up to 300 microM); all 3 compounds were able to inhibit 5-lipoxygenase metabolite biosynthesis in intact human polymorphonuclear leukocytes (IC50 of 0.044 microM, 0.85 microM, and 1.5 microM, respectively). Platelet LTC4-S does not appear pharmacologically different from expression cloned LTC4-S. LTC4-S inhibition by FLAP inhibitors is in agreement with the significant homology reported for expression-cloned LTC4-S with FLAP, Furthermore, functional homology of the binding sites for inhibitors on LTC4-S and FLAP is suggested by the conservation of the relative potencies of MK-886 and BAY-X1005 vs FLAP-dependent 5-lipoxygenase activity and LTC4-S inhibition: MK-886 was 19.3-fold more potent than BAY-X1005 as FLAP inhibitor and 19.6-fold more potent than BAY-X1005 as LTC4-S inhibitor.

  10. Bioinformatics Prediction of Polyketide Synthase Gene Clusters from Mycosphaerella fijiensis.

    Science.gov (United States)

    Noar, Roslyn D; Daub, Margaret E

    2016-01-01

    Mycosphaerella fijiensis, causal agent of black Sigatoka disease of banana, is a Dothideomycete fungus closely related to fungi that produce polyketides important for plant pathogenicity. We utilized the M. fijiensis genome sequence to predict PKS genes and their gene clusters and make bioinformatics predictions about the types of compounds produced by these clusters. Eight PKS gene clusters were identified in the M. fijiensis genome, placing M. fijiensis into the 23rd percentile for the number of PKS genes compared to other Dothideomycetes. Analysis of the PKS domains identified three of the PKS enzymes as non-reducing and two as highly reducing. Gene clusters contained types of genes frequently found in PKS clusters including genes encoding transporters, oxidoreductases, methyltransferases, and non-ribosomal peptide synthases. Phylogenetic analysis identified a putative PKS cluster encoding melanin biosynthesis. None of the other clusters were closely aligned with genes encoding known polyketides, however three of the PKS genes fell into clades with clusters encoding alternapyrone, fumonisin, and solanapyrone produced by Alternaria and Fusarium species. A search for homologs among available genomic sequences from 103 Dothideomycetes identified close homologs (>80% similarity) for six of the PKS sequences. One of the PKS sequences was not similar (< 60% similarity) to sequences in any of the 103 genomes, suggesting that it encodes a unique compound. Comparison of the M. fijiensis PKS sequences with those of two other banana pathogens, M. musicola and M. eumusae, showed that these two species have close homologs to five of the M. fijiensis PKS sequences, but three others were not found in either species. RT-PCR and RNA-Seq analysis showed that the melanin PKS cluster was down-regulated in infected banana as compared to growth in culture. Three other clusters, however were strongly upregulated during disease development in banana, suggesting that they may encode

  11. Sucrose synthase: A unique glycosyltransferase for biocatalytic glycosylation process development.

    Science.gov (United States)

    Schmölzer, Katharina; Gutmann, Alexander; Diricks, Margo; Desmet, Tom; Nidetzky, Bernd

    2016-01-01

    Sucrose synthase (SuSy, EC 2.4.1.13) is a glycosyltransferase (GT) long known from plants and more recently discovered in bacteria. The enzyme catalyzes the reversible transfer of a glucosyl moiety between fructose and a nucleoside diphosphate (NDP) (sucrose+NDP↔NDP-glucose+fructose). The equilibrium for sucrose conversion is pH dependent, and pH values between 5.5 and 7.5 promote NDP-glucose formation. The conversion of a bulk chemical to high-priced NDP-glucose in a one-step reaction provides the key aspect for industrial interest. NDP-sugars are important as such and as key intermediates for glycosylation reactions by highly selective Leloir GTs. SuSy has gained renewed interest as industrially attractive biocatalyst, due to substantial scientific progresses achieved in the last few years. These include biochemical characterization of bacterial SuSys, overproduction of recombinant SuSys, structural information useful for design of tailor-made catalysts, and development of one-pot SuSy-GT cascade reactions for production of several relevant glycosides. These advances could pave the way for the application of Leloir GTs to be used in cost-effective processes. This review provides a framework for application requirements, focusing on catalytic properties, heterologous enzyme production and reaction engineering. The potential of SuSy biocatalysis will be presented based on various biotechnological applications: NDP-sugar synthesis; sucrose analog synthesis; glycoside synthesis by SuSy-GT cascade reactions. Copyright © 2015 Elsevier Inc. All rights reserved.

  12. Insights into the reactivation of cobalamin-dependent methionine synthase

    Energy Technology Data Exchange (ETDEWEB)

    Koutmos, Markos; Datta, Supratim; Pattridge, Katherine A.; Smith, Janet L.; Matthews, Rowena G.; (Michigan)

    2009-12-10

    Cobalamin-dependent methionine synthase (MetH) is a modular protein that catalyzes the transfer of a methyl group from methyltetrahydrofolate to homocysteine to produce methionine and tetrahydrofolate. The cobalamin cofactor, which serves as both acceptor and donor of the methyl group, is oxidized once every {approx}2,000 catalytic cycles and must be reactivated by the uptake of an electron from reduced flavodoxin and a methyl group from S-adenosyl-L-methionine (AdoMet). Previous structures of a C-terminal fragment of MetH (MetH{sup CT}) revealed a reactivation conformation that juxtaposes the cobalamin- and AdoMet-binding domains. Here we describe 2 structures of a disulfide stabilized MetH{sup CT} ({sub s-s}MetH{sup CT}) that offer further insight into the reactivation of MetH. The structure of {sub s-s}MetH{sup CT} with cob(II)alamin and S-adenosyl-L-homocysteine represents the enzyme in the reactivation step preceding electron transfer from flavodoxin. The structure supports earlier suggestions that the enzyme acts to lower the reduction potential of the Co(II)/Co(I) couple by elongating the bond between the cobalt and its upper axial water ligand, effectively making the cobalt 4-coordinate, and illuminates the role of Tyr-1139 in the stabilization of this 4-coordinate state. The structure of {sub s-s}MetH{sub CT} with aquocobalamin may represent a transient state at the end of reactivation as the newly remethylated 5-coordinate methylcobalamin returns to the 6-coordinate state, triggering the rearrangement to a catalytic conformation.

  13. Bioinformatics Prediction of Polyketide Synthase Gene Clusters from Mycosphaerella fijiensis.

    Directory of Open Access Journals (Sweden)

    Roslyn D Noar

    Full Text Available Mycosphaerella fijiensis, causal agent of black Sigatoka disease of banana, is a Dothideomycete fungus closely related to fungi that produce polyketides important for plant pathogenicity. We utilized the M. fijiensis genome sequence to predict PKS genes and their gene clusters and make bioinformatics predictions about the types of compounds produced by these clusters. Eight PKS gene clusters were identified in the M. fijiensis genome, placing M. fijiensis into the 23rd percentile for the number of PKS genes compared to other Dothideomycetes. Analysis of the PKS domains identified three of the PKS enzymes as non-reducing and two as highly reducing. Gene clusters contained types of genes frequently found in PKS clusters including genes encoding transporters, oxidoreductases, methyltransferases, and non-ribosomal peptide synthases. Phylogenetic analysis identified a putative PKS cluster encoding melanin biosynthesis. None of the other clusters were closely aligned with genes encoding known polyketides, however three of the PKS genes fell into clades with clusters encoding alternapyrone, fumonisin, and solanapyrone produced by Alternaria and Fusarium species. A search for homologs among available genomic sequences from 103 Dothideomycetes identified close homologs (>80% similarity for six of the PKS sequences. One of the PKS sequences was not similar (< 60% similarity to sequences in any of the 103 genomes, suggesting that it encodes a unique compound. Comparison of the M. fijiensis PKS sequences with those of two other banana pathogens, M. musicola and M. eumusae, showed that these two species have close homologs to five of the M. fijiensis PKS sequences, but three others were not found in either species. RT-PCR and RNA-Seq analysis showed that the melanin PKS cluster was down-regulated in infected banana as compared to growth in culture. Three other clusters, however were strongly upregulated during disease development in banana, suggesting that

  14. Prostaglandin endoperoxide H synthases: peroxidase hydroperoxide specificity and cyclooxygenase activation.

    Science.gov (United States)

    Liu, Jiayan; Seibold, Steve A; Rieke, Caroline J; Song, Inseok; Cukier, Robert I; Smith, William L

    2007-06-22

    The cyclooxygenase (COX) activity of prostaglandin endoperoxide H synthases (PGHSs) converts arachidonic acid and O2 to prostaglandin G2 (PGG2). PGHS peroxidase (POX) activity reduces PGG2 to PGH2. The first step in POX catalysis is formation of an oxyferryl heme radical cation (Compound I), which undergoes intramolecular electron transfer forming Intermediate II having an oxyferryl heme and a Tyr-385 radical required for COX catalysis. PGHS POX catalyzes heterolytic cleavage of primary and secondary hydroperoxides much more readily than H2O2, but the basis for this specificity has been unresolved. Several large amino acids form a hydrophobic "dome" over part of the heme, but when these residues were mutated to alanines there was little effect on Compound I formation from H2O2 or 15-hydroperoxyeicosatetraenoic acid, a surrogate substrate for PGG2. Ab initio calculations of heterolytic bond dissociation energies of the peroxyl groups of small peroxides indicated that they are almost the same. Molecular Dynamics simulations suggest that PGG2 binds the POX site through a peroxyl-iron bond, a hydrogen bond with His-207 and van der Waals interactions involving methylene groups adjoining the carbon bearing the peroxyl group and the protoporphyrin IX. We speculate that these latter interactions, which are not possible with H2O2, are major contributors to PGHS POX specificity. The distal Gln-203 four residues removed from His-207 have been thought to be essential for Compound I formation. However, Q203V PGHS-1 and PGHS-2 mutants catalyzed heterolytic cleavage of peroxides and exhibited native COX activity. PGHSs are homodimers with each monomer having a POX site and COX site. Cross-talk occurs between the COX sites of adjoining monomers. However, no cross-talk between the POX and COX sites of monomers was detected in a PGHS-2 heterodimer comprised of a Q203R monomer having an inactive POX site and a G533A monomer with an inactive COX site.

  15. Hyaluronan synthase mediates dye translocation across liposomal membranes

    Directory of Open Access Journals (Sweden)

    Medina Andria P

    2012-01-01

    Full Text Available Abstract Background Hyaluronan (HA is made at the plasma membrane and secreted into the extracellular medium or matrix by phospolipid-dependent hyaluronan synthase (HAS, which is active as a monomer. Since the mechanism by which HA is translocated across membranes is still unresolved, we assessed the presence of an intraprotein pore within HAS by adding purified Streptococcus equisimilis HAS (SeHAS to liposomes preloaded with the fluorophore Cascade Blue (CB. Results CB translocation (efflux was not observed with mock-purified material from empty vector control E. coli membranes, but was induced by SeHAS, purified from membranes, in a time- and dose-dependent manner. CB efflux was eliminated or greatly reduced when purified SeHAS was first treated under conditions that inhibit enzyme activity: heating, oxidization or cysteine modification with N-ethylmaleimide. Reduced CB efflux also occurred with SeHAS K48E or K48F mutants, in which alteration of K48 within membrane domain 2 causes decreased activity and HA product size. The above results used liposomes containing bovine cardiolipin (BCL. An earlier study testing many synthetic lipids found that the best activating lipid for SeHAS is tetraoleoyl cardiolipin (TO-CL and that, in contrast, tetramyristoyl cardiolipin (TM-CL is an inactivating lipid (Weigel et al, J. Biol. Chem. 281, 36542, 2006. Consistent with the effects of these CL species on SeHAS activity, CB efflux was more than 2-fold greater in liposomes made with TO-CL compared to TM-CL. Conclusions The results indicate the presence of an intraprotein pore in HAS and support a model in which HA is translocated to the exterior by HAS itself.

  16. p63 promotes cell survival through fatty acid synthase.

    Directory of Open Access Journals (Sweden)

    Venkata Sabbisetti

    2009-06-01

    Full Text Available There is increasing evidence that p63, and specifically DeltaNp63, plays a central role in both development and tumorigenesis by promoting epithelial cell survival. However, few studies have addressed the molecular mechanisms through which such important function is exerted. Fatty acid synthase (FASN, a key enzyme that synthesizes long-chain fatty acids and is involved in both embryogenesis and cancer, has been recently proposed as a direct target of p53 family members, including p63 and p73. Here we show that knockdown of either total or DeltaN-specific p63 isoforms in squamous cell carcinoma (SCC9 or immortalized prostate epithelial (iPrEC cells caused a decrease in cell viability by inducing apoptosis without affecting the cell cycle. p63 silencing significantly reduced both the expression and the activity of FASN. Importantly, stable overexpression of either FASN or myristoylated AKT (myr-AKT was able to partially rescue cells from cell death induced by p63 silencing. FASN induced AKT phosphorylation and a significant reduction in cell viability was observed when FASN-overexpressing SCC9 cells were treated with an AKT inhibitor after p63 knockdown, indicating that AKT plays a major role in FASN-mediated survival. Activated AKT did not cause any alteration in the FASN protein levels but induced its activity, suggesting that the rescue from apoptosis documented in the p63-silenced cells expressing myr-AKT cells may be partially mediated by FASN. Finally, we demonstrated that p63 and FASN expression are positively associated in clinical squamous cell carcinoma samples as well as in the developing prostate. Taken together, our findings demonstrate that FASN is a functionally relevant target of p63 and is required for mediating its pro-survival effects.

  17. Regulation of glycogen synthase kinase-3 during bipolar mania treatment.

    Science.gov (United States)

    Li, Xiaohong; Liu, Min; Cai, Zhuoji; Wang, Gang; Li, Xiaohua

    2010-11-01

    Bipolar disorder is a debilitating psychiatric illness presenting with recurrent mania and depression. The pathophysiology of bipolar disorder is poorly understood, and molecular targets in the treatment of bipolar disorder remain to be identified. Preclinical studies have suggested that glycogen synthase kinase-3 (GSK3) is a potential therapeutic target in bipolar disorder, but evidence of abnormal GSK3 in human bipolar disorder and its response to treatment is still lacking. This study was conducted in acutely ill type I bipolar disorder subjects who were hospitalized for a manic episode. The protein level and the inhibitory serine phosphorylation of GSK3 in peripheral blood mononuclear cells of bipolar manic and healthy control subjects were compared, and the response of GSK3 to antimanic treatment was evaluated. The levels of GSK3α and GSK3β in this group of bipolar manic subjects were higher than healthy controls. Symptom improvement during an eight-week antimanic treatment with lithium, valproate, and atypical antipsychotics was accompanied by a significant increase in the inhibitory serine phosphorylation of GSK3, but not the total level of GSK3, whereas concomitant electroconvulsive therapy treatment during a manic episode appeared to dampen the response of GSK3 to pharmacological treatment. Results of this study suggest that GSK3 can be modified during the treatment of bipolar mania. This finding in human bipolar disorder is in agreement with preclinical data suggesting that inhibition of GSK3 by increasing serine phosphorylation is a response of GSK3 to psychotropics used in bipolar disorder, supporting the notion that GSK3 is a promising molecular target in the pharmacological treatment of bipolar disorder. © 2010 John Wiley and Sons A/S.

  18. Molecular cloning and characterization of glycogen synthase in Eriocheir sinensis.

    Science.gov (United States)

    Li, Ran; Zhu, Li-Na; Ren, Li-Qi; Weng, Jie-Yang; Sun, Jin-Sheng

    2017-12-01

    Glycogen plays an important role in glucose and energy homeostasis at cellular and organismal levels. In glycogen synthesis, glycogen synthase (GS) is a rate-limiting enzyme catalysing the addition of α-1,4-linked glucose units from (UDP) 3 -glucose to a nascent glycogen chain using glycogenin (GN) as a primer. While studies on mammalian liver GS (GYS2) are numerous, enzymes from crustaceans, which also use glycogen and glucose as their main energy source, have received less attention. In the present study, we amplified full-length GS cDNA from Eriocheir sinensis. Tissue expression profiling revealed the highest expression of GS in the hepatopancreas. During moulting, GS expression and activity declined, and glycogen levels in the hepatopancreas were reduced. Recombinant GS was expressed in Escherichia coli Rosetta (DE3), and induction at 37°C or 16°C yielded EsGS in insoluble inclusion bodies (EsGS-I) or in soluble form (EsGS-S), respectively. Enzyme activity was measured in a cell-free system containing glucose-6-phosphate (G6P), and both forms possessed glycosyltransferase activity, but refolded EsGS-I was more active. Enzyme activity of both GS and EsGS-I in the hepatopancreas was optimum at 25°C, which is coincident with the optimum growth temperature of Chinese mitten crab, and higher (37°C) or lower (16°C) temperatures resulted in lower enzyme activity. Taken together, the results suggest that GS may be important for maintaining normal physiological functions such as growth and reproduction. Copyright © 2017 Elsevier Inc. All rights reserved.

  19. Cyclophilin D Promotes Brain Mitochondrial F1FO ATP Synthase Dysfunction in Aging Mice.

    Science.gov (United States)

    Gauba, Esha; Guo, Lan; Du, Heng

    2017-01-01

    Brain aging is the known strongest risk factor for Alzheimer's disease (AD). In recent years, mitochondrial deficits have been proposed to be a common mechanism linking brain aging to AD. Therefore, to elucidate the causative mechanisms of mitochondrial dysfunction in aging brains is of paramount importance for our understanding of the pathogenesis of AD, in particular its sporadic form. Cyclophilin D (CypD) is a specific mitochondrial protein. Recent studies have shown that F1FO ATP synthase oligomycin sensitivity conferring protein (OSCP) is a binding partner of CypD. The interaction of CypD with OSCP modulates F1FO ATP synthase function and mediates mitochondrial permeability transition pore (mPTP) opening. Here, we have found that increased CypD expression, enhanced CypD/OSCP interaction, and selective loss of OSCP are prominent brain mitochondrial changes in aging mice. Along with these changes, brain mitochondria from the aging mice demonstrated decreased F1FO ATP synthase activity and defective F1FO complex coupling. In contrast, CypD deficient mice exhibited substantially mitigated brain mitochondrial F1FO ATP synthase dysfunction with relatively preserved mitochondrial function during aging. Interestingly, the aging-related OSCP loss was also dramatically attenuated by CypD depletion. Therefore, the simplest interpretation of this study is that CypD promotes F1FO ATP synthase dysfunction and the resultant mitochondrial deficits in aging brains. In addition, in view of CypD and F1FO ATP synthase alterations seen in AD brains, the results further suggest that CypD-mediated F1FO ATP synthase deregulation is a shared mechanism linking mitochondrial deficits in brain aging and AD.

  20. The molecular motor F-ATP synthase is targeted by the tumoricidal protein HAMLET.

    Science.gov (United States)

    Ho, James; Sielaff, Hendrik; Nadeem, Aftab; Svanborg, Catharina; Grüber, Gerhard

    2015-05-22

    HAMLET (human alpha-lactalbumin made lethal to tumor cells) interacts with multiple tumor cell compartments, affecting cell morphology, metabolism, proteasome function, chromatin structure and viability. This study investigated if these diverse effects of HAMLET might be caused, in part, by a direct effect on the ATP synthase and a resulting reduction in cellular ATP levels. A dose-dependent reduction in cellular ATP levels was detected in A549 lung carcinoma cells, and by confocal microscopy, co-localization of HAMLET with the nucleotide-binding subunits α (non-catalytic) and β (catalytic) of the energy converting F1F0 ATP synthase was detected. As shown by fluorescence correlation spectroscopy, HAMLET binds to the F1 domain of the F1F0 ATP synthase with a dissociation constant (KD) of 20.5μM. Increasing concentrations of the tumoricidal protein HAMLET added to the enzymatically active α3β3γ complex of the F-ATP synthase lowered its ATPase activity, demonstrating that HAMLET binding to the F-ATP synthase effects the catalysis of this molecular motor. Single-molecule analysis was applied to study HAMLET-α3β3γ complex interaction. Whereas the α3β3γ complex of the F-ATP synthase rotated in a counterclockwise direction with a mean rotational rate of 3.8±0.7s(-1), no rotation could be observed in the presence of bound HAMLET. Our findings suggest that direct effects of HAMLET on the F-ATP synthase may inhibit ATP-dependent cellular processes. Copyright © 2015 Elsevier Ltd. All rights reserved.

  1. Research of photoinduced potentials of pepper leaves

    Directory of Open Access Journals (Sweden)

    D. V. Chernetchenko

    2015-09-01

    Full Text Available Bioelectrical potentials of the plants during photostimulation with various intensity values and wave lengths are studied. Suchstimulation provides light-dependent reactions of photosynthesis. The universal scheme of registration of bioelectric potentials, which allowsto carry out the experimental study of light stimuli effect on the plant is proposed. All registrations of potentials are observed on the pepper leaves. Photoinduced stimuli are different with intensity changed from 150 to 450 lux and different spectrums of white light and red light with wave length 690 nm. Different parameters of stimuli drive to different types of biopotentials of the plant, quantitative and qualitative relationships of this process are obtained. It is also found that bioelectrical reaction of the leaves is quantitatively different in various spectral ranges of light, but the quality remains the same for all cases, as shown in the study of bioelectric responses during exposure to the light in red spectrum range. The explanation of the additional depolarization phase that occurs during the running of dark reparative process of photosynthesis is given. Light-dependent reactions of photosynthesis are accompanied by significant changes in the electrical potential of chloroplasts’ membrane. Besides, the dependence of bioelectrical reaction of the plant on different spectra of light is found. By this way, biophysical relation of plant potentials to the intracellular biophysical mechanisms during photo stimulation is obtained.

  2. Enhancing Water Evaporation with Floating Synthetic Leaves

    Science.gov (United States)

    Boreyko, Jonathan; Vieitez, Joshua; Berrier, Austin; Roseveare, Matthew; Shi, Weiwei

    2017-11-01

    When a wetted nanoporous medium is exposed to a subsaturated ambient environment, the water menisci assume a concave curvature to achieve a negative pressure. This negative water pressure is required to balance the mismatch in water activity across the water-air interface to achieve local equilibrium. Here, we show that the diffusive evaporation rate of water can be greatly modulated by floating a nanoporous synthetic leaf at the water's free interface. For high ambient humidities, adding the leaf serves to enhance the evaporation rate, presumably by virtue of the menisci enhancing the effective liquid-vapor surface area. For low humidities, the menisci cannot achieve a local equilibrium and retreat partway into the leaf, which increases the local humidity directly above the menisci. In light of these two effects, we find the surprising result that leaves exposed to an ambient humidity of 90 percent can evaporate water at the same rate as leaves exposed to only 50 percent humidity. These findings have implications for using synthetic trees to enhance steam generation or water harvesting. This work was supported by the National Science Foundation (CBET-1653631).

  3. The Length of Maternity Leave and Family Health

    DEFF Research Database (Denmark)

    Beuchert-Pedersen, Louise Voldby; Humlum, Maria Knoth; Vejlin, Rune Majlund

    We study the relationship between the length of maternity leave and the physical and psychological health of the family. Using a reform of the parental leave scheme in Denmark that increased the number of weeks of leave with full benefit compensation, we estimate the effect of the lenght...... of maternity leave on a range of health indicators including the number of hospital admissions for both mother and child and the probability of the mother receiving antidepressants. The reform led to an increase in average post-birth maternity leave matters for child or maternal health outcomes and thus we...... complement the existing evidence on maternity leave expansions that tends to find limited effects on children's later deveopmental, educational, and labor market outcomes. Our results suggest that any beneficial effects of increasing the lenght of maternity leave are greater for low-resource families....

  4. Antinociceptive Activity of Methanol Extract of Muntingia calabura Leaves and the Mechanisms of Action Involved

    Directory of Open Access Journals (Sweden)

    M. H. Mohd. Sani

    2012-01-01

    Full Text Available Muntingia calabura L. (family Elaeocarpaceae has been traditionally used to relieve various pain-related ailments. The present study aimed to determine the antinociceptive activity of methanol extract of M. calabura leaves (MEMC and to elucidate the possible mechanism of antinociception involved. The in vivo chemicals (acetic acid-induced abdominal constriction and formalin-, capsaicin-, glutamate-, serotonin-induced paw licking test and thermal (hot plate test models of nociception were used to evaluate the extract antinociceptive activity. The extract (100, 250, and 500 mg/kg was administered orally 60 min prior to subjection to the respective test. The results obtained demonstrated that MEMC produced significant (P<0.05 antinociceptive response in all the chemical- and thermal-induced nociception models, which was reversed after pretreatment with 5 mg/kg naloxone, a non-selective opioid antagonist. Furthermore, pretreatment with L-arginine (a nitric oxide (NO donor, NG-nitro-L-arginine methyl esters (L-NAME; an inhibitor of NO synthase (NOS, methylene blue (MB; an inhibitor of cyclic-guanosine monophosphate (cGMP pathway, or their combination also caused significant (P<0.05 change in the intensity of the MEMC antinociception. In conclusion, the MEMC antinociceptive activity involves activation of the peripheral and central mechanisms, and modulation via, partly, the opioid receptors and NO/cGMP pathway.

  5. Essential oil from leaves of Liquidambar formosana ameliorates inflammatory response in lipopolysaccharide-activated mouse macrophages.

    Science.gov (United States)

    Hua, Kuo-Feng; Yang, Tzu-Jung; Chiu, Huan-Wen; Ho, Chen-Lung

    2014-06-01

    The essential oil from Liquidambar formosana leaves (EOLF) was demonstrated to exhibit anti-inflammatory activity in mouse macrophages. EOLF reduced nitrite oxide generation, secretion levels of tumor necrosis factor-alpha and interleukin-6, and expression levels of prointerleukin-beta, inducible nitric oxide synthase, and cyclooxygenase-2 in lipopolysaccharide (LPS)-activated mouse macrophages. EOLF also reduced NLRP3 inflammasome-derived interleukin-1beta secretion. The underlying mechanisms for the EOLF-mediated anti-inflammatory activity were (1) reduction of LPS-induced reactive oxygen species generation; (2) reduction of LPS-induced activation of c-Jun N-terminal kinase, extracellular signal-regulated kinase, and p38 MAP kinase; (3) reduction of LPS-induced nuclear factor-kappaBeta activation. Furthermore, 25 compounds were identified in the EOLF using GC-FID and GC-MS and the major compounds were terpinen-4-ol (32.0%), beta-pinene (18.0%), gamma-terpinene (13.8%), and alpha-terpinene (9.7%). We found that LPS-induced nitrite oxide generation was inhibited significantly by terpinen-4-ol. Our results indicated that EOLF has anti-inflammatory activity and may provide a molecular rationale for future therapeutic interventions in immune modulation.

  6. Role of Polymorphisms of Inducible Nitric Oxide Synthase and Endothelial Nitric Oxide Synthase in Idiopathic Environmental Intolerances

    Directory of Open Access Journals (Sweden)

    Chiara De Luca

    2015-01-01

    Full Text Available Oxidative stress and inflammation play a pathogenetic role in idiopathic environmental intolerances (IEI, namely, multiple chemical sensitivity (MCS, fibromyalgia (FM, and chronic fatigue syndrome (CFS. Given the reported association of nitric oxide synthase (NOS gene polymorphisms with inflammatory disorders, we aimed to investigate the distribution of NOS2A −2.5 kb (CCTTTn as well as Ser608Leu and NOS3 −786T>C variants and their correlation with nitrite/nitrate levels, in a study cohort including 170 MCS, 108 suspected MCS (SMCS, 89 FM/CFS, and 196 healthy subjects. Patients and controls had similar distributions of NOS2A Ser608Leu and NOS3 −786T>C polymorphisms. Interestingly, the NOS3 −786TT genotype was associated with increased nitrite/nitrate levels only in IEI patients. We also found that the NOS2A −2.5 kb (CCTTT11 allele represents a genetic determinant for FM/CFS, and the (CCTTT16 allele discriminates MCS from SMCS patients. Instead, the (CCTTT8 allele reduces by three-, six-, and tenfold, respectively, the risk for MCS, SMCS, and FM/CFS. Moreover, a short number of (CCTTT repeats is associated with higher concentrations of nitrites/nitrates. Here, we first demonstrate that NOS3 −786T>C variant affects nitrite/nitrate levels in IEI patients and that screening for NOS2A −2.5 kb (CCTTTn polymorphism may be useful for differential diagnosis of various IEI.

  7. Isolation and Characterization of Three New Monoterpene Synthases from Artemisia annua

    Science.gov (United States)

    Ruan, Ju-Xin; Li, Jian-Xu; Fang, Xin; Wang, Ling-Jian; Hu, Wen-Li; Chen, Xiao-Ya; Yang, Chang-Qing

    2016-01-01

    Artemisia annua, an annual herb used in traditional Chinese medicine, produces a wealth of monoterpenes and sesquiterpenes, including the well-known sesquiterpene lactone artemisinin, an active ingredient in the treatment for malaria. Here we report three new monoterpene synthases of A. annua. From a glandular trichome cDNA library, monoterpene synthases of AaTPS2, AaTPS5, and AaTPS6, were isolated and characterized. The recombinant proteins of AaTPS5 and AaTPS6 produced multiple products with camphene and 1,8-cineole as major products, respectively, and AaTPS2 produced a single product, β-myrcene. Although both Mg2+ and Mn2+ were able to support their catalytic activities, altered product spectrum was observed in the presence of Mn2+ for AaTPS2 and AaTPS5. Analysis of extracts of aerial tissues and root of A. annua with gas chromatography–mass spectrometry detected more than 20 monoterpenes, of which the three enzymes constituted more than 1/3 of the total. Mechanical wounding induced the expression of all three monoterpene synthase genes, and transcript levels of AaTPS5 and AaTPS6 were also elevated after treatments with phytohormones of methyl jasmonate, salicylic acid, and gibberellin, suggesting a role of these monoterpene synthases in plant–environment interactions. The three new monoterpene synthases reported here further our understanding of molecular basis of monoterpene biosynthesis and regulation in plant. PMID:27242840

  8. Pivotal role of glycogen synthase kinase-3: A therapeutic target for Alzheimer's disease.

    Science.gov (United States)

    Maqbool, Mudasir; Mobashir, Mohammad; Hoda, Nasimul

    2016-01-01

    Neurodegenerative diseases are among the most challenging diseases with poorly known mechanism of cause and paucity of complete cure. Out of all the neurodegenerative diseases, Alzheimer's disease is the most devastating and loosening of thinking and judging ability disease that occurs in the old age people. Many hypotheses came forth in order to explain its causes. In this review, we have enlightened Glycogen Synthase Kinase-3 which has been considered as a concrete cause for Alzheimer's disease. Plaques and Tangles (abnormal structures) are the basic suspects in damaging and killing of nerve cells wherein Glycogen Synthase Kinase-3 has a key role in the formation of these fatal accumulations. Various Glycogen Synthase Kinase-3 inhibitors have been reported to reduce the amount of amyloid-beta as well as the tau hyperphosphorylation in both neuronal and nonneuronal cells. Additionally, Glycogen Synthase Kinase-3 inhibitors have been reported to enhance the adult hippocampal neurogenesis in vivo as well as in vitro. Keeping the chemotype of the reported Glycogen Synthase Kinase-3 inhibitors in consideration, they may be grouped into natural inhibitors, inorganic metal ions, organo-synthetic, and peptide like inhibitors. On the basis of their mode of binding to the constituent enzyme, they may also be grouped as ATP, nonATP, and allosteric binding sites competitive inhibitors. ATP competitive inhibitors were known earlier inhibitors but they lack efficient selectivity. This led to find the new ways for the enzyme inhibition. Copyright © 2015 Elsevier Masson SAS. All rights reserved.

  9. High order quaternary arrangement confers increased structural stability to Brucella Spp. lumazine synthase

    Energy Technology Data Exchange (ETDEWEB)

    Zylberman, V.; Craig, P.O.; Klinke, S.; Cauerhff, A.; Goldbaum, F.A. [Instituto Leloir, Buenos Aires (Argentina); Braden, B.C. [Bowie State Univ., Maryland (United States)

    2004-07-01

    The penultimate step in the pathway of riboflavin biosynthesis is catalyzed by the enzyme lumazine synthase (LS). One of the most distinctive characteristics of this enzyme is the structural quaternary divergence found in different species. The protein exists as pentameric and icosahedral forms, built from practically the same structural monomeric unit. The pentameric structure is formed by five 18 kDa monomers, each extensively contacting neighboring monomers. The icosahedral structure consists of 60 LS monomers arranged as twelve pentamers giving rise to a capsid exhibiting icosahedral 532 symmetry. In all lumazine synthases studied, the topologically equivalent active sites are located at the interfaces between adjacent subunits in the pentameric modules. The Brucella spp. lumazine synthase (BLS) sequence clearly diverges from pentameric and icosahedral enzymes. This unusual divergence prompted to further investigate on its quaternary arrangement. In the present work, we demonstrate by means of solution Light Scattering and X-ray structural analyses that BLS assembles as a very stable dimer of pentamers representing a third category of quaternary assembly for lumazine synthases. We also describe by spectroscopic studies the thermodynamic stability of this oligomeric protein, and postulate a mechanism for dissociation/unfolding of this macromolecular assembly. The higher molecular order of BLS increases its stability 20 deg C compared to pentameric lumazine synthases. The decameric arrangement described in this work highlights the importance of quaternary interactions in the stabilization of proteins. (author)

  10. High order quaternary arrangement confers increased structural stability to Brucella Spp. lumazine synthase

    International Nuclear Information System (INIS)

    Zylberman, V.; Craig, P.O.; Klinke, S.; Cauerhff, A.; Goldbaum, F.A.; Braden, B.C.

    2004-01-01

    The penultimate step in the pathway of riboflavin biosynthesis is catalyzed by the enzyme lumazine synthase (LS). One of the most distinctive characteristics of this enzyme is the structural quaternary divergence found in different species. The protein exists as pentameric and icosahedral forms, built from practically the same structural monomeric unit. The pentameric structure is formed by five 18 kDa monomers, each extensively contacting neighboring monomers. The icosahedral structure consists of 60 LS monomers arranged as twelve pentamers giving rise to a capsid exhibiting icosahedral 532 symmetry. In all lumazine synthases studied, the topologically equivalent active sites are located at the interfaces between adjacent subunits in the pentameric modules. The Brucella spp. lumazine synthase (BLS) sequence clearly diverges from pentameric and icosahedral enzymes. This unusual divergence prompted to further investigate on its quaternary arrangement. In the present work, we demonstrate by means of solution Light Scattering and X-ray structural analyses that BLS assembles as a very stable dimer of pentamers representing a third category of quaternary assembly for lumazine synthases. We also describe by spectroscopic studies the thermodynamic stability of this oligomeric protein, and postulate a mechanism for dissociation/unfolding of this macromolecular assembly. The higher molecular order of BLS increases its stability 20 deg C compared to pentameric lumazine synthases. The decameric arrangement described in this work highlights the importance of quaternary interactions in the stabilization of proteins. (author)

  11. Identification of a novel CoA synthase isoform, which is primarily expressed in Brain

    International Nuclear Information System (INIS)

    Nemazanyy, Ivan; Panasyuk, Ganna; Breus, Oksana; Zhyvoloup, Alexander; Filonenko, Valeriy; Gout, Ivan T.

    2006-01-01

    CoA and its derivatives Acetyl-CoA and Acyl-CoA are important players in cellular metabolism and signal transduction. CoA synthase is a bifunctional enzyme which mediates the final stages of CoA biosynthesis. In previous studies, we have reported molecular cloning, biochemical characterization, and subcellular localization of CoA synthase (CoASy). Here, we describe the existence of a novel CoA synthase isoform, which is the product of alternative splicing and possesses a 29aa extension at the N-terminus. We termed it CoASy β and originally identified CoA synthase, CoASy α. The transcript specific for CoASy β was identified by electronic screening and by RT-PCR analysis of various rat tissues. The existence of this novel isoform was further confirmed by immunoblot analysis with antibodies directed to the N-terminal peptide of CoASy β. In contrast to CoASy α, which shows ubiquitous expression, CoASy β is primarily expressed in Brain. Using confocal microscopy, we demonstrated that both isoforms are localized on mitochondria. The N-terminal extension does not affect the activity of CoA synthase, but possesses a proline-rich sequence which can bring the enzyme into complexes with signalling proteins containing SH3 or WW domains. The role of this novel isoform in CoA biosynthesis, especially in Brain, requires further elucidation

  12. Influenza in workplaces: transmission, workers' adherence to sick leave advice and European sick leave recommendations.

    Science.gov (United States)

    Edwards, Christina Hansen; Tomba, Gianpaolo Scalia; de Blasio, Birgitte Freiesleben

    2016-06-01

    Knowledge about influenza transmission in the workplace and whether staying home from work when experiencing influenza-like illness can reduce the spread of influenza is crucial for the design of efficient public health initiatives. This review synthesizes current literature on sickness presenteeism and influenza transmission in the workplace and provides an overview of sick leave recommendations in Europe for influenza. A search was performed on Medline, Embase, PsychINFO, Cinahl, Web of Science, Scopus and SweMed to identify studies related to workplace contacts, -transmission, -interventions and compliance with recommendations to take sick leave. A web-based survey on national recommendations and policies for sick leave during influenza was issued to 31 European countries. Twenty-two articles (9 surveys; 13 modelling articles) were eligible for this review. Results from social mixing studies suggest that 20-25% of weekly contacts are made in the workplace, while modelling studies suggest that on average 16% (range 9-33%) of influenza transmission occurs in the workplace. The effectiveness of interventions to reduce workplace presenteeism is largely unknown. Finally, estimates from studies reporting expected compliance with sick leave recommendations ranged from 71 to 95%. Overall, 18 countries participated in the survey of which nine (50%) had issued recommendations encouraging sick employees to stay at home during the 2009 A(H1N1) pandemic, while only one country had official recommendations for seasonal influenza. During the 2009 A(H1N1) pandemic, many European countries recommended ill employees to take sick leave. Further research is warranted to quantify the effect of reduced presenteeism during influenza illness. © The Author 2016. Published by Oxford University Press on behalf of the European Public Health Association.

  13. Influenza in workplaces: transmission, workers’ adherence to sick leave advice and European sick leave recommendations

    Science.gov (United States)

    Tomba, Gianpaolo Scalia; de Blasio, Birgitte Freiesleben

    2016-01-01

    Background: Knowledge about influenza transmission in the workplace and whether staying home from work when experiencing influenza-like illness can reduce the spread of influenza is crucial for the design of efficient public health initiatives. Aim: This review synthesizes current literature on sickness presenteeism and influenza transmission in the workplace and provides an overview of sick leave recommendations in Europe for influenza. Methods: A search was performed on Medline, Embase, PsychINFO, Cinahl, Web of Science, Scopus and SweMed to identify studies related to workplace contacts, -transmission, -interventions and compliance with recommendations to take sick leave. A web-based survey on national recommendations and policies for sick leave during influenza was issued to 31 European countries. Results: Twenty-two articles (9 surveys; 13 modelling articles) were eligible for this review. Results from social mixing studies suggest that 20–25% of weekly contacts are made in the workplace, while modelling studies suggest that on average 16% (range 9–33%) of influenza transmission occurs in the workplace. The effectiveness of interventions to reduce workplace presenteeism is largely unknown. Finally, estimates from studies reporting expected compliance with sick leave recommendations ranged from 71 to 95%. Overall, 18 countries participated in the survey of which nine (50%) had issued recommendations encouraging sick employees to stay at home during the 2009 A(H1N1) pandemic, while only one country had official recommendations for seasonal influenza. Conclusions: During the 2009 A(H1N1) pandemic, many European countries recommended ill employees to take sick leave. Further research is warranted to quantify the effect of reduced presenteeism during influenza illness. PMID:27060594

  14. Maternity leave: existing policies in obstetrics and gynecology residency programs.

    Science.gov (United States)

    Davis, J L; Baillie, S; Hodgson, C S; Vontver, L; Platt, L D

    2001-12-01

    To survey program directors in obstetrics and gynecology regarding maternity leave and to determine how programs are dealing with maternity leave coverage. Questionnaires regarding impact and policy on maternity leave were mailed to accredited obstetrics and gynecology residency programs. A total of 188 of 274 (69%) questionnaires were returned completed. Respectively, 80% and 69% of respondents indicated that they have a formal maternity (maximum mean 8.7 weeks) and paternity (mean 5.27 days) leave policy. Approximately 75% of programs require residents to make up time if their leave exceeds 8 weeks during the first 3 years. Eighty-five percent of programs require residents to make up time if their leave exceeds 6 weeks during the fourth year. Ninety-three percent of programs require residents to make up time if their leave exceeds 20 weeks over the 4 years. Seventy-seven percent of respondents have other residents in their program cover for the absent resident. Thirty-seven percent of programs have schedules flexible enough to allow rearrangement so that some rotations go uncovered. Eighty-three percent of programs surveyed stated that maternity leave has a somewhat to very significant impact on the residents' schedules. Most residency programs have written maternity/paternity leave policies. A more flexible curriculum may help to accommodate the residents on leave without overburdening the residents who are left to cover.

  15. Bifunctional activity of deoxyhypusine synthase/hydroxylase from Trichomonas vaginalis.

    Science.gov (United States)

    Quintas-Granados, Laura Itzel; Carvajal Gamez, Bertha Isabel; Villalpando, Jose Luis; Ortega-Lopez, Jaime; Arroyo, Rossana; Azuara-Liceaga, Elisa; Álvarez-Sánchez, María Elizbeth

    2016-04-01

    The Trichomonas vaginalis genome analysis suggested the presence of a putative deoxyhypusine synthase (TvDHS) that catalyzes the posttranslational modification of eIF-5A. Herein, we expressed and purified the recombinant TvDHS (rTvDHS) protein (43 kDa) and the recombinant TveIF-5A (rTveIF-5A) precursor protein (46 kDa). A 41 kDa band of the native TvDHS was recognized by western blot analysis in T. vaginalis total protein extract by a mouse polyclonal anti-rTvDHS antibody. The enzymatic activity of rTvDHS was determined by in vitro rTveIF-5A precursor modification. The modification reaction was performed by using ((3)H)-spermidine, and the biochemical analysis showed that rTvDHS exhibited Km value of 0.6 μM. The rTvDHS activity was inhibited by the spermidine analog, N″-guanyl-1,7-diamino-heptane (GC7). Native gel electrophoresis analysis showed two bands corresponding to an rTvDHS-rTveIF-5A complex and an intermediate form of rTveIF-5A. The two forms were subsequently separated by ion exchange chromatography to identify the hypusine residue by MS/MS analysis. Moreover, mutations in TvDHS showed that the putative HE motif present in this enzyme is involved in the hydroxylation of TveIF-5A. We observed that only hypusine-containing TveIF-5A was bound to an RNA hairpin ERE structure from the cox-2 gene, which contains the AAAUGUCACAC consensus sequence. Interestingly, 2DE-WB assays, using parasites that were grown in DAB-culture conditions and transferred to exogenous putrescine, showed the new isoform of TveIF-5A. In summary, our results indicate that T. vaginalis contains an active TvDHS capable of modifying the precursor TveIF-5A protein, which subsequently exhibits RNA binding activity. Copyright © 2015. Published by Elsevier B.V.

  16. Nitric oxide-dependent vasorelaxation induced by extractive solutions and fractions of Maytenus ilicifolia Mart ex Reissek (Celastraceae) leaves.

    Science.gov (United States)

    Rattmann, Yanna D; Cipriani, Thales R; Sassaki, Guilherme L; Iacomini, Marcello; Rieck, Lia; Marques, Maria C A; da Silva-Santos, José E

    2006-04-06

    This study reveals that an ethanolic supernatant obtained from an aqueous extractive solution prepared from residues of methanolic extracts of ground leaves of Maytenus ilicifolia is able to cause a concentration- and endothelium-dependent relaxation in pre-contract rat aorta rings, with EC(50) of 199.7 (190-210) microg/ml. The non-selective nitric oxide synthase inhibitors l-NAME and l-NMMA abolished this effect, while superoxide dismutase and MnTBAP (a non-enzymatic superoxide dismutase mimetic) enhanced it. Further, relaxation induced by this ethanolic supernatant have been strongly inhibited by the guanylate cyclase inhibitors methylene blue and ODQ, as well as by the potassium channel blockers 4-aminopyridine and tetraethylammonium, but was unchanged by the cyclooxygenase inhibitor indomethacin and the membrane receptor antagonists atropine, HOE-140 and pirilamine. Partition of the ethanolic supernatant between H(2)O and EtOAc generated a fraction several times more potent, able to fully relax endothelium-intact aorta rings with an EC(50) of 4.3 (3.9-4.8) microg/ml. (13)C NMR spectrum of this fraction showed signals typical of catechin. This study reveals that the leaves of M. ilicifolia possess one or more potent substances able to relax endothelium-intact rat aorta rings, an event that appears to involve nitric oxide production, guanylate cyclase activation and potassium channel opening.

  17. Formation of (E)-nerolidol in tea (Camellia sinensis) leaves exposed to multiple stresses during tea manufacturing.

    Science.gov (United States)

    Zhou, Ying; Zeng, Lanting; Liu, Xiaoyu; Gui, Jiadong; Mei, Xin; Fu, Xiumin; Dong, Fang; Tang, Jingchi; Zhang, Lingyun; Yang, Ziyin

    2017-09-15

    (E)-Nerolidol is a volatile sesquiterpene that contributes to the floral aroma of teas (Camellia sinensis). The unique manufacturing process for oolong tea involves multiple stresses, resulting in a high content of (E)-nerolidol, which is not known to form in tea leaves. This study aimed to determine the formation mechanism of (E)-nerolidol in tea exposed to multiple stresses during tea manufacture. C. sinensis (E)-nerolidol synthase (CsNES) recombinant protein, found in the cytosol, was found to transform farnesyl diphosphate into (E)-nerolidol. CsNES was highly expressed during the oolong tea turn over process, resulting in (E)-nerolidol accumulation. Continuous mechanical damage, simulating the turn over process, significantly enhanced CsNES expression level and (E)-nerolidol content. The combination of low temperature stress and mechanical damage had a synergistic effect on (E)-nerolidol formation. This is the first evidence of (E)-nerolidol formation mechanism in tea leaves and a characteristic example of plant volatile formation in response to dual stresses. Copyright © 2017 Elsevier Ltd. All rights reserved.

  18. Flavonoids from leaves of Mauritia flexuosa

    Directory of Open Access Journals (Sweden)

    Djalma M. de Oliveira

    2013-09-01

    Full Text Available The chromatographic fractionation of the Mauritia flexuosa L. f., Arecaceae, leaves extract, a plant known by the name of buriti palm tree, resulted in the isolation of six flavonoids: tricin-7-O-rutinoside, apigenin-6-C-arabinoside, 8-C-glucoside (isoschaftoside, kaempferol-3-O-rutinoside (nicotiflorine, quercetin-3-O-rutinoside (rutin, luteolin-8-C-glucoside (orientin and luteolin-6-C-glucoside (isoorientin. The flavonoids were found out and previously reported as constituents of the Arecaceae family plants, but the occurrence of C-glucoside flavonoids, in the species being analyzed, is described for the first time on this study. The structural elucidations of all of the isolated compounds were performed by means of the comparison of their spectral data (¹H and 13C NMR, UV and ESI-MS with those ones of the literature.

  19. Green leaves as indicator for air pollution

    International Nuclear Information System (INIS)

    Abd Alla, A. A. M.

    2004-02-01

    Green leaves of Ficus (Ficus penegalensis) and Neem (Azadirachta indica) were analyzed for their trace metals (Pb, Zn and Cd) contents. The samples were collected and washed according to metal analysis standardization. Solutions of the samples for analysis were obtained by wet-digestion method using nitric perchloric acid mixture. The trace elements lead, zinc and cadmium were determined by Atomic Absorption Spectroscopic technique (AAS) for the 18 samples collected from Khartoum (Sharia elneel), Omdurman (Ombadda) and Khartoum North (Kadaro) as heavy-traffic, low-traffic areas and distal area, respectively. The species Ficus and Neem samples were collected each randomly from such areas. The samples were taken from the tips, mids and bottoms of each tree. (Author)

  20. Green leaves as indicator for air pollution

    Energy Technology Data Exchange (ETDEWEB)

    Abd Alla, A. A. M. [Department of Chemistry, Faculty of Science, University of Juba, Khartoum (Sudan)

    2004-02-15

    Green leaves of Ficus (Ficus penegalensis) and Neem (Azadirachta indica) were analyzed for their trace metals (Pb, Zn and Cd) contents. The samples were collected and washed according to metal analysis standardization. Solutions of the samples for analysis were obtained by wet-digestion method using nitric perchloric acid mixture. The trace elements lead, zinc and cadmium were determined by Atomic Absorption Spectroscopic technique (AAS) for the 18 samples collected from Khartoum (Sharia elneel), Omdurman (Ombadda) and Khartoum North (Kadaro) as heavy-traffic, low-traffic areas and distal area, respectively. The species Ficus and Neem samples were collected each randomly from such areas. The samples were taken from the tips, mids and bottoms of each tree. (Author)

  1. NOpiates: Novel Dual Action Neuronal Nitric Oxide Synthase Inhibitors with μ-Opioid Agonist Activity.

    Science.gov (United States)

    Renton, Paul; Green, Brenda; Maddaford, Shawn; Rakhit, Suman; Andrews, John S

    2012-03-08

    A novel series of benzimidazole designed multiple ligands (DMLs) with activity at the neuronal nitric oxide synthase (nNOS) enzyme and the μ-opioid receptor was developed. Targeting of the structurally dissimilar heme-containing enzyme and the μ-opioid GPCR was predicated on the modulatory role of nitric oxide on μ-opioid receptor function. Structure-activity relationship studies yielded lead compound 24 with excellent nNOS inhibitory activity (IC50 = 0.44 μM), selectivity over both endothelial nitric oxide synthase (10-fold) and inducible nitric oxide synthase (125-fold), and potent μ-opioid binding affinity, K i = 5.4 nM. The functional activity as measured in the cyclic adenosine monosphospate secondary messenger assay resulted in full agonist activity (EC50 = 0.34 μM). This work represents a novel approach in the development of new analgesics for the treatment of pain.

  2. Crystallization and preliminary crystallographic analysis of an octaketide-producing plant type III polyketide synthase

    Energy Technology Data Exchange (ETDEWEB)

    Morita, Hiroyuki [Mitsubishi Kagaku Institute of Life Sciences (MITILS), 11 Minamiooya, Machida, Tokyo 194-8511 (Japan); Kondo, Shin; Kato, Ryohei [Innovation Center Yokohama, Mitsubishi Chemical Corporation, 1000 Kamoshida, Aoba, Yokohama, Kanagawa 227-8502 (Japan); Wanibuchi, Kiyofumi; Noguchi, Hiroshi [School of Pharmaceutical Sciences, University of Shizuoka, Shizuoka 422-8526 (Japan); Sugio, Shigetoshi, E-mail: sugio.shigetoshi@mw.m-kagaku.co.jp [Innovation Center Yokohama, Mitsubishi Chemical Corporation, 1000 Kamoshida, Aoba, Yokohama, Kanagawa 227-8502 (Japan); Abe, Ikuro, E-mail: sugio.shigetoshi@mw.m-kagaku.co.jp [School of Pharmaceutical Sciences, University of Shizuoka, Shizuoka 422-8526 (Japan); PRESTO, Japan Science and Technology Agency, Kawaguchi, Saitama 332-0012 (Japan); Kohno, Toshiyuki, E-mail: sugio.shigetoshi@mw.m-kagaku.co.jp [Mitsubishi Kagaku Institute of Life Sciences (MITILS), 11 Minamiooya, Machida, Tokyo 194-8511 (Japan)

    2007-11-01

    Octaketide synthase from A. arborescens has been overexpressed in E. coli, purified and crystallized. Diffraction data have been collected to 2.6 Å. Octaketide synthase (OKS) from Aloe arborescens is a plant-specific type III polyketide synthase that produces SEK4 and SEK4b from eight molecules of malonyl-CoA. Recombinant OKS expressed in Escherichia coli was crystallized by the hanging-drop vapour-diffusion method. The crystals belonged to space group I422, with unit-cell parameters a = b = 110.2, c = 281.4 Å, α = β = γ = 90.0°. Diffraction data were collected to 2.6 Å resolution using synchrotron radiation at BL24XU of SPring-8.

  3. Expression, purification and preliminary crystallographic analysis of sucrose phosphate synthase (SPS) from Halothermothrix orenii

    International Nuclear Information System (INIS)

    Huynh, Frederick; Tan, Tien-Chye; Swaminathan, Kunchithapadam; Patel, Bharat K. C.

    2004-01-01

    The first crystallographic study of a sucrose phosphate synthase from H. orenii, an organism that is both thermophilic and halophilic, is reported. The protein crystal diffracts X-rays to 3.01 Å. This is the first report of the crystallization of a sucrose phosphate synthase (SPS; EC 2.4.1.14). It also constitutes the first study of a sucrose phosphate synthase from a non-photosynthetic thermohalophilic anaerobic bacterium, Halothermothrix orenii. The purified recombinant spsA protein has been crystallized in the monoclinic space group C2, with unit-cell parameters a = 154.2, b = 47.9, c = 72.3 Å, β = 103.16°, using the hanging-drop vapour-diffusion method. The crystal diffracts X-rays to a resolution limit of 3.01 Å. Heavy-metal and halide-soaking trials are currently in progress to solve the structure

  4. Broad Substrate Specificity of the Loading Didomain of the Lipomycin Polyketide Synthase

    Energy Technology Data Exchange (ETDEWEB)

    Yuzawa, S; Eng, CH; Katz, L; Keasling, JD

    2013-06-04

    LipPks1, a polyketide synthase subunit of the lipomycin synthase, is believed to catalyze the polyketide chain initiation reaction using isobutyryl-CoA as a substrate, followed by an elongation reaction with methylmalonyl-CoA to start the biosynthesis of antibiotic alpha-lipomycin in Streptomyces aureofaciens Tu117. Recombinant LipPks1, containing the thioesterase domain from the 6-deoxyerythronolide B synthase, was produced in Escherichia coli, and its substrate specificity was investigated in vitro. Surprisingly, several different acyl-CoAs, including isobutyryl-CoA, were accepted as the starter substrates, while no product was observed with acetyl-CoA. These results demonstrate the broad substrate specificity of LipPks1 and may be applied to producing new antibiotics.

  5. Novel polyhydroxyalkanoate copolymers produced in Pseudomonas putida by metagenomic polyhydroxyalkanoate synthases.

    Science.gov (United States)

    Cheng, Jiujun; Charles, Trevor C

    2016-09-01

    Bacterially produced biodegradable polyhydroxyalkanoates (PHAs) with versatile properties can be achieved using different PHA synthases (PhaCs). This work aims to expand the diversity of known PhaCs via functional metagenomics and demonstrates the use of these novel enzymes in PHA production. Complementation of a PHA synthesis-deficient Pseudomonas putida strain with a soil metagenomic cosmid library retrieved 27 clones expressing either class I, class II, or unclassified PHA synthases, and many did not have close sequence matches to known PhaCs. The composition of PHA produced by these clones was dependent on both the supplied growth substrates and the nature of the PHA synthase, with various combinations of short-chain-length (SCL) and medium-chain-length (MCL) PHA. These data demonstrate the ability to isolate diverse genes for PHA synthesis by functional metagenomics and their use for the production of a variety of PHA polymer and copolymer mixtures.

  6. Human METTL12 is a mitochondrial methyltransferase that modifies citrate synthase.

    Science.gov (United States)

    Rhein, Virginie F; Carroll, Joe; Ding, Shujing; Fearnley, Ian M; Walker, John E

    2017-06-01

    The protein methylome in mammalian mitochondria has been little studied until recently. Here, we describe that lysine-368 of human citrate synthase is methylated and that the modifying enzyme, localized in the mitochondrial matrix, is methyltransferase-like protein 12 (METTL12), a member of the family of 7β-strand methyltransferases. Lysine-368 is near the active site of citrate synthase, but removal of methylation has no effect on its activity. In mitochondria, it is possible that some or all of the enzymes of the citric acid cycle, including citrate synthase, are organized in metabolons to facilitate the channelling of substrates between participating enzymes. Thus, possible roles for the methylation of Lys-368 are in controlling substrate channelling itself, or in influencing protein-protein interactions in the metabolon. © 2017 The Authors FEBS Letters published by John Wiley & Sons Ltd on behalf of Federation of European Biochemical Societies.

  7. Potassium deficiency affects the carbon-nitrogen balance in cotton leaves.

    Science.gov (United States)

    Hu, Wei; Coomer, Taylor D; Loka, Dimitra A; Oosterhuis, Derrick M; Zhou, Zhiguo

    2017-06-01

    Potassium (K) plays important roles in the metabolism of carbon (C) and nitrogen (N), but studies of K deficiency affecting C-N balance are lacking. This study explored the influence of K deficiency on C-N interaction in cotton leaves by conducting a field experiment with cotton cultivar DP0912 under two K rates (K0: 0 kg K 2 O ha -1 and K67: 67 kg K 2 O ha -1 ) and a controlled environment experiment with K-deficient solution (K1: 0 mM K + ) and K-sufficient solution (K2: 6 mM K + ). The results showed that leaf K content, leaf number, leaf area, boll number, reproductive dry weight and total dry weight were significant lower under K deficiency (K0 or K1). Lower total chlorophyll content and Chl a/b ratio, and decreased Pn along with lower Gs and higher Ci were measured under K deficiency, suggesting that the decrease in Pn was resulted from non-stomatal limitation. Leaf glucose, fructose, sucrose and starch contents were higher under K deficiency, because lower sucrose export was detected in phloem. Although leaf nitrate and ammonium contents significantly decreased, free amino acid content was increased by 40-63% under K deficiency, since lower amino acid export was also measured in phloem. K deficiency also induced lower soluble protein content in leaves. Leaf ATP level was significantly increased under K deficiency, indicating ATP utilization was lower, so that less energy was supplied to C and N metabolism. The ratio of soluble sugar to free amino acid and the C/N ratio markedly increased under K deficiency, and one reason was that the phloem export reduced more prominent for sucrose (54.6-78.0%) than amino acid (36.7-85.4%) under K deficiency. In addition, lower phosphoenolpyruvate carboxylase activity limited malate and citrate biosynthesis under K deficiency, causing a decrease of C flux into the amino acids, which was not beneficial for maintaining C-N balance. Sucrose phosphate synthase and nitrate reductase activities were lower under K deficiency

  8. Association of Endothelial Nitric Oxide Synthase Gene Polymorphisms With Acute Rejection in Liver Transplant Recipients.

    Science.gov (United States)

    Azarpira, Negar; Namazi, Soha; Malahi, Sayan; Kazemi, Kourosh

    2016-06-01

    Polymorphisms of the endothelial nitric oxide synthase gene have been associated with altered endothelial nitric oxide synthase activity. The purpose of this study was to investigate the relation between endothelial nitric oxide synthase -786T/C and 894G/T polymorphism and their haplotypes on the occurrence of acute rejection episodes in liver transplant recipients. We conducted a case control study in which 100 liver transplant recipients and 100 healthy controls were recruited from Shiraz Transplant Center. The patients used triple therapy including tacrolimus, mycophenolate mofetil, and prednisolone for immunosuppression maintenance. DNA was extracted from peripheral blood and endothelial nitric oxide synthase polymorphisms were determined by polymerase chain reaction and restriction fragment length polymorphism. Patients included 60 men and 40 women (mean age, 32.35 ± 10.2 y). There was a significant association of endothelial nitric oxide synthase 894G/T and acute rejection episode. The GT* gen-otype and acute rejection episodes had a significant association (odds ratio, 2.42; 95% confidence interval, 0.97-6.15; P = .03). The GG and GT* genotype and T* allele frequency were significantly different between patients and control subjects (P = .001). Haplotype TT* was higher in recipients than control subjects (odds ratio, 2.17; 95% confidence interval, 1.12-4.25; P = .01). Haplotype TG was higher in the control group (odds ratio, 0.62; 95% confidence interval, 0.40-0.96; P = .02). Our results suggest a relation between different endothelial nitric oxide synthase geno-types and risk of acute rejection episodes. However, further study is necessary to determine genetic susceptibility for transplant patients.

  9. Molecular cloning of a seed specific multifunctional RFO synthase/ galactosylhydrolase in Arabidopsis thaliana

    Directory of Open Access Journals (Sweden)

    Roman eGangl

    2015-09-01

    Full Text Available Stachyose is among the raffinose family oligosaccharides one of the major water-soluble carbohydrates next to sucrose in seeds of a number of plant species. Especially in leguminous seeds, e.g. chickpea, stachyose is reported as the major component. In contrast to their ambiguous potential as essential source of carbon for germination, raffinose family oligosaccharides are indigestible for humans and can contribute to diverse abdominal disorders.In the genome of Arabidopsis thaliana, six putative raffinose synthase genes are reported, whereas little is known about these putative raffinose synthases and their biochemical characteristics or their contribution to the raffinose family oligosaccharide physiology in A. thaliana.In this paper, we report on the molecular cloning, functional expression in Escherichia coli and purification of recombinant AtRS4 from A. thaliana and the biochemical characterisation of the putative stachyose synthase (AtSTS, At4g01970 as a raffinose and high affinity stachyose synthase (Km for raffinose 259.2 ± 21.15 µM as well as stachyose and galactinol specific galactosylhydrolase. A T-DNA insertional mutant in the AtRS4 gene was isolated. Only sqPCR from WT siliques showed a specific transcriptional AtRS4 PCR product. Metabolite measurements in seeds of ΔAtRS4 mutant plants revealed a total loss of stachyose in ΔAtRS4 mutant seeds. We conclude that AtRS4 is the only stachyose synthase in the genome of A. thaliana that AtRS4 represents a key regulation mechanism in the raffinose family oligosaccharide physiology of A. thaliana due to its multifunctional enzyme activity and that AtRS4 is possibly the second seed specific raffinose synthase beside AtRS5, which is responsible for Raf-accumulation under abiotic stress.

  10. Homocysteine threshold value based on cystathionine beta synthase and paraoxonase 1 activities in mice.

    Science.gov (United States)

    Hamelet, J; Aït-Yahya-Graison, E; Matulewicz, E; Noll, C; Badel-Chagnon, A; Camproux, A-C; Demuth, K; Paul, J-L; Delabar, J M; Janel, N

    2007-12-01

    Hyperhomocysteinaemia is a metabolic disorder associated with the development of premature atherosclerosis. Among the determinants which predispose to premature thromboembolic and atherothrombotic events, serum activity of paraoxonase 1, mainly synthesized in the liver, has been shown to be a predictor of cardiovascular disease and to be negatively correlated with serum homocysteine levels in human. Even though treatments of hyperhomocysteinaemic patients ongoing cardiovascular complications are commonly used, it still remains unclear above which homocysteine level a preventive therapy should be started. In order to establish a threshold of plasma homocysteine concentration we have analyzed the hepatic cystathionine beta synthase and paraoxonase 1 activities in a moderate to intermediate murine model of hyperhomocysteinaemia. Using wild type and heterozygous cystathionine beta synthase deficient mice fed a methionine enriched diet or a control diet, we first studied the link between cystathionine beta synthase and paraoxonase 1 activities and plasma homocysteine concentration. Among the animals used in this study, we observed a negative correlation between plasma homocysteine level and cystathionine beta synthase activity (rho=-0.52, P=0.0008) or paraoxonase 1 activity (rho=-0.49, P=0.002). Starting from these results, a homocysteine cut-off value of 15 microm has been found for both cystathionine beta synthase (P=0.0003) and paraoxonase 1 (P=0.0007) activities. Our results suggest that both cystathionine beta synthase and paraoxonase 1 activities are significantly decreased in mice with a plasma homocysteine value greater than 15 microm. In an attempt to set up preventive treatment for cardiovascular disease our results indicate that treatments should be started from 15 microm of plasma homocysteine.

  11. a Modeling Method of Fluttering Leaves Based on Point Cloud

    Science.gov (United States)

    Tang, J.; Wang, Y.; Zhao, Y.; Hao, W.; Ning, X.; Lv, K.; Shi, Z.; Zhao, M.

    2017-09-01

    Leaves falling gently or fluttering are common phenomenon in nature scenes. The authenticity of leaves falling plays an important part in the dynamic modeling of natural scenes. The leaves falling model has a widely applications in the field of animation and virtual reality. We propose a novel modeling method of fluttering leaves based on point cloud in this paper. According to the shape, the weight of leaves and the wind speed, three basic trajectories of leaves falling are defined, which are the rotation falling, the roll falling and the screw roll falling. At the same time, a parallel algorithm based on OpenMP is implemented to satisfy the needs of real-time in practical applications. Experimental results demonstrate that the proposed method is amenable to the incorporation of a variety of desirable effects.

  12. A MODELING METHOD OF FLUTTERING LEAVES BASED ON POINT CLOUD

    Directory of Open Access Journals (Sweden)

    J. Tang

    2017-09-01

    Full Text Available Leaves falling gently or fluttering are common phenomenon in nature scenes. The authenticity of leaves falling plays an important part in the dynamic modeling of natural scenes. The leaves falling model has a widely applications in the field of animation and virtual reality. We propose a novel modeling method of fluttering leaves based on point cloud in this paper. According to the shape, the weight of leaves and the wind speed, three basic trajectories of leaves falling are defined, which are the rotation falling, the roll falling and the screw roll falling. At the same time, a parallel algorithm based on OpenMP is implemented to satisfy the needs of real-time in practical applications. Experimental results demonstrate that the proposed method is amenable to the incorporation of a variety of desirable effects.

  13. Generation of poly-β-hydroxybutyrate from acetate in higher plants: Detection of acetoacetyl CoA reductase- and PHB synthase- activities in rice.

    Science.gov (United States)

    Tsuda, Hirohisa; Shiraki, Mari; Inoue, Eri; Saito, Terumi

    2016-08-20

    It has been reported that Poly-β-hydroxybutyrate (PHB) is generated from acetate in the rice root. However, no information is available about the biosynthetic pathway of PHB from acetate in plant cells. In the bacterium Ralstonia eutropha H16 (R. eutropha), PHB is synthesized from acetyl CoA by the consecutive reaction of three enzymes: β-ketothiolase (EC: 2.3.1.9), acetoacetyl CoA reductase (EC: 1.1.1.36) and PHB synthase (EC: 2.3.1.-). Thus, in this study, we examined whether the above three enzymatic activities were also detected in rice seedlings. The results clearly showed that the activities of the above three enzymes were all detected in rice. In particular, the PHB synthase activity was detected specifically in the sonicated particulate fractions (2000g 10min precipitate (ppt) and the 8000g 30min ppt) of rice roots and leaves. In addition to these enzyme activities, several new experimental results were obtained on PHB synthesis in higher plants: (a) (14)C-PHB generated from 2-(14)C-acetate was mainly localized in the 2000g 10min ppt and the 8000g 30min ppt of rice root. (b) Addition of acetate (0.1-10mM) to culture medium of rice seedlings did not increase the content of PHB in the rice root or leaf. (c) In addition to C3 plants, PHB was generated from acetate in a C4 plant (corn) and in a CAM plant (Bryophyllum pinnatum). d) Washing with ethylenediaminetetraacetic acid (EDTA) strongly suggested that the PHB synthesized from acetate was of plant origin and was not bacterial contamination. Copyright © 2016 Elsevier GmbH. All rights reserved.

  14. Mechanisms of suppression of inducible nitric oxide synthase (iNOS) expression in RAW 264.7 cells by andrographolide

    Science.gov (United States)

    Chiou, Wen-Fei; Chen, Chieh-Fu; Lin, Jin-Jung

    2000-01-01

    Andrographolide, an active component found in leaves of Andrographis paniculata, has been reported to exhibit nitric oxide (NO) inhibitory property in endotoxin-stimulated macrophages, however, the detailed mechanisms remain unclear. In the present study we investigated the effect of andrographolide on the expression of inducible NO synthase (iNOS) mRNA, protein, and enzyme activity in RAW 264.7 macrophages stimulated with lipopolysaccharide (LPS) plus interferon-γ (IFN-γ).RAW 264.7 cells stimulated with LPS/IFN-γ activated NO production; in this condition andrographolide (1–100 μM) inhibited NO production in a dose-dependent manner with an IC50 value of 17.4±1.1 μM. Andrographolide also reduces the expression of iNOS protein level but without a significant effect on iNOS mRNA. The reduction of iNOS activity is thought to be caused by decreased expression of iNOS protein.In a protein stability assay, andrographolide moderately but significantly reduced the amount of iNOS protein as suggested by accelerating degradation. Furthermore, andrographolide also inhibited total protein de novo synthesis as demonstrated by [35S]-methionine incorporation.As a whole, these data suggest that andrographolide inhibits NO synthesis in RAW 264.7 cells by reducing the expression of iNOS protein and the reduction could occur through two additional mechanisms: prevention of the de novo protein synthesis and decreasing the protein stability via a post-transcriptional mechanism. It is also possible that inhibition of iNOS protein expression and NO production under immune stimulation and/or bacteria infection may explain, in part, the beneficial effects of andrographolide as an anti-inflammatory agent. PMID:10780958

  15. Suppressing Farnesyl Diphosphate Synthase Alters Chloroplast Development and Triggers Sterol-Dependent Induction of Jasmonate- and Fe-Related Responses.

    Science.gov (United States)

    Manzano, David; Andrade, Paola; Caudepón, Daniel; Altabella, Teresa; Arró, Montserrat; Ferrer, Albert

    2016-09-01

    Farnesyl diphosphate synthase (FPS) catalyzes the synthesis of farnesyl diphosphate from isopentenyl diphosphate and dimethylallyl diphosphate. Arabidopsis (Arabidopsis thaliana) contains two genes (FPS1 and FPS2) encoding FPS. Single fps1 and fps2 knockout mutants are phenotypically indistinguishable from wild-type plants, while fps1/fps2 double mutants are embryo lethal. To assess the effect of FPS down-regulation at postembryonic developmental stages, we generated Arabidopsis conditional knockdown mutants expressing artificial microRNAs devised to simultaneously silence both FPS genes. Induction of silencing from germination rapidly caused chlorosis and a strong developmental phenotype that led to seedling lethality. However, silencing of FPS after seed germination resulted in a slight developmental delay only, although leaves and cotyledons continued to show chlorosis and altered chloroplasts. Metabolomic analyses also revealed drastic changes in the profile of sterols, ubiquinones, and plastidial isoprenoids. RNA sequencing and reverse transcription-quantitative polymerase chain reaction transcriptomic analysis showed that a reduction in FPS activity levels triggers the misregulation of genes involved in biotic and abiotic stress responses, the most prominent one being the rapid induction of a set of genes related to the jasmonic acid pathway. Down-regulation of FPS also triggered an iron-deficiency transcriptional response that is consistent with the iron-deficient phenotype observed in FPS-silenced plants. The specific inhibition of the sterol biosynthesis pathway by chemical and genetic blockage mimicked these transcriptional responses, indicating that sterol depletion is the primary cause of the observed alterations. Our results highlight the importance of sterol homeostasis for normal chloroplast development and function and reveal important clues about how isoprenoid and sterol metabolism is integrated within plant physiology and development. © 2016

  16. Isolation and characterization of three new monoterpene synthases from Artemisia annua

    OpenAIRE

    Ju-Xin eRuan; Jian-Xu eLi; Xin eFang; Ling-Jian eWang; Wen-Li eHu; Xiao-Ya eChen; Changqing eYang

    2016-01-01

    Artemisia annua, an annual herb used in traditional Chinese medicine, produces a wealth of monoterpenes and sesquiterpenes, including the well-known sesquiterpene lactone artemisinin, an active ingredient in the treatment for malaria. Here we report three new monoterpene synthases of A. annua. From a glandular trichome cDNA library, monoterpene synthases of AaTPS2, AaTPS5 and AaTPS6, were isolated and characterized. The recombinant proteins of AaTPS5 and AaTPS6 produced multiple products with...

  17. Mechanistic studies of 3-deoxy-D-manno-octulosonic acid 8-phosphate synthase

    International Nuclear Information System (INIS)

    Dotson, G.D.; Woodard, R.W.

    1994-01-01

    The enzyme 3-deOXY-D-manno-octulosonic acid 8-phosphate synthase (KDO 8-P synthase) catalyses the condensation of arabinose 5-phosphate (A 5-P) with phosphoenolpyruvate (PEP) to give the unique eight-carbon acidic sugar 3-deoxy-D-nianno-octulosonic acid 8-phosphate (KDO 8-P) found only in gram-negative bacteria and required for lipid A maturation and cellular growth. The E. coli gene kdsA that encodes KDO 8-P synthase has been amplified by standard PCR methodologies. The synthetic gene, subcloned into the expression vector pT7-7 was used to infect E. coli BL 21 (DE 3). Purification of crude supernatant from this transformant on Q Sepharose yields >200 mg of near-homogeneous KDO 8-P synthase per liter of cell culture. To explore the mechanism of KDO 8-P synthase, we prepared (E)- and (Z)-(3 2 H)PEP, (2- 13 C)PEP, and (2- 13 C, 18 O)PEP chemically from the appropriately labeled 3-bromopyruvates by reaction with trimethylphosphite under Perkow reaction conditions. Our 1 H-NMR analysis of the stereochemistry at C3 of the KDO 8-Ps, obtained by separate incubation of (E)- and (Z)-(3- 2 H)PEP with A 5-P in the presence of KDO 8-P synthase, demonstrated that the reaction is stereospecific with respect to both the C3 of PEP and the C1 carbonyl of A 5-P. (Z)-(3- 2 H)PEP gave predominantly (3S)-(3 2 H)KDO 8-P and (E)-(3- 2 H)PEP gave predominantly (3R)-(3 2 H)KDO-8P, which indicates condensation of the si face of PEP upon the re face of A 5-P-an orientation analogous to that seen with the similar aldehyde Iyase DAH 7-P synthase. The fate of the enolic oxygen of (2- 13 C, 18 O)PEP, during the course of the KDO 8-P synthase-catalyzed reaction as monitored by both 13 C- and 31 P-NMR spectroscopy demonstrated that the inorganic phosphate (Pi) and not the KDO 8-P contained the 18 O

  18. Isolation and identification of a thermophilic strain producing trehalose synthase from geothermal water in China.

    Science.gov (United States)

    Zhu, Yueming; Zhang, Jun; Wei, Dongsheng; Wang, Yufan; Chen, Xiaoyun; Xing, Laijun; Li, Mingchun

    2008-08-01

    A slightly thermophilic strain, CBS-01, producing trehalose synthase (TreS), was isolated from geothermal water in this study. According to the phenotypic characteristics and phylogenetic analysis of the 16s rRNA gene sequence, it was identified as Meiothermus ruber. The trehalose synthase gene of Meiothermus ruber CBS-01 was cloned by polymerase chain reaction and sequenced. The TreS gene consisted of 2,895 nucleotides, which specified a 964-amino-acid protein. This novel TreS catalyzed reversible interconversion of maltose and trehalose.

  19. Effects of acetoacetyl-CoA synthase expression on production of farnesene in Saccharomyces cerevisiae

    DEFF Research Database (Denmark)

    Tippmann, Stefan; Ferreira, Raphael; Siewers, Verena

    2017-01-01

    to overcome the thermodynamic constraint imposed on the first reaction, in which acetoacetyl-CoA is produced from two moles of acetyl-CoA by acetoacetyl-CoA thiolase. Recently, a novel acetoacetyl-CoA synthase (nphT7) has been identified from Streptomyces sp. strain CL190, which catalyzes the irreversible...... functionality of the bypass was limited by the efficiency of acetoacetyl-CoA synthase (nphT7). Besides modulation of the expression level, which could be used as a means to partially restore the phenotype, nphT7 from Streptomyces glaucescens showed clearly higher efficiency compared to Streptomyces sp. strain...

  20. Identification, functional characterization and developmental regulation of sesquiterpene synthases from sunflower capitate glandular trichomes

    Directory of Open Access Journals (Sweden)

    Ro Dae-Kyun

    2009-07-01

    Full Text Available Abstract Background Sesquiterpene lactones are characteristic metabolites of Asteraceae (or Compositae which often display potent bioactivities and are sequestered in specialized organs such as laticifers, resin ducts, and trichomes. For characterization of sunflower sesquiterpene synthases we employed a simple method to isolate pure trichomes from anther appendages which facilitated the identification of these genes and investigation of their enzymatic functions and expression patterns during trichome development. Results Glandular trichomes of sunflower (Helianthus annuus L. were isolated, and their RNA was extracted to investigate the initial steps of sesquiterpene lactone biosynthesis. Reverse transcription-PCR experiments led to the identification of three sesquiterpene synthases. By combination of in vitro and in vivo characterization of sesquiterpene synthase gene products in Escherichia coli and Saccharomyces cerevisiae, respectively, two enzymes were identified as germacrene A synthases, the key enzymes of sesquiterpene lactone biosynthesis. Due to the very low in vitro activity, the third enzyme was expressed in vivo in yeast as a thioredoxin-fusion protein for functional characterization. In in vivo assays, it was identified as a multiproduct enzyme with the volatile sesquiterpene hydrocarbon δ-cadinene as one of the two main products with α-muuorlene, β-caryophyllene, α-humulene and α-copaene as minor products. The second main compound remained unidentified. For expression studies, glandular trichomes from the anther appendages of sunflower florets were isolated in particular developmental stages from the pre- to the post-secretory phase. All three sesquiterpene synthases were solely upregulated during the biosynthetically active stages of the trichomes. Expression in different aerial plant parts coincided with occurrence and maturity of trichomes. Young roots with root hairs showed expression of the sesquiterpene synthase genes

  1. Mechanistic studies of 3-deoxy-D-manno-octulosonic acid 8-phosphate synthase

    Energy Technology Data Exchange (ETDEWEB)

    Dotson, G.D.; Woodard, R.W. [Univ. of Michigan, Ann Arbor, MI (United States)

    1994-12-01

    The enzyme 3-deOXY-D-manno-octulosonic acid 8-phosphate synthase (KDO 8-P synthase) catalyses the condensation of arabinose 5-phosphate (A 5-P) with phosphoenolpyruvate (PEP) to give the unique eight-carbon acidic sugar 3-deoxy-D-nianno-octulosonic acid 8-phosphate (KDO 8-P) found only in gram-negative bacteria and required for lipid A maturation and cellular growth. The E. coli gene kdsA that encodes KDO 8-P synthase has been amplified by standard PCR methodologies. The synthetic gene, subcloned into the expression vector pT7-7 was used to infect E. coli BL 21 (DE 3). Purification of crude supernatant from this transformant on Q Sepharose yields >200 mg of near-homogeneous KDO 8-P synthase per liter of cell culture. To explore the mechanism of KDO 8-P synthase, we prepared (E)- and (Z)-(3{sup 2}H)PEP, (2-{sup 13}C)PEP, and (2-{sup 13}C,{sup 18}O)PEP chemically from the appropriately labeled 3-bromopyruvates by reaction with trimethylphosphite under Perkow reaction conditions. Our {sup 1}H-NMR analysis of the stereochemistry at C3 of the KDO 8-Ps, obtained by separate incubation of (E)- and (Z)-(3-{sup 2}H)PEP with A 5-P in the presence of KDO 8-P synthase, demonstrated that the reaction is stereospecific with respect to both the C3 of PEP and the C1 carbonyl of A 5-P. (Z)-(3-{sup 2}H)PEP gave predominantly (3S)-(3{sup 2}H)KDO 8-P and (E)-(3-{sup 2}H)PEP gave predominantly (3R)-(3{sup 2}H)KDO-8P, which indicates condensation of the si face of PEP upon the re face of A 5-P-an orientation analogous to that seen with the similar aldehyde Iyase DAH 7-P synthase. The fate of the enolic oxygen of (2-{sup 13}C, {sup 18}O)PEP, during the course of the KDO 8-P synthase-catalyzed reaction as monitored by both {sup 13}C- and {sup 31}P-NMR spectroscopy demonstrated that the inorganic phosphate (Pi) and not the KDO 8-P contained the {sup 18}O.

  2. Is part-time sick leave helping the unemployed?

    OpenAIRE

    Andrén, Daniela

    2011-01-01

    Using a discrete choice one-factor model, we estimate mean treatment parameters and distributional treatment parameters to analyze the effects of degree of sick leave on the probability of full recovery of lost work capacity for employed and unemployed individuals, respectively. Our results indicate that one year after the sick leave spell started, the average potential impact of part-time sick listing on an individual randomly chosen from the population on sick leave was positive for both gr...

  3. Chemical composition on cacao leaves infected by viruses

    International Nuclear Information System (INIS)

    Mustafa, M.; Delilah, M.; Syafrul, L.; Suryadi.

    1980-01-01

    Chemical analysis on cacao leaves that have chlorosis spots caused by cocoa swollen shoot viruses were carried out. It can be shown that leaves with chlorosis spots contain less chlorophyl and lipides than those without, but both do not show any significant difference in the concentration of water, glucose, saccharides, amino acid and proteins. It can be concluded that transport systems in the infected leaves are good so that the water and saccharides distribution in them are not disturbed. (author tr.)

  4. Abscisic acid protects bean leaves from ozone-induced phytotoxicity

    Energy Technology Data Exchange (ETDEWEB)

    Fletcher, R.A.; Adedipe, N.O.; Ormrod, D.P.

    1972-01-01

    Abscisic acid treatment of primary bean leaves caused a partial closure of stomates and thus considerably reduced the phytotoxicity of ozone. The symptoms of ozone-induced phytotoxicity in the water-treated leaves are a marked decrease in chlorophyll and slight decreases in the levels of protein and RNA. The evidence indicates that ozone injury to leaves is not metabolically related to normal leaf senescence.

  5. The Duration of Paid Parental Leave and Children's Scholastic Performance

    OpenAIRE

    Liu, Qian; Nordström Skans, Oskar

    2009-01-01

    We study how the duration of paid parental leave affects the accumulation of cognitive skills among children. We use a reform which extended parental leave benefits from 12 to 15 months for Swedish children born after August 1988 to evaluate the effects of prolonged parental leave on children's test scores and grades at age 16. We show that, on average, the reform had no effect on children's scholastic performance. However, we do find positive effects for children of well-educated mothers, a ...

  6. Development of intron length polymorphism markers in genes encoding diketide-CoA synthase and curcumin synthase for discriminating Curcuma species.

    Science.gov (United States)

    Kita, Tomoko; Komatsu, Katsuko; Zhu, Shu; Iida, Osamu; Sugimura, Koji; Kawahara, Nobuo; Taguchi, Hiromu; Masamura, Noriya; Cai, Shao-Qing

    2016-03-01

    Various Curcuma rhizomes have been used as medicines or spices in Asia since ancient times. It is very difficult to distinguish them morphologically, especially when they are boiled and dried, which causes misidentification leading to a loss of efficacy. We developed a method for discriminating Curcuma species by intron length polymorphism markers in genes encoding diketide-CoA synthase and curcumin synthase. This method could apply to identification of not only fresh plants but also samples of crude drugs or edible spices. By applying this method to Curcuma specimens and samples, and constructing a dendrogram based on these markers, seven Curcuma species were clearly distinguishable. Moreover, Curcuma longa specimens were geographically distinguishable. On the other hand, Curcuma kwangsiensis (gl type) specimens also showed intraspecies polymorphism, which may have occurred as a result of hybridization with other Curcuma species. The molecular method we developed is a potential tool for global classification of the genus Curcuma. Copyright © 2015 Elsevier Ltd. All rights reserved.

  7. The Polyketide Components of Waxes and the Cer-cqu Gene Cluster Encoding a Novel Polyketide Synthase, the β-Diketone Synthase, DKS.

    Science.gov (United States)

    von Wettstein-Knowles, Penny

    2017-07-10

    The primary function of the outermost, lipophilic layer of plant aerial surfaces, called the cuticle, is preventing non-stomatal water loss. Its exterior surface is often decorated with wax crystals, imparting a blue-grey color. Identification of the barley Cer-c , -q and -u genes forming the 101 kb Cer-cqu gene cluster encoding a novel polyketide synthase-the β-diketone synthase (DKS), a lipase/carboxyl transferase, and a P450 hydroxylase, respectively, establishes a new, major pathway for the synthesis of plant waxes. The major product is a β-diketone (14,16-hentriacontane) aliphatic that forms long, thin crystalline tubes. A pathway branch leads to the formation of esterified alkan-2-ols.

  8. Predicting the functions and specificity of triterpenoid synthases: a mechanism-based multi-intermediate docking approach.

    Directory of Open Access Journals (Sweden)

    Bo-Xue Tian

    2014-10-01

    Full Text Available Terpenoid synthases construct the carbon skeletons of tens of thousands of natural products. To predict functions and specificity of triterpenoid synthases, a mechanism-based, multi-intermediate docking approach is proposed. In addition to enzyme function prediction, other potential applications of the current approach, such as enzyme mechanistic studies and enzyme redesign by mutagenesis, are discussed.

  9. Friedelin Synthase from Maytenus ilicifolia: Leucine 482 Plays an Essential Role in the Production of the Most Rearranged Pentacyclic Triterpene

    Science.gov (United States)

    Souza-Moreira, Tatiana M.; Alves, Thaís B.; Pinheiro, Karina A.; Felippe, Lidiane G.; de Lima, Gustavo M. A.; Watanabe, Tatiana F.; Barbosa, Cristina C.; Santos, Vânia A. F. F. M.; Lopes, Norberto P.; Valentini, Sandro R.; Guido, Rafael V. C.; Furlan, Maysa; Zanelli, Cleslei F.

    2016-11-01

    Among the biologically active triterpenes, friedelin has the most-rearranged structure produced by the oxidosqualene cyclases and is the only one containing a cetonic group. In this study, we cloned and functionally characterized friedelin synthase and one cycloartenol synthase from Maytenus ilicifolia (Celastraceae). The complete coding sequences of these 2 genes were cloned from leaf mRNA, and their functions were characterized by heterologous expression in yeast. The cycloartenol synthase sequence is very similar to other known OSCs of this type (approximately 80% identity), although the M. ilicifolia friedelin synthase amino acid sequence is more related to β-amyrin synthases (65-74% identity), which is similar to the friedelin synthase cloned from Kalanchoe daigremontiana. Multiple sequence alignments demonstrated the presence of a leucine residue two positions upstream of the friedelin synthase Asp-Cys-Thr-Ala-Glu (DCTAE) active site motif, while the vast majority of OSCs identified so far have a valine or isoleucine residue at the same position. The substitution of the leucine residue with valine, threonine or isoleucine in M. ilicifolia friedelin synthase interfered with substrate recognition and lead to the production of different pentacyclic triterpenes. Hence, our data indicate a key role for the leucine residue in the structure and function of this oxidosqualene cyclase.

  10. Part-Time Sick Leave as a Treatment Method?

    OpenAIRE

    Andrén D; Andrén T

    2009-01-01

    This paper analyzes the effects of being on part-time sick leave compared to full-time sick leave on the probability of recovering (i.e., returning to work with full recovery of lost work capacity). Using a discrete choice one-factor model, we estimate mean treatment parameters and distributional treatment parameters from a common set of structural parameters. Our results show that part-time sick leave increases the likelihood of recovering and dominates full-time sick leave for sickness spel...

  11. Parental Leave Policies and Pediatric Trainees in the United States.

    Science.gov (United States)

    Dixit, Avika; Feldman-Winter, Lori; Szucs, Kinga A

    2015-08-01

    The American Academy of Pediatrics (AAP) states that each residency program should have a clearly delineated, written policy for parental leave. Parental leave has important implications for trainees' ability to achieve their breastfeeding goals. This study aimed to measure the knowledge and awareness among members of the AAP Section on Medical Students, Residents, and Fellowship Trainees (SOMSRFT) regarding parental leave. An online survey was emailed to SOMSRFT members in June 2013. Quantitative data are presented as percentage of respondents. Awareness of leave policies was analyzed based on having children and the sex of respondents. Nine hundred twenty-seven members responded to the survey. Among those with children, 40% needed to extend the duration of their training in order to have longer maternity leave, 44% of whom did so in order to breastfeed longer. Thirty percent of respondents did not know if their program had a written, accessible policy for parental leave. Trainees without children and men were more unaware of specific aspects of parental leave such as eligibility for the Family Medical Leave Act as compared to women and those with children. Despite the fact that United States national policies support parental leave during pediatrics training, and a majority of programs comply, trainees' awareness regarding these policies needs improvement. © The Author(s) 2015.

  12. Responce of leaves of three plant species to aluminium stress

    Directory of Open Access Journals (Sweden)

    Agata Konarska

    2012-12-01

    Full Text Available Water culture experiments were undertaken for 14 days to examine the effect of increasing aluminum level (0, 10, 20 40 mg·dm-3 AlCl3·6 H2O on growth of sunflower, red pepper and radish leaves. The early stage of Al toxicity was characterized by curling or rolling of young leaves, marginal and veinal chlorosis, dark green leaves as soon as purpling of margins and veins of leaves. Reduction of leaf size and increased stomata density were observed with increasing Al concentration. Additionally, length of stomata cells decreased after Al-treatment.

  13. Family medical leave as a resilience resource for family caregivers.

    Science.gov (United States)

    Swanke, Jayme; Zeman, Laura Dreuth

    2009-01-01

    Case managers mobilize family networks to care for patients. Family medical leave can be a resource for case managers who seek to enhance resilience among family caregivers. The Family Medical Leave Act, passed in 1993, was the first U.S. policy to regulate employee leaves from work for family care purposes (29 CFR 825.102). This policy offers family caregivers increased flexibility and equality. Current and emerging policies also can reduce financial strain. The discussion examines how case managers can integrate family medical leave into best-practice models to support patients and family caregivers.

  14. Natural variation in monoterpene synthesis in kiwifruit: transcriptional regulation of terpene synthases by NAC and ETHYLENE-INSENSITIVE3-like transcription factors.

    Science.gov (United States)

    Nieuwenhuizen, Niels J; Chen, Xiuyin; Wang, Mindy Y; Matich, Adam J; Perez, Ramon Lopez; Allan, Andrew C; Green, Sol A; Atkinson, Ross G

    2015-04-01

    Two kiwifruit (Actinidia) species with contrasting terpene profiles were compared to understand the regulation of fruit monoterpene production. High rates of terpinolene production in ripe Actinidia arguta fruit were correlated with increasing gene and protein expression of A. arguta terpene synthase1 (AaTPS1) and correlated with an increase in transcript levels of the 2-C-methyl-D-erythritol 4-phosphate pathway enzyme 1-deoxy-D-xylulose-5-phosphate synthase (DXS). Actinidia chinensis terpene synthase1 (AcTPS1) was identified as part of an array of eight tandemly duplicated genes, and AcTPS1 expression and terpene production were observed only at low levels in developing fruit. Transient overexpression of DXS in Nicotiana benthamiana leaves elevated monoterpene synthesis by AaTPS1 more than 100-fold, indicating that DXS is likely to be the key step in regulating 2-C-methyl-D-erythritol 4-phosphate substrate flux in kiwifruit. Comparative promoter analysis identified potential NAC (for no apical meristem [NAM], Arabidopsis transcription activation factor [ATAF], and cup-shaped cotyledon [CUC])-domain transcription factor) and ETHYLENE-INSENSITIVE3-like transcription factor (TF) binding sites in the AaTPS1 promoter, and cloned members of both TF classes were able to activate the AaTPS1 promoter in transient assays. Electrophoretic mobility shift assays showed that AaNAC2, AaNAC3, and AaNAC4 bind a 28-bp fragment of the proximal NAC binding site in the AaTPS1 promoter but not the A. chinensis AcTPS1 promoter, where the NAC binding site was mutated. Activation could be restored by reintroducing multiple repeats of the 12-bp NAC core-binding motif. The absence of NAC transcriptional activation in ripe A. chinensis fruit can account for the low accumulation of AcTPS1 transcript, protein, and monoterpene volatiles in this species. These results indicate the importance of NAC TFs in controlling monoterpene production and other traits in ripening fruits. © 2015 American

  15. Natural Variation in Monoterpene Synthesis in Kiwifruit: Transcriptional Regulation of Terpene Synthases by NAC and ETHYLENE-INSENSITIVE3-Like Transcription Factors1

    Science.gov (United States)

    Nieuwenhuizen, Niels J.; Chen, Xiuyin; Wang, Mindy Y.; Matich, Adam J.; Perez, Ramon Lopez; Allan, Andrew C.; Green, Sol A.; Atkinson, Ross G.

    2015-01-01

    Two kiwifruit (Actinidia) species with contrasting terpene profiles were compared to understand the regulation of fruit monoterpene production. High rates of terpinolene production in ripe Actinidia arguta fruit were correlated with increasing gene and protein expression of A. arguta terpene synthase1 (AaTPS1) and correlated with an increase in transcript levels of the 2-C-methyl-d-erythritol 4-phosphate pathway enzyme 1-deoxy-d-xylulose-5-phosphate synthase (DXS). Actinidia chinensis terpene synthase1 (AcTPS1) was identified as part of an array of eight tandemly duplicated genes, and AcTPS1 expression and terpene production were observed only at low levels in developing fruit. Transient overexpression of DXS in Nicotiana benthamiana leaves elevated monoterpene synthesis by AaTPS1 more than 100-fold, indicating that DXS is likely to be the key step in regulating 2-C-methyl-d-erythritol 4-phosphate substrate flux in kiwifruit. Comparative promoter analysis identified potential NAC (for no apical meristem [NAM], Arabidopsis transcription activation factor [ATAF], and cup-shaped cotyledon [CUC])-domain transcription factor) and ETHYLENE-INSENSITIVE3-like transcription factor (TF) binding sites in the AaTPS1 promoter, and cloned members of both TF classes were able to activate the AaTPS1 promoter in transient assays. Electrophoretic mobility shift assays showed that AaNAC2, AaNAC3, and AaNAC4 bind a 28-bp fragment of the proximal NAC binding site in the AaTPS1 promoter but not the A. chinensis AcTPS1 promoter, where the NAC binding site was mutated. Activation could be restored by reintroducing multiple repeats of the 12-bp NAC core-binding motif. The absence of NAC transcriptional activation in ripe A. chinensis fruit can account for the low accumulation of AcTPS1 transcript, protein, and monoterpene volatiles in this species. These results indicate the importance of NAC TFs in controlling monoterpene production and other traits in ripening fruits. PMID:25649633

  16. Novel class III phosphoribosyl diphosphate synthase: structure and properties of the tetrameric, phosphate-activated, non-allosterically inhibited enzyme from Methanocaldococcus jannaschii

    DEFF Research Database (Denmark)

    Kadziola, Anders; Jepsen, Clemens H; Johansson, Eva

    2005-01-01

    The prs gene encoding phosphoribosyl diphosphate (PRPP) synthase of the hyperthermophilic autotrophic methanogenic archaeon Methanocaldococcus jannaschii has been cloned and expressed in Escherichia coli. Subsequently, M.jannaschii PRPP synthase has been purified, characterised, crystallised, and...

  17. The biosynthetic origin of irregular monoterpenes in Lavandula: isolation and biochemical characterization of a novel cis-prenyl diphosphate synthase gene, lavandulyl diphosphate synthase.

    Science.gov (United States)

    Demissie, Zerihun A; Erland, Lauren A E; Rheault, Mark R; Mahmoud, Soheil S

    2013-03-01

    Lavender essential oils are constituted predominantly of regular monoterpenes, for example linalool, 1,8-cineole, and camphor. However, they also contain irregular monoterpenes including lavandulol and lavandulyl acetate. Although the majority of genes responsible for the production of regular monoterpenes in lavenders are now known, enzymes (including lavandulyl diphosphate synthase (LPPS)) catalyzing the biosynthesis of irregular monoterpenes in these plants have not been described. Here, we report the isolation and functional characterization of a novel cis-prenyl diphosphate synthase cDNA, termed Lavandula x intermedia lavandulyl diphosphate synthase (LiLPPS), through a homology-based cloning strategy. The LiLPPS ORF, encoding for a 305-amino acid long protein, was expressed in Escherichia coli, and the recombinant protein was purified by nickel-nitrilotriacetic acid affinity chromatography. The approximately 34.5-kDa bacterially produced protein specifically catalyzed the head-to-middle condensation of two dimethylallyl diphosphate units to LPP in vitro with apparent Km and kcat values of 208 ± 12 μm and 0.1 s(-1), respectively. LiLPPS is a homodimeric enzyme with a sigmoidal saturation curve and Hill coefficient of 2.7, suggesting a positive co-operative interaction among its catalytic sites. LiLPPS could be used to modulate the production of lavandulol and its derivatives in plants through metabolic engineering.

  18. Evaluation of synthase and hemisynthase activities of glucosamine-6-phosphate synthase by matrix-assisted laser desorption/ionization time-of-flight mass spectrometry.

    Science.gov (United States)

    Gaucher-Wieczorek, Florence; Guérineau, Vincent; Touboul, David; Thétiot-Laurent, Sophie; Pelissier, Franck; Badet-Denisot, Marie-Ange; Badet, Bernard; Durand, Philippe

    2014-08-01

    Glucosamine-6-phosphate synthase (GlmS, EC 2.6.1.16) catalyzes the first and rate-limiting step in the hexosamine biosynthetic pathway, leading to the synthesis of uridine-5'-diphospho-N-acetyl-D-glucosamine, the major building block for the edification of peptidoglycan in bacteria, chitin in fungi, and glycoproteins in mammals. This bisubstrate enzyme converts D-fructose-6-phosphate (Fru-6P) and L-glutamine (Gln) into D-glucosamine-6-phosphate (GlcN-6P) and L-glutamate (Glu), respectively. We previously demonstrated that matrix-assisted laser desorption/ionization time-of-flight mass spectrometry (MALDI-TOF-MS) allows determination of the kinetic parameters of the synthase activity. We propose here to refine the experimental protocol to quantify Glu and GlcN-6P, allowing determination of both hemisynthase and synthase parameters from a single assay kinetic experiment, while avoiding interferences encountered in other assays. It is the first time that MALDI-MS is used to survey the activity of a bisubstrate enzyme. Copyright © 2014 Elsevier Inc. All rights reserved.

  19. The C-terminal peptide of Aquifex aeolicus riboflavin synthase directs encapsulation of native and foreign guests by a cage-forming lumazine synthase.

    Science.gov (United States)

    Azuma, Yusuke; Zschoche, Reinhard; Hilvert, Donald

    2017-06-23

    Encapsulation of specific enzymes in self-assembling protein cages is a hallmark of bacterial compartments that function as counterparts to eukaryotic organelles. The cage-forming enzyme lumazine synthase (LS) from Bacillus subtilis (BsLS), for example, encapsulates riboflavin synthase (BsRS), enabling channeling of lumazine from the site of its generation to the site of its conversion to vitamin B 2 Elucidating the molecular mechanisms underlying the assembly of these supramolecular complexes could help inform new approaches for metabolic engineering, nanotechnology, and drug delivery. To that end, we investigated a thermostable LS from Aquifex aeolicus (AaLS) and found that it also forms cage complexes with the cognate riboflavin synthase (AaRS) when both proteins are co-produced in the cytosol of Escherichia coli A 12-amino acid-long peptide at the C terminus of AaRS serves as a specific localization sequence responsible for targeting the guest to the protein compartment. Sequence comparisons suggested that analogous peptide segments likely direct RS complexation by LS cages in other bacterial species. Covalent fusion of this peptide tag to heterologous guest molecules led to their internalization into AaLS assemblies both in vivo and in vitro , providing a firm foundation for creating tailored biomimetic nanocompartments for medical and biotechnological applications. © 2017 by The American Society for Biochemistry and Molecular Biology, Inc.

  20. Effect of guava leaves on growth and the non-specific immune response of Penaeus monodon.

    Science.gov (United States)

    Yin, Xiao-Li; Li, Zhuo-Jia; Yang, Keng; Lin, Hei-Zhao; Guo, Zhi-Xun

    2014-09-01

    Guava (Psidium guajava L.) leaf extracts have antiviral and antibacterial activity against shrimp pathogens such as yellow-head virus (YHV), white spot syndrome virus (WSSV), and Vibrio harveyi, which make it a potential water disinfectant for use in shrimp culture. In this study, the safety of guava leaf supplementation in shrimp was evaluated by studying its influence on growth and the non-specific immune response of Penaeus monodon. Six diets containing different levels of guava leaves (0% [basal diet], 0.025% [G1], 0.05% [G2], 0.1% [G3], 0.2% [G4], and 0.4% [G5]) were fed to groups of shrimp (1.576 ± 0.011 g body weight) in triplicate for 56 days. Growth performance (final body weight, WG, PWG, SGR) of shrimp fed guava leaf diets was significantly higher (P 0.05) were found. Dietary supplementation with guava leaf improved the activities of prophenoloxidase (PO) and nitric oxide synthase (NOS) in serum, and of superoxide dismutase (SOD), acid phosphatase (ACP), alkaline phosphatase (AKP), and lysozyme (LSZ) both in serum and hepatopancreas of shrimp. In the experimental groups, the activities of these enzymes followed a similar pattern of change; they increased initially at low levels of dietary supplementation and then decreased with increasing concentrations of dietary guava leaf. Serum PO and SOD activities in shrimp fed the G1 diet reached 7.50 U ml(-1) and 178.33 U ml(-1), respectively, with PO activity being significantly higher than in controls. In shrimp fed the G1 diet, SOD, ACP, and AKP activities in hepatopancreas were significantly higher than in the controls, reaching 57.32 U g(-1), 23.28 U g(-1), and 19.35 U g(-1) protein, respectively. The highest activities of serum ACP, AKP, LSZ, and of hepatopancreas LSZ, were observed in the G3 diet group. Total nitric oxide synthase (TNOS) activity was highest (64.80 U ml(-1)) in the G4 diet group, which was significantly higher than that observed in the control group. These results suggest that dietary