Directory of Open Access Journals (Sweden)
Shan Lu
2017-08-01
Full Text Available Phosphate (Pi deficiency is a common nutritional stress of plants in both agricultural and natural ecosystems. Plants respond to Pi starvation in the environment by triggering a suite of biochemical, physiological, and developmental changes that increase survival and growth. The key factors that determine plant sensitivity to Pi starvation, however, are unclear. In this research, we identified an Arabidopsis mutant, dps1, with greatly reduced sensitivity to Pi starvation. The dps1 phenotypes are caused by a mutation in the previously characterized SVR1 (SUPPRESSION OF VARIAGATION 1 gene, which encodes a chloroplast-localized pseudouridine synthase. The mutation of SVR1 results in defects in chloroplast rRNA biogenesis, which subsequently reduces chloroplast translation. Another mutant, rps5, which contains a mutation in the chloroplast ribosomal protein RPS5 and has reduced chloroplast translation, also displayed decreased sensitivity to Pi starvation. Furthermore, wild type plants treated with lincomycin, a chemical inhibitor of chloroplast translation, showed similar growth phenotypes and Pi starvation responses as dps1 and rps5. These results suggest that impaired chloroplast translation desensitizes plants to Pi starvation. Combined with previously published results showing that enhanced leaf photosynthesis augments plant responses to Pi starvation, we propose that the decrease in responses to Pi starvation in dps1, rps5, and lincomycin-treated plants is due to their reduced demand for Pi input from the environment.
Identification of the enzyme responsible for N1-methylation of pseudouridine 54 in archaeal tRNAs.
Wurm, Jan Philip; Griese, Marco; Bahr, Ute; Held, Martin; Heckel, Alexander; Karas, Michael; Soppa, Jörg; Wöhnert, Jens
2012-03-01
tRNAs from all three kingdoms of life contain a variety of modified nucleotides required for their stability, proper folding, and accurate decoding. One prominent example is the eponymous ribothymidine (rT) modification at position 54 in the T-arm of eukaryotic and bacterial tRNAs. In contrast, in most archaea this position is occupied by another hypermodified nucleotide: the isosteric N1-methylated pseudouridine. While the enzyme catalyzing pseudouridine formation at this position is known, the pseudouridine N1-specific methyltransferase responsible for this modification has not yet been experimentally identified. Here, we present biochemical and genetic evidence that the two homologous proteins, Mja_1640 (COG 1901, Pfam DUF358) and Hvo_1989 (Pfam DUF358) from Methanocaldococcus jannaschii and Haloferax volcanii, respectively, are representatives of the methyltransferase responsible for this modification. However, the in-frame deletion of the pseudouridine N1-methyltransferase gene in H. volcanii did not result in a discernable phenotype in line with similar observations for knockouts of other T-arm methylating enzymes.
Czudnochowski, Nadine; Wang, Amy Liya; Finer-Moore, Janet; Stroud, Robert M
2013-10-23
Human pseudouridine (Ψ) synthase Pus1 (hPus1) modifies specific uridine residues in several non-coding RNAs: tRNA, U2 spliceosomal RNA, and steroid receptor activator RNA. We report three structures of the catalytic core domain of hPus1 from two crystal forms, at 1.8Å resolution. The structures are the first of a mammalian Ψ synthase from the set of five Ψ synthase families common to all kingdoms of life. hPus1 adopts a fold similar to bacterial Ψ synthases, with a central antiparallel β-sheet flanked by helices and loops. A flexible hinge at the base of the sheet allows the enzyme to open and close around an electropositive active-site cleft. In one crystal form, a molecule of Mes [2-(N-morpholino)ethane sulfonic acid] mimics the target uridine of an RNA substrate. A positively charged electrostatic surface extends from the active site towards the N-terminus of the catalytic domain, suggesting an extensive binding site specific for target RNAs. Two α-helices C-terminal to the core domain, but unique to hPus1, extend along the back and top of the central β-sheet and form the walls of the RNA binding surface. Docking of tRNA to hPus1 in a productive orientation requires only minor conformational changes to enzyme and tRNA. The docked tRNA is bound by the electropositive surface of the protein employing a completely different binding mode than that seen for the tRNA complex of the Escherichia coli homologue TruA. Copyright © 2013 Elsevier Ltd. All rights reserved.
DEFF Research Database (Denmark)
Pedersen, L.H.; Jacobsen, S.; Hejgaard, J.
1993-01-01
The plasma membrane bound beta-1,3-D-glucan (callose) synthase. assumed to be involved in the resistance to the powdery mildew fungus (Erysiphe graminis f.sp. hordei), was partially purified from a microsomal fraction of green barley leaves (Hordeum vulgare L.). Plasma membranes were enriched...
Fan, Yuan-Jie; Ye, Yan-Bin; Gao, Wen; Zhang, Feng; Zhang, Ying-Xia
2010-11-01
To study the dynamic variations of the contents of total polyphenols, flvonoids and chlorogenic acid from Acer truncatum leaves in different months, and their inhibitory activities on fatty acid synthase. Spectrophotometry was used to determine the contents of total polyphenols, flavonoids and chlorogenic acid in extracts and the extracts' inhibitory effects were also investigated. All Leaves picked from May to November have inhibitory effect. But the contents of polyphenols in leaves of July appeared to be higher than other months', and consequently exhibited stronger inhibition against FAS. A positive correlation between the content of polyphenols in leaves extract and the inhibitory efficacy on FAS could be established.
Protein (Cyanobacteria): 69154 [PGDBj - Ortholog DB
Lifescience Database Archive (English)
Full Text Available YP_007109048.1 1117:1269 1150:280 63132:1363 1173025:1363 pseudouridine synthase Geit...AEALAQLQQGVTIQDYRTKPAIARLLPEEPPLPPREPPIRYRKEIPTAWLEITLTEGRNRQVRRMTAAVGFPTLRLVRFAIGDLRLEGLAPGQWRDLSAPELAALKSLGKRPVSRARGSRPRGDRS ...
Jullien, Frédéric; Moja, Sandrine; Bony, Aurélie; Legrand, Sylvain; Petit, Cécile; Benabdelkader, Tarek; Poirot, Kévin; Fiorucci, Sébastien; Guitton, Yann; Nicolè, Florence; Baudino, Sylvie; Magnard, Jean-Louis
2014-01-01
In this paper we characterize three sTPSs: a germacrene D (LaGERDS), a (E)-β-caryophyllene (LaCARS) and a τ-cadinol synthase (LaCADS). τ-cadinol synthase is reported here for the first time and its activity was studied in several biological models including transiently or stably transformed tobacco species. Three dimensional structure models of LaCADS and Ocimum basilicum γ-cadinene synthase were built by homology modeling using the template structure of Gossypium arboreum δ-cadinene synthase. The depiction of their active site organization provides evidence of the global influence of the enzymes on the formation of τ-cadinol: instead of a unique amino-acid, the electrostatic properties and solvent accessibility of the whole active site in LaCADS may explain the stabilization of the cadinyl cation intermediate. Quantitative PCR performed from leaves and inflorescences showed two patterns of expression. LaGERDS and LaCARS were mainly expressed during early stages of flower development and, at these stages, transcript levels paralleled the accumulation of the corresponding terpene products (germacrene D and (E)-β-caryophyllene). By contrast, the expression level of LaCADS was constant in leaves and flowers. Phylogenetic analysis provided informative results on potential duplication process leading to sTPS diversification in lavender.
Directory of Open Access Journals (Sweden)
Kawamukai Makoto
2004-11-01
Full Text Available Abstract Background Isopentenyl diphosphate (IPP, a common biosynthetic precursor to the labdane diterpene forskolin, has been biosynthesised via a non-mevalonate pathway. Geranylgeranyl diphosphate (GGPP synthase is an important branch point enzyme in terpenoid biosynthesis. Therefore, GGPP synthase is thought to be a key enzyme in biosynthesis of forskolin. Herein we report the first confirmation of the GGPP synthase gene in Coleus forskohlii Briq. Results The open reading frame for full-length GGPP synthase encodes a protein of 359 amino acids, in which 1,077 nucleotides long with calculated molecular mass of 39.3 kDa. Alignments of C. forskohlii GGPP synthase amino acid sequences revealed high homologies with other plant GGPP synthases. Several highly conserved regions, including two aspartate-rich motifs were identified. Transient expression of the N-terminal region of C. forskohlii GGPP synthase-GFP fusion protein in tobacco cells demonstrated subcellular localization in the chloroplast. Carotenoid production was observed in Escherichia coli harboring pACCAR25ΔcrtE from Erwinia uredovora and plasmid carrying C. forskohlii GGPP synthase. These results suggested that cDNA encoded functional GGPP synthase. Furthermore, C. forskohlii GGPP synthase expression was strong in leaves, decreased in stems and very little expression was observed in roots. Conclusion This investigation proposed that forskolin was synthesised via a non-mevalonate pathway. GGPP synthase is thought to be involved in the biosynthesis of forskolin, which is primarily synthesised in the leaves and subsequently accumulates in the stems and roots.
Monoterpene synthase from Dracocephalum kotschyi and SPME-GC-MS analysis of its aroma profile
Directory of Open Access Journals (Sweden)
S. Saeidnia
2014-04-01
Full Text Available Dracocephalum kotschyi (Lamiaceae, as one of the remarkable aromatic plants, widely grows and also is cultivated in various temperate regions of Iran. There are diverse reports about the composition of the oil of this plant representing limonene derivatives as its major compounds. There is no report on cloning of mono- or sesquiterpene synthases from this plant. In the present study, the aroma profile of D. kotschyi has been extracted and analyzed via Headspace Solid-Phase Microextraction technique coupled with Gas Chromatography- Mass Spectroscopy. In order to determine the sequence of the active terpene synthase in this plant, first mRNA was prepared and cloning was performed by 3’ and 5’-RACEs-PCR method, then cDNA was sequenced and finally aligned with other recognized terpene synthases. The results showed that the plant leaves mainly comprised geranial (37.2%, limonene-10-al (28.5%, limonene (20.1% and 1,1-dimethoxy decane (14.5%. Sequencing the cDNA cloned from this plant revealed the presence of a monoterpene synthase absolutely similar to limonene synthase, responsible in formation of limonene, terpinolene, camphene and some other cyclic monoterpenes in its young leaves.
Seasonal influence on gene expression of monoterpene synthases in Salvia officinalis (Lamiaceae).
Grausgruber-Gröger, Sabine; Schmiderer, Corinna; Steinborn, Ralf; Novak, Johannes
2012-03-01
Garden sage (Salvia officinalis L., Lamiaceae) is one of the most important medicinal and aromatic plants and possesses antioxidant, antimicrobial, spasmolytic, astringent, antihidrotic and specific sensorial properties. The essential oil of the plant, formed mainly in very young leaves, is in part responsible for these activities. It is mainly composed of the monoterpenes 1,8-cineole, α- and β-thujone and camphor synthesized by the 1,8-cineole synthase, the (+)-sabinene synthase and the (+)-bornyl diphosphate synthase, respectively, and is produced and stored in epidermal glands. In this study, the seasonal influence on the formation of the main monoterpenes in young, still expanding leaves of field-grown sage plants was studied in two cultivars at the level of mRNA expression, analyzed by qRT-PCR, and at the level of end-products, analyzed by gas chromatography. All monoterpene synthases and monoterpenes were significantly influenced by cultivar and season. 1,8-Cineole synthase and its end product 1,8-cineole remained constant until August and then decreased slightly. The thujones increased steadily during the vegetative period. The transcript level of their corresponding terpene synthase, however, showed its maximum in the middle of the vegetative period and declined afterwards. Camphor remained constant until August and then declined, exactly correlated with the mRNA level of the corresponding terpene synthase. In summary, terpene synthase mRNA expression and respective end product levels were concordant in the case of 1,8-cineole (r=0.51 and 0.67 for the two cultivars, respectively; p<0.05) and camphor (r=0.75 and 0.82; p<0.05) indicating basically transcriptional control, but discordant for α-/β-thujone (r=-0.05 and 0.42; p=0.87 and 0.13, respectively). Copyright © 2011 Elsevier GmbH. All rights reserved.
Yahyaa, Mosaab; Matsuba, Yuki; Brandt, Wolfgang; Doron-Faigenboim, Adi; Bar, Einat; McClain, Alan; Davidovich-Rikanati, Rachel; Lewinsohn, Efraim; Pichersky, Eran; Ibdah, Mwafaq
2015-01-01
Bay laurel (Laurus nobilis) is an agriculturally and economically important dioecious tree in the basal dicot family Lauraceae used in food and drugs and in the cosmetics industry. Bay leaves, with their abundant monoterpenes and sesquiterpenes, are used to impart flavor and aroma to food, and have also drawn attention in recent years because of their potential pharmaceutical applications. To identify terpene synthases (TPSs) involved in the production of these volatile terpenes, we performed RNA sequencing to profile the transcriptome of L. nobilis leaves. Bioinformatic analysis led to the identification of eight TPS complementary DNAs. We characterized the enzymes encoded by three of these complementary DNAs: a monoterpene synthase that belongs to the TPS-b clade catalyzes the formation of mostly 1,8-cineole; a sesquiterpene synthase belonging to the TPS-a clade catalyzes the formation of mainly cadinenes; and a diterpene synthase of the TPS-e/f clade catalyzes the formation of geranyllinalool. Comparison of the sequences of these three TPSs indicated that the TPS-a and TPS-b clades of the TPS gene family evolved early in the evolution of the angiosperm lineage, and that geranyllinalool synthase activity is the likely ancestral function in angiosperms of genes belonging to an ancient TPS-e/f subclade that diverged from the kaurene synthase gene lineages before the split of angiosperms and gymnosperms. PMID:26157114
Directory of Open Access Journals (Sweden)
Jinheng Zhu
2018-02-01
Full Text Available Sucrose-metabolizing enzymes in plant leaves have hitherto been investigated mainly in temperate plants, and rarely conducted in tandem with gene expression and sugar analysis. Here, we investigated the sugar content, gene expression, and the activity of sucrose-metabolizing enzymes in the leaves of Hevea brasiliensis, a tropical tree widely cultivated for natural rubber. Sucrose, fructose and glucose were the major sugars detected in Hevea leaves at four developmental stages (I to IV, with starch and quebrachitol as minor saccharides. Fructose and glucose contents increased until stage III, but decreased strongly at stage IV (mature leaves. On the other hand, sucrose increased continuously throughout leaf development. Activities of all sucrose-cleaving enzymes decreased markedly at maturation, consistent with transcript decline for most of their encoding genes. Activity of sucrose phosphate synthase (SPS was low in spite of its high transcript levels at maturation. Hence, the high sucrose content in mature leaves was not due to increased sucrose-synthesizing activity, but more to the decline in sucrose cleavage. Gene expression and activities of sucrose-metabolizing enzymes in Hevea leaves showed striking differences compared with other plants. Unlike in most other species where vacuolar invertase predominates in sucrose cleavage in developing leaves, cytoplasmic invertase and sucrose synthase (cleavage direction also featured prominently in Hevea. Whereas SPS is normally responsible for sucrose synthesis in plant leaves, sucrose synthase (synthesis direction was comparable or higher than that of SPS in Hevea leaves. Mature Hevea leaves had an unusually high sucrose:starch ratio of about 11, the highest reported to date in plants.
Molecular cloning and characterization of strictosidine synthase, a ...
African Journals Online (AJOL)
Mitragynine is one of the most dominant indole alkaloids present in the leaves of Mitragyna speciosa, a species of Rubiaceae. This alkaloid is believed to be synthesized via condensation of the amino acid derivative, tryptamine and secologanine by the action of strictosidine synthase (STR). The cDNA clone encoding STR ...
Schmidt, C O; Bouwmeester, H J; Bülow, N; König, W A
1999-04-15
The leaves of the composite Solidago canadensis (goldenrod) were shown to contain (-)-alpha-gurjunene synthase activity. This sesquiterpene is likely to be the precursor for cyclocolorenone, a sesquiterpene ketone present in high amounts in S. canadensis leaves. (-)-alpha-Gurjunene synthase was purified to apparent homogeneity (741-fold) by anion-exchange chromatography (on several matrices), dye ligand chromatography, hydroxylapatite chromatography, and gel filtration. Chromatography on a gel filtration matrix indicated a native molecular mass of 48 kDa, and SDS-PAGE showed the enzyme to be composed of one subunit with a denatured mass of 60 kDa. Its maximum activity was observed at pH 7.8 in the presence of 10 mM Mg2+ and the KM value for the substrate farnesyl diphosphate was 5.5 microM. Over a range of purification steps (-)-alpha-gurjunene and (+)-gamma-gurjunene synthase activities copurified. In addition, the product ratio of the enzyme activity under several different assay conditions was always 91% (-)-alpha-gurjunene and 9% (+)-gamma-gurjunene. This suggests that the formation of these two structurally related products is catalyzed by one enzyme. For further confirmation, we carried out a number of mechanistic studies with (-)-alpha-gurjunene synthase, in which an enzyme preparation was incubated with deuterated substrate analogues. Based on mass spectrometry analysis of the products formed, a cyclization mechanism was postulated which makes it plausible that the synthase catalyzes the formation of both sesquiterpenes. Copyright 1999 Academic Press.
Directory of Open Access Journals (Sweden)
Berta Alquézar
2017-08-01
Full Text Available Citrus aroma and flavor, chief traits of fruit quality, are derived from their high content in essential oils of most plant tissues, including leaves, stems, flowers, and fruits. Accumulated in secretory cavities, most components of these oils are volatile terpenes. They contribute to defense against herbivores and pathogens, and perhaps also protect tissues against abiotic stress. In spite of their importance, our understanding of the physiological, biochemical, and genetic regulation of citrus terpene volatiles is still limited. The availability of the sweet orange (Citrus sinensis L. Osbeck genome sequence allowed us to characterize for the first time the terpene synthase (TPS family in a citrus type. CsTPS is one of the largest angiosperm TPS families characterized so far, formed by 95 loci from which just 55 encode for putative functional TPSs. All TPS angiosperm families, TPS-a, TPS-b, TPS-c, TPS-e/f, and TPS-g were represented in the sweet orange genome, with 28, 18, 2, 2, and 5 putative full length genes each. Additionally, sweet orange β-farnesene synthase, (Z-β-cubebene/α-copaene synthase, two β-caryophyllene synthases, and three multiproduct enzymes yielding β-cadinene/α-copaene, β-elemene, and β-cadinene/ledene/allo-aromandendrene as major products were identified, and functionally characterized via in vivo recombinant Escherichia coli assays.
Chatterjee, Kunal; Blaby, Ian K.; Thiaville, Patrick C.; Majumder, Mrinmoyee; Grosjean, Henri; Yuan, Y. Adam; Gupta, Ramesh; de Crécy-Lagard, Valérie
2012-01-01
The methylation of pseudouridine (Ψ) at position 54 of tRNA, producing m1Ψ, is a hallmark of many archaeal species, but the specific methylase involved in the formation of this modification had yet to be characterized. A comparative genomics analysis had previously identified COG1901 (DUF358), part of the SPOUT superfamily, as a candidate for this missing methylase family. To test this prediction, the COG1901 encoding gene, HVO_1989, was deleted from the Haloferax volcanii genome. Analyses of modified base contents indicated that while m1Ψ was present in tRNA extracted from the wild-type strain, it was absent from tRNA extracted from the mutant strain. Expression of the gene encoding COG1901 from Halobacterium sp. NRC-1, VNG1980C, complemented the m1Ψ minus phenotype of the ΔHVO_1989 strain. This in vivo validation was extended with in vitro tests. Using the COG1901 recombinant enzyme from Methanocaldococcus jannaschii (Mj1640), purified enzyme Pus10 from M. jannaschii and full-size tRNA transcripts or TΨ-arm (17-mer) fragments as substrates, the sequential pathway of m1Ψ54 formation in Archaea was reconstituted. The methylation reaction is AdoMet dependent. The efficiency of the methylase reaction depended on the identity of the residue at position 55 of the TΨ-loop. The presence of Ψ55 allowed the efficient conversion of Ψ54 to m1Ψ54, whereas in the presence of C55, the reaction was rather inefficient and no methylation reaction occurred if a purine was present at this position. These results led to renaming the Archaeal COG1901 members as TrmY proteins. PMID:22274953
International Nuclear Information System (INIS)
Tian, Hongmei; Ma, Leyuan; Zhao, Cong; Hao, Hui; Gong, Biao; Yu, Xiyan; Wang, Xiufeng
2010-01-01
To unravel the roles of sucrose phosphate synthase (SPS) in muskmelon (Cucumis melo L.), we reduced its activity in transgenic muskmelon plants by an antisense approach. For this purpose, an 830 bp cDNA fragment of muskmelon sucrose phosphate synthase was expressed in antisense orientation behind the 35S promoter of the cauliflower mosaic virus. The phenotype of the antisense plants clearly differed from that of control plants. The transgenic plant leaves were markedly smaller, and the plant height and stem diameter were obviously shorter and thinner. Transmission electron microscope observation revealed that the membrane degradation of chloroplast happened in transgenic leaves and the numbers of grana and grana lamella in the chloroplast were significantly less, suggesting that the slow growth and weaker phenotype of transgenic plants may be due to the damage of the chloroplast ultrastructure, which in turn results in the decrease of the net photosynthetic rate. The sucrose concentration and levels of sucrose phosphate synthase decreased in transgenic mature fruit, and the fruit size was smaller than the control fruit. Together, our results suggest that sucrose phosphate synthase may play an important role in regulating the muskmelon plant growth and fruit development.
Energy Technology Data Exchange (ETDEWEB)
Tian, Hongmei; Ma, Leyuan; Zhao, Cong; Hao, Hui; Gong, Biao [College of Horticulture Science and Engineering, State Key Laboratory of Crop Biology, Shandong Agricultural University, Tai' an, Shandong 271018 (China); Yu, Xiyan, E-mail: yuxiyan@sdau.edu.cn [College of Horticulture Science and Engineering, State Key Laboratory of Crop Biology, Shandong Agricultural University, Tai' an, Shandong 271018 (China); Wang, Xiufeng, E-mail: xfwang@sdau.edu.cn [College of Horticulture Science and Engineering, State Key Laboratory of Crop Biology, Shandong Agricultural University, Tai' an, Shandong 271018 (China)
2010-03-12
To unravel the roles of sucrose phosphate synthase (SPS) in muskmelon (Cucumis melo L.), we reduced its activity in transgenic muskmelon plants by an antisense approach. For this purpose, an 830 bp cDNA fragment of muskmelon sucrose phosphate synthase was expressed in antisense orientation behind the 35S promoter of the cauliflower mosaic virus. The phenotype of the antisense plants clearly differed from that of control plants. The transgenic plant leaves were markedly smaller, and the plant height and stem diameter were obviously shorter and thinner. Transmission electron microscope observation revealed that the membrane degradation of chloroplast happened in transgenic leaves and the numbers of grana and grana lamella in the chloroplast were significantly less, suggesting that the slow growth and weaker phenotype of transgenic plants may be due to the damage of the chloroplast ultrastructure, which in turn results in the decrease of the net photosynthetic rate. The sucrose concentration and levels of sucrose phosphate synthase decreased in transgenic mature fruit, and the fruit size was smaller than the control fruit. Together, our results suggest that sucrose phosphate synthase may play an important role in regulating the muskmelon plant growth and fruit development.
Hurd, Matthew C; Kwon, Moonhyuk; Ro, Dae-Kyun
2017-08-26
Lippia dulcis (Aztec sweet herb) contains the potent natural sweetener hernandulcin, a sesquiterpene ketone found in the leaves and flowers. Utilizing the leaves for agricultural application is challenging due to the presence of the bitter-tasting and toxic monoterpene, camphor. To unlock the commercial potential of L. dulcis leaves, the first step of camphor biosynthesis by a bornyl diphosphate synthase needs to be elucidated. Two putative monoterpene synthases (LdTPS3 and LdTPS9) were isolated from L. dulcis leaf cDNA. To elucidate their catalytic functions, E. coli-produced recombinant enzymes with truncations of their chloroplast transit peptides were assayed with geranyl diphosphate (GPP). In vitro enzyme assays showed that LdTPS3 encodes bornyl diphosphate synthase (thus named LdBPPS) while LdTPS9 encodes linalool synthase. Interestingly, the N-terminus of LdBPPS possesses two arginine-rich (RRX 8 W) motifs, and enzyme assays showed that the presence of both RRX 8 W motifs completely inhibits the catalytic activity of LdBPPS. Only after the removal of the putative chloroplast transit peptide and the first RRX 8 W, LdBPPS could react with GPP to produce bornyl diphosphate. LdBPPS is distantly related to the known bornyl diphosphate synthase from sage in a phylogenetic analysis, indicating a converged evolution of camphor biosynthesis in sage and L. dulcis. The discovery of LdBPPS opens up the possibility of engineering L. dulcis to remove the undesirable product, camphor. Copyright © 2017 Elsevier Inc. All rights reserved.
[Study on the weight-reducing effect of Acer truncatum leave extract in alimentary obesity rat].
Gao, Lifang; Cao, Lige; Tian, Mi; Chen, Zhenliang
2012-07-01
To investigate the weight-reducing effect of Acer truncatum leave extract on alimentary obesity rats and its effect on fatty acid synthase (FAS). SPF-grade adult male Wistar rats were fed with high-fat diet and Acer truncatum leave extract (10, 30 and 100 mg/kg BW) was given by gavage once a day for 31 days. Body weight (BW), adipose weight and food consumption were recorded, and the activity of hepatic fatty acid synthase (FAS) was measured. Compared with the model-control group, body weight, adipose weight and the ratio of adipose weight to body weight were obviously lower in 30 mg/kg BW and 100 mg/kg BW groups (P Acer truncatum leave extract on reducing body weight.
Occurrence of theobromine synthase genes in purine alkaloid-free species of Camellia plants.
Ishida, Mariko; Kitao, Naoko; Mizuno, Kouichi; Tanikawa, Natsu; Kato, Misako
2009-02-01
Caffeine (1,3,7-trimethylxanthine) and theobromine (3,7-dimethylxanthine) are purine alkaloids that are present in high concentrations in plants of some species of Camellia. However, most members of the genus Camellia contain no purine alkaloids. Tracer experiments using [8-(14)C]adenine and [8-(14)C]theobromine showed that the purine alkaloid pathway is not fully functional in leaves of purine alkaloid-free species. In five species of purine alkaloid-free Camellia plants, sufficient evidence was obtained to show the occurrence of genes that are homologous to caffeine synthase. Recombinant enzymes derived from purine alkaloid-free species showed only theobromine synthase activity. Unlike the caffeine synthase gene, these genes were expressed more strongly in mature tissue than in young tissue.
Directory of Open Access Journals (Sweden)
Csengele E. Barta
2017-10-01
Full Text Available Mature oak (Quercus spp. leaves, although abundantly available during the plants’ developmental cycle, are rarely exploited as viable sources of genomic DNA. These leaves are rich in metabolites difficult to remove during standard DNA purification, interfering with downstream molecular genetics applications. The current work assessed whether in situ dark adaptation, to deplete sugar reserves and inhibit secondary metabolite synthesis could compensate for the difficulties encountered when isolating DNA from mature leaves rich in secondary metabolites. We optimized a rapid, commercial kit based method to extract genomic DNA from dark- and light-adapted leaves. We demonstrated that in situ dark adaptation increases the yield and quality of genomic DNA obtained from mature oak leaves, yielding templates of sufficiently high quality for direct downstream applications, such as PCR amplification and gene identification. The quality of templates isolated from dark-adapted pin oak leaves particularly improved the amplification of larger fragments in our experiments. From DNA extracts prepared with our optimized method, we identified for the first time partial segments of the genes encoding 18S rRNA and isoprene synthase (IspS from pin oak (Quercus palustris, whose full genome has not yet been sequenced.
DEFF Research Database (Denmark)
Zerbe, Philipp; Chiang, Angela; Dullat, Harpreet
2014-01-01
Marrubium vulgare (Lamiaceae) is a medicinal plant whose major bioactive compounds, marrubiin and other labdane-related furanoid diterpenoids, have potential applications as anti-diabetics, analgesics or vasorelaxants. Metabolite and transcriptome profiling of M. vulgare leaves identified five...... different candidate diterpene synthases (diTPSs) of the TPS-c and TPS-e/f clades. We describe the in vitro and in vivo functional characterization of the M. vulgare diTPS family. In addition to MvEKS ent-kaurene synthase of general metabolism, we identified three diTPSs of specialized metabolism: MvCPS3...
Functional Characterization of Sesquiterpene Synthase from Polygonum minus
Directory of Open Access Journals (Sweden)
Su-Fang Ee
2014-01-01
Full Text Available Polygonum minus is an aromatic plant, which contains high abundance of terpenoids, especially the sesquiterpenes C15H24. Sesquiterpenes were believed to contribute to the many useful biological properties in plants. This study aimed to functionally characterize a full length sesquiterpene synthase gene from P. minus. P. minus sesquiterpene synthase (PmSTS has a complete open reading frame (ORF of 1689 base pairs encoding a 562 amino acid protein. Similar to other sesquiterpene synthases, PmSTS has two large domains: the N-terminal domain and the C-terminal metal-binding domain. It also consists of three conserved motifs: the DDXXD, NSE/DTE, and RXR. A three-dimensional protein model for PmSTS built clearly distinguished the two main domains, where conserved motifs were highlighted. We also constructed a phylogenetic tree, which showed that PmSTS belongs to the angiosperm sesquiterpene synthase subfamily Tps-a. To examine the function of PmSTS, we expressed this gene in Arabidopsis thaliana. Two transgenic lines, designated as OE3 and OE7, were further characterized, both molecularly and functionally. The transgenic plants demonstrated smaller basal rosette leaves, shorter and fewer flowering stems, and fewer seeds compared to wild type plants. Gas chromatography-mass spectrometry analysis of the transgenic plants showed that PmSTS was responsible for the production of β-sesquiphellandrene.
Landmann, Christian; Fink, Barbara; Festner, Maria; Dregus, Márta; Engel, Karl-Heinz; Schwab, Wilfried
2007-09-15
The essential oil of lavender (Lavandula angustifolia) is mainly composed of mono- and sesquiterpenes. Using a homology-based PCR strategy, two monoterpene synthases (LaLIMS and LaLINS) and one sesquiterpene synthase (LaBERS) were cloned from lavender leaves and flowers. LaLIMS catalyzed the formation of (R)-(+)-limonene, terpinolene, (1R,5S)-(+)-camphene, (1R,5R)-(+)-alpha-pinene, beta-myrcene and traces of alpha-phellandrene. The proportions of these products changed significantly when Mn(2+) was supplied as the cofactor instead of Mg(2+). The second enzyme LaLINS produced exclusively (R)-(-)-linalool, the main component of lavender essential oil. LaBERS transformed farnesyl diphosphate and represents the first reported trans-alpha-bergamotene synthase. It accepted geranyl diphosphate with higher affinity than farnesyl diphosphate and also produced monoterpenes, albeit at low rates. LaBERS is probably derived from a parental monoterpene synthase by the loss of the plastidial signal peptide and by broadening its substrate acceptance spectrum. The identification and description of the first terpene synthases from L. angustifolia forms the basis for the biotechnological modification of essential oil composition in lavender.
Characterization of three chalcone synthase-like genes from apple (Malus x domestica Borkh.).
Yahyaa, Mosaab; Ali, Samah; Davidovich-Rikanati, Rachel; Ibdah, Muhammad; Shachtier, Alona; Eyal, Yoram; Lewinsohn, Efraim; Ibdah, Mwafaq
2017-08-01
Apple (Malus x domestica Brokh.) is a widely cultivated deciduous tree species of significant economic importance. Apple leaves accumulate high levels of flavonoids and dihydrochalcones, and their formation is dependent on enzymes of the chalcone synthase family. Three CHS genes were cloned from apple leaves and expressed in Escherichia coli. The encoded recombinant enzymes were purified and functionally characterized. In-vitro activity assays indicated that MdCHS1, MdCHS2 and MdCHS3 code for proteins exhibiting polyketide synthase activity that accepted either p-dihydrocoumaroyl-CoA, p-coumaroyl-CoA, or cinnamoyl-CoA as starter CoA substrates in the presence of malonyl-CoA, leading to production of phloretin, naringenin chalcone, and pinocembrin chalcone. MdCHS3 coded a chalcone-dihydrochalcone synthase enzyme with narrower substrate specificity than the previous ones. The apparent Km values of MdCHS3 for p-dihydrocoumaryl-CoA and p-coumaryl-CoA were both 5.0 μM. Expression analyses of MdCHS genes varied according to tissue type. MdCHS1, MdCHS2 and MdCHS3 expression levels were associated with the levels of phloretin accumulate in the respective tissues. Copyright © 2017 Elsevier Ltd. All rights reserved.
Aschenbrenner, Anna-Katharina; Kwon, Moonhyuk; Conrad, Jürgen; Ro, Dae-Kyun; Spring, Otmar
2016-04-01
Sunflower is known to produce a variety of bisabolene-type sesquiterpenes and accumulates these substances in trichomes of leaves, stems and flowering parts. A bioinformatics approach was used to identify the enzyme responsible for the initial step in the biosynthesis of these compounds from its precursor farnesyl pyrophosphate. Based on sequence similarity with a known bisabolene synthases from Arabidopsis thaliana AtTPS12, candidate genes of Helianthus were searched in EST-database and used to design specific primers. PCR experiments identified two candidates in the RNA pool of linear glandular trichomes of sunflower. Their sequences contained the typical motifs of sesquiterpene synthases and their expression in yeast functionally characterized them as bisabolene synthases. Spectroscopic analysis identified the stereochemistry of the product of both enzymes as (Z)-γ-bisabolene. The origin of the two sunflower bisabolene synthase genes from the transcripts of linear trichomes indicates that they may be involved in the synthesis of sesquiterpenes produced in these trichomes. Comparison of the amino acid sequences of the sunflower bisabolene synthases showed high similarity with sesquiterpene synthases from other Asteracean species and indicated putative evolutionary origin from a β-farnesene synthase. Copyright © 2016 Elsevier Ltd. All rights reserved.
Modified cellulose synthase gene from Arabidopsis thaliana confers herbicide resistance to plants
Somerville, Chris R [Portola Valley, CA; Scheible, Wolf [Golm, DE
2007-07-10
Cellulose synthase ("CS"), a key enzyme in the biosynthesis of cellulose in plants is inhibited by herbicides comprising thiazolidinones such as 5-tert-butyl-carbamoyloxy-3-(3-trifluromethyl)phenyl-4-thiazolidinone (TZ), isoxaben and 2,6-dichlorobenzonitrile (DCB). Two mutant genes encoding isoxaben and TZ-resistant cellulose synthase have been isolated from isoxaben and TZ-resistant Arabidopsis thaliana mutants. When compared with the gene coding for isoxaben or TZ-sensitive cellulose synthase, one of the resistant CS genes contains a point mutation, wherein glycine residue 998 is replaced by an aspartic acid. The other resistant mutation is due to a threonine to isoleucine change at amino acid residue 942. The mutant CS gene can be used to impart herbicide resistance to a plant; thereby permitting the utilization of the herbicide as a single application at a concentration which ensures the complete or substantially complete killing of weeds, while leaving the transgenic crop plant essentially undamaged.
Institute of Scientific and Technical Information of China (English)
YU Yang; HOU Wen-sheng; YaeI Hacham; SUN Shi; WU Cun-xiang; Ifat Matityahu; SONG Shikui; RacheI Amir; HAN Tian-fu
2018-01-01
Soybean (Glycine max (L.) Merr.) is a major crop that provides plant-origin protein and oil for humans and livestock. Although the soybean vegetative tissues and seeds provide a major source of high-quality protein, they suffer from low concentration of an essential sulfur-containing amino acid, methionine, which significantly limits their nutritional quality. The level of methionine is mainly controlled by the first unique enzyme of methionine synthesis, cystathione γ-synthase (CGS). Aiming to elevate methionine level in vegetative tissues and seeds, we constitutively over-expressed a feedback-insensitive Arabidopsis CGS (AtD-CGS) in soybean cultivars, Zigongdongdou (ZD) and Jilinxiaoli 1 (JX). The levels of soluble methionine increased remarkably in leaves of transgenic soybeans compared to wild-type plants (6.6- and 7.3-fold in two transgenic ZD lines, and 3.7-fold in one transgenic JX line). Furthermore, the total methionine contents were significantly increased in seeds of the transgenic ZD lines (1.5- to 4.8-fold increase) and the transgenic JX lines (1.3- to 2.3-fold increase) than in the wild type. The protein contents of the transgenic soybean seeds were significantly elevated compared to the wild type, suggesting that the scarcity of methionine in soybeans may limit protein accumulation in soybean seeds. The increased protein content did not alter the profile of major storage proteins in the seeds. Generally, this study provides a promising strategy to increase the levels of methionine and protein in soybean through the breeding programs.
Kracht, Octavia Natascha; Ammann, Ann-Christin; Stockmann, Julia; Wibberg, Daniel; Kalinowski, Jörn; Piotrowski, Markus; Kerr, Russell; Brück, Thomas; Kourist, Robert
2017-04-01
Plant terpenoids are a large and highly diverse class of metabolites with an important role in the immune defense. They find wide industrial application as active pharmaceutical ingredients, aroma and fragrance compounds. Several Eremophila sp. derived terpenoids have been documented. To elucidate the terpenoid metabolism, the transcriptome of juvenile and mature Eremophila serrulata (A.DC.) Druce (Scrophulariaceae) leaves was sequenced and a transcript library was generated. We report on the first transcriptomic dataset of an Eremophila plant. IlluminaMiSeq sequencing (2 × 300 bp) revealed 7,093,266 paired reads, which could be assembled to 34,505 isogroups. To enable detection of terpene biosynthetic genes, leaves were separately treated with methyl jasmonate, a well-documented inducer of plant secondary metabolites. In total, 21 putative terpene synthase genes were detected in the transcriptome data. Two terpene synthase isoenzymatic genes, termed ES01 and ES02, were successfully expressed in E. coli. The resulting proteins catalyzed the conversion of geranyl pyrophosphate, the universal substrate of monoterpene synthases to myrcene and Z-(b)-ocimene, respectively. The transcriptomic data and the discovery of the first terpene synthases from Eremophila serrulata are the initial step for the understanding of the terpene metabolism in this medicinally important plant genus. Copyright © 2017 Elsevier Ltd. All rights reserved.
Karuppiah, Vijaykumar; Ranaghan, Kara E.; Leferink, Nicole G. H.; Johannissen, Linus O.; Shanmugam, Muralidharan; Ní Cheallaigh, Aisling; Bennett, Nathan J.; Kearsey, Lewis J.; Takano, Eriko; Gardiner, John M.; van der Kamp, Marc W.; Hay, Sam; Mulholland, Adrian J.; Leys, David; Scrutton, Nigel S.
2017-01-01
Terpenoids form the largest and stereochemically most diverse class of natural products, and there is considerable interest in producing these by biocatalysis with whole cells or purified enzymes, and by metabolic engineering. The monoterpenes are an important class of terpenes and are industrially important as flavors and fragrances. We report here structures for the recently discovered Streptomyces clavuligerus monoterpene synthases linalool synthase (bLinS) and 1,8-cineole synthase (bCinS)...
Zhang, Chunyu; Zhang, Wei; Ren, Guodong; Li, Delin; Cahoon, Rebecca E; Chen, Ming; Zhou, Yongming; Yu, Bin; Cahoon, Edgar B
2015-08-01
Chlorophyll synthase catalyzes the final step in chlorophyll biosynthesis: the esterification of chlorophyllide with either geranylgeranyl diphosphate or phytyl diphosphate (PDP). Recent studies have pointed to the involvement of chlorophyll-linked reduction of geranylgeranyl by geranylgeranyl reductase as a major pathway for the synthesis of the PDP precursor of tocopherols. This indirect pathway of PDP synthesis suggests a key role of chlorophyll synthase in tocopherol production to generate the geranylgeranyl-chlorophyll substrate for geranylgeranyl reductase. In this study, contributions of chlorophyll synthase to tocopherol formation in Arabidopsis (Arabidopsis thaliana) were explored by disrupting and altering expression of the corresponding gene CHLOROPHYLL SYNTHASE (CHLSYN; At3g51820). Leaves from the homozygous chlysyn1-1 null mutant were nearly devoid of tocopherols, whereas seeds contained only approximately 25% of wild-type tocopherol levels. Leaves of RNA interference lines with partial suppression of CHLSYN displayed marked reductions in chlorophyll but up to a 2-fold increase in tocopherol concentrations. Cauliflower mosaic virus35S-mediated overexpression of CHLSYN unexpectedly caused a cosuppression phenotype at high frequencies accompanied by strongly reduced chlorophyll content and increased tocopherol levels. This phenotype and the associated detection of CHLSYN-derived small interfering RNAs were reversed with CHLSYN overexpression in rna-directed rna polymerase6 (rdr6), which is defective in RNA-dependent RNA polymerase6, a key enzyme in sense transgene-induced small interfering RNA production. CHLSYN overexpression in rdr6 had little effect on chlorophyll content but resulted in up to a 30% reduction in tocopherol levels in leaves. These findings show that altered CHLSYN expression impacts tocopherol levels and also, show a strong epigenetic surveillance of CHLSYN to control chlorophyll and tocopherol synthesis. © 2015 American Society of
HAEM SYNTHASE AND COBALT PORPHYRIN SYNTHASE IN VARIOUS MICRO-ORGANISMS.
PORRA, R J; ROSS, B D
1965-03-01
1. The preparation of a crude extract of Clostridium tetanomorphum containing cobalt porphyrin synthase but little haem-synthase activity is described. 2. The properties of cobalt porphyrin synthase in the clostridial extracts is compared with the properties of a haem synthase present in crude extracts of the yeast Torulopsis utilis. 3. Cobalt porphyrin synthase in extracts of C. tetanomorphum inserts Co(2+) ions into the following dicarboxylic porphyrins in descending order of rate of insertion: meso-, deutero- and proto-porphyrins. Esterification renders meso- and deutero-porphyrins inactive as substrates. Neither the tetracarboxylic (coproporphyrin III) nor the octacarboxylic (uroporphyrin III) compounds are converted into cobalt porphyrins by the extract, but the non-enzymic incorporation of Co(2+) ions into these two porphyrins is rapid. These extracts are unable to insert Mn(2+), Zn(2+), Mg(2+) or Cu(2+) ions into mesoporphyrin. 4. Crude extracts of T. utilis readily insert both Co(2+) and Fe(2+) ions into deutero-, meso, and proto-porphyrins. Unlike the extracts of C. tetanomorphum, these preparations catalyse the insertion of Co(2+) ions into deuteroporphyrin more rapidly than into mesoporphyrin. This parallels the formation of haems by the T. utilis extract. 5. Cobalt porphyrin synthase is present in the particulate fraction of the extracts of C. tetanomorphum but requires a heat-stable factor present in the soluble fraction. This soluble factor can be replaced by GSH. 6. Cobalt porphyrin synthase in the clostridial extract is inhibited by iodoacetamide and to a smaller extent by p-chloromercuribenzoate and N-ethylmaleimide. The haem synthases of T. utilis and Micrococcus denitrificans are also inhibited by various thiol reagents.
Genes up-regulated during red coloration in UV-B irradiated lettuce leaves.
Park, Jong-Sug; Choung, Myoung-Gun; Kim, Jung-Bong; Hahn, Bum-Soo; Kim, Jong-Bum; Bae, Shin-Chul; Roh, Kyung-Hee; Kim, Yong-Hwan; Cheon, Choong-Ill; Sung, Mi-Kyung; Cho, Kang-Jin
2007-04-01
Molecular analysis of gene expression differences between green and red lettuce leaves was performed using the SSH method. BlastX comparisons of subtractive expressed sequence tags (ESTs) indicated that 7.6% of clones encoded enzymes involved in secondary metabolism. Such clones had a particularly high abundance of flavonoid-metabolism proteins (6.5%). Following SSH, 566 clones were rescreened for differential gene expression using dot-blot hybridization. Of these, 53 were found to overexpressed during red coloration. The up-regulated expression of six genes was confirmed by Northern blot analyses. The expression of chalcone synthase (CHS), flavanone 3-hydroxylase (F3H), and dihydroflavonol 4-reductase (DFR) genes showed a positive correlation with anthocyanin accumulation in UV-B-irradiated lettuce leaves; flavonoid 3',5'-hydroxylase (F3',5'H) and anthocyanidin synthase (ANS) were expressed continuously in both samples. These results indicated that the genes CHS, F3H, and DFR coincided with increases in anthocyanin accumulation during the red coloration of lettuce leaves. This study show a relationship between red coloration and the expression of up-regulated genes in lettuce. The subtractive cDNA library and EST database described in this study represent a valuable resource for further research for secondary metabolism in the vegetable crops.
Modified cellulose synthase gene from 'Arabidopsis thaliana' confers herbicide resistance to plants
Energy Technology Data Exchange (ETDEWEB)
Somerville, Chris R.; Scieble, Wolf
2000-10-11
Cellulose synthase ('CS'), a key enzyme in the biosynthesis of cellulose in plants is inhibited by herbicides comprising thiazolidinones such as 5-tert-butyl-carbamoyloxy-3-(3-trifluromethyl) phenyl-4-thiazolidinone (TZ), isoxaben and 2,6-dichlorobenzonitrile (DCB). Two mutant genes encoding isoxaben and TZ-resistant cellulose synthase have been isolated from isoxaben and TZ-resistant Arabidopsis thaliana mutants. When compared with the gene coding for isoxaben or TZ-sensitive cellulose synthase, one of the resistant CS genes contains a point mutation, wherein glycine residue 998 is replaced by an aspartic acid. The other resistant mutation is due to a threonine to isoleucine change at amino acid residue 942. The mutant CS gene can be used to impart herbicide resistance to a plant; thereby permitting the utilization of the herbicide as a single application at a concentration which ensures the complete or substantially complete killing of weeds, while leaving the transgenic crop plant essentially undamaged.
Lücker, Joost; Schwab, Wilfried; van Hautum, Bianca; Blaas, Jan; van der Plas, Linus H. W.; Bouwmeester, Harro J.; Verhoeven, Harrie A.
2004-01-01
Wild-type tobacco (Nicotiana tabacum) plants emit low levels of terpenoids, particularly from the flowers. By genetic modification of tobacco cv Petit Havana SR1 using three different monoterpene synthases from lemon (Citrus limon L. Burm. f.) and the subsequent combination of these three into one plant by crossings, we show that it is possible to increase the amount and alter the composition of the blend of monoterpenoids produced in tobacco plants. The transgenic tobacco plant line with the three introduced monoterpene synthases is emitting β-pinene, limonene, and γ-terpinene and a number of side products of the introduced monoterpene synthases, from its leaves and flowers, in addition to the terpenoids emitted by wild-type plants. The results show that there is a sufficiently high level of substrate accessible for the introduced enzymes. PMID:14718674
Cloning and functional characterization of β-phellandrene synthase from Lavandula angustifolia.
Demissie, Zerihun A; Sarker, Lukman S; Mahmoud, Soheil S
2011-04-01
En route to building genomics resources for Lavandula, we have obtained over 14,000 ESTs for leaves and flowers of L. angustifolia, a major essential oil crop, and identified a number of previously uncharacterized terpene synthase (TPS) genes. Here we report the cloning, expression in E. coli, and functional characterization of β-phellandrene synthase, LaβPHLS. The ORF--excluding the transit peptide--for this gene encoded a 62.3 kDa protein that contained all conserved motifs present in plant TPSs. Expression in bacteria resulted in the production of a soluble protein that was purified by Ni-NTA agarose affinity chromatography. While the recombinant LaβPHLS did not utilize FPP as a substrate, it converted GPP (the preferred substrate) and NPP into β-phellandrene as the major product, with K (m) and k (cat) of 6.55 μM and 1.75 × 10(-2) s(-1), respectively, for GPP. The LaβPHLS transcripts were highly abundant in young leaves where β-phellandrene is produced, but were barely detectable in flowers and older leaves, where β-phellandrene is not synthesized in significant quantities. This data indicate that β-phellandrene biosynthesis is transcriptionally and developmentally regulated. We also cloned and expressed in E. coli a second TPS-like protein, LaTPS-I, that lacks an internal stretch of 73 amino acids, including the signature DDxxD divalent metal binding motif, compared to other plant TPSs. The recombinant LaTPS-I did not produce detectable products in vitro when assayed with GPP, NPP or FPP as substrates. The lack of activity is most likely due to the absence of catalytically important amino acid residues within the missing region.
Directory of Open Access Journals (Sweden)
Bua-In Saowaluck
2014-01-01
Full Text Available Cassumunar ginger (Zingiber montanum (Koenig Link ex Dietr. is a native Thai herb with a high content and large variety of terpenoids in its essential oil. Improving the essential oil content and quality of cassumunar ginger is difficult for a breeder due to its clonally propagated nature. In this research, we describe the isolation and expression level of the monoterpene synthase gene that controls the key step of essential oil synthesis in this plant and evaluate the mechanical wounding that may influence the transcription level of the monoterpene synthase gene. To isolate the gene, the selected clones from DNA derived from young leaves were sequenced and analyzed and the monoterpene synthase gene from cassumunar ginger (ZMM1 was identified. The ZMM1 CDS containing 1 773 bp (KF500399 is predicted to encode a protein of 590 amino acids. The deduced amino acid sequence is 40-74% identical with known sequences of other angiosperm monoterpene synthases belonging to the isoprenoid biosynthesis C1 superfamily. A transcript of ZMM1 was detected almost exclusively in the leaves and was related to leaf wounding. The results of this research offer insight into the control of monoterpene synthesis in this plant. This finding can be applied to breeding programs or crop management of cassumunar ginger for better yield and quality of essential oil.
Wang, Huicong; Ma, Fangfang; Cheng, Lailiang
2010-07-01
Metabolite profiles and activities of key enzymes in the metabolism of organic acids, nitrogen and amino acids were compared between chlorotic leaves and normal leaves of 'Honeycrisp' apple to understand how accumulation of non-structural carbohydrates affects the metabolism of organic acids, nitrogen and amino acids. Excessive accumulation of non-structural carbohydrates and much lower CO(2) assimilation were found in chlorotic leaves than in normal leaves, confirming feedback inhibition of photosynthesis in chlorotic leaves. Dark respiration and activities of several key enzymes in glycolysis and tricarboxylic acid (TCA) cycle, ATP-phosphofructokinase, pyruvate kinase, citrate synthase, aconitase and isocitrate dehydrogenase were significantly higher in chlorotic leaves than in normal leaves. However, concentrations of most organic acids including phosphoenolpyruvate (PEP), pyruvate, oxaloacetate, 2-oxoglutarate, malate and fumarate, and activities of key enzymes involved in the anapleurotic pathway including PEP carboxylase, NAD-malate dehydrogenase and NAD-malic enzyme were significantly lower in chlorotic leaves than in normal leaves. Concentrations of soluble proteins and most free amino acids were significantly lower in chlorotic leaves than in normal leaves. Activities of key enzymes in nitrogen assimilation and amino acid synthesis, including nitrate reductase, glutamine synthetase, ferredoxin and NADH-dependent glutamate synthase, and glutamate pyruvate transaminase were significantly lower in chlorotic leaves than in normal leaves. It was concluded that, in response to excessive accumulation of non-structural carbohydrates, glycolysis and TCA cycle were up-regulated to "consume" the excess carbon available, whereas the anapleurotic pathway, nitrogen assimilation and amino acid synthesis were down-regulated to reduce the overall rate of amino acid and protein synthesis.
Zhang, Chunyu; Zhang, Wei; Ren, Guodong; Li, Delin; Cahoon, Rebecca E.; Chen, Ming; Zhou, Yongming; Yu, Bin
2015-01-01
Chlorophyll synthase catalyzes the final step in chlorophyll biosynthesis: the esterification of chlorophyllide with either geranylgeranyl diphosphate or phytyl diphosphate (PDP). Recent studies have pointed to the involvement of chlorophyll-linked reduction of geranylgeranyl by geranylgeranyl reductase as a major pathway for the synthesis of the PDP precursor of tocopherols. This indirect pathway of PDP synthesis suggests a key role of chlorophyll synthase in tocopherol production to generate the geranylgeranyl-chlorophyll substrate for geranylgeranyl reductase. In this study, contributions of chlorophyll synthase to tocopherol formation in Arabidopsis (Arabidopsis thaliana) were explored by disrupting and altering expression of the corresponding gene CHLOROPHYLL SYNTHASE (CHLSYN; At3g51820). Leaves from the homozygous chlysyn1-1 null mutant were nearly devoid of tocopherols, whereas seeds contained only approximately 25% of wild-type tocopherol levels. Leaves of RNA interference lines with partial suppression of CHLSYN displayed marked reductions in chlorophyll but up to a 2-fold increase in tocopherol concentrations. Cauliflower mosaic virus35S-mediated overexpression of CHLSYN unexpectedly caused a cosuppression phenotype at high frequencies accompanied by strongly reduced chlorophyll content and increased tocopherol levels. This phenotype and the associated detection of CHLSYN-derived small interfering RNAs were reversed with CHLSYN overexpression in rna-directed rna polymerase6 (rdr6), which is defective in RNA-dependent RNA polymerase6, a key enzyme in sense transgene-induced small interfering RNA production. CHLSYN overexpression in rdr6 had little effect on chlorophyll content but resulted in up to a 30% reduction in tocopherol levels in leaves. These findings show that altered CHLSYN expression impacts tocopherol levels and also, show a strong epigenetic surveillance of CHLSYN to control chlorophyll and tocopherol synthesis. PMID:26048882
The influence of altered gravity on carbohydrate metabolism in excised wheat leaves
Obenland, D. M.; Brown, C. S.
1994-01-01
We developed a system to study the influence of altered gravity on carbohydrate metabolism in excised wheat leaves by means of clinorotation. The use of excised leaves in our clinostat studies offered a number of advantages over the use of whole plants, most important of which were minimization of exogenous mechanical stress and a greater amount of carbohydrate accumulation during the time of treatment. We found that horizontal clinorotation of excised wheat leaves resulted in significant reductions in the accumulation of fructose, sucrose, starch and fructan relative to control, vertically clinorotated leaves. Photosynthesis, dark respiration and the extractable activities of ADP glucose pyrophosphorylase (EC 2.7.7.27), sucrose phosphate synthase (EC 2.4.4.14), sucrose sucrose fructosyltransferase (EC 2.4.1.99), and fructan hydrolase (EC 3.2.1.80) were unchanged due to altered gravity treatment.
Tuan, Pham Anh; Kim, Jae Kwang; Lee, Sanghyun; Chae, Soo Cheon; Park, Sang Un
2012-12-05
Riboflavin (vitamin B2) is the universal precursor of the coenzymes flavin mononucleotide and flavin adenine dinucleotide--cofactors that are essential for the activity of a wide variety of metabolic enzymes in animals, plants, and microbes. Using the RACE PCR approach, cDNAs encoding lumazine synthase (McLS) and riboflavin synthase (McRS), which catalyze the last two steps in the riboflavin biosynthetic pathway, were cloned from bitter melon (Momordica charantia), a popular vegetable crop in Asia. Amino acid sequence alignments indicated that McLS and McRS share high sequence identity with other orthologous genes and carry an N-terminal extension, which is reported to be a plastid-targeting sequence. Organ expression analysis using quantitative real-time RT PCR showed that McLS and McRS were constitutively expressed in M. charantia, with the strongest expression levels observed during the last stage of fruit ripening (stage 6). This correlated with the highest level of riboflavin content, which was detected during ripening stage 6 by HPLC analysis. McLS and McRS were highly expressed in the young leaves and flowers, whereas roots exhibited the highest accumulation of riboflavin. The cloning and characterization of McLS and McRS from M. charantia may aid the metabolic engineering of vitamin B2 in crops.
Simoes-Barbosa, Augusto; Chakrabarti, Kausik; Pearson, Michael; Benarroch, Delphine; Shuman, Stewart; Johnson, Patricia J.
2012-01-01
The 2,2,7-trimethylguanosine caps of eukaryal snRNAs and snoRNA are formed by the enzyme Tgs1, which catalyzes sequential guanine-N2 methylations of m7G caps. Atypically, in the divergent unicellular eukaryote Trichomonas vaginalis, spliceosomal snRNAs lack a guanosine cap and the recombinant T. vaginalis trimethylguanosine synthase (TvTgs) produces only m2,7G in vitro. Here, we show by direct metabolic labeling that endogenous T. vaginalis RNAs contain m7G, m2,7G, and m2,2,7G caps. Immunodepletion of TvTgs from cell extracts and TvTgs add-back experiments demonstrate that TvTgs produces m2,7G and m2,2,7G caps. Expression of TvTgs in yeast tgs1Δ cells leads to the formation of m2,7G and m2,2,7G caps and complementation of the lethality of a tgs1Δ mud2Δ strain. Whereas TvTgs is present in the nucleus and cytosol of T. vaginalis cells, TMG-containing RNAs are localized primarily in the nucleolus. Molecular cloning of anti-TMG affinity-purified T. vaginalis RNAs identified 16 box H/ACA snoRNAs, which are implicated in guiding RNA pseudouridylation. The ensemble of new T. vaginalis H/ACA snoRNAs allowed us to predict and partially validate an extensive map of pseudouridines in T. vaginalis rRNA. PMID:22847815
Monoterpene synthases from common sage (Salvia officinalis)
Energy Technology Data Exchange (ETDEWEB)
Croteau, Rodney Bruce (Pullman, WA); Wise, Mitchell Lynn (Pullman, WA); Katahira, Eva Joy (Pullman, WA); Savage, Thomas Jonathan (Christchurch 5, NZ)
1999-01-01
cDNAs encoding (+)-bornyl diphosphate synthase, 1,8-cineole synthase and (+)-sabinene synthase from common sage (Salvia officinalis) have been isolated and sequenced, and the corresponding amino acid sequences has been determined. Accordingly, isolated DNA sequences (SEQ ID No:1; SEQ ID No:3 and SEQ ID No:5) are provided which code for the expression of (+)-bornyl diphosphate synthase (SEQ ID No:2), 1,8-cineole synthase (SEQ ID No:4) and (+)-sabinene synthase SEQ ID No:6), respectively, from sage (Salvia officinalis). In other aspects, replicable recombinant cloning vehicles are provided which code for (+)-bornyl diphosphate synthase, 1,8-cineole synthase or (+)-sabinene synthase, or for a base sequence sufficiently complementary to at least a portion of (+)-bornyl diphosphate synthase, 1,8-cineole synthase or (+)-sabinene synthase DNA or RNA to enable hybridization therewith. In yet other aspects, modified host cells are provided that have been transformed, transfected, infected and/or injected with a recombinant cloning vehicle and/or DNA sequence encoding (+)-bornyl diphosphate synthase, 1,8-cineole synthase or (+)-sabinene synthase. Thus, systems and methods are provided for the recombinant expression of the aforementioned recombinant monoterpene synthases that may be used to facilitate their production, isolation and purification in significant amounts. Recombinant (+)-bornyl diphosphate synthase, 1,8-cineole synthase and (+)-sabinene synthase may be used to obtain expression or enhanced expression of (+)-bornyl diphosphate synthase, 1,8-cineole synthase and (+)-sabinene synthase in plants in order to enhance the production of monoterpenoids, or may be otherwise employed for the regulation or expression of (+)-bornyl diphosphate synthase, 1,8-cineole synthase and (+)-sabinene synthase, or the production of their products.
Wan, Huihua; Zhang, Jie; Song, Tingting; Tian, Ji; Yao, Yuncong
2015-01-01
Flavonoids are secondary metabolites that play important roles in plant physiology. Despite numerous studies examined the effects of available carbon (C) or nitrogen (N) on flavonoid biosynthesis, the mechanism of C/N interactive effects on flavonoid metabolism is still unclear. In this study, we analyzed the composition of flavonoids and the expression levels of flavonoid-related genes in leaves and calli of crabapple (Malus sp.) cultivars with different leaf colors grown on media with different C/N ratios. Our results show that high C/N ratios induce anthocyanin pigmentation in leaves of the ever-red cultivar 'Royalty' and the spring-red cultivar 'Prairifire,' as well as in three types of calli derived from the ever-green cultivar 'Spring Snow,' but not in the leaves of the ever-green cultivar 'Flame.' This phenomenon therefore correlated with anthocyanin content in these different samples. In addition, high C/N ratios in the growth media resulted in an increase in the concentration of flavones and flavonols in the leaves of the three crabapple cultivars. The transcript levels of the general flavonoid pathway genes [from chalcone synthase (CHS) to uridine diphosphat-glucose: flavonoid 3-O-glycosyltransferase (UFGT) and flavonol synthase (FLS)] increased in response to high C/N ratios, and this in turn was correlated with the concentration of anthocyanins, flavones and flavonols in the leaves and calli. Expression of the late flavonoid/anthocyanin biosynthetic genes, anthocyanidin synthase (ANS), UFGT and FLS in particular, was more strongly influenced by C/N ratios than other structural genes, and the increased expression of the structural genes under high C/N ratios coincided with a coordinated increase in transcript levels of a MYB transcription factor, MYB10. These results are likely to be useful for future generation of plants with an optimized flavonoid/anthocyanin content or desirable organ coloration.
Directory of Open Access Journals (Sweden)
Huihua eWan
2015-09-01
Full Text Available Flavonoids are secondary metabolites that play important roles in plant physiology. Despite numerous studies examined the effects of available carbon (C or nitrogen (N on flavonoid biosynthesis, the mechanism of C/N interactive effects on flavonoid metabolism is still unclear. In this study, we analyzed the composition of flavonoids and the expression levels of flavonoid-related genes in leaves and calli of crabapple (Malus spp. cultivars with different leaf colors grown on media with different C/N ratios. Our results show that high C/N ratios induce anthocyanin pigmentation in leaves of the ever-red cultivar ‘Royalty’ and the spring-red cultivar ‘Prairifire’, as well as in three types of calli derived from the ever-green cultivar ‘Spring Snow’, but not in the leaves of the ever-green cultivar ‘Flame’. This phenomenon therefore correlated with anthocyanin content in these different samples. In addition, high C/N ratios in the growth media resulted in an increase in the concentration of flavones and flavonols in the leaves of the three crabapple cultivars. The transcript levels of the general flavonoid pathway genes [from chalcone synthase (CHS to uridine diphosphate (UDP-glucose: flavonoid 3-O-glycosyltransferase (UFGT and flavonol synthase (FLS] increased in response to high C/N ratios, and this in turn was correlated with the concentration of anthocyanin, flavone and flavonol in the leaves and calli. Expression of the late flavonoid/anthocyanin biosynthetic genes, anthocyanidin synthase (ANS, UFGT and FLS in particular, was more strongly influenced by C/N ratios than other structural genes, and the increased expression of the structural genes under high C/N ratios coincided with a coordinated increase in transcript levels of a MYB transcription factor, MYB10. These results are likely to be useful for future generation of plants with an optimized flavonoid/anthocyanin content or desirable organ coloration.
Isolation and characterization of terpene synthases in cotton (Gossypium hirsutum).
Yang, Chang-Qing; Wu, Xiu-Ming; Ruan, Ju-Xin; Hu, Wen-Li; Mao, Yin-Bo; Chen, Xiao-Ya; Wang, Ling-Jian
2013-12-01
Cotton plants accumulate gossypol and related sesquiterpene aldehydes, which function as phytoalexins against pathogens and feeding deterrents to herbivorous insects. However, to date little is known about the biosynthesis of volatile terpenes in this crop. Herein is reported that 5 monoterpenes and 11 sesquiterpenes from extracts of a glanded cotton cultivar, Gossypium hirsutum cv. CCRI12, were detected by gas chromatography-mass spectrometry (GC-MS). By EST data mining combined with Rapid Amplification of cDNA Ends (RACE), full-length cDNAs of three terpene synthases (TPSs), GhTPS1, GhTPS2 and GhTPS3 were isolated. By in vitro assays of the recombinant proteins, it was found that GhTPS1 and GhTPS2 are sesquiterpene synthases: the former converted farnesyl pyrophosphate (FPP) into β-caryophyllene and α-humulene in a ratio of 2:1, whereas the latter produced several sesquiterpenes with guaia-1(10),11-diene as the major product. By contrast, GhTPS3 is a monoterpene synthase, which produced α-pinene, β-pinene, β-phellandrene and trace amounts of other monoterpenes from geranyl pyrophosphate (GPP). The TPS activities were also supported by Virus Induced Gene Silencing (VIGS) in the cotton plant. GhTPS1 and GhTPS3 were highly expressed in the cotton plant overall, whereas GhTPS2 was expressed only in leaves. When stimulated by mechanical wounding, Verticillium dahliae (Vde) elicitor or methyl jasmonate (MeJA), production of terpenes and expression of the corresponding synthase genes were induced. These data demonstrate that the three genes account for the biosynthesis of volatile terpenes of cotton, at least of this Upland cotton. Copyright © 2013 Elsevier Ltd. All rights reserved.
Sitthithaworn, W; Kojima, N; Viroonchatapan, E; Suh, D Y; Iwanami, N; Hayashi, T; Noji, M; Saito, K; Niwa, Y; Sankawa, U
2001-02-01
cDNAs encoding geranylgeranyl diphosphate synthase (GGPPS) of two diterpene-producing plants, Scoparia dulcis and Croton sublyratus, have been isolated using the homology-based polymerase chain reaction (PCR) method. Both clones contained highly conserved aspartate-rich motifs (DDXX(XX)D) and their N-terminal residues exhibited the characteristics of chloroplast targeting sequence. When expressed in Escherichia coli, both the full-length and truncated proteins in which the putative targeting sequence was deleted catalyzed the condensation of farnesyl diphosphate and isopentenyl diphosphate to produce geranylgeranyl diphosphate (GGPP). The structural factors determining the product length in plant GGPPSs were investigated by constructing S. dulcis GGPPS mutants on the basis of sequence comparison with the first aspartate-rich motif (FARM) of plant farnesyl diphosphate synthase. The result indicated that in plant GGPPSs small amino acids, Met and Ser, at the fourth and fifth positions before FARM and Pro and Cys insertion in FARM play essential roles in determination of product length. Further, when a chimeric gene comprised of the putative transit peptide of the S. dulcis GGPPS gene and a green fluorescent protein was introduced into Arabidopsis leaves by particle gun bombardment, the chimeric protein was localized in chloroplasts, indicating that the cloned S. dulcis GGPPS is a chloroplast protein.
Lücker, J.; Bouwmeester, H.J.; Schwab, W.; Blaas, J.; Plas, van der L.H.W.; Verhoeven, H.A.
2001-01-01
Petunia hybrida W115 was transformed with a Clarkia breweri S-linalool synthase cDNA (lis). Lis was expressed in all tissues analysed, and linalool was detected in leaves, sepals, corolla, stem and ovary, but not in nectaries, roots, pollen and style. However, the S-linalool produced by the plant in
Schimpl, Flávia Camila; Kiyota, Eduardo; Mayer, Juliana Lischka Sampaio; Gonçalves, José Francisco de Carvalho; da Silva, José Ferreira; Mazzafera, Paulo
2014-09-01
Guarana seeds have the highest caffeine concentration among plants accumulating purine alkaloids, but in contrast with coffee and tea, practically nothing is known about caffeine metabolism in this Amazonian plant. In this study, the levels of purine alkaloids in tissues of five guarana cultivars were determined. Theobromine was the main alkaloid that accumulated in leaves, stems, inflorescences and pericarps of fruit, while caffeine accumulated in the seeds and reached levels from 3.3% to 5.8%. In all tissues analysed, the alkaloid concentration, whether theobromine or caffeine, was higher in young/immature tissues, then decreasing with plant development/maturation. Caffeine synthase activity was highest in seeds of immature fruit. A nucleotide sequence (PcCS) was assembled with sequences retrieved from the EST database REALGENE using sequences of caffeine synthase from coffee and tea, whose expression was also highest in seeds from immature fruit. The PcCS has 1083bp and the protein sequence has greater similarity and identity with the caffeine synthase from cocoa (BTS1) and tea (TCS1). A recombinant PcCS allowed functional characterization of the enzyme as a bifunctional CS, able to catalyse the methylation of 7-methylxanthine to theobromine (3,7-dimethylxanthine), and theobromine to caffeine (1,3,7-trimethylxanthine), respectively. Among several substrates tested, PcCS showed higher affinity for theobromine, differing from all other caffeine synthases described so far, which have higher affinity for paraxanthine. When compared to previous knowledge on the protein structure of coffee caffeine synthase, the unique substrate affinity of PcCS is probably explained by the amino acid residues found in the active site of the predicted protein. Copyright © 2014 Elsevier Ltd. All rights reserved.
Directory of Open Access Journals (Sweden)
Ikuro eAbe
2012-03-01
Full Text Available Benzalacetone synthase, from the medicinal plant Rheum palmatum (Polygonaceae (RpBAS, is a plant-specific chalcone synthase (CHS superfamily of type III polyketide synthase (PKS. RpBAS catalyzes the one-step, decarboxylative condensation of 4-coumaroyl-CoA with malonyl-CoA to produce the C6-C4 benzalacetone scaffold. The X-ray crystal structures of RpBAS confirmed that the diketide-forming activity is attributable to the characteristic substitution of the conserved active-site "gatekeeper" Phe with Leu. Furthermore, the crystal structures suggested that RpBAS employs novel catalytic machinery for the thioester bond cleavage of the enzyme-bound diketide intermediate and the final decarboxylation reaction to produce benzalacetone. Finally, by exploiting the remarkable substrate tolerance and catalytic versatility of RpBAS, precursor-directed biosynthesis efficiently generated chemically and structurally divergent, unnatural novel polyketide scaffolds. These findings provided a structural basis for the functional diversity of the type III PKS enzymes.
Krill, Christian; Barrow, Russell A.; Chen, Shasha; Trengove, Robert; Oliver, Richard P.; Solomon, Peter S.
2014-01-01
Parastagonospora nodorum is a pathogen of wheat that affects yields globally. Previous transcriptional analysis identified a partially reducing polyketide synthase (PR-PKS) gene, SNOG_00477 (SN477), in P. nodorum that is highly upregulated during infection of wheat leaves. Disruption of the corresponding SN477 gene resulted in the loss of production of two compounds, which we identified as (R)-mellein and (R)-O-methylmellein. Using a Saccharomyces cerevisiae yeast heterologous expression system, we successfully demonstrated that SN477 is the only enzyme required for the production of (R)-mellein. This is the first identification of a fungal PKS that is responsible for the synthesis of (R)-mellein. The P. nodorum ΔSN477 mutant did not show any significant difference from the wild-type strain in its virulence against wheat. However, (R)-mellein at 200 μg/ml inhibited the germination of wheat (Triticum aestivum) and barrel medic (Medicago truncatula) seeds. Comparative sequence analysis identified the presence of mellein synthase (MLNS) homologues in several Dothideomycetes and two sodariomycete genera. Phylogenetic analysis suggests that the MLNSs in fungi and bacteria evolved convergently from fungal and bacterial 6-methylsalicylic acid synthases. PMID:25326302
Despinasse, Yolande; Fiorucci, Sébastien; Antonczak, Serge; Moja, Sandrine; Bony, Aurélie; Nicolè, Florence; Baudino, Sylvie; Magnard, Jean-Louis; Jullien, Frédéric
2017-05-01
Lavender essential oils (EOs) of higher quality are produced by a few Lavandula angustifolia cultivars and mainly used in the perfume industry. Undesirable compounds such as camphor and borneol are also synthesized by lavender leading to a depreciated EO. Here, we report the cloning of bornyl diphosphate synthase of lavender (LaBPPS), an enzyme that catalyzes the production of bornyl diphosphate (BPP) and then by-products such as borneol or camphor, from an EST library. Compared to the BPPS of Salvia officinalis, the functional characterization of LaBPPS showed several differences in amino acid sequence, and the distribution of catalyzed products. Molecular modeling of the enzyme's active site suggests that the carbocation intermediates are more stable in LaBPPS than in SoBPPS leading probably to a lower efficiency of LaBPPS to convert GPP into BPP. Quantitative RT-PCR performed from leaves and flowers at different development stages of L. angustifolia samples show a clear correlation between transcript level of LaBPPS and accumulation of borneol/camphor, suggesting that LaBPPS is mainly responsible of in vivo biosynthesis of borneol/camphor in fine lavender. A phylogenetic analysis of terpene synthases (TPS) pointed out the basal position of LaBPPS in the TPSb clade, suggesting that LaBPPS could be an ancestor of others lavender TPSb. Finally, borneol could be one of the first monoterpenes to be synthesized in the Lavandula subgenus. Knowledge gained from these experiments will facilitate future studies to improve the lavender oils through metabolic engineering or plant breeding. Accession numbers: LaBPPS: KM015221. Copyright © 2017. Published by Elsevier Ltd.
International Nuclear Information System (INIS)
Hartwig, S.; Frister, T.; Alemdar, S.; Li, Z.; Scheper, T.; Beutel, S.
2015-01-01
An uncharacterized plant cDNA coding for a polypeptide presumably having sesquiterpene synthase activity, was expressed in soluble and active form. Two expression strategies were evaluated in Escherichia coli. The enzyme was fused to a highly soluble SUMO domain, in addition to being produced in an unfused form by a cold-shock expression system. Yields up to ∼325 mg/L −1 were achieved in batch cultivations. The 6x-His-tagged enzyme was purified employing an Ni 2+ -IMAC-based procedure. Identity of the protein was established by Western Blot analysis as well as peptide mass fingerprinting. A molecular mass of 64 kDa and an isoelectric point of pI 4.95 were determined by 2D gel electrophoresis. Cleavage of the fusion domain was possible by digestion with specific SUMO protease. The synthase was active in Mg 2+ containing buffer and catalyzed the production of (+)-zizaene (syn. khusimene), a precursor of khusimol, from farnesyl diphosphate. Product identity was confirmed by GC–MS and comparison of retention indices. Enzyme kinetics were determined by measuring initial reaction rates for the product, using varying substrate concentrations. By assuming a Michaelis–Menten model, kinetic parameters of K M = 1.111 μM (±0.113), v max = 0.3245 μM min −1 (±0.0035), k cat = 2.95 min −1 , as well as a catalytic efficiency k cat /K M = 4.43 × 10 4 M −1 s −1 were calculated. Fusion to a SUMO moiety can substantially increase soluble expression levels of certain hard to express terpene synthases in E. coli. The kinetic data determined for the recombinant synthase are comparable to other described plant sesquiterpene synthases and in the typical range of enzymes belonging to the secondary metabolism. This leaves potential for optimizing catalytic parameters through methods like directed evolution. - Highlights: • Uncharacterized (+)-zizaene synthase from C. zizanoides was cloned and expressed. • Fusion to SUMO and cold-shock induction
Energy Technology Data Exchange (ETDEWEB)
Hartwig, S.; Frister, T.; Alemdar, S.; Li, Z.; Scheper, T.; Beutel, S., E-mail: beutel@iftc.uni-hannover.de
2015-03-20
An uncharacterized plant cDNA coding for a polypeptide presumably having sesquiterpene synthase activity, was expressed in soluble and active form. Two expression strategies were evaluated in Escherichia coli. The enzyme was fused to a highly soluble SUMO domain, in addition to being produced in an unfused form by a cold-shock expression system. Yields up to ∼325 mg/L{sup −1} were achieved in batch cultivations. The 6x-His-tagged enzyme was purified employing an Ni{sup 2+}-IMAC-based procedure. Identity of the protein was established by Western Blot analysis as well as peptide mass fingerprinting. A molecular mass of 64 kDa and an isoelectric point of pI 4.95 were determined by 2D gel electrophoresis. Cleavage of the fusion domain was possible by digestion with specific SUMO protease. The synthase was active in Mg{sup 2+} containing buffer and catalyzed the production of (+)-zizaene (syn. khusimene), a precursor of khusimol, from farnesyl diphosphate. Product identity was confirmed by GC–MS and comparison of retention indices. Enzyme kinetics were determined by measuring initial reaction rates for the product, using varying substrate concentrations. By assuming a Michaelis–Menten model, kinetic parameters of K{sub M} = 1.111 μM (±0.113), v{sub max} = 0.3245 μM min{sup −1} (±0.0035), k{sub cat} = 2.95 min{sup −1}, as well as a catalytic efficiency k{sub cat}/K{sub M} = 4.43 × 10{sup 4} M{sup −1} s{sup −1} were calculated. Fusion to a SUMO moiety can substantially increase soluble expression levels of certain hard to express terpene synthases in E. coli. The kinetic data determined for the recombinant synthase are comparable to other described plant sesquiterpene synthases and in the typical range of enzymes belonging to the secondary metabolism. This leaves potential for optimizing catalytic parameters through methods like directed evolution. - Highlights: • Uncharacterized (+)-zizaene synthase from C. zizanoides was cloned
Mendoza-Poudereux, Isabel; Muñoz-Bertomeu, Jesús; Navarro, Alicia; Arrillaga, Isabel; Segura, Juan
2014-05-01
Transgenic Lavandula latifolia plants overexpressing the linalool synthase (LIS) gene from Clarkia breweri, encoding the LIS enzyme that catalyzes the synthesis of linalool were generated. Most of these plants increased significantly their linalool content as compared to controls, especially in the youngest leaves, where a linalool increase up to a 1000% was observed. The phenotype of increased linalool content observed in young leaves was maintained in those T1 progenies that inherit the LIS transgene, although this phenotype was less evident in the flower essential oil. Cross-pollination of transgenic spike lavender plants allowed the generation of double transgenic plants containing the DXS (1-deoxy-d-xylulose-5-P synthase), coding for the first enzyme of the methyl-d-erythritol-4-phosphate pathway, and LIS genes. Both essential oil yield and linalool content in double DXS-LIS transgenic plants were lower than that of their parentals, which could be due to co-suppression effects linked to the structures of the constructs used. Copyright © 2014 International Metabolic Engineering Society. Published by Elsevier Inc. All rights reserved.
DEFF Research Database (Denmark)
Yang, Ting; Stoopen, Geert; Thoen, Manus
2013-01-01
Herbivore-induced plant volatiles are often involved in direct and indirect plant defence against herbivores. Linalool is a common floral scent and found to be released from leaves by many plants after herbivore attack. In this study, a linalool/nerolidol synthase, FaNES1, was overexpressed...... less preferred by WFT. Considering the common occurrence of linalool and its glycosides in plant tissues, it suggests that plants may balance attractive fragrance with 'poor taste' using the same precursor compound....
Cloning of a sesquiterpene synthase from Lavandula x intermedia glandular trichomes.
Sarker, Lukman S; Demissie, Zerihun A; Mahmoud, Soheil S
2013-11-01
The essential oil (EO) of Lavandula is dominated by monoterpenes, but can also contain small amounts of sesquiterpenes, depending on species and environmental conditions. For example, the sesquiterpene 9-epi-caryophyllene can make up to 8 % of the EO in a few species, including those commercially propagated for EO production. Here, we report the cloning and functional characterization of 9-epi-caryophyllene synthase (LiCPS) from the glandular trichomes of Lavandula x intermedia, cv. Grosso. The 1,617 bp open reading frame of LiCPS, which did not encode a transit peptide, was expressed in Escherichia coli and the recombinant protein purified by Ni-NTA agarose affinity chromatography. The ca. 60 kDa recombinant protein specifically converted farnesyl diphosphate to 9-epi-caryophyllene. LiCPS also produced a few monoterpenes when assayed with the monoterpene precursor geranyl diphosphate (GPP), but--unlike most monoterpene synthases--was not able to derive detectable amounts of any products from the cis isomer of GPP, neryl diphosphate. The LiCPS transcripts accumulated in developing L. x intermedia flowers and were highly enriched in glandular trichomes, but were not detected in leaves suggesting that the transcriptional expression of this gene is spatially and developmentally regulated.
Directory of Open Access Journals (Sweden)
Lingxia Wang
2017-04-01
Full Text Available Plant anthocyanin biosynthesis is well understood, but the regulatory mechanism in purple foliage tea remains unclear. Using isobaric tag for relative and absolute quantification (iTRAQ, 815 differential proteins were identified in the leaves of Zijuan tea, among which 20 were associated with the regulation of anthocyanin metabolism. We found that the abundances of anthocyanin synthesis-related enzymes such as chalcone synthase, chalcone isomerase, dihydroflavonol 4-reductase and anthocyanin synthetase, as well as anthocyanin accumulation-related UDP-glucosyl transferase and ATP-binding cassette (ABC transporters in the purple leaves were all significantly higher than those in the green leaves. The abundances of the transcription factors bHLH and HY5, regulating anthocyanin biosynthesis at transcriptional level were also obviously higher in purple leaves than those in green leaves. In addition, bifunctional 3-dehydroquinate dehydratase and chorismate mutase in purple leaves were distinctly higher in abundance compared to green leaves, which provided sufficient phenylalanine substrate for anthocyanin synthesis. Furthermore, lignin synthesis was found to be reduced due to the lower abundances of cinnamoyl-CoA reductase 1, peroxidase 15 and laccase-6, which resulted in increase of intermediates flow into anthocyanin synthesis pathway. The physiological data were consistent with proteomic results. These four aspects of biosynthetic regulation contribute to anthocyanin accumulation in purple leaves of Zijuan tea.
Prostaglandin E(2) synthase inhibition as a therapeutic target.
Iyer, Jitesh P; Srivastava, Punit K; Dev, Rishabh; Dastidar, Sunanda G; Ray, Abhijit
2009-07-01
Most NSAIDs function by inhibiting biosynthesis of PGE(2) by inhibition of COX-1 and/or COX-2. Since COX-1 has a protective function in the gastro-intestinal tract (GIT), non-selective inhibition of both cycloxy genases leads to moderate to severe gastro-intestinal intolerance. Attempts to identify selective inhibitors of COX-2, led to the identification of celecoxib and rofecoxib. However, long-term use of these drugs has serious adverse effects of sudden myocardial infarction and thrombosis. Drug-mediated imbalance in the levels of prostaglandin I(2) (PGI(2)) and thromboxane A(2) (TXA(2)) with a bias towards TXA(2) may be the primary reason for these events. This resulted in the drugs being withdrawn from the market, leaving a need for an effective and safe anti-inflammatory drug. Recently, the focus of research has shifted to enzymes downstream of COX in the prosta glandin biosynthetic pathway such as prostaglandin E(2) synthases. Microsomal prostaglandin E(2) synthase-1 (mPGES-1) specifically isomerizes PGH(2) to PGE(2), under inflammatory conditions. In this review, we examine the biology of mPGES-1 and its role in disease. Progress in designing molecules that can selectively inhibit mPGES-1 is reviewed. mPGES-1 has the potential to be a target for anti-inflammatory therapy, devoid of adverse GIT and cardiac effects and warrants further investigation.
Endler, Anne; Schneider, Rene; Kesten, Christopher; Lampugnani, Edwin R.; Persson, Staffan
2016-01-01
Cellulose is a cell wall constituent that is essential for plant growth and development, and an important raw material for a range of industrial applications. Cellulose is synthesized at the plasma membrane by massive cellulose synthase (CesA) complexes that track along cortical microtubules in elongating cells of Arabidopsis through the activity of the protein CELLULOSE SYNTHASE INTERACTING1 (CSI1). In a recent study we identified another family of proteins that also are associated with the ...
Directory of Open Access Journals (Sweden)
Xiudao Yu
2013-10-01
Full Text Available Aphids are major agricultural pests that cause significant yield losses in crop plants each year. (E-β-farnesene (EβF is the main or only component of an alarm pheromone involved in chemical communication within aphid species and particularly in the avoidance of predation. EβF also occurs in the essential oil of some plant species, and is catalyzed by EβF synthase. By using oligonucleotide primers designed from the known sequence of an EβF synthase gene from black peppermint (Mentha × piperita, two cDNA sequences, MaβFS1 and MaβFS2, were isolated from Asian peppermint (Mentha asiatica. Expression pattern analysis showed that the MaβFS1 gene exhibited higher expression in flowers than in roots, stems and leaves at the transcriptional level. Overexpression of MaβFS1 in tobacco plants resulted in emission of pure EβF ranging from 2.62 to 4.85 ng d− 1 g− 1 of fresh tissue. Tritrophic interactions involving peach aphids (Myzus persicae, and predatory lacewing (Chrysopa septempunctata larvae demonstrated that transgenic tobacco expressing MaβFS1 had lower aphid infestation. This result suggested that the EβF synthase gene from Asian peppermint could be a good candidate for genetic engineering of agriculturally important crop plants.
Xu, Jinkun; Ai, Ying; Wang, Jianhui; Xu, Jingwei; Zhang, Yongkang; Yang, Dong
2017-05-01
S-limonene synthase is a model monoterpene synthase that cyclizes geranyl pyrophosphate (GPP) to form S-limonene. It is a relatively specific enzyme as the majority of its products are composed of limonene. In this study, we converted it to pinene or phellandrene synthases after introducing N345A/L423A/S454A or N345I mutations. Further studies on N345 suggest the polarity of this residue plays a critical role in limonene production by stabilizing the terpinyl cation intermediate. If it is mutated to a non-polar residue, further cyclization or hydride shifts occurs so the carbocation migrates towards the pyrophosphate, leading to the production of pinene or phellandrene. On the other hand, mutant enzymes that still possess a polar residue at this position produce limonene as the major product. N345 is not the only polar residue that may stabilize the terpinyl cation because it is not strictly conserved among limonene synthases across species and there are also several other polar residues in this area. These residues could form a "polar pocket" that may collectively play this stabilizing role. Our study provides important insights into the catalytic mechanism of limonene synthases. Furthermore, it also has wider implications on the evolution of terpene synthases. Copyright © 2017 Elsevier Ltd. All rights reserved.
Singh, Anup Kumar; Dwivedi, Varun; Rai, Avanish; Pal, Shaifali; Reddy, Sajjalavarahalli Gangireddy Eswara; Rao, Dodaghatta Krishnarao Venkata; Shasany, Ajit Kumar; Nagegowda, Dinesh A
2015-12-01
Withania somnifera (L.) Dunal is an important Indian medicinal plant that produces withanolides, which are triterpenoid steroidal lactones having diverse biological activities. To enable fast and efficient functional characterization of genes in this slow-growing and difficult-to-transform plant, a virus-induced gene silencing (VIGS) was established by silencing phytoene desaturase (PDS) and squalene synthase (SQS). VIGS of the gene encoding SQS, which provides precursors for triterpenoids, resulted in significant reduction of squalene and withanolides, demonstrating its application in studying withanolides biosynthesis in W. somnifera leaves. A comprehensive analysis of gene expression and sterol pathway intermediates in WsSQS-vigs plants revealed transcriptional modulation with positive feedback regulation of mevalonate pathway genes, and negative feed-forward regulation of downstream sterol pathway genes including DWF1 (delta-24-sterol reductase) and CYP710A1 (C-22-sterol desaturase), resulting in significant reduction of sitosterol, campesterol and stigmasterol. However, there was little effect of SQS silencing on cholesterol, indicating the contribution of sitosterol, campesterol and stigmasterol, but not of cholesterol, towards withanolides formation. Branch-point oxidosqualene synthases in WsSQS-vigs plants exhibited differential regulation with reduced CAS (cycloartenol synthase) and cycloartenol, and induced BAS (β-amyrin synthase) and β-amyrin. Moreover, SQS silencing also led to the down-regulation of brassinosteroid-6-oxidase-2 (BR6OX2), pathogenesis-related (PR) and nonexpressor of PR (NPR) genes, resulting in reduced tolerance to bacterial and fungal infection as well as to insect feeding. Taken together, SQS silencing negatively regulated sterol and defence-related genes leading to reduced phytosterols, withanolides and biotic stress tolerance, thus implicating the application of VIGS for functional analysis of genes related to withanolides
Directory of Open Access Journals (Sweden)
Leila ePazouki
2015-03-01
Full Text Available Terpenoid synthases constitute a highly diverse gene family producing a wide range of cyclic and acyclic molecules consisting of isoprene (C5 residues. Often a single terpene synthase produces a spectrum of molecules of given chain length, but some terpene synthases can use multiple substrates, producing products of different chain length. Only a few such enzymes has been characterized, but the capacity for multiple-substrate use can be more widespread than previously thought. Here we focused on germacrene A synthase (GAS that is a key cytosolic enzyme in the sesquiterpene lactone biosynthesis pathway in the important medicinal plant Achillea millefolium (AmGAS. The full length encoding gene was heterologously expressed in Escherichia coli BL21 (DE3, functionally characterized, and its in vivo expression was analyzed. The recombinant protein catalyzed formation of germacrene A with the C15 substrate farnesyl diphosphate (FDP, while acyclic monoterpenes were formed with the C10 substrate geranyl diphosphate (GDP and cyclic monoterpenes with the C10 substrate neryl diphosphate (NDP. Although monoterpene synthesis has been assumed to be confined exclusively to plastids, AmGAS can potentially synthesize monoterpenes in cytosol when GDP or NDP become available. AmGAS enzyme had high homology with GAS sequences from other Asteraceae species, suggesting that multi-substrate use can be more widespread among germacrene A synthases than previously thought. Expression studies indicated that AmGAS was expressed in both autotrophic and heterotrophic plant compartments with the highest expression levels in leaves and flowers. To our knowledge, this is the first report on the cloning and characterization of germacrene A synthase coding gene in A. millefolium, and multi-substrate use of GAS enzymes.
Directory of Open Access Journals (Sweden)
Nevzat Selim Gokay
2016-01-01
Full Text Available The objective of this study was to investigate the effects of selective inducible nitric oxide synthase and neuronal nitric oxide synthase inhibitors on cartilage regeneration. The study involved 27 Wistar rats that were divided into five groups. On Day 1, both knees of 3 rats were resected and placed in a formalin solution as a control group. The remaining 24 rats were separated into 4 groups, and their right knees were surgically damaged. Depending on the groups, the rats were injected with intra-articular normal saline solution, neuronal nitric oxide synthase inhibitor 7-nitroindazole (50 mg/kg, inducible nitric oxide synthase inhibitor amino-guanidine (30 mg/kg, or nitric oxide precursor L-arginine (200 mg/kg. After 21 days, the right and left knees of the rats were resected and placed in formalin solution. The samples were histopathologically examined by a blinded evaluator and scored on 8 parameters. Although selective neuronal nitric oxide synthase inhibition exhibited significant (P=0.044 positive effects on cartilage regeneration following cartilage damage, it was determined that inducible nitric oxide synthase inhibition had no statistically significant effect on cartilage regeneration. It was observed that the nitric oxide synthase activation triggered advanced arthrosis symptoms, such as osteophyte formation. The fact that selective neuronal nitric oxide synthase inhibitors were observed to have mitigating effects on the severity of the damage may, in the future, influence the development of new agents to be used in the treatment of cartilage disorders.
Study of the biochemical indicators of chronic irradiation in rats.
Szabo, L D; Benko, A B; Gyenge, L; Predmerszky, T
1976-01-01
Daily urinary excretion of pseudouridine, creatinine and creatine of chronically irradiated Wistar rats was estimated. The irradiation conditions were: 60Co gamma source, dose-rate 10 rad/day, total dose 200, 400 and 600 rad. Control groups were kept under similar conditions. Urine samples were taken three times after the end of the irradiation period. It was found that: (1) pseudouridine excretion seems more suitable for indicating radiation injury than the creatine/creatinine ratio in chronic irradiation in rats; (ii) there are significant changes in dose dependence of pseudouridine excretion in the post-irradiation period; (iii) a new method for pseudouridine estimation gives closely similar data to those of earlier investigations.
ExpI and PhzI are descendants of the long lost cognate signal synthase for SdiA.
Directory of Open Access Journals (Sweden)
Anice Sabag-Daigle
Full Text Available SdiA of E. coli and Salmonella is a LuxR homolog that detects N-acyl homoserine lactones (AHLs. Most LuxR homologs function together with a cognate AHL synthase (a LuxI homolog, but SdiA does not. Instead, SdiA detects AHLs produced by other bacterial species. In this report, we performed a phylogenetic analysis of SdiA. The results suggest that one branch of the Enterobacteriaceae obtained a rhlR/rhlI pair by horizontal transfer. The Erwinia and Pantoea branches still contain the complete pair where it is known as expR/expI and phzR/phzI, respectively. A deletion event removed the luxI homolog from the remainder of the group, leaving just the luxR homolog known as sdiA. Thus ExpR and PhzR are SdiA orthologs and ExpI and PhzI are descendants of the long lost cognate signal synthase of SdiA.
CTP synthase forms cytoophidia in the cytoplasm and nucleus
International Nuclear Information System (INIS)
Gou, Ke-Mian; Chang, Chia-Chun; Shen, Qing-Ji; Sung, Li-Ying; Liu, Ji-Long
2014-01-01
CTP synthase is an essential metabolic enzyme responsible for the de novo synthesis of CTP. Multiple studies have recently showed that CTP synthase protein molecules form filamentous structures termed cytoophidia or CTP synthase filaments in the cytoplasm of eukaryotic cells, as well as in bacteria. Here we report that CTP synthase can form cytoophidia not only in the cytoplasm, but also in the nucleus of eukaryotic cells. Both glutamine deprivation and glutamine analog treatment promote formation of cytoplasmic cytoophidia (C-cytoophidia) and nuclear cytoophidia (N-cytoophidia). N-cytoophidia are generally shorter and thinner than their cytoplasmic counterparts. In mammalian cells, both CTP synthase 1 and CTP synthase 2 can form cytoophidia. Using live imaging, we have observed that both C-cytoophidia and N-cytoophidia undergo multiple rounds of fusion upon glutamine analog treatment. Our study reveals the coexistence of cytoophidia in the cytoplasm and nucleus, therefore providing a good opportunity to investigate the intracellular compartmentation of CTP synthase. - Highlights: • CTP synthase forms cytoophidia not only in the cytoplasm but also in the nucleus. • Glutamine deprivation and Glutamine analogs promotes cytoophidium formation. • N-cytoophidia exhibit distinct morphology when compared to C-cytoophidia. • Both CTP synthase 1 and CTP synthase 2 form cytoophidia in mammalian cells. • Fusions of cytoophidia occur in the cytoplasm and nucleus
CTP synthase forms cytoophidia in the cytoplasm and nucleus
Energy Technology Data Exchange (ETDEWEB)
Gou, Ke-Mian [MRC Functional Genomics Unit, Department of Physiology, Anatomy and Genetics, University of Oxford, Oxford OX1 3PT (United Kingdom); State Key Laboratory for Agrobiotechnology, College of Biological Sciences, China Agricultural University, Beijing 100193 (China); Chang, Chia-Chun [Institute of Biotechnology, National Taiwan University, Taipei, Taiwan, ROC (China); Shen, Qing-Ji [MRC Functional Genomics Unit, Department of Physiology, Anatomy and Genetics, University of Oxford, Oxford OX1 3PT (United Kingdom); Sung, Li-Ying, E-mail: liyingsung@ntu.edu.tw [Institute of Biotechnology, National Taiwan University, Taipei, Taiwan, ROC (China); Agricultural Biotechnology Research Center, Academia Sinica, Taipei 115, Taiwan, ROC (China); Liu, Ji-Long, E-mail: jilong.liu@dpag.ox.ac.uk [MRC Functional Genomics Unit, Department of Physiology, Anatomy and Genetics, University of Oxford, Oxford OX1 3PT (United Kingdom)
2014-04-15
CTP synthase is an essential metabolic enzyme responsible for the de novo synthesis of CTP. Multiple studies have recently showed that CTP synthase protein molecules form filamentous structures termed cytoophidia or CTP synthase filaments in the cytoplasm of eukaryotic cells, as well as in bacteria. Here we report that CTP synthase can form cytoophidia not only in the cytoplasm, but also in the nucleus of eukaryotic cells. Both glutamine deprivation and glutamine analog treatment promote formation of cytoplasmic cytoophidia (C-cytoophidia) and nuclear cytoophidia (N-cytoophidia). N-cytoophidia are generally shorter and thinner than their cytoplasmic counterparts. In mammalian cells, both CTP synthase 1 and CTP synthase 2 can form cytoophidia. Using live imaging, we have observed that both C-cytoophidia and N-cytoophidia undergo multiple rounds of fusion upon glutamine analog treatment. Our study reveals the coexistence of cytoophidia in the cytoplasm and nucleus, therefore providing a good opportunity to investigate the intracellular compartmentation of CTP synthase. - Highlights: • CTP synthase forms cytoophidia not only in the cytoplasm but also in the nucleus. • Glutamine deprivation and Glutamine analogs promotes cytoophidium formation. • N-cytoophidia exhibit distinct morphology when compared to C-cytoophidia. • Both CTP synthase 1 and CTP synthase 2 form cytoophidia in mammalian cells. • Fusions of cytoophidia occur in the cytoplasm and nucleus.
Glycogen synthase activation by sugars in isolated hepatocytes.
Ciudad, C J; Carabaza, A; Bosch, F; Gòmez I Foix, A M; Guinovart, J J
1988-07-01
We have investigated the activation by sugars of glycogen synthase in relation to (i) phosphorylase a activity and (ii) changes in the intracellular concentration of glucose 6-phosphate and adenine nucleotides. All the sugars tested in this work present the common denominator of activating glycogen synthase. On the other hand, phosphorylase a activity is decreased by mannose and glucose, unchanged by galactose and xylitol, and increased by tagatose, glyceraldehyde, and fructose. Dihydroxyacetone exerts a biphasic effect on phosphorylase. These findings provide additional evidence proving that glycogen synthase can be activated regardless of the levels of phosphorylase a, clearly establishing that a nonsequential mechanism for the activation of glycogen synthase occurs in liver cells. The glycogen synthase activation state is related to the concentrations of glucose 6-phosphate and adenine nucleotides. In this respect, tagatose, glyceraldehyde, and fructose deplete ATP and increase AMP contents, whereas glucose, mannose, galactose, xylitol, and dihydroxyacetone do not alter the concentration of these nucleotides. In addition, all these sugars, except glyceraldehyde, increase the intracellular content of glucose 6-phosphate. The activation of glycogen synthase by sugars is reflected in decreases on both kinetic constants of the enzyme, M0.5 (for glucose 6-phosphate) and S0.5 (for UDP-glucose). We propose that hepatocyte glycogen synthase is activated by monosaccharides by a mechanism triggered by changes in glucose 6-phosphate and adenine nucleotide concentrations which have been described to modify glycogen synthase phosphatase activity. This mechanism represents a metabolite control of the sugar-induced activation of hepatocyte glycogen synthase.
Threonine phosphorylation of rat liver glycogen synthase
International Nuclear Information System (INIS)
Arino, J.; Arro, M.; Guinovart, J.J.
1985-01-01
32 P-labeled glycogen synthase specifically immunoprecipitated from 32 P-phosphate incubated rat hepatocytes contains, in addition to [ 32 P] phosphoserine, significant levels of [ 32 P] phosphothreonine. When the 32 P-immunoprecipitate was cleaved with CNBr, the [ 32 P] phosphothreonine was recovered in the large CNBr fragment (CB-2, Mapp 28 Kd). Homogeneous rat liver glycogen synthase was phosphorylated by all the protein kinases able to phosphorylate CB-2 in vitro. After analysis of the immunoprecipitated enzyme for phosphoaminoacids, it was observed that only casein kinase II was able to phosphorylate on threonine and 32 P-phosphate was only found in CB-2. These results demonstrate that rat liver glycogen synthase is phosphorylated at threonine site(s) contained in CB-2 and strongly indicate that casein kinase II may play a role in the ''in vivo'' phosphorylation of liver glycogen synthase. This is the first protein kinase reported to phosphorylate threonine residues in liver glycogen synthase
Energy Technology Data Exchange (ETDEWEB)
Nicholas C Carpita
2009-04-20
Five specific objectives of this project are to develop strategies to identify the genes that encode the catalytic components of "mixed-linkage" (1→3),(1→4)-beta-D-glucans in grasses, to determine the protein components of the synthase complex, and determine the biochemical mechanism of synthesis. We have used proteomic approaches to define intrinsic and extrinsic polypeptides of Golgi membranes that are associated with polysaccharide synthesis and trafficking. We were successful in producing recombinant catalytic domains of cellulose synthase genes and discovered that they dimerize upon concentration, indicating that two CesA proteins form the catalytic unit. We characterized a brittle stalk2 mutant as a defect in a COBRA-like protein that results in compromised lignin-cellulose interactions that decrease tissue flexibility. We used virus-induced gene silencing of barley cell wall polysaccharide synthesis by BSMV in an attempt to silence specific members of the cellulose synthase-like gene family. However, we unexpectedly found that regardless of the specificity of the target gene, whole gene interaction networks were silenced. We discovered the cause to be an antisense transcript of the cellulose synthase gene initiated small interfering RNAs that spread silencing to related genes.
REMINDER Saved Leave Scheme (SLS) : Transfer of leave to saved leave accounts
HR Division
2002-01-01
Under the provisions of the voluntary saved leave scheme (SLS), a maximum total of 10 days'*) annual and compensatory leave (excluding saved leave accumulated in accordance with the provisions of Administrative Circular No. 22B) can be transferred to the saved leave account at the end of the leave year (30 September). We remind you that, since last year, unused leave of all those taking part in the saved leave scheme at the closure of the leave-year accounts is transferred automatically to the saved leave account on that date. Therefore, staff members have no administrative steps to take. In addition, the transfer, which eliminates the risk of omitting to request leave transfers and rules out calculation errors in transfer requests, will be clearly shown in the list of leave transactions that can be consulted in EDH from October 2002 onwards. Furthermore, this automatic leave transfer optimizes staff members' chances of benefiting from a saved leave bonus provided that they are still participants in the schem...
Flynn, Christopher M; Schmidt-Dannert, Claudia
2018-06-01
The wood-rotting mushroom Stereum hirsutum is a known producer of a large number of namesake hirsutenoids, many with important bioactivities. Hirsutenoids form a structurally diverse and distinct class of sesquiterpenoids. No genes involved in hirsutenoid biosynthesis have yet been identified or their enzymes characterized. Here, we describe the cloning and functional characterization of a hirsutene synthase as an unexpected fusion protein of a sesquiterpene synthase (STS) with a C-terminal 3-hydroxy-3-methylglutaryl-coenzyme A (3-hydroxy-3-methylglutaryl-CoA) synthase (HMGS) domain. Both the full-length fusion protein and truncated STS domain are highly product-specific 1,11-cyclizing STS enzymes with kinetic properties typical of STSs. Complementation studies in Saccharomyces cerevisiae confirmed that the HMGS domain is also functional in vivo Phylogenetic analysis shows that the hirsutene synthase domain does not form a clade with other previously characterized sesquiterpene synthases from Basidiomycota. Comparative gene structure analysis of this hirsutene synthase with characterized fungal enzymes reveals a significantly higher intron density, suggesting that this enzyme may be acquired by horizontal gene transfer. In contrast, the HMGS domain is clearly related to other fungal homologs. This STS-HMGS fusion protein is part of a biosynthetic gene cluster that includes P450s and oxidases that are expressed and could be cloned from cDNA. Finally, this unusual fusion of a terpene synthase to an HMGS domain, which is not generally recognized as a key regulatory enzyme of the mevalonate isoprenoid precursor pathway, led to the identification of additional HMGS duplications in many fungal genomes, including the localization of HMGSs in other predicted sesquiterpenoid biosynthetic gene clusters. IMPORTANCE Hirsutenoids represent a structurally diverse class of bioactive sesquiterpenoids isolated from fungi. Identification of their biosynthetic pathways will provide
Clinical significance of Phosphatidyl Inositol Synthase overexpression in oral cancer
International Nuclear Information System (INIS)
Kaur, Jatinder; Sawhney, Meenakshi; DattaGupta, Siddartha; Shukla, Nootan K; Srivastava, Anurag; Ralhan, Ranju
2010-01-01
We reported increased levels of Phosphatidyl Inositol synthase (PI synthase), (enzyme that catalyses phosphatidyl inositol (PI) synthesis-implicated in intracellular signaling and regulation of cell growth) in smokeless tobacco (ST) exposed oral cell cultures by differential display. This study determined the clinical significance of PI synthase overexpression in oral squamous cell carcinoma (OSCC) and premalignant lesions (leukoplakia), and identified the downstream signaling proteins in PI synthase pathway that are perturbed by smokeless tobacco (ST) exposure. Tissue microarray (TMA) Immunohistochemistry, Western blotting, Confocal laser scan microscopy, RT-PCR were performed to define the expression of PI synthase in clinical samples and in oral cell culture systems. Significant increase in PI synthase immunoreactivity was observed in premalignant lesions and OSCCs as compared to oral normal tissues (p = 0.000). Further, PI synthase expression was significantly associated with de-differentiation of OSCCs, (p = 0.005) and tobacco consumption (p = 0.03, OR = 9.0). Exposure of oral cell systems to smokeless tobacco (ST) in vitro confirmed increase in PI synthase, Phosphatidylinositol 3-kinase (PI3K) and cyclin D1 levels. Collectively, increased PI synthase expression was found to be an early event in oral cancer and a target for smokeless tobacco
Directory of Open Access Journals (Sweden)
Tri Joko Raharjo
2011-12-01
Full Text Available Resveratrol is a potent anticancer agent resulted as the main product of enzymatic reaction between common precursor in plants and Stilbene Synthase enzyme, which is expressed by sts gene. Characterization of internal fragment of Stilbene Synthase (STS encoding gene from melinjo plant (Gnetum gnemon L. has been carried out as part of a larger work to obtain a full length of Stilbene Synthase encoding gene of the plant. RT-PCR (Reverse Transcriptase Polymerase Chain Reaction was performed using two degenerated primers to amplify the gene fragment. Ten published STS conserved amino acid sequences from various plant species from genebank were utilized to construct a pair of GGF2 (5' GTTCCACCTGCGAAGCAGCC 3' and GGR2 (5' CTGGATCGCACATCC TGGTG 3' primers. Both designed primers were predicted to be in the position of 334-354 and 897-916 kb of the gene respectively. Total RNA isolated from melinjo leaves was used as template for the RT-PCR amplification process using two-step technique. A collection of 0.58 DNA fragments was generated from RT-PCR amplification and met the expected results. The obtained DNA fragments were subsequently isolated, refined and sequenced. A nucleotide sequence analysis was accomplished by comparing it to the existed sts genes available in genebank. Homology analysis of the DNA fragments with Arachis hypogaea L00952 sts gene showed high similarity level. Taken together, the results are evidence that the amplified fragment obtained in this study is part of melinjo sts gene
Oberthür, Christine; Hamburger, Matthias
2004-07-01
Tryptanthrin is a pharmacologically active compound in the anti-inflammatory herb Isatis tinctoria, with potent inhibitory activity on prostaglandin and leukotriene synthesis and on inducible NO synthase. The tryptanthrin content of five defined woad strains was analyzed in dependence of the time of harvest and post-harvest treatment. Tryptanthrin was determined by a validated ESI-LC-MS isotope dilution assay with d(8)-tryptanthrin as internal standard. The tryptanthrin concentration in freeze-dried leaf samples was low. Drying at ambient temperature led to a significant increase of tryptanthrin concentration, but the highest concentrations were found when leaves were dried at 40 degrees C. Tryptanthrin content in fermented woad leaves was below the limit of quantification. Tryptanthrin appears thus to be a product of post-harvest processes, but details of its formation remain to be elucidated.
Heterooligomeric phosphoribosyl diphosphate synthase of Saccharomyces cerevisiae
DEFF Research Database (Denmark)
Hove-Jensen, Bjarne
2004-01-01
The yeast Saccharomyces cerevisiae contains five phosphoribosyl diphosphate (PRPP) synthase-homologous genes (PRS1-5), which specify PRPP synthase subunits 1-5. Expression of the five S. cerevisiae PRS genes individually in an Escherichia coli PRPP-less strain (Deltaprs) showed that a single PRS...
Directory of Open Access Journals (Sweden)
Dong Liang
2018-04-01
Full Text Available Melatonin, a multiple signal molecule, plays important roles in delaying senescence during the development of plants. Because few species have been studied for the effect of exogenous melatonin on anti-aging, the plausible mechanism of melatonin of anti-aging effects on other plant species has remained largely unknown. In the present study, the effects of exogenous melatonin on leaf senescence in kiwifruit were examined during natural aging after melatonin (200 μM or water (Control pretreatment. The decreased membrane damage and lower hydrogen peroxide (H2O2 content due to the enhanced scavenging activity of antioxidant enzymes peroxidase (POD, superoxide dismutase (SOD, and catalase (CAT demonstrated that melatonin effectively delayed the aging of kiwifruit leaves. Likewise, owing to up-regulated expression of chlorophyll a/b-binding protein (CAB gene in the sampled leaves pretreated with melatonin, chlorophyll degradation decreased. Therefore, osmoregulatory substances in sampled leaves accumulated (e.g., soluble sugar and soluble protein and seedling cell environment stability was maintained. Simultaneously, melatonin decreased H2O2 concentration owing to increased glutathione (GSH and ascorbate (AsA content, and the expression levels of glutathione reductase (GR, ascorbate peroxidase (APX, monodehydroascorbate reductase (MDAR, dehydroascorbate reductase (DHAR were up-regulated by melatonin application, indicating that the increase of GSH and AsA was attributed to the expression of these genes. In addition, a large amount of flavonoids accumulated in seedlings pretreated with melatonin, and transcript levels of eight genes involved in flavonoid synthesis, including phenylalanine ammonia-lyase (PAL, cinnamate-4-hydroxymate (C4H, chalcone synthase (CHS, flavanone 3-hydroxylase (F3H, flavonol synthase (FNS, leucoanthocyanin reductase (LAR, anthocyanin reductase (ANR, flavonoid 3-O-glucosyltransferase (UFGT were enhanced in response to melatonin
Foyer, Christine H.; Valadier, Marie-Hélène; Migge, Andrea; Becker, Thomas W.
1998-01-01
Maize (Zea mays L.) plants were grown to the nine-leaf stage. Despite a saturating N supply, the youngest mature leaves (seventh position on the stem) contained little NO3− reserve. Droughted plants (deprived of nutrient solution) showed changes in foliar enzyme activities, mRNA accumulation, photosynthesis, and carbohydrate and amino acid contents. Total leaf water potential and CO2 assimilation rates, measured 3 h into the photoperiod, decreased 3 d after the onset of drought. Starch, glucose, fructose, and amino acids, but not sucrose (Suc), accumulated in the leaves of droughted plants. Maximal extractable phosphoenolpyruvate carboxylase activities increased slightly during water deficit, whereas the sensitivity of this enzyme to the inhibitor malate decreased. Maximal extractable Suc phosphate synthase activities decreased as a result of water stress, and there was an increase in the sensitivity to the inhibitor orthophosphate. A correlation between maximal extractable foliar nitrate reductase (NR) activity and the rate of CO2 assimilation was observed. The NR activation state and maximal extractable NR activity declined rapidly in response to drought. Photosynthesis and NR activity recovered rapidly when nutrient solution was restored at this point. The decrease in maximal extractable NR activity was accompanied by a decrease in NR transcripts, whereas Suc phosphate synthase and phosphoenolpyruvate carboxylase mRNAs were much less affected. The coordination of N and C metabolism is retained during drought conditions via modulation of the activities of Suc phosphate synthase and NR commensurate with the prevailing rate of photosynthesis. PMID:9576798
[Cellulose synthase genes that control the fiber formation of flax (Linum usitatissimum L.)].
Galinovskiĭ, D V; Anisimova, N V; Raĭskiĭ, A P; Leont'ev, V N; Titok, V V; Hotyleva, L V
2014-01-01
Four cellulose synthase genes were identified by analysis of their class-specific regions (CSRII) in plants of fiber flax during the "rapid growth" stage. These genes were designated as LusCesA1, LusCesA4, LusCesA7 and LusCesA9. LusCesA4, LusCesA7, and LusCesA9 genes were expressed in the stem; LusCesA1 and LusCesA4 genes were expressed in the apex part of plants, and the LusCesA4 gene was expressed in the leaves of fiber flax. The expression of the LusCesA7 and LusCesA9 genes was specific to the stems of fiber flax. These genes may influence the quality of the flax fiber.
Saved Leave Scheme (SLS) : Simplified procedure for the transfer of leave to saved leave accounts
HR Division
2001-01-01
As part of the process of streamlining procedures, the HR and AS Divisions have jointly developed a system whereby annual and compensatory leave will henceforth be automatically transferred1) to saved leave accounts. Under the provisions of the voluntary saved leave scheme (SLS), a maximum total of 10 days'2) annual and compensatory leave (excluding saved leave accumulated in accordance with the provisions of Administrative Circular No. 22 B) can be transferred to the saved leave account at the end of the leave year (30 September). Previously, every person taking part in the scheme has been individually issued with a form for the purposes of requesting the transfer of leave to the leave account and the transfer has then had to be done manually by HR Division. To streamline the procedure, unused leave of all those taking part in the saved leave scheme at the closure of of the leave-year accounts will henceforth be transferred automatically to the saved leave account on that date. This simplification is in the ...
Paid Family Leave, Fathers' Leave-Taking, and Leave-Sharing in Dual-Earner Households.
Bartel, Anne P; Rossin-Slater, Maya; Ruhm, Christopher J; Stearns, Jenna; Waldfogel, Jane
Using difference-in-difference and difference-in-difference-in-difference designs, we study California's Paid Family Leave (CA-PFL) program, the first source of government-provided paid parental leave available to fathers in the Unites States. Relative to the pre-treatment mean, fathers of infants in California are 46 percent more likely to be on leave when CA-PFL is available. In households where both parents work, we find suggestive evidence that CA-PFL increases both father-only leave-taking (i.e., father on leave while mother is at work) and joint leave-taking (i.e., both parents on leave at the same time). Effects are larger for fathers of first-born children than for fathers of later-born children.
The Tomato Terpene Synthase Gene Family1[W][OA
Falara, Vasiliki; Akhtar, Tariq A.; Nguyen, Thuong T.H.; Spyropoulou, Eleni A.; Bleeker, Petra M.; Schauvinhold, Ines; Matsuba, Yuki; Bonini, Megan E.; Schilmiller, Anthony L.; Last, Robert L.; Schuurink, Robert C.; Pichersky, Eran
2011-01-01
Compounds of the terpenoid class play numerous roles in the interactions of plants with their environment, such as attracting pollinators and defending the plant against pests. We show here that the genome of cultivated tomato (Solanum lycopersicum) contains 44 terpene synthase (TPS) genes, including 29 that are functional or potentially functional. Of these 29 TPS genes, 26 were expressed in at least some organs or tissues of the plant. The enzymatic functions of eight of the TPS proteins were previously reported, and here we report the specific in vitro catalytic activity of 10 additional tomato terpene synthases. Many of the tomato TPS genes are found in clusters, notably on chromosomes 1, 2, 6, 8, and 10. All TPS family clades previously identified in angiosperms are also present in tomato. The largest clade of functional TPS genes found in tomato, with 12 members, is the TPS-a clade, and it appears to encode only sesquiterpene synthases, one of which is localized to the mitochondria, while the rest are likely cytosolic. A few additional sesquiterpene synthases are encoded by TPS-b clade genes. Some of the tomato sesquiterpene synthases use z,z-farnesyl diphosphate in vitro as well, or more efficiently than, the e,e-farnesyl diphosphate substrate. Genes encoding monoterpene synthases are also prevalent, and they fall into three clades: TPS-b, TPS-g, and TPS-e/f. With the exception of two enzymes involved in the synthesis of ent-kaurene, the precursor of gibberellins, no other tomato TPS genes could be demonstrated to encode diterpene synthases so far. PMID:21813655
Isolation and functional effects of monoclonal antibodies binding to thymidylate synthase.
Jastreboff, M M; Todd, M B; Malech, H L; Bertino, J R
1985-01-29
Monoclonal antibodies against electrophoretically pure thymidylate synthase from HeLa cells have been produced. Antibodies (M-TS-4 and M-TS-9) from hybridoma clones were shown by enzyme-linked immunoassay to recognize thymidylate synthase from a variety of human cell lines, but they did not bind to thymidylate synthase from mouse cell lines. The strongest binding of antibodies was observed to enzyme from HeLa cells. These two monoclonal antibodies bind simultaneously to different antigenic sites on thymidylate synthase purified from HeLa cells, as reflected by a high additivity index and results of cross-linked radioimmunoassay. Both monoclonal antibodies inhibit the activity of thymidylate synthase from human cell lines. The strongest inhibition was observed with thymidylate synthase from HeLa cells. Monoclonal antibody M-TS-9 (IgM subclass) decreased the rate of binding of [3H]FdUMP to thymidylate synthase in the presence of 5,10-methylenetetrahydrofolate while M-TS-4 (IgG1) did not change the rate of ternary complex formation. These data indicate that the antibodies recognize different epitopes on the enzyme molecule.
Paid Family Leave, Fathers' Leave-Taking, and Leave-Sharing in Dual-Earner Households
Bartel, Ann P.; Rossin-Slater, Maya; Ruhm, Christopher J.; Stearns, Jenna; Waldfogel, Jane
2015-01-01
This paper provides quasi-experimental evidence on the impact of paid leave legislation on fathers' leave-taking, as well as on the division of leave between mothers and fathers in dual-earner households. Using difference-in-difference and difference-in-difference-in-difference designs, we study California's Paid Family Leave (CA-PFL) program, which is the first source of government-provided paid parental leave available to fathers in the United States. Our results show that fathers in Califo...
Attia, Mohamed; Kim, Soo-Un; Ro, Dae-Kyun
2012-11-01
Hernandulcin, a C15 sesquiterpene ketone, is a natural sweetener isolated from the leaves of Lippia dulcis. It is a promising sugar substitute due to its safety and low caloric potential. However, the biosynthesis of hernandulcin in L. dulcis remains unknown. The first biochemical step of hernandulcin is the synthesis of (+)-epi-α-bisabolol from farnesyl diphosphate, which is presumed to be catalyzed by a unique sesquiterpene synthase in L. dulcis. In order to decipher hernandulcin biosynthesis, deep transcript sequencings (454 and Illumina) were performed, which facilitated the molecular cloning of five new sesquiterpene synthase cDNAs from L. dulcis. In vivo activity evaluation of these cDNAs in yeast identified them as the sesquiterpene synthases for α-copaene/δ-cadinene, bicyclogermacrene, β-caryophyllene, trans-α-bergamotene, and α-bisabolol. The engineered yeast could synthesize a significant amount (~0.3 mg per mL) of α-bisabolol in shake-flask cultivation. This efficient in vivo production was congruent with the competent kinetic properties of recombinant α-bisabolol synthase (K(m) 4.8 μM and k(cat) 0.04 s(-1)). Detailed chemical analyses of the biosynthesized α-bisabolol confirmed its configuration to be (+)-epi-α-bisabolol, the core skeleton of hernandulcin. These results demonstrated that enzymatic, stereoselective synthesis of (+)-epi-α-bisabolol can be achieved, promising the heterologous production of a natural sweetener, hernandulcin. Copyright © 2012 Elsevier Inc. All rights reserved.
Structure and mechanism of the diterpene cyclase ent-copalyl diphosphate synthase
Energy Technology Data Exchange (ETDEWEB)
Köksal, Mustafa; Hu, Huayou; Coates, Robert M.; Peters, Reuben J.; Christianson, David W. (UIUC); (Iowa State); (Penn)
2011-09-20
The structure of ent-copalyl diphosphate synthase reveals three {alpha}-helical domains ({alpha}, {beta} and {gamma}), as also observed in the related diterpene cyclase taxadiene synthase. However, active sites are located at the interface of the {beta}{gamma} domains in ent-copalyl diphosphate synthase but exclusively in the {alpha} domain of taxadiene synthase. Modular domain architecture in plant diterpene cyclases enables the evolution of alternative active sites and chemical strategies for catalyzing isoprenoid cyclization reactions.
Generation and Functional Evaluation of Designer Monoterpene Synthases.
Srividya, N; Lange, I; Lange, B M
2016-01-01
Monoterpene synthases are highly versatile enzymes that catalyze the first committed step in the pathways toward terpenoids, the structurally most diverse class of plant natural products. Recent advancements in our understanding of the reaction mechanism have enabled engineering approaches to develop mutant monoterpene synthases that produce specific monoterpenes. In this chapter, we are describing protocols to introduce targeted mutations, express mutant enzyme catalysts in heterologous hosts, and assess their catalytic properties. Mutant monoterpene synthases have the potential to contribute significantly to synthetic biology efforts aimed at producing larger amounts of commercially attractive monoterpenes. © 2016 Elsevier Inc. All rights reserved.
Gonzalez, Veronica; Touchet, Sabrina; Grundy, Daniel J; Faraldos, Juan A; Allemann, Rudolf K
2014-10-15
Germacrene A synthase (GAS) from Solidago canadensis catalyzes the conversion of farnesyl diphosphate (FDP) to the plant sesquiterpene (+)-germacrene A. After diphosphate expulsion, farnesyl cation reacts with the distal 10,11-double bond to afford germacrene A (>96%) and <2% α-humulene, which arises from 1,11-cyclization of FDP. The origin of the 1,11-activity of GAS was investigated by amino acid sequence alignments of 1,10- and 1,11-synthases and comparisons of X-ray crystal structures with the homology model of GAS; a triad [Thr 401-Gly 402-Gly 403] that might be responsible for the predominant 1,10-cyclization activity of GAS was identified. Replacement of Gly 402 with residues of increasing size led to a progressive increase of 1,11-cyclization. The catalytic robustness of these 1,10- /1,11-GAS variants point to Gly 402 as a functional switch of evolutionary significance and suggests that enzymes with strict functionalities have evolved from less specific ancestors through a small number of substitutions. Similar results were obtained with germacrene D synthase (GDS) upon replacement of the homologous active-site residue Gly 404: GDS-G404V generated approximately 20% bicyclogermacrene, a hydrocarbon with a cyclopropane ring that underlines the dual 1,10-/1,11-cyclization activity of this mutant. This suggests that the reaction pathways to germacrenes and humulenes might be connected through a bridged 1,10,11-carbocation intermediate or transition state that resembles bicyclogermacrene. Mechanistic studies using [1-(3)H1]-10-fluorofarnesyl diphosphate and deuterium-labeling experiments with [12,13-(2)H6]-FDP support a germacrene-humulene rearrangement linking 1,10- and 1,11-pathways. These results support the bioinformatics proposal that modern 1,10-synthases could have evolved from promiscuous 1,11-sesquiterpene synthases.
DEFF Research Database (Denmark)
Gaster, Michael; Brusgaard, Klaus; Handberg, Aa.
2004-01-01
The mechanism responsible for the diminished activation of glycogen synthase (GS) in diabetic myotubes remains unclear, but may involve increased activity and/or expression of glycogen synthase kinase-3 (GSK-3). In myotubes established from type 2 diabetic and healthy control subjects we determined...
Insight into Biochemical Characterization of Plant Sesquiterpene Synthases
DEFF Research Database (Denmark)
Manczak, Tom; Simonsen, Henrik Toft
2016-01-01
A fast and reproducible protocol was established for enzymatic characterization of plant sesquiterpene synthases that can incorporate radioactivity in their products. The method utilizes the 96-well format in conjunction with cluster tubes and enables processing of >200 samples a day. Along...... with reduced reagent usage, it allows further reduction in the use of radioactive isotopes and flammable organic solvents. The sesquiterpene synthases previously characterized were expressed in yeast, and the plant-derived Thapsia garganica kunzeaol synthase TgTPS2 was tested in this method. KM for TgTPS2...... was found to be 0.55 μM; the turnover number, kcat, was found to be 0.29 s-1, kcat for TgTPS2 is in agreement with that of terpene synthases of other plants, and kcat/KM was found to be 0.53 s-1 μM-1 for TgTPS2. The kinetic parameters were in agreement with previously published data....
Directory of Open Access Journals (Sweden)
Hyun Jo Koo
Full Text Available The essential oils of ginger (Zingiber officinale and turmeric (Curcuma longa contain a large variety of terpenoids, some of which possess anticancer, antiulcer, and antioxidant properties. Despite their importance, only four terpene synthases have been identified from the Zingiberaceae family: (+-germacrene D synthase and (S-β-bisabolene synthase from ginger rhizome, and α-humulene synthase and β-eudesmol synthase from shampoo ginger (Zingiber zerumbet rhizome. We report the identification of 25 mono- and 18 sesquiterpene synthases from ginger and turmeric, with 13 and 11, respectively, being functionally characterized. Novel terpene synthases, (--caryolan-1-ol synthase and α-zingiberene/β-sesquiphellandrene synthase, which is responsible for formation of the major sesquiterpenoids in ginger and turmeric rhizomes, were also discovered. These suites of enzymes are responsible for formation of the majority of the terpenoids present in these two plants. Structures of several were modeled, and a comparison of sets of paralogs suggests how the terpene synthases in ginger and turmeric evolved. The most abundant and most important sesquiterpenoids in turmeric rhizomes, (+-α-turmerone and (+-β-turmerone, are produced from (--α-zingiberene and (--β-sesquiphellandrene, respectively, via α-zingiberene/β-sesquiphellandrene oxidase and a still unidentified dehydrogenase.
Suites of Terpene Synthases Explain Differential Terpenoid Production in Ginger and Turmeric Tissues
Koo, Hyun Jo; Gang, David R.
2012-01-01
The essential oils of ginger (Zingiber officinale) and turmeric (Curcuma longa) contain a large variety of terpenoids, some of which possess anticancer, antiulcer, and antioxidant properties. Despite their importance, only four terpene synthases have been identified from the Zingiberaceae family: (+)-germacrene D synthase and (S)-β-bisabolene synthase from ginger rhizome, and α-humulene synthase and β-eudesmol synthase from shampoo ginger (Zingiber zerumbet) rhizome. We report the identification of 25 mono- and 18 sesquiterpene synthases from ginger and turmeric, with 13 and 11, respectively, being functionally characterized. Novel terpene synthases, (−)-caryolan-1-ol synthase and α-zingiberene/β-sesquiphellandrene synthase, which is responsible for formation of the major sesquiterpenoids in ginger and turmeric rhizomes, were also discovered. These suites of enzymes are responsible for formation of the majority of the terpenoids present in these two plants. Structures of several were modeled, and a comparison of sets of paralogs suggests how the terpene synthases in ginger and turmeric evolved. The most abundant and most important sesquiterpenoids in turmeric rhizomes, (+)-α-turmerone and (+)-β-turmerone, are produced from (−)-α-zingiberene and (−)-β-sesquiphellandrene, respectively, via α-zingiberene/β-sesquiphellandrene oxidase and a still unidentified dehydrogenase. PMID:23272109
Directory of Open Access Journals (Sweden)
Xia Li
Full Text Available Leaf coloration is one of the most important and attractive characteristics of Ananas comosus var. bracteatus. The chimeric character is not stable during the in vitro tissue culturing. Many regenerated plants lost economic values for the loss of the chimeric character of leaves. In order to reveal the molecular mechanisms involved in the albino phenotype of the leaf cells, the physiological and transcriptional differences between complete white (CWh and green (CGr leaf cells of A. comosus var. bracteatus were analyzed. A total of 1,431 differentially expressed unigenes (DEGs in CGr and CWh leaves were identified using RNA-seq. A comparison to the COG, GO and KEGG annotations revealed DEGs involved in chlorophyll biosynthesis, chloroplast development and photosynthesis. Furthermore, the measurement of main precursors of chlorophyll in the CWh leaves confirmed that the rate-limiting step in chlorophyll biosynthesis, and thus the cause of the albino phenotype of the white cells, was the conversion of pyrrole porphobilinogen (PBG to uroporphyrinogen III (Uro III. The enzyme activity of porphobilinogen deaminase (PBGD and uroporporphyrinogn III synthase (UROS, which catalyze the transition of PBG to Uro III, was significantly decreased in the CWh leaves. Our data showed the transcriptional differences between the CWh and CGr plants and characterized key steps in chlorophyll biosynthesis of the CWh leaves. These results contribute to our understanding of the mechanisms and regulation of pigment biosynthesis in the CWh leaf cells of A. comosus var. bracteatus.
2000-01-01
Planning a holiday? Then if you're a member of the personnel, you'll need to use the Laboratory's new leave system that will be put in place on 1 October. Leave allocations don't change - you are entitled to just as much holiday as before - but instead of being credited annually, your leave will be credited on a monthly basis, and this information will be communicated on your salary slip. The reason for the change is that with the various new leave schemes such as Recruitment by Saved Leave (RSL) and the Progressive Retirement Programme (PRP), a streamlined procedure was required for dealing with all kinds of leave. In the new system, each member of the personnel will have leave accounts to which leave will be credited monthly from the payroll and debited each time an absence is registered in the CERN Electronic Document Handling system (EDH). Leave balances will appear on monthly pay slips, and full details of leave transactions and balances will be available through EDH at all times. As the leave will be c...
Highly divergent mitochondrial ATP synthase complexes in Tetrahymena thermophila.
Directory of Open Access Journals (Sweden)
Praveen Balabaskaran Nina
2010-07-01
Full Text Available The F-type ATP synthase complex is a rotary nano-motor driven by proton motive force to synthesize ATP. Its F(1 sector catalyzes ATP synthesis, whereas the F(o sector conducts the protons and provides a stator for the rotary action of the complex. Components of both F(1 and F(o sectors are highly conserved across prokaryotes and eukaryotes. Therefore, it was a surprise that genes encoding the a and b subunits as well as other components of the F(o sector were undetectable in the sequenced genomes of a variety of apicomplexan parasites. While the parasitic existence of these organisms could explain the apparent incomplete nature of ATP synthase in Apicomplexa, genes for these essential components were absent even in Tetrahymena thermophila, a free-living ciliate belonging to a sister clade of Apicomplexa, which demonstrates robust oxidative phosphorylation. This observation raises the possibility that the entire clade of Alveolata may have invented novel means to operate ATP synthase complexes. To assess this remarkable possibility, we have carried out an investigation of the ATP synthase from T. thermophila. Blue native polyacrylamide gel electrophoresis (BN-PAGE revealed the ATP synthase to be present as a large complex. Structural study based on single particle electron microscopy analysis suggested the complex to be a dimer with several unique structures including an unusually large domain on the intermembrane side of the ATP synthase and novel domains flanking the c subunit rings. The two monomers were in a parallel configuration rather than the angled configuration previously observed in other organisms. Proteomic analyses of well-resolved ATP synthase complexes from 2-D BN/BN-PAGE identified orthologs of seven canonical ATP synthase subunits, and at least 13 novel proteins that constitute subunits apparently limited to the ciliate lineage. A mitochondrially encoded protein, Ymf66, with predicted eight transmembrane domains could be a
5 CFR 630.1204 - Intermittent leave or reduced leave schedule.
2010-01-01
... insurance, health benefits, retirement coverage, and leave accrual). (e) The agency shall determine the... REGULATIONS ABSENCE AND LEAVE Family and Medical Leave § 630.1204 Intermittent leave or reduced leave schedule... reduced leave schedule unless the employee and the agency agree to do so. (b) Leave under § 630.1203(a) (3...
Bacillus caldolyticus prs gene encoding phosphoribosyldiphosphate synthase
DEFF Research Database (Denmark)
Krath, Britta N.; Hove-Jensen, Bjarne
1996-01-01
The prs gene, encoding phosphoribosyl-diphosphate (PRPP) synthase, as well as the flanking DNA sequences were cloned and sequenced from the Gram-positive thermophile, Bacillus caldolyticus. Comparison with the homologous sequences from the mesophile, Bacillus subtilis, revealed a gene (gca......D) encoding N-acetylglucosamine-l-phosphate uridyltransferase upstream of prs, and a gene homologous to ctc downstream of prs. cDNA synthesis with a B. caldolyticus gcaD-prs-ctc-specified mRNA as template, followed by amplification utilising the polymerase chain reaction indicated that the three genes are co......-transcribed. Comparison of amino acid sequences revealed a high similarity among PRPP synthases across a wide phylogenetic range. An E. coli strain harbouring the B. caldolyticus prs gene in a multicopy plasmid produced PRPP synthase activity 33-fold over the activity of a haploid B. caldolyticus strain. B. caldolyticus...
Beta-Glucan Synthase Gene Expression in Pleurotus sp
International Nuclear Information System (INIS)
Azhar Mohamad; Nie, H.J.
2016-01-01
Pleurotus sp. is a popular edible mushroom, containing various functional component, in particular, Beta-glucan. Beta-glucans is a part of glucan family of polysaccharides and supposedly contribute to medicinal and nutritional value of Pleurotus.sp. In order to understand the distribution of Beta-glucan in Pleurotus.sp, the Beta-glucan synthase gene expression was determined and compared in different part of Pleurotus, namely mycelium, stripe and cap. The Pleurotus.sp RNA was extracted using commercial kit, employing Tissuelyser ll (Qiagen, USA) to disrupt the cell walls. Then the RNA was quantified by Nano drop (Thermo Fisher, USA) and visualized using denaturing agarose gel. RNA with good OD 260.280 reading (∼2.0) was chosen and converted to cDNA. Using Laccase synthase gene as home keeping gene, Beta-glucan synthase gene expression was quantified using CFX 96 Real Time PCR detection system (Biorad, USA). Preliminary result shows that Beta-glucan synthase was relatively expressed the most in stripe, followed by mycelium and barely in cap. (author)
RNA Pseudouridylation in Physiology and Medicine: For Better and for Worse
Directory of Open Access Journals (Sweden)
Marianna Penzo
2017-11-01
Full Text Available Pseudouridine is the most abundant modification found in RNA. Today, thanks to next-generation sequencing techniques used in the detection of RNA modifications, pseudouridylation sites have been described in most eukaryotic RNA classes. In the present review, we will first consider the available information on the functional roles of pseudouridine(s in different RNA species. We will then focus on how alterations in the pseudouridylation process may be connected with a series of human pathologies, including inherited disorders, cancer, diabetes, and viral infections. Finally, we will discuss how the availability of novel technical approaches are likely to increase the knowledge in this field.
Sequence analysis of cereal sucrose synthase genes and isolation ...
African Journals Online (AJOL)
SERVER
2007-10-18
Oct 18, 2007 ... sequencing of sucrose synthase gene fragment from sor- ghum using primers designed at their conserved exons. MATERIALS AND METHODS. Multiple sequence alignment. Sucrose synthase gene sequences of various cereals like rice, maize, and barley were accessed from NCBI Genbank database.
Directory of Open Access Journals (Sweden)
Resnanti Utami Handayani
2014-07-01
Full Text Available Ethylene has an important function in plant growth and development. Ethylene production generally increases in response to pathogen attacks and other environmental stress conditions. The synthesis of this phytohormone is regulated by two enzymes, ACC synthase (ACS and ACC oxidase (ACO. ACC synthase is encoded by a multigene that regulates the production of ACC, after which this precursor is converted into ethylene by ACO. Pisang Ambon (Musa sp. AAA group, a banana cultivar originating from Indonesia, has nine ACS genes (MaACS 1-9 and one ACO gene (MaACO. One of the banana ACS genes, MaACS2, is stress-inducible. In this research, we have investigated the expression profile of MaACS2 in the roots and leaf tissues of infected tissue culture plants. Quantification of gene expression was analyzed using Real-Time PCR (qPCR using Ma18srRNA and MaGAPDH as reference genes. The results showed nine-to ten fold higher MaACS2 expression levels in the infected roots tissues compared to the uninfected roots tissues. However, MaACS2 expression in the leaves was only detected in infected tissue.
Localization of nitric oxide synthase in human skeletal muscle
DEFF Research Database (Denmark)
Frandsen, Ulrik; Lopez-Figueroa, M.; Hellsten, Ylva
1996-01-01
The present study investigated the cellular localization of the neuronal type I and endothelial type III nitric oxide synthase in human skeletal muscle. Type I NO synthase immunoreactivity was found in the sarcolemma and the cytoplasm of all muscle fibres. Stronger immunoreactivity was expressed...
Sucrose Phosphate Synthase and Sucrose Accumulation at Low Temperature 1
Guy, Charles L.; Huber, Joan L. A.; Huber, Steven C.
1992-01-01
The influence of growth temperature on the free sugar and sucrose phosphate synthase content and activity of spinach (Spinacia oleracea) leaf tissue was studied. When plants were grown at 25°C for 3 weeks and then transferred to a constant 5°C, sucrose, glucose, and fructose accumulated to high levels during a 14-d period. Predawn sugar levels increased from 14- to 20-fold over the levels present at the outset of the low-temperature treatment. Sucrose was the most abundant free sugar before, during, and after exposure to 5°C. Leaf sucrose phosphate synthase activity was significantly increased by the low-temperature treatment, whereas sucrose synthase and invertases were not. Synthesis of the sucrose phosphate synthase subunit was increased during and after low-temperature exposure and paralleled an increase in the steady-state level of the subunit. The increases in sucrose and its primary biosynthetic enzyme, sucrose phosphate synthase, are discussed in relation to adjustment of metabolism to low nonfreezing temperature and freezing stress tolerance. Images Figure 1 Figure 2 Figure 3 PMID:16652990
Pydiura, N A; Bayer, G Ya; Galinousky, D V; Yemets, A I; Pirko, Ya V; Podvitski, T A; Anisimova, N V; Khotyleva, L V; Kilchevsky, A V; Blume, Ya B
2015-01-01
A bioinformatic search of sequences encoding cellulose synthase genes in the flax genome, and their comparison to dicots orthologs was carried out. The analysis revealed 32 cellulose synthase gene candidates, 16 of which are highly likely to encode cellulose synthases, and the remaining 16--cellulose synthase-like proteins (Csl). Phylogenetic analysis of gene products of cellulose synthase genes allowed distinguishing 6 groups of cellulose synthase genes of different classes: CesA1/10, CesA3, CesA4, CesA5/6/2/9, CesA7 and CesA8. Paralogous sequences within classes CesA1/10 and CesA5/6/2/9 which are associated with the primary cell wall formation are characterized by a greater similarity within these classes than orthologous sequences. Whereas the genes controlling the biosynthesis of secondary cell wall cellulose form distinct clades: CesA4, CesA7, and CesA8. The analysis of 16 identified flax cellulose synthase gene candidates shows the presence of at least 12 different cellulose synthase gene variants in flax genome which are represented in all six clades of cellulose synthase genes. Thus, at this point genes of all ten known cellulose synthase classes are identify in flax genome, but their correct classification requires additional research.
Effects and mechanism of acid rain on plant chloroplast ATP synthase.
Sun, Jingwen; Hu, Huiqing; Li, Yueli; Wang, Lihong; Zhou, Qing; Huang, Xiaohua
2016-09-01
Acid rain can directly or indirectly affect plant physiological functions, especially photosynthesis. The enzyme ATP synthase is the key in photosynthetic energy conversion, and thus, it affects plant photosynthesis. To clarify the mechanism by which acid rain affects photosynthesis, we studied the effects of acid rain on plant growth, photosynthesis, chloroplast ATP synthase activity and gene expression, chloroplast ultrastructure, intracellular H(+) level, and water content of rice seedlings. Acid rain at pH 4.5 remained the chloroplast structure unchanged but increased the expression of six chloroplast ATP synthase subunits, promoted chloroplast ATP synthase activity, and increased photosynthesis and plant growth. Acid rain at pH 4.0 or less decreased leaf water content, destroyed chloroplast structure, inhibited the expression of six chloroplast ATP synthase subunits, decreased chloroplast ATP synthase activity, and reduced photosynthesis and plant growth. In conclusion, acid rain affected the chloroplast ultrastructure, chloroplast ATPase transcription and activity, and P n by changing the acidity in the cells, and thus influencing the plant growth and development. Finally, the effects of simulated acid rain on the test indices were found to be dose-dependent.
HR Division
2001-01-01
As part of the process of streamlining procedures, the HR and AS Divisions have jointly developed a system whereby annual and compensatory leave will henceforth be automatically transferred1) to saved leave accounts. Under the provisions of the voluntary saved leave scheme (SLS), a maximum total of 10 days'2)Previously, every person taking part in the scheme has been individually issued with a form for the purposes of requesting the transfer of leave to the leave account and the transfer has then had to be done manually by HR Division. To streamline the procedure, unused leave of all those taking part in the saved leave scheme at the closure of the leave-year accounts will henceforth be transferred automatically to the saved leave account on that date. This simplification is in the interest of all parties concerned. This automatic transfer procedure has a number of advantages for participants in the SLS scheme. First, staff members will no longer have to take any administrative steps. Secondly, the new proced...
The Eucalyptus terpene synthase gene family.
Külheim, Carsten; Padovan, Amanda; Hefer, Charles; Krause, Sandra T; Köllner, Tobias G; Myburg, Alexander A; Degenhardt, Jörg; Foley, William J
2015-06-11
Terpenoids are abundant in the foliage of Eucalyptus, providing the characteristic smell as well as being valuable economically and influencing ecological interactions. Quantitative and qualitative inter- and intra- specific variation of terpenes is common in eucalypts. The genome sequences of Eucalyptus grandis and E. globulus were mined for terpene synthase genes (TPS) and compared to other plant species. We investigated the relative expression of TPS in seven plant tissues and functionally characterized five TPS genes from E. grandis. Compared to other sequenced plant genomes, Eucalyptus grandis has the largest number of putative functional TPS genes of any sequenced plant. We discovered 113 and 106 putative functional TPS genes in E. grandis and E. globulus, respectively. All but one TPS from E. grandis were expressed in at least one of seven plant tissues examined. Genomic clusters of up to 20 genes were identified. Many TPS are expressed in tissues other than leaves which invites a re-evaluation of the function of terpenes in Eucalyptus. Our data indicate that terpenes in Eucalyptus may play a wider role in biotic and abiotic interactions than previously thought. Tissue specific expression is common and the possibility of stress induction needs further investigation. Phylogenetic comparison of the two investigated Eucalyptus species gives insight about recent evolution of different clades within the TPS gene family. While the majority of TPS genes occur in orthologous pairs some clades show evidence of recent gene duplication, as well as loss of function.
Parental leave: the impact of recent legislation on parents' leave taking.
Han, Wen-Jui; Waldfogel, Jane
2003-02-01
We use data from the Survey of Income and Program Participation to examine the impact of leave entitlements on unpaid leave usage by men and women after the birth of a child from 1991 to 1999. The results indicate that legislation providing the right to unpaid leave has not affected men's leave usage. The results for women are mixed: in some specifications, leave entitlements are associated with increased leave taking or longer leaves, but the results depend on how we define leave coverage. Our results point to the limited impact of unpaid leave policies and the potential importance of paid-leave policies.
Directory of Open Access Journals (Sweden)
Zexiong Chen
2018-03-01
Full Text Available Lonicera macranthoides is an important medicinal plant widely used in traditional Chinese medicine. Luteoloside is a critical bioactive compound in L. macranthoides. To date, the molecular mechanisms underlying luteoloside biosynthesis are still largely unknown. In this work, high performance liquid chromatography (HPLC was employed to determine the luteoloside contents in leaves, stems, and flowers at different developmental stages. Results showed that senescing leaves can accumulate large amounts of luteoloside, extremely higher than that in young and semi-lignified leaves and other tissues. RNA-Seq analysis identified that twenty-four differentially expressed unigenes (DEGs associated with luteoloside biosynthesis were significantly up-regulated in senescing leaves, which are positively correlated with luteoloside accumulation. These DEGs include phenylalanine ammonia lyase 2, cinnamate 4-hydroxylase 2, thirteen 4-coumarate-CoA ligases, chalcone synthase 2, six flavonoid 3′-monooxygenase (F3′H and two flavone 7-O-β-glucosyltransferase (UFGT genes. Further analysis demonstrated that two F3′Hs (CL11828.Contig1 and CL11828.Contig2 and two UFGTs (Unigene2918 and Unigene97915 might play vital roles in luteoloside generation. Furthermore, several transcription factors (TFs related to flavonoid biosynthesis including MYB, bHLH and WD40, were differentially expressed during leaf senescence. Among these TFs, MYB12, MYB75, bHLH113 and TTG1 were considered to be key factors involved in the regulation of luteoloside biosynthesis. These findings provide insights for elucidating the molecular signatures of luteoloside accumulation in L. macranthoides.
Inhibitors of Fatty Acid Synthase for Prostate Cancer
2012-05-01
compounds. For example, numerous classes of acetyl- cholinesterase inhibitors have been developed, m any with fe mtomolar binding affinities (7). This...AD_________________ Award Number: W81XWH-09-1-0204 TITLE: Inhibitors of Fatty Acid Synthase for...CONTRACT NUMBER Inhibitors of Fatty Acid Synthase for Prostate Cancer 5b. GRANT NUMBER W81XWH-09-1-0204 5c. PROGRAM ELEMENT NUMBER 6. AUTHOR
Shaw, Jeffrey J.; Berbasova, Tetyana; Sasaki, Tomoaki; Jefferson-George, Kyra; Spakowicz, Daniel J.; Dunican, Brian F.; Portero, Carolina E.; Narváez-Trujillo, Alexandra; Strobel, Scott A.
2015-01-01
Terpenes are an important and diverse class of secondary metabolites widely produced by fungi. Volatile compound screening of a fungal endophyte collection revealed a number of isolates in the family Xylariaceae, producing a series of terpene molecules, including 1,8-cineole. This compound is a commercially important component of eucalyptus oil used in pharmaceutical applications and has been explored as a potential biofuel additive. The genes that produce terpene molecules, such as 1,8-cineole, have been little explored in fungi, providing an opportunity to explore the biosynthetic origin of these compounds. Through genome sequencing of cineole-producing isolate E7406B, we were able to identify 11 new terpene synthase genes. Expressing a subset of these genes in Escherichia coli allowed identification of the hyp3 gene, responsible for 1,8-cineole biosynthesis, the first monoterpene synthase discovered in fungi. In a striking example of convergent evolution, mutational analysis of this terpene synthase revealed an active site asparagine critical for water capture and specificity during cineole synthesis, the same mechanism used in an unrelated plant homologue. These studies have provided insight into the evolutionary relationship of fungal terpene synthases to those in plants and bacteria and further established fungi as a relatively untapped source of this important and diverse class of compounds. PMID:25648891
Virtual Screening of Novel Glucosamine-6-Phosphate Synthase Inhibitors.
Lather, Amit; Sharma, Sunil; Khatkar, Anurag
2018-01-01
Infections caused by microorganisms are the major cause of death today. The tremendous and improper use of antimicrobial agents leads to antimicrobial resistance. Various currently available antimicrobial drugs are inadequate to control the infections and lead to various adverse drug reactions. Efforts based on computer-aided drug design (CADD) can excavate a large number of databases to generate new, potent hits and minimize the requirement of time as well as money for the discovery of newer antimicrobials. Pharmaceutical sciences also have made development with advances in drug designing concepts. The current research article focuses on the study of various G-6-P synthase inhibitors from literature cited molecular database. Docking analysis was conducted and ADMET data of various molecules was evaluated by Schrodinger Glide and PreADMET software, respectively. Here, the results presented efficacy of various inhibitors towards enzyme G-6-P synthase. Docking scores, binding energy and ADMET data of various molecules showed good inhibitory potential toward G-6-P synthase as compared to standard antibiotics. This novel antimicrobial drug target G-6-P synthase has not so extensively been explored for its application in antimicrobial therapy, so the work done so far proved highly essential. This article has helped the drug researchers and scientists to intensively explore about this wonderful antimicrobial drug target. The Schrodinger, Inc. (New York, USA) software was utilized to carry out the computational calculations and docking studies. The hardware configuration was Intel® core (TM) i5-4210U CPU @ 2.40GHz, RAM memory 4.0 GB under 64-bit window operating system. The ADMET data was calculated by using the PreADMET tool (PreADMET ver. 2.0). All the computational work was completed in the Laboratory for Enzyme Inhibition Studies, Department of Pharmaceutical Sciences, M.D. University, Rohtak, INDIA. Molecular docking studies were carried out to identify the binding
Class II recombinant phosphoribosyl diphosphate synthase from spinach
DEFF Research Database (Denmark)
Krath, B N; Hove-Jensen, B
2001-01-01
to other PRPP synthases the activity of spinach PRPP synthase isozyme 3 is independent of P(i), and the enzyme is inhibited by ribonucleoside diphosphates in a purely competitive manner, which indicates a lack of allosteric inhibition by these compounds. In addition spinach PRPP synthase isozyme 3 shows...... an unusual low specificity toward diphosphoryl donors by accepting dATP, GTP, CTP, and UTP in addition to ATP. The kinetic mechanism of the enzyme is an ordered steady state Bi Bi mechanism with K(ATP) and K(Rib-5-P) values of 170 and 110 micrometer, respectively, and a V(max) value of 13.1 micromol (min x...... mg of protein)(-1). The enzyme has an absolute requirement for magnesium ions, and maximal activity is obtained at 40 degrees C at pH 7.6....
Tian, Ji; Han, Zhen-yun; Zhang, Jie; Hu, YuJing; Song, Tingting; Yao, Yuncong
2015-07-20
Red leaf color is an attractive trait of Malus families, including crabapple (Malus spp.); however, little is known about the molecular mechanisms that regulate the coloration. Dihydroflavonols are intermediates in the production of both colored anthocyanins and colorless flavonols, and this current study focused on the gene expression balance involved in the relative accumulation of these compounds in crabapple leaves. Levels of anthocyanins and the transcript abundances of the anthocyanin biosynthetic gene, dihydroflavonol 4-reductase (McDFR) and the flavonol biosynthetic gene, flavonol synthase (McFLS), were assessed during the leaf development in two crabapple cultivars, 'Royalty' and 'Flame'. The concentrations of anthocyanins and flavonols correlated with leaf color and we propose that the expression of McDFR and McFLS influences their accumulation. Further studies showed that overexpression of McDFR, or silencing of McFLS, increased anthocyanin production, resulting in red-leaf and red fruit peel phenotypes. Conversely, elevated flavonol production and green phenotypes in crabapple leaves and apple peel were observed when McFLS was overexpressed or McDFR was silenced. These results suggest that the relative activities of McDFR and McFLS are important determinants of the red color of crabapple leaves, via the regulation of the metabolic fate of substrates that these enzymes have in common.
Directory of Open Access Journals (Sweden)
Meng eWang
2013-05-01
Full Text Available Nearly one-third of the world population, mostly women and children, suffer from iron malnutrition and its consequences, such as anemia or impaired mental development. Biofortification of rice, which is a staple crop for nearly half of the world’s population, can significantly contribute in alleviating iron deficiency. NFP rice (transgenic rice expressing nicotianamine synthase, ferritin and phytase genes has a more than six-fold increase in iron content in polished rice grains, resulting from the synergistic action of nicotianamine synthase (NAS and ferritin transgenes. We investigated iron homeostasis in NFP plants by analyzing the expression of 28 endogenous rice genes known to be involved in the homeostasis of iron and other metals, in iron-deficient and iron-sufficient conditions. RNA was collected from different tissues (roots, flag leaves, grains and at three developmental stages during grain filling. NFP plants showed increased sensitivity to iron-deficiency conditions and changes in the expression of endogenous genes involved in nicotianamine (NA metabolism, in comparison to their non-transgenic siblings. Elevated transcript levels were detected in NFP plants for several iron transporters. In contrast, expression of OsYSL2, which encodes a member of Yellow Stripe-like protein family, and a transporter of the NA-Fe(II complex was reduced in NFP plants under low iron conditions, indicating that expression of OsYSL2 is regulated by the endogenous iron status. Expression of the transgenes did not significantly affect overall iron homeostasis in NFP plants, which establishes the engineered push-pull mechanism as a suitable strategy to increase rice endosperm iron content.
Characterization of the human gene (TBXAS1) encoding thromboxane synthase.
Miyata, A; Yokoyama, C; Ihara, H; Bandoh, S; Takeda, O; Takahashi, E; Tanabe, T
1994-09-01
The gene encoding human thromboxane synthase (TBXAS1) was isolated from a human EMBL3 genomic library using human platelet thromboxane synthase cDNA as a probe. Nucleotide sequencing revealed that the human thromboxane synthase gene spans more than 75 kb and consists of 13 exons and 12 introns, of which the splice donor and acceptor sites conform to the GT/AG rule. The exon-intron boundaries of the thromboxane synthase gene were similar to those of the human cytochrome P450 nifedipine oxidase gene (CYP3A4) except for introns 9 and 10, although the primary sequences of these enzymes exhibited 35.8% identity each other. The 1.2-kb of the 5'-flanking region sequence contained potential binding sites for several transcription factors (AP-1, AP-2, GATA-1, CCAAT box, xenobiotic-response element, PEA-3, LF-A1, myb, basic transcription element and cAMP-response element). Primer-extension analysis indicated the multiple transcription-start sites, and the major start site was identified as an adenine residue located 142 bases upstream of the translation-initiation site. However, neither a typical TATA box nor a typical CAAT box is found within the 100-b upstream of the translation-initiation site. Southern-blot analysis revealed the presence of one copy of the thromboxane synthase gene per haploid genome. Furthermore, a fluorescence in situ hybridization study revealed that the human gene for thromboxane synthase is localized to band q33-q34 of the long arm of chromosome 7. A tissue-distribution study demonstrated that thromboxane synthase mRNA is widely expressed in human tissues and is particularly abundant in peripheral blood leukocyte, spleen, lung and liver. The low but significant levels of mRNA were observed in kidney, placenta and thymus.
Dare, Andrew P; Tomes, Sumathi; Jones, Midori; McGhie, Tony K; Stevenson, David E; Johnson, Ross A; Greenwood, David R; Hellens, Roger P
2013-05-01
We have identified in apple (Malus × domestica) three chalcone synthase (CHS) genes. In order to understand the functional redundancy of this gene family RNA interference knockout lines were generated where all three of these genes were down-regulated. These lines had no detectable anthocyanins and radically reduced concentrations of dihydrochalcones and flavonoids. Surprisingly, down-regulation of CHS also led to major changes in plant development, resulting in plants with shortened internode lengths, smaller leaves and a greatly reduced growth rate. Microscopic analysis revealed that these phenotypic changes extended down to the cellular level, with CHS-silenced lines showing aberrant cellular organisation in the leaves. Fruit collected from one CHS-silenced line was smaller than the 'Royal Gala' controls, lacked flavonoids in the skin and flesh and also had changes in cell morphology. Auxin transport experiments showed increased rates of auxin transport in a CHS-silenced line compared with the 'Royal Gala' control. As flavonoids are well known to be key modulators of auxin transport, we hypothesise that the removal of almost all flavonoids from the plant by CHS silencing creates a vastly altered environment for auxin transport to occur and results in the observed changes in growth and development. © 2013 The Authors The Plant Journal © 2013 Blackwell Publishing Ltd.
29 CFR 825.202 - Intermittent leave or reduced leave schedule.
2010-07-01
... leave schedule is a leave schedule that reduces an employee's usual number of working hours per workweek, or hours per workday. A reduced leave schedule is a change in the employee's schedule for a period of... 29 Labor 3 2010-07-01 2010-07-01 false Intermittent leave or reduced leave schedule. 825.202...
Chakraborty, Jayashree B; Mahato, Sanjit K; Joshi, Kalpana; Shinde, Vaibhav; Rakshit, Srabanti; Biswas, Nabendu; Choudhury Mukherjee, Indrani; Mandal, Labanya; Ganguly, Dipyaman; Chowdhury, Avik A; Chaudhuri, Jaydeep; Paul, Kausik; Pal, Bikas C; Vinayagam, Jayaraman; Pal, Churala; Manna, Anirban; Jaisankar, Parasuraman; Chaudhuri, Utpal; Konar, Aditya; Roy, Siddhartha; Bandyopadhyay, Santu
2012-01-01
Alcoholic extract of Piper betle (Piper betle L.) leaves was recently found to induce apoptosis of CML cells expressing wild type and mutated Bcr-Abl with imatinib resistance phenotype. Hydroxy-chavicol (HCH), a constituent of the alcoholic extract of Piper betle leaves, was evaluated for anti-CML activity. Here, we report that HCH and its analogues induce killing of primary cells in CML patients and leukemic cell lines expressing wild type and mutated Bcr-Abl, including the T315I mutation, with minimal toxicity to normal human peripheral blood mononuclear cells. HCH causes early but transient increase of mitochondria-derived reactive oxygen species. Reactive oxygen species-dependent persistent activation of JNK leads to an increase in endothelial nitric oxide synthase-mediated nitric oxide generation. This causes loss of mitochondrial membrane potential, release of cytochrome c from mitochondria, cleavage of caspase 9, 3 and poly-adenosine diphosphate-ribose polymerase leading to apoptosis. One HCH analogue was also effective in vivo in SCID mice against grafts expressing the T315I mutation, although to a lesser extent than grafts expressing wild type Bcr-Abl, without showing significant bodyweight loss. Our data describe the role of JNK-dependent endothelial nitric oxide synthase-mediated nitric oxide for anti-CML activity of HCH and this molecule merits further testing in pre-clinical and clinical settings. © 2011 Japanese Cancer Association.
Geranylfarnesyl diphosphate synthase from Methanosarcina mazei: Different role, different evolution
International Nuclear Information System (INIS)
Ogawa, Takuya; Yoshimura, Tohru; Hemmi, Hisashi
2010-01-01
The gene of (all-E) geranylfarnesyl diphosphate synthase that is responsible for the biosynthesis of methanophenazine, an electron carrier utilized for methanogenesis, was cloned from a methanogenic archaeon Methanosarcina mazei Goe1. The properties of the recombinant enzyme and the results of phylogenetic analysis suggest that the enzyme is closely related to (all-E) prenyl diphosphate synthases that are responsible for the biosynthesis of respiratory quinones, rather than to the enzymes involved in the biosynthesis of archaeal membrane lipids, including (all-E) geranylfarnesyl diphosphate synthase from a thermophilic archaeon.
Directory of Open Access Journals (Sweden)
Leila Shabani
2015-03-01
Full Text Available Spearmint (Mentha spicata L. is an important economical and medicinal plant from Lamiaceae family, which has gained research attraction as a model for biosynthesis of essential oils due to its high capability for synthesis of monoterpenes. Limonene is a simple monoterpene and its biosynthesis is catalyzed by limonene synthase a key regulatory enzyme in the biosynthesis pathway of monoterpenes in spearmint plant. This study was concerned with the effect of colonization of roots with Funneliformis mosseae and F. etunicatum fungi on spearmint plant growth indices, leaf essential oils and changes in the expression of limonene synthase (LS gene. This study also explained the application of GADPH gene as the internal standard for real-time quantitative PCR (RTqPCR analysis of LS in spearmints. Our results showed that essential oil content of leaf in spearmint genotype Meybod inoculated with F. etunicatum was higher than that of genotypes from populations Kashan and Bojnourd and was 130% higher than the control. According to the results of this study, increase in transcript accumulation of the LS gene in leaves of spearmint plants inoculated with F. etunicatum was concordant with the increased essential oil contents and was dependent on the plant genotype.
DEFF Research Database (Denmark)
Yang, Ting; Gao, Liping; Hu, Hao
2014-01-01
Chrysanthemyl diphosphate synthase (CDS) is the first path-way-specific enzyme in the biosynthesis of pyrethrins, the most widely used plant-derived pesticide. CDS catalyzes c1′-2-3 cyclopropanation reactions of two molecules of dimethylallyl diphosphate (DMAPP) to yield chrysanthemyl diphosphate...
Alliinase and cysteine synthase transcription in developing garlic (Allium sativum L.) over time.
Mitrová, Katarina; Svoboda, Pavel; Milella, Luigi; Ovesná, Jaroslava
2018-06-15
Garlic is a valuable source of healthy compounds, including secondary metabolites rich in sulphur such as cysteine sulphoxides (CSOs). Here, we present new qRT-PCR assays analysing the transcription of two genes encoding key enzymes in CSO biosynthetic pathways (cysteine synthase and alliinase) in developing garlic. We also identified a set of genes (ACT I, GAPDH, and TUB) to use as transcription normalisation controls. We showed that the (normalised) transcription of both enzymes was highest during sprouting and decreased significantly in fully developed leaves, which are the major CSO-producing organs. Transcriptional activity further declined at the end of the growing season. Different cultivars show similar sulphur metabolism gene expression when European garlics were compared to Chinese and American genotypes. The qRT-PCR assays presented are also suitable for investigating the effects of agricultural practices on CSO formation in garlic to satisfy consumer demands. Copyright © 2017. Published by Elsevier Ltd.
Hybrid Sequencing of Full-Length cDNA Transcripts of Stems and Leaves in Dendrobium officinale
Directory of Open Access Journals (Sweden)
Liu He
2017-10-01
Full Text Available Dendrobium officinale is an extremely valuable orchid used in traditional Chinese medicine, so sought after that it has a higher market value than gold. Although the expression profiles of some genes involved in the polysaccharide synthesis have previously been investigated, little research has been carried out on their alternatively spliced isoforms in D. officinale. In addition, information regarding the translocation of sugars from leaves to stems in D. officinale also remains limited. We analyzed the polysaccharide content of D. officinale leaves and stems, and completed in-depth transcriptome sequencing of these two diverse tissue types using second-generation sequencing (SGS and single-molecule real-time (SMRT sequencing technology. The results of this study yielded a digital inventory of gene and mRNA isoform expressions. A comparative analysis of both transcriptomes uncovered a total of 1414 differentially expressed genes, including 844 that were up-regulated and 570 that were down-regulated in stems. Of these genes, one sugars will eventually be exported transporter (SWEET and one sucrose transporter (SUT are expressed to a greater extent in D. officinale stems than in leaves. Two glycosyltransferase (GT and four cellulose synthase (Ces genes undergo a distinct degree of alternative splicing. In the stems, the content of polysaccharides is twice as much as that in the leaves. The differentially expressed GT and transcription factor (TF genes will be the focus of further study. The genes DoSWEET4 and DoSUT1 are significantly expressed in the stem, and are likely to be involved in sugar loading in the phloem.
Energy Technology Data Exchange (ETDEWEB)
Fortman, Jeffrey L.; Hagen, Andrew; Katz, Leonard; Keasling, Jay D.; Poust, Sean; Zhang, Jingwei; Zotchev, Sergey
2016-05-10
The present invention provides for a polyketide synthase (PKS) capable of synthesizing an even-chain or odd-chain diacid or lactam or diamine. The present invention also provides for a host cell comprising the PKS and when cultured produces the even-chain diacid, odd-chain diacid, or KAPA. The present invention also provides for a host cell comprising the PKS capable of synthesizing a pimelic acid or KAPA, and when cultured produces biotin.
Inhibitors of Fatty Acid Synthase for Prostate Cancer. Revision
2013-05-01
acetyl- cholinesterase inhibitors have been developed, many with femtomolar binding affinities (7). This body of literature also confirms that the...AD_________________ Award Number: W81XWH-09-1-0204 TITLE: Inhibitors of Fatty Acid Synthase for...May 2013 2. REPORT TYPE Revised Final 3. DATES COVERED 01 May 2009-30 Apr 2013 4. TITLE AND SUBTITLE Inhibitors of Fatty Acid Synthase for
Prostaglandin H synthase immunoreactivity in human gut. An immunohistochemical study
DEFF Research Database (Denmark)
Mikkelsen, H B; Rumessen, J J; Qvortrup, Klaus
1991-01-01
Prostaglandins exhibit a variety of actions on intestinal smooth muscle depending upon the type, dose and muscle layer studied. As the cellular origin of prostaglandin H (PGH) synthase has not been established with certainty in the human gut wall, we studied the localization of PGH synthase...
Human Resources Department
2005-01-01
Members of the personnel entitled to annual leave and, where appropriate, saved leave and/or compensatory leave are requested to take note of the new arrangements described below, which were recommended by the Standing Concertation Committee (SCC) at its meeting on 1Â September 2005 and subsequently approved by the Director-General. The changes do not apply to members of the personnel participating in the Progressive Retirement Programme (PRP) or the Part-time Work as a pre-retirement measure, for whom the specific provisions communicated at the time of joining will continue to apply. Â Negative balances in annual leave, saved leave and/or compensatory leave accounts at the end of the leave year (30th September) and on the date on which bonuses are credited to the saved leave account (31st December): Where members of the personnel have a leave account with a negative balance on 30Â September and/or 31Â December, leave will automatically be transferred from one account to another on the relevant dates i...
Human Resources Department
2005-01-01
Members of the personnel entitled to annual leave and, where appropriate, saved leave and/or compensatory leave are requested to take note of the new arrangements described below, which were recommended by the Standing Concertation Committee (SCC) at its meeting on 1 September 2005 and subsequently approved by the Director-General. The changes do not apply to members of the personnel participating in the Progressive Retirement Programme (PRP) or the Part-time Work as a pre-retirement measure, for whom the specific provisions communicated at the time of joining will continue to apply. Negative balances in annual leave, saved leave and/or compensatory leave accounts at the end of the leave year (30th September) and on the date on which bonuses are credited to the saved leave account (31st December): Where members of the personnel have a leave account with a negative balance on 30 September and/or 31 December, leave will automatically be transferred from one account to another on the relevant dates in or...
Zhou, Ying; Zeng, Lanting; Liu, Xiaoyu; Gui, Jiadong; Mei, Xin; Fu, Xiumin; Dong, Fang; Tang, Jingchi; Zhang, Lingyun; Yang, Ziyin
2017-09-15
(E)-Nerolidol is a volatile sesquiterpene that contributes to the floral aroma of teas (Camellia sinensis). The unique manufacturing process for oolong tea involves multiple stresses, resulting in a high content of (E)-nerolidol, which is not known to form in tea leaves. This study aimed to determine the formation mechanism of (E)-nerolidol in tea exposed to multiple stresses during tea manufacture. C. sinensis (E)-nerolidol synthase (CsNES) recombinant protein, found in the cytosol, was found to transform farnesyl diphosphate into (E)-nerolidol. CsNES was highly expressed during the oolong tea turn over process, resulting in (E)-nerolidol accumulation. Continuous mechanical damage, simulating the turn over process, significantly enhanced CsNES expression level and (E)-nerolidol content. The combination of low temperature stress and mechanical damage had a synergistic effect on (E)-nerolidol formation. This is the first evidence of (E)-nerolidol formation mechanism in tea leaves and a characteristic example of plant volatile formation in response to dual stresses. Copyright © 2017 Elsevier Ltd. All rights reserved.
DEFF Research Database (Denmark)
Christensen, Caspar Elo; Kragelund, Birthe B; von Wettstein-Knowles, Penny
2007-01-01
Two distinct ways of organizing fatty acid biosynthesis exist: the multifunctional type I fatty acid synthase (FAS) of mammals, fungi, and lower eukaryotes with activities residing on one or two polypeptides; and the dissociated type II FAS of prokaryotes, plastids, and mitochondria with individual...... activities encoded by discrete genes. The beta-ketoacyl [ACP] synthase (KAS) moiety of the mitochondrial FAS (mtKAS) is targeted by the antibiotic cerulenin and possibly by the other antibiotics inhibiting prokaryotic KASes: thiolactomycin, platensimycin, and the alpha-methylene butyrolactone, C75. The high...... degree of structural similarity between mitochondrial and prokaryotic KASes complicates development of novel antibiotics targeting prokaryotic KAS without affecting KAS domains of cytoplasmic FAS. KASes catalyze the C(2) fatty acid elongation reaction using either a Cys-His-His or Cys-His-Asn catalytic...
International Nuclear Information System (INIS)
Wu, K.K.; Sanduja, R.; Tsai, A.L.; Ferhanoglu, B.; Loose-Mitchell, D.S.
1991-01-01
Prostaglandin H (PGH) synthase is a key enzyme in the biosynthesis of prostaglandins, thromboxane, and prostacyclin. In cultured human umbilical vein endothelial cells, interleukin 1 (IL-1) is known to induce the synthesis of this enzyme, thereby raising the level of PGH synthase protein severalfold over the basal level. Pretreatment with aspirin at low concentrations inhibited more than 60% of the enzyme mass and also the cyclooxygenase activity in IL-1-induced cells with only minimal effects on the basal level of the synthase enzyme in cells without IL-1. Sodium salicylate exhibited a similar inhibitory action whereas indomethacin had no apparent effect. Similarly low levels of aspirin inhibited the increased L-[ 35 S]methionine incorporation into PGH synthase that was induced by IL0-1 and also suppressed expression of the 2.7-kilobase PGH synthase mRNA. These results suggest that in cultured endothelial cells a potent inhibition of eicosanoid biosynthetic capacity can be effected by aspirin or salicylate at the level of PGH synthase gene expression. The aspirin effect may well be due to degradation of salicylate
Ober, Dietrich; Hartmann, Thomas
1999-01-01
Pyrrolizidine alkaloids are preformed plant defense compounds with sporadic phylogenetic distribution. They are thought to have evolved in response to the selective pressure of herbivory. The first pathway-specific intermediate of these alkaloids is the rare polyamine homospermidine, which is synthesized by homospermidine synthase (HSS). The HSS gene from Senecio vernalis was cloned and shown to be derived from the deoxyhypusine synthase (DHS) gene, which is highly conserved among all eukaryotes and archaebacteria. DHS catalyzes the first step in the activation of translation initiation factor 5A (eIF5A), which is essential for eukaryotic cell proliferation and which acts as a cofactor of the HIV-1 Rev regulatory protein. Sequence comparison provides direct evidence for the evolutionary recruitment of an essential gene of primary metabolism (DHS) for the origin of the committing step (HSS) in the biosynthesis of pyrrolizidine alkaloids. PMID:10611289
Structure of the dimeric form of CTP synthase from Sulfolobus solfataricus
DEFF Research Database (Denmark)
Lauritsen, Iben; Willemoës, Martin; Jensen, Kaj Frank
2011-01-01
CTP synthase catalyzes the last committed step in de novo pyrimidine-nucleotide biosynthesis. Active CTP synthase is a tetrameric enzyme composed of a dimer of dimers. The tetramer is favoured in the presence of the substrate nucleotides ATP and UTP; when saturated with nucleotide, the tetramer...... completely dominates the oligomeric state of the enzyme. Furthermore, phosphorylation has been shown to regulate the oligomeric states of the enzymes from yeast and human. The crystal structure of a dimeric form of CTP synthase from Sulfolobus solfataricus has been determined at 2.5 Å resolution...
Monoterpene and sesquiterpene synthases and the origin of terpene skeletal diversity in plants.
Degenhardt, Jörg; Köllner, Tobias G; Gershenzon, Jonathan
2009-01-01
The multitude of terpene carbon skeletons in plants is formed by enzymes known as terpene synthases. This review covers the monoterpene and sesquiterpene synthases presenting an up-to-date list of enzymes reported and evidence for their ability to form multiple products. The reaction mechanisms of these enzyme classes are described, and information on how terpene synthase proteins mediate catalysis is summarized. Correlations between specific amino acid motifs and terpene synthase function are described, including an analysis of the relationships between active site sequence and cyclization type and a discussion of whether specific protein features might facilitate multiple product formation.
Jin, Zhehao; Kim, Jin-Hee; Park, Sang Un; Kim, Soo-Un
2016-12-01
Two cDNAs for indole-3-glycerol phosphate lyase homolog were cloned from Polygonum tinctorium. One encoded cytosolic indole synthase possibly in indigoid synthesis, whereas the other encoded a putative tryptophan synthase α-subunit. Indigo is an old natural blue dye produced by plants such as Polygonum tinctorium. Key step in plant indigoid biosynthesis is production of indole by indole-3-glycerol phosphate lyase (IGL). Two tryptophan synthase α-subunit (TSA) homologs, PtIGL-short and -long, were isolated by RACE PCR from P. tinctorium. The genome of the plant contained two genes coding for IGL. The short and the long forms, respectively, encoded 273 and 316 amino acid residue-long proteins. The short form complemented E. coli ΔtnaA ΔtrpA mutant on tryptophan-depleted agar plate signifying production of free indole, and thus was named indole synthase gene (PtINS). The long form, either intact or without the transit peptide sequence, did not complement the mutant and was tentatively named PtTSA. PtTSA was delivered into chloroplast as predicted by 42-residue-long targeting sequence, whereas PtINS was localized in cytosol. Genomic structure analysis suggested that a TSA duplicate acquired splicing sites during the course of evolution toward PtINS so that the targeting sequence-containing pre-mRNA segment was deleted as an intron. PtINS had about two to fivefolds higher transcript level than that of PtTSA, and treatment of 2,1,3-benzothiadiazole caused the relative transcript level of PtINS over PtTSA was significantly enhanced in the plant. The results indicate participation of PtINS in indigoid production.
Rai, Avanish; Smita, Shachi S; Singh, Anup Kumar; Shanker, Karuna; Nagegowda, Dinesh A
2013-09-01
Catharanthus roseus is the sole source of two most important monoterpene indole alkaloid (MIA) anti-cancer agents: vinblastine and vincristine. MIAs possess a terpene and an indole moiety derived from terpenoid and shikimate pathways, respectively. Geranyl diphosphate (GPP), the entry point to the formation of terpene moiety, is a product of the condensation of isopentenyl diphosphate (IPP) and dimethylallyl diphosphate (DMAPP) by GPP synthase (GPPS). Here, we report three genes encoding proteins with sequence similarity to large subunit (CrGPPS.LSU) and small subunit (CrGPPS.SSU) of heteromeric GPPSs, and a homomeric GPPSs. CrGPPS.LSU is a bifunctional enzyme producing both GPP and geranyl geranyl diphosphate (GGPP), CrGPPS.SSU is inactive, whereas CrGPPS is a homomeric enzyme forming GPP. Co-expression of both subunits in Escherichia coli resulted in heteromeric enzyme with enhanced activity producing only GPP. While CrGPPS.LSU and CrGPPS showed higher expression in older and younger leaves, respectively, CrGPPS.SSU showed an increasing trend and decreased gradually. Methyl jasmonate (MeJA) treatment of leaves significantly induced the expression of only CrGPPS.SSU. GFP localization indicated that CrGPPS.SSU is plastidial whereas CrGPPS is mitochondrial. Transient overexpression of AmGPPS.SSU in C. roseus leaves resulted in increased vindoline, immediate monomeric precursor of vinblastine and vincristine. Although C. roseus has both heteromeric and homomeric GPPS enzymes, our results implicate the involvement of only heteromeric GPPS with CrGPPS.SSU regulating the GPP flux for MIA biosynthesis.
Molecular size estimation of plasma membrane β-glucan synthase from red beet root
International Nuclear Information System (INIS)
Sloan, M.E.; Eiberger, L.L.; Wasserman, B.P.
1986-01-01
Cellulose and cell wall β-D-glucans in higher plants are thought to be synthesized by the plasma membrane enzyme, β-glucan synthase. This enzyme has never been purified to homogeneity, hence its subunit composition is unknown. Partial purification of red beet root glucan synthase by glycerol density gradient centrifugation followed by SDS-PAGE yielded a highly enriched subunit of 68 kDa. Radiation inactivation of plasma membranes gave a molecular size the 450 kDa for the holoenzyme complex. This suggests that glucan synthase consists of 6 to 7 subunits and confirms electron microscope studies showing that glucan synthases exist as multi-subunit complexes embedded within the membrane
Directory of Open Access Journals (Sweden)
Huifen Xi
Full Text Available BACKGROUND: Only a small amount of solar ultraviolet C (UV-C radiation reaches the Earth's surface. This is because of the filtering effects of the stratospheric ozone layer. Artificial UV-C irradiation is used on leaves and fruits to stimulate different biological processes in plants. Grapes are a major fruit crop and are grown in many parts of the world. Research has shown that UV-C irradiation induces the biosynthesis of phenols in grape leaves. However, few studies have analyzed the overall changes in gene expression in grape leaves exposed to UV-C. METHODOLOGY/PRINCIPAL FINDINGS: In the present study, transcriptional responses were investigated in grape (Vitis vinifera L. leaves before and after exposure to UV-C irradiation (6 W·m-2 for 10 min using an Affymetrix Vitis vinifera (Grape Genome Array (15,700 transcripts. A total of 5274 differentially expressed probe sets were defined, including 3564 (67.58% probe sets that appeared at both 6 and 12 h after exposure to UV-C irradiation but not before exposure. A total of 468 (8.87% probe sets and 1242 (23.55% probe sets were specifically expressed at these times. The probe sets were associated with a large number of important traits and biological pathways, including cell rescue (i.e., antioxidant enzymes, protein fate (i.e., HSPs, primary and secondary metabolism, and transcription factors. Interestingly, some of the genes involved in secondary metabolism, such as stilbene synthase, responded intensely to irradiation. Some of the MYB and WRKY family transcription factors, such as VvMYBPA1, VvMYB14, VvMYB4, WRKY57-like, and WRKY 65, were also strongly up-regulated (about 100 to 200 fold. CONCLUSIONS: UV-C irridiation has an important role in some biology processes, especially cell rescue, protein fate, secondary metabolism, and regulation of transcription.These results opened up ways of exploring the molecular mechanisms underlying the effects of UV-C irradiation on grape leaves and have
Xi, Huifen; Ma, Ling; Liu, Guotian; Wang, Nian; Wang, Junfang; Wang, Lina; Dai, Zhanwu; Li, Shaohua; Wang, Lijun
2014-01-01
Only a small amount of solar ultraviolet C (UV-C) radiation reaches the Earth's surface. This is because of the filtering effects of the stratospheric ozone layer. Artificial UV-C irradiation is used on leaves and fruits to stimulate different biological processes in plants. Grapes are a major fruit crop and are grown in many parts of the world. Research has shown that UV-C irradiation induces the biosynthesis of phenols in grape leaves. However, few studies have analyzed the overall changes in gene expression in grape leaves exposed to UV-C. In the present study, transcriptional responses were investigated in grape (Vitis vinifera L.) leaves before and after exposure to UV-C irradiation (6 W·m-2 for 10 min) using an Affymetrix Vitis vinifera (Grape) Genome Array (15,700 transcripts). A total of 5274 differentially expressed probe sets were defined, including 3564 (67.58%) probe sets that appeared at both 6 and 12 h after exposure to UV-C irradiation but not before exposure. A total of 468 (8.87%) probe sets and 1242 (23.55%) probe sets were specifically expressed at these times. The probe sets were associated with a large number of important traits and biological pathways, including cell rescue (i.e., antioxidant enzymes), protein fate (i.e., HSPs), primary and secondary metabolism, and transcription factors. Interestingly, some of the genes involved in secondary metabolism, such as stilbene synthase, responded intensely to irradiation. Some of the MYB and WRKY family transcription factors, such as VvMYBPA1, VvMYB14, VvMYB4, WRKY57-like, and WRKY 65, were also strongly up-regulated (about 100 to 200 fold). UV-C irridiation has an important role in some biology processes, especially cell rescue, protein fate, secondary metabolism, and regulation of transcription.These results opened up ways of exploring the molecular mechanisms underlying the effects of UV-C irradiation on grape leaves and have great implications for further studies.
Directory of Open Access Journals (Sweden)
DURDI QUJEQ
1999-10-01
Full Text Available A deficiency of the phenylalanine hydroxylase activity or its cofactor tetrahydrobiopterin may"nlead to hyperphenylalamnemia and as a result, loss of IQ, poor school performance, and"nbehavior problems occurs. Deficiency in 6-pyruvoyl-tetrahydropterin synthase activity is the"nmajor cause of tetrahydrobiopterin deficient phenylketonuria. In this study, blood specimens"nfrom 165 healthy volunteers and 127 children with phenylketonuria were used to determine"nthe 6-pyruvoyl-tetrahydropterin synthase activity. It was found that the activity of 6-"npyruvoyl- tetrahydropterin synthase was decreased in comparison with control [23.46 +/-"n2.94, (mean +/- SD, mmol/ ml/h, n=I27 vs. 127.63 +/- 4.52, n=165, p<0.05]. Results of"nthis study indicate that examination of 6-pyruvoyl-tetrahydropterin synthase activity is helpful"nand may lead to the diagnosis cause of hyperphenylalaninemia.
Impaired glycogen synthase activity and mitochondrial dysfunction in skeletal muscle
DEFF Research Database (Denmark)
Højlund, Kurt; Beck-Nielsen, Henning
2006-01-01
Insulin resistance in skeletal muscle is a major hallmark of type 2 diabetes and an early detectable abnormality in the development of this disease. The cellular mechanisms of insulin resistance include impaired insulin-mediated muscle glycogen synthesis and increased intramyocellular lipid content......, whereas impaired insulin activation of muscle glycogen synthase represents a consistent, molecular defect found in both type 2 diabetic and high-risk individuals. Despite several studies of the insulin signaling pathway believed to mediate dephosphorylation and hence activation of glycogen synthase......, the molecular mechanisms responsible for this defect remain unknown. Recently, the use of phospho-specific antibodies in human diabetic muscle has revealed hyperphosphorylation of glycogen synthase at sites not regulated by the classical insulin signaling pathway. In addition, novel approaches such as gene...
Modulation of hyaluronan synthase activity in cellular membrane fractions
Vigetti, Davide; Genasetti, A; Karousou, Evgenia; Viola, Manuela; Clerici, M; Bartolini, B; Moretto, Paola; DE LUCA, Giancarlo; Hascall, Vc; Passi, Alberto
2009-01-01
Hyaluronan (HA), the only non-sulfated glycosaminoglycan, is involved in morphogenesis, wound healing, inflammation, angiogenesis, and cancer. In mammals, HA is synthesized by three homologous HA synthases, HAS1, HAS2, and HAS3, that polymerize the HA chain using UDP-glucuronic acid and UDP-N-acetylglucosamine as precursors. Since the amount of HA is critical in several pathophysiological conditions, we developed a non-radioactive assay for measuring the activity of HA synthases (HASs) in euk...
Directory of Open Access Journals (Sweden)
Maiko Furubayashi
Full Text Available Terpene synthases catalyze the formation of a variety of terpene chemical structures. Systematic mutagenesis studies have been effective in providing insights into the characteristic and complex mechanisms of C-C bond formations and in exploring the enzymatic potential for inventing new chemical structures. In addition, there is growing demand to increase terpene synthase activity in heterologous hosts, given the maturation of metabolic engineering and host breeding for terpenoid synthesis. We have developed a simple screening method for the cellular activities of terpene synthases by scoring their substrate consumption based on the color loss of the cell harboring carotenoid pathways. We demonstrate that this method can be used to detect activities of various terpene synthase or prenyltransferase genes in a high-throughput manner, irrespective of the product type, enabling the mutation analysis and directed evolution of terpene synthases. We also report the possibility for substrate-specific screening system of terpene synthases by taking advantage of the substrate-size specificity of C30 and C40 carotenoid pathways.
Cloning and sequence analysis of putative type II fatty acid synthase ...
Indian Academy of Sciences (India)
Prakash
Cloning and sequence analysis of putative type II fatty acid synthase genes from Arachis hypogaea L. ... acyl carrier protein (ACP), malonyl-CoA:ACP transacylase, β-ketoacyl-ACP .... Helix II plays a dominant role in the interaction ... main distinguishing features of plant ACPs in plastids and ..... synthase component; J. Biol.
The molecular motor F-ATP synthase is targeted by the tumoricidal protein HAMLET.
Ho, James; Sielaff, Hendrik; Nadeem, Aftab; Svanborg, Catharina; Grüber, Gerhard
2015-05-22
HAMLET (human alpha-lactalbumin made lethal to tumor cells) interacts with multiple tumor cell compartments, affecting cell morphology, metabolism, proteasome function, chromatin structure and viability. This study investigated if these diverse effects of HAMLET might be caused, in part, by a direct effect on the ATP synthase and a resulting reduction in cellular ATP levels. A dose-dependent reduction in cellular ATP levels was detected in A549 lung carcinoma cells, and by confocal microscopy, co-localization of HAMLET with the nucleotide-binding subunits α (non-catalytic) and β (catalytic) of the energy converting F1F0 ATP synthase was detected. As shown by fluorescence correlation spectroscopy, HAMLET binds to the F1 domain of the F1F0 ATP synthase with a dissociation constant (KD) of 20.5μM. Increasing concentrations of the tumoricidal protein HAMLET added to the enzymatically active α3β3γ complex of the F-ATP synthase lowered its ATPase activity, demonstrating that HAMLET binding to the F-ATP synthase effects the catalysis of this molecular motor. Single-molecule analysis was applied to study HAMLET-α3β3γ complex interaction. Whereas the α3β3γ complex of the F-ATP synthase rotated in a counterclockwise direction with a mean rotational rate of 3.8±0.7s(-1), no rotation could be observed in the presence of bound HAMLET. Our findings suggest that direct effects of HAMLET on the F-ATP synthase may inhibit ATP-dependent cellular processes. Copyright © 2015 Elsevier Ltd. All rights reserved.
Analysis of Clonostachys rosea-induced resistance to tomato gray mold disease in tomato leaves.
Directory of Open Access Journals (Sweden)
Liana Dalcantara Ongouya Mouekouba
Full Text Available Tomato gray mold disease, caused by Botrytis cinerea, is a serious disease in tomato. Clonostachys rosea is an antagonistic microorganism to B. cinerea. To investigate the induced resistance mechanism of C. rosea, we examined the effects of these microorganisms on tomato leaves, along with changes in the activities of three defense enzymes (PAL, PPO, GST, second messengers (NO, H2O2, O2(- and phytohormones (IAA, ABA, GA3, ZT, MeJA, SA and C2H4. Compared to the control, all treatments induced higher levels of PAL, PPO and GST activity in tomato leaves and increased NO, SA and GA3 levels. The expression of WRKY and MAPK, two important transcription factors in plant disease resistance, was upregulated in C. rosea- and C. rosea plus B. cinerea-treated samples. Two-dimensional gel electrophoresis analysis showed that two abundant proteins were present in the C. rosea plus B. cinerea-treated samples but not in the other samples. These proteins were determined (by mass spectrum analysis to be LEXYL2 (β-xylosidase and ATP synthase CF1 alpha subunit. Therefore, C. rosea plus B. cinerea treatment induces gray mold resistance in tomato. This study provides a basis for elucidating the mechanism of C. rosea as a biocontrol agent.
DEFF Research Database (Denmark)
von Wettstein, Penny
2017-01-01
The primary function of the outermost, lipophilic layer of plant aerial surfaces, called the cuticle, is preventing non-stomatal water loss. Its exterior surface is often decorated with wax crystals, imparting a blue-grey color. Identification of the barley Cer-c, -q and -u genes forming the 101 kb...... Cer-cqu gene cluster encoding a novel polyketide synthase-the β-diketone synthase (DKS), a lipase/carboxyl transferase, and a P450 hydroxylase, respectively, establishes a new, major pathway for the synthesis of plant waxes. The major product is a β-diketone (14,16-hentriacontane) aliphatic that forms...
REMINDER: Saved Leave Scheme (SLS)
2003-01-01
Transfer of leave to saved leave accounts Under the provisions of the voluntary saved leave scheme (SLS), a maximum total of 10 days'* annual and compensatory leave (excluding saved leave accumulated in accordance with the provisions of Administrative Circular No 22B) can be transferred to the saved leave account at the end of the leave year (30 September). We remind you that unused leave of all those taking part in the saved leave scheme at the closure of the leave year accounts is transferred automatically to the saved leave account on that date. Therefore, staff members have no administrative steps to take. In addition, the transfer, which eliminates the risk of omitting to request leave transfers and rules out calculation errors in transfer requests, will be clearly shown in the list of leave transactions that can be consulted in EDH from October 2003 onwards. Furthermore, this automatic leave transfer optimizes staff members' chances of benefiting from a saved leave bonus provided that they ar...
Mechanistic studies of 3-deoxy-D-manno-octulosonic acid 8-phosphate synthase
International Nuclear Information System (INIS)
Dotson, G.D.; Woodard, R.W.
1994-01-01
The enzyme 3-deOXY-D-manno-octulosonic acid 8-phosphate synthase (KDO 8-P synthase) catalyses the condensation of arabinose 5-phosphate (A 5-P) with phosphoenolpyruvate (PEP) to give the unique eight-carbon acidic sugar 3-deoxy-D-nianno-octulosonic acid 8-phosphate (KDO 8-P) found only in gram-negative bacteria and required for lipid A maturation and cellular growth. The E. coli gene kdsA that encodes KDO 8-P synthase has been amplified by standard PCR methodologies. The synthetic gene, subcloned into the expression vector pT7-7 was used to infect E. coli BL 21 (DE 3). Purification of crude supernatant from this transformant on Q Sepharose yields >200 mg of near-homogeneous KDO 8-P synthase per liter of cell culture. To explore the mechanism of KDO 8-P synthase, we prepared (E)- and (Z)-(3 2 H)PEP, (2- 13 C)PEP, and (2- 13 C, 18 O)PEP chemically from the appropriately labeled 3-bromopyruvates by reaction with trimethylphosphite under Perkow reaction conditions. Our 1 H-NMR analysis of the stereochemistry at C3 of the KDO 8-Ps, obtained by separate incubation of (E)- and (Z)-(3- 2 H)PEP with A 5-P in the presence of KDO 8-P synthase, demonstrated that the reaction is stereospecific with respect to both the C3 of PEP and the C1 carbonyl of A 5-P. (Z)-(3- 2 H)PEP gave predominantly (3S)-(3 2 H)KDO 8-P and (E)-(3- 2 H)PEP gave predominantly (3R)-(3 2 H)KDO-8P, which indicates condensation of the si face of PEP upon the re face of A 5-P-an orientation analogous to that seen with the similar aldehyde Iyase DAH 7-P synthase. The fate of the enolic oxygen of (2- 13 C, 18 O)PEP, during the course of the KDO 8-P synthase-catalyzed reaction as monitored by both 13 C- and 31 P-NMR spectroscopy demonstrated that the inorganic phosphate (Pi) and not the KDO 8-P contained the 18 O
Mechanistic studies of 3-deoxy-D-manno-octulosonic acid 8-phosphate synthase
Energy Technology Data Exchange (ETDEWEB)
Dotson, G.D.; Woodard, R.W. [Univ. of Michigan, Ann Arbor, MI (United States)
1994-12-01
The enzyme 3-deOXY-D-manno-octulosonic acid 8-phosphate synthase (KDO 8-P synthase) catalyses the condensation of arabinose 5-phosphate (A 5-P) with phosphoenolpyruvate (PEP) to give the unique eight-carbon acidic sugar 3-deoxy-D-nianno-octulosonic acid 8-phosphate (KDO 8-P) found only in gram-negative bacteria and required for lipid A maturation and cellular growth. The E. coli gene kdsA that encodes KDO 8-P synthase has been amplified by standard PCR methodologies. The synthetic gene, subcloned into the expression vector pT7-7 was used to infect E. coli BL 21 (DE 3). Purification of crude supernatant from this transformant on Q Sepharose yields >200 mg of near-homogeneous KDO 8-P synthase per liter of cell culture. To explore the mechanism of KDO 8-P synthase, we prepared (E)- and (Z)-(3{sup 2}H)PEP, (2-{sup 13}C)PEP, and (2-{sup 13}C,{sup 18}O)PEP chemically from the appropriately labeled 3-bromopyruvates by reaction with trimethylphosphite under Perkow reaction conditions. Our {sup 1}H-NMR analysis of the stereochemistry at C3 of the KDO 8-Ps, obtained by separate incubation of (E)- and (Z)-(3-{sup 2}H)PEP with A 5-P in the presence of KDO 8-P synthase, demonstrated that the reaction is stereospecific with respect to both the C3 of PEP and the C1 carbonyl of A 5-P. (Z)-(3-{sup 2}H)PEP gave predominantly (3S)-(3{sup 2}H)KDO 8-P and (E)-(3-{sup 2}H)PEP gave predominantly (3R)-(3{sup 2}H)KDO-8P, which indicates condensation of the si face of PEP upon the re face of A 5-P-an orientation analogous to that seen with the similar aldehyde Iyase DAH 7-P synthase. The fate of the enolic oxygen of (2-{sup 13}C, {sup 18}O)PEP, during the course of the KDO 8-P synthase-catalyzed reaction as monitored by both {sup 13}C- and {sup 31}P-NMR spectroscopy demonstrated that the inorganic phosphate (Pi) and not the KDO 8-P contained the {sup 18}O.
Crystallization of Δ1-tetrahydrocannabinolic acid (THCA) synthase from Cannabis sativa
International Nuclear Information System (INIS)
Shoyama, Yoshinari; Takeuchi, Ayako; Taura, Futoshi; Tamada, Taro; Adachi, Motoyasu; Kuroki, Ryota; Shoyama, Yukihiro; Morimoto, Satoshi
2005-01-01
Δ 1 -Tetrahydrocannabinolic acid (THCA) synthase from C. sativa was crystallized. The crystal diffracted to 2.7 Å resolution with sufficient quality for further structure determination. Δ 1 -Tetrahydrocannabinolic acid (THCA) synthase is a novel oxidoreductase that catalyzes the biosynthesis of the psychoactive compound THCA in Cannabis sativa (Mexican strain). In order to investigate the structure–function relationship of THCA synthase, this enzyme was overproduced in insect cells, purified and finally crystallized in 0.1 M HEPES buffer pH 7.5 containing 1.4 M sodium citrate. A single crystal suitable for X-ray diffraction measurement was obtained in 0.09 M HEPES buffer pH 7.5 containing 1.26 M sodium citrate. The crystal diffracted to 2.7 Å resolution at beamline BL41XU, SPring-8. The crystal belonged to the primitive cubic space group P432, with unit-cell parameters a = b = c = 178.2 Å. The calculated Matthews coefficient was approximately 4.1 or 2.0 Å 3 Da −1 assuming the presence of one or two molecules of THCA synthase in the asymmetric unit, respectively
Directory of Open Access Journals (Sweden)
Abir U Igamberdiev
2015-01-01
Full Text Available The bulk of ATP synthesis in plants is performed by ATP synthase, the main bioenergetics engine of cells, operating both in mitochondria and in chloroplasts. The reaction mechanism of ATP synthase has been studied in detail for over half a century; however, its optimal performance depends also on the steady delivery of ATP synthase substrates and the removal of its products. For mitochondrial ATP synthase, we analyze here the provision of stable conditions for (i the supply of ADP and Mg2+, supported by adenylate kinase (AK equilibrium in the intermembrane space, (ii the supply of phosphate via membrane transporter in symport with H+, and (iii the conditions of outflow of ATP by adenylate transporter carrying out the exchange of free adenylates. We also show that, in chloroplasts, AK equilibrates adenylates and governs Mg2+ contents in the stroma, optimizing ATP synthase and Calvin cycle operation, and affecting the import of inorganic phosphate in exchange with triose phosphates. It is argued that chemiosmosis is not the sole component of ATP synthase performance, which also depends on AK-mediated equilibrium of adenylates and Mg2+, adenylate transport and phosphate release and supply.
DEFF Research Database (Denmark)
Nielsen, Rikke Skovgaard
2015-01-01
The paper focuses on ethnic differences in the timing and patterns of leaving the parental home. Leaving home is a key transition in the life course of the individual, and extensive research has been conducted on the timing and patterns of leaving it. However, ethnic differences in these patterns...... of leaving home. Results showed that while some differences disappeared when controlling for covariates, others persisted, thus indicating ethnic differences in home-leaving patterns. A strong link between leaving home and marriage was substantiated for Turks, but not for Somalis. The home-leaving patterns...... of Somalis were much more similar to those of Danes. Overall, Turkish descendants were similar to Turkish immigrants but with some differentiation. The analyses identified the existence of ethnic differences in home-leaving patterns but also found evidence of a shift towards less traditional patterns, i...
Purification and characterization of CDP-diacylglycerol synthase from Saccharomyces cerevisiae
International Nuclear Information System (INIS)
Kelley, M.J.; Carman, G.M.
1987-01-01
The membrane-associated phospholipid biosynthetic enzyme CDP-diacylglycerol synthase (CTP:phosphatidate cytidylyltransferase was purified 2300-fold from Saccharomyces cerevisiae. The purification procedure included Triton X-100 solubilization of mitochondrial membranes, CDP-diacylglycerol-Sepharose affinity chromatography, and hydroxylapatite chromatography. The procedure resulted in a nearly homogeneous enzyme preparation as determined by native and sodium dodecyl sulfate-polyacrylamide gel electrophoresis. Radiation inactivation of mitochondrial associated and purified CDP-diacylglycerol synthase suggested that the molecular weight of the native enzyme was 114,000. Sodium dodecyl sulfate-polyacrylamide gel electrophoresis of the purified enzyme preparation yielded two subunits with molecular weights of 56,000 and 54,000. Antibodies prepared against the purified enzyme immunoprecipitated CDP-diacylglycerol synthase activity and subunits. CDP-diacylglycerol synthase activity was dependent on magnesium ions and Triton X-100 at pH 6.5. Thio-reactive agents inhibited activity. The activation energy for the reaction was 9 kcal/mol, and the enzyme was thermally labile above 30 degrees C. The Km values for CTP and phosphatidate were 1 and 0.5 mM, respectively, and the Vmax was 4700 nmol/min/mg. Results of kinetic and isotopic exchange reactions suggested that the enzyme catalyzes a sequential Bi Bi reaction mechanism
Gaucher-Wieczorek, Florence; Guérineau, Vincent; Touboul, David; Thétiot-Laurent, Sophie; Pelissier, Franck; Badet-Denisot, Marie-Ange; Badet, Bernard; Durand, Philippe
2014-08-01
Glucosamine-6-phosphate synthase (GlmS, EC 2.6.1.16) catalyzes the first and rate-limiting step in the hexosamine biosynthetic pathway, leading to the synthesis of uridine-5'-diphospho-N-acetyl-D-glucosamine, the major building block for the edification of peptidoglycan in bacteria, chitin in fungi, and glycoproteins in mammals. This bisubstrate enzyme converts D-fructose-6-phosphate (Fru-6P) and L-glutamine (Gln) into D-glucosamine-6-phosphate (GlcN-6P) and L-glutamate (Glu), respectively. We previously demonstrated that matrix-assisted laser desorption/ionization time-of-flight mass spectrometry (MALDI-TOF-MS) allows determination of the kinetic parameters of the synthase activity. We propose here to refine the experimental protocol to quantify Glu and GlcN-6P, allowing determination of both hemisynthase and synthase parameters from a single assay kinetic experiment, while avoiding interferences encountered in other assays. It is the first time that MALDI-MS is used to survey the activity of a bisubstrate enzyme. Copyright © 2014 Elsevier Inc. All rights reserved.
Isolation and Characterization of Three New Monoterpene Synthases from Artemisia annua
Ruan, Ju-Xin; Li, Jian-Xu; Fang, Xin; Wang, Ling-Jian; Hu, Wen-Li; Chen, Xiao-Ya; Yang, Chang-Qing
2016-01-01
Artemisia annua, an annual herb used in traditional Chinese medicine, produces a wealth of monoterpenes and sesquiterpenes, including the well-known sesquiterpene lactone artemisinin, an active ingredient in the treatment for malaria. Here we report three new monoterpene synthases of A. annua. From a glandular trichome cDNA library, monoterpene synthases of AaTPS2, AaTPS5, and AaTPS6, were isolated and characterized. The recombinant proteins of AaTPS5 and AaTPS6 produced multiple products with camphene and 1,8-cineole as major products, respectively, and AaTPS2 produced a single product, β-myrcene. Although both Mg2+ and Mn2+ were able to support their catalytic activities, altered product spectrum was observed in the presence of Mn2+ for AaTPS2 and AaTPS5. Analysis of extracts of aerial tissues and root of A. annua with gas chromatography–mass spectrometry detected more than 20 monoterpenes, of which the three enzymes constituted more than 1/3 of the total. Mechanical wounding induced the expression of all three monoterpene synthase genes, and transcript levels of AaTPS5 and AaTPS6 were also elevated after treatments with phytohormones of methyl jasmonate, salicylic acid, and gibberellin, suggesting a role of these monoterpene synthases in plant–environment interactions. The three new monoterpene synthases reported here further our understanding of molecular basis of monoterpene biosynthesis and regulation in plant. PMID:27242840
Isolation and characterization of three new monoterpene synthases from Artemisia annua
Directory of Open Access Journals (Sweden)
Ju-Xin eRuan
2016-05-01
Full Text Available Artemisia annua, an annual herb used in traditional Chinese medicine, produces a wealth of monoterpenes and sesquiterpenes, including the well-known sesquiterpene lactone artemisinin, an active ingredient in the treatment for malaria. Here we report three new monoterpene synthases of A. annua. From a glandular trichome cDNA library, monoterpene synthases of AaTPS2, AaTPS5 and AaTPS6, were isolated and characterized. The recombinant proteins of AaTPS5 and AaTPS6 produced multiple products with camphene and 1,8-cineole as major products, respectively, and AaTPS2 produced a single product, β-myrcene. Although both Mg2+ and Mn2+ were able to support their catalytic activities, altered product spectrum was observed in the presence of Mn2+ for AaTPS2 and AaTPS5. Analysis of extracts of aerial tissues and root of A. annua with gas chromatography-mass spectrometry (GC-MS detected more than 20 monoterpenes, of which the three enzymes constituted more than 1/3 of the total. Mechanical wounding induced the expression of all three monoterpene synthase genes, and transcript levels of AaTPS5 and AaTPS6 were also elevated after treatments with phytohormones of methyl jasmonate (MeJA, salicylic acid (SA and gibberellin (GA, suggesting a role of these monoterpene synthases in plant-environment interactions. The three new monoterpene synthases reported here further our understanding of molecular basis of monoterpene biosynthesis and regulation in plant.
Endothelial nitric oxide synthase gene polymorphisms associated ...
African Journals Online (AJOL)
STORAGESEVER
2010-05-24
May 24, 2010 ... chronic periodontitis (CP), 31 with gingivitis (G) and 50 healthy controls. Probing depth ..... Periodontal disease in pregnancy I. Prevalence and severity. ... endothelial nitric oxide synthase gene in premenopausal women with.
DEFF Research Database (Denmark)
Rostgaard, Tine; Christoffersen, Mogens; Weise, Hanne
This artcle considders the political aims for different leave schemes and reviews studies af these schemes. The use of parental leave is sensitive to the financial loss involved in taking leave: a decrease in the benefit payments has had a significant influence on take-up, while, in general, fami......, families'' loss of income is less if leave is taken up by the mothers. Only few fathers participate in parental leave....
Directory of Open Access Journals (Sweden)
Bechard Matthew E.
2003-01-01
Full Text Available Tetrahydromethanopterin (H4MPT is a tetrahydrofolate analog originally discovered in methanogenic archaea, but later found in other archaea and bacteria. The extent to which H4MPT occurs among living organisms is unknown. The key enzyme which distinguishes the biosynthetic pathways of H4MPT and tetrahydrofolate is ribofuranosylaminobenzene 5'-phosphate synthase (RFAP synthase. Given the importance of RFAP synthase in H4MPT biosynthesis, the identification of putative RFAP synthase genes and measurement of RFAP synthase activity would provide an indication of the presence of H4MPT in untested microorganisms. Investigation of putative archaeal RFAP synthase genes has been hampered by the tendency of the resulting proteins to form inactive inclusion bodies in Escherichia coli. The current work describes a colorimetric assay for measuring RFAP synthase activity, and two modified procedures for expressing recombinant RFAP synthase genes to produce soluble, active enzyme. By lowering the incubation temperature during expression, RFAP synthase from Archaeoglobus fulgidus was produced in E. coli and purified to homogeneity. The production of active RFAP synthase from Methanothermobacter thermautotrophicus was achieved by coexpression of the gene MTH0830 with a molecular chaperone. This is the first direct biochemical identification of a methanogen gene that codes for an active RFAP synthase.
Bechard, Matthew E.; Chhatwal, Sonya; Garcia, Rosemarie E.; Rasche, Madeline E.
2003-01-01
Tetrahydromethanopterin (H(4)MPT) is a tetrahydrofolate analog originally discovered in methanogenic archaea, but later found in other archaea and bacteria. The extent to which H(4)MPT occurs among living organisms is unknown. The key enzyme which distinguishes the biosynthetic pathways of H(4)MPT and tetrahydrofolate is ribofuranosylaminobenzene 5'-phosphate synthase (RFAP synthase). Given the importance of RFAP synthase in H(4)MPT biosynthesis, the identification of putative RFAP synthase genes and measurement of RFAP synthase activity would provide an indication of the presence of H(4)MPT in untested microorganisms. Investigation of putative archaeal RFAP synthase genes has been hampered by the tendency of the resulting proteins to form inactive inclusion bodies in Escherichia coli. The current work describes a colorimetric assay for measuring RFAP synthase activity, and two modified procedures for expressing recombinant RFAP synthase genes to produce soluble, active enzyme. By lowering the incubation temperature during expression, RFAP synthase from Archaeoglobus fulgidus was produced in E. coli and purified to homogeneity. The production of active RFAP synthase from Methanothermobacter thermautotrophicus was achieved by coexpression of the gene MTH0830 with a molecular chaperone. This is the first direct biochemical identification of a methanogen gene that codes for an active RFAP synthase.
Dai, Ru; Ge, Hui; Howard, Susanne; Qiu, Wenping
2012-12-01
Stilbenic compounds are natural phytoalexins that have antimicrobial activities in plant defense against pathogens. Stilbene synthase (STS) is the key enzyme that catalyzes the biosynthesis of stilbenic compounds. Grapevine genome contains a family of preliminarily annotated 35 STS genes, the regulation of each STS gene needs to be studied to define their roles. In this study, we selected eight STS genes, STS8, STS27/31, STS16/22, STS13/17/23, and applied quantitative polymerase chain reaction (qPCR) to characterize their transcriptional expression profiles in leaf tissues upon infection by the powdery mildew fungus (PM), Erysiphe necator (Schw.) Burr. Their transcripts were also compared in young and old leaves as well as in the berry skin at five developmental stages in Vitis vinifera 'Cabernet Sauvignon' and Vitis aestivalis 'Norton'. The results showed that transcripts of selected STS genes increased significantly in Cabernet Sauvignon leaves at 24 and 48 h post inoculation with PM spores and remained unchanged in Norton leaves in response to the PM infection. Transcripts of STS8, STS27/31 and STS13/17/23 were more abundant in the old leaves of Norton than in Cabernet Sauvignon. STS genes showed lower expression levels in young leaves than in old leaves. Transcript levels of the eight STS genes increased drastically in the berry skin of Cabernet Sauvignon and Norton post véraison. In addition, the content of trans-resveratrol in the berry skin rapidly increased post véraison and reached the highest level at harvest. These assays demonstrated that individual STS genes are regulated differentially in response to PM infection and during development in the two grape varieties. The present study yields basic knowledge for further investigation of the regulation and function of each STS gene in grapevine and provides experimental evidences for the functional annotation of the STS gene family in the grapevine genome. Copyright © 2012 Elsevier Ireland Ltd. All
Platelet-derived growth factor (PDGF) stimulates glycogen synthase activity in 3T3 cells
International Nuclear Information System (INIS)
Chan, C.P.; Bowen-Pope, D.F.; Ross, R.; Krebs, E.G.
1986-01-01
Hormonal regulation of glycogen synthase, an enzyme that can be phosphorylated on multiple sites, is often associated with changes in its phosphorylation state. Enzyme activation is conventionally monitored by determining the synthase activity ratio [(activity in the absence of glucose 6-P)/(activity in the presence of glucose 6-P)]. Insulin causes an activation of glycogen synthase with a concomitant decrease in its phosphate content. In a previous report, the authors showed that epidermal growth factor (EGF) increases the glycogen synthase activity ratio in Swiss 3T3 cells. The time and dose-dependency of this response was similar to that of insulin. Their recent results indicate that PDGF also stimulates glycogen synthase activity. Enzyme activation was maximal after 30 min. of incubation with PDGF; the time course observed was very similar to that with insulin and EGF. At 1 ng/ml (0.03nM), PDGF caused a maximal stimulation of 4-fold in synthase activity ratio. Half-maximal stimulation was observed at 0.2 ng/ml (6 pM). The time course of changes in enzyme activity ratio closely followed that of 125 I-PDGF binding. The authors data suggest that PDGF, as well as EFG and insulin, may be important in regulating glycogen synthesis through phosphorylation/dephosphorylation mechanisms
5 CFR 630.1015 - Movement between voluntary leave bank and leave transfer programs.
2010-01-01
... 5 Administrative Personnel 1 2010-01-01 2010-01-01 false Movement between voluntary leave bank and leave transfer programs. 630.1015 Section 630.1015 Administrative Personnel OFFICE OF PERSONNEL MANAGEMENT CIVIL SERVICE REGULATIONS ABSENCE AND LEAVE Voluntary Leave Bank Program § 630.1015 Movement...
Kim, Min-Hye; Kim, Jin Nam; Han, Sung Nim; Kim, Hye-Kyeong
2015-06-01
Psidium guajava (guava) leaves have been frequently used for the treatment of rheumatism, fever, arthritis and other inflammatory conditions. The purpose of this study was to identify major anti-inflammatory compounds from guava leaf extract. The methanol extract and its hexane-, dichloromethane-, ethylacetate-, n-butanol- and water-soluble phases derived from guava leaves were evaluated to determine their inhibitory activity on nitric oxide (NO) production by RAW 264.7 cells stimulated with lipopolysaccharide (LPS). The methanol extract decreased NO production in a dose-dependent manner without cytotoxicity at a concentration range of 0-100 μg/mL. The n-butanol soluble phase was the most potent among the five soluble phases. Four compounds were isolated by reversed-phase HPLC from the n-butanol soluble phase and identified to be avicularin, guaijaverin, leucocyanidin and ursolic acid by their NMR spectra. Among these compounds, ursolic acid inhibited LPS-induced NO production in a dose-dependent manner without cytotoxity at a concentration range of 1-10 µM, but the other three compounds had no effect. Ursolic acid also inhibited LPS-induced prostaglandin E2 production. A western blot analysis showed that ursolic acid decreased the LPS-stimulated inducible nitric oxide synthase and cyclooxygenase protein levels. In addition, ursolic acid suppressed the production of intracellular reactive oxygen species in LPS-stimulated RAW 264.7 cells, as measured by flow cytometry. Taken together, these results identified ursolic acid as a major anti-inflammatory compound in guava leaves.
ATP Synthase, a Target for Dementia and Aging?
Larrick, James W; Larrick, Jasmine W; Mendelsohn, Andrew R
2018-02-01
Advancing age is the biggest risk factor for development for the major life-threatening diseases in industrialized nations accounting for >90% of deaths. Alzheimer's dementia (AD) is among the most devastating. Currently approved therapies fail to slow progression of the disease, providing only modest improvements in memory. Recently reported work describes mechanistic studies of J147, a promising therapeutic molecule previously shown to rescue the severe cognitive deficits exhibited by aged, transgenic AD mice. Apparently, J147 targets the mitochondrial alpha-F1-ATP synthase (ATP5A). Modest inhibition of the ATP synthase modulates intracellular calcium to activate AMP-activated protein kinase to inhibit mammalian target of rapamycin, a known mechanism of lifespan extension from worms to mammals.
Hübner, Michaela; Matsubara, Shizue; Beyer, Peter
2015-01-01
Attaining defined steady-state carotenoid levels requires balancing of the rates governing their synthesis and metabolism. Phytoene formation mediated by phytoene synthase (PSY) is rate limiting in the biosynthesis of carotenoids, whereas carotenoid catabolism involves a multitude of nonenzymatic and enzymatic processes. We investigated carotenoid and apocarotenoid formation in Arabidopsis (Arabidopsis thaliana) in response to enhanced pathway flux upon PSY overexpression. This resulted in a dramatic accumulation of mainly β-carotene in roots and nongreen calli, whereas carotenoids remained unchanged in leaves. We show that, in chloroplasts, surplus PSY was partially soluble, localized in the stroma and, therefore, inactive, whereas the membrane-bound portion mediated a doubling of phytoene synthesis rates. Increased pathway flux was not compensated by enhanced generation of long-chain apocarotenals but resulted in higher levels of C13 apocarotenoid glycosides (AGs). Using mutant lines deficient in carotenoid cleavage dioxygenases (CCDs), we identified CCD4 as being mainly responsible for the majority of AGs formed. Moreover, changed AG patterns in the carotene hydroxylase mutants lutein deficient1 (lut1) and lut5 exhibiting altered leaf carotenoids allowed us to define specific xanthophyll species as precursors for the apocarotenoid aglycons detected. In contrast to leaves, carotenoid hyperaccumulating roots contained higher levels of β-carotene-derived apocarotenals, whereas AGs were absent. These contrasting responses are associated with tissue-specific capacities to synthesize xanthophylls, which thus determine the modes of carotenoid accumulation and apocarotenoid formation. PMID:26134165
Selectivity of the surface binding site (SBS) on barley starch synthase I
DEFF Research Database (Denmark)
Wilkens, Casper; Cuesta-Seijo, Jose A.; Palcic, Monica
2014-01-01
Starch synthase I (SSI) from various sources has been shown to preferentially elongate branch chains of degree of polymerisation (DP) from 6–7 to produce chains of DP 8–12. In the recently determined crystal structure of barley starch synthase I (HvSSI) a so-called surface binding site (SBS) was ...
Mousa, Ahmad A; Strauss, Jerome F; Walsh, Scott W
2012-06-01
Preeclampsia is characterized by increased thromboxane and decreased prostacyclin levels, which predate symptoms, and can explain some of the clinical manifestations of preeclampsia, including hypertension and thrombosis. In this study, we examined DNA methylation of the promoter region of the thromboxane synthase gene (TBXAS1) and the expression of thromboxane synthase in systemic blood vessels of normal pregnant and preeclamptic women. Thromboxane synthase is responsible for the synthesis of thromboxane A(2), a potent vasoconstrictor and activator of platelets. We also examined the effect of experimentally induced DNA hypomethylation on the expression of thromboxane synthase in a neutrophil-like cell line (HL-60 cells) and in cultured vascular smooth muscle and endothelial cells. We found that DNA methylation of the TBXAS1 promoter was decreased and thromboxane synthase expression was increased in omental arteries of preeclamptic women as compared with normal pregnant women. Increased thromboxane synthase expression was observed in vascular smooth muscles cells, endothelial cells, and infiltrating neutrophils. Experimentally induced DNA hypomethylation only increased expression of thromboxane synthase in the neutrophil-like cell line, whereas tumor necrosis factor-α, a neutrophil product, increased its expression in cultured vascular smooth muscle cells. Our study suggests that epigenetic mechanisms and release of tumor necrosis factor-α by infiltrating neutrophils could contribute to the increased expression of thromboxane synthase in maternal systemic blood vessels, contributing to the hypertension and coagulation abnormalities associated with preeclampsia.
von Wettstein-Knowles, Penny
2017-07-10
The primary function of the outermost, lipophilic layer of plant aerial surfaces, called the cuticle, is preventing non-stomatal water loss. Its exterior surface is often decorated with wax crystals, imparting a blue-grey color. Identification of the barley Cer-c , -q and -u genes forming the 101 kb Cer-cqu gene cluster encoding a novel polyketide synthase-the β-diketone synthase (DKS), a lipase/carboxyl transferase, and a P450 hydroxylase, respectively, establishes a new, major pathway for the synthesis of plant waxes. The major product is a β-diketone (14,16-hentriacontane) aliphatic that forms long, thin crystalline tubes. A pathway branch leads to the formation of esterified alkan-2-ols.
Zeng, Xiangling; Liu, Cai; Zheng, Riru; Cai, Xuan; Luo, Jing; Zou, Jingjing; Wang, Caiyun
2016-01-01
Osmanthus fragrans is an ornamental and economically important plant known for its magnificent aroma, and the most important aroma-active compounds in flowers are monoterpenes, mainly β-ocimene, linalool and linalool derivatives. To understand the molecular mechanism of monoterpene production, we analyzed the emission and accumulation patterns of these compounds and the transcript levels of the genes involved in their biosynthesis in two O. fragrans cultivars during flowering stages. The results showed that both emission and accumulation of monoterpenes varied with flower development and glycosylation had an important impact on floral linalool emission during this process. Gene expression demonstrated that the transcript levels of terpene synthase (TPS) genes probably played a key role in monoterpene production, compared to the genes in the MEP pathway. Phylogenetic analysis showed that OfTPS1 and OfTPS2 belonged to a TPS-g subfamily, and OfTPS3 and OfTPS4 clustered into a TPS-b subfamily. Their transient and stable expression in tobacco leaves suggested that OfTPS1 and OfTPS2 exclusively produced β-linalool, and trans-β-ocimene was the sole product from OfTPS3, while OfTPS4, a predictive sesquiterpene synthase, produced α-farnesene. These results indicate that OfTPS1, OfTPS2, and OfTPS3 could account for the major floral monoterpenes, linalool and trans-β-ocimene, produced in O. fragrans flowers. PMID:26793212
Directory of Open Access Journals (Sweden)
Xaingling eZeng
2016-01-01
Full Text Available Osmanthus fragrans is an ornamental and economically important plant known for its magnificent aroma, and the most important aroma-active compounds in flowers are monoterpenes, mainly β-ocimene, linalool and linalool derivatives. To understand the molecular mechanism of monoterpene production, we analyzed the emission and accumulation patterns of these compounds and the transcript levels of the genes involved in their biosynthesis in two O. fragrans cultivars during flowering stages. The results showed that both emission and accumulation of monoterpenes varied with flower development and glycosylation had an important impact on floral linalool emission during this process. Gene expression demonstrated that the transcript levels of terpene synthase (TPS genes probably played a key role in monoterpene production, compared to the genes in the MEP pathway. Phylogenetic analysis showed that OfTPS1 and OfTPS2 belonged to a TPS-g subfamily, and OfTPS3 and OfTPS4 clustered into a TPS-b subfamily. Their transient and stable expression in tobacco leaves suggested that OfTPS1 and OfTPS2 exclusively produced β-linalool, and trans-β-ocimene was the sole product from OfTPS3, while OfTPS4, a predictive sesquiterpene synthase, produced α-farnesene. These results indicate that OfTPS1, OfTPS2 and OfTPS3 could account for the major floral monoterpenes, linalool and trans-β-ocimene, produced in O. fragrans flowers.
Nitric Oxide Synthases Reveal a Role for Calmodulin in Controlling Electron Transfer
Abu-Soud, Husam M.; Stuehr, Dennis J.
1993-11-01
Nitric oxide (NO) is synthesized within the immune, vascular, and nervous systems, where it acts as a wide-ranging mediator of mammalian physiology. The NO synthases (EC 1.14.13.39) isolated from neurons or endothelium are calmodulin dependent. Calmodulin binds reversibly to neuronal NO synthase in response to elevated Ca2+, triggering its NO production by an unknown mechanism. Here we show that calmodulin binding allows NADPH-derived electrons to pass onto the heme group of neuronal NO synthase. Calmodulin-triggered electron transfer to heme was independent of substrate binding, caused rapid enzymatic oxidation of NADPH in the presence of O_2, and was required for NO synthesis. An NO synthase isolated from cytokine-induced macrophages that contains tightly bound calmodulin catalyzed spontaneous electron transfer to its heme, consistent with bound calmodulin also enabling electron transfer within this isoform. Together, these results provide a basis for how calmodulin may regulate NO synthesis. The ability of calmodulin to trigger electron transfer within an enzyme is unexpected and represents an additional function for calcium-binding proteins in biology.
Cyclophilin D Promotes Brain Mitochondrial F1FO ATP Synthase Dysfunction in Aging Mice.
Gauba, Esha; Guo, Lan; Du, Heng
2017-01-01
Brain aging is the known strongest risk factor for Alzheimer's disease (AD). In recent years, mitochondrial deficits have been proposed to be a common mechanism linking brain aging to AD. Therefore, to elucidate the causative mechanisms of mitochondrial dysfunction in aging brains is of paramount importance for our understanding of the pathogenesis of AD, in particular its sporadic form. Cyclophilin D (CypD) is a specific mitochondrial protein. Recent studies have shown that F1FO ATP synthase oligomycin sensitivity conferring protein (OSCP) is a binding partner of CypD. The interaction of CypD with OSCP modulates F1FO ATP synthase function and mediates mitochondrial permeability transition pore (mPTP) opening. Here, we have found that increased CypD expression, enhanced CypD/OSCP interaction, and selective loss of OSCP are prominent brain mitochondrial changes in aging mice. Along with these changes, brain mitochondria from the aging mice demonstrated decreased F1FO ATP synthase activity and defective F1FO complex coupling. In contrast, CypD deficient mice exhibited substantially mitigated brain mitochondrial F1FO ATP synthase dysfunction with relatively preserved mitochondrial function during aging. Interestingly, the aging-related OSCP loss was also dramatically attenuated by CypD depletion. Therefore, the simplest interpretation of this study is that CypD promotes F1FO ATP synthase dysfunction and the resultant mitochondrial deficits in aging brains. In addition, in view of CypD and F1FO ATP synthase alterations seen in AD brains, the results further suggest that CypD-mediated F1FO ATP synthase deregulation is a shared mechanism linking mitochondrial deficits in brain aging and AD.
Directory of Open Access Journals (Sweden)
Ro Dae-Kyun
2009-07-01
Full Text Available Abstract Background Sesquiterpene lactones are characteristic metabolites of Asteraceae (or Compositae which often display potent bioactivities and are sequestered in specialized organs such as laticifers, resin ducts, and trichomes. For characterization of sunflower sesquiterpene synthases we employed a simple method to isolate pure trichomes from anther appendages which facilitated the identification of these genes and investigation of their enzymatic functions and expression patterns during trichome development. Results Glandular trichomes of sunflower (Helianthus annuus L. were isolated, and their RNA was extracted to investigate the initial steps of sesquiterpene lactone biosynthesis. Reverse transcription-PCR experiments led to the identification of three sesquiterpene synthases. By combination of in vitro and in vivo characterization of sesquiterpene synthase gene products in Escherichia coli and Saccharomyces cerevisiae, respectively, two enzymes were identified as germacrene A synthases, the key enzymes of sesquiterpene lactone biosynthesis. Due to the very low in vitro activity, the third enzyme was expressed in vivo in yeast as a thioredoxin-fusion protein for functional characterization. In in vivo assays, it was identified as a multiproduct enzyme with the volatile sesquiterpene hydrocarbon δ-cadinene as one of the two main products with α-muuorlene, β-caryophyllene, α-humulene and α-copaene as minor products. The second main compound remained unidentified. For expression studies, glandular trichomes from the anther appendages of sunflower florets were isolated in particular developmental stages from the pre- to the post-secretory phase. All three sesquiterpene synthases were solely upregulated during the biosynthetically active stages of the trichomes. Expression in different aerial plant parts coincided with occurrence and maturity of trichomes. Young roots with root hairs showed expression of the sesquiterpene synthase genes
Cytidine triphosphate synthase activity and mRNA expression in normal human blood cells
Verschuur, A. C.; van Gennip, A. H.; Muller, E. J.; Voûte, P. A.; Vreken, P.; van Kuilenburg, A. B.
1999-01-01
Cytidine triphosphate (CTP) synthase is one of the key enzymes in pyrimidine nucleotide anabolic pathways. The activity of this enzyme is elevated in various malignancies including acute lymphocytic leukemia (ALL). In this study we investigated the activity of CTP synthase in various human blood
Energy Technology Data Exchange (ETDEWEB)
Gonzalez-Mendoza, Daniel [Departamento de Recursos del Mar, Cinvestav-Unidad Merida, Merida, Yucatan (Mexico); Moreno, Adriana Quiroz [Unidad de biotecnologia, CICY, Merida, Yucatan (Mexico); Zapata-Perez, Omar [Departamento de Recursos del Mar, Cinvestav-Unidad Merida, Merida, Yucatan (Mexico)]. E-mail: ozapata@mda.cinvestav.mx
2007-08-01
To evaluate the role of phytochelatins and metallothioneins in heavy metal tolerance of black mangrove Avicennia germinans, 3-month-old seedlings were exposed to cadmium or copper for 30 h, under hydroponic conditions. Degenerate Mt2 and PCS primers were synthesized based on amino acid and nucleotide alignment sequences reported for Mt2 and PCS in other plant species found in GenBank. Total RNA was isolated from A. germinans leaves and two partial fragments of metallothionein and phytochelatin synthase genes were isolated. Gene expression was evaluated with reverse transcripatase-polymerase chain reaction (RT-PCR) amplification technique. Temporal analysis showed that low Cd{sup 2+} and Cu{sup 2+} concentrations caused a slight (but not significant) increase in AvMt2 expression after a 16 h exposure time, while AvPCS expression showed a significant increase under the same conditions but only after 4 h. Results strongly suggest that the rapid increase in AvPCS expression may contribute to Cd{sup 2+} and Cu{sup 2+} detoxification. Moreover, we found that A. germinans has the capacity to over-express both genes (AvMt2 and AvPCS), which may constitute a coordinated detoxification response mechanism targeting non-essential metals. Nonetheless, our results confirm that AvPCS was the most active gene involved in the regulation of essential metals (e.g., Cu{sup 2+}) in A. germinans leaves.
DEFF Research Database (Denmark)
Amilon, Anna
2010-01-01
Lone mothers have to take care of a sick child with little or no help from the child’s other parent and have to carry all costs connected to leave-taking. This paper empirically tests whether lone mothers take more temporary parental leave to care for sick children than partnered mothers...... and whether parental leave is associated with a signaling cost. The results from this study of Swedish mothers show that lone mothers use more temporary parental leave than partnered mothers. Further, within the group of lone mothers, those with higher socioeconomic status take less temporary parental leave...... than those with lower socioeconomic status, whereas no such differences are found within the group of partnered mothers. One possible interpretation is that signaling costs negatively influence the utilization of temporary parental leave for lone mothers....
["Paternity leave"? Retrospective view on a delayed reform of maternity leave in Austria].
Munz, R
1984-01-01
Only 1 of 3 Austrian fathers involves himself daily in child rearing, and the younger the children, the less likely he is to be involved. Austria is among those European countries with the greatest pregnancy benefits. New mothers may take up to 1 year of paid maternity leave without fear of losing their jobs. This article uses 1982 Institute of Demography survey data to determine support for similar paternity leave for fathers. In the last few years, both Social Democrat and Conservative women have worked for this leave, although the movement has also found opposition by women in trade unions, as well as from conservative groups. Survey results show that 46% of married Austrian women, under age 40, favor paternity leave; 1 or 4 women can imagine their husbands taking such leave. Among husbands, 34% favored the leave option, and 1 of 4 could imagine taking the leave for a least part of the baby's first year. The study attempts to identify those husbands most likely to take advantage of paternity leave. At present, most men will not choose to stay with their children at the expense of earnings reduction. Compensation reforms for both mothers and fathers must first occur before men and women in a position to make real decisions on maternity and paternity leave.
Cloning and expression of pineapple sucrose- phosphate synthase ...
African Journals Online (AJOL)
hope&shola
2010-12-06
Dec 6, 2010 ... phosphate; EDTA, ethylene diamine tetraacetic acid; Ivr, invertase; SS .... phenolics, tannins and artifacts due to differences of tissue composition ..... Banana sucrose-phosphate synthase gene expression during fruit ripening.
Multi-substrate terpene synthases: their occurrence and physiological significance
Directory of Open Access Journals (Sweden)
Leila Pazouki
2016-07-01
Full Text Available Terpene synthases are responsible for synthesis of a large number of terpenes in plants using substrates provided by two distinct metabolic pathways, the mevalonate-dependent pathway that is located in cytosol and has been suggested to be responsible for synthesis of sesquiterpenes (C15, and 2-C-methyl-D-erythritol-4-phosphate pathway located in plastids and suggested to be responsible for the synthesis of hemi- (C5, mono- (C10 and diterpenes (C20. Recent advances in characterization of genes and enzymes responsible for substrate and end product biosynthesis as well as efforts in metabolic engineering have demonstrated existence of a number of multi-substrate terpene synthases. This review summarizes the progress in the characterization of such multi-substrate terpene synthases and suggests that the presence of multi-substrate use might have been significantly underestimated. Multi-substrate use could lead to important changes in terpene product profiles upon substrate profile changes under perturbation of metabolism in stressed plants as well as under certain developmental stages. We therefore argue that multi-substrate use can be significant under physiological conditions and can result in complicate modifications in terpene profiles.
Longevity in vivo of primary cell wall cellulose synthases.
Hill, Joseph Lee; Josephs, Cooper; Barnes, William J; Anderson, Charles T; Tien, Ming
2018-02-01
Our work focuses on understanding the lifetime and thus stability of the three main cellulose synthase (CESA) proteins involved in primary cell wall synthesis of Arabidopsis. It had long been thought that a major means of CESA regulation was via their rapid degradation. However, our studies here have uncovered that AtCESA proteins are not rapidly degraded. Rather, they persist for an extended time in the plant cell. Plant cellulose is synthesized by membrane-embedded cellulose synthase complexes (CSCs). The CSC is composed of cellulose synthases (CESAs), of which three distinct isozymes form the primary cell wall CSC and another set of three isozymes form the secondary cell wall CSC. We determined the stability over time of primary cell wall (PCW) CESAs in Arabidopsis thaliana seedlings, using immunoblotting after inhibiting protein synthesis with cycloheximide treatment. Our work reveals very slow turnover for the Arabidopsis PCW CESAs in vivo. Additionally, we show that the stability of all three CESAs within the PCW CSC is altered by mutations in individual CESAs, elevated temperature, and light conditions. Together, these results suggest that CESA proteins are very stable in vivo, but that their lifetimes can be modulated by intrinsic and environmental cues.
Use of octaketide synthases to produce kermesic acid and flavokermesic acid
DEFF Research Database (Denmark)
2017-01-01
A method for producing an octaketide derived aromatic compound of interest (e.g. carminic acid), wherein the method comprises (I): heterologous expression of a recombinantly introduced Type III polyketide synthase (PKS) gene encoding an octaketide synthase (OKS) to obtain non-reduced octaketide...... in vivo within the recombinant host cell and (II): converting in vivo the non-reduced octaketide of step (I) into a C14-C34 aromatic compound of interest (e.g. carminic acid)....
Use of octaketide synthases to produce kermesic acid and flavokermesic acid
DEFF Research Database (Denmark)
2016-01-01
A method for producing an octaketide derived aromatic compound of interest (e.g. carminic acid), wherein the method comprises (I): heterologous expression of a recombinantly introduced Type III polyketide synthase (PKS) gene encoding an octaketide synthase (OKS) to obtain non-reduced octaketide...... in vivo within the recombinant host cell and (II): converting in vivo the non-reduced octaketide of step (I) into a C14-C34 aromatic compound of interest (e.g. carminic acid)....
Directory of Open Access Journals (Sweden)
Mirian Perez Maluf
2009-01-01
Full Text Available In this work, we studied the biosynthesis of caffeine by examining the expression of genes involved in this biosynthetic pathway in coffee fruits containing normal or low levels of this substance. The amplification of gene-specific transcripts during fruit development revealed that low-caffeine fruits had a lower expression of the theobromine synthase and caffeine synthase genes and also contained an extra transcript of the caffeine synthase gene. This extra transcript contained only part of exon 1 and all of exon 3. The sequence of the mutant caffeine synthase gene revealed the substitution of isoleucine for valine in the enzyme active site that probably interfered with enzymatic activity. These findings indicate that the absence of caffeine in these mutants probably resulted from a combination of transcriptional regulation and the presence of mutations in the caffeine synthase amino acid sequence.
Kuzmanoff, K. M.
1984-01-01
In plants, gravity stimulates differential growth in the upper and lower halves of horizontally oriented organs. Auxin regulation of cell wall loosening and elongation is the basis for most models of this phenomenon. Auxin treatment of pea stem tissue rapidly increases the activity of Golgi-localized Beta-1,4-glucan synthase, an enzyme involved in biosynthesis of wall xyloglucan which apparently constitutes the substrate for the wall loosening process. The primary objective is to determine if auxin induces de novo formation of Golgi glucan synthase and increases the level of this glucan synthase mRNA. This shall be accomplished by (a) preparation of a monoclonal antibody to the synthase, (b) isolation, and characterization of the glucan synthase, and (c) examination for cross reactivity between the antibody and translation products of auxin induced mRNAs in pea tissue. The antibody will also be used to localize the glucan synthase in upper and lower halves of pea stem tissue before, during and after the response to gravity.
An Arabidopsis callose synthase
DEFF Research Database (Denmark)
Ostergaard, Lars; Petersen, Morten; Mattsson, Ole
2002-01-01
in the Arabidopsis mpk4 mutant which exhibits systemic acquired resistance (SAR), elevated beta-1,3-glucan synthase activity, and increased callose levels. In addition, AtGsl5 is a likely target of salicylic acid (SA)-dependent SAR, since AtGsl5 mRNA accumulation is induced by SA in wild-type plants, while...... expression of the nahG salicylate hydroxylase reduces AtGsl5 mRNA levels in the mpk4 mutant. These results indicate that AtGsl5 is likely involved in callose synthesis in flowering tissues and in the mpk4 mutant....
[Disability leave and sick leave in Spain. 2016 legislative update].
Vicente-Herrero, María Teófila; Terradillos-García, María Jesús; Capdevila-García, Luisa M; Ramírez-Íñiguez de la Torre, María Victoria; Aguilar-Jiménez, Encarna; Aguado-Benedí, María José; López-González, Angel Arturo; Torres-Alberich, José Ignacio
2018-01-01
In Spanish, the concepts of discapacidad (disability leave) and incapacidad (sick leave) jointly refer to the impairment of a person due to injuries, diseases or deficiencies that limit their activity in a social, personal or occupational field. However, this common link does not imply that both concepts are the same. Statistical data from INE (Instituto Nacional de Estadística: Statistic National Institute) show that Spain had in 2015 3.85 million persons with a disability (59.8% were women). Statistical data from 2015 from INSS (Instituto Nacional de Seguridad Social: Social Security National Institute) show high levels in the number of processes and in workers affected by temporary sick leave, with social costs to the social security system. Both concepts have been updated: about disability leave, Law 39/2006 adjusted terminology by avoiding the use of concepts with discriminating or pejorative connotation. Regarding sick leave, the Ley General de Seguridad Social (General Social Security Law)has been amended and came into effect in January, 2016. It is necessary to know and distinguish these aspects for a better administrative management, and a more oriented information to the affected patient.
Wilson, Wayne A; Pradhan, Prajakta; Madhan, Nayasha; Gist, Galen C; Brittingham, Andrew
2017-07-01
Trichomonas vaginalis, a parasitic protist, is the causative agent of the common sexually-transmitted infection trichomoniasis. The organism has long been known to synthesize substantial glycogen as a storage polysaccharide, presumably mobilizing this compound during periods of carbohydrate limitation, such as might be encountered during transmission between hosts. However, little is known regarding the enzymes of glycogen metabolism in T. vaginalis. We had previously described the identification and characterization of two forms of glycogen phosphorylase in the organism. Here, we measure UDP-glucose-dependent glycogen synthase activity in cell-free extracts of T. vaginalis. We then demonstrate that the TVAG_258220 open reading frame encodes a glycosyltransferase that is presumably responsible for this synthetic activity. We show that expression of TVAG_258220 in a yeast strain lacking endogenous glycogen synthase activity is sufficient to restore glycogen accumulation. Furthermore, when TVAG_258220 is expressed in bacteria, the resulting recombinant protein has glycogen synthase activity in vitro, transferring glucose from either UDP-glucose or ADP-glucose to glycogen and using both substrates with similar affinity. This protein is also able to transfer glucose from UDP-glucose or ADP-glucose to maltose and longer oligomers of glucose but not to glucose itself. However, with these substrates, there is no evidence of processivity and sugar transfer is limited to between one and three glucose residues. Taken together with our earlier work on glycogen phosphorylase, we are now well positioned to define both how T. vaginalis synthesizes and utilizes glycogen, and how these processes are regulated. Copyright © 2017 Elsevier B.V. and Société Française de Biochimie et Biologie Moléculaire (SFBBM). All rights reserved.
Broad Substrate Specificity of the Loading Didomain of the Lipomycin Polyketide Synthase
Energy Technology Data Exchange (ETDEWEB)
Yuzawa, S; Eng, CH; Katz, L; Keasling, JD
2013-06-04
LipPks1, a polyketide synthase subunit of the lipomycin synthase, is believed to catalyze the polyketide chain initiation reaction using isobutyryl-CoA as a substrate, followed by an elongation reaction with methylmalonyl-CoA to start the biosynthesis of antibiotic alpha-lipomycin in Streptomyces aureofaciens Tu117. Recombinant LipPks1, containing the thioesterase domain from the 6-deoxyerythronolide B synthase, was produced in Escherichia coli, and its substrate specificity was investigated in vitro. Surprisingly, several different acyl-CoAs, including isobutyryl-CoA, were accepted as the starter substrates, while no product was observed with acetyl-CoA. These results demonstrate the broad substrate specificity of LipPks1 and may be applied to producing new antibiotics.
Crystallization of Δ{sup 1}-tetrahydrocannabinolic acid (THCA) synthase from Cannabis sativa
Energy Technology Data Exchange (ETDEWEB)
Shoyama, Yoshinari; Takeuchi, Ayako; Taura, Futoshi [Faculty of Pharmaceutical Sciences, Kyushu University, 3-1-1 Maidashi, Higashi-ku, Fukuoka 812-8582 (Japan); Tamada, Taro; Adachi, Motoyasu; Kuroki, Ryota [Neutron Science Research Center, Japan Atomic Energy Research Institute, 2-4 Shirakata-Shirane, Tokai, Ibaraki 319-1195 (Japan); Shoyama, Yukihiro; Morimoto, Satoshi [Faculty of Pharmaceutical Sciences, Kyushu University, 3-1-1 Maidashi, Higashi-ku, Fukuoka 812-8582 (Japan)
2005-08-01
Δ{sup 1}-Tetrahydrocannabinolic acid (THCA) synthase from C. sativa was crystallized. The crystal diffracted to 2.7 Å resolution with sufficient quality for further structure determination. Δ{sup 1}-Tetrahydrocannabinolic acid (THCA) synthase is a novel oxidoreductase that catalyzes the biosynthesis of the psychoactive compound THCA in Cannabis sativa (Mexican strain). In order to investigate the structure–function relationship of THCA synthase, this enzyme was overproduced in insect cells, purified and finally crystallized in 0.1 M HEPES buffer pH 7.5 containing 1.4 M sodium citrate. A single crystal suitable for X-ray diffraction measurement was obtained in 0.09 M HEPES buffer pH 7.5 containing 1.26 M sodium citrate. The crystal diffracted to 2.7 Å resolution at beamline BL41XU, SPring-8. The crystal belonged to the primitive cubic space group P432, with unit-cell parameters a = b = c = 178.2 Å. The calculated Matthews coefficient was approximately 4.1 or 2.0 Å{sup 3} Da{sup −1} assuming the presence of one or two molecules of THCA synthase in the asymmetric unit, respectively.
Köllner, Tobias G; Schnee, Christiane; Gershenzon, Jonathan; Degenhardt, Jörg
2004-05-01
The mature leaves and husks of Zea mays release a complex blend of terpene volatiles after anthesis consisting predominantly of bisabolane-, sesquithujane-, and bergamotane-type sesquiterpenes. The varieties B73 and Delprim release the same volatile constituents but in significantly different proportions. To study the molecular genetic and biochemical mechanisms controlling terpene diversity and distribution in these varieties, we isolated the closely related terpene synthase genes terpene synthase4 (tps4) and tps5 from both varieties. The encoded enzymes, TPS4 and TPS5, each formed the same complex mixture of sesquiterpenes from the precursor farnesyl diphosphate but with different proportions of products. These mixtures correspond to the sesquiterpene blends observed in the varieties B73 and Delprim, respectively. The differences in the stereoselectivity of TPS4 and TPS5 are determined by four amino acid substitutions with the most important being a Gly instead of an Ala residue at position 409 at the catalytic site of the enzyme. Although both varieties contain tps4 and tps5 alleles, their differences in terpene composition result from the fact that B73 has only a single functional allele of tps4 and no functional alleles of tps5, whereas Delprim has only a functional allele of tps5 and no functional alleles of tps4. Lack of functionality was shown to be attributable to frame-shift mutations or amino acid substitutions that greatly reduce the activity of their encoded proteins. Therefore, the diversity of sesquiterpenes in these two maize cultivars is strongly influenced by single nucleotide changes in the alleles of two terpene synthase genes.
DEFF Research Database (Denmark)
Müller, Christian; Hjort, C.M.; Hansen, K.
2002-01-01
In Aspergillus oryzae, one full-length chitin synthase (chsB) and fragments of two other chitin synthases (csmA and chsC) were identified. The deduced amino acid sequence of chsB was similar (87% identity) to chsB from Aspergillus nidulans, which encodes a class III chitin synthase. The sequence...
Cheng, Jiujun; Charles, Trevor C
2016-09-01
Bacterially produced biodegradable polyhydroxyalkanoates (PHAs) with versatile properties can be achieved using different PHA synthases (PhaCs). This work aims to expand the diversity of known PhaCs via functional metagenomics and demonstrates the use of these novel enzymes in PHA production. Complementation of a PHA synthesis-deficient Pseudomonas putida strain with a soil metagenomic cosmid library retrieved 27 clones expressing either class I, class II, or unclassified PHA synthases, and many did not have close sequence matches to known PhaCs. The composition of PHA produced by these clones was dependent on both the supplied growth substrates and the nature of the PHA synthase, with various combinations of short-chain-length (SCL) and medium-chain-length (MCL) PHA. These data demonstrate the ability to isolate diverse genes for PHA synthesis by functional metagenomics and their use for the production of a variety of PHA polymer and copolymer mixtures.
Human METTL12 is a mitochondrial methyltransferase that modifies citrate synthase.
Rhein, Virginie F; Carroll, Joe; Ding, Shujing; Fearnley, Ian M; Walker, John E
2017-06-01
The protein methylome in mammalian mitochondria has been little studied until recently. Here, we describe that lysine-368 of human citrate synthase is methylated and that the modifying enzyme, localized in the mitochondrial matrix, is methyltransferase-like protein 12 (METTL12), a member of the family of 7β-strand methyltransferases. Lysine-368 is near the active site of citrate synthase, but removal of methylation has no effect on its activity. In mitochondria, it is possible that some or all of the enzymes of the citric acid cycle, including citrate synthase, are organized in metabolons to facilitate the channelling of substrates between participating enzymes. Thus, possible roles for the methylation of Lys-368 are in controlling substrate channelling itself, or in influencing protein-protein interactions in the metabolon. © 2017 The Authors FEBS Letters published by John Wiley & Sons Ltd on behalf of Federation of European Biochemical Societies.
Parental Leave Policies and Parents' Employment and Leave-Taking
Han, Wen-Jui; Ruhm, Christopher; Waldfogel, Jane
2009-01-01
We describe trends in maternal employment and leave-taking after birth of a newborn and analyze the extent to which these behaviors are influenced by parental leave policies. Data are from the June Current Population Survey (CPS) Fertility Supplements, merged with other months of the CPS, and cover the period 1987 to 1994. This time span is one…
29 CFR 825.205 - Increments of FMLA leave for intermittent or reduced schedule leave.
2010-07-01
... intermittent leave or working a reduced leave schedule to commence or end work mid-way through a shift, such as... per week, but works only 20 hours a week under a reduced leave schedule, the employee's ten hours of... 29 Labor 3 2010-07-01 2010-07-01 false Increments of FMLA leave for intermittent or reduced...
Endothelial nitric oxide synthase gene polymorphisms associated ...
African Journals Online (AJOL)
Endothelial nitric oxide synthase (NOS3) is involved in key steps of immune response. Genetic factors predispose individuals to periodontal disease. This study's aim was to explore the association between NOS3 gene polymorphisms and clinical parameters in patients with periodontal disease. Genomic DNA was obtained ...
Directory of Open Access Journals (Sweden)
Roman eGangl
2015-09-01
Full Text Available Stachyose is among the raffinose family oligosaccharides one of the major water-soluble carbohydrates next to sucrose in seeds of a number of plant species. Especially in leguminous seeds, e.g. chickpea, stachyose is reported as the major component. In contrast to their ambiguous potential as essential source of carbon for germination, raffinose family oligosaccharides are indigestible for humans and can contribute to diverse abdominal disorders.In the genome of Arabidopsis thaliana, six putative raffinose synthase genes are reported, whereas little is known about these putative raffinose synthases and their biochemical characteristics or their contribution to the raffinose family oligosaccharide physiology in A. thaliana.In this paper, we report on the molecular cloning, functional expression in Escherichia coli and purification of recombinant AtRS4 from A. thaliana and the biochemical characterisation of the putative stachyose synthase (AtSTS, At4g01970 as a raffinose and high affinity stachyose synthase (Km for raffinose 259.2 ± 21.15 µM as well as stachyose and galactinol specific galactosylhydrolase. A T-DNA insertional mutant in the AtRS4 gene was isolated. Only sqPCR from WT siliques showed a specific transcriptional AtRS4 PCR product. Metabolite measurements in seeds of ΔAtRS4 mutant plants revealed a total loss of stachyose in ΔAtRS4 mutant seeds. We conclude that AtRS4 is the only stachyose synthase in the genome of A. thaliana that AtRS4 represents a key regulation mechanism in the raffinose family oligosaccharide physiology of A. thaliana due to its multifunctional enzyme activity and that AtRS4 is possibly the second seed specific raffinose synthase beside AtRS5, which is responsible for Raf-accumulation under abiotic stress.
Isolation of developing secondary xylem specific cellulose synthase ...
Indian Academy of Sciences (India)
The present study aimed at identifying developing secondary xylem specific cellulose synthase genes from .... the First strand cDNA synthesis kit (Fermentas, Pittsburgh,. USA). .... ing height of the rooted cutting, girth of the stem, leaf area.
Isolation and characterization of three new monoterpene synthases from Artemisia annua
Ju-Xin eRuan; Jian-Xu eLi; Xin eFang; Ling-Jian eWang; Wen-Li eHu; Xiao-Ya eChen; Changqing eYang
2016-01-01
Artemisia annua, an annual herb used in traditional Chinese medicine, produces a wealth of monoterpenes and sesquiterpenes, including the well-known sesquiterpene lactone artemisinin, an active ingredient in the treatment for malaria. Here we report three new monoterpene synthases of A. annua. From a glandular trichome cDNA library, monoterpene synthases of AaTPS2, AaTPS5 and AaTPS6, were isolated and characterized. The recombinant proteins of AaTPS5 and AaTPS6 produced multiple products with...
Strang, Lucy; Broeks, Miriam
2017-01-01
Abstract Over recent years many European Union countries have made changes to the design of the maternity leave provision. These policy developments reflect calls for greater gender equality in the workforce and more equal share of childcare responsibilities. However, while research shows that long period of leave can have negative effects on women's labour market attachment and career advancements, early return to work can be seen as a factor preventing exclusive breastfeeding, and therefore, potentially having negative health impacts for babies. Indeed, the World Health Organisation recommends exclusive breastfeeding up to 6 months of age to provide babies with the nutrition for healthy growth and brain development, protection from life-threatening ailments, obesity and non-communicable diseases such as asthma and diabetes. Therefore, labour market demands on women may be at odds with the health benefits for children gained by longer periods of maternity leave. The aim of this article is to examine the relationship between leave provision and health benefits for children. We examine maternity and parental leave provision across European countries and its potential impact on the breastfeeding of very young babies (up to 6-months of age). We also consider economic factors of potential extension of maternity leave provision to 6 months, such as costs to businesses, effects on the female labour market attachment, and wider consequences (benefits and costs) for individuals, families, employers and the wider society. PMID:28983432
5 CFR 630.1104 - Donations from a leave bank to an emergency leave transfer program.
2010-01-01
... 5 Administrative Personnel 1 2010-01-01 2010-01-01 false Donations from a leave bank to an emergency leave transfer program. 630.1104 Section 630.1104 Administrative Personnel OFFICE OF PERSONNEL MANAGEMENT CIVIL SERVICE REGULATIONS ABSENCE AND LEAVE Emergency Leave Transfer Program § 630.1104 Donations...
DEFF Research Database (Denmark)
Vestergaard, Martin; Nøhr-Meldgaard, Katrine; Bojer, Martin Saxtorph
2017-01-01
, linezolid, daptomycin, and oxacillin were unchanged. ATP synthase activity is known to be inhibited by oligomycin A, and the presence of this compound increased polymyxin B-mediated killing of S. aureus Our results demonstrate that the ATP synthase contributes to intrinsic resistance of S. aureus towards...
Mechanism of Action and Inhibition of dehydrosqualene Synthase
Energy Technology Data Exchange (ETDEWEB)
F Lin; C Liu; Y Liu; Y Zhang; K Wang; W Jeng; T Ko; R Cao; A Wang; E Oldfield
2011-12-31
'Head-to-head' terpene synthases catalyze the first committed steps in sterol and carotenoid biosynthesis: the condensation of two isoprenoid diphosphates to form cyclopropylcarbinyl diphosphates, followed by ring opening. Here, we report the structures of Staphylococcus aureus dehydrosqualene synthase (CrtM) complexed with its reaction intermediate, presqualene diphosphate (PSPP), the dehydrosqualene (DHS) product, as well as a series of inhibitors. The results indicate that, on initial diphosphate loss, the primary carbocation so formed bends down into the interior of the protein to react with C2,3 double bond in the prenyl acceptor to form PSPP, with the lower two-thirds of both PSPP chains occupying essentially the same positions as found in the two farnesyl chains in the substrates. The second-half reaction is then initiated by the PSPP diphosphate returning back to the Mg{sup 2+} cluster for ionization, with the resultant DHS so formed being trapped in a surface pocket. This mechanism is supported by the observation that cationic inhibitors (of interest as antiinfectives) bind with their positive charge located in the same region as the cyclopropyl carbinyl group; that S-thiolo-diphosphates only inhibit when in the allylic site; activity results on 11 mutants show that both DXXXD conserved domains are essential for PSPP ionization; and the observation that head-to-tail isoprenoid synthases as well as terpene cyclases have ionization and alkene-donor sites which spatially overlap those found in CrtM.
Pivotal role of glycogen synthase kinase-3: A therapeutic target for Alzheimer's disease.
Maqbool, Mudasir; Mobashir, Mohammad; Hoda, Nasimul
2016-01-01
Neurodegenerative diseases are among the most challenging diseases with poorly known mechanism of cause and paucity of complete cure. Out of all the neurodegenerative diseases, Alzheimer's disease is the most devastating and loosening of thinking and judging ability disease that occurs in the old age people. Many hypotheses came forth in order to explain its causes. In this review, we have enlightened Glycogen Synthase Kinase-3 which has been considered as a concrete cause for Alzheimer's disease. Plaques and Tangles (abnormal structures) are the basic suspects in damaging and killing of nerve cells wherein Glycogen Synthase Kinase-3 has a key role in the formation of these fatal accumulations. Various Glycogen Synthase Kinase-3 inhibitors have been reported to reduce the amount of amyloid-beta as well as the tau hyperphosphorylation in both neuronal and nonneuronal cells. Additionally, Glycogen Synthase Kinase-3 inhibitors have been reported to enhance the adult hippocampal neurogenesis in vivo as well as in vitro. Keeping the chemotype of the reported Glycogen Synthase Kinase-3 inhibitors in consideration, they may be grouped into natural inhibitors, inorganic metal ions, organo-synthetic, and peptide like inhibitors. On the basis of their mode of binding to the constituent enzyme, they may also be grouped as ATP, nonATP, and allosteric binding sites competitive inhibitors. ATP competitive inhibitors were known earlier inhibitors but they lack efficient selectivity. This led to find the new ways for the enzyme inhibition. Copyright © 2015 Elsevier Masson SAS. All rights reserved.
Energy Technology Data Exchange (ETDEWEB)
Zylberman, V.; Craig, P.O.; Klinke, S.; Cauerhff, A.; Goldbaum, F.A. [Instituto Leloir, Buenos Aires (Argentina); Braden, B.C. [Bowie State Univ., Maryland (United States)
2004-07-01
The penultimate step in the pathway of riboflavin biosynthesis is catalyzed by the enzyme lumazine synthase (LS). One of the most distinctive characteristics of this enzyme is the structural quaternary divergence found in different species. The protein exists as pentameric and icosahedral forms, built from practically the same structural monomeric unit. The pentameric structure is formed by five 18 kDa monomers, each extensively contacting neighboring monomers. The icosahedral structure consists of 60 LS monomers arranged as twelve pentamers giving rise to a capsid exhibiting icosahedral 532 symmetry. In all lumazine synthases studied, the topologically equivalent active sites are located at the interfaces between adjacent subunits in the pentameric modules. The Brucella spp. lumazine synthase (BLS) sequence clearly diverges from pentameric and icosahedral enzymes. This unusual divergence prompted to further investigate on its quaternary arrangement. In the present work, we demonstrate by means of solution Light Scattering and X-ray structural analyses that BLS assembles as a very stable dimer of pentamers representing a third category of quaternary assembly for lumazine synthases. We also describe by spectroscopic studies the thermodynamic stability of this oligomeric protein, and postulate a mechanism for dissociation/unfolding of this macromolecular assembly. The higher molecular order of BLS increases its stability 20 deg C compared to pentameric lumazine synthases. The decameric arrangement described in this work highlights the importance of quaternary interactions in the stabilization of proteins. (author)
International Nuclear Information System (INIS)
Zylberman, V.; Craig, P.O.; Klinke, S.; Cauerhff, A.; Goldbaum, F.A.; Braden, B.C.
2004-01-01
The penultimate step in the pathway of riboflavin biosynthesis is catalyzed by the enzyme lumazine synthase (LS). One of the most distinctive characteristics of this enzyme is the structural quaternary divergence found in different species. The protein exists as pentameric and icosahedral forms, built from practically the same structural monomeric unit. The pentameric structure is formed by five 18 kDa monomers, each extensively contacting neighboring monomers. The icosahedral structure consists of 60 LS monomers arranged as twelve pentamers giving rise to a capsid exhibiting icosahedral 532 symmetry. In all lumazine synthases studied, the topologically equivalent active sites are located at the interfaces between adjacent subunits in the pentameric modules. The Brucella spp. lumazine synthase (BLS) sequence clearly diverges from pentameric and icosahedral enzymes. This unusual divergence prompted to further investigate on its quaternary arrangement. In the present work, we demonstrate by means of solution Light Scattering and X-ray structural analyses that BLS assembles as a very stable dimer of pentamers representing a third category of quaternary assembly for lumazine synthases. We also describe by spectroscopic studies the thermodynamic stability of this oligomeric protein, and postulate a mechanism for dissociation/unfolding of this macromolecular assembly. The higher molecular order of BLS increases its stability 20 deg C compared to pentameric lumazine synthases. The decameric arrangement described in this work highlights the importance of quaternary interactions in the stabilization of proteins. (author)
Formentini, Laura; Pereira, Marta P; Sánchez-Cenizo, Laura; Santacatterina, Fulvio; Lucas, José J; Navarro, Carmen; Martínez-Serrano, Alberto; Cuezva, José M
2014-04-01
A key transducer in energy conservation and signaling cell death is the mitochondrial H(+)-ATP synthase. The expression of the ATPase inhibitory factor 1 (IF1) is a strategy used by cancer cells to inhibit the activity of the H(+)-ATP synthase to generate a ROS signal that switches on cellular programs of survival. We have generated a mouse model expressing a mutant of human IF1 in brain neurons to assess the role of the H(+)-ATP synthase in cell death in vivo. The expression of hIF1 inhibits the activity of oxidative phosphorylation and mediates the shift of neurons to an enhanced aerobic glycolysis. Metabolic reprogramming induces brain preconditioning affording protection against quinolinic acid-induced excitotoxicity. Mechanistically, preconditioning involves the activation of the Akt/p70S6K and PARP repair pathways and Bcl-xL protection from cell death. Overall, our findings provide the first in vivo evidence highlighting the H(+)-ATP synthase as a target to prevent neuronal cell death.
Demissie, Zerihun A; Erland, Lauren A E; Rheault, Mark R; Mahmoud, Soheil S
2013-03-01
Lavender essential oils are constituted predominantly of regular monoterpenes, for example linalool, 1,8-cineole, and camphor. However, they also contain irregular monoterpenes including lavandulol and lavandulyl acetate. Although the majority of genes responsible for the production of regular monoterpenes in lavenders are now known, enzymes (including lavandulyl diphosphate synthase (LPPS)) catalyzing the biosynthesis of irregular monoterpenes in these plants have not been described. Here, we report the isolation and functional characterization of a novel cis-prenyl diphosphate synthase cDNA, termed Lavandula x intermedia lavandulyl diphosphate synthase (LiLPPS), through a homology-based cloning strategy. The LiLPPS ORF, encoding for a 305-amino acid long protein, was expressed in Escherichia coli, and the recombinant protein was purified by nickel-nitrilotriacetic acid affinity chromatography. The approximately 34.5-kDa bacterially produced protein specifically catalyzed the head-to-middle condensation of two dimethylallyl diphosphate units to LPP in vitro with apparent Km and kcat values of 208 ± 12 μm and 0.1 s(-1), respectively. LiLPPS is a homodimeric enzyme with a sigmoidal saturation curve and Hill coefficient of 2.7, suggesting a positive co-operative interaction among its catalytic sites. LiLPPS could be used to modulate the production of lavandulol and its derivatives in plants through metabolic engineering.
Guendelman, Sylvia; Goodman, Julia; Kharrazi, Martin; Lahiff, Maureen
2014-01-01
Early return to work after childbirth has been increasing among working mothers in the US. We assessed the relationship between access to employer-offered maternity leave (EOML) (both paid and unpaid) and uptake and duration of maternity leave following childbirth in a socio-economically diverse sample of full-time working women. We focus on California, a state that has long provided more generous maternity leave benefits than those offered by federal maternity leave policies through the State Disability Insurance program. The sample included 691 mothers who gave birth in Southern California in 2002-2003. Using weighted logistic regression, we examined the EOML-maternity leave duration relationship, controlling for whether the leave was paid, as well as other occupational, personality and health-related covariates. Compared with mothers who were offered more than 12 weeks of maternity leave, mothers with leave had six times higher odds of an early return. These relationships were similar after controlling for whether the leave was paid and after controlling for other occupational and health characteristics. Access to and duration of employer-offered maternity leave significantly determine timing of return to work following childbirth, potentially affecting work-family balance. Policy makers should recognize the pivotal role of employers in offering job security during and after maternity leave and consider widening the eligibility criteria of the Family and Medical Leave Act.
Adal, Ayelign M; Sarker, Lukman S; Lemke, Ashley D; Mahmoud, Soheil S
2017-04-01
A methyl jasmonate responsive 3-carene synthase (Li3CARS) gene was isolated from Lavandula x intermedia and functionally characterized in vitro. Lavenders produce essential oils consisting mainly of monoterpenes, including the potent antimicrobial and insecticidal monoterpene 3-carene. In this study we isolated and functionally characterized a leaf-specific, methyl jasmonate (MeJA)-responsive monoterpene synthase (Li3CARS) from Lavandula x intermedia. The ORF excluding transit peptides encoded a 64.9 kDa protein that was expressed in E. coli, and purified with Ni-NTA agarose affinity chromatography. The recombinant Li3CARS converted GPP into 3-carene as the major product, with K m and k cat of 3.69 ± 1.17 µM and 2.01 s -1 respectively. Li3CARS also accepted NPP as a substrate to produce multiple products including a small amount of 3-carene. The catalytic efficiency of Li3CARS to produce 3-carene was over ten fold higher for GPP (k cat /K m = 0.56 µM -1 s -1 ) than NPP (k cat /K m = 0.044 µM -1 s -1 ). Production of distinct end product profiles from different substrates (GPP versus NPP) by Li3CARS indicates that monoterpene metabolism may be controlled in part through substrate availability. Li3CARS transcripts were found to be highly abundant in leaves (16-fold) as compared to flower tissues. The transcriptional activity of Li3CARS correlated with 3-carene production, and was up-regulated (1.18- to 3.8-fold) with MeJA 8-72 h post-treatment. The results suggest that Li3CARS may have a defensive role in Lavandula.
Maternity leave duration and postpartum mental and physical health: implications for leave policies.
Dagher, Rada K; McGovern, Patricia M; Dowd, Bryan E
2014-04-01
This study examines the association of leave duration with depressive symptoms, mental health, physical health, and maternal symptoms in the first postpartum year, using a prospective cohort design. Eligible employed women, eighteen years or older, were interviewed in person at three Minnesota hospitals while hospitalized for childbirth in 2001. Telephone interviews were conducted at six weeks (N = 716), twelve weeks (N = 661), six months (N = 625), and twelve months (N = 575) after delivery. Depressive symptoms (Edinburgh Postnatal Depression Scale), mental and physical health (SF-12 Health Survey), and maternal childbirth-related symptoms were measured at each time period. Two-stage least squares analysis showed that the relationship between leave duration and postpartum depressive symptoms is U-shaped, with a minimum at six months. In the first postpartum year, an increase in leave duration is associated with a decrease in depressive symptoms until six months postpartum. Moreover, ordinary least squares analysis showed a marginally significant linear positive association between leave duration and physical health. Taking leave from work provides time for mothers to rest and recover from pregnancy and childbirth. Findings indicate that the current leave duration provided by the Family and Medical Leave Act, twelve weeks, may not be sufficient for mothers at risk for or experiencing postpartum depression.
Azuma, Yusuke; Zschoche, Reinhard; Hilvert, Donald
2017-06-23
Encapsulation of specific enzymes in self-assembling protein cages is a hallmark of bacterial compartments that function as counterparts to eukaryotic organelles. The cage-forming enzyme lumazine synthase (LS) from Bacillus subtilis (BsLS), for example, encapsulates riboflavin synthase (BsRS), enabling channeling of lumazine from the site of its generation to the site of its conversion to vitamin B 2 Elucidating the molecular mechanisms underlying the assembly of these supramolecular complexes could help inform new approaches for metabolic engineering, nanotechnology, and drug delivery. To that end, we investigated a thermostable LS from Aquifex aeolicus (AaLS) and found that it also forms cage complexes with the cognate riboflavin synthase (AaRS) when both proteins are co-produced in the cytosol of Escherichia coli A 12-amino acid-long peptide at the C terminus of AaRS serves as a specific localization sequence responsible for targeting the guest to the protein compartment. Sequence comparisons suggested that analogous peptide segments likely direct RS complexation by LS cages in other bacterial species. Covalent fusion of this peptide tag to heterologous guest molecules led to their internalization into AaLS assemblies both in vivo and in vitro , providing a firm foundation for creating tailored biomimetic nanocompartments for medical and biotechnological applications. © 2017 by The American Society for Biochemistry and Molecular Biology, Inc.
Protein modelling of triterpene synthase genes from mangrove plants using Phyre2 and Swiss-model
Basyuni, M.; Wati, R.; Sulistiyono, N.; Hayati, R.; Sumardi; Oku, H.; Baba, S.; Sagami, H.
2018-03-01
Molecular cloning of five oxidosqualene cyclases (OSC) genes from Bruguiera gymnorrhiza, Kandelia candel, and Rhizophora stylosa had previously been cloned, characterized, and encoded mono and -multi triterpene synthases. The present study analyzed protein modelling of triterpene synthase genes from mangrove using Phyre2 and Swiss-model. The diversity was noted within protein modelling of triterpene synthases using Phyre2 from sequence identity (38-43%) and residue (696-703). RsM2 was distinguishable from others for template structure; it used lanosterol synthase as a template (PDB ID: w6j.1.A). By contrast, other genes used human lanosterol synthase (1w6k.1.A). The predicted bind sites were correlated with the product of triterpene synthase, the product of BgbAS was β-amyrin, while RsM1 contained a significant amount of β-amyrin. Similarly BgLUS and KcMS, both main products was lupeol, on the other hand, RsM2 with the outcome of taraxerol. Homology modelling revealed that 696 residues of BgbAS, BgLUS, RsM1, and RsM2 (91-92% of the amino acid sequence) had been modelled with 100% confidence by the single highest scoring template using Phyre2. This coverage was higher than Swiss-model (85-90%). The present study suggested that molecular cloning of triterpene genes provides useful tools for studying the protein modelling related regulation of isoprenoids biosynthesis in mangrove forests.
Beekwilder, Jules; van Houwelingen, Adèle; Cankar, Katarina; van Dijk, Aalt D J; de Jong, René M; Stoopen, Geert; Bouwmeester, Harro; Achkar, Jihane; Sonke, Theo; Bosch, Dirk
2014-02-01
Nootkatone is one of the major terpenes in the heartwood of the Nootka cypress Callitropsis nootkatensis. It is an oxidized sesquiterpene, which has been postulated to be derived from valencene. Both valencene and nootkatone are used for flavouring citrus beverages and are considered among the most valuable terpenes used at commercial scale. Functional evaluation of putative terpene synthase genes sourced by large-scale EST sequencing from Nootka cypress wood revealed a valencene synthase gene (CnVS). CnVS expression in different tissues from the tree correlates well with nootkatone content, suggesting that CnVS represents the first dedicated gene in the nootkatone biosynthetic pathway in C. nootkatensis The gene belongs to the gymnosperm-specific TPS-d subfamily of terpenes synthases and its protein sequence has low similarity to known citrus valencene synthases. In vitro, CnVS displays high robustness under different pH and temperature regimes, potentially beneficial properties for application in different host and physiological conditions. Biotechnological production of sesquiterpenes has been shown to be feasible, but productivity of microbial strains expressing valencene synthase from Citrus is low, indicating that optimization of valencene synthase activity is needed. Indeed, expression of CnVS in Saccharomyces cerevisiae indicated potential for higher yields. In an optimized Rhodobacter sphaeroides strain, expression of CnVS increased valencene yields 14-fold to 352 mg/L, bringing production to levels with industrial potential. © 2013 Society for Experimental Biology, Association of Applied Biologists and John Wiley & Sons Ltd.
Martins, Marina Camara Mattos; Hejazi, Mahdi; Fettke, Joerg; Steup, Martin; Feil, Regina; Krause, Ursula; Arrivault, Stéphanie; Vosloh, Daniel; Figueroa, Carlos María; Ivakov, Alexander; Yadav, Umesh Prasad; Piques, Maria; Metzner, Daniela; Stitt, Mark; Lunn, John Edward
2013-01-01
Many plants accumulate substantial starch reserves in their leaves during the day and remobilize them at night to provide carbon and energy for maintenance and growth. In this paper, we explore the role of a sugar-signaling metabolite, trehalose-6-phosphate (Tre6P), in regulating the accumulation and turnover of transitory starch in Arabidopsis (Arabidopsis thaliana) leaves. Ethanol-induced overexpression of trehalose-phosphate synthase during the day increased Tre6P levels up to 11-fold. There was a transient increase in the rate of starch accumulation in the middle of the day, but this was not linked to reductive activation of ADP-glucose pyrophosphorylase. A 2- to 3-fold increase in Tre6P during the night led to significant inhibition of starch degradation. Maltose and maltotriose did not accumulate, suggesting that Tre6P affects an early step in the pathway of starch degradation in the chloroplasts. Starch granules isolated from induced plants had a higher orthophosphate content than granules from noninduced control plants, consistent either with disruption of the phosphorylation-dephosphorylation cycle that is essential for efficient starch breakdown or with inhibition of starch hydrolysis by β-amylase. Nonaqueous fractionation of leaves showed that Tre6P is predominantly located in the cytosol, with estimated in vivo Tre6P concentrations of 4 to 7 µm in the cytosol, 0.2 to 0.5 µm in the chloroplasts, and 0.05 µm in the vacuole. It is proposed that Tre6P is a component in a signaling pathway that mediates the feedback regulation of starch breakdown by sucrose, potentially linking starch turnover to demand for sucrose by growing sink organs at night. PMID:24043444
Bechard, Matthew E.; Chhatwal, Sonya; Garcia, Rosemarie E.; Rasche, Madeline E.
2003-01-01
Tetrahydromethanopterin (H4MPT) is a tetrahydrofolate analog originally discovered in methanogenic archaea, but later found in other archaea and bacteria. The extent to which H4MPT occurs among living organisms is unknown. The key enzyme which distinguishes the biosynthetic pathways of H4MPT and tetrahydrofolate is ribofuranosylaminobenzene 5'-phosphate synthase (RFAP synthase). Given the importance of RFAP synthase in H4MPT biosynthesis, the identification of putative RFAP synthase genes and...
DEFF Research Database (Denmark)
Gojkovic, Zoran; Sandrini, Michael; Piskur, Jure
2001-01-01
no pyrimidine catabolic pathway, it enabled growth on N-carbamyl- beta -alanine as the sole nitrogen source. The D. discoideum and D. melanogaster PYD3 gene products are similar to mammalian beta -alanine synthases. In contrast, the S. kluyveri protein is quite different from these and more similar to bacterial......beta -Alanine synthase (EC 3.5.1.6), which catalyzes the final step of pyrimidine catabolism, has only been characterized in mammals. A Saccharomyces kluyveri pyd3 mutant that is unable to grow on N-carbamy-beta -alanine as the sole nitrogen source and exhibits diminished beta -alanine synthase...... N- carbamyl amidohydrolases. All three beta -alanine synthases are to some degree related to various aspartate transcarbamylases, which catalyze the second step of the de novo pyrimidine biosynthetic pathway. PYD3 expression in yeast seems to be inducible by dihydrouracil and N...
DEFF Research Database (Denmark)
Backhausen, Mette; Damm, Peter; Bendix, Jane
2018-01-01
of long-term sick leave. Method Data from 508 employed pregnant women seeking antenatal care was collected by questionnaires from August 2015 to March 2016. The questionnaires, which were filled in at 20 and 32 weeks of gestation, provided information on maternal characteristics, the number of days spent...... on sick leave and the associated reasons. Descriptive statistics and logistic regression analysis were applied. Results The prevalence of sick leave was 56% of employed pregnant women in the first 32 weeks of gestation and more than one in four reported long-term sick leave (>20 days, continuous...... was a negative predictor. Conclusions The prevalence of sick leave was 56% in the first 32 weeks of gestation and more than one in four women reported long-term sick leave. The majority of reasons for sick leave were pregnancy-related and low back pain was the most frequently given reason....
Hamelet, J; Aït-Yahya-Graison, E; Matulewicz, E; Noll, C; Badel-Chagnon, A; Camproux, A-C; Demuth, K; Paul, J-L; Delabar, J M; Janel, N
2007-12-01
Hyperhomocysteinaemia is a metabolic disorder associated with the development of premature atherosclerosis. Among the determinants which predispose to premature thromboembolic and atherothrombotic events, serum activity of paraoxonase 1, mainly synthesized in the liver, has been shown to be a predictor of cardiovascular disease and to be negatively correlated with serum homocysteine levels in human. Even though treatments of hyperhomocysteinaemic patients ongoing cardiovascular complications are commonly used, it still remains unclear above which homocysteine level a preventive therapy should be started. In order to establish a threshold of plasma homocysteine concentration we have analyzed the hepatic cystathionine beta synthase and paraoxonase 1 activities in a moderate to intermediate murine model of hyperhomocysteinaemia. Using wild type and heterozygous cystathionine beta synthase deficient mice fed a methionine enriched diet or a control diet, we first studied the link between cystathionine beta synthase and paraoxonase 1 activities and plasma homocysteine concentration. Among the animals used in this study, we observed a negative correlation between plasma homocysteine level and cystathionine beta synthase activity (rho=-0.52, P=0.0008) or paraoxonase 1 activity (rho=-0.49, P=0.002). Starting from these results, a homocysteine cut-off value of 15 microm has been found for both cystathionine beta synthase (P=0.0003) and paraoxonase 1 (P=0.0007) activities. Our results suggest that both cystathionine beta synthase and paraoxonase 1 activities are significantly decreased in mice with a plasma homocysteine value greater than 15 microm. In an attempt to set up preventive treatment for cardiovascular disease our results indicate that treatments should be started from 15 microm of plasma homocysteine.
Liang, Jing; Han, Qian; Ding, Haizhen; Li, Jianyong
2017-12-01
In available insect genomes, there are several L-3,4-dihydroxyphenylalanine (L-dopa) decarboxylase (DDC)-like or aromatic amino acid decarboxylase (AAAD) sequences. This contrasts to those of mammals whose genomes contain only one DDC. Our previous experiments established that two DDC-like proteins from Drosophila actually mediate a complicated decarboxylation-oxidative deamination process of dopa in the presence of oxygen, leading to the formation of 3,4-dihydroxyphenylacetaldehyde (DHPA), CO 2 , NH 3, and H 2 O 2 . This contrasts to the typical DDC-catalyzed reaction, which produces CO 2 and dopamine. These DDC-like proteins were arbitrarily named DHPA synthases based on their critical role in insect soft cuticle formation. Establishment of reactions catalyzed by these AAAD-like proteins solved a puzzle that perplexed researchers for years, but to tell a true DHPA synthase from a DDC in the insect AAAD family remains problematic due to high sequence similarity. In this study, we performed extensive structural and biochemical comparisons between DHPA synthase and DDC. These comparisons identified several target residues potentially dictating DDC-catalyzed and DHPA synthase-catalyzed reactions, respectively. Comparison of DHPA synthase homology models with crystal structures of typical DDC proteins, particularly residues in the active sites, provided further insights for the roles these identified target residues play. Subsequent site-directed mutagenesis of the tentative target residues and activity evaluations of their corresponding mutants determined that active site His192 and Asn192 are essential signature residues for DDC- and DHPA synthase-catalyzed reactions, respectively. Oxygen is required in DHPA synthase-mediated process and this oxidizing agent is reduced to H 2 O 2 in the process. Biochemical assessment established that H 2 O 2 , formed in DHPA synthase-mediated process, can be reused as oxidizing agent and this active oxygen species is reduced to H 2
Nieuwenhuizen, Niels J; Chen, Xiuyin; Wang, Mindy Y; Matich, Adam J; Perez, Ramon Lopez; Allan, Andrew C; Green, Sol A; Atkinson, Ross G
2015-04-01
Two kiwifruit (Actinidia) species with contrasting terpene profiles were compared to understand the regulation of fruit monoterpene production. High rates of terpinolene production in ripe Actinidia arguta fruit were correlated with increasing gene and protein expression of A. arguta terpene synthase1 (AaTPS1) and correlated with an increase in transcript levels of the 2-C-methyl-D-erythritol 4-phosphate pathway enzyme 1-deoxy-D-xylulose-5-phosphate synthase (DXS). Actinidia chinensis terpene synthase1 (AcTPS1) was identified as part of an array of eight tandemly duplicated genes, and AcTPS1 expression and terpene production were observed only at low levels in developing fruit. Transient overexpression of DXS in Nicotiana benthamiana leaves elevated monoterpene synthesis by AaTPS1 more than 100-fold, indicating that DXS is likely to be the key step in regulating 2-C-methyl-D-erythritol 4-phosphate substrate flux in kiwifruit. Comparative promoter analysis identified potential NAC (for no apical meristem [NAM], Arabidopsis transcription activation factor [ATAF], and cup-shaped cotyledon [CUC])-domain transcription factor) and ETHYLENE-INSENSITIVE3-like transcription factor (TF) binding sites in the AaTPS1 promoter, and cloned members of both TF classes were able to activate the AaTPS1 promoter in transient assays. Electrophoretic mobility shift assays showed that AaNAC2, AaNAC3, and AaNAC4 bind a 28-bp fragment of the proximal NAC binding site in the AaTPS1 promoter but not the A. chinensis AcTPS1 promoter, where the NAC binding site was mutated. Activation could be restored by reintroducing multiple repeats of the 12-bp NAC core-binding motif. The absence of NAC transcriptional activation in ripe A. chinensis fruit can account for the low accumulation of AcTPS1 transcript, protein, and monoterpene volatiles in this species. These results indicate the importance of NAC TFs in controlling monoterpene production and other traits in ripening fruits. © 2015 American
Ji, Yingbin; Liu, Jian; Xing, Da
2016-09-01
In plants, extensive efforts have been devoted to understanding the crosstalk between salicylic acid (SA) and jasmonic acid (JA) signaling in pathogen defenses, but this crosstalk has scarcely been addressed during senescence. In this study, the effect of SA application on methyl jasmonate (MeJA)-induced leaf senescence was assessed. We found that low concentrations of SA (1-50 μM) played a delayed role against the senescence promoted by MeJA. Furthermore, low concentrations of SA enhanced plant antioxidant defenses and restricted reactive oxygen species (ROS) accumulation in MeJA-treated leaves. When applied simultaneously with MeJA, low concentrations of SA triggered a nitric oxide (NO) burst, and the elevated NO levels were linked to the nitric oxide associated 1 (NOA1)-dependent pathway via nitric oxide synthase (NOS) activity. The ability of SA to up-regulate plant antioxidant defenses, reduce ROS accumulation, and suppress leaf senescence was lost in NO-deficient Atnoa1 plants. In a converse manner, exogenous addition of NO donors increased the plant antioxidant capacity and lowered the ROS levels in MeJA-treated leaves. Taken together, the results indicate that SA at low concentrations counteracts MeJA-induced leaf senescence through NOA1-dependent NO signaling and strengthening of the antioxidant defense. © The Author 2016. Published by Oxford University Press on behalf of the Society for Experimental Biology. All rights reserved. For permissions, please email: journals.permissions@oup.com.
Cloning and expression of pineapple sucrosephosphate synthase ...
African Journals Online (AJOL)
A 1132-base pairs (bp) polymerase-chain-reaction product of sucrose-phosphate synthase (SPS) (EC 2.3.1.14) from pineapple (Ananas comosus cv. Comte de paris) fruit was cloned and nominated as Ac- SPS1. The sequence encodes a putative 377 amino acids protein containing two serine conserved features that had ...
Radwan, Alzahraa; Kleinwächter, Maik; Selmar, Dirk
2017-09-01
In previous experiments, we demonstrated that the amount of monoterpenes in sage is increased massively by drought stress. Our current study is aimed to elucidate whether this increase is due, at least in part, to elevated activity of the monoterpene synthases responsible for the biosynthesis of essential oils in sage. Accordingly, the transcription rates of the monoterpene synthases were analyzed. Salvia officinalis plants were cultivated under moderate drought stress. The concentrations of monoterpenes as well as the expression of the monoterpene synthases were analyzed. The amount of monoterpenes massively increased in response to drought stress; it doubled after just two days of drought stress. The observed changes in monoterpene content mostly match with the patterns of monoterpene synthase expressions. The expression of bornyl diphosphate synthase was strongly up-regulated; its maximum level was reached after two days. Sabinene synthase increased gradually and reached a maximum after two weeks. In contrast, the transcript level of cineole synthase continuously declined. This study revealed that the stress related increase of biosynthesis is not only due to a "passive" shift caused by the stress related over-reduced status, but also is due - at least in part-to an "active" up-regulation of the enzymes involved. Copyright © 2017 Elsevier Ltd. All rights reserved.
Creation of a high-amylose durum wheat through mutagenesis of starch synthase II (SSIIa)
In cereal seeds mutations in one or more starch synthases lead to decreased amylopectin and increased amylose content. Here, the impact of starch synthase IIa (SSIIa or SGP-1) mutations upon durum starch was investigated. A screen of durum accessions identified two lines lacking SGP-A1, the A geno...
Clay, Nicole K; Nelson, Timothy
2005-06-01
Polar auxin transport has been implicated in the induction of vascular tissue and in the definition of vein positions. Leaves treated with chemical inhibitors of polar auxin transport exhibited vascular phenotypes that include increased vein thickness and vascularization. We describe a recessive mutant, thickvein (tkv), which develops thicker veins in leaves and in inflorescence stems. The increased vein thickness is attributable to an increased number of vascular cells. Mutant plants have smaller leaves and shorter inflorescence stems, and this reduction in organ size and height is accompanied by an increase in organ vascularization, which appears to be attributable to an increase in the recruitment of cells into veins. Furthermore, although floral development is normal, auxin transport in the inflorescence stem is significantly reduced in the mutant, suggesting that the defect in auxin transport is responsible for the vascular phenotypes. In the primary root, the veins appear morphologically normal, but root growth in the tkv mutant is hypersensitive to exogenous cytokinin. The tkv mutation was found to reside in the ACL5 gene, which encodes a spermine synthase and whose expression is specific to provascular cells. We propose that ACL5/TKV is involved in vein definition (defining the boundaries between veins and nonvein regions) and in polar auxin transport, and that polyamines are involved in this process.
Directory of Open Access Journals (Sweden)
Edgardo Federico Alfano
2015-12-01
Full Text Available Lumazine synthase from Brucella spp. (BLS is a highly immunogenic decameric protein which can accommodate foreign polypeptides or protein domains fused to its N-termini, markedly increasing their immunogenicity.The inner core domain (VP8d of VP8 spike protein from bovine rotavirus (BRV is responsible for viral adhesion to sialic acid residues and infection. It also displays neutralizing epitopes, making it a good candidate for vaccination.In this work, the BLS scaffold was assessed for the first time in plants for recombinant vaccine development by N-terminally fusing BLS to VP8d and expressing the resulting fusion (BLSVP8d in tobacco chloroplasts. Transplastomic plants were obtained and characterized by Southern, northern and western blot. BLSVP8d was highly expressed, representing 40% of total soluble protein (TSP (4.85 mg/g fresh tissue. BLSVP8d remained soluble and stable during all stages of plant development and even in lyophilized leaves stored at room temperature. Soluble protein extracts from fresh and lyophilized leaves were able to induce specific neutralizing IgY antibodies in a laying hen model. This work presents BLS as an interesting platform for highly immunogenic injectable, or even oral, subunit vaccines. Lyophilization of transplastomic leaves expressing stable antigenic fusions to BLS would further reduce costs and simplify downstream processing, purification and storage, allowing for more practical vaccines.
Identification of a novel CoA synthase isoform, which is primarily expressed in Brain
International Nuclear Information System (INIS)
Nemazanyy, Ivan; Panasyuk, Ganna; Breus, Oksana; Zhyvoloup, Alexander; Filonenko, Valeriy; Gout, Ivan T.
2006-01-01
CoA and its derivatives Acetyl-CoA and Acyl-CoA are important players in cellular metabolism and signal transduction. CoA synthase is a bifunctional enzyme which mediates the final stages of CoA biosynthesis. In previous studies, we have reported molecular cloning, biochemical characterization, and subcellular localization of CoA synthase (CoASy). Here, we describe the existence of a novel CoA synthase isoform, which is the product of alternative splicing and possesses a 29aa extension at the N-terminus. We termed it CoASy β and originally identified CoA synthase, CoASy α. The transcript specific for CoASy β was identified by electronic screening and by RT-PCR analysis of various rat tissues. The existence of this novel isoform was further confirmed by immunoblot analysis with antibodies directed to the N-terminal peptide of CoASy β. In contrast to CoASy α, which shows ubiquitous expression, CoASy β is primarily expressed in Brain. Using confocal microscopy, we demonstrated that both isoforms are localized on mitochondria. The N-terminal extension does not affect the activity of CoA synthase, but possesses a proline-rich sequence which can bring the enzyme into complexes with signalling proteins containing SH3 or WW domains. The role of this novel isoform in CoA biosynthesis, especially in Brain, requires further elucidation
Díaz-Pérez, A J; Sharifi-Tehrani, M; Inda, L A; Catalán, P
2014-10-01
The fine-leaved Loliinae is one of the temperate grass lineages that is richest in number of evolutionary switches from perennial to annual life-cycle, and also shows one of the most complex reticulate patterns involving distinct diploid and allopolyploid lineages. Eight distinct annual lineages, that have traditionally been placed in the genus Vulpia and in other fine-leaved ephemeral genera, have apparently emerged from different perennial Festuca ancestors. The phenotypically similar Vulpia taxa have been reconstructed as polyphyletic, with polyploid lineages showing unclear relationships to their purported diploid relatives. Interspecific and intergeneric hybridization is, however, rampant across different lineages. An evolutionary analysis based on cloned nuclear low-copy GBSSI (Granule-Bound Starch Synthase I) and multicopy ITS (Internal Transcribed Spacer) sequences has been conducted on representatives of most Vulpia species and other fine-leaved lineages, using Bayesian consensus and agreement trees, networking split graphs and species tree-based approaches, to disentangle their phylogenetic relationships and to identify the parental genome donors of the allopolyploids. Both data sets were able to reconstruct a congruent phylogeny in which Vulpia was resolved as polyphyletic from at least three main ancestral diploid lineages. These, in turn, participated in the origin of the derived allopolyploid Vulpia lineages together with other Festuca-like, Psilurus-like and some unknown genome donors. Long-distance dispersal events were inferred to explain the polytopic origin of the Mediterranean and American Vulpia lineages. Copyright © 2014 Elsevier Inc. All rights reserved.
Giri, Sib Sankar; Sen, Shib Sankar; Chi, Cheng; Kim, Hyoun Joong; Yun, Saekil; Park, Se Chang; Sukumaran, V
2015-10-01
The present study aimed to evaluate the effects of Psidium guajava L. (guava) leaves on the growth and immune response of the fish species Labeo rohita and its susceptibility to Aeromonas hydrophila infection. Diets containing five different concentrations of guava leaves (0% [basal diet], 0.1% [G1], 0.5% [G2], 1% [G3], and 1.5% [G4]) were fed to fish (average weight: 11.1 g) for 60 days. Various growth and immune parameters were examined 60 days post-feeding. Fish were challenged with A. hydrophila at the end of the trial, and mortalities were recorded over 15 days post-infection. We found that growth parameters such as percent weight gain (657.61 ± 9.74) and specific growth rate (3.37 ± 0.021) were significantly higher in G2 group than in the control (P guava leaves at any concentration on plasma IgM level. Of the cytokine-related genes examined, interleukin-1beta (IL-1β) and tumour necrosis factor-alpha (TNF-α) were up-regulated in the head-kidney, intestine, and hepatopancreas of fish fed experimental diets, and expression was significantly higher in G2 and G3 than in the control group. In contrast, gene expression of IL-10, transforming growth factor-beta (TGF-β), inducible nitric oxide synthase (iNOS), cyclooxygenase-2 (COX-2), and transcription factor nuclear factor-κB (NF-κB) were down-regulated in the treatment groups. Moreover, fish fed the G2 diet exhibited a significantly higher post-challenge survival rate (66.66%). Collectively, these results suggest that dietary supplementation with guava leaves (at 0.5% concentration) could promote growth performance and strengthen immunity of L. rohita. Guava leaves therefore represent a promising feed additive for carps in aquaculture. Copyright © 2015 Elsevier Ltd. All rights reserved.
[Precautionary maternity leave in Tirol].
Ludescher, K; Baumgartner, E; Roner, A; Brezinka, C
1998-01-01
Under Austrian law, precautionary maternity leave is a decree issued by the district public health physician. It forbids a pregnant woman to work and mandates immediate maternity leave. Regular maternity leave for all women employed in all jobs begins at 32 weeks of gestation. Women who work in workplaces deemed dangerous and women with a history of obstetric problems such as premature or growth-retarded babies from previous pregnancies are regularly 'sent' into precautionary maternity leave. The public health physicians of Tirol's nine administrative districts were interviewed and supplied data on precautionary maternity leave from their districts. In 100 women who attended the clinic for pregnancies at risk of the Obstetrics/Gynecology Department of Innsbruck University Hospital and who had already obtained precautionary maternity leave, the medical/administrative procedure was studied in each case and correlated with pregnancy outcome. The town district of Innsbruck and the district that comprises the suburbs of the provincial capital had the highest rates of precautionary maternity leave. The town district of Innsbruck had a rate of 24.3% of all pregnant women (employed and not employed) in precautionary maternity leave in 1997, whereas the whole province of Tirol had 13.4%. More than 80% of decrees for precautionary maternity leave are issued by district public health physicians on the basis of written recommendations from gynecologists. One third of women who are sent into precautionary maternity leave are issued the decree prior to 12 weeks of gestation - mostly cases of multiple pregnancies and women with previous miscarriages. The present system of precautionary maternity leave appears to work in the sense that most working pregnant women with risk factors are correctly identified - with most errors on the side of caution. As the system also helps employers - the employee's pay is paid from the federal family support fund and state insurance once she is in
Parental leave and child health.
Ruhm, C J
2000-11-01
This study investigates whether rights to parental leave improve pediatric health. Aggregate data are used for 16 European countries over the 1969 through 1994 period. More generous paid leave is found to reduce deaths of infants and young children. The magnitudes of the estimated effects are substantial, especially where a causal effect of leave is most plausible. In particular, there is a much stronger negative relationship between leave durations and post-neonatal or child fatalities than for perinatal mortality, neonatal deaths, or low birth weight. The evidence further suggests that parental leave may be a cost-effective method of bettering child health.
The subcellular localization of yeast glycogen synthase is dependent upon glycogen content
Wilson, Wayne A.; Boyer, Michael P.; Davis, Keri D.; Burke, Michael; Roach, Peter J.
2010-01-01
The budding yeast, Saccharomyces cerevisiae, accumulates the storage polysaccharide glycogen in response to nutrient limitation. Glycogen synthase, the major form of which is encoded by the GSY2 gene, catalyzes the key regulated step in glycogen storage. Here, we utilize Gsy2p fusions to green fluorescent protein (GFP) to determine where glycogen synthase is located within cells. We demonstrate that the localization pattern of Gsy2-GFP depends upon the glycogen content of the cell. When glyco...
Kita, Tomoko; Komatsu, Katsuko; Zhu, Shu; Iida, Osamu; Sugimura, Koji; Kawahara, Nobuo; Taguchi, Hiromu; Masamura, Noriya; Cai, Shao-Qing
2016-03-01
Various Curcuma rhizomes have been used as medicines or spices in Asia since ancient times. It is very difficult to distinguish them morphologically, especially when they are boiled and dried, which causes misidentification leading to a loss of efficacy. We developed a method for discriminating Curcuma species by intron length polymorphism markers in genes encoding diketide-CoA synthase and curcumin synthase. This method could apply to identification of not only fresh plants but also samples of crude drugs or edible spices. By applying this method to Curcuma specimens and samples, and constructing a dendrogram based on these markers, seven Curcuma species were clearly distinguishable. Moreover, Curcuma longa specimens were geographically distinguishable. On the other hand, Curcuma kwangsiensis (gl type) specimens also showed intraspecies polymorphism, which may have occurred as a result of hybridization with other Curcuma species. The molecular method we developed is a potential tool for global classification of the genus Curcuma. Copyright © 2015 Elsevier Ltd. All rights reserved.
Leaves of Absence. School Law Summary.
National Education Association, Washington, DC. Research Div.
This report contains State-by-State statutory summaries on three types of leaves of absence relating to teachers -- sick leave, maternity leave, and sabbatical leave. Only State laws that have specific reference to one of these three types of leaves of absence are included. Not included are those statutes granting boards of education the general…
International Nuclear Information System (INIS)
Sheorain, V.S.; Ramakrishna, S.; Benjamin, W.B.; Soderling, T.R.
1985-01-01
A multifunctional protein kinase, purified from rat liver as ATP-citrate lyase kinase, has been identified as a glycogen synthase kinase. This kinase catalyzed incorporation of up to 1.5 mol of and]2number 2 PO 4 /mol of synthase subunit associated with a decrease in the glycogen synthase activity ratio from 0.85 to a value of 0.15. Approximately 65-70% of the 34 PO 4 was incorporated into site 3 and 30-35% into site 2 as determined by reverse phase high performance liquid chromatography. This multifunctional kinase was distinguished from glycogen synthase kinase-3 on the basis of nucleotide and protein substrate specificities. Since the phosphate contents in glycogen synthase of sites 3 and 2 are altered in diabetes and by insulin administration, the possible involvement of the multifunctional kinase was explored. Glycogen synthase purified from diabetic rabbits was phosphorylated in vitro by this multifunctional kinase at only 10% of the rate compared to synthase purified from control rabbits. Treatment of the diabetics with insulin restored the synthase to a form that was readily phosphorylated in vitro
From bacterial to human dihydrouridine synthase: automated structure determination
Energy Technology Data Exchange (ETDEWEB)
Whelan, Fiona, E-mail: fiona.whelan@york.ac.uk; Jenkins, Huw T., E-mail: fiona.whelan@york.ac.uk [The University of York, Heslington, York YO10 5DD (United Kingdom); Griffiths, Samuel C. [University of Oxford, Headington, Oxford OX3 7BN (United Kingdom); Byrne, Robert T. [Ludwig-Maximilians-University Munich, Feodor-Lynen-Strasse 25, 81377 Munich (Germany); Dodson, Eleanor J.; Antson, Alfred A., E-mail: fiona.whelan@york.ac.uk [The University of York, Heslington, York YO10 5DD (United Kingdom)
2015-06-30
The crystal structure of a human dihydrouridine synthase, an enzyme associated with lung cancer, with 18% sequence identity to a T. maritima enzyme, has been determined at 1.9 Å resolution by molecular replacement after extensive molecular remodelling of the template. The reduction of uridine to dihydrouridine at specific positions in tRNA is catalysed by dihydrouridine synthase (Dus) enzymes. Increased expression of human dihydrouridine synthase 2 (hDus2) has been linked to pulmonary carcinogenesis, while its knockdown decreased cancer cell line viability, suggesting that it may serve as a valuable target for therapeutic intervention. Here, the X-ray crystal structure of a construct of hDus2 encompassing the catalytic and tRNA-recognition domains (residues 1–340) determined at 1.9 Å resolution is presented. It is shown that the structure can be determined automatically by phenix.mr-rosetta starting from a bacterial Dus enzyme with only 18% sequence identity and a significantly divergent structure. The overall fold of the human Dus2 is similar to that of bacterial enzymes, but has a larger recognition domain and a unique three-stranded antiparallel β-sheet insertion into the catalytic domain that packs next to the recognition domain, contributing to domain–domain interactions. The structure may inform the development of novel therapeutic approaches in the fight against lung cancer.
From bacterial to human dihydrouridine synthase: automated structure determination
International Nuclear Information System (INIS)
Whelan, Fiona; Jenkins, Huw T.; Griffiths, Samuel C.; Byrne, Robert T.; Dodson, Eleanor J.; Antson, Alfred A.
2015-01-01
The crystal structure of a human dihydrouridine synthase, an enzyme associated with lung cancer, with 18% sequence identity to a T. maritima enzyme, has been determined at 1.9 Å resolution by molecular replacement after extensive molecular remodelling of the template. The reduction of uridine to dihydrouridine at specific positions in tRNA is catalysed by dihydrouridine synthase (Dus) enzymes. Increased expression of human dihydrouridine synthase 2 (hDus2) has been linked to pulmonary carcinogenesis, while its knockdown decreased cancer cell line viability, suggesting that it may serve as a valuable target for therapeutic intervention. Here, the X-ray crystal structure of a construct of hDus2 encompassing the catalytic and tRNA-recognition domains (residues 1–340) determined at 1.9 Å resolution is presented. It is shown that the structure can be determined automatically by phenix.mr-rosetta starting from a bacterial Dus enzyme with only 18% sequence identity and a significantly divergent structure. The overall fold of the human Dus2 is similar to that of bacterial enzymes, but has a larger recognition domain and a unique three-stranded antiparallel β-sheet insertion into the catalytic domain that packs next to the recognition domain, contributing to domain–domain interactions. The structure may inform the development of novel therapeutic approaches in the fight against lung cancer
Energy Technology Data Exchange (ETDEWEB)
Morita, Hiroyuki [Mitsubishi Kagaku Institute of Life Sciences (MITILS), 11 Minamiooya, Machida, Tokyo 194-8511 (Japan); Kondo, Shin; Kato, Ryohei [Innovation Center Yokohama, Mitsubishi Chemical Corporation, 1000 Kamoshida, Aoba, Yokohama, Kanagawa 227-8502 (Japan); Wanibuchi, Kiyofumi; Noguchi, Hiroshi [School of Pharmaceutical Sciences, University of Shizuoka, Shizuoka 422-8526 (Japan); Sugio, Shigetoshi, E-mail: sugio.shigetoshi@mw.m-kagaku.co.jp [Innovation Center Yokohama, Mitsubishi Chemical Corporation, 1000 Kamoshida, Aoba, Yokohama, Kanagawa 227-8502 (Japan); Abe, Ikuro, E-mail: sugio.shigetoshi@mw.m-kagaku.co.jp [School of Pharmaceutical Sciences, University of Shizuoka, Shizuoka 422-8526 (Japan); PRESTO, Japan Science and Technology Agency, Kawaguchi, Saitama 332-0012 (Japan); Kohno, Toshiyuki, E-mail: sugio.shigetoshi@mw.m-kagaku.co.jp [Mitsubishi Kagaku Institute of Life Sciences (MITILS), 11 Minamiooya, Machida, Tokyo 194-8511 (Japan)
2007-11-01
Octaketide synthase from A. arborescens has been overexpressed in E. coli, purified and crystallized. Diffraction data have been collected to 2.6 Å. Octaketide synthase (OKS) from Aloe arborescens is a plant-specific type III polyketide synthase that produces SEK4 and SEK4b from eight molecules of malonyl-CoA. Recombinant OKS expressed in Escherichia coli was crystallized by the hanging-drop vapour-diffusion method. The crystals belonged to space group I422, with unit-cell parameters a = b = 110.2, c = 281.4 Å, α = β = γ = 90.0°. Diffraction data were collected to 2.6 Å resolution using synchrotron radiation at BL24XU of SPring-8.
Souza-Moreira, Tatiana M.; Alves, Thaís B.; Pinheiro, Karina A.; Felippe, Lidiane G.; de Lima, Gustavo M. A.; Watanabe, Tatiana F.; Barbosa, Cristina C.; Santos, Vânia A. F. F. M.; Lopes, Norberto P.; Valentini, Sandro R.; Guido, Rafael V. C.; Furlan, Maysa; Zanelli, Cleslei F.
2016-11-01
Among the biologically active triterpenes, friedelin has the most-rearranged structure produced by the oxidosqualene cyclases and is the only one containing a cetonic group. In this study, we cloned and functionally characterized friedelin synthase and one cycloartenol synthase from Maytenus ilicifolia (Celastraceae). The complete coding sequences of these 2 genes were cloned from leaf mRNA, and their functions were characterized by heterologous expression in yeast. The cycloartenol synthase sequence is very similar to other known OSCs of this type (approximately 80% identity), although the M. ilicifolia friedelin synthase amino acid sequence is more related to β-amyrin synthases (65-74% identity), which is similar to the friedelin synthase cloned from Kalanchoe daigremontiana. Multiple sequence alignments demonstrated the presence of a leucine residue two positions upstream of the friedelin synthase Asp-Cys-Thr-Ala-Glu (DCTAE) active site motif, while the vast majority of OSCs identified so far have a valine or isoleucine residue at the same position. The substitution of the leucine residue with valine, threonine or isoleucine in M. ilicifolia friedelin synthase interfered with substrate recognition and lead to the production of different pentacyclic triterpenes. Hence, our data indicate a key role for the leucine residue in the structure and function of this oxidosqualene cyclase.
Clay, Nicole K.; Nelson, Timothy
2005-01-01
Polar auxin transport has been implicated in the induction of vascular tissue and in the definition of vein positions. Leaves treated with chemical inhibitors of polar auxin transport exhibited vascular phenotypes that include increased vein thickness and vascularization. We describe a recessive mutant, thickvein (tkv), which develops thicker veins in leaves and in inflorescence stems. The increased vein thickness is attributable to an increased number of vascular cells. Mutant plants have smaller leaves and shorter inflorescence stems, and this reduction in organ size and height is accompanied by an increase in organ vascularization, which appears to be attributable to an increase in the recruitment of cells into veins. Furthermore, although floral development is normal, auxin transport in the inflorescence stem is significantly reduced in the mutant, suggesting that the defect in auxin transport is responsible for the vascular phenotypes. In the primary root, the veins appear morphologically normal, but root growth in the tkv mutant is hypersensitive to exogenous cytokinin. The tkv mutation was found to reside in the ACL5 gene, which encodes a spermine synthase and whose expression is specific to provascular cells. We propose that ACL5/TKV is involved in vein definition (defining the boundaries between veins and nonvein regions) and in polar auxin transport, and that polyamines are involved in this process. PMID:15894745
Rudolf, Jeffrey D; Dong, Liao-Bin; Cao, Hongnan; Hatzos-Skintges, Catherine; Osipiuk, Jerzy; Endres, Michael; Chang, Chin-Yuan; Ma, Ming; Babnigg, Gyorgy; Joachimiak, Andrzej; Phillips, George N; Shen, Ben
2016-08-31
Terpenoids are the largest and most structurally diverse family of natural products found in nature, yet their presence in bacteria is underappreciated. The carbon skeletons of terpenoids are generated through carbocation-dependent cyclization cascades catalyzed by terpene synthases (TSs). Type I and type II TSs initiate cyclization via diphosphate ionization and protonation, respectively, and protein structures of both types are known. Most plant diterpene synthases (DTSs) possess three α-helical domains (αβγ), which are thought to have arisen from the fusion of discrete, ancestral bacterial type I TSs (α) and type II TSs (βγ). Type II DTSs of bacterial origin, of which there are no structurally characterized members, are a missing piece in the structural evolution of TSs. Here, we report the first crystal structure of a type II DTS from bacteria. PtmT2 from Streptomyces platensis CB00739 was verified as an ent-copalyl diphosphate synthase involved in the biosynthesis of platensimycin and platencin. The crystal structure of PtmT2 was solved at a resolution of 1.80 Å, and docking studies suggest the catalytically active conformation of geranylgeranyl diphosphate (GGPP). Site-directed mutagenesis confirmed residues involved in binding the diphosphate moiety of GGPP and identified DxxxxE as a potential Mg(2+)-binding motif for type II DTSs of bacterial origin. Finally, both the shape and physicochemical properties of the active sites are responsible for determining specific catalytic outcomes of TSs. The structure of PtmT2 fundamentally advances the knowledge of bacterial TSs, their mechanisms, and their role in the evolution of TSs.
Mizuno, Kouhei; Kihara, Takahiro; Tsuge, Takeharu; Lundgren, Benjamin R; Sarwar, Zaara; Pinto, Atahualpa; Nomura, Christopher T
2017-01-01
Many microorganisms harbor genes necessary to synthesize biodegradable plastics known as polyhydroxyalkanoates (PHAs). We surveyed a genomic database and discovered a new cluster of class IV PHA synthase genes (phaRC). These genes are different in sequence and operon structure from any previously reported PHA synthase. The newly discovered PhaRC synthase was demonstrated to produce PHAs in recombinant Escherichia coli.
Gas-Pascual, Elisabet; Berna, Anne; Bach, Thomas J; Schaller, Hubert
2014-01-01
The plant sterol pathway exhibits a major biosynthetic difference as compared with that of metazoans. The committed sterol precursor is the pentacyclic cycloartenol (9β,19-cyclolanost-24-en-3β-ol) and not lanosterol (lanosta-8,24-dien-3β-ol), as it was shown in the late sixties. However, plant genome mining over the last years revealed the general presence of lanosterol synthases encoding sequences (LAS1) in the oxidosqualene cyclase repertoire, in addition to cycloartenol synthases (CAS1) and to non-steroidal triterpene synthases that contribute to the metabolic diversity of C30H50O compounds on earth. Furthermore, plant LAS1 proteins have been unambiguously identified by peptidic signatures and by their capacity to complement the yeast lanosterol synthase deficiency. A dual pathway for the synthesis of sterols through lanosterol and cycloartenol was reported in the model Arabidopsis thaliana, though the contribution of a lanosterol pathway to the production of 24-alkyl-Δ(5)-sterols was quite marginal (Ohyama et al. (2009) PNAS 106, 725). To investigate further the physiological relevance of CAS1 and LAS1 genes in plants, we have silenced their expression in Nicotiana benthamiana. We used virus induced gene silencing (VIGS) based on gene specific sequences from a Nicotiana tabacum CAS1 or derived from the solgenomics initiative (http://solgenomics.net/) to challenge the respective roles of CAS1 and LAS1. In this report, we show a CAS1-specific functional sterol pathway in engineered yeast, and a strict dependence on CAS1 of tobacco sterol biosynthesis.
Non-bilayer structures in mitochondrial membranes regulate ATP synthase activity.
Gasanov, Sardar E; Kim, Aleksandr A; Yaguzhinsky, Lev S; Dagda, Ruben K
2018-02-01
Cardiolipin (CL) is an anionic phospholipid at the inner mitochondrial membrane (IMM) that facilitates the formation of transient non-bilayer (non-lamellar) structures to maintain mitochondrial integrity. CL modulates mitochondrial functions including ATP synthesis. However, the biophysical mechanisms by which CL generates non-lamellar structures and the extent to which these structures contribute to ATP synthesis remain unknown. We hypothesized that CL and ATP synthase facilitate the formation of non-bilayer structures at the IMM to stimulate ATP synthesis. By using 1 H NMR and 31 P NMR techniques, we observed that increasing the temperature (8°C to 37°C), lowering the pH (3.0), or incubating intact mitochondria with CTII - an IMM-targeted toxin that increases the formation of immobilized non-bilayer structures - elevated the formation of non-bilayer structures to stimulate ATP synthesis. The F 0 sector of the ATP synthase complex can facilitate the formation of non-bilayer structures as incubating model membranes enriched with IMM-specific phospholipids with exogenous DCCD-binding protein of the F 0 sector (DCCD-BPF) elevated the formation of immobilized non-bilayer structures to a similar manner as CTII. Native PAGE assays revealed that CL, but not other anionic phospholipids, specifically binds to DCCD-BPF to promote the formation of stable lipid-protein complexes. Mechanistically, molecular docking studies identified two lipid binding sites for CL in DCCD-BPF. We propose a new model of ATP synthase regulation in which CL mediates the formation of non-bilayer structures that serve to cluster protons and ATP synthase complexes as a mechanism to enhance proton translocation to the F 0 sector, and thereby increase ATP synthesis. Copyright © 2017 Elsevier B.V. All rights reserved.
Misra, Rajesh Chandra; Garg, Anchal; Roy, Sudeep; Chanotiya, Chandan Singh; Vasudev, Prema G; Ghosh, Sumit
2015-11-01
Ent-labdane-related diterpene (ent-LRD) specialized (i.e. secondary) metabolites of the medicinal plant kalmegh (Andrographis paniculata) have long been known for several pharmacological activities. However, our understanding of the ent-LRD biosynthetic pathway has remained largely incomplete. Since ent-LRDs accumulate in leaves, we carried out a comparative transcriptional analysis using leaf and root tissues, and identified 389 differentially expressed transcripts, including 223 transcripts that were preferentially expressed in leaf tissue. Analysis of the transcripts revealed various specialized metabolic pathways, including transcripts of the ent-LRD biosynthetic pathway. Two class II diterpene synthases (ApCPS1 and ApCPS2) along with one (ApCPS1') and two (ApCPS2' and ApCPS2″) transcriptional variants that were the outcomes of alternative splicing of the precursor mRNA and alternative transcriptional termination, respectively, were identified. ApCPS1 and ApCPS2 encode for 832- and 817-amino acids proteins, respectively, and are phylogenetically related to the dicotyledons ent-copalyl diphosphate synthases (ent-CPSs). The spatio-temporal patterns of ent-LRD metabolites accumulation and gene expression suggested a likely role for ApCPS1 in general (i.e. primary) metabolism, perhaps by providing precursor for the biosynthesis of phytohormone gibberellin (GA). However, ApCPS2 is potentially involved in tissue-specific accumulation of ent-LRD specialized metabolites. Bacterially expressed recombinant ApCPS2 catalyzed the conversion of (E,E,E)-geranylgeranyl diphosphate (GGPP), the general precursor of diterpenes to ent-copalyl diphosphate (ent-CPP), the precursor of ent-LRDs. Taken together, these results advance our understanding of the tissue-specific accumulation of specialized ent-LRDs of medicinal importance. Copyright © 2015 Elsevier Ireland Ltd. All rights reserved.
Nieuwenhuizen, Niels J.; Chen, Xiuyin; Wang, Mindy Y.; Matich, Adam J.; Perez, Ramon Lopez; Allan, Andrew C.; Green, Sol A.; Atkinson, Ross G.
2015-01-01
Two kiwifruit (Actinidia) species with contrasting terpene profiles were compared to understand the regulation of fruit monoterpene production. High rates of terpinolene production in ripe Actinidia arguta fruit were correlated with increasing gene and protein expression of A. arguta terpene synthase1 (AaTPS1) and correlated with an increase in transcript levels of the 2-C-methyl-d-erythritol 4-phosphate pathway enzyme 1-deoxy-d-xylulose-5-phosphate synthase (DXS). Actinidia chinensis terpene synthase1 (AcTPS1) was identified as part of an array of eight tandemly duplicated genes, and AcTPS1 expression and terpene production were observed only at low levels in developing fruit. Transient overexpression of DXS in Nicotiana benthamiana leaves elevated monoterpene synthesis by AaTPS1 more than 100-fold, indicating that DXS is likely to be the key step in regulating 2-C-methyl-d-erythritol 4-phosphate substrate flux in kiwifruit. Comparative promoter analysis identified potential NAC (for no apical meristem [NAM], Arabidopsis transcription activation factor [ATAF], and cup-shaped cotyledon [CUC])-domain transcription factor) and ETHYLENE-INSENSITIVE3-like transcription factor (TF) binding sites in the AaTPS1 promoter, and cloned members of both TF classes were able to activate the AaTPS1 promoter in transient assays. Electrophoretic mobility shift assays showed that AaNAC2, AaNAC3, and AaNAC4 bind a 28-bp fragment of the proximal NAC binding site in the AaTPS1 promoter but not the A. chinensis AcTPS1 promoter, where the NAC binding site was mutated. Activation could be restored by reintroducing multiple repeats of the 12-bp NAC core-binding motif. The absence of NAC transcriptional activation in ripe A. chinensis fruit can account for the low accumulation of AcTPS1 transcript, protein, and monoterpene volatiles in this species. These results indicate the importance of NAC TFs in controlling monoterpene production and other traits in ripening fruits. PMID:25649633
Producing biofuels using polyketide synthases
Katz, Leonard; Fortman, Jeffrey L; Keasling, Jay D
2013-04-16
The present invention provides for a non-naturally occurring polyketide synthase (PKS) capable of synthesizing a carboxylic acid or a lactone, and a composition such that a carboxylic acid or lactone is included. The carboxylic acid or lactone, or derivative thereof, is useful as a biofuel. The present invention also provides for a recombinant nucleic acid or vector that encodes such a PKS, and host cells which also have such a recombinant nucleic acid or vector. The present invention also provides for a method of producing such carboxylic acids or lactones using such a PKS.
Yin, Jun-Lin; Wong, Woon-Seng; Jang, In-Cheol; Chua, Nam-Hai
2017-02-01
Monoterpenes are important for plant survival and useful to humans. In addition to their function in plant defense, monoterpenes are also used as flavors, fragrances and medicines. Several metabolic engineering strategies have been explored to produce monoterpene in tobacco but only trace amounts of monoterpenes have been detected. We investigated the effects of Solanum lycopersicum 1-deoxy-d-xylulose-5-phosphate synthase (SlDXS), Arabidopsis thaliana geranyl diphosphate synthase 1 (AtGPS) and Mentha × piperita geranyl diphosphate synthase small subunit (MpGPS.SSU) on production of monoterpene and geranylgeranyl diphosphate (GGPP) diversities, and plant morphology by transient expression in Nicotiana benthamiana and overexpression in transgenic Nicotiana tabacum. We showed that MpGPS.SSU could enhance the production of various monoterpenes such as (-)-limonene, (-)-linalool, (-)-α-pinene/β-pinene or myrcene, in transgenic tobacco by elevating geranyl diphosphate synthase (GPS) activity. In addition, overexpression of MpGPS.SSU in tobacco caused early flowering phenotype and increased shoot branching by elevating contents of GA 3 and cytokinins due to upregulated transcript levels of several plastidic 2-C-methyl-d-erythritol-4-phosphate (MEP) pathway genes, geranylgeranyl diphosphate synthases 3 (GGPPS3) and GGPPS4. Our method would allow the identification of new monoterpene synthase genes using transient expression in N. benthamiana and the improvement of monoterpene production in transgenic tobacco plants. © 2016 The Authors. New Phytologist © 2016 New Phytologist Trust.
PCR cloning of Polyhydroxybutyrate Synthase Gene (phbC) from Aeromonashydrophila
International Nuclear Information System (INIS)
Enan, M. R.; Bashandy, S.A.
2006-01-01
Plastic wastes are considered to be severe environmental contaminantscausing waste disposal problems. Widespread use of biodegradable plastics isone of the solutions, but it is limited by high production cost. A polymerasechain reaction (PCR) protocol was developed for the specific for the specificdetection and isolation of full-length gene coding for polyhydroxybutyrate(PBH). (PCR) strategy using (PHB) primers resulted in the amplification of(DNA) fragments with the expected size from all isolated bacteria (PBH)synthase gene was cloned directly from Aeromonas hydrophila genome for thefirst time. The clonec fragment was named (phbCAh) gene exhibits similarly to(PHB) synthase genes of Alcaligenes latus and Pseudomonas oleovorans (97%),Alcaligenes sp. (81%) and Comamonas acidovorans (84%). (author)
Directory of Open Access Journals (Sweden)
Vannozzi Alessandro
2012-08-01
Full Text Available Abstract Background Plant stilbenes are a small group of phenylpropanoids, which have been detected in at least 72 unrelated plant species and accumulate in response to biotic and abiotic stresses such as infection, wounding, UV-C exposure and treatment with chemicals. Stilbenes are formed via the phenylalanine/polymalonate-route, the last step of which is catalyzed by the enzyme stilbene synthase (STS, a type III polyketide synthase (PKS. Stilbene synthases are closely related to chalcone synthases (CHS, the key enzymes of the flavonoid pathway, as illustrated by the fact that both enzymes share the same substrates. To date, STSs have been cloned from peanut, pine, sorghum and grapevine, the only stilbene-producing fruiting-plant for which the entire genome has been sequenced. Apart from sorghum, STS genes appear to exist as a family of closely related genes in these other plant species. Results In this study a complete characterization of the STS multigenic family in grapevine has been performed, commencing with the identification, annotation and phylogenetic analysis of all members and integration of this information with a comprehensive set of gene expression analyses including healthy tissues at differential developmental stages and in leaves exposed to both biotic (downy mildew infection and abiotic (wounding and UV-C exposure stresses. At least thirty-three full length sequences encoding VvSTS genes were identified, which, based on predicted amino acid sequences, cluster in 3 principal groups designated A, B and C. The majority of VvSTS genes cluster in groups B and C and are located on chr16 whereas the few gene family members in group A are found on chr10. Microarray and mRNA-seq expression analyses revealed different patterns of transcript accumulation between the different groups of VvSTS family members and between VvSTSs and VvCHSs. Indeed, under certain conditions the transcriptional response of VvSTS and VvCHS genes appears to be
Azarpira, Negar; Namazi, Soha; Malahi, Sayan; Kazemi, Kourosh
2016-06-01
Polymorphisms of the endothelial nitric oxide synthase gene have been associated with altered endothelial nitric oxide synthase activity. The purpose of this study was to investigate the relation between endothelial nitric oxide synthase -786T/C and 894G/T polymorphism and their haplotypes on the occurrence of acute rejection episodes in liver transplant recipients. We conducted a case control study in which 100 liver transplant recipients and 100 healthy controls were recruited from Shiraz Transplant Center. The patients used triple therapy including tacrolimus, mycophenolate mofetil, and prednisolone for immunosuppression maintenance. DNA was extracted from peripheral blood and endothelial nitric oxide synthase polymorphisms were determined by polymerase chain reaction and restriction fragment length polymorphism. Patients included 60 men and 40 women (mean age, 32.35 ± 10.2 y). There was a significant association of endothelial nitric oxide synthase 894G/T and acute rejection episode. The GT* gen-otype and acute rejection episodes had a significant association (odds ratio, 2.42; 95% confidence interval, 0.97-6.15; P = .03). The GG and GT* genotype and T* allele frequency were significantly different between patients and control subjects (P = .001). Haplotype TT* was higher in recipients than control subjects (odds ratio, 2.17; 95% confidence interval, 1.12-4.25; P = .01). Haplotype TG was higher in the control group (odds ratio, 0.62; 95% confidence interval, 0.40-0.96; P = .02). Our results suggest a relation between different endothelial nitric oxide synthase geno-types and risk of acute rejection episodes. However, further study is necessary to determine genetic susceptibility for transplant patients.
Marsala, Jozef; Lukácová, Nadezda; Cízková, Dása; Lukác, Imrich; Kuchárová, Karolína; Marsala, Martin
2004-03-01
In this study we investigate the occurrence and origin of punctate nitric oxide synthase immunoreactivity in the neuropil of the ventral motor nucleus in C7-Th1 segments of the dog spine, which are supposed to be the terminal field of an ascending premotor propriospinal nitric oxide synthase-immunoreactive pathway. As the first step, nitric oxide synthase immunohistochemistry was used to distinguish nitric oxide synthase-immunoreactive staining of the ventral motor nucleus. Dense, punctate nitric oxide synthase immunoreactivity was found on control sections in the neuropil of the ventral motor nucleus. After hemisection at Th10-11, axotomy-induced retrograde changes consisting in a strong upregulation of nitric oxide synthase-containing neurons were found mostly unilaterally in lamina VIII, the medial part of lamina VII and in the pericentral region in all segments of the lumbosacral enlargement. Concurrently, a strong depletion of the punctate nitric oxide synthase immunopositivity in the neuropil of the ventral motor nucleus ipsilaterally with the hemisection was detected, thus revealing that an uncrossed ascending premotor propriospinal pathway containing a fairly high number of nitric oxide synthase-immunoreactive fibers terminates in the ventral motor nucleus. Application of the retrograde fluorescent tracer Fluorogold injected into the ventral motor nucleus and analysis of alternate sections processed for nitric oxide synthase immunocytochemistry revealed the presence of Fluorogold-labeled and nitric oxide synthase-immunoreactive axons in the ventrolateral funiculus and in the lateral and medial portions of the ventral column throughout the thoracic and upper lumbar segments. A noticeable number of Fluorogold-labeled and nitric oxide synthase-immunoreactive somata detected on consecutive sections were found in the lumbosacral enlargement, mainly in laminae VIII-IX, the medial part of lamina VII and in the pericentral region (lamina X), ipsilaterally with the
2007-01-01
As announced at the meeting of the Standing Concertation Committee (SCC) on 26 June 2007 and in http://Bulletin No. 28/2007, the existing Saved Leave Scheme will be discontinued as of 31 December 2007. Staff participating in the Scheme will shortly receive a contract amendment stipulating the end of financial contributions compensated by save leave. Leave already accumulated on saved leave accounts can continue to be taken in accordance with the rules applicable to the current scheme. A new system of saved leave will enter into force on 1 January 2008 and will be the subject of a new implementation procedure entitled "Short-term saved leave scheme" dated 1 January 2008. At its meeting on 4 December 2007, the SCC agreed to recommend the Director-General to approve this procedure, which can be consulted on the HR Department’s website at the following address: https://cern.ch/hr-services/services-Ben/sls_shortterm.asp All staff wishing to participate in the new scheme a...
HR Department
2007-01-01
As announced at the meeting of the Standing Concertation Committee (SCC) on 26 June 2007 and in http://Bulletin No. 28/2007, the existing Saved Leave Scheme will be discontinued as of 31 December 2007. Staff participating in the Scheme will shortly receive a contract amendment stipulating the end of financial contributions compensated by save leave. Leave already accumulated on saved leave accounts can continue to be taken in accordance with the rules applicable to the current scheme. A new system of saved leave will enter into force on 1 January 2008 and will be the subject of a new im-plementation procedure entitled "Short-term saved leave scheme" dated 1 January 2008. At its meeting on 4 December 2007, the SCC agreed to recommend the Director-General to approve this procedure, which can be consulted on the HR Department’s website at the following address: https://cern.ch/hr-services/services-Ben/sls_shortterm.asp All staff wishing to participate in the new scheme ...
DEFF Research Database (Denmark)
González-Mellado, Damián; von Wettstein, Penny; Garcés, Rafael
2010-01-01
The ß-ketoacyl-acyl carrier protein synthase III (KAS III; EC 2.3.1.180) is a condensing enzyme catalyzing the initial step of fatty acid biosynthesis using acetyl-CoA as primer. To determine the mechanisms involved in the biosynthesis of fatty acids in sunflower (Helianthus annuus L.) developing...... seeds, a cDNA coding for HaKAS III (EF514400) was isolated, cloned and sequenced. Its protein sequence is as much as 72% identical to other KAS III-like ones such as those from Perilla frutescens, Jatropha curcas, Ricinus communis or Cuphea hookeriana. Phylogenetic study of the HaKAS III homologous...... proteins infers its origin from cyanobacterial ancestors. A genomic DNA gel blot analysis revealed that HaKAS III is a single copy gene. Expression levels of this gene, examined by Q-PCR, revealed higher levels in developing seeds storing oil than in leaves, stems, roots or seedling cotyledons...
2010-01-01
... needs of individual emergency leave recipients, an employing agency may allow an employee to receive... annual leave received by an emergency leave recipient. 630.1111 Section 630.1111 Administrative Personnel... recipient. An emergency leave recipient may receive a maximum of 240 hours of donated annual leave at any...
Toroser, D.; McMichael, R. Jr; Krause, K. P.; Kurreck, J.; Sonnewald, U.; Stitt, M.; Huber, S. C.; Davies, E. (Principal Investigator)
1999-01-01
Site-directed mutagenesis of spinach sucrose-phosphate synthase (SPS) was performed to investigate the role of Ser158 in the modulation of spinach leaf SPS. Tobacco plants expressing the spinach wild-type (WT), S158A, S158T and S157F/S158E SPS transgenes were produced. Expression of transgenes appeared not to reduce expression of the tobacco host SPS. SPS activity in the WT and the S158T SPS transgenics showed light/dark modulation, whereas the S158A and S157F/S158E mutants were not similarly light/dark modulated: the S158A mutant enzyme was not inactivated in the dark, and the S157F/S158E was not activated in the light. The inability to modulate the activity of the S158A mutant enzyme by protein phosphorylation was demonstrated in vitro. The WT spinach enzyme immunopurified from dark transgenic tobacco leaves had a low initial activation state, and could be activated by PP2A and subsequently inactivated by SPS-kinase plus ATP. Rapid purification of the S158A mutant enzyme from dark leaves of transgenic plants using spinach-specific monoclonal antibodies yielded enzyme that had a high initial activation state, and pre-incubation with leaf PP2A or ATP plus SPS-kinase (the PKIII enzyme) caused little modulation of activity. The results demonstrate the regulatory significance of Ser158 as the major site responsible for dark inactivation of spinach SPS in vivo, and indicate that the significance of phosphorylation is the introduction of a negative charge at the Ser158 position.
Characterising the cellulose synthase complexes of cell walls
Mansoori Zangir, N.
2012-01-01
One of the characteristics of the plant kingdom is the presence of a structural cell wall. Cellulose is a major component in both the primary and secondary cell walls of plants. In higher plants cellulose is synthesized by so called rosette protein complexes with cellulose synthases (CESAs) as
Phytochelatin synthase activity as a marker of metal pollution
Energy Technology Data Exchange (ETDEWEB)
Zitka, Ondrej; Krystofova, Olga; Sobrova, Pavlina [Department of Chemistry and Biochemistry, Faculty of Agronomy, Mendel University in Brno, Zemedelska 1, CZ-613 00 Brno (Czech Republic); Adam, Vojtech [Department of Chemistry and Biochemistry, Faculty of Agronomy, Mendel University in Brno, Zemedelska 1, CZ-613 00 Brno (Czech Republic); Central European Institute of Technology, Brno University of Technology, Technicka 3058/10, CZ-616 00 Brno (Czech Republic); Zehnalek, Josef; Beklova, Miroslava [Department of Chemistry and Biochemistry, Faculty of Agronomy, Mendel University in Brno, Zemedelska 1, CZ-613 00 Brno (Czech Republic); Kizek, Rene, E-mail: kizek@sci.muni.cz [Department of Chemistry and Biochemistry, Faculty of Agronomy, Mendel University in Brno, Zemedelska 1, CZ-613 00 Brno (Czech Republic); Central European Institute of Technology, Brno University of Technology, Technicka 3058/10, CZ-616 00 Brno (Czech Republic)
2011-08-30
Highlights: {yields} New tool for determination of phytochelatin synthase activity. {yields} The optimization of experimental condition for determination of the enzyme activity. {yields} First evaluation of K{sub m} for the enzyme. {yields} The effects of cadmium (II) not only on the activity of the enzyme but also on K{sub m}. -- Abstract: The synthesis of phytochelatins is catalyzed by {gamma}-Glu-Cys dipeptidyl transpeptidase called phytochelatin synthase (PCS). Aim of this study was to suggest a new tool for determination of phytochelatin synthase activity in the tobacco BY-2 cells treated with different concentrations of the Cd(II). After the optimization steps, an experiment on BY-2 cells exposed to different concentrations of Cd(NO{sub 3}){sub 2} for 3 days was performed. At the end of the experiment, cells were harvested and homogenized. Reduced glutathione and cadmium (II) ions were added to the cell suspension supernatant. These mixtures were incubated at 35 {sup o}C for 30 min and analysed using high performance liquid chromatography coupled with electrochemical detector (HPLC-ED). The results revealed that PCS activity rises markedly with increasing concentration of cadmium (II) ions. The lowest concentration of the toxic metal ions caused almost three fold increase in PCS activity as compared to control samples. The activity of PCS (270 fkat) in treated cells was more than seven times higher in comparison to control ones. K{sub m} for PCS was estimated as 2.3 mM.
Phytochelatin synthase activity as a marker of metal pollution
International Nuclear Information System (INIS)
Zitka, Ondrej; Krystofova, Olga; Sobrova, Pavlina; Adam, Vojtech; Zehnalek, Josef; Beklova, Miroslava; Kizek, Rene
2011-01-01
Highlights: → New tool for determination of phytochelatin synthase activity. → The optimization of experimental condition for determination of the enzyme activity. → First evaluation of K m for the enzyme. → The effects of cadmium (II) not only on the activity of the enzyme but also on K m . -- Abstract: The synthesis of phytochelatins is catalyzed by γ-Glu-Cys dipeptidyl transpeptidase called phytochelatin synthase (PCS). Aim of this study was to suggest a new tool for determination of phytochelatin synthase activity in the tobacco BY-2 cells treated with different concentrations of the Cd(II). After the optimization steps, an experiment on BY-2 cells exposed to different concentrations of Cd(NO 3 ) 2 for 3 days was performed. At the end of the experiment, cells were harvested and homogenized. Reduced glutathione and cadmium (II) ions were added to the cell suspension supernatant. These mixtures were incubated at 35 o C for 30 min and analysed using high performance liquid chromatography coupled with electrochemical detector (HPLC-ED). The results revealed that PCS activity rises markedly with increasing concentration of cadmium (II) ions. The lowest concentration of the toxic metal ions caused almost three fold increase in PCS activity as compared to control samples. The activity of PCS (270 fkat) in treated cells was more than seven times higher in comparison to control ones. K m for PCS was estimated as 2.3 mM.
Cloning and Characterization of Two Iridoid Synthase Homologs from Swertia Mussotii
Directory of Open Access Journals (Sweden)
Beibei Xiang
2017-08-01
Full Text Available Swertia mussotii is an important medicinal plant found on the Qinghai Tibetan Plateau that has great economic and medicinal value. This plant has enjoyed a long history of use as a curative for hepatitis. The biological activity of secoiridoids, including gentiopicroside and swertiamarin, has been mainly tested for its anti-hepatitis effects. Here, we identify two candidate genes (SmIS1 and SmIS2 that are homologues of iridoid synthase and that are components of the secoiridoid pathway in S. mussotii. Using sequencing and phylogenetic analyses, we confirm that SmIS1 and SmIS2 contain six conserved short-chain dehydrogenases/reductase (SDR motifs and thus belong to the P5βRs group. The two purified Escherichia coli-expressed proteins reduced 8-oxogeranial to both nepetalactol and iridodials. A comparison of the kinetic parameters of SmIS1 and SmIS2 recombinant proteins revealed that SmIS2 has a lower affinity than SmIS1 for 8-oxogeranial. Transcript levels of the two genes were analysed in three different tissues of S. mussotii using semi-quantitative RT-PCR and RT-qPCR. SmIS1 and SmIS2 expression levels were more abundant in leaves and stems. This investigation adds to our knowledge of P5βRs genes in the secoiridoid synthesis pathway and provides candidate genes for genetically improving S. mussotii by enhancing secondary metabolite production.
International Nuclear Information System (INIS)
Cheng, Xia; Lu, Guangwen; Qi, Jianxun; Cheng, Hao; Gao, Feng; Wang, Jundong; Yan, Jinghua
2010-01-01
Crystals of SAICAR synthase from S. suis serotype 2 were obtained in the presence of 40 mM aspartic acid substrate; they belonged to space group P2 and diffracted to 2.8 Å resolution. Phosphoribosylaminoimidazole-succinocarboxamide synthase (SAICAR synthase) plays an essential role in the de novo biosynthesis of purine nucleotides. In this study, the SAICAR synthase from Streptococcus suis was cloned and overexpressed in Escherichia coli. The subsequent product was purified and crystallized using the hanging-drop vapour-diffusion method. The crystals diffracted to 2.8 Å resolution and belonged to space group P2, with unit-cell parameters a = 70.2, b = 52.2, c = 153.9 Å, β = 102.8°
Paid Maternity Leave and Breastfeeding Outcomes.
Mirkovic, Kelsey R; Perrine, Cria G; Scanlon, Kelley S
2016-09-01
Despite the benefits of breastfeeding, rates in the United States are low. Shorter maternity leave is associated with lower initiation and shorter durations of breastfeeding; however, little is known about how paid maternity leave may influence breastfeeding rates. We used data from the 2006-2010 U.S. National Survey of Family Growth on the most recent birth to employed women who delivered a child within the previous 5 years. Separate multivariable logistic regression models were used to describe the associations between paid leave duration (0, 1-5, 6-11, ≥ 12 weeks, maternity leave not taken) and three outcomes: 1) breastfeeding initiation, 2) 6-month duration, and 3) 6-month duration among initiators. Twenty-eight percent of prenatally employed women received no paid leave. Women who received 12 or more weeks of paid leave were more likely to initiate breastfeeding compared to women with no paid leave (87.3% vs 66.7%, adjusted odds ratio [aOR] 2.83 [95% confidence interval {CI} 1.23-6.48]). Similarly, women with 12 or more weeks of paid leave were more likely to breastfeed at 6 months, compared to women with no paid leave (24.9% vs 50.1%, aOR 2.26 [95% CI 1.20-4.26]). Among women who initiated breastfeeding, having received 12 or more weeks' paid leave increased the odds of breastfeeding for 6 or more months; however, the association was not statistically significant in the adjusted model (aOR 1.81 [95% CI 0.93-3.52]). Employed women who received 12 or more weeks of paid maternity leave were more likely to initiate breastfeeding and be breastfeeding their child at 6 months than those without paid leave. Published 2016. This article is a U.S. Government work and is in the public domain in the USA.
Goodbye, Mandatory Maternity Leaves
Nation's Schools, 1972
1972-01-01
In precedent-setting decrees, courts and federal and State authorities have branded compulsory maternity leaves either unconstitutional or illegal. School administrators are urged to prod boards of education to adopt more lenient maternity leave policies -- now. (Author)
Gupta, Dinesh; Ip, Tina; Summers, Michael L; Basu, Chhandak
2015-01-01
Phytol is a diterpene alcohol of medicinal importance and it also has potential to be used as biofuel. We found over production of phytol in Nostoc punctiforme by expressing a 2-Methyl-3-buten-2-ol (MBO) synthase gene. MBO synthase catalyzes the conversion of dimethylallyl pyrophosphate (DMAPP) into MBO, a volatile hemiterpene alcohol, in Pinus sabiniana. The result of enhanced phytol production in N. punctiforme, instead of MBO, could be explained by one of the 2 models: either the presence of a native prenyltransferase enzyme with a broad substrate specificity, or appropriation of a MBO synthase metabolic intermediate by a native geranyl diphosphate (GDP) synthase. In this work, an expression vector with an indigenous petE promoter for gene expression in the cyanobacterium N. punctiforme was constructed and MBO synthase gene expression was successfully shown using reverse transcriptase (RT)-PCR and SDS-PAGE. Gas chromatography--mass spectrophotometry (GC-MS) was performed to confirm phytol production from the transgenic N. punctiforme strains. We conclude that the expression of MBO synthase in N. punctiforme leads to overproduction of an economically important compound, phytol. This study provides insights about metabolic channeling of isoprenoids in cyanobacteria and also illustrates the challenges of bioengineering non-native hosts to produce economically important compounds.
Studies on the Active Site of Deacetoxycephalosporin C Synthase
Lloyd, Matthew D.; Lee, Hwei-Jen; Harlos, Karl; Zhang, Zhi-Hong; Baldwin, Jack E.; Schofield, Christopher J.; Charnock, John M.; Garner, C. David; Hara, Takane; Terwisscha van Scheltinga, Anke C.; Valegård, Karin; Viklund, Jenny A.C.; Hajdu, Janos; Andersson, Inger; Danielsson, Åke; Bhikhabhai, Rama
1999-01-01
The Fe(II) and 2-oxoglutarate-dependent dioxygenase deacetoxycephalosporin C synthase (DAOCS) from Streptomyces clavuligerus was expressed at ca 25% of total soluble protein in Escherichia coli and purified by an efficient large-scale procedure. Purified protein catalysed the conversions of
Dong, Lemeng; Miettinen, Karel; Goedbloed, Miriam; Verstappen, Francel W A; Voster, Alessandra; Jongsma, Maarten A; Memelink, Johan; van der Krol, Sander; Bouwmeester, Harro J
2013-11-01
Two geraniol synthases (GES), from Valeriana officinalis (VoGES) and Lippia dulcis (LdGES), were isolated and were shown to have geraniol biosynthetic activity with Km values of 32 µM and 51 µM for GPP, respectively, upon expression in Escherichia coli. The in planta enzymatic activity and sub-cellular localization of VoGES and LdGES were characterized in stable transformed tobacco and using transient expression in Nicotiana benthamiana. Transgenic tobacco expressing VoGES or LdGES accumulate geraniol, oxidized geraniol compounds like geranial, geranic acid and hexose conjugates of these compounds to similar levels. Geraniol emission of leaves was lower than that of flowers, which could be related to higher levels of competing geraniol-conjugating activities in leaves. GFP-fusions of the two GES proteins show that VoGES resides (as expected) predominantly in the plastids, while LdGES import into to the plastid is clearly impaired compared to that of VoGES, resulting in both cytosolic and plastidic localization. Geraniol production by VoGES and LdGES in N. benthamiana was nonetheless very similar. Expression of a truncated version of VoGES or LdGES (cytosolic targeting) resulted in the accumulation of 30% less geraniol glycosides than with the plastid targeted VoGES and LdGES, suggesting that the substrate geranyl diphosphate is readily available, both in the plastids as well as in the cytosol. The potential role of GES in the engineering of the TIA pathway in heterologous hosts is discussed. © 2013 The Authors. Published by Elsevier Inc. All rights reserved.
Niemüller, Daniel; Reimann, Andreas; Ober, Dietrich
2012-07-01
Homospermidine synthase (HSS) is the first specific enzyme in pyrrolizidine alkaloid (PA) biosynthesis, a pathway involved in the plant's chemical defense. HSS has been shown to be recruited repeatedly by duplication of a gene involved in primary metabolism. Within the lineage of the Boraginales, only one gene duplication event gave rise to HSS. Here, we demonstrate that the tissue-specific expression of HSS in three boraginaceous species, Heliotropium indicum, Symphytum officinale, and Cynoglossum officinale, is unique with respect to plant organ, tissue, and cell type. Within H. indicum, HSS is expressed exclusively in nonspecialized cells of the lower epidermis of young leaves and shoots. In S. officinale, HSS expression has been detected in the cells of the root endodermis and in leaves directly underneath developing inflorescences. In young roots of C. officinale, HSS is detected only in cells of the endodermis, but in a later developmental stage, additionally in the pericycle. The individual expression patterns are compared with those within the Senecioneae lineage (Asteraceae), where HSS expression is reproducibly found in specific cells of the endodermis and the adjacent cortex parenchyma of the roots. The individual expression patterns within the Boraginales species are discussed as being a requirement for the successful recruitment of HSS after gene duplication. The diversity of HSS expression within this lineage adds a further facet to the already diverse patterns of expression that have been observed for HSS in other PA-producing plant lineages, making this PA-specific enzyme one of the most diverse expressed proteins described in the literature.
Liu, Guo-Tian; Wang, Jun-Fang; Cramer, Grant; Dai, Zhan-Wu; Duan, Wei; Xu, Hong-Guo; Wu, Ben-Hong; Fan, Pei-Ge; Wang, Li-Jun; Li, Shao-Hua
2012-09-28
, antioxidant enzymes (i.e., ascorbate peroxidase), and galactinol synthase may be important to thermotolerance of grape. HSF30 may be a key regulator for heat stress and recovery, while HSF7 and HSF1 may only be specific to recovery. The identification of heat stress or recovery responsive genes in this study provides novel insights into the molecular basis for heat tolerance in grape leaves.
Directory of Open Access Journals (Sweden)
Liu Guo-Tian
2012-09-01
. The results indicated HSPs, especially small HSPs, antioxidant enzymes (i.e., ascorbate peroxidase, and galactinol synthase may be important to thermotolerance of grape. HSF30 may be a key regulator for heat stress and recovery, while HSF7 and HSF1 may only be specific to recovery. The identification of heat stress or recovery responsive genes in this study provides novel insights into the molecular basis for heat tolerance in grape leaves.
Hegebarth, Daniela; Buschhaus, Christopher; Joubès, Jérôme; Thoraval, Didier; Bird, David; Jetter, Reinhard
2017-09-01
The aliphatic waxes sealing plant surfaces against environmental stress are generated by fatty acid elongase complexes, each containing a β-ketoacyl-CoA synthase (KCS) enzyme that catalyses a crucial condensation forming a new C─C bond to extend the carbon backbone. The relatively high abundance of C 35 and C 37 alkanes derived from C 36 and C 38 acyl-CoAs in Arabidopsis leaf trichomes (relative to other epidermis cells) suggests differences in the elongation machineries of different epidermis cell types, possibly involving KCS16, a condensing enzyme expressed preferentially in trichomes. Here, KCS16 was found expressed primarily in Arabidopsis rosette leaves, flowers and siliques, and the corresponding protein was localized to the endoplasmic reticulum. The cuticular waxes on young leaves and isolated leaf trichomes of ksc16 loss-of-function mutants were depleted of C 35 and C 37 alkanes and alkenes, whereas expression of Arabidopsis KCS16 in yeast and ectopic overexpression in Arabidopsis resulted in accumulation of C 36 and C 38 fatty acid products. Taken together, our results show that KCS16 is the sole enzyme catalysing the elongation of C 34 to C 38 acyl-CoAs in Arabidopsis leaf trichomes and that it contributes to the formation of extra-long compounds in adjacent pavement cells. © 2017 John Wiley & Sons Ltd.
Potassium deficiency affects the carbon-nitrogen balance in cotton leaves.
Hu, Wei; Coomer, Taylor D; Loka, Dimitra A; Oosterhuis, Derrick M; Zhou, Zhiguo
2017-06-01
Potassium (K) plays important roles in the metabolism of carbon (C) and nitrogen (N), but studies of K deficiency affecting C-N balance are lacking. This study explored the influence of K deficiency on C-N interaction in cotton leaves by conducting a field experiment with cotton cultivar DP0912 under two K rates (K0: 0 kg K 2 O ha -1 and K67: 67 kg K 2 O ha -1 ) and a controlled environment experiment with K-deficient solution (K1: 0 mM K + ) and K-sufficient solution (K2: 6 mM K + ). The results showed that leaf K content, leaf number, leaf area, boll number, reproductive dry weight and total dry weight were significant lower under K deficiency (K0 or K1). Lower total chlorophyll content and Chl a/b ratio, and decreased Pn along with lower Gs and higher Ci were measured under K deficiency, suggesting that the decrease in Pn was resulted from non-stomatal limitation. Leaf glucose, fructose, sucrose and starch contents were higher under K deficiency, because lower sucrose export was detected in phloem. Although leaf nitrate and ammonium contents significantly decreased, free amino acid content was increased by 40-63% under K deficiency, since lower amino acid export was also measured in phloem. K deficiency also induced lower soluble protein content in leaves. Leaf ATP level was significantly increased under K deficiency, indicating ATP utilization was lower, so that less energy was supplied to C and N metabolism. The ratio of soluble sugar to free amino acid and the C/N ratio markedly increased under K deficiency, and one reason was that the phloem export reduced more prominent for sucrose (54.6-78.0%) than amino acid (36.7-85.4%) under K deficiency. In addition, lower phosphoenolpyruvate carboxylase activity limited malate and citrate biosynthesis under K deficiency, causing a decrease of C flux into the amino acids, which was not beneficial for maintaining C-N balance. Sucrose phosphate synthase and nitrate reductase activities were lower under K deficiency
Directory of Open Access Journals (Sweden)
Chun-Hsien eHung
2016-01-01
Full Text Available Phosphatidylglycerol (PG and cardiolipin (CL are two essential classes of phospholipid in plants and algae. Phosphatidylglycerophosphate synthase (PGPS and cardiolipin synthase (CLS involved in the biosynthesis of PG and CL belong to CDP-alcohol phosphotransferase and share overall amino acid sequence homology. However, it remains elusive whether PGPS and CLS are functionally distinct in vivo. Here, we report identification of a gene encoding CLS in Chlamydomonas reinhardtii, CrCLS1, and its functional compatibility. Whereas CrCLS1 did not complement the growth phenotype of a PGPS mutant of Synechocystis sp. PCC 6803, it rescued the temperature-sensitive growth phenotype, growth profile with different carbon sources, phospholipid composition and enzyme activity of ∆crd1, a CLS mutant of Saccharomyces cerevisiae. These results suggest that CrCLS1 encodes a functional CLS of C. reinhardtii as the first identified algal CLS, whose enzyme function is distinct from that of PGPSs from C. reinhardtii. Comparison of CDP-alcohol phosphotransferase motif between PGPS and CLS among different species revealed a possible additional motif that might define the substrate specificity of these closely related enzymes.
Heme A synthase in bacteria depends on one pair of cysteinyls for activity.
Lewin, Anna; Hederstedt, Lars
2016-02-01
Heme A is a prosthetic group unique for cytochrome a-type respiratory oxidases in mammals, plants and many microorganisms. The poorly understood integral membrane protein heme A synthase catalyzes the synthesis of heme A from heme O. In bacteria, but not in mitochondria, this enzyme contains one or two pairs of cysteine residues that are present in predicted hydrophilic polypeptide loops on the extracytoplasmic side of the membrane. We used heme A synthase from the eubacterium Bacillus subtilis and the hyperthermophilic archeon Aeropyrum pernix to investigate the functional role of these cysteine residues. Results with B. subtilis amino acid substituted proteins indicated the pair of cysteine residues in the loop connecting transmembrane segments I and II as being essential for catalysis but not required for binding of the enzyme substrate, heme O. Experiments with isolated A. pernix and B. subtilis heme A synthase demonstrated that a disulfide bond can form between the cysteine residues in the same loop and also between loops showing close proximity of the two loops in the folded enzyme protein. Based on the findings, we propose a classification scheme for the four discrete types of heme A synthase found so far in different organisms and propose that essential cysteinyls mediate transfer of reducing equivalents required for the oxygen-dependent catalysis of heme A synthesis from heme O. Copyright © 2015 Elsevier B.V. All rights reserved.
Directory of Open Access Journals (Sweden)
Bo-Xue Tian
2014-10-01
Full Text Available Terpenoid synthases construct the carbon skeletons of tens of thousands of natural products. To predict functions and specificity of triterpenoid synthases, a mechanism-based, multi-intermediate docking approach is proposed. In addition to enzyme function prediction, other potential applications of the current approach, such as enzyme mechanistic studies and enzyme redesign by mutagenesis, are discussed.
Jin, Zhehao; Kwon, Moonhyuk; Lee, Ah-Reum; Ro, Dae-Kyun; Wungsintaweekul, Juraithip; Kim, Soo-Un
2018-01-15
To identify terpene synthases (TPS) responsible for the biosynthesis of the sesquiterpenes that contribute to the characteristic flavors of black pepper (Piper nigrum), unripe peppercorn was subjected to the Illumina transcriptome sequencing. The BLAST analysis using amorpha-4,11-diene synthase as a query identified 19 sesquiterpene synthases (sesqui-TPSs), of which three full-length cDNAs (PnTPS1 through 3) were cloned. These sesqui-TPS cDNAs were expressed in E. coli to produce recombinant enzymes for in vitro assays, and also expressed in the engineered yeast strain to assess their catalytic activities in vivo. PnTPS1 produced β-caryophyllene as a main product and humulene as a minor compound, and thus was named caryophyllene synthase (PnCPS). Likewise, PnTPS2 and PnTPS3 were, respectively, named cadinol/cadinene synthase (PnCO/CDS) and germacrene D synthase (PnGDS). PnGDS expression in yeast yielded β-cadinene and α-copaene, the rearrangement products of germacrene D. Their k cat /K m values (20-37.7 s -1 mM -1 ) were comparable to those of other sesqui-TPSs. Among three PnTPSs, the transcript level of PnCPS was the highest, correlating with the predominant β-caryophyllene biosynthesis in the peppercorn. The products and rearranged products of three PnTPSs could account for about a half of the sesquiterpenes in number found in unripe peppercorn. Copyright © 2017 Elsevier Inc. All rights reserved.
van Os-Medendorp, Harmieke; Appelman-Noordermeer, Simone; Bruijnzeel-Koomen, Carla; de Bruin-Weller, Marjolein
2015-03-27
Little is known about the prevalence of sick leave due to atopic dermatitis (AD). The current literature on factors influencing sick leave is mostly derived from other chronic inflammatory diseases. This study aimed to determine the prevalence of sick leave due to AD and to identify influencing factors. A cross-sectional study was carried out in adult patients with AD. sick leave during the two-week and one-year periods, socio-demographic characteristics, disease severity, quality of life and socio-occupational factors. Logistic regression analyses were used to determine influencing factors on sick leave over the two-week period. In total, 253 patients were included; 12% of the patients had to take sick leave in the last two weeks due to AD and 42% in the past year. A higher level of symptom interference (OR 1.26; 95% CI 1.13-1.40) or perfectionism/diligence (OR 0.90; 95% CI 0.83-0.96) may respectively increase or decrease the number of sick leave days. Sick leave in patients with AD is a common problem and symptom interference and perfectionism/diligence appeared to influence it. Novel approaches are needed to deal with symptoms at work or school to reduce the amount of sick leave due to AD.
Vassilopoulos, Athanassios; Pennington, J Daniel; Andresson, Thorkell; Rees, David M; Bosley, Allen D; Fearnley, Ian M; Ham, Amy; Flynn, Charles Robb; Hill, Salisha; Rose, Kristie Lindsey; Kim, Hyun-Seok; Deng, Chu-Xia; Walker, John E; Gius, David
2014-08-01
Adenosine triphosphate (ATP) synthase uses chemiosmotic energy across the inner mitochondrial membrane to convert adenosine diphosphate and orthophosphate into ATP, whereas genetic deletion of Sirt3 decreases mitochondrial ATP levels. Here, we investigate the mechanistic connection between SIRT3 and energy homeostasis. By using both in vitro and in vivo experiments, we demonstrate that ATP synthase F1 proteins alpha, beta, gamma, and Oligomycin sensitivity-conferring protein (OSCP) contain SIRT3-specific reversible acetyl-lysines that are evolutionarily conserved and bind to SIRT3. OSCP was further investigated and lysine 139 is a nutrient-sensitive SIRT3-dependent deacetylation target. Site directed mutants demonstrate that OSCP(K139) directs, at least in part, mitochondrial ATP production and mice lacking Sirt3 exhibit decreased ATP muscle levels, increased ATP synthase protein acetylation, and an exercise-induced stress-deficient phenotype. This work connects the aging and nutrient response, via SIRT3 direction of the mitochondrial acetylome, to the regulation of mitochondrial energy homeostasis under nutrient-stress conditions by deacetylating ATP synthase proteins. Our data suggest that acetylome signaling contributes to mitochondrial energy homeostasis by SIRT3-mediated deacetylation of ATP synthase proteins.
Predicting the catalytic sites of isopenicillin N synthase (IPNS ...
African Journals Online (AJOL)
Isopenicillin N synthase (IPNS) related Non-haem iron-dependent oxygenases and oxidases (NHIDOX) demonstrated a striking structural conservativeness, even with low protein sequence homology. It is evident that these enzymes have an architecturally similar catalytic centre with active ligands lining the reactive pocket.
Dynamics of meso and thermo citrate synthases with implicit solvation
Cordeiro, J. M. M.
The dynamics of hydration of meso and thermo citrate synthases has been investigated using the EEF1 methodology implemented with the CHARMM program. The native enzymes are composed of two identical subunits, each divided into a small and large domain. The dynamics behavior of both enzymes at 30°C and 60°C has been compared. The results of simulations show that during the hydration process, each subunit follows a different pathway of hydration, in spite of the identical sequence. The hydrated structures were compared with the crystalline structure, and the root mean square deviation (RMSD) of each residue along the trajectory was calculated. The regions with larger and smaller mobility were identified. In particular, helices belonging to the small domain are more mobile than those of the large domain. In contrast, the residues that constitute the active site show a much lower displacement compared with the crystalline structure. Hydration free energy calculations point out that Thermoplasma acidophilum citrate synthase (TCS) is more stable than chicken citrate synthase (CCS), at high temperatures. Such result has been ascribed to the higher number of superficial charges in the thermophilic homologue, which stabilizes the enzyme, while the mesophilic homologue denatures. These results are in accord with the experimental found that TCS keeps activity at temperatures farther apart from the catalysis regular temperature than the CCS.
Rattmann, Yanna D; Cipriani, Thales R; Sassaki, Guilherme L; Iacomini, Marcello; Rieck, Lia; Marques, Maria C A; da Silva-Santos, José E
2006-04-06
This study reveals that an ethanolic supernatant obtained from an aqueous extractive solution prepared from residues of methanolic extracts of ground leaves of Maytenus ilicifolia is able to cause a concentration- and endothelium-dependent relaxation in pre-contract rat aorta rings, with EC(50) of 199.7 (190-210) microg/ml. The non-selective nitric oxide synthase inhibitors l-NAME and l-NMMA abolished this effect, while superoxide dismutase and MnTBAP (a non-enzymatic superoxide dismutase mimetic) enhanced it. Further, relaxation induced by this ethanolic supernatant have been strongly inhibited by the guanylate cyclase inhibitors methylene blue and ODQ, as well as by the potassium channel blockers 4-aminopyridine and tetraethylammonium, but was unchanged by the cyclooxygenase inhibitor indomethacin and the membrane receptor antagonists atropine, HOE-140 and pirilamine. Partition of the ethanolic supernatant between H(2)O and EtOAc generated a fraction several times more potent, able to fully relax endothelium-intact aorta rings with an EC(50) of 4.3 (3.9-4.8) microg/ml. (13)C NMR spectrum of this fraction showed signals typical of catechin. This study reveals that the leaves of M. ilicifolia possess one or more potent substances able to relax endothelium-intact rat aorta rings, an event that appears to involve nitric oxide production, guanylate cyclase activation and potassium channel opening.
RECRUITMENT FINANCED BY SAVED LEAVE (RSL PROGRAMME)
Division du Personnel; Tel. 73903
1999-01-01
Transfer to the saved leave account and saved leave bonusStaff members participating in the RSL programme may opt to transfer up to 10 days of unused annual leave or unused compensatory leave into their saved leave account, at the end of the leave year, i.e. 30 September (as set out in the implementation procedure dated 27 August 1997).A leave transfer request form, which you should complete, sign and return, if you wish to use this possibility, has been addressed you. To allow the necessary time for the processing of your request, you should return it without delay.As foreseen in the implementation procedure, an additional day of saved leave will be granted for each full period of 20 days remaining in the saved leave account on 31 December 1999, for any staff member participating in the RSL programme until that date.For part-time staff members participating in the RSL programme, the above-mentioned days of leave (annual, compensatory and saved) are adjusted proportionally to their contractual working week as...
Incorporation of phosphate into glycogen by glycogen synthase.
Contreras, Christopher J; Segvich, Dyann M; Mahalingan, Krishna; Chikwana, Vimbai M; Kirley, Terence L; Hurley, Thomas D; DePaoli-Roach, Anna A; Roach, Peter J
2016-05-01
The storage polymer glycogen normally contains small amounts of covalently attached phosphate as phosphomonoesters at C2, C3 and C6 atoms of glucose residues. In the absence of the laforin phosphatase, as in the rare childhood epilepsy Lafora disease, the phosphorylation level is elevated and is associated with abnormal glycogen structure that contributes to the pathology. Laforin therefore likely functions in vivo as a glycogen phosphatase. The mechanism of glycogen phosphorylation is less well-understood. We have reported that glycogen synthase incorporates phosphate into glycogen via a rare side reaction in which glucose-phosphate rather than glucose is transferred to a growing polyglucose chain (Tagliabracci et al. (2011) Cell Metab13, 274-282). We proposed a mechanism to account for phosphorylation at C2 and possibly at C3. Our results have since been challenged (Nitschke et al. (2013) Cell Metab17, 756-767). Here we extend the evidence supporting our conclusion, validating the assay used for the detection of glycogen phosphorylation, measurement of the transfer of (32)P from [β-(32)P]UDP-glucose to glycogen by glycogen synthase. The (32)P associated with the glycogen fraction was stable to ethanol precipitation, SDS-PAGE and gel filtration on Sephadex G50. The (32)P-signal was not affected by inclusion of excess unlabeled UDP before analysis or by treatment with a UDPase, arguing against the signal being due to contaminating [β-(32)P]UDP generated in the reaction. Furthermore, [(32)P]UDP did not bind non-covalently to glycogen. The (32)P associated with glycogen was released by laforin treatment, suggesting that it was present as a phosphomonoester. The conclusion is that glycogen synthase can mediate the introduction of phosphate into glycogen, thereby providing a possible mechanism for C2, and perhaps C3, phosphorylation. Copyright © 2016 Elsevier Inc. All rights reserved.
Gay, Darren C; Wagner, Drew T; Meinke, Jessica L; Zogzas, Charles E; Gay, Glen R; Keatinge-Clay, Adrian T
2016-03-01
Polyketides such as the clinically-valuable antibacterial agent mupirocin are constructed by architecturally-sophisticated assembly lines known as trans-acyltransferase polyketide synthases. Organelle-sized megacomplexes composed of several copies of trans-acyltransferase polyketide synthase assembly lines have been observed by others through transmission electron microscopy to be located at the Bacillus subtilis plasma membrane, where the synthesis and export of the antibacterial polyketide bacillaene takes place. In this work we analyze ten crystal structures of trans-acyltransferase polyketide synthases ketosynthase domains, seven of which are reported here for the first time, to characterize a motif capable of zippering assembly lines into a megacomplex. While each of the three-helix LINKS (Laterally-INteracting Ketosynthase Sequence) motifs is observed to similarly dock with a spatially-reversed copy of itself through hydrophobic and ionic interactions, the amino acid sequences of this motif are not conserved. Such a code is appropriate for mediating homotypic contacts between assembly lines to ensure the ordered self-assembly of a noncovalent, yet tightly-knit, enzymatic network. LINKS-mediated lateral interactions would also have the effect of bolstering the vertical association of the polypeptides that comprise a polyketide synthase assembly line. Copyright © 2015 Elsevier Inc. All rights reserved.
Zerbe, Philipp; Chiang, Angela; Yuen, Macaire; Hamberger, Björn; Hamberger, Britta; Draper, Jason A.; Britton, Robert; Bohlmann, Jörg
2012-01-01
The labdanoid diterpene alcohol cis-abienol is a major component of the aromatic oleoresin of balsam fir (Abies balsamea) and serves as a valuable bioproduct material for the fragrance industry. Using high-throughput 454 transcriptome sequencing and metabolite profiling of balsam fir bark tissue, we identified candidate diterpene synthase sequences for full-length cDNA cloning and functional characterization. We discovered a bifunctional class I/II cis-abienol synthase (AbCAS), along with the paralogous levopimaradiene/abietadiene synthase and isopimaradiene synthase, all of which are members of the gymnosperm-specific TPS-d subfamily. The AbCAS-catalyzed formation of cis-abienol proceeds via cyclization and hydroxylation at carbon C-8 of a postulated carbocation intermediate in the class II active site, followed by cleavage of the diphosphate group and termination of the reaction sequence without further cyclization in the class I active site. This reaction mechanism is distinct from that of synthases of the isopimaradiene- or levopimaradiene/abietadiene synthase type, which employ deprotonation reactions in the class II active site and secondary cyclizations in the class I active site, leading to tricyclic diterpenes. Comparative homology modeling suggested the active site residues Asp-348, Leu-617, Phe-696, and Gly-723 as potentially important for the specificity of AbCAS. As a class I/II bifunctional enzyme, AbCAS is a promising target for metabolic engineering of cis-abienol production. PMID:22337889
Renton, Paul; Green, Brenda; Maddaford, Shawn; Rakhit, Suman; Andrews, John S
2012-03-08
A novel series of benzimidazole designed multiple ligands (DMLs) with activity at the neuronal nitric oxide synthase (nNOS) enzyme and the μ-opioid receptor was developed. Targeting of the structurally dissimilar heme-containing enzyme and the μ-opioid GPCR was predicated on the modulatory role of nitric oxide on μ-opioid receptor function. Structure-activity relationship studies yielded lead compound 24 with excellent nNOS inhibitory activity (IC50 = 0.44 μM), selectivity over both endothelial nitric oxide synthase (10-fold) and inducible nitric oxide synthase (125-fold), and potent μ-opioid binding affinity, K i = 5.4 nM. The functional activity as measured in the cyclic adenosine monosphospate secondary messenger assay resulted in full agonist activity (EC50 = 0.34 μM). This work represents a novel approach in the development of new analgesics for the treatment of pain.
International Nuclear Information System (INIS)
Huynh, Frederick; Tan, Tien-Chye; Swaminathan, Kunchithapadam; Patel, Bharat K. C.
2004-01-01
The first crystallographic study of a sucrose phosphate synthase from H. orenii, an organism that is both thermophilic and halophilic, is reported. The protein crystal diffracts X-rays to 3.01 Å. This is the first report of the crystallization of a sucrose phosphate synthase (SPS; EC 2.4.1.14). It also constitutes the first study of a sucrose phosphate synthase from a non-photosynthetic thermohalophilic anaerobic bacterium, Halothermothrix orenii. The purified recombinant spsA protein has been crystallized in the monoclinic space group C2, with unit-cell parameters a = 154.2, b = 47.9, c = 72.3 Å, β = 103.16°, using the hanging-drop vapour-diffusion method. The crystal diffracts X-rays to a resolution limit of 3.01 Å. Heavy-metal and halide-soaking trials are currently in progress to solve the structure
Directory of Open Access Journals (Sweden)
Harmieke van Os-Medendorp
2015-03-01
Full Text Available Background: Little is known about the prevalence of sick leave due to atopic dermatitis (AD. The current literature on factors influencing sick leave is mostly derived from other chronic inflammatory diseases. This study aimed to determine the prevalence of sick leave due to AD and to identify influencing factors. Methods: A cross-sectional study was carried out in adult patients with AD. Outcome measures: sick leave during the two-week and one-year periods, socio-demographic characteristics, disease severity, quality of life and socio-occupational factors. Logistic regression analyses were used to determine influencing factors on sick leave over the two-week period. Results: In total, 253 patients were included; 12% of the patients had to take sick leave in the last two weeks due to AD and 42% in the past year. A higher level of symptom interference (OR 1.26; 95% CI 1.13–1.40 or perfectionism/diligence (OR 0.90; 95% CI 0.83–0.96 may respectively increase or decrease the number of sick leave days. Conclusion: Sick leave in patients with AD is a common problem and symptom interference and perfectionism/diligence appeared to influence it. Novel approaches are needed to deal with symptoms at work or school to reduce the amount of sick leave due to AD.
Jeangkhwoa, Pattraporn; Bandhaya, Achirapa; Umpunjun, Puangpaka; Chuenboonngarm, Ngarmnij; Panvisavas, Nathinee
2017-03-01
This study reports a successful application of fluorescence in situ hybridization (FISH) technique in the identification of Cannabis sativa L. cells recovered from fresh and dried powdered plant materials. Two biotin-16-dUTP-labeled FISH probes were designed from the Cannabis-specific tetrahydrocannabinolic acid synthase (THCAS) gene and the ITS region of the 45S rRNA gene. Specificity of probe-target hybridization was tested against the target and 4 non-target plant species, i.e., Humulus lupulus, Mitragyna speciosa, Papaver sp., and Nicotiana tabacum. The 1-kb THCA synthase hybridization probe gave Cannabis-specific hybridization signals, unlike the 700-bp Cannabis-ITS hybridization probe. Probe-target hybridization was also confirmed against 20 individual Cannabis plant samples. The 1-kb THCA synthase and 700-bp Cannabis-ITS hybridization probes clearly showed 2 hybridization signals per cell with reproducibility. The 1-kb THCA synthase probe did not give any FISH signal when tested against H. lupulus, its closely related member of the Canabaceae family. It was also showed that 1-kb THCA synthase FISH probe can be applied to identify small amount of dried powdered Cannabis material with an addition of rehydration step prior to the experimental process. This study provided an alternative identification method for Cannabis trace. Copyright © 2016. Published by Elsevier B.V.
International Nuclear Information System (INIS)
Tanaka, Hiroaki; Tsurumura, Toshiharu; Aritake, Kosuke; Furubayashi, Naoki; Takahashi, Sachiko; Yamanaka, Mari; Hirota, Erika; Sano, Satoshi; Sato, Masaru; Kobayashi, Tomoyuki; Tanaka, Tetsuo; Inaka, Koji; Urade, Yoshihiro
2011-01-01
Crystals of hematopoietic prostaglandin D synthase grown in microgravity show improved quality. Human hematopoietic prostaglandin synthase, one of the better therapeutic target enzymes for allergy and inflammation, was crystallized with 22 inhibitors and in three inhibitor-free conditions in microgravity. Most of the space-grown crystals showed better X-ray diffraction patterns than the terrestrially grown ones, indicating the advantage of a microgravity environment on protein crystallization, especially in the case of this protein
Prosser, Ian; Phillips, Andy L; Gittings, Simon; Lewis, Mervyn J; Hooper, Antony M; Pickett, John A; Beale, Michael H
2002-08-01
Profiling of sesquiterpene hydrocarbons in extracts of goldenrod, Solidago canadensis, by GC-MS revealed the presence of both enantiomers of germacrene D and lesser amounts of germacrene A, alpha-humulene, and beta-caryophyllene. A similarity-based cloning strategy using degenerate oligonucleotide primers, based on conserved amino acid sequences in known plant sesquiterpene synthases and RT-PCR, resulted in the isolation of a full length sesquiterpene synthase cDNA. Functional expression of the cDNA in E. coli, as an N-terminal thioredoxin fusion protein using the pET32b vector yielded an enzyme that was readily purified by nickel-chelate affinity chromatography. Chiral GC-MS analysis of products from of (3)H- and (2)H-labelled farnesyl diphosphate identified the enzyme as (+)-(10R)-germacrene A synthase. Sequence analysis and molecular modelling was used to compare this enzyme with the mechanistically related epi-aristolochene synthase from tobacco.
Stapelfeldt, Christina Malmose; Jensen, Chris; Andersen, Niels Trolle; Fleten, Nils; Nielsen, Claus Vinther
2012-08-15
Previous validation studies of sick leave measures have focused on self-reports. Register-based sick leave data are considered to be valid; however methodological problems may be associated with such data. A Danish national register on sickness benefit (DREAM) has been widely used in sick leave research. On the basis of sick leave records from 3,554 and 2,311 eldercare workers in 14 different workplaces, the aim of this study was to: 1) validate registered sickness benefit data from DREAM against workplace-registered sick leave spells of at least 15 days; 2) validate self-reported sick leave days during one year against workplace-registered sick leave. Agreement between workplace-registered sick leave and DREAM-registered sickness benefit was reported as sensitivities, specificities and positive predictive values. A receiver-operating characteristic curve and a Bland-Altman plot were used to study the concordance with sick leave duration of the first spell. By means of an analysis of agreement between self-reported and workplace-registered sick leave sensitivity and specificity was calculated. Ninety-five percent confidence intervals (95% CI) were used. The probability that registered DREAM data on sickness benefit agrees with workplace-registered sick leave of at least 15 days was 96.7% (95% CI: 95.6-97.6). Specificity was close to 100% (95% CI: 98.3-100). The registered DREAM data on sickness benefit overestimated the duration of sick leave spells by an average of 1.4 (SD: 3.9) weeks. Separate analysis on pregnancy-related sick leave revealed a maximum sensitivity of 20% (95% CI: 4.3-48.1).The sensitivity of self-reporting at least one or at least 56 sick leave day/s was 94.5 (95% CI: 93.4 - 95.5) % and 58.5 (95% CI: 51.1 - 65.6) % respectively. The corresponding specificities were 85.3 (95% CI: 81.4 - 88.6) % and 98.9 (95% CI: 98.3 - 99.3) %. The DREAM register offered valid measures of sick leave spells of at least 15 days among eldercare employees. Pregnancy
Directory of Open Access Journals (Sweden)
Stapelfeldt Christina Malmose
2012-08-01
Full Text Available Abstract Background Previous validation studies of sick leave measures have focused on self-reports. Register-based sick leave data are considered to be valid; however methodological problems may be associated with such data. A Danish national register on sickness benefit (DREAM has been widely used in sick leave research. On the basis of sick leave records from 3,554 and 2,311 eldercare workers in 14 different workplaces, the aim of this study was to: 1 validate registered sickness benefit data from DREAM against workplace-registered sick leave spells of at least 15 days; 2 validate self-reported sick leave days during one year against workplace-registered sick leave. Methods Agreement between workplace-registered sick leave and DREAM-registered sickness benefit was reported as sensitivities, specificities and positive predictive values. A receiver-operating characteristic curve and a Bland-Altman plot were used to study the concordance with sick leave duration of the first spell. By means of an analysis of agreement between self-reported and workplace-registered sick leave sensitivity and specificity was calculated. Ninety-five percent confidence intervals (95% CI were used. Results The probability that registered DREAM data on sickness benefit agrees with workplace-registered sick leave of at least 15 days was 96.7% (95% CI: 95.6-97.6. Specificity was close to 100% (95% CI: 98.3-100. The registered DREAM data on sickness benefit overestimated the duration of sick leave spells by an average of 1.4 (SD: 3.9 weeks. Separate analysis on pregnancy-related sick leave revealed a maximum sensitivity of 20% (95% CI: 4.3-48.1. The sensitivity of self-reporting at least one or at least 56 sick leave day/s was 94.5 (95% CI: 93.4 – 95.5 % and 58.5 (95% CI: 51.1 – 65.6 % respectively. The corresponding specificities were 85.3 (95% CI: 81.4 – 88.6 % and 98.9 (95% CI: 98.3 – 99.3 %. Conclusions The DREAM register offered valid measures of sick
Differentiation of Cannabis subspecies by THCA synthase gene analysis using RFLP.
Cirovic, Natasa; Kecmanovic, Miljana; Keckarevic, Dusan; Keckarevic Markovic, Milica
2017-10-01
Cannabis sativa subspecies, known as industrial hemp (C. sativa sativa) and marijuana (C. sativa indica) show no evident morphological distinctions, but they contain different levels of psychoactive Δ-9-tetrahidrocanabinol (THC), with considerably higher concentration in marijuana than in hemp. C. sativa subspecies differ in sequence of tetrahydrocannabinolic acid (THCA) synthase gene, responsible for THC production, and only one active copy of the gene, distinctive for marijuana, is capable of producing THC in concentration more then 0,3% in dried plants, usually punishable by the law. Twenty different samples of marijuana that contain THC in concentration more then 0,3% and three varieties of industrial hemp were analyzed for presence of an active copy of THCA synthase gene using in-house developed restriction fragment length polymorphism (RFLP) method All twenty samples of marijuana were positive for the active copy of THCA synthase gene, 16 of them heterozygous. All three varieties of industrial hemp were homozygous for inactive copy. An algorithm for the fast and accurate forensic analysis of samples suspected to be marijuana was constructed, answering the question if an analyzed sample is capable of producing THC in concentrations higher than 0.3%. Copyright © 2017 Elsevier Ltd and Faculty of Forensic and Legal Medicine. All rights reserved.
Crystal structure of riboflavin synthase
Energy Technology Data Exchange (ETDEWEB)
Liao, D.-I.; Wawrzak, Z.; Calabrese, J.C.; Viitanen, P.V.; Jordan, D.B. (DuPont); (NWU)
2010-03-05
Riboflavin synthase catalyzes the dismutation of two molecules of 6,7-dimethyl-8-(1'-D-ribityl)-lumazine to yield riboflavin and 4-ribitylamino-5-amino-2,6-dihydroxypyrimidine. The homotrimer of 23 kDa subunits has no cofactor requirements for catalysis. The enzyme is nonexistent in humans and is an attractive target for antimicrobial agents of organisms whose pathogenicity depends on their ability to biosynthesize riboflavin. The first three-dimensional structure of the enzyme was determined at 2.0 {angstrom} resolution using the multiwavelength anomalous diffraction (MAD) method on the Escherichia coli protein containing selenomethionine residues. The homotrimer consists of an asymmetric assembly of monomers, each of which comprises two similar {beta} barrels and a C-terminal {alpha} helix. The similar {beta} barrels within the monomer confirm a prediction of pseudo two-fold symmetry that is inferred from the sequence similarity between the two halves of the protein. The {beta} barrels closely resemble folds found in phthalate dioxygenase reductase and other flavoproteins. The three active sites of the trimer are proposed to lie between pairs of monomers in which residues conserved among species reside, including two Asp-His-Ser triads and dyads of Cys-Ser and His-Thr. The proposed active sites are located where FMN (an analog of riboflavin) is modeled from an overlay of the {beta} barrels of phthalate dioxygenase reductase and riboflavin synthase. In the trimer, one active site is formed, and the other two active sites are wide open and exposed to solvent. The nature of the trimer configuration suggests that only one active site can be formed and be catalytically competent at a time.
International Nuclear Information System (INIS)
Reuber, S.; Leitsch, J.; Krause, G.H.; Weissenböck, G.
1993-01-01
The present study was undertaken in order to investigate the suitability of certain markers for UV plant response. In addition, we attempted to link the internal tissue distribution of specific UV-absorbing compounds to profiles of radiation gradients within intact primary rye leaves (Secale cereale L. cv. Kustro). Etiolated rye seedlings irradiated with low visible light (LL) and/or UV radiation were used to study enzyme activities of the two key enzymes, phenylalanine ammonia-lyase (PAL) and chalcone synthase (CHS), together with the tissue-specific accumulation of soluble phenylpropanoid products. Plants grown under relatively high visible light (HL) with or without supplementary UV-B radiation were used for further characterization. Apparent quantum yield and fluorescence quenching parameters were monitored to assess potential physiological changes due to UV-B exposure in HL-grown seedlings. A quartz fibreoptic microprobe was used to characterize the internal UV-B gradient of the leaf. The response of the phenylpropanoid metabolism to UV radiation was similar in primary leaves of both etiolated and HL-treated green plants. The epidermis-specific flavonoids together with CHS activity turned out to be suitable markers for assessing the effect of UV on the phenolic metabolism. The functional role of phenylpropanoid compounds was strongly implicated in protecting rye from UV-B radiation
Dihydropteroate synthase gene mutations in Pneumocystis and sulfa resistance
DEFF Research Database (Denmark)
Huang, Laurence; Crothers, Kristina; Atzori, Chiara
2004-01-01
in the dihydropteroate synthase (DHPS) gene. Similar mutations have been observed in P. jirovecii. Studies have consistently demonstrated a significant association between the use of sulfa drugs for PCP prophylaxis and DHPS gene mutations. Whether these mutations confer resistance to TMP-SMX or dapsone plus trimethoprim...
Access to paid parental leave for academic surgeons.
Itum, Dina S; Oltmann, Sarah C; Choti, Michael A; Piper, Hannah G
2018-01-31
Parental leave is linked to health benefits for both child and parent. It is unclear whether surgeons at academic centers have access to paid parental leave. The aim of this study was to determine parental leave policies at the top academic medical centers in the United States to identify trends among institutions. The top academic medical centers were identified (US News & World Report 2016). Institutional websites were reviewed, or human resource departments were contacted to determine parental leave policies. "Paid leave" was defined as leave without the mandated use of personal time off. Institutions were categorized based on geographical region, funding, and ranking to determine trends regarding availability and duration of paid parental leave. Among the top 91 ranked medical schools, 48 (53%) offer paid parental leave. Availability of a paid leave policy differed based on private versus public institutions (70% versus 38%, P leaves (>6 wk) than public institutions (67% versus 33%; P = 0.02). No difference in paid leave duration was noted based on region (P = 0.60) or rank (P = 0.81). Approximately, 50% of top academic medical centers offer paid parental leave. Private institutions are more likely to offer paid leave and leave of longer duration. There is considerable variability in access to paid parenteral leave for academic surgeons. Copyright © 2018 Elsevier Inc. All rights reserved.
Sugar beet leaves for functional ingredients
Tamayo Tenorio, Angelica
2017-01-01
Plant leaves are recognised as a potential source for food applications based on their nutritional profile and interesting technological properties of leaf components, and based on the large availability of plant leaves in agricultural waste streams. Besides proteins, leaves have a rich
Paternity leave experiences of NHS doctors.
Gordon, Hannah; Szram, Joanna
2013-10-01
This study assesses NHS doctors' experiences of paternity leave and evaluates whether practices have changed since the introduction of additional paternity leave (APL) in April 2011. An anonymised online survey designed to discover experiences and uptake of APL and ordinary paternity leave (OPL) was distributed to all members of the London Deanery Synapse® network. In total, 364 fathers responded. Their seniority ranged from foundation trainees to consultants. Following the formal introduction of OPL in 2003, the number of fathers taking any paternity leave increased (from 50% to 95.6%). The majority of respondents (76.7%) felt well supported by their employer. Since the introduction of APL, 3% of respondents took additional leave. Reasons for the low uptake of APL included the impracticalities of the law, poor awareness and perceived attitudes and implications for training. Problems with OPL included the inadequate provision of cover and difficulties in timing the leave appropriately.
Directory of Open Access Journals (Sweden)
Tiago Benedito Dos Santos
2015-06-01
Full Text Available Increased synthesis of galactinol and raffinose family oligosaccharides (RFOs has been reported in vegetative tissues in response to a range of abiotic stresses. In this work, we evaluated the transcriptional profile of a Coffea canephora galactinol synthase gene (CcGolS1 in two clones that differed in tolerance to water deficit in order to assess the contribution of this gene to drought tolerance. The expression of CcGolS1 in leaves was differentially regulated by water deficit, depending on the intensity of stress and the genotype. In clone 109A (drought-susceptible, the abundance of CcGolS1 transcripts decreased upon exposure to drought, reaching minimum values during recovery from severe water deficit and stress. In contrast, CcGolS1 gene expression in clone 14 (drought-tolerant was stimulated by water deficit. Changes in galactinol and RFO content did not correlate with variation in the steady-state transcript level. However, the magnitude of increase in RFO accumulation was higher in the tolerant cultivar, mainly under severe water deficit. The finding that the drought-tolerant coffee clone showed enhanced accumulation of CcGolS1 transcripts and RFOs under water deficit suggests the possibility of using this gene to improve drought tolerance in this important crop.
Enhancement of vascular targeting by inhibitors of nitric oxide synthase
International Nuclear Information System (INIS)
Davis, Peter D.; Tozer, Gillian M.; Naylor, Matthew A.; Thomson, Peter; Lewis, Gemma; Hill, Sally A.
2002-01-01
Purpose: This study investigates the enhancement of the vascular targeting activity of the tubulin-binding agent combretastatin A4 phosphate (CA4P) by various inhibitors of nitric oxide synthases. Methods and Materials: The syngeneic tumors CaNT and SaS growing in CBA mice were used for this study. Reduction in perfused vascular volume was measured by injection of Hoechst 33342 24 h after drug administration. Necrosis (hematoxylin and eosin stain) was assessed also at 24 h after treatment. Combretastatin A4 phosphate was synthesized by a modification of the published procedure and the nitric oxide synthase inhibitors L-NNA, L-NMMA, L-NIO, L-NIL, S-MTC, S-EIT, AMP, AMT, and L-TC, obtained from commercial sources. Results: A statistically significant augmentation of the reduction in perfused vascular volume by CA4P in the CaNT tumor was observed with L-NNA, AMP, and AMT. An increase in CA4P-induced necrosis in the same tumor achieved significance with L-NNA, L-NMMA, L-NIL, and AMT. CA4P induced little necrosis in the SaS tumor, but combination with the inhibitors L-NNA, L-NMMA, L-NIO, S-EIT, and L-TC was effective. Conclusions: Augmentation of CA4P activity by nitric oxide synthase inhibitors of different structural classes supports a nitric oxide-related mechanism for this effect. L-NNA was the most effective inhibitor studied
Directory of Open Access Journals (Sweden)
Gaoyi Cao
Full Text Available A key enzyme in the shikimate pathway, 5-enolpyruvylshikimate-3-phosphate synthase (EPSPS is the primary target of the broad-spectrum herbicide glyphosate. Identification of new aroA genes coding for EPSPS with a high level of glyphosate tolerance is essential for the development of glyphosate-tolerant crops. In the present study, the glyphosate tolerance of five bacterial aroA genes was evaluated in the E. coli aroA-defective strain ER2799 and in transgenic tobacco plants. All five aroA genes could complement the aroA-defective strain ER2799, and AM79 aroA showed the highest glyphosate tolerance. Although glyphosate treatment inhibited the growth of both WT and transgenic tobacco plants, transgenic plants expressing AM79 aroA tolerated higher concentration of glyphosate and had a higher fresh weight and survival rate than plants expressing other aroA genes. When treated with high concentration of glyphosate, lower shikimate content was detected in the leaves of transgenic plants expressing AM79 aroA than transgenic plants expressing other aroA genes. These results suggest that AM79 aroA could be a good candidate for the development of transgenic glyphosate-tolerant crops.
INTRODUCTION OF A NEW LEAVE MANAGEMENT SYSTEM
HR Division
2000-01-01
The introduction of new leave rules (arising from the RSL, PRP and other programmes) has made the present leave management system rather complicated and difficult to manage. It has therefore been decided to replace it with a more flexible and adaptable system, which will come into force on 1st October 2000. Henceforth, days of leave will be credited monthly instead of annually. Members of the personnel will have round-the-clock direct access to more detailed, confidential information regarding their various kinds of leave.They will also receive a personal monthly statement with their pay slips. The new system does not require any amendment of the regulations, except with respect to the frequency of leave calculations (monthly instead of annual). I. Main characteristics of the new leave system 1. The main feature of the new system is the creation of accounts to which leave will be credited or debited as appropriate. Depending on their circumstances, members of the personnel may have up to four individual leave...
In vitro biochemical characterization of all barley endosperm starch synthases
DEFF Research Database (Denmark)
Cuesta-Seijo, Jose A.; Nielsen, Morten M.; Ruzanski, Christian
2016-01-01
Starch is the main storage polysaccharide in cereals and the major source of calories in the human diet. It is synthesized by a panel of enzymes including five classes of starch synthases (SSs). While the overall starch synthase (SS) reaction is known, the functional differences between the five SS....... Here we provide a detailed biochemical study of the activity of all five classes of SSs in barley endosperm. Each enzyme was produced recombinantly in E. coli and the properties and modes of action in vitro were studied in isolation from other SSs and other substrate modifying activities. Our results...... define the mode of action of each SS class in unprecedented detail; we analyze their substrate selection, temperature dependence and stability, substrate affinity and temporal abundance during barley development. Our results are at variance with some generally accepted ideas about starch biosynthesis...
Directory of Open Access Journals (Sweden)
Irene Mavelli
2012-02-01
Full Text Available Warburg’s hypothesis has been challenged by a number of studies showing that oxidative phosphorylation is repressed in some tumors, rather than being inactive per se. Thus, treatments able to shift energy metabolism by activating mitochondrial pathways have been suggested as an intriguing basis for the optimization of antitumor strategies. In this study, HepG2 hepatocarcinoma cells were cultivated with different metabolic substrates under conditions mimicking “positive” (activation/biogenesis or “negative” (silencing mitochondrial adaptation. In addition to the expected up-regulation of mitochondrial biogenesis, glucose deprivation caused an increase in phosphorylating respiration and a rise in the expression levels of the ATP synthase β subunit and Inhibitor Factor 1 (IF1. Hyperglycemia, on the other hand, led to a markedly decreased level of the transcriptional coactivator PGC-α suggesting down-regulation of mitochondrial biogenesis, although no change in mitochondrial mass and no impairment of phosphorylating respiration were observed. Moreover, a reduction in mitochondrial networking and in ATP synthase dimer stability was produced. No effect on β-ATP synthase expression was elicited. Notably, hyperglycemia caused an increase in IF1 expression levels, but it did not alter the amount of IF1 associated with ATP synthase. These results point to a new role of IF1 in relation to high glucose utilization by tumor cells, in addition to its well known effect upon mitochondrial ATP synthase regulation.
38 CFR 21.342 - Leave accounting policy.
2010-07-01
... 38 Pensions, Bonuses, and Veterans' Relief 2 2010-07-01 2010-07-01 false Leave accounting policy. 21.342 Section 21.342 Pensions, Bonuses, and Veterans' Relief DEPARTMENT OF VETERANS AFFAIRS.... Chapter 31 Leaves of Absence § 21.342 Leave accounting policy. (a) Amount of leave. A veteran pursuing one...
Endothelial nitric oxide synthase polymorphism G298T in ...
Indian Academy of Sciences (India)
Supplementary data: Endothelial nitric oxide synthase polymorphism G298T in association with oxidative DNA damage in coronary atherosclerosis. Rajesh G. Kumar, Mrudula K. Spurthi, Kishore G. Kumar, Sanjib K. Sahu and Surekha H. Rani. J. Genet. 91, 349–352. Table 1. The demographic and clinical data of the CHD ...
ATP synthase--a marvellous rotary engine of the cell.
Yoshida, M; Muneyuki, E; Hisabori, T
2001-09-01
ATP synthase can be thought of as a complex of two motors--the ATP-driven F1 motor and the proton-driven Fo motor--that rotate in opposite directions. The mechanisms by which rotation and catalysis are coupled in the working enzyme are now being unravelled on a molecular scale.
van Os-Medendorp, Harmieke; Appelman-Noordermeer, Simone; Bruijnzeel-Koomen, Carla A.F.M.; de Bruin-Weller, MS
2015-01-01
BACKGROUND: Little is known about the prevalence of sick leave due to atopic dermatitis (AD). The current literature on factors influencing sick leave is mostly derived from other chronic inflammatory diseases. This study aimed to determine the prevalence of sick leave due to AD and to identify
Employer Provisions for Parental Leave.
Meisenheimer, Joseph R., II
1989-01-01
Slightly more than one-third of full-time employees in medium and large firms in private industry were covered by maternity- or paternity-leave policies; days off were usually leave without pay. (Author)
Directory of Open Access Journals (Sweden)
Yosi Bayu Murti
2015-11-01
Full Text Available Legundi (Vitex trifolia L. is one of Indonesia’s traditional crops that have not been studied and developed into fitofarmaka. Legundi leaves can be used for therapy in asthmatics with optimum level. Therefore it is necessary for optimization of harvesting Legundi leaves which includes time and degree of maturation of the leaves. Harvesting time optimization by means of harvesting the leaves at the different times i.e. morning, noon, and evening, while the leaf maturation level optimization by way of harvesting leaves numbered one through five of the youngest end, then the time of harvesting and leaves that provide optimum levels of viteksikarpin were assigned. Measurements of viteksikarpin assigned using TLCdensitometry then analyzed using Wincats software and Microsoft Office Excel 2007. The highest viteksikarpin levels in Legundi leaves harvested in the afternoon, then during the day, and the lowest in the morning. The highest viteksikarpin levels of Legundi leaves were on second leaf, first leaf, third leaf, fourth leaf, and the lowest on fifth leaf. Optimum levels of viteksikarpin in Legundi leaves was harvested in the afternoon by picking the first until the third leaf.
INTRODUCTION OF A NEW LEAVE MANAGEMENT SYSTEM
DIVISION HR
2000-01-01
The introduction of new leave rules (arising from the RSL, PRP and other programs) has made the present leave management system rather complicated and difficult to manage. It has therefore been decided to replace it with a more flexible and adaptable system, which will come into force on 1st October 2000. Henceforth, days of leave will be credited monthly instead of annually. Members of the personnel will have round-the-clock direct access to more detailed, confidential information regarding their various kinds of leave. They will also receive a personal monthly statement with their pay slips. The new system does not require any amendment of the regulations, except with respect to the frequency of leave calculations (monthly instead of annual). I. Main characteristics of the new leave system1. The main feature of the new system is the creation of accounts to which leave will be credited or debited as appropriate. Depending on their circumstances, members of the personnel may have up to four individual leave a...
DEFF Research Database (Denmark)
2016-01-01
A method for producing individual or libraries of tri- to pentadecaketide-derived aromatic compounds of interest by heterologous expression of polyketide synthase and aromatase/cyclase in a recombinant host cell.......A method for producing individual or libraries of tri- to pentadecaketide-derived aromatic compounds of interest by heterologous expression of polyketide synthase and aromatase/cyclase in a recombinant host cell....
Directory of Open Access Journals (Sweden)
Michael D. Threadgill
2010-04-01
Full Text Available Two isomeric N-(methoxycarbonylthienylmethylthioureas were synthesised by a sequence of radical bromination of methylthiophenecarboxylic esters, substitution with trifluoroacetamide anion, deprotection, formation of the corresponding isothiocyanates and addition of ammonia. The interaction of these new thiophene-based thioureas with inducible and neuronal nitric oxide synthase was evaluauted. These novel thienylmethylthioureas stimulated the activity of inducible Nitric Oxide Synthase (iNOS.
Energy Technology Data Exchange (ETDEWEB)
Morgunova, Ekaterina [Karolinska Institutet NOVUM, Center of Structural Biochemistry, Hälsovägen 7-9, 141 57 Huddinge (Sweden); Illarionov, Boris; Saller, Sabine [Institut für Lebensmittelchemie, Universität Hamburg, Grindelallee 117, 20146 Hamburg (Germany); Popov, Aleksander [European Synchrotron Radiation Facility, BP 220, F-38043 Grenoble CEDEX 09 (France); Sambaiah, Thota [Department of Medicinal Chemistry and Molecular Pharmacology, Purdue University (United States); Bacher, Adelbert [Chemistry Department, Technical University of Munich, 85747 Garching (Germany); Cushman, Mark [Department of Medicinal Chemistry and Molecular Pharmacology, Purdue University (United States); Fischer, Markus [Institut für Lebensmittelchemie, Universität Hamburg, Grindelallee 117, 20146 Hamburg (Germany); Ladenstein, Rudolf, E-mail: rudolf.ladenstein@ki.se [Karolinska Institutet NOVUM, Center of Structural Biochemistry, Hälsovägen 7-9, 141 57 Huddinge (Sweden)
2010-09-01
Crystallographic studies of lumazine synthase, the penultimate enzyme of the riboflavin-biosynthetic pathway in B. anthracis, provide a structural framework for the design of antibiotic inhibitors, together with calorimetric and kinetic investigations of inhibitor binding. The crystal structure of lumazine synthase from Bacillus anthracis was solved by molecular replacement and refined to R{sub cryst} = 23.7% (R{sub free} = 28.4%) at a resolution of 3.5 Å. The structure reveals the icosahedral symmetry of the enzyme and specific features of the active site that are unique in comparison with previously determined orthologues. The application of isothermal titration calorimetry in combination with enzyme kinetics showed that three designed pyrimidine derivatives bind to lumazine synthase with micromolar dissociation constants and competitively inhibit the catalytic reaction. Structure-based modelling suggested the binding modes of the inhibitors in the active site and allowed an estimation of the possible contacts formed upon binding. The results provide a structural framework for the design of antibiotics active against B. anthracis.
Examining the Evolution of Paid Parental Leave.
Sladek, Carol
While the United States continues to be the only developed nation without mandated paid maternity leave, U.S. employers are blazing their own trail for new parents. This article defines parental leave, explains what's driving the increased interest in paid parental leave among employers offering it and discusses how paid parental leave can benefit employers and employees alike. Finally, the author discusses why not all employers are offering these benefits as well as considerations for employers contemplating whether paid parental leave is right for them.
Michel, J B; Feron, O; Sase, K; Prabhakar, P; Michel, T
1997-10-10
Nitric oxide is synthesized in diverse mammalian tissues by a family of calmodulin-dependent nitric oxide synthases. The endothelial isoform of nitric oxide synthase (eNOS) is targeted to the specialized signal-transducing membrane domains termed plasmalemmal caveolae. Caveolin, the principal structural protein in caveolae, interacts with eNOS and leads to enzyme inhibition in a reversible process modulated by Ca2+-calmodulin (Michel, J. B., Feron, O., Sacks, D., and Michel, T. (1997) J. Biol. Chem. 272, 15583-15586). Caveolin also interacts with other structurally distinct signaling proteins via a specific region identified within the caveolin sequence (amino acids 82-101) that appears to subserve the role of a "scaffolding domain." We now report that the co-immunoprecipitation of eNOS with caveolin is completely and specifically blocked by an oligopeptide corresponding to the caveolin scaffolding domain. Peptides corresponding to this domain markedly inhibit nitric oxide synthase activity in endothelial membranes and interact directly with the enzyme to inhibit activity of purified recombinant eNOS expressed in Escherichia coli. The inhibition of purified eNOS by the caveolin scaffolding domain peptide is competitive and completely reversed by Ca2+-calmodulin. These studies establish that caveolin, via its scaffolding domain, directly forms an inhibitory complex with eNOS and suggest that caveolin inhibits eNOS by abrogating the enzyme's activation by calmodulin.
Monoterpene engineering in a woody plant Eucalyptus camaldulensis using a limonene synthase cDNA.
Ohara, Kazuaki; Matsunaga, Etsuko; Nanto, Kazuya; Yamamoto, Kyoko; Sasaki, Kanako; Ebinuma, Hiroyasu; Yazaki, Kazufumi
2010-01-01
Metabolic engineering aimed at monoterpene production has become an intensive research topic in recent years, although most studies have been limited to herbal plants including model plants such as Arabidopsis. The genus Eucalyptus includes commercially important woody plants in terms of essential oil production and the pulp industry. This study attempted to modify the production of monoterpenes, which are major components of Eucalyptus essential oil, by introducing two expression constructs containing Perilla frutescens limonene synthase (PFLS) cDNA, whose gene products were designed to be localized in either the plastid or cytosol, into Eucalyptus camaldulensis. The expression of the plastid-type and cytosol-type PFLS cDNA in transgenic E. camaldulensis was confirmed by real-time polymerase chain reaction (PCR). Gas chromatography with a flame ionization detector analyses of leaf extracts revealed that the plastidic and cytosolic expression of PFLS yielded 2.6- and 4.5-times more limonene than that accumulated in wild-type E. camaldulensis, respectively, while the ectopic expression of PFLS had only a small effect on the emission of limonene from the leaves of E. camaldulensis. Surprisingly, the high level of PFLS in Eucalyptus was accompanied by a synergistic increase in the production of 1,8-cineole and alpha-pinene, two major components of Eucalyptus monoterpenes. This genetic engineering of monoterpenes demonstrated a new potential for molecular breeding in woody plants.
Sinha, A K; Shirke, P A; Pathre, U; Sane, P V
1997-10-01
Light dependent modulation of sucrose-phosphate synthase activity (SPS; EC 2.4.1.14) was studied in a tree species, namely Prosopis juliflora. In this paper we demonstrate that cycloheximide, an inhibitor of cytoplasmic protein synthesis, when fed to detached leaves of P. juliflora through transpiration stream in the dark or in light completely prevents in vivo light activation of Vlim and Vmax activities of SPS. In case of spinach, however, cycloheximide feeding affects only Vlim activity while Vmax activity remained unchanged. In contrast, chloramphenicol, an inhibitor of protein synthesis in chloroplast has no effect on the light activation of SPS in Prosopis. The treatment with cycloheximide showed slight reduction in the rate of O2 evolution indicating that cycloheximide had very little effect on overall photosynthesis. These results indicate that short term protein turnover of the SPS protein and some other essential component(s) (e.g., a putative protein that modifies SPS activity) is one of the primary steps in a complex and unique regulatory cascade effecting the reversible light activation of SPS.
Analysis of genetic variation of inducible nitric oxide synthase and ...
African Journals Online (AJOL)
The genetic diversity of 100 Malaysian native chickens was investigated using polymerase chain reaction-restriction fragment polymorphism (PCR-RFLP) for two candidate genes: inducible nitric oxide synthase (INOS) and natural resistance-associated macrophage protein 1 (NRAMP1). The two genes were selected ...
Sieurin, Leif; Josephson, Malin; Vingård, Eva
2009-01-01
To describe the consequences of long-term sick leave (>28 days) on working situation, health and lifestyle among employees from the public sector in Sweden. Employees in four county councils and two municipalities on long term sick leave on 1 November 2005 (n = 1,128) answered a questionnaire in February 2006. The response rate was 71.7%. Eighty seven per cent were still on sick leave when the questionnaire was answered: 54% part time and 33% full time. Reporting positive consequences was rare but reporting negative consequences, such as effects on the development of salary, the possibilities of pursuing a career or to change to another job were common. Sick leave seemed to lead to a considerable loss of zest for work, even if the respondents were back in work full time. Regardless of the negative consequences at work, 92% of those on part-time sick leave believed that the part-time sick leave was good for them even if many thought it had negative consequences for employer and colleagues. Long-term sick leave has negative consequences for the individual in work situations, even for those back at work full time. The development of salary and career seem to be most affected. The attitude towards part-time sick leave was positive and this result indicates that there is a potential for an increased degree of partial return to work in the group of people on long-term sick leave.
Post-irradiation inactivation, protection, and repair of the sulfhydryl enzyme malate synthase
International Nuclear Information System (INIS)
Durchschlag, H.; Zipper, P.
1985-01-01
Malate synthase from baker's yeast, a trimeric sulfhydryl enzyme with one essential sulfhydryl group per subunit, was inactivated by 2 kGy X-irradiation in air-saturated aqueous solution (enzyme concentration: 0.5 mg/ml). The radiation induced changes of enzymic activity were registered at about 0,30,60 h after irradiation. To elucidate the role of OH - , O 2 , and H 2 O 2 in the X-ray inactivation of the enzyme, experiments were performed in the absence of presence of different concentrations of specific additives (formate, superoxide dismutase, catalase). These additives were added to malate synthase solutions before or after X-irradiation. Moreover, repairs of inactivated malate synthase were initiated at about 0 or 30 h after irradiation by means of the sulfhydryl agent dithiothreitol. Experiments yielded the following results: 1. Irradiation of malate synthase in the absence of additives inactivated the enzyme immediately to a residual activity Asub(r)=3% (corresponding to a D 37 =0.6 kGy), and led to further slow inactivation in the post-irradiation phase. Repairs, initiated at different times after irradiation, restored enzymic activity considerably. The repair initiated at t=0 led to Asub(r)=21%; repairs started later on resulted in somewhat lower activities. The decay of reparability, however, was found to progress more slowly than post-irradiation inactivation itself. After completion of repair the activities of repaired samples did not decrease significantly. 2. The presence of specific additives during irradiation caused significant protective effects against primary inactivation. The protection by formate was very pronounced (e.g., Asub(r)=72% and D 37 =6 kGy for 100 mM formate). The presence of catalytic amounts of superoxide dismutase and/or catalase exhibited only minor effects, depending on the presence and concentration of formate. (orig.)
Effects of hypercapnia and NO synthase inhibition in sustained hypoxic pulmonary vasoconstriction
2012-01-01
Background Acute respiratory disorders may lead to sustained alveolar hypoxia with hypercapnia resulting in impaired pulmonary gas exchange. Hypoxic pulmonary vasoconstriction (HPV) optimizes gas exchange during local acute (0-30 min), as well as sustained (> 30 min) hypoxia by matching blood perfusion to alveolar ventilation. Hypercapnia with acidosis improves pulmonary gas exchange in repetitive conditions of acute hypoxia by potentiating HPV and preventing pulmonary endothelial dysfunction. This study investigated, if the beneficial effects of hypercapnia with acidosis are preserved during sustained hypoxia as it occurs, e.g in permissive hypercapnic ventilation in intensive care units. Furthermore, the effects of NO synthase inhibitors under such conditions were examined. Method We employed isolated perfused and ventilated rabbit lungs to determine the influence of hypercapnia with or without acidosis (pH corrected with sodium bicarbonate), and inhibitors of endothelial as well as inducible NO synthase on acute or sustained HPV (180 min) and endothelial permeability. Results In hypercapnic acidosis, HPV was intensified in sustained hypoxia, in contrast to hypercapnia without acidosis when HPV was amplified during both phases. L-NG-Nitroarginine (L-NNA), a non-selective NO synthase inhibitor, enhanced acute as well as sustained HPV under all conditions, however, the amplification of sustained HPV induced by hypercapnia with or without acidosis compared to normocapnia disappeared. In contrast 1400 W, a selective inhibitor of inducible NO synthase (iNOS), decreased HPV in normocapnia and hypercapnia without acidosis at late time points of sustained HPV and selectively reversed the amplification of sustained HPV during hypercapnia without acidosis. Hypoxic hypercapnia without acidosis increased capillary filtration coefficient (Kfc). This increase disappeared after administration of 1400 W. Conclusion Hypercapnia with and without acidosis increased HPV during
Effects of hypercapnia and NO synthase inhibition in sustained hypoxic pulmonary vasoconstriction
Directory of Open Access Journals (Sweden)
Ketabchi Farzaneh
2012-01-01
Full Text Available Abstract Background Acute respiratory disorders may lead to sustained alveolar hypoxia with hypercapnia resulting in impaired pulmonary gas exchange. Hypoxic pulmonary vasoconstriction (HPV optimizes gas exchange during local acute (0-30 min, as well as sustained (> 30 min hypoxia by matching blood perfusion to alveolar ventilation. Hypercapnia with acidosis improves pulmonary gas exchange in repetitive conditions of acute hypoxia by potentiating HPV and preventing pulmonary endothelial dysfunction. This study investigated, if the beneficial effects of hypercapnia with acidosis are preserved during sustained hypoxia as it occurs, e.g in permissive hypercapnic ventilation in intensive care units. Furthermore, the effects of NO synthase inhibitors under such conditions were examined. Method We employed isolated perfused and ventilated rabbit lungs to determine the influence of hypercapnia with or without acidosis (pH corrected with sodium bicarbonate, and inhibitors of endothelial as well as inducible NO synthase on acute or sustained HPV (180 min and endothelial permeability. Results In hypercapnic acidosis, HPV was intensified in sustained hypoxia, in contrast to hypercapnia without acidosis when HPV was amplified during both phases. L-NG-Nitroarginine (L-NNA, a non-selective NO synthase inhibitor, enhanced acute as well as sustained HPV under all conditions, however, the amplification of sustained HPV induced by hypercapnia with or without acidosis compared to normocapnia disappeared. In contrast 1400 W, a selective inhibitor of inducible NO synthase (iNOS, decreased HPV in normocapnia and hypercapnia without acidosis at late time points of sustained HPV and selectively reversed the amplification of sustained HPV during hypercapnia without acidosis. Hypoxic hypercapnia without acidosis increased capillary filtration coefficient (Kfc. This increase disappeared after administration of 1400 W. Conclusion Hypercapnia with and without acidosis
Effects of hypercapnia and NO synthase inhibition in sustained hypoxic pulmonary vasoconstriction.
Ketabchi, Farzaneh; Ghofrani, Hossein A; Schermuly, Ralph T; Seeger, Werner; Grimminger, Friedrich; Egemnazarov, Bakytbek; Shid-Moosavi, S Mostafa; Dehghani, Gholam A; Weissmann, Norbert; Sommer, Natascha
2012-01-31
Acute respiratory disorders may lead to sustained alveolar hypoxia with hypercapnia resulting in impaired pulmonary gas exchange. Hypoxic pulmonary vasoconstriction (HPV) optimizes gas exchange during local acute (0-30 min), as well as sustained (> 30 min) hypoxia by matching blood perfusion to alveolar ventilation. Hypercapnia with acidosis improves pulmonary gas exchange in repetitive conditions of acute hypoxia by potentiating HPV and preventing pulmonary endothelial dysfunction. This study investigated, if the beneficial effects of hypercapnia with acidosis are preserved during sustained hypoxia as it occurs, e.g in permissive hypercapnic ventilation in intensive care units. Furthermore, the effects of NO synthase inhibitors under such conditions were examined. We employed isolated perfused and ventilated rabbit lungs to determine the influence of hypercapnia with or without acidosis (pH corrected with sodium bicarbonate), and inhibitors of endothelial as well as inducible NO synthase on acute or sustained HPV (180 min) and endothelial permeability. In hypercapnic acidosis, HPV was intensified in sustained hypoxia, in contrast to hypercapnia without acidosis when HPV was amplified during both phases. L-NG-Nitroarginine (L-NNA), a non-selective NO synthase inhibitor, enhanced acute as well as sustained HPV under all conditions, however, the amplification of sustained HPV induced by hypercapnia with or without acidosis compared to normocapnia disappeared. In contrast 1400 W, a selective inhibitor of inducible NO synthase (iNOS), decreased HPV in normocapnia and hypercapnia without acidosis at late time points of sustained HPV and selectively reversed the amplification of sustained HPV during hypercapnia without acidosis. Hypoxic hypercapnia without acidosis increased capillary filtration coefficient (Kfc). This increase disappeared after administration of 1400 W. Hypercapnia with and without acidosis increased HPV during conditions of sustained hypoxia. The
5 CFR 630.906 - Transfer of annual leave.
2010-01-01
... employing agency may not be sufficient to meet the needs of the leave recipient; or (3) In the judgment of... specified leave recipient. Except as provided in paragraph (f) of this section, annual leave may be transferred only to a leave recipient employed by the leave donor's employing agency. (b) Except as provided...
Tsuda, Hirohisa; Shiraki, Mari; Inoue, Eri; Saito, Terumi
2016-08-20
It has been reported that Poly-β-hydroxybutyrate (PHB) is generated from acetate in the rice root. However, no information is available about the biosynthetic pathway of PHB from acetate in plant cells. In the bacterium Ralstonia eutropha H16 (R. eutropha), PHB is synthesized from acetyl CoA by the consecutive reaction of three enzymes: β-ketothiolase (EC: 2.3.1.9), acetoacetyl CoA reductase (EC: 1.1.1.36) and PHB synthase (EC: 2.3.1.-). Thus, in this study, we examined whether the above three enzymatic activities were also detected in rice seedlings. The results clearly showed that the activities of the above three enzymes were all detected in rice. In particular, the PHB synthase activity was detected specifically in the sonicated particulate fractions (2000g 10min precipitate (ppt) and the 8000g 30min ppt) of rice roots and leaves. In addition to these enzyme activities, several new experimental results were obtained on PHB synthesis in higher plants: (a) (14)C-PHB generated from 2-(14)C-acetate was mainly localized in the 2000g 10min ppt and the 8000g 30min ppt of rice root. (b) Addition of acetate (0.1-10mM) to culture medium of rice seedlings did not increase the content of PHB in the rice root or leaf. (c) In addition to C3 plants, PHB was generated from acetate in a C4 plant (corn) and in a CAM plant (Bryophyllum pinnatum). d) Washing with ethylenediaminetetraacetic acid (EDTA) strongly suggested that the PHB synthesized from acetate was of plant origin and was not bacterial contamination. Copyright © 2016 Elsevier GmbH. All rights reserved.
Grass leaves as potential hominin dietary resources.
Paine, Oliver C C; Koppa, Abigale; Henry, Amanda G; Leichliter, Jennifer N; Codron, Daryl; Codron, Jacqueline; Lambert, Joanna E; Sponheimer, Matt
2018-04-01
Discussions about early hominin diets have generally excluded grass leaves as a staple food resource, despite their ubiquity in most early hominin habitats. In particular, stable carbon isotope studies have shown a prevalent C 4 component in the diets of most taxa, and grass leaves are the single most abundant C 4 resource in African savannas. Grass leaves are typically portrayed as having little nutritional value (e.g., low in protein and high in fiber) for hominins lacking specialized digestive systems. It has also been argued that they present mechanical challenges (i.e., high toughness) for hominins with bunodont dentition. Here, we compare the nutritional and mechanical properties of grass leaves with the plants growing alongside them in African savanna habitats. We also compare grass leaves to the leaves consumed by other hominoids and demonstrate that many, though by no means all, compare favorably with the nutritional and mechanical properties of known primate foods. Our data reveal that grass leaves exhibit tremendous variation and suggest that future reconstructions of hominin dietary ecology take a more nuanced approach when considering grass leaves as a potential hominin dietary resource. Copyright © 2017. Published by Elsevier Ltd.
Schmiderer, Corinna; Grausgruber-Gröger, Sabine; Grassi, Paolo; Steinborn, Ralf; Novak, Johannes
2010-07-01
Common sage (Salvia officinalis L., Lamiaceae) is one of the most important medicinal and aromatic plants, with antioxidant, antimicrobial, spasmolytic, astringent, antihidrotic and specific sensorial properties. The essential oil of the plant, composed mainly of the monoterpenes 1,8-cineole, alpha-thujone, beta-thujone and camphor, is responsible for some of these effects. Gibberellins regulate diverse physiological processes in plants, such as seed germination, shoot elongation and cell division. In this study, we analyzed the effect of exogenously applied plant growth regulators, namely gibberellic acid (GA(3)) and daminozide, on leaf morphology and essential oil formation of two leaf stages during the period of leaf expansion. Essential oil content increased with increasing levels of gibberellins and decreased when gibberellin biosynthesis was blocked with daminozide. With increasing levels of gibberellins, 1,8-cineole and camphor contents increased. Daminozide blocked the accumulation of alpha- and beta-thujone. GA(3) at the highest level applied also led to a significant decrease of alpha- and beta-thujone. Monoterpene synthases are a class of enzymes responsible for the first step in monoterpene biosynthesis, competing for the same substrate geranylpyrophosphate. The levels of gene expression of the three most important monoterpene synthases in sage were investigated, 1,8-cineole synthase leading directly to 1,8-cineole, (+)-sabinene synthase responsible for the first step in the formation of alpha- and beta-thujone, and (+)-bornyl diphosphate synthase, the first step in camphor biosynthesis. The foliar application of GA(3) increased, while daminozide significantly decreased gene expression of the monoterpene synthases. The amounts of two of the end products, 1,8-cineole and camphor, were directly correlated with the levels of gene expression of the respective monoterpene synthases, indicating transcriptional control, while the formation of alpha- and beta
International Nuclear Information System (INIS)
Grum, Daniel; Boom, Johannes van den; Neumann, Daniel; Matena, Anja; Link, Nina M.; Mueller, Jonathan W.
2010-01-01
3'-Phospho-adenosine-5'-phosphosulphate (PAPS) synthases are fundamental to mammalian sulphate metabolism. These enzymes have recently been linked to a rising number of human diseases. Despite many studies, it is not yet understood how the mammalian PAPS synthases 1 and 2 interact with each other. We provide first evidence for heterodimerisation of these two enzymes by pull-down assays and Foerster resonance energy transfer (FRET) measurements. Kinetics of dimer dissociation/association indicates that these heterodimers form as soon as PAPSS1 and -S2 encounter each other in solution. Affinity of the homo- and heterodimers were found to be in the low nanomolar range using anisotropy measurements employing proteins labelled with the fluorescent dye IAEDANS that - in spite of its low quantum yield - is well suited for anisotropy due to its large Stokes shift. Within its kinase domain, the PAPS synthase heterodimer displays similar substrate inhibition by adenosine-5'-phosphosulphate (APS) as the homodimers. Due to divergent catalytic efficacies of PAPSS1 and -S2, the heterodimer might be a way of regulating PAPS synthase function within mammalian cells.
Nurses' leaving intentions: antecedents and mediating factors.
Takase, Miyuki; Yamashita, Noriko; Oba, Keiko
2008-05-01
This paper is a report of a study to investigate how nurses' work values, perceptions of environmental characteristics, and organizational commitment are related to their leaving intentions. Nurse leaving is a serious international problem as it contributes to the nursing shortage that threatens the welfare of society. The characteristics of nurses, the work environment and nurses' feelings towards their jobs (or organizations) have an impact on their leaving intentions. A convenience sample of 849 Registered Nurses was recruited from three public hospitals in the central-west region of Japan during 2006 and 319 completed questionnaires were returned (response rate 39%). Data were analysed using regression analysis. Nurses' work values and their perceptions of their workplace environment interacted to influence leaving intentions. When there was a match between the importance nurses placed on being able to challenge current clinical practices and the number of the actual opportunities to do so, leaving intentions were low. When there was a mismatch, intention to quit the job became stronger. In addition, organizational commitment intervened between nurses' perceptions of the match in clinical challenges and leaving intention. Nurses' leaving intentions, deserve extensive exploration of their causes. Such exploration should include attending to both nurses' needs and organizational characteristics, investigating how the match between them could affect nurses' leaving intention, and exploring factors that intervene between nurses' perceptions of the match and leaving intention.
Highly Divergent Mitochondrial ATP Synthase Complexes in Tetrahymena thermophila
Nina, Praveen Balabaskaran; Dudkina, Natalya V.; Kane, Lesley A.; van Eyk, Jennifer E.; Boekema, Egbert J.; Mather, Michael W.; Vaidya, Akhil B.; Eisen, Jonathan A.
The F-type ATP synthase complex is a rotary nano-motor driven by proton motive force to synthesize ATP. Its F(1) sector catalyzes ATP synthesis, whereas the F(o) sector conducts the protons and provides a stator for the rotary action of the complex. Components of both F(1) and F(o) sectors are
Contribution of granule bound starch synthase in kernel modification ...
African Journals Online (AJOL)
The role of gbssI and gbssII genes, encoding granule bound starch synthase enzyme I and II, respectively, in quality protein maize (QPM) were studied at different days after pollination (DAP). Total RNA was used for first strand cDNA synthesis using the ImpromIISriptTM reverse transcriptase. No detectable levels of gbssI ...
[Modeling polarimetric BRDF of leaves surfaces].
Xie, Dong-Hui; Wang, Pei-Juan; Zhu, Qi-Jiang; Zhou, Hong-Min
2010-12-01
The purpose of the present paper is to model a physical polarimetric bidirectional reflectance distribution function (pBRDF), which can character not only the non-Lambertian but also the polarized features in order that the pBRDF can be applied to analyze the relationship between the degree of polarization and the physiological and biochemical parameters of leaves quantitatively later. Firstly, the bidirectional polarized reflectance distributions from several leaves surfaces were measured by the polarized goniometer developed by Changchun Institute of Optics, Fine Mechanics and Physics, Chinese Academy of Sciences. The samples of leaves include two pieces of zea mays L. leaves (young leaf and mature leaf) and a piece of E. palcherrima wild leaf. Non-Lambertian characteristics of directional reflectance from the surfaces of these three leaves are obvious. A Cook-Torrance model was modified by coupling the polarized Fresnel equations to simulate the bidirectional polarized reflectance properties of leaves surfaces. The three parameters in the modified pBRDF model, such as diffuse reflectivity, refractive index and roughness of leaf surface were inversed with genetic algorithm (GA). It was found that the pBRDF model can fit with the measured data well. In addition, these parameters in the model are related with both the physiological and biochemical properties and the polarized characteristics of leaves, therefore it is possible to build the relationships between them later.
Lee, Ya-Wen; Dai, Yu-Tzu; Chang, Mei Yeh; Chang, Yue-Cune; Yao, Kaiping Grace; Liu, Mei-Chun
2017-07-01
To examine the associations among quality of work life, nurses' intention to leave the profession, and nurses leaving the profession. A prospective study design was used. Participants were 1,283 hospital nurses with a purposive sampling in Taiwan. The self-reported questionnaire consisted of three questionnaires: the Chinese version of the Quality of Nursing Work Life scale, an intention-to-leave profession questionnaire, and a demographic questionnaire. Records of nurses leaving the profession were surveyed 1 year later. Data were analyzed by descriptive statistics and inferential statistics. As many as 720 nurses (56.1%) had tendencies to leave their profession. However, only 31 nurses (2.5%) left their profession 1 year later. Nurses' intention to leave the profession mediated the relationship between the milieu of respect and autonomy, quality of work life, and nurses leaving the profession. The milieu of respect and autonomy describing the quality of work life predicts the nurses' intention to leave the profession, and together these predict nurses leaving the profession. This study illustrates that nurse managers could provide effective interventions to ameliorate the milieu of respect and autonomy aspect of quality of work life to prevent nurses from leaving their profession. © 2017 Sigma Theta Tau International.
Isolation of an ATP synthase cDNA from Sinonovacula constricta ...
African Journals Online (AJOL)
Yomi
2012-01-24
Jan 24, 2012 ... protein involved in temperature challenge in S. constricta. Key words: Sinonovacula constricta, ATP synthase, ... MATERIALS AND METHODS. Experimental animals. Sinonovacula constricta (7 to 8 g ... Dissociation curve analysis of amplification products was performed at the end of each PCR reaction to ...
Polyketide synthases from poison hemlock (Conium maculatum L.).
Hotti, Hannu; Seppänen-Laakso, Tuulikki; Arvas, Mikko; Teeri, Teemu H; Rischer, Heiko
2015-11-01
Coniine is a toxic alkaloid, the biosynthesis of which is not well understood. A possible route, supported by evidence from labelling experiments, involves a polyketide formed by the condensation of one acetyl-CoA and three malonyl-CoAs catalysed by a polyketide synthase (PKS). We isolated PKS genes or their fragments from poison hemlock (Conium maculatum L.) by using random amplification of cDNA ends (RACE) and transcriptome analysis, and characterized three full-length enzymes by feeding different starter-CoAs in vitro. On the basis of our in vitro experiments, two of the three characterized PKS genes in poison hemlock encode chalcone synthases (CPKS1 and CPKS2), and one encodes a novel type of PKS (CPKS5). We show that CPKS5 kinetically favours butyryl-CoA as a starter-CoA in vitro. Our results suggest that CPKS5 is responsible for the initiation of coniine biosynthesis by catalysing the synthesis of the carbon backbone from one butyryl-CoA and two malonyl-CoAs. © 2015 FEBS.
Hendrix, D L; Huber, S C
1986-06-01
In fully expanded leaves of greenhouse-grown cotton (Gossypium hirsutum L., cv Coker 100) plants, carbon export, starch accumulation rate, and carbon exchange rate exhibited different behavior during the light period. Starch accumulation rates were relatively constant during the light period, whereas carbon export rate was greater in the afternoon than in the morning even though the carbon exchange rate peaked about noon. Sucrose levels increased throughout the light period and dropped sharply with the onset of darkness; hexose levels were relatively constant except for a slight peak in the early morning. Sucrose synthase, usually thought to be a degradative enzyme, was found in unusually high activities in cotton leaf. Both sucrose synthase and sucrose phosphate synthetase activities were found to fluctuate diurnally in cotton leaves but with different rhythms. Diurnal fluctuations in the rate of sucrose export were generally aligned with sucrose phosphate synthase activity during the light period but not with sucrose synthase activity; neither enzyme activity correlated with carbon export during the dark. Cotton leaf sucrose phosphate synthase activity was sufficient to account for the observed carbon export rates; there is no need to invoke sucrose synthase as a synthetic enzyme in mature cotton leaves. During the dark a significant correlation was found between starch degradation rate and leaf carbon export. These results indicate that carbon partitioning in cotton leaf is somewhat independent of the carbon exchange rate and that leaf carbon export rate may be linked to sucrose formation and content during the light period and to starch breakdown in the dark.
Hideg, Ivona; Krstic, Anja; Trau, Raymond N C; Zarina, Tanya
2018-06-07
To support women in the workplace, longer legislated maternity leaves have been encouraged in Scandinavian countries and recently in Canada. Yet, past research shows that longer legislated maternity leaves (i.e., 1 year and longer) may unintentionally harm women's career progress. To address this issue, we first sought to identify one potential mechanism underlying negative effects of longer legislated maternity leaves: others' lower perceptions of women's agency. Second, we utilize this knowledge to test interventions that boost others' perceptions of women's agency and thus mitigate negative effects of longer legislated maternity leaves. We test our hypotheses in three studies in the context of Canadian maternity leave policies. Specifically, in Study 1, we found that others' lower perceptions of women's agency mediated the negative effects of a longer legislated maternity leave, that is, 1 year (vs. shorter, i.e., 1 month maternity leave) on job commitment. In Study 2, we found that providing information about a woman's agency mitigates the unintended negative effects of a longer legislated maternity leave on job commitment and hireability. In Study 3, we showed that use of a corporate program that enables women to stay in touch with the workplace while on maternity leave (compared to conditions in which no such program was offered; a program was offered but not used by the applicant; and the program was offered, but there was no information about its usage by the applicant) enhances agency perceptions and perceptions of job commitment and hireability. Implications for theory and practice are discussed. (PsycINFO Database Record (c) 2018 APA, all rights reserved).
Energy Technology Data Exchange (ETDEWEB)
Rudolf, Jeffrey D.; Dong, Liao-Bin; Cao, Hongnan; Hatzos-Skintges, Catherine; Osipiuk, Jerzy; Endres, Michael; Chang, Chin-Yuan; Ma, Ming; Babnigg, Gyorgy; Joachimiak, Andrzej; Phillips, George N.; Shen, Ben
2016-08-31
Terpenoids are the largest and most structurally diverse family of natural products found in nature, yet their presence in bacteria is underappreciated. The carbon skeletons of terpenoids are generated through carbocation-dependent cyclization cascades catalyzed by terpene synthases (TSs). Type I and type II TSs initiate cyclization via diphosphate ionization and protonation, respectively, and protein structures of both types are known. Most plant diterpene synthases (DTSs) possess three alpha-helical domains (alpha beta gamma), which are thought to have arisen from the fusion of discrete, ancestral bacterial type I TSs (alpha) and type II TSs (beta gamma). Type II DTSs of bacterial origin, of which there are no structurally characterized members, are a missing piece in the structural evolution of TSs. Here, we report the first crystal structure of a type II DTS from bacteria. PtnaT2 from Streptomyces platensis CB00739 was verified as an ent-copalyl diphosphate synthase involved in the biosynthesis of platensimycin and platencin. The crystal structure of PtmT2 was solved at a resolution of 1.80 angstrom, and docking studies suggest the catalytically active conformation of geranylgeranyl diphosphate (GGPP). Site-directed mutagenesis confirmed residues involved in binding the diphosphate moiety of GGPP and identified DxxxxE as a potential Mg2+-binding motif for type II DTSs of bacterial origin. Finally, both the shape and physicochemical properties of the active sites are responsible for determining specific catalytic outcomes of TSs. The structure of PtmT2 fundamentally advances the knowledge of bacterial TSs, their mechanisms, and their role in the evolution of TSs.
Directory of Open Access Journals (Sweden)
Gea Guerriero
Full Text Available Oomycetes represent some of the most devastating plant and animal pathogens. Typical examples are Phytophthora infestans, which causes potato and tomato late blight, and Saprolegnia parasitica, responsible for fish diseases. Despite the economical and environmental importance of oomycete diseases, their control is difficult, particularly in the aquaculture industry. Carbohydrate synthases are vital for hyphal growth and represent interesting targets for tackling the pathogens. The existence of 2 different chitin synthase genes (SmChs1 and SmChs2 in Saprolegnia monoica was demonstrated using bioinformatics and molecular biology approaches. The function of SmCHS2 was unequivocally demonstrated by showing its catalytic activity in vitro after expression in Pichia pastoris. The recombinant SmCHS1 protein did not exhibit any activity in vitro, suggesting that it requires other partners or effectors to be active, or that it is involved in a different process than chitin biosynthesis. Both proteins contained N-terminal Microtubule Interacting and Trafficking domains, which have never been reported in any other known carbohydrate synthases. These domains are involved in protein recycling by endocytosis. Enzyme kinetics revealed that Saprolegnia chitin synthases are competitively inhibited by nikkomycin Z and quantitative PCR showed that their expression is higher in presence of the inhibitor. The use of nikkomycin Z combined with microscopy showed that chitin synthases are active essentially at the hyphal tips, which burst in the presence of the inhibitor, leading to cell death. S. parasitica was more sensitive to nikkomycin Z than S. monoica. In conclusion, chitin synthases with species-specific characteristics are involved in tip growth in Saprolegnia species and chitin is vital for the micro-organisms despite its very low abundance in the cell walls. Chitin is most likely synthesized transiently at the apex of the cells before cellulose, the major
International Nuclear Information System (INIS)
Cuskin, Fiona; Solovyova, Alexandra S.; Lewis, Richard J.; Race, Paul R.
2011-01-01
The expression, purification and crystallization of the trans-acting acyltransferase PksC from the bacillaene hybrid polyketide synthase/nonribosomal peptide synthetase is described. The crystals belonged to the orthorhombic space group P2 1 2 1 2 1 and diffracted to 1.44 Å resolution. The antibiotic bacillaene is biosynthesized in Bacillus subtilis by a hybrid type 1 modular polyketide synthase/nonribosomal peptide synthetase of the trans-acyltransferase (trans-AT) class. Within this system, the essential acyl-group loading activity is provided by the action of three free-standing trans-acting acyltransferases. Here, the recombinant expression, purification and crystallization of the bacillaene synthase trans-acting acyltransferase PksC are reported. A diffraction data set has been collected from a single PksC crystal to 1.44 Å resolution and the crystal was found to belong to the orthorhombic space group P2 1 2 1 2 1
Directory of Open Access Journals (Sweden)
Dullat Harpreet K
2011-03-01
Full Text Available Abstract Background In conifers, terpene synthases (TPSs of the gymnosperm-specific TPS-d subfamily form a diverse array of mono-, sesqui-, and diterpenoid compounds, which are components of the oleoresin secretions and volatile emissions. These compounds contribute to defence against herbivores and pathogens and perhaps also protect against abiotic stress. Results The availability of extensive transcriptome resources in the form of expressed sequence tags (ESTs and full-length cDNAs in several spruce (Picea species allowed us to estimate that a conifer genome contains at least 69 unique and transcriptionally active TPS genes. This number is comparable to the number of TPSs found in any of the sequenced and well-annotated angiosperm genomes. We functionally characterized a total of 21 spruce TPSs: 12 from Sitka spruce (P. sitchensis, 5 from white spruce (P. glauca, and 4 from hybrid white spruce (P. glauca × P. engelmannii, which included 15 monoterpene synthases, 4 sesquiterpene synthases, and 2 diterpene synthases. Conclusions The functional diversity of these characterized TPSs parallels the diversity of terpenoids found in the oleoresin and volatile emissions of Sitka spruce and provides a context for understanding this chemical diversity at the molecular and mechanistic levels. The comparative characterization of Sitka spruce and Norway spruce diterpene synthases revealed the natural occurrence of TPS sequence variants between closely related spruce species, confirming a previous prediction from site-directed mutagenesis and modelling.
Isolation and expression of the Pneumocystis carinii thymidylate synthase gene
DEFF Research Database (Denmark)
Edman, U; Edman, J C; Lundgren, B
1989-01-01
The thymidylate synthase (TS) gene from Pneumocystis carinii has been isolated from complementary and genomic DNA libraries and expressed in Escherichia coli. The coding sequence of TS is 891 nucleotides, encoding a 297-amino acid protein of Mr 34,269. The deduced amino acid sequence is similar...
Maternity and family leave policies in rural family practices.
Mainguy, S; Crouse, B J
1998-09-01
To help recruit and retain physicians, especially women, rural family practice groups need to establish policies regarding maternity and other family leaves. Also important are policies regarding paternity leave, adoptive leave, and leave to care for elderly parents. We surveyed members of the American Academy of Family Physicians in rural practice in 1995 to assess the prevalence of leave policies, the degree to which physicians are taking family leave, and the characteristics of ideal policies. Currently, both men and women physicians are taking family leaves of absence, which indicates a need for leave policies. Furthermore, a lack of family leave policies may deter women from entering rural practice.
Negotiating leave in the workplace
DEFF Research Database (Denmark)
Bloksgaard, Lotte
In Denmark leave entitlement is not only regulated by law but is also part of the various collective agreements established in the respective occupational sectors and at the local workplace level. Consequently, Danish fathers have very different leave entitlements, depending on the sector, branch...
Negotiating leave in the workplace
DEFF Research Database (Denmark)
Bloksgaard, Lotte
2014-01-01
In Denmark leave entitlement is not only regulated by law but is also part of the various collective agreements established in the respective occupational sectors and at the local workplace level. Consequently, Danish fathers have very different leave entitlements, depending on the sector, branch...
DEFF Research Database (Denmark)
Freiberg, Jacob J; Dahl, Morten; Tybjaerg-Hansen, Anne
2009-01-01
Ischemic cardiovascular disease and obstructive pulmonary disease involve inflammation. Leukotrienes may be important pro-inflammatory mediators. We tested the hypothesis that the (-1072)G > A and (-444)A > C promoter polymorphisms of leukotriene C4 synthase confer risk of transient ischemic atta...... with risk of asthma or COPD. Leukotriene C4 synthase promoter genotypes influence risk of TIA and ischemic stroke, but not risk of IHD/coronary atherosclerosis, asthma, or COPD....
HR Department
2009-01-01
Following the communication of the Standing Concertation Committee published in Weekly Bulletin No. 18-19 of 27 April 2009, the current statement of leave on monthly pay slips has been replaced with the EDH Leave Transactions report that displays the up-to-date situation of individual leave balances at all times. The report is available on EDH. Additionally, the layout of the pay slip has been modernised. The new version of the pay slip will be send out from September 2009 onwards. Finance and Purchasing Department, Personnel Accounting Human Resources Department, Organisation and Procedures General Infrastructure Services Department, Administrative Information Services
Shahbaaz, Mohd; Ahmad, Faizan; Imtaiyaz Hassan, Md
2015-06-01
Haemophilus influenzae is a small pleomorphic Gram-negative bacteria which causes several chronic diseases, including bacteremia, meningitis, cellulitis, epiglottitis, septic arthritis, pneumonia, and empyema. Here we extensively analyzed the sequenced genome of H. influenzae strain Rd KW20 using protein family databases, protein structure prediction, pathways and genome context methods to assign a precise function to proteins whose functions are unknown. These proteins are termed as hypothetical proteins (HPs), for which no experimental information is available. Function prediction of these proteins would surely be supportive to precisely understand the biochemical pathways and mechanism of pathogenesis of Haemophilus influenzae. During the extensive analysis of H. influenzae genome, we found the presence of eight HPs showing lyase activity. Subsequently, we modeled and analyzed three-dimensional structure of all these HPs to determine their functions more precisely. We found these HPs possess cystathionine-β-synthase, cyclase, carboxymuconolactone decarboxylase, pseudouridine synthase A and C, D-tagatose-1,6-bisphosphate aldolase and aminodeoxychorismate lyase-like features, indicating their corresponding functions in the H. influenzae. Lyases are actively involved in the regulation of biosynthesis of various hormones, metabolic pathways, signal transduction, and DNA repair. Lyases are also considered as a key player for various biological processes. These enzymes are critically essential for the survival and pathogenesis of H. influenzae and, therefore, these enzymes may be considered as a potential target for structure-based rational drug design. Our structure-function relationship analysis will be useful to search and design potential lead molecules based on the structure of these lyases, for drug design and discovery.
Citric acid production and citrate synthase genes in distinct strains of ...
African Journals Online (AJOL)
SAM
2014-05-28
May 28, 2014 ... synthase in lactic acid production by A. niger and with the ... A number of microorganisms, including both bacteria and fungi, possess the capacity ..... citric acid production by solid-state fermentation from cassava bagasse and ...
Weterings, Koen; Pezzotti, Mario; Cornelissen, Marc; Mariani, Celestina
2002-11-01
In flowering plants, pollination of the stigma sets off a cascade of responses in the distal flower organs. Ethylene and its biosynthetic precursor 1-aminocyclopropane-1-carboxylate (ACC) play an important role in regulating these responses. Because exogenous application of ethylene or ACC does not invoke the full postpollination syndrome, the pollination signal probably consists of a more complex set of stimuli. We set out to study how and when the pollination signal moves through the style of tobacco (Nicotiana tabacum) by analyzing the expression patterns of pistil-expressed ACC-synthase and -oxidase genes. Results from this analysis showed that pollination induces high ACC-oxidase transcript levels in all cells of the transmitting tissue. ACC-synthase mRNA accumulated only in a subset of transmitting tract cells and to lower levels as compared with ACC-oxidase. More significantly, we found that although ACC-oxidase transcripts accumulate to uniform high levels, the ACC-synthase transcripts accumulate in a wave-like pattern in which the peak coincides with the front of the ingrowing pollen tube tips. This wave of ACC-synthase expression can also be induced by incongruous pollination and (partially) by wounding. This indicates that wounding-like features of pollen tube invasion might be part of the stimuli evoking the postpollination response and that these stimuli are interpreted differently by the regulatory mechanisms of the ACC-synthase and -oxidase genes.
DEFF Research Database (Denmark)
Vad, Knud; de Neergaard, Eigil; Madriz-Ordeñana, Kenneth
1993-01-01
The race specific resistance of pea to Ascochyta pisi Lib. was shown to be exhibited as a hypersensitive response associated with the production of polyphenolic substances in epidermal and mesophyll cells. The levels of transcripts representing a pathogenesis-related (PR) protein (chitinase......) and an enzyme of phytoalexin biosynthesis (chalcone synthase) were shown to accumulate more rapidly during the hypersensitive response than during lesion development in the compatible interaction. A full-length (1143 bp) cDNA sequence of a pea chitinase (EC 3.2.1.14) (coding for an approx. 34 500 Da protein......) was deduced by combining the overlapping sequences of three clones obtained following PCR amplification of cDNA prepared from mRNA isolated 24 h after inoculation of pea leaves with Ascochyta pisi. The combined sequences were identified as a class I chitinase corresponding to the basic A1-chitinase enzyme...
Chalcone synthase genes from milk thistle (Silybum marianum ...
Indian Academy of Sciences (India)
In the current research, fragments of CHS genes were amplified ... transcript level in petals in the early flowering stage and in the stem of five upper leaves, followed by five upper leaves in the ..... First strand cDNA was amplified by 1 μg of.
Stochastic thermodynamics of a chemical nanomachine: The channeling enzyme tryptophan synthase.
Loutchko, Dimitri; Eisbach, Maximilian; Mikhailov, Alexander S
2017-01-14
The enzyme tryptophan synthase is characterized by a complex pattern of allosteric interactions that regulate the catalytic activity of its two subunits and opening or closing of their ligand gates. As a single macromolecule, it implements 13 different reaction steps, with an intermediate product directly channeled from one subunit to another. Based on experimental data, a stochastic model for the operation of tryptophan synthase has been earlier constructed [D. Loutchko, D. Gonze, and A. S. Mikhailov, J. Phys. Chem. B 120, 2179 (2016)]. Here, this model is used to consider stochastic thermodynamics of such a chemical nanomachine. The Gibbs energy landscape of the internal molecular states is determined, the production of entropy and its flow within the enzyme are analyzed, and the information exchange between the subunits resulting from allosteric cross-regulations and channeling is discussed.
Energy Technology Data Exchange (ETDEWEB)
Miyata, Maiko [Department of Life and Medical Sciences, Chubu University Faculty of Life and Health Sciences, Matsumoto, Kasugai 487-8501 (Japan); Department of Biochemistry II, Nagoya University Graduate School of Medicine, 65 Tsurumai, Showa-ku, Nagoya 466-0065 (Japan); Ichihara, Masatoshi; Tajima, Orie; Sobue, Sayaka; Kambe, Mariko [Department of Life and Medical Sciences, Chubu University Faculty of Life and Health Sciences, Matsumoto, Kasugai 487-8501 (Japan); Sugiura, Kazumitsu [Department of Dermatology, Nagoya University Graduate School of Medicine, 65 Tsurumai, Showa-ku, Nagoya 466-0065 (Japan); Furukawa, Koichi, E-mail: koichi@med.nagoya-u.ac.jp [Department of Biochemistry II, Nagoya University Graduate School of Medicine, 65 Tsurumai, Showa-ku, Nagoya 466-0065 (Japan); Furukawa, Keiko [Department of Life and Medical Sciences, Chubu University Faculty of Life and Health Sciences, Matsumoto, Kasugai 487-8501 (Japan); Department of Biochemistry II, Nagoya University Graduate School of Medicine, 65 Tsurumai, Showa-ku, Nagoya 466-0065 (Japan)
2014-03-07
Highlights: • Melanocytes showed low ST8SIA1 and high B3GALT4 levels in contrast with melanomas. • Direct UVB irradiation of melanocytes did not induce ganglioside synthase genes. • Culture supernatants of UVB-irradiated keratinocytes induced ST8SIA1 in melanocytes. • TNFα and IL-6 secreted from keratinocytes enhanced ST8SIA1 expression in melanocytes. • Inflammatory cytokines induced melanoma-related ST8SIA1 in melanocytes. - Abstract: Although expression of gangliosides and their synthetic enzyme genes in malignant melanomas has been well studied, that in normal melanocytes has been scarcely analyzed. In particular, changes in expression levels of glycosyltransferase genes responsible for ganglioside synthesis during evolution of melanomas from melanocytes are very important to understand roles of gangliosides in melanomas. Here, expression of glycosyltransferase genes related to the ganglioside synthesis was analyzed using RNAs from cultured melanocytes and melanoma cell lines. Quantitative RT-PCR revealed that melanomas expressed high levels of mRNA of GD3 synthase and GM2/GD2 synthase genes and low levels of GM1/GD1b synthase genes compared with melanocytes. As a representative exogenous stimulation, effects of ultraviolet B (UVB) on the expression levels of 3 major ganglioside synthase genes in melanocytes were analyzed. Although direct UVB irradiation of melanocytes caused no marked changes, culture supernatants of UVB-irradiated keratinocytes (HaCaT cells) induced definite up-regulation of GD3 synthase and GM2/GD2 synthase genes. Detailed examination of the supernatants revealed that inflammatory cytokines such as TNFα and IL-6 enhanced GD3 synthase gene expression. These results suggest that inflammatory cytokines secreted from UVB-irradiated keratinocytes induced melanoma-associated ganglioside synthase genes, proposing roles of skin microenvironment in the promotion of melanoma-like ganglioside profiles in melanocytes.
International Nuclear Information System (INIS)
Miyata, Maiko; Ichihara, Masatoshi; Tajima, Orie; Sobue, Sayaka; Kambe, Mariko; Sugiura, Kazumitsu; Furukawa, Koichi; Furukawa, Keiko
2014-01-01
Highlights: • Melanocytes showed low ST8SIA1 and high B3GALT4 levels in contrast with melanomas. • Direct UVB irradiation of melanocytes did not induce ganglioside synthase genes. • Culture supernatants of UVB-irradiated keratinocytes induced ST8SIA1 in melanocytes. • TNFα and IL-6 secreted from keratinocytes enhanced ST8SIA1 expression in melanocytes. • Inflammatory cytokines induced melanoma-related ST8SIA1 in melanocytes. - Abstract: Although expression of gangliosides and their synthetic enzyme genes in malignant melanomas has been well studied, that in normal melanocytes has been scarcely analyzed. In particular, changes in expression levels of glycosyltransferase genes responsible for ganglioside synthesis during evolution of melanomas from melanocytes are very important to understand roles of gangliosides in melanomas. Here, expression of glycosyltransferase genes related to the ganglioside synthesis was analyzed using RNAs from cultured melanocytes and melanoma cell lines. Quantitative RT-PCR revealed that melanomas expressed high levels of mRNA of GD3 synthase and GM2/GD2 synthase genes and low levels of GM1/GD1b synthase genes compared with melanocytes. As a representative exogenous stimulation, effects of ultraviolet B (UVB) on the expression levels of 3 major ganglioside synthase genes in melanocytes were analyzed. Although direct UVB irradiation of melanocytes caused no marked changes, culture supernatants of UVB-irradiated keratinocytes (HaCaT cells) induced definite up-regulation of GD3 synthase and GM2/GD2 synthase genes. Detailed examination of the supernatants revealed that inflammatory cytokines such as TNFα and IL-6 enhanced GD3 synthase gene expression. These results suggest that inflammatory cytokines secreted from UVB-irradiated keratinocytes induced melanoma-associated ganglioside synthase genes, proposing roles of skin microenvironment in the promotion of melanoma-like ganglioside profiles in melanocytes
Directory of Open Access Journals (Sweden)
Wen-Qin Bai
Full Text Available Bioactive gibberellins (GAs comprise an important class of natural plant growth regulators and play essential roles in cotton fiber development. To date, the molecular base of GAs' functions in fiber development is largely unclear. To address this question, the endogenous bioactive GA levels in cotton developing fibers were elevated by specifically up-regulating GA 20-oxidase and suppressing GA 2-oxidase via transgenic methods. Higher GA levels in transgenic cotton fibers significantly increased micronaire values, 1000-fiber weight, cell wall thickness and cellulose contents of mature fibers. Quantitative RT-PCR and biochemical analysis revealed that the transcription of sucrose synthase gene GhSusA1 and sucrose synthase activities were significantly enhanced in GA overproducing transgenic fibers, compared to the wild-type cotton. In addition, exogenous application of bioactive GA could promote GhSusA1 expression in cultured fibers, as well as in cotton hypocotyls. Our results suggested that bioactive GAs promoted secondary cell wall deposition in cotton fibers by enhancing sucrose synthase expression.
Strategies in megasynthase engineering – fatty acid synthases (FAS as model proteins
Directory of Open Access Journals (Sweden)
Manuel Fischer
2017-06-01
Full Text Available Megasynthases are large multienzyme proteins that produce a plethora of important natural compounds by catalyzing the successive condensation and modification of precursor units. Within the class of megasynthases, polyketide synthases (PKS are responsible for the production of a large spectrum of bioactive polyketides (PK, which have frequently found their way into therapeutic applications. Rational engineering approaches have been performed during the last 25 years that seek to employ the “assembly-line synthetic concept” of megasynthases in order to deliver new bioactive compounds. Here, we highlight PKS engineering strategies in the light of the newly emerging structural information on megasynthases, and argue that fatty acid synthases (FAS are and will be valuable objects for further developing this field.
Glycogen synthase kinase 3: more than a namesake.
Rayasam, Geetha Vani; Tulasi, Vamshi Krishna; Sodhi, Reena; Davis, Joseph Alex; Ray, Abhijit
2009-03-01
Glycogen synthase kinase 3 (GSK3), a constitutively acting multi-functional serine threonine kinase is involved in diverse physiological pathways ranging from metabolism, cell cycle, gene expression, development and oncogenesis to neuroprotection. These diverse multiple functions attributed to GSK3 can be explained by variety of substrates like glycogen synthase, tau protein and beta catenin that are phosphorylated leading to their inactivation. GSK3 has been implicated in various diseases such as diabetes, inflammation, cancer, Alzheimer's and bipolar disorder. GSK3 negatively regulates insulin-mediated glycogen synthesis and glucose homeostasis, and increased expression and activity of GSK3 has been reported in type II diabetics and obese animal models. Consequently, inhibitors of GSK3 have been demonstrated to have anti-diabetic effects in vitro and in animal models. However, inhibition of GSK3 poses a challenge as achieving selectivity of an over achieving kinase involved in various pathways with multiple substrates may lead to side effects and toxicity. The primary concern is developing inhibitors of GSK3 that are anti-diabetic but do not lead to up-regulation of oncogenes. The focus of this review is the recent advances and the challenges surrounding GSK3 as an anti-diabetic therapeutic target.
Energy Technology Data Exchange (ETDEWEB)
Morita, Hiroyuki [Mitsubishi Kagaku Institute of Life Sciences (MITILS), 11 Minamiooya, Machida, Tokyo 194-8511 (Japan); Kondo, Shin [ZOEGENE Corporation, 1000 Kamoshida, Aoba, Yokohama, Kanagawa 227-8502 (Japan); Abe, Tsuyoshi; Noguchi, Hiroshi [School of Pharmaceutical Sciences and the COE21 Program, University of Shizuoka, Shizuoka 422-8526 (Japan); Sugio, Shigetoshi, E-mail: ssugio@rc.m-kagaku.co.jp [ZOEGENE Corporation, 1000 Kamoshida, Aoba, Yokohama, Kanagawa 227-8502 (Japan); Abe, Ikuro, E-mail: ssugio@rc.m-kagaku.co.jp [School of Pharmaceutical Sciences and the COE21 Program, University of Shizuoka, Shizuoka 422-8526 (Japan); PRESTO, Japan Science and Technology Agency, Kawaguchi, Saitama 332-0012 (Japan); Kohno, Toshiyuki, E-mail: ssugio@rc.m-kagaku.co.jp [Mitsubishi Kagaku Institute of Life Sciences (MITILS), 11 Minamiooya, Machida, Tokyo 194-8511 (Japan)
2006-09-01
Pentaketide chromone synthase from A. arborescens has been overexpressed in E. coli, purified and crystallized. Diffraction data have been collected to 1.6 Å. Pentaketide chromone synthase (PCS) from Aloe arborescens is a novel plant-specific type III polyketide synthase that catalyzes the formation of 5,7-dihydroxy-2-methylchromone from five molecules of malonyl-CoA. Recombinant PCS expressed in Escherichia coli was crystallized by the hanging-drop vapour-diffusion method. The crystals belonged to space group P2{sub 1}, with unit-cell parameters a = 73.2, b = 88.4, c = 70.0 Å, α = γ = 90.0, β = 95.6°. Diffraction data were collected to 1.6 Å resolution using synchrotron radiation at BL24XU of SPring-8.
DEFF Research Database (Denmark)
Brinch-Pedersen, H.; Galili, G.; Sørensen, K.
1996-01-01
In prokaryotes and plants the synthesis of the essential amino acids lysine and threonine is predominantly regulated by feed-back inhibition of aspartate kinase (AK) and dihydrodipicolinate synthase (DHPS). In order to modify the flux through the aspartate family pathway in barley and enhance...... the accumulation of the corresponding amino acids, we have generated transgenic barley plants that constitutively express mutant Escherichia coli genes encoding lysine feed-back insensitive forms of AK and DHPS. As a result, leaves of primary transformants (T0) exhibited a 14-fold increase of free lysine and an 8......, no differences were observed in the composition of total amino acids. The introduced genes were inherited in the T1 generation where enzymic activities revealed a 2.3-fold increase of AK activity and a 4.0-9.5-fold increase for DHPS. T1 seeds of DHPS transformants showed the same changes in free amino acids...
International Nuclear Information System (INIS)
Tsai, Shihfeng; Bishop, D.F.; Desnick, R.J.
1988-01-01
Uroporphyrinogen III synthase, the fourth enzyme in the heme biosynthetic pathway, is responsible for conversion of the linear tetrapyrrole, hydroxymethylbilane, to the cyclic tetrapyrrole, uroporphyrinogen III. The deficient activity of URO-synthase is the enzymatic defect in the autosomal recessive disorder congenital erythropoietic porphyria. To facilitate the isolation of a full-length cDNA for human URO-synthase, the human erythrocyte enzyme was purified to homogeneity and 81 nonoverlapping amino acids were determined by microsequencing the N terminus and four tryptic peptides. Two synthetic oligonucleotide mixtures were used to screen 1.2 x 10 6 recombinants from a human adult liver cDNA library. Eight clones were positive with both oligonucleotide mixtures. Of these, dideoxy sequencing of the 1.3 kilobase insert from clone pUROS-2 revealed 5' and 3' untranslated sequences of 196 and 284 base pairs, respectively, and an open reading frame of 798 base pairs encoding a protein of 265 amino acids with a predicted molecular mass of 28,607 Da. The isolation and expression of this full-length cDNA for human URO-synthase should facilitate studies of the structure, organization, and chromosomal localization of this heme biosynthetic gene as well as the characterization of the molecular lesions causing congenital erythropoietic porphyria
Paid maternity and paternity leave: rights and choices.
Jordan, Claire
2007-01-01
From April 2007 onwards, maternity leave will be raised to nine months Paid maternity leave is associated with significant health benefits for babies, including reduced infant mortality The Government proposes to increase paid maternity leave to one year and introduce additional paternity leave by around 2009 The U.K's provision for maternity leave and child care is more generous than the U.S.A. or Australia but less than in the Scandinavian countries
Causes and Consequences of a Father's Child Leave: Evidence from a Reform of Leave Schemes
DEFF Research Database (Denmark)
Nielsen, Helena Skyt
are the most progressive when it comes to family-friendly policies. An extensive reform of child leave schemes in Denmark affected couples differently depending on whether the parents where employed in the same or in different parts of the public sector. Based on a difference-in-differences strategy, I find...... that economic incentives are very important for intra-household leave-sharing. Increasing the couples' after tax income by $9 per day of leave which is transferred from the mother to the father is found to lead to a one day transfer. This corresponds to a supply elasticity close to unity....
DEFF Research Database (Denmark)
Krath, Britta N.; Eriksen, Tina A.; Poulsen, Tim S.
1999-01-01
cDNAs specifying four active phosphoribosyl diphosphate synthase isozymes were isolated from an Arabidopsis thaliana cDNA library. In contrast to other phosphoribosyl diphosphate synthases the activity of two of the A. thaliana isozymes are independent of Pi. Amino acid sequence comparison and ph...
Influence of maternity leave on exclusive breastfeeding.
Monteiro, Fernanda R; Buccini, Gabriela Dos S; Venâncio, Sônia I; da Costa, Teresa H M
To describe the profile of women with children aged under 4 months living in the Brazilian state capitals and in the Federal District according to their working status and to analyze the influence of maternity leave on exclusive breastfeeding (EBF) among working women. This was a cross-sectional study with data extracted from the II National Maternal Breastfeeding Prevalence Survey carried out in 2008. Initially, a descriptive analysis of the profile of 12,794 women was performed, according to their working status and maternity leave and the frequency of maternity leave in the Brazilian regions and capitals. The study used a multiple model to identify the influence of maternity leave on EBF interruption, including 3766 women who declared they were working and were on maternity leave at the time of the interview. The outcome assessed in the study was the interruption of the EBF, classified by the WHO. Regarding the working status of the mothers, 63.4% did not work outside of their homes and among those who worked, 69.8% were on maternity leave. The largest prevalence among workers was of women older than 35 years of age, with more than 12 years of schooling, primiparous and from the Southeast and South regions. The lack of maternity leave increased by 23% the chance of EBF interruption. Maternity leave contributed to increase the prevalence of EBF in the Brazilian states capitals, supporting the importance of increasing the maternity leave period from four to six months. Copyright © 2017 Sociedade Brasileira de Pediatria. Published by Elsevier Editora Ltda. All rights reserved.
Influence of maternity leave on exclusive breastfeeding
Directory of Open Access Journals (Sweden)
Fernanda R. Monteiro
Full Text Available Abstract Objectives: To describe the profile of women with children aged under 4 months living in the Brazilian state capitals and in the Federal District according to their working status and to analyze the influence of maternity leave on exclusive breastfeeding (EBF among working women. Methods: This was a cross-sectional study with data extracted from the II National Maternal Breastfeeding Prevalence Survey carried out in 2008. Initially, a descriptive analysis of the profile of 12,794 women was performed, according to their working status and maternity leave and the frequency of maternity leave in the Brazilian regions and capitals. The study used a multiple model to identify the influence of maternity leave on EBF interruption, including 3766 women who declared they were working and were on maternity leave at the time of the interview. The outcome assessed in the study was the interruption of the EBF, classified by the WHO. Results: Regarding the working status of the mothers, 63.4% did not work outside of their homes and among those who worked, 69.8% were on maternity leave. The largest prevalence among workers was of women older than 35 years of age, with more than 12 years of schooling, primiparous and from the Southeast and South regions. The lack of maternity leave increased by 23% the chance of EBF interruption. Conclusion: Maternity leave contributed to increase the prevalence of EBF in the Brazilian states capitals, supporting the importance of increasing the maternity leave period from four to six months.
Energy Technology Data Exchange (ETDEWEB)
Varco-Merth, Benjamin; Fromme, Raimund; Wang, Meitian; Fromme, Petra (AZU)
2008-08-27
The ATP synthase is one of the most important enzymes on earth as it couples the transmembrane electrochemical potential of protons to the synthesis of ATP from ADP and inorganic phosphage, providing the main ATP source of almost all higher life on earth. During ATP synthesis, stepwise protonation of a conserved carboxylate on each protein subunit of an oligomeric ring of 10--15 c-subunits is commonly thought to drive rotation of the rotor moiety (c{sub 10-14}{gamma}{sup {epsilon}}) relative to stator moiety ({alpha}{sub 3}{beta}{sub 3}{delta}ab{sub 2}). Here we report the isolation and crystallization of the c{sub 14}-ring of subunit c from the spinach chloroplast enzyme diffracting as far as 2.8 {angstrom}. Though ATP synthase was not previously know to contain any pigments, the crystals of the c-subunit possessed a strong yellow color. The pigment analysis revaled that they contain 1 chlorophyll and 2 carotenoids, thereby showing for the first time that the chloroplast ATP synthase contains cofactors, leading to the question of the possible roles of the functions of the pigments in the chloroplast ATP synthase.
International Nuclear Information System (INIS)
Parsons, James F.; Shi, Katherine; Calabrese, Kelly; Ladner, Jane E.
2006-01-01
Salicylate synthase, which catalyzes the first step in the synthesis of the siderophore yersiniabactin, has been crystallized. Diffraction data have been collected to 2.5 Å. Bacteria have evolved elaborate schemes that help them thrive in environments where free iron is severely limited. Siderophores such as yersiniabactin are small iron-scavenging molecules that are deployed by bacteria during iron starvation. Several studies have linked siderophore production and virulence. Yersiniabactin, produced by several Enterobacteriaceae, is derived from the key metabolic intermediate chorismic acid via its conversion to salicylate by salicylate synthase. Crystals of salicylate synthase from the uropathogen Escherichia coli CFT073 have been grown by vapour diffusion using polyethylene glycol as the precipitant. The monoclinic (P2 1 ) crystals diffract to 2.5 Å. The unit-cell parameters are a = 57.27, b = 164.07, c = 59.04 Å, β = 108.8°. The solvent content of the crystals is 54% and there are two molecules of the 434-amino-acid protein in the asymmetric unit. It is anticipated that the structure will reveal key details about the reaction mechanism and the evolution of salicylate synthase
Energy Technology Data Exchange (ETDEWEB)
Parsons, James F., E-mail: parsonsj@umbi.umd.edu; Shi, Katherine; Calabrese, Kelly [Center for Advanced Research in Biotechnology, The University of Maryland Biotechnology Institute, 9600 Gudelsky Drive, Rockville, MD 20850 (United States); Ladner, Jane E. [Center for Advanced Research in Biotechnology, The University of Maryland Biotechnology Institute, 9600 Gudelsky Drive, Rockville, MD 20850 (United States); National Institute of Standards and Technology (United States)
2006-03-01
Salicylate synthase, which catalyzes the first step in the synthesis of the siderophore yersiniabactin, has been crystallized. Diffraction data have been collected to 2.5 Å. Bacteria have evolved elaborate schemes that help them thrive in environments where free iron is severely limited. Siderophores such as yersiniabactin are small iron-scavenging molecules that are deployed by bacteria during iron starvation. Several studies have linked siderophore production and virulence. Yersiniabactin, produced by several Enterobacteriaceae, is derived from the key metabolic intermediate chorismic acid via its conversion to salicylate by salicylate synthase. Crystals of salicylate synthase from the uropathogen Escherichia coli CFT073 have been grown by vapour diffusion using polyethylene glycol as the precipitant. The monoclinic (P2{sub 1}) crystals diffract to 2.5 Å. The unit-cell parameters are a = 57.27, b = 164.07, c = 59.04 Å, β = 108.8°. The solvent content of the crystals is 54% and there are two molecules of the 434-amino-acid protein in the asymmetric unit. It is anticipated that the structure will reveal key details about the reaction mechanism and the evolution of salicylate synthase.
Guidelines for the diagnosis and management of cystathionine beta-synthase deficiency
Morris, A.A.; Kozich, V.; Santra, S.; Andria, G.; Ben-Omran, T.I.; Chakrapani, A.B.; Crushell, E.; Henderson, M.J.; Hochuli, M.; Huemer, M.; Janssen, M.C.H.; Maillot, F.; Mayne, P.D.; McNulty, J.; Morrison, T.M.; Ogier, H.; O'Sullivan, S.; Pavlikova, M.; Almeida, I.T. de; Terry, A.; Yap, S.; Blom, H.J.; Chapman, K.A.
2017-01-01
Cystathionine beta-synthase (CBS) deficiency is a rare inherited disorder in the methionine catabolic pathway, in which the impaired synthesis of cystathionine leads to accumulation of homocysteine. Patients can present to many different specialists and diagnosis is often delayed. Severely affected
Childcare and the division of parental leave
Norén, Anna
2015-01-01
Despite several policies aimed at increasing fathers' participation in the caring of children, Swedish mothers still use the bulk of the paid parental leave which may have several negative consequences for the family e.g. in terms of weaker labor market attachment for the mother. Division of parental leave is likely affected by how parents value the costs associated with parental leave. I investigate whether a reduction in the care burden, or a decreased non-monetary cost, of parental leave t...
Nitric oxide synthase isoforms in spontaneous and salt hypertension
Czech Academy of Sciences Publication Activity Database
Hojná, Silvie; Kuneš, Jaroslav; Zicha, Josef
2007-01-01
Roč. 25, Suppl. 2 (2007), S 338-S 338 ISSN 0263-6352. [European Meeting on Hypertension /17./. 15.06.2007-19.06.2007, Milan] R&D Projects: GA MŠk(CZ) 1M0510 Institutional research plan: CEZ:AV0Z50110509 Keywords : nitric oxide synthase isoforms * spontaneous and salt hypertension Subject RIV: FA - Cardiovascular Diseases incl. Cardiotharic Surgery
Trypanosoma brucei solanesyl-diphosphate synthase localizes to the mitochondrion
Czech Academy of Sciences Publication Activity Database
Lai, D.-H.; Bontempi, E. J.; Lukeš, Julius
2012-01-01
Roč. 183, č. 2 (2012), s. 189-192 ISSN 0166-6851 R&D Projects: GA ČR(CZ) GAP305/11/2179 Institutional support: RVO:60077344 Keywords : Trypanosoma brucei * Sleeping sickness * Ubiquinone * Solanesyl-diphosphate synthase * Digitonin permeabilization * In situ tagging Subject RIV: EB - Genetics ; Molecular Biology Impact factor: 2.734, year: 2012 http://www.sciencedirect.com/science/article/pii/S0166685112000539
Son, Hyeong-U; Lee, Seul; Heo, Jin-Chul; Lee, Sang-Han
2017-05-01
Artemisia capillaris, which belongs to the Asteraceae family and the genus Artemisia, has been reported to exert inhibitory effects on diabetes, cancer and inflammation. In this study, in order to enhance the bioactivity potential of the leaves of Artemisia by Ganoderma lucidum mycelium, we prepared aqueous samples of Artemisia capillaris (Ac) leaves, Ganoderma lucidum (Gl) and aqueous fractions produced by the solid fermentation of Ganoderma lucidum on Artemisia capillaris leaves (afAc/Gl). Thereafter, we evaluated whether these samples have potential to attenuate inflammation-related symptoms in an amimal model of 2,4-dinitrofluorobenzene (DNFB)-induced atopic dermatitis. We found that afAc/Gl exhibited enhanced anti-inflamamatory activity following the solid fermentation process when compared with Ac or Gl on ear thickness, ear epidermal thickness and eosinophil infiltration in the skin tissues. The expression of nitric oxide (NO) synthases (NOSs) was measured by immunohistochemical staining. The results revealed that afAc/Gl decreased endothelial NOS and inducible NOS expression compared with the DNFB group, while neuronal NOS expression was not altered. By comparing NO production, we found that as opposed to Ac, afAc/Gl has potential to inhibit atopic dermatitis-related symptoms during the inflammatory event. As regards matrix metalloproteinase (MMP) expression patterns, afAc/Gl exerted potent inhibitory activity on the mRNA expression of MMP-2, -7, -9, -12, -14 and -19. Taken together, these results suggest that the solid state fermentation of Ac by Gl is an effective strategy to obtaining useful ingredients which are converted into valuable compounds during an atopic inflammatory insult.
Zhu, Yueming; Zhang, Jun; Wei, Dongsheng; Wang, Yufan; Chen, Xiaoyun; Xing, Laijun; Li, Mingchun
2008-08-01
A slightly thermophilic strain, CBS-01, producing trehalose synthase (TreS), was isolated from geothermal water in this study. According to the phenotypic characteristics and phylogenetic analysis of the 16s rRNA gene sequence, it was identified as Meiothermus ruber. The trehalose synthase gene of Meiothermus ruber CBS-01 was cloned by polymerase chain reaction and sequenced. The TreS gene consisted of 2,895 nucleotides, which specified a 964-amino-acid protein. This novel TreS catalyzed reversible interconversion of maltose and trehalose.
DEFF Research Database (Denmark)
Tippmann, Stefan; Ferreira, Raphael; Siewers, Verena
2017-01-01
to overcome the thermodynamic constraint imposed on the first reaction, in which acetoacetyl-CoA is produced from two moles of acetyl-CoA by acetoacetyl-CoA thiolase. Recently, a novel acetoacetyl-CoA synthase (nphT7) has been identified from Streptomyces sp. strain CL190, which catalyzes the irreversible...... functionality of the bypass was limited by the efficiency of acetoacetyl-CoA synthase (nphT7). Besides modulation of the expression level, which could be used as a means to partially restore the phenotype, nphT7 from Streptomyces glaucescens showed clearly higher efficiency compared to Streptomyces sp. strain...
Mutation of Cellulose Synthase Gene Improves the Nutritive Value of Rice Straw
Directory of Open Access Journals (Sweden)
Yanjing Su
2012-06-01
Full Text Available Rice straw is an important roughage resource for ruminants in many rice-producing countries. In this study, a rice brittle mutant (BM, mutation in OsCesA4, encoding cellulose synthase and its wild type (WT were employed to investigate the effects of a cellulose synthase gene mutation on rice straw morphological fractions, chemical composition, stem histological structure and in situ digestibility. The morphological fractions investigation showed that BM had a higher leaf sheath proportion (43.70% vs 38.21%, p0.05 was detected in neutral detergent fiber (NDFom and ADL contents for both strains. Histological structure observation indicated that BM stems had fewer sclerenchyma cells and a thinner sclerenchyma cell wall than WT. The results of in situ digestion showed that BM had higher DM, NDFom, cellulose and hemicellulose disappearance at 24 or 48 h of incubation (p<0.05. The effective digestibility of BM rice straw DM and NDFom was greater than that of WT (31.4% vs 26.7% for DM, 29.1% vs 24.3% for NDFom, p<0.05, but the rate of digestion of the slowly digested fraction of BM rice straw DM and NDF was decreased. These results indicated that the mutation in the cellulose synthase gene could improve the nutritive value of rice straw for ruminants.
Directory of Open Access Journals (Sweden)
M. A. Slugina
2016-01-01
Full Text Available The potato is one of the main strategic crops in the Russian Federation, Belarus and Kazakhstan. Currently, we have achieved significant advances in the understanding of metabolic mechanism of carbohydrate and interconversion «sucrose – starch» in potato tubers. Sucrose synthase (Sus is a key enzyme in the breakdown of sucrose. Sucrose synthase (Sus is catalyzing a reversible reaction of conversion sucrose and UDP into fructose and UDP-glucose. The identification and subsequent characterization of the genes encoding plant sucrose synthase is the first step towards understanding their physiological roles and metabolic mechanism involved in carbohydrate accumulation in potato tubers. In the present work the nucleotide and amino acid polymorphism of the Sus4 gene fragments containing sequences of the sucrose synthase domain were analyzed. Sus4 gene fragments (intron III – exon VI in 9 potato cultivars of Russian, Kazakh and Belarusian breeding were analyzed. The polymorphism of the Sus4 sucrose synthase domain sequences was first examined. The length of analyzed fragment varied from 977 b.p. (cultivars Favorit, Karasaiskii, Miras to 1013 b.p. (cultivars Zorochka, Manifest, Elisaveta, Bashkirskii. It was demonstrated that the examined sequences contained point mutations, as well as insertions and deletions. The common polymorphism level was 5.82%. It was shown that the examined sequences contained 58 SNPs and 4 indels. The most variable were introns IV (12.4% and V (9.18%. The most variable was exon IV. 7 allelic variants were detected. 6 different amino acid sequences specific to different varieties were also identified.
Hua, Kuo-Feng; Yang, Tzu-Jung; Chiu, Huan-Wen; Ho, Chen-Lung
2014-06-01
The essential oil from Liquidambar formosana leaves (EOLF) was demonstrated to exhibit anti-inflammatory activity in mouse macrophages. EOLF reduced nitrite oxide generation, secretion levels of tumor necrosis factor-alpha and interleukin-6, and expression levels of prointerleukin-beta, inducible nitric oxide synthase, and cyclooxygenase-2 in lipopolysaccharide (LPS)-activated mouse macrophages. EOLF also reduced NLRP3 inflammasome-derived interleukin-1beta secretion. The underlying mechanisms for the EOLF-mediated anti-inflammatory activity were (1) reduction of LPS-induced reactive oxygen species generation; (2) reduction of LPS-induced activation of c-Jun N-terminal kinase, extracellular signal-regulated kinase, and p38 MAP kinase; (3) reduction of LPS-induced nuclear factor-kappaBeta activation. Furthermore, 25 compounds were identified in the EOLF using GC-FID and GC-MS and the major compounds were terpinen-4-ol (32.0%), beta-pinene (18.0%), gamma-terpinene (13.8%), and alpha-terpinene (9.7%). We found that LPS-induced nitrite oxide generation was inhibited significantly by terpinen-4-ol. Our results indicated that EOLF has anti-inflammatory activity and may provide a molecular rationale for future therapeutic interventions in immune modulation.
Directory of Open Access Journals (Sweden)
Luis R. Domínguez A.
2014-12-01
Full Text Available This article aims to show the results of the review of literature of relevant studies of the causal elements of intention to leave in the last five years (2009-2013. The method used to evaluate the literature was based on the seven steps for research synthesis: problem formulation, literature search, obtaining information from studies, quality assessment studies, analysis and integration of results, interpretation of evidence and presentation of results. 48 studies from 15 different countries with a sample of 35804 employees of different companies were evaluated. The findings suggest the existence of 89 different variables influencing the intention to leave of employees in an organization. The results of this study will allow researchers to better understand the variables that can be studied to verify the impact of variables such as causal elements, but also see those that have a mediating effect between them for predicting intention to leave as an element of employee turnover. This study makes three important contributions to literature of turnover. First, in this study all the parameters associated with the intention to leave were checked. Second, this study categorizes and displays in proportion relevant interests to the scientific community whom studying employee turnover across the intention to leave. And thirdly provides clues organizations to improve some of its structural and contextual features to control turnover.
The Length of Maternity Leave and Family Health
DEFF Research Database (Denmark)
Beuchert-Pedersen, Louise Voldby; Humlum, Maria Knoth; Vejlin, Rune Majlund
We study the relationship between the length of maternity leave and the physical and psychological health of the family. Using a reform of the parental leave scheme in Denmark that increased the number of weeks of leave with full benefit compensation, we estimate the effect of the lenght...... of maternity leave on a range of health indicators including the number of hospital admissions for both mother and child and the probability of the mother receiving antidepressants. The reform led to an increase in average post-birth maternity leave matters for child or maternal health outcomes and thus we...... complement the existing evidence on maternity leave expansions that tends to find limited effects on children's later deveopmental, educational, and labor market outcomes. Our results suggest that any beneficial effects of increasing the lenght of maternity leave are greater for low-resource families....
The CCCTB Rules on Leaving a Group
van de Streek, J.
2012-01-01
The consolidation system proposed in the draft of the CCCTB Directive puts relationships between Member States on edge. This is clearly apparent in the rules that apply when a company leaves a group. In this article the leaving rules are examined. Although the leaving rules are claimed to be
On the Sharing of Temporary Parental Leave
DEFF Research Database (Denmark)
Amilon, Anna
2007-01-01
This paper views temporary parental leave (leave from work to take care of a sick child) as a household public good, produced with time inputs of the parents as the only input. Assuming equal productivities in the production of temporary parental leave and equal utility functions of the spouses...
[Beneficial effect of maternity leave on delivery].
Xu, Qian; Séguin, Louise; Goulet, Lise
2002-01-01
To identify the contribution of the duration of the prenatal maternity leave on term delivery. Characteristics of the prenatal maternity leave and delivery among 363 working women who had delivered a full-term infant at 1 of 4 hospitals in Montreal during 1996 were studied. The presence of an intervention or complication during delivery was observed in 68.9% of the participants. The average duration of the prenatal maternity leave was about 8 weeks (SD = 7). The adjusted risk of a difficult delivery decreased significantly with the duration of the prenatal maternity leave (OR = 0.96; 95% CI: 0.93-0.99). The duration of the maternity leave before delivery is associated with an easier term delivery for working women.
[New cerebroside from leaves of pineapple].
Wang, Jin-Ping; Wang, Hong-Ying; Du, Li-Jun; Ding, Yi; Xing, Dong-Ming; Wang, Wei
2007-03-01
To study the chemical constituents of the leaves of pineapple. Chromatographic methods were used to isolate compounds from the leaves of pineapple and spectral methods were used to identify the structures of the isolated compounds. Compound 1 was isolated from the leaves of pineapple. It was identified as 1-O-beta-D-glucopyranosyl-(2S, 3R, 4E, 11E)-2-[(2(R)-hydroxydocosanoyl) amido]-4, 11-hexadecanediene-1, 3-diol. Compound 1 was a new compound.
Pre- and posttranslational upregulation of muscle-specific glycogen synthase in athletes
DEFF Research Database (Denmark)
Vestergaard, H; Andersen, P H; Lund, S
1994-01-01
Expression of muscle-specific glycogen synthase (GS) and phosphofructokinase (PFK) was analyzed in seven athletes and eight control subjects who were characterized using the euglycemic, hyperinsulinemic (2 mU.kg-1.min-1) clamp technique in combination with indirect calorimetry and biopsy sampling...
Expanding the product portfolio of fungal type I fatty acid synthases
DEFF Research Database (Denmark)
Zhu, Zhiwei; Zhou, Yongjin J.; Krivoruchko, Anastasia
2017-01-01
Fungal type I fatty acid synthases (FASs) are mega-enzymes with two separated, identical compartments, in which the acyl carrier protein (ACP) domains shuttle substrates to catalytically active sites embedded in the chamber wall. We devised synthetic FASs by integrating heterologous enzymes into ...
Compassionate Care Leave & Benefits. CAUT Briefing Note
Canadian Association of University Teachers, 2016
2016-01-01
Compassionate care leave and benefits were introduced in 2003/04 to help employees cope with this difficult work-life balance challenge. Employment Standards legislation and the Employment Insurance program (EI) were amended to provide leave without pay, with payment of EI benefits for compassionate care leave. Collective agreements have been…
48 CFR 752.7031 - Leave and holidays.
2010-10-01
... States (less language training) and the actual days overseas beginning on the date of departure from the.... (e) Military leave. Military leave of not more than 15 calendar days in any calendar year may be... such military leave has been approved in advance by the cognizant Mission Director or Assistant...
Stereochemical course of enzyme-catalyzed aminopropyl transfer: spermidine synthase
International Nuclear Information System (INIS)
Kullberg, D.W.; Orr, G.R.; Coward, J.K.
1986-01-01
The R and S enantionmers of S-adenosyl-3-[ 2 H]3-(methylthio)-1-propylamine (decarboxylated S-adenosylmethionine), previously synthesized in this laboratory, were incubated with [1,4- 2 H 4 ]-putrescine in the presence of spermidine synthase from E. coli. The resulting chiral [ 2 H 5 ]spermidines were isolated and converted to their N 1 ,N 7 -dibocspermidine-N 4 -(1S,4R)-camphanamides. The derivatives were analyzed by 500 MHz 1 H-NMR and the configuration of the chiral center assigned by correlation with the spectra of synthetic chiral [ 2 H 3 ]dibocspermidine camphanamide standards. The enzyme-catalyzed aminopropyl transfer was shown to occur with net retention of configuration, indicative of a double-displacement mechanism. This result concurs with that of a previous steady-state kinetics study of spermidine synthase isolated from E. coli, but contradicts the single-displacement mechanism suggested by a stereochemical analysis of chiral spermidines biosynthesized in E. coli treated with chirally deuterated methionines. It also indicates that this aminopropyltransferase is mechanistically distinct from the methyltransferases, which have been shown to act via a single-displacement mechanism (net inversion at -CH 3 ) in all cases studied to date
The crystal structure of human GDP-L-fucose synthase.
Zhou, Huan; Sun, Lihua; Li, Jian; Xu, Chunyan; Yu, Feng; Liu, Yahui; Ji, Chaoneng; He, Jianhua
2013-09-01
Human GDP-l-fucose synthase, also known as FX protein, synthesizes GDP-l-fucose from its substrate GDP-4-keto-6-deoxy-d-mannose. The reaction involves epimerization at both C-3 and C-5 followed by an NADPH-dependent reduction of the carbonyl at C-4. In this paper, the first crystal structure of human FX protein was determined at 2.37 Å resolution. The asymmetric unit of the crystal structure contains four molecules which form two homodimers. Each molecule consists of two domains, a Rossmann-fold NADPH-binding motif and a carboxyl terminal domain. Compared with the Escherichia coli GDP-l-fucose synthase, the overall structures of these two enzymes have four major differences. There are four loops in the structure of human FX protein corresponding to two α-helices and two β-sheets in that of the E. coli enzyme. Besides, there are seven different amino acid residues binding with NAPDH comparing human FX protein with that from E. coli. The structure of human FX reveals the key catalytic residues and could be useful for the design of drugs for the treatment of inflammation, auto-immune diseases, and possibly certain types of cancer.
78 FR 8833 - The Family and Medical Leave Act
2013-02-06
... creates a new qualifying exigency leave category for parental care. In military caregiver leave, the Final... covered employers to take job- protected, unpaid leave, or to substitute appropriate accrued paid leave... CFR Part 825 The Family and Medical Leave Act; Final Rule #0;#0;Federal Register / Vol. 78 , No. 25...
Expression of prostaglandin synthases (pgds and pges) during zebrafish gonadal differentiation
DEFF Research Database (Denmark)
Jørgensen, Anne; Nielsen, John E; Nielsen, Betina Frydenlund
2010-01-01
The present study aimed at elucidating whether the expression pattern of the membrane bound form of prostaglandin E2 synthase (pges) and especially the lipocalin-type prostaglandin D2 synthase (pgds) indicates involvement in gonadal sex differentiation in zebrafish as has previously been found....... In this study, a sexually dimorphic expression of pgds was found in gonads of adult zebrafish with expression in testis but not in ovaries. To determine whether the sex-specific expression pattern of pgds was present in gonads of juvenile zebrafish and therefore could be an early marker of sex in zebrafish, we...... microdissected gonads from four randomly selected individual zebrafish for every second day in the period 2-20 days post hatch (dph) and 0-1 dph. The temporal expression of pgds and pges was investigated in the microdissected gonads, however, no differential expression that could indicate sex-specific difference...
Niemüller, Daniel; Reimann, Andreas; Ober, Dietrich
2012-01-01
Homospermidine synthase (HSS) is the first specific enzyme in pyrrolizidine alkaloid (PA) biosynthesis, a pathway involved in the plant’s chemical defense. HSS has been shown to be recruited repeatedly by duplication of a gene involved in primary metabolism. Within the lineage of the Boraginales, only one gene duplication event gave rise to HSS. Here, we demonstrate that the tissue-specific expression of HSS in three boraginaceous species, Heliotropium indicum, Symphytum officinale, and Cynoglossum officinale, is unique with respect to plant organ, tissue, and cell type. Within H. indicum, HSS is expressed exclusively in nonspecialized cells of the lower epidermis of young leaves and shoots. In S. officinale, HSS expression has been detected in the cells of the root endodermis and in leaves directly underneath developing inflorescences. In young roots of C. officinale, HSS is detected only in cells of the endodermis, but in a later developmental stage, additionally in the pericycle. The individual expression patterns are compared with those within the Senecioneae lineage (Asteraceae), where HSS expression is reproducibly found in specific cells of the endodermis and the adjacent cortex parenchyma of the roots. The individual expression patterns within the Boraginales species are discussed as being a requirement for the successful recruitment of HSS after gene duplication. The diversity of HSS expression within this lineage adds a further facet to the already diverse patterns of expression that have been observed for HSS in other PA-producing plant lineages, making this PA-specific enzyme one of the most diverse expressed proteins described in the literature. PMID:22566491
HSE Unit
2013-01-01
Now that autumn is here, dead leaves falling from the trees form a colourful carpet that is pleasing to the eye. However, the reality is less pleasant for pedestrians, since these leaves increase the risk of slipping and falling, especially when the ground is wet. These conditions are also hazardous for two- and four-wheeled vehicles, whose grip on the ground can be severely reduced, thereby increasing the risk of them skidding out of control. Cyclists are among the most vulnerable road users when faced with these hazards. It is therefore essential to be alert to the dangers, which can be lessened by taking a few simple precautions such as moderating your speed and wearing suitable shoes. We also invite you to notify the Service Desk if you notice a road or pavement where there is a high concentration of dead leaves. The CERN Roads and Drainage Service will then ensure that the leaves are cleared in order to reduce the risk of accidents in the area.
5 CFR 630.1206 - Notice of leave.
2010-01-01
... medical treatment, the employee shall provide notice to the agency of his or her intention to take leave... placement or planned medical treatment requires leave to begin within 30 calendar days, the employee shall... 5 Administrative Personnel 1 2010-01-01 2010-01-01 false Notice of leave. 630.1206 Section 630...
Morcx, Serena; Kunz, Caroline; Choquer, Mathias; Assie, Sébastien; Blondet, Eddy; Simond-Côte, Elisabeth; Gajek, Karina; Chapeland-Leclerc, Florence; Expert, Dominique; Soulie, Marie-Christine
2013-03-01
Chitin synthases play critical roles in hyphal development and fungal pathogenicity. Previous studies on Botrytis cinerea, a model organism for necrotrophic pathogens, have shown that disruption of Bcchs1 and more particularly Bcchs3a genes have a drastic impact on virulence (Soulié et al., 2003, 2006). In this work, we investigate the role of other CHS including BcCHS4, BcCHS6 and BcCHS7 during the life cycle of B. cinerea. Single deletions of corresponding genes were carried out. Phenotypic analysis indicates that: (i) BcCHS4 enzyme is not essential for development and pathogenicity of the fungus; (ii) BcCHS7 is required for pathogenicity in a host dependant manner. For Bcchs6 gene disruption, we obtained only heterokaryotic strains. Indeed, sexual or asexual purification assays were unsuccessful. We concluded that class VI chitin synthase could be essential for B. cinerea and therefore BcCHS6 represents a valuable antifungal target. Copyright © 2012 Elsevier Inc. All rights reserved.
Chen, Xujun; Chen, Hao; Yuan, Joshua S; Köllner, Tobias G; Chen, Yuying; Guo, Yufen; Zhuang, Xiaofeng; Chen, Xinlu; Zhang, Yong-Jun; Fu, Jianyu; Nebenführ, Andreas; Guo, Zejian; Chen, Feng
2018-03-06
Rice blast disease, caused by the fungus Magnaporthe oryzae, is the most devastating disease of rice. In our ongoing characterization of the defence mechanisms of rice plants against M. oryzae, a terpene synthase gene OsTPS19 was identified as a candidate defence gene. Here, we report the functional characterization of OsTPS19, which is up-regulated by M. oryzae infection. Overexpression of OsTPS19 in rice plants enhanced resistance against M. oryzae, while OsTPS19 RNAi lines were more susceptible to the pathogen. Metabolic analysis revealed that the production of a monoterpene (S)-limonene was increased and decreased in OsTPS19 overexpression and RNAi lines, respectively, suggesting that OsTPS19 functions as a limonene synthase in planta. This notion was further supported by in vitro enzyme assays with recombinant OsTPS19, in which OsTPS19 had both sesquiterpene activity and monoterpene synthase activity, with limonene as a major product. Furthermore, in a subcellular localization experiment, OsTPS19 was localized in plastids. OsTPS19 has a highly homologous paralog, OsTPS20, which likely resulted from a recent gene duplication event. We found that the variation in OsTPS19 and OsTPS20 enzyme activities was determined by a single amino acid in the active site cavity. The expression of OsTPS20 was not affected by M. oryzae infection. This indicates functional divergence of OsTPS19 and OsTPS20. Lastly, (S)-limonene inhibited the germination of M. oryzae spores in vitro. OsTPS19 was determined to function as an (S)-limonene synthase in rice and plays a role in defence against M. oryzae, at least partly, by inhibiting spore germination. © 2018 The Authors. Plant Biotechnology Journal published by Society for Experimental Biology and The Association of Applied Biologists and John Wiley & Sons Ltd.
International Nuclear Information System (INIS)
Frost, D.J.; Wu, A.; Read, S.M.; Wasserman, B.P.; Drake, R.R.; Haley, B.E.
1989-01-01
The photoaffinity probe 5-azido-uridine 5'-β-[ 32 P]-diphosphate glucose was used to identify the major UDPG-binding polypeptide of red beet (1,3)-β-glucan synthase. Glucan synthase was purified from plasma membranes by sequential solubilization with CHAPS followed by product entrapment. Two major polypeptides at 72 and 54 kD were labelled by probe. Labelling of both was abolished with increasing levels of cold UDPG. However, labelling of the 54 kD polypeptide was dependent upon the presence of divalent cations. These data suggest that the 54 kD polypeptide is a substrate-binding and cation-regulated component of the glucan synthase complex
International Nuclear Information System (INIS)
Sá-Moura, Bebiana; Albuquerque, Luciana; Empadinhas, Nuno; Costa, Milton S. da; Pereira, Pedro José Barbosa; Macedo-Ribeiro, Sandra
2008-01-01
The enzyme mannosyl-3-phosphoglycerate synthase from R. xylanophilus has been expressed, purified and crystallized. The crystals belong to the hexagonal space group P6 5 22 and diffract to 2.2 Å resolution. Rubrobacter xylanophilus is the only Gram-positive bacterium known to synthesize the compatible solute mannosylglycerate (MG), which is commonly found in hyperthermophilic archaea and some thermophilic bacteria. Unlike the salt-dependent pattern of accumulation observed in (hyper)thermophiles, in R. xylanophilus MG accumulates constitutively. The synthesis of MG in R. xylanophilus was tracked from GDP-mannose and 3-phosphoglycerate, but the genome sequence of the organism failed to reveal any of the genes known to be involved in this pathway. The native enzyme was purified and its N-terminal sequence was used to identify the corresponding gene (mpgS) in the genome of R. xylanophilus. The gene encodes a highly divergent mannosyl-3-phosphoglycerate synthase (MpgS) without relevant sequence homology to known mannosylphosphoglycerate synthases. In order to understand the specificity and enzymatic mechanism of this novel enzyme, it was expressed in Escherichia coli, purified and crystallized. The crystals thus obtained belonged to the hexagonal space group P6 5 22 and contained two protein molecules per asymmetric unit. The structure was solved by SIRAS using a mercury derivative
Lineage-Specific Expansion of the Chalcone Synthase Gene Family in Rosids.
Directory of Open Access Journals (Sweden)
Kattina Zavala
Full Text Available Rosids are a monophyletic group that includes approximately 70,000 species in 140 families, and they are found in a variety of habitats and life forms. Many important crops such as fruit trees and legumes are rosids. The evolutionary success of this group may have been influenced by their ability to produce flavonoids, secondary metabolites that are synthetized through a branch of the phenylpropanoid pathway where chalcone synthase is a key enzyme. In this work, we studied the evolution of the chalcone synthase gene family in 12 species belonging to the rosid clade. Our results show that the last common ancestor of the rosid clade possessed six chalcone synthase gene lineages that were differentially retained during the evolutionary history of the group. In fact, of the six gene lineages that were present in the last common ancestor, 7 species retained 2 of them, whereas the other 5 only retained one gene lineage. We also show that one of the gene lineages was disproportionately expanded in species that belonged to the order Fabales (soybean, barrel medic and Lotus japonicas. Based on the available literature, we suggest that this gene lineage possesses stress-related biological functions (e.g., response to UV light, pathogen defense. We propose that the observed expansion of this clade was a result of a selective pressure to increase the amount of enzymes involved in the production of phenylpropanoid pathway-derived secondary metabolites, which is consistent with the hypothesis that suggested that lineage-specific expansions fuel plant adaptation.
DEFF Research Database (Denmark)
Kadziola, Anders; Jepsen, Clemens H; Johansson, Eva
2005-01-01
The prs gene encoding phosphoribosyl diphosphate (PRPP) synthase of the hyperthermophilic autotrophic methanogenic archaeon Methanocaldococcus jannaschii has been cloned and expressed in Escherichia coli. Subsequently, M.jannaschii PRPP synthase has been purified, characterised, crystallised, and...
Leaving the hospital - your discharge plan
... patientinstructions/000867.htm Leaving the hospital - your discharge plan To use the sharing features on this page, ... once you leave. This is called a discharge plan. Your health care providers at the hospital will ...
Hendy, Helen M.; Can, S. Hakan; Joseph, Lauren J.; Scherer, Cory R.
2013-01-01
The University Students Leaving Relationships scale was developed to identify student concerns when contemplating dissolution of romantic relationships. Participants included 1,106 students who rated the importance of issues when deciding to leave relationships. Factor analysis produced three dimensions: Missing the Relationship, Social…
Self-Funded Leave and Life Role Development
Furbish, Dale S.
2009-01-01
Self-funded leave is an employee benefit that provides a time resource to those who wish to develop interests and other life roles. Semistructured interviews were used for this qualitative study to explore the motivations for enrolling in the self-funded leave program, how the leave contributed to work-life balance through development of other…
Human Resources Division
2002-01-01
Administrative procedures for : Travel to the home station and home leave (hl) Additional travel to the home station (at) Travel to the home station and home leave for family reasons (hlf) As part of the process of simplifying administrative procedures, HR and AS Divisions have devised a new, virtually automatic procedure for payment of travel expenses to the home station. The changes are aimed at rationalising administrative procedures and not at reducing benefits. The conditions of eligibility are unchanged. The new procedure, which will be operational with effect from 1st June 2002, will greatly simplify the administrative processing of claims for travel expenses and the recording of home leaves. Currently, requests for payment are introduced manually into the Advances and Claims system (AVCL) by divisional secretariats. All travel to the home station starting prior to 1st June 2002 will be processed according to the existing system whereas that starting on 1st June and after will be processed accordi...
The influence of monoterpene synthase transformation on the odour of tabacco.
Tamer, el M.K.; Smeets, M.A.M.; Holthuysen, N.T.E.; Lucker, J.; Tang, A.; Roozen, J.P.; Bouwmeester, H.J.; Voragen, A.G.J.
2003-01-01
Monoterpenes are an important class of terpenoids that are commonly present in plant essential oils. These can be extracted from plants and are used in the flavouring and perfumery industry. Monoterpene synthases are the key enzymes in monoterpene biosynthesis, as they catalyse the cyclisation of
of endothelial nitric oxide synthase gene and serum level of vascular ...
African Journals Online (AJOL)
uwerhiavwe
Davignon and Ganz, 2004). NO is synthe- sized via a reaction that includes the conversion of L- arginine to L-citruline catalyzed by endothelial nitric oxide synthase (eNOS), which is one of the three isoforms of the enzyme (Mayer and Hemmens, 1997) ...
Factors influencing gene silencing of granule-bound starch synthase in potato
Heilersig, H.J.B.
2005-01-01
In the past, antisense RNA technology was used to modify the composition of potato tuber starch. Potato starch comprises amylose and amylopectin, polymers of glucose. Amylose production in potato is completely dependent on the presence of granule-bound starch synthase I (GBSSI). Inhibition of GBSSI
Directory of Open Access Journals (Sweden)
Max Hirte
2018-04-01
Full Text Available Diterpene synthases catalyze complex, multi-step C-C coupling reactions thereby converting the universal, aliphatic precursor geranylgeranyl diphosphate into diverse olefinic macrocylces that form the basis for the structural diversity of the diterpene natural product family. Since catalytically relevant crystal structures of diterpene synthases are scarce, homology based biomolecular modeling techniques offer an alternative route to study the enzyme's reaction mechanism. However, precise identification of catalytically relevant amino acids is challenging since these models require careful preparation and refinement techniques prior to substrate docking studies. Targeted amino acid substitutions in this protein class can initiate premature quenching of the carbocation centered reaction cascade. The structural characterization of those alternative cyclization products allows for elucidation of the cyclization reaction cascade and provides a new source for complex macrocyclic synthons. In this study, new insights into structure and function of the fungal, bifunctional Aphidicolan-16-ß-ol synthase were achieved using a simplified biomolecular modeling strategy. The applied refinement methodologies could rapidly generate a reliable protein-ligand complex, which provides for an accurate in silico identification of catalytically relevant amino acids. Guided by our modeling data, ACS mutations lead to the identification of the catalytically relevant ACS amino acid network I626, T657, Y658, A786, F789, and Y923. Moreover, the ACS amino acid substitutions Y658L and D661A resulted in a premature termination of the cyclization reaction cascade en-route from syn-copalyl diphosphate to Aphidicolan-16-ß-ol. Both ACS mutants generated the diterpene macrocycle syn-copalol and a minor, non-hydroxylated labdane related diterpene, respectively. Our biomolecular modeling and mutational studies suggest that the ACS substrate cyclization occurs in a spatially
Hirte, Max; Meese, Nicolas; Mertz, Michael; Fuchs, Monika; Brück, Thomas B
2018-01-01
Diterpene synthases catalyze complex, multi-step C-C coupling reactions thereby converting the universal, aliphatic precursor geranylgeranyl diphosphate into diverse olefinic macrocylces that form the basis for the structural diversity of the diterpene natural product family. Since catalytically relevant crystal structures of diterpene synthases are scarce, homology based biomolecular modeling techniques offer an alternative route to study the enzyme's reaction mechanism. However, precise identification of catalytically relevant amino acids is challenging since these models require careful preparation and refinement techniques prior to substrate docking studies. Targeted amino acid substitutions in this protein class can initiate premature quenching of the carbocation centered reaction cascade. The structural characterization of those alternative cyclization products allows for elucidation of the cyclization reaction cascade and provides a new source for complex macrocyclic synthons. In this study, new insights into structure and function of the fungal, bifunctional Aphidicolan-16-ß-ol synthase were achieved using a simplified biomolecular modeling strategy. The applied refinement methodologies could rapidly generate a reliable protein-ligand complex, which provides for an accurate in silico identification of catalytically relevant amino acids. Guided by our modeling data, ACS mutations lead to the identification of the catalytically relevant ACS amino acid network I626, T657, Y658, A786, F789, and Y923. Moreover, the ACS amino acid substitutions Y658L and D661A resulted in a premature termination of the cyclization reaction cascade en-route from syn-copalyl diphosphate to Aphidicolan-16-ß-ol. Both ACS mutants generated the diterpene macrocycle syn-copalol and a minor, non-hydroxylated labdane related diterpene, respectively. Our biomolecular modeling and mutational studies suggest that the ACS substrate cyclization occurs in a spatially restricted location of
Hirte, Max; Meese, Nicolas; Mertz, Michael; Fuchs, Monika; Brück, Thomas B.
2018-04-01
Diterpene synthases catalyze complex, multi-step C-C coupling reactions thereby converting the universal, aliphatic precursor geranylgeranyl diphosphate into diverse olefinic macrocylces that form the basis for the structural diversity of the diterpene natural product family. Since catalytically relevant crystal structures of diterpene synthases are scarce, homology based biomolecular modelling techniques offer an alternative route to study the enzyme’s reaction mechanism. However, precise identification of catalytically relevant amino acids is challenging since these models require careful preparation and refinement techniques prior to substrate docking studies. Targeted amino acid substitutions in this protein class can initiate premature quenching of the carbocation centered reaction cascade. The structural characterization of those alternative cyclization products allows for elucidation of the cyclization reaction cascade and provides a new source for complex macrocyclic synthons. In this study, new insights into structure and function of the fungal, bifunctional Aphidicolan-16-ß-ol synthase were achieved using a simplified biomolecular modelling strategy. The applied refinement methodologies could rapidly generate a reliable protein-ligand complex, which provides for an accurate in silico identification of catalytically relevant amino acids. Guided by our modelling data, ACS mutations lead to the identification of the catalytically relevant ACS amino acid network I626, T657, Y658, A786, F789 and Y923. Moreover, the ACS amino acid substitutions Y658L and D661A resulted in a premature termination of the cyclization reaction cascade en-route from syn-copalyl diphosphate to Aphidicolan-16-ß-ol. Both ACS mutants generated the diterpene macrocycle syn-copalol and a minor, non-hydroxylated labdane related diterpene, respectively. Our biomolecular modelling and mutational studies suggest that the ACS substrate cyclization occurs in a spatially restricted location
DEFF Research Database (Denmark)
Krath, B N; Hove-Jensen, B
2001-01-01
Spinach 5-phospho-D-ribosyl alpha-1-diphosphate (PRPP) synthase isozyme 4 was synthesized in Escherichia coli and purified to near homogeneity. The activity of the enzyme is independent of P(i); it is inhibited by ADP in a competitive manner, indicating a lack of an allosteric site; and it accepts...... is consistent with a homotrimer. Secondary structure prediction shows that spinach PRPP synthase isozyme 4 has a general folding similar to that of Bacillus subtilis class I PRPP synthase, for which the three-dimensional structure has been solved, as the position and extent of helices and beta-sheets of the two...... in the spinach enzyme. In contrast, residues of the active site of B. subtilis PRPP synthase show extensive conservation in spinach PRPP synthase isozyme 4....
Genotoxicity of Nicotiana tabacum leaves on Helix aspersa.
da Silva, Fernanda R; Erdtmann, Bernardo; Dalpiaz, Tiago; Nunes, Emilene; Ferraz, Alexandre; Martins, Tales L C; Dias, Johny F; da Rosa, Darlan P; Porawskie, Marilene; Bona, Silvia; da Silva, Juliana
2013-07-01
Tobacco farmers are routinely exposed to complex mixtures of inorganic and organic chemicals present in tobacco leaves. In this study, we examined the genotoxicity of tobacco leaves in the snail Helix aspersa as a measure of the risk to human health. DNA damage was evaluated using the micronucleus test and the Comet assay and the concentration of cytochrome P450 enzymes was estimated. Two groups of snails were studied: one fed on tobacco leaves and one fed on lettuce (Lactuca sativa L) leaves (control group). All of the snails received leaves (tobacco and lettuce leaves were the only food provided) and water ad libitum. Hemolymph cells were collected after 0, 24, 48 and 72 h. The Comet assay and micronucleus test showed that exposure to tobacco leaves for different periods of time caused significant DNA damage. Inhibition of cytochrome P450 enzymes occurred only in the tobacco group. Chemical analysis indicated the presence of the alkaloid nicotine, coumarins, saponins, flavonoids and various metals. These results show that tobacco leaves are genotoxic in H. aspersa and inhibit cytochrome P450 activity, probably through the action of the complex chemical mixture present in the plant.
Genotoxicity of Nicotiana tabacum leaves on Helix aspersa
Directory of Open Access Journals (Sweden)
Fernanda R. da Silva
2013-01-01
Full Text Available Tobacco farmers are routinely exposed to complex mixtures of inorganic and organic chemicals present in tobacco leaves. In this study, we examined the genotoxicity of tobacco leaves in the snail Helix aspersa as a measure of the risk to human health. DNA damage was evaluated using the micronucleus test and the Comet assay and the concentration of cytochrome P450 enzymes was estimated. Two groups of snails were studied: one fed on tobacco leaves and one fed on lettuce (Lactuca sativa L leaves (control group. All of the snails received leaves (tobacco and lettuce leaves were the only food provided and water ad libitum. Hemolymph cells were collected after 0, 24, 48 and 72 h. The Comet assay and micronucleus test showed that exposure to tobacco leaves for different periods of time caused significant DNA damage. Inhibition of cytochrome P450 enzymes occurred only in the tobacco group. Chemical analysis indicated the presence of the alkaloid nicotine, coumarins, saponins, flavonoids and various metals. These results show that tobacco leaves are genotoxic in H. aspersa and inhibit cytochrome P450 activity, probably through the action of the complex chemical mixture present in the plant.
International Nuclear Information System (INIS)
Salvucci, M.E.; Crafts-Brandner, S.J.
1991-01-01
A method for product analysis that eliminates a problematic step in the radiometric sucrose-phosphate synthase assay is described. The method uses chromatography on a boronate-derivatized high-performance liquid chromatography column to separate the labeled product, [14C]sucrose phosphate, from unreacted uridine 5'-diphosphate-[14C]glucose (UDP-Glc). Direct separation of these compounds eliminates the need for treatment of the reaction mixtures with alkaline phosphatase, thereby avoiding the problem of high background caused by contaminating phosphodiesterase activity in alkaline phosphatase preparations. The method presented in this paper can be applied to many UDP-Glc requiring enzymes; here the authors show its use for determining the activities of sucrose-phosphate synthase, sucrose synthase, and uridine diphosphate-glucose pyrophosphorylase in plant extracts
In silico design of PHA synthase and its validation by PHAs producing bacterial isolates
Directory of Open Access Journals (Sweden)
Susrita Sahoo
2017-10-01
Full Text Available Biopolymers are important alternatives to the petroleum-based plastics due to environment friendly manufacturing processes, biodegradability and biocompatibility. Therefore use of novel biopolymers such as polylactide, polysaccharides, aliphatic polyesters and polyhydroxyalkonoates (PHAs is of interest. PHAs are biodegradable polyesters of hydroxyalkanoates (HA produced from renewable resources by using microorganisms as intracellular carbon and energy storage compounds. Even though PHAs are promising candidate for biodegradable polymers, however, the production cost limits their application on an industrial scale. Therefore an attempt was made to model different PHAs synthases which are the key enzyme in the biosynthesis of Polyhydroxyalkanoates as the structural information of this enzyme is in dark veil.Then molecular docking of class I PHA Synthase from Ralstonia Eutrophia was done to study the PHA synthase activity. As there are lots of strain which needs to explore for the production of PHA. This investigation leads to find out the most industrial applicable microbes. Few bacterial isolates from soil sample were screened for production of PHA followed by the validation of the enzymatic activity and its product characterization to understand its structural properties.
Directory of Open Access Journals (Sweden)
Fonovich de Schroeder T.M.
1998-01-01
Full Text Available Nitric oxide synthase activity was measured in Langerhans islets isolated from control and streptozotocin diabetic rats. The activity of the enzyme was linear up to 150 µg of protein from control rats and was optimal at 0.1 µM calcium, when it was measured after 45 min of incubation at 37oC in the presence of 200 µM arginine. Specific activity of the enzyme was 25 x 10-4 nmol [3H]citrulline 45 min-1 mg protein-1. Streptozotocin diabetic rats exhibited less enzyme activity both in total pancreas homogenate and in isolated Langerhans islets when compared to control animals. Nitric oxide synthase activity measured in control and diabetic rats 15 days after the last streptozotocin injection in the second group of animals corresponded only to a constitutive enzyme since it was not inhibited by aminoguanidine in any of the mentioned groups. Hyperglycemia in diabetic rats may be the consequence of impaired insulin release caused at least in part by reduced positive modulation mediated by constitutive nitric oxide synthase activity, which was dramatically reduced in islets severely damaged after streptozotocin treatment.
Parental leave for residents and pediatric training programs.
2013-02-01
The American Academy of Pediatrics (AAP) is committed to the development of rational, equitable, and effective parental leave policies that are sensitive to the needs of pediatric residents, families, and developing infants and that enable parents to spend adequate and good-quality time with their young children. It is important for each residency program to have a policy for parental leave that is written, that is accessible to residents, and that clearly delineates program practices regarding parental leave. At a minimum, a parental leave policy for residents and fellows should conform legally with the Family Medical Leave Act as well as with respective state laws and should meet institutional requirements of the Accreditation Council for Graduate Medical Education for accredited programs. Policies should be well formulated and communicated in a culturally sensitive manner. The AAP advocates for extension of benefits consistent with the Family Medical Leave Act to all residents and interns beginning at the time that pediatric residency training begins. The AAP recommends that regardless of gender, residents who become parents should be guaranteed 6 to 8 weeks, at a minimum, of parental leave with pay after the infant's birth. In addition, in conformance with federal law, the resident should be allowed to extend the leave time when necessary by using paid vacation time or leave without pay. Coparenting, adopting, or fostering of a child should entitle the resident, regardless of gender, to the same amount of paid leave (6-8 weeks) as a person who takes maternity/paternity leave. Flexibility, creativity, and advanced planning are necessary to arrange schedules that optimize resident education and experience, cultivate equity in sharing workloads, and protect pregnant residents from overly strenuous work experiences at critical times of their pregnancies.
[Teacher sick leave: Prevalence, duration, reasons and covariates].
Vercambre-Jacquot, M-N; Gilbert, F; Billaudeau, N
2018-02-01
Absences from work have considerable social and economic impact. In the education sector, the phenomenon is particularly worrying since teacher sick leave has an impact on the overall performance of the education system. Yet, available data are scarce. In April-June 2013, 2653 teachers responded to a population-based postal survey on their quality of life (enquête Qualité de vie des enseignants, MGEN Foundation/Ministry of education, response rate 53 %). Besides questions on work environment and health, teachers were asked to describe their eventual sick leave(s) since the beginning of the school year: duration, type and medical reasons. Self-reported information was reinforced by administrative data from ministerial databases and weighted to be extrapolated to all French teachers. Tobit models adjusted for individual factors of a private nature were used to investigate different occupational risk factors of teacher sick leave, taking into account both the estimated effect on the probability of sick leave and the length of it. More than one in three teachers (36 %) reported having had at least one day of sick leave since the beginning of the school year. Respiratory/ENT diseases were the leading reason for sick leave (37 %). However, and because sick leave duration depended on the underlying health problem, such diseases came in third place among justifications of sick leave days (14 %), far behind musculoskeletal problems (27 %) and neurological and psychological disorders (25 %). Tobit models suggested that some occupational factors significantly associated with the risk of sick leave may represent promising preventive targets, including high psychological demand, workplace violence and unfavorable socio-environmental context. Our study provides objective evidence about the issue of sick leave among French teachers, highlighting the usefulness of implementing actions to minimize its weight. To this end, the study findings point-out the importance of
DEFF Research Database (Denmark)
Jensen, Søren A; Vainer, Ben; Kruhøffer, Mogens
2009-01-01
unclarified. The association of MSI and MMR status with outcome and with thymidylate synthase (TS) and dihydropyrimidine dehydrogenase (DPD) expression in colorectal cancer were evaluated. METHODS: MSI in five reference loci, MMR enzymes (hMSH2, hMSH6, hMLH1 and hPMS2), thymidylate synthase (TS....... Absence of repair protein expression was assessed in 52 (17.0%) tumors, which had primarily lost hMLH1 in 39 (12.7%), hMSH2 in 5 (1.6%), and hMSH6 in 8 (2.6%) tumors. In multivariate analysis MSI (instable) compared to MSS (stable) tumors were significantly associated with lower risk of recurrence (hazard...
Joo, Hye-Eun; Lee, Hyo-Jung; Sohn, Eun Jung; Lee, Min-Ho; Ko, Hyun-Suk; Jeong, Soo-Jin; Lee, Hyo-Jeong; Kim, Sung-Hoon
2013-01-01
The metabolic syndrome creates risk factors for coronary heart disease, diabetes, fatty liver, obesity and several cancers. Our group has already reported that the essential oil from leaves of Pinus koraiensis SIEB (EOPK) exerted antihyperlipidemic effects by upregulating the low-density lipoprotein receptor and inhibiting acyl-coenzyme A, cholesterol acyltransferases. We evaluated in the current study the anti-diabetic effects of EOPK on mice with streptozotocin (STZ)-induced type I diabetes and on HIT-T15 pancreatic β cells. EOPK significantly protected HIT-T15 cells from STZ-induced cytotoxicity and reduced the blood glucose level in STZ-induced diabetic mice when compared with the untreated control. EOPK consistently and significantly suppressed the α-amylase activity in a dose-dependent manner and enhanced the expression of insulin at the mRNA level in STZ-treated HIT-T15 cells, while the expression of insulin was attenuated. EOPK also significantly abrogated the population of reactive oxygen species when compared to the untreated control in STZ-treated HIT-T15 cells. Furthermore, EOPK significantly reduce nitric oxide production, suppressed the phosphorylation of endothelial nitric oxide (NO) synthase and suppressed the production of vascular endothelial growth factor (VEGF) in STZ-treated HIT-T15 cells, implying its potential application to diabetic retinopathy. Overall, our findings suggest that EOPK had hypoglycemic potential by inhibiting reactive oxygene species (ROS), endothelial NO synthase (eNOS) and VEGF in STZ-treated mice and HIT-T15 pancreatic β cells as a potent anti-diabetic agent.
Salunke, Rahul
2018-05-14
The mitochondrial F-type ATP synthase, a multi-subunit nanomotor, is critical for maintaining cellular ATP levels. In Toxoplasma gondii and other apicomplexan parasites, many subunit components, necessary for proper assembly and functioning of this enzyme, appear to be missing. Here, we report the identification of 20 novel subunits of T. gondii F-type ATP synthase from mass spectrometry analysis of partially purified monomer (~600 kDa) and dimer (>1 MDa) forms of the enzyme. Despite extreme sequence diversification, key FO subunits, a, b and d, can be identified from conserved structural features. Orthologs for these proteins are restricted to apicomplexan, chromerid and dinoflagellate species. Interestingly, their absence in ciliates indicates a major diversion, with respect to subunit composition of this enzyme, within the alveolate clade. Discovery of these highly diversified novel components of the apicomplexan F-type ATP synthase complex will facilitate the development of novel anti-parasitic agents. Structural and functional characterization of this unusual enzyme complex will advance our fundamental understanding of energy metabolism in apicomplexan species.
Salunke, Rahul; Mourier, Tobias; Banerjee, Manidipa; Pain, Arnab; Shanmugam, Dhanasekaran
2018-01-01
The mitochondrial F-type ATP synthase, a multi-subunit nanomotor, is critical for maintaining cellular ATP levels. In Toxoplasma gondii and other apicomplexan parasites, many subunit components, necessary for proper assembly and functioning of this enzyme, appear to be missing. Here, we report the identification of 20 novel subunits of T. gondii F-type ATP synthase from mass spectrometry analysis of partially purified monomer (~600 kDa) and dimer (>1 MDa) forms of the enzyme. Despite extreme sequence diversification, key FO subunits, a, b and d, can be identified from conserved structural features. Orthologs for these proteins are restricted to apicomplexan, chromerid and dinoflagellate species. Interestingly, their absence in ciliates indicates a major diversion, with respect to subunit composition of this enzyme, within the alveolate clade. Discovery of these highly diversified novel components of the apicomplexan F-type ATP synthase complex will facilitate the development of novel anti-parasitic agents. Structural and functional characterization of this unusual enzyme complex will advance our fundamental understanding of energy metabolism in apicomplexan species.
Erratum Aldosterone synthase C-344T, angiotensin II type 1 receptor ...
Indian Academy of Sciences (India)
Aldosterone synthase C-344T, angiotensin II type 1 receptor A1166C and 11-β hydroxysteroid dehydrogenase G534A gene polymorphisms and essential hypertension in the population of Odisha, India. Manisha Patnaik, Pallabi Pati, Surendra N. Swain, Manoj K. Mohapatra, Bhagirathi Dwibedi, Shantanu K. Kar.
Moll, Stefanie; Anke, Sven; Kahmann, Uwe; Hänsch, Robert; Hartmann, Thomas; Ober, Dietrich
2002-01-01
Pyrrolizidine alkaloids (PAs) are constitutive plant defense compounds with a sporadic taxonomic occurrence. The first committed step in PA biosynthesis is catalyzed by homospermidine synthase (HSS). Recent evidence confirmed that HSS evolved by gene duplication from deoxyhypusine synthase (DHS), an enzyme involved in the posttranslational activation of the eukaryotic translation initiation factor 5A. To better understand the evolutionary relationship between these two enzymes, which are involved in completely different biological processes, we studied their tissue-specific expression. RNA-blot analysis, reverse transcriptase-PCR, and immunolocalization techniques demonstrated that DHS is constitutively expressed in shoots and roots of Senecio vernalis (Asteraceae), whereas HSS expression is root specific and restricted to distinct groups of endodermis and neighboring cortex cells located opposite to the phloem. All efforts to detect DHS by immunolocalization failed, but studies with promoter-β-glucuronidase fusions confirmed a general expression pattern, at least in young seedlings of tobacco (Nicotiana tabacum). The expression pattern for HSS differs completely from its ancestor DHS due to the adaptation of HSS to the specific requirements of PA biosynthesis. PMID:12226485
Late adolescents' conceptualizations of home-leaving.
Moore, D; Hotch, D F
1981-02-01
Separation from the family, a key developmental task, has received scant attention from developmentalists. In this study, college students' dissimilarity ratings and ratings on 22 bipolar adjective scales were obtained for a set of 20 definitions of home-leaving. Results of a cluster analysis revealed that conceptualizations of the definitions are organized in terms of eight clusters. Ratings on the 22 adjective scales provided an empirical means for interpreting the typological structure of the home-leaving definitions. Convergence the results of this inductive study of home-leaving and elements of ego development theory was noted.
DEFF Research Database (Denmark)
Hove-Jensen, Bjarne; Bentsen, Ann-Kristin K; Harlow, Kenneth W
2005-01-01
Eleven of the codons specifying the amino acids of the flexible catalytic loop [KRRPRPNVAEVM(197-208)] of Bacillus subtilis phosphoribosyl diphosphate synthase have been changed individually to specify alanine. The resulting variant enzyme forms, as well as the wildtype enzyme, were produced...... in an Escherichia coli strain lacking endogenous phosphoribosyl diphosphate synthase activity and purified to near homogeneity. The B. subtilis phosphoribosyl diphosphate synthase mutant variants K197A and R199A were studied in detail. The physical properties of the two enzymes were similar to those of the wildtype...
DEFF Research Database (Denmark)
Bernal Giraldo, Adriana Jimena; Yoo, Cheol-Min; Mutwil, Marek
2008-01-01
A reverse genetic approach was used to investigate the functions of three members of the cellulose synthase superfamily in Arabidopsis (Arabidopsis thaliana), CELLULOSE SYNTHASE-LIKE D1 (CSLD1), CSLD2, and CSLD4. CSLD2 is required for normal root hair growth but has a different role from that pre......A reverse genetic approach was used to investigate the functions of three members of the cellulose synthase superfamily in Arabidopsis (Arabidopsis thaliana), CELLULOSE SYNTHASE-LIKE D1 (CSLD1), CSLD2, and CSLD4. CSLD2 is required for normal root hair growth but has a different role from...... for insertions in these genes were partially rescued by reduced temperature growth. However, this was not the case for a double mutant homozygous for insertions in both CSLD2 and CSLD3, suggesting that there may be partial redundancy in the functions of these genes. Mutants in CSLD1 and CSLD4 had a defect...
DEFF Research Database (Denmark)
Vestergaard, H; Lund, S; Bjørbaek, C
1995-01-01
We have previously shown that the mRNA expression of muscle glycogen synthase is decreased in non-insulin-dependent diabetic (NIDDM) patients; the objective of the present protocol was to examine whether the gene expression of muscle glycogen synthase in NIDDM is affected by chronic sulphonylurea...... as enhanced beta-cell responses to an oral glucose load. During euglycaemic, hyperinsulinaemic clamp (2 mU x kg-1 x min-1) in combination with indirect calorimetry, a 35% (p=0.005) increase in whole-body insulin-stimulated glucose disposal rate, predominantly due to an increased non-oxidative glucose....... In conclusion, improved blood glucose control in gliclazide-treated obese NIDDM patients has no impact on the gene expression of muscle glycogen synthase....
Directory of Open Access Journals (Sweden)
Aarón Barraza
2016-11-01
Full Text Available Legumes form symbioses with rhizobia, producing nitrogen-fixing nodules on the roots of the plant host. The network of plant signaling pathways affecting carbon metabolism may determine the final number of nodules. The trehalose biosynthetic pathway regulates carbon metabolism and plays a fundamental role in plant growth and development, as well as in plant-microbe interactions. The expression of genes for trehalose synthesis during nodule development suggests that this metabolite may play a role in legume-rhizobia symbiosis. In this work, PvTPS9, which encodes a Class II trehalose-6-phosphate synthase (TPS of common bean (Phaseolus vulgaris, was silenced by RNA interference in transgenic nodules. The silencing of PvTPS9 in root nodules resulted in a reduction of 85% (± 1% of its transcript, which correlated with a 30% decrease in trehalose contents of transgenic nodules and in untransformed leaves. Composite transgenic plants with PvTPS9 silenced in the roots showed no changes in nodule number and nitrogen fixation, but a severe reduction in plant biomass and altered transcript profiles of all Class II TPS genes. Our data suggest that PvTPS9 plays a key role in modulating trehalose metabolism in the symbiotic nodule and, therefore, in the whole plant.
The Problems of Parental Leave.
Price, Sean
2017-10-01
The United States is the only major industrialized country in the world to not require paid parental leave. Numerous studies have shown that allowing parents time with a newborn makes the child and the parents healthier, both physically and mentally. Many physicians, especially those who work in practices with five or fewer doctors, worry about how to pay for parental leave for themselves and their staff.
The dewetting properties of lotus leaves.
Zhang, Jihua; Sheng, Xianliang; Jiang, Lei
2009-02-03
The high dewetting abilities of lotus leaves can be transited to a complete wetting state by soaking the leaves in water at a depth of 50 cm for 2 h. However, after being dried by N2 gas, the high dewetting behavior of lotus leaves may be mostly restored. This indicates that experimental procedure might considerably affect the dewetting abilities of lotus leaves. To discover the mechanism underlying this interesting dewetting phenomena, the dewetting force was used to characterize the dewetting abilities of surfaces, and model studies to mimic the papillae were done. Surface hydrophobicity, sizes, rise angles, and secondary structures of the models' sides affected their dewetting force with water. So we suggested that the dewetting states, Cassie or Wenzel's state, of lotus surfaces depend much on the depth of water, i.e., the hydraulic pressure. On the other hand, the primary structures of papillae in Cassie's state led to a high receding angle with respect to the plane of the leaf during the dewetting measurement. The secondary structures and micro/nano arrays of papillae increased the dewetting abilities of lotus leaves, since no water intruded between papillae. However, the structures of papillae in Wenzle's state significantly reduced the dewetting abilities of lotus leaves after being soaked at a depth of 50 cm for 2 h. Therefore, as for novel designs of microdevices floating on water, including the use of the high dewetting properties of suphydrophobic materials, surface (primary or secondary) microstructure and external pressure, such as static hydraulic pressure, must be taken into account.
The impact of paternity leave on fathers' future earnings.
Rege, Mari; Solli, Ingeborg F
2013-12-01
Using Norwegian registry data, we investigate the effect of paternity leave on fathers' long-term earnings. If the paternity leave increased long-term father involvement, then we should expect a reduction in fathers' long-term earnings as they shift time and effort from market to home production. For identification, we use the Norwegian introduction of a paternity-leave quota in 1993, reserving four weeks of the total of 42 weeks of paid parental leave exclusively for the father. The introduction of the paternity-leave quota led to a sharp increase in rates of leave-taking for fathers. We estimate a difference-in-differences model that exploits differences in fathers' exposure to the paternity-leave quota by the child's age and year of observation. Our analysis suggests that four weeks of paternity leave during the child's first year decreases fathers' future earnings, an effect that persists through our last point of observation, when the child is 5 years old. A battery of robustness tests supports our results.
International Nuclear Information System (INIS)
Leduc, Yvonne A.; Phenix, Christopher P.; Puttick, Jennifer; Nienaber, Kurt; Palmer, David R. J.; Delbaere, Louis T. J.
2005-01-01
MosA from S. meliloti L5-30 has been crystallized in solution with pyruvate and the 2.3 Å resolution structure has been solved by molecular replacement using E. coli dihydrodipicolinate synthase as the model. The structure of MosA, a dihydrodipicolinate synthase and reported methyltransferase from Sinorhizobium meliloti, has been solved using molecular replacement with Escherichia coli dihydrodipicolinate synthase as the model. A crystal grown in the presence of pyruvate diffracted X-rays to 2.3 Å resolution using synchrotron radiation and belonged to the orthorhombic space group C222 1 , with unit-cell parameters a = 69.14, b = 138.87, c = 124.13 Å
International Nuclear Information System (INIS)
Yip, Wingkip; Dong, Jianguo; Yang, Shang Fa
1989-01-01
Tomato ACC synthase is inactivated by its substrate SAM, with the moiety of aminobutyrate being covalently linked to ACC synthase during the catalytic reactions. A partial purified ACC synthase (the catalytic activity 100 μmol/h·mg protein) from pellets of apple extract was incubated with [3,4 14 C] SAM. Only one radioactive peak was revealed in a C-4 reverse phase HPLC and one radioactive band on SDS-PAGE with an M.W. of 48 kDa. Apple ACC synthase in native form is resistant to V8, α-chromtrypsin and carboxylpeptidase A digestion, but effectively inactivated by trypsin and ficin, as demonstrated by both the activity assay and SAM labeling. The radioactive protein cut from the SDS-PAGE was injected to three mice, two of the mice showed responses to the protein in western blot analysis. The antibodies from mice is currently under characterization
Díaz, Adelaida; Martínez-Pons, Carlos; Fita, Ignacio; Ferrer, Juan C.; Guinovart, Joan J.
2011-01-01
Glycogen synthase, a central enzyme in glucose metabolism, catalyzes the successive addition of α-1,4-linked glucose residues to the non-reducing end of a growing glycogen molecule. A non-catalytic glycogen-binding site, identified by x-ray crystallography on the surface of the glycogen synthase from the archaeon Pyrococcus abyssi, has been found to be functionally conserved in the eukaryotic enzymes. The disruption of this binding site in both the archaeal and the human muscle glycogen synth...
Effects of Tributyltin Chloride on Cybrids with or without an ATP Synthase Pathologic Mutation.
López-Gallardo, Ester; Llobet, Laura; Emperador, Sonia; Montoya, Julio; Ruiz-Pesini, Eduardo
2016-09-01
The oxidative phosphorylation system (OXPHOS) includes nuclear chromosome (nDNA)- and mitochondrial DNA (mtDNA)-encoded polypeptides. Many rare OXPHOS disorders, such as striatal necrosis syndromes, are caused by genetic mutations. Despite important advances in sequencing procedures, causative mutations remain undetected in some patients. It is possible that etiologic factors, such as environmental toxins, are the cause of these cases. Indeed, the inhibition of a particular enzyme by a poison could imitate the biochemical effects of pathological mutations in that enzyme. Moreover, environmental factors can modify the penetrance or expressivity of pathological mutations. We studied the interaction between mitochondrially encoded ATP synthase 6 (p.MT-ATP6) subunit and an environmental exposure that may contribute phenotypic differences between healthy individuals and patients suffering from striatal necrosis syndromes or other mitochondriopathies. We analyzed the effects of the ATP synthase inhibitor tributyltin chloride (TBTC), a widely distributed environmental factor that contaminates human food and water, on transmitochondrial cell lines with or without an ATP synthase mutation that causes striatal necrosis syndrome. Doses were selected based on TBTC concentrations previously reported in human whole blood samples. TBTC modified the phenotypic effects caused by a pathological mtDNA mutation. Interestingly, wild-type cells treated with this xenobiotic showed similar bioenergetics when compared with the untreated mutated cells. In addition to the known genetic causes, our findings suggest that environmental exposure to TBTC might contribute to the etiology of striatal necrosis syndromes. López-Gallardo E, Llobet L, Emperador S, Montoya J, Ruiz-Pesini E. 2016. Effects of tributyltin chloride on cybrids with or without an ATP synthase pathologic mutation. Environ Health Perspect 124:1399-1405; http://dx.doi.org/10.1289/EHP182.
77 FR 8959 - The Family and Medical Leave Act
2012-02-15
...; and extends FMLA military caregiver leave to family members of certain veterans with serious injuries... Medical Leave Act of 1993, Final Rule on November 17, 2008 (2008 final rule). 73 FR 67934. A. What the... covered servicemember (referred to as ``military caregiver leave''). These two leave entitlements are...
Toyomasu, Tomonobu; Miyamoto, Koji; Shenton, Matthew R; Sakai, Arisa; Sugawara, Chizu; Horie, Kiyotaka; Kawaide, Hiroshi; Hasegawa, Morifumi; Chuba, Masaru; Mitsuhashi, Wataru; Yamane, Hisakazu; Kurata, Nori; Okada, Kazunori
2016-11-18
Cultivated rice (Oryza sativa) possesses various labdane-related diterpene synthase genes, homologs of ent-copalyl diphosphate synthase (CPS) and ent-kaurene synthase (KS) that are responsible for the biosynthesis of phytohormone gibberellins. The CPS homologs and KS like (KSL) homologs successively converted geranylgeranyl diphosphate to cyclic diterpene hydrocarbons via ent-copalyl diphosphate or syn-copalyl diphosphate in O. sativa. Consequently, a variety of labdane-related diterpenoids, including phytoalexin phytocassanes, momilactones and oryzalexins, have been identified from cultivated rice. Our previous report indicated that the biosynthesis of phytocassanes and momilactones is conserved in Oryza rufipogon, the progenitor of Asian cultivated rice. Moreover, their biosynthetic gene clusters, containing OsCPS2 and OsKSL7 for phytocassane biosynthesis and OsCPS4 and OsKSL4 for momilactone biosynthesis, are also present in the O. rufipogon genome. We herein characterized O. rufipogon homologs of OsKSL5, OsKSL6, OsKSL8 responsible for oryzalexin S biosynthesis, and OsKSL10 responsible for oryzalexins A-F biosynthesis, to obtain more evolutionary insight into diterpenoid biosynthesis in O. sativa. Our phytoalexin analyses showed that no accumulation of oryzalexins was detected in extracts from O. rufipogon leaf blades. In vitro functional analyses indicated that unlike OsKSL10, O. rufipogon KSL10 functions as an ent-miltiradiene synthase, which explains the lack of accumulation of oryzalexins A-F in O. rufipogon. The different functions of KSL5 and KSL8 in O. sativa japonica to those in indica are conserved in each type of O. rufipogon, while KSL6 functions (ent-isokaurene synthases) are well conserved. Our study suggests that O. sativa japonica has evolved distinct specialized diterpenoid metabolism, including the biosynthesis of oryzalexins. Copyright © 2016 Elsevier Inc. All rights reserved.
An Internatioal Comparison and Assessment of Maternity Leave Regulation
Dorothea Alewell, Kerstin Pull
2001-01-01
Provisions for maternity leave are common among industrialized countries, but their institutional design varies distinctly from country to country. Developing our theory on the impact on maternity leave regulations on women's labor market situation, we argue that a woman on leave creates a re-organization problem for her employer. The costs of re-organization will not simply increase with the duration of maternity leave, but display a hump-shaped curvature which peeks at medium-leave duration...
Biochemical and neurophysiological parameters in hemodialyzed patients with chronic renal failure
Schoots, A.C.; Vries, de P.M.J.M.; Thiemann, R.C.J.; Hazejager, W.A.; Visser, S.L.; Oe, P.L.
1989-01-01
Serum concentrations of accumulated solutes, standard clinical biochemistry, and parameters of clinical neuropathy, were determined in hemodialyzed patients with chronic renal failure. Analyses by high-performance liquid chromatography included creatinine, pseudouridine, urate, p-hydroxyhippuric
Structure of dimeric, recombinant Sulfolobus solfataricus phosphoribosyl diphosphate synthase
DEFF Research Database (Denmark)
Andersen, Rune W.; Lo Leggio, Leila; Hove-Jensen, Bjarne
2015-01-01
The enzyme 5-phosphoribosyl-1-α-diphosphate (PRPP) synthase (EC 2.7.6.1) catalyses the Mg2+-dependent transfer of a diphosphoryl group from ATP to the C1 hydroxyl group of ribose 5-phosphate resulting in the production of PRPP and AMP. A nucleotide sequence specifying Sulfolobus solfataricus PRPP...
The effect of high pressure on the intracellular trehalose synthase activity of Thermus aquaticus.
Dong, Yongsheng; Ma, Lei; Duan, Yuanliang
2016-01-01
To understand the effect of high pressure on the intracellular trehalose synthase activity, Thermus aquaticus (T. aquaticus) in the logarithmic growth phase was treated with high-pressure air, and its intracellular trehalose synthase (TSase) activity was determined. Our results indicated that pressure is a factor strongly affecting the cell growth. High pressure significantly attenuated the growth rate of T. aquaticus and shortened the duration of stationary phase. However, after 2 h of culture under 1.0 MPa pressure, the activity of intracellular TSase in T. aquaticus reached its maximum value, indicating that pressure can significantly increase the activity of intracellular TSase in T. aquaticus. Thus the present study provides an important guide for the enzymatic production of trehalose.
Part-Time Sick Leave as a Treatment Method?
Andrén D; Andrén T
2009-01-01
This paper analyzes the effects of being on part-time sick leave compared to full-time sick leave on the probability of recovering (i.e., returning to work with full recovery of lost work capacity). Using a discrete choice one-factor model, we estimate mean treatment parameters and distributional treatment parameters from a common set of structural parameters. Our results show that part-time sick leave increases the likelihood of recovering and dominates full-time sick leave for sickness spel...
The Length of Maternity Leave and Family Health
Beuchert, Louise Voldby; Humlum, Maria Knoth; Vejlin, Rune Majlund
2014-01-01
We study the relationship between the length of maternity leave and the physical and psychological health of the family. Using a reform of the parental leave scheme in Denmark that increased the number of weeks of leave with full benefit compensation,we estimate the effect of the length of maternity leave on a range of health indicators including the number of hospital admissions for both mother and child and the probability of the mother receiving antidepressants. The reform led to an increa...
Properties of leaves particleboard for sheathing application
Nuryawan, Arif; Rahmawaty
2018-03-01
Manufacturing particleboard (PB) made of leaves was carried out to make non-structural building components, such as insulation, partition, wall, and sheathing. Raw materials used dry leaves originated from plantation (palm oil leaves) and forest plantation (magahony leaves). The adhesive used was interior type thermosetting commercial resins, namely 10% urea-formaldehyde (UF) based on oven dry leaves. Hardener used for UF resin was 1% and 3% ammonium chloride (NH4Cl) 20% (w/w), respectively. Technically, the target density of PB was 0.8 g/cm3 with the dimension’s size of (250 x 250 x 10) mm3. The pressure, temperature, and time of pressing of the hot press were 25 kgf/cm2, 120C, and 10 minutes, respectively. After conditioning for one week, the PB then was evaluated their physical and mechanical properties according to Japanese Industrial Standard (JIS) A 5908 (2003). Results of this work showed: 1) Both types of PB (palm oil and mahagony leaves) were feasible to be produced for non-structural applications; 2) Addition of hardener enhanced the physical and mechanical properties of PB; 3) It was recommended to enhance the performance of the PB by manipulation of the raw materials and the design.
Office design's impact on sick leave rates.
Bodin Danielsson, Christina; Chungkham, Holendro Singh; Wulff, Cornelia; Westerlund, Hugo
2014-01-01
The effect of office type on sickness absence among office employees was studied prospectively in 1852 employees working in (1) cell-offices; (2) shared-room offices; (3) small, (4) medium-sized and (5) large open-plan offices; (6) flex-offices and (7) combi-offices. Sick leaves were self-reported two years later as number of (a) short and (b) long (medically certified) sick leave spells as well as (c) total number of sick leave days. Multivariate logistic regression analysis was used, with adjustment for background factors. A significant excess risk for sickness absence was found only in terms of short sick leave spells in the three open-plan offices. In the gender separate analysis, this remained for women, whereas men had a significantly increased risk in flex-offices. For long sick leave spells, a significantly higher risk was found among women in large open-plan offices and for total number of sick days among men in flex-offices. A prospective study of the office environment's effect on employees is motivated by the high rates of sick leaves in the workforce. The results indicate differences between office types, depending on the number of people sharing workspace and the opportunity to exert personal control as influenced by the features that define the office types.
Directory of Open Access Journals (Sweden)
Yan Yang
2017-04-01
Full Text Available To conform to the multiple regulations of triterpene biosynthesis, the gene encoding farnesyl pyrophosphate synthase (FPS was transformed into Panax notoginseng (P. notoginseng cells in which RNA interference (RNAi of the cycloartenol synthase (CAS gene had been accomplished. Transgenic cell lines showed both higher expression levels of FPS and lower expression levels of CAS compared to the wild-type (WT cells. In the triterpene and phytosterol analysis, transgenic cell lines provided a higher accumulation of total triterpene saponins, and a lower amount of phytosterols in comparison with the WT cells. Compared with the cells in which RNAi of the CAS gene was achieved, the cells with simultaneously over-expressed FPS and silenced CAS showed higher triterpene contents. These results demonstrate that over-expression of FPS can break the rate-limiting reaction catalyzed by FPS in the triterpene saponins biosynthetic pathway; and inhibition of CAS expression can decrease the synthesis metabolic flux of the phytosterol branch. Thus, more precursors flow in the direction of triterpene synthesis, and ultimately promote the accumulation of P. notoginseng saponins. Meanwhile, silencing and over-expressing key enzyme genes simultaneously is more effective than just manipulating one gene in the regulation of saponin biosynthesis.
De Marchi, Umberto; Thevenet, Jonathan; Hermant, Aurelie; Dioum, Elhadji; Wiederkehr, Andreas
2014-01-01
Mitochondrial energy metabolism is essential for glucose-induced calcium signaling and, therefore, insulin granule exocytosis in pancreatic beta cells. Calcium signals are sensed by mitochondria acting in concert with mitochondrial substrates for the full activation of the organelle. Here we have studied glucose-induced calcium signaling and energy metabolism in INS-1E insulinoma cells and human islet beta cells. In insulin secreting cells a surprisingly large fraction of total respiration under resting conditions is ATP synthase-independent. We observe that ATP synthase-dependent respiration is markedly increased after glucose stimulation. Glucose also causes a very rapid elevation of oxidative metabolism as was followed by NAD(P)H autofluorescence. However, neither the rate of the glucose-induced increase nor the new steady-state NAD(P)H levels are significantly affected by calcium. Our findings challenge the current view, which has focused mainly on calcium-sensitive dehydrogenases as the target for the activation of mitochondrial energy metabolism. We propose a model of tight calcium-dependent regulation of oxidative metabolism and ATP synthase-dependent respiration in beta cell mitochondria. Coordinated activation of matrix dehydrogenases and respiratory chain activity by calcium allows the respiratory rate to change severalfold with only small or no alterations of the NAD(P)H/NAD(P)+ ratio. PMID:24554722
29 CFR 825.120 - Leave for pregnancy or birth.
2010-07-01
... Regulations Relating to Labor (Continued) WAGE AND HOUR DIVISION, DEPARTMENT OF LABOR OTHER LAWS THE FAMILY AND MEDICAL LEAVE ACT OF 1993 Coverage Under the Family and Medical Leave Act § 825.120 Leave for... of a child as follows: (1) Both the mother and father are entitled to FMLA leave for the birth of...
International Nuclear Information System (INIS)
Raetz, C.R.H.; Carman, G.M.; Dowhan, W.; Jiang, R.T.; Waszkuc, W.; Loffredo, W.; Tsai, M.D.
1987-01-01
The steric courses of the reactions catalyzed by phosphatidylserine (PS) synthase from Escherichia coli and yeast were elucidated by the following procedure. R/sub P/ and S/sub P/ isomers of 1,2-dipalmitoyl-sn-glycero-3-[ 17 O, 18 O]phosphoethanolamine ([ 17 O, 18 O]DPPE) were synthesized and converted to (R/sub P/)- and (S/sub P/)-1,2-dipalmitoyl-sn-glycero-3-[ 16 O, 17 O, 18 O]DPPA), respectively, by incubating with phospholipase D. Condensation of [ 16 O, 17 O, 18 O]DPPA with cytidine 5'-monophosphomorpholidate in pyridine gave the desired substrate for PS synthase, [ 17 O, 18 O]cytidine 5'-diphospho-1,2-dipalmitoyl-sn-glycerol ([ 17 O, 18 O]CDP-DPG), as a mixture of several isotopic and configurational isomers. Incubation of [ 17 O, 18 O]CDP-DPG), as a mixture of several isotopic and configurational isomers. Incubation of [ 17 O, 18 O] CDP-DPG with a mixture of L-serine, PS synthase and PS decarboxylase gave [ 17 O, 18 O]DPPE. The configuration and isotopic enrichments of the starting [ 17 O, 18 O]DPPE and the product were analyzed by 31 P NMR following trimethylsilylation of the DPPE. The results indicate that the reaction of E. coli PS synthase proceeds with retention of configuration at phosphorus, which suggests a two-step mechanism involving a phosphatidyl-enzyme intermediate, while the yeast PS synthase catalyzes the reaction with inversion of configuration, which suggests a single-displacement mechanism. Such results lend strong support to the ping-pong mechanism proposed for the E. coli enzyme and the sequential Bi-Bi mechanism proposed for the yeast enzyme, both based on previous isotopic exchange experiments
DEFF Research Database (Denmark)
Bernal Giraldo, Adriana Jimena; Jensen, Jacob Krüger; Harholt, Jesper
2007-01-01
Members of a large family of cellulose synthase-like genes (CSLs) are predicted to encode glycosyl transferases (GTs) involved in the biosynthesis of plant cell walls. The CSLA and CSLF families are known to contain mannan and glucan synthases, respectively, but the products of other CSLs...... are unknown. Here we report the effects of disrupting ATCSLD5 expression in Arabidopsis. Both stem and root growth were significantly reduced in ATCSLD5 knock-out plants, and these plants also had increased susceptibility to the cellulose synthase inhibitor isoxaben. Antibody and carbohydrate-binding module...
Directory of Open Access Journals (Sweden)
Kexiu Song
2014-01-01
Full Text Available HDL cholesterol is known to be inversely correlated with cardiovascular disease due to its diverse antiatherogenic functions. SR-BI mediates the selective uptake of HDL-C. SR-BI knockout diminishes but does not completely block the transport of HDL; other receptors may be involved. Ectopic ATP synthase β-chain in hepatocytes has been previously characterized as an apoA-I receptor, triggering HDL internalization. This study was undertaken to identify the overexpression of ectopic ATP synthase β-chain on DIL-HDL uptake in primary hepatocytes in vitro and on plasma HDL levels in SR-BI knockout mice. Human ATP synthase β-chain cDNA was delivered to the mouse liver by adenovirus and GFP adenovirus as control. The adenovirus-mediated overexpression of β-chain was identified at both mRNA and protein levels on mice liver and validated by its increasing of DiL-HDL uptake in primary hepatocytes. In response to hepatic overexpression of β-chain, plasma HDL-C levels and cholesterol were reduced in SR-BI knockout mice, compared with the control. The present data suggest that ATP synthase β-chain can serve as the endocytic receptor of HDL, and its overexpression can reduce plasma HDL-C.
Directory of Open Access Journals (Sweden)
Anne K. Braczynski
2015-01-01
Full Text Available TMEM70 is involved in the biogenesis of mitochondrial ATP synthase and mutations in the TMEM70 gene impair oxidative phosphorylation. Herein, we report on pathology and treatment of ATP synthase deficiency in four siblings. A consanguineous family of Roma (Gipsy ethnic origin gave birth to 6 children of which 4 were affected presenting with dysmorphic features, failure to thrive, cardiomyopathy, metabolic crises, and 3-methylglutaconic aciduria as clinical symptoms. Genetic testing revealed a homozygous mutation (c.317-2A>G in the TMEM70 gene. While light microscopy was unremarkable, ultrastructural investigation of muscle tissue revealed accumulation of swollen degenerated mitochondria with lipid crystalloid inclusions, cristae aggregation, and exocytosis of mitochondrial material. Biochemical analysis of mitochondrial complexes showed an almost complete ATP synthase deficiency. Despite harbouring the same mutation, the clinical outcome in the four siblings was different. Two children died within 60 h after birth; the other two had recurrent life-threatening metabolic crises but were successfully managed with supplementation of anaplerotic amino acids, lipids, and symptomatic treatment during metabolic crisis. In summary, TMEM70 mutations can cause distinct ultrastructural mitochondrial degeneration and almost complete deficiency of ATP synthase but are still amenable to treatment.
DEFF Research Database (Denmark)
Heo, Min-Ji; Jung, Hwi-Min; Um, Jaeyong
2017-01-01
Genome editing using CRISPR/Cas9 was successfully demonstrated in Esherichia coli to effectively produce n-butanol in a defined medium under microaerobic condition. The butanol synthetic pathway genes including those encoding oxygen-tolerant alcohol dehydrogenase were overexpressed in metabolically...... prediction program, UTR designer, and modified using the CRISPR/Cas9 genome editing method to reduce its expression level. E. coli strains with decreased citrate synthase expression produced more butanol and the citrate synthase activity was correlated with butanol production. These results demonstrate...
Japanese tea leaves: a possible biological standard reference material
International Nuclear Information System (INIS)
Fuwa, Keiichiro; Notsu, Kenji; Tsunoda, Kin-ichi; Kato, Hideaki; Yamamoto, Yuko.
1978-01-01
Japanese Tea Leaves, prepared by pulverizing with an agate ball mill and sieving with a Saran fiber sieve (50 mesh) were assessed as a possible biological standard reference material for elemental analysis. The metal content of the tea leaves was determined independently at two laboratories using atomic absorption and flame emission spectrometry. Neutron activation analysis was also performed to determine the content (21 elements) of Tea Leaves. For some elements the result from the various methods were compared. The characteristics of Tea Leaves are discussed and the elemental composition is compared to that of Orchard Leaves (NBS SRM, 1571). The most significant characteristic of Tea Leaves was the high manganese content. (auth.)
Ishikawa, Ken; Calzavacca, Paolo; Bellomo, Rinaldo; Bailey, Michael; May, Clive N
2012-08-01
Nitric oxide plays an important role in the control of renal blood flow and renal function. In sepsis, increased levels of inducible nitric oxide synthase produce excessive nitric oxide, which may contribute to the development of acute kidney injury. We, therefore, examined the effects of intrarenal infusion of selective inducible nitric oxide synthase inhibitors in a large animal model of hyperdynamic sepsis in which acute kidney injury occurs in the presence of increased renal blood flow. Prospective crossover randomized controlled interventional studies. University-affiliated research institute. Twelve unilaterally nephrectomized Merino ewes. Infusion of a selective (1400W) and a partially selective inducible nitric oxide synthase inhibitor (aminoguanidine) into the renal artery for 2 hrs after the induction of sepsis, and comparison with a nonselective inhibitor (Nω-nitro-L-arginine methyl ester). In sheep with nonhypotensive hyperdynamic sepsis, creatinine clearance halved (32 to 16 mL/min, ratio [95% confidence interval] 0.51 [0.28-0.92]) despite increased renal blood flow (241 to 343 mL/min, difference [95% confidence interval] 102 [78-126]). Infusion of 1400W did not change renal blood flow, urine output, or creatinine clearance, whereas infusion of Nω-nitro-L-arginine methyl ester and a high dose of aminoguanidine normalized renal blood flow, but did not alter creatinine clearance. In hyperdynamic sepsis, intrarenal infusion of a highly selective inducible nitric oxide synthase inhibitor did not reduce the elevated renal blood flow or improve renal function. In contrast, renal blood flow was reduced by infusion of a nonselective NOS inhibitor or a high dose of a partially selective inducible nitric oxide synthase inhibitor. The renal vasodilatation in septic acute kidney injury may be due to nitric oxide derived from the endothelial and neural isoforms of nitric oxide synthase, but their blockade did not restore renal function.
Cloning and characterization of ATP synthase CF1 α gene from ...
African Journals Online (AJOL)
ATP synthase CF1 α subunit protein is a key enzyme for energy metabolism in plant kingdom, and plays an important role in multiple cell processes. In this study, the complete atpA gene (accession no. JN247444) was cloned from sweet potato (Ipomoea batatas L. Lam) by reverse transcriptasepolymerase chain reaction ...
Energy Technology Data Exchange (ETDEWEB)
Morita, Hiroyuki [Mitsubishi Kagaku Institute of Life Sciences (MITILS), 11 Minamiooya, Machida, Tokyo 194-8511 (Japan); Kondo, Shin; Kato, Ryohei [Innovation Center Yokohama, Mitsubishi Chemical Corporation, 1000 Kamoshida, Aoba, Yokohama, Kanagawa 227-8502 (Japan); Wanibuchi, Kiyofumi; Noguchi, Hiroshi [School of Pharmaceutical Sciences, University of Shizuoka and the COE21 Program, Shizuoka 422-8526 (Japan); Sugio, Shigetoshi [Innovation Center Yokohama, Mitsubishi Chemical Corporation, 1000 Kamoshida, Aoba, Yokohama, Kanagawa 227-8502 (Japan); Abe, Ikuro [School of Pharmaceutical Sciences, University of Shizuoka and the COE21 Program, Shizuoka 422-8526 (Japan); PRESTO, Japan Science and Technology Agency, Kawaguchi, Saitama 332-0012 (Japan); Kohno, Toshiyuki [Mitsubishi Kagaku Institute of Life Sciences (MITILS), 11 Minamiooya, Machida, Tokyo 194-8511 (Japan)
2007-07-01
An acridone-producing novel type III polyketide synthase from H. serrata has been overexpressed in E. coli, purified and crystallized. Diffraction data have been collected to 2.0 Å. Polyketide synthase 1 (PKS1) from Huperzia serrata is a plant-specific type III polyketide synthase that shows an unusually versatile catalytic potential, producing various aromatic tetraketides, including chalcones, benzophenones, phlorogulucinols and acridones. Recombinant H. serrata PKS1 expressed in Escherichia coli was crystallized using the hanging-drop vapour-diffusion method. The crystals belonged to space group I222 or I2{sub 1}2{sub 1}2{sub 1}, with unit-cell parameters a = 73.3, b = 85.0, c = 137.7 Å, α = β = γ = 90.0°. Diffraction data were collected to 2.0 Å resolution using synchrotron radiation at BL24XU of SPring-8.
Amaryllidaceae Alkaloids as Potential Glycogen Synthase Kinase-3β Inhibitors
Directory of Open Access Journals (Sweden)
Daniela Hulcová
2018-03-01
Full Text Available Glycogen synthase kinase-3β (GSK-3β is a multifunctional serine/threonine protein kinase that was originally identified as an enzyme involved in the control of glycogen metabolism. It plays a key role in diverse physiological processes including metabolism, the cell cycle, and gene expression by regulating a wide variety of well-known substances like glycogen synthase, tau-protein, and β-catenin. Recent studies have identified GSK-3β as a potential therapeutic target in Alzheimer´s disease, bipolar disorder, stroke, more than 15 types of cancer, and diabetes. GSK-3β is one of the most attractive targets for medicinal chemists in the discovery, design, and synthesis of new selective potent inhibitors. In the current study, twenty-eight Amaryllidaceae alkaloids of various structural types were studied for their potency to inhibit GSK-3β. Promising results have been demonstrated by alkaloids of the homolycorine-{9-O-demethylhomolycorine (IC50 = 30.00 ± 0.71 µM, masonine (IC50 = 27.81 ± 0.01 μM}, and lycorine-types {caranine (IC50 = 30.75 ± 0.04 μM}.
Biosynthesis of sucrose and mannitol as a function of leaf age in celery (Apium graveolens L. )
Energy Technology Data Exchange (ETDEWEB)
Davis, J.M.; Fellman, J.K.; Loescher, W.H.
1988-01-01
In celery (Apium graveolens L.), the two major translocated carbohydrates are sucrose and the acyclic polyol mannitol. Their metabolism, however, is different and their specific functions are uncertain. To compare their roles in carbon partitioning and sink-source transitions, developmental changes in /sup 14/CO/sub 2/ labeling, pool sizes, and key enzyme activities in leaf tissues were examined. The proportion of label in mannitol increased dramatically with leaf maturation whereas that in sucrose remained fairly constant. Mannitol content, however, was high in all leaves and sucrose content increased as leaves developed. Activities of mannose-6-P reductase, cytoplasmic and chloroplastic fructose-1,6-bis-phosphatases, sucrose phosphate synthase, and sucrose synthase increased with leaf maturation and decreased as leaves senesced. Ribulose bisphosphate carboxylase and nonreversible glyceraldehyde-3-P dehydrogenase activities rose as leaves developed but did not decrease. Thus, sucrose is produced in all photosynthetically active leaves whereas mannitol is synthesized primarily in mature leaves and stored in all leaves. Onset of sucrose export in celery may result from sucrose accumulation in expanding leaves, but mannitol export is clearly unrelated to mannitol concentration. Mannitol export, however, appears to coincide with increased mannitol biosynthesis. Although mannitol and sucrose arise from a common precursor in celery, subsequent metabolism and transport must be regulated separately.
Father's Rights to Paid Parental Leave in the Nordic Countries
DEFF Research Database (Denmark)
Rostgaard, Tine; Haas, L.
2011-01-01
to what extent government-provided, paid parental leave and quotas for fathers could bring about equality in the division of leave between men and women by focusing on the pioneers in the field, the Nordic countries – the first nations to offer fathers parental leave and introduce quotas. First, we......European Union policy encourages men and women to share parental leave to balance work and family life and promote gender equality in the labor market. A new directive extends parental leave to four months and introduces a quota, so one month is reserved for each parent. This article explores...... describe the extent to which parental leave policies have been established and implemented in a way that is likely to promote equal sharing of leave. Next, we evaluate the impact of particular configurations of gender equality incentives in present parental leave policies for the actual division of leave...
Maternity leave, women's employment, and marital incompatibility.
Hyde, J S; Essex, M J; Clark, R; Klein, M H
2001-09-01
This research investigated the relationship between the length of women's maternity leave and marital incompatibility, in the context of other variables including the woman's employment, her dissatisfaction with the division of household labor, and her sense of role overload. Length of leave, work hours, and family salience were associated with several forms of dissatisfaction, which in turn predicted role overload. Role overload predicted increased marital incompatibility for experienced mothers but did not for first-time mothers, for whom discrepancies between preferred and actual child care were more important. Length of maternity leave showed significant interactions with other variables, supporting the hypothesis that a short leave is a risk factor that, when combined with another risk factor, contributes to personal and marital distress.
DEFF Research Database (Denmark)
Munkholm, Klaus; Lenskjold, Toke; Jacoby, Anne Sophie
2016-01-01
cells were quantitated using enzyme immunometric assays. The activity of GSK-3β (serine-9-phosphorylated GSK-3β/total GSK-3β) was lower at baseline compared with follow-up. No significant mean change over time was observed in levels of total GSK-3β and serine-9-phosphorylated GSK-3β. Exploratory......Evidence indicates a role for glycogen synthase kinase-3β (GSK-3β) in the pathophysiology of mood disorders and in cognitive disturbances; however, the natural variation in GSK-3β activity over time is unknown. We aimed to investigate GSK-3β activity over time and its possible correlation...... with emotional lability, subjective mood fluctuations and cognitive function in healthy individuals. Thirty-seven healthy subjects were evaluated with neuropsychological tests and blood samples at baseline and 12-week follow-up. Total GSK-3β and serine-9-phosphorylated GSK-3β in peripheral blood mononuclear...
Edwards, Christina Hansen; Tomba, Gianpaolo Scalia; de Blasio, Birgitte Freiesleben
2016-06-01
Knowledge about influenza transmission in the workplace and whether staying home from work when experiencing influenza-like illness can reduce the spread of influenza is crucial for the design of efficient public health initiatives. This review synthesizes current literature on sickness presenteeism and influenza transmission in the workplace and provides an overview of sick leave recommendations in Europe for influenza. A search was performed on Medline, Embase, PsychINFO, Cinahl, Web of Science, Scopus and SweMed to identify studies related to workplace contacts, -transmission, -interventions and compliance with recommendations to take sick leave. A web-based survey on national recommendations and policies for sick leave during influenza was issued to 31 European countries. Twenty-two articles (9 surveys; 13 modelling articles) were eligible for this review. Results from social mixing studies suggest that 20-25% of weekly contacts are made in the workplace, while modelling studies suggest that on average 16% (range 9-33%) of influenza transmission occurs in the workplace. The effectiveness of interventions to reduce workplace presenteeism is largely unknown. Finally, estimates from studies reporting expected compliance with sick leave recommendations ranged from 71 to 95%. Overall, 18 countries participated in the survey of which nine (50%) had issued recommendations encouraging sick employees to stay at home during the 2009 A(H1N1) pandemic, while only one country had official recommendations for seasonal influenza. During the 2009 A(H1N1) pandemic, many European countries recommended ill employees to take sick leave. Further research is warranted to quantify the effect of reduced presenteeism during influenza illness. © The Author 2016. Published by Oxford University Press on behalf of the European Public Health Association.
Tomba, Gianpaolo Scalia; de Blasio, Birgitte Freiesleben
2016-01-01
Background: Knowledge about influenza transmission in the workplace and whether staying home from work when experiencing influenza-like illness can reduce the spread of influenza is crucial for the design of efficient public health initiatives. Aim: This review synthesizes current literature on sickness presenteeism and influenza transmission in the workplace and provides an overview of sick leave recommendations in Europe for influenza. Methods: A search was performed on Medline, Embase, PsychINFO, Cinahl, Web of Science, Scopus and SweMed to identify studies related to workplace contacts, -transmission, -interventions and compliance with recommendations to take sick leave. A web-based survey on national recommendations and policies for sick leave during influenza was issued to 31 European countries. Results: Twenty-two articles (9 surveys; 13 modelling articles) were eligible for this review. Results from social mixing studies suggest that 20–25% of weekly contacts are made in the workplace, while modelling studies suggest that on average 16% (range 9–33%) of influenza transmission occurs in the workplace. The effectiveness of interventions to reduce workplace presenteeism is largely unknown. Finally, estimates from studies reporting expected compliance with sick leave recommendations ranged from 71 to 95%. Overall, 18 countries participated in the survey of which nine (50%) had issued recommendations encouraging sick employees to stay at home during the 2009 A(H1N1) pandemic, while only one country had official recommendations for seasonal influenza. Conclusions: During the 2009 A(H1N1) pandemic, many European countries recommended ill employees to take sick leave. Further research is warranted to quantify the effect of reduced presenteeism during influenza illness. PMID:27060594
Microsomal prostaglandin E synthase-1 in rheumatic diseases
Directory of Open Access Journals (Sweden)
Marina eKorotkova
2011-01-01
Full Text Available Microsomal prostaglandin E synthase-1 (mPGES-1 is a well recognized target for the development of novel anti-inflammatory drugs that can reduce symptoms of inflammation in rheumatic diseases and other inflammatory conditions. In this review, we focus on mPGES-1 in rheumatic diseases with the aim to cover the most recent advances in the understanding of mPGES-1 in rheumatoid arthritis, osteoarthritis and inflammatory myopathies. Novel findings regarding regulation of mPGES1 cell expression as well as enzyme inhibitors are also summarized.
Xu, Lisheng; Wang, Zhiyuan; Mao, Pingting; Liu, Junzhong; Zhang, Hongjuan; Liu, Qian; Jiao, Qing-Cai
2013-04-01
An economical method for production of S-phenyl-L-cysteine from keratin acid hydrolysis wastewater (KHW) containing L-serine was developed by recombinant tryptophan synthase. This study provides us with an alternative KHW utilization strategy to synthesize S-phenyl-L-cysteine. Tryptophan synthase could efficiently convert L-serine contained in KHW to S-phenyl-L-cysteine at pH 9.0, 40°C and Trion X-100 of 0.02%. In a scale up study, L-serine conversion rate reach 97.1% with a final S-phenyl-L-cysteine concentration of 38.6 g l(-1). Copyright © 2013 Elsevier Ltd. All rights reserved.
Molecular characterization of two alkylresorcylic acid synthases from Sordariomycetes fungi
DEFF Research Database (Denmark)
Ramakrishnan, Dhivya; Tiwari, Manish Kumar; Manoharan, Gomathi
2018-01-01
Two putative type III polyketide synthase genes (PKS) were identified from Sordariomycetes fungi. These two type III PKS genes from Sordaria macrospora (SmPKS) and Chaetomium thermophilum (CtPKS), shared 59.8% sequence identity. Both, full-length and truncated versions of type III PKSs were...
Roberts, Andy V
2007-12-01
"Bead beating" is commonly used to release DNA from cells for genomic studies but it was used here to prepare suspensions of plant nuclei for measurement of DNA amounts by flow cytometry. Plant material was placed in 2-ml screw-capped tubes containing beads of zirconia/silica (2.5 mm diameter) or glass (2.5 or 1.0 mm diameter) and 1 ml of lysis buffer. The tubes were mechanically shaken with an FP120 FastPrep Cell Disrupter to release intact nuclei from plant tissue by the impact of the beads. The nuclei were then stained with propidium iodide (PI) and analyzed by flow cytometry. The method was tested using fresh leaves, fresh petals and herbarium leaves of Rosa canina, leaves and pollen of R. rugosa, and fresh leaves of Petroselinum crispum, Nicotiana tabacum, and Allium cepa. Batches of 12 samples of fresh leaves were prepared, simultaneously, in 45 s by bead beating in the Cell Disrupter. In flow cytometry histograms, nuclei of fresh leaves gave G(1)/G(0) peaks with CVs of less than 3.0% and nuclei from fresh petals and herbarium leaves of R. canina, and pollen of the generative nuclei of R. rugosa gave peaks with coefficients of variation (CVs) of less than 4.0%. DNA amounts estimated from 24-month-old herbarium leaves, using P. crispum as an internal standard, were less than those of fresh leaves by a small but significant amount. Suspensions of nuclei can be prepared rapidly and conveniently from a diversity of tissues by bead beating. Exposure of laboratory workers to harmful substances in the lysis buffer is minimized. (c) 2007 International Society for Analytical Cytology
A MODELING METHOD OF FLUTTERING LEAVES BASED ON POINT CLOUD
J. Tang; Y. Wang; Y. Zhao; Y. Zhao; W. Hao; X. Ning; K. Lv; Z. Shi; M. Zhao
2017-01-01
Leaves falling gently or fluttering are common phenomenon in nature scenes. The authenticity of leaves falling plays an important part in the dynamic modeling of natural scenes. The leaves falling model has a widely applications in the field of animation and virtual reality. We propose a novel modeling method of fluttering leaves based on point cloud in this paper. According to the shape, the weight of leaves and the wind speed, three basic trajectories of leaves falling are defined, which ar...
Growth of Cucurbita maxima L. plants in the presence of the cycloartenol synthase inhibitor U18666A.
Fenner, G P; Raphiou, I
1995-03-01
Squash, like other Cucurbitaceae, have unique sterol profiles that offer an excellent opportunity to examine the relationship between sterol biosynthesis and plant growth. To determine the effect of sterol biosynthesis inhibition on squash growth, Cucurbita maxima seedlings with and without cotyledons were subjected to increasing concentrations of the cycloarternol synthase (EC 5.4.99.8) inhibitor 3 beta-(2-diethylaminoethoxy)androstenone (U18666A). Inhibition of shoot growth was concentration-dependent (from 0, 2, 5, 10, and 20 microM); plants with intact cotyledons grew to 26.4, 23.7, 21.6, 20.0, and 15.6 cm, respectively, at the above inhibitor concentrations, compared to 25.5, 19.4, 17.0, 12.0, and 11 cm for plants with severed cotyledons. In plants with severed cotyledons, 10 and 20 microM U18666A caused rapid necrosis of the first two, newly emerged, primary leaves, and halted new leaf formation. Secondary root formation was initially affected at all inhibitor concentrations regardless of whether cotyledons were present or not. Vegetative tissue showed a decrease in the accumulation of the major squash sterol, 7,22-stigmastadienol, accompanied by increased accumulation of minor sterol components. Sterol profiles in cotyledons were unaltered. The data show that sterols are crucial for maintaining plant growth and viability, but do not address the cotyledonary effect on growth with respect to sterol biosynthesis.
Konference Fathers and Paternity Leave: Men Do It
Czech Academy of Sciences Publication Activity Database
Maříková, Hana
2006-01-01
Roč. 42, č. 14 (2006), s. 833-835 ISSN 0038-0288. [Fathers and Paternity Leave: Men Do It] R&D Projects: GA AV ČR IAA700280504 Institutional research plan: CEZ:AV0Z70280505 Keywords : parental leave * paternity leave * fathering Subject RIV: AO - Sociology, Demography Impact factor: 0.128, year: 2006
Prosser, Ian; Altug, Iris G; Phillips, Andy L; König, Wilfried A; Bouwmeester, Harro J; Beale, Michael H
2004-12-15
The naturally occurring, volatile sesquiterpene hydrocarbon germacrene D has strong effects on insect behaviour and genes encoding enzymes that produce this compound are of interest in the study of plant-insect interactions and in a number of biotechnological approaches to pest control. Goldenrod, Solidago canadensis, is unusual in that it produces both enantiomers of germacrene D. Two new sesquiterpene synthase cDNAs, designated Sc11 and Sc19, have been isolated from goldenrod and functional expression in Escherichia coli identified Sc11 as (+)-germacrene D synthase and Sc19 as (-)-germacrene D synthase. Thus, the enantiomers of germacrene D are the products of separate, but closely related (85% amino-acid identity), enzymes. Unlike other sesquiterpene synthases and the related monoterpene synthases and prenyl transferases, which contain the characteristic amino-acid motif DDXX(D,E), Sc11 is unusual in that this motif occurs as (303)NDTYD. Mutagenesis of this motif to (303)DDTYD gave rise to an enzyme that fully retained (+)-germacrene D synthase activity. The converse mutation in Sc19 (D303N) resulted in a less efficient but functional enzyme. Mutagenesis of position 303 to glutamate in both enzymes resulted in loss of activity. These results indicate that the magnesium ion-binding role of the first aspartate in the DDXXD motif may not be as critical as previously thought. Further amino-acid sequence comparisons and molecular modelling of the enzyme structures revealed that very subtle changes to the active site of this family of enzymes are required to alter the reaction pathway to form, in this case, different enantiomers from the same enzyme-bound carbocationic intermediate.
Use of linalool synthase in genetic engineering of scent production
Pichersky, Eran
1998-01-01
A purified S-linalool synthase polypeptide from Clarkia breweri is disclosed as is the recombinant polypeptide and nucleic acid sequences encoding the polypeptide. Also disclosed are antibodies immunoreactive with the purified peptide and with recombinant versions of the polypeptide. Methods of using the nucleic acid sequences, as well as methods of enhancing the smell and the flavor of plants expressing the nucleic acid sequences are also disclosed.
The reduced genomes of Parcubacteria (OD1) contain signatures of a symbiotic lifestyle
Energy Technology Data Exchange (ETDEWEB)
Nelson, William C.; Stegen, James C.
2015-07-21
Candidate phylum OD1 bacteria (also referred to as Parcubacteria) have been identified in broad range of anoxic environments through community survey analysis. Although none of these species have been isolated in the laboratory, several genome sequences have been reconstructed from metagenomic sequence data and single-cell sequencing. The organisms have small (generally <1 Mb) genomes with severely reduced metabolic capabilities. We have reconstructed 8 partial to near-complete OD1 genomes from oxic groundwater samples, and compared them against existing genomic data. The conserved core gene set comprises 202 genes, or ~28% of the genomic complement. ‘Housekeeping’ genes and genes for biosynthesis of peptidoglycan and Type IV pilus production are conserved. Gene sets for biosynthesis of cofactors, amino acids, nucleotides and fatty acids are absent entirely or greatly reduced. The only aspects of energy metabolism conserved are the non-oxidative branch of the pentose-phosphate shunt and central glycolysis. These organisms also lack some activities conserved in almost all other known bacterial genomes, including signal recognition particle, pseudouridine synthase A, and FAD synthase. Pan-genome analysis indicates a broad genotypic diversity and perhaps a highly fluid gene complement, indicating historical adaptation to a wide range of growth environments and a high degree of specialization. The genomes were examined for signatures suggesting either a free-living, streamlined lifestyle or a symbiotic lifestyle. The lack of biosynthetic capabilities and DNA repair, along with the presence of potential attachment and adhesion proteins suggest the Parcubacteria are ectosymbionts or parasites of other organisms. The wide diversity of genes that potentially mediate cell-cell contact suggests a broad range of partner/prey organisms across the phylum.
Liu, Yi; Shi, Zi; Maximova, Siela; Payne, Mark J; Guiltinan, Mark J
2013-12-05
The proanthocyanidins (PAs), a subgroup of flavonoids, accumulate to levels of approximately 10% total dry weight of cacao seeds. PAs have been associated with human health benefits and also play important roles in pest and disease defense throughout the plant. To dissect the genetic basis of PA biosynthetic pathway in cacao (Theobroma cacao), we have isolated three genes encoding key PA synthesis enzymes, anthocyanidin synthase (ANS), anthocyanidin reductase (ANR) and leucoanthocyanidin reductase (LAR). We measured the expression levels of TcANR, TcANS and TcLAR and PA content in cacao leaves, flowers, pod exocarp and seeds. In all tissues examined, all three genes were abundantly expressed and well correlated with PA accumulation levels, suggesting their active roles in PA synthesis. Overexpression of TcANR in an Arabidopsis ban mutant complemented the PA deficient phenotype in seeds and resulted in reduced anthocyanidin levels in hypocotyls. Overexpression of TcANS in tobacco resulted in increased content of both anthocyanidins and PAs in flower petals. Overexpression of TcANS in an Arabidopsis ldox mutant complemented its PA deficient phenotype in seeds. Recombinant TcLAR protein converted leucoanthocyanidin to catechin in vitro. Transgenic tobacco overexpressing TcLAR had decreased amounts of anthocyanidins and increased PAs. Overexpressing TcLAR in Arabidopsis ldox mutant also resulted in elevated synthesis of not only catechin but also epicatechin. Our results confirm the in vivo function of cacao ANS and ANR predicted based on sequence homology to previously characterized enzymes from other species. In addition, our results provide a clear functional analysis of a LAR gene in vivo.
29 CFR 825.100 - The Family and Medical Leave Act.
2010-07-01
... 29 Labor 3 2010-07-01 2010-07-01 false The Family and Medical Leave Act. 825.100 Section 825.100... THE FAMILY AND MEDICAL LEAVE ACT OF 1993 Coverage Under the Family and Medical Leave Act § 825.100 The Family and Medical Leave Act. (a) The Family and Medical Leave Act of 1993, as amended, (FMLA or Act...
DEFF Research Database (Denmark)
Maile, C A; Hingst, Janne Rasmuss; Mahalingan, K K
2017-01-01
BACKGROUND: Equine type 1 polysaccharide storage myopathy (PSSM1) is associated with a missense mutation (R309H) in the glycogen synthase (GYS1) gene, enhanced glycogen synthase (GS) activity and excessive glycogen and amylopectate inclusions in muscle. METHODS: Equine muscle biochemical...... had significantly higher glycogen content than control horse muscle despite no difference in GS expression. GS activity was significantly higher in muscle from homozygous mutants than from heterozygote and control horses, in the absence and presence of the allosteric regulator, glucose 6 phosphate (G6...
International Nuclear Information System (INIS)
Atkinson, Sarah C.; Dogovski, Con; Dobson, Renwick C. J.; Perugini, Matthew A.
2012-01-01
Dihydrodipicolinate synthase from the plant pathogen A. tumefaciens has been cloned, expressed, purified and crystallized in its unliganded form, in the presence of its substrate pyruvate and in the presence of pyruvate and the allosteric inhibitor lysine. Diffraction data for the crystals were collected to a maximum resolution of 1.40 Å. Dihydrodipicolinate synthase (DHDPS) catalyzes the first committed step of the lysine-biosynthesis pathway in bacteria, plants and some fungi. This study describes the cloning, expression, purification and crystallization of DHDPS (NP-354047.1) from the plant pathogen Agrobacterium tumefaciens (AgT-DHDPS). Enzyme-kinetics studies demonstrate that AgT-DHDPS possesses DHDPS activity in vitro. Crystals of AgT-DHDPS were grown in the unliganded form and in forms with substrate bound and with substrate plus allosteric inhibitor (lysine) bound. X-ray diffraction data sets were subsequently collected to a maximum resolution of 1.40 Å. Determination of the structure with and without substrate and inhibitor will offer insight into the design of novel pesticide agents
Functional and Structural Characterization of a (+)-Limonene Synthase from Citrus sinensis.
Morehouse, Benjamin R; Kumar, Ramasamy P; Matos, Jason O; Olsen, Sarah Naomi; Entova, Sonya; Oprian, Daniel D
2017-03-28
Terpenes make up the largest and most diverse class of natural compounds and have important commercial and medical applications. Limonene is a cyclic monoterpene (C 10 ) present in nature as two enantiomers, (+) and (-), which are produced by different enzymes. The mechanism of production of the (-)-enantiomer has been studied in great detail, but to understand how enantiomeric selectivity is achieved in this class of enzymes, it is important to develop a thorough biochemical description of enzymes that generate (+)-limonene, as well. Here we report the first cloning and biochemical characterization of a (+)-limonene synthase from navel orange (Citrus sinensis). The enzyme obeys classical Michaelis-Menten kinetics and produces exclusively the (+)-enantiomer. We have determined the crystal structure of the apoprotein in an "open" conformation at 2.3 Å resolution. Comparison with the structure of (-)-limonene synthase (Mentha spicata), which is representative of a fully closed conformation (Protein Data Bank entry 2ONG ), reveals that the short H-α1 helix moves nearly 5 Å inward upon substrate binding, and a conserved Tyr flips to point its hydroxyl group into the active site.
Characterization of untreated and treated male and female date palm leaves
International Nuclear Information System (INIS)
AlMaadeed, M.A.; Kahraman, Ramazan; Noorunnisa Khanam, P.; Al-Maadeed, Somaya
2013-01-01
Highlights: ► Sheshi female and male date palm leaves were treated with NaOH concentrations. ► Male leaves have lower mechanical properties and improved when treated by NaOH 2%. ► Female leaves have higher thermal stability. ► There are different properties for different types of date leaves. ► Leaves can be used as reinforcements for thermoplastic materials. -- Abstract: This paper describes the characterization of male and female date palm leaves from two different cultivars, Sheshi female and unknown male leaves. Characterization was done for both untreated and NaOH treated date palm leaves by infrared spectroscopy, thermogravimetric analysis and scanning electron microscopic techniques. To our knowledge, the difference in specious reaction to the treatment type of date palm fiber has not been investigated earlier. These leaves were treated with different concentrations of NaOH, 0.5%, 1%, 2% and 5% (w/w). The results from this investigation indicate that female leaves have better tensile properties which deteriorate with the increase of the alkali. The male leaves have lower tensile properties than female leaves and their mechanical properties are improved slightly by NaOH treatment. Female leaves have more pores than male leaves, this was proved and calculated by image analysis. Untreated female leaves have higher thermal stability (353 °C) than male leaves (343 °C). Both can be used as reinforcements in thermoplastic matrix materials whose processing temperatures are below 300 °C.
de Kroon, Marlou L A; Bulthuis, Jozien; Mulder, Wico; Schaafsma, Frederieke G; Anema, Johannes R
2016-12-01
Since the extent of sick leave and the problems of vocational school students are relatively large, we aimed to tailor a sick leave protocol at Dutch lower secondary education schools to the particular context of vocational schools. Four steps of the iterative process of Intervention Mapping (IM) to adapt this protocol were carried out: (1) performing a needs assessment and defining a program objective, (2) determining the performance and change objectives, (3) identifying theory-based methods and practical strategies and (4) developing a program plan. Interviews with students using structured questionnaires, in-depth interviews with relevant stakeholders, a literature research and, finally, a pilot implementation were carried out. A sick leave protocol was developed that was feasible and acceptable for all stakeholders. The main barriers for widespread implementation are time constraints in both monitoring and acting upon sick leave by school and youth health care. The iterative process of IM has shown its merits in the adaptation of the manual 'A quick return to school is much better' to a sick leave protocol for vocational school students.
Antioxidant activity of Arbutus unedo leaves.
Pabuçcuoğlu, A; Kivçak, B; Baş, M; Mert, T
2003-09-01
The ethanol and methanol extracts of Arbutus unedo leaves were screened for antioxidant activity. The antioxidant activity was determined by an improved assay based on the decolorization of the radical monocation of [2,2'-azinobis-(3-ethylbenzothiazoline-6-sulfonic acid)] (ABTS). The ethanol and methanol extract of A. unedo leaves displayed potent antioxidant activity.
Directory of Open Access Journals (Sweden)
Xiang Zhou
2014-07-01
Full Text Available A set of bisphosphonate ethers has been prepared through sequential phosphonylation and alkylation of monophosphonate ethers. After formation of the corresponding phosphonic acid salts, these compounds were tested for their ability to inhibit the enzyme geranylgeranyl diphosphate synthase (GGDPS. Five of the new compounds show IC50 values of less than 1 μM against GGDPS with little to no activity against the related enzyme farnesyl diphosphate synthase (FDPS. The most active compound displayed an IC50 value of 82 nM when assayed with GGDPS, and no activity against FDPS even at a 10 μM concentration.
Maternity leave policies in academic and private radiology practices
International Nuclear Information System (INIS)
Spirt, B.A.; Rauth, V.; Price, A.P.F.; Pagani, A.H.
1988-01-01
In 1987, the American Association of Women Radiologists surveyed both academic and private radiology departments regarding pregnancy and maternity leave policies. One hundred academic institutions (70% response), 30 radiotherapy departments (38% response), and 31 private practices responded. Details were obtained regarding maternity leave policy for residents and attending physicians; availability of paternity leave; policies regarding on-call time, fluoroscopy time and intracavitary/interstitial applications during pregnancy; and problems that occurred during resident or attending physician pregnancies. There was a wide range of responses regarding paid leave time, availability of additional time, and the use of vacation time during maternity leave
Child-Care in Norway: Use of Parental Leave by Fathers
Naz, Ghazala
2011-01-01
An important feature of parental leave in Norway is that it allows significant sharing of leave between parents. Parents may take 54 weeks of leave and receive 80 per cent of previous earnings or 44 weeks of leave with 100 per cent of earnings, up to a ceiling amount. Nine weeks of total leave are, however, reserved for the mother and six weeks for the father and, as a general rule, these weeks cannot be transferred to the other parent. The remaining parental leave can be shared between paren...
DEFF Research Database (Denmark)
Hove-Jensen, Bjarne; McGuire, James N
2004-01-01
The amino acid sequence of 5-phospho-alpha-D-ribosyl 1-diphosphate synthase from the thermophile Bacillus caldolyticus is 81% identical to the amino acid sequence of 5-phospho-alpha-D-ribosyl 1-diphosphate synthase from the mesophile Bacillus subtilis. Nevertheless the enzyme from the two organisms...... possesses very different thermal properties. The B. caldolyticus enzyme has optimal activity at 60-65 degrees C and a half-life of 26 min at 65 degrees C, compared to values of 46 degrees C and 60 s at 65 degrees C, respectively, for the B. subtilis enzyme. Chemical cross-linking shows that both enzymes...... are hexamers. Vmax is determined as 440 micromol.min(-1).mg protein(-1) and Km values for ATP and ribose 5-phosphate are determined as 310 and 530 microM, respectively, for the B. caldolyticus enzyme. The enzyme requires 50 mM Pi as well as free Mg2+ for maximal activity. Manganese ion substitutes for Mg2...
Labour Supply Responses to Paid Parental Leave
Karimi, Arizo; Lindahl, Erica; Skogman Thoursie, Peter
2012-01-01
Women account for the majority of parental leave take-up, which is likely one of the major reasons for the gender gap in income and wages. Consequently, many countries exert effort to promote a more gender equal division of parental leave. Indeed, the last decades have seen an increase in fathers' take-up of parental leave benefits, but the gender earnings gap has remained fairly constant. In this paper we re-evaluate the labour supply responses of both mothers and fathers to three major refo...