WorldWideScience

Sample records for ps-on sld neurons

  1. B physics at SLD

    International Nuclear Information System (INIS)

    Willocq, S.

    1997-06-01

    The authors review recent B physics results obtained in polarized e + e - interactions at the SLC by the SLD experiment. The excellent 3-D vertexing capabilities of SLD are exploited to extract precise B + and B d 0 lifetimes, as well as measurements of the time evolution of B d 0 - (anti B d 0 ) mixing

  2. Overview of the SLD

    International Nuclear Information System (INIS)

    Breidenbach, M.

    1985-10-01

    The SLD is a second generation detector for the SLAC Linear Collider (SLC). It is optimized for Z 0 physics and exploration of new physics in the Z 0 energy region. The SLD will have a CCD vertex detector, high resolution drift chambers for momentum measurement, a Cerenkov Ring Imaging Detector for particle identification, and calorimetry based on lead/liquid argon followed by an iron/gas system. The detector covers the full solid angle. 13 refs., 7 figs

  3. SLD liquid argon calorimeter

    International Nuclear Information System (INIS)

    Vella, E.

    1992-10-01

    The liquid argon calorimeter (LAC) of the SLD detector is a parallel plate -- liquid argon sampling calorimeter, used to measure particle energies in Z 0 decays at the Stanford Linear Collider. The LAC module design is based on a unique projective tower structure, in which lead plates and segmented lead tiles serve both as absorbers and electrodes. The LAC front end electronics incorporates several novel features, including extensive multiplexing and optical fiber readout, which take advantage of the low SLC beam crossing frequency. The operational performance of the LAC during the recently completed SLD physics run (which recorded over 10,000 Z 0 events) is discussed

  4. QCD at SLD

    Energy Technology Data Exchange (ETDEWEB)

    Plano, R. [Rutgers Univ., New Brunswick, NJ (United States)

    1997-01-01

    This talk reviews seven SLD papers, which provide useful, unique, and precise contributions to our understanding of hadron production in the decay of Z{sup 0} produced in e{sup +}e{sup -} collisions. The data were gathered by the SLAC Large Detector (SLD) at the SLAC Linear Collider (SLC). This accelerator/detector is able to systematic advantages including a tiny and stable interaction region combined with a precise high-resolution vertex detector, excellent particle identification, and a high-resolution vertex detector, excellent particle identification, and a highly polarized electron beam. The papers include studies of: (1) factorial and cumulant moments, (2) charged multiplicities produced by b, c, and uds quarks, (3) rapidity gaps, orientations and energy partitions of three-jet events, (4) jet handedness, (5) triple-product correlation in polarized Z{sup 0} decays to three jets, and {pi}{sup {+-}}, K{sup {+-}}, p, K{sup 0}, and {Lambda} production in Z{sup 0} decays. Comparisons are made to LEP results where appropriate.

  5. SLD physics studies: Proceedings of the SLD physics week

    International Nuclear Information System (INIS)

    1989-10-01

    This report contains papers on the following topics relating to SLD physics: electroweak parameter and QCD tests; heavy quark spectroscopy; B bar B mixing and CP violations; search for supersymmetry; search for technicolor; and search for new quarks, leptons and Z's

  6. Dicty_cDB: SLD492 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available SL (Link to library) SLD492 (Link to dictyBase) - - - Contig-U11049-1 SLD492P (Link to Original site) SLD492...F 347 SLD492Z 454 SLD492P 801 - - Show SLD492 Library SL (Link to library) Clone ID SLD492... URL http://dictycdb.biol.tsukuba.ac.jp/CSM/SL/SLD4-D/SLD492Q.Seq.d/ Representative seq. ID SLD492...P (Link to Original site) Representative DNA sequence >SLD492 (SLD492Q) /CSM/SL/SLD4-D/SLD492...nces producing significant alignments: (bits) Value SLD492 (SLD492Q) /CSM/SL/SLD4-D/SLD492

  7. Localization of the brainstem GABAergic neurons controlling paradoxical (REM sleep.

    Directory of Open Access Journals (Sweden)

    Emilie Sapin

    Full Text Available Paradoxical sleep (PS is a state characterized by cortical activation, rapid eye movements and muscle atonia. Fifty years after its discovery, the neuronal network responsible for the genesis of PS has been only partially identified. We recently proposed that GABAergic neurons would have a pivotal role in that network. To localize these GABAergic neurons, we combined immunohistochemical detection of Fos with non-radioactive in situ hybridization of GAD67 mRNA (GABA synthesis enzyme in control rats, rats deprived of PS for 72 h and rats allowed to recover after such deprivation. Here we show that GABAergic neurons gating PS (PS-off neurons are principally located in the ventrolateral periaqueductal gray (vlPAG and the dorsal part of the deep mesencephalic reticular nucleus immediately ventral to it (dDpMe. Furthermore, iontophoretic application of muscimol for 20 min in this area in head-restrained rats induced a strong and significant increase in PS quantities compared to saline. In addition, we found a large number of GABAergic PS-on neurons in the vlPAG/dDPMe region and the medullary reticular nuclei known to generate muscle atonia during PS. Finally, we showed that PS-on neurons triggering PS localized in the SLD are not GABAergic. Altogether, our results indicate that multiple populations of PS-on GABAergic neurons are distributed in the brainstem while only one population of PS-off GABAergic neurons localized in the vlPAG/dDpMe region exist. From these results, we propose a revised model for PS control in which GABAergic PS-on and PS-off neurons localized in the vlPAG/dDPMe region play leading roles.

  8. Data acquisition system for SLD

    International Nuclear Information System (INIS)

    Sherden, D.J.

    1985-05-01

    This paper describes the data acquisition system planned for the SLD detector which is being constructed for use with the SLAC Linear Collider (SLC). An exclusively FASTBUS front-end system is used together with a VAX-based host system. While the volume of data transferred does not challenge the band-width capabilities of FASTBUS, extensive use is made of the parallel processing capabilities allowed by FASTBUS to reduce the data to a size which can be handled by the host system. The low repetition rate of the SLC allows a relatively simple software-based trigger. The principal components and overall architecture of the hardware and software are described

  9. Heavy quark physics from SLD

    Energy Technology Data Exchange (ETDEWEB)

    Messner, R. [Stanford Univ., CA (United States)

    1997-01-01

    This report covers preliminary measurements from SLD on heavy quark production at the Z{sup 0}, using 150,000 hadronic Z{sup 0} decays accumulated during the 1993-1995 runs. A measurement of R{sub b} with a lifetime double tag is presented. The high electron beam polarization of the SLC is employed in the direct measurement of the parity-violating parameters A{sub b} and A{sub c} by use of the left-right forward-backward asymmetry. The lifetimes of B{sup +} and B{sup 0} mesons have been measured by two analyses. The first identifies semileptonic decays of B mesons with high (p,p{sub t}) leptons; the second analysis isolates a sample of B meson decays with a two-dimensional impact parameter tag and reconstructs the decay length and charge using a topological vertex reconstruction method.

  10. Heavy quark physics from SLD

    International Nuclear Information System (INIS)

    Messner, R.

    1997-01-01

    This report covers preliminary measurements from SLD on heavy quark production at the Z 0 , using 150,000 hadronic Z 0 decays accumulated during the 1993-1995 runs. A measurement of R b with a lifetime double tag is presented. The high electron beam polarization of the SLC is employed in the direct measurement of the parity-violating parameters A b and A c by use of the left-right forward-backward asymmetry. The lifetimes of B + and B 0 mesons have been measured by two analyses. The first identifies semileptonic decays of B mesons with high (p,p t ) leptons; the second analysis isolates a sample of B meson decays with a two-dimensional impact parameter tag and reconstructs the decay length and charge using a topological vertex reconstruction method

  11. Recent QCD Results from SLD

    International Nuclear Information System (INIS)

    Muller, David

    1999-01-01

    We present selected results on strong interaction physics from the SLD experiment at the SLAC Linear Collider. We report on several new studies of 3- and 4-jet hadronic Z 0 decays, in which jets are identified as quark, antiquark or gluon. The 3-jet Z 0 --> b anti-bg rate is sensitive to the b-quark mass; prospects for measuring m b are discussed. The gluon energy spectrum is measured over the full kinematic range, providing an improved test of QCD and limits on anomalous b anti-bg couplings. The parity violation in Z 0 --> b anti-bg decays is consistent with electroweak theory plus QCD. New tests of T- and CP-conservation at the bbg vertex are performed. A new measurement of the rate of gluon splitting into b anti-b pairs yields g b anti-b = 0.0031 ± 0.0007 (stat.)± 0.0006 (syst.) (Preliminary). We also present a number of new results on jet fragmentation into identified hadrons. The B hadron energy spectrum is measured over the full kinematic range using a new, inclusive technique, allowing stringent tests of predictions for its shape and a precise measurement of (xB) = 0.714 ± 0.005(stat.) ± 0.007(syst.) (Preliminary). A detailed study of correlations in rapidity y between pairs of identified pi ± , K ± and p/anti-p confirms that strangeness and baryon number are conserved locally, and shows local charge conservation between meson-baryon and strange-nonstrange pairs. Flavor-dependent long-range correlations are observed for all combinations of these hadron species, yielding new information on leading particle production. The first study of correlations using rapidities signed such that y > 0 corresponds to the quark direction provides additional new insights into fragmentation, including the first direct observation of baryon number ordering along the q anti-q axis

  12. Physics at the Z pole with SLD

    International Nuclear Information System (INIS)

    Willocq, S.

    1997-06-01

    The authors review recent results from a wide physics program in polarized e + e - interactions at the SLC performed by the SLD experiment. Unique and precise measurements of the electroweak parameters A e , A b , A c , and R b provide valuable constraints on the Standard Model. The excellent 3-D vertexing capabilities of SLD are further exploited to extract precise B + and B d 0 lifetimes, as well as measurements of the time evolution of B d 0 - (anti B d 0 ) mixing. Finally, the unique capabilities of the SLC/SLD are used to test QCD in new ways. The authors present results on general properties of particle production in light, c, and b quark events, as well as the first observation of leading particle production in light-quark hemispheres

  13. First results from the SLD silicon calorimeters

    International Nuclear Information System (INIS)

    Berridge, S.C.; Bugg, W.M.; Kroeger, R.S.; Weidemann, A.W.; White, S.L.

    1992-07-01

    The small-angle calorimeters of the SLD were successfully operated during the recent SLC engineering run. The Luminosity Monitor and Small-Angle Tagger (LMSAT) covers the angular region between 28 and 68 milliradians from the beam axis, while the Medium-Angle Silicon Calorimeter (MASC) covers the 68--190 milliradian region. Both are silicon-tungsten sampling calorimeters; the LMSAT employs 23 layers of 0.86 X 0 sampling, while the MASC has 10 layers of 1.74 X 0 sampling. We present results from the first run of the SLC with the SLD on beamline

  14. Physics with polarization at the SLD

    International Nuclear Information System (INIS)

    Burrows, P.N.

    1990-05-01

    The SLD detector is nearing completion and will start physics-quality data-taking at the SLC in 1991 with a longitudinally polarized electron beam and unpolarized positron beam. The current status of the detector is reviewed and the rich program of physics measurements possible with polarization and the SLD detector is briefly presented. In particular, the left-right polarization asymmetry, A LR , will be a unique measurement for the next few years and will allow tight bounds to be set upon the mass of the top quark. 14 refs., 1 fig

  15. Heavy Flavor Fragmentation and Decay at SLD

    Energy Technology Data Exchange (ETDEWEB)

    Plano, Richard M

    1999-02-24

    Results on heavy quark fragmentation obtained using the SLD detector at the SLAC Linear Collider are presented. This talk will cover the ratio of vector to pseudoscalar charmed meson production, the inclusive B hadron energy distribution, the inclusive particle production in heavy jets compared to their production in light jets, and charged and neutral B meson lifetimes.

  16. SLD liquid argon calorimeter prototype test results

    International Nuclear Information System (INIS)

    Dubois, R.; Eigen, G.; Au, Y.

    1985-10-01

    The results of the SLD test beam program for the selection of a calorimeter radiator composition within a liquid argon system are described, with emphasis on the study of the use of uranium to obtain equalization of pion and electron responses

  17. Dicty_cDB: SLD420 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available SL (Link to library) SLD420 (Link to dictyBase) - - - Contig-U16325-1 SLD420E (Link... to Original site) - - - - - - SLD420E 434 Show SLD420 Library SL (Link to library) Clone ID SLD420 (Link to dict...yBase) Atlas ID - NBRP ID - dictyBase ID - Link to Contig Contig-U16325-1 Original site URL http://dict... 7 Homology vs DNA Score E Sequences producing significant alignments: (bits) Value N ( AF066071 ) Dict...yostelium discoideum SP85 (pspB) gene, comple... 860 0.0 1 ( AC117075 ) Dictyostelium

  18. The data acquisition system for SLD

    International Nuclear Information System (INIS)

    Sherden, D.J.

    1986-10-01

    This paper describes the data acquisition system planned for the SLD detector, which is being constructed for use with the SLAC Linear Collider (SLC). Analog electronics, heavily incorporating hybrid and custom VLSI circuitry, is mounted on the detector itself. Extensive use is made of multiplexing through optical fibers to a FASTBUS readout system. The low repetition rate of the SLC allows a relatively simple software-based trigger. Hardware and software processors within the acquisition modules are used to reduce the large volume of data per event and to calibrate the electronics. A farm of microprocessors is used for full reconstruction of a sample of events prior to transmission to the host

  19. Early radiological diagnostics for scapholunate dissociation (SLD); Radiologische Fruehdiagnostik der skapholunaeren Dissoziation (SLD)

    Energy Technology Data Exchange (ETDEWEB)

    Schmitt, R.; Froehner, S.; Fodor, S.; Christopoulos, G. [Herz- und Gefaessklinik GmbH, Institut fuer Diagnostische und Interventionelle Radiologie, Bad Neustadt an der Saale (Germany); Kalb, K.H. [Herz- und Gefaessklinik GmbH, Bad Neustadt an der Saale (Germany). Klinik fuer Handchirurgie

    2006-08-15

    The partial tear of the scapholunate ligament (pre-dynamic stage of SLD) as well as the complete tear (dynamic stage) does not lead to carpal malalignment. However, if the completely ruptured ligament is accompanied by lesions of the extrinsic ligaments, both the scaphoid and the lunate are malaligned already at rest (static stage of SLD). Later, osteoarthritis will develop, beginning in the radioscaphoid compartment, progressing to the midcarpal joint, and ending in a carpal collapse (osteoarthrotic stage of SLD). Dynamic SLD is detectable only in stress views and in cinematography. The high utility of MRI for directly visualizing the injured ligament is emphasized: reparation tissue is focally enhanced at the rupture site by intravenously applied contrast agent; the individual segments of the scapholunate ligament can be visualized in direct MR arthrography, therefore allowing differentiation of partial and complete ligamentous tears. (orig.) [German] Die Teilruptur des Lig. scapholunatum (praedynamisches Stadium) und die isolierte Komplettruptur (dynamisches Stadium) fuehren zu keiner karpalen Gefuegestoerung in Ruhe. Erst wenn die Komplettruptur von Laesionen der extrinsischen Bandstabilisatoren begleitet wird, stehen das Skaphoid und Lunatum bereits in Ruhe in Fehlstellung (statisches Stadium). Spaeter kommt es zur Handgelenkarthrose, zuerst radioskaphoidal, dann mediokarpal mit Ausbildung eines karpalen Kollapses (arthrotisches Stadium). Die dynamische Instabilitaet ist nur mit Stressaufnahmen und kinematographisch nachweisbar. Die MRT vermag das rupturierte Lig. scapholunatum direkt darzustellen: Intravenoes verabreichtes Kontrastmittel reichert sich fokal am Reparationsgewebe der Rupturstelle an; mit der direkten MR-Arthrogaphie koennen die Bandsegmente besser abgegrenzt und Partial- von Komplettrupturen unterschieden werden. (orig.)

  20. Status of ALR measurement at SLD

    International Nuclear Information System (INIS)

    Ash, W.W.

    1993-11-01

    The SLD Collaboration is making a precision measurement of the left-right asymmetry (A LR ) at the SLAC Linear Collider, exploiting the significantly improved luminosity and the high electron-beam polarization of over 60%. General features of the polarized source and polarimetry are described. The experimental method is briefly presented, together with the preliminary values of the raw asymmetry, which should lead to a precision in the measurement of sin 2 θ W eff of ±0.0008 ± 0.0005. The collaboration is preparing a proposal for an extended run for one million Z o s with improved polarimetry to reach an ultimate level of δ sin 2 θ W eff = ±0.00025

  1. B/sub s/ mixing at SLD

    CERN Document Server

    Usher, T

    2001-01-01

    A preliminary 95% C.L. exclusion on the oscillation frequency of B/sub s//sup 0/-B/sub s//sup 0/ mixing is presented by combining three analyses of a sample of 400,000 hadronic Z/sup 0/ decays collected by the SLD experiment at the SLC between 1996 and 1998. All three analyses exploit the large forward-backward asymmetry of polarized Z /sup 0/ to bbdecays, as well as information from the hemisphere opposite that of the reconstructed B decay, to determine the b-hadron flavor at production. The three analyses differ in their reconstruction of the proper time and flavor of the b-hadron at decay. The first analysis performs a full reconstruction of a cascade D/sub s / meson and a partial reconstruction of the b-hadron. In the second analysis, semileptonic decays are selected and the B decay point is reconstructed by vertexing a lepton with a partially reconstructed cascade D meson. The third analysis reconstructs B decay vertices inclusively using a topological technique, with separation between B /sub s//sup 0/ ...

  2. QCD tests with SLD and polarized beams

    Energy Technology Data Exchange (ETDEWEB)

    Strauss, M.G. [Univ. of Massachusetts, Amherst, MA (United States)

    1994-12-01

    The author presents a measurement of the strong coupling {alpha}{sub s} derived from multijet rates using data collected by the SLD experiment at SLAC and find that {alpha}{sub s}(M{sub Z}{sup 2}) = 0.118 {+-} 0.002(stat.) {+-} 0.003(syst.) {+-} 0.010(theory). He presents tests of the flavor independence of strong interactions via preliminary measurements of the ratios {alpha}{sub s}(b)/{alpha}{sub s}(udsc) and {alpha}{sub s}(uds)/{alpha}{sub s}(bc). In addition, the group has measured the difference in charged particle multiplicity between Z{sup 0} {yields} b{bar b} and Z{sup 0} {yields} u{bar u}, d{bar d}, s{bar s} events, and find that it supports the prediction of perturbative QCD that the multiplicity difference be independent of center-of-mass energy. Finally, the group has made a preliminary study of jet polarization using the jet handedness technique.

  3. Updated measurement of the tau lifetime at SLD

    International Nuclear Information System (INIS)

    1996-01-01

    We present an updated measurement of the tau lifetime at SLD. 4316 τ-pair events, selected from a 150k Z 0 data sample, are analyzed using three techniques: decay length, impact parameter, and impact parameter difference methods. The measurement benefits from the small and stable interaction region at the SLC and the precision CCD pixel vertex detector of the SLD. The combined result is: τ τ = 288.1 ± 6.1(stat) ± 3.3(syst) fs

  4. Performance of the SLD Warm Iron Calorimeter prototype

    International Nuclear Information System (INIS)

    Callegari, G.; Piemontese, L.; De Sangro, R.; Peruzzi, I.; Piccolo, M.; Busza, W.; Friedman, J.; Johnson, A.; Kendall, H.; Kistiakowsky, V.

    1986-03-01

    A prototype hadron calorimeter, of similar design to the Warm Iron Calorimeter (WIC) planned for the SLD experiment, has been built and its performance has been studied in a test beam. The WIC is an iron sampling calorimeter whose active elements are plastic streamer tubes similar to those used for the Mont-Blanc proton decay experiment. The construction and operation of the tubes will be briefly described together with their use in an iron calorimeter - muon tracker. Efficiency, resolution and linearity have been measured in a hadron/muon beam up to 11 GeV. The measured values correspond to the SLD design goals

  5. SLD Identification: A Survey of Methods Used by School Psychologists

    Science.gov (United States)

    Watson, Michael D., Jr.; Simon, Joan B.; Nunnley, Lenora

    2016-01-01

    IDEA 2004 opened the door for states, and in some cases districts, to choose among three different methods for identifying children with Specific Learning Disabilities (SLDs). This study provides an in-depth look at SLD identification practices in a state that allows school psychologists to use any of the three methods. Eighty-four school…

  6. A status report on the SLD data acquisition system

    International Nuclear Information System (INIS)

    1988-11-01

    The basic design of the SLD data acquisition system and its present status are reviewed. Aspects of the design that take particular advantage of the relatively low e + e/sup /minus// cross section and the low beam crossing rate of a linear collider are explained. 14 refs., 8 figs

  7. The first results from the CRID detector at SLD

    International Nuclear Information System (INIS)

    Va'vra, J.; Antilogus, P.; Aston, D.; Bienz, T.; Bird, F.; Dasu, S.; Dolinsky, S.; Dunwoodie, W.; hallewell, G.; Kawahara, H.; Kwon, Y.; Leith, D.W.G.S.; Mueller, G.; Muller, D.; Nagamine, T.; Pavel, T.J.; Ratcliff, B.; Rensing, P.; Schultz, D.; Shapiro, S.; Simopoulos, C.; Solodov, E.; Toge, N.; Williams, S.H.; Abe, K.; Hasegawa, K.; Hasegawa, Y.; Suekane, F.; Yuta, H.; Baird, K.; Jacques, P.; Kalelkar, M.; Plano, R.; Stamer, P.; Word, G.; Bean, A.; Caldwell, D.O.; Duboscq, J.; Huber, J.; Lu, A.; Mathys, L.; McHugh, S.; Yellin, S.; David, R.B.; Manly, S.; Snyder, J.; Sforza, M.C.; Coyle, P.; Coyne, D.; Liu, X.; Williams, D.A.; Coller, J.; Shank, J.T.; Whitaker, J.S.; d'Oliveira, A.; Johnson, R.A.; Martinez, J.; Meadows, B.; Nussbaum, M.; Santha, A.K.S.; Sokoloff, M.D.; Stockdale, I.; Turk, J.; Wilson, R.J.

    1992-10-01

    We report first results from the initial physics run of the Cherenkov Ring Imaging Detector (CRID) in the SLD experiment at the SLC. We describe the experimental conditions, show liquid and gas rings, report the number of photoelectrons per ring, and comment on resolution

  8. Measurements of Z0 Electroweak Couplings at SLD

    International Nuclear Information System (INIS)

    Mancinelli, Giampero

    1999-01-01

    In this paper we report a summary of the results of several electroweak measurements performed by the SLD experiment at the Stanford Linear Collider (SLC). Most of these results are preliminary and are based, unless otherwise indicated, on the full 1993-1998 dataset of 560,000 hadronic Z 0 decays, produced with an average electron beam polarization of 73%

  9. Polarized source performance in 1992 for SLC--SLD

    International Nuclear Information System (INIS)

    Schultz, D.; Alley, R.; Clendenin, J.; Frisch, J.; Garden, C.; Hoyt, E.; Klaisner, L.; Kulikov, A.; Prescott, C.; Saez, P.; Tang, H.; Turner, J.; Wicks, M.; Woods, M.; Yeremian, D.; Zolotorev, M.

    1993-02-01

    In its initial operation, the SLC Polarized Electron Source successfully met the SLC goals for 1992 for intensity and efficiency. However, the stability of the beam at the source was marginal, and the polarization was only ∼28%. The SLC goal to provide > 10,000 Z events for the SLD from polarized electrons was met

  10. An improved inclusive measurement of Ac using the SLD detector

    International Nuclear Information System (INIS)

    1998-01-01

    The authors report a new measurement of A c using data obtained by SLD in 1993--97. This measurement uses a vertex tag technique, where the selection of a c hemisphere is based on the reconstructed mass of the charm hadron decay vertex. The method uses the 3D vertexting capabilities of SLD's CCD vertex detector and the small and stable SLC beams to obtain a high c-event tagging efficiency and purity of 28% and 81%, respectively. Charged kaons identified by the CRID detector and the charge of the reconstructed vertex provide an efficient quark-antiquark tag. They obtain a preliminary result of A c = 0.650 ± 0.041 ± 0.033

  11. SLC and SLD: Experimental experience with a linear collider

    International Nuclear Information System (INIS)

    Breidenbach, M.

    1993-08-01

    The SLAC Linear Collider (SLC) is the prototype e + e - linear collider. This talk will consist of an introduction to SLC, a description of the strategy for luminosity, a description of the systems for the transport and measurement of the polarized electrons, and a description of the present performance of the SLC and planned upgrades. The detector, SLD, and the status of the polarization asymmetry measurement A LR will be described

  12. The fluid systems for the SLD Cherenkov ring imaging detector

    International Nuclear Information System (INIS)

    Abe, K.; Hasegawa, K.; Hasegawa, Y.; Iwasaki, Y.; Suekane, F.; Yuta, H.; Baird, K.; Jacques, P.; Kalelkar, M.; Plano, R.; Stamer, P.; Word, G.; Bean, A.; Caldwell, D.O.; Duboscq, J.; Huber, J.; Lu, A.; Mathys, L.; McHugh, S.; Yellin, S.; Ben-David, R.; Manly, S.; Snyder, J.; Turk, J.; Cavalli-Sforza, M.; Coyle, P.; Coyne, D.; Gagnon, P.; Liu, X.; Schneider, M.; Williams, D.A.; Coller, J.; Shank, J.T.; Whitaker, J.S.; d'Oliveira, A.; Johnson, R.A.; Martinez, J.; Nussbaum, M.; Santha, A.K.S.; Sokoloff, M.D.; Stockdale, I.; Wilson, R.J.

    1992-10-01

    We describe the design and operation of the fluid delivery, monitor and control systems for the SLD barrel Cherenkov Ring Imaging Detector (CRID). The systems deliver drift gas (C 2 H 6 + TMAE), radiator gas (C 5 F 12 + N 2 ) and radiator liquid (C 6 F 14 ). Measured critical quantities such as electron lifetime in the drift gas and ultra-violet (UV) transparencies of the radiator fluids, together with the operational experience, are also reported

  13. Pulse to pulse monitoring of the SLD detector

    International Nuclear Information System (INIS)

    Bogart, J.; Huffer, M.; Russell, J.

    1993-04-01

    The SLAC Linear Collider produces bunches of positrons and polarized electrons which collide at 120 hertz inside the SLD detector. A limited amount of information is collected for each pulse in the modules which do real-time data acquisition. Buffers of approximately ten seconds' worth of this monitor data are periodically delivered to a VAX. The generation and uses of the monitor data will be discussed

  14. Construction and testing of the SLD Cerenkov ring imaging detector

    International Nuclear Information System (INIS)

    Cavalli-Sforza, M.; Coyle, P.; Coyne, D.; Gagnon, P.; Williams, D.A.; Abe, K.; Hasegawa, K.; Suekane, F.; Yuta, H.

    1990-01-01

    The authors report on the construction of the Cherenkov Ring Imaging Detector (CRID) for the SLD experiment at the SLAC Linear Collider and the testing of its components. The authors include results from testing the drift boxes, liquid radiator trays, and mirrors for the barrel CRID. The authors also discuss development of the support systems essential for the operation of the CRID: gas and liquid recirculator systems and monitoring

  15. Front-end data processing the SLD data acquisition system

    International Nuclear Information System (INIS)

    Nielsen, B.S.

    1986-07-01

    The data acquisition system for the SLD detector will make extensive use of parallel at the front-end level. Fastbus acquisition modules are being built with powerful processing capabilities for calibration, data reduction and further pre-processing of the large amount of analog data handled by each module. This paper describes the read-out electronics chain and data pre-processing system adapted for most of the detector channels, exemplified by the central drift chamber waveform digitization and processing system

  16. The SLD Cerenkov Ring Imaging Detector: Progress report

    International Nuclear Information System (INIS)

    Ashford, V.; Bienz, T.; Bird, F.

    1986-10-01

    We describe test beam results from a prototype Cerenkov Ring Imaging Detector (CRID) for the SLD experiment at the SLAC Linear Collider (SLC). The system includes both liquid and gas radiators, a long drift box containing gaseous TMAE and a proportional wire chamber with charge division readout. Measurements of the multiplicity and detection resolution of Cerenkov photons, from both radiators are presented. Various design aspects of a new engineering prototype, currently under construction, are discussed and recent R and D results relevant to this effort are reported

  17. The scanning Compton polarimeter for the SLD experiment

    International Nuclear Information System (INIS)

    Woods, M.

    1996-10-01

    For the 1994/95 run of the SLD experiment at SLAC, a Compton polarimeter measured the luminosity-weighted electron beam polarization to be (77.2 ± 0.5)%. This excellent accuracy is achieved by measuring the rate asymmetry of Compton-scattered electrons near the kinematic endpoint. The polarimeter takes data continuously while the electron and positron beams are in collision and achieves a statistical precision of better than 1% in a three minute run. To calibrate the polarimeter and demonstrate its accuracy, many scans are frequently done. These include scans of the laser polarization, the detector position with respect to the kinematic edge, and the laser power

  18. Final Results on Heavy Quarks at LEP and SLD

    CERN Document Server

    Stocchi, A

    2002-01-01

    In the last decade, the LEP and SLD experiments played a central role in the study of B hadrons (hadrons containing a b quark). New B hadrons have been observed ($B^0_s$, \\Lambda_b$, $\\Xi_b$ and $B^{**}$) and their production and decay properties have been measured. In this paper we will focus on measurements of the CKM matrix elements: $|V_{cb}|$, $|V_{ub}|$, $|V_{td}|$ and $|V_{ts}|$. We will show how all these measurements, together with theoretical developments, have significantly improved our knowledge on the flavour sector of the Standard Model.

  19. Identification and characterization of mouse PSF1-binding protein, SLD5

    International Nuclear Information System (INIS)

    Kong, Lingyu; Ueno, Masaya; Itoh, Machiko; Yoshioka, Katsuji; Takakura, Nobuyuki

    2006-01-01

    Although most somatic cells cannot proliferate, immature cells proliferate continuously to produce mature cells. Recently, we cloned mouse PSF1 from a hematopoietic stem cell specific cDNA library and reported that PSF1 is indispensable for the proliferation of immature cells. To identify the PSF1-binding protein, we used the yeast two-hybrid system with PSF1 as bait, and identified and cloned SLD5. SLD5 interacted with a central region of PSF1. Tissue distribution of SLD5 was quite similar to that of PSF1. When overexpressed, SLD5 protein was co-localized with PSF1. These data suggest that PSF1 and SLD5 may cooperate in the proliferation of immature cell populations

  20. Drosophila Sld5 is essential for normal cell cycle progression and maintenance of genomic integrity

    Energy Technology Data Exchange (ETDEWEB)

    Gouge, Catherine A. [Department of Biology, East Carolina University East Carolina University, Greenville, NC 27858 (United States); Christensen, Tim W., E-mail: christensent@ecu.edu [Department of Biology, East Carolina University East Carolina University, Greenville, NC 27858 (United States)

    2010-09-10

    Research highlights: {yields} Drosophila Sld5 interacts with Psf1, PPsf2, and Mcm10. {yields} Haploinsufficiency of Sld5 leads to M-phase delay and genomic instability. {yields} Sld5 is also required for normal S phase progression. -- Abstract: Essential for the normal functioning of a cell is the maintenance of genomic integrity. Failure in this process is often catastrophic for the organism, leading to cell death or mis-proliferation. Central to genomic integrity is the faithful replication of DNA during S phase. The GINS complex has recently come to light as a critical player in DNA replication through stabilization of MCM2-7 and Cdc45 as a member of the CMG complex which is likely responsible for the processivity of helicase activity during S phase. The GINS complex is made up of 4 members in a 1:1:1:1 ratio: Psf1, Psf2, Psf3, And Sld5. Here we present the first analysis of the function of the Sld5 subunit in a multicellular organism. We show that Drosophila Sld5 interacts with Psf1, Psf2, and Mcm10 and that mutations in Sld5 lead to M and S phase delays with chromosomes exhibiting hallmarks of genomic instability.

  1. Preliminary results on heavy flavor physics at SLD

    Energy Technology Data Exchange (ETDEWEB)

    Usher, T. [Stanford Univ., CA (United States)

    1994-12-01

    The author reports on preliminary heavy flavor physics results from the SLD detector at the SLAC Linear Collider. Efficient tagging of b{bar b} events is achieved with an impact parameter technique that takes advantage of the small and stable interaction point of the SLC and all charged tracks in Z{sup 0} decays. This technique is applied to samples of Z{sup 0} events collected during the 1992 and 1993 physics runs. Preliminary measurements of the ratio R{sub b} = {Gamma}(Z{sup 0} {yields} b{bar b})/{Gamma}(Z{sup 0} {yields} hadrons) and the average B hadron lifetime <{tau}{sub B}> are reported. In a sample of 27K Z{sup 0} events, values of R{sub b} = 0.235 {+-} 0.006(stat.) {+-} 0.018(syst.) and <{tau}{sub B}> = 1.53 {+-} 0.006(stat.) {+-} 0.018(syst.) are obtained. In addition, the first measurement of the left-right asymmetry A{sub b} is reported. Using a sample of 38K Z{sup 0} events with a luminosity weighted electron polarization of 62%, the author obtains a preliminary value of A{sub b} = 0.94 {+-} 0.006(stat.) {+-} 0.018(syst.).

  2. A measurement of the tau Michel parameters at SLD

    International Nuclear Information System (INIS)

    Quigley, J.

    1997-05-01

    This thesis presents a measurement of the tau Michel parameters. This measurement utilizes the highly polarized SLC electron beam to extract these quantities directly from the measured tau decay spectra using the 1993--95 SLD sample of 4,528 tau pair events. The results are ρ e = 0.71 ± 0.14 ± 0.05, ξ e = 1.16 ± 0.52 ± 0.06, and (ξδ) e = 0.85 ± 0.43 ± 0.08 for tau decays to electrons and ρ μ = 0.54 ± 0.28 - 0.14, η μ = -0.59 ± 0.82 ± 0.45, ξ μ = 0.75 ± 0.50 ± 0.14, and (ξδ) μ = 0.82 ± 0.32 ± 0.07 for tau decays to muons. Combining all leptonic tau decays gives ρ = 0.72 ± 0.09 ± 0.03, ξ = 1.05 ± 0.35 ± 0.04, and Ξδ = 0.88 ± 0.27 ± 0.04. These results agree well with the current world average and the Standard Model

  3. Highlights of the SLD Physics Program at the SLAC Linear Collider

    International Nuclear Information System (INIS)

    Willocq, Stephane

    2001-01-01

    Starting in 1989, and continuing through the 1990s, high-energy physics witnessed a flowering of precision measurements in general and tests of the standard model in particular, led by e + e - collider experiments operating at the Z 0 resonance. Key contributions to this work came from the SLD collaboration at the SLAC Linear Collider. By exploiting the unique capabilities of this pioneering accelerator and the SLD detector, including a polarized electron beam, exceptionally small beam dimensions, and a CCD pixel vertex detector, SLD produced a broad array of electroweak, heavy-flavor, and QCD measurements. Many of these results are one of a kind or represent the world's standard in precision. This article reviews the highlights of the SLD physics program, with an eye toward associated advances in experimental technique, and the contribution of these measurements to our dramatically improved present understanding of the standard model and its possible extensions

  4. Highlights of the SLD Physics Program at the SLAC Linear Collider

    Energy Technology Data Exchange (ETDEWEB)

    Willocq, Stephane

    2001-09-07

    Starting in 1989, and continuing through the 1990s, high-energy physics witnessed a flowering of precision measurements in general and tests of the standard model in particular, led by e{sup +}e{sup -} collider experiments operating at the Z{sup 0} resonance. Key contributions to this work came from the SLD collaboration at the SLAC Linear Collider. By exploiting the unique capabilities of this pioneering accelerator and the SLD detector, including a polarized electron beam, exceptionally small beam dimensions, and a CCD pixel vertex detector, SLD produced a broad array of electroweak, heavy-flavor, and QCD measurements. Many of these results are one of a kind or represent the world's standard in precision. This article reviews the highlights of the SLD physics program, with an eye toward associated advances in experimental technique, and the contribution of these measurements to our dramatically improved present understanding of the standard model and its possible extensions.

  5. Phosphopeptide binding by Sld3 links Dbf4-dependent kinase to MCM replicative helicase activation.

    Science.gov (United States)

    Deegan, Tom D; Yeeles, Joseph Tp; Diffley, John Fx

    2016-05-02

    The initiation of eukaryotic DNA replication requires the assembly of active CMG (Cdc45-MCM-GINS) helicases at replication origins by a set of conserved and essential firing factors. This process is controlled during the cell cycle by cyclin-dependent kinase (CDK) and Dbf4-dependent kinase (DDK), and in response to DNA damage by the checkpoint kinase Rad53/Chk1. Here we show that Sld3, previously shown to be an essential CDK and Rad53 substrate, is recruited to the inactive MCM double hexamer in a DDK-dependent manner. Sld3 binds specifically to DDK-phosphorylated peptides from two MCM subunits (Mcm4, 6) and then recruits Cdc45. MCM mutants that cannot bind Sld3 or Sld3 mutants that cannot bind phospho-MCM or Cdc45 do not support replication. Moreover, phosphomimicking mutants in Mcm4 and Mcm6 bind Sld3 without DDK and facilitate DDK-independent replication. Thus, Sld3 is an essential "reader" of DDK phosphorylation, integrating signals from three distinct protein kinase pathways to coordinate DNA replication during S phase. © 2016 The Authors. Published under the terms of the CC BY 4.0 license.

  6. Measurement of the polarized forward-backward asymmetry of s-quarks at SLD

    International Nuclear Information System (INIS)

    Narita, Shinya

    1998-03-01

    This thesis presents a direct measurement of the parity-violating parameter A s by analyzing the polarized forward-backward asymmetry of s quarks in e + e - → Z 0 → s anti s. The author has used the data taken at the Stanford Linear Accelerator Center (SLAC), from the SLAC Large Detector (SLD), which records the products of e + e - interactions at a center of mass energy √s = 91.2 GeV at the SLAC Linear Collider (SLC). The unique features of the SLC/SLD experimental apparatus provide interesting tests of the electroweak and the QCD physics. The small, stable SLC beam spot, and the precise tracking capability of the SLD allow the isolation of light flavor events. Charged hadrons are identified over wide momentum range with the Cherenkov Ring Imaging Detector (CRID). High momentum charged kaon, Λ 0 /anti Λ 0 , and K s 0 are used to select Z 0 → s anti s events and to identify the s-quark direction. The averaged polarization was 63.0% in 1993 SLD run and 77.3% in 1994--95 run. The author obtained A s = 0.86 ± 0.17(stat.) ± 0.10(syst.). This value is consistent with the prediction from the Standard Model and with the values of A b measurements from SLD and LEP experiments

  7. High-speed 405-nm superluminescent diode (SLD) with 807-MHz modulation bandwidth

    KAUST Repository

    Shen, Chao

    2016-08-25

    III-nitride LEDs are fundamental components for visible-light communication (VLC). However, the modulation bandwidth is inherently limited by the relatively long carrier lifetime. In this letter, we present the 405 nm emitting superluminescent diode (SLD) with tilted facet design on semipolar GaN substrate, showing a broad emission of ∼9 nm at 20 mW optical power. Owing to the fast recombination (τ<0.35 ns) through the amplified spontaneous emission, the SLD exhibits a significantly large 3-dB bandwidth of 807 MHz. A data rate of 1.3 Gbps with a bit-error rate of 2.9 × 10 was obtained using on-off keying modulation scheme, suggesting the SLD being a high-speed transmitter for VLC applications.

  8. VXD3: The SLD vertex detector upgrade based on a 307 Mpixel CCD system

    International Nuclear Information System (INIS)

    1995-07-01

    The SLD Collaboration is building a new CCD vertex detector (VXD3) comprising 96 3.2 Mpixel CCDs of 13 cm 2 each for a total of 307 million pixels. This system is an upgrade of the Pioneering CCD vertex detector VXD2 which has operated in SLD since 1992. The CCDs of VXD3 are mounted on beryllium ladders in three cylinders, providing three space point measurements along each track of about 5 microns resolution in all three coordinates. The design and construction of VXD3 builds on three years of successful performance of VXD2. Significant improvements are achieved with VXD3 in impact parameters resolution (about a factor of two) and acceptance (∼20%) through optimized geometry and reduced material. New readout electronics have been developed for this system. This new vertex detector will be installed in late 1995 for the future runs of SLD

  9. High-speed 405-nm superluminescent diode (SLD) with 807-MHz modulation bandwidth

    KAUST Repository

    Shen, Chao; Lee, Changmin; Ng, Tien Khee; Nakamura, Shuji; Speck, James S.; DenBaars, Steven P.; Alyamani, Ahmed Y.; El-Desouki, Munir M.; Ooi, Boon S.

    2016-01-01

    III-nitride LEDs are fundamental components for visible-light communication (VLC). However, the modulation bandwidth is inherently limited by the relatively long carrier lifetime. In this letter, we present the 405 nm emitting superluminescent diode (SLD) with tilted facet design on semipolar GaN substrate, showing a broad emission of ∼9 nm at 20 mW optical power. Owing to the fast recombination (τ<0.35 ns) through the amplified spontaneous emission, the SLD exhibits a significantly large 3-dB bandwidth of 807 MHz. A data rate of 1.3 Gbps with a bit-error rate of 2.9 × 10 was obtained using on-off keying modulation scheme, suggesting the SLD being a high-speed transmitter for VLC applications.

  10. Bs Physics at LEP, SLD, and CDF Delta m_s and Delta Gamma_s

    CERN Document Server

    Boix, G

    2001-01-01

    The current status of the experimental knowledge of $\\Bs$ meson physics is reviewed. Results from LEP and CDF on the width difference $\\dgs$ are presented, the corresponding average is found to be in good agreement with the present theoretical estimation. The $\\Bs$ oscillations have not yet been resolved, despite the progress recently achieved by SLD and ALEPH. The world combination, including results from the LEP experiments, SLD and CDF, is presented, together with the expected and observed lower limit on the $\\Bs$ oscillation frequency. A tantalizing hint of an oscillation is observed around $\\dms\\sim17 \\psin$, near future results could increase the significance of this hint.

  11. The impact of 4Ps on Purchase Decision: A case of Apple in Hanoi, Vietnam

    OpenAIRE

    Bui Trung Thieu

    2016-01-01

    By using quantitative research methods and deductive reasoning, this research paper aims to address the importance of four marketing mix components (4Ps) on purchase decisions of customers of Apple Inc., by launching a survey in Hanoi, Vietnam, to generate primary data. The chosen sampling technique is quota sampling and several “quotas” were built. Descriptive analysis and hypothetical analysis (t-test, one-way ANOVA and Regression) using SPSS 20.0 are applied. Other implications of the rese...

  12. Performance of the SLD Barrel CRID during the 1992 physics data run

    International Nuclear Information System (INIS)

    Abe, K.; Hasegawa, K.; Hasegawa, Y.; Iwasaki, Y.; Suekane, F.; Toge, N.; Yuta, H.; Baird, K.; Jacques, P.; Kalelkar, M.; Plano, R.; Stamer, P.; Word, G.; Bean, A.; Caldwell, D.O.; Duboscq, J.; Huber, J.; Lu, A.; Mathys, L.; McHugh, S.; Yellin, S.; Ben-David, R.; Manly, S.; Snyder, J.; Turk, J.; Cavalli-Sforza, M.; Colye, P.; Coyne, D.; Liu, X.; Williams, D.A.; Coller, J.; Shank, J.T.; Whitaker, J.S.; d'Oliveira, A.; Johnson, R.A.; Martinez, J.; Meadows, B.; Nussbaum, M.; Santha, A.K.S.; Sokoloff, M.D.; Stockdale, I.; Wilson, R.J.

    1992-11-01

    The SLD Barrel Cherenkov Ring Imaging Detector was fully operational in the 1992 physics data run. The electron drift velocity and magnetic field deflection of electron trajectories have been measured. Cherenkov rings have been observed from both the liquid and gas radiators. The number and the resolution of the angle of Cherenkov photons have been measured to be approximately equal to design specifications

  13. Stress Levels of Kuwaiti Mothers of Children with SLD: Does Work and Educational Status Matter?

    Science.gov (United States)

    Alazemi, Saad S.; Hadadian, Azar; Merbler, John B.; Wang, Cen

    2015-01-01

    Existing research literature indicates that parents of children with disabilities have higher stress. The purpose of this study was to examine differences in stress levels between mothers in relation to their children with specific learning disabilities (SLD). A sub sample of 91 mothers participated in the study. The outcome of the research…

  14. Overview of the data acquisition electronics system design for the SLAC Linear Collider Detector (SLD)

    International Nuclear Information System (INIS)

    Larsen, R.S.

    1985-09-01

    The SLD Detector will contain five major electronics subsystems: Vertex, Drift, Liquid Argon Calorimeter, Cerenkov Ring Imaging, and Warm Iron Calorimeter. To implement the approximately 170,000 channels of electronics, extensive miniaturization and heavy use of multiplexing techniques are required. Design criteria for each subsystem, overall system architecture, and the R and D program are described

  15. Analysis and simulation of the SLD WIC [Warm Iron Calorimeter] PADS hybrid preamplifier circuitry

    International Nuclear Information System (INIS)

    Fox, J.D.; Horelick, D.

    1990-10-01

    The SLD PADS electronics consist of over 9000 channels of charge-sensitive preamplifiers followed by integrated sample/hold data storage, digitizing, and readout circuitry. This paper uses computer simulation techniques to analyze critical performance parameters of the preamplifier hybrid including its interactions with the detector system. Simulation results are presented and verified with measured performance. 6 refs., 9 figs

  16. The impact of 4Ps on Purchase Decision: A case of Apple in Hanoi, Vietnam

    Directory of Open Access Journals (Sweden)

    Bui Trung Thieu

    2016-01-01

    Full Text Available By using quantitative research methods and deductive reasoning, this research paper aims to address the importance of four marketing mix components (4Ps on purchase decisions of customers of Apple Inc., by launching a survey in Hanoi, Vietnam, to generate primary data. The chosen sampling technique is quota sampling and several “quotas” were built. Descriptive analysis and hypothetical analysis (t-test, one-way ANOVA and Regression using SPSS 20.0 are applied. Other implications of the research and limitations were also discussed below.

  17. The limited streamer tubes system for the SLD warm iron calorimeter

    International Nuclear Information System (INIS)

    Benvenuti, A.C.; Camanzi, B.; Piemontese, L.; Zucchelli, P.; Calcaterra, A.; De Sangro, R.; De Simone, P.; De Simone, S.; Gallinaro, M.; Peruzzi, I.; Piccolo, M.; Bacchetta, N.; Bisello, D.; Castro, A.; Galvagni, S.; Loreti, M.; Pescara, L.; Wyss, J.; Battiston, R.; Biasini, M.; Bilei, G.M.; Checcucci, B; Mancinelli, G.; Mantovani, G.; Pauluzzi, M.; Santocchia, A.; Servoli, L.; Carpinelli, M.; Castaldi, R.; Cazzola, U.; Dell'Orso, R.; Pieroni, E.; Vannini, C.; Verdini, P.G.; Byers, B.L.; Escalera, J.; Kharakh, D.; Messner, R.L.; Zdarko, R.W.; Johnson, J.R.

    1992-01-01

    The SLD detector at the Stanford Linear Accelerator Center is a general purpose device for studying e + ε - interaction at the Z 0 . The SLD calorimeter system consists of two parts: a lead Liquid Argon Calorimeter (LAC) with both electromagnetic (22 radiation lengths) and hadronic sections (2.8 absorption lengths) housed inside the coil, and the Warm Ion limited streamer tubes Calorimeter (WIC) outside the coil which uses as radiator the iron of the flux return for the magnetic field. The WIC completes the measurement of the hadronic shower energy (∼85% on average is contained in the LAC) and it provides identification and tracking for muons over 99% of the solid angle. In this note we report on the construction, test and commissioning of such a large system

  18. The analog processing system for the Liquid Argon Calorimeter for SLD at SLAC

    International Nuclear Information System (INIS)

    Haller, G.M.; Nelson, D.; Freytag, D.R.

    1986-09-01

    The analog processing system for the Liquid Argon Calorimeter for the SLD project at SLAC is described. Amplification, storage of the analog information, and multiplexing is realized on specially developed hybrids, which will be mounted directly on the detector. This leads to a substantial reduction of the cable plant. Test results for the amplifier and for the sampling and multiplexing hybrid (CDU hybrid) are presented. The latter hybird contains a custom monolithic device, the Calorimeter Data Unit

  19. The SLD Vertex Detector Upgrade (VXD3) and a study of b anti bg events

    International Nuclear Information System (INIS)

    Dervan, P.J.

    1998-04-01

    This thesis presents a variety of work concerning the design, construction and use of the SLD's vertex detector. SLD's pioneering 120 Mpixel vertex detector, VXD2, was replaced by VXD3, a 307Mpixel CCD vertex detector in january 1996. The motivation for the up-grade detector and its subsequent construction and testing are described in some detail. This work represents the collaborative work of a large number of people. The authors' work was mainly carried out at EEV on the testing of the CCDs and subsequent ladders. VXD3 was commissioned during the 1996 SLD run and performed very close to design specifications. Monitoring the position of VXD3 is crucial for reconstructing the data in the detector for physics analysis. This was carried out using a capacitive wire position monitoring system. The system indicated that VXD3 was very stable during the whole of the 1996 run, except for known controlled movements. VXD3 was aligned globally for each period in-between these known movements using the tracks from e + e - → Z 0 → hadrons. The structure of three-jet b anti bg events has been studied using hadronic Z 0 decays from the 1993--1995 SLD data. Three-jet final states were selected and the CCD-based vertex detector was used to identify two of the jets as a b or anti b. The distributions of the gluon energy and polar angle with respect to the electron beam direction were examined and were compared with perturbative QCD predictions. It was found that the QCD Parton Shower prediction was needed to describe the data well

  20. Precision electroweak physics with the SLD/SLC: The left-right polarization asymmetry

    International Nuclear Information System (INIS)

    Rowson, P.C.

    1994-12-01

    Following a brief review of a commonly used general framework for the analysis of radiative corrections and possible new physics, the recent precision results from the SLD/SLC are discussed and used to test the standard electroweak model. In the 1993 SLD/SLC run, the SLD recorded 50,000 Z events produced by the collision of longitudinally polarized electrons on unpolarized positrons at a center-of-mass energy of 91.26 GeV. The luminosity-weighted average polarization of the SLC electron beam was (63.0 ± 1.1)%. We measure the left-right cross-section asymmetry in Z boson production, A LR , to be 0.1628 ± 0.0071 (stat) ± 0.0028 (syst) which determines the effective weak mixing angle to be sin 2 θ W eff = 0.2292 ± 0.0009 (stat) ± 0.0004 (syst). When averaged with our 1992 result, we obtain sin 2 θ W eff = 0.2294 ± 0. 0010. This result differs from analogous LEP results at the level of about 2.5 σ. The world averages of electroweak data are comfortably in agreement with the standard model

  1. SLD-MOSCNT: A new MOSCNT with step-linear doping profile in the source and drain regions

    Science.gov (United States)

    Tahne, Behrooz Abdi; Naderi, Ali

    2017-01-01

    In this paper, a new structure, step-linear doping MOSCNT (SLD-MOSCNT), is proposed to improve the performance of basic MOSCNTs. The basic structure suffers from band to band tunneling (BTBT). We show that using SLD profile for source and drain regions increases the horizontal distance between valence and conduction bands at gate to source/drain junction which reduces BTBT probability. SLD performance is compared with other similar structures which have recently been proposed to reduce BTBT such as MOSCNT with lightly-doped drain and source (LDDS), and with double-light doping in source and drain regions (DLD). The obtained results using a nonequilibrium Green’s function (NEGF) method show that the SLD-MOSCNT has the lowest leakage current, power consumption and delay time, and the highest current ratio and voltage gain. The ambipolar conduction in the proposed structure is very low and can be neglected. In addition, these structures can improve short-channel effects. Also, the investigation of cutoff frequency of the different structures shows that the SLD has the highest cutoff frequency. Device performance has been investigated for gate length from 8 to 20 nm which demonstrates all discussions regarding the superiority of the proposed structure are also valid for different channel lengths. This improvement is more significant especially for channel length less than 12 nm. Therefore, the SLD can be considered as a candidate to be used in the applications with high speed and low power consumption.

  2. Component and system tests of the SLD Cerenkov Ring Imaging Detector

    International Nuclear Information System (INIS)

    Antilogus, P.; Aston, D.; Bienz, T.; Bird, F.; Dasu, S.; Dolinsky, S.; Dunwoodie, W.; Hallewell, G.; Kawahara, H.; Kwon, Y.; Leith, D.; Muller, D.; Nagamine, T.; Pavel, T.; Ratcliff, B.; Rensing, P.; Schultz, D.; Shapiro, S.; Simopoulos, C.; Solodov, E.; Toge, N.; Va'vra, J.; Williams, S.; Cavalli-Sforza, M.; Coyle, P.; Coyne, D.; Gagnon, P.; Liu, X.; Williams, D.A.; Whitaker, J.S.; Wilson, R.J.; Bean, A.; Caldwell, D.; Duboscq, J.; Huber, J.; Lu, A.; Mathys, L.; McHugh, S.; Witherell, M.; Yellin, S.; D'Oliveira, A.; Johnson, R.A.; Martinez, J.L.; Meadows, B.; Nussbaum, M.; Santha, A.K.S.; Shoup, A.; Stockdale, I.; Baird, K.; Jacques, P.; Kalelkar, M.; Plano, R.; Stamer, P.; Word, G.; Abe, K.; Hasegawa, K.; Suekane, F.; Yuta, H.

    1991-02-01

    The components of the SLD barrel Cerenkov Ring Imaging Detector (CRID) are now built and are being installed. We report on tests of these, including tests of the fiber optic calibration system, detailed studies of electron drift paths on production drift boxes and detectors, tests of the dynamic gating system and its effect on drift path distortions due to space-charge, and a measurement of the electron lifetime in a production drift box. In addition, we report on the UV transmission of recirculated liquid C 6 F 14 and on the effects of CRID construction materials on electron lifetime. 9 refs., 11 figs

  3. A cryogenic monitor system for the Liquid Argon Calorimeter in the SLD detector

    International Nuclear Information System (INIS)

    Fox, M.J.; Fox, J.D.

    1988-10-01

    This paper describes the monitoring electronics system design for the Liquid Argon Calorimeter (LAC) portion of the SLD detector. This system measures temperatures and liquid levels inside the LAC cryostat and transfers the results over a fiber-optic serial link to an external monitoring computer. System requirements, unique design constraints, and detailed analog, digital and software designs are presented. Fault tolerance and the requirement for a single design to work in several different operating environments are discussed. 4 refs., 3 figs., 1 tab

  4. Component and system tests of the SLD Cerenkov Ring Imaging Detector

    International Nuclear Information System (INIS)

    Antilogus, P.; Bird, F.; Aston, D.; Dasu, S.; Dunwoodie, W.; Hallewell, G.; Kawahara, H.; Kwon, Y.; Leith, D.; Nagamine, T.; Pavel, T.; Muller, D.; Williams, S.; Bienz, T.; Dolinsky, S.; Solodov, E.; Coyle, P.; Cavalli-Sforza, M.; Coyne, D.; Gagnon, P.; Liu, X.; Williams, D.A.

    1990-01-01

    The components of the SLD barrel Cerenkov Ring Imaging Detector (CRID) are now built and are being installed. This paper reports on tests of these components, including tests of the fiber optic calibration system, detailed studies of electron drift paths on production drift boxes and detectors, tests of the dynamic gating system and its effect on drift path distortions due to space-charge, and a measurement of the electron lifetime in a production drift box. In addition, the authors report on the UV transmission of recirculated liquid freon and on the effects of CRID construction materials on electron lifetime

  5. Component and system tests of the SLD Cerenkov Ring Imaging Detector

    International Nuclear Information System (INIS)

    Antilogus, P.; Aston, D.; Bienz, T.; Bird, F.; Dasu, S.; Dolinsky, S.; Dunwoodie, W.; Hallewell, G.; Kawahara, H.; Kwon, Y.; Leith, D.; Muller, D.; Nagamine, T.; Pavel, T.; Ratcliff, B.; Rensing, P.; Schultz, D.; Shapiro, S.; Simopoulos, C.; Solodov, E.; Toge, N.; Va'vra, J.; Williams, S.; Cavalli-Sforza, M.; Coyle, P.; Coyne, D.; Gagnon, P.; Liu, X.; Williams, D.A.; Whitaker, J.S.; Wilson, R.J.; Bean, A.; Caldwell, D.; Duboscq, J.; Huber, J.; Lu, A.; Mathys, L.; McHugh, S.; Witherell, M.; Yellin, S.; d'Oliveira, A.; Johnson, R.A.; Martinez, J.; Meadows, B.; Nussbaum, M.; Santha, A.K.S.; Shoup, A.; Stockdale, I.; Jacques, P.; Kalelkar, M.; Plano, R.; Stamer, P.; Abe, K.; Hasegawa, K.; Suekane, F.; Yuta, H.

    1990-10-01

    The components of the SLD barrel Cerenkov Ring Imaging Detector (CRID) are now built and are being installed. We report on tests of these components, including tests of the fiber optic calibration system, detailed studies of electron drift paths on production drift boxes and detectors, tests of the dynamic gating systems and its effect on drift path distortions due to space-charge, and a measurement of the electron lifetime in a production drift box. In addition, we report on the UV transmission of recirculated liquid freon and on the effects of CRID construction materials on electron lifetime. 16 refs., 12 figs

  6. Lorentz angle studies for the SLD endcap Cerenkov Ring Imaging Detector

    International Nuclear Information System (INIS)

    Coyle, P.; Cavalli-Sforza, M.; Coyne, D.

    1987-11-01

    The design of the endcap Cerenkov Ring Imaging Detectors for SLD requires a detailed understanding of how electrons drift in gases under the influence of crossed electric and magnetic fields. In this report, we present recent measurements of Lorentz angles and drift velocities in gases suitable for the endcap CRID photon detectors. We compare these measurements to predictions from a theoretical model; good agreement is observed. Based on our results we present a design for detectors operating in a 0.6 Tesla transverse magnetic field. 14 refs., 10 figs., 4 tabs

  7. STS-55 MS1/PLC Ross and Payload Specialist Walter work in SL-D2 module

    Science.gov (United States)

    1993-01-01

    STS-55 Mission Specialist 1 (MS1) and Payload Commander (PLC) Jerry L. Ross floats near cycle ergometer and Rack 9 Anthrorack (AR) (Human Physiology Laboratory) as German Payload Specialist 1 Ulrich Walter reviews a checklist in front of Rack 11 Experiment Rack. These experiment stations and the crewmembers are in the shirt-sleeve environment of the Spacelab Deutsche 2 (SL-D2) science module onboard the Earth-orbiting Columbia, Orbiter Vehicle (OV) 102. In the background is the SL-D2 aft end cone. Behind Ross and Walter is Rack 12 Experiment Rack with Baroreflex (BA).

  8. Measurement of the Z0 → $s\\bar{s}$ Coupling at the SLD

    Energy Technology Data Exchange (ETDEWEB)

    Staengle, Hermann

    1999-11-24

    This dissertation presents a direct measurement of the parity-violating coupling of the Z{sup 0} to strange quarks, A{sub s}, derived from e{sup +}e{sup -} collision data containing approximately 550,000 hadronic decays of polarized Z{sup 0} bosons. Data were recorded with the SLC Large Detector (SLD) at the SLAC Linear Collider (SLC) between 1993 and 1998 with an average electron beam polarization of 73% and 74% during the 1993-5 and 1996-8 run periods, respectively. Making use of several unique features of the SLC and SLD, this measurement relies on a new generation particle identification system, the Cherenkov Ring Imaging Detector, to test the Standard Model prediction of universality in the coupling of the Z{sup 0} to down-type quarks. Polarized Z{sup 0} --> s anti-s events are tagged by the presence in each event hemisphere of a high-momentum K {+-}, K{sub s}{sup 0} or Lambda{sup 0}/ anti-Lambda{sup 0} identified using particle identification and/or a mass tag. The background from heavy flavor events is suppressed with the CCD-based vertex detector. The event thrust axis is signed with the strangeness of the tagged particle to point in the direction of the initial s quark. The coupling A{sub s} is derived from a maximum likelihood fit to the polar angle distributions of the tagged s quark measured with left- and right-handed electron beams. To reduce the model dependence of the measurement, the background from u anti-u and d anti-d events as well as the analyzing power of the method for s anti-s events are constrained from the data. We obtain A{sub s} = 0.86 {+-} 0.08(stat.) {+-} 0.05(syst.). The result is consistent with both the Standard Model prediction and previous bottom quark coupling mA{sub b}, measurements performed by SLD and LEP, and therefore supports the predicted universality of the Z{sup 0} to down-type quark couplings.

  9. Strangeonium spectroscopy at 11 GeV/c and Cherenkov Ring Imaging at the SLD

    International Nuclear Information System (INIS)

    Bienz, T.L.

    1990-07-01

    This thesis is divided into two sections, which describe portions of the data acquisition system and online software for the Cherenkov Ring Imaging Detector (CRID) for the SLD, and analyses of several low cross section strangeonium channels in data from the LASS spectrometer. The CRID section includes a description of the data acquisition system, determination of the preamplifier gain, and development of an online pulse finding algorithm based on deconvolution. Deconvolution uses knowledge of the preamplifier impulse response to aid in pulse finding. The algorithm is fast and shows good single pulse resolution and excellent double pulse resolution in preliminary tests. The strangeonium analyses are based on data from a 4.1 event/nanobarn exposure of the LASS spectrometer in K - p interactions at 11 GeV/c, and include studies of Ληπ + π - , ΛΚ*Κ*, and Λφφ

  10. GINS complex protein Sld5 recruits SIK1 to activate MCM helicase during DNA replication.

    Science.gov (United States)

    Joshi, Kiranmai; Shah, Varun Jayeshkumar; Maddika, Subbareddy

    2016-12-01

    In eukaryotes, proper loading and activation of MCM helicase at chromosomal origins plays a central role in DNA replication. Activation of MCM helicase requires its association with CDC45-GINS complex, but the mechanism of how this complex activates MCM helicase is poorly understood. Here we identified SIK1 (salt-inducible kinase 1), an AMPK related protein kinase, as a molecular link that connects GINS complex with MCM helicase activity. We demonstrated that Sld5 a component of GINS complex interacts with SIK1 and recruits it to the sites of DNA replication at the onset of S phase. Depletion of SIK1 leads to defective DNA replication. Further, we showed that SIK1 phosphorylates MCM2 at five conserved residues at its N-terminus, which is essential for the activation of MCM helicase. Collectively, our results suggest SIK1 as a novel integral component of CMG replicative helicase during eukaryotic DNA replication. Copyright © 2016 Elsevier Inc. All rights reserved.

  11. Radiation aging studies of CO2 hydrocarbon mixtures for the SLD drift chamber

    International Nuclear Information System (INIS)

    Venuti, J.P.; Chadwick, G.B.

    1988-10-01

    The SLD drift chamber requires a 'slow' drifting gas and low diffusion to allow wave form digitization. CO 2 provides this but requires an admixture of a quencher to provide more gain. A test chamber with an 8 sense wire cell, such as will appear in the final chamber, was exposed to an x-ray tube while containing a variety of binary admixtures of Co 2 : 8% isobutane, 8% ethane, and 2% isopropanol. It was determined that adding small fractions of water (≤0.66%) or isopropanol (1--2%) to the Co 2 : 8% ethane, or 8% isobutane extended the useful life of the chamber so that integrated charge collections of /approximately/1 C/cm are permissible. Results and discussions are presented. 10 refs., 7 figs., 1 tab

  12. The left-right forward-backward asymmetry for B quarks at the SLD

    Energy Technology Data Exchange (ETDEWEB)

    Williams, David C. [Stanford Univ., CA (United States)

    1994-05-01

    The left-right asymmetry for b quarks, A{sub b}, is precisely predicted by the Weinberg-Salam-Glashow model of particle interactions, now the standard model for high-energy particle physics. As a test of this model, Ab is directly measured at the SLC Large Detector (SLD) by taking advantage of the unique polarized electron beam at the Stanford Linear Collider (SLC) and measuring the left-right forward-backward asymmetry of b quarks. To measure the asymmetry, b quarks are identified using muons of high total and transverse momenta. The result for the 1993 data sample of 37,843 hadronic Z`s is Ab = 0.91 ± 0.19 ± 0.06, where the first error is statistical and the second systematic. This result is in agreement with the standard model prediction of Ab = 0.935.

  13. The left-right forward-backward asymmetry for B quarks at the SLD

    International Nuclear Information System (INIS)

    Williams, D.C.

    1994-05-01

    The left-right asymmetry for b quarks, A b , is precisely predicted by the Weinberg-Salam-Glashow model of particle interactions, now the standard model for high-energy particle physics. As a test of this model, A b is directly measured at the SLC Large Detector (SLD) by taking advantage of the unique polarized electron beam at the Stanford Linear Collider (SLC) and measuring the left-right forward-backward asymmetry of b quarks. To measure the asymmetry, b quarks are identified using muons of high total and transverse momenta. The result for the 1993 data sample of 37,843 hadronic Z's is A b = 0.91 ± 0.19 ± 0.06, where the first error is statistical and the second systematic. This result is in agreement with the standard model prediction of A b = 0.935

  14. Expressive map design: OGC SLD/SE++ extension for expressive map styles

    Science.gov (United States)

    Christophe, Sidonie; Duménieu, Bertrand; Masse, Antoine; Hoarau, Charlotte; Ory, Jérémie; Brédif, Mathieu; Lecordix, François; Mellado, Nicolas; Turbet, Jérémie; Loi, Hugo; Hurtut, Thomas; Vanderhaeghe, David; Vergne, Romain; Thollot, Joëlle

    2018-05-01

    In the context of custom map design, handling more artistic and expressive tools has been identified as a carto-graphic need, in order to design stylized and expressive maps. Based on previous works on style formalization, an approach for specifying the map style has been proposed and experimented for particular use cases. A first step deals with the analysis of inspiration sources, in order to extract `what does make the style of the source', i.e. the salient visual characteristics to be automatically reproduced (textures, spatial arrangements, linear stylization, etc.). In a second step, in order to mimic and generate those visual characteristics, existing and innovative rendering techniques have been implemented in our GIS engine, thus extending the capabilities to generate expressive renderings. Therefore, an extension of the existing cartographic pipeline has been proposed based on the following aspects: 1- extension of the symbolization specifications OGC SLD/SE in order to provide a formalism to specify and reference expressive rendering methods; 2- separate the specification of each rendering method and its parameterization, as metadata. The main contribution has been described in (Christophe et al. 2016). In this paper, we focus firstly on the extension of the cartographic pipeline (SLD++ and metadata) and secondly on map design capabilities which have been experimented on various topographic styles: old cartographic styles (Cassini), artistic styles (watercolor, impressionism, Japanese print), hybrid topographic styles (ortho-imagery & vector data) and finally abstract and photo-realist styles for the geovisualization of costal area. The genericity and interoperability of our approach are promising and have already been tested for 3D visualization.

  15. GA-DoSLD: Genetic Algorithm Based Denial-of-Sleep Attack Detection in WSN

    Directory of Open Access Journals (Sweden)

    Mahalakshmi Gunasekaran

    2017-01-01

    Full Text Available Denial-of-sleep (DoSL attack is a special category of denial-of-service attack that prevents the battery powered sensor nodes from going into the sleep mode, thus affecting the network performance. The existing schemes used for the DoSL attack detection do not provide an optimal energy conservation and key pairing operation. Hence, in this paper, an efficient Genetic Algorithm (GA based denial-of-sleep attack detection (GA-DoSLD algorithm is suggested for analyzing the misbehaviors of the nodes. The suggested algorithm implements a Modified-RSA (MRSA algorithm in the base station (BS for generating and distributing the key pair among the sensor nodes. Before sending/receiving the packets, the sensor nodes determine the optimal route using Ad Hoc On-Demand Distance Vector Routing (AODV protocol and then ensure the trustworthiness of the relay node using the fitness calculation. The crossover and mutation operations detect and analyze the methods that the attackers use for implementing the attack. On determining an attacker node, the BS broadcasts the blocked information to all the other sensor nodes in the network. Simulation results prove that the suggested algorithm is optimal compared to the existing algorithms such as X-MAC, ZKP, and TE2P schemes.

  16. A Measurement of the Parity Violating Parameter Ab with a Muon Tag at the SLD

    Energy Technology Data Exchange (ETDEWEB)

    Bellodi, Giulia

    2001-02-12

    We present a direct measurement of the parity violation parameter A{sub b}, derived from the left-right forward-backward asymmetry of b quarks tagged via muons from semileptonic decays. The value of A{sub b} is extracted using a maximum likelihood fit to the differential cross section for fermion production. The novelty of this measurement consists in the use of topological vertexing information alongside the more traditional decay kinematics to discriminate among the different sources of tagged leptons. The small and stable SLC beam spot and the CCD based vertex detector are used to reconstruct secondary decay vertices and to provide precise kinematic information and a highly efficient and pure B mass tag. A multivariate approach has been used, with a total of 4 tagging variables, whose correlation with each other has been taken into account. The final result has been cross-checked both with a classical cut-and-count method and combining all the information into a neural net. Based on the full SLD dataset of 550K Z{sup 0} events with highly polarized electron beams, this measurement represents an improvement of a factor of 2 with respect to the previously published result (1993-1995 only and with no vertexing information). The statistical sensitivity achieved is around 4% for A{sub b}, making this a world-class single measurement. An estimate of A{sub c} has been simultaneously derived from a common fit, with a precision of about 10%.

  17. Design and construction of the front-end electronics data acquisition for the SLD CRID [Cherenkov Ring Imaging Detector

    International Nuclear Information System (INIS)

    Hoeflich, J.; McShurley, D.; Marshall, D.; Oxoby, G.; Shapiro, S.; Stiles, P.; Spencer, E.

    1990-10-01

    We describe the front-end electronics for the Cherenkov Ring Imaging Detector (CRID) of the SLD at the Stanford Linear Accelerator Center. The design philosophy and implementation are discussed with emphasis on the low-noise hybrid amplifiers, signal processing and data acquisition electronics. The system receives signals from a highly efficient single-photo electron detector. These signals are shaped and amplified before being stored in an analog memory and processed by a digitizing system. The data from several ADCs are multiplexed and transmitted via fiber optics to the SLD FASTBUS system. We highlight the technologies used, as well as the space, power dissipation, and environmental constraints imposed on the system. 16 refs., 10 figs

  18. Measurement of the polarized forward-backward asymmetry of B quarks using momentum-weighted track charge at SLD

    International Nuclear Information System (INIS)

    Junk, T.R.

    1995-11-01

    This thesis presents a direct measurement of the parity-violating parameter A b by analyzing the polarized forward-backward asymmetry of b quarks in e + e - → Z 0 → b bar b. Data were taken at the Stanford Linear Accelerator Center (SLAC), with the Stanford Large Detector (SLD), which records the products of e + e - interactions at a center of mass energy √s = 91.2 GeV/c 2 at the SLAC Linear Collider (SLC). The SLC/SLD experimental apparatus provides a unique and ideal environment for measuring electroweak asymmetries. Heavy flavor decays of the Z 0 were identified inclusively by taking advantage of the long lifetime of B hadrons, the small, stable SLC beam spot, and SLD's precise tracking detectors. Two analysis techniques for measuring A b are presented: a binned fit to the left-right forward-backwards asymmetry of tagged events signed with momentum-weighted track charge, and a self-calibrating maximum-likelihood technique using momentum-weighted charge from the two hemispheres in each tagged event. From our 1994-1995 sample of 3.6 pb -1 , having a luminosity-weighted average e - polarization of 77.3%, and our 1993 sample of 1.8 pb -1 , having a luminosity-weighted polarization of 63.1%, we obtain A b = 0.848 ± 0.046(stat.) ± 0.050(syst.)

  19. Optogenetic Activation of the Sublaterodorsal (SLD) Nucleus Induces Rapid Muscle Inhibition

    Science.gov (United States)

    2015-09-01

    followed by 10% formalin with 15% sucrose, for cryoprotection. Brains were sectioned at 40 µm and tissue stained for Nissl and green fluorescent...injection location Figure 6A: A coronal brain section from rat CG4: The blue Nissl stain highlights neuronal cell bodies, while the darker black is an...coronal brain section from rat CG3: The blue Nissl stain highlights neuronal cell bodies, while the darker black is an anti-GFP stain to determine

  20. Measurement of the polarized forward-backward asymmetry of B quarks using momentum-weighted track charge at SLD

    Energy Technology Data Exchange (ETDEWEB)

    Junk, Thomas Robert [Stanford Univ., CA (United States)

    1995-11-01

    This thesis presents a direct measurement of the parity-violating parameter Ab by analyzing the polarized forward-backward asymmetry of b quarks in e+e- → Z0 → b$\\bar{b}$. Data were taken at the Stanford Linear Accelerator Center (SLAC), with the Stanford Large Detector (SLD), which records the products of e+e- interactions at a center of mass energy √s = 91.2 GeV/c2 at the SLAC Linear Collider (SLC). The SLC/SLD experimental apparatus provides a unique and ideal environment for measuring electroweak asymmetries. Heavy flavor decays of the Z0 were identified inclusively by taking advantage of the long lifetime of B hadrons, the small, stable SLC beam spot, and SLD`s precise tracking detectors. Two analysis techniques for measuring Ab are presented: a binned fit to the left-right forward-backwards asymmetry of tagged events signed with momentum-weighted track charge, and a self-calibrating maximum-likelihood technique using momentum-weighted charge from the two hemispheres in each tagged event. From our 1994-1995 sample of 3.6 pb-1, having a luminosity-weighted average e- polarization of 77.3%, and our 1993 sample of 1.8 pb-1, having a luminosity-weighted polarization of 63.1%, we obtain Ab = 0.848 ± 0.046(stat.) ± 0.050(syst.).

  1. Measurement of the B{sup +} and B{sup 0} lifetimes with topological vertexing at SLD

    Energy Technology Data Exchange (ETDEWEB)

    Abe, K. [Nagoya Univ. (Japan); Abe, K. [Tohoku Univ., Sendai (Japan); Abt, I. [Univ. of Illinois, Urbana, IL (United States)] [and others; SLD Collaboration

    1996-07-01

    The lifetimes of the B{sup +} (B{sub u}) and B{sup 0} (B{sub d}) mesons have been measured using a sample of 150,000 hadronic Z{sup 0} decays collected by the SLD experiment at the SLC between 1993 and 1995. The analysis reconstructs the decay length and charge of the B meson using a novel topological technique. This method results in a high statistics sample of 6,033 (3,665) charged (neutral) vertices. The ratio of B{sup +}:B{sup 0} decays in the charged (neutral) sample is 1.8:1 (1:2.3).

  2. A measurement of the electroweak asymmetry parameter for the tau lepton using the 1993 and 1994--95 SLD data sample

    International Nuclear Information System (INIS)

    Bolen, B.D.

    1996-07-01

    A measurement of the electroweak asymmetry parameter A t is presented using e + E LR - → τ + τ - events from the 1993, 1994--95 data runs at the SLD experiment at SLAC. The analysis takes advantage of the polarized electron beam in the SLAC Linear Collider (SLC) to improve the precision of the analysis over the standard forward-backward asymmetry techniques

  3. Strange meson spectroscopy in K[omega] and K[phi] at 11 GeV/c and Cherenkov ring imaging at SLD

    Energy Technology Data Exchange (ETDEWEB)

    Kwon, Youngjoon.

    1993-01-01

    This thesis consists of two independent parts; development of Cherenkov Ring Imaging Detector (CRID) system and analysis of high-statistics data of strange meson reactions from the LASS spectrometer. Part 1: The CRID system is devoted to charged particle identification in the SLAC Large Detector (SLD) to study e[sup +]e[sup [minus

  4. Motor Neurons

    DEFF Research Database (Denmark)

    Hounsgaard, Jorn

    2017-01-01

    Motor neurons translate synaptic input from widely distributed premotor networks into patterns of action potentials that orchestrate motor unit force and motor behavior. Intercalated between the CNS and muscles, motor neurons add to and adjust the final motor command. The identity and functional...... in in vitro preparations is far from complete. Nevertheless, a foundation has been provided for pursuing functional significance of intrinsic response properties in motoneurons in vivo during motor behavior at levels from molecules to systems....

  5. Measurements of Γ(ZO → b bar b)/Γ(ZO → hadrons) using the SLD

    International Nuclear Information System (INIS)

    Neal, H.A. Jr. II.

    1995-07-01

    The quantity R b = Γ(Z o →b bar b)/Γ(Z o → hadrons) is a sensitive measure of corrections to the Zbb vertex. The precision necessary to observe the top quark mass dependent corrections is close to being achieved. LEP is already observing a 1.8σ deviation from the Standard Model prediction. Knowledge of the top quark mass combined with the observation of deviations from the Standard Model prediction would indicate new physics. Models which include charged Higgs or light SUSY particles yield predictions for R b appreciably different from the Standard Model. In this thesis two independent methods are used to measure R b . One uses a general event tag which determines R b from the rate at which events are tagged as Z o → b bar b in data and the estimated rates at which various flavors of events are tagged from the Monte Carlo. The second method reduces the reliance on the Monte Carlo by separately tagging each hemisphere as containing a b-decay. The rates of single hemisphere tagged events and both hemisphere tagged events are used to determine the tagging efficiency for b-quarks directly from the data thus eliminating the main sources of systematic error present in the event tag. Both measurements take advantage of the unique environment provided by the SLAC Linear Collider (SLC) and the SLAC Large Detector (SLD). From the event tag a result of R b = 0.230±0.004 statistical ±0.013 systematic is obtained. The higher precision hemisphere tag result obtained is R b = 0.218±0.004 statistical ±0.004 systematic ±0.003 Rc

  6. [Mirror neurons].

    Science.gov (United States)

    Rubia Vila, Francisco José

    2011-01-01

    Mirror neurons were recently discovered in frontal brain areas of the monkey. They are activated when the animal makes a specific movement, but also when the animal observes the same movement in another animal. Some of them also respond to the emotional expression of other animals of the same species. These mirror neurons have also been found in humans. They respond to or "reflect" actions of other individuals in the brain and are thought to represent the basis for imitation and empathy and hence the neurobiological substrate for "theory of mind", the potential origin of language and the so-called moral instinct.

  7. SLD Design Report

    International Nuclear Information System (INIS)

    1984-05-01

    This Design Report describes the plans for the construction of the second detector for the SLAC Linear Collider to study e + e - collisions at energies of up to 100 GeV in the center-of-mass. Particle tracking and momentum measurement are provided by a vertex detector, a high-precision central drift chamber, and pairs of endcap drift chambers, all in a 1 Tesla magnetic field produced by a superconducting solenoid. Particle identification is provided by CRIDs (Cerenkov Ring Imaging Detectors). Calorimetry is done in two parts; a liquid argon calorimeter (LAC) with uranium and iron radiators is located inside the coil, and the laminated iron of the flux return is instrumented with limited-streamer-mode tubes to complete the hadron calorimetry. The streamer tubes of this warm-iron calorimeter, called the WIC, are instrumented with strip readout to provide muon tracking in addition to calorimetry. The same technology is used on the end structures of the detector and the central region, thus providing uniform response in both regions

  8. Strange meson spectroscopy in Kω and KΦ at 11 GeV/c and Cherenkov ring imaging at SLD

    Energy Technology Data Exchange (ETDEWEB)

    Kwon, Youngjoon [Stanford Univ., CA (United States)

    1993-01-01

    This thesis consists of two independent parts; development of Cherenkov Ring Imaging Detector (CRID) system and analysis of high-statistics data of strange meson reactions from the LASS spectrometer. Part 1: The CRID system is devoted to charged particle identification in the SLAC Large Detector (SLD) to study e+e- collisions at √s = mZ0. By measuring the angles of emission of the Cherenkov photons inside liquid and gaseous radiators, {pi}/K/p separation will be achieved up to ~30 GeV/c. The signals from CRID are read in three coordinates, one of which is measured by charge-division technique. To obtain a ~1% spatial resolution in the charge-division, low-noise CRID preamplifier prototypes were developed and tested resulting in <1000 electrons noise for an average photoelectron signal with 2 x 105 gain. To help ensure the long-term stability of CRID operation at high efficiency, a comprehensive monitoring and control system was developed. Part 2: Results from the partial wave analysis of strange meson final states in the reactions K-p → K-ωp and K-p → $\\bar{K}$0Φn are presented. The analyses are based on data from a 4.1 event/nb exposure of the LASS spectrometer in K-p interactions at 11 GeV/c. The data sample of K-ωp final state contains {approximately}105 events. From the partial wave analysis, resonance structures of JP= 2-, 3- and 2+ amplitudes are observed in the Kω system. The analysis of 2- amplitudes provides an evidence for two strange meson states in the mass region around 1.75 GeV/c2. The appropriate branching fractions are calculated and compared with the SU(3) predictions. The partial wave analysis of $\\bar{K}$0Φ system favors JP = 1- and 2+ states in the 1.9--2.0 GeV/c2 region.

  9. Expression of alpha and beta subunit isoforms of Na,K-ATPase in the mouse inner ear and changes with mutations at the Wv or Sld loci.

    Science.gov (United States)

    Schulte, B A; Steel, K P

    1994-07-01

    Mice homozygous for mutations at the viable dominant spotting (Wv) and Steel-dickie (Sld) loci exhibit a similar phenotype which includes deafness. The auditory dysfunction derives from failure of the stria vascularis to develop normally and to generate a high positive endocochlear potential (EP). Because strial function is driven by Na,K-ATPase its expression was investigated in inner ears of Wv/Wv and Sld/Sld mice and their wild-type littermates by immunostaining with antisera against four of the enzyme's subunit isoforms. Wild-type mice from two different genetic backgrounds showed an identical distribution of subunit isoforms among inner ear transport cells. Several epithelial cell types coexpressed the alpha 1 and beta 1 subunits. Vestibular dark cells showed no reactivity for beta 1 but expressed abundant beta 2, whereas, strial marginal cells stained strongly for both beta isoforms. The only qualitative difference between mutant and wild-type mice was the absence of beta 1 subunit in marginal cells of the mutant's stria. However, it is unlikely that this difference accounts for failure of mutants to generate a high EP because the beta 1 subunit is not present in the stria vascularis of either rats or gerbils with normal EP values. Strong immunostaining for Na,K-ATPase in lateral wall fibrocytes of normal mice along with diminished immunoreactivity in the mutants supports the concept that these strategically located transport fibrocytes actively resorb K+ leaked across Reissner's membrane into scala vestibuli or effluxed from hair cells and nerves into scala tympani. It is further speculated that the resorbed K+ normally is siphoned down its concentration gradient into the intrastrial space through gap junctions between fibrocytes and strial basal and intermediate cells where it is recycled back to endolymph via marginal cells. Thus, failure of mutants to generate a positive EP could be explained by the absence of intermediate cells which may form the final

  10. Neurons other than motor neurons in motor neuron disease.

    Science.gov (United States)

    Ruffoli, Riccardo; Biagioni, Francesca; Busceti, Carla L; Gaglione, Anderson; Ryskalin, Larisa; Gambardella, Stefano; Frati, Alessandro; Fornai, Francesco

    2017-11-01

    Amyotrophic lateral sclerosis (ALS) is typically defined by a loss of motor neurons in the central nervous system. Accordingly, morphological analysis for decades considered motor neurons (in the cortex, brainstem and spinal cord) as the neuronal population selectively involved in ALS. Similarly, this was considered the pathological marker to score disease severity ex vivo both in patients and experimental models. However, the concept of non-autonomous motor neuron death was used recently to indicate the need for additional cell types to produce motor neuron death in ALS. This means that motor neuron loss occurs only when they are connected with other cell types. This concept originally emphasized the need for resident glia as well as non-resident inflammatory cells. Nowadays, the additional role of neurons other than motor neurons emerged in the scenario to induce non-autonomous motor neuron death. In fact, in ALS neurons diverse from motor neurons are involved. These cells play multiple roles in ALS: (i) they participate in the chain of events to produce motor neuron loss; (ii) they may even degenerate more than and before motor neurons. In the present manuscript evidence about multi-neuronal involvement in ALS patients and experimental models is discussed. Specific sub-classes of neurons in the whole spinal cord are reported either to degenerate or to trigger neuronal degeneration, thus portraying ALS as a whole spinal cord disorder rather than a disease affecting motor neurons solely. This is associated with a novel concept in motor neuron disease which recruits abnormal mechanisms of cell to cell communication.

  11. Robust Replication Control Is Generated by Temporal Gaps between Licensing and Firing Phases and Depends on Degradation of Firing Factor Sld2

    Directory of Open Access Journals (Sweden)

    Karl-Uwe Reusswig

    2016-10-01

    Full Text Available Temporal separation of DNA replication initiation into licensing and firing phases ensures the precise duplication of the genome during each cell cycle. Cyclin-dependent kinase (CDK is known to generate this separation by activating firing factors and at the same time inhibiting licensing factors but may not be sufficient to ensure robust separation at transitions between both phases. Here, we show that a temporal gap separates the inactivation of firing factors from the re-activation of licensing factors during mitosis in budding yeast. We find that gap size critically depends on phosphorylation-dependent degradation of the firing factor Sld2 mediated by CDK, DDK, Mck1, and Cdc5 kinases and the ubiquitin-ligases Dma1/2. Stable mutants of Sld2 minimize the gap and cause increased genome instability in an origin-dependent manner when combined with deregulation of other replication regulators or checkpoint mechanisms. Robust separation of licensing and firing phases therefore appears indispensable to safeguard genome stability.

  12. Anti-Stokes effect CCD camera and SLD based optical coherence tomography for full-field imaging in the 1550nm region

    Science.gov (United States)

    Kredzinski, Lukasz; Connelly, Michael J.

    2012-06-01

    Full-field Optical coherence tomography is an en-face interferometric imaging technology capable of carrying out high resolution cross-sectional imaging of the internal microstructure of an examined specimen in a non-invasive manner. The presented system is based on competitively priced optical components available at the main optical communications band located in the 1550 nm region. It consists of a superluminescent diode and an anti-stokes imaging device. The single mode fibre coupled SLD was connected to a multi-mode fibre inserted into a mode scrambler to obtain spatially incoherent illumination, suitable for OCT wide-field modality in terms of crosstalk suppression and image enhancement. This relatively inexpensive system with moderate resolution of approximately 24um x 12um (axial x lateral) was constructed to perform a 3D cross sectional imaging of a human tooth. To our knowledge this is the first 1550 nm full-field OCT system reported.

  13. QCD test in three-jet Z0 decays at SLD and detector development for H0 → γγ searches in high energy hadron colliders

    International Nuclear Information System (INIS)

    Hwang, Hyun.

    1994-08-01

    Polarized Z degrees decays into three jets have been detected and measured in the SLAC Large Detector (SLD) experiment operating it the SLAC Linear Collider (SLC). The hadrons from the jets were detected in the SLD liquid argon calorimeter, providing a sensitivity over 98% of the solid angle. The spin of the gluon was tested by studying the scaled jet energies (x 1 , x 2 , x 3 ), the Ellis-Karliner angle (cosθ EK ) and the parameters of event plane orientation (α, α N , β). These measured variables are compared with quantum chromodynamics (QCD) and a scalar gluon model. Good agreement is found between data, and the vector QCD model for the distributions of (x 1 , x 2 , x 3 ) and (cosθ EK ). Two detector prototypes for the GEM detector of the Superconducting Super Collider have been studied: a prototype silicon-tungsten preradiator and a liquid argon hadron calorimeter. The silicon-tungsten preradiator was designed for the GEM detector to distinguish between single photons from Higgs decay and background photon pairs from π degrees decay. This preradiator was tested in a beam at Brookhaven National Laboratory in July, 1992. A lead glass array placed behind the silicon was used to determine energy resolution effects. The results from the test on spatial distributions and energy resolution, including correction for the energy deposited in the preradiator are presented, along with comparisons to EGS simulations. Data from a beam test of the liquid argon prototype was analyzed and compared to CALOR89 simulations. The studies concentrated on energy resolution optimization and electronic noise suppression

  14. Neuronal Migration Disorders

    Science.gov (United States)

    ... Understanding Sleep The Life and Death of a Neuron Genes At Work In The Brain Order Publications ... birth defects caused by the abnormal migration of neurons in the developing brain and nervous system. In ...

  15. Motor Neuron Diseases

    Science.gov (United States)

    ... and other neurodegenerative diseases to better understand the function of neurons and other support cells and identify candidate therapeutic ... and other neurodegenerative diseases to better understand the function of neurons and other support cells and identify candidate therapeutic ...

  16. Part I. A study of the decays D → Kππeν and D → K*πeν. Part II. SLD Cherenkov Ring Imaging Detector development

    International Nuclear Information System (INIS)

    Huber, J.S.

    1992-01-01

    A thesis in two independent halves. Part I. A search for the exclusive semileptonic decay modes D + → bar K ππ + ν e and D + → bar K * πe + ν e are presented using data from the Fermi-lab photoproduction experiment E691. With good sensitivity, the author observes no signals in the channels D + → K - π + π degrees e + ν e and D + → bar K degrees π + π - e + ν e , and set upper limits that represent only a small fraction of the inclusive semileptonic branching ration. The experiment was conducted at the Fermi-lab tagged Photon Laboratory, using a large acceptance spectrometer with silicon microvertex detector to extract a large, clean charm sample. Part II. The physics, design, and results of the Stanford Large Detector (SLD) Cherenkov Ring Imaging Detector (CRID) are described. The physics motivation and performance for the SLD CRID, the principles of Cherenkov detection, and a description of the SLD CRID are combined with a detailed description of the production and testing of the mirrors. In addition, results from the engineering run and cosmic ray tests demonstrate the current status of the system

  17. Kappe neurons, a novel population of olfactory sensory neurons

    OpenAIRE

    Ahuja, Gaurav; Nia, Shahrzad Bozorg; Zapilko, Veronika; Shiriagin, Vladimir; Kowatschew, Daniel; Oka, Yuichiro; Korsching, Sigrun I.

    2014-01-01

    Perception of olfactory stimuli is mediated by distinct populations of olfactory sensory neurons, each with a characteristic set of morphological as well as functional parameters. Beyond two large populations of ciliated and microvillous neurons, a third population, crypt neurons, has been identified in teleost and cartilaginous fishes. We report here a novel, fourth olfactory sensory neuron population in zebrafish, which we named kappe neurons for their characteristic shape. Kappe neurons ar...

  18. NEURON and Python.

    Science.gov (United States)

    Hines, Michael L; Davison, Andrew P; Muller, Eilif

    2009-01-01

    The NEURON simulation program now allows Python to be used, alone or in combination with NEURON's traditional Hoc interpreter. Adding Python to NEURON has the immediate benefit of making available a very extensive suite of analysis tools written for engineering and science. It also catalyzes NEURON software development by offering users a modern programming tool that is recognized for its flexibility and power to create and maintain complex programs. At the same time, nothing is lost because all existing models written in Hoc, including graphical user interface tools, continue to work without change and are also available within the Python context. An example of the benefits of Python availability is the use of the xml module in implementing NEURON's Import3D and CellBuild tools to read MorphML and NeuroML model specifications.

  19. Spinal cord: motor neuron diseases.

    Science.gov (United States)

    Rezania, Kourosh; Roos, Raymond P

    2013-02-01

    Spinal cord motor neuron diseases affect lower motor neurons in the ventral horn. This article focuses on the most common spinal cord motor neuron disease, amyotrophic lateral sclerosis, which also affects upper motor neurons. Also discussed are other motor neuron diseases that only affect the lower motor neurons. Despite the identification of several genes associated with familial amyotrophic lateral sclerosis, the pathogenesis of this complex disease remains elusive. Copyright © 2013 Elsevier Inc. All rights reserved.

  20. Neuronal-glial trafficking

    International Nuclear Information System (INIS)

    Bachelard, H.S.

    2001-01-01

    Full text: The name 'glia' originates from the Greek word for glue, because astro glia (or astrocytes) were thought only to provide an anatomical framework for the electrically-excitable neurones. However, awareness that astrocytes perform vital roles in protecting the neurones, which they surround, emerged from evidence that they act as neuroprotective K + -sinks, and that they remove potentially toxic extracellular glutamate from the vicinity of the neurones. The astrocytes convert the glutamate to non-toxic glutamine which is returned to the neurones and used to replenish transmitter glutamate. This 'glutamate-glutamine cycle' (established in the 1960s by Berl and his colleagues) also contributes to protecting the neurones against a build-up of toxic ammonia. Glial cells also supply the neurones with components for free-radical scavenging glutathione. Recent studies have revealed that glial cells play a more positive interactive role in furnishing the neurones with fuels. Studies using radioactive 14 C, 13 C-MRS and 15 N-GCMS have revealed that glia produce alanine, lactate and proline for consumption by neurones, with increased formation of neurotransmitter glutamate. On neuronal activation the release of NH 4 + and glutamate from the neurones stimulates glucose uptake and glycolysis in the glia to produce more alanine, which can be regarded as an 'alanine-glutamate cycle' Use of 14 C-labelled precursors provided early evidence that neurotransmitter GABA may be partly derived from glial glutamine, and this has been confirmed recently in vivo by MRS isotopomer analysis of the GABA and glutamine labelled from 13 C-acetate. Relative rates of intermediary metabolism in glia and neurones can be calculated using a combination of [1- 13 C] glucose and [1,2- 13 C] acetate. When glutamate is released by neurones there is a net neuronal loss of TCA intermediates which have to be replenished. Part of this is derived from carboxylation of pyruvate, (pyruvate carboxylase

  1. Single neuron computation

    CERN Document Server

    McKenna, Thomas M; Zornetzer, Steven F

    1992-01-01

    This book contains twenty-two original contributions that provide a comprehensive overview of computational approaches to understanding a single neuron structure. The focus on cellular-level processes is twofold. From a computational neuroscience perspective, a thorough understanding of the information processing performed by single neurons leads to an understanding of circuit- and systems-level activity. From the standpoint of artificial neural networks (ANNs), a single real neuron is as complex an operational unit as an entire ANN, and formalizing the complex computations performed by real n

  2. Mesmerising mirror neurons.

    Science.gov (United States)

    Heyes, Cecilia

    2010-06-01

    Mirror neurons have been hailed as the key to understanding social cognition. I argue that three currents of thought-relating to evolution, atomism and telepathy-have magnified the perceived importance of mirror neurons. When they are understood to be a product of associative learning, rather than an adaptation for social cognition, mirror neurons are no longer mesmerising, but they continue to raise important questions about both the psychology of science and the neural bases of social cognition. Copyright 2010 Elsevier Inc. All rights reserved.

  3. The mirror neuron system.

    Science.gov (United States)

    Cattaneo, Luigi; Rizzolatti, Giacomo

    2009-05-01

    Mirror neurons are a class of neurons, originally discovered in the premotor cortex of monkeys, that discharge both when individuals perform a given motor act and when they observe others perform that same motor act. Ample evidence demonstrates the existence of a cortical network with the properties of mirror neurons (mirror system) in humans. The human mirror system is involved in understanding others' actions and their intentions behind them, and it underlies mechanisms of observational learning. Herein, we will discuss the clinical implications of the mirror system.

  4. Neuromorphic Silicon Neuron Circuits

    Science.gov (United States)

    Indiveri, Giacomo; Linares-Barranco, Bernabé; Hamilton, Tara Julia; van Schaik, André; Etienne-Cummings, Ralph; Delbruck, Tobi; Liu, Shih-Chii; Dudek, Piotr; Häfliger, Philipp; Renaud, Sylvie; Schemmel, Johannes; Cauwenberghs, Gert; Arthur, John; Hynna, Kai; Folowosele, Fopefolu; Saighi, Sylvain; Serrano-Gotarredona, Teresa; Wijekoon, Jayawan; Wang, Yingxue; Boahen, Kwabena

    2011-01-01

    Hardware implementations of spiking neurons can be extremely useful for a large variety of applications, ranging from high-speed modeling of large-scale neural systems to real-time behaving systems, to bidirectional brain–machine interfaces. The specific circuit solutions used to implement silicon neurons depend on the application requirements. In this paper we describe the most common building blocks and techniques used to implement these circuits, and present an overview of a wide range of neuromorphic silicon neurons, which implement different computational models, ranging from biophysically realistic and conductance-based Hodgkin–Huxley models to bi-dimensional generalized adaptive integrate and fire models. We compare the different design methodologies used for each silicon neuron design described, and demonstrate their features with experimental results, measured from a wide range of fabricated VLSI chips. PMID:21747754

  5. Neuromorphic silicon neuron circuits

    Directory of Open Access Journals (Sweden)

    Giacomo eIndiveri

    2011-05-01

    Full Text Available Hardware implementations of spiking neurons can be extremely useful for a large variety of applications, ranging from high-speed modeling of large-scale neural systems to real-time behaving systems, to bidirectional brain-machine interfaces. The specific circuit solutions used to implement silicon neurons depend on the application requirements. In this paper we describe the most common building blocks and techniques used to implement these circuits, and present an overview of a wide range of neuromorphic silicon neurons, which implement different computational models, ranging from biophysically realistic and conductance based Hodgkin-Huxley models to bi-dimensional generalized adaptive Integrate and Fire models. We compare the different design methodologies used for each silicon neuron design described, and demonstrate their features with experimental results, measured from a wide range of fabricated VLSI chips.

  6. NeuronBank: a tool for cataloging neuronal circuitry

    Directory of Open Access Journals (Sweden)

    Paul S Katz

    2010-04-01

    Full Text Available The basic unit of any nervous system is the neuron. Therefore, understanding the operation of nervous systems ultimately requires an inventory of their constituent neurons and synaptic connectivity, which form neural circuits. The presence of uniquely identifiable neurons or classes of neurons in many invertebrates has facilitated the construction of cellular-level connectivity diagrams that can be generalized across individuals within a species. Homologous neurons can also be recognized across species. Here we describe NeuronBank.org, a web-based tool that we are developing for cataloging, searching, and analyzing neuronal circuitry within and across species. Information from a single species is represented in an individual branch of NeuronBank. Users can search within a branch or perform queries across branches to look for similarities in neuronal circuits across species. The branches allow for an extensible ontology so that additional characteristics can be added as knowledge grows. Each entry in NeuronBank generates a unique accession ID, allowing it to be easily cited. There is also an automatic link to a Wiki page allowing an encyclopedic explanation of the entry. All of the 44 previously published neurons plus one previously unpublished neuron from the mollusc, Tritonia diomedea, have been entered into a branch of NeuronBank as have 4 previously published neurons from the mollusc, Melibe leonina. The ability to organize information about neuronal circuits will make this information more accessible, ultimately aiding research on these important models.

  7. Neuronal avalanches and learning

    Energy Technology Data Exchange (ETDEWEB)

    Arcangelis, Lucilla de, E-mail: dearcangelis@na.infn.it [Department of Information Engineering and CNISM, Second University of Naples, 81031 Aversa (Italy)

    2011-05-01

    Networks of living neurons represent one of the most fascinating systems of biology. If the physical and chemical mechanisms at the basis of the functioning of a single neuron are quite well understood, the collective behaviour of a system of many neurons is an extremely intriguing subject. Crucial ingredient of this complex behaviour is the plasticity property of the network, namely the capacity to adapt and evolve depending on the level of activity. This plastic ability is believed, nowadays, to be at the basis of learning and memory in real brains. Spontaneous neuronal activity has recently shown features in common to other complex systems. Experimental data have, in fact, shown that electrical information propagates in a cortex slice via an avalanche mode. These avalanches are characterized by a power law distribution for the size and duration, features found in other problems in the context of the physics of complex systems and successful models have been developed to describe their behaviour. In this contribution we discuss a statistical mechanical model for the complex activity in a neuronal network. The model implements the main physiological properties of living neurons and is able to reproduce recent experimental results. Then, we discuss the learning abilities of this neuronal network. Learning occurs via plastic adaptation of synaptic strengths by a non-uniform negative feedback mechanism. The system is able to learn all the tested rules, in particular the exclusive OR (XOR) and a random rule with three inputs. The learning dynamics exhibits universal features as function of the strength of plastic adaptation. Any rule could be learned provided that the plastic adaptation is sufficiently slow.

  8. Neuronal avalanches and learning

    International Nuclear Information System (INIS)

    Arcangelis, Lucilla de

    2011-01-01

    Networks of living neurons represent one of the most fascinating systems of biology. If the physical and chemical mechanisms at the basis of the functioning of a single neuron are quite well understood, the collective behaviour of a system of many neurons is an extremely intriguing subject. Crucial ingredient of this complex behaviour is the plasticity property of the network, namely the capacity to adapt and evolve depending on the level of activity. This plastic ability is believed, nowadays, to be at the basis of learning and memory in real brains. Spontaneous neuronal activity has recently shown features in common to other complex systems. Experimental data have, in fact, shown that electrical information propagates in a cortex slice via an avalanche mode. These avalanches are characterized by a power law distribution for the size and duration, features found in other problems in the context of the physics of complex systems and successful models have been developed to describe their behaviour. In this contribution we discuss a statistical mechanical model for the complex activity in a neuronal network. The model implements the main physiological properties of living neurons and is able to reproduce recent experimental results. Then, we discuss the learning abilities of this neuronal network. Learning occurs via plastic adaptation of synaptic strengths by a non-uniform negative feedback mechanism. The system is able to learn all the tested rules, in particular the exclusive OR (XOR) and a random rule with three inputs. The learning dynamics exhibits universal features as function of the strength of plastic adaptation. Any rule could be learned provided that the plastic adaptation is sufficiently slow.

  9. Kappe neurons, a novel population of olfactory sensory neurons.

    Science.gov (United States)

    Ahuja, Gaurav; Bozorg Nia, Shahrzad; Zapilko, Veronika; Shiriagin, Vladimir; Kowatschew, Daniel; Oka, Yuichiro; Korsching, Sigrun I

    2014-02-10

    Perception of olfactory stimuli is mediated by distinct populations of olfactory sensory neurons, each with a characteristic set of morphological as well as functional parameters. Beyond two large populations of ciliated and microvillous neurons, a third population, crypt neurons, has been identified in teleost and cartilaginous fishes. We report here a novel, fourth olfactory sensory neuron population in zebrafish, which we named kappe neurons for their characteristic shape. Kappe neurons are identified by their Go-like immunoreactivity, and show a distinct spatial distribution within the olfactory epithelium, similar to, but significantly different from that of crypt neurons. Furthermore, kappe neurons project to a single identified target glomerulus within the olfactory bulb, mdg5 of the mediodorsal cluster, whereas crypt neurons are known to project exclusively to the mdg2 glomerulus. Kappe neurons are negative for established markers of ciliated, microvillous and crypt neurons, but appear to have microvilli. Kappe neurons constitute the fourth type of olfactory sensory neurons reported in teleost fishes and their existence suggests that encoding of olfactory stimuli may require a higher complexity than hitherto assumed already in the peripheral olfactory system.

  10. Stochastic neuron models

    CERN Document Server

    Greenwood, Priscilla E

    2016-01-01

    This book describes a large number of open problems in the theory of stochastic neural systems, with the aim of enticing probabilists to work on them. This includes problems arising from stochastic models of individual neurons as well as those arising from stochastic models of the activities of small and large networks of interconnected neurons. The necessary neuroscience background to these problems is outlined within the text, so readers can grasp the context in which they arise. This book will be useful for graduate students and instructors providing material and references for applying probability to stochastic neuron modeling. Methods and results are presented, but the emphasis is on questions where additional stochastic analysis may contribute neuroscience insight. An extensive bibliography is included. Dr. Priscilla E. Greenwood is a Professor Emerita in the Department of Mathematics at the University of British Columbia. Dr. Lawrence M. Ward is a Professor in the Department of Psychology and the Brain...

  11. Neuronal Migration and Neuronal Migration Disorder in Cerebral Cortex

    OpenAIRE

    SUN, Xue-Zhi; TAKAHASHI, Sentaro; GUI, Chun; ZHANG, Rui; KOGA, Kazuo; NOUYE, Minoru; MURATA, Yoshiharu

    2002-01-01

    Neuronal cell migration is one of the most significant features during cortical development. After final mitosis, neurons migrate from the ventricular zone into the cortical plate, and then establish neuronal lamina and settle onto the outermost layer, forming an "inside-out" gradient of maturation. Neuronal migration is guided by radial glial fibers and also needs proper receptors, ligands, and other unknown extracellular factors, requests local signaling (e.g. some emitted by the Cajal-Retz...

  12. Neuronal nets in robotics

    International Nuclear Information System (INIS)

    Jimenez Sanchez, Raul

    1999-01-01

    The paper gives a generic idea of the solutions that the neuronal nets contribute to the robotics. The advantages and the inconveniences are exposed that have regarding the conventional techniques. It also describe the more excellent applications as the pursuit of trajectories, the positioning based on images, the force control or of the mobile robots management, among others

  13. Vasculo-Neuronal Coupling: Retrograde Vascular Communication to Brain Neurons.

    Science.gov (United States)

    Kim, Ki Jung; Ramiro Diaz, Juan; Iddings, Jennifer A; Filosa, Jessica A

    2016-12-14

    Continuous cerebral blood flow is essential for neuronal survival, but whether vascular tone influences resting neuronal function is not known. Using a multidisciplinary approach in both rat and mice brain slices, we determined whether flow/pressure-evoked increases or decreases in parenchymal arteriole vascular tone, which result in arteriole constriction and dilation, respectively, altered resting cortical pyramidal neuron activity. We present evidence for intercellular communication in the brain involving a flow of information from vessel to astrocyte to neuron, a direction opposite to that of classic neurovascular coupling and referred to here as vasculo-neuronal coupling (VNC). Flow/pressure increases within parenchymal arterioles increased vascular tone and simultaneously decreased resting pyramidal neuron firing activity. On the other hand, flow/pressure decreases evoke parenchymal arteriole dilation and increased resting pyramidal neuron firing activity. In GLAST-CreERT2; R26-lsl-GCaMP3 mice, we demonstrate that increased parenchymal arteriole tone significantly increased intracellular calcium in perivascular astrocyte processes, the onset of astrocyte calcium changes preceded the inhibition of cortical pyramidal neuronal firing activity. During increases in parenchymal arteriole tone, the pyramidal neuron response was unaffected by blockers of nitric oxide, GABA A , glutamate, or ecto-ATPase. However, VNC was abrogated by TRPV4 channel, GABA B , as well as an adenosine A 1 receptor blocker. Differently to pyramidal neuron responses, increases in flow/pressure within parenchymal arterioles increased the firing activity of a subtype of interneuron. Together, these data suggest that VNC is a complex constitutive active process that enables neurons to efficiently adjust their resting activity according to brain perfusion levels, thus safeguarding cellular homeostasis by preventing mismatches between energy supply and demand. We present evidence for vessel-to-neuron

  14. Neuronal survival in the brain: neuron type-specific mechanisms

    DEFF Research Database (Denmark)

    Pfisterer, Ulrich Gottfried; Khodosevich, Konstantin

    2017-01-01

    Neurogenic regions of mammalian brain produce many more neurons that will eventually survive and reach a mature stage. Developmental cell death affects both embryonically produced immature neurons and those immature neurons that are generated in regions of adult neurogenesis. Removal of substantial...... numbers of neurons that are not yet completely integrated into the local circuits helps to ensure that maturation and homeostatic function of neuronal networks in the brain proceed correctly. External signals from brain microenvironment together with intrinsic signaling pathways determine whether...... for survival in a certain brain region. This review focuses on how immature neurons survive during normal and impaired brain development, both in the embryonic/neonatal brain and in brain regions associated with adult neurogenesis, and emphasizes neuron type-specific mechanisms that help to survive for various...

  15. Neuronal synchrony: peculiarity and generality.

    Science.gov (United States)

    Nowotny, Thomas; Huerta, Ramon; Rabinovich, Mikhail I

    2008-09-01

    Synchronization in neuronal systems is a new and intriguing application of dynamical systems theory. Why are neuronal systems different as a subject for synchronization? (1) Neurons in themselves are multidimensional nonlinear systems that are able to exhibit a wide variety of different activity patterns. Their "dynamical repertoire" includes regular or chaotic spiking, regular or chaotic bursting, multistability, and complex transient regimes. (2) Usually, neuronal oscillations are the result of the cooperative activity of many synaptically connected neurons (a neuronal circuit). Thus, it is necessary to consider synchronization between different neuronal circuits as well. (3) The synapses that implement the coupling between neurons are also dynamical elements and their intrinsic dynamics influences the process of synchronization or entrainment significantly. In this review we will focus on four new problems: (i) the synchronization in minimal neuronal networks with plastic synapses (synchronization with activity dependent coupling), (ii) synchronization of bursts that are generated by a group of nonsymmetrically coupled inhibitory neurons (heteroclinic synchronization), (iii) the coordination of activities of two coupled neuronal networks (partial synchronization of small composite structures), and (iv) coarse grained synchronization in larger systems (synchronization on a mesoscopic scale). (c) 2008 American Institute of Physics.

  16. From Neurons to Newtons

    DEFF Research Database (Denmark)

    Nielsen, Bjørn Gilbert

    2001-01-01

    proteins generate forces, to the macroscopic levels where overt arm movements are vol- untarily controlled within an unpredictable environment by legions of neurons¯ring in orderly fashion. An extensive computer simulation system has been developed for this thesis, which at present contains a neural...... network scripting language for specifying arbitrary neural architectures, de¯nition ¯les for detailed spinal networks, various biologically realistic models of neurons, and dynamic synapses. Also included are structurally accurate models of intrafusal and extra-fusal muscle ¯bers and a general body...... that an explicit function may be derived which expresses the force that the spindle contractile elements must produce to exactly counter spindle unloading during muscle shortening. This information was used to calculate the corresponding "optimal" °-motoneuronal activity level. For some simple arm movement tasks...

  17. Criticality in Neuronal Networks

    Science.gov (United States)

    Friedman, Nir; Ito, Shinya; Brinkman, Braden A. W.; Shimono, Masanori; Deville, R. E. Lee; Beggs, John M.; Dahmen, Karin A.; Butler, Tom C.

    2012-02-01

    In recent years, experiments detecting the electrical firing patterns in slices of in vitro brain tissue have been analyzed to suggest the presence of scale invariance and possibly criticality in the brain. Much of the work done however has been limited in two ways: 1) the data collected is from local field potentials that do not represent the firing of individual neurons; 2) the analysis has been primarily limited to histograms. In our work we examine data based on the firing of individual neurons (spike data), and greatly extend the analysis by considering shape collapse and exponents. Our results strongly suggest that the brain operates near a tuned critical point of a highly distinctive universality class.

  18. Parvalbumin+ Neurons and Npas1+ Neurons Are Distinct Neuron Classes in the Mouse External Globus Pallidus.

    Science.gov (United States)

    Hernández, Vivian M; Hegeman, Daniel J; Cui, Qiaoling; Kelver, Daniel A; Fiske, Michael P; Glajch, Kelly E; Pitt, Jason E; Huang, Tina Y; Justice, Nicholas J; Chan, C Savio

    2015-08-26

    Compelling evidence suggests that pathological activity of the external globus pallidus (GPe), a nucleus in the basal ganglia, contributes to the motor symptoms of a variety of movement disorders such as Parkinson's disease. Recent studies have challenged the idea that the GPe comprises a single, homogenous population of neurons that serves as a simple relay in the indirect pathway. However, we still lack a full understanding of the diversity of the neurons that make up the GPe. Specifically, a more precise classification scheme is needed to better describe the fundamental biology and function of different GPe neuron classes. To this end, we generated a novel multicistronic BAC (bacterial artificial chromosome) transgenic mouse line under the regulatory elements of the Npas1 gene. Using a combinatorial transgenic and immunohistochemical approach, we discovered that parvalbumin-expressing neurons and Npas1-expressing neurons in the GPe represent two nonoverlapping cell classes, amounting to 55% and 27% of the total GPe neuron population, respectively. These two genetically identified cell classes projected primarily to the subthalamic nucleus and to the striatum, respectively. Additionally, parvalbumin-expressing neurons and Npas1-expressing neurons were distinct in their autonomous and driven firing characteristics, their expression of intrinsic ion conductances, and their responsiveness to chronic 6-hydroxydopamine lesion. In summary, our data argue that parvalbumin-expressing neurons and Npas1-expressing neurons are two distinct functional classes of GPe neurons. This work revises our understanding of the GPe, and provides the foundation for future studies of its function and dysfunction. Until recently, the heterogeneity of the constituent neurons within the external globus pallidus (GPe) was not fully appreciated. We addressed this knowledge gap by discovering two principal GPe neuron classes, which were identified by their nonoverlapping expression of the

  19. Parvalbumin+ Neurons and Npas1+ Neurons Are Distinct Neuron Classes in the Mouse External Globus Pallidus

    Science.gov (United States)

    Hernández, Vivian M.; Hegeman, Daniel J.; Cui, Qiaoling; Kelver, Daniel A.; Fiske, Michael P.; Glajch, Kelly E.; Pitt, Jason E.; Huang, Tina Y.; Justice, Nicholas J.

    2015-01-01

    Compelling evidence suggests that pathological activity of the external globus pallidus (GPe), a nucleus in the basal ganglia, contributes to the motor symptoms of a variety of movement disorders such as Parkinson's disease. Recent studies have challenged the idea that the GPe comprises a single, homogenous population of neurons that serves as a simple relay in the indirect pathway. However, we still lack a full understanding of the diversity of the neurons that make up the GPe. Specifically, a more precise classification scheme is needed to better describe the fundamental biology and function of different GPe neuron classes. To this end, we generated a novel multicistronic BAC (bacterial artificial chromosome) transgenic mouse line under the regulatory elements of the Npas1 gene. Using a combinatorial transgenic and immunohistochemical approach, we discovered that parvalbumin-expressing neurons and Npas1-expressing neurons in the GPe represent two nonoverlapping cell classes, amounting to 55% and 27% of the total GPe neuron population, respectively. These two genetically identified cell classes projected primarily to the subthalamic nucleus and to the striatum, respectively. Additionally, parvalbumin-expressing neurons and Npas1-expressing neurons were distinct in their autonomous and driven firing characteristics, their expression of intrinsic ion conductances, and their responsiveness to chronic 6-hydroxydopamine lesion. In summary, our data argue that parvalbumin-expressing neurons and Npas1-expressing neurons are two distinct functional classes of GPe neurons. This work revises our understanding of the GPe, and provides the foundation for future studies of its function and dysfunction. SIGNIFICANCE STATEMENT Until recently, the heterogeneity of the constituent neurons within the external globus pallidus (GPe) was not fully appreciated. We addressed this knowledge gap by discovering two principal GPe neuron classes, which were identified by their nonoverlapping

  20. Metabolic reprogramming during neuronal differentiation.

    Science.gov (United States)

    Agostini, M; Romeo, F; Inoue, S; Niklison-Chirou, M V; Elia, A J; Dinsdale, D; Morone, N; Knight, R A; Mak, T W; Melino, G

    2016-09-01

    Newly generated neurons pass through a series of well-defined developmental stages, which allow them to integrate into existing neuronal circuits. After exit from the cell cycle, postmitotic neurons undergo neuronal migration, axonal elongation, axon pruning, dendrite morphogenesis and synaptic maturation and plasticity. Lack of a global metabolic analysis during early cortical neuronal development led us to explore the role of cellular metabolism and mitochondrial biology during ex vivo differentiation of primary cortical neurons. Unexpectedly, we observed a huge increase in mitochondrial biogenesis. Changes in mitochondrial mass, morphology and function were correlated with the upregulation of the master regulators of mitochondrial biogenesis, TFAM and PGC-1α. Concomitant with mitochondrial biogenesis, we observed an increase in glucose metabolism during neuronal differentiation, which was linked to an increase in glucose uptake and enhanced GLUT3 mRNA expression and platelet isoform of phosphofructokinase 1 (PFKp) protein expression. In addition, glutamate-glutamine metabolism was also increased during the differentiation of cortical neurons. We identified PI3K-Akt-mTOR signalling as a critical regulator role of energy metabolism in neurons. Selective pharmacological inhibition of these metabolic pathways indicate existence of metabolic checkpoint that need to be satisfied in order to allow neuronal differentiation.

  1. Imitation, mirror neurons and autism

    OpenAIRE

    Williams, Justin H.G.; Whiten, Andrew; Suddendorf, Thomas; Perrett, David I.

    2001-01-01

    Various deficits in the cognitive functioning of people with autism have been documented in recent years but these provide only partial explanations for the condition. We focus instead on an imitative disturbance involving difficulties both in copying actions and in inhibiting more stereotyped mimicking, such as echolalia. A candidate for the neural basis of this disturbance may be found in a recently discovered class of neurons in frontal cortex, 'mirror neurons' (MNs). These neurons show ac...

  2. The biophysics of neuronal growth

    International Nuclear Information System (INIS)

    Franze, Kristian; Guck, Jochen

    2010-01-01

    For a long time, neuroscience has focused on biochemical, molecular biological and electrophysiological aspects of neuronal physiology and pathology. However, there is a growing body of evidence indicating the importance of physical stimuli for neuronal growth and development. In this review we briefly summarize the historical background of neurobiophysics and give an overview over the current understanding of neuronal growth from a physics perspective. We show how biophysics has so far contributed to a better understanding of neuronal growth and discuss current inconsistencies. Finally, we speculate how biophysics may contribute to the successful treatment of lesions to the central nervous system, which have been considered incurable until very recently.

  3. The Neuronal Ceroid-Lipofuscinoses

    Science.gov (United States)

    Bennett, Michael J.; Rakheja, Dinesh

    2013-01-01

    The neuronal ceroid-lipofuscinoses (NCL's, Batten disease) represent a group of severe neurodegenerative diseases, which mostly present in childhood. The phenotypes are similar and include visual loss, seizures, loss of motor and cognitive function, and early death. At autopsy, there is massive neuronal loss with characteristic storage in…

  4. The straintronic spin-neuron

    International Nuclear Information System (INIS)

    Biswas, Ayan K; Bandyopadhyay, Supriyo; Atulasimha, Jayasimha

    2015-01-01

    In artificial neural networks, neurons are usually implemented with highly dissipative CMOS-based operational amplifiers. A more energy-efficient implementation is a ‘spin-neuron’ realized with a magneto-tunneling junction (MTJ) that is switched with a spin-polarized current (representing weighted sum of input currents) that either delivers a spin transfer torque or induces domain wall motion in the soft layer of the MTJ to mimic neuron firing. Here, we propose and analyze a different type of spin-neuron in which the soft layer of the MTJ is switched with mechanical strain generated by a voltage (representing weighted sum of input voltages) and term it straintronic spin-neuron. It dissipates orders of magnitude less energy in threshold operations than the traditional current-driven spin neuron at 0 K temperature and may even be faster. We have also studied the room-temperature firing behaviors of both types of spin neurons and find that thermal noise degrades the performance of both types, but the current-driven type is degraded much more than the straintronic type if both are optimized for maximum energy-efficiency. On the other hand, if both are designed to have the same level of thermal degradation, then the current-driven version will dissipate orders of magnitude more energy than the straintronic version. Thus, the straintronic spin-neuron is superior to current-driven spin neurons. (paper)

  5. Neuronal discrimination capacity

    International Nuclear Information System (INIS)

    Deng Yingchun; Williams, Peter; Feng Jianfeng; Liu Feng

    2003-01-01

    We explore neuronal mechanisms of discriminating between masked signals. It is found that when the correlation between input signals is zero, the output signals are separable if and only if input signals are separable. With positively (negatively) correlated signals, the output signals are separable (mixed) even when input signals are mixed (separable). Exact values of discrimination capacity are obtained for two most interesting cases: the exactly balanced inhibitory and excitatory input case and the uncorrelated input case. Interestingly, the discrimination capacity obtained in these cases is independent of model parameters, input distribution and is universal. Our results also suggest a functional role of inhibitory inputs and correlated inputs or, more generally, the large variability of efferent spike trains observed in in vivo experiments: the larger the variability of efferent spike trains, the easier it is to discriminate between masked input signals

  6. Neuronal discrimination capacity

    Energy Technology Data Exchange (ETDEWEB)

    Deng Yingchun [Department of Mathematics, Hunan Normal University 410081, Changsha (China); COGS, University of Sussex at Brighton, BN1 9QH (United Kingdom); Williams, Peter; Feng Jianfeng [COGS, University of Sussex at Brighton, BN1 9QH (United Kingdom); Liu Feng [COGS, University of Sussex at Brighton, BN1 9QH (United Kingdom); Physics Department, Nanjing University (China)

    2003-12-19

    We explore neuronal mechanisms of discriminating between masked signals. It is found that when the correlation between input signals is zero, the output signals are separable if and only if input signals are separable. With positively (negatively) correlated signals, the output signals are separable (mixed) even when input signals are mixed (separable). Exact values of discrimination capacity are obtained for two most interesting cases: the exactly balanced inhibitory and excitatory input case and the uncorrelated input case. Interestingly, the discrimination capacity obtained in these cases is independent of model parameters, input distribution and is universal. Our results also suggest a functional role of inhibitory inputs and correlated inputs or, more generally, the large variability of efferent spike trains observed in in vivo experiments: the larger the variability of efferent spike trains, the easier it is to discriminate between masked input signals.

  7. Orexin neurons receive glycinergic innervations.

    Directory of Open Access Journals (Sweden)

    Mari Hondo

    Full Text Available Glycine, a nonessential amino-acid that acts as an inhibitory neurotransmitter in the central nervous system, is currently used as a dietary supplement to improve the quality of sleep, but its mechanism of action is poorly understood. We confirmed the effects of glycine on sleep/wakefulness behavior in mice when administered peripherally. Glycine administration increased non-rapid eye movement (NREM sleep time and decreased the amount and mean episode duration of wakefulness when administered in the dark period. Since peripheral administration of glycine induced fragmentation of sleep/wakefulness states, which is a characteristic of orexin deficiency, we examined the effects of glycine on orexin neurons. The number of Fos-positive orexin neurons markedly decreased after intraperitoneal administration of glycine to mice. To examine whether glycine acts directly on orexin neurons, we examined the effects of glycine on orexin neurons by patch-clamp electrophysiology. Glycine directly induced hyperpolarization and cessation of firing of orexin neurons. These responses were inhibited by a specific glycine receptor antagonist, strychnine. Triple-labeling immunofluorescent analysis showed close apposition of glycine transporter 2 (GlyT2-immunoreactive glycinergic fibers onto orexin-immunoreactive neurons. Immunoelectron microscopic analysis revealed that GlyT2-immunoreactive terminals made symmetrical synaptic contacts with somata and dendrites of orexin neurons. Double-labeling immunoelectron microscopy demonstrated that glycine receptor alpha subunits were localized in the postsynaptic membrane of symmetrical inhibitory synapses on orexin neurons. Considering the importance of glycinergic regulation during REM sleep, our observations suggest that glycine injection might affect the activity of orexin neurons, and that glycinergic inhibition of orexin neurons might play a role in physiological sleep regulation.

  8. Pathogenesis of motor neuron disease

    Institute of Scientific and Technical Information of China (English)

    Xuefei Wang

    2006-01-01

    OBJECTIVE: To summarize and analyze the factors and theories related to the attack of motor neuron disease, and comprehensively investigate the pathogenesis of motor neuron disease.DATA SOURCES: A search of Pubmed database was undertaken to identify articles about motor neuron disease published in English from January 1994 to June 2006 by using the keywords of "neurodegenerative diseases". Other literatures were collected by retrieving specific journals and articles.STUDY SELECTION: The data were checked primarily, articles related to the pathogenesis of motor neuron disease were involved, and those obviously irrelated to the articles were excluded.DATA EXTRACTION: Totally 54 articles were collected, 30 of them were involved, and the other 24 were excluded.DATA SYNTHESIS: The pathogenesis of motor neuron disease has multiple factors, and the present related theories included free radical oxidation, excitotoxicity, genetic and immune factors, lack of neurotrophic factor,injury of neurofilament, etc. The studies mainly come from transgenic animal models, cell culture in vitro and patients with familial motor neuron disease, but there are still many restrictions and disadvantages.CONCLUSION: It is necessary to try to find whether there is internal association among different mechanisms,comprehensively investigate the pathogenesis of motor neuron diseases, in order to provide reliable evidence for the clinical treatment.

  9. Simulating synchronization in neuronal networks

    Science.gov (United States)

    Fink, Christian G.

    2016-06-01

    We discuss several techniques used in simulating neuronal networks by exploring how a network's connectivity structure affects its propensity for synchronous spiking. Network connectivity is generated using the Watts-Strogatz small-world algorithm, and two key measures of network structure are described. These measures quantify structural characteristics that influence collective neuronal spiking, which is simulated using the leaky integrate-and-fire model. Simulations show that adding a small number of random connections to an otherwise lattice-like connectivity structure leads to a dramatic increase in neuronal synchronization.

  10. Glial tumors with neuronal differentiation.

    Science.gov (United States)

    Park, Chul-Kee; Phi, Ji Hoon; Park, Sung-Hye

    2015-01-01

    Immunohistochemical studies for neuronal differentiation in glial tumors revealed subsets of tumors having both characteristics of glial and neuronal lineages. Glial tumors with neuronal differentiation can be observed with diverse phenotypes and histologic grades. The rosette-forming glioneuronal tumor of the fourth ventricle and papillary glioneuronal tumor have been newly classified as distinct disease entities. There are other candidates for classification, such as the glioneuronal tumor without pseudopapillary architecture, glioneuronal tumor with neuropil-like islands, and the malignant glioneuronal tumor. The clinical significance of these previously unclassified tumors should be confirmed. Copyright © 2015 Elsevier Inc. All rights reserved.

  11. Mechanosensing in hypothalamic osmosensory neurons.

    Science.gov (United States)

    Prager-Khoutorsky, Masha

    2017-11-01

    Osmosensory neurons are specialized cells activated by increases in blood osmolality to trigger thirst, secretion of the antidiuretic hormone vasopressin, and elevated sympathetic tone during dehydration. In addition to multiple extrinsic factors modulating their activity, osmosensory neurons are intrinsically osmosensitive, as they are activated by increased osmolality in the absence of neighboring cells or synaptic contacts. This intrinsic osmosensitivity is a mechanical process associated with osmolality-induced changes in cell volume. This review summarises recent findings revealing molecular mechanisms underlying the mechanical activation of osmosensory neurons and highlighting important roles of microtubules, actin, and mechanosensitive ion channels in this process. Copyright © 2017 Elsevier Ltd. All rights reserved.

  12. From Neurons to Brain: Adaptive Self-Wiring of Neurons

    OpenAIRE

    Segev, Ronen; Ben-Jacob, Eshel

    1998-01-01

    During embryonic morpho-genesis, a collection of individual neurons turns into a functioning network with unique capabilities. Only recently has this most staggering example of emergent process in the natural world, began to be studied. Here we propose a navigational strategy for neurites growth cones, based on sophisticated chemical signaling. We further propose that the embryonic environment (the neurons and the glia cells) acts as an excitable media in which concentric and spiral chemical ...

  13. Imaging of intracranial neuronal and mixed neuronal-glial tumours

    International Nuclear Information System (INIS)

    Cui Shimin; Qin Jinxi; Zhang Leili; Liu Meili; Jin Song; Yan Shixin; Liu Li; Dai Weiying; Li Tao; Gao Man

    2001-01-01

    Objective: To investigate the characteristic clinical, imaging , and pathologic findings of intracranial neuronal and mixed neuronal-glial tumours. Methods: The imaging findings of surgery and pathobiology proved intracranial neuronal and mixed neuronal-glial tumours in 14 cases (7 male and 7 female, ranging in age from 6-56 years; mean age 33.8 years) were retrospectively analyzed. Results: Eight gangliogliomas were located in the frontal lobe (4 cases), temporal lobe (1 case), front- temporal lobe (2 cases), and pons (1 case). They appeared as iso-or low density on CT, iso-or low signal intensity on T 1 WI, and high signal intensity on T 2 WI on MR imaging. Two central neurocytomas were located in the supratentorial ventricles. Four desmoplastic gangliogliomas were seen as cystic masses, appearing as low signal intensity on T 1 WI and high signal intensity on T 2 WI. Conclusion: Intracranial neuronal and mixed neuronal-glial tumours had imaging characteristics. Combined with clinical history, it was possible to make a tendency preoperative diagnosis using CT or MR

  14. Tinbergen on mirror neurons

    Science.gov (United States)

    Heyes, Cecilia

    2014-01-01

    Fifty years ago, Niko Tinbergen defined the scope of behavioural biology with his four problems: causation, ontogeny, survival value and evolution. About 20 years ago, there was another highly significant development in behavioural biology—the discovery of mirror neurons (MNs). Here, I use Tinbergen's original four problems (rather than the list that appears in textbooks) to highlight the differences between two prominent accounts of MNs, the genetic and associative accounts; to suggest that the latter provides the defeasible ‘best explanation’ for current data on the causation and ontogeny of MNs; and to argue that functional analysis, of the kind that Tinbergen identified somewhat misleadingly with studies of ‘survival value’, should be a high priority for future research. In this kind of functional analysis, system-level theories would assign MNs a small, but potentially important, role in the achievement of action understanding—or another social cognitive function—by a production line of interacting component processes. These theories would be tested by experimental intervention in human and non-human animal samples with carefully documented and controlled developmental histories. PMID:24778376

  15. Neurons on the couch.

    Science.gov (United States)

    Marić, Nadja P; Jašović-Gašić, Miroslava

    2010-12-01

    A hundred years after psychoanalysis was introduced, neuroscience has taken a giant step forward. It seems nowadays that effects of psychotherapy could be monitored and measured by state-of-the art brain imaging techniques. Today, the psychotherapy is considered as a strategic and purposeful environmental influence intended to enhance learning. Since gene expression is regulated by environmental influences throughout life and these processes create brain architecture and influence the strength of synaptic connections, psychotherapy (as a kind of learning) should be explored in the context of aforementioned paradigm. In other words, when placing a client on the couch, therapist actually placed client's neuronal network; while listening and talking, expressing and analyzing, experiencing transference and counter transference, therapist tends to stabilize synaptic connections and influence dendritic growth by regulating gene-transcriptional activity. Therefore, we strongly believe that, in the near future, an increasing knowledge on cellular and molecular interactions and mechanisms of action of different psycho- and pharmaco-therapeutic procedures will enable us to tailor a sophisticated therapeutic approach toward a person, by combining major therapeutic strategies in psychiatry on the basis of rational goals and evidence-based therapeutic expectations.

  16. Tinbergen on mirror neurons.

    Science.gov (United States)

    Heyes, Cecilia

    2014-01-01

    Fifty years ago, Niko Tinbergen defined the scope of behavioural biology with his four problems: causation, ontogeny, survival value and evolution. About 20 years ago, there was another highly significant development in behavioural biology-the discovery of mirror neurons (MNs). Here, I use Tinbergen's original four problems (rather than the list that appears in textbooks) to highlight the differences between two prominent accounts of MNs, the genetic and associative accounts; to suggest that the latter provides the defeasible 'best explanation' for current data on the causation and ontogeny of MNs; and to argue that functional analysis, of the kind that Tinbergen identified somewhat misleadingly with studies of 'survival value', should be a high priority for future research. In this kind of functional analysis, system-level theories would assign MNs a small, but potentially important, role in the achievement of action understanding-or another social cognitive function-by a production line of interacting component processes. These theories would be tested by experimental intervention in human and non-human animal samples with carefully documented and controlled developmental histories.

  17. Understanding Neuronal Mechanisms of Epilepsy ...

    Indian Academy of Sciences (India)

    Admin

    α subunit of Rat Brain type IIA Voltage Gated Sodium Channel and geneticin selection ..... scaling the mother wavelet. Scale = 1/ .... through dynamic clamp. Dynamic Clamp ... It has been shown that like in vivo neurons, cortical networks in.

  18. Imitation, mirror neurons and autism.

    Science.gov (United States)

    Williams, J H; Whiten, A; Suddendorf, T; Perrett, D I

    2001-06-01

    Various deficits in the cognitive functioning of people with autism have been documented in recent years but these provide only partial explanations for the condition. We focus instead on an imitative disturbance involving difficulties both in copying actions and in inhibiting more stereotyped mimicking, such as echolalia. A candidate for the neural basis of this disturbance may be found in a recently discovered class of neurons in frontal cortex, 'mirror neurons' (MNs). These neurons show activity in relation both to specific actions performed by self and matching actions performed by others, providing a potential bridge between minds. MN systems exist in primates without imitative and 'theory of mind' abilities and we suggest that in order for them to have become utilized to perform social cognitive functions, sophisticated cortical neuronal systems have evolved in which MNs function as key elements. Early developmental failures of MN systems are likely to result in a consequent cascade of developmental impairments characterised by the clinical syndrome of autism.

  19. Information processing by neuronal populations

    National Research Council Canada - National Science Library

    Hölscher, Christian; Munk, Matthias

    2009-01-01

    ... simultaneously recorded spike trains 120 Mark Laubach, Nandakumar S. Narayanan, and Eyal Y. Kimchi Part III Neuronal population information coding and plasticity in specific brain areas 149 7 F...

  20. Chimera states in bursting neurons

    OpenAIRE

    Bera, Bidesh K.; Ghosh, Dibakar; Lakshmanan, M.

    2015-01-01

    We study the existence of chimera states in pulse-coupled networks of bursting Hindmarsh-Rose neurons with nonlocal, global and local (nearest neighbor) couplings. Through a linear stability analysis, we discuss the behavior of stability function in the incoherent (i.e. disorder), coherent, chimera and multi-chimera states. Surprisingly, we find that chimera and multi-chimera states occur even using local nearest neighbor interaction in a network of identical bursting neurons alone. This is i...

  1. Communication among neurons.

    Science.gov (United States)

    Marner, Lisbeth

    2012-04-01

    The communication among neurons is the prerequisite for the working brain. To understand the cellular, neurochemical, and structural basis of this communication, and the impacts of aging and disease on brain function, quantitative measures are necessary. This thesis evaluates several quantitative neurobiological methods with respect to possible bias and methodological issues. Stereological methods are suited for the unbiased estimation of number, length, and volumes of components of the nervous system. Stereological estimates of the total length of myelinated nerve fibers were made in white matter of post mortem brains, and the impact of aging and diseases as Schizophrenia and Alzheimer's disease were evaluated. Although stereological methods are in principle unbiased, shrinkage artifacts are difficult to account for. Positron emission tomography (PET) recordings, in conjunction with kinetic modeling, permit the quantitation of radioligand binding in brain. The novel serotonin 5-HT4 antagonist [11C]SB207145 was used as an example of the validation process for quantitative PET receptor imaging. Methods based on reference tissue as well as methods based on an arterial plasma input function were evaluated with respect to precision and accuracy. It was shown that [11C]SB207145 binding had high sensitivity to occupancy by unlabeled ligand, necessitating high specific activity in the radiosynthesis to avoid bias. The established serotonin 5-HT2A ligand [18F]altanersin was evaluated in a two-year follow-up study in elderly subjects. Application of partial volume correction of the PET data diminished the reliability of the measures, but allowed for the correct distinction between changes due to brain atrophy and receptor availability. Furthermore, a PET study of patients with Alzheimer's disease with the serotonin transporter ligand [11C]DASB showed relatively preserved serotonergic projections, despite a marked decrease in 5-HT2A receptor binding. Possible confounders are

  2. Learning of time series through neuron-to-neuron instruction

    Energy Technology Data Exchange (ETDEWEB)

    Miyazaki, Y [Department of Physics, Kyoto University, Kyoto 606-8502, (Japan); Kinzel, W [Institut fuer Theoretische Physik, Universitaet Wurzburg, 97074 Wurzburg (Germany); Shinomoto, S [Department of Physics, Kyoto University, Kyoto (Japan)

    2003-02-07

    A model neuron with delayline feedback connections can learn a time series generated by another model neuron. It has been known that some student neurons that have completed such learning under the instruction of a teacher's quasi-periodic sequence mimic the teacher's time series over a long interval, even after instruction has ceased. We found that in addition to such faithful students, there are unfaithful students whose time series eventually diverge exponentially from that of the teacher. In order to understand the circumstances that allow for such a variety of students, the orbit dimension was estimated numerically. The quasi-periodic orbits in question were found to be confined in spaces with dimensions significantly smaller than that of the full phase space.

  3. Learning of time series through neuron-to-neuron instruction

    International Nuclear Information System (INIS)

    Miyazaki, Y; Kinzel, W; Shinomoto, S

    2003-01-01

    A model neuron with delayline feedback connections can learn a time series generated by another model neuron. It has been known that some student neurons that have completed such learning under the instruction of a teacher's quasi-periodic sequence mimic the teacher's time series over a long interval, even after instruction has ceased. We found that in addition to such faithful students, there are unfaithful students whose time series eventually diverge exponentially from that of the teacher. In order to understand the circumstances that allow for such a variety of students, the orbit dimension was estimated numerically. The quasi-periodic orbits in question were found to be confined in spaces with dimensions significantly smaller than that of the full phase space

  4. The mirror-neuron system.

    Science.gov (United States)

    Rizzolatti, Giacomo; Craighero, Laila

    2004-01-01

    A category of stimuli of great importance for primates, humans in particular, is that formed by actions done by other individuals. If we want to survive, we must understand the actions of others. Furthermore, without action understanding, social organization is impossible. In the case of humans, there is another faculty that depends on the observation of others' actions: imitation learning. Unlike most species, we are able to learn by imitation, and this faculty is at the basis of human culture. In this review we present data on a neurophysiological mechanism--the mirror-neuron mechanism--that appears to play a fundamental role in both action understanding and imitation. We describe first the functional properties of mirror neurons in monkeys. We review next the characteristics of the mirror-neuron system in humans. We stress, in particular, those properties specific to the human mirror-neuron system that might explain the human capacity to learn by imitation. We conclude by discussing the relationship between the mirror-neuron system and language.

  5. Neuronal factors determining high intelligence.

    Science.gov (United States)

    Dicke, Ursula; Roth, Gerhard

    2016-01-05

    Many attempts have been made to correlate degrees of both animal and human intelligence with brain properties. With respect to mammals, a much-discussed trait concerns absolute and relative brain size, either uncorrected or corrected for body size. However, the correlation of both with degrees of intelligence yields large inconsistencies, because although they are regarded as the most intelligent mammals, monkeys and apes, including humans, have neither the absolutely nor the relatively largest brains. The best fit between brain traits and degrees of intelligence among mammals is reached by a combination of the number of cortical neurons, neuron packing density, interneuronal distance and axonal conduction velocity--factors that determine general information processing capacity (IPC), as reflected by general intelligence. The highest IPC is found in humans, followed by the great apes, Old World and New World monkeys. The IPC of cetaceans and elephants is much lower because of a thin cortex, low neuron packing density and low axonal conduction velocity. By contrast, corvid and psittacid birds have very small and densely packed pallial neurons and relatively many neurons, which, despite very small brain volumes, might explain their high intelligence. The evolution of a syntactical and grammatical language in humans most probably has served as an additional intelligence amplifier, which may have happened in songbirds and psittacids in a convergent manner. © 2015 The Author(s).

  6. Energy Model of Neuron Activation.

    Science.gov (United States)

    Romanyshyn, Yuriy; Smerdov, Andriy; Petrytska, Svitlana

    2017-02-01

    On the basis of the neurophysiological strength-duration (amplitude-duration) curve of neuron activation (which relates the threshold amplitude of a rectangular current pulse of neuron activation to the pulse duration), as well as with the use of activation energy constraint (the threshold curve corresponds to the energy threshold of neuron activation by a rectangular current pulse), an energy model of neuron activation by a single current pulse has been constructed. The constructed model of activation, which determines its spectral properties, is a bandpass filter. Under the condition of minimum-phase feature of the neuron activation model, on the basis of Hilbert transform, the possibilities of phase-frequency response calculation from its amplitude-frequency response have been considered. Approximation to the amplitude-frequency response by the response of the Butterworth filter of the first order, as well as obtaining the pulse response corresponding to this approximation, give us the possibility of analyzing the efficiency of activating current pulses of various shapes, including analysis in accordance with the energy constraint.

  7. Turning skin into dopamine neurons

    Institute of Scientific and Technical Information of China (English)

    Malin Parmar; Johan Jakobsson

    2011-01-01

    The possibility to generate neurons from fibroblasts became a reality with the development of iPS technology a few years ago.By reprogramming somatic cells using transcription factor (TF) overexpression,it is possible to generate pluripotent stem cells that then can be differentiated into any somatic cell type including various subtypes of neurons.This raises the possibility of using donor-matched or even patientspecific cells for cell therapy of neurological disorders such as Parkinson's disease (PD),Huntington's disease and stroke.Supporting this idea,dopamine neurons,which are the cells dying in PD,derived from human iPS cells have been demonstrated to survive transplantation and reverse motor symptoms in animal models of PD [1].

  8. Neuronal involvement in cisplatin neuropathy

    DEFF Research Database (Denmark)

    Krarup-Hansen, A; Helweg-Larsen, Susanne Elisabeth; Schmalbruch, H

    2007-01-01

    of large dorsal root ganglion cells. Motor conduction studies, autonomic function and warm and cold temperature sensation remained unchanged at all doses of cisplatin treatment. The results of these studies are consistent with degeneration of large sensory neurons whereas there was no evidence of distal......Although it is well known that cisplatin causes a sensory neuropathy, the primary site of involvement is not established. The clinical symptoms localized in a stocking-glove distribution may be explained by a length dependent neuronopathy or by a distal axonopathy. To study whether the whole neuron...

  9. Calcium signals in olfactory neurons.

    Science.gov (United States)

    Tareilus, E; Noé, J; Breer, H

    1995-11-09

    Laser scanning confocal microscopy in combination with the fluorescent calcium indicators Fluo-3 and Fura-Red was employed to estimate the intracellular concentration of free calcium ions in individual olfactory receptor neurons and to monitor temporal and spatial changes in the Ca(2+)-level upon stimulation. The chemosensory cells responded to odorants with a significant increase in the calcium concentration, preferentially in the dendritic knob. Applying various stimulation paradigma, it was found that in a population of isolated cells, subsets of receptor neurons display distinct patterns of responsiveness.

  10. Acetaminophen inhibits neuronal inflammation and protects neurons from oxidative stress

    Directory of Open Access Journals (Sweden)

    Grammas Paula

    2009-03-01

    Full Text Available Abstract Background Recent studies have demonstrated a link between the inflammatory response, increased cytokine formation, and neurodegeneration in the brain. The beneficial effects of anti-inflammatory drugs in neurodegenerative diseases, such as Alzheimer's disease (AD, have been documented. Increasing evidence suggests that acetaminophen has unappreciated anti-oxidant and anti-inflammatory properties. The objectives of this study are to determine the effects of acetaminophen on cultured brain neuronal survival and inflammatory factor expression when exposed to oxidative stress. Methods Cerebral cortical cultured neurons are pretreated with acetaminophen and then exposed to the superoxide-generating compound menadione (5 μM. Cell survival is assessed by MTT assay and inflammatory protein (tumor necrosis factor alpha, interleukin-1, macrophage inflammatory protein alpha, and RANTES release quantitated by ELISA. Expression of pro- and anti-apoptotic proteins is assessed by western blots. Results Acetaminophen has pro-survival effects on neurons in culture. Menadione, a superoxide releasing oxidant stressor, causes a significant (p Conclusion These data show that acetaminophen has anti-oxidant and anti-inflammatory effects on neurons and suggest a heretofore unappreciated therapeutic potential for this drug in neurodegenerative diseases such as AD that are characterized by oxidant and inflammatory stress.

  11. Neuronal coherence and its functional role in communication between neurons

    NARCIS (Netherlands)

    Zeitler-Geurds, M.

    2010-01-01

    Neuronal oscillations are observed in many brain areas in various frequency bands. Each of the frequency bands is associated with a particular functional role. Gamma oscillations (30-80 Hz) are thought to be related to cognitive tasks like memory and attention and possibly also involved in the

  12. Unbalanced Neuronal Circuits in Addiction

    OpenAIRE

    Volkow, Nora D.; Wang, Gen-Jack; Tomasi, Dardo; Baler, Ruben D.

    2013-01-01

    Through sequential waves of drug-induced neurochemical stimulation, addiction co-opts the brain's neuronal circuits that mediate reward, motivation, , to behavioral inflexibility and a severe disruption of self-control and compulsive drug intake. Brain imaging technologies have allowed neuroscientists to map out the neural landscape of addiction in the human brain and to understand how drugs modify it.

  13. Computing with Spiking Neuron Networks

    NARCIS (Netherlands)

    H. Paugam-Moisy; S.M. Bohte (Sander); G. Rozenberg; T.H.W. Baeck (Thomas); J.N. Kok (Joost)

    2012-01-01

    htmlabstractAbstract Spiking Neuron Networks (SNNs) are often referred to as the 3rd gener- ation of neural networks. Highly inspired from natural computing in the brain and recent advances in neurosciences, they derive their strength and interest from an ac- curate modeling of synaptic interactions

  14. What do mirror neurons mirror?

    NARCIS (Netherlands)

    Uithol, S.; Rooij, I.J.E.I. van; Bekkering, H.; Haselager, W.F.G.

    2011-01-01

    Single cell recordings in monkeys provide strong evidence for an important role of the motor system in action understanding. This evidence is backed up by data from studies of the (human) mirror neuron system using neuroimaging or TMS techniques, and behavioral experiments. Although the data

  15. Optimal compensation for neuron loss

    Science.gov (United States)

    Barrett, David GT; Denève, Sophie; Machens, Christian K

    2016-01-01

    The brain has an impressive ability to withstand neural damage. Diseases that kill neurons can go unnoticed for years, and incomplete brain lesions or silencing of neurons often fail to produce any behavioral effect. How does the brain compensate for such damage, and what are the limits of this compensation? We propose that neural circuits instantly compensate for neuron loss, thereby preserving their function as much as possible. We show that this compensation can explain changes in tuning curves induced by neuron silencing across a variety of systems, including the primary visual cortex. We find that compensatory mechanisms can be implemented through the dynamics of networks with a tight balance of excitation and inhibition, without requiring synaptic plasticity. The limits of this compensatory mechanism are reached when excitation and inhibition become unbalanced, thereby demarcating a recovery boundary, where signal representation fails and where diseases may become symptomatic. DOI: http://dx.doi.org/10.7554/eLife.12454.001 PMID:27935480

  16. Hypothalamic neurones governing glucose homeostasis.

    Science.gov (United States)

    Coppari, R

    2015-06-01

    The notion that the brain directly controls the level of glucose in the blood (glycaemia) independent of its known action on food intake and body weight has been known ever since 1849. That year, the French physiologist Dr Claude Bernard reported that physical puncture of the floor of the fourth cerebral ventricle rapidly leads to an increased level of sugar in the blood (and urine) in rabbits. Despite this important discovery, it took approximately 150 years before significant efforts aimed at understanding the underlying mechanism of brain-mediated control of glucose metabolism were made. Technological developments allowing for genetically-mediated manipulation of selected molecular pathways in a neurone-type-specific fashion unravelled the importance of specific molecules in specific neuronal populations. These neuronal pathways govern glucose metabolism in the presence and even in the absence of insulin. Also, a peculiarity of these pathways is that certain biochemically-defined neurones govern glucose metabolism in a tissue-specific fashion. © 2015 British Society for Neuroendocrinology.

  17. BlastNeuron for Automated Comparison, Retrieval and Clustering of 3D Neuron Morphologies.

    Science.gov (United States)

    Wan, Yinan; Long, Fuhui; Qu, Lei; Xiao, Hang; Hawrylycz, Michael; Myers, Eugene W; Peng, Hanchuan

    2015-10-01

    Characterizing the identity and types of neurons in the brain, as well as their associated function, requires a means of quantifying and comparing 3D neuron morphology. Presently, neuron comparison methods are based on statistics from neuronal morphology such as size and number of branches, which are not fully suitable for detecting local similarities and differences in the detailed structure. We developed BlastNeuron to compare neurons in terms of their global appearance, detailed arborization patterns, and topological similarity. BlastNeuron first compares and clusters 3D neuron reconstructions based on global morphology features and moment invariants, independent of their orientations, sizes, level of reconstruction and other variations. Subsequently, BlastNeuron performs local alignment between any pair of retrieved neurons via a tree-topology driven dynamic programming method. A 3D correspondence map can thus be generated at the resolution of single reconstruction nodes. We applied BlastNeuron to three datasets: (1) 10,000+ neuron reconstructions from a public morphology database, (2) 681 newly and manually reconstructed neurons, and (3) neurons reconstructions produced using several independent reconstruction methods. Our approach was able to accurately and efficiently retrieve morphologically and functionally similar neuron structures from large morphology database, identify the local common structures, and find clusters of neurons that share similarities in both morphology and molecular profiles.

  18. Oscillating from Neurosecretion to Multitasking Dopamine Neurons

    Directory of Open Access Journals (Sweden)

    David R. Grattan

    2016-04-01

    Full Text Available In this issue of Cell Reports, Stagkourakis et al. (2016 report that oscillating hypothalamic TIDA neurons, previously thought to be simple neurosecretory neurons controlling pituitary prolactin secretion, control dopamine output via autoregulatory mechanisms and thus could potentially regulate other physiologically important hypothalamic neuronal circuits.

  19. Coherence resonance in globally coupled neuronal networks with different neuron numbers

    International Nuclear Information System (INIS)

    Ning Wei-Lian; Zhang Zheng-Zhen; Zeng Shang-You; Luo Xiao-Shu; Hu Jin-Lin; Zeng Shao-Wen; Qiu Yi; Wu Hui-Si

    2012-01-01

    Because a brain consists of tremendous neuronal networks with different neuron numbers ranging from tens to tens of thousands, we study the coherence resonance due to ion channel noises in globally coupled neuronal networks with different neuron numbers. We confirm that for all neuronal networks with different neuron numbers there exist the array enhanced coherence resonance and the optimal synaptic conductance to cause the maximal spiking coherence. Furthermoremore, the enhancement effects of coupling on spiking coherence and on optimal synaptic conductance are almost the same, regardless of the neuron numbers in the neuronal networks. Therefore for all the neuronal networks with different neuron numbers in the brain, relative weak synaptic conductance (0.1 mS/cm 2 ) is sufficient to induce the maximal spiking coherence and the best sub-threshold signal encoding. (interdisciplinary physics and related areas of science and technology)

  20. Responses of single neurons and neuronal ensembles in frog first- and second-order olfactory neurons

    Czech Academy of Sciences Publication Activity Database

    Rospars, J. P.; Šanda, Pavel; Lánský, Petr; Duchamp-Viret, P.

    2013-01-01

    Roč. 1536, NOV 6 (2013), s. 144-158 ISSN 0006-8993 R&D Projects: GA ČR(CZ) GBP304/12/G069; GA ČR(CZ) GAP103/11/0282 Institutional support: RVO:67985823 Keywords : olfaction * spiking activity * neuronal model Subject RIV: JD - Computer Applications, Robotics Impact factor: 2.828, year: 2013

  1. How to make spinal motor neurons.

    Science.gov (United States)

    Davis-Dusenbery, Brandi N; Williams, Luis A; Klim, Joseph R; Eggan, Kevin

    2014-02-01

    All muscle movements, including breathing, walking, and fine motor skills rely on the function of the spinal motor neuron to transmit signals from the brain to individual muscle groups. Loss of spinal motor neuron function underlies several neurological disorders for which treatment has been hampered by the inability to obtain sufficient quantities of primary motor neurons to perform mechanistic studies or drug screens. Progress towards overcoming this challenge has been achieved through the synthesis of developmental biology paradigms and advances in stem cell and reprogramming technology, which allow the production of motor neurons in vitro. In this Primer, we discuss how the logic of spinal motor neuron development has been applied to allow generation of motor neurons either from pluripotent stem cells by directed differentiation and transcriptional programming, or from somatic cells by direct lineage conversion. Finally, we discuss methods to evaluate the molecular and functional properties of motor neurons generated through each of these techniques.

  2. Firing dynamics of an autaptic neuron

    International Nuclear Information System (INIS)

    Wang Heng-Tong; Chen Yong

    2015-01-01

    Autapses are synapses that connect a neuron to itself in the nervous system. Previously, both experimental and theoretical studies have demonstrated that autaptic connections in the nervous system have a significant physiological function. Autapses in nature provide self-delayed feedback, thus introducing an additional timescale to neuronal activities and causing many dynamic behaviors in neurons. Recently, theoretical studies have revealed that an autapse provides a control option for adjusting the response of a neuron: e.g., an autaptic connection can cause the electrical activities of the Hindmarsh–Rose neuron to switch between quiescent, periodic, and chaotic firing patterns; an autapse can enhance or suppress the mode-locking status of a neuron injected with sinusoidal current; and the firing frequency and interspike interval distributions of the response spike train can also be modified by the autapse. In this paper, we review recent studies that showed how an autapse affects the response of a single neuron. (topical review)

  3. Neurons from the adult human dentate nucleus: neural networks in the neuron classification.

    Science.gov (United States)

    Grbatinić, Ivan; Marić, Dušica L; Milošević, Nebojša T

    2015-04-07

    Topological (central vs. border neuron type) and morphological classification of adult human dentate nucleus neurons according to their quantified histomorphological properties using neural networks on real and virtual neuron samples. In the real sample 53.1% and 14.1% of central and border neurons, respectively, are classified correctly with total of 32.8% of misclassified neurons. The most important result present 62.2% of misclassified neurons in border neurons group which is even greater than number of correctly classified neurons (37.8%) in that group, showing obvious failure of network to classify neurons correctly based on computational parameters used in our study. On the virtual sample 97.3% of misclassified neurons in border neurons group which is much greater than number of correctly classified neurons (2.7%) in that group, again confirms obvious failure of network to classify neurons correctly. Statistical analysis shows that there is no statistically significant difference in between central and border neurons for each measured parameter (p>0.05). Total of 96.74% neurons are morphologically classified correctly by neural networks and each one belongs to one of the four histomorphological types: (a) neurons with small soma and short dendrites, (b) neurons with small soma and long dendrites, (c) neuron with large soma and short dendrites, (d) neurons with large soma and long dendrites. Statistical analysis supports these results (pneurons can be classified in four neuron types according to their quantitative histomorphological properties. These neuron types consist of two neuron sets, small and large ones with respect to their perykarions with subtypes differing in dendrite length i.e. neurons with short vs. long dendrites. Besides confirmation of neuron classification on small and large ones, already shown in literature, we found two new subtypes i.e. neurons with small soma and long dendrites and with large soma and short dendrites. These neurons are

  4. Mirror neurons and motor intentionality.

    Science.gov (United States)

    Rizzolatti, Giacomo; Sinigaglia, Corrado

    2007-01-01

    Our social life rests to a large extent on our ability to understand the intentions of others. What are the bases of this ability? A very influential view is that we understand the intentions of others because we are able to represent them as having mental states. Without this meta-representational (mind-reading) ability their behavior would be meaningless to us. Over the past few years this view has been challenged by neurophysiological findings and, in particular, by the discovery of mirror neurons. The functional properties of these neurons indicate that intentional understanding is based primarily on a mechanism that directly matches the sensory representation of the observed actions with one's own motor representation of those same actions. These findings reveal how deeply motor and intentional components of action are intertwined, suggesting that both can be fully comprehended only starting from a motor approach to intentionality.

  5. Oscillatory integration windows in neurons

    Science.gov (United States)

    Gupta, Nitin; Singh, Swikriti Saran; Stopfer, Mark

    2016-01-01

    Oscillatory synchrony among neurons occurs in many species and brain areas, and has been proposed to help neural circuits process information. One hypothesis states that oscillatory input creates cyclic integration windows: specific times in each oscillatory cycle when postsynaptic neurons become especially responsive to inputs. With paired local field potential (LFP) and intracellular recordings and controlled stimulus manipulations we directly test this idea in the locust olfactory system. We find that inputs arriving in Kenyon cells (KCs) sum most effectively in a preferred window of the oscillation cycle. With a computational model, we show that the non-uniform structure of noise in the membrane potential helps mediate this process. Further experiments performed in vivo demonstrate that integration windows can form in the absence of inhibition and at a broad range of oscillation frequencies. Our results reveal how a fundamental coincidence-detection mechanism in a neural circuit functions to decode temporally organized spiking. PMID:27976720

  6. Unbalanced neuronal circuits in addiction.

    Science.gov (United States)

    Volkow, Nora D; Wang, Gen-Jack; Tomasi, Dardo; Baler, Ruben D

    2013-08-01

    Through sequential waves of drug-induced neurochemical stimulation, addiction co-opts the brain's neuronal circuits that mediate reward, motivation to behavioral inflexibility and a severe disruption of self-control and compulsive drug intake. Brain imaging technologies have allowed neuroscientists to map out the neural landscape of addiction in the human brain and to understand how drugs modify it. Published by Elsevier Ltd.

  7. Neurochemical phenotypes of cardiorespiratory neurons.

    Science.gov (United States)

    Pilowsky, Paul M

    2008-12-10

    Interactions between the cardiovascular and respiratory systems have been known for many years but the functional significance of the interactions is still widely debated. Here I discuss the possible role of metabotropic receptors in regulating cardiorespiratory neurons in the brainstem and spinal cord. It is clear that, although much has been discovered, cardiorespiratory regulation is certainly one area that still has a long way to go before its secrets are fully divulged and their function in controlling circulatory and respiratory function is revealed.

  8. Mirror Neurons from Associative Learning

    OpenAIRE

    Catmur, Caroline; Press, Clare; Heyes, Cecilia

    2016-01-01

    Mirror neurons fire both when executing actions and observing others perform similar actions. Their sensorimotor matching properties have generally been considered a genetic adaptation for social cognition; however, in the present chapter we argue that the evidence in favor of this account is not compelling. Instead we present evidence supporting an alternative account: that mirror neurons’ matching properties arise from associative learning during individual development. Notably, this proces...

  9. Trafficking of neuronal calcium channels

    Czech Academy of Sciences Publication Activity Database

    Weiss, Norbert; Zamponi, G. W.

    2017-01-01

    Roč. 1, č. 1 (2017), č. článku NS20160003. ISSN 2059-6553 R&D Projects: GA ČR GA15-13556S; GA MŠk 7AMB15FR015 Institutional support: RVO:61388963 Keywords : calcium channel * neuron * trafficing Subject RIV: ED - Physiology OBOR OECD: Physiology (including cytology) http://www.neuronalsignaling.org/content/1/1/NS20160003

  10. Selective serotonergic excitation of callosal projection neurons

    Directory of Open Access Journals (Sweden)

    Daniel eAvesar

    2012-03-01

    Full Text Available Serotonin (5-HT acting as a neurotransmitter in the cerebral cortex is critical for cognitive function, yet how 5-HT regulates information processing in cortical circuits is not well understood. We tested the serotonergic responsiveness of layer 5 pyramidal neurons (L5PNs of the mouse medial prefrontal cortex (mPFC, and found 3 distinct response types: long-lasting 5-HT1A (1A receptor-dependent inhibitory responses (84% of L5PNs, 5-HT2A (2A receptor-dependent excitatory responses (9%, and biphasic responses in which 2A-dependent excitation followed brief inhibition (5%. Relative to 5-HT-inhibited neurons, those excited by 5-HT had physiological properties characteristic of callosal/commissural (COM neurons that project to the contralateral cortex. We tested whether serotonergic responses in cortical pyramidal neurons are correlated with their axonal projection pattern using retrograde fluorescent labeling of COM and corticopontine-projecting (CPn neurons. 5-HT generated excitatory or biphasic responses in all 5-HT-responsive layer 5 COM neurons. Conversely, CPn neurons were universally inhibited by 5-HT. Serotonergic excitation of COM neurons was blocked by the 2A antagonist MDL 11939, while serotonergic inhibition of CPn neurons was blocked by the 1A antagonist WAY 100635, confirming a role for these two receptor subtypes in regulating pyramidal neuron activity. Selective serotonergic excitation of COM neurons was not layer-specific, as COM neurons in layer 2/3 were also selectively excited by 5-HT relative to their non-labeled pyramidal neuron neighbors. Because neocortical 2A receptors are implicated in the etiology and pathophysiology of schizophrenia, we propose that COM neurons may represent a novel cellular target for intervention in psychiatric disease.

  11. Results on a Binding Neuron Model and Their Implications for Modified Hourglass Model for Neuronal Network

    Directory of Open Access Journals (Sweden)

    Viswanathan Arunachalam

    2013-01-01

    Full Text Available The classical models of single neuron like Hodgkin-Huxley point neuron or leaky integrate and fire neuron assume the influence of postsynaptic potentials to last till the neuron fires. Vidybida (2008 in a refreshing departure has proposed models for binding neurons in which the trace of an input is remembered only for a finite fixed period of time after which it is forgotten. The binding neurons conform to the behaviour of real neurons and are applicable in constructing fast recurrent networks for computer modeling. This paper develops explicitly several useful results for a binding neuron like the firing time distribution and other statistical characteristics. We also discuss the applicability of the developed results in constructing a modified hourglass network model in which there are interconnected neurons with excitatory as well as inhibitory inputs. Limited simulation results of the hourglass network are presented.

  12. Single-cell axotomy of cultured hippocampal neurons integrated in neuronal circuits.

    Science.gov (United States)

    Gomis-Rüth, Susana; Stiess, Michael; Wierenga, Corette J; Meyn, Liane; Bradke, Frank

    2014-05-01

    An understanding of the molecular mechanisms of axon regeneration after injury is key for the development of potential therapies. Single-cell axotomy of dissociated neurons enables the study of the intrinsic regenerative capacities of injured axons. This protocol describes how to perform single-cell axotomy on dissociated hippocampal neurons containing synapses. Furthermore, to axotomize hippocampal neurons integrated in neuronal circuits, we describe how to set up coculture with a few fluorescently labeled neurons. This approach allows axotomy of single cells in a complex neuronal network and the observation of morphological and molecular changes during axon regeneration. Thus, single-cell axotomy of mature neurons is a valuable tool for gaining insights into cell intrinsic axon regeneration and the plasticity of neuronal polarity of mature neurons. Dissociation of the hippocampus and plating of hippocampal neurons takes ∼2 h. Neurons are then left to grow for 2 weeks, during which time they integrate into neuronal circuits. Subsequent axotomy takes 10 min per neuron and further imaging takes 10 min per neuron.

  13. Glutamate neurons are intermixed with midbrain dopamine neurons in nonhuman primates and humans

    Science.gov (United States)

    Root, David H.; Wang, Hui-Ling; Liu, Bing; Barker, David J.; Mód, László; Szocsics, Péter; Silva, Afonso C.; Maglóczky, Zsófia; Morales, Marisela

    2016-01-01

    The rodent ventral tegmental area (VTA) and substantia nigra pars compacta (SNC) contain dopamine neurons intermixed with glutamate neurons (expressing vesicular glutamate transporter 2; VGluT2), which play roles in reward and aversion. However, identifying the neuronal compositions of the VTA and SNC in higher mammals has remained challenging. Here, we revealed VGluT2 neurons within the VTA and SNC of nonhuman primates and humans by simultaneous detection of VGluT2 mRNA and tyrosine hydroxylase (TH; for identification of dopamine neurons). We found that several VTA subdivisions share similar cellular compositions in nonhuman primates and humans; their rostral linear nuclei have a high prevalence of VGluT2 neurons lacking TH; their paranigral and parabrachial pigmented nuclei have mostly TH neurons, and their parabrachial pigmented nuclei have dual VGluT2-TH neurons. Within nonhuman primates and humans SNC, the vast majority of neurons are TH neurons but VGluT2 neurons were detected in the pars lateralis subdivision. The demonstration that midbrain dopamine neurons are intermixed with glutamate or glutamate-dopamine neurons from rodents to humans offers new opportunities for translational studies towards analyzing the roles that each of these neurons play in human behavior and in midbrain-associated illnesses such as addiction, depression, schizophrenia, and Parkinson’s disease. PMID:27477243

  14. Neuronal Differentiation Modulated by Polymeric Membrane Properties.

    Science.gov (United States)

    Morelli, Sabrina; Piscioneri, Antonella; Drioli, Enrico; De Bartolo, Loredana

    2017-01-01

    In this study, different collagen-blend membranes were successfully constructed by blending collagen with chitosan (CHT) or poly(lactic-co-glycolic acid) (PLGA) to enhance their properties and thus create new biofunctional materials with great potential use for neuronal tissue engineering and regeneration. Collagen blending strongly affected membrane properties in the following ways: (i) it improved the surface hydrophilicity of both pure CHT and PLGA membranes, (ii) it reduced the stiffness of CHT membranes, but (iii) it did not modify the good mechanical properties of PLGA membranes. Then, we investigated the effect of the different collagen concentrations on the neuronal behavior of the membranes developed. Morphological observations, immunocytochemistry, and morphometric measures demonstrated that the membranes developed, especially CHT/Col30, PLGA, and PLGA/Col1, provided suitable microenvironments for neuronal growth owing to their enhanced properties. The most consistent neuronal differentiation was obtained in neurons cultured on PLGA-based membranes, where a well-developed neuronal network was achieved due to their improved mechanical properties. Our findings suggest that tensile strength and elongation at break are key material parameters that have potential influence on both axonal elongation and neuronal structure and organization, which are of fundamental importance for the maintenance of efficient neuronal growth. Hence, our study has provided new insights regarding the effects of membrane mechanical properties on neuronal behavior, and thus it may help to design and improve novel instructive biomaterials for neuronal tissue engineering. © 2017 S. Karger AG, Basel.

  15. Synaptic Circuit Organization of Motor Corticothalamic Neurons

    Science.gov (United States)

    Yamawaki, Naoki

    2015-01-01

    Corticothalamic (CT) neurons in layer 6 constitute a large but enigmatic class of cortical projection neurons. How they are integrated into intracortical and thalamo-cortico-thalamic circuits is incompletely understood, especially outside of sensory cortex. Here, we investigated CT circuits in mouse forelimb motor cortex (M1) using multiple circuit-analysis methods. Stimulating and recording from CT, intratelencephalic (IT), and pyramidal tract (PT) projection neurons, we found strong CT↔ CT and CT↔ IT connections; however, CT→IT connections were limited to IT neurons in layer 6, not 5B. There was strikingly little CT↔ PT excitatory connectivity. Disynaptic inhibition systematically accompanied excitation in these pathways, scaling with the amplitude of excitation according to both presynaptic (class-specific) and postsynaptic (cell-by-cell) factors. In particular, CT neurons evoked proportionally more inhibition relative to excitation (I/E ratio) than IT neurons. Furthermore, the amplitude of inhibition was tuned to match the amount of excitation at the level of individual neurons; in the extreme, neurons receiving no excitation received no inhibition either. Extending these studies to dissect the connectivity between cortex and thalamus, we found that M1-CT neurons and thalamocortical neurons in the ventrolateral (VL) nucleus were remarkably unconnected in either direction. Instead, VL axons in the cortex excited both IT and PT neurons, and CT axons in the thalamus excited other thalamic neurons, including those in the posterior nucleus, which additionally received PT excitation. These findings, which contrast in several ways with previous observations in sensory areas, illuminate the basic circuit organization of CT neurons within M1 and between M1 and thalamus. PMID:25653383

  16. Hindbrain Catecholamine Neurons Activate Orexin Neurons During Systemic Glucoprivation in Male Rats.

    Science.gov (United States)

    Li, Ai-Jun; Wang, Qing; Elsarelli, Megan M; Brown, R Lane; Ritter, Sue

    2015-08-01

    Hindbrain catecholamine neurons are required for elicitation of feeding responses to glucose deficit, but the forebrain circuitry required for these responses is incompletely understood. Here we examined interactions of catecholamine and orexin neurons in eliciting glucoprivic feeding. Orexin neurons, located in the perifornical lateral hypothalamus (PeFLH), are heavily innervated by hindbrain catecholamine neurons, stimulate food intake, and increase arousal and behavioral activation. Orexin neurons may therefore contribute importantly to appetitive responses, such as food seeking, during glucoprivation. Retrograde tracing results showed that nearly all innervation of the PeFLH from the hindbrain originated from catecholamine neurons and some raphe nuclei. Results also suggested that many catecholamine neurons project collaterally to the PeFLH and paraventricular hypothalamic nucleus. Systemic administration of the antiglycolytic agent, 2-deoxy-D-glucose, increased food intake and c-Fos expression in orexin neurons. Both responses were eliminated by a lesion of catecholamine neurons innervating orexin neurons using the retrogradely transported immunotoxin, anti-dopamine-β-hydroxylase saporin, which is specifically internalized by dopamine-β-hydroxylase-expressing catecholamine neurons. Using designer receptors exclusively activated by designer drugs in transgenic rats expressing Cre recombinase under the control of tyrosine hydroxylase promoter, catecholamine neurons in cell groups A1 and C1 of the ventrolateral medulla were activated selectively by peripheral injection of clozapine-N-oxide. Clozapine-N-oxide injection increased food intake and c-Fos expression in PeFLH orexin neurons as well as in paraventricular hypothalamic nucleus neurons. In summary, catecholamine neurons are required for the activation of orexin neurons during glucoprivation. Activation of orexin neurons may contribute to appetitive responses required for glucoprivic feeding.

  17. A chimeric path to neuronal synchronization

    Science.gov (United States)

    Essaki Arumugam, Easwara Moorthy; Spano, Mark L.

    2015-01-01

    Synchronization of neuronal activity is associated with neurological disorders such as epilepsy. This process of neuronal synchronization is not fully understood. To further our understanding, we have experimentally studied the progression of this synchronization from normal neuronal firing to full synchronization. We implemented nine FitzHugh-Nagumo neurons (a simplified Hodgkin-Huxley model) via discrete electronics. For different coupling parameters (synaptic strengths), the neurons in the ring were either unsynchronized or completely synchronized when locally coupled in a ring. When a single long-range connection (nonlocal coupling) was introduced, an intermediate state known as a chimera appeared. The results indicate that (1) epilepsy is likely not only a dynamical disease but also a topological disease, strongly tied to the connectivity of the underlying network of neurons, and (2) the synchronization process in epilepsy may not be an "all or none" phenomenon, but can pass through an intermediate stage (chimera).

  18. A chimeric path to neuronal synchronization

    Energy Technology Data Exchange (ETDEWEB)

    Essaki Arumugam, Easwara Moorthy; Spano, Mark L. [School of Biological and Health Systems Engineering, Arizona State University, Tempe, Arizona 85287-9709 (United States)

    2015-01-15

    Synchronization of neuronal activity is associated with neurological disorders such as epilepsy. This process of neuronal synchronization is not fully understood. To further our understanding, we have experimentally studied the progression of this synchronization from normal neuronal firing to full synchronization. We implemented nine FitzHugh-Nagumo neurons (a simplified Hodgkin-Huxley model) via discrete electronics. For different coupling parameters (synaptic strengths), the neurons in the ring were either unsynchronized or completely synchronized when locally coupled in a ring. When a single long-range connection (nonlocal coupling) was introduced, an intermediate state known as a chimera appeared. The results indicate that (1) epilepsy is likely not only a dynamical disease but also a topological disease, strongly tied to the connectivity of the underlying network of neurons, and (2) the synchronization process in epilepsy may not be an “all or none” phenomenon, but can pass through an intermediate stage (chimera)

  19. Mini Review: Biomaterials for Enhancing Neuronal Repair

    Science.gov (United States)

    Cangellaris, Olivia V.; Gillette, Martha U.

    2018-04-01

    As they differentiate from neuroblasts, nascent neurons become highly polarized and elongate. Neurons extend and elaborate fine and fragile cellular extensions that form circuits enabling long-distance communication and signal integration within the body. While other organ systems are developing, projections of differentiating neurons find paths to distant targets. Subsequent post-developmental neuronal damage is catastrophic because the cues for reinnervation are no longer active. Advances in biomaterials are enabling fabrication of micro-environments that encourage neuronal regrowth and restoration of function by recreating these developmental cues. This mini-review considers new materials that employ topographical, chemical, electrical, and/or mechanical cues for use in neuronal repair. Manipulating and integrating these elements in different combinations will generate new technologies to enhance neural repair.

  20. Npas4: Linking Neuronal Activity to Memory.

    Science.gov (United States)

    Sun, Xiaochen; Lin, Yingxi

    2016-04-01

    Immediate-early genes (IEGs) are rapidly activated after sensory and behavioral experience and are believed to be crucial for converting experience into long-term memory. Neuronal PAS domain protein 4 (Npas4), a recently discovered IEG, has several characteristics that make it likely to be a particularly important molecular link between neuronal activity and memory: it is among the most rapidly induced IEGs, is expressed only in neurons, and is selectively induced by neuronal activity. By orchestrating distinct activity-dependent gene programs in different neuronal populations, Npas4 affects synaptic connections in excitatory and inhibitory neurons, neural circuit plasticity, and memory formation. It may also be involved in circuit homeostasis through negative feedback and psychiatric disorders. We summarize these findings and discuss their implications. Copyright © 2016 Elsevier Ltd. All rights reserved.

  1. A chimeric path to neuronal synchronization

    International Nuclear Information System (INIS)

    Essaki Arumugam, Easwara Moorthy; Spano, Mark L.

    2015-01-01

    Synchronization of neuronal activity is associated with neurological disorders such as epilepsy. This process of neuronal synchronization is not fully understood. To further our understanding, we have experimentally studied the progression of this synchronization from normal neuronal firing to full synchronization. We implemented nine FitzHugh-Nagumo neurons (a simplified Hodgkin-Huxley model) via discrete electronics. For different coupling parameters (synaptic strengths), the neurons in the ring were either unsynchronized or completely synchronized when locally coupled in a ring. When a single long-range connection (nonlocal coupling) was introduced, an intermediate state known as a chimera appeared. The results indicate that (1) epilepsy is likely not only a dynamical disease but also a topological disease, strongly tied to the connectivity of the underlying network of neurons, and (2) the synchronization process in epilepsy may not be an “all or none” phenomenon, but can pass through an intermediate stage (chimera)

  2. Neuronal Networks on Nanocellulose Scaffolds.

    Science.gov (United States)

    Jonsson, Malin; Brackmann, Christian; Puchades, Maja; Brattås, Karoline; Ewing, Andrew; Gatenholm, Paul; Enejder, Annika

    2015-11-01

    Proliferation, integration, and neurite extension of PC12 cells, a widely used culture model for cholinergic neurons, were studied in nanocellulose scaffolds biosynthesized by Gluconacetobacter xylinus to allow a three-dimensional (3D) extension of neurites better mimicking neuronal networks in tissue. The interaction with control scaffolds was compared with cationized nanocellulose (trimethyl ammonium betahydroxy propyl [TMAHP] cellulose) to investigate the impact of surface charges on the cell interaction mechanisms. Furthermore, coatings with extracellular matrix proteins (collagen, fibronectin, and laminin) were investigated to determine the importance of integrin-mediated cell attachment. Cell proliferation was evaluated by a cellular proliferation assay, while cell integration and neurite propagation were studied by simultaneous label-free Coherent anti-Stokes Raman Scattering and second harmonic generation microscopy, providing 3D images of PC12 cells and arrangement of nanocellulose fibrils, respectively. Cell attachment and proliferation were enhanced by TMAHP modification, but not by protein coating. Protein coating instead promoted active interaction between the cells and the scaffold, hence lateral cell migration and integration. Irrespective of surface modification, deepest cell integration measured was one to two cell layers, whereas neurites have a capacity to integrate deeper than the cell bodies in the scaffold due to their fine dimensions and amoeba-like migration pattern. Neurites with lengths of >50 μm were observed, successfully connecting individual cells and cell clusters. In conclusion, TMAHP-modified nanocellulose scaffolds promote initial cellular scaffold adhesion, which combined with additional cell-scaffold treatments enables further formation of 3D neuronal networks.

  3. C. elegans model of neuronal aging

    OpenAIRE

    Peng, Chiu-Ying; Chen, Chun-Hao; Hsu, Jiun-Min; Pan, Chun-Liang

    2011-01-01

    Aging of the nervous system underlies the behavioral and cognitive decline associated with senescence. Understanding the molecular and cellular basis of neuronal aging will therefore contribute to the development of effective treatments for aging and age-associated neurodegenerative disorders. Despite this pressing need, there are surprisingly few animal models that aim at recapitulating neuronal aging in a physiological context. We recently developed a C. elegans model of neuronal aging, and...

  4. Spike timing precision of neuronal circuits.

    Science.gov (United States)

    Kilinc, Deniz; Demir, Alper

    2018-04-17

    Spike timing is believed to be a key factor in sensory information encoding and computations performed by the neurons and neuronal circuits. However, the considerable noise and variability, arising from the inherently stochastic mechanisms that exist in the neurons and the synapses, degrade spike timing precision. Computational modeling can help decipher the mechanisms utilized by the neuronal circuits in order to regulate timing precision. In this paper, we utilize semi-analytical techniques, which were adapted from previously developed methods for electronic circuits, for the stochastic characterization of neuronal circuits. These techniques, which are orders of magnitude faster than traditional Monte Carlo type simulations, can be used to directly compute the spike timing jitter variance, power spectral densities, correlation functions, and other stochastic characterizations of neuronal circuit operation. We consider three distinct neuronal circuit motifs: Feedback inhibition, synaptic integration, and synaptic coupling. First, we show that both the spike timing precision and the energy efficiency of a spiking neuron are improved with feedback inhibition. We unveil the underlying mechanism through which this is achieved. Then, we demonstrate that a neuron can improve on the timing precision of its synaptic inputs, coming from multiple sources, via synaptic integration: The phase of the output spikes of the integrator neuron has the same variance as that of the sample average of the phases of its inputs. Finally, we reveal that weak synaptic coupling among neurons, in a fully connected network, enables them to behave like a single neuron with a larger membrane area, resulting in an improvement in the timing precision through cooperation.

  5. Do enteric neurons make hypocretin? ☆

    OpenAIRE

    Baumann, Christian R.; Clark, Erika L.; Pedersen, Nigel P.; Hecht, Jonathan L.; Scammell, Thomas E.

    2007-01-01

    Hypocretins (orexins) are wake-promoting neuropeptides produced by hypothalamic neurons. These hypocretin-producing cells are lost in people with narcolepsy, possibly due to an autoimmune attack. Prior studies described hypocretin neurons in the enteric nervous system, and these cells could be an additional target of an autoimmune process. We sought to determine whether enteric hypocretin neurons are lost in narcoleptic subjects. Even though we tried several methods (including whole mounts, s...

  6. High-Degree Neurons Feed Cortical Computations.

    Directory of Open Access Journals (Sweden)

    Nicholas M Timme

    2016-05-01

    Full Text Available Recent work has shown that functional connectivity among cortical neurons is highly varied, with a small percentage of neurons having many more connections than others. Also, recent theoretical developments now make it possible to quantify how neurons modify information from the connections they receive. Therefore, it is now possible to investigate how information modification, or computation, depends on the number of connections a neuron receives (in-degree or sends out (out-degree. To do this, we recorded the simultaneous spiking activity of hundreds of neurons in cortico-hippocampal slice cultures using a high-density 512-electrode array. This preparation and recording method combination produced large numbers of neurons recorded at temporal and spatial resolutions that are not currently available in any in vivo recording system. We utilized transfer entropy (a well-established method for detecting linear and nonlinear interactions in time series and the partial information decomposition (a powerful, recently developed tool for dissecting multivariate information processing into distinct parts to quantify computation between neurons where information flows converged. We found that computations did not occur equally in all neurons throughout the networks. Surprisingly, neurons that computed large amounts of information tended to receive connections from high out-degree neurons. However, the in-degree of a neuron was not related to the amount of information it computed. To gain insight into these findings, we developed a simple feedforward network model. We found that a degree-modified Hebbian wiring rule best reproduced the pattern of computation and degree correlation results seen in the real data. Interestingly, this rule also maximized signal propagation in the presence of network-wide correlations, suggesting a mechanism by which cortex could deal with common random background input. These are the first results to show that the extent to

  7. Design of memristive interface between electronic neurons

    Science.gov (United States)

    Gerasimova, S. A.; Mikhaylov, A. N.; Belov, A. I.; Korolev, D. S.; Guseinov, D. V.; Lebedeva, A. V.; Gorshkov, O. N.; Kazantsev, V. B.

    2018-05-01

    Nonlinear dynamics of two electronic oscillators coupled via a memristive device has been investigated. Such model mimics the interaction between synaptically coupled brain neurons with the memristive device imitating neuron axon. The synaptic connection is provided by the adaptive behavior of memristive device that changes its resistance under the action of spike-like activity. Mathematical model of such a memristive interface has been developed to describe and predict the experimentally observed regularities of forced synchronization of neuron-like oscillators.

  8. Mirror neurons: From origin to function

    OpenAIRE

    Cook, R; Bird, G; Catmur, C; Press, C; Heyes, C

    2014-01-01

    This article argues that mirror neurons originate in sensorimotor associative learning and therefore a new approach is needed to investigate their functions. Mirror neurons were discovered about 20 years ago in the monkey brain, and there is now evidence that they are also present in the human brain. The intriguing feature of many mirror neurons is that they fire not only when the animal is performing an action, such as grasping an object using a power grip, but also when the animal passively...

  9. Geometrical Determinants of Neuronal Actin Waves

    OpenAIRE

    Tomba, Caterina; Bra?ni, C?line; Bugnicourt, Ghislain; Cohen, Floriane; Friedrich, Benjamin M.; Gov, Nir S.; Villard, Catherine

    2017-01-01

    Hippocampal neurons produce in their early stages of growth propagative, actin-rich dynamical structures called actin waves. The directional motion of actin waves from the soma to the tip of neuronal extensions has been associated with net forward growth, and ultimately with the specification of neurites into axon and dendrites. Here, geometrical cues are used to control actin wave dynamics by constraining neurons on adhesive stripes of various widths. A key observable, the average time betwe...

  10. The Relevance of AgRP Neuron-Derived GABA Inputs to POMC Neurons Differs for Spontaneous and Evoked Release

    OpenAIRE

    Rau, Andrew R.; Hentges, Shane T.

    2017-01-01

    Hypothalamic agouti-related peptide (AgRP) neurons potently stimulate food intake, whereas proopiomelanocortin (POMC) neurons inhibit feeding. Whether AgRP neurons exert their orexigenic actions, at least in part, by inhibiting anorexigenic POMC neurons remains unclear. Here, the connectivity between GABA-releasing AgRP neurons and POMC neurons was examined in brain slices from male and female mice. GABA-mediated spontaneous IPSCs (sIPSCs) in POMC neurons were unaffected by disturbing GABA re...

  11. Performance limitations of relay neurons.

    Directory of Open Access Journals (Sweden)

    Rahul Agarwal

    Full Text Available Relay cells are prevalent throughout sensory systems and receive two types of inputs: driving and modulating. The driving input contains receptive field properties that must be transmitted while the modulating input alters the specifics of transmission. For example, the visual thalamus contains relay neurons that receive driving inputs from the retina that encode a visual image, and modulating inputs from reticular activating system and layer 6 of visual cortex that control what aspects of the image will be relayed back to visual cortex for perception. What gets relayed depends on several factors such as attentional demands and a subject's goals. In this paper, we analyze a biophysical based model of a relay cell and use systems theoretic tools to construct analytic bounds on how well the cell transmits a driving input as a function of the neuron's electrophysiological properties, the modulating input, and the driving signal parameters. We assume that the modulating input belongs to a class of sinusoidal signals and that the driving input is an irregular train of pulses with inter-pulse intervals obeying an exponential distribution. Our analysis applies to any [Formula: see text] order model as long as the neuron does not spike without a driving input pulse and exhibits a refractory period. Our bounds on relay reliability contain performance obtained through simulation of a second and third order model, and suggest, for instance, that if the frequency of the modulating input increases or the DC offset decreases, then relay increases. Our analysis also shows, for the first time, how the biophysical properties of the neuron (e.g. ion channel dynamics define the oscillatory patterns needed in the modulating input for appropriately timed relay of sensory information. In our discussion, we describe how our bounds predict experimentally observed neural activity in the basal ganglia in (i health, (ii in Parkinson's disease (PD, and (iii in PD during

  12. Neurosemantics, neurons and system theory.

    Science.gov (United States)

    Breidbach, Olaf

    2007-08-01

    Following the concept of internal representations, signal processing in a neuronal system has to be evaluated exclusively based on internal system characteristics. Thus, this approach omits the external observer as a control function for sensory integration. Instead, the configuration of the system and its computational performance are the effects of endogenous factors. Such self-referential operation is due to a strictly local computation in a network and, thereby, computations follow a set of rules that constitute the emergent behaviour of the system. These rules can be shown to correspond to a "logic" that is intrinsic to the system, an idea which provides the basis for neurosemantics.

  13. Neuronal involvement in cisplatin neuropathy

    DEFF Research Database (Denmark)

    Krarup-Hansen, A; Helweg-Larsen, Susanne Elisabeth; Schmalbruch, H

    2007-01-01

    Although it is well known that cisplatin causes a sensory neuropathy, the primary site of involvement is not established. The clinical symptoms localized in a stocking-glove distribution may be explained by a length dependent neuronopathy or by a distal axonopathy. To study whether the whole neuron...... of the foot evoked by a tactile probe showed similar changes to those observed in SNAPs evoked by electrical stimulation. At these doses, somatosensory evoked potentials (SEPs) from the tibial nerve had increased latencies of peripheral, spinal and central responses suggesting loss of central processes...

  14. A New Population of Parvocellular Oxytocin Neurons Controlling Magnocellular Neuron Activity and Inflammatory Pain Processing.

    Science.gov (United States)

    Eliava, Marina; Melchior, Meggane; Knobloch-Bollmann, H Sophie; Wahis, Jérôme; da Silva Gouveia, Miriam; Tang, Yan; Ciobanu, Alexandru Cristian; Triana Del Rio, Rodrigo; Roth, Lena C; Althammer, Ferdinand; Chavant, Virginie; Goumon, Yannick; Gruber, Tim; Petit-Demoulière, Nathalie; Busnelli, Marta; Chini, Bice; Tan, Linette L; Mitre, Mariela; Froemke, Robert C; Chao, Moses V; Giese, Günter; Sprengel, Rolf; Kuner, Rohini; Poisbeau, Pierrick; Seeburg, Peter H; Stoop, Ron; Charlet, Alexandre; Grinevich, Valery

    2016-03-16

    Oxytocin (OT) is a neuropeptide elaborated by the hypothalamic paraventricular (PVN) and supraoptic (SON) nuclei. Magnocellular OT neurons of these nuclei innervate numerous forebrain regions and release OT into the blood from the posterior pituitary. The PVN also harbors parvocellular OT cells that project to the brainstem and spinal cord, but their function has not been directly assessed. Here, we identified a subset of approximately 30 parvocellular OT neurons, with collateral projections onto magnocellular OT neurons and neurons of deep layers of the spinal cord. Evoked OT release from these OT neurons suppresses nociception and promotes analgesia in an animal model of inflammatory pain. Our findings identify a new population of OT neurons that modulates nociception in a two tier process: (1) directly by release of OT from axons onto sensory spinal cord neurons and inhibiting their activity and (2) indirectly by stimulating OT release from SON neurons into the periphery. Copyright © 2016 Elsevier Inc. All rights reserved.

  15. Mechanisms of Neuronal Apoptosis In Vivo

    National Research Council Canada - National Science Library

    Martin, Lee J

    2004-01-01

    .... Neuronal cell death in the form of apoptosis or necrosis occurs after exposure to neurotoxins, chemical warfare agents, radiation, viruses, and after seizures, trauma, limb amputation, and hypoxic...

  16. Autosomal dominant adult neuronal ceroid lipofuscinosis

    NARCIS (Netherlands)

    Nijssen, Peter C.G.

    2011-01-01

    this thesis investigates a family with autosomal dominant neuronal ceroid lipofuscinosis, with chapters on clinical neurology, neuropathology, neurogenetics, neurophysiology, auditory and visual aspects.

  17. Neurochemistry of olivocochlear neurons in the hamster.

    Science.gov (United States)

    Reuss, Stefan; Disque-Kaiser, Ursula; Antoniou-Lipfert, Patricia; Gholi, Maryam Najaf; Riemann, Elke; Riemann, Randolf

    2009-04-01

    The present study was conducted to characterize the superior olivary complex (SOC) of the lower brain stem in the pigmented Djungarian hamster Phodopus sungorus. Using Nissl-stained serial cryostat sections from fresh-frozen brains, we determined the borders of the SOC nuclei. We also identified olivocochlear (OC) neurons by retrograde neuronal tracing upon injection of Fluoro-Gold into the scala tympani. To evaluate the SOC as a putative source of neuronal nitric oxide synthase (nNOS), arginine-vasopressin (AVP), oxytocin (OT), vasoactive intestinal polypeptide (VIP), or pituitary adenylate cyclase-activating polypeptide (PACAP) that were all found in the cochlea, we conducted immunohistochemistry on sections exhibiting retrogradely labeled neurons. We did not observe AVP-, OT-, or VIP-immunoreactivity, neither in OC neurons nor in the SOC at all, revealing that cochlear AVP, OT, and VIP are of nonolivary origin. However, we found nNOS, the enzyme responsible for nitric oxide synthesis in neurons, and PACAP in neuronal perikarya of the SOC. Retrogradely labeled neurons of the lateral olivocochlear (LOC) system in the lateral superior olive did not contain PACAP and were only infrequently nNOS-immunoreactive. In contrast, some shell neurons and some of the medial OC (MOC) system exhibited immunofluorescence for either substance. Our data obtained from the dwarf hamster Phodopus sungorus confirm previous observations that a part of the LOC system is nitrergic. They further demonstrate that the medial olivocochlear system is partly nitrergic and use PACAP as neurotransmitter or modulator.

  18. Mirror neurons and language in schizophrenia

    OpenAIRE

    Bendová, Marie

    2016-01-01

    Mirror neurons are a specific kind of visuomotor neurons that are involved in action execution and also in action perception. The mirror mechanism is linked to a variety of complex psychological functions such as social-cognitive functions and language. People with schizophrenia have often difficulties both in mirror neuron system and in language skills. In the first part of our research we studied the connectivity of mirror neuron areas (such as IFG, STG, PMC, SMC and so on) by fMRI in resti...

  19. Beyond Critical Exponents in Neuronal Avalanches

    Science.gov (United States)

    Friedman, Nir; Butler, Tom; Deville, Robert; Beggs, John; Dahmen, Karin

    2011-03-01

    Neurons form a complex network in the brain, where they interact with one another by firing electrical signals. Neurons firing can trigger other neurons to fire, potentially causing avalanches of activity in the network. In many cases these avalanches have been found to be scale independent, similar to critical phenomena in diverse systems such as magnets and earthquakes. We discuss models for neuronal activity that allow for the extraction of testable, statistical predictions. We compare these models to experimental results, and go beyond critical exponents.

  20. Glutamate mediated astrocytic filtering of neuronal activity.

    Directory of Open Access Journals (Sweden)

    Gilad Wallach

    2014-12-01

    Full Text Available Neuron-astrocyte communication is an important regulatory mechanism in various brain functions but its complexity and role are yet to be fully understood. In particular, the temporal pattern of astrocyte response to neuronal firing has not been fully characterized. Here, we used neuron-astrocyte cultures on multi-electrode arrays coupled to Ca2+ imaging and explored the range of neuronal stimulation frequencies while keeping constant the amount of stimulation. Our results reveal that astrocytes specifically respond to the frequency of neuronal stimulation by intracellular Ca2+ transients, with a clear onset of astrocytic activation at neuron firing rates around 3-5 Hz. The cell-to-cell heterogeneity of the astrocyte Ca2+ response was however large and increasing with stimulation frequency. Astrocytic activation by neurons was abolished with antagonists of type I metabotropic glutamate receptor, validating the glutamate-dependence of this neuron-to-astrocyte pathway. Using a realistic biophysical model of glutamate-based intracellular calcium signaling in astrocytes, we suggest that the stepwise response is due to the supralinear dynamics of intracellular IP3 and that the heterogeneity of the responses may be due to the heterogeneity of the astrocyte-to-astrocyte couplings via gap junction channels. Therefore our results present astrocyte intracellular Ca2+ activity as a nonlinear integrator of glutamate-dependent neuronal activity.

  1. Glutamate Mediated Astrocytic Filtering of Neuronal Activity

    Science.gov (United States)

    Herzog, Nitzan; De Pittà, Maurizio; Jacob, Eshel Ben; Berry, Hugues; Hanein, Yael

    2014-01-01

    Neuron-astrocyte communication is an important regulatory mechanism in various brain functions but its complexity and role are yet to be fully understood. In particular, the temporal pattern of astrocyte response to neuronal firing has not been fully characterized. Here, we used neuron-astrocyte cultures on multi-electrode arrays coupled to Ca2+ imaging and explored the range of neuronal stimulation frequencies while keeping constant the amount of stimulation. Our results reveal that astrocytes specifically respond to the frequency of neuronal stimulation by intracellular Ca2+ transients, with a clear onset of astrocytic activation at neuron firing rates around 3-5 Hz. The cell-to-cell heterogeneity of the astrocyte Ca2+ response was however large and increasing with stimulation frequency. Astrocytic activation by neurons was abolished with antagonists of type I metabotropic glutamate receptor, validating the glutamate-dependence of this neuron-to-astrocyte pathway. Using a realistic biophysical model of glutamate-based intracellular calcium signaling in astrocytes, we suggest that the stepwise response is due to the supralinear dynamics of intracellular IP3 and that the heterogeneity of the responses may be due to the heterogeneity of the astrocyte-to-astrocyte couplings via gap junction channels. Therefore our results present astrocyte intracellular Ca2+ activity as a nonlinear integrator of glutamate-dependent neuronal activity. PMID:25521344

  2. Spiking Neurons for Analysis of Patterns

    Science.gov (United States)

    Huntsberger, Terrance

    2008-01-01

    Artificial neural networks comprising spiking neurons of a novel type have been conceived as improved pattern-analysis and pattern-recognition computational systems. These neurons are represented by a mathematical model denoted the state-variable model (SVM), which among other things, exploits a computational parallelism inherent in spiking-neuron geometry. Networks of SVM neurons offer advantages of speed and computational efficiency, relative to traditional artificial neural networks. The SVM also overcomes some of the limitations of prior spiking-neuron models. There are numerous potential pattern-recognition, tracking, and data-reduction (data preprocessing) applications for these SVM neural networks on Earth and in exploration of remote planets. Spiking neurons imitate biological neurons more closely than do the neurons of traditional artificial neural networks. A spiking neuron includes a central cell body (soma) surrounded by a tree-like interconnection network (dendrites). Spiking neurons are so named because they generate trains of output pulses (spikes) in response to inputs received from sensors or from other neurons. They gain their speed advantage over traditional neural networks by using the timing of individual spikes for computation, whereas traditional artificial neurons use averages of activity levels over time. Moreover, spiking neurons use the delays inherent in dendritic processing in order to efficiently encode the information content of incoming signals. Because traditional artificial neurons fail to capture this encoding, they have less processing capability, and so it is necessary to use more gates when implementing traditional artificial neurons in electronic circuitry. Such higher-order functions as dynamic tasking are effected by use of pools (collections) of spiking neurons interconnected by spike-transmitting fibers. The SVM includes adaptive thresholds and submodels of transport of ions (in imitation of such transport in biological

  3. Life-long stability of neurons: a century of research on neurogenesis, neuronal death and neuron quantification in adult CNS.

    Science.gov (United States)

    Turlejski, Kris; Djavadian, Ruzanna

    2002-01-01

    In this chapter we provide an extensive review of 100 years of research on the stability of neurons in the mammalian brain, with special emphasis on humans. Although Cajal formulated the Neuronal Doctrine, he was wrong in his beliefs that adult neurogenesis did not occur and adult neurons are dying throughout life. These two beliefs became accepted "common knowledge" and have shaped much of neuroscience research and provided much of the basis for clinical treatment of age-related brain diseases. In this review, we consider adult neurogenesis from a historical and evolutionary perspective. It is concluded, that while adult neurogenesis is a factor in the dynamics of the dentate gyrus and olfactory bulb, it is probably not a major factor during the life-span in most brain areas. Likewise, the acceptance of neuronal death as an explanation for normal age-related senility is challenged with evidence collected over the last fifty years. Much of the problem in changing this common belief of dying neurons was the inadequacies of neuronal counting methods. In this review we discuss in detail implications of recent improvements in neuronal quantification. We conclude: First, age-related neuronal atrophy is the major factor in functional deterioration of existing neurons and could be slowed down, or even reversed by various pharmacological interventions. Second, in most cases neuronal degeneration during aging is a pathology that in principle may be avoided. Third, loss of myelin and of the white matter is more frequent and important than the limited neuronal death in normal aging.

  4. Endorphinic neurons are contacting the tuberoinfundibular dopaminergic neurons in the rat brain

    International Nuclear Information System (INIS)

    Morel, G.; Pelletier, G.

    1986-01-01

    The anatomical relationships between endorphinic neurons and dopaminergic neurons were evaluated in the rat hypothalamus using a combination of immunocytochemistry and autoradiography. In the arcuate nucleus, endorphinic endings were seen making contacts with dopaminergic cell bodies and dendrites. No synapsis could be observed at the sites of contacts. These results strongly suggest that the endorphinic neurons are directly acting on dopaminergic neurons to modify the release of dopamine into the pituitary portal system

  5. Discrimination of communication vocalizations by single neurons and groups of neurons in the auditory midbrain.

    Science.gov (United States)

    Schneider, David M; Woolley, Sarah M N

    2010-06-01

    Many social animals including songbirds use communication vocalizations for individual recognition. The perception of vocalizations depends on the encoding of complex sounds by neurons in the ascending auditory system, each of which is tuned to a particular subset of acoustic features. Here, we examined how well the responses of single auditory neurons could be used to discriminate among bird songs and we compared discriminability to spectrotemporal tuning. We then used biologically realistic models of pooled neural responses to test whether the responses of groups of neurons discriminated among songs better than the responses of single neurons and whether discrimination by groups of neurons was related to spectrotemporal tuning and trial-to-trial response variability. The responses of single auditory midbrain neurons could be used to discriminate among vocalizations with a wide range of abilities, ranging from chance to 100%. The ability to discriminate among songs using single neuron responses was not correlated with spectrotemporal tuning. Pooling the responses of pairs of neurons generally led to better discrimination than the average of the two inputs and the most discriminating input. Pooling the responses of three to five single neurons continued to improve neural discrimination. The increase in discriminability was largest for groups of neurons with similar spectrotemporal tuning. Further, we found that groups of neurons with correlated spike trains achieved the largest gains in discriminability. We simulated neurons with varying levels of temporal precision and measured the discriminability of responses from single simulated neurons and groups of simulated neurons. Simulated neurons with biologically observed levels of temporal precision benefited more from pooling correlated inputs than did neurons with highly precise or imprecise spike trains. These findings suggest that pooling correlated neural responses with the levels of precision observed in the

  6. BigNeuron: Large-scale 3D Neuron Reconstruction from Optical Microscopy Images

    OpenAIRE

    Peng, Hanchuan; Hawrylycz, Michael; Roskams, Jane; Hill, Sean; Spruston, Nelson; Meijering, Erik; Ascoli, Giorgio A.

    2015-01-01

    textabstractUnderstanding the structure of single neurons is critical for understanding how they function within neural circuits. BigNeuron is a new community effort that combines modern bioimaging informatics, recent leaps in labeling and microscopy, and the widely recognized need for openness and standardization to provide a community resource for automated reconstruction of dendritic and axonal morphology of single neurons. Understanding the structure of single neurons is critical for unde...

  7. Leptin Action on GABAergic Neurons Prevents Obesity and Reduces Inhibitory Tone to POMC Neurons

    OpenAIRE

    Vong, Linh; Ye, Chianping; Yang, Zongfang; Choi, Brian; Chua, Streamson; Lowell, Bradford B.

    2011-01-01

    Leptin acts in the brain to prevent obesity. The underlying neurocircuitry responsible for this is poorly understood, in part due to incomplete knowledge regarding first order, leptin-responsive neurons. To address this, we and others have been removing leptin receptors from candidate first order neurons. While functionally relevant neurons have been identified, the observed effects have been small suggesting that most first order neurons remain unidentified. Here we take an alternative appro...

  8. Essential roles of mitochondrial depolarization in neuron loss through microglial activation and attraction toward neurons.

    Science.gov (United States)

    Nam, Min-Kyung; Shin, Hyun-Ah; Han, Ji-Hye; Park, Dae-Wook; Rhim, Hyangshuk

    2013-04-10

    As life spans increased, neurodegenerative disorders that affect aging populations have also increased. Progressive neuronal loss in specific brain regions is the most common cause of neurodegenerative disease; however, key determinants mediating neuron loss are not fully understood. Using a model of mitochondrial membrane potential (ΔΨm) loss, we found only 25% cell loss in SH-SY5Y (SH) neuronal mono-cultures, but interestingly, 85% neuronal loss occurred when neurons were co-cultured with BV2 microglia. SH neurons overexpressing uncoupling protein 2 exhibited an increase in neuron-microglia interactions, which represent an early step in microglial phagocytosis of neurons. This result indicates that ΔΨm loss in SH neurons is an important contributor to recruitment of BV2 microglia. Notably, we show that ΔΨm loss in BV2 microglia plays a crucial role in microglial activation and phagocytosis of damaged SH neurons. Thus, our study demonstrates that ΔΨm loss in both neurons and microglia is a critical determinant of neuron loss. These findings also offer new insights into neuroimmunological and bioenergetical aspects of neurodegenerative disease. Copyright © 2013 Elsevier B.V. All rights reserved.

  9. Cerebellar Nuclear Neurons Use Time and Rate Coding to Transmit Purkinje Neuron Pauses.

    Science.gov (United States)

    Sudhakar, Shyam Kumar; Torben-Nielsen, Benjamin; De Schutter, Erik

    2015-12-01

    Neurons of the cerebellar nuclei convey the final output of the cerebellum to their targets in various parts of the brain. Within the cerebellum their direct upstream connections originate from inhibitory Purkinje neurons. Purkinje neurons have a complex firing pattern of regular spikes interrupted by intermittent pauses of variable length. How can the cerebellar nucleus process this complex input pattern? In this modeling study, we investigate different forms of Purkinje neuron simple spike pause synchrony and its influence on candidate coding strategies in the cerebellar nuclei. That is, we investigate how different alignments of synchronous pauses in synthetic Purkinje neuron spike trains affect either time-locking or rate-changes in the downstream nuclei. We find that Purkinje neuron synchrony is mainly represented by changes in the firing rate of cerebellar nuclei neurons. Pause beginning synchronization produced a unique effect on nuclei neuron firing, while the effect of pause ending and pause overlapping synchronization could not be distinguished from each other. Pause beginning synchronization produced better time-locking of nuclear neurons for short length pauses. We also characterize the effect of pause length and spike jitter on the nuclear neuron firing. Additionally, we find that the rate of rebound responses in nuclear neurons after a synchronous pause is controlled by the firing rate of Purkinje neurons preceding it.

  10. Cerebellar Nuclear Neurons Use Time and Rate Coding to Transmit Purkinje Neuron Pauses

    Science.gov (United States)

    Sudhakar, Shyam Kumar; Torben-Nielsen, Benjamin; De Schutter, Erik

    2015-01-01

    Neurons of the cerebellar nuclei convey the final output of the cerebellum to their targets in various parts of the brain. Within the cerebellum their direct upstream connections originate from inhibitory Purkinje neurons. Purkinje neurons have a complex firing pattern of regular spikes interrupted by intermittent pauses of variable length. How can the cerebellar nucleus process this complex input pattern? In this modeling study, we investigate different forms of Purkinje neuron simple spike pause synchrony and its influence on candidate coding strategies in the cerebellar nuclei. That is, we investigate how different alignments of synchronous pauses in synthetic Purkinje neuron spike trains affect either time-locking or rate-changes in the downstream nuclei. We find that Purkinje neuron synchrony is mainly represented by changes in the firing rate of cerebellar nuclei neurons. Pause beginning synchronization produced a unique effect on nuclei neuron firing, while the effect of pause ending and pause overlapping synchronization could not be distinguished from each other. Pause beginning synchronization produced better time-locking of nuclear neurons for short length pauses. We also characterize the effect of pause length and spike jitter on the nuclear neuron firing. Additionally, we find that the rate of rebound responses in nuclear neurons after a synchronous pause is controlled by the firing rate of Purkinje neurons preceding it. PMID:26630202

  11. Stages of neuronal network formation

    International Nuclear Information System (INIS)

    Woiterski, Lydia; Käs, Josef A; Claudepierre, Thomas; Luxenhofer, Robert; Jordan, Rainer

    2013-01-01

    Graph theoretical approaches have become a powerful tool for investigating the architecture and dynamics of complex networks. The topology of network graphs revealed small-world properties for very different real systems among these neuronal networks. In this study, we observed the early development of mouse retinal ganglion cell (RGC) networks in vitro using time-lapse video microscopy. By means of a time-resolved graph theoretical analysis of the connectivity, shortest path length and the edge length, we were able to discover the different stages during the network formation. Starting from single cells, at the first stage neurons connected to each other ending up in a network with maximum complexity. In the further course, we observed a simplification of the network which manifested in a change of relevant network parameters such as the minimization of the path length. Moreover, we found that RGC networks self-organized as small-world networks at both stages; however, the optimization occurred only in the second stage. (paper)

  12. [Infantile autism and mirror neurons].

    Science.gov (United States)

    Cornelio-Nieto, J O

    2009-02-27

    Infantile autism is a disorder that is characterised by alterations affecting reciprocal social interactions, abnormal verbal and non-verbal communication, poor imaginative activity and a restricted repertoire of activities and interests. The causes of autism remain unknown, but there are a number of different approaches that attempt to explain the neurobiological causes of the syndrome. A recent theory that has been considered is that of a dysfunction in the mirror neuron system (MNS). The MNS is a neuronal complex, originally described in monkeys and also found in humans, that is related with our movements and which offers specific responses to the movements and intended movements of other subjects. This system is believed to underlie processes of imitation and our capacity to learn by imitation. It is also thought to play a role in language acquisition, in expressing the emotions, in understanding what is happening to others and in empathy. Because these functions are altered in children with autism, it has been suggested that there is some dysfunction present in the MNS of those with autism. Dysfunction of the MNS could account for the symptoms that are observed in children with autism.

  13. Inhibitory neurons modulate spontaneous signaling in cultured cortical neurons: density-dependent regulation of excitatory neuronal signaling

    International Nuclear Information System (INIS)

    Serra, Michael; Guaraldi, Mary; Shea, Thomas B

    2010-01-01

    Cortical neuronal activity depends on a balance between excitatory and inhibitory influences. Culturing of neurons on multi-electrode arrays (MEAs) has provided insight into the development and maintenance of neuronal networks. Herein, we seeded MEAs with murine embryonic cortical/hippocampal neurons at different densities ( 1000 cells mm −2 ) and monitored resultant spontaneous signaling. Sparsely seeded cultures displayed a large number of bipolar, rapid, high-amplitude individual signals with no apparent temporal regularity. By contrast, densely seeded cultures instead displayed clusters of signals at regular intervals. These patterns were observed even within thinner and thicker areas of the same culture. GABAergic neurons (25% of total neurons in our cultures) mediated the differential signal patterns observed above, since addition of the inhibitory antagonist bicuculline to dense cultures and hippocampal slice cultures induced the signal pattern characteristic of sparse cultures. Sparsely seeded cultures likely lacked sufficient inhibitory neurons to modulate excitatory activity. Differential seeding of MEAs can provide a unique model for analyses of pertubation in the interaction between excitatory and inhibitory function during aging and neuropathological conditions where dysregulation of GABAergic neurons is a significant component

  14. Interactive Exploration for Continuously Expanding Neuron Databases.

    Science.gov (United States)

    Li, Zhongyu; Metaxas, Dimitris N; Lu, Aidong; Zhang, Shaoting

    2017-02-15

    This paper proposes a novel framework to help biologists explore and analyze neurons based on retrieval of data from neuron morphological databases. In recent years, the continuously expanding neuron databases provide a rich source of information to associate neuronal morphologies with their functional properties. We design a coarse-to-fine framework for efficient and effective data retrieval from large-scale neuron databases. In the coarse-level, for efficiency in large-scale, we employ a binary coding method to compress morphological features into binary codes of tens of bits. Short binary codes allow for real-time similarity searching in Hamming space. Because the neuron databases are continuously expanding, it is inefficient to re-train the binary coding model from scratch when adding new neurons. To solve this problem, we extend binary coding with online updating schemes, which only considers the newly added neurons and update the model on-the-fly, without accessing the whole neuron databases. In the fine-grained level, we introduce domain experts/users in the framework, which can give relevance feedback for the binary coding based retrieval results. This interactive strategy can improve the retrieval performance through re-ranking the above coarse results, where we design a new similarity measure and take the feedback into account. Our framework is validated on more than 17,000 neuron cells, showing promising retrieval accuracy and efficiency. Moreover, we demonstrate its use case in assisting biologists to identify and explore unknown neurons. Copyright © 2017 Elsevier Inc. All rights reserved.

  15. Neuron Morphology Influences Axon Initial Segment Plasticity.

    Science.gov (United States)

    Gulledge, Allan T; Bravo, Jaime J

    2016-01-01

    In most vertebrate neurons, action potentials are initiated in the axon initial segment (AIS), a specialized region of the axon containing a high density of voltage-gated sodium and potassium channels. It has recently been proposed that neurons use plasticity of AIS length and/or location to regulate their intrinsic excitability. Here we quantify the impact of neuron morphology on AIS plasticity using computational models of simplified and realistic somatodendritic morphologies. In small neurons (e.g., dentate granule neurons), excitability was highest when the AIS was of intermediate length and located adjacent to the soma. Conversely, neurons having larger dendritic trees (e.g., pyramidal neurons) were most excitable when the AIS was longer and/or located away from the soma. For any given somatodendritic morphology, increasing dendritic membrane capacitance and/or conductance favored a longer and more distally located AIS. Overall, changes to AIS length, with corresponding changes in total sodium conductance, were far more effective in regulating neuron excitability than were changes in AIS location, while dendritic capacitance had a larger impact on AIS performance than did dendritic conductance. The somatodendritic influence on AIS performance reflects modest soma-to-AIS voltage attenuation combined with neuron size-dependent changes in AIS input resistance, effective membrane time constant, and isolation from somatodendritic capacitance. We conclude that the impact of AIS plasticity on neuron excitability will depend largely on somatodendritic morphology, and that, in some neurons, a shorter or more distally located AIS may promote, rather than limit, action potential generation.

  16. Intratelencephalic corticostriatal neurons equally excite striatonigral and striatopallidal neurons and their discharge activity is selectively reduced in experimental parkinsonism

    OpenAIRE

    Ballion, B. (B.); Mallet, N. (Nicolas); Bezard, E. (E.); Lanciego, J.L. (José Luis); Gonon, F. (Francois)

    2008-01-01

    Striatonigral and striatopallidal neurons form distinct populations of striatal projection neurons. Their discharge activity is imbalanced after dopaminergic degeneration in Parkinson's disease. Striatal projection neurons receive massive cortical excitatory inputs from bilateral intratelencephalic (IT) neurons projecting to both the ipsilateral and contralateral striatum and from collateral axons of ipsilateral neurons that send their main axon through the pyramidal tract (PT). Previous anat...

  17. Heavy metals in locus ceruleus and motor neurons in motor neuron disease.

    Science.gov (United States)

    Pamphlett, Roger; Kum Jew, Stephen

    2013-12-12

    The causes of sporadic amyotrophic lateral sclerosis (SALS) and other types of motor neuron disease (MND) remain largely unknown. Heavy metals have long been implicated in MND, and it has recently been shown that inorganic mercury selectively enters human locus ceruleus (LC) and motor neurons. We therefore used silver nitrate autometallography (AMG) to look for AMG-stainable heavy metals (inorganic mercury and bismuth) in LC and motor neurons of 24 patients with MND (18 with SALS and 6 with familial MND) and in the LC of 24 controls. Heavy metals in neurons were found in significantly more MND patients than in controls when comparing: (1) the presence of any versus no heavy metal-containing LC neurons (MND 88%, controls 42%), (2) the median percentage of heavy metal-containing LC neurons (MND 9.5%, control 0.0%), and (3) numbers of individuals with heavy metal-containing LC neurons in the upper half of the percentage range (MND 75%, controls 25%). In MND patients, 67% of remaining spinal motor neurons contained heavy metals; smaller percentages were found in hypoglossal, nucleus ambiguus and oculomotor neurons, but none in cortical motor neurons. The majority of MND patients had heavy metals in both LC and spinal motor neurons. No glia or other neurons, including neuromelanin-containing neurons of the substantia nigra, contained stainable heavy metals. Uptake of heavy metals by LC and lower motor neurons appears to be fairly common in humans, though heavy metal staining in the LC, most likely due to inorganic mercury, was seen significantly more often in MND patients than in controls. The LC innervates many cell types that are affected in MND, and it is possible that MND is triggered by toxicant-induced interactions between LC and motor neurons.

  18. Heavy metals in locus ceruleus and motor neurons in motor neuron disease

    Science.gov (United States)

    2013-01-01

    Background The causes of sporadic amyotrophic lateral sclerosis (SALS) and other types of motor neuron disease (MND) remain largely unknown. Heavy metals have long been implicated in MND, and it has recently been shown that inorganic mercury selectively enters human locus ceruleus (LC) and motor neurons. We therefore used silver nitrate autometallography (AMG) to look for AMG-stainable heavy metals (inorganic mercury and bismuth) in LC and motor neurons of 24 patients with MND (18 with SALS and 6 with familial MND) and in the LC of 24 controls. Results Heavy metals in neurons were found in significantly more MND patients than in controls when comparing: (1) the presence of any versus no heavy metal-containing LC neurons (MND 88%, controls 42%), (2) the median percentage of heavy metal-containing LC neurons (MND 9.5%, control 0.0%), and (3) numbers of individuals with heavy metal-containing LC neurons in the upper half of the percentage range (MND 75%, controls 25%). In MND patients, 67% of remaining spinal motor neurons contained heavy metals; smaller percentages were found in hypoglossal, nucleus ambiguus and oculomotor neurons, but none in cortical motor neurons. The majority of MND patients had heavy metals in both LC and spinal motor neurons. No glia or other neurons, including neuromelanin-containing neurons of the substantia nigra, contained stainable heavy metals. Conclusions Uptake of heavy metals by LC and lower motor neurons appears to be fairly common in humans, though heavy metal staining in the LC, most likely due to inorganic mercury, was seen significantly more often in MND patients than in controls. The LC innervates many cell types that are affected in MND, and it is possible that MND is triggered by toxicant-induced interactions between LC and motor neurons. PMID:24330485

  19. Transfection in Primary Cultured Neuronal Cells.

    Science.gov (United States)

    Marwick, Katie F M; Hardingham, Giles E

    2017-01-01

    Transfection allows the introduction of foreign nucleic acid into eukaryotic cells. It is an important tool in understanding the roles of NMDARs in neurons. Here, we describe using lipofection-mediated transfection to introduce cDNA encoding NMDAR subunits into postmitotic rodent primary cortical neurons maintained in culture.

  20. IGF-1: elixir for motor neuron diseases.

    Science.gov (United States)

    Papanikolaou, Theodora; Ellerby, Lisa M

    2009-08-13

    Modulation of testosterone levels is a therapeutic approach for spinal and bulbar muscular atrophy (SBMA), a polyglutamine disorder that affects the motor neurons. The article by Palazzolo et al. in this issue of Neuron provides compelling evidence that the expression of insulin growth hormone is a potential therapeutic for SBMA.

  1. Neuromodulation of vertebrate motor neuron membrane properties

    DEFF Research Database (Denmark)

    Hultborn, Hans; Kiehn, Ole

    1992-01-01

    The short-term function of motor neurons is to integrate synaptic inputs converging onto the somato-dendritic membrane and to transform the net synaptic drive into spike trains. A set of voltage-gated ion channels determines the electro-responsiveness and thereby the motor neuron's input-output f...

  2. Neuronal hyperplasia in the anal canal

    DEFF Research Database (Denmark)

    Fenger, C; Schrøder, H D

    1990-01-01

    In a consecutive series of minor surgical specimens from the anal canal, neuronal hyperplasia was found in nine of 56 haemorrhoidectomy specimens and in four of 23 fibrous polyps. In an additional series of 14 resections of the anal canal, neuronal hyperplasia was present in six cases, of which f...

  3. Life and Death of a Neuron

    Science.gov (United States)

    ... order to clear debris. Hope Through Research Scientists hope that by understanding more about the life and death of neurons they can develop new ... NIH is appreciated. Patient & Caregiver Education ... Your Brain Preventing Stroke Understanding Sleep The Life and Death of a Neuron Genes At Work ...

  4. The Mirror Neuron System and Action Recognition

    Science.gov (United States)

    Buccino, Giovanni; Binkofski, Ferdinand; Riggio, Lucia

    2004-01-01

    Mirror neurons, first described in the rostral part of monkey ventral premotor cortex (area F5), discharge both when the animal performs a goal-directed hand action and when it observes another individual performing the same or a similar action. More recently, in the same area mirror neurons responding to the observation of mouth actions have been…

  5. Mirror neurons: functions, mechanisms and models.

    Science.gov (United States)

    Oztop, Erhan; Kawato, Mitsuo; Arbib, Michael A

    2013-04-12

    Mirror neurons for manipulation fire both when the animal manipulates an object in a specific way and when it sees another animal (or the experimenter) perform an action that is more or less similar. Such neurons were originally found in macaque monkeys, in the ventral premotor cortex, area F5 and later also in the inferior parietal lobule. Recent neuroimaging data indicate that the adult human brain is endowed with a "mirror neuron system," putatively containing mirror neurons and other neurons, for matching the observation and execution of actions. Mirror neurons may serve action recognition in monkeys as well as humans, whereas their putative role in imitation and language may be realized in human but not in monkey. This article shows the important role of computational models in providing sufficient and causal explanations for the observed phenomena involving mirror systems and the learning processes which form them, and underlines the need for additional circuitry to lift up the monkey mirror neuron circuit to sustain the posited cognitive functions attributed to the human mirror neuron system. Copyright © 2012 Elsevier Ireland Ltd. All rights reserved.

  6. Where do mirror neurons come from?

    Science.gov (United States)

    Heyes, Cecilia

    2010-03-01

    Debates about the evolution of the 'mirror neuron system' imply that it is an adaptation for action understanding. Alternatively, mirror neurons may be a byproduct of associative learning. Here I argue that the adaptation and associative hypotheses both offer plausible accounts of the origin of mirror neurons, but the associative hypothesis has three advantages. First, it provides a straightforward, testable explanation for the differences between monkeys and humans that have led some researchers to question the existence of a mirror neuron system. Second, it is consistent with emerging evidence that mirror neurons contribute to a range of social cognitive functions, but do not play a dominant, specialised role in action understanding. Finally, the associative hypothesis is supported by recent data showing that, even in adulthood, the mirror neuron system can be transformed by sensorimotor learning. The associative account implies that mirror neurons come from sensorimotor experience, and that much of this experience is obtained through interaction with others. Therefore, if the associative account is correct, the mirror neuron system is a product, as well as a process, of social interaction. (c) 2009 Elsevier Ltd. All rights reserved.

  7. Nicotinic activation of laterodorsal tegmental neurons

    DEFF Research Database (Denmark)

    Ishibashi, Masaru; Leonard, Christopher S; Kohlmeier, Kristi A

    2009-01-01

    Identifying the neurological mechanisms underlying nicotine reinforcement is a healthcare imperative, if society is to effectively combat tobacco addiction. The majority of studies of the neurobiology of addiction have focused on dopamine (DA)-containing neurons of the ventral tegmental area (VTA......). However, recent data suggest that neurons of the laterodorsal tegmental (LDT) nucleus, which sends cholinergic, GABAergic, and glutamatergic-containing projections to DA-containing neurons of the VTA, are critical to gating normal functioning of this nucleus. The actions of nicotine on LDT neurons...... are unknown. We addressed this issue by examining the effects of nicotine on identified cholinergic and non-cholinergic LDT neurons using whole-cell patch clamp and Ca(2+)-imaging methods in brain slices from mice (P12-P45). Nicotine applied by puffer pipette or bath superfusion elicited membrane...

  8. Timing control by redundant inhibitory neuronal circuits

    Energy Technology Data Exchange (ETDEWEB)

    Tristan, I., E-mail: itristan@ucsd.edu; Rulkov, N. F.; Huerta, R.; Rabinovich, M. [BioCircuits Institute, University of California, San Diego, La Jolla, California 92093-0402 (United States)

    2014-03-15

    Rhythms and timing control of sequential activity in the brain is fundamental to cognition and behavior. Although experimental and theoretical studies support the understanding that neuronal circuits are intrinsically capable of generating different time intervals, the dynamical origin of the phenomenon of functionally dependent timing control is still unclear. Here, we consider a new mechanism that is related to the multi-neuronal cooperative dynamics in inhibitory brain motifs consisting of a few clusters. It is shown that redundancy and diversity of neurons within each cluster enhances the sensitivity of the timing control with the level of neuronal excitation of the whole network. The generality of the mechanism is shown to work on two different neuronal models: a conductance-based model and a map-based model.

  9. Neuronal migration, apoptosis and bipolar disorder.

    Science.gov (United States)

    Uribe, Ezequiel; Wix, Richard

    2012-01-01

    Bipolar disorder, like the majority of psychiatric disorders, is considered a neurodevelopment disease of neurodevelopment. There is an increased rate of neuronal birth and death during this development period. In the particular case of the processes that determine neuronal death, it is known that those neurons that establish connections have to be removed from the central nervous system. There is a deficit of GABAergic interneurons in the cerebral cortex in bipolar disorder, accompanied by overexpression of proapoptic genes. There is also an alteration in the expression of molecules that mediate in the migration of these neurons and their inclusion in functional synapsis during the foetal stage. The role of these molecules in the neuronal death pathways by apoptosis will be reviewed here in an attempt to establish biological hypotheses of the genesis of bipolar disorder. Copyright © 2011 SEP y SEPB. Published by Elsevier Espana. All rights reserved.

  10. Chromatin Regulation of Neuronal Maturation and Plasticity.

    Science.gov (United States)

    Gallegos, David A; Chan, Urann; Chen, Liang-Fu; West, Anne E

    2018-05-01

    Neurons are dynamic cells that respond and adapt to stimuli throughout their long postmitotic lives. The structural and functional plasticity of neurons requires the regulated transcription of new gene products, and dysregulation of transcription in either the developing or adult brain impairs cognition. We discuss how mechanisms of chromatin regulation help to orchestrate the transcriptional programs that underlie the maturation of developing neurons and the plasticity of adult neurons. We review how chromatin regulation acts locally to modulate the expression of specific genes and more broadly to coordinate gene expression programs during transitions between cellular states. These data highlight the importance of epigenetic transcriptional mechanisms in postmitotic neurons. We suggest areas where emerging methods may advance understanding in the future. Copyright © 2018 Elsevier Ltd. All rights reserved.

  11. A COMPUTATIONAL MODEL OF MOTOR NEURON DEGENERATION

    Science.gov (United States)

    Le Masson, Gwendal; Przedborski, Serge; Abbott, L.F.

    2014-01-01

    SUMMARY To explore the link between bioenergetics and motor neuron degeneration, we used a computational model in which detailed morphology and ion conductance are paired with intracellular ATP production and consumption. We found that reduced ATP availability increases the metabolic cost of a single action potential and disrupts K+/Na+ homeostasis, resulting in a chronic depolarization. The magnitude of the ATP shortage at which this ionic instability occurs depends on the morphology and intrinsic conductance characteristic of the neuron. If ATP shortage is confined to the distal part of the axon, the ensuing local ionic instability eventually spreads to the whole neuron and involves fasciculation-like spiking events. A shortage of ATP also causes a rise in intracellular calcium. Our modeling work supports the notion that mitochondrial dysfunction can account for salient features of the paralytic disorder amyotrophic lateral sclerosis, including motor neuron hyperexcitability, fasciculation, and differential vulnerability of motor neuron subpopulations. PMID:25088365

  12. A computational model of motor neuron degeneration.

    Science.gov (United States)

    Le Masson, Gwendal; Przedborski, Serge; Abbott, L F

    2014-08-20

    To explore the link between bioenergetics and motor neuron degeneration, we used a computational model in which detailed morphology and ion conductance are paired with intracellular ATP production and consumption. We found that reduced ATP availability increases the metabolic cost of a single action potential and disrupts K+/Na+ homeostasis, resulting in a chronic depolarization. The magnitude of the ATP shortage at which this ionic instability occurs depends on the morphology and intrinsic conductance characteristic of the neuron. If ATP shortage is confined to the distal part of the axon, the ensuing local ionic instability eventually spreads to the whole neuron and involves fasciculation-like spiking events. A shortage of ATP also causes a rise in intracellular calcium. Our modeling work supports the notion that mitochondrial dysfunction can account for salient features of the paralytic disorder amyotrophic lateral sclerosis, including motor neuron hyperexcitability, fasciculation, and differential vulnerability of motor neuron subpopulations. Copyright © 2014 Elsevier Inc. All rights reserved.

  13. Interaction function of coupled bursting neurons

    International Nuclear Information System (INIS)

    Shi Xia; Zhang Jiadong

    2016-01-01

    The interaction functions of electrically coupled Hindmarsh–Rose (HR) neurons for different firing patterns are investigated in this paper. By applying the phase reduction technique, the phase response curve (PRC) of the spiking neuron and burst phase response curve (BPRC) of the bursting neuron are derived. Then the interaction function of two coupled neurons can be calculated numerically according to the PRC (or BPRC) and the voltage time course of the neurons. Results show that the BPRC is more and more complicated with the increase of the spike number within a burst, and the curve of the interaction function oscillates more and more frequently with it. However, two certain things are unchanged: ϕ = 0, which corresponds to the in-phase synchronization state, is always the stable equilibrium, while the anti-phase synchronization state with ϕ = 0.5 is an unstable equilibrium. (paper)

  14. Timing control by redundant inhibitory neuronal circuits

    International Nuclear Information System (INIS)

    Tristan, I.; Rulkov, N. F.; Huerta, R.; Rabinovich, M.

    2014-01-01

    Rhythms and timing control of sequential activity in the brain is fundamental to cognition and behavior. Although experimental and theoretical studies support the understanding that neuronal circuits are intrinsically capable of generating different time intervals, the dynamical origin of the phenomenon of functionally dependent timing control is still unclear. Here, we consider a new mechanism that is related to the multi-neuronal cooperative dynamics in inhibitory brain motifs consisting of a few clusters. It is shown that redundancy and diversity of neurons within each cluster enhances the sensitivity of the timing control with the level of neuronal excitation of the whole network. The generality of the mechanism is shown to work on two different neuronal models: a conductance-based model and a map-based model

  15. Reflections on mirror neurons and speech perception

    Science.gov (United States)

    Lotto, Andrew J.; Hickok, Gregory S.; Holt, Lori L.

    2010-01-01

    The discovery of mirror neurons, a class of neurons that respond when a monkey performs an action and also when the monkey observes others producing the same action, has promoted a renaissance for the Motor Theory (MT) of speech perception. This is because mirror neurons seem to accomplish the same kind of one to one mapping between perception and action that MT theorizes to be the basis of human speech communication. However, this seeming correspondence is superficial, and there are theoretical and empirical reasons to temper enthusiasm about the explanatory role mirror neurons might have for speech perception. In fact, rather than providing support for MT, mirror neurons are actually inconsistent with the central tenets of MT. PMID:19223222

  16. Attractor dynamics in local neuronal networks

    Directory of Open Access Journals (Sweden)

    Jean-Philippe eThivierge

    2014-03-01

    Full Text Available Patterns of synaptic connectivity in various regions of the brain are characterized by the presence of synaptic motifs, defined as unidirectional and bidirectional synaptic contacts that follow a particular configuration and link together small groups of neurons. Recent computational work proposes that a relay network (two populations communicating via a third, relay population of neurons can generate precise patterns of neural synchronization. Here, we employ two distinct models of neuronal dynamics and show that simulated neural circuits designed in this way are caught in a global attractor of activity that prevents neurons from modulating their response on the basis of incoming stimuli. To circumvent the emergence of a fixed global attractor, we propose a mechanism of selective gain inhibition that promotes flexible responses to external stimuli. We suggest that local neuronal circuits may employ this mechanism to generate precise patterns of neural synchronization whose transient nature delimits the occurrence of a brief stimulus.

  17. Central auditory neurons have composite receptive fields.

    Science.gov (United States)

    Kozlov, Andrei S; Gentner, Timothy Q

    2016-02-02

    High-level neurons processing complex, behaviorally relevant signals are sensitive to conjunctions of features. Characterizing the receptive fields of such neurons is difficult with standard statistical tools, however, and the principles governing their organization remain poorly understood. Here, we demonstrate multiple distinct receptive-field features in individual high-level auditory neurons in a songbird, European starling, in response to natural vocal signals (songs). We then show that receptive fields with similar characteristics can be reproduced by an unsupervised neural network trained to represent starling songs with a single learning rule that enforces sparseness and divisive normalization. We conclude that central auditory neurons have composite receptive fields that can arise through a combination of sparseness and normalization in neural circuits. Our results, along with descriptions of random, discontinuous receptive fields in the central olfactory neurons in mammals and insects, suggest general principles of neural computation across sensory systems and animal classes.

  18. A single-neuron tracing study of arkypallidal and prototypic neurons in healthy rats.

    Science.gov (United States)

    Fujiyama, Fumino; Nakano, Takashi; Matsuda, Wakoto; Furuta, Takahiro; Udagawa, Jun; Kaneko, Takeshi

    2016-12-01

    The external globus pallidus (GP) is known as a relay nucleus of the indirect pathway of the basal ganglia. Recent studies in dopamine-depleted and healthy rats indicate that the GP comprises two main types of pallidofugal neurons: the so-called "prototypic" and "arkypallidal" neurons. However, the reconstruction of complete arkypallidal neurons in healthy rats has not been reported. Here we visualized the entire axonal arborization of four single arkypallidal neurons and six single prototypic neurons in rat brain using labeling with a viral vector expressing membrane-targeted green fluorescent protein and examined the distribution of axon boutons in the target nuclei. Results revealed that not only the arkypallidal neurons but nearly all of the prototypic neurons projected to the striatum with numerous axon varicosities. Thus, the striatum is a major target nucleus for pallidal neurons. Arkypallidal and prototypic GP neurons located in the calbindin-positive and calbindin-negative regions mainly projected to the corresponding positive and negative regions in the striatum. Because the GP and striatum calbindin staining patterns reflect the topographic organization of the striatopallidal projection, the striatal neurons in the sensorimotor and associative regions constitute the reciprocal connection with the GP neurons in the corresponding regions.

  19. Neuron-derived IgG protects neurons from complement-dependent cytotoxicity.

    Science.gov (United States)

    Zhang, Jie; Niu, Na; Li, Bingjie; McNutt, Michael A

    2013-12-01

    Passive immunity of the nervous system has traditionally been thought to be predominantly due to the blood-brain barrier. This concept must now be revisited based on the existence of neuron-derived IgG. The conventional concept is that IgG is produced solely by mature B lymphocytes, but it has now been found to be synthesized by murine and human neurons. However, the function of this endogenous IgG is poorly understood. In this study, we confirm IgG production by rat cortical neurons at the protein and mRNA levels, with 69.0 ± 5.8% of cortical neurons IgG-positive. Injury to primary-culture neurons was induced by complement leading to increases in IgG production. Blockage of neuron-derived IgG resulted in more neuronal death and early apoptosis in the presence of complement. In addition, FcγRI was found in microglia and astrocytes. Expression of FcγR I in microglia was increased by exposure to neuron-derived IgG. Release of NO from microglia triggered by complement was attenuated by neuron-derived IgG, and this attenuation could be reversed by IgG neutralization. These data demonstrate that neuron-derived IgG is protective of neurons against injury induced by complement and microglial activation. IgG appears to play an important role in maintaining the stability of the nervous system.

  20. Role of neuronal activity in regulating the structure and function of auditory neurons

    International Nuclear Information System (INIS)

    Born, D.E.

    1986-01-01

    The role of afferent activity in maintaining neuronal structure and function was investigated in second order auditory neurons in nucleus magnocellularis (NM) of the chicken. The cochlea provides the major excitatory input to NM neurons via the eighth nerve. Removal of the cochlea causes dramatic changes in NM neurons. To determine if the elimination of neuronal activity is responsible for the changes in NM seen after cochlea removal, tetrodotoxin was used block action potentials in the cochlear ganglion cells. Tetrodotoxin injections into the perilymph reliably blocked neuronal activity in the cochlear nerve and NM. Far field recordings of sound-evoked potentials revealed that responses returned within 6 hours. Changes in amino acid incorporation in NM neurons were measured by giving intracardiac injections of 3 H-leucine and preparing tissue for autoradiographic demonstration of incorporated amino acid. Grain counts over individual neurons revealed that a single injection of tetrodotoxin produced a 40% decrease in grain density in ipsilateral NM neurons. It is concluded that neuronal activity plays an important contribution to the maintenance of the normal properties of NM neurons

  1. MRI of neuronal migration disorders

    International Nuclear Information System (INIS)

    Engelbrecht, V.

    1996-01-01

    Twenty-one MRI examinations of the brain were performed in 19 children with neuronal migration disorders. Multiplanar oriented spin-echo sequences were on a scanner with 1.5 T. In 8 children we performed an additional turbo-inversion recovery (TIR) sequence. Results of sonography or CT from five children were compared with MRI scans. Using the actual nomenclature, we found the following migration disorders: Lissencephaly (n=6), cobblestone lissencephaly with Walker-Warbung syndrome (WWS) (n=2), polymicrogyria and schizencephaly (n=2), focal heterotopia (n=5), diffuse heterotopie (n=2) and hemimegalencephaly (n=2). MRI was superior to CT and sonography in all children. Except for the two boys with WWS, the TIR sequence was the best to demonstrate the changes in migration disorder because of the high contrast between gray and white matter. We demonstrate the characteristic features of the different migration disorders and compare them with the existing literature. (orig.) [de

  2. Neuronal responses to physiological stress

    DEFF Research Database (Denmark)

    Kagias, Konstantinos; Nehammer, Camilla; Pocock, Roger David John

    2012-01-01

    damage during aging that results in decline and eventual death. Studies have shown that the nervous system plays a pivotal role in responding to stress. Neurons not only receive and process information from the environment but also actively respond to various stresses to promote survival. These responses......Physiological stress can be defined as any external or internal condition that challenges the homeostasis of a cell or an organism. It can be divided into three different aspects: environmental stress, intrinsic developmental stress, and aging. Throughout life all living organisms are challenged...... by changes in the environment. Fluctuations in oxygen levels, temperature, and redox state for example, trigger molecular events that enable an organism to adapt, survive, and reproduce. In addition to external stressors, organisms experience stress associated with morphogenesis and changes in inner...

  3. Responses of neurons to extreme osmomechanical stress.

    Science.gov (United States)

    Wan, X; Harris, J A; Morris, C E

    1995-05-01

    Neurons are often regarded as fragile cells, easily destroyed by mechanical and osmotic insult. The results presented here demonstrate that this perception needs revision. Using extreme osmotic swelling, we show that molluscan neurons are astonishingly robust. In distilled water, a heterogeneous population of Lymnaea stagnalis CNS neurons swelled to several times their initial volume, yet had a ST50 (survival time for 50% of cells) > 60 min. Cells that were initially bigger survived longer. On return to normal medium, survivors were able, over the next 24 hr, to rearborize. Reversible membrane capacitance changes corresponding to about 0.7 muF/cm2 of apparent surface area accompanied neuronal swelling and shrinking in hypo- and hyperosmotic solutions; reversible changes in cell surface area evidently contributed to the neurons' ability to accommodate hydrostatic pressures then recover. The reversible membrane area/capacitance changes were not dependent on extracellular Ca2+. Neurons were monitored for potassium currents during direct mechanical inflation and during osmotically driven inflation. The latter but not the former stimulus routinely elicited small potassium currents, suggesting that tension increases activate the currents only if additional disruption of the cortex has occurred. Under stress in distilled water, a third of the neurons displayed a quite unexpected behavior: prolonged writhing of peripheral regions of the soma. This suggested that a plasma membrane-linked contractile machinery (presumably actomyosin) might contribute to the neurons' mechano-osmotic robustness by restricting water influx. Consistent with this possibility, 1 mM N-ethyl-maleimide, which inhibits myosin ATPase, decreased the ST50 to 18 min, rendered the survival time independent of initial size, and abolished writhing activity. For neurons, active mechanical resistance of the submembranous cortex, along with the mechanical compliance supplied by insertion or eversion of membrane

  4. Mirror neurons: from origin to function.

    Science.gov (United States)

    Cook, Richard; Bird, Geoffrey; Catmur, Caroline; Press, Clare; Heyes, Cecilia

    2014-04-01

    This article argues that mirror neurons originate in sensorimotor associative learning and therefore a new approach is needed to investigate their functions. Mirror neurons were discovered about 20 years ago in the monkey brain, and there is now evidence that they are also present in the human brain. The intriguing feature of many mirror neurons is that they fire not only when the animal is performing an action, such as grasping an object using a power grip, but also when the animal passively observes a similar action performed by another agent. It is widely believed that mirror neurons are a genetic adaptation for action understanding; that they were designed by evolution to fulfill a specific socio-cognitive function. In contrast, we argue that mirror neurons are forged by domain-general processes of associative learning in the course of individual development, and, although they may have psychological functions, they do not necessarily have a specific evolutionary purpose or adaptive function. The evidence supporting this view shows that (1) mirror neurons do not consistently encode action "goals"; (2) the contingency- and context-sensitive nature of associative learning explains the full range of mirror neuron properties; (3) human infants receive enough sensorimotor experience to support associative learning of mirror neurons ("wealth of the stimulus"); and (4) mirror neurons can be changed in radical ways by sensorimotor training. The associative account implies that reliable information about the function of mirror neurons can be obtained only by research based on developmental history, system-level theory, and careful experimentation.

  5. Contribution of synchronized GABAergic neurons to dopaminergic neuron firing and bursting.

    Science.gov (United States)

    Morozova, Ekaterina O; Myroshnychenko, Maxym; Zakharov, Denis; di Volo, Matteo; Gutkin, Boris; Lapish, Christopher C; Kuznetsov, Alexey

    2016-10-01

    In the ventral tegmental area (VTA), interactions between dopamine (DA) and γ-aminobutyric acid (GABA) neurons are critical for regulating DA neuron activity and thus DA efflux. To provide a mechanistic explanation of how GABA neurons influence DA neuron firing, we developed a circuit model of the VTA. The model is based on feed-forward inhibition and recreates canonical features of the VTA neurons. Simulations revealed that γ-aminobutyric acid (GABA) receptor (GABAR) stimulation can differentially influence the firing pattern of the DA neuron, depending on the level of synchronization among GABA neurons. Asynchronous activity of GABA neurons provides a constant level of inhibition to the DA neuron and, when removed, produces a classical disinhibition burst. In contrast, when GABA neurons are synchronized by common synaptic input, their influence evokes additional spikes in the DA neuron, resulting in increased measures of firing and bursting. Distinct from previous mechanisms, the increases were not based on lowered firing rate of the GABA neurons or weaker hyperpolarization by the GABAR synaptic current. This phenomenon was induced by GABA-mediated hyperpolarization of the DA neuron that leads to decreases in intracellular calcium (Ca 2+ ) concentration, thus reducing the Ca 2+ -dependent potassium (K + ) current. In this way, the GABA-mediated hyperpolarization replaces Ca 2+ -dependent K + current; however, this inhibition is pulsatile, which allows the DA neuron to fire during the rhythmic pauses in inhibition. Our results emphasize the importance of inhibition in the VTA, which has been discussed in many studies, and suggest a novel mechanism whereby computations can occur locally. Copyright © 2016 the American Physiological Society.

  6. Stochastic multiresonance in coupled excitable FHN neurons

    Science.gov (United States)

    Li, Huiyan; Sun, Xiaojuan; Xiao, Jinghua

    2018-04-01

    In this paper, effects of noise on Watts-Strogatz small-world neuronal networks, which are stimulated by a subthreshold signal, have been investigated. With the numerical simulations, it is surprisingly found that there exist several optimal noise intensities at which the subthreshold signal can be detected efficiently. This indicates the occurrence of stochastic multiresonance in the studied neuronal networks. Moreover, it is revealed that the occurrence of stochastic multiresonance has close relationship with the period of subthreshold signal Te and the noise-induced mean period of the neuronal networks T0. In detail, we find that noise could induce the neuronal networks to generate stochastic resonance for M times if Te is not very large and falls into the interval ( M × T 0 , ( M + 1 ) × T 0 ) with M being a positive integer. In real neuronal system, subthreshold signal detection is very meaningful. Thus, the obtained results in this paper could give some important implications on detecting subthreshold signal and propagating neuronal information in neuronal systems.

  7. Neuronal medium that supports basic synaptic functions and activity of human neurons in vitro.

    Science.gov (United States)

    Bardy, Cedric; van den Hurk, Mark; Eames, Tameji; Marchand, Cynthia; Hernandez, Ruben V; Kellogg, Mariko; Gorris, Mark; Galet, Ben; Palomares, Vanessa; Brown, Joshua; Bang, Anne G; Mertens, Jerome; Böhnke, Lena; Boyer, Leah; Simon, Suzanne; Gage, Fred H

    2015-05-19

    Human cell reprogramming technologies offer access to live human neurons from patients and provide a new alternative for modeling neurological disorders in vitro. Neural electrical activity is the essence of nervous system function in vivo. Therefore, we examined neuronal activity in media widely used to culture neurons. We found that classic basal media, as well as serum, impair action potential generation and synaptic communication. To overcome this problem, we designed a new neuronal medium (BrainPhys basal + serum-free supplements) in which we adjusted the concentrations of inorganic salts, neuroactive amino acids, and energetic substrates. We then tested that this medium adequately supports neuronal activity and survival of human neurons in culture. Long-term exposure to this physiological medium also improved the proportion of neurons that were synaptically active. The medium was designed to culture human neurons but also proved adequate for rodent neurons. The improvement in BrainPhys basal medium to support neurophysiological activity is an important step toward reducing the gap between brain physiological conditions in vivo and neuronal models in vitro.

  8. Protocol for culturing low density pure rat hippocampal neurons supported by mature mixed neuron cultures.

    Science.gov (United States)

    Yang, Qian; Ke, Yini; Luo, Jianhong; Tang, Yang

    2017-02-01

    primary hippocampal neuron cultures allow for subcellular morphological dissection, easy access to drug treatment and electrophysiology analysis of individual neurons, and is therefore an ideal model for the study of neuron physiology. While neuron and glia mixed cultures are relatively easy to prepare, pure neurons are particular hard to culture at low densities which are suitable for morphology studies. This may be due to a lack of neurotrophic factors such as brain derived neurotrophic factor (BDNF), neurotrophin-3 (NT3) and Glial cell line-derived neurotrophic factor (GDNF). In this study we used a two step protocol in which neuron-glia mixed cultures were initially prepared for maturation to support the growth of young neurons plated at very low densities. Our protocol showed that neurotrophic support resulted in physiologically functional hippocampal neurons with larger cell body, increased neurite length and decreased branching and complexity compared to cultures prepared using a conventional method. Our protocol provides a novel way to culture highly uniformed hippocampal neurons for acquiring high quality, neuron based data. Copyright © 2016 Elsevier B.V. All rights reserved.

  9. Survival motor neuron protein in motor neurons determines synaptic integrity in spinal muscular atrophy.

    Science.gov (United States)

    Martinez, Tara L; Kong, Lingling; Wang, Xueyong; Osborne, Melissa A; Crowder, Melissa E; Van Meerbeke, James P; Xu, Xixi; Davis, Crystal; Wooley, Joe; Goldhamer, David J; Lutz, Cathleen M; Rich, Mark M; Sumner, Charlotte J

    2012-06-20

    The inherited motor neuron disease spinal muscular atrophy (SMA) is caused by deficient expression of survival motor neuron (SMN) protein and results in severe muscle weakness. In SMA mice, synaptic dysfunction of both neuromuscular junctions (NMJs) and central sensorimotor synapses precedes motor neuron cell death. To address whether this synaptic dysfunction is due to SMN deficiency in motor neurons, muscle, or both, we generated three lines of conditional SMA mice with tissue-specific increases in SMN expression. All three lines of mice showed increased survival, weights, and improved motor behavior. While increased SMN expression in motor neurons prevented synaptic dysfunction at the NMJ and restored motor neuron somal synapses, increased SMN expression in muscle did not affect synaptic function although it did improve myofiber size. Together these data indicate that both peripheral and central synaptic integrity are dependent on motor neurons in SMA, but SMN may have variable roles in the maintenance of these different synapses. At the NMJ, it functions at the presynaptic terminal in a cell-autonomous fashion, but may be necessary for retrograde trophic signaling to presynaptic inputs onto motor neurons. Importantly, SMN also appears to function in muscle growth and/or maintenance independent of motor neurons. Our data suggest that SMN plays distinct roles in muscle, NMJs, and motor neuron somal synapses and that restored function of SMN at all three sites will be necessary for full recovery of muscle power.

  10. Glass promotes the differentiation of neuronal and non-neuronal cell types in the Drosophila eye

    Science.gov (United States)

    Morrison, Carolyn A.; Chen, Hao; Cook, Tiffany; Brown, Stuart

    2018-01-01

    Transcriptional regulators can specify different cell types from a pool of equivalent progenitors by activating distinct developmental programs. The Glass transcription factor is expressed in all progenitors in the developing Drosophila eye, and is maintained in both neuronal and non-neuronal cell types. Glass is required for neuronal progenitors to differentiate as photoreceptors, but its role in non-neuronal cone and pigment cells is unknown. To determine whether Glass activity is limited to neuronal lineages, we compared the effects of misexpressing it in neuroblasts of the larval brain and in epithelial cells of the wing disc. Glass activated overlapping but distinct sets of genes in these neuronal and non-neuronal contexts, including markers of photoreceptors, cone cells and pigment cells. Coexpression of other transcription factors such as Pax2, Eyes absent, Lozenge and Escargot enabled Glass to induce additional genes characteristic of the non-neuronal cell types. Cell type-specific glass mutations generated in cone or pigment cells using somatic CRISPR revealed autonomous developmental defects, and expressing Glass specifically in these cells partially rescued glass mutant phenotypes. These results indicate that Glass is a determinant of organ identity that acts in both neuronal and non-neuronal cells to promote their differentiation into functional components of the eye. PMID:29324767

  11. Parkin Mutations Reduce the Complexity of Neuronal Processes in iPSC-derived Human Neurons

    Science.gov (United States)

    Ren, Yong; Jiang, Houbo; Hu, Zhixing; Fan, Kevin; Wang, Jun; Janoschka, Stephen; Wang, Xiaomin; Ge, Shaoyu; Feng, Jian

    2015-01-01

    Parkinson’s disease (PD) is characterized by the degeneration of nigral dopaminergic (DA) neurons and non-DA neurons in many parts of the brain. Mutations of parkin, an E3 ubiquitin ligase that strongly binds to microtubules, are the most frequent cause of recessively inherited Parkinson’s disease. The lack of robust PD phenotype in parkin knockout mice suggests a unique vulnerability of human neurons to parkin mutations. Here, we show that the complexity of neuronal processes as measured by total neurite length, number of terminals, number of branch points and Sholl analysis, was greatly reduced in induced pluripotent stem cell (iPSC)-derived TH+ or TH− neurons from PD patients with parkin mutations. Consistent with these, microtubule stability was significantly decreased by parkin mutations in iPSC-derived neurons. Overexpression of parkin, but not its PD-linked mutant nor GFP, restored the complexity of neuronal processes and the stability of microtubules. Consistent with these, the microtubule-depolymerizing agent colchicine mimicked the effect of parkin mutations by decreasing neurite length and complexity in control neurons while the microtubule-stabilizing drug taxol mimicked the effect of parkin overexpression by enhancing the morphology of parkin-deficient neurons. The results suggest that parkin maintains the morphological complexity of human neurons by stabilizing microtubules. PMID:25332110

  12. Context-aware modeling of neuronal morphologies

    Directory of Open Access Journals (Sweden)

    Benjamin eTorben-Nielsen

    2014-09-01

    Full Text Available Neuronal morphologies are pivotal for brain functioning: physical overlap between dendrites and axons constrain the circuit topology, and the precise shape and composition of dendrites determine the integration of inputs to produce an output signal. At the same time, morphologies are highly diverse and variant. The variance, presumably, originates from neurons developing in a densely packed brain substrate where they interact (e.g., repulsion or attraction with other actors in this substrate. However, when studying neurons their context is never part of the analysis and they are treated as if they existed in isolation.Here we argue that to fully understand neuronal morphology and its variance it is important to consider neurons in relation to each other and to other actors in the surrounding brain substrate, i.e., their context. We propose a context-aware computational framework, NeuroMaC, in which large numbers of neurons can be grown simultaneously according to growth rules expressed in terms of interactions between the developing neuron and the surrounding brain substrate.As a proof of principle, we demonstrate that by using NeuroMaC we can generate accurate virtual morphologies of distinct classes both in isolation and as part of neuronal forests. Accuracy is validated against population statistics of experimentally reconstructed morphologies. We show that context-aware generation of neurons can explain characteristics of variation. Indeed, plausible variation is an inherent property of the morphologies generated by context-aware rules. We speculate about the applicability of this framework to investigate morphologies and circuits, to classify healthy and pathological morphologies, and to generate large quantities of morphologies for large-scale modeling.

  13. Evoking prescribed spike times in stochastic neurons

    Science.gov (United States)

    Doose, Jens; Lindner, Benjamin

    2017-09-01

    Single cell stimulation in vivo is a powerful tool to investigate the properties of single neurons and their functionality in neural networks. We present a method to determine a cell-specific stimulus that reliably evokes a prescribed spike train with high temporal precision of action potentials. We test the performance of this stimulus in simulations for two different stochastic neuron models. For a broad range of parameters and a neuron firing with intermediate firing rates (20-40 Hz) the reliability in evoking the prescribed spike train is close to its theoretical maximum that is mainly determined by the level of intrinsic noise.

  14. Response of spiking neurons to correlated inputs

    International Nuclear Information System (INIS)

    Moreno, Ruben; Rocha, Jaime de la; Renart, Alfonso; Parga, Nestor

    2002-01-01

    The effect of a temporally correlated afferent current on the firing rate of a leaky integrate-and-fire neuron is studied. This current is characterized in terms of rates, autocorrelations, and cross correlations, and correlation time scale τ c of excitatory and inhibitory inputs. The output rate ν out is calculated in the Fokker-Planck formalism in the limit of both small and large τ c compared to the membrane time constant τ of the neuron. By simulations we check the analytical results, provide an interpolation valid for all τ c , and study the neuron's response to rapid changes in the correlation magnitude

  15. The Relevance of AgRP Neuron-Derived GABA Inputs to POMC Neurons Differs for Spontaneous and Evoked Release.

    Science.gov (United States)

    Rau, Andrew R; Hentges, Shane T

    2017-08-02

    Hypothalamic agouti-related peptide (AgRP) neurons potently stimulate food intake, whereas proopiomelanocortin (POMC) neurons inhibit feeding. Whether AgRP neurons exert their orexigenic actions, at least in part, by inhibiting anorexigenic POMC neurons remains unclear. Here, the connectivity between GABA-releasing AgRP neurons and POMC neurons was examined in brain slices from male and female mice. GABA-mediated spontaneous IPSCs (sIPSCs) in POMC neurons were unaffected by disturbing GABA release from AgRP neurons either by cell type-specific deletion of the vesicular GABA transporter or by expression of botulinum toxin in AgRP neurons to prevent vesicle-associated membrane protein 2-dependent vesicle fusion. Additionally, there was no difference in the ability of μ-opioid receptor (MOR) agonists to inhibit sIPSCs in POMC neurons when MORs were deleted from AgRP neurons, and activation of the inhibitory designer receptor hM4Di on AgRP neurons did not affect sIPSCs recorded from POMC neurons. These approaches collectively indicate that AgRP neurons do not significantly contribute to the strong spontaneous GABA input to POMC neurons. Despite these observations, optogenetic stimulation of AgRP neurons reliably produced evoked IPSCs in POMC neurons, leading to the inhibition of POMC neuron firing. Thus, AgRP neurons can potently affect POMC neuron function without contributing a significant source of spontaneous GABA input to POMC neurons. Together, these results indicate that the relevance of GABAergic inputs from AgRP to POMC neurons is state dependent and highlight the need to consider different types of transmitter release in circuit mapping and physiologic regulation. SIGNIFICANCE STATEMENT Agouti-related peptide (AgRP) neurons play an important role in driving food intake, while proopiomelanocortin (POMC) neurons inhibit feeding. Despite the importance of these two well characterized neuron types in maintaining metabolic homeostasis, communication between these

  16. Effect of correlating adjacent neurons for identifying communications: Feasibility experiment in a cultured neuronal network

    OpenAIRE

    Yoshi Nishitani; Chie Hosokawa; Yuko Mizuno-Matsumoto; Tomomitsu Miyoshi; Shinichi Tamura

    2017-01-01

    Neuronal networks have fluctuating characteristics, unlike the stable characteristics seen in computers. The underlying mechanisms that drive reliable communication among neuronal networks and their ability to perform intelligible tasks remain unknown. Recently, in an attempt to resolve this issue, we showed that stimulated neurons communicate via spikes that propagate temporally, in the form of spike trains. We named this phenomenon “spike wave propagation”. In these previous studies, using ...

  17. Reconstruction of phrenic neuron identity in embryonic stem cell-derived motor neurons.

    Science.gov (United States)

    Machado, Carolina Barcellos; Kanning, Kevin C; Kreis, Patricia; Stevenson, Danielle; Crossley, Martin; Nowak, Magdalena; Iacovino, Michelina; Kyba, Michael; Chambers, David; Blanc, Eric; Lieberam, Ivo

    2014-02-01

    Air breathing is an essential motor function for vertebrates living on land. The rhythm that drives breathing is generated within the central nervous system and relayed via specialised subsets of spinal motor neurons to muscles that regulate lung volume. In mammals, a key respiratory muscle is the diaphragm, which is innervated by motor neurons in the phrenic nucleus. Remarkably, relatively little is known about how this crucial subtype of motor neuron is generated during embryogenesis. Here, we used direct differentiation of motor neurons from mouse embryonic stem cells as a tool to identify genes that direct phrenic neuron identity. We find that three determinants, Pou3f1, Hoxa5 and Notch, act in combination to promote a phrenic neuron molecular identity. We show that Notch signalling induces Pou3f1 in developing motor neurons in vitro and in vivo. This suggests that the phrenic neuron lineage is established through a local source of Notch ligand at mid-cervical levels. Furthermore, we find that the cadherins Pcdh10, which is regulated by Pou3f1 and Hoxa5, and Cdh10, which is controlled by Pou3f1, are both mediators of like-like clustering of motor neuron cell bodies. This specific Pcdh10/Cdh10 activity might provide the means by which phrenic neurons are assembled into a distinct nucleus. Our study provides a framework for understanding how phrenic neuron identity is conferred and will help to generate this rare and inaccessible yet vital neuronal subtype directly from pluripotent stem cells, thus facilitating subsequent functional investigations.

  18. Fitting neuron models to spike trains

    Directory of Open Access Journals (Sweden)

    Cyrille eRossant

    2011-02-01

    Full Text Available Computational modeling is increasingly used to understand the function of neural circuitsin systems neuroscience.These studies require models of individual neurons with realisticinput-output properties.Recently, it was found that spiking models can accurately predict theprecisely timed spike trains produced by cortical neurons in response tosomatically injected currents,if properly fitted. This requires fitting techniques that are efficientand flexible enough to easily test different candidate models.We present a generic solution, based on the Brian simulator(a neural network simulator in Python, which allowsthe user to define and fit arbitrary neuron models to electrophysiological recordings.It relies on vectorization and parallel computing techniques toachieve efficiency.We demonstrate its use on neural recordings in the barrel cortex andin the auditory brainstem, and confirm that simple adaptive spiking modelscan accurately predict the response of cortical neurons. Finally, we show how a complexmulticompartmental model can be reduced to a simple effective spiking model.

  19. Toward functional classification of neuronal types.

    Science.gov (United States)

    Sharpee, Tatyana O

    2014-09-17

    How many types of neurons are there in the brain? This basic neuroscience question remains unsettled despite many decades of research. Classification schemes have been proposed based on anatomical, electrophysiological, or molecular properties. However, different schemes do not always agree with each other. This raises the question of whether one can classify neurons based on their function directly. For example, among sensory neurons, can a classification scheme be devised that is based on their role in encoding sensory stimuli? Here, theoretical arguments are outlined for how this can be achieved using information theory by looking at optimal numbers of cell types and paying attention to two key properties: correlations between inputs and noise in neural responses. This theoretical framework could help to map the hierarchical tree relating different neuronal classes within and across species. Copyright © 2014 Elsevier Inc. All rights reserved.

  20. From quantum entanglement to mirror neuron

    International Nuclear Information System (INIS)

    Zak, Michail

    2007-01-01

    It is proposed that two fundamental phenomena: quantum entanglement in physics, and mirror neuron in biopsychology, can be described by using the same mathematical formalism, namely, the feedback from the Liouville equation to equation of motion

  1. Do enteric neurons make hypocretin? ☆

    Science.gov (United States)

    Baumann, Christian R.; Clark, Erika L.; Pedersen, Nigel P.; Hecht, Jonathan L.; Scammell, Thomas E.

    2008-01-01

    Hypocretins (orexins) are wake-promoting neuropeptides produced by hypothalamic neurons. These hypocretin-producing cells are lost in people with narcolepsy, possibly due to an autoimmune attack. Prior studies described hypocretin neurons in the enteric nervous system, and these cells could be an additional target of an autoimmune process. We sought to determine whether enteric hypocretin neurons are lost in narcoleptic subjects. Even though we tried several methods (including whole mounts, sectioned tissue, pre-treatment of mice with colchicine, and the use of various primary antisera), we could not identify hypocretin-producing cells in enteric nervous tissue collected from mice or normal human subjects. These results raise doubts about whether enteric neurons produce hypocretin. PMID:18191238

  2. Advances in 3D neuronal cell culture

    NARCIS (Netherlands)

    Frimat, Jean Philippe; Xie, Sijia; Bastiaens, Alex; Schurink, Bart; Wolbers, Floor; Den Toonder, Jaap; Luttge, Regina

    2015-01-01

    In this contribution, the authors present our advances in three-dimensional (3D) neuronal cell culture platform technology contributing to controlled environments for microtissue engineering and analysis of cellular physiological and pathological responses. First, a micromachined silicon sieving

  3. Review Paper: Polyphenolic Antioxidants and Neuronal Regeneration

    Directory of Open Access Journals (Sweden)

    Amin Ataie

    2016-05-01

    Full Text Available Many studies indicate that oxidative stress is involved in the pathophysiology of neurodegenerative diseases. Oxidative stress can induce neuronal damages, modulate intracellular signaling and ultimately leads to neuronal death by apoptosis or necrosis. To review antioxidants preventive effects on oxidative stress and neurodegenerative diseases we accumulated data from international medical journals and academic informations' sites. According to many studies, antioxidants could reduce toxic neuronal damages and many studies confirmed the efficacy of polyphenol antioxidants in fruits and vegetables to reduce neuronal death and to diminish oxidative stress. This systematic review showed the antioxidant activities of phytochemicals which play as natural neuroprotectives with low adverse effects against some neurodegenerative diseases as Parkinson or Alzheimer diseases.

  4. Review Paper: Polyphenolic Antioxidants and Neuronal Regeneration

    Directory of Open Access Journals (Sweden)

    Amin Ataie

    2016-04-01

    Full Text Available Many studies indicate that oxidative stress is involved in the pathophysiology of neurodegenerative diseases. Oxidative stress can induce neuronal damages, modulate intracellular signaling and ultimately leads to neuronal death by apoptosis or necrosis. To review antioxidants preventive effects on oxidative stress and neurodegenerative diseases we accumulated data from international medical journals and academic informations' sites. According to many studies, antioxidants could reduce toxic neuronal damages and many studies confirmed the efficacy of polyphenol antioxidants in fruits and vegetables to reduce neuronal death and to diminish oxidative stress. This systematic review showed the antioxidant activities of phytochemicals which play as natural neuroprotectives with low adverse effects against some neurodegenerative diseases as Parkinson or Alzheimer diseases.

  5. AgRP neurons regulate development of dopamine neuronal plasticity and nonfood-associated behaviors

    Science.gov (United States)

    Dietrich, Marcelo O; Bober, Jeremy; Ferreira, Jozélia G; Tellez, Luis A; Mineur, Yann S; Souza, Diogo O; Gao, Xiao-Bing; Picciotto, Marina R; Araújo, Ivan; Liu, Zhong-Wu; Horvath, Tamas L

    2012-01-01

    It is not known whether behaviors unrelated to feeding are affected by hypothalamic regulators of hunger. We found that impairment of Agouti-related protein (AgRP) circuitry by either Sirt1 knockdown in AgRP-expressing neurons or early postnatal ablation of these neurons increased exploratory behavior and enhanced responses to cocaine. In AgRP circuit–impaired mice, ventral tegmental dopamine neurons exhibited enhanced spike timing–dependent long-term potentiation, altered amplitude of miniature postsynaptic currents and elevated dopamine in basal forebrain. Thus, AgRP neurons determine the set point of the reward circuitry and associated behaviors. PMID:22729177

  6. Labeling of neuronal differentiation and neuron cells with biocompatible fluorescent nanodiamonds.

    Science.gov (United States)

    Hsu, Tzu-Chia; Liu, Kuang-Kai; Chang, Huan-Cheng; Hwang, Eric; Chao, Jui-I

    2014-05-16

    Nanodiamond is a promising carbon nanomaterial developed for biomedical applications. Here, we show fluorescent nanodiamond (FND) with the biocompatible properties that can be used for the labeling and tracking of neuronal differentiation and neuron cells derived from embryonal carcinoma stem (ECS) cells. The fluorescence intensities of FNDs were increased by treatment with FNDs in both the mouse P19 and human NT2/D1 ECS cells. FNDs were taken into ECS cells; however, FNDs did not alter the cellular morphology and growth ability. Moreover, FNDs did not change the protein expression of stem cell marker SSEA-1 of ECS cells. The neuronal differentiation of ECS cells could be induced by retinoic acid (RA). Interestingly, FNDs did not affect on the morphological alteration, cytotoxicity and apoptosis during the neuronal differentiation. Besides, FNDs did not alter the cell viability and the expression of neuron-specific marker β-III-tubulin in these differentiated neuron cells. The existence of FNDs in the neuron cells can be identified by confocal microscopy and flow cytometry. Together, FND is a biocompatible and readily detectable nanomaterial for the labeling and tracking of neuronal differentiation process and neuron cells from stem cells.

  7. Neuronal growth on L- and D-cysteine self-assembled monolayers reveals neuronal chiral sensitivity.

    Science.gov (United States)

    Baranes, Koby; Moshe, Hagay; Alon, Noa; Schwartz, Shmulik; Shefi, Orit

    2014-05-21

    Studying the interaction between neuronal cells and chiral molecules is fundamental for the design of novel biomaterials and drugs. Chirality influences all biological processes that involve intermolecular interaction. One common method used to study cellular interactions with different enantiomeric targets is the use of chiral surfaces. Based on previous studies that demonstrated the importance of cysteine in the nervous system, we studied the effect of L- and D-cysteine on single neuronal growth. L-Cysteine, which normally functions as a neuromodulator or a neuroprotective antioxidant, causes damage at elevated levels, which may occur post trauma. In this study, we grew adult neurons in culture enriched with L- and D-cysteine as free compounds or as self-assembled monolayers of chiral surfaces and examined the effect on the neuronal morphology and adhesion. Notably, we have found that exposure to the L-cysteine enantiomer inhibited, and even prevented, neuronal attachment more severely than exposure to the D-cysteine enantiomer. Atop the L-cysteine surfaces, neuronal growth was reduced and degenerated. Since the cysteine molecules were attached to the surface via the thiol groups, the neuronal membrane was exposed to the molecular chiral site. Thus, our results have demonstrated high neuronal chiral sensitivity, revealing chiral surfaces as indirect regulators of neuronal cells and providing a reference for studying chiral drugs.

  8. A neuron-astrocyte transistor-like model for neuromorphic dressed neurons.

    Science.gov (United States)

    Valenza, G; Pioggia, G; Armato, A; Ferro, M; Scilingo, E P; De Rossi, D

    2011-09-01

    Experimental evidences on the role of the synaptic glia as an active partner together with the bold synapse in neuronal signaling and dynamics of neural tissue strongly suggest to investigate on a more realistic neuron-glia model for better understanding human brain processing. Among the glial cells, the astrocytes play a crucial role in the tripartite synapsis, i.e. the dressed neuron. A well-known two-way astrocyte-neuron interaction can be found in the literature, completely revising the purely supportive role for the glia. The aim of this study is to provide a computationally efficient model for neuron-glia interaction. The neuron-glia interactions were simulated by implementing the Li-Rinzel model for an astrocyte and the Izhikevich model for a neuron. Assuming the dressed neuron dynamics similar to the nonlinear input-output characteristics of a bipolar junction transistor, we derived our computationally efficient model. This model may represent the fundamental computational unit for the development of real-time artificial neuron-glia networks opening new perspectives in pattern recognition systems and in brain neurophysiology. Copyright © 2011 Elsevier Ltd. All rights reserved.

  9. NBLAST: Rapid, Sensitive Comparison of Neuronal Structure and Construction of Neuron Family Databases.

    Science.gov (United States)

    Costa, Marta; Manton, James D; Ostrovsky, Aaron D; Prohaska, Steffen; Jefferis, Gregory S X E

    2016-07-20

    Neural circuit mapping is generating datasets of tens of thousands of labeled neurons. New computational tools are needed to search and organize these data. We present NBLAST, a sensitive and rapid algorithm, for measuring pairwise neuronal similarity. NBLAST considers both position and local geometry, decomposing neurons into short segments; matched segments are scored using a probabilistic scoring matrix defined by statistics of matches and non-matches. We validated NBLAST on a published dataset of 16,129 single Drosophila neurons. NBLAST can distinguish neuronal types down to the finest level (single identified neurons) without a priori information. Cluster analysis of extensively studied neuronal classes identified new types and unreported topographical features. Fully automated clustering organized the validation dataset into 1,052 clusters, many of which map onto previously described neuronal types. NBLAST supports additional query types, including searching neurons against transgene expression patterns. Finally, we show that NBLAST is effective with data from other invertebrates and zebrafish. VIDEO ABSTRACT. Copyright © 2016 MRC Laboratory of Molecular Biology. Published by Elsevier Inc. All rights reserved.

  10. Intrinsically active and pacemaker neurons in pluripotent stem cell-derived neuronal populations.

    Science.gov (United States)

    Illes, Sebastian; Jakab, Martin; Beyer, Felix; Gelfert, Renate; Couillard-Despres, Sébastien; Schnitzler, Alfons; Ritter, Markus; Aigner, Ludwig

    2014-03-11

    Neurons generated from pluripotent stem cells (PSCs) self-organize into functional neuronal assemblies in vitro, generating synchronous network activities. Intriguingly, PSC-derived neuronal assemblies develop spontaneous activities that are independent of external stimulation, suggesting the presence of thus far undetected intrinsically active neurons (IANs). Here, by using mouse embryonic stem cells, we provide evidence for the existence of IANs in PSC-neuronal networks based on extracellular multielectrode array and intracellular patch-clamp recordings. IANs remain active after pharmacological inhibition of fast synaptic communication and possess intrinsic mechanisms required for autonomous neuronal activity. PSC-derived IANs are functionally integrated in PSC-neuronal populations, contribute to synchronous network bursting, and exhibit pacemaker properties. The intrinsic activity and pacemaker properties of the neuronal subpopulation identified herein may be particularly relevant for interventions involving transplantation of neural tissues. IANs may be a key element in the regulation of the functional activity of grafted as well as preexisting host neuronal networks.

  11. Effects of weak electric fields on the activity of neurons and neuronal networks

    International Nuclear Information System (INIS)

    Jeffreys, J.G.R.; Deans, J.; Bikson, M.; Fox, J.

    2003-01-01

    Electric fields applied to brain tissue will affect cellular properties. They will hyperpolarise the ends of cells closest to the positive part of the field, and depolarise ends closest to the negative. In the case of neurons this affects excitability. How these changes in transmembrane potential are distributed depends on the length constant of the neuron, and on its geometry; if the neuron is electrically compact, the change in transmembrane potential becomes an almost linear function of distance in the direction of the field. Neurons from the mammalian hippocampus, maintained in tissue slices in vitro, are significantly affected by fields of around 1-5 Vm -1 . (author)

  12. Statistics of Visual Responses to Image Object Stimuli from Primate AIT Neurons to DNN Neurons.

    Science.gov (United States)

    Dong, Qiulei; Wang, Hong; Hu, Zhanyi

    2018-02-01

    Under the goal-driven paradigm, Yamins et al. ( 2014 ; Yamins & DiCarlo, 2016 ) have shown that by optimizing only the final eight-way categorization performance of a four-layer hierarchical network, not only can its top output layer quantitatively predict IT neuron responses but its penultimate layer can also automatically predict V4 neuron responses. Currently, deep neural networks (DNNs) in the field of computer vision have reached image object categorization performance comparable to that of human beings on ImageNet, a data set that contains 1.3 million training images of 1000 categories. We explore whether the DNN neurons (units in DNNs) possess image object representational statistics similar to monkey IT neurons, particularly when the network becomes deeper and the number of image categories becomes larger, using VGG19, a typical and widely used deep network of 19 layers in the computer vision field. Following Lehky, Kiani, Esteky, and Tanaka ( 2011 , 2014 ), where the response statistics of 674 IT neurons to 806 image stimuli are analyzed using three measures (kurtosis, Pareto tail index, and intrinsic dimensionality), we investigate the three issues in this letter using the same three measures: (1) the similarities and differences of the neural response statistics between VGG19 and primate IT cortex, (2) the variation trends of the response statistics of VGG19 neurons at different layers from low to high, and (3) the variation trends of the response statistics of VGG19 neurons when the numbers of stimuli and neurons increase. We find that the response statistics on both single-neuron selectivity and population sparseness of VGG19 neurons are fundamentally different from those of IT neurons in most cases; by increasing the number of neurons in different layers and the number of stimuli, the response statistics of neurons at different layers from low to high do not substantially change; and the estimated intrinsic dimensionality values at the low

  13. Layer 5 Callosal Parvalbumin-Expressing Neurons: A Distinct Functional Group of GABAergic Neurons.

    Science.gov (United States)

    Zurita, Hector; Feyen, Paul L C; Apicella, Alfonso Junior

    2018-01-01

    Previous studies have shown that parvalbumin-expressing neurons (CC-Parv neurons) connect the two hemispheres of motor and sensory areas via the corpus callosum, and are a functional part of the cortical circuit. Here we test the hypothesis that layer 5 CC-Parv neurons possess anatomical and molecular mechanisms which dampen excitability and modulate the gating of interhemispheric inhibition. In order to investigate this hypothesis we use viral tracing to determine the anatomical and electrophysiological properties of layer 5 CC-Parv and parvalbumin-expressing (Parv) neurons of the mouse auditory cortex (AC). Here we show that layer 5 CC-Parv neurons had larger dendritic fields characterized by longer dendrites that branched farther from the soma, whereas layer 5 Parv neurons had smaller dendritic fields characterized by shorter dendrites that branched nearer to the soma. The layer 5 CC-Parv neurons are characterized by delayed action potential (AP) responses to threshold currents, lower firing rates, and lower instantaneous frequencies compared to the layer 5 Parv neurons. Kv1.1 containing K + channels are the main source of the AP repolarization of the layer 5 CC-Parv and have a major role in determining both the spike delayed response, firing rate and instantaneous frequency of these neurons.

  14. Progranulin regulates neuronal outgrowth independent of Sortilin

    Directory of Open Access Journals (Sweden)

    Gass Jennifer

    2012-07-01

    Full Text Available Abstract Background Progranulin (PGRN, a widely secreted growth factor, is involved in multiple biological functions, and mutations located within the PGRN gene (GRN are a major cause of frontotemporal lobar degeneration with TDP-43-positive inclusions (FLTD-TDP. In light of recent reports suggesting PGRN functions as a protective neurotrophic factor and that sortilin (SORT1 is a neuronal receptor for PGRN, we used a Sort1-deficient (Sort1−/− murine primary hippocampal neuron model to investigate whether PGRN’s neurotrophic effects are dependent on SORT1. We sought to elucidate this relationship to determine what role SORT1, as a regulator of PGRN levels, plays in modulating PGRN’s neurotrophic effects. Results As the first group to evaluate the effect of PGRN loss in Grn knockout primary neuronal cultures, we show neurite outgrowth and branching are significantly decreased in Grn−/− neurons compared to wild-type (WT neurons. More importantly, we also demonstrate that PGRN overexpression can rescue this phenotype. However, the recovery in outgrowth is not observed following treatment with recombinant PGRN harboring missense mutations p.C139R, p.P248L or p.R432C, indicating that these mutations adversely affect the neurotrophic properties of PGRN. In addition, we also present evidence that cleavage of full-length PGRN into granulin peptides is required for increased neuronal outgrowth, suggesting that the neurotrophic functions of PGRN are contained within certain granulins. To further characterize the mechanism by which PGRN impacts neuronal morphology, we assessed the involvement of SORT1. We demonstrate that PGRN induced-outgrowth occurs in the absence of SORT1 in Sort1−/− cultures. Conclusion We demonstrate that loss of PGRN impairs proper neurite outgrowth and branching, and that exogenous PGRN alleviates this impairment. Furthermore, we determined that exogenous PGRN induces outgrowth independent of SORT1, suggesting another

  15. Action observation: Inferring intentions without mirror neurons

    DEFF Research Database (Denmark)

    Frith, Christopher; Kilner, James M

    2008-01-01

    A recent study has shown, using fMRI, that the mirror neuron system does not mediate action understanding when the observed action is novel or when it is hard to understand.......A recent study has shown, using fMRI, that the mirror neuron system does not mediate action understanding when the observed action is novel or when it is hard to understand....

  16. Unidirectional synchronization of Hodgkin-Huxley neurons

    Energy Technology Data Exchange (ETDEWEB)

    Cornejo-Perez, Octavio [Division de Matematicas Aplicadas y Sistemas, Computacionales, IPICYT, Apdo. Postal 3-74 Tangamanga, 78231 San Luis Potosi (Mexico)]. E-mail: octavio@ipicyt.edu.mx; Femat, Ricardo [Division de Matematicas Aplicadas y Sistemas, Computacionales, IPICYT, Apdo. Postal 3-74 Tangamanga, 78231 San Luis Potosi (Mexico)]. E-mail: rfemat@ipicyt.edu.mx

    2005-07-01

    Synchronization dynamics of two noiseless Hodgkin-Huxley (HH) neurons under the action of feedback control is studied. The spiking patterns of the action potentials evoked by periodic external modulations attain synchronization states under the feedback action. Numerical simulations for the synchronization dynamics of regular-irregular desynchronized spiking sequences are displayed. The results are discussed in context of generalized synchronization. It is also shown that the HH neurons can be synchronized in face of unmeasured states.

  17. Arsenic Trioxide Modulates the Central Snail Neuron Action Potential

    Directory of Open Access Journals (Sweden)

    Guan-Ling Lu

    2009-09-01

    Conclusion: As2O3 at 10 mM elicits BoPs in central snail neurons and this effect may relate to the PLC activity of the neuron, rather than protein kinase A activity, or calcium influxes of the neuron. As2O3 at higher concentration irreversibly abolishes the spontaneous action potentials of the neuron.

  18. Information transmission with spiking Bayesian neurons

    International Nuclear Information System (INIS)

    Lochmann, Timm; Deneve, Sophie

    2008-01-01

    Spike trains of cortical neurons resulting from repeatedpresentations of a stimulus are variable and exhibit Poisson-like statistics. Many models of neural coding therefore assumed that sensory information is contained in instantaneous firing rates, not spike times. Here, we ask how much information about time-varying stimuli can be transmitted by spiking neurons with such input and output variability. In particular, does this variability imply spike generation to be intrinsically stochastic? We consider a model neuron that estimates optimally the current state of a time-varying binary variable (e.g. presence of a stimulus) by integrating incoming spikes. The unit signals its current estimate to other units with spikes whenever the estimate increased by a fixed amount. As shown previously, this computation results in integrate and fire dynamics with Poisson-like output spike trains. This output variability is entirely due to the stochastic input rather than noisy spike generation. As a result such a deterministic neuron can transmit most of the information about the time varying stimulus. This contrasts with a standard model of sensory neurons, the linear-nonlinear Poisson (LNP) model which assumes that most variability in output spike trains is due to stochastic spike generation. Although it yields the same firing statistics, we found that such noisy firing results in the loss of most information. Finally, we use this framework to compare potential effects of top-down attention versus bottom-up saliency on information transfer with spiking neurons

  19. The transfer function of neuron spike.

    Science.gov (United States)

    Palmieri, Igor; Monteiro, Luiz H A; Miranda, Maria D

    2015-08-01

    The mathematical modeling of neuronal signals is a relevant problem in neuroscience. The complexity of the neuron behavior, however, makes this problem a particularly difficult task. Here, we propose a discrete-time linear time-invariant (LTI) model with a rational function in order to represent the neuronal spike detected by an electrode located in the surroundings of the nerve cell. The model is presented as a cascade association of two subsystems: one that generates an action potential from an input stimulus, and one that represents the medium between the cell and the electrode. The suggested approach employs system identification and signal processing concepts, and is dissociated from any considerations about the biophysical processes of the neuronal cell, providing a low-complexity alternative to model the neuronal spike. The model is validated by using in vivo experimental readings of intracellular and extracellular signals. A computational simulation of the model is presented in order to assess its proximity to the neuronal signal and to observe the variability of the estimated parameters. The implications of the results are discussed in the context of spike sorting. Copyright © 2015 Elsevier Ltd. All rights reserved.

  20. Endocannabinoids mediate neuron-astrocyte communication.

    Science.gov (United States)

    Navarrete, Marta; Araque, Alfonso

    2008-03-27

    Cannabinoid receptors play key roles in brain function, and cannabinoid effects in brain physiology and drug-related behavior are thought to be mediated by receptors present in neurons. Neuron-astrocyte communication relies on the expression by astrocytes of neurotransmitter receptors. Yet, the expression of cannabinoid receptors by astrocytes in situ and their involvement in the neuron-astrocyte communication remain largely unknown. We show that hippocampal astrocytes express CB1 receptors that upon activation lead to phospholipase C-dependent Ca2+ mobilization from internal stores. These receptors are activated by endocannabinoids released by neurons, increasing astrocyte Ca2+ levels, which stimulate glutamate release that activates NMDA receptors in pyramidal neurons. These results demonstrate the existence of endocannabinoid-mediated neuron-astrocyte communication, revealing that astrocytes are targets of cannabinoids and might therefore participate in the physiology of cannabinoid-related addiction. They also reveal the existence of an endocannabinoid-glutamate signaling pathway where astrocytes serve as a bridge for nonsynaptic interneuronal communication.

  1. Mechanical Dissociation of Retinal Neurons with Vibration

    Science.gov (United States)

    Motomura, Tamami; Hayashida, Yuki; Murayama, Nobuki

    The neuromorphic device, which implements the functions of biological neural circuits by means of VLSI technology, has been collecting much attention in the engineering fields in the last decade. Concurrently, progress in neuroscience research has revealed the nonlinear computation in single neuron levels, suggesting that individual neurons are not merely the circuit elements but computational units. Thus, elucidating the properties of neuronal signal processing is thought to be an essential step for developing the next generation of neuromorphic devices. In the present study, we developed a method for dissociating single neurons from specific sublayers of mammalian retinas with using no proteolytic enzymes but rather combining tissue incubation in a low-Ca2+ medium and the vibro-dissociation technique developed for the slices of brains and spinal cords previously. Our method took shorter time of the procedure, and required less elaborated skill, than the conventional enzymatic method did; nevertheless it yielded enough number of the cells available for acute electrophysiological experiments. The isolated retinal neurons were useful for measuring the nonlinear membrane conductances as well as the spike firing properties under the perforated-patch whole-cell configuration. These neurons also enabled us to examine the effects of proteolytic enzymes on the membrane excitability in those cells.

  2. Graphene foam as a biocompatible scaffold for culturing human neurons

    Science.gov (United States)

    Mattei, Cristiana; Nasr, Babak; Hudson, Emma J.; Alshawaf, Abdullah J.; Chana, Gursharan; Everall, Ian P.; Dottori, Mirella; Skafidas, Efstratios

    2018-01-01

    In this study, we explore the use of electrically active graphene foam as a scaffold for the culture of human-derived neurons. Human embryonic stem cell (hESC)-derived cortical neurons fated as either glutamatergic or GABAergic neuronal phenotypes were cultured on graphene foam. We show that graphene foam is biocompatible for the culture of human neurons, capable of supporting cell viability and differentiation of hESC-derived cortical neurons. Based on the findings, we propose that graphene foam represents a suitable scaffold for engineering neuronal tissue and warrants further investigation as a model for understanding neuronal maturation, function and circuit formation. PMID:29657752

  3. Neuron matters: electric activation of neuronal tissue is dependent on the interaction between the neuron and the electric field.

    Science.gov (United States)

    Ye, Hui; Steiger, Amanda

    2015-08-12

    In laboratory research and clinical practice, externally-applied electric fields have been widely used to control neuronal activity. It is generally accepted that neuronal excitability is controlled by electric current that depolarizes or hyperpolarizes the excitable cell membrane. What determines the amount of polarization? Research on the mechanisms of electric stimulation focus on the optimal control of the field properties (frequency, amplitude, and direction of the electric currents) to improve stimulation outcomes. Emerging evidence from modeling and experimental studies support the existence of interactions between the targeted neurons and the externally-applied electric fields. With cell-field interaction, we suggest a two-way process. When a neuron is positioned inside an electric field, the electric field will induce a change in the resting membrane potential by superimposing an electrically-induced transmembrane potential (ITP). At the same time, the electric field can be perturbed and re-distributed by the cell. This cell-field interaction may play a significant role in the overall effects of stimulation. The redistributed field can cause secondary effects to neighboring cells by altering their geometrical pattern and amount of membrane polarization. Neurons excited by the externally-applied electric field can also affect neighboring cells by ephaptic interaction. Both aspects of the cell-field interaction depend on the biophysical properties of the neuronal tissue, including geometric (i.e., size, shape, orientation to the field) and electric (i.e., conductivity and dielectricity) attributes of the cells. The biophysical basis of the cell-field interaction can be explained by the electromagnetism theory. Further experimental and simulation studies on electric stimulation of neuronal tissue should consider the prospect of a cell-field interaction, and a better understanding of tissue inhomogeneity and anisotropy is needed to fully appreciate the neural

  4. Adult neuronal ceroid-lipofuscinosis.

    Science.gov (United States)

    Goebel, H H; Braak, H

    1989-01-01

    Among the different clinical forms of neuronal ceroid-lipofuscinosis (NCL), the adult type is the least frequent, most sporadic and most difficult one to diagnose. Clinical symptomatology differs from the classical childhood NCL forms in that ocular symptoms are absent while changes of behavior, dementia and seizures dominate the clinical picture. Excessive accumulation of NCL-specific lipopigments has largely been explored in the nervous system, where pigmento-architectonic investigations disclose layer-specific cortical pathology similar to but less pronounced than that of juvenile and protracted juvenile NCL. Ultrastructural analysis of lipopigments in adult NCL reveals diversity of lipopigment fine structure, but less impressive than in the childhood forms of NCL. Abnormal accretion of lipopigments outside the nervous system has rarely been demonstrated and requires ampler documentation, making in vivo diagnosis of adult NCL often difficult and sometimes equivocal. Adult NCL is now frequently considered identical to "Kufs' disease". However, in the past, the latter term has comprised a heterogeneous spectrum of lipidoses the NCL-nature of which had not been unequivocally established. Thus, one may either speak of "Kufs' syndrome" or abandon this term altogether. Although patients afflicted with adult NCL may suffer from Kufs' disease, not all who have and had Kufs disease may have or have had adult NCL. The current debate on adult NCL centers around scepticism concerning many of the earlier reports, on incorporating diagnostic studies of non-CNS organs in presumptive patients and on distinguishing adult NCL from "atypical" patients or forms of NCL, as well as other disorders marked by non-specific abnormal accumulation of lipofuscin.

  5. Synchronization of Coupled Neurons Controlled by a Pacemaker

    International Nuclear Information System (INIS)

    Li Mei-Sheng; Zhang Hong-Hui; Zhao Yong; Shi Xia

    2011-01-01

    We investigate synchronization of Hindmarsh—Rose neurons with gap junctions under the control of a pacemaker. In a ring Hindmarsh—Rose neuronal network, the coupled neurons with the pacemaker can occur in synchronization more easily than those without the pacemaker. Furthermore, the pacemaker can induce phase synchronization or nearly-complete synchronization of nonidentical neurons. This synchronization can occur more easily when time delay is considered. Theses results can be helpful to understand the activities of the real neuronal system. (general)

  6. NeuronMetrics: software for semi-automated processing of cultured neuron images.

    Science.gov (United States)

    Narro, Martha L; Yang, Fan; Kraft, Robert; Wenk, Carola; Efrat, Alon; Restifo, Linda L

    2007-03-23

    Using primary cell culture to screen for changes in neuronal morphology requires specialized analysis software. We developed NeuronMetrics for semi-automated, quantitative analysis of two-dimensional (2D) images of fluorescently labeled cultured neurons. It skeletonizes the neuron image using two complementary image-processing techniques, capturing fine terminal neurites with high fidelity. An algorithm was devised to span wide gaps in the skeleton. NeuronMetrics uses a novel strategy based on geometric features called faces to extract a branch number estimate from complex arbors with numerous neurite-to-neurite contacts, without creating a precise, contact-free representation of the neurite arbor. It estimates total neurite length, branch number, primary neurite number, territory (the area of the convex polygon bounding the skeleton and cell body), and Polarity Index (a measure of neuronal polarity). These parameters provide fundamental information about the size and shape of neurite arbors, which are critical factors for neuronal function. NeuronMetrics streamlines optional manual tasks such as removing noise, isolating the largest primary neurite, and correcting length for self-fasciculating neurites. Numeric data are output in a single text file, readily imported into other applications for further analysis. Written as modules for ImageJ, NeuronMetrics provides practical analysis tools that are easy to use and support batch processing. Depending on the need for manual intervention, processing time for a batch of approximately 60 2D images is 1.0-2.5 h, from a folder of images to a table of numeric data. NeuronMetrics' output accelerates the quantitative detection of mutations and chemical compounds that alter neurite morphology in vitro, and will contribute to the use of cultured neurons for drug discovery.

  7. Leptin signaling in GABA neurons, but not glutamate neurons, is required for reproductive function.

    Science.gov (United States)

    Zuure, Wieteke A; Roberts, Amy L; Quennell, Janette H; Anderson, Greg M

    2013-11-06

    The adipocyte-derived hormone leptin acts in the brain to modulate the central driver of fertility: the gonadotropin releasing hormone (GnRH) neuronal system. This effect is indirect, as GnRH neurons do not express leptin receptors (LEPRs). Here we test whether GABAergic or glutamatergic neurons provide the intermediate pathway between the site of leptin action and the GnRH neurons. Leptin receptors were deleted from GABA and glutamate neurons using Cre-Lox transgenics, and the downstream effects on puberty onset and reproduction were examined. Both mouse lines displayed the expected increase in body weight and region-specific loss of leptin signaling in the hypothalamus. The GABA neuron-specific LEPR knock-out females and males showed significantly delayed puberty onset. Adult fertility observations revealed that these knock-out animals have decreased fecundity. In contrast, glutamate neuron-specific LEPR knock-out mice displayed normal fertility. Assessment of the estrogenic hypothalamic-pituitary-gonadal axis regulation in females showed that leptin action on GABA neurons is not necessary for estradiol-mediated suppression of tonic luteinizing hormone secretion (an indirect measure of GnRH neuron activity) but is required for regulation of a full preovulatory-like luteinizing hormone surge. In conclusion, leptin signaling in GABAergic (but not glutamatergic neurons) plays a critical role in the timing of puberty onset and is involved in fertility regulation throughout adulthood in both sexes. These results form an important step in explaining the role of central leptin signaling in the reproductive system. Limiting the leptin-to-GnRH mediators to GABAergic cells will enable future research to focus on a few specific types of neurons.

  8. A novel perspective on neuron study: damaging and promoting effects in different neurons induced by mechanical stress.

    Science.gov (United States)

    Wang, Yazhou; Wang, Wei; Li, Zong; Hao, Shilei; Wang, Bochu

    2016-10-01

    A growing volume of experimental evidence demonstrates that mechanical stress plays a significant role in growth, proliferation, apoptosis, gene expression, electrophysiological properties and many other aspects of neurons. In this review, first, the mechanical microenvironment and properties of neurons under in vivo conditions are introduced and analyzed. Second, research works in recent decades on the effects of different mechanical forces, especially compression and tension, on various neurons, including dorsal root ganglion neurons, retinal ganglion cells, cerebral cortex neurons, hippocampus neurons, neural stem cells, and other neurons, are summarized. Previous research results demonstrate that mechanical stress can not only injure neurons by damaging their morphology, impacting their electrophysiological characteristics and gene expression, but also promote neuron self-repair. Finally, some future perspectives in neuron research are discussed.

  9. Signals and Circuits in the Purkinje Neuron

    Directory of Open Access Journals (Sweden)

    Ze'ev R Abrams

    2011-09-01

    Full Text Available Purkinje neurons in the cerebellum have over 100,000 inputs organized in an orthogonal geometry, and a single output channel. As the sole output of the cerebellar cortex layer, their complex firing pattern has been associated with motor control and learning. As such they have been extensively modeled and measured using tools ranging from electrophysiology and neuroanatomy, to dynamic systems and artificial intelligence methods. However, there is an alternative approach to analyze and describe the neuronal output of these cells using concepts from Electrical Engineering, particularly signal processing and digital/analog circuits. By viewing the Purkinje neuron as an unknown circuit to be reverse-engineered, we can use the tools that provide the foundations of today’s integrated circuits and communication systems to analyze the Purkinje system at the circuit level. We use Fourier transforms to analyze and isolate the inherent frequency modes in the Purkinje neuron and define 3 unique frequency ranges associated with the cells’ output. Comparing the Purkinje neuron to a signal generator that can be externally modulated adds an entire level of complexity to the functional role of these neurons both in terms of data analysis and information processing, relying on Fourier analysis methods in place of statistical ones. We also re-describe some of the recent literature in the field, using the nomenclature of signal processing. Furthermore, by comparing the experimental data of the past decade with basic electronic circuitry, we can resolve the outstanding controversy in the field, by recognizing that the Purkinje neuron can act as a multivibrator circuit.

  10. Resveratrol stimulates AMP kinase activity in neurons.

    Science.gov (United States)

    Dasgupta, Biplab; Milbrandt, Jeffrey

    2007-04-24

    Resveratrol is a polyphenol produced by plants that has multiple beneficial activities similar to those associated with caloric restriction (CR), such as increased life span and delay in the onset of diseases associated with aging. CR improves neuronal health, and the global beneficial effects of CR have been postulated to be mediated by the nervous system. One key enzyme thought to be activated during CR is the AMP-activated kinase (AMPK), a sensor of cellular energy levels. AMPK is activated by increases in the cellular AMP:ATP ratio, whereupon it functions to help preserve cellular energy. In this regard, the regulation of dietary food intake by hypothalamic neurons is mediated by AMPK. The suppression of nonessential energy expenditure by activated AMPK along with the CR mimetic and neuroprotective properties of resveratrol led us to hypothesize that neuronal activation of AMPK could be an important component of resveratrol activity. Here, we show that resveratrol activated AMPK in Neuro2a cells and primary neurons in vitro as well as in the brain. Resveratrol and the AMPK-activating compound 5-aminoimidazole-4-carboxamide-1-beta-D-ribofuranoside (AICAR) promoted robust neurite outgrowth in Neuro2a cells, which was blocked by genetic and pharmacologic inhibition of AMPK. Resveratrol also stimulated mitochondrial biogenesis in an AMPK-dependent manner. Resveratrol-stimulated AMPK activity in neurons depended on LKB1 activity but did not require the NAD-dependent protein deacetylase SIRT1 during this time frame. These findings suggest that neuronal activation of AMPK by resveratrol could affect neuronal energy homeostasis and contribute to the neuroprotective effects of resveratrol.

  11. Channel properties of Nax expressed in neurons.

    Directory of Open Access Journals (Sweden)

    Masahito Matsumoto

    Full Text Available Nax is a sodium-concentration ([Na+]-sensitive Na channel with a gating threshold of ~150 mM for extracellular [Na+] ([Na+]o in vitro. We previously reported that Nax was preferentially expressed in the glial cells of sensory circumventricular organs including the subfornical organ, and was involved in [Na+] sensing for the control of salt-intake behavior. Although Nax was also suggested to be expressed in the neurons of some brain regions including the amygdala and cerebral cortex, the channel properties of Nax have not yet been adequately characterized in neurons. We herein verified that Nax was expressed in neurons in the lateral amygdala of mice using an antibody that was newly generated against mouse Nax. To investigate the channel properties of Nax expressed in neurons, we established an inducible cell line of Nax using the mouse neuroblastoma cell line, Neuro-2a, which is endogenously devoid of the expression of Nax. Functional analyses of this cell line revealed that the [Na+]-sensitivity of Nax in neuronal cells was similar to that expressed in glial cells. The cation selectivity sequence of the Nax channel in cations was revealed to be Na+ ≈ Li+ > Rb+ > Cs+ for the first time. Furthermore, we demonstrated that Nax bound to postsynaptic density protein 95 (PSD95 through its PSD95/Disc-large/ZO-1 (PDZ-binding motif at the C-terminus in neurons. The interaction between Nax and PSD95 may be involved in promoting the surface expression of Nax channels because the depletion of endogenous PSD95 resulted in a decrease in Nax at the plasma membrane. These results indicated, for the first time, that Nax functions as a [Na+]-sensitive Na channel in neurons as well as in glial cells.

  12. Bax regulates neuronal Ca2+ homeostasis.

    Science.gov (United States)

    D'Orsi, Beatrice; Kilbride, Seán M; Chen, Gang; Perez Alvarez, Sergio; Bonner, Helena P; Pfeiffer, Shona; Plesnila, Nikolaus; Engel, Tobias; Henshall, David C; Düssmann, Heiko; Prehn, Jochen H M

    2015-01-28

    Excessive Ca(2+) entry during glutamate receptor overactivation ("excitotoxicity") induces acute or delayed neuronal death. We report here that deficiency in bax exerted broad neuroprotection against excitotoxic injury and oxygen/glucose deprivation in mouse neocortical neuron cultures and reduced infarct size, necrotic injury, and cerebral edema formation after middle cerebral artery occlusion in mice. Neuronal Ca(2+) and mitochondrial membrane potential (Δψm) analysis during excitotoxic injury revealed that bax-deficient neurons showed significantly reduced Ca(2+) transients during the NMDA excitation period and did not exhibit the deregulation of Δψm that was observed in their wild-type (WT) counterparts. Reintroduction of bax or a bax mutant incapable of proapoptotic oligomerization equally restored neuronal Ca(2+) dynamics during NMDA excitation, suggesting that Bax controlled Ca(2+) signaling independently of its role in apoptosis execution. Quantitative confocal imaging of intracellular ATP or mitochondrial Ca(2+) levels using FRET-based sensors indicated that the effects of bax deficiency on Ca(2+) handling were not due to enhanced cellular bioenergetics or increased Ca(2+) uptake into mitochondria. We also observed that mitochondria isolated from WT or bax-deficient cells similarly underwent Ca(2+)-induced permeability transition. However, when Ca(2+) uptake into the sarco/endoplasmic reticulum was blocked with the Ca(2+)-ATPase inhibitor thapsigargin, bax-deficient neurons showed strongly elevated cytosolic Ca(2+) levels during NMDA excitation, suggesting that the ability of Bax to support dynamic ER Ca(2+) handling is critical for cell death signaling during periods of neuronal overexcitation. Copyright © 2015 the authors 0270-6474/15/351706-17$15.00/0.

  13. Estradiol Protects Proopiomelanocortin Neurons Against Insulin Resistance.

    Science.gov (United States)

    Qiu, Jian; Bosch, Martha A; Meza, Cecilia; Navarro, Uyen-Vy; Nestor, Casey C; Wagner, Edward J; Rønnekleiv, Oline K; Kelly, Martin J

    2018-02-01

    Insulin resistance is at the core of the metabolic syndrome, and men exhibit a higher incidence of metabolic syndrome than women in early adult life, but this sex advantage diminishes sharply when women reach the postmenopausal state. Because 17β-estradiol (E2) augments the excitability of the anorexigenic proopiomelanocortin (POMC) neurons, we investigated the neuroprotective effects of E2 against insulin resistance in POMC neurons from diet-induced obese (DIO) female and male mice. The efficacy of insulin to activate canonical transient receptor potential 5 (TRPC5) channels and depolarize POMC neurons was significantly reduced in DIO male mice but not in DIO female mice. However, the insulin response in POMC neurons was abrogated in ovariectomized DIO females but restored with E2 replacement. E2 increased T-type calcium channel Cav3.1 messenger RNA (mRNA) expression and whole-cell currents but downregulated stromal-interaction molecule 1 mRNA, which rendered POMC neurons more excitable and responsive to insulin-mediated TRPC5 channel activation. Moreover, E2 prevented the increase in suppressor of cytokine signaling-3 mRNA expression with DIO as seen in DIO males. As proof of principle, insulin [intracerebroventricular injection into the third ventricle (ICV)] decreased food intake and increased metabolism in female but not male guinea pigs fed a high-fat diet. The uncoupling of the insulin receptor from its downstream effector system was corroborated by the reduced expression of phosphorylated protein kinase B in the arcuate nucleus of male but not female guinea pigs following insulin. Therefore, E2 protects female POMC neurons from insulin resistance by enhancing POMC neuronal excitability and the coupling of insulin receptor to TRPC5 channel activation. Copyright © 2018 Endocrine Society.

  14. Neuronal medium that supports basic synaptic functions and activity of human neurons in vitro

    NARCIS (Netherlands)

    Bardy, C.; Hurk, M. van den; Eames, T.; Marchand, C.; Hernandez, R.V.; Kellogg, M.; Gorris, M.A.J.; Galet, B.; Palomares, V.; Brown, J.; Bang, A.G.; Mertens, J.; Bohnke, L.; Boyer, L.; Simon, S.; Gage, F.H.

    2015-01-01

    Human cell reprogramming technologies offer access to live human neurons from patients and provide a new alternative for modeling neurological disorders in vitro. Neural electrical activity is the essence of nervous system function in vivo. Therefore, we examined neuronal activity in media widely

  15. Morphine disinhibits glutamatergic input to VTA dopamine neurons and promotes dopamine neuron excitation.

    Science.gov (United States)

    Chen, Ming; Zhao, Yanfang; Yang, Hualan; Luan, Wenjie; Song, Jiaojiao; Cui, Dongyang; Dong, Yi; Lai, Bin; Ma, Lan; Zheng, Ping

    2015-07-24

    One reported mechanism for morphine activation of dopamine (DA) neurons of the ventral tegmental area (VTA) is the disinhibition model of VTA-DA neurons. Morphine inhibits GABA inhibitory neurons, which shifts the balance between inhibitory and excitatory input to VTA-DA neurons in favor of excitation and then leads to VTA-DA neuron excitation. However, it is not known whether morphine has an additional strengthening effect on excitatory input. Our results suggest that glutamatergic input to VTA-DA neurons is inhibited by GABAergic interneurons via GABAB receptors and that morphine promotes presynaptic glutamate release by removing this inhibition. We also studied the contribution of the morphine-induced disinhibitory effect on the presynaptic glutamate release to the overall excitatory effect of morphine on VTA-DA neurons and related behavior. Our results suggest that the disinhibitory action of morphine on presynaptic glutamate release might be the main mechanism for morphine-induced increase in VTA-DA neuron firing and related behaviors.

  16. Transgenic tools to characterize neuronal properties of discrete populations of zebrafish neurons.

    Science.gov (United States)

    Satou, Chie; Kimura, Yukiko; Hirata, Hiromi; Suster, Maximiliano L; Kawakami, Koichi; Higashijima, Shin-ichi

    2013-09-01

    The developing nervous system consists of a variety of cell types. Transgenic animals expressing reporter genes in specific classes of neuronal cells are powerful tools for the study of neuronal network formation. We generated a wide variety of transgenic zebrafish that expressed reporter genes in specific classes of neurons or neuronal progenitors. These include lines in which neurons of specific neurotransmitter phenotypes expressed fluorescent proteins or Gal4, and lines in which specific subsets of the dorsal progenitor domain in the spinal cord expressed fluorescent proteins. Using these, we examined domain organization in the developing dorsal spinal cord, and found that there are six progenitor domains in zebrafish, which is similar to the domain organization in mice. We also systematically characterized neurotransmitter properties of the neurons that are produced from each domain. Given that reporter gene expressions occurs in a wide area of the nervous system in the lines generated, these transgenic fish should serve as powerful tools for the investigation of not only the neurons in the dorsal spinal cord but also neuronal structures and functions in many other regions of the nervous system.

  17. CRISPR Epigenome Editing of AKAP150 in DRG Neurons Abolishes Degenerative IVD-Induced Neuronal Activation.

    Science.gov (United States)

    Stover, Joshua D; Farhang, Niloofar; Berrett, Kristofer C; Gertz, Jason; Lawrence, Brandon; Bowles, Robby D

    2017-09-06

    Back pain is a major contributor to disability and has significant socioeconomic impacts worldwide. The degenerative intervertebral disc (IVD) has been hypothesized to contribute to back pain, but a better understanding of the interactions between the degenerative IVD and nociceptive neurons innervating the disc and treatment strategies that directly target these interactions is needed to improve our understanding and treatment of back pain. We investigated degenerative IVD-induced changes to dorsal root ganglion (DRG) neuron activity and utilized CRISPR epigenome editing as a neuromodulation strategy. By exposing DRG neurons to degenerative IVD-conditioned media under both normal and pathological IVD pH levels, we demonstrate that degenerative IVDs trigger interleukin (IL)-6-induced increases in neuron activity to thermal stimuli, which is directly mediated by AKAP and enhanced by acidic pH. Utilizing this novel information on AKAP-mediated increases in nociceptive neuron activity, we developed lentiviral CRISPR epigenome editing vectors that modulate endogenous expression of AKAP150 by targeted promoter histone methylation. When delivered to DRG neurons, these epigenome-modifying vectors abolished degenerative IVD-induced DRG-elevated neuron activity while preserving non-pathologic neuron activity. This work elucidates the potential for CRISPR epigenome editing as a targeted gene-based pain neuromodulation strategy. Copyright © 2017 The American Society of Gene and Cell Therapy. Published by Elsevier Inc. All rights reserved.

  18. BigNeuron: Large-Scale 3D Neuron Reconstruction from Optical Microscopy Images

    NARCIS (Netherlands)

    H. Peng (Hanchuan); M. Hawrylycz (Michael); J. Roskams (Jane); S. Hill (Sean); N. Spruston (Nelson); E. Meijering (Erik); G.A. Ascoli (Giorgio A.)

    2015-01-01

    textabstractUnderstanding the structure of single neurons is critical for understanding how they function within neural circuits. BigNeuron is a new community effort that combines modern bioimaging informatics, recent leaps in labeling and microscopy, and the widely recognized need for openness and

  19. Optogenetic identification of hypothalamic orexin neuron projections to paraventricular spinally projecting neurons.

    Science.gov (United States)

    Dergacheva, Olga; Yamanaka, Akihiro; Schwartz, Alan R; Polotsky, Vsevolod Y; Mendelowitz, David

    2017-04-01

    Orexin neurons, and activation of orexin receptors, are generally thought to be sympathoexcitatory; however, the functional connectivity between orexin neurons and a likely sympathetic target, the hypothalamic spinally projecting neurons (SPNs) in the paraventricular nucleus of the hypothalamus (PVN) has not been established. To test the hypothesis that orexin neurons project directly to SPNs in the PVN, channelrhodopsin-2 (ChR2) was selectively expressed in orexin neurons to enable photoactivation of ChR2-expressing fibers while examining evoked postsynaptic currents in SPNs in rat hypothalamic slices. Selective photoactivation of orexin fibers elicited short-latency postsynaptic currents in all SPNs tested ( n = 34). These light-triggered responses were heterogeneous, with a majority being excitatory glutamatergic responses (59%) and a minority of inhibitory GABAergic (35%) and mixed glutamatergic and GABAergic currents (6%). Both glutamatergic and GABAergic responses were present in the presence of tetrodotoxin and 4-aminopyridine, suggesting a monosynaptic connection between orexin neurons and SPNs. In addition to generating postsynaptic responses, photostimulation facilitated action potential firing in SPNs (current clamp configuration). Glutamatergic, but not GABAergic, postsynaptic currents were diminished by application of the orexin receptor antagonist almorexant, indicating orexin release facilitates glutamatergic neurotransmission in this pathway. This work identifies a neuronal circuit by which orexin neurons likely exert sympathoexcitatory control of cardiovascular function. NEW & NOTEWORTHY This is the first study to establish, using innovative optogenetic approaches in a transgenic rat model, that there are robust heterogeneous projections from orexin neurons to paraventricular spinally projecting neurons, including excitatory glutamatergic and inhibitory GABAergic neurotransmission. Endogenous orexin release modulates glutamatergic, but not

  20. Energy-efficient neural information processing in individual neurons and neuronal networks.

    Science.gov (United States)

    Yu, Lianchun; Yu, Yuguo

    2017-11-01

    Brains are composed of networks of an enormous number of neurons interconnected with synapses. Neural information is carried by the electrical signals within neurons and the chemical signals among neurons. Generating these electrical and chemical signals is metabolically expensive. The fundamental issue raised here is whether brains have evolved efficient ways of developing an energy-efficient neural code from the molecular level to the circuit level. Here, we summarize the factors and biophysical mechanisms that could contribute to the energy-efficient neural code for processing input signals. The factors range from ion channel kinetics, body temperature, axonal propagation of action potentials, low-probability release of synaptic neurotransmitters, optimal input and noise, the size of neurons and neuronal clusters, excitation/inhibition balance, coding strategy, cortical wiring, and the organization of functional connectivity. Both experimental and computational evidence suggests that neural systems may use these factors to maximize the efficiency of energy consumption in processing neural signals. Studies indicate that efficient energy utilization may be universal in neuronal systems as an evolutionary consequence of the pressure of limited energy. As a result, neuronal connections may be wired in a highly economical manner to lower energy costs and space. Individual neurons within a network may encode independent stimulus components to allow a minimal number of neurons to represent whole stimulus characteristics efficiently. This basic principle may fundamentally change our view of how billions of neurons organize themselves into complex circuits to operate and generate the most powerful intelligent cognition in nature. © 2017 Wiley Periodicals, Inc. © 2017 Wiley Periodicals, Inc.

  1. Crosstalks between kisspeptin neurons and somatostatin neurons are not photoperiod dependent in the ewe hypothalamus.

    Science.gov (United States)

    Dufourny, Laurence; Lomet, Didier

    2017-12-01

    Seasonal reproduction is under the control of gonadal steroid feedback, itself synchronized by day-length or photoperiod. As steroid action on GnRH neurons is mostly indirect and therefore exerted through interneurons, we looked for neuroanatomical interactions between kisspeptin (KP) neurons and somatostatin (SOM) neurons, two populations targeted by sex steroids, in three diencephalic areas involved in the central control of ovulation and/or sexual behavior: the arcuate nucleus (ARC), the preoptic area (POA) and the ventrolateral part of the ventromedial hypothalamus (VMHvl). KP is the most potent secretagogue of GnRH secretion while SOM has been shown to centrally inhibit LH pulsatile release. Notably, hypothalamic contents of these two neuropeptides vary with photoperiod in specific seasonal species. Our hypothesis is that SOM inhibits KP neuron activity and therefore indirectly modulate GnRH release and that this effect may be seasonally regulated. We used sections from ovariectomized estradiol-replaced ewes killed after photoperiodic treatment mimicking breeding or anestrus season. We performed triple immunofluorescent labeling to simultaneously detect KP, SOM and synapsin, a marker for synaptic vesicles. Sections from the POA and from the mediobasal hypothalamus were examined using a confocal microscope. Randomly selected KP or SOM neurons were observed in the POA and ARC. SOM neurons were also observed in the VMHvl. In both the ARC and POA, nearly all KP neurons presented numerous SOM contacts. SOM neurons presented KP terminals more frequently in the ARC than in the POA and VMHvl. Quantitative analysis failed to demonstrate major seasonal variations of KP and SOM interactions. Our data suggest a possible inhibitory action of SOM on all KP neurons in both photoperiodic statuses. On the other hand, the physiological significance of KP modulation of SOM neuron activity and vice versa remain to be determined. Copyright © 2017 Elsevier Inc. All rights reserved.

  2. Binding by asynchrony: the neuronal phase code

    Directory of Open Access Journals (Sweden)

    Zoltan Nadasdy

    2010-09-01

    Full Text Available Neurons display continuous subthreshold oscillations and discrete action potentials. When action potentials are phase-locked to the subthreshold oscillation, we hypothesize they represent two types of information: the presence/absence of a sensory feature and the phase of subthreshold oscillation. If subthreshold oscillation phases are neuron-specific, then the sources of action potentials can be recovered based on the action potential times. If the spatial information about the stimulus is converted to action potential phases, then action potentials from multiple neurons can be combined into a single axon and the spatial configuration reconstructed elsewhere. For the reconstruction to be successful, we introduce two assumptions: that a subthreshold oscillation field has a constant phase gradient and that coincidences between action potentials and intracellular subthreshold oscillations are neuron-specific as defined by the "interference principle." Under these assumptions, a phase coding model enables information transfer between structures and reproduces experimental phenomenons such as phase precession, grid cell architecture, and phase modulation of cortical spikes. This article reviews a recently proposed neuronal algorithm for information encoding and decoding from the phase of action potentials (Nadasdy 2009. The focus is given to the principles common across different systems instead of emphasizing system specific differences.

  3. Synchronous behavior of two coupled electronic neurons

    International Nuclear Information System (INIS)

    Pinto, R. D.; Varona, P.; Volkovskii, A. R.; Szuecs, A.; Abarbanel, Henry D. I.; Rabinovich, M. I.

    2000-01-01

    We report on experimental studies of synchronization phenomena in a pair of analog electronic neurons (ENs). The ENs were designed to reproduce the observed membrane voltage oscillations of isolated biological neurons from the stomatogastric ganglion of the California spiny lobster Panulirus interruptus. The ENs are simple analog circuits which integrate four-dimensional differential equations representing fast and slow subcellular mechanisms that produce the characteristic regular/chaotic spiking-bursting behavior of these cells. In this paper we study their dynamical behavior as we couple them in the same configurations as we have done for their counterpart biological neurons. The interconnections we use for these neural oscillators are both direct electrical connections and excitatory and inhibitory chemical connections: each realized by analog circuitry and suggested by biological examples. We provide here quantitative evidence that the ENs and the biological neurons behave similarly when coupled in the same manner. They each display well defined bifurcations in their mutual synchronization and regularization. We report briefly on an experiment on coupled biological neurons and four-dimensional ENs, which provides further ground for testing the validity of our numerical and electronic models of individual neural behavior. Our experiments as a whole present interesting new examples of regularization and synchronization in coupled nonlinear oscillators. (c) 2000 The American Physical Society

  4. Doubly stochastic coherence in complex neuronal networks

    Science.gov (United States)

    Gao, Yang; Wang, Jianjun

    2012-11-01

    A system composed of coupled FitzHugh-Nagumo neurons with various topological structures is investigated under the co-presence of two independently additive and multiplicative Gaussian white noises, in which particular attention is paid to the neuronal networks spiking regularity. As the additive noise intensity and the multiplicative noise intensity are simultaneously adjusted to optimal values, the temporal periodicity of the output of the system reaches the maximum, indicating the occurrence of doubly stochastic coherence. The network topology randomness exerts different influences on the temporal coherence of the spiking oscillation for dissimilar coupling strength regimes. At a small coupling strength, the spiking regularity shows nearly no difference in the regular, small-world, and completely random networks. At an intermediate coupling strength, the temporal periodicity in a small-world neuronal network can be improved slightly by adding a small fraction of long-range connections. At a large coupling strength, the dynamical behavior of the neurons completely loses the resonance property with regard to the additive noise intensity or the multiplicative noise intensity, and the spiking regularity decreases considerably with the increase of the network topology randomness. The network topology randomness plays more of a depressed role than a favorable role in improving the temporal coherence of the spiking oscillation in the neuronal network research study.

  5. Bursting synchronization in clustered neuronal networks

    International Nuclear Information System (INIS)

    Yu Hai-Tao; Wang Jiang; Deng Bin; Wei Xi-Le

    2013-01-01

    Neuronal networks in the brain exhibit the modular (clustered) property, i.e., they are composed of certain subnetworks with differential internal and external connectivity. We investigate bursting synchronization in a clustered neuronal network. A transition to mutual-phase synchronization takes place on the bursting time scale of coupled neurons, while on the spiking time scale, they behave asynchronously. This synchronization transition can be induced by the variations of inter- and intracoupling strengths, as well as the probability of random links between different subnetworks. Considering that some pathological conditions are related with the synchronization of bursting neurons in the brain, we analyze the control of bursting synchronization by using a time-periodic external signal in the clustered neuronal network. Simulation results show a frequency locking tongue in the driving parameter plane, where bursting synchronization is maintained, even in the presence of external driving. Hence, effective synchronization suppression can be realized with the driving parameters outside the frequency locking region. (interdisciplinary physics and related areas of science and technology)

  6. Epigenetic Basis of Neuronal and Synaptic Plasticity.

    Science.gov (United States)

    Karpova, Nina N; Sales, Amanda J; Joca, Samia R

    2017-01-01

    Neuronal network and plasticity change as a function of experience. Altered neural connectivity leads to distinct transcriptional programs of neuronal plasticity-related genes. The environmental challenges throughout life may promote long-lasting reprogramming of gene expression and the development of brain disorders. The modifications in neuronal epigenome mediate gene-environmental interactions and are required for activity-dependent regulation of neuronal differentiation, maturation and plasticity. Here, we highlight the latest advances in understanding the role of the main players of epigenetic machinery (DNA methylation and demethylation, histone modifications, chromatin-remodeling enzymes, transposons, and non-coding RNAs) in activity-dependent and long- term neural and synaptic plasticity. The review focuses on both the transcriptional and post-transcriptional regulation of gene expression levels, including the processes of promoter activation, alternative splicing, regulation of stability of gene transcripts by natural antisense RNAs, and alternative polyadenylation. Further, we discuss the epigenetic aspects of impaired neuronal plasticity and the pathogenesis of neurodevelopmental (Rett syndrome, Fragile X Syndrome, genomic imprinting disorders, schizophrenia, and others), stressrelated (mood disorders) and neurodegenerative Alzheimer's, Parkinson's and Huntington's disorders. The review also highlights the pharmacological compounds that modulate epigenetic programming of gene expression, the potential treatment strategies of discussed brain disorders, and the questions that should be addressed during the development of effective and safe approaches for the treatment of brain disorders.

  7. Spin orbit torque based electronic neuron

    Energy Technology Data Exchange (ETDEWEB)

    Sengupta, Abhronil, E-mail: asengup@purdue.edu; Choday, Sri Harsha; Kim, Yusung; Roy, Kaushik [School of Electrical and Computer Engineering, Purdue University, West Lafayette, Indiana 47907 (United States)

    2015-04-06

    A device based on current-induced spin-orbit torque (SOT) that functions as an electronic neuron is proposed in this work. The SOT device implements an artificial neuron's thresholding (transfer) function. In the first step of a two-step switching scheme, a charge current places the magnetization of a nano-magnet along the hard-axis, i.e., an unstable point for the magnet. In the second step, the SOT device (neuron) receives a current (from the synapses) which moves the magnetization from the unstable point to one of the two stable states. The polarity of the synaptic current encodes the excitatory and inhibitory nature of the neuron input and determines the final orientation of the magnetization. A resistive crossbar array, functioning as synapses, generates a bipolar current that is a weighted sum of the inputs. The simulation of a two layer feed-forward artificial neural network based on the SOT electronic neuron shows that it consumes ∼3× lower power than a 45 nm digital CMOS implementation, while reaching ∼80% accuracy in the classification of 100 images of handwritten digits from the MNIST dataset.

  8. Spin orbit torque based electronic neuron

    International Nuclear Information System (INIS)

    Sengupta, Abhronil; Choday, Sri Harsha; Kim, Yusung; Roy, Kaushik

    2015-01-01

    A device based on current-induced spin-orbit torque (SOT) that functions as an electronic neuron is proposed in this work. The SOT device implements an artificial neuron's thresholding (transfer) function. In the first step of a two-step switching scheme, a charge current places the magnetization of a nano-magnet along the hard-axis, i.e., an unstable point for the magnet. In the second step, the SOT device (neuron) receives a current (from the synapses) which moves the magnetization from the unstable point to one of the two stable states. The polarity of the synaptic current encodes the excitatory and inhibitory nature of the neuron input and determines the final orientation of the magnetization. A resistive crossbar array, functioning as synapses, generates a bipolar current that is a weighted sum of the inputs. The simulation of a two layer feed-forward artificial neural network based on the SOT electronic neuron shows that it consumes ∼3× lower power than a 45 nm digital CMOS implementation, while reaching ∼80% accuracy in the classification of 100 images of handwritten digits from the MNIST dataset

  9. Large-scale modelling of neuronal systems

    International Nuclear Information System (INIS)

    Castellani, G.; Verondini, E.; Giampieri, E.; Bersani, F.; Remondini, D.; Milanesi, L.; Zironi, I.

    2009-01-01

    The brain is, without any doubt, the most, complex system of the human body. Its complexity is also due to the extremely high number of neurons, as well as the huge number of synapses connecting them. Each neuron is capable to perform complex tasks, like learning and memorizing a large class of patterns. The simulation of large neuronal systems is challenging for both technological and computational reasons, and can open new perspectives for the comprehension of brain functioning. A well-known and widely accepted model of bidirectional synaptic plasticity, the BCM model, is stated by a differential equation approach based on bistability and selectivity properties. We have modified the BCM model extending it from a single-neuron to a whole-network model. This new model is capable to generate interesting network topologies starting from a small number of local parameters, describing the interaction between incoming and outgoing links from each neuron. We have characterized this model in terms of complex network theory, showing how this, learning rule can be a support For network generation.

  10. Memristors Empower Spiking Neurons With Stochasticity

    KAUST Repository

    Al-Shedivat, Maruan

    2015-06-01

    Recent theoretical studies have shown that probabilistic spiking can be interpreted as learning and inference in cortical microcircuits. This interpretation creates new opportunities for building neuromorphic systems driven by probabilistic learning algorithms. However, such systems must have two crucial features: 1) the neurons should follow a specific behavioral model, and 2) stochastic spiking should be implemented efficiently for it to be scalable. This paper proposes a memristor-based stochastically spiking neuron that fulfills these requirements. First, the analytical model of the memristor is enhanced so it can capture the behavioral stochasticity consistent with experimentally observed phenomena. The switching behavior of the memristor model is demonstrated to be akin to the firing of the stochastic spike response neuron model, the primary building block for probabilistic algorithms in spiking neural networks. Furthermore, the paper proposes a neural soma circuit that utilizes the intrinsic nondeterminism of memristive switching for efficient spike generation. The simulations and analysis of the behavior of a single stochastic neuron and a winner-take-all network built of such neurons and trained on handwritten digits confirm that the circuit can be used for building probabilistic sampling and pattern adaptation machinery in spiking networks. The findings constitute an important step towards scalable and efficient probabilistic neuromorphic platforms. © 2011 IEEE.

  11. Synchronization of motor neurons during locomotion in the neonatal rat

    DEFF Research Database (Denmark)

    Tresch, Matthew C.; Kiehn, Ole

    2002-01-01

    We describe here the robust synchronization of motor neurons at a millisecond time scale during locomotor activity in the neonatal rat. Action potential activity of motor neuron pairs was recorded extracellularly using tetrodes during locomotor activity in the in vitro neonatal rat spinal cord....... Approximately 40% of motor neuron pairs recorded in the same spinal segment showed significant synchronization, with the duration of the central peak in cross-correlograms between motor neurons typically ranging between ∼ 30 and 100 msec. The percentage of synchronized motor neuron pairs was considerably higher...... between motor neurons persisted. On the other hand, both local and distant coupling between motor neurons were preserved after antagonism of gap junction coupling between motor neurons. These results demonstrate that motor neuron activity is strongly synchronized at a millisecond time scale during...

  12. Neuronal replacement therapy: previous achievements and challenges ahead

    Science.gov (United States)

    Grade, Sofia; Götz, Magdalena

    2017-10-01

    Lifelong neurogenesis and incorporation of newborn neurons into mature neuronal circuits operates in specialized niches of the mammalian brain and serves as role model for neuronal replacement strategies. However, to which extent can the remaining brain parenchyma, which never incorporates new neurons during the adulthood, be as plastic and readily accommodate neurons in networks that suffered neuronal loss due to injury or neurological disease? Which microenvironment is permissive for neuronal replacement and synaptic integration and which cells perform best? Can lost function be restored and how adequate is the participation in the pre-existing circuitry? Could aberrant connections cause malfunction especially in networks dominated by excitatory neurons, such as the cerebral cortex? These questions show how important connectivity and circuitry aspects are for regenerative medicine, which is the focus of this review. We will discuss the impressive advances in neuronal replacement strategies and success from exogenous as well as endogenous cell sources. Both have seen key novel technologies, like the groundbreaking discovery of induced pluripotent stem cells and direct neuronal reprogramming, offering alternatives to the transplantation of fetal neurons, and both herald great expectations. For these to become reality, neuronal circuitry analysis is key now. As our understanding of neuronal circuits increases, neuronal replacement therapy should fulfill those prerequisites in network structure and function, in brain-wide input and output. Now is the time to incorporate neural circuitry research into regenerative medicine if we ever want to truly repair brain injury.

  13. Autapse-induced synchronization in a coupled neuronal network

    International Nuclear Information System (INIS)

    Ma, Jun; Song, Xinlin; Jin, Wuyin; Wang, Chuni

    2015-01-01

    Highlights: • The functional effect of autapse on neuronal activity is detected. • Autapse driving plays active role in regulating electrical activities as pacemaker. • It confirms biological experimental results for rhythm synchronization between heterogeneous cells. - Abstract: The effect of autapse on coupled neuronal network is detected. In our studies, three identical neurons are connected with ring type and autapse connected to one neuron of the network. The autapse connected to neuron can impose time-delayed feedback in close loop on the neuron thus the dynamics of membrane potentials can be changed. Firstly, the effect of autapse driving on single neuron is confirmed that negative feedback can calm down the neuronal activity while positive feedback can excite the neuronal activity. Secondly, the collective electrical behaviors of neurons are regulated by a pacemaker, which associated with the autapse forcing. By using appropriate gain and time delay in the autapse, the neurons can reach synchronization and the membrane potentials of all neurons can oscillate with the same rhythm under mutual coupling. It indicates that autapse forcing plays an important role in changing the collective electric activities of neuronal network, and appropriate electric modes can be selected due to the switch of feedback type(positive or negative) in autapse. And the autapse-induced synchronization in network is also consistent with some biological experiments about synchronization between nonidentical neurons.

  14. Decoding spikes in a spiking neuronal network

    Energy Technology Data Exchange (ETDEWEB)

    Feng Jianfeng [Department of Informatics, University of Sussex, Brighton BN1 9QH (United Kingdom); Ding, Mingzhou [Department of Mathematics, Florida Atlantic University, Boca Raton, FL 33431 (United States)

    2004-06-04

    We investigate how to reliably decode the input information from the output of a spiking neuronal network. A maximum likelihood estimator of the input signal, together with its Fisher information, is rigorously calculated. The advantage of the maximum likelihood estimation over the 'brute-force rate coding' estimate is clearly demonstrated. It is pointed out that the ergodic assumption in neuroscience, i.e. a temporal average is equivalent to an ensemble average, is in general not true. Averaging over an ensemble of neurons usually gives a biased estimate of the input information. A method on how to compensate for the bias is proposed. Reconstruction of dynamical input signals with a group of spiking neurons is extensively studied and our results show that less than a spike is sufficient to accurately decode dynamical inputs.

  15. Dynamics of a structured neuron population

    International Nuclear Information System (INIS)

    Pakdaman, Khashayar; Salort, Delphine; Perthame, Benoît

    2010-01-01

    We study the dynamics of assemblies of interacting neurons. For large fully connected networks, the dynamics of the system can be described by a partial differential equation reminiscent of age-structure models used in mathematical ecology, where the 'age' of a neuron represents the time elapsed since its last discharge. The nonlinearity arises from the connectivity J of the network. We prove some mathematical properties of the model that are directly related to qualitative properties. On the one hand, we prove that it is well-posed and that it admits stationary states which, depending upon the connectivity, can be unique or not. On the other hand, we study the long time behaviour of solutions; both for small and large J, we prove the relaxation to the steady state describing asynchronous firing of the neurons. In the middle range, numerical experiments show that periodic solutions appear expressing re-synchronization of the network and asynchronous firing

  16. Current Source Density Estimation for Single Neurons

    Directory of Open Access Journals (Sweden)

    Dorottya Cserpán

    2014-03-01

    Full Text Available Recent developments of multielectrode technology made it possible to measure the extracellular potential generated in the neural tissue with spatial precision on the order of tens of micrometers and on submillisecond time scale. Combining such measurements with imaging of single neurons within the studied tissue opens up new experimental possibilities for estimating distribution of current sources along a dendritic tree. In this work we show that if we are able to relate part of the recording of extracellular potential to a specific cell of known morphology we can estimate the spatiotemporal distribution of transmembrane currents along it. We present here an extension of the kernel CSD method (Potworowski et al., 2012 applicable in such case. We test it on several model neurons of progressively complicated morphologies from ball-and-stick to realistic, up to analysis of simulated neuron activity embedded in a substantial working network (Traub et al, 2005. We discuss the caveats and possibilities of this new approach.

  17. Runx transcription factors in neuronal development

    Directory of Open Access Journals (Sweden)

    Shiga Takashi

    2008-08-01

    Full Text Available Abstract Runt-related (Runx transcription factors control diverse aspects of embryonic development and are responsible for the pathogenesis of many human diseases. In recent years, the functions of this transcription factor family in the nervous system have just begun to be understood. In dorsal root ganglion neurons, Runx1 and Runx3 play pivotal roles in the development of nociceptive and proprioceptive sensory neurons, respectively. Runx appears to control the transcriptional regulation of neurotrophin receptors, numerous ion channels and neuropeptides. As a consequence, Runx contributes to diverse aspects of the sensory system in higher vertebrates. In this review, we summarize recent progress in determining the role of Runx in neuronal development.

  18. GABAergic actions on cholinergic laterodorsal tegmental neurons

    DEFF Research Database (Denmark)

    Kohlmeier, K A; Kristiansen, Uffe

    2010-01-01

    Cholinergic neurons of the pontine laterodorsal tegmentum (LDT) play a critical role in regulation of behavioral state. Therefore, elucidation of mechanisms that control their activity is vital for understanding of how switching between wakefulness, sleep and anesthetic states is effectuated....... In vivo studies suggest that GABAergic mechanisms within the pons play a critical role in behavioral state switching. However, the postsynaptic, electrophysiological actions of GABA on LDT neurons, as well as the identity of GABA receptors present in the LDT mediating these actions is virtually unexplored...... neurons. Post-synaptic location of GABA(A) receptors was demonstrated by persistence of muscimol-induced inward currents in TTX and low Ca(2+) solutions. THIP, a selective GABA(A) receptor agonist with a preference for d-subunit containing GABA(A) receptors, induced inward currents, suggesting...

  19. Decoding spikes in a spiking neuronal network

    International Nuclear Information System (INIS)

    Feng Jianfeng; Ding, Mingzhou

    2004-01-01

    We investigate how to reliably decode the input information from the output of a spiking neuronal network. A maximum likelihood estimator of the input signal, together with its Fisher information, is rigorously calculated. The advantage of the maximum likelihood estimation over the 'brute-force rate coding' estimate is clearly demonstrated. It is pointed out that the ergodic assumption in neuroscience, i.e. a temporal average is equivalent to an ensemble average, is in general not true. Averaging over an ensemble of neurons usually gives a biased estimate of the input information. A method on how to compensate for the bias is proposed. Reconstruction of dynamical input signals with a group of spiking neurons is extensively studied and our results show that less than a spike is sufficient to accurately decode dynamical inputs

  20. Mechanosensor Channels in Mammalian Somatosensory Neurons

    Directory of Open Access Journals (Sweden)

    Patrick Delmas

    2007-09-01

    Full Text Available Mechanoreceptive sensory neurons innervating the skin, skeletal muscles andviscera signal both innocuous and noxious information necessary for proprioception, touchand pain. These neurons are responsible for the transduction of mechanical stimuli intoaction potentials that propagate to the central nervous system. The ability of these cells todetect mechanical stimuli impinging on them relies on the presence of mechanosensitivechannels that transduce the external mechanical forces into electrical and chemical signals.Although a great deal of information regarding the molecular and biophysical properties ofmechanosensitive channels in prokaryotes has been accumulated over the past two decades,less is known about the mechanosensitive channels necessary for proprioception and thesenses of touch and pain. This review summarizes the most pertinent data onmechanosensitive channels of mammalian somatosensory neurons, focusing on theirproperties, pharmacology and putative identity.

  1. MR imaging of neuronal migration anomaly

    International Nuclear Information System (INIS)

    Hong, Hyun Sook; Choi, Eun Wan; Kim, Dae Ho; Chung, Moo Chan; Kwon, Kuy Hyang; Kim, Ki Jung

    1991-01-01

    Abnormalities of neuronal migration are characterized by anectopic location of neurons in the cerebral cortex. This broad group of anomalies includes agyria, pachygyria, schizencephaly, unilateral megalencephaly, and gray matter heterotopia. Patients with this anomaly present clinically with a variety of symptoms which are proportional to the extent of the brain involved. These abnormalities have characterized pathologically in vivo by sonography and CT scan. MR appears to be an imaging technique of choice in evaluating these anomalies because it is capable of exceptionally good differentiation between gray and white matter, high contrast resolution, multiplanar display of the anatomy, and lack of overlying bone artifac. The purpose of this paper is to describe the MR findings of neuronal migration anomaly. The results of our study support that MR appears to be the imaging method of choice for diagnosing migration anomalies and the primary screening method for infants or children who have seisure/and delayed development

  2. Mirror Neurons and Mirror-Touch Synesthesia.

    Science.gov (United States)

    Linkovski, Omer; Katzin, Naama; Salti, Moti

    2016-05-30

    Since mirror neurons were introduced to the neuroscientific community more than 20 years ago, they have become an elegant and intuitive account for different cognitive mechanisms (e.g., empathy, goal understanding) and conditions (e.g., autism spectrum disorders). Recently, mirror neurons were suggested to be the mechanism underlying a specific type of synesthesia. Mirror-touch synesthesia is a phenomenon in which individuals experience somatosensory sensations when seeing someone else being touched. Appealing as it is, careful delineation is required when applying this mechanism. Using the mirror-touch synesthesia case, we put forward theoretical and methodological issues that should be addressed before relying on the mirror-neurons account. © The Author(s) 2016.

  3. Merkel cells and neurons keep in touch

    Science.gov (United States)

    Woo, Seung-Hyun; Lumpkin, Ellen A.; Patapoutian, Ardem

    2014-01-01

    The Merkel cell-neurite complex is a unique vertebrate touch receptor comprising two distinct cell types in the skin. Its presence in touch-sensitive skin areas was recognized more than a century ago, but the functions of each cell type in sensory transduction have been unclear. Three recent studies demonstrate that Merkel cells are mechanosensitive cells that function in touch transduction via Piezo2. One study concludes that Merkel cells rather than sensory neurons are principal sites of mechanotransduction, whereas the other two studies report that both Merkel cells and neurons encode mechanical inputs. Together, these studies settle a longstanding debate on whether Merkel cells are mechanosensory cells, and enable future investigations of how these skin cells communicate with neurons. PMID:25480024

  4. Descending Command Neurons in the Brainstem that Halt Locomotion

    DEFF Research Database (Denmark)

    Bouvier, Julien; Caggiano, Vittorio; Leiras, Roberto

    2015-01-01

    identifiable brainstem populations to a potential locomotor stop signal, we used developmental genetics and considered a discrete neuronal population in the reticular formation: the V2a neurons. We find that those neurons constitute a major excitatory pathway to locomotor areas of the ventral spinal cord....... Selective activation of V2a neurons of the rostral medulla stops ongoing locomotor activity, owing to an inhibition of premotor locomotor networks in the spinal cord. Moreover, inactivation of such neurons decreases spontaneous stopping in vivo. Therefore, the V2a "stop neurons" represent a glutamatergic...

  5. Mirror neurons: Enigma of the metaphysical modular brain.

    Science.gov (United States)

    Acharya, Sourya; Shukla, Samarth

    2012-07-01

    Mirror neurons are one of the most important discoveries in the last decade of neuroscience. These are a variety of visuospatial neurons which indicate fundamentally about human social interaction. Essentially, mirror neurons respond to actions that we observe in others. The interesting part is that mirror neurons fire in the same way when we actually recreate that action ourselves. Apart from imitation, they are responsible for myriad of other sophisticated human behavior and thought processes. Defects in the mirror neuron system are being linked to disorders like autism. This review is a brief introduction to the neurons that shaped our civilization.

  6. Neuronal glycogen synthesis contributes to physiological aging.

    Science.gov (United States)

    Sinadinos, Christopher; Valles-Ortega, Jordi; Boulan, Laura; Solsona, Estel; Tevy, Maria F; Marquez, Mercedes; Duran, Jordi; Lopez-Iglesias, Carmen; Calbó, Joaquim; Blasco, Ester; Pumarola, Marti; Milán, Marco; Guinovart, Joan J

    2014-10-01

    Glycogen is a branched polymer of glucose and the carbohydrate energy store for animal cells. In the brain, it is essentially found in glial cells, although it is also present in minute amounts in neurons. In humans, loss-of-function mutations in laforin and malin, proteins involved in suppressing glycogen synthesis, induce the presence of high numbers of insoluble polyglucosan bodies in neuronal cells. Known as Lafora bodies (LBs), these deposits result in the aggressive neurodegeneration seen in Lafora's disease. Polysaccharide-based aggregates, called corpora amylacea (CA), are also present in the neurons of aged human brains. Despite the similarity of CA to LBs, the mechanisms and functional consequences of CA formation are yet unknown. Here, we show that wild-type laboratory mice also accumulate glycogen-based aggregates in the brain as they age. These structures are immunopositive for an array of metabolic and stress-response proteins, some of which were previously shown to aggregate in correlation with age in the human brain and are also present in LBs. Remarkably, these structures and their associated protein aggregates are not present in the aged mouse brain upon genetic ablation of glycogen synthase. Similar genetic intervention in Drosophila prevents the accumulation of glycogen clusters in the neuronal processes of aged flies. Most interestingly, targeted reduction of Drosophila glycogen synthase in neurons improves neurological function with age and extends lifespan. These results demonstrate that neuronal glycogen accumulation contributes to physiological aging and may therefore constitute a key factor regulating age-related neurological decline in humans. © 2014 The Authors. Aging cell published by the Anatomical Society and John Wiley & Sons Ltd.

  7. Nuclear Calcium Buffering Capacity Shapes Neuronal Architecture*

    Science.gov (United States)

    Mauceri, Daniela; Hagenston, Anna M.; Schramm, Kathrin; Weiss, Ursula; Bading, Hilmar

    2015-01-01

    Calcium-binding proteins (CaBPs) such as parvalbumin are part of the cellular calcium buffering system that determines intracellular calcium diffusion and influences the spatiotemporal dynamics of calcium signals. In neurons, CaBPs are primarily localized to the cytosol and function, for example, in nerve terminals in short-term synaptic plasticity. However, CaBPs are also expressed in the cell nucleus, suggesting that they modulate nuclear calcium signals, which are key regulators of neuronal gene expression. Here we show that the calcium buffering capacity of the cell nucleus in mouse hippocampal neurons regulates neuronal architecture by modulating the expression levels of VEGFD and the complement factor C1q-c, two nuclear calcium-regulated genes that control dendrite geometry and spine density, respectively. Increasing the levels of nuclear calcium buffers by means of expression of a nuclearly targeted form of parvalbumin fused to mCherry (PV.NLS-mC) led to a reduction in VEGFD expression and, as a result, to a decrease in total dendritic length and complexity. In contrast, mRNA levels of the synapse pruning factor C1q-c were increased in neurons expressing PV.NLS-mC, causing a reduction in the density and size of dendritic spines. Our results establish a close link between nuclear calcium buffering capacity and the transcription of genes that determine neuronal structure. They suggest that the development of cognitive deficits observed in neurological conditions associated with CaBP deregulation may reflect the loss of necessary structural features of dendrites and spines. PMID:26231212

  8. Nuclear Calcium Buffering Capacity Shapes Neuronal Architecture.

    Science.gov (United States)

    Mauceri, Daniela; Hagenston, Anna M; Schramm, Kathrin; Weiss, Ursula; Bading, Hilmar

    2015-09-18

    Calcium-binding proteins (CaBPs) such as parvalbumin are part of the cellular calcium buffering system that determines intracellular calcium diffusion and influences the spatiotemporal dynamics of calcium signals. In neurons, CaBPs are primarily localized to the cytosol and function, for example, in nerve terminals in short-term synaptic plasticity. However, CaBPs are also expressed in the cell nucleus, suggesting that they modulate nuclear calcium signals, which are key regulators of neuronal gene expression. Here we show that the calcium buffering capacity of the cell nucleus in mouse hippocampal neurons regulates neuronal architecture by modulating the expression levels of VEGFD and the complement factor C1q-c, two nuclear calcium-regulated genes that control dendrite geometry and spine density, respectively. Increasing the levels of nuclear calcium buffers by means of expression of a nuclearly targeted form of parvalbumin fused to mCherry (PV.NLS-mC) led to a reduction in VEGFD expression and, as a result, to a decrease in total dendritic length and complexity. In contrast, mRNA levels of the synapse pruning factor C1q-c were increased in neurons expressing PV.NLS-mC, causing a reduction in the density and size of dendritic spines. Our results establish a close link between nuclear calcium buffering capacity and the transcription of genes that determine neuronal structure. They suggest that the development of cognitive deficits observed in neurological conditions associated with CaBP deregulation may reflect the loss of necessary structural features of dendrites and spines. © 2015 by The American Society for Biochemistry and Molecular Biology, Inc.

  9. Determination of the rate constant for neuronal and extra-neuronal monoamine oxidase

    International Nuclear Information System (INIS)

    Cassis, L.; Ludwig, J.; Trendelenburg, U.

    1986-01-01

    In the rat vas deferens, neuronal deamination of 3 H-(-) noradrenaline ( 3 H-NA) to 3 H-dihydroxyphenethylglycol ( 3 HDOPEG) cannot be inhibited by pretreatment with a monoamine oxidase (MAO) inhibitor. However, in the extraneuronal compartment of the rat heart, inhibition of MAO abolishes the formation of 3 HDOPEG. To clarify this discrepancy, the authors determined the rate constant for MAO (/sup k/mao/) neuronally (rat vas deferens) and extraneuronally (rat heart). For neuronal /sup k/mao, vasa deferentia were incubated with 3 HNA for 300 minutes, and the cumulative formation of 3 HDOPEG measured. The delay in time before 3 HDOPEG achieves steady state (/sup tau/system), is inversely proportional to /sup k/mao. Because /sup tau/system is very short for neuronal MAO, an appreciable delay was only achieved after partial inhibition of MAO with various parglyline concentrations. To relate to the uninhibited enzyme, the percentage inhibition by pargyline was then determined in homogenate preparations. For extraneuronal MAO, a similar procedure was performed in perfused rat hearts. Results show a significantly greater /sup k/mao of neuronal origin, (/sup k/mao = .57min - 1) which when related to the fractional size of the neuronal compartment suggests a very high activity of neuronal MAO

  10. Direct Neuronal Reprogramming for Disease Modeling Studies Using Patient-Derived Neurons: What Have We Learned?

    Directory of Open Access Journals (Sweden)

    Janelle Drouin-Ouellet

    2017-09-01

    Full Text Available Direct neuronal reprogramming, by which a neuron is formed via direct conversion from a somatic cell without going through a pluripotent intermediate stage, allows for the possibility of generating patient-derived neurons. A unique feature of these so-called induced neurons (iNs is the potential to maintain aging and epigenetic signatures of the donor, which is critical given that many diseases of the CNS are age related. Here, we review the published literature on the work that has been undertaken using iNs to model human brain disorders. Furthermore, as disease-modeling studies using this direct neuronal reprogramming approach are becoming more widely adopted, it is important to assess the criteria that are used to characterize the iNs, especially in relation to the extent to which they are mature adult neurons. In particular: i what constitutes an iN cell, ii which stages of conversion offer the earliest/optimal time to assess features that are specific to neurons and/or a disorder and iii whether generating subtype-specific iNs is critical to the disease-related features that iNs express. Finally, we discuss the range of potential biomedical applications that can be explored using patient-specific models of neurological disorders with iNs, and the challenges that will need to be overcome in order to realize these applications.

  11. Identification of neuronal network properties from the spectral analysis of calcium imaging signals in neuronal cultures.

    Science.gov (United States)

    Tibau, Elisenda; Valencia, Miguel; Soriano, Jordi

    2013-01-01

    Neuronal networks in vitro are prominent systems to study the development of connections in living neuronal networks and the interplay between connectivity, activity and function. These cultured networks show a rich spontaneous activity that evolves concurrently with the connectivity of the underlying network. In this work we monitor the development of neuronal cultures, and record their activity using calcium fluorescence imaging. We use spectral analysis to characterize global dynamical and structural traits of the neuronal cultures. We first observe that the power spectrum can be used as a signature of the state of the network, for instance when inhibition is active or silent, as well as a measure of the network's connectivity strength. Second, the power spectrum identifies prominent developmental changes in the network such as GABAA switch. And third, the analysis of the spatial distribution of the spectral density, in experiments with a controlled disintegration of the network through CNQX, an AMPA-glutamate receptor antagonist in excitatory neurons, reveals the existence of communities of strongly connected, highly active neurons that display synchronous oscillations. Our work illustrates the interest of spectral analysis for the study of in vitro networks, and its potential use as a network-state indicator, for instance to compare healthy and diseased neuronal networks.

  12. Axonal regeneration and neuronal function are preserved in motor neurons lacking ß-actin in vivo.

    Directory of Open Access Journals (Sweden)

    Thomas R Cheever

    2011-03-01

    Full Text Available The proper localization of ß-actin mRNA and protein is essential for growth cone guidance and axon elongation in cultured neurons. In addition, decreased levels of ß-actin mRNA and protein have been identified in the growth cones of motor neurons cultured from a mouse model of Spinal Muscular Atrophy (SMA, suggesting that ß-actin loss-of-function at growth cones or pre-synaptic nerve terminals could contribute to the pathogenesis of this disease. However, the role of ß-actin in motor neurons in vivo and its potential relevance to disease has yet to be examined. We therefore generated motor neuron specific ß-actin knock-out mice (Actb-MNsKO to investigate the function of ß-actin in motor neurons in vivo. Surprisingly, ß-actin was not required for motor neuron viability or neuromuscular junction maintenance. Skeletal muscle from Actb-MNsKO mice showed no histological indication of denervation and did not significantly differ from controls in several measurements of physiologic function. Finally, motor axon regeneration was unimpaired in Actb-MNsKO mice, suggesting that ß-actin is not required for motor neuron function or regeneration in vivo.

  13. Direct projections from hypothalamic orexin neurons to brainstem cardiac vagal neurons.

    Science.gov (United States)

    Dergacheva, Olga; Yamanaka, Akihiro; Schwartz, Alan R; Polotsky, Vsevolod Y; Mendelowitz, David

    2016-12-17

    Orexin neurons are known to augment the sympathetic control of cardiovascular function, however the role of orexin neurons in parasympathetic cardiac regulation remains unclear. To test the hypothesis that orexin neurons contribute to parasympathetic control we selectively expressed channelrhodopsin-2 (ChR2) in orexin neurons in orexin-Cre transgenic rats and examined postsynaptic currents in cardiac vagal neurons (CVNs) in the dorsal motor nucleus of the vagus (DMV). Simultaneous photostimulation and recording in ChR2-expressing orexin neurons in the lateral hypothalamus resulted in reliable action potential firing as well as large whole-cell currents suggesting a strong expression of ChR2 and reliable optogenetic excitation. Photostimulation of ChR2-expressing fibers in the DMV elicited short-latency (ranging from 3.2ms to 8.5ms) postsynaptic currents in 16 out of 44 CVNs tested. These responses were heterogeneous and included excitatory glutamatergic (63%) and inhibitory GABAergic (37%) postsynaptic currents. The results from this study suggest different sub-population of orexin neurons may exert diverse influences on brainstem CVNs and therefore may play distinct functional roles in parasympathetic control of the heart. Copyright © 2016 IBRO. Published by Elsevier Ltd. All rights reserved.

  14. Power laws from linear neuronal cable theory

    DEFF Research Database (Denmark)

    Pettersen, Klas H; Lindén, Henrik Anders; Tetzlaff, Tom

    2014-01-01

    suggested to be at the root of this phenomenon, we here demonstrate a possible origin of such power laws in the biophysical properties of single neurons described by the standard cable equation. Taking advantage of the analytical tractability of the so called ball and stick neuron model, we derive general...... are homogeneously distributed across the neural membranes and themselves exhibit pink ([Formula: see text]) noise distributions. While the PSD noise spectra at low frequencies may be dominated by synaptic noise, our findings suggest that the high-frequency power laws may originate in noise from intrinsic ion...

  15. An introduction to modeling neuronal dynamics

    CERN Document Server

    Börgers, Christoph

    2017-01-01

    This book is intended as a text for a one-semester course on Mathematical and Computational Neuroscience for upper-level undergraduate and beginning graduate students of mathematics, the natural sciences, engineering, or computer science. An undergraduate introduction to differential equations is more than enough mathematical background. Only a slim, high school-level background in physics is assumed, and none in biology. Topics include models of individual nerve cells and their dynamics, models of networks of neurons coupled by synapses and gap junctions, origins and functions of population rhythms in neuronal networks, and models of synaptic plasticity. An extensive online collection of Matlab programs generating the figures accompanies the book. .

  16. Neuronal release of proBDNF

    OpenAIRE

    Yang, Jianmin; Siao, Chia-Jen; Nagappan, Guhan; Marinic, Tina; Jing, Deqiang; McGrath, Kelly; Chen, Zhe-Yu; Mark, Willie; Tessarollo, Lino; Lee, Francis S; Lu, Bai; Hempstead, Barbara L

    2009-01-01

    Pro–brain-derived neurotrophic factor (proBDNF) and mature BDNF utilize distinct receptors to mediate divergent neuronal actions. Using new tools to quantitate endogenous BDNF isoforms, we found that mouse neurons secrete both proBDNF and mature BDNF. The highest levels of proBDNF and p75 were observed perinatally and declined, but were still detectable, in adulthood. Thus, BDNF actions are developmentally regulated by secretion of proBDNF or mature BDNF and by local expression of p75 and Trk...

  17. Intrinsic neuromodulation: altering neuronal circuits from within.

    Science.gov (United States)

    Katz, P S; Frost, W N

    1996-02-01

    There are two sources of neuromodulation for neuronal circuits: extrinsic inputs and intrinsic components of the circuits themselves. Extrinsic neuromodulation is known to be pervasive in nervous systems, but intrinsic neuromodulation is less recognized, despite the fact that it has now been demonstrated in sensory and neuromuscular circuits and in central pattern generators. By its nature, intrinsic neuromodulation produces local changes in neuronal computation, whereas extrinsic neuromodulation can cause global changes, often affecting many circuits simultaneously. Studies in a number of systems are defining the different properties of these two forms of neuromodulation.

  18. Insights into the role of neuronal glucokinase.

    Science.gov (United States)

    De Backer, Ivan; Hussain, Sufyan S; Bloom, Stephen R; Gardiner, James V

    2016-07-01

    Glucokinase is a key component of the neuronal glucose-sensing mechanism and is expressed in brain regions that control a range of homeostatic processes. In this review, we detail recently identified roles for neuronal glucokinase in glucose homeostasis and counterregulatory responses to hypoglycemia and in regulating appetite. We describe clinical implications from these advances in our knowledge, especially for developing novel treatments for diabetes and obesity. Further research required to extend our knowledge and help our efforts to tackle the diabetes and obesity epidemics is suggested. Copyright © 2016 the American Physiological Society.

  19. Insights into the role of neuronal glucokinase

    Science.gov (United States)

    De Backer, Ivan; Hussain, Sufyan S.; Gardiner, James V.

    2016-01-01

    Glucokinase is a key component of the neuronal glucose-sensing mechanism and is expressed in brain regions that control a range of homeostatic processes. In this review, we detail recently identified roles for neuronal glucokinase in glucose homeostasis and counterregulatory responses to hypoglycemia and in regulating appetite. We describe clinical implications from these advances in our knowledge, especially for developing novel treatments for diabetes and obesity. Further research required to extend our knowledge and help our efforts to tackle the diabetes and obesity epidemics is suggested. PMID:27189932

  20. Temporal characteristics of gustatory responses in rat parabrachial neurons vary by stimulus and chemosensitive neuron type.

    Science.gov (United States)

    Geran, Laura; Travers, Susan

    2013-01-01

    It has been demonstrated that temporal features of spike trains can increase the amount of information available for gustatory processing. However, the nature of these temporal characteristics and their relationship to different taste qualities and neuron types are not well-defined. The present study analyzed the time course of taste responses from parabrachial (PBN) neurons elicited by multiple applications of "sweet" (sucrose), "salty" (NaCl), "sour" (citric acid), and "bitter" (quinine and cycloheximide) stimuli in an acute preparation. Time course varied significantly by taste stimulus and best-stimulus classification. Across neurons, the ensemble code for the three electrolytes was similar initially but quinine diverged from NaCl and acid during the second 500 ms of stimulation and all four qualities became distinct just after 1s. This temporal evolution was reflected in significantly broader tuning during the initial response. Metric space analyses of quality discrimination by individual neurons showed that increases in information (H) afforded by temporal factors was usually explained by differences in rate envelope, which had a greater impact during the initial 2s (22.5% increase in H) compared to the later response (9.5%). Moreover, timing had a differential impact according to cell type, with between-quality discrimination in neurons activated maximally by NaCl or citric acid most affected. Timing was also found to dramatically improve within-quality discrimination (80% increase in H) in neurons that responded optimally to bitter stimuli (B-best). Spikes from B-best neurons were also more likely to occur in bursts. These findings suggest that among PBN taste neurons, time-dependent increases in mutual information can arise from stimulus- and neuron-specific differences in response envelope during the initial dynamic period. A stable rate code predominates in later epochs.

  1. Neuron-to-neuron transmission of α-synuclein fibrils through axonal transport

    Science.gov (United States)

    Freundt, Eric C.; Maynard, Nate; Clancy, Eileen K.; Roy, Shyamali; Bousset, Luc; Sourigues, Yannick; Covert, Markus; Melki, Ronald; Kirkegaard, Karla; Brahic, Michel

    2012-01-01

    Objective The lesions of Parkinson's disease spread through the brain in a characteristic pattern that corresponds to axonal projections. Previous observations suggest that misfolded α-synuclein could behave as a prion, moving from neuron to neuron and causing endogenous α-synuclein to misfold. Here, we characterized and quantified the axonal transport of α-synuclein fibrils and showed that fibrils could be transferred from axons to second-order neurons following anterograde transport. Methods We grew primary cortical mouse neurons in microfluidic devices to separate soma from axonal projections in fluidically isolated microenvironments. We used live-cell imaging and immunofluorescence to characterize the transport of fluorescent α-synuclein fibrils and their transfer to second-order neurons. Results Fibrillar α-synuclein was internalized by primary neurons and transported in axons with kinetics consistent with slow component-b of axonal transport (fast axonal transport with saltatory movement). Fibrillar α-synuclein was readily observed in the cell bodies of second-order neurons following anterograde axonal transport. Axon-to-soma transfer appeared not to require synaptic contacts. Interpretation These results support the hypothesis that the progression of Parkinson's disease can be caused by neuron-to-neuron spread of α-synuclein aggregates and that the anatomical pattern of progression of lesions between axonally connected areas results from the axonal transport of such aggregates. That the transfer did not appear to be transsynaptic gives hope that α-synuclein fibrils could be intercepted by drugs during the extra-cellular phase of their journey. PMID:23109146

  2. Recurrently connected and localized neuronal communities initiate coordinated spontaneous activity in neuronal networks

    Science.gov (United States)

    Amin, Hayder; Maccione, Alessandro; Nieus, Thierry

    2017-01-01

    Developing neuronal systems intrinsically generate coordinated spontaneous activity that propagates by involving a large number of synchronously firing neurons. In vivo, waves of spikes transiently characterize the activity of developing brain circuits and are fundamental for activity-dependent circuit formation. In vitro, coordinated spontaneous spiking activity, or network bursts (NBs), interleaved within periods of asynchronous spikes emerge during the development of 2D and 3D neuronal cultures. Several studies have investigated this type of activity and its dynamics, but how a neuronal system generates these coordinated events remains unclear. Here, we investigate at a cellular level the generation of network bursts in spontaneously active neuronal cultures by exploiting high-resolution multielectrode array recordings and computational network modelling. Our analysis reveals that NBs are generated in specialized regions of the network (functional neuronal communities) that feature neuronal links with high cross-correlation peak values, sub-millisecond lags and that share very similar structural connectivity motifs providing recurrent interactions. We show that the particular properties of these local structures enable locally amplifying spontaneous asynchronous spikes and that this mechanism can lead to the initiation of NBs. Through the analysis of simulated and experimental data, we also show that AMPA currents drive the coordinated activity, while NMDA and GABA currents are only involved in shaping the dynamics of NBs. Overall, our results suggest that the presence of functional neuronal communities with recurrent local connections allows a neuronal system to generate spontaneous coordinated spiking activity events. As suggested by the rules used for implementing our computational model, such functional communities might naturally emerge during network development by following simple constraints on distance-based connectivity. PMID:28749937

  3. Recurrently connected and localized neuronal communities initiate coordinated spontaneous activity in neuronal networks.

    Directory of Open Access Journals (Sweden)

    Davide Lonardoni

    2017-07-01

    Full Text Available Developing neuronal systems intrinsically generate coordinated spontaneous activity that propagates by involving a large number of synchronously firing neurons. In vivo, waves of spikes transiently characterize the activity of developing brain circuits and are fundamental for activity-dependent circuit formation. In vitro, coordinated spontaneous spiking activity, or network bursts (NBs, interleaved within periods of asynchronous spikes emerge during the development of 2D and 3D neuronal cultures. Several studies have investigated this type of activity and its dynamics, but how a neuronal system generates these coordinated events remains unclear. Here, we investigate at a cellular level the generation of network bursts in spontaneously active neuronal cultures by exploiting high-resolution multielectrode array recordings and computational network modelling. Our analysis reveals that NBs are generated in specialized regions of the network (functional neuronal communities that feature neuronal links with high cross-correlation peak values, sub-millisecond lags and that share very similar structural connectivity motifs providing recurrent interactions. We show that the particular properties of these local structures enable locally amplifying spontaneous asynchronous spikes and that this mechanism can lead to the initiation of NBs. Through the analysis of simulated and experimental data, we also show that AMPA currents drive the coordinated activity, while NMDA and GABA currents are only involved in shaping the dynamics of NBs. Overall, our results suggest that the presence of functional neuronal communities with recurrent local connections allows a neuronal system to generate spontaneous coordinated spiking activity events. As suggested by the rules used for implementing our computational model, such functional communities might naturally emerge during network development by following simple constraints on distance-based connectivity.

  4. Understanding metal homeostasis in primary cultured neurons. Studies using single neuron subcellular and quantitative metallomics.

    Science.gov (United States)

    Colvin, Robert A; Lai, Barry; Holmes, William R; Lee, Daewoo

    2015-07-01

    The purpose of this study was to demonstrate how single cell quantitative and subcellular metallomics inform us about both the spatial distribution and cellular mechanisms of metal buffering and homeostasis in primary cultured neurons from embryonic rat brain, which are often used as models of human disease involving metal dyshomeostasis. The present studies utilized synchrotron radiation X-ray fluorescence (SRXRF) and focused primarily on zinc and iron, two abundant metals in neurons that have been implicated in the pathogenesis of neurodegenerative diseases such as Alzheimer's disease and Parkinson's disease. Total single cell contents for calcium, iron, zinc, copper, manganese, and nickel were determined. Resting steady state zinc showed a diffuse distribution in both soma and processes, best defined by the mass profile of the neuron with an enrichment in the nucleus compared with the cytoplasm. Zinc buffering and homeostasis was studied using two modes of cellular zinc loading - transporter and ionophore (pyrithione) mediated. Single neuron zinc contents were shown to statistically significantly increase by either loading method - ionophore: 160 million to 7 billion; transporter 160 million to 280 million atoms per neuronal soma. The newly acquired and buffered zinc still showed a diffuse distribution. Soma and processes have about equal abilities to take up zinc via transporter mediated pathways. Copper levels are distributed diffusely as well, but are relatively higher in the processes relative to zinc levels. Prior studies have observed iron puncta in certain cell types, but others have not. In the present study, iron puncta were characterized in several primary neuronal types. The results show that iron puncta could be found in all neuronal types studied and can account for up to 50% of the total steady state content of iron in neuronal soma. Although other metals can be present in iron puncta, they are predominantly iron containing and do not appear to be

  5. Neurons of self-defence: neuronal innervation of the exocrine defence glands in stick insects.

    Science.gov (United States)

    Stolz, Konrad; von Bredow, Christoph-Rüdiger; von Bredow, Yvette M; Lakes-Harlan, Reinhard; Trenczek, Tina E; Strauß, Johannes

    2015-01-01

    Stick insects (Phasmatodea) use repellent chemical substances (allomones) for defence which are released from so-called defence glands in the prothorax. These glands differ in size between species, and are under neuronal control from the CNS. The detailed neural innervation and possible differences between species are not studied so far. Using axonal tracing, the neuronal innervation is investigated comparing four species. The aim is to document the complexity of defence gland innervation in peripheral nerves and central motoneurons in stick insects. In the species studied here, the defence gland is innervated by the intersegmental nerve complex (ISN) which is formed by three nerves from the prothoracic (T1) and suboesophageal ganglion (SOG), as well as a distinct suboesophageal nerve (Nervus anterior of the suboesophageal ganglion). In Carausius morosus and Sipyloidea sipylus, axonal tracing confirmed an innervation of the defence glands by this N. anterior SOG as well as N. anterior T1 and N. posterior SOG from the intersegmental nerve complex. In Peruphasma schultei, which has rather large defence glands, only the innervation by the N. anterior SOG was documented by axonal tracing. In the central nervous system of all species, 3-4 neuron types are identified by axonal tracing which send axons in the N. anterior SOG likely innervating the defence gland as well as adjacent muscles. These neurons are mainly suboesophageal neurons with one intersegmental neuron located in the prothoracic ganglion. The neuron types are conserved in the species studied, but the combination of neuron types is not identical. In addition, the central nervous system in S. sipylus contains one suboesophageal and one prothoracic neuron type with axons in the intersegmental nerve complex contacting the defence gland. Axonal tracing shows a very complex innervation pattern of the defence glands of Phasmatodea which contains different neurons in different nerves from two adjacent body segments

  6. Complete synchronization in coupled type-I neurons

    Indian Academy of Sciences (India)

    Keywords. Complete synchronization; noise; coupled type-I neurons. Abstract. For a system of type-I neurons bidirectionally coupled through a nonlinear feedback mechanism, we discuss the issue of ... Pramana – Journal of Physics | News.

  7. Synaptic glutamate release by postnatal rat serotonergic neurons in microculture.

    Science.gov (United States)

    Johnson, M D

    1994-02-01

    Serotonergic neurons are thought to play a role in depression and obsessive compulsive disorder. However, their functional transmitter repertoire is incompletely known. To investigate this repertoire, intracellular recordings were obtained from 132 cytochemically identified rat mesopontine serotonergic neurons that had re-established synapses in microcultures. Approximately 60% of the neurons evoked excitatory glutamatergic potentials in themselves or in target neurons. Glutamatergic transmission was frequently observed in microcultures containing a solitary serotonergic neuron. Evidence for co-release of serotonin and glutamate from single raphe neurons was also obtained. However, evidence for gamma-aminobutyric acid release by serotonergic neurons was observed in only two cases. These findings indicate that many cultured serotonergic neurons form glutamatergic synapses and may explain several observations in slices and in vivo.

  8. Protective effect of parvalbumin on excitotoxic motor neuron death

    DEFF Research Database (Denmark)

    Van den Bosch, L.; Schwaller, B.; Vleminckx, V.

    2002-01-01

    Amyotrophic lateral sclerosis, ALS, AMPA receptor, calcium-binding proteins, calcium buffering, excitotoxity, kainic acid, motor neuron, parvalbumin......Amyotrophic lateral sclerosis, ALS, AMPA receptor, calcium-binding proteins, calcium buffering, excitotoxity, kainic acid, motor neuron, parvalbumin...

  9. Neuron-glia metabolic coupling: Role in plasticity and neuroprotection

    KAUST Repository

    Magistretti, Pierre J.

    2017-01-01

    A tight metabolic coupling between astrocytes and neurons is a key feature of brain energy metabolism (Magistretti and Allaman, Neuron, 2015). Over the years we have described two basic mechanisms of neurometabolic coupling. First the glycogenolytic

  10. GABAA receptor-expressing neurons promote consumption in Drosophila melanogaster.

    Science.gov (United States)

    Cheung, Samantha K; Scott, Kristin

    2017-01-01

    Feeding decisions are highly plastic and bidirectionally regulated by neurons that either promote or inhibit feeding. In Drosophila melanogaster, recent studies have identified four GABAergic interneurons that act as critical brakes to prevent incessant feeding. These GABAergic neurons may inhibit target neurons that drive consumption. Here, we tested this hypothesis by examining GABA receptors and neurons that promote consumption. We find that Resistance to dieldrin (RDL), a GABAA type receptor, is required for proper control of ingestion. Knockdown of Rdl in a subset of neurons causes overconsumption of tastants. Acute activation of these neurons is sufficient to drive consumption of appetitive substances and non-appetitive substances and acute silencing of these neurons decreases consumption. Taken together, these studies identify GABAA receptor-expressing neurons that promote Drosophila ingestive behavior and provide insight into feeding regulation.

  11. Bayesian population decoding of spiking neurons.

    Science.gov (United States)

    Gerwinn, Sebastian; Macke, Jakob; Bethge, Matthias

    2009-01-01

    The timing of action potentials in spiking neurons depends on the temporal dynamics of their inputs and contains information about temporal fluctuations in the stimulus. Leaky integrate-and-fire neurons constitute a popular class of encoding models, in which spike times depend directly on the temporal structure of the inputs. However, optimal decoding rules for these models have only been studied explicitly in the noiseless case. Here, we study decoding rules for probabilistic inference of a continuous stimulus from the spike times of a population of leaky integrate-and-fire neurons with threshold noise. We derive three algorithms for approximating the posterior distribution over stimuli as a function of the observed spike trains. In addition to a reconstruction of the stimulus we thus obtain an estimate of the uncertainty as well. Furthermore, we derive a 'spike-by-spike' online decoding scheme that recursively updates the posterior with the arrival of each new spike. We use these decoding rules to reconstruct time-varying stimuli represented by a Gaussian process from spike trains of single neurons as well as neural populations.

  12. Bayesian population decoding of spiking neurons

    Directory of Open Access Journals (Sweden)

    Sebastian Gerwinn

    2009-10-01

    Full Text Available The timing of action potentials in spiking neurons depends on the temporal dynamics of their inputs and contains information about temporal fluctuations in the stimulus. Leaky integrate-and-fire neurons constitute a popular class of encoding models, in which spike times depend directly on the temporal structure of the inputs. However, optimal decoding rules for these models have only been studied explicitly in the noiseless case. Here, we study decoding rules for probabilistic inference of a continuous stimulus from the spike times of a population of leaky integrate-and-fire neurons with threshold noise. We derive three algorithms for approximating the posterior distribution over stimuli as a function of the observed spike trains. In addition to a reconstruction of the stimulus we thus obtain an estimate of the uncertainty as well. Furthermore, we derive a `spike-by-spike' online decoding scheme that recursively updates the posterior with the arrival of each new spike. We use these decoding rules to reconstruct time-varying stimuli represented by a Gaussian process from spike trains of single neurons as well as neural populations.

  13. Adrenal Steroids: Biphasic Effects on Neurons

    NARCIS (Netherlands)

    Joels, M.; Karst, H.; Squire, L.R.

    2009-01-01

    Corticosteroid hormones are released from the adrenal gland after stress. They enter the brain and bind to high-affinity mineralocorticoid and lower affinity glucocorticoid receptors. Through these nuclear receptors, corticosteroids exert long-lasting effects on essential properties of neurons, such

  14. Asynchronous Rate Chaos in Spiking Neuronal Circuits.

    Directory of Open Access Journals (Sweden)

    Omri Harish

    2015-07-01

    Full Text Available The brain exhibits temporally complex patterns of activity with features similar to those of chaotic systems. Theoretical studies over the last twenty years have described various computational advantages for such regimes in neuronal systems. Nevertheless, it still remains unclear whether chaos requires specific cellular properties or network architectures, or whether it is a generic property of neuronal circuits. We investigate the dynamics of networks of excitatory-inhibitory (EI spiking neurons with random sparse connectivity operating in the regime of balance of excitation and inhibition. Combining Dynamical Mean-Field Theory with numerical simulations, we show that chaotic, asynchronous firing rate fluctuations emerge generically for sufficiently strong synapses. Two different mechanisms can lead to these chaotic fluctuations. One mechanism relies on slow I-I inhibition which gives rise to slow subthreshold voltage and rate fluctuations. The decorrelation time of these fluctuations is proportional to the time constant of the inhibition. The second mechanism relies on the recurrent E-I-E feedback loop. It requires slow excitation but the inhibition can be fast. In the corresponding dynamical regime all neurons exhibit rate fluctuations on the time scale of the excitation. Another feature of this regime is that the population-averaged firing rate is substantially smaller in the excitatory population than in the inhibitory population. This is not necessarily the case in the I-I mechanism. Finally, we discuss the neurophysiological and computational significance of our results.

  15. Observability and synchronization of neuron models

    Science.gov (United States)

    Aguirre, Luis A.; Portes, Leonardo L.; Letellier, Christophe

    2017-10-01

    Observability is the property that enables recovering the state of a dynamical system from a reduced number of measured variables. In high-dimensional systems, it is therefore important to make sure that the variable recorded to perform the analysis conveys good observability of the system dynamics. The observability of a network of neuron models depends nontrivially on the observability of the node dynamics and on the topology of the network. The aim of this paper is twofold. First, to perform a study of observability using four well-known neuron models by computing three different observability coefficients. This not only clarifies observability properties of the models but also shows the limitations of applicability of each type of coefficients in the context of such models. Second, to study the emergence of phase synchronization in networks composed of neuron models. This is done performing multivariate singular spectrum analysis which, to the best of the authors' knowledge, has not been used in the context of networks of neuron models. It is shown that it is possible to detect phase synchronization: (i) without having to measure all the state variables, but only one (that provides greatest observability) from each node and (ii) without having to estimate the phase.

  16. Neuron-glia metabolic coupling and plasticity.

    Science.gov (United States)

    Magistretti, Pierre J

    2006-06-01

    The coupling between synaptic activity and glucose utilization (neurometabolic coupling) is a central physiological principle of brain function that has provided the basis for 2-deoxyglucose-based functional imaging with positron emission tomography (PET). Astrocytes play a central role in neurometabolic coupling, and the basic mechanism involves glutamate-stimulated aerobic glycolysis; the sodium-coupled reuptake of glutamate by astrocytes and the ensuing activation of the Na-K-ATPase triggers glucose uptake and processing via glycolysis, resulting in the release of lactate from astrocytes. Lactate can then contribute to the activity-dependent fuelling of the neuronal energy demands associated with synaptic transmission. An operational model, the 'astrocyte-neuron lactate shuttle', is supported experimentally by a large body of evidence, which provides a molecular and cellular basis for interpreting data obtained from functional brain imaging studies. In addition, this neuron-glia metabolic coupling undergoes plastic adaptations in parallel with adaptive mechanisms that characterize synaptic plasticity. Thus, distinct subregions of the hippocampus are metabolically active at different time points during spatial learning tasks, suggesting that a type of metabolic plasticity, involving by definition neuron-glia coupling, occurs during learning. In addition, marked variations in the expression of genes involved in glial glycogen metabolism are observed during the sleep-wake cycle, with in particular a marked induction of expression of the gene encoding for protein targeting to glycogen (PTG) following sleep deprivation. These data suggest that glial metabolic plasticity is likely to be concomitant with synaptic plasticity.

  17. Beyond the frontiers of neuronal types

    Science.gov (United States)

    Battaglia, Demian; Karagiannis, Anastassios; Gallopin, Thierry; Gutch, Harold W.; Cauli, Bruno

    2012-01-01

    Cortical neurons and, particularly, inhibitory interneurons display a large diversity of morphological, synaptic, electrophysiological, and molecular properties, as well as diverse embryonic origins. Various authors have proposed alternative classification schemes that rely on the concomitant observation of several multimodal features. However, a broad variability is generally observed even among cells that are grouped into a same class. Furthermore, the attribution of specific neurons to a single defined class is often difficult, because individual properties vary in a highly graded fashion, suggestive of continua of features between types. Going beyond the description of representative traits of distinct classes, we focus here on the analysis of atypical cells. We introduce a novel paradigm for neuronal type classification, assuming explicitly the existence of a structured continuum of diversity. Our approach, grounded on the theory of fuzzy sets, identifies a small optimal number of model archetypes. At the same time, it quantifies the degree of similarity between these archetypes and each considered neuron. This allows highlighting archetypal cells, which bear a clear similarity to a single model archetype, and edge cells, which manifest a convergence of traits from multiple archetypes. PMID:23403725

  18. Beyond the frontiers of neuronal types

    Directory of Open Access Journals (Sweden)

    Demian eBattaglia

    2013-02-01

    Full Text Available Cortical neurons and, particularly, inhibitory interneurons display a large diversity of morphological, synaptic, electrophysiological and molecular properties, as well as diverse embryonic origins. Various authors have proposed alternative classification schemes that rely on the concomitant observation of several multimodal features. However, a broad variability is generally observed even among cells that are grouped into a same class. Furthermore, the attribution of specific neurons to a single defined class is often difficult, because individual properties vary in a highly graded fashion, suggestive of continua of features between types. Going beyond the description of representative traits of distinct classes, we focus here on the analysis of atypical cells. We introduce a novel paradigm for neuronal type classification, assuming explicitly the existence of a structured continuum of diversity. Our approach, grounded on the theory of fuzzy sets, identifies a small optimal number of model archetypes. At the same time, it quantifies the degree of similarity between these archetypes and each considered neuron. This allows highlighting archetypal cells, which bear a clear similarity to a single model archetype, and edge cells, which manifest a convergence of traits from multiple archetypes.

  19. Numbers, Neurons and Tides, Oh My!

    Science.gov (United States)

    Ortiz, Mary Theresa

    2006-01-01

    Mathematical applications to biology are presented in Anatomy & Physiology, General and Marine Biology. Body measurements and anatomical terminology are integrated, and problems involving neuron conduction speed, red blood cells, hemoglobin and glomerular filtration presented. General Biology applications include trans-membrane potential and…

  20. Motor neuron, nerve, and neuromuscular junction disease.

    Science.gov (United States)

    Finsterer, Josef; Papić, Lea; Auer-Grumbach, Michaela

    2011-10-01

    The aim is to review the most relevant findings published during the last year concerning clinical, genetic, pathogenic, and therapeutic advances in motor neuron disease, neuropathies, and neuromuscular junction disorders. Studies on animal and cell models have improved the understanding of how mutated survival motor neuron protein in spinal muscular atrophy governs the pathogenetic processes. New phenotypes of SOD1 mutations have been described. Moreover, animal models enhanced the insight into the pathogenetic background of sporadic and familial amyotrophic lateral sclerosis. Novel treatment options for motor neuron disease have been described in humans and animal models. Considerable progress has been achieved also in elucidating the genetic background of many forms of inherited neuropathies and high clinical and genetic heterogeneity has been demonstrated. Mutations in MuSK and GFTP1 have been shown to cause new types of congenital myasthenic syndromes. A third type of autoantibodies (Lrp4) has been detected to cause myasthenia gravis. Advances in the clinical and genetic characterization of motor neuron diseases, neuropathies, and neuromuscular transmission defects have important implications on the fundamental understanding, diagnosis, and management of these disorders. Identification of crucial steps of the pathogenetic process may provide the basis for the development of novel therapeutic strategies.

  1. GaAs optoelectronic neuron arrays

    Science.gov (United States)

    Lin, Steven; Grot, Annette; Luo, Jiafu; Psaltis, Demetri

    1993-01-01

    A simple optoelectronic circuit integrated monolithically in GaAs to implement sigmoidal neuron responses is presented. The circuit integrates a light-emitting diode with one or two transistors and one or two photodetectors. The design considerations for building arrays with densities of up to 10,000/sq cm are discussed.

  2. Managing Brain Extracellular K(+) during Neuronal Activity

    DEFF Research Database (Denmark)

    Larsen, Brian Roland; Stoica, Anca; MacAulay, Nanna

    2016-01-01

    characteristics required to fulfill their distinct physiological roles in clearance of K(+) from the extracellular space in the face of neuronal activity. Understanding the nature, impact and effects of the various Na(+)/K(+)-ATPase isoform combinations in K(+) management in the central nervous system might...... understanding of the pathological events occurring during disease....

  3. Modulation of neuronal network activity with ghrelin

    NARCIS (Netherlands)

    Stoyanova, Irina; Rutten, Wim; le Feber, Jakob

    2012-01-01

    Ghrelin is a neuropeptide regulating multiple physiological processes, including high brain functions such as learning and memory formation. However, the effect of ghrelin on network activity patterns and developments has not been studied yet. Therefore, we used dissociated cortical neurons plated

  4. Characterization of astrocytic and neuronal benzodiazepine receptors

    Energy Technology Data Exchange (ETDEWEB)

    Bender, A.S.

    1988-01-01

    Primary cultures of astrocytes and neurons express benzodiazepine receptors. Neuronal benzodiazepine receptors were of high-affinity, K{sub D} values were 7.5-43 nM and the densities of receptors (B{sub max}) were 924-4131 fmol/mg protein. Astrocytes posses a high-affinity benzodiazepine receptor, K{sub D} values were 6.6-13 nM. The B{sub max} values were 6,033-12,000 fmol/mg protein. The pharmacological profile of the neuronal benzodiazepine receptor was that of the central-type benzodiazepine receptor, where clonazepam has a high-affinity and Ro 5-4864 (4{prime}-chlorodiazepam) has a low-affinity. Whereas astrocytic benzoidazepine receptor was characteristic of the so called peripheral-type benzodiazepine receptors, which shows a high-affinity towards Ro 5-4863, and a low-affinity towards clonazepam. The astrocytic benzodiazepine receptors was functionally correlated with voltage dependent calcium channels, since dihydropyridines and benzodiazepines interacted with ({sup 3}H) diazepam and ({sup 3}H) nitrendipine receptors with the same rank order of potency, showing a statistically significant correlation. No such correlation was observed in neurons.

  5. Taurine Biosynthesis by Neurons and Astrocytes*

    Science.gov (United States)

    Vitvitsky, Victor; Garg, Sanjay K.; Banerjee, Ruma

    2011-01-01

    The physiological roles of taurine, a product of cysteine degradation and one of the most abundant amino acids in the body, remain elusive. Taurine deficiency leads to heart dysfunction, brain development abnormalities, retinal degradation, and other pathologies. The taurine synthetic pathway is proposed to be incomplete in astrocytes and neurons, and metabolic cooperation between these cell types is reportedly needed to complete the pathway. In this study, we analyzed taurine synthesis capability as reported by incorporation of radioactivity from [35S]cysteine into taurine, in primary murine astrocytes and neurons, and in several transformed cell lines (human (SH-SY5Y) and murine (N1E-115) neuroblastoma, human astrocytoma (U-87MG and 1321 N1), and rat glioma (C6)). Extensive incorporation of radioactivity from [35S]cysteine into taurine was observed in rat glioma cells as well as in primary mouse astrocytes and neurons, establishing the presence of an intact taurine synthesis pathway in these cells. Interestingly, exposure of cells to cysteine or cysteamine resulted in elevated intracellular hypotaurine without a corresponding increase in taurine levels, suggesting that oxidation of hypotaurine limits taurine synthesis in cells. Consistent with its role as an organic osmolyte, taurine synthesis was stimulated under hypertonic conditions in neurons. PMID:21778230

  6. Astrocytic actions on extrasynaptic neuronal currents

    Directory of Open Access Journals (Sweden)

    Balazs ePal

    2015-12-01

    Full Text Available In the last few decades, knowledge about astrocytic functions has significantly increased. It was demonstrated that astrocytes are not passive elements of the central nervous system, but active partners of neurons. There is a growing body of knowledge about the calcium excitability of astrocytes, the actions of different gliotransmitters and their release mechanisms, as well as the participation of astrocytes in the regulation of synaptic functions and their contribution to synaptic plasticity. However, astrocytic functions are even more complex than being a partner of the 'tripartite synapse', as they can influence extrasynaptic neuronal currents either by releasing substances or regulating ambient neurotransmitter levels. Several types of currents or changes of membrane potential with different kinetics and via different mechanisms can be elicited by astrocytic activity. Astrocyte-dependent phasic or tonic, inward or outward currents were described in several brain areas. Such currents, together with the synaptic actions of astrocytes, can contribute to neuromodulatory mechanisms, neurosensory and –secretory processes, cortical oscillatory activity, memory and learning or overall neuronal excitability. This mini-review is an attempt to give a brief summary of astrocyte-dependent extrasynaptic neuronal currents and their possible functional significance.

  7. Coupling Perception with Actions via Mirror Neurons

    Czech Academy of Sciences Publication Activity Database

    Wiedermann, Jiří

    č. 55 (2003), s. 11-12 ISSN 0926-4981 R&D Projects: GA ČR GA201/02/1456 Institutional research plan: AV0Z1030915 Keywords : mirror neurons * cognitive agents * neural nets Subject RIV: BA - General Mathematics http://www.ercim.eu/publication/Ercim_News/enw55/wiedermann.html

  8. Daidzein induces neuritogenesis in DRG neuronal cultures

    Directory of Open Access Journals (Sweden)

    Yang Shih-Hung

    2012-08-01

    Full Text Available Absract Background Daidzein, a phytoestrogen found in isoflavone, is known to exert neurotrophic and neuroprotective effects on the nervous system. Using primary rat dorsal root ganglion (DRG neuronal cultures, we have examined the potential neurite outgrowth effect of daidzein. Methods Dissociated dorsal root ganglia (DRG cultures were used to study the signaling mechanism of daidzein-induced neuritogenesis by immunocytochemistry and Western blotting. Results In response to daidzein treatment, DRG neurons showed a significant increase in total neurite length and in tip number per neuron. The neuritogenic effect of daidzein was significantly hampered by specific blockers for Src, protein kinase C delta (PKCδ and mitogen-activated protein kinase/extracellular signal-regulated kinase kinases (MEK/ERK, but not by those for estrogen receptor (ER. Moreover, daidzein induced phosphorylation of Src, PKCδ and ERK. The activation of PKCδ by daidzein was attenuated in the presence of a Src kinase inhibitor, and that of ERK by daidzein was diminished in the presence of either a Src or PKCδ inhibitor. Conclusion Daidzein may stimulate neurite outgrowth of DRG neurons depending on Src kinase, PKCδ and ERK signaling pathway.

  9. Magnocellular Neurons and Posterior Pituitary Function.

    Science.gov (United States)

    Brown, Colin H

    2016-09-15

    The posterior pituitary gland secretes oxytocin and vasopressin (the antidiuretic hormone) into the blood system. Oxytocin is required for normal delivery of the young and for delivery of milk to the young during lactation. Vasopressin increases water reabsorption in the kidney to maintain body fluid balance and causes vasoconstriction to increase blood pressure. Oxytocin and vasopressin secretion occurs from the axon terminals of magnocellular neurons whose cell bodies are principally found in the hypothalamic supraoptic nucleus and paraventricular nucleus. The physiological functions of oxytocin and vasopressin depend on their secretion, which is principally determined by the pattern of action potentials initiated at the cell bodies. Appropriate secretion of oxytocin and vasopressin to meet the challenges of changing physiological conditions relies mainly on integration of afferent information on reproductive, osmotic, and cardiovascular status with local regulation of magnocellular neurons by glia as well as intrinsic regulation by the magnocellular neurons themselves. This review focuses on the control of magnocellular neuron activity with a particular emphasis on their regulation by reproductive function, body fluid balance, and cardiovascular status. © 2016 American Physiological Society. Compr Physiol 6:1701-1741, 2016. Copyright © 2016 John Wiley & Sons, Inc.

  10. C1 neurons: the body's EMTs.

    Science.gov (United States)

    Guyenet, Patrice G; Stornetta, Ruth L; Bochorishvili, Genrieta; Depuy, Seth D; Burke, Peter G R; Abbott, Stephen B G

    2013-08-01

    The C1 neurons reside in the rostral and intermediate portions of the ventrolateral medulla (RVLM, IVLM). They use glutamate as a fast transmitter and synthesize catecholamines plus various neuropeptides. These neurons regulate the hypothalamic pituitary axis via direct projections to the paraventricular nucleus and regulate the autonomic nervous system via projections to sympathetic and parasympathetic preganglionic neurons. The presympathetic C1 cells, located in the RVLM, are probably organized in a roughly viscerotopic manner and most of them regulate the circulation. C1 cells are variously activated by hypoglycemia, infection or inflammation, hypoxia, nociception, and hypotension and contribute to most glucoprivic responses. C1 cells also stimulate breathing and activate brain stem noradrenergic neurons including the locus coeruleus. Based on the various effects attributed to the C1 cells, their axonal projections and what is currently known of their synaptic inputs, subsets of C1 cells appear to be differentially recruited by pain, hypoxia, infection/inflammation, hemorrhage, and hypoglycemia to produce a repertoire of stereotyped autonomic, metabolic, and neuroendocrine responses that help the organism survive physical injury and its associated cohort of acute infection, hypoxia, hypotension, and blood loss. C1 cells may also contribute to glucose and cardiovascular homeostasis in the absence of such physical stresses, and C1 cell hyperactivity may contribute to the increase in sympathetic nerve activity associated with diseases such as hypertension.

  11. Asynchronous Rate Chaos in Spiking Neuronal Circuits

    Science.gov (United States)

    Harish, Omri; Hansel, David

    2015-01-01

    The brain exhibits temporally complex patterns of activity with features similar to those of chaotic systems. Theoretical studies over the last twenty years have described various computational advantages for such regimes in neuronal systems. Nevertheless, it still remains unclear whether chaos requires specific cellular properties or network architectures, or whether it is a generic property of neuronal circuits. We investigate the dynamics of networks of excitatory-inhibitory (EI) spiking neurons with random sparse connectivity operating in the regime of balance of excitation and inhibition. Combining Dynamical Mean-Field Theory with numerical simulations, we show that chaotic, asynchronous firing rate fluctuations emerge generically for sufficiently strong synapses. Two different mechanisms can lead to these chaotic fluctuations. One mechanism relies on slow I-I inhibition which gives rise to slow subthreshold voltage and rate fluctuations. The decorrelation time of these fluctuations is proportional to the time constant of the inhibition. The second mechanism relies on the recurrent E-I-E feedback loop. It requires slow excitation but the inhibition can be fast. In the corresponding dynamical regime all neurons exhibit rate fluctuations on the time scale of the excitation. Another feature of this regime is that the population-averaged firing rate is substantially smaller in the excitatory population than in the inhibitory population. This is not necessarily the case in the I-I mechanism. Finally, we discuss the neurophysiological and computational significance of our results. PMID:26230679

  12. The mirror neuron system : New frontiers

    NARCIS (Netherlands)

    Keysers, Christian; Fadiga, Luciano

    2008-01-01

    Since the discovery of mirror neurons, much effort has been invested into Studying their location and properties in the human brain. Here we review these original findings and introduce the Main topics of this special issue of Social Neuroscience. What does the mirror system code? How is the mirror

  13. Unbroken Mirror Neurons in Autism Spectrum Disorders

    Science.gov (United States)

    Fan, Yang-Teng; Decety, Jean; Yang, Chia-Yen; Liu, Ji-Lin; Cheng, Yawei

    2010-01-01

    Background: The "broken mirror" theory of autism, which proposes that a dysfunction of the human mirror neuron system (MNS) is responsible for the core social and cognitive deficits in individuals with autism spectrum disorders (ASD), has received considerable attention despite weak empirical evidence. Methods: In this electroencephalographic…

  14. Geometrical Determinants of Neuronal Actin Waves.

    Science.gov (United States)

    Tomba, Caterina; Braïni, Céline; Bugnicourt, Ghislain; Cohen, Floriane; Friedrich, Benjamin M; Gov, Nir S; Villard, Catherine

    2017-01-01

    Hippocampal neurons produce in their early stages of growth propagative, actin-rich dynamical structures called actin waves. The directional motion of actin waves from the soma to the tip of neuronal extensions has been associated with net forward growth, and ultimately with the specification of neurites into axon and dendrites. Here, geometrical cues are used to control actin wave dynamics by constraining neurons on adhesive stripes of various widths. A key observable, the average time between the production of consecutive actin waves, or mean inter-wave interval (IWI), was identified. It scales with the neurite width, and more precisely with the width of the proximal segment close to the soma. In addition, the IWI is independent of the total number of neurites. These two results suggest a mechanistic model of actin wave production, by which the material conveyed by actin waves is assembled in the soma until it reaches the threshold leading to the initiation and propagation of a new actin wave. Based on these observations, we formulate a predictive theoretical description of actin wave-driven neuronal growth and polarization, which consistently accounts for different sets of experiments.

  15. C1 neurons: the body's EMTs

    Science.gov (United States)

    Stornetta, Ruth L.; Bochorishvili, Genrieta; DePuy, Seth D.; Burke, Peter G. R.; Abbott, Stephen B. G.

    2013-01-01

    The C1 neurons reside in the rostral and intermediate portions of the ventrolateral medulla (RVLM, IVLM). They use glutamate as a fast transmitter and synthesize catecholamines plus various neuropeptides. These neurons regulate the hypothalamic pituitary axis via direct projections to the paraventricular nucleus and regulate the autonomic nervous system via projections to sympathetic and parasympathetic preganglionic neurons. The presympathetic C1 cells, located in the RVLM, are probably organized in a roughly viscerotopic manner and most of them regulate the circulation. C1 cells are variously activated by hypoglycemia, infection or inflammation, hypoxia, nociception, and hypotension and contribute to most glucoprivic responses. C1 cells also stimulate breathing and activate brain stem noradrenergic neurons including the locus coeruleus. Based on the various effects attributed to the C1 cells, their axonal projections and what is currently known of their synaptic inputs, subsets of C1 cells appear to be differentially recruited by pain, hypoxia, infection/inflammation, hemorrhage, and hypoglycemia to produce a repertoire of stereotyped autonomic, metabolic, and neuroendocrine responses that help the organism survive physical injury and its associated cohort of acute infection, hypoxia, hypotension, and blood loss. C1 cells may also contribute to glucose and cardiovascular homeostasis in the absence of such physical stresses, and C1 cell hyperactivity may contribute to the increase in sympathetic nerve activity associated with diseases such as hypertension. PMID:23697799

  16. Efficient information transfer by Poisson neurons

    Czech Academy of Sciences Publication Activity Database

    Košťál, Lubomír; Shinomoto, S.

    2016-01-01

    Roč. 13, č. 3 (2016), s. 509-520 ISSN 1547-1063 R&D Projects: GA ČR(CZ) GA15-08066S Institutional support: RVO:67985823 Keywords : information capacity * Poisson neuron * metabolic cost * decoding error Subject RIV: BD - Theory of Information Impact factor: 1.035, year: 2016

  17. Achalasia: virus-induced euthanasia of neurons?

    NARCIS (Netherlands)

    Boeckxstaens, Guy E.

    2008-01-01

    Achalasia, a motor disorder of the esophagus, is characterized by myenteric plexitis leading to neuronal loss. Cytotoxic T cells, isolated from the lower esophageal sphincter of achalasia patients, respond to human herpes virus-1 (HSV-1) with gamma-IFN (and to a lesser extent IL-2) production and

  18. PYRETHROID MODULATION OF SPONTANEOUS NEURONAL EXCITABILITY AND NEUROTRANSMISSION IN HIPPOCAMPAL NEURONS IN CULTURE

    Science.gov (United States)

    Pyrethroid insecticides have potent actions on voltage-gated sodium channels, inhibiting inactivation and increasing channel open times. These are thought to underlie, at least in part, the clinical symptoms of pyrethroid intoxication. However, disruption of neuronal activity at ...

  19. Additivity of Pyrethroid Actions on Sodium Influx in Cortical Neurons in Cerebrocortical Neurons in Primary Culture

    Science.gov (United States)

    BACKGROUND: Pyrethroid insecticides bind to voltage-gated sodium channels and modify their gating kinetics, thereby disrupting neuronal function. Although previous work has tested the additivity of pyrethroids in vivo, this has not been assessed directly at the primary molecular ...

  20. Population coding in sparsely connected networks of noisy neurons

    OpenAIRE

    Tripp, Bryan P.; Orchard, Jeff

    2012-01-01

    This study examines the relationship between population coding and spatial connection statistics in networks of noisy neurons. Encoding of sensory information in the neocortex is thought to require coordinated neural populations, because individual cortical neurons respond to a wide range of stimuli, and exhibit highly variable spiking in response to repeated stimuli. Population coding is rooted in network structure, because cortical neurons receive information only from other neurons, and be...

  1. Gene Expression and the Diversity of Identified Neurons

    OpenAIRE

    Buck, L.; Stein, R.; Palazzolo, M.; Anderson, D. J.; Axel, R.

    1983-01-01

    Nervous systems consist of diverse populations of neurons that are anatomically and functionally distinct. The diversity of neurons and the precision with which they are interconnected suggest that specific genes or sets of genes are activated in some neurons but not expressed in others. Experimentally, this problem may be considered at two levels. First, what is the total number of genes expressed in the brain, and how are they distributed among the different populations of neurons? Second, ...

  2. Rapid shift in substrate utilization driven by hypothalamic Agrp neurons

    OpenAIRE

    Cavalcanti-De-Albuquerque, Joao; Dietrich, Marcelo; Bober, Jeremy; Zimmer, Marcelo

    2016-01-01

    Agrp neurons drive feeding. To what extend these neurons participate in the regulation of other homeostatic processes is not well understood. We investigated the role of Agrp neurons in substrate utilization in mice. Activation of Agrp neurons was sufficient to rapidly increase RER and carbohydrate utilization, while decreasing fat utilization. These metabolic changes were linearly correlated with carbohydrates ingested, but not protein or fat ingestion. However, even in the absence of ingest...

  3. Mirror neurons: Enigma of the metaphysical modular brain

    OpenAIRE

    Acharya, Sourya; Shukla, Samarth

    2012-01-01

    Mirror neurons are one of the most important discoveries in the last decade of neuroscience. These are a variety of visuospatial neurons which indicate fundamentally about human social interaction. Essentially, mirror neurons respond to actions that we observe in others. The interesting part is that mirror neurons fire in the same way when we actually recreate that action ourselves. Apart from imitation, they are responsible for myriad of other sophisticated human behavior and thought process...

  4. Mirror Neurons, Embodied Cognitive Agents and Imitation Learning

    OpenAIRE

    Wiedermann, Jiří

    2003-01-01

    Mirror neurons are a relatively recent discovery; it has been conjectured that these neurons play an important role in imitation learning and other cognitive phenomena. We will study a possible place and role of mirror neurons in the neural architecture of embodied cognitive agents. We will formulate and investigate the hypothesis that mirror neurons serve as a mechanism which coordinates the multimodal (i.e., motor, perceptional and proprioceptive) information and completes it so that the ag...

  5. Effect of different glucose supply conditions on neuronal energy metabolism

    OpenAIRE

    Zheng, Hongwen; Wang, Rubin; Qu, Jingyi

    2016-01-01

    The glucose-excited neurons in brain can sense blood glucose levels and reflect different firing states, which are mainly associated with regulation of blood glucose and energy demand in the brain. In this paper, a new model of glucose-excited neuron in hypothalamus is proposed. The firing properties and energy consumption of this type of neuron under conditions of different glucose levels are simulated and analyzed. The results show that the firing rate and firing duration of the neuron both...

  6. ALS and other motor neuron diseases.

    Science.gov (United States)

    Tiryaki, Ezgi; Horak, Holli A

    2014-10-01

    This review describes the most common motor neuron disease, ALS. It discusses the diagnosis and evaluation of ALS and the current understanding of its pathophysiology, including new genetic underpinnings of the disease. This article also covers other motor neuron diseases, reviews how to distinguish them from ALS, and discusses their pathophysiology. In this article, the spectrum of cognitive involvement in ALS, new concepts about protein synthesis pathology in the etiology of ALS, and new genetic associations will be covered. This concept has changed over the past 3 to 4 years with the discovery of new genes and genetic processes that may trigger the disease. As of 2014, two-thirds of familial ALS and 10% of sporadic ALS can be explained by genetics. TAR DNA binding protein 43 kDa (TDP-43), for instance, has been shown to cause frontotemporal dementia as well as some cases of familial ALS, and is associated with frontotemporal dysfunction in ALS. The anterior horn cells control all voluntary movement: motor activity, respiratory, speech, and swallowing functions are dependent upon signals from the anterior horn cells. Diseases that damage the anterior horn cells, therefore, have a profound impact. Symptoms of anterior horn cell loss (weakness, falling, choking) lead patients to seek medical attention. Neurologists are the most likely practitioners to recognize and diagnose damage or loss of anterior horn cells. ALS, the prototypical motor neuron disease, demonstrates the impact of this class of disorders. ALS and other motor neuron diseases can represent diagnostic challenges. Neurologists are often called upon to serve as a "medical home" for these patients: coordinating care, arranging for durable medical equipment, and leading discussions about end-of-life care with patients and caregivers. It is important for neurologists to be able to identify motor neuron diseases and to evaluate and treat patients affected by them.

  7. Discrimination of Communication Vocalizations by Single Neurons and Groups of Neurons in the Auditory Midbrain

    OpenAIRE

    Schneider, David M.; Woolley, Sarah M. N.

    2010-01-01

    Many social animals including songbirds use communication vocalizations for individual recognition. The perception of vocalizations depends on the encoding of complex sounds by neurons in the ascending auditory system, each of which is tuned to a particular subset of acoustic features. Here, we examined how well the responses of single auditory neurons could be used to discriminate among bird songs and we compared discriminability to spectrotemporal tuning. We then used biologically realistic...

  8. GABAergic inhibition through synergistic astrocytic neuronal interaction transiently decreases vasopressin neuronal activity during hypoosmotic challenge.

    Science.gov (United States)

    Wang, Yu-Feng; Sun, Min-Yu; Hou, Qiuling; Hamilton, Kathryn A

    2013-04-01

    The neuropeptide vasopressin is crucial to mammalian osmotic regulation. Local hypoosmotic challenge transiently decreases and then increases vasopressin secretion. To investigate mechanisms underlying this transient response, we examined the effects of hypoosmotic challenge on the electrical activity of rat hypothalamic supraoptic nucleus (SON) vasopressin neurons using patch-clamp recordings. We found that 5 min exposure of hypothalamic slices to hypoosmotic solution transiently increased inhibitory postsynaptic current (IPSC) frequency and reduced the firing rate of vasopressin neurons. Recovery occurred by 10 min of exposure, even though the osmolality remained low. The γ-aminobutyric acid (GABA)A receptor blocker, gabazine, blocked the IPSCs and the hypoosmotic suppression of firing. The gliotoxin l-aminoadipic acid blocked the increase in IPSC frequency at 5 min and the recovery of firing at 10 min, indicating astrocytic involvement in hypoosmotic modulation of vasopressin neuronal activity. Moreover, β-alanine, an osmolyte of astrocytes and GABA transporter (GAT) inhibitor, blocked the increase in IPSC frequency at 5 min of hypoosmotic challenge. Confocal microscopy of immunostained SON sections revealed that astrocytes and magnocellular neurons both showed positive staining of vesicular GATs (VGAT). Hypoosmotic stimulation in vivo reduced the number of VGAT-expressing neurons, and increased co-localisation and molecular association of VGAT with glial fibrillary acidic protein that increased significantly by 10 min. By 30 min, neuronal VGAT labelling was partially restored, and astrocytic VGAT was relocated to the ventral portion while it decreased in the somatic zone of the SON. Thus, synergistic astrocytic and neuronal GABAergic inhibition could ensure that vasopressin neuron firing is only transiently suppressed under hypoosmotic conditions. © 2013 Federation of European Neuroscience Societies and Blackwell Publishing Ltd.

  9. Developmental time windows for axon growth influence neuronal network topology.

    Science.gov (United States)

    Lim, Sol; Kaiser, Marcus

    2015-04-01

    Early brain connectivity development consists of multiple stages: birth of neurons, their migration and the subsequent growth of axons and dendrites. Each stage occurs within a certain period of time depending on types of neurons and cortical layers. Forming synapses between neurons either by growing axons starting at similar times for all neurons (much-overlapped time windows) or at different time points (less-overlapped) may affect the topological and spatial properties of neuronal networks. Here, we explore the extreme cases of axon formation during early development, either starting at the same time for all neurons (parallel, i.e., maximally overlapped time windows) or occurring for each neuron separately one neuron after another (serial, i.e., no overlaps in time windows). For both cases, the number of potential and established synapses remained comparable. Topological and spatial properties, however, differed: Neurons that started axon growth early on in serial growth achieved higher out-degrees, higher local efficiency and longer axon lengths while neurons demonstrated more homogeneous connectivity patterns for parallel growth. Second, connection probability decreased more rapidly with distance between neurons for parallel growth than for serial growth. Third, bidirectional connections were more numerous for parallel growth. Finally, we tested our predictions with C. elegans data. Together, this indicates that time windows for axon growth influence the topological and spatial properties of neuronal networks opening up the possibility to a posteriori estimate developmental mechanisms based on network properties of a developed network.

  10. First-spike latency in Hodgkin's three classes of neurons.

    Science.gov (United States)

    Wang, Hengtong; Chen, Yueling; Chen, Yong

    2013-07-07

    We study the first-spike latency (FSL) in Hodgkin's three classes of neurons with the Morris-Lecar neuron model. It is found that all the three classes of neurons can encode an external stimulus into FSLs. With DC inputs, the FSLs of all of the neurons decrease with input intensity. With input current decreased to the threshold, class 1 neurons show an arbitrary long FSL whereas class 2 and 3 neurons exhibit the short-limit FSLs. When the input current is sinusoidal, the amplitude, frequency and initial phase can be encoded by all the three classes of neurons. The FSLs of all of the neurons decrease with the input amplitude and frequency. When the input frequency is too high, all of the neurons respond with infinite FSLs. When the initial phase increases, the FSL decreases and then jumps to a maximal value and finally decreases linearly. With changes in the input parameters, the FSLs of the class 1 and 2 neurons exhibit similar properties. However, the FSL of the class 3 neurons became slightly longer and only produces responses for a narrow range of initial phase if input frequencies are low. Moreover, our results also show that the FSL and firing rate responses are mutually independent processes and that neurons can encode an external stimulus into different FSLs and firing rates simultaneously. This finding is consistent with the current theory of dual or multiple complementary coding mechanisms. Copyright © 2013 Elsevier Ltd. All rights reserved.

  11. Multiple Modes of Communication between Neurons and Oligodendrocyte Precursor Cells

    NARCIS (Netherlands)

    Maldonado, Paloma P; Angulo, María Cecilia

    The surprising discovery of bona fide synapses between neurons and oligodendrocytes precursor cells (OPCs) 15 years ago placed these progenitors as real partners of neurons in the CNS. The role of these synapses has not been established yet, but a main hypothesis is that neuron-OPC synaptic activity

  12. THE MITOCHONDRIAL DERANGEMENTS IN NEURONAL DEGENER ATION AND NEURODEGENERATIVE DISEASES

    Institute of Scientific and Technical Information of China (English)

    Xue, Qi-ming; Gao, Feng; Chen, Qin-tang

    2000-01-01

    @@There are diverse concepts on the pathogenesis of neuronal degeneration and the neurodegenerative diseases. Among them there are different factors which might influence the initiation of neuronal degeneration as well as the pathogenesis of neurodegenerative diseases, such as Alzheimer′s disease, Parkinson′s disease, motor neuron disease, and so on.

  13. What is happening to motor neuron disease in Nigeria? | Imam ...

    African Journals Online (AJOL)

    Background: Systematic studies of motor neuron disease were last reported from Ibadan, Nigeria, more than two decades ago. Since then, information about motor neuron disease has become limited making it necessary to review the current status of the disease. Methods: The clinical records of all cases of motor neuron ...

  14. Social interaction in robotic agents emulating the mirror neuron function

    NARCIS (Netherlands)

    Barakova, E.I.; Mira, J.; Álvarez, J.R.

    2007-01-01

    Emergent interactions that are expressed by the movements of two agents are discussed in this paper. The common coding principle is used to show how the mirror neuron system may facilitate interaction behaviour. Synchronization between neuron groups in different structures of the mirror neuron

  15. Dcc regulates asymmetric outgrowth of forebrain neurons in zebrafish.

    Directory of Open Access Journals (Sweden)

    Jingxia Gao

    Full Text Available The guidance receptor DCC (deleted in colorectal cancer ortholog UNC-40 regulates neuronal asymmetry development in Caenorhabditis elegans, but it is not known whether DCC plays a role in the specification of neuronal polarity in vertebrates. To examine the roles of DCC in neuronal asymmetry regulation in vertebrates, we studied zebrafish anterior dorsal telencephalon (ADt neuronal axons. We generated transgenic zebrafish animals expressing the photo-convertible fluorescent protein Kaede in ADt neurons and then photo-converted Kaede to label specifically the ADt neuron axons. We found that ADt axons normally project ventrally. Knock down of Dcc function by injecting antisense morpholino oligonucleotides caused the ADt neurons to project axons dorsally. To examine the axon projection pattern of individual ADt neurons, we labeled single ADt neurons using a forebrain-specific promoter to drive fluorescent protein expression. We found that individual ADt neurons projected axons dorsally or formed multiple processes after morpholino knock down of Dcc function. We further found that knock down of the Dcc ligand, Netrin1, also caused ADt neurons to project axons dorsally. Knockdown of Neogenin1, a guidance receptor closely related to Dcc, enhanced the formation of aberrant dorsal axons in embryos injected with Dcc morpholino. These experiments provide the first evidence that Dcc regulates polarized axon initiation and asymmetric outgrowth of forebrain neurons in vertebrates.

  16. The origin and function of mirror neurons: the missing link.

    Science.gov (United States)

    Lingnau, Angelika; Caramazza, Alfonso

    2014-04-01

    We argue, by analogy to the neural organization of the object recognition system, that demonstration of modulation of mirror neurons by associative learning does not imply absence of genetic adaptation. Innate connectivity defines the types of processes mirror neurons can participate in while allowing for extensive local plasticity. However, the proper function of these neurons remains to be worked out.

  17. The role of mirror neurons in language acquisition and evolution.

    Science.gov (United States)

    Behme, Christina

    2014-04-01

    I argue that Cook et al.'s attack of the genetic hypothesis of mirror neurons misses its target because the authors miss the point that genetics may specify how neurons may learn, not what they learn. Paying more attention to recent work linking mirror neurons to language acquisition and evolution would strengthen Cook et al.'s arguments against a rigid genetic hypothesis.

  18. Reliable activation of immature neurons in the adult hippocampus.

    Directory of Open Access Journals (Sweden)

    Lucas A Mongiat

    Full Text Available Neurons born in the adult dentate gyrus develop, mature, and connect over a long interval that can last from six to eight weeks. It has been proposed that, during this period, developing neurons play a relevant role in hippocampal signal processing owing to their distinctive electrical properties. However, it has remained unknown whether immature neurons can be recruited into a network before synaptic and functional maturity have been achieved. To address this question, we used retroviral expression of green fluorescent protein to identify developing granule cells of the adult mouse hippocampus and investigate the balance of afferent excitation, intrinsic excitability, and firing behavior by patch clamp recordings in acute slices. We found that glutamatergic inputs onto young neurons are significantly weaker than those of mature cells, yet stimulation of cortical excitatory axons elicits a similar spiking probability in neurons at either developmental stage. Young neurons are highly efficient in transducing ionic currents into membrane depolarization due to their high input resistance, which decreases substantially in mature neurons as the inward rectifier potassium (Kir conductance increases. Pharmacological blockade of Kir channels in mature neurons mimics the high excitability characteristic of young neurons. Conversely, Kir overexpression induces mature-like firing properties in young neurons. Therefore, the differences in excitatory drive of young and mature neurons are compensated by changes in membrane excitability that render an equalized firing activity. These observations demonstrate that the adult hippocampus continuously generates a population of highly excitable young neurons capable of information processing.

  19. Disruption of astrocyte-neuron cholesterol cross talk affects neuronal function in Huntington's disease.

    Science.gov (United States)

    Valenza, M; Marullo, M; Di Paolo, E; Cesana, E; Zuccato, C; Biella, G; Cattaneo, E

    2015-04-01

    In the adult brain, neurons require local cholesterol production, which is supplied by astrocytes through apoE-containing lipoproteins. In Huntington's disease (HD), such cholesterol biosynthesis in the brain is severely reduced. Here we show that this defect, occurring in astrocytes, is detrimental for HD neurons. Astrocytes bearing the huntingtin protein containing increasing CAG repeats secreted less apoE-lipoprotein-bound cholesterol in the medium. Conditioned media from HD astrocytes and lipoprotein-depleted conditioned media from wild-type (wt) astrocytes were equally detrimental in a neurite outgrowth assay and did not support synaptic activity in HD neurons, compared with conditions of cholesterol supplementation or conditioned media from wt astrocytes. Molecular perturbation of cholesterol biosynthesis and efflux in astrocytes caused similarly altered astrocyte-neuron cross talk, whereas enhancement of glial SREBP2 and ABCA1 function reversed the aspects of neuronal dysfunction in HD. These findings indicate that astrocyte-mediated cholesterol homeostasis could be a potential therapeutic target to ameliorate neuronal dysfunction in HD.

  20. Metabolic reprogramming during neuronal differentiation from aerobic glycolysis to neuronal oxidative phosphorylation.

    Science.gov (United States)

    Zheng, Xinde; Boyer, Leah; Jin, Mingji; Mertens, Jerome; Kim, Yongsung; Ma, Li; Ma, Li; Hamm, Michael; Gage, Fred H; Hunter, Tony

    2016-06-10

    How metabolism is reprogrammed during neuronal differentiation is unknown. We found that the loss of hexokinase (HK2) and lactate dehydrogenase (LDHA) expression, together with a switch in pyruvate kinase gene splicing from PKM2 to PKM1, marks the transition from aerobic glycolysis in neural progenitor cells (NPC) to neuronal oxidative phosphorylation. The protein levels of c-MYC and N-MYC, transcriptional activators of the HK2 and LDHA genes, decrease dramatically. Constitutive expression of HK2 and LDHA during differentiation leads to neuronal cell death, indicating that the shut-off aerobic glycolysis is essential for neuronal survival. The metabolic regulators PGC-1α and ERRγ increase significantly upon neuronal differentiation to sustain the transcription of metabolic and mitochondrial genes, whose levels are unchanged compared to NPCs, revealing distinct transcriptional regulation of metabolic genes in the proliferation and post-mitotic differentiation states. Mitochondrial mass increases proportionally with neuronal mass growth, indicating an unknown mechanism linking mitochondrial biogenesis to cell size.

  1. Beyond Neuronal Activity Markers: Select Immediate Early Genes in Striatal Neuron Subtypes Functionally Mediate Psychostimulant Addiction

    Directory of Open Access Journals (Sweden)

    Ramesh Chandra

    2017-06-01

    Full Text Available Immediate early genes (IEGs were traditionally used as markers of neuronal activity in striatum in response to stimuli including drugs of abuse such as psychostimulants. Early studies using these neuronal activity markers led to important insights in striatal neuron subtype responsiveness to psychostimulants. Such studies have helped identify striatum as a critical brain center for motivational, reinforcement and habitual behaviors in psychostimulant addiction. While the use of IEGs as neuronal activity markers in response to psychostimulants and other stimuli persists today, the functional role and implications of these IEGs has often been neglected. Nonetheless, there is a subset of research that investigates the functional role of IEGs in molecular, cellular and behavioral alterations by psychostimulants through striatal medium spiny neuron (MSN subtypes, the two projection neuron subtypes in striatum. This review article will address and highlight the studies that provide a functional mechanism by which IEGs mediate psychostimulant molecular, cellular and behavioral plasticity through MSN subtypes. Insight into the functional role of IEGs in striatal MSN subtypes could provide improved understanding into addiction and neuropsychiatric diseases affecting striatum, such as affective disorders and compulsive disorders characterized by dysfunctional motivation and habitual behavior.

  2. Neurochemistry of neurons in the ventrolateral medulla activated by hypotension: Are the same neurons activated by glucoprivation?

    Science.gov (United States)

    Parker, Lindsay M; Le, Sheng; Wearne, Travis A; Hardwick, Kate; Kumar, Natasha N; Robinson, Katherine J; McMullan, Simon; Goodchild, Ann K

    2017-06-15

    Previous studies have demonstrated that a range of stimuli activate neurons, including catecholaminergic neurons, in the ventrolateral medulla. Not all catecholaminergic neurons are activated and other neurochemical content is largely unknown hence whether stimulus specific populations exist is unclear. Here we determine the neurochemistry (using in situ hybridization) of catecholaminergic and noncatecholaminergic neurons which express c-Fos immunoreactivity throughout the rostrocaudal extent of the ventrolateral medulla, in Sprague Dawley rats treated with hydralazine or saline. Distinct neuronal populations containing PPCART, PPPACAP, and PPNPY mRNAs, which were largely catecholaminergic, were activated by hydralazine but not saline. Both catecholaminergic and noncatecholaminergic neurons containing preprotachykinin and prepro-enkephalin (PPE) mRNAs were also activated, with the noncatecholaminergic population located in the rostral C1 region. Few GlyT2 neurons were activated. A subset of these data was then used to compare the neuronal populations activated by 2-deoxyglucose evoked glucoprivation (Brain Structure and Function (2015) 220:117). Hydralazine activated more neurons than 2-deoxyglucose but similar numbers of catecholaminergic neurons. Commonly activated populations expressing PPNPY and PPE mRNAs were defined. These likely include PPNPY expressing catecholaminergic neurons projecting to vasopressinergic and corticotrophin releasing factor neurons in the paraventricular nucleus, which when activated result in elevated plasma vasopressin and corticosterone. Stimulus specific neurons included noncatecholaminergic neurons and a few PPE positive catecholaminergic neuron but neurochemical codes were largely unidentified. Reasons for the lack of identification of stimulus specific neurons, readily detectable using electrophysiology in anaesthetized preparations and for which neural circuits can be defined, are discussed. © 2017 Wiley Periodicals, Inc.

  3. Scaling of Brain Metabolism with a Fixed Energy Budget per Neuron: Implications for Neuronal Activity, Plasticity and Evolution

    OpenAIRE

    Herculano-Houzel, Suzana

    2011-01-01

    It is usually considered that larger brains have larger neurons, which consume more energy individually, and are therefore accompanied by a larger number of glial cells per neuron. These notions, however, have never been tested. Based on glucose and oxygen metabolic rates in awake animals and their recently determined numbers of neurons, here I show that, contrary to the expected, the estimated glucose use per neuron is remarkably constant, varying only by 40% across the six species of rodent...

  4. Neuronal degeneration in autonomic nervous system of Dystonia musculorum mice

    Directory of Open Access Journals (Sweden)

    Liu Kang-Jen

    2011-01-01

    Full Text Available Abstract Background Dystonia musculorum (dt is an autosomal recessive hereditary neuropathy with a characteristic uncoordinated movement and is caused by a defect in the bullous pemphigoid antigen 1 (BPAG1 gene. The neural isoform of BPAG1 is expressed in various neurons, including those in the central and peripheral nerve systems of mice. However, most previous studies on neuronal degeneration in BPAG1-deficient mice focused on peripheral sensory neurons and only limited investigation of the autonomic system has been conducted. Methods In this study, patterns of nerve innervation in cutaneous and iridial tissues were examined using general neuronal marker protein gene product 9.5 via immunohistochemistry. To perform quantitative analysis of the autonomic neuronal number, neurons within the lumbar sympathetic and parasympathetic ciliary ganglia were calculated. In addition, autonomic neurons were cultured from embryonic dt/dt mutants to elucidate degenerative patterns in vitro. Distribution patterns of neuronal intermediate filaments in cultured autonomic neurons were thoroughly studied under immunocytochemistry and conventional electron microscopy. Results Our immunohistochemistry results indicate that peripheral sensory nerves and autonomic innervation of sweat glands and irises dominated degeneration in dt/dt mice. Quantitative results confirmed that the number of neurons was significantly decreased in the lumbar sympathetic ganglia as well as in the parasympathetic ciliary ganglia of dt/dt mice compared with those of wild-type mice. We also observed that the neuronal intermediate filaments were aggregated abnormally in cultured autonomic neurons from dt/dt embryos. Conclusions These results suggest that a deficiency in the cytoskeletal linker BPAG1 is responsible for dominant sensory nerve degeneration and severe autonomic degeneration in dt/dt mice. Additionally, abnormally aggregated neuronal intermediate filaments may participate in

  5. Response sensitivity of barrel neuron subpopulations to simulated thalamic input.

    Science.gov (United States)

    Pesavento, Michael J; Rittenhouse, Cynthia D; Pinto, David J

    2010-06-01

    Our goal is to examine the relationship between neuron- and network-level processing in the context of a well-studied cortical function, the processing of thalamic input by whisker-barrel circuits in rodent neocortex. Here we focus on neuron-level processing and investigate the responses of excitatory and inhibitory barrel neurons to simulated thalamic inputs applied using the dynamic clamp method in brain slices. Simulated inputs are modeled after real thalamic inputs recorded in vivo in response to brief whisker deflections. Our results suggest that inhibitory neurons require more input to reach firing threshold, but then fire earlier, with less variability, and respond to a broader range of inputs than do excitatory neurons. Differences in the responses of barrel neuron subtypes depend on their intrinsic membrane properties. Neurons with a low input resistance require more input to reach threshold but then fire earlier than neurons with a higher input resistance, regardless of the neuron's classification. Our results also suggest that the response properties of excitatory versus inhibitory barrel neurons are consistent with the response sensitivities of the ensemble barrel network. The short response latency of inhibitory neurons may serve to suppress ensemble barrel responses to asynchronous thalamic input. Correspondingly, whereas neurons acting as part of the barrel circuit in vivo are highly selective for temporally correlated thalamic input, excitatory barrel neurons acting alone in vitro are less so. These data suggest that network-level processing of thalamic input in barrel cortex depends on neuron-level processing of the same input by excitatory and inhibitory barrel neurons.

  6. Intrinsic and integrative properties of substantia nigra pars reticulata neurons

    Science.gov (United States)

    Zhou, Fu-Ming; Lee, Christian R.

    2011-01-01

    The GABA projection neurons of the substantia nigra pars reticulata (SNr) are output neurons for the basal ganglia and thus critical for movement control. Their most striking neurophysiological feature is sustained, spontaneous high frequency spike firing. A fundamental question is: what are the key ion channels supporting the remarkable firing capability in these neurons? Recent studies indicate that these neurons express tonically active TRPC3 channels that conduct a Na-dependent inward current even at hyperpolarized membrane potentials. When the membrane potential reaches −60 mV, a voltage-gated persistent sodium current (INaP) starts to activate, further depolarizing the membrane potential. At or slightly below −50 mV, the large transient voltage-activated sodium current (INaT) starts to activate and eventually triggers the rapid rising phase of action potentials. SNr GABA neurons have a higher density of (INaT), contributing to the faster rise and larger amplitude of action potentials, compared with the slow-spiking dopamine neurons. INaT also recovers from inactivation more quickly in SNr GABA neurons than in nigral dopamine neurons. In SNr GABA neurons, the rising phase of the action potential triggers the activation of high-threshold, inactivation-resistant Kv3-like channels that can rapidly repolarize the membrane. These intrinsic ion channels provide SNr GABA neurons with the ability to fire spontaneous and sustained high frequency spikes. Additionally, robust GABA inputs from direct pathway medium spiny neurons in the striatum and GABA neurons in the globus pallidus may inhibit and silence SNr GABA neurons, whereas glutamate synaptic input from the subthalamic nucleus may induce burst firing in SNr GABA neurons. Thus, afferent GABA and glutamate synaptic inputs sculpt the tonic high frequency firing of SNr GABA neurons and the consequent inhibition of their targets into an integrated motor control signal that is further fine-tuned by neuromodulators

  7. Sensory neurons do not induce motor neuron loss in a human stem cell model of spinal muscular atrophy.

    Science.gov (United States)

    Schwab, Andrew J; Ebert, Allison D

    2014-01-01

    Spinal muscular atrophy (SMA) is an autosomal recessive disorder leading to paralysis and early death due to reduced SMN protein. It is unclear why there is such a profound motor neuron loss, but recent evidence from fly and mouse studies indicate that cells comprising the whole sensory-motor circuit may contribute to motor neuron dysfunction and loss. Here, we used induced pluripotent stem cells derived from SMA patients to test whether sensory neurons directly contribute to motor neuron loss. We generated sensory neurons from SMA induced pluripotent stem cells and found no difference in neuron generation or survival, although there was a reduced calcium response to depolarizing stimuli. Using co-culture of SMA induced pluripotent stem cell derived sensory neurons with control induced pluripotent stem cell derived motor neurons, we found no significant reduction in motor neuron number or glutamate transporter boutons on motor neuron cell bodies or neurites. We conclude that SMA sensory neurons do not overtly contribute to motor neuron loss in this human stem cell system.

  8. Progranulin is expressed within motor neurons and promotes neuronal cell survival

    Directory of Open Access Journals (Sweden)

    Kay Denis G

    2009-10-01

    Full Text Available Abstract Background Progranulin is a secreted high molecular weight growth factor bearing seven and one half copies of the cysteine-rich granulin-epithelin motif. While inappropriate over-expression of the progranulin gene has been associated with many cancers, haploinsufficiency leads to atrophy of the frontotemporal lobes and development of a form of dementia (frontotemporal lobar degeneration with ubiquitin positive inclusions, FTLD-U associated with the formation of ubiquitinated inclusions. Recent reports indicate that progranulin has neurotrophic effects, which, if confirmed would make progranulin the only neuroprotective growth factor that has been associated genetically with a neurological disease in humans. Preliminary studies indicated high progranulin gene expression in spinal cord motor neurons. However, it is uncertain what the role of Progranulin is in normal or diseased motor neuron function. We have investigated progranulin gene expression and subcellular localization in cultured mouse embryonic motor neurons and examined the effect of progranulin over-expression and knockdown in the NSC-34 immortalized motor neuron cell line upon proliferation and survival. Results In situ hybridisation and immunohistochemical techniques revealed that the progranulin gene is highly expressed by motor neurons within the mouse spinal cord and in primary cultures of dissociated mouse embryonic spinal cord-dorsal root ganglia. Confocal microscopy coupled to immunocytochemistry together with the use of a progranulin-green fluorescent protein fusion construct revealed progranulin to be located within compartments of the secretory pathway including the Golgi apparatus. Stable transfection of the human progranulin gene into the NSC-34 motor neuron cell line stimulates the appearance of dendritic structures and provides sufficient trophic stimulus to survive serum deprivation for long periods (up to two months. This is mediated at least in part through

  9. Neuronal surface antigen antibodies in limbic encephalitis

    Science.gov (United States)

    Graus, F; Saiz, A; Lai, M; Bruna, J; López, F; Sabater, L; Blanco, Y; Rey, M J.; Ribalta, T; Dalmau, J

    2008-01-01

    Objective: To report the frequency and type of antibodies against neuronal surface antigens (NSA-ab) in limbic encephalitis (LE). Methods: Analysis of clinical features, neuropathologic findings, and detection of NSA-ab using immunochemistry on rat tissue and neuronal cultures in a series of 45 patients with paraneoplastic (23) or idiopathic (22) LE. Results: NSA-ab were identified in 29 patients (64%; 12 paraneoplastic, 17 idiopathic). Thirteen patients had voltage-gated potassium channels (VGKC)-ab, 11 novel NSA (nNSA)-ab, and 5 NMDA receptor (NMDAR)-ab. nNSA-ab did not identify a common antigen and were more frequent in paraneoplastic than idiopathic LE (39% vs 9%; p = 0.03). When compared with VGKC-ab or NMDAR-ab, the nNSA associated more frequently with intraneuronal antibodies (11% vs 73%; p = 0.001). Of 12 patients (9 nNSA-ab, 2 VGKC-ab, 1 NMDAR-ab) with paraneoplastic LE and NSA-ab, concomitant intraneuronal antibodies occurred in 9 (75%). None of these 12 patients improved with immunotherapy. The autopsy of three of them showed neuronal loss, microgliosis, and cytotoxic T cell infiltrates in the hippocampus and amygdala. These findings were compatible with a T-cell mediated neuronal damage. In contrast, 13 of 17 (76%) patients with idiopathic LE and NSA-ab (8 VGKC-ab, 4 NMDAR-ab, 1 nNSA-ab) and 1 of 5 (20%) without antibodies had clinical improvement (p = 0.04). Conclusions: In paraneoplastic limbic encephalitis (LE), novel antibodies against neuronal surface antigens (nNSA-ab) occur frequently, coexist with antibodies against intracellular antigens, and these cases are refractory to immunotherapy. In idiopathic LE, the likelihood of improvement is significantly higher in patients with NSA-ab than in those without antibodies. GLOSSARY GAD = glutamic acid decarboxylase; LE = limbic encephalitis; NMDAR = N-methyl-D-aspartate receptor; NSA = neuronal surface antigens; nNSA = novel NSA; SCLC = small-cell lung cancer; VGKC = voltage-gated potassium channels

  10. Spiking neuron devices consisting of single-flux-quantum circuits

    International Nuclear Information System (INIS)

    Hirose, Tetsuya; Asai, Tetsuya; Amemiya, Yoshihito

    2006-01-01

    Single-flux-quantum (SFQ) circuits can be used for making spiking neuron devices, which are useful elements for constructing intelligent, brain-like computers. The device we propose is based on the leaky integrate-and-fire neuron (IFN) model and uses a SFQ pulse as an action signal or a spike of neurons. The operation of the neuron device is confirmed by computer simulator. It can operate with a short delay of 100 ps or less and is the highest-speed neuron device ever reported

  11. Mirror neuron system: basic findings and clinical applications.

    Science.gov (United States)

    Iacoboni, Marco; Mazziotta, John C

    2007-09-01

    In primates, ventral premotor and rostral inferior parietal neurons fire during the execution of hand and mouth actions. Some cells (called mirror neurons) also fire when hand and mouth actions are just observed. Mirror neurons provide a simple neural mechanism for understanding the actions of others. In humans, posterior inferior frontal and rostral inferior parietal areas have mirror properties. These human areas are relevant to imitative learning and social behavior. Indeed, the socially isolating condition of autism is associated with a deficit in mirror neuron areas. Strategies inspired by mirror neuron research recently have been used in the treatment of autism and in motor rehabilitation after stroke.

  12. A Simple Picaxe Microcontroller Pulse Source for Juxtacellular Neuronal Labelling.

    Science.gov (United States)

    Verberne, Anthony J M

    2016-10-19

    Juxtacellular neuronal labelling is a method which allows neurophysiologists to fill physiologically-identified neurons with small positively-charged marker molecules. Labelled neurons are identified by histochemical processing of brain sections along with immunohistochemical identification of neuropeptides, neurotransmitters, neurotransmitter transporters or biosynthetic enzymes. A microcontroller-based pulser circuit and associated BASIC software script is described for incorporation into the design of a commercially-available intracellular electrometer for use in juxtacellular neuronal labelling. Printed circuit board construction has been used for reliability and reproducibility. The current design obviates the need for a separate digital pulse source and simplifies the juxtacellular neuronal labelling procedure.

  13. Quinolinic acid induces disrupts cytoskeletal homeostasis in striatal neurons. Protective role of astrocyte-neuron interaction.

    Science.gov (United States)

    Pierozan, Paula; Ferreira, Fernanda; de Lima, Bárbara Ortiz; Pessoa-Pureur, Regina

    2015-02-01

    Quinolinic acid (QUIN) is an endogenous metabolite of the kynurenine pathway involved in several neurological disorders. Among the several mechanisms involved in QUIN-mediated toxicity, disruption of the cytoskeleton has been demonstrated in striatally injected rats and in striatal slices. The present work searched for the actions of QUIN in primary striatal neurons. Neurons exposed to 10 µM QUIN presented hyperphosphorylated neurofilament (NF) subunits (NFL, NFM, and NFH). Hyperphosphorylation was abrogated in the presence of protein kinase A and protein kinase C inhibitors H89 (20 μM) and staurosporine (10 nM), respectively, as well as by specific antagonists to N-methyl-D-aspartate (50 µM DL-AP5) and metabotropic glutamate receptor 1 (100 µM MPEP). Also, intra- and extracellular Ca(2+) chelators (10 µM BAPTA-AM and 1 mM EGTA, respectively) and Ca(2+) influx through L-type voltage-dependent Ca(2+) channel (10 µM verapamil) are implicated in QUIN-mediated effects. Cells immunostained for the neuronal markers βIII-tubulin and microtubule-associated protein 2 showed altered neurite/neuron ratios and neurite outgrowth. NF hyperphosphorylation and morphological alterations were totally prevented by conditioned medium from QUIN-treated astrocytes. Cocultured astrocytes and neurons interacted with one another reciprocally, protecting them against QUIN injury. Cocultured cells preserved their cytoskeletal organization and cell morphology together with unaltered activity of the phosphorylating system associated with the cytoskeleton. This article describes cytoskeletal disruption as one of the most relevant actions of QUIN toxicity in striatal neurons in culture with soluble factors secreted by astrocytes, with neuron-astrocyte interaction playing a role in neuroprotection. © 2014 Wiley Periodicals, Inc.

  14. Perifornical orexinergic neurons modulate REM sleep by influencing locus coeruleus neurons in rats.

    Science.gov (United States)

    Choudhary, R C; Khanday, M A; Mitra, A; Mallick, B N

    2014-10-24

    Activation of the orexin (OX)-ergic neurons in the perifornical (PeF) area has been reported to induce waking and reduce rapid eye movement sleep (REMS). The activities of OX-ergic neurons are maximum during active waking and they progressively reduce during non-REMS (NREMS) and REMS. Apparently, the locus coeruleus (LC) neurons also behave in a comparable manner as that of the OX-ergic neurons particularly in relation to waking and REMS. Further, as PeF OX-ergic neurons send dense projections to LC, we argued that the former could drive the LC neurons to modulate waking and REMS. Studies in freely moving normally behaving animals where simultaneously neuro-chemo-anatomo-physio-behavioral information could be deciphered would significantly strengthen our understanding on the regulation of REMS. Therefore, in this study in freely behaving chronically prepared rats we stimulated the PeF neurons without or with simultaneous blocking of specific subtypes of OX-ergic receptors in the LC while electrophysiological recording characterizing sleep-waking was continued. Single dose of glutamate stimulation as well as sustained mild electrical stimulation of PeF (both bilateral) significantly increased waking and reduced REMS as compared to baseline. Simultaneous application of OX-receptor1 (OX1R) antagonist bilaterally into the LC prevented PeF stimulation-induced REMS suppression. Also, the effect of electrical stimulation of the PeF was long lasting as compared to that of the glutamate stimulation. Further, sustained electrical stimulation significantly decreased both REMS duration as well as REMS frequency, while glutamate stimulation decreased REMS duration only. Copyright © 2014 IBRO. Published by Elsevier Ltd. All rights reserved.

  15. Cortical cell and neuron density estimates in one chimpanzee hemisphere.

    Science.gov (United States)

    Collins, Christine E; Turner, Emily C; Sawyer, Eva Kille; Reed, Jamie L; Young, Nicole A; Flaherty, David K; Kaas, Jon H

    2016-01-19

    The density of cells and neurons in the neocortex of many mammals varies across cortical areas and regions. This variability is, perhaps, most pronounced in primates. Nonuniformity in the composition of cortex suggests regions of the cortex have different specializations. Specifically, regions with densely packed neurons contain smaller neurons that are activated by relatively few inputs, thereby preserving information, whereas regions that are less densely packed have larger neurons that have more integrative functions. Here we present the numbers of cells and neurons for 742 discrete locations across the neocortex in a chimpanzee. Using isotropic fractionation and flow fractionation methods for cell and neuron counts, we estimate that neocortex of one hemisphere contains 9.5 billion cells and 3.7 billion neurons. Primary visual cortex occupies 35 cm(2) of surface, 10% of the total, and contains 737 million densely packed neurons, 20% of the total neurons contained within the hemisphere. Other areas of high neuron packing include secondary visual areas, somatosensory cortex, and prefrontal granular cortex. Areas of low levels of neuron packing density include motor and premotor cortex. These values reflect those obtained from more limited samples of cortex in humans and other primates.

  16. Somatomotor and oculomotor inferior olivary neurons have distinct electrophysiological phenotypes

    Science.gov (United States)

    Urbano, Francisco J.; Simpson, John I.; Llinás, Rodolfo R.

    2006-01-01

    The electrophysiological properties of rat inferior olive (IO) neurons in the dorsal cap of Kooy (DCK) and the adjacent ventrolateral outgrowth (VLO) were compared with those of IO neurons in the principal olive (PO). Whereas DCK/VLO neurons are involved in eye movement control via their climbing fiber projection to the cerebellar flocculus, PO neurons control limb and digit movements via their climbing fiber projection to the lateral cerebellar hemisphere. In vitro patch recordings from DCK/VLO neurons revealed that low threshold calcium currents, Ih currents, and subthreshold oscillations are lacking in this subset of IO neurons. The recordings of activity in DCK neurons obtained by using voltage-sensitive dye imaging showed that activity is not limited to a single neuron, but rather that clusters of DCK neurons can be active in unison. These electrophysiological results show that the DCK/VLO neurons have unique properties that set them apart from the neurons in the PO nucleus. This finding indicates that motor control, from the perspective of the olivocerebellar system, is fundamentally different for the oculomotor and the somatomotor systems. PMID:17050678

  17. Critical time window of neuronal cholesterol synthesis during neurite outgrowth.

    Science.gov (United States)

    Fünfschilling, Ursula; Jockusch, Wolf J; Sivakumar, Nandhini; Möbius, Wiebke; Corthals, Kristina; Li, Sai; Quintes, Susanne; Kim, Younghoon; Schaap, Iwan A T; Rhee, Jeong-Seop; Nave, Klaus-Armin; Saher, Gesine

    2012-05-30

    Cholesterol is an essential membrane component enriched in plasma membranes, growth cones, and synapses. The brain normally synthesizes all cholesterol locally, but the contribution of individual cell types to brain cholesterol metabolism is unknown. To investigate whether cortical projection neurons in vivo essentially require cholesterol biosynthesis and which cell types support neurons, we have conditionally ablated the cholesterol biosynthesis in these neurons in mice either embryonically or postnatally. We found that cortical projection neurons synthesize cholesterol during their entire lifetime. At all stages, they can also benefit from glial support. Adult neurons that lack cholesterol biosynthesis are mainly supported by astrocytes such that their functional integrity is preserved. In contrast, microglial cells support young neurons. However, compensatory efforts of microglia are only transient leading to layer-specific neuronal death and the reduction of cortical projections. Hence, during the phase of maximal membrane growth and maximal cholesterol demand, neuronal cholesterol biosynthesis is indispensable. Analysis of primary neurons revealed that neurons tolerate only slight alteration in the cholesterol content and plasma membrane tension. This quality control allows neurons to differentiate normally and adjusts the extent of neurite outgrowth, the number of functional growth cones and synapses to the available cholesterol. This study highlights both the flexibility and the limits of horizontal cholesterol transfer in vivo and may have implications for the understanding of neurodegenerative diseases.

  18. Lactate rescues neuronal sodium homeostasis during impaired energy metabolism.

    Science.gov (United States)

    Karus, Claudia; Ziemens, Daniel; Rose, Christine R

    2015-01-01

    Recently, we established that recurrent activity evokes network sodium oscillations in neurons and astrocytes in hippocampal tissue slices. Interestingly, metabolic integrity of astrocytes was essential for the neurons' capacity to maintain low sodium and to recover from sodium loads, indicating an intimate metabolic coupling between the 2 cell types. Here, we studied if lactate can support neuronal sodium homeostasis during impaired energy metabolism by analyzing whether glucose removal, pharmacological inhibition of glycolysis and/or addition of lactate affect cellular sodium regulation. Furthermore, we studied the effect of lactate on sodium regulation during recurrent network activity and upon inhibition of the glial Krebs cycle by sodium-fluoroacetate. Our results indicate that lactate is preferentially used by neurons. They demonstrate that lactate supports neuronal sodium homeostasis and rescues the effects of glial poisoning by sodium-fluoroacetate. Altogether, they are in line with the proposed transfer of lactate from astrocytes to neurons, the so-called astrocyte-neuron-lactate shuttle.

  19. The Hypocretin/Orexin Neuronal Networks in Zebrafish.

    Science.gov (United States)

    Elbaz, Idan; Levitas-Djerbi, Talia; Appelbaum, Lior

    2017-01-01

    The hypothalamic Hypocretin/Orexin (Hcrt) neurons secrete two Hcrt neuropeptides. These neurons and peptides play a major role in the regulation of feeding, sleep wake cycle, reward-seeking, addiction, and stress. Loss of Hcrt neurons causes the sleep disorder narcolepsy. The zebrafish has become an attractive model to study the Hcrt neuronal network because it is a transparent vertebrate that enables simple genetic manipulation, imaging of the structure and function of neuronal circuits in live animals, and high-throughput monitoring of behavioral performance during both day and night. The zebrafish Hcrt network comprises ~16-60 neurons, which similar to mammals, are located in the hypothalamus and widely innervate the brain and spinal cord, and regulate various fundamental behaviors such as feeding, sleep, and wakefulness. Here we review how the zebrafish contributes to the study of the Hcrt neuronal system molecularly, anatomically, physiologically, and pathologically.

  20. Multiple Modes of Communication between Neurons and Oligodendrocyte Precursor Cells.

    Science.gov (United States)

    Maldonado, Paloma P; Angulo, María Cecilia

    2015-06-01

    The surprising discovery of bona fide synapses between neurons and oligodendrocytes precursor cells (OPCs) 15 years ago placed these progenitors as real partners of neurons in the CNS. The role of these synapses has not been established yet, but a main hypothesis is that neuron-OPC synaptic activity is a signaling pathway controlling OPC proliferation/differentiation, influencing the myelination process. However, new evidences describing non-synaptic mechanisms of communication between neurons and OPCs have revealed that neuron-OPC interactions are more complex than expected. The activation of extrasynaptic receptors by ambient neurotransmitter or local spillover and the ability of OPCs to sense neuronal activity through a potassium channel suggest that distinct modes of communication mediate different functions of OPCs in the CNS. This review discusses different mechanisms used by OPCs to interact with neurons and their potential roles during postnatal development and in brain disorders. © The Author(s) 2014.

  1. Naftidrofuryl affects neurite regeneration by injured adult auditory neurons.

    Science.gov (United States)

    Lefebvre, P P; Staecker, H; Moonen, G; van de Water, T R

    1993-07-01

    Afferent auditory neurons are essential for the transmission of auditory information from Corti's organ to the central auditory pathway. Auditory neurons are very sensitive to acute insult and have a limited ability to regenerate injured neuronal processes. Therefore, these neurons appear to be a limiting factor in restoration of hearing function following an injury to the peripheral auditory receptor. In a previous study nerve growth factor (NGF) was shown to stimulate neurite repair but not survival of injured auditory neurons. In this study, we have demonstrated a neuritogenesis promoting effect of naftidrofuryl in an vitro model for injury to adult auditory neurons, i.e. dissociated cell cultures of adult rat spiral ganglia. Conversely, naftidrofuryl did not have any demonstrable survival promoting effect on these in vitro preparations of injured auditory neurons. The potential uses of this drug as a therapeutic agent in acute diseases of the inner ear are discussed in the light of these observations.

  2. Lactate rescues neuronal sodium homeostasis during impaired energy metabolism

    Science.gov (United States)

    Karus, Claudia; Ziemens, Daniel; Rose, Christine R

    2015-01-01

    Recently, we established that recurrent activity evokes network sodium oscillations in neurons and astrocytes in hippocampal tissue slices. Interestingly, metabolic integrity of astrocytes was essential for the neurons' capacity to maintain low sodium and to recover from sodium loads, indicating an intimate metabolic coupling between the 2 cell types. Here, we studied if lactate can support neuronal sodium homeostasis during impaired energy metabolism by analyzing whether glucose removal, pharmacological inhibition of glycolysis and/or addition of lactate affect cellular sodium regulation. Furthermore, we studied the effect of lactate on sodium regulation during recurrent network activity and upon inhibition of the glial Krebs cycle by sodium-fluoroacetate. Our results indicate that lactate is preferentially used by neurons. They demonstrate that lactate supports neuronal sodium homeostasis and rescues the effects of glial poisoning by sodium-fluoroacetate. Altogether, they are in line with the proposed transfer of lactate from astrocytes to neurons, the so-called astrocyte-neuron-lactate shuttle. PMID:26039160

  3. Dorsal Raphe Dopamine Neurons Represent the Experience of Social Isolation

    Science.gov (United States)

    Matthews, Gillian A.; Nieh, Edward H.; Vander Weele, Caitlin M.; Halbert, Sarah A.; Pradhan, Roma V.; Yosafat, Ariella S.; Glober, Gordon F.; Izadmehr, Ehsan M.; Thomas, Rain E.; Lacy, Gabrielle D.; Wildes, Craig P.; Ungless, Mark A.; Tye, Kay M.

    2016-01-01

    Summary The motivation to seek social contact may arise from either positive or negative emotional states, as social interaction can be rewarding and social isolation can be aversive. While ventral tegmental area (VTA) dopamine (DA) neurons may mediate social reward, a cellular substrate for the negative affective state of loneliness has remained elusive. Here, we identify a functional role for DA neurons in the dorsal raphe nucleus (DRN), in which we observe synaptic changes following acute social isolation. DRN DA neurons show increased activity upon social contact following isolation, revealed by in vivo calcium imaging. Optogenetic activation of DRN DA neurons increases social preference but causes place avoidance. Furthermore, these neurons are necessary for promoting rebound sociability following an acute period of isolation. Finally, the degree to which these neurons modulate behavior is predicted by social rank, together supporting a role for DRN dopamine neurons in mediating a loneliness-like state. PaperClip PMID:26871628

  4. Integrated neuron circuit for implementing neuromorphic system with synaptic device

    Science.gov (United States)

    Lee, Jeong-Jun; Park, Jungjin; Kwon, Min-Woo; Hwang, Sungmin; Kim, Hyungjin; Park, Byung-Gook

    2018-02-01

    In this paper, we propose and fabricate Integrate & Fire neuron circuit for implementing neuromorphic system. Overall operation of the circuit is verified by measuring discrete devices and the output characteristics of the circuit. Since the neuron circuit shows asymmetric output characteristic that can drive synaptic device with Spike-Timing-Dependent-Plasticity (STDP) characteristic, the autonomous weight update process is also verified by connecting the synaptic device and the neuron circuit. The timing difference of the pre-neuron and the post-neuron induce autonomous weight change of the synaptic device. Unlike 2-terminal devices, which is frequently used to implement neuromorphic system, proposed scheme of the system enables autonomous weight update and simple configuration by using 4-terminal synapse device and appropriate neuron circuit. Weight update process in the multi-layer neuron-synapse connection ensures implementation of the hardware-based artificial intelligence, based on Spiking-Neural- Network (SNN).

  5. Choline acetyltransferase-containing neurons in the human parietal neocortex

    Directory of Open Access Journals (Sweden)

    V Benagiano

    2009-06-01

    Full Text Available A number of immunocytochemical studies have indicated the presence of cholinergic neurons in the cerebral cortex of various species of mammals. Whether such cholinergic neurons in the human cerebral cortex are exclusively of subcortical origin is still debated. In this immunocytochemical study, the existence of cortical cholinergic neurons was investigated on surgical samples of human parietal association neocortex using a highly specific monoclonal antibody against choline acetyltransferase (ChAT, the acetylcholine biosynthesising enzyme. ChAT immunoreactivity was detected in a subpopulation of neurons located in layers II and III. These were small or medium-sized pyramidal neurons which showed cytoplasmic immunoreactivity in the perikarya and processes, often in close association to blood microvessels. This study, providing demonstration of ChAT neurons in the human parietal neocortex, strongly supports the existence of intrinsic cholinergic innervation of the human neocortex. It is likely that these neurons contribute to the cholinergic innervation of the intracortical microvessels.

  6. Retrograde Neuroanatomical Tracing of Phrenic Motor Neurons in Mice.

    Science.gov (United States)

    Vandeweerd, Jean-Michel; Hontoir, Fanny; De Knoop, Alexis; De Swert, Kathleen; Nicaise, Charles

    2018-02-22

    Phrenic motor neurons are cervical motor neurons originating from C3 to C6 levels in most mammalian species. Axonal projections converge into phrenic nerves innervating the respiratory diaphragm. In spinal cord slices, phrenic motor neurons cannot be identified from other motor neurons on morphological or biochemical criteria. We provide the description of procedures for visualizing phrenic motor neuron cell bodies in mice, following intrapleural injections of cholera toxin subunit beta (CTB) conjugated to a fluorophore. This fluorescent neuroanatomical tracer has the ability to be caught up at the diaphragm neuromuscular junction, be carried retrogradely along the phrenic axons and reach the phrenic cell bodies. Two methodological approaches of intrapleural CTB delivery are compared: transdiaphragmatic versus transthoracic injections. Both approaches are successful and result in similar number of CTB-labeled phrenic motor neurons. In conclusion, these techniques can be applied to visualize or quantify the phrenic motor neurons in various experimental studies such as those focused on the diaphragm-phrenic circuitry.

  7. Transitions to Synchrony in Coupled Bursting Neurons

    Science.gov (United States)

    Dhamala, Mukeshwar; Jirsa, Viktor K.; Ding, Mingzhou

    2004-01-01

    Certain cells in the brain, for example, thalamic neurons during sleep, show spike-burst activity. We study such spike-burst neural activity and the transitions to a synchronized state using a model of coupled bursting neurons. In an electrically coupled network, we show that the increase of coupling strength increases incoherence first and then induces two different transitions to synchronized states, one associated with bursts and the other with spikes. These sequential transitions to synchronized states are determined by the zero crossings of the maximum transverse Lyapunov exponents. These results suggest that synchronization of spike-burst activity is a multi-time-scale phenomenon and burst synchrony is a precursor to spike synchrony.

  8. Transitions to synchrony in coupled bursting neurons

    International Nuclear Information System (INIS)

    Dhamala, Mukeshwar; Jirsa, Viktor K.; Ding Mingzhou

    2004-01-01

    Certain cells in the brain, for example, thalamic neurons during sleep, show spike-burst activity. We study such spike-burst neural activity and the transitions to a synchronized state using a model of coupled bursting neurons. In an electrically coupled network, we show that the increase of coupling strength increases incoherence first and then induces two different transitions to synchronized states, one associated with bursts and the other with spikes. These sequential transitions to synchronized states are determined by the zero crossings of the maximum transverse Lyapunov exponents. These results suggest that synchronization of spike-burst activity is a multi-time-scale phenomenon and burst synchrony is a precursor to spike synchrony

  9. Detection of Temperature Difference in Neuronal Cells.

    Science.gov (United States)

    Tanimoto, Ryuichi; Hiraiwa, Takumi; Nakai, Yuichiro; Shindo, Yutaka; Oka, Kotaro; Hiroi, Noriko; Funahashi, Akira

    2016-03-01

    For a better understanding of the mechanisms behind cellular functions, quantification of the heterogeneity in an organism or cells is essential. Recently, the importance of quantifying temperature has been highlighted, as it correlates with biochemical reaction rates. Several methods for detecting intracellular temperature have recently been established. Here we develop a novel method for sensing temperature in living cells based on the imaging technique of fluorescence of quantum dots. We apply the method to quantify the temperature difference in a human derived neuronal cell line, SH-SY5Y. Our results show that temperatures in the cell body and neurites are different and thus suggest that inhomogeneous heat production and dissipation happen in a cell. We estimate that heterogeneous heat dissipation results from the characteristic shape of neuronal cells, which consist of several compartments formed with different surface-volume ratios. Inhomogeneous heat production is attributable to the localization of specific organelles as the heat source.

  10. The mirror neuron system: new frontiers.

    Science.gov (United States)

    Keysers, Christian; Fadiga, Luciano

    2008-01-01

    Since the discovery of mirror neurons, much effort has been invested into studying their location and properties in the human brain. Here we review these original findings and introduce the main topics of this special issue of Social Neuroscience. What does the mirror system code? How is the mirror system embedded into the mosaic of circuits that compose our brain? How does the mirror system contribute to communication, language and social interaction? Can the principle of mirror neurons be extended to emotions, sensations and thoughts? Papers using a wide range of methods, including single cell recordings, fMRI, TMS, EEG and psychophysics, collected in this special issue, start to give us some impressive answers.

  11. Language comprehension warps the mirror neuron system

    Directory of Open Access Journals (Sweden)

    Noah eZarr

    2013-12-01

    Full Text Available Is the mirror neuron system (MNS used in language understanding? According to embodied accounts of language comprehension, understanding sentences describing actions makes use of neural mechanisms of action control, including the MNS. Consequently, repeatedly comprehending sentences describing similar actions should induce adaptation of the MNS thereby warping its use in other cognitive processes such as action recognition and prediction. To test this prediction, participants read blocks of multiple sentences where each sentence in the block described transfer of objects in a direction away or toward the reader. Following each block, adaptation was measured by having participants predict the end-point of videotaped actions. The adapting sentences disrupted prediction of actions in the same direction, but a only for videos of biological motion, and b only when the effector implied by the language (e.g., the hand matched the videos. These findings are signatures of the mirror neuron system.

  12. Abnormal neuronal migration: radiologic-clinic study

    International Nuclear Information System (INIS)

    Martinez Fernandez, M.; Menor Serrano, F.; Bordon Ferre, F.; Garcia Tena, J.; Esteban Hernandez, E.; Sanguesa Nebot, C.; Marti Bonnati, L.

    1994-01-01

    We present our experience in 18 pediatric patients with abnormal neuronal migration. Seven cases of heterotopia of the gray matter, 7 agyria-pachygyria complexes, 1 case of polymicrogyria, 2 cases of schizencephaly and 1 case of hemimegalencephaly were diagnosed by means of ultrasonography, computed tomography and magnetic resonance. The clinical picture was reviewed in each case, with special attention to the occurrence of convulsions, psycho motor development and visual changes. In general, the greater the morphological change, the greater the neurological involvement in these patients. However, the two cases of schizencephaly presented mild clinical expression. Magnetic resonance increases the diagnostic yield in neuronal migration disorders. Nevertheless, either ultrasonography or, especially, computed tomography is useful as a first diagnostic approach in these malformative disorders. (Author)

  13. Neuronal regulation of homeostasis by nutrient sensing.

    Science.gov (United States)

    Lam, Tony K T

    2010-04-01

    In type 2 diabetes and obesity, the homeostatic control of glucose and energy balance is impaired, leading to hyperglycemia and hyperphagia. Recent studies indicate that nutrient-sensing mechanisms in the body activate negative-feedback systems to regulate energy and glucose homeostasis through a neuronal network. Direct metabolic signaling within the intestine activates gut-brain and gut-brain-liver axes to regulate energy and glucose homeostasis, respectively. In parallel, direct metabolism of nutrients within the hypothalamus regulates food intake and blood glucose levels. These findings highlight the importance of the central nervous system in mediating the ability of nutrient sensing to maintain homeostasis. Futhermore, they provide a physiological and neuronal framework by which enhancing or restoring nutrient sensing in the intestine and the brain could normalize energy and glucose homeostasis in diabetes and obesity.

  14. Towards reproducible descriptions of neuronal network models.

    Directory of Open Access Journals (Sweden)

    Eilen Nordlie

    2009-08-01

    Full Text Available Progress in science depends on the effective exchange of ideas among scientists. New ideas can be assessed and criticized in a meaningful manner only if they are formulated precisely. This applies to simulation studies as well as to experiments and theories. But after more than 50 years of neuronal network simulations, we still lack a clear and common understanding of the role of computational models in neuroscience as well as established practices for describing network models in publications. This hinders the critical evaluation of network models as well as their re-use. We analyze here 14 research papers proposing neuronal network models of different complexity and find widely varying approaches to model descriptions, with regard to both the means of description and the ordering and placement of material. We further observe great variation in the graphical representation of networks and the notation used in equations. Based on our observations, we propose a good model description practice, composed of guidelines for the organization of publications, a checklist for model descriptions, templates for tables presenting model structure, and guidelines for diagrams of networks. The main purpose of this good practice is to trigger a debate about the communication of neuronal network models in a manner comprehensible to humans, as opposed to machine-readable model description languages. We believe that the good model description practice proposed here, together with a number of other recent initiatives on data-, model-, and software-sharing, may lead to a deeper and more fruitful exchange of ideas among computational neuroscientists in years to come. We further hope that work on standardized ways of describing--and thinking about--complex neuronal networks will lead the scientific community to a clearer understanding of high-level concepts in network dynamics, and will thus lead to deeper insights into the function of the brain.

  15. Hidden neuronal correlations in cultured networks

    International Nuclear Information System (INIS)

    Segev, Ronen; Baruchi, Itay; Hulata, Eyal; Ben-Jacob, Eshel

    2004-01-01

    Utilization of a clustering algorithm on neuronal spatiotemporal correlation matrices recorded during a spontaneous activity of in vitro networks revealed the existence of hidden correlations: the sequence of synchronized bursting events (SBEs) is composed of statistically distinguishable subgroups each with its own distinct pattern of interneuron spatiotemporal correlations. These findings hint that each of the SBE subgroups can serve as a template for coding, storage, and retrieval of a specific information

  16. Hungry Neurons: Metabolic Insights on Seizure Dynamics

    OpenAIRE

    Paolo Bazzigaluppi; Azin Ebrahim Amini; Iliya Weisspapir; Bojana Stefanovic; Peter L. Carlen

    2017-01-01

    Epilepsy afflicts up to 1.6% of the population and the mechanisms underlying the appearance of seizures are still not understood. In past years, many efforts have been spent trying to understand the mechanisms underlying the excessive and synchronous firing of neurons. Traditionally, attention was pointed towards synaptic (dys)function and extracellular ionic species (dys)regulation. Recently, novel clinical and preclinical studies explored the role of brain metabolism (i.e., glucose utilizat...

  17. Cognitive and neuronal correlates of videogaming

    OpenAIRE

    Schlüter, Kim-John

    2016-01-01

    BACKGROUND: Within the past few decades video gaming has become a popular recreational activity all over the world and throughout all social classes. Nevertheless distinct scientific conclusions about potential harm or more importantly benefits of video gaming are lacking. However, recent studies point to possible improvements of some cognitive abilities through the high mental demands of modern games. The prefrontal cortex is the essential neuronal correlate of cognitive processing. Scientif...

  18. Diffusion approximation of neuronal models revisited

    Czech Academy of Sciences Publication Activity Database

    Čupera, Jakub

    2014-01-01

    Roč. 11, č. 1 (2014), s. 11-25 ISSN 1547-1063. [International Workshop on Neural Coding (NC) /10./. Praha, 02.09.2012-07.09.2012] R&D Projects: GA ČR(CZ) GAP103/11/0282 Institutional support: RVO:67985823 Keywords : stochastic model * neuronal activity * first-passage time Subject RIV: JD - Computer Applications, Robotics Impact factor: 0.840, year: 2014

  19. Neuron-glia metabolic coupling and plasticity

    OpenAIRE

    Magistretti PJ

    2011-01-01

    Abstract The focus of the current research projects in my laboratory revolves around the question of metabolic plasticity of neuron glia coupling. Our hypothesis is that behavioural conditions such as for example learning or the sleep wake cycle in which synaptic plasticity is well documented or during specific pathological conditions are accompanied by changes in the regulation of energy metabolism of astrocytes. We have indeed observed that the 'metabolic profile' of astrocytes is modified...

  20. Building functional networks of spiking model neurons.

    Science.gov (United States)

    Abbott, L F; DePasquale, Brian; Memmesheimer, Raoul-Martin

    2016-03-01

    Most of the networks used by computer scientists and many of those studied by modelers in neuroscience represent unit activities as continuous variables. Neurons, however, communicate primarily through discontinuous spiking. We review methods for transferring our ability to construct interesting networks that perform relevant tasks from the artificial continuous domain to more realistic spiking network models. These methods raise a number of issues that warrant further theoretical and experimental study.

  1. Associative memory in phasing neuron networks

    Energy Technology Data Exchange (ETDEWEB)

    Nair, Niketh S [ORNL; Bochove, Erik J. [United States Air Force Research Laboratory, Kirtland Air Force Base; Braiman, Yehuda [ORNL

    2014-01-01

    We studied pattern formation in a network of coupled Hindmarsh-Rose model neurons and introduced a new model for associative memory retrieval using networks of Kuramoto oscillators. Hindmarsh-Rose Neural Networks can exhibit a rich set of collective dynamics that can be controlled by their connectivity. Specifically, we showed an instance of Hebb's rule where spiking was correlated with network topology. Based on this, we presented a simple model of associative memory in coupled phase oscillators.

  2. Excitotoxicity and neuronal death in epilepsy

    OpenAIRE

    Lorigados, Lourdes; Orozco, Sandra; Morales, Lilia; Estupiñán, Bárbara; García, Iván; Rocha, Luisa

    2013-01-01

    Epilepsy is a recurrent, often progressive neurological disorder with a chronic evolution, affecting 1 to 2 % of the world population. Research with experimental models and imaging analysis of diseased patients have been used to show that recurrent episodes produce oxidative stress, most of which is related to neuronal excitability phenomena. It is known that the excessive stimulation of glutamate receptors results in neurotoxicity; a process that, under the denomination of excitotoxicity, is...

  3. Neuronal network analyses: premises, promises and uncertainties

    OpenAIRE

    Parker, David

    2010-01-01

    Neuronal networks assemble the cellular components needed for sensory, motor and cognitive functions. Any rational intervention in the nervous system will thus require an understanding of network function. Obtaining this understanding is widely considered to be one of the major tasks facing neuroscience today. Network analyses have been performed for some years in relatively simple systems. In addition to the direct insights these systems have provided, they also illustrate some of the diffic...

  4. A Neuronal Model of Classical Conditioning.

    Science.gov (United States)

    1987-10-01

    suggests that nervous system activity can be understood in terms of two- 20. DISTRIBUTION/ AVAILABILIT Y OF ABSTRACT 21 ABSTRACT SECURITY CLASSIF ICATION...unconditionea stimuli having an external source (food and water are examples). Acquired neuronal drives, likewise, are expected to have internal...Moore, B. R. (19731. The form of the autushdpeo response with food or water reitArcers. Journal of the Experitiental Analykis uf Behavior, 20, 1b3-18

  5. Beta-amyloid and cholinergic neurons

    Czech Academy of Sciences Publication Activity Database

    Doležal, Vladimír; Kašparová, Jana

    2003-01-01

    Roč. 28, 3-4 (2003), s. 499-506 ISSN 0364-3190 R&D Projects: GA ČR GA305/01/0283; GA AV ČR IAA5011206 Institutional research plan: CEZ:AV0Z5011922 Keywords : cholinergic neurons * AlzheimerŽs disease * beta-amyloid Subject RIV: FH - Neurology Impact factor: 1.511, year: 2003

  6. Neuronal Adaptive Mechanisms Underlying Intelligent Information Processing

    Science.gov (United States)

    1981-05-01

    event in contrast with PSP or spike production, per se, resulting from natural auditory stimuli which serve as CS’s in Pavlovian blink conditioning...types of neurons responding to ACh or cGHP were conducted using aceclidine, a chol incmimetic drug . Similar effects on membrane resistance were...obtained with this drug , and the effects could be blocked by atropine (a muscarinic receptor blocker), A cell responding to aceclidine with an

  7. Estrogens modulate ventrolateral ventromedial hypothalamic glucose-inhibited neurons

    Directory of Open Access Journals (Sweden)

    Ammy M. Santiago

    2016-10-01

    Full Text Available Objective: Brain regulation of glucose homeostasis is sexually dimorphic; however, the impact sex hormones have on specific neuronal populations within the ventromedial hypothalamic nucleus (VMN, a metabolically sensitive brain region, has yet to be fully characterized. Glucose-excited (GE and -inhibited (GI neurons are located throughout the VMN and may play a critical role in glucose and energy homeostasis. Within the ventrolateral portion of the VMN (VL-VMN, glucose sensing neurons and estrogen receptor (ER distributions overlap. We therefore tested the hypothesis that VL-VMN glucose sensing neurons were sexually dimorphic and regulated by 17β-estradiol (17βE. Methods: Electrophysiological recordings of VL-VMN glucose sensing neurons in brain slices isolated from age- and weight-matched female and male mice were performed in the presence and absence of 17βE. Results: We found a new class of VL-VMN GI neurons whose response to low glucose was transient despite continued exposure to low glucose. Heretofore, we refer to these newly identified VL-VMN GI neurons as ‘adapting’ or AdGI neurons. We found a sexual dimorphic response to low glucose, with male nonadapting GI neurons, but not AdGI neurons, responding more robustly to low glucose than those from females. 17βE blunted the response of both nonadapting GI and AdGI neurons to low glucose in both males and females, which was mediated by activation of estrogen receptor β and inhibition of AMP-activated kinase. In contrast, 17βE had no impact on GE or non-glucose sensing neurons in either sex. Conclusion: These data suggest sex differences and estrogenic regulation of VMN hypothalamic glucose sensing may contribute to the sexual dimorphism in glucose homeostasis. Author Video: Author Video Watch what authors say about their articles Keywords: 17β-estradiol, AMP-activated kinase, Glucose excited neurons, Glucose inhibited neurons, Ventromedial hypothalamic nucleus, Sexual dimorphism

  8. Automatically tracking neurons in a moving and deforming brain.

    Directory of Open Access Journals (Sweden)

    Jeffrey P Nguyen

    2017-05-01

    Full Text Available Advances in optical neuroimaging techniques now allow neural activity to be recorded with cellular resolution in awake and behaving animals. Brain motion in these recordings pose a unique challenge. The location of individual neurons must be tracked in 3D over time to accurately extract single neuron activity traces. Recordings from small invertebrates like C. elegans are especially challenging because they undergo very large brain motion and deformation during animal movement. Here we present an automated computer vision pipeline to reliably track populations of neurons with single neuron resolution in the brain of a freely moving C. elegans undergoing large motion and deformation. 3D volumetric fluorescent images of the animal's brain are straightened, aligned and registered, and the locations of neurons in the images are found via segmentation. Each neuron is then assigned an identity using a new time-independent machine-learning approach we call Neuron Registration Vector Encoding. In this approach, non-rigid point-set registration is used to match each segmented neuron in each volume with a set of reference volumes taken from throughout the recording. The way each neuron matches with the references defines a feature vector which is clustered to assign an identity to each neuron in each volume. Finally, thin-plate spline interpolation is used to correct errors in segmentation and check consistency of assigned identities. The Neuron Registration Vector Encoding approach proposed here is uniquely well suited for tracking neurons in brains undergoing large deformations. When applied to whole-brain calcium imaging recordings in freely moving C. elegans, this analysis pipeline located 156 neurons for the duration of an 8 minute recording and consistently found more neurons more quickly than manual or semi-automated approaches.

  9. Automating NEURON Simulation Deployment in Cloud Resources.

    Science.gov (United States)

    Stockton, David B; Santamaria, Fidel

    2017-01-01

    Simulations in neuroscience are performed on local servers or High Performance Computing (HPC) facilities. Recently, cloud computing has emerged as a potential computational platform for neuroscience simulation. In this paper we compare and contrast HPC and cloud resources for scientific computation, then report how we deployed NEURON, a widely used simulator of neuronal activity, in three clouds: Chameleon Cloud, a hybrid private academic cloud for cloud technology research based on the OpenStack software; Rackspace, a public commercial cloud, also based on OpenStack; and Amazon Elastic Cloud Computing, based on Amazon's proprietary software. We describe the manual procedures and how to automate cloud operations. We describe extending our simulation automation software called NeuroManager (Stockton and Santamaria, Frontiers in Neuroinformatics, 2015), so that the user is capable of recruiting private cloud, public cloud, HPC, and local servers simultaneously with a simple common interface. We conclude by performing several studies in which we examine speedup, efficiency, total session time, and cost for sets of simulations of a published NEURON model.

  10. Enteric neurons show a primary cilium.

    Science.gov (United States)

    Luesma, Ma José; Cantarero, Irene; Castiella, Tomás; Soriano, Mario; Garcia-Verdugo, José Manuel; Junquera, Concepción

    2013-01-01

    The primary cilium is a non-motile cilium whose structure is 9+0. It is involved in co-ordinating cellular signal transduction pathways, developmental processes and tissue homeostasis. Defects in the structure or function of the primary cilium underlie numerous human diseases, collectively termed ciliopathies. The presence of single cilia in the central nervous system (CNS) is well documented, including some choroid plexus cells, neural stem cells, neurons and astrocytes, but the presence of primary cilia in differentiated neurons of the enteric nervous system (ENS) has not yet been described in mammals to the best of our knowledge. The enteric nervous system closely resembles the central nervous system. In fact, the ultrastructure of the ENS is more similar to the CNS ultrastructure than to the rest of the peripheral nervous system. This research work describes for the first time the ultrastructural characteristics of the single cilium in neurons of rat duodenum myenteric plexus, and reviews the cilium function in the CNS to propose the possible role of cilia in the ENS cells. © 2012 The Authors. Published by Foundation for Cellular and Molecular Medicine/Blackwell Publishing Ltd. This is an open access article under the terms of the Creative Commons Attribution License, which permits use, distribution and reproduction in any medium, provided the original work is properly cited.

  11. Adaptive global synchrony of inferior olive neurons

    International Nuclear Information System (INIS)

    Lee, Keum W; Singh, Sahjendra N

    2009-01-01

    This paper treats the question of global adaptive synchronization of inferior olive neurons (IONs) based on the immersion and invariance approach. The ION exhibits a variety of orbits as the parameter (termed the bifurcation parameter), which appears in its nonlinear functions, is varied. It is seen that once the bifurcation parameter exceeds a critical value, the stability of the equilibrium point of the ION is lost, and periodic orbits are born. The size and shape of the orbits depend on the value of the bifurcation parameter. It is assumed that bifurcation parameters of the IONs are not known. The orbits of IONs beginning from arbitrary initial conditions are not synchronized. For the synchronization of the IONs, a non-certainty equivalent adaptation law is derived. The control system has a modular structure consisting of an identifier and a control module. Using the Lyapunov approach, it is shown that in the closed-loop system, global synchronization of the neurons with a prescribed relative phase is accomplished, and the estimated bifurcation parameters converge to the true parameters. Unlike the certainty-equivalent adaptive control systems, an interesting feature of the designed control system is that whenever the estimated parameters coincide with the true values, the parameter estimates remain frozen thereafter, and the closed-loop system recovers the performance of the deterministic closed-loop system. Simulation results are presented which show that in the closed-loop system, the synchrony of neurons with prescribed phases is accomplished despite the uncertainties in the bifurcation parameters.

  12. Neuron-glia metabolic coupling and plasticity.

    Science.gov (United States)

    Magistretti, Pierre J

    2011-04-01

    The focus of the current research projects in my laboratory revolves around the question of metabolic plasticity of neuron-glia coupling. Our hypothesis is that behavioural conditions, such as for example learning or the sleep-wake cycle, in which synaptic plasticity is well documented, or during specific pathological conditions, are accompanied by changes in the regulation of energy metabolism of astrocytes. We have indeed observed that the 'metabolic profile' of astrocytes is modified during the sleep-wake cycle and during conditions mimicking neuroinflammation in the presence or absence of amyloid-β. The effect of amyloid-β on energy metabolism is dependent on its state of aggregation and on internalization of the peptide by astrocytes. Distinct patterns of metabolic activity could be observed during the learning and recall phases in a spatial learning task. Gene expression analysis in activated areas, notably hippocampous and retrosplenial cortex, demonstrated that the expression levels of several genes implicated in astrocyte-neuron metabolic coupling are enhanced by learning. Regarding metabolic plasticity during the sleep-wake cycle, we have observed that the level of expression of a panel of selected genes, which we know are key for neuron-glia metabolic coupling, is modulated by sleep deprivation.

  13. Data on isoaspartylation of neuronal ELAVL proteins

    Directory of Open Access Journals (Sweden)

    Mario A. Pulido

    2016-12-01

    Full Text Available This article contains experimental data examining the propensity of neuronal ELAVL proteins to become isoaspartylated. The data are related to the article “Isoaspartylation appears to trigger small cell lung cancer-associated autoimmunity against neuronal protein ELAVL4” (M.A. Pulido, M.K. DerHartunian, Z. Qin, E.M. Chung, D.S. Kang, A.W. Woodham, J.A. Tsou, R. Klooster, O. Akbari, L. Wang, W.M. Kast, S.V. Liu, J.J.G.M. Verschuuren, D.W. Aswad, I.A. Laird-Offringa, 2016 [1], in which it was reported that the N-terminal region of recombinant human ELAVL4 protein, incubated under physiological conditions, acquires a type of highly immunogenic protein damage. Here, we present Western blot analysis data generated by using an affinity-purified polyclonal rabbit antibody (raised against an N-terminal ELAVL4 isoaspartyl-converted peptide to probe recombinant protein fragments of the other three members of the ELAVL family: the highly homologous neuronal ELAVL2 (HuB and ELAVL3 (HuC, and the much less homologous ubiquitously expressed ELAVL1 (HuR.

  14. Mirror neuron dysfunction in autism spectrum disorders.

    Science.gov (United States)

    Perkins, Tom; Stokes, Mark; McGillivray, Jane; Bittar, Richard

    2010-10-01

    Autism spectrum disorders (ASDs) are developmental conditions characterized by deficits in social interaction, verbal and nonverbal communication and obsessive/stereotyped patterns of behaviour. Although there is no reliable neurophysiological marker associated with ASDs, dysfunction of the parieto-frontal mirror neuron system has been suggested as a disturbance linked to the disorder. Mirror neurons (MNs) are visuomotor neurons which discharge both when performing and observing a goal directed action. Research suggests MNs may have a role in imitation, empathy, theory of mind and language. Although the research base is small, evidence from functional MRI, transcranial magnetic stimulation, and an electroencephalographic component called the mu rhythm suggests MNs are dysfunctional in subjects with ASD. These deficits are more pronounced when ASD subjects complete tasks with social relevance, or that are emotional in nature. Promising research has identified that interventions targeting MN related functions such as imitation can improve social functioning in ASDs. Boosting the function of MNs may improve the prognosis of ASDs, and contribute to diagnostic clarity. Copyright 2010 Elsevier Ltd. All rights reserved.

  15. Spike Code Flow in Cultured Neuronal Networks.

    Science.gov (United States)

    Tamura, Shinichi; Nishitani, Yoshi; Hosokawa, Chie; Miyoshi, Tomomitsu; Sawai, Hajime; Kamimura, Takuya; Yagi, Yasushi; Mizuno-Matsumoto, Yuko; Chen, Yen-Wei

    2016-01-01

    We observed spike trains produced by one-shot electrical stimulation with 8 × 8 multielectrodes in cultured neuronal networks. Each electrode accepted spikes from several neurons. We extracted the short codes from spike trains and obtained a code spectrum with a nominal time accuracy of 1%. We then constructed code flow maps as movies of the electrode array to observe the code flow of "1101" and "1011," which are typical pseudorandom sequence such as that we often encountered in a literature and our experiments. They seemed to flow from one electrode to the neighboring one and maintained their shape to some extent. To quantify the flow, we calculated the "maximum cross-correlations" among neighboring electrodes, to find the direction of maximum flow of the codes with lengths less than 8. Normalized maximum cross-correlations were almost constant irrespective of code. Furthermore, if the spike trains were shuffled in interval orders or in electrodes, they became significantly small. Thus, the analysis suggested that local codes of approximately constant shape propagated and conveyed information across the network. Hence, the codes can serve as visible and trackable marks of propagating spike waves as well as evaluating information flow in the neuronal network.

  16. Spike Code Flow in Cultured Neuronal Networks

    Directory of Open Access Journals (Sweden)

    Shinichi Tamura

    2016-01-01

    Full Text Available We observed spike trains produced by one-shot electrical stimulation with 8 × 8 multielectrodes in cultured neuronal networks. Each electrode accepted spikes from several neurons. We extracted the short codes from spike trains and obtained a code spectrum with a nominal time accuracy of 1%. We then constructed code flow maps as movies of the electrode array to observe the code flow of “1101” and “1011,” which are typical pseudorandom sequence such as that we often encountered in a literature and our experiments. They seemed to flow from one electrode to the neighboring one and maintained their shape to some extent. To quantify the flow, we calculated the “maximum cross-correlations” among neighboring electrodes, to find the direction of maximum flow of the codes with lengths less than 8. Normalized maximum cross-correlations were almost constant irrespective of code. Furthermore, if the spike trains were shuffled in interval orders or in electrodes, they became significantly small. Thus, the analysis suggested that local codes of approximately constant shape propagated and conveyed information across the network. Hence, the codes can serve as visible and trackable marks of propagating spike waves as well as evaluating information flow in the neuronal network.

  17. How neurons migrate: a dynamic in-silico model of neuronal migration in the developing cortex

    LENUS (Irish Health Repository)

    Setty, Yaki

    2011-09-30

    Abstract Background Neuronal migration, the process by which neurons migrate from their place of origin to their final position in the brain, is a central process for normal brain development and function. Advances in experimental techniques have revealed much about many of the molecular components involved in this process. Notwithstanding these advances, how the molecular machinery works together to govern the migration process has yet to be fully understood. Here we present a computational model of neuronal migration, in which four key molecular entities, Lis1, DCX, Reelin and GABA, form a molecular program that mediates the migration process. Results The model simulated the dynamic migration process, consistent with in-vivo observations of morphological, cellular and population-level phenomena. Specifically, the model reproduced migration phases, cellular dynamics and population distributions that concur with experimental observations in normal neuronal development. We tested the model under reduced activity of Lis1 and DCX and found an aberrant development similar to observations in Lis1 and DCX silencing expression experiments. Analysis of the model gave rise to unforeseen insights that could guide future experimental study. Specifically: (1) the model revealed the possibility that under conditions of Lis1 reduced expression, neurons experience an oscillatory neuron-glial association prior to the multipolar stage; and (2) we hypothesized that observed morphology variations in rats and mice may be explained by a single difference in the way that Lis1 and DCX stimulate bipolar motility. From this we make the following predictions: (1) under reduced Lis1 and enhanced DCX expression, we predict a reduced bipolar migration in rats, and (2) under enhanced DCX expression in mice we predict a normal or a higher bipolar migration. Conclusions We present here a system-wide computational model of neuronal migration that integrates theory and data within a precise

  18. How neurons migrate: a dynamic in-silico model of neuronal migration in the developing cortex

    Directory of Open Access Journals (Sweden)

    Skoblov Nikita

    2011-09-01

    Full Text Available Abstract Background Neuronal migration, the process by which neurons migrate from their place of origin to their final position in the brain, is a central process for normal brain development and function. Advances in experimental techniques have revealed much about many of the molecular components involved in this process. Notwithstanding these advances, how the molecular machinery works together to govern the migration process has yet to be fully understood. Here we present a computational model of neuronal migration, in which four key molecular entities, Lis1, DCX, Reelin and GABA, form a molecular program that mediates the migration process. Results The model simulated the dynamic migration process, consistent with in-vivo observations of morphological, cellular and population-level phenomena. Specifically, the model reproduced migration phases, cellular dynamics and population distributions that concur with experimental observations in normal neuronal development. We tested the model under reduced activity of Lis1 and DCX and found an aberrant development similar to observations in Lis1 and DCX silencing expression experiments. Analysis of the model gave rise to unforeseen insights that could guide future experimental study. Specifically: (1 the model revealed the possibility that under conditions of Lis1 reduced expression, neurons experience an oscillatory neuron-glial association prior to the multipolar stage; and (2 we hypothesized that observed morphology variations in rats and mice may be explained by a single difference in the way that Lis1 and DCX stimulate bipolar motility. From this we make the following predictions: (1 under reduced Lis1 and enhanced DCX expression, we predict a reduced bipolar migration in rats, and (2 under enhanced DCX expression in mice we predict a normal or a higher bipolar migration. Conclusions We present here a system-wide computational model of neuronal migration that integrates theory and data within a

  19. Scaling of brain metabolism with a fixed energy budget per neuron: implications for neuronal activity, plasticity and evolution.

    Science.gov (United States)

    Herculano-Houzel, Suzana

    2011-03-01

    It is usually considered that larger brains have larger neurons, which consume more energy individually, and are therefore accompanied by a larger number of glial cells per neuron. These notions, however, have never been tested. Based on glucose and oxygen metabolic rates in awake animals and their recently determined numbers of neurons, here I show that, contrary to the expected, the estimated glucose use per neuron is remarkably constant, varying only by 40% across the six species of rodents and primates (including humans). The estimated average glucose use per neuron does not correlate with neuronal density in any structure. This suggests that the energy budget of the whole brain per neuron is fixed across species and brain sizes, such that total glucose use by the brain as a whole, by the cerebral cortex and also by the cerebellum alone are linear functions of the number of neurons in the structures across the species (although the average glucose consumption per neuron is at least 10× higher in the cerebral cortex than in the cerebellum). These results indicate that the apparently remarkable use in humans of 20% of the whole body energy budget by a brain that represents only 2% of body mass is explained simply by its large number of neurons. Because synaptic activity is considered the major determinant of metabolic cost, a conserved energy budget per neuron has several profound implications for synaptic homeostasis and the regulation of firing rates, synaptic plasticity, brain imaging, pathologies, and for brain scaling in evolution.

  20. Scaling of brain metabolism with a fixed energy budget per neuron: implications for neuronal activity, plasticity and evolution.

    Directory of Open Access Journals (Sweden)

    Suzana Herculano-Houzel

    Full Text Available It is usually considered that larger brains have larger neurons, which consume more energy individually, and are therefore accompanied by a larger number of glial cells per neuron. These notions, however, have never been tested. Based on glucose and oxygen metabolic rates in awake animals and their recently determined numbers of neurons, here I show that, contrary to the expected, the estimated glucose use per neuron is remarkably constant, varying only by 40% across the six species of rodents and primates (including humans. The estimated average glucose use per neuron does not correlate with neuronal density in any structure. This suggests that the energy budget of the whole brain per neuron is fixed across species and brain sizes, such that total glucose use by the brain as a whole, by the cerebral cortex and also by the cerebellum alone are linear functions of the number of neurons in the structures across the species (although the average glucose consumption per neuron is at least 10× higher in the cerebral cortex than in the cerebellum. These results indicate that the apparently remarkable use in humans of 20% of the whole body energy budget by a brain that represents only 2% of body mass is explained simply by its large number of neurons. Because synaptic activity is considered the major determinant of metabolic cost, a conserved energy budget per neuron has several profound implications for synaptic homeostasis and the regulation of firing rates, synaptic plasticity, brain imaging, pathologies, and for brain scaling in evolution.

  1. Scaling of Brain Metabolism with a Fixed Energy Budget per Neuron: Implications for Neuronal Activity, Plasticity and Evolution

    Science.gov (United States)

    Herculano-Houzel, Suzana

    2011-01-01

    It is usually considered that larger brains have larger neurons, which consume more energy individually, and are therefore accompanied by a larger number of glial cells per neuron. These notions, however, have never been tested. Based on glucose and oxygen metabolic rates in awake animals and their recently determined numbers of neurons, here I show that, contrary to the expected, the estimated glucose use per neuron is remarkably constant, varying only by 40% across the six species of rodents and primates (including humans). The estimated average glucose use per neuron does not correlate with neuronal density in any structure. This suggests that the energy budget of the whole brain per neuron is fixed across species and brain sizes, such that total glucose use by the brain as a whole, by the cerebral cortex and also by the cerebellum alone are linear functions of the number of neurons in the structures across the species (although the average glucose consumption per neuron is at least 10× higher in the cerebral cortex than in the cerebellum). These results indicate that the apparently remarkable use in humans of 20% of the whole body energy budget by a brain that represents only 2% of body mass is explained simply by its large number of neurons. Because synaptic activity is considered the major determinant of metabolic cost, a conserved energy budget per neuron has several profound implications for synaptic homeostasis and the regulation of firing rates, synaptic plasticity, brain imaging, pathologies, and for brain scaling in evolution. PMID:21390261

  2. Spinal Accessory Motor Neurons in the Mouse: A Special Type of Branchial Motor Neuron?

    Science.gov (United States)

    Watson, Charles; Tvrdik, Petr

    2018-04-16

    The spinal accessory nerve arises from motor neurons in the upper cervical spinal cord. The axons of these motor neurons exit dorsal to the ligamentum denticulatum and form the spinal accessory nerve. The nerve ascends in the spinal subarachnoid space to enter the posterior cranial fossa through the foramen magnum. The spinal accessory nerve then turns caudally to exit through the jugular foramen alongside the vagus and glossopharyngeal nerves, and then travels to supply the sternomastoid and trapezius muscles in the neck. The unusual course of the spinal accessory nerve has long prompted speculation that it is not a typical spinal motor nerve and that it might represent a caudal remnant of the branchial motor system. Our cell lineage tracing data, combined with images from public databases, show that the spinal accessory motor neurons in the mouse transiently express Phox2b, a transcription factor that is required for development of brain stem branchial motor nuclei. While this is strong prima facie evidence that the spinal accessory motor neurons should be classified as branchial motor, the evolutionary history of these motor neurons in anamniote vertebrates suggests that they may be considered to be an atypical branchial group that possesses both branchial and somatic characteristics. Anat Rec, 2018. © 2018 Wiley Periodicals, Inc. © 2018 Wiley Periodicals, Inc.

  3. Connectivity and dynamics of neuronal networks as defined by the shape of individual neurons

    International Nuclear Information System (INIS)

    Ahnert, Sebastian E; A N Travencolo, Bruno; Costa, Luciano da Fontoura

    2009-01-01

    Biological neuronal networks constitute a special class of dynamical systems, as they are formed by individual geometrical components, namely the neurons. In the existing literature, relatively little attention has been given to the influence of neuron shape on the overall connectivity and dynamics of the emerging networks. The current work addresses this issue by considering simplified neuronal shapes consisting of circular regions (soma/axons) with spokes (dendrites). Networks are grown by placing these patterns randomly in the two-dimensional (2D) plane and establishing connections whenever a piece of dendrite falls inside an axon. Several topological and dynamical properties of the resulting graph are measured, including the degree distribution, clustering coefficients, symmetry of connections, size of the largest connected component, as well as three hierarchical measurements of the local topology. By varying the number of processes of the individual basic patterns, we can quantify relationships between the individual neuronal shape and the topological and dynamical features of the networks. Integrate-and-fire dynamics on these networks is also investigated with respect to transient activation from a source node, indicating that long-range connections play an important role in the propagation of avalanches.

  4. An FPGA-based silicon neuronal network with selectable excitability silicon neurons

    Directory of Open Access Journals (Sweden)

    Jing eLi

    2012-12-01

    Full Text Available This paper presents a digital silicon neuronal network which simulates the nerve system in creatures and has the ability to execute intelligent tasks, such as associative memory. Two essential elements, the mathematical-structure-based digital spiking silicon neuron (DSSN and the transmitter release based silicon synapse, allow the network to show rich dynamic behaviors and are computationally efficient for hardware implementation. We adopt mixed pipeline and parallel structure and shift operations to design a sufficient large and complex network without excessive hardware resource cost. The network with $256$ full-connected neurons is built on a Digilent Atlys board equipped with a Xilinx Spartan-6 LX45 FPGA. Besides, a memory control block and USB control block are designed to accomplish the task of data communication between the network and the host PC. This paper also describes the mechanism of associative memory performed in the silicon neuronal network. The network is capable of retrieving stored patterns if the inputs contain enough information of them. The retrieving probability increases with the similarity between the input and the stored pattern increasing. Synchronization of neurons is observed when the successful stored pattern retrieval occurs.

  5. Tetracycline inducible gene manipulation in serotonergic neurons.

    Directory of Open Access Journals (Sweden)

    Tillmann Weber

    Full Text Available The serotonergic (5-HT neuronal system has important and diverse physiological functions throughout development and adulthood. Its dysregulation during development or later in adulthood has been implicated in many neuropsychiatric disorders. Transgenic animal models designed to study the contribution of serotonergic susceptibility genes to a pathological phenotype should ideally allow to study candidate gene overexpression or gene knockout selectively in serotonergic neurons at any desired time during life. For this purpose, conditional expression systems such as the tet-system are preferable. Here, we generated a transactivator (tTA mouse line (TPH2-tTA that allows temporal and spatial control of tetracycline (Ptet controlled transgene expression as well as gene deletion in 5-HT neurons. The tTA cDNA was inserted into a 196 kb PAC containing a genomic mouse Tph2 fragment (177 kb by homologous recombination in E. coli. For functional analysis of Ptet-controlled transgene expression, TPH2-tTA mice were crossed to a Ptet-regulated lacZ reporter line (Ptet-nLacZ. In adult double-transgenic TPH2-tTA/Ptet-nLacZ mice, TPH2-tTA founder line L62-20 showed strong serotonergic β-galactosidase expression which could be completely suppressed with doxycycline (Dox. Furthermore, Ptet-regulated gene expression could be reversibly activated or inactivated when Dox was either withdrawn or added to the system. For functional analysis of Ptet-controlled, Cre-mediated gene deletion, TPH2-tTA mice (L62-20 were crossed to double transgenic Ptet-Cre/R26R reporter mice to generate TPH2-tTA/Ptet-Cre/R26R mice. Without Dox, 5-HT specific recombination started at E12.5. With permanent Dox administration, Ptet-controlled Cre-mediated recombination was absent. Dox withdrawal either postnatally or during adulthood induced efficient recombination in serotonergic neurons of all raphe nuclei, respectively. In the enteric nervous system, recombination could not be detected. We

  6. Nitric Oxide in Astrocyte-Neuron Signaling

    Energy Technology Data Exchange (ETDEWEB)

    Li, Nianzhen [Iowa State Univ., Ames, IA (United States)

    2002-01-01

    Astrocytes, a subtype of glial cell, have recently been shown to exhibit Ca2+ elevations in response to neurotransmitters. A Ca2+ elevation can propagate to adjacent astrocytes as a Ca2+ wave, which allows an astrocyte to communicate with its neighbors. Additionally, glutamate can be released from astrocytes via a Ca2+-dependent mechanism, thus modulating neuronal activity and synaptic transmission. In this dissertation, the author investigated the roles of another endogenous signal, nitric oxide (NO), in astrocyte-neuron signaling. First the author tested if NO is generated during astrocytic Ca2+ signaling by imaging NO in purified murine cortical astrocyte cultures. Physiological concentrations of a natural messenger, ATP, caused a Ca2+-dependent NO production. To test the roles of NO in astrocytic Ca2+ signaling, the author applied NO to astrocyte cultures via addition of a NO donor, S-nitrosol-N-acetylpenicillamine (SNAP). NO induced an influx of external Ca2+, possibly through store-operated Ca2+ channels. The NO-induced Ca2+ signaling is cGMP-independent since 8-Br-cGMP, an agonistic analog of cGMP, did not induce a detectable Ca2+ change. The consequence of this NO-induced Ca2+ influx was assessed by simultaneously monitoring of cytosolic and internal store Ca2+ using fluorescent Ca2+ indicators x-rhod-1 and mag-fluo-4. Blockage of NO signaling with the NO scavenger PTIO significantly reduced the refilling percentage of internal stores following ATP-induced Ca2+ release, suggesting that NO modulates internal store refilling. Furthermore, locally photo-release of NO to a single astrocyte led to a Ca2+ elevation in the stimulated astrocyte and a subsequent Ca2+ wave to neighbors. Finally, the author tested the role of NO inglutamate-mediated astrocyte-neuron signaling by

  7. A low-density culture method of cerebellar granule neurons with paracrine support applicable for the study of neuronal morphogenesis.

    Science.gov (United States)

    Kubota, Kenta; Seno, Takeshi; Konishi, Yoshiyuki

    2013-11-20

    Cerebellar granule neuronal cultures have been used to study the molecular mechanisms underlying neuronal functions, including neuronal morphogenesis. However, a limitation of this system is the difficulty to analyze isolated neurons because these are required to be maintained at a high density. Therefore, in the present study, we aimed to develop a simple and cost-effective method for culturing low-density cerebellar granule neurons. Cerebellar granule cells at two different densities (low- and high-density) were co-cultivated in order for the low-density culture to be supported by the paracrine signals from the high-density culture. This method enabled morphology analysis of isolated cerebellar granule neurons without astrocytic feeder cultures or supplements such as B27. Using this method, we investigated the function of a polarity factor. Studies using hippocampal neurons suggested that glycogen synthase kinase-3 (GSK-3) is an essential regulator of neuronal polarity, and inhibition of GSK-3 results in the formation of multiple axons. Pharmacological inhibitors for GSK-3 (6-bromoindirubin-3'-oxime and lithium chloride) did not cause the formation of multiple axons of cerebellar granule neurons but significantly reduced their length. Consistent results were obtained by introducing kinase-dead form of GSK-3 beta (K85A). These results indicated that GSK-3 is not directly involved in the control of neuronal polarity in cerebellar granule neurons. Overall, this study provides a simple method for culturing low-density cerebellar granule neurons and insights in to the neuronal-type dependent function of GSK-3 in neuronal morphogenesis. © 2013 Elsevier B.V. All rights reserved.

  8. Bistability induces episodic spike communication by inhibitory neurons in neuronal networks.

    Science.gov (United States)

    Kazantsev, V B; Asatryan, S Yu

    2011-09-01

    Bistability is one of the important features of nonlinear dynamical systems. In neurodynamics, bistability has been found in basic Hodgkin-Huxley equations describing the cell membrane dynamics. When the neuron is clamped near its threshold, the stable rest potential may coexist with the stable limit cycle describing periodic spiking. However, this effect is often neglected in network computations where the neurons are typically reduced to threshold firing units (e.g., integrate-and-fire models). We found that the bistability may induce spike communication by inhibitory coupled neurons in the spiking network. The communication is realized in the form of episodic discharges with synchronous (correlated) spikes during the episodes. A spiking phase map is constructed to describe the synchronization and to estimate basic spike phase locking modes.

  9. Neuronal Rac1 Is Required for Learning-Evoked Neurogenesis

    Science.gov (United States)

    Anderson, Matthew P.; Freewoman, Julia; Cord, Branden; Babu, Harish; Brakebusch, Cord

    2013-01-01

    Hippocampus-dependent learning and memory relies on synaptic plasticity as well as network adaptations provided by the addition of adult-born neurons. We have previously shown that activity-induced intracellular signaling through the Rho family small GTPase Rac1 is necessary in forebrain projection neurons for normal synaptic plasticity in vivo, and here we show that selective loss of neuronal Rac1 also impairs the learning-evoked increase in neurogenesis in the adult mouse hippocampus. Earlier work has indicated that experience elevates the abundance of adult-born neurons in the hippocampus primarily by enhancing the survival of neurons produced just before the learning event. Loss of Rac1 in mature projection neurons did reduce learning-evoked neurogenesis but, contrary to our expectations, these effects were not mediated by altering the survival of young neurons in the hippocampus. Instead, loss of neuronal Rac1 activation selectively impaired a learning-evoked increase in the proliferation and accumulation of neural precursors generated during the learning event itself. This indicates that experience-induced alterations in neurogenesis can be mechanistically resolved into two effects: (1) the well documented but Rac1-independent signaling cascade that enhances the survival of young postmitotic neurons; and (2) a previously unrecognized Rac1-dependent signaling cascade that stimulates the proliferative production and retention of new neurons generated during learning itself. PMID:23884931

  10. Population activity structure of excitatory and inhibitory neurons.

    Directory of Open Access Journals (Sweden)

    Sean R Bittner

    Full Text Available Many studies use population analysis approaches, such as dimensionality reduction, to characterize the activity of large groups of neurons. To date, these methods have treated each neuron equally, without taking into account whether neurons are excitatory or inhibitory. We studied population activity structure as a function of neuron type by applying factor analysis to spontaneous activity from spiking networks with balanced excitation and inhibition. Throughout the study, we characterized population activity structure by measuring its dimensionality and the percentage of overall activity variance that is shared among neurons. First, by sampling only excitatory or only inhibitory neurons, we found that the activity structures of these two populations in balanced networks are measurably different. We also found that the population activity structure is dependent on the ratio of excitatory to inhibitory neurons sampled. Finally we classified neurons from extracellular recordings in the primary visual cortex of anesthetized macaques as putative excitatory or inhibitory using waveform classification, and found similarities with the neuron type-specific population activity structure of a balanced network with excitatory clustering. These results imply that knowledge of neuron type is important, and allows for stronger statistical tests, when interpreting population activity structure.

  11. Population activity structure of excitatory and inhibitory neurons.

    Science.gov (United States)

    Bittner, Sean R; Williamson, Ryan C; Snyder, Adam C; Litwin-Kumar, Ashok; Doiron, Brent; Chase, Steven M; Smith, Matthew A; Yu, Byron M

    2017-01-01

    Many studies use population analysis approaches, such as dimensionality reduction, to characterize the activity of large groups of neurons. To date, these methods have treated each neuron equally, without taking into account whether neurons are excitatory or inhibitory. We studied population activity structure as a function of neuron type by applying factor analysis to spontaneous activity from spiking networks with balanced excitation and inhibition. Throughout the study, we characterized population activity structure by measuring its dimensionality and the percentage of overall activity variance that is shared among neurons. First, by sampling only excitatory or only inhibitory neurons, we found that the activity structures of these two populations in balanced networks are measurably different. We also found that the population activity structure is dependent on the ratio of excitatory to inhibitory neurons sampled. Finally we classified neurons from extracellular recordings in the primary visual cortex of anesthetized macaques as putative excitatory or inhibitory using waveform classification, and found similarities with the neuron type-specific population activity structure of a balanced network with excitatory clustering. These results imply that knowledge of neuron type is important, and allows for stronger statistical tests, when interpreting population activity structure.

  12. Bidirectional Microglia-Neuron Communication in the Healthy Brain

    Directory of Open Access Journals (Sweden)

    Ukpong B. Eyo

    2013-01-01

    Full Text Available Unlike other resident neural cells that are of neuroectodermal origin, microglia are resident neural cells of mesodermal origin. Traditionally recognized for their immune functions during disease, new roles are being attributed to these cells in the development and maintenance of the central nervous system (CNS including specific communication with neurons. In this review, we highlight some of the recent findings on the bidirectional interaction between neurons and microglia. We discuss these interactions along two lines. First, we review data that suggest that microglial activity is modulated by neuronal signals, focusing on evidence that (i neurons are capable of regulating microglial activation state and influence basal microglial activities; (ii classic neurotransmitters affect microglial behavior; (iii chemotactic signals attract microglia during acute neuronal injury. Next, we discuss some of the recent data on how microglia signal to neurons. Signaling mechanisms include (i direct physical contact of microglial processes with neuronal elements; (ii microglial regulation of neuronal synapse and circuit by fractalkine, complement, and DAP12 signaling. In addition, we discuss the use of microglial depletion strategies in studying the role of microglia in neuronal development and synaptic physiology. Deciphering the mechanisms of bidirectional microglial-neuronal communication provides novel insights in understanding microglial function in both the healthy and diseased brain.

  13. Relating normalization to neuronal populations across cortical areas.

    Science.gov (United States)

    Ruff, Douglas A; Alberts, Joshua J; Cohen, Marlene R

    2016-09-01

    Normalization, which divisively scales neuronal responses to multiple stimuli, is thought to underlie many sensory, motor, and cognitive processes. In every study where it has been investigated, neurons measured in the same brain area under identical conditions exhibit a range of normalization, ranging from suppression by nonpreferred stimuli (strong normalization) to additive responses to combinations of stimuli (no normalization). Normalization has been hypothesized to arise from interactions between neuronal populations, either in the same or different brain areas, but current models of normalization are not mechanistic and focus on trial-averaged responses. To gain insight into the mechanisms underlying normalization, we examined interactions between neurons that exhibit different degrees of normalization. We recorded from multiple neurons in three cortical areas while rhesus monkeys viewed superimposed drifting gratings. We found that neurons showing strong normalization shared less trial-to-trial variability with other neurons in the same cortical area and more variability with neurons in other cortical areas than did units with weak normalization. Furthermore, the cortical organization of normalization was not random: neurons recorded on nearby electrodes tended to exhibit similar amounts of normalization. Together, our results suggest that normalization reflects a neuron's role in its local network and that modulatory factors like normalization share the topographic organization typical of sensory tuning properties. Copyright © 2016 the American Physiological Society.

  14. A phase plane analysis of neuron-astrocyte interactions.

    Science.gov (United States)

    Amiri, Mahmood; Montaseri, Ghazal; Bahrami, Fariba

    2013-08-01

    Intensive experimental studies have shown that astrocytes are active partners in modulation of synaptic transmission. In the present research, we study neuron-astrocyte signaling using a biologically inspired model of one neuron synapsing one astrocyte. In this model, the firing dynamics of the neuron is described by the Morris-Lecar model and the Ca(2+) dynamics of a single astrocyte explained by a functional model introduced by Postnov and colleagues. Using the coupled neuron-astrocyte model and based on the results of the phase plane analyses, it is demonstrated that the astrocyte is able to activate the silent neuron or change the neuron spiking frequency through bidirectional communication. This suggests that astrocyte feedback signaling is capable of modulating spike transmission frequency by changing neuron spiking frequency. This effect is described by a saddle-node on invariant circle bifurcation in the coupled neuron-astrocyte model. In this way, our results suggest that the neuron-astrocyte crosstalk has a fundamental role in producing diverse neuronal activities and therefore enhances the information processing capabilities of the brain. Crown Copyright © 2013. Published by Elsevier Ltd. All rights reserved.

  15. Population activity structure of excitatory and inhibitory neurons

    Science.gov (United States)

    Doiron, Brent

    2017-01-01

    Many studies use population analysis approaches, such as dimensionality reduction, to characterize the activity of large groups of neurons. To date, these methods have treated each neuron equally, without taking into account whether neurons are excitatory or inhibitory. We studied population activity structure as a function of neuron type by applying factor analysis to spontaneous activity from spiking networks with balanced excitation and inhibition. Throughout the study, we characterized population activity structure by measuring its dimensionality and the percentage of overall activity variance that is shared among neurons. First, by sampling only excitatory or only inhibitory neurons, we found that the activity structures of these two populations in balanced networks are measurably different. We also found that the population activity structure is dependent on the ratio of excitatory to inhibitory neurons sampled. Finally we classified neurons from extracellular recordings in the primary visual cortex of anesthetized macaques as putative excitatory or inhibitory using waveform classification, and found similarities with the neuron type-specific population activity structure of a balanced network with excitatory clustering. These results imply that knowledge of neuron type is important, and allows for stronger statistical tests, when interpreting population activity structure. PMID:28817581

  16. DRP1 Suppresses Leptin and Glucose Sensing of POMC Neurons.

    Science.gov (United States)

    Santoro, Anna; Campolo, Michela; Liu, Chen; Sesaki, Hiromi; Meli, Rosaria; Liu, Zhong-Wu; Kim, Jung Dae; Diano, Sabrina

    2017-03-07

    Hypothalamic pro-opiomelanocortin (POMC) neurons regulate energy and glucose metabolism. Intracellular mechanisms that enable these neurons to respond to changes in metabolic environment are ill defined. Here we show reduced expression of activated dynamin-related protein (pDRP1), a mitochondrial fission regulator, in POMC neurons of fed mice. These POMC neurons displayed increased mitochondrial size and aspect ratio compared to POMC neurons of fasted animals. Inducible deletion of DRP1 of mature POMC neurons (Drp1 fl/fl -POMC-cre:ER T2 ) resulted in improved leptin sensitivity and glucose responsiveness. In Drp1 fl/fl -POMC-cre:ER T2 mice, POMC neurons showed increased mitochondrial size, ROS production, and neuronal activation with increased expression of Kcnj11 mRNA regulated by peroxisome proliferator-activated receptor (PPAR). Furthermore, deletion of DRP1 enhanced the glucoprivic stimulus in these neurons, causing their stronger inhibition and a greater activation of counter-regulatory responses to hypoglycemia that were PPAR dependent. Together, these data unmasked a role for mitochondrial fission in leptin sensitivity and glucose sensing of POMC neurons. Copyright © 2017 Elsevier Inc. All rights reserved.

  17. Norepinephrine metabolism in neuronal cultures is increased by angiotensin II

    International Nuclear Information System (INIS)

    Sumners, C.; Shalit, S.L.; Kalberg, C.J.; Raizada, M.K.

    1987-01-01

    In this study the authors have examined the actions of angiotensin II (ANG II) on catecholamine metabolism in neuronal brain cell cultures prepared from the hypothalamus and brain stem. Neuronal cultures prepared from the brains of 1-day-old Sprague-Dawley rats exhibit specific neuronal uptake mechanisms for both norepinephrine (NE) and dopamine (DA), and also monoamine oxidase (MAO) and catechol O-methyltransferase (COMT) activity. Separate neuronal uptake sites for NE and DA were identified by using specific neuronal uptake inhibitors for each amine. In previous studies, they determined that ANG II (10 nM-1 μM) stimulates increased neuronal [ 3 H]NE uptake by acting as specific receptors. They have confirmed these results here and in addition have shown that ANG II has not significant effects on neuronal [ 3 H]DA uptake. These results suggest that the actions of ANG II are restricted to the NE transporter in neuronal cultures. It is possible that ANG II stimulates the intraneuronal metabolism of at least part of the NE that is taken up, because the peptide stimulates MAO activity, an effect mediated by specific ANG II receptors. ANG II had no effect on COMT activity in neuronal cultures. Therefore, the use of neuronal cultures of hypothalamus and brain stem they have determined that ANG II can specifically alter NE metabolism in these areas, while apparently not altering DA metabolism

  18. Mature neurons dynamically restrict apoptosis via redundant premitochondrial brakes.

    Science.gov (United States)

    Annis, Ryan P; Swahari, Vijay; Nakamura, Ayumi; Xie, Alison X; Hammond, Scott M; Deshmukh, Mohanish

    2016-12-01

    Apoptotic cell death is critical for the early development of the nervous system, but once the nervous system is established, the apoptotic pathway becomes highly restricted in mature neurons. However, the mechanisms underlying this increased resistance to apoptosis in these mature neurons are not completely understood. We have previously found that members of the miR-29 family of microRNAs (miRNAs) are induced with neuronal maturation and that overexpression of miR-29 was sufficient to restrict apoptosis in neurons. To determine whether endogenous miR-29 alone was responsible for the inhibition of cytochrome c release in mature neurons, we examined the status of the apoptotic pathway in sympathetic neurons deficient for all three miR-29 family members. Unexpectedly, we found that the apoptotic pathway remained largely restricted in miR-29-deficient mature neurons. We therefore probed for additional mechanisms by which mature neurons resist apoptosis. We identify miR-24 as another miRNA that is upregulated in the maturing cerebellum and sympathetic neurons that can act redundantly with miR-29 by targeting a similar repertoire of prodeath BH3-only genes. Overall, our results reveal that mature neurons engage multiple redundant brakes to restrict the apoptotic pathway and ensure their long-term survival. © 2016 Federation of European Biochemical Societies.

  19. Dicer maintains the identity and function of proprioceptive sensory neurons.

    Science.gov (United States)

    O'Toole, Sean M; Ferrer, Monica M; Mekonnen, Jennifer; Zhang, Haihan; Shima, Yasuyuki; Ladle, David R; Nelson, Sacha B

    2017-03-01

    Neuronal cell identity is established during development and must be maintained throughout an animal's life (Fishell G, Heintz N. Neuron 80: 602-612, 2013). Transcription factors critical for establishing neuronal identity can be required for maintaining it (Deneris ES, Hobert O. Nat Neurosci 17: 899-907, 2014). Posttranscriptional regulation also plays an important role in neuronal differentiation (Bian S, Sun T. Mol Neurobiol 44: 359-373, 2011), but its role in maintaining cell identity is less established. To better understand how posttranscriptional regulation might contribute to cell identity, we examined the proprioceptive neurons in the dorsal root ganglion (DRG), a highly specialized sensory neuron class, with well-established properties that distinguish them from other neurons in the ganglion. By conditionally ablating Dicer in mice, using parvalbumin (Pvalb)-driven Cre recombinase, we impaired posttranscriptional regulation in the proprioceptive sensory neuron population. Knockout (KO) animals display a progressive form of ataxia at the beginning of the fourth postnatal week that is accompanied by a cell death within the DRG. Before cell loss, expression profiling shows a reduction of proprioceptor specific genes and an increased expression of nonproprioceptive genes normally enriched in other ganglion neurons. Furthermore, although central connections of these neurons are intact, the peripheral connections to the muscle are functionally impaired. Posttranscriptional regulation is therefore necessary to retain the transcriptional identity and support functional specialization of the proprioceptive sensory neurons. NEW & NOTEWORTHY We have demonstrated that selectively impairing Dicer in parvalbumin-positive neurons, which include the proprioceptors, triggers behavioral changes, a lack of muscle connectivity, and a loss of transcriptional identity as observed through RNA sequencing. These results suggest that Dicer and, most likely by extension, micro

  20. Molecular and functional differences in voltage-activated sodium currents between GABA projection neurons and dopamine neurons in the substantia nigra

    OpenAIRE

    Ding, Shengyuan; Wei, Wei; Zhou, Fu-Ming

    2011-01-01

    GABA projection neurons (GABA neurons) in the substantia nigra pars reticulata (SNr) and dopamine projection neurons (DA neurons) in substantia nigra pars compacta (SNc) have strikingly different firing properties. SNc DA neurons fire low-frequency, long-duration spikes, whereas SNr GABA neurons fire high-frequency, short-duration spikes. Since voltage-activated sodium (NaV) channels are critical to spike generation, the different firing properties raise the possibility that, compared with DA...

  1. Dicty_cDB: SLD739 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available Antarctic fish Dissostichus mawsoni adult... 42 6.5 1 ( FE221128 ) O019B05 Antarctic fish Dissostichus mawson...i adult... 42 6.5 1 ( FE203112 ) B385G09 Antarctic fish Dissostichus mawsoni ad...ult... 42 6.5 1 ( FE196180 ) B197B12 Antarctic fish Dissostichus mawsoni adult... 42 6.5 1 ( FE195928 ) B193...H07 Antarctic fish Dissostichus mawsoni adult... 42 6.5 1 dna update 2009. 3.21 Homology vs Protein Score E

  2. Dicty_cDB: SLD776 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available AACATCGAATGTGTTATTTCATATGACGATATTAATAATTAGAAAAACATANATA AATAGTATAAATAAGTATATAAATAAATATACAAATATATAAATAACCAAAT...TTCATATGACGATATTAATAATTAGAAAAACATANATA AATAGTATAAATAAGTATATAAATAAATATACAAATATATAAATAACCAAATATATATTA ATAAACCA

  3. sld007.htm | epub DCs | presentations | epubworkshop | Indian ...

    Indian Academy of Sciences (India)

    Toggle navigation. Logo of the Indian Academy of Sciences. Indian Academy of Sciences. Home · About IASc · History · Memorandum of Association · Role of the Academy · Statutes · Council · Raman Chair · Jubilee Chair · Academy – Springer Nature chair · Academy Trust · Contact details · Office Staff · Office complaint ...

  4. Bimodal SLD Ice Accretion on a NACA 0012 Airfoil Model

    Science.gov (United States)

    Potapczuk, Mark; Tsao, Jen-Ching; King-Steen, Laura

    2016-01-01

    This presentation describes the results of ice accretion measurements on a NACA 0012 airfoil model, from the NASA Icing Research Tunnel, using an icing cloud composed of a bimodal distribution of Supercooled Large Droplets. The data consists of photographs, laser scans of the ice surface, and measurements of the mass of ice for each icing condition. The results of ice shapes accumulated as a result of exposure to an icing cloud with a bimodal droplet distribution were compared to the ice shapes resulting from an equivalent cloud composed of a droplet distribution with a standard bell curve shape.

  5. First results from SLD with polarized electron beam at SLC

    International Nuclear Information System (INIS)

    Fero, M.J.

    1992-12-01

    The SLAC Linear Collider (SLC) has been modified to collide a longitudinally polarized electron beam with the unpolarized positron beam. We review the beginning of polarized beam running at the SLC, and report on the measurement of the left-right cross section asymmetry (A LR ) made with a sample of 10,224 Z decays collected over the course of the 1992 run. The average beam polarization for this set of Z decays was 22.4 ± 0.6%(syst.). A LR was measured to be 0.100 ± 0.044(stat.) ± 0.004(syst.). From this measurement, the weak mixing angle defined at the Z boson pole is determined to be sin 2 θ eff W = 0.2378 ± 0.0056 ± 0.0005

  6. HCS-Neurons: identifying phenotypic changes in multi-neuron images upon drug treatments of high-content screening.

    Science.gov (United States)

    Charoenkwan, Phasit; Hwang, Eric; Cutler, Robert W; Lee, Hua-Chin; Ko, Li-Wei; Huang, Hui-Ling; Ho, Shinn-Ying

    2013-01-01

    High-content screening (HCS) has become a powerful tool for drug discovery. However, the discovery of drugs targeting neurons is still hampered by the inability to accurately identify and quantify the phenotypic changes of multiple neurons in a single image (named multi-neuron image) of a high-content screen. Therefore, it is desirable to develop an automated image analysis method for analyzing multi-neuron images. We propose an automated analysis method with novel descriptors of neuromorphology features for analyzing HCS-based multi-neuron images, called HCS-neurons. To observe multiple phenotypic changes of neurons, we propose two kinds of descriptors which are neuron feature descriptor (NFD) of 13 neuromorphology features, e.g., neurite length, and generic feature descriptors (GFDs), e.g., Haralick texture. HCS-neurons can 1) automatically extract all quantitative phenotype features in both NFD and GFDs, 2) identify statistically significant phenotypic changes upon drug treatments using ANOVA and regression analysis, and 3) generate an accurate classifier to group neurons treated by different drug concentrations using support vector machine and an intelligent feature selection method. To evaluate HCS-neurons, we treated P19 neurons with nocodazole (a microtubule depolymerizing drug which has been shown to impair neurite development) at six concentrations ranging from 0 to 1000 ng/mL. The experimental results show that all the 13 features of NFD have statistically significant difference with respect to changes in various levels of nocodazole drug concentrations (NDC) and the phenotypic changes of neurites were consistent to the known effect of nocodazole in promoting neurite retraction. Three identified features, total neurite length, average neurite length, and average neurite area were able to achieve an independent test accuracy of 90.28% for the six-dosage classification problem. This NFD module and neuron image datasets are provided as a freely downloadable

  7. AgRP Neurons Can Increase Food Intake during Conditions of Appetite Suppression and Inhibit Anorexigenic Parabrachial Neurons.

    Science.gov (United States)

    Essner, Rachel A; Smith, Alison G; Jamnik, Adam A; Ryba, Anna R; Trutner, Zoe D; Carter, Matthew E

    2017-09-06

    To maintain energy homeostasis, orexigenic (appetite-inducing) and anorexigenic (appetite suppressing) brain systems functionally interact to regulate food intake. Within the hypothalamus, neurons that express agouti-related protein (AgRP) sense orexigenic factors and orchestrate an increase in food-seeking behavior. In contrast, calcitonin gene-related peptide (CGRP)-expressing neurons in the parabrachial nucleus (PBN) suppress feeding. PBN CGRP neurons become active in response to anorexigenic hormones released following a meal, including amylin, secreted by the pancreas, and cholecystokinin (CCK), secreted by the small intestine. Additionally, exogenous compounds, such as lithium chloride (LiCl), a salt that creates gastric discomfort, and lipopolysaccharide (LPS), a bacterial cell wall component that induces inflammation, exert appetite-suppressing effects and activate PBN CGRP neurons. The effects of increasing the homeostatic drive to eat on feeding behavior during appetite suppressing conditions are unknown. Here, we show in mice that food deprivation or optogenetic activation of AgRP neurons induces feeding to overcome the appetite suppressing effects of amylin, CCK, and LiCl, but not LPS. AgRP neuron photostimulation can also increase feeding during chemogenetic-mediated stimulation of PBN CGRP neurons. AgRP neuron stimulation reduces Fos expression in PBN CGRP neurons across all conditions. Finally, stimulation of projections from AgRP neurons to the PBN increases feeding following administration of amylin, CCK, and LiCl, but not LPS. These results demonstrate that AgRP neurons are sufficient to increase feeding during noninflammatory-based appetite suppression and to decrease activity in anorexigenic PBN CGRP neurons, thereby increasing food intake during homeostatic need. SIGNIFICANCE STATEMENT The motivation to eat depends on the relative balance of activity in distinct brain regions that induce or suppress appetite. An abnormal amount of activity in

  8. Optogenetic activation of serotonergic terminals facilitates GABAergic inhibitory input to orexin/hypocretin neurons

    OpenAIRE

    Chowdhury, Srikanta; Yamanaka, Akihiro

    2016-01-01

    Orexin/hypocretin neurons play a crucial role in the regulation of sleep/wakefulness, primarily in the maintenance of wakefulness. These neurons innervate wide areas of the brain and receive diverse synaptic inputs including those from serotonergic (5-HT) neurons in the raphe nucleus. Previously we showed that pharmacological application of 5-HT directly inhibited orexin neurons via 5-HT1A receptors. However, it was still unclear how 5-HT neurons regulated orexin neurons since 5-HT neurons co...

  9. Failure of Neuronal Maturation in Alzheimer Disease Dentate Gyrus

    Science.gov (United States)

    Li, Bin; Yamamori, Hidenaga; Tatebayashi, Yoshitaka; Shafit-Zagardo, Bridget; Tanimukai, Hitoshi; Chen, She; Iqbal, Khalid; Grundke-Iqbal, Inge

    2011-01-01

    The dentate gyrus, an important anatomic structure of the hippocampal formation, is one of the major areas in which neurogenesis takes place in the adult mammalian brain. Neurogenesis in the dentate gyrus is thought to play an important role in hippocampus-dependent learning and memory. Neurogenesis has been reported to be increased in the dentate gyrus of patients with Alzheimer disease, but it is not known whether the newly generated neurons differentiate into mature neurons. In this study, the expression of the mature neuronal marker high molecular weight microtubule-associated protein (MAP) isoforms MAP2a and b was found to be dramatically decreased in Alzheimer disease dentate gyrus, as determined by immunohistochemistry and in situ hybridization. The total MAP2, including expression of the immature neuronal marker, the MAP2c isoform, was less affected. These findings suggest that newly generated neurons in Alzheimer disease dentate gyrus do not become mature neurons, although neuroproliferation is increased. PMID:18091557

  10. Neurochemistry of bulbospinal presympathetic neurons of the medulla oblongata.

    Science.gov (United States)

    Stornetta, Ruth L

    2009-11-01

    This review focuses on presympathetic neurons in the medulla oblongata including the adrenergic cell groups C1-C3 in the rostral ventrolateral medulla and the serotonergic, GABAergic and glycinergic neurons in the ventromedial medulla. The phenotypes of these neurons including colocalized neuropeptides (e.g., neuropeptide Y, enkephalin, thyrotropin-releasing hormone, substance P) as well as their relative anatomical location are considered in relation to predicting their function in control of sympathetic outflow, in particular the sympathetic outflows controlling blood pressure and thermoregulation. Several explanations are considered for how the neuroeffectors coexisting in these neurons might be functioning, although their exact purpose remains unknown. Although there is abundant data on potential neurotransmitters and neuropeptides contained in the presympathetic neurons, we are still unable to predict function and physiology based solely on the phenotype of these neurons.

  11. Neuronal matrix metalloproteinase-9 is a determinant of selective neurodegeneration.

    Science.gov (United States)

    Kaplan, Artem; Spiller, Krista J; Towne, Christopher; Kanning, Kevin C; Choe, Ginn T; Geber, Adam; Akay, Turgay; Aebischer, Patrick; Henderson, Christopher E

    2014-01-22

    Selective neuronal loss is the hallmark of neurodegenerative diseases. In patients with amyotrophic lateral sclerosis (ALS), most motor neurons die but those innervating extraocular, pelvic sphincter, and slow limb muscles exhibit selective resistance. We identified 18 genes that show >10-fold differential expression between resistant and vulnerable motor neurons. One of these, matrix metalloproteinase-9 (MMP-9), is expressed only by fast motor neurons, which are selectively vulnerable. In ALS model mice expressing mutant superoxide dismutase (SOD1), reduction of MMP-9 function using gene ablation, viral gene therapy, or pharmacological inhibition significantly delayed muscle denervation. In the presence of mutant SOD1, MMP-9 expressed by fast motor neurons themselves enhances activation of ER stress and is sufficient to trigger axonal die-back. These findings define MMP-9 as a candidate therapeutic target for ALS. The molecular basis of neuronal diversity thus provides significant insights into mechanisms of selective vulnerability to neurodegeneration. Copyright © 2014 Elsevier Inc. All rights reserved.

  12. Hunger neurons drive feeding through a sustained, positive reinforcement signal.

    Science.gov (United States)

    Chen, Yiming; Lin, Yen-Chu; Zimmerman, Christopher A; Essner, Rachel A; Knight, Zachary A

    2016-08-24

    The neural mechanisms underlying hunger are poorly understood. AgRP neurons are activated by energy deficit and promote voracious food consumption, suggesting these cells may supply the fundamental hunger drive that motivates feeding. However recent in vivo recording experiments revealed that AgRP neurons are inhibited within seconds by the sensory detection of food, raising the question of how these cells can promote feeding at all. Here we resolve this paradox by showing that brief optogenetic stimulation of AgRP neurons before food availability promotes intense appetitive and consummatory behaviors that persist for tens of minutes in the absence of continued AgRP neuron activation. We show that these sustained behavioral responses are mediated by a long-lasting potentiation of the rewarding properties of food and that AgRP neuron activity is positively reinforcing. These findings reveal that hunger neurons drive feeding by transmitting a positive valence signal that triggers a stable transition between behavioral states.

  13. Synchronization of ;light-sensitive; Hindmarsh-Rose neurons

    Science.gov (United States)

    Castanedo-Guerra, Isaac; Steur, Erik; Nijmeijer, Henk

    2018-04-01

    The suprachiasmatic nucleus is a network of synchronized neurons whose electrical activity follows a 24 h cycle. The synchronization phenomenon (among these neurons) is not completely understood. In this work we study, via experiments and numerical simulations, the phenomenon in which the synchronization threshold changes under the influence of an external (bifurcation) parameter in coupled Hindmarsh-Rose neurons. This parameter ;shapes; the activity of the individual neurons the same way as some neurons in the brain react to light. We corroborate this experimental finding with numerical simulations by quantifying the amount of synchronization using Pearson's correlation coefficient. In order to address the local stability problem of the synchronous state, Floquet theory is applied in the case where the dynamic systems show continuous periodic solutions. These results show how the sufficient coupling strength for synchronization between these neurons is affected by an external cue (e.g. light).

  14. Temporal structure of neuronal population oscillations with empirical model decomposition

    International Nuclear Information System (INIS)

    Li Xiaoli

    2006-01-01

    Frequency analysis of neuronal oscillation is very important for understanding the neural information processing and mechanism of disorder in the brain. This Letter addresses a new method to analyze the neuronal population oscillations with empirical mode decomposition (EMD). Following EMD of neuronal oscillation, a series of intrinsic mode functions (IMFs) are obtained, then Hilbert transform of IMFs can be used to extract the instantaneous time frequency structure of neuronal oscillation. The method is applied to analyze the neuronal oscillation in the hippocampus of epileptic rats in vivo, the results show the neuronal oscillations have different descriptions during the pre-ictal, seizure onset and ictal periods of the epileptic EEG at the different frequency band. This new method is very helpful to provide a view for the temporal structure of neural oscillation

  15. P2X receptors, sensory neurons and pain.

    Science.gov (United States)

    Bele, Tanja; Fabbretti, Elsa

    2015-01-01

    Pain represents a very large social and clinical problem since the current treatment provides insufficient pain relief. Plasticity of pain receptors together with sensitisation of sensory neurons, and the role of soluble mediators released from non-neuronal cells render difficult to understand the spatial and temporal scale of pain development, neuronal responses and disease progression. In pathological conditions, ATP is one of the most powerful mediators that activates P2X receptors that behave as sensitive ATP-detectors, such as neuronal P2X3 receptor subtypes and P2X4 and P2X7 receptors expressed on non-neuronal cells. Dissecting the molecular mechanisms occurring in sensory neurons and in accessory cells allows to design appropriate tissue- and cell- targeted approaches to treat chronic pain.

  16. A hidden Markov model approach to neuron firing patterns.

    Science.gov (United States)

    Camproux, A C; Saunier, F; Chouvet, G; Thalabard, J C; Thomas, G

    1996-11-01

    Analysis and characterization of neuronal discharge patterns are of interest to neurophysiologists and neuropharmacologists. In this paper we present a hidden Markov model approach to modeling single neuron electrical activity. Basically the model assumes that each interspike interval corresponds to one of several possible states of the neuron. Fitting the model to experimental series of interspike intervals by maximum likelihood allows estimation of the number of possible underlying neuron states, the probability density functions of interspike intervals corresponding to each state, and the transition probabilities between states. We present an application to the analysis of recordings of a locus coeruleus neuron under three pharmacological conditions. The model distinguishes two states during halothane anesthesia and during recovery from halothane anesthesia, and four states after administration of clonidine. The transition probabilities yield additional insights into the mechanisms of neuron firing.

  17. [Two-nuclear neurons: sincitial fusion or amitotic division].

    Science.gov (United States)

    Sotnikov, O S; Frumkina, L E; Lactionova, A A; Paramonova, N M; Novakovskaia, S A

    2011-01-01

    In the review the history of research two-nuclear neurons is stated and two hypotheses about mechanisms of their formation are analysed: by sincitial fusion or amytotic divisions. The facts of discrepancy of the former orthodox cellular theory categorically denying possibility sincitial of communications in nervous system and of sincitial fusion neurons are mentioned. As an example results of ultrastructural researches of occurrence sincitium in a cortex of the big brain of rats, in autonomic ganglions, in hypocampus and a cerebellum of adult animals are presented. The video data of the sincitial fusion of live neurons and the mechanism of formation multinuclear neurons in tissue culture are analyzed. Existing data about amytotic a way of formation two-nuclear neurons are critically considered. The conclusion becomes, that the mechanism of formation two-nuclear neurons is cellular fusion. Simultaneously the review confirms our representations about existence in nervous system sincitial interneural communications.

  18. Soft chitosan microbeads scaffold for 3D functional neuronal networks.

    Science.gov (United States)

    Tedesco, Maria Teresa; Di Lisa, Donatella; Massobrio, Paolo; Colistra, Nicolò; Pesce, Mattia; Catelani, Tiziano; Dellacasa, Elena; Raiteri, Roberto; Martinoia, Sergio; Pastorino, Laura

    2018-02-01

    The availability of 3D biomimetic in vitro neuronal networks of mammalian neurons represents a pivotal step for the development of brain-on-a-chip experimental models to study neuronal (dys)functions and particularly neuronal connectivity. The use of hydrogel-based scaffolds for 3D cell cultures has been extensively studied in the last years. However, limited work on biomimetic 3D neuronal cultures has been carried out to date. In this respect, here we investigated the use of a widely popular polysaccharide, chitosan (CHI), for the fabrication of a microbead based 3D scaffold to be coupled to primary neuronal cells. CHI microbeads were characterized by optical and atomic force microscopies. The cell/scaffold interaction was deeply characterized by transmission electron microscopy and by immunocytochemistry using confocal microscopy. Finally, a preliminary electrophysiological characterization by micro-electrode arrays was carried out. Copyright © 2017 Elsevier Ltd. All rights reserved.

  19. Development of rat telencephalic neurons after prenatal x-irradiation

    International Nuclear Information System (INIS)

    Norton, S.

    1979-01-01

    Telencephalic neurons of rats, irradiated at day 15 of gestation with 125 R, develop synaptic connections on dendrites during maturation which appear to be normal spines in Golgi-stained light microscope preparations. At six weeks of postnatal age both control and irradiated rats have spiny dendritic processes on cortical pyramidal cells and caudate Golgi type II neurons. However, when the rats are 6 months old the irradiated rats have more neurons with beaded dendritic processes that lack spines or neurons and are likely to be degenerating neurons. The apparently normal development of the neurons followed by degeneration in the irradiated rat has a parallel in previous reports of the delayed hyperactivity which develops in rats irradiated on the fifteenth gestational day

  20. A minimal model for a slow pacemaking neuron

    International Nuclear Information System (INIS)

    Zakharov, D.G.; Kuznetsov, A.

    2012-01-01

    Highlights: ► We have constructed a phenomenological model for slow pacemaking neurons. ► The model implements a nonlinearity introduced by an ion-dependent current. ► The new nonlinear dependence allows for differentiating responses to various stimuli. ► We discuss implications of our results for a broad class of neurons. - Abstract: We have constructed a phenomenological model for slow pacemaking neurons. These are neurons that generate very regular periodic oscillations of the membrane potential. Many of these neurons also differentially respond to various types of stimulation. The model is based on FitzHugh–Nagumo (FHN) oscillator and implements a nonlinearity introduced by a current that depends on an ion concentration. The comparison with the original FHN oscillator has shown that the new nonlinear dependence allows for differentiating responses to various stimuli. We discuss implications of our results for a broad class of neurons.