
Sample records for prunus persica peach

  1. Peach (Prunus persica L.). (United States)

    Sabbadini, Silvia; Pandolfini, Tiziana; Girolomini, Luca; Molesini, Barbara; Navacchi, Oriano


    Until now, the application of genetic transformation techniques in peach has been limited by the difficulties in developing efficient regeneration and transformation protocols. Here we describe an efficient regeneration protocol for the commercial micropropagation of GF677 rootstock (Prunus persica × Prunus amygdalus). The method is based on the production, via organogenesis, of meristematic bulk tissues characterized by a high competence for shoot regeneration. This protocol has also been used to obtain GF677 plants genetically engineered with an empty hairpin cassette (hereafter indicated as hp-pBin19), through Agrobacterium tumefaciens-mediated transformation. After 7-8 months of selection on media containing kanamycin, we obtained two genetically modified GF677 lines. PCR and Southern blot analyses were performed to confirm the genetic status.

  2. Molecular characterization of peach [Prunus persica (L.) Batsch] germplasm in the United States using microsatellite markers (United States)

    Peach [Prunus persica (L.) Batsch] is an important medicinal fruit with immense health benefits and antioxidant activity. In this study, microsatellite markers were used as DNA fingerprinting tools for the identification and characterization of peach germplasm in the United States. Eleven microsatel...

  3. Comparative assessment of physicochemical properties of unripe peach (Prunus persica) and Japanese apricot (Prunus mume). (United States)

    Kim, Hye-Ryun; Kim, Il-Doo; Dhungana, Sanjeev Kumar; Kim, Mi-Ok; Shin, Dong-Hyun


    To investigate the physicochemical properties of unripe peach-Prunus persica cv. Mibaekdo (Mibaekdo) and Prunus persica cv. Nagasawa Hakuho (Nagasawa Hakuho) as an alternative to food supplement while Japanese apricot (Prunus mume cv. Backaha) (Backaha) was used as a control sample. The unripe fruits were analyzed for soluble solid ( ˚Brix), titratable acidity, pH, total polyphenol content, 1,1-diphenyl-2-picrylhydrazyl (DPPH) radical scavenging activity, amygdalin content, free amino acid content, organic acid content, free sugar content, and α-amylase activities. Total polyphenol content of unripe peach ranged between 137.27-151.64 µg/g whereas that of apricot was 160.73 µg/g. DPPH radical scavenging activities of Backaha was the highest (89.16%) followed by Mibaekdo (85.05%) and Nagasawa Hakuho (41.50%). The highest amount of oxalic acid (612.8 mg/100 g) was observed in Mibaekdo while that of Nagasawa Hakuho and Backaha were (184.6±18.1) and (334.8±16.1) mg/100 g, respectively. Amygdalin contents of Mibaekdo, Nagasawa Hakuho and Backaha were 486.61, 548.60 and 174.28 µg/g, respectively. The results suggest that the unripe fruit of peach has a significant biochemical potential of using as a food supplement with potential health benefit for human health.

  4. Comparative assessment of physicochemical properties of unripe peach (Prunus persica) and Japanese apricot (Prunus mume) (United States)

    Kim, Hye-Ryun; Kim, Il-Doo; Dhungana, Sanjeev Kumar; Kim, Mi-Ok; Shin, Dong-Hyun


    Objective To investigate the physicochemical properties of unripe peach-Prunus persica cv. Mibaekdo (Mibaekdo) and Prunus persica cv. Nagasawa Hakuho (Nagasawa Hakuho) as an alternative to food supplement while Japanese apricot (Prunus mume cv. Backaha) (Backaha) was used as a control sample. Methods The unripe fruits were analyzed for soluble solid ( ˚Brix), titratable acidity, pH, total polyphenol content, 1,1-diphenyl-2-picrylhydrazyl (DPPH) radical scavenging activity, amygdalin content, free amino acid content, organic acid content, free sugar content, and α-amylase activities. Results Total polyphenol content of unripe peach ranged between 137.27-151.64 µg/g whereas that of apricot was 160.73 µg/g. DPPH radical scavenging activities of Backaha was the highest (89.16%) followed by Mibaekdo (85.05%) and Nagasawa Hakuho (41.50%). The highest amount of oxalic acid (612.8 mg/100 g) was observed in Mibaekdo while that of Nagasawa Hakuho and Backaha were (184.6±18.1) and (334.8±16.1) mg/100 g, respectively. Amygdalin contents of Mibaekdo, Nagasawa Hakuho and Backaha were 486.61, 548.60 and 174.28 µg/g, respectively. Conclusions The results suggest that the unripe fruit of peach has a significant biochemical potential of using as a food supplement with potential health benefit for human health. PMID:25182279

  5. Dormancy in Peach (Prunus persica L.) Flower Buds 1 (United States)

    Luna, Virginia; Lorenzo, Eugenia; Reinoso, Herminda; Tordable, Maria C.; Abdala, Guillermina; Pharis, Richard P.; Bottini, Ruben


    Flower buds of peach (Prunus persica L.) trees, cv Novedad de Cordoba (Argentina), were collected near the end of the dormant period and immediately before anthesis. After removal of scale leaves, morphological observations of representative buds, made on transverse and longitudinal microtome sections, showed that all verticils making up the flower are present in an undifferentiated form during the dormant period (June). Flower buds collected at the end of dormant period (August) showed additional growth and differentiation, at which time formation of two ovules was beginning in the unicarpelar gynoecium. Dehiscence of anthers had not yet occurred 10 days before full bloom, and the ovules were still developing. Free endogenous gibberellin (GA)-like substances were quantified by bioassay (Tan-ginbozu dwarf rice microdrop) after SiO2 partition column chromatography, reversed phase C18-high performance liquid chromatography, and finally Nucleosil [N(CH3)2]high performance liquid chromatography. Bioactive fractions were then subjected to capillary gas chromatography-mass spectrometry-selected ion monitoring (GC-MS-SIM). Gibberellins A1, A3, and A8 were tentatively identified in peach flower buds using GC-SIM and Kovat's retention indices, and relative amounts approximated by GC-SIM (2:8:6 for GA1, GA3, and GA8, respectively). The highest concentration (330 nanograms per gram dry weight) of free GA1/GA3 was found in dormant buds (June) and diminished thereafter. The concentration free of GA1/GA3 did not increase immediately prior to bud break. However, high GA1/GA3 concentrations occurred during stages where rate of growth and cellular differentiation of (mainly fertile) verticils can be influenced. Images Figure 1 PMID:16667435

  6. Archaeological evidence for peach (Prunus persica) cultivation and domestication in China. (United States)

    Zheng, Yunfei; Crawford, Gary W; Chen, Xugao


    The cultivated/domesticated peach (Prunus persica var. persica; Rosaceae, subgenus Amygdalus; synonym: Amygdalus persica) originated in China, but its wild ancestor, as well as where, when, and under what circumstances the peach was domesticated, is poorly known. Five populations of archaeological peach stones recovered from Zhejiang Province, China, document peach use and evolution beginning ca. 8000 BP. The majority of the archaeological sites from which the earliest peach stones have been recovered are from the Yangzi River valley, indicating that this is where early selection for favorable peach varieties likely took place. Furthermore, peach stone morphology through time is consistent with the hypothesis that an unknown wild P. persica was the ancestor of the cultivated peach. The oldest archaeological peach stones are from the Kuahuqiao (8000-7000 BP) and Tianluoshan (7000-6500 BP) sites and both stone samples segregate into two size groups, suggesting early selection of preferred types. The first peach stones in China most similar to modern cultivated forms are from the Liangzhu culture (ca. 5300 to 4300 BP), where the peach stones are significantly larger and more compressed than earlier stones. Similar peach stones are reported from Japan much earlier (6700-6400 BP). This large, compressed-stone peach was introduced to Japan and indicates a yet unidentified source population in China that was similar to the Liangzhu culture peach. This study proposes that the lower Yangzi River valley is a region, if not the region, of early peach selection and domestication and that the process began at least 7500 years ago.

  7. Variation in resistance mechanisms to the green peach aphid among different Prunus persica commercial cultivars. (United States)

    Verdugo, J A; Méndez, T; Ortiz-Martínez, S A; Cumsille, R; Ramírez, C C


    ABSTRACT Peaches and nectarines are frequently attacked by the green peach aphid Myzus persicae (Sulzer), with significant negative impacts on fruit production. The genetic variability of resistance to this aphid among commercial cultivars of Prunus persica (L.) Batsch and Prunus persica variety nectarina was evaluated in this study. In total, 16 cultivars of P. persica were selected to evaluate the occurrence and population growth rate of M. persicae in commercial orchards, as well as in no-choice and probing behavior laboratory assays. The results showed variability between cultivars in resistance and susceptibility to M. persicae, with three cultivars exhibiting different signatures of resistance. The peach cultivar 'Elegant Lady' exhibited a low occurrence of aphids in the orchard, a low rate of growth, moderate leaf-rejection in a no-choice test and a higher number and longer period of salivation into sieve elements, suggesting resistance at the phloematic level. The nectarine cultivar 'August Red' also exhibited low aphid occurrence in the orchard, a low rate of growth, and resistance at the prephloem and phloem levels. Finally, the nectarine 'July Red-NS92' exhibited a low occurrence of aphids in the orchard, a higher number of rejections in no-choice assays and no ingestion of phloem during the probing behavior experiments, suggesting prephloematic resistance. The rest of the cultivars studied exhibited clear susceptibility. Hence, different resistance mechanisms are apparent among the studied cultivars. The information gathered in this study regarding the resistance to M. persicae may assist breeding programs aimed at increasing aphid resistance to peaches and nectarines.

  8. The potential of Prunus davidiana for introgression into peach [Prunus persica (L.) Batsch] assessed by comparative mapping. (United States)

    Foulongne, M; Pascal, T; Arús, P; Kervella, J


    The potential for introgression of Prunus davidiana, a wild species related to peach, was evaluated with respect to problems of non-Mendelian segregation or suppressed recombination which often hamper breeding processes based on interspecific crosses. Three connected (F1, F2 and BC2) populations, derived from a cross between P. davidiana clone P1908 and the peach cultivar Summergrand were used. The intraspecific map of P. davidiana already established using the F1 progeny was complemented, and two interspecific maps, for the F2 and BC2 progenies, were built with a set of markers selected from the Prunus reference map. With the molecular data collected for the F2 map construction, regions with distorted marker segregation were detected on the genome; one third of all loci deviated significantly from the expected Mendelian ratios. However, some of these distorted segregations were probably not due to the interspecific cross. On linkage group 6, a skewed area under gametic selection was most likely influenced by the self-incompatibility gene of P. davidiana. Using anchor loci, a good colinearity between the three maps built and the Prunus reference map was demonstrated. Comparative mapping also revealed that homologous recombination occurred normally between P. davidiana and the Prunus persica genome. This confirmed the closeness of the two species. Higher recombination rates were generally observed between P. davidiana and P. persica than between Prunus amygdalus and P. persica. The consequences for plant breeding strategy are discussed. The three maps of the F1, F2 and BC2 progenies provide useful tools for QTL detection and marker-assisted selection, as well as for assessing the efficiency of the peach breeding scheme applied to introgress P. davidiana genes into peach cultivated varieties.

  9. Cultivar identification, pedigree verification, and diversity analysis among Peach (Prunus persica L. Batsch) Cultivars based on Simple Sequence Repeat markers (United States)

    The genetic relationships and pedigree inferences among peach (Prunus persica (L.) Batsch) accessions and breeding lines used in genetic improvement were evaluated using 15 simple sequence repeat (SSR) markers. A total of 80 alleles were detected among the 37 peach accessions with an average of 5.53...

  10. Endogenous hormones response to cytokinins with regard to organogenesis in explants of peach (Prunus persica L. Batsch) cultivars and rootstocks (P. persica × Prunus dulcis). (United States)

    Pérez-Jiménez, Margarita; Cantero-Navarro, Elena; Pérez-Alfocea, Francisco; Cos-Terrer, José


    Organogenesis in peach (Prunus persica L. Batsch) and peach rootstocks (P. persica × Prunus dulcis) has been achieved and the action of the regeneration medium on 7 phytohormones, zeatin (Z), zeatin riboside (ZR), indole-3-acetic acid (IAA), abscisic acid (ABA), ethylene precursor 1-aminocyclopropane-1-carboxylic acid (ACC), salicylic acid (SA), and jasmonic acid (JA), has been studied using High performance liquid chromatography - mass spectrometry (HPLC-MS/MS). Three scion peach cultivars, 'UFO-3', 'Flariba' and 'Alice Bigi', and the peach × almond rootstocks 'Garnem' and 'GF677' were cultured in two different media, Murashige and Skoog supplemented with plant growth regulators (PGRs) (regeneration medium) and without PGRs (control medium), in order to study the effects of the media and/or genotypes in the endogenous hormones content and their role in organogenesis. The highest regeneration rate was obtained with the peach × almond rootstocks and showed a lower content of Z, IAA, ABA, ACC and JA. Only Z, ZR and IAA were affected by the action of the culture media. This study shows which hormones are external PGRs-dependent and what is the weight of the genotype and hormones in peach organogenesis that provide an avenue to manipulate in vitro organogenesis in peach. Copyright © 2014 Elsevier Masson SAS. All rights reserved.

  11. Phenotypic diversity among peach and nectarine (Prunus persica L.) fruit in the national prunus collection at the USDA-ARS, National Clonal Germplasm Repository (NCGR) (United States)

    The diversity and relationships of fruit quality traits peach and nectarine (Prunus persica L.) in the National Prunus collection were studied using comprehensive phenotyping methods. The collection was re-propagated in 2013 and planted in 2014 providing a unique opportunity to evaluate an even-aged...

  12. New insights into the properties of pubescent surfaces: the peach fruit (prunus persica batsch) as a model


    Fernández, Victoria; Khayet, Mohamed; Montero Prado, Pablo; Heredia Guerrero, Alejandrio; Liakopulos, Georgios; Karabourniotis, George; del Río, Víctor; Domínguez, Eva; Tacchini, Ignacio; Nerín, Csritian¡a; Heredia, Antonio


    The surface of peach (Prunus persica ‘Calrico’) is covered by a dense indumentum, which may serve various protective purposes. With the aim of relating structure to function, the chemical composition, morphology, and hydrophobicity of the peach skin was assessed as a model for a pubescent plant surface. Distinct physicochemical features were observed for trichomes versus isolated cuticles. Peach cuticles were composed of 53% cutan, 27% waxes, 23% cutin, and 1% hydroxycinnamic acid derivatives...

  13. Investigation of the aroma of commercial peach (Prunus persica L. Batsch) types by Proton Transfer Reaction-Mass Spectrometry (PTR-MS) and sensory analysis

    NARCIS (Netherlands)

    Cardoso Ferreira Pinhancos de Bianchi, Tiago; Weesepoel, Yannick; Koot, Alex; Iglesias, Ignasi; Eduardo, Iban; Gratacós-Cubarsí, Marta; Guerrero, Luis; Hortós, Maria; Ruth, van Saskia


    The aim of this study was to investigate the aroma and sensory profiles of various types of peaches (Prunus persica L. Batsch.). Forty-three commercial cultivars comprising peaches, flat peaches, nectarines, and canning peaches (pavías) were grown over two consecutive harvest years. Fruits were

  14. Development of sequence-tagged site markers linked to the pillar growth type in peach (Prunus persica) (United States)

    In peach [Prunus persica (L.) Batsch], trees showing columnar [also termed pillar or broomy] growth habit are of interest for high density production systems. While the selection of the columnar homozygote (pillar) phenotype (brbr) can be carried out prior to field planting, the intermediate hetero...

  15. Unique expression, processing regulation, and regulatory network of peach (Prunus persica) miRNAs. (United States)

    Zhu, Hong; Xia, Rui; Zhao, Bingyu; An, Yong-qiang; Dardick, Chris D; Callahan, Ann M; Liu, Zongrang


    MicroRNAs (miRNAs) have recently emerged as important gene regulators in plants. MiRNAs and their targets have been extensively studied in Arabidopsis and rice. However, relatively little is known about the characterization of miRNAs and their target genes in peach (Prunus persica), which is a complex crop with unique developmental programs. We performed small RNA deep sequencing and identified 47 peach-specific and 47 known miRNAs or families with distinct expression patterns. Together, the identified miRNAs targeted 80 genes, many of which have not been reported previously. Like the model plant systems, peach has two of the three conserved trans-acting siRNA biogenesis pathways with similar mechanistic features and target specificity. Unique to peach, three of the miRNAs collectively target 49 MYBs, 19 of which are known to regulate phenylpropanoid metabolism, a key pathway associated with stone hardening and fruit color development, highlighting a critical role of miRNAs in the regulation of peach fruit development and ripening. We also found that the majority of the miRNAs were differentially regulated in different tissues, in part due to differential processing of miRNA precursors. Up to 16% of the peach-specific miRNAs were differentially processed from their precursors in a tissue specific fashion, which has been rarely observed in plant cells. The miRNA precursor processing activity appeared not to be coupled with its transcriptional activity but rather acted independently in peach. Collectively, the data characterizes the unique expression pattern and processing regulation of peach miRNAs and demonstrates the presence of a complex, multi-level miRNA regulatory network capable of targeting a wide variety of biological functions, including phenylpropanoid pathways which play a multifaceted spatial-temporal role in peach fruit development.

  16. Unique expression, processing regulation, and regulatory network of peach (Prunus persica miRNAs

    Directory of Open Access Journals (Sweden)

    Zhu Hong


    Full Text Available Abstract Background MicroRNAs (miRNAs have recently emerged as important gene regulators in plants. MiRNAs and their targets have been extensively studied in Arabidopsis and rice. However, relatively little is known about the characterization of miRNAs and their target genes in peach (Prunus persica, which is a complex crop with unique developmental programs. Results We performed small RNA deep sequencing and identified 47 peach-specific and 47 known miRNAs or families with distinct expression patterns. Together, the identified miRNAs targeted 80 genes, many of which have not been reported previously. Like the model plant systems, peach has two of the three conserved trans-acting siRNA biogenesis pathways with similar mechanistic features and target specificity. Unique to peach, three of the miRNAs collectively target 49 MYBs, 19 of which are known to regulate phenylpropanoid metabolism, a key pathway associated with stone hardening and fruit color development, highlighting a critical role of miRNAs in the regulation of peach fruit development and ripening. We also found that the majority of the miRNAs were differentially regulated in different tissues, in part due to differential processing of miRNA precursors. Up to 16% of the peach-specific miRNAs were differentially processed from their precursors in a tissue specific fashion, which has been rarely observed in plant cells. The miRNA precursor processing activity appeared not to be coupled with its transcriptional activity but rather acted independently in peach. Conclusions Collectively, the data characterizes the unique expression pattern and processing regulation of peach miRNAs and demonstrates the presence of a complex, multi-level miRNA regulatory network capable of targeting a wide variety of biological functions, including phenylpropanoid pathways which play a multifaceted spatial-temporal role in peach fruit development.

  17. Transcriptome analysis of peach (Prunus persica L. Batsch) during the late stage of fruit ripening. (United States)

    Pan, H F; Sheng, Y; Gao, Z H; Chen, H L; Qi, Y J; Yi, X K; Qin, G H; Zhang, J Y


    Fruit ripening is a complex developmental process, the details of which remain largely unknown in fleshy fruits. In this paper, the fruit flesh of two peach varieties, "Zhongyou9" (a nectarine; Prunus persica L. Batsch) and its mutant "Hongyu", was analyzed by RNA-seq technology during two stages of ripening at 20-day intervals. One hundred and eighty significant upregulated and two hundred and thirty-five downregulated genes were identified in the experiment. Many of these genes were related to plant hormones, chlorophyll breakdown, accumulation of aroma and flavor volatiles, and stress. To the best of our knowledge, this is the first transcriptome analysis of peach ripening, and our data will be useful for further studies of the molecular basis of fruit ripening.

  18. Peach (Prunus persica) extract inhibits angiotensin II-induced signal transduction in vascular smooth muscle cells. (United States)

    Kono, Ryohei; Okuno, Yoshiharu; Nakamura, Misa; Inada, Ken-ichi; Tokuda, Akihiko; Yamashita, Miki; Hidaka, Ryu; Utsunomiya, Hirotoshi


    Angiotensin II (Ang II) is a vasoactive hormone that has been implicated in cardiovascular diseases. Here, the effect of peach, Prunus persica L. Batsch, pulp extract on Ang II-induced intracellular Ca(2+) mobilization, reactive oxygen species (ROS) production and signal transduction events in cultured vascular smooth muscle cells (VSMCs) was investigated. Pretreatment of peach ethyl acetate extract inhibited Ang II-induced intracellular Ca(2+) elevation in VSMCs. Furthermore, Ang II-induced ROS generation, essential for signal transduction events, was diminished by the peach ethyl acetate extract. The peach ethyl acetate extract also attenuated the Ang II-induced phosphorylation of epidermal growth factor receptor and myosin phosphatase target subunit 1, both of which are associated with atherosclerosis and hypertension. These results suggest that peach ethyl acetate extract may have clinical potential for preventing cardiovascular diseases by interfering with Ang II-induced intracellular Ca(2+) elevation, the generation of ROS, and then blocking signal transduction events. Copyright © 2013 Elsevier Ltd. All rights reserved.

  19. Molecular cloning and expression analysis of an arginine decarboxylase gene from peach (Prunus persica). (United States)

    Liu, Ji Hong; Ban, Yusuke; Wen, Xiao-Peng; Nakajima, Ikuko; Moriguchi, Takaya


    Arginine decarboxylase (ADC), one of the enzymes responsible for putrescine (Put) biosynthesis, has been shown to be implicated in stress response. In the current paper attempts were made to clone and characterize a gene encoding ADC from peach (Prunus persica (L.) Batsch, 'Akatsuki'). Rapid amplification of cDNA ends (RACE) gave rise to a full-length ADC cDNA (PpADC) with a complete open reading frame of 2178 bp, encoding a 725 amino acid polypeptide. Homology search and sequence multi-alignment demonstrated that the deduced PpADC protein sequence shared a high identity with ADCs from other plants, including several highly conservative motifs and amino acids. Southern blotting indicated that PpADC existed in peach genome as a single gene. Expression levels of PpADC in different tissues of peach (P. persica 'Akatsuki') were spatially and developmentally regulated. Treatment of peach shoots from 'Mochizuki' with exogenous 5 mM Put, an indirect product of ADC, remarkably induced accumulation of PpADC mRNA. Transcripts of PpADC in peach leaves from 'Mochizuki' were quickly induced, either transiently or continuously, in response to dehydration, high salinity (200 mM NaCl), low temperature (4 degrees C) and heavy metal (150 microM CdCl(2)), but repressed by high temperature 37 degrees C) during a 2-day treatment, which changed in an opposite direction when the stresses were otherwise removed with the exception of CdCl(2) treatment. In addition, steady-state of PpADC mRNA could be also transiently up-regulated by abscisic acid (ABA) in 'Mochizuki' leaves. All of these, taken together, suggest that PpADC is a stress-responsive gene and can be considered as a potential target that is genetically manipulated so as to create novel germplasms with enhanced stress tolerance in the future.

  20. Comparative population genomics reveals the domestication history of the peach, Prunus persica, and human influences on perennial fruit crops. (United States)

    Cao, Ke; Zheng, Zhijun; Wang, Lirong; Liu, Xin; Zhu, Gengrui; Fang, Weichao; Cheng, Shifeng; Zeng, Peng; Chen, Changwen; Wang, Xinwei; Xie, Min; Zhong, Xiao; Wang, Xiaoli; Zhao, Pei; Bian, Chao; Zhu, Yinling; Zhang, Jiahui; Ma, Guosheng; Chen, Chengxuan; Li, Yanjun; Hao, Fengge; Li, Yong; Huang, Guodong; Li, Yuxiang; Li, Haiyan; Guo, Jian; Xu, Xun; Wang, Jun


    Recently, many studies utilizing next generation sequencing have investigated plant evolution and domestication in annual crops. Peach, Prunus persica, is a typical perennial fruit crop that has ornamental and edible varieties. Unlike other fruit crops, cultivated peach includes a large number of phenotypes but few polymorphisms. In this study, we explore the genetic basis of domestication in peach and the influence of humans on its evolution. We perform large-scale resequencing of 10 wild and 74 cultivated peach varieties, including 9 ornamental, 23 breeding, and 42 landrace lines. We identify 4.6 million SNPs, a large number of which could explain the phenotypic variation in cultivated peach. Population analysis shows a single domestication event, the speciation of P. persica from wild peach. Ornamental and edible peach both belong to P. persica, along with another geographically separated subgroup, Prunus ferganensis. Our analyses enhance our knowledge of the domestication history of perennial fruit crops, and the dataset we generated could be useful for future research on comparative population genomics.

  1. Phenolic composition and antioxidant properties of different peach [Prunus persica (L.) Batsch] cultivars in China. (United States)

    Zhao, Xiaoyong; Zhang, Wenna; Yin, Xueren; Su, Mingshen; Sun, Chongde; Li, Xian; Chen, Kunsong


    China is an important centre of diversity for Prunus persica. In the present study, 17 Chinese peach cultivars were evaluated for phenolic content and antioxidant activity. Neochlorogenic acid (NCHA), chlorogenic acid (CHA), procyanidin B1 (B1), catechin (CAT), cyanidin-3-O-glucoside (C3G), quercetin-3-O-galactoside (Q3GAL), quercetin-3-O-glucoside (Q3GLU), quercetin-3-O-rutinoside (Q3R), and kaempferol-3-O-rutinoside (K3R) were identified and quantified. CHA and CAT were the predominant components in both the peel and pulp of this fruit. In general, peel extracts showed higher antioxidant activities than the pulp counterparts, consistent with the observed higher phenolic content. The melting peach cultivar "Xinyu" showed the highest antioxidant potency composite (APC) index. The principal component analysis (PCA) of peel phenolics showed a clear distinction between the melting peach and nectarine. Overall, peach cultivars rich in hydroxycinnamates and flavan-3-ols showed relatively higher antioxidant activities and might be excellent sources of phytochemicals and natural antioxidants.

  2. Extrafloral nectaries alter arthropod community structure and mediate peach (Prunus persica) plant defense. (United States)

    Mathews, Clarissa R; Bottrell, Dale G; Brown, Mark W


    We investigated the role of extrafloral nectaries (EFNs) in mediating plant defense for newly established peach (Prunus persica) trees. We used peaches of a single cultivar ("Lovell") that varied with respect to EFN leaf phenotype (with or without EFNs) to determine if the EFNs affected the structure of the arthropod community colonizing newly planted seedlings. We also tested if the plants producing EFNs benefited from reduced herbivory or enhanced productivity. In the first year following planting, the young peach trees with EFNs were dominated by ants, and arthropod community diversity was lower than for trees without EFNs. The young trees with EFNs harbored fewer herbivores and experienced a twofold reduction in folivory compared to trees without EFNs. Productivity was also enhanced for the trees with EFNs, which attained significantly higher rates of trunk growth, greater terminal carbon composition, and a threefold increase in buds produced in subsequent years. In the second year of the field study, ants remained numerically dominant on trees with EFNs, but arthropod community diversity was higher than for trees without EFNs. An additional study revealed that folivory rates in May increased dramatically for trees with EFNs if ants were excluded from their canopies, indicating that ants have a protective function when the perennial trees produce new leaves. However, in later months, regardless of ants' presence, the trees with EFNs suffered less folivory than trees lacking EFNs. The diversity and richness of the predator trophic group increased when ants were excluded from trees with EFNs, but overall community diversity (i.e., herbivores and predators combined) was not affected by the ants' presence. Our research indicates that the EFNs play an important role in attracting predators that protect the trees from herbivores, and the EFN host-plant characteristic should be retained in future peach cultivar selections. Furthermore, peach production programs aimed

  3. Accelerated solvent extraction of carotenoids from: Tunisian Kaki (Diospyros kaki L.), peach (Prunus persica L.) and apricot (Prunus armeniaca L.). (United States)

    Zaghdoudi, Khalil; Pontvianne, Steve; Framboisier, Xavier; Achard, Mathilde; Kudaibergenova, Rabiga; Ayadi-Trabelsi, Malika; Kalthoum-Cherif, Jamila; Vanderesse, Régis; Frochot, Céline; Guiavarc'h, Yann


    Extraction of carotenoids from biological matrices and quantifications remains a difficult task. Accelerated solvent extraction was used as an efficient extraction process for carotenoids extraction from three fruits cultivated in Tunisia: kaki (Diospyros kaki L.), peach (Prunus persica L.) and apricot (Prunus armeniaca L.). Based on a design of experiment (DoE) approach, and using a binary solvent consisting of methanol and tetrahydrofuran, we could identify the best extraction conditions as being 40°C, 20:80 (v:v) methanol/tetrahydrofuran and 5 min of extraction time. Surprisingly and likely due to the high extraction pressure used (103 bars), these conditions appeared to be the best ones both for extracting xanthophylls such as lutein, zeaxanthin or β-cryptoxanthin and carotenes such as β-carotene, which present quite different polarities. Twelve surface responses were generated for lutein, zeaxanthin, β-cryptoxanthin and β-carotene in kaki, peach and apricot. Further LC-MS analysis allowed comparisons in carotenoids profiles between the fruits. Copyright © 2015 Elsevier Ltd. All rights reserved.

  4. Identification of Proteins from Prunus persica That Interact with Peach Latent Mosaic Viroid▿ (United States)

    Dubé, Audrey; Bisaillon, Martin; Perreault, Jean-Pierre


    Peach latent mosaic viroid (PLMVd) is a small, single-stranded, circular RNA pathogen that infects Prunus persica trees. As with all other known viroids, the PLMVd genome does not encode any proteins. Consequently, it must interact with host cellular factors in order to ensure its life cycle. With the objective of identifying cellular proteins that interact with PLMVd, Northwestern hybridizations were performed using partially purified peach leaf extracts. Mass spectrometric analysis of the detected RNA-protein complexes led to the identification of six putative RNA-binding proteins. One of these was found to be elongation factor 1-alpha (eEF1A), and because of its known involvement in the replication and translation of various RNA viruses, further characterizations were performed. Initially, the existence of this interaction received support from an experiment that immunoprecipitated the eEF1A from a crude extract of infected peach leaves, coupled with reverse transcription-PCR detection of the PLMVd. Subsequently, eEF1A interaction with PLMVd strands of both polarities was confirmed in vitro by electrophoresis mobility shift assays, fluorescence spectroscopy, and the prediction of an altered PLMVd RNase mapping profile in the presence of the protein. The potential contribution of eEF1A to the molecular biology of PLMVd, including for viroid replication, is discussed. PMID:19759139

  5. Glucitol dehydrogenase from peach (Prunus persica) fruits is regulated by thioredoxin h. (United States)

    Hartman, Matías D; Figueroa, Carlos M; Piattoni, Claudia V; Iglesias, Alberto A


    Glucitol (Gol) is a major photosynthetic product in plants from the Rosaceae family. Herein we report the molecular cloning, heterologous expression and characterization of Gol dehydrogenase (GolDHase, EC from peach (Prunus persica) fruits. The recombinant enzyme showed kinetic parameters similar to those reported for orthologous enzymes purified from apple and pear fruits. The activity of recombinant GolDHase was strongly inhibited by Cu(2+) and Hg(2+), suggesting that it might have cysteine residues critical for functionality. Oxidizing compounds (such as diamide, hydrogen peroxide and oxidized glutathione) inactivated the enzyme, whereas its activity was restored after incubation with reduced glutathione and thioredoxin from Escherichia coli. Recombinant thioredoxin h from peach fruits also recovered the activity of oxidized GolDHase. Our results suggest that peach fruit GolDHase could be redox regulated in vivo and this would be of relevance to determine carbon assimilation and partitioning in plants accumulating sugar alcohols. © The Author 2014. Published by Oxford University Press on behalf of Japanese Society of Plant Physiologists. All rights reserved. For permissions, please email:

  6. Transcriptome analysis of seed dormancy after rinsing and chilling in ornamental peaches (Prunus persica (L.) Batsch). (United States)

    Kanjana, Worarad; Suzuki, Tomohiro; Ishii, Kazuo; Kozaki, Toshinori; Iigo, Masayuki; Yamane, Kenji


    Ornamental peaches cv. 'Yaguchi' (Prunus persica (L.) Batsch) can be propagated via seeds. The establishment of efficient seed treatments for early germination and seedling growth is required to shorten nursery and breeding periods. It is important, therefore, to identify potential candidate genes responsible for the effects of rinsing and chilling on seed germination. We hypothesized that longer rinsing combined with chilling of seeds can alter the genes expression in related to dormancy and then raise the germination rate in the peach. To date, most molecular studies in peaches have involved structural genomics, and few transcriptome studies of seed germination have been conducted. In this study, we investigated the function of key seed dormancy-related genes using next-generation sequencing to profile the transcriptomes involved in seed dormancy in peaches. De novo assembly and analysis of the transcriptome identified differentially expressed and unique genes present in this fruit. De novo RNA-sequencing of peach was performed using the Illumina Miseq 2000 system. Paired-end sequence from mRNAs generated high quality sequence reads (9,049,964, 10,026,362 and 10,101,918 reads) from 'Yaguchi' peach seeds before rinsed (BR) and after rinsed for 2 or 7 days with a chilling period of 4 weeks (termed 2D4W and 7D4W), respectively. The germination rate of 7D4W was significantly higher than that of 2D4W. In total, we obtained 51,366 unique sequences. Differential expression analysis identified 7752, 8469 and 506 differentially expressed genes from BR vs 2D4W, BR vs 7D4W and 2D4W vs 7D4W libraries respectively, filtered based on p-value and an adjusted false discovery rate of less than 0.05. This study identified genes associated with the rinsing and chilling process that included those associated with phytohormones, the stress response and transcription factors. 7D4W treatment downregulated genes involved in ABA synthesis, catabolism and signaling pathways, which

  7. Pattern recognition of peach cultivars (Prunus persica L.) from their volatile components. (United States)

    Montero-Prado, Pablo; Bentayeb, Karim; Nerín, Cristina


    The volatile compounds of four peach cultivars (Prunus persica L.) were studied: Sudanell, San Lorenzo, Miraflores and Calanda (two clones, Calante and Jesca). 17-23 Samples of each cultivar with the same maturity level were analyzed, measuring color, firmness, and soluble solids content. The pulp was crushed and mixed with water prior to HS-SPME analysis, and GC-MS was used to determine the volatile compounds. Sixty-five compounds were identified using spectral library matching, Kovat's indices and, when available, pure standards. The main components were lactones and C6 compounds. From the distribution of these compounds, Principal Component Analysis led to the clustering of the samples according to their different cultivars. Finally, Canonical Component Analysis was used to create a classification function that identifies the origin of an unknown sample from its volatile composition. The results obtained will help to avoid fraud and protect the European Designation of Origin 'Melocotón de Calanda'. Copyright © 2012 Elsevier Ltd. All rights reserved.

  8. Peach (Prunus persica) fruit response to anoxia: reversible ripening delay and biochemical changes. (United States)

    Lara, María V; Budde, Claudio O; Porrini, Lucía; Borsani, Julia; Murray, Ricardo; Andreo, Carlos S; Drincovich, María F


    The use of modified atmospheres has been successfully applied in different fruits to delay the ripening process and to prevent physiological disorders. In addition, during normal ripening, hypoxic areas are generated inside the fruit; moreover, anaerobic conditions may also arise during fruit post-harvest storage and handling. In consequence, the fruit is an interesting model to analyze the metabolic modifications due to changes in oxygen levels. In this work, a 72 h anoxic treatment by using an N(2) storage atmosphere was applied to peaches (Prunus persica L. Batsch) after harvest. Ripening was effectively delayed in treated fruits, preventing fruit softening, color changes and ethylene production. Metabolic changes induced by anoxia included induction of fermentative pathways, glycolysis and enzymes involved in both sucrose synthesis and degradation. Sucrose, fructose and glucose contents remained unchanged in treated fruit, probably due to sucrose cycling. Sorbitol was not consumed and citrate was increased, correlating with citric acid cycle impairment due to O(2) deprivation. Malate content was not affected, indicating compensation in the reactions producing and consuming malate. Changes in malic enzymes and pyruvate orthophosphate dikinase may provide pyruvate for fermentation or even act to regenerate NADP. After fruit transfer to aerobic conditions, no signs of post-anoxia injury were observed and metabolic changes were reversed, with the exception of acetaldehyde levels. The results obtained indicate that peach fruit is an organ with a high capacity for anoxic tolerance, which is in accord with the presence of hypoxic areas inside fruits and the fact that hypoxic pre-treatment improves tolerance to subsequent anoxia.

  9. Increased levels of IAA are required for system 2 ethylene synthesis causing fruit softening in peach (Prunus persica L. Batsch). (United States)

    Tatsuki, Miho; Nakajima, Naoko; Fujii, Hiroshi; Shimada, Takehiko; Nakano, Michiharu; Hayashi, Ken-ichiro; Hayama, Hiroko; Yoshioka, Hirohito; Nakamura, Yuri


    The fruit of melting-flesh peach (Prunus persica L. Batsch) cultivars produce high levels of ethylene caused by high expression of PpACS1 (an isogene of 1-aminocyclopropane-1-carboxylic acid synthase), resulting in rapid fruit softening at the late-ripening stage. In contrast, the fruit of stony hard peach cultivars do not soften and produce little ethylene due to low expression of PpACS1. To elucidate the mechanism for suppressing PpACS1 expression in stony hard peaches, a microarray analysis was performed. Several genes that displayed similar expression patterns as PpACS1 were identified and shown to be indole-3-acetic acid (IAA)-inducible genes (Aux/IAA, SAUR). That is, expression of IAA-inducible genes increased at the late-ripening stage in melting flesh peaches; however, these transcripts were low in mature fruit of stony hard peaches. The IAA concentration increased suddenly just before harvest time in melting flesh peaches exactly coinciding with system 2 ethylene production. In contrast, the IAA concentration did not increase in stony hard peaches. Application of 1-naphthalene acetic acid, a synthetic auxin, to stony hard peaches induced a high level of PpACS1 expression, a large amount of ethylene production and softening. Application of an anti-auxin, α-(phenylethyl-2-one)-IAA, to melting flesh peaches reduced levels of PpACS1 expression and ethylene production. These observations indicate that suppression of PpACS1 expression at the late-ripening stage of stony hard peach may result from a low level of IAA and that a high concentration of IAA is required to generate a large amount of system 2 ethylene in peaches.

  10. Mites fluctuation population on peach tree (Prunus persica (L. Batsch and in associated plants

    Directory of Open Access Journals (Sweden)

    Carla Rosana Eichelberger


    Full Text Available Despite the importance of peach (Prunus persica (L. Batsch in Rio Grande do Sul, little is known about mites fluctuation population considered important to this crop. The objective of this study was to know the population diversity and fluctuation of mite species associated with Premier and Eldorado varieties in Roca Sales and Venâncio Aires counties, Rio Grande do Sul. The study was conducted from July 2008 to June 2009 when 15 plants were randomly chosen in each area. The plants were divided in quadrants and from each one a branch was chosen from which three leaves were removed: one collected in the apical region, another in the medium and the other in the basal region, totalizing 180 leaves/area. Five of the most abundant associated plants were collected monthly in enough amounts for the screening under the stereoscopic microscope during an hour. A total of 1,124 mites were found belonging to 14 families and 28 species. Tetranychus ludeni Zacher, 1913, Panonychus ulmi (Koch, 1836 and Mononychellus planki (McGregor, 1950 were the most abundant phytophagous mites, whereas Typhlodromalus aripo Deleon, 1967 and Phytoseiulus macropilis (Banks, 1904 the most common predatory mites. The period of one hour under stereoscopic microscope was enough to get a representative sample. In both places evaluated the ecologic indices were low, but little higherin Premier (H' 0.56; EqJ: 0.43 when compared to Eldorado (H' 0.53; EqJ 0.40. In Premier constant species were not observed and accessory only Brevipalpus phoenicis (Geijskes, 1939, T. ludeni and T. aripo. Higher abundance was observed in December and January and bigger amount in April. Already in Eldorado, T. ludeni and P. ulmi were constants. Greater abundance was observed in November and December, whereas grater richness in December and January. In both orchards were not found mites in buds. Tetranychus ludeni is the most abundant phytophagous mites with outbreak population in November, December and

  11. Variation in Minerals, Phenolics and Antioxidant Activity of Peel and Pulp of Different Varieties of Peach (Prunus persica L.) Fruit from Pakistan


    Muhammad Ashraf; Zahed Mahmood; Umer Rashid; Maleeha Manzoor; Farooq Anwar


    Peach (Prunus persica L.), being a potential source of bioactive compounds, has been demonstrated to have medicinal benefits. In this study variation of minerals and antioxidant characteristics (total phenolic contents, total flavonoid contents, reducing power, inhibition of peroxidation using linoleic acid system and DPPH free radical scavenging activity) between peel and pulp parts of different peach varieties, namely Golden, Shireen, and Shahpasand were investigated. T...

  12. Protective Effect of White-fleshed Peach (Prunus persica (L.) Batsch) on Chronic Nicotine-induced Toxicity. (United States)

    Kim, Hyun-Jeong; Park, Kwang-Kyun; Chung, Won-Yoon; Lee, Sun Kyoung; Kim, Ki-Rim


    Nicotine is a major toxic component of tobacco smoke and has been recognized as a risk factor to induce oxidative tissue damage, which is a precursor to cardiovascular diseases, lung-related diseases, and cancers. Peaches (Prunus persica) have been used for the treatment of degenerative disorders, such as hypermenorrhea, dysmenorrhea, and infertility in Asian countries. In this study, we investigated the effects of white-fleshed peach on the excretion of nicotine metabolites and 1-hydroxypyrene in smokers and chronic nicotine-induced tissue damages in mice. The concentrations of cotinine and 1-hydroxypyrene were measured in urine of smokers before or after intake of white-fleshed peaches. In addition, ICR mice were injected with nicotine (5 mg/kg body weight) and then orally administered with white-fleshed peach extracts (WFPE) (250 or 500 mg/kg body weight) for 36 days. The oxidative stress parameters and the activities of antioxidant enzymes were measured in liver and kidney tissues. Also, histological changes and nitrotyrosine expression were assessed. Intake of white-fleshed peaches increased the urinary concentration of nicotine metabolites and 1-hydroxypyrene in 91.67% and 83.33% of smokers, respectively. WFPE decreased the malondialdehyde levels and recovered the activities of antioxidant enzymes in nicotine-injected mice. In addition, WFPE inhibited nitrotyrosine expression and inflammatory responses in the liver, kidney, and lung tissues of nicotine-treated mice. White-fleshed peaches may increase the metabolism of toxic components in tobacco smoke in smokers and protect normal tissues against nicotine toxicity in mice. Therefore, supplementation of white-fleshed peaches might be beneficial to smokers.

  13. Genome-wide analysis and identification of KT/HAK/KUP potassium transporter gene family in peach (Prunus persica). (United States)

    Song, Z Z; Ma, R J; Yu, M L


    The KT/HAK/KUP family members encoding high-affinity potassium (K(+)) transporters mediate K(+) transport across the plasma membranes of plant cells to maintain plant normal growth and metabolic activities. In this paper, we identified 16 potassium transporter genes in the peach (Prunus persica) using the Hidden Markov model scanning strategy and searching the peach genome database. Utilizing the Arabidopsis KT/HAK/KUP family as a reference, phylogenetic analysis indicates that the KT/HAK/KUP family in the peach can be classified into 3 groups. Genomic localization indicated that 16 KT/HAK/KUP family genes were well distributed on 7 scaffolds. Gene structure analysis showed that the KT/HAK/KUP family genes have 6-9 introns. In addition, all of the KT/HAK/KUP family members were hydrophobic proteins; they exhibited similar secondary structure patterns and homologous tertiary structures. Putative cis-elements involved in abiotic stress adaption, Ca(2+) response, light and circadian rhythm regulation, and seed development were observed in the promoters of the KT/HAK/KUP family genes. Subcellular localization prediction indicated that the KT/HAK/KUP members were mainly located in the plasma membrane. Expression levels of the KT/HAK/ KUP family genes were much higher in the fruit and flower than those in the other 7 tissues examined, indicating that the KT/HAK/KUP family genes may have important roles in K(+) uptake and transport, which mainly contribute to flower formation and fruit development in the peach.

  14. Improvement of Root System Architecture in Peach (Prunus persica) Seedlings by Arbuscular Mycorrhizal Fungi, Related to Allocation of Glucose/Sucrose to Root


    Wu, Qiang-Sheng; Guo-Huai LI; Zou, Ying-Ning


    Root system architecture (RSA) is used to describe the spatial configuration of a root system in the soil, which substantially determines the capacity of a plant to take up nutrients and water. The present study was to assess if arbuscular mycorrhizal fungi (AMF), Glomus mosseae, G. versiforme, and Paraglomus occultum would alter RSA of peach (Prunus persica L. Batsch) seedlings, and the alteration due to mycorrhization was related to allocation of glucose/sucrose to root (Aglucose/sucrose). ...

  15. Prunus persica var. platycarpa (Tabacchiera Peach): Bioactive Compounds and Antioxidant Activity of Pulp, Peel and Seed Ethanolic Extracts. (United States)

    Loizzo, Monica R; Pacetti, Deborah; Lucci, Paolo; Núñez, Oscar; Menichini, Francesco; Frega, Natale Giuseppe; Tundis, Rosa


    A comparative analysis of ethanol extracts from peel, pulp and seed of Prunus persica var. platycarpa (Tabacchiera peach) was done. The total phenol, flavonoid and carotenoid content as well as the antioxidant properties by using different in vitro assays (DPPH, ABTS, FRAP, Fe-chelating, β-carotene bleaching test) were evaluated. Pulp extract was subjected to liquid chromatography-electrospray-tandem mass spectrometry (HPLC-ESI-MS/MS). Gallic acid, protocatechuic acid, protocatechualdehyde, chlorogenic acid, p-coumaric acid, and ferulic acid were identified as main constituents. Pulp extract was characterized by the highest total phytonutrients content and exhibited the highest antioxidant activity in all in vitro assays (IC(50) values of 2.2 μg/mL after 60 min of incubation by using β-carotene bleaching test and 2.9 μg/mL by using Fe-chelating assay). Overall, the obtained results suggest that P. persica var. platycarpa displays a good antioxidant activity and its consumption could be promoted.

  16. Effects of different products of peach (Prunus persica L. Batsch) from a variety developed in southern Brazil on oxidative stress and inflammatory parameters in vitro and ex vivo (United States)

    Gasparotto, Juciano; Somensi, Nauana; Bortolin, Rafael Calixto; Moresco, Karla Suzana; Girardi, Carolina Saibro; Klafke, Karina; Rabelo, Thallita Kelly; Morrone, Maurilio Da Silva; Vizzotto, Márcia; Raseira, Maria do Carmo Bassols; Moreira, José Claudio Fonseca; Gelain, Daniel Pens


    Antioxidant, anti-glycation and anti-inflammatory activities of fresh and conserved peach fruits (Prunus persica L. Batsch) were compared. Fresh peach pulps, peels, preserve peach pulps and the preserve syrup were prepared at equal concentrations. Rat liver, kidney and brain cortex tissue slices were pre-incubated with peach samples, subjected to oxidative stress with FeSO4 and hydrogen peroxide. Fresh peach pulps and peel conferred higher protection against cytotoxicity and oxidative stress than preserve peach pulps in most tissues. Release of tumor necrosis factor-α and interleukin-1β was also significantly decreased by Fresh peach pulps and peel, followed by preserve peach pulps. Total phenolic determination and HPLC analysis of carotenoids showed that the content of secondary metabolites in Fresh peach pulps and peel is significantly higher than in preserve peach pulps, while the syrup had only small or trace amounts of these compounds. Fresh peach pulps and Peel demonstrated high antioxidant and anti-inflammatory effects preventing against induced damage. PMID:25320458

  17. Comparison between in toto peach (Prunus persica L. Batsch) supplementation and its polyphenolic extract on rat liver xenobiotic metabolizing enzymes. (United States)

    Canistro, Donatella; Vivarelli, Fabio; Cirillo, Silvia; Costa, Guglielmo; Andreotti, Carlo; Paolini, Moreno


    Over the past years, there has been a growing interest in the natural constituents of foods as a potential means of cancer control. To date, epidemiology studies seem to indicate an inverse association between regular consumption of fruit and vegetables and cancer risk. Here, the potential chemopreventive activity of the polyphenolic extract (PPE) of peach (Prunus persica L. Batsch) and of the freeze-dried fruit in toto (LFT), focusing on the modulation of xenobiotic metabolizing enzymes (XMEs) in vivo, was investigated. Rats were daily supplemented with LFT at 250 and 500 mg/kg b.w. or with the corresponding amount of PPE (2.5 and 5 mL/kg b.w., respectively) for either 7 or 14 days. While PPE treatment resulted in a widespread phase-I inactivation, a complex modulation pattern with drastic decreases (7α-testosterone hydroxylase, pentoxyresorufin O-dealkylase (PROD)), coupled with marked up-regulations of ethoxyresorufin O-deethylase (EROD) and methoxyresorufin O-demethylase (MROD) after LFT administration, was seen. A notable down-regulation (over 50%) following LFT or PPE treatment for the phase-II enzymes was also recorded. The observed remarkable changes in XMEs, if reproduced in humans, might have public health implications. These data suggest caution in promoting peach fruit (mono-diet) consumption or its polyphenolic extract in the field of chemoprevention. Copyright © 2016 Elsevier Ltd. All rights reserved.

  18. Mapping quantitative trait loci associated with chilling requirement, heat requirement and bloom date in peach (Prunus persica). (United States)

    Fan, Shenghua; Bielenberg, Douglas G; Zhebentyayeva, Tetyana N; Reighard, Gregory L; Okie, William R; Holland, Doron; Abbott, Albert G


    *Chilling requirement, together with heat requirement, determines the bloom date, which has an impact on the climatic distribution of the genotypes of tree species. The molecular basis of floral bud chilling requirement is poorly understood, despite its importance to the adaptation and production of fruit trees. In addition, the genetic nature of heat requirement and the genetic interrelationships among chilling requirement, heat requirement and bloom date remain unclear. *A peach (Prunus persica) F(2) population of 378 genotypes developed from two genotypes with contrasting chilling requirements was used for linkage map construction and quantitative trait loci (QTL) mapping. The floral bud chilling and heat requirements of each genotype were evaluated over 2 yr and the bloom date was scored over 4 yr. *Twenty QTLs with additive effects were identified for three traits, including one major QTL for chilling requirement and two major QTLs for bloom date. The majority of QTLs colocalized with QTLs for other trait(s). In particular, one genomic region of 2 cM, pleiotropic for the three traits, overlapped with the sequenced peach EVG region. *This first report on the QTL mapping of floral bud chilling requirement will facilitate marker-assisted breeding for low chilling requirement cultivars and the map-based cloning of genes controlling chilling requirement. The extensive colocalization of QTLs suggests that there may be one unified temperature sensing and action system regulating chilling requirement, heat requirement and bloom date together.

  19. Copigmentation triggers the development of skin burning disorder on peach and nectarine fruit [Prunus persica (L.) Batsch]. (United States)

    Cantín, Celia M; Tian, Li; Qin, Xiaoqiong; Crisosto, Carlos H


    Skin burning is a new type of skin damage related to exposure to high pH values during the brushing-waxing postharvest operations that has been observed recently on some newly released peach and nectarine [Prunus persica (L.) Batsch] cultivars. In this work, we described this skin disorder for the first time and studied its triggers and biological basis. Different skin burning susceptibility was observed after screening 21 peach and nectarine cultivars. The stability of the skin phenolic extracts to pH in the range 7-10 was studied by UV-visible spectroscopy. This study demonstrated that fruit skin phenolics are not stable at high pH and that the transformations occurring at high pH are reversible and time-dependent. The changes on the UV-visible absorption spectra at different pH values pointed out the copigmentation of anthocyanins as the mechanism beyond the skin burning disorder. Finally, some recommendations to minimize this postharvest damage are also discussed.

  20. The high-quality draft genome of peach (Prunus persica) identifies unique patterns of genetic diversity, domestication and genome evolution. (United States)

    Verde, Ignazio; Abbott, Albert G; Scalabrin, Simone; Jung, Sook; Shu, Shengqiang; Marroni, Fabio; Zhebentyayeva, Tatyana; Dettori, Maria Teresa; Grimwood, Jane; Cattonaro, Federica; Zuccolo, Andrea; Rossini, Laura; Jenkins, Jerry; Vendramin, Elisa; Meisel, Lee A; Decroocq, Veronique; Sosinski, Bryon; Prochnik, Simon; Mitros, Therese; Policriti, Alberto; Cipriani, Guido; Dondini, Luca; Ficklin, Stephen; Goodstein, David M; Xuan, Pengfei; Del Fabbro, Cristian; Aramini, Valeria; Copetti, Dario; Gonzalez, Susana; Horner, David S; Falchi, Rachele; Lucas, Susan; Mica, Erica; Maldonado, Jonathan; Lazzari, Barbara; Bielenberg, Douglas; Pirona, Raul; Miculan, Mara; Barakat, Abdelali; Testolin, Raffaele; Stella, Alessandra; Tartarini, Stefano; Tonutti, Pietro; Arús, Pere; Orellana, Ariel; Wells, Christina; Main, Dorrie; Vizzotto, Giannina; Silva, Herman; Salamini, Francesco; Schmutz, Jeremy; Morgante, Michele; Rokhsar, Daniel S


    Rosaceae is the most important fruit-producing clade, and its key commercially relevant genera (Fragaria, Rosa, Rubus and Prunus) show broadly diverse growth habits, fruit types and compact diploid genomes. Peach, a diploid Prunus species, is one of the best genetically characterized deciduous trees. Here we describe the high-quality genome sequence of peach obtained from a completely homozygous genotype. We obtained a complete chromosome-scale assembly using Sanger whole-genome shotgun methods. We predicted 27,852 protein-coding genes, as well as noncoding RNAs. We investigated the path of peach domestication through whole-genome resequencing of 14 Prunus accessions. The analyses suggest major genetic bottlenecks that have substantially shaped peach genome diversity. Furthermore, comparative analyses showed that peach has not undergone recent whole-genome duplication, and even though the ancestral triplicated blocks in peach are fragmentary compared to those in grape, all seven paleosets of paralogs from the putative paleoancestor are detectable.

  1. Proanthocyanidin monomers and cyanidin 3-O-glucoside accumulation in blood-flesh peach (Prunus persica (L. Batsch fruit

    Directory of Open Access Journals (Sweden)

    Yan Juan


    Full Text Available To better understand the characteristics and mechanisms of proanthocyanidin monomers and anthocyanin synthesis in blood-flesh peach (Prunus persica (L. Batsch, the accumulation of catechin, epicatechin and cyanidin 3-O-glucoside was determined, and the expression patterns of structural genes associated with biosynthesis of those compounds were investigated in the blood-flesh peach fruit of cultivar “Dahongpao” during fruit development. Our results show that catechin concentration remained low and comparatively stable throughout fruit development. The concentration of epicatechin remained low at the early stages of fruit development and rapidly accumulated during ripening. Cyanidin 3-O-glucoside was not detected in theearly stages. Epicatechin started to rapidly accumulate during the ripening period, reaching a maximum at the mature stage. The expressions of the early and common genes, phenylalanine ammonia-lyase and chalcone isomerase, were less associated with proanthocyanidin monomers and cyanidin 3-O-glucoside accumulation. The expression of other flavonoid ‘early’ biosynthetic genes, including chalcone synthase (CHS, flavanone 3-hydroxylase, dihydroflavonol 4-reductase (DFR and leucoanthocyanidin dioxygenase (LDOX, were partly associated with proanthocyanidin monomers and cyanidin 3-O-glucoside levels, with expression quantities peaking synchronously at the mature stage. Leucoanthocyanidin reductase and anthocyanidin reductase, which were the key genes for proanthocyanidin monomer synthesis, correlated during fruit development with catechin and epicatechin accumulation respectively; UDP-glucose: flavonoid 3-O-glucosyltransferase (UGFT, the key gene for anthocyanin synthesis, was correlated with cyanidin 3-O-glucoside levels. The synchronous accumulation of epicatechin and cyanidin 3-O-glucoside in blood-flesh peach could not be explained by the current theory of competitive distribution mechanism of common substrate.

  2. Evaluation of different doses of gamma radiation on physicochemical characteristics of peach Prunus persica (cv. Chimarrita) minimally processed

    Energy Technology Data Exchange (ETDEWEB)

    Oliveira, Ana Claudia S.; Silva, Lucia C.A.S.; Perecin, Thalita Neme; Arthur, Valter; Harder, Marcia N.C. [Centro de Energia Nuclear na Agricultura (CENA/USP), Piracicaba, SP (Brazil). Dept. de Radiobiologia e Ambiente], e-mail:, e-mail:; Mansi, Debora N.; Canniatti-Brazaca, Solange G. [Escola Superior de Agricultura Luiz de Queiroz (ESALQ/USP), Piracicaba, SP (Brazil). Dept. de Agroindustria, Alimentos e Nutricao


    The objective was to evaluate the effect of different doses of gamma radiation on the physico-chemical characteristics of peach Prunus persica (cv. Chimarrita) minimally processed, to increase the useful life of the fruit. The peaches were purchased at Ceasa of Campinas/SP and taken to the Laboratory of Radiobiology and Environment of CENA/USP (Piracicaba/SP), which were washed in tap water, peeled and cut into four pieces. The pieces of peach were dipped in sodium hypochlorite solution of 15 mL/L for 4 minutes and dry in a plastic support. Then it were placed in plastic containers (polypropylene). Subsequently, they were irradiated in a Cobalt-60 source, type Gammacell-220 (dose rate of 0,543 kGy/hour) with doses of: 0 (control), 1.0 and 2.0 kGy and stored at a temperature of 8 deg C. The experimental was developed entirely at random with 3 replicates for each treatment. For the statistic analysis was using the Tuckey test at 5% level of probability. Subsequently, analysis was carried out: color factors (l, a, b), pH, soluble solids (deg Brix), acidity and vitamin C. The tests were performed at 1, 3 and 6 days after irradiation. According to the results concluded that the analysis of color and acidity there was no significant difference between treatments, however, for the soluble solids (deg Brix), vitamin C and texture significant difference showing a decrease proportional to increasing doses of radiation and storage time. But the pH increased in relation to dose and during the analysis. (author)

  3. Relationship between endogenous hormonal content and somatic organogenesis in callus of peach (Prunus persica L. Batsch) cultivars and Prunus persica×Prunus dulcis rootstocks. (United States)

    Pérez-Jiménez, Margarita; Cantero-Navarro, Elena; Pérez-Alfocea, Francisco; Le-Disquet, Isabel; Guivarc'h, Anne; Cos-Terrer, José


    The relationship between endogenous hormones content and the induction of somatic peach plant was studied. To induce multiple shoots from callus derived from the base of stem explants of the scion cultivars 'UFO-3', 'Flariba' and 'Alice Bigi', and the peach×almond rootstocks 'Garnem' and 'GF677', propagated plants were cultured on Murashige and Skoog salts augmented with 0.1mgL(-1) of indolebutyric acid, 1mgL(-1) of 6-benzylaminopurine and 3% sucrose. The highest regeneration rate was obtained with the peach×almond rootstocks. Endogenous levels of abscisic acid (ABA), indole-3-acetic acid (IAA), zeatin (Z), zeatin riboside (ZR), ethylene precursor 1-aminocyclopropane-1-carboxylic acid (ACC), salicylic acid (SA), and jasmonic acid (JA) were analyzed in the organogenic callus. Lower levels of several hormones, namely Z, ZR, ABA, and ACC were found in the peach×almond rootstock compared to peach cultivars, while IAA and SA presented inconclusive returns. These results suggest that the difference in somatic organogenesis capacity observed in peach and peach×almond hybrids is markedly affected by the endogenous hormonal content of the studied genotypes. Copyright © 2014 Elsevier GmbH. All rights reserved.

  4. Chemical characterization and thermal properties of kernel oils from Tunisian peach and nectarine varieties of Prunus persica

    Directory of Open Access Journals (Sweden)

    D. Chamli


    Full Text Available A comparative study was conducted to determine the fatty acids, triacylglycerol compositions and thermal properties of Tunisian kernel oils from the Prunus persica varieties, peach and nectarine, grown in two areas of Tunisia, Gabes and Morneg. Qualitatively, the fatty acids composition and triacylglycerol species were identical for all samples. Oleic acid (67.7-75.0% was the main fatty acid, followed by linoleic (15.7-22.1% and palmitic (5.6-6.3% acids. The major triacylglycerol species were triolein, OOO (38.4-50.5%, followed by OOL (18.2-23.2%, POO (8.3-9.7% and OLL (6.3-10.1%. The thermal profiles were highly influenced by the high content of triolein due to the importance of oleic acid in these oils. Moreover, the fatty acids distribution in TAG external positions was determined as corresponding to an α asymmetry coefficient that was between 0.10 and 0.12, indicating a high asymmetry in the distribution of saturated fatty acids in the position sn-1 and sn-3 in the TAG species of all samples.

  5. Improvement of physicochemical properties and phenolic compounds bioavailability by concentrating dietary fiber of peach (Prunus persica) juice by-product. (United States)

    Rodríguez-González, Sarahí; Pérez-Ramírez, Iza F; Castaño-Tostado, Eduardo; Amaya-Llano, Silvia; Rodríguez-García, Mario E; Reynoso-Camacho, Rosalía


    This study aimed to concentrate dietary fiber (DF) from peach (Prunus persica) juice by-product (PJBP), to improve its functional properties, and its polyphenols bioavailability. The dietary fiber concentrates (DFC) were obtained from PJBP using water/ethanol treatments (100:0, 20:80, 50:50, 80:20, and 0:100, v/v) at 1:5 ratio (wet weight/solvent, w/v) for 5 and 20 min at 21 °C. All treatments concentrated condensed tannins, total and insoluble DF, founding the highest content with 100% H2O treatment. The major polyphenols of DFC were 4-O-caffeoylquinic, chlorogenic, and 1,5-Di-O-caffeoylquinic acids. Water and oil retention capacity and maximum glucose diffusion rate were improved mainly with 100% H2O treatment. Healthy rats were fed with standard diet supplemented with 8% of PJBP, DFC obtained with 100% H2O for 5 min, or DFC obtained with 20% EtOH for 5 min. Gastrointestinal digesta weight and viscosity were increased in animals supplemented with 100% H2O DFC. Moreover, the urinary excretion of polyphenol metabolites, mainly glucuronide and sulfate conjugates, was increased with this treatment, indicating a greater bioavailability of PJBP polyphenols, which was associated with an increased dietary fiber porosity. Water treatment could be used to potentiate PJBP functional properties and polyphenols bioavailability. This article is protected by copyright. All rights reserved.

  6. Pegamento e crescimento inicial de enxertos do pessegueiro 'Aurora-1' em clones de umezeiro (Prunus mume Sieb. et Zucc. e 'Okinawa' [Prunus persica (L. Batsch] propagados por estacas herbáceas Tissue union and initial growth of 'Aurora-1' peach buds on mume clones (Prunus mume Sieb. et Zucc. and 'Okinawa' [Prunus persica (L. Batsch] propagated by herbaceous cuttings

    Directory of Open Access Journals (Sweden)

    Newton Alex Mayer


    Full Text Available O presente estudo teve por objetivo avaliar o pegamento e o crescimento inicial de enxertos do pessegueiro 'Aurora-1' em clones de umezeiro (Prunus mume Sieb. et Zucc. e 'Okinawa' [Prunus persica (L. Batsch] propagados por estacas herbáceas. Realizaram-se dois experimentos, adotando-se a enxertia de borbulhia por escudo (março e borbulhia por escudo modificada (julho. Com os resultados obtidos, pode-se concluir que é viável a realização da enxertia do 'Aurora-1' nos Clones 05; 10 e 15 de umezeiro e no 'Okinawa', tanto em março quanto em julho, com as metodologias utilizadas. O 'Okinawa' induz crescimento mais rápido ao enxerto, de forma que o ponto máximo do comprimento é atingido em tempo menor.This study aimed to evaluate the tissue union and initial growth of 'Aurora-1' peach buds on mume clones (Prunus mume Sieb. et Zucc. and 'Okinawa' [Prunus persica (L. Batsch] propagated by herbaceous cuttings. Two experiments were carried out, being adopted the chip budding (March and chip budding modified (July. The results showed that accomplishment of 'Aurora-1' peach bud on mume Clones 05, 10 and 15 and 'Okinawa' is viable, in both periods, with the methodologies used. The 'Okinawa' induces faster growth to the bud and the maximum length point is reached in a short time.

  7. Investigation of the aroma of commercial peach (Prunus persica L. Batsch) types by Proton Transfer Reaction-Mass Spectrometry (PTR-MS) and sensory analysis. (United States)

    Bianchi, Tiago; Weesepoel, Yannick; Koot, Alex; Iglesias, Ignasi; Eduardo, Iban; Gratacós-Cubarsí, Marta; Guerrero, Luis; Hortós, Maria; van Ruth, Saskia


    The aim of this study was to investigate the aroma and sensory profiles of various types of peaches (Prunus persica L. Batsch.). Forty-three commercial cultivars comprising peaches, flat peaches, nectarines, and canning peaches (pavías) were grown over two consecutive harvest years. Fruits were assessed for chemical aroma and sensory profiles. Chemical aroma profile was obtained by proton transfer reaction-mass spectrometry (PTR-MS) and spectral masses were tentatively identified with PTR-Time of Flight-MS (PTR-Tof-MS). Sensory analysis was performed at commercial maturity considering seven aroma/flavor attributes. The four types of peaches showed both distinct chemical aroma and sensory profiles. Flat peaches and canning peaches showed most distinct patterns according to discriminant analysis. The sensory data were related to the volatile compounds by partial least square regression. γ-Hexalactone, γ-octalactone, hotrienol, acetic acid and ethyl acetate correlated positively, and benzeneacetaldehyde, trimethylbenzene and acetaldehyde negatively to the intensities of aroma and ripe fruit sensory scores. Copyright © 2017 Elsevier Ltd. All rights reserved.


    Directory of Open Access Journals (Sweden)



    Full Text Available La caracterización de cultivares de duraznero (Prunus persica (L Batsch se hace por medio de la descripción de caracteres agronómicos y morfológicos codificados por organizaciones internacionales, los cuales están fuertemente influenciados por el ambiente. Se han buscado métodos alternativos de caracterización y las isoenzimas han sido utilizadas por su independencia de las condiciones del ambiente, además de identificar individuos en etapas tempranas de su desarrollo. El objetivo del presente estudio es caracterizar cultivares de duraznero mediante el análisis isoenzimático de catecol oxidasas, fosfatasas ácidas, esterazas y peroxidazos en extractos de hojas. Los cultivares de duraznero analizados presentaron bajo polimorfismo isoenzimático, las esterazas caracterizaron diez cultivares, las catecol oxidasas un cultivar agrupándose el resto en cinco modelos, las fosfatasas ácidas caracterizaron dos cultivares agrupándose los otros en siete modelos y las peroxidazos formaron tres grupos. Ello puede explicarse ya que el duraznero es una especie autofértil y presenta una base genética muy reducida. Los evidentes límites discriminatorios de este tipo de análisis hacen que su aporte sea sólo complementario a los métodos de los caracteres agronómicos y morfológicos.Characterization of peach cultivars (Prunus persica (L Batsh was made by description of agronomical and morphological characters codified from international organizations, which are strongly affected by environmental conditions. Alternative methods of characterization have been searched, and isoenzymes have been used as independent of environmental conditions in addition to identify some individuals in early stages of development. The goal of this study is the peach cultivars characterization by isoenzymatic analysis of catecol oxidases, acid phosphatases, esterases and peroxidases within the leaf extracts. The peach cultivars analyzed have showed low isoenzymatic

  9. Heterogeneity in the entire genome for three genotypes of peach [Prunus persica (L.) Batsch] as distinguished from sequence analysis of genomic variants. (United States)

    Fresnedo-Ramírez, Jonathan; Martínez-García, Pedro J; Parfitt, Dan E; Crisosto, Carlos H; Gradziel, Thomas M


    Peach [Prunus persica (L.) Batsch] is an economically important fruit crop that has become a genetic-genomic model for all Prunus species in the family Rosaceae. A doubled haploid reference genome sequence length of 227.3 Mb, a narrow genetic base contrasted by a wide phenotypic variability, the generation of cultivars through hybridization with subsequent clonal propagation, and the current accessibility of many founder genotypes, as well as the pedigree of modern commercial cultivars make peach a model for the study of inter-cultivar genomic heterogeneity and its shaping by artificial selection. The quantitative genomic differences among the three genotypes studied as genomic variants, included small variants (SNPs and InDels) and structural variants (SV) (duplications, inversions and translocations). The heirloom cultivar 'Georgia Belle' and an almond by peach introgression breeding line 'F8,1-42' are more heterogeneous than is the modern cultivar 'Dr. Davis' when compared to the peach reference genome ('Lovell'). A pair-wise comparison of consensus genome sequences with 'Lovell' showed that 'F8,1-42' and 'Georgia Belle' were more divergent than were 'Dr. Davis' and 'Lovell'. A novel application of emerging bioinformatics tools to the analysis of ongoing genome sequencing project outputs has led to the identification of a range of genomic variants. Results can be used to delineate the genomic and phenotypic differences among peach genotypes. For crops such as fruit trees, the availability of old cultivars, breeding selections and their pedigrees, make them suitable models for the study of genome shaping by artificial selection. The findings from the study of such genomic variants can then elucidate the control of pomological traits and the characterization of metabolic pathways, thus facilitating the development of protocols for the improvement of Prunus crops.

  10. Whole genome sequencing of peach (Prunus persica L.) for SNP identification and selection. (United States)

    Ahmad, Riaz; Parfitt, Dan E; Fass, Joseph; Ogundiwin, Ebenezer; Dhingra, Amit; Gradziel, Thomas M; Lin, Dawei; Joshi, Nikhil A; Martinez-Garcia, Pedro J; Crisosto, Carlos H


    The application of next generation sequencing technologies and bioinformatic scripts to identify high frequency SNPs distributed throughout the peach genome is described. Three peach genomes were sequenced using Roche 454 and Illumina/Solexa technologies to obtain long contigs for alignment to the draft 'Lovell' peach sequence as well as sufficient depth of coverage for 'in silico' SNP discovery. The sequences were aligned to the 'Lovell' peach genome released April 01, 2010 by the International Peach Genome Initiative (IPGI). 'Dr. Davis', 'F8, 1-42' and 'Georgia Belle' were sequenced to add SNPs segregating in two breeding populations, Pop DF ('Dr. Davis' × 'F8, 1-42') and Pop DG ('Dr. Davis' × 'Georgia Belle'). Roche 454 sequencing produced 980,000 total reads with 236 Mb sequence for 'Dr. Davis' and 735,000 total reads with 172 Mb sequence for 'F8, 1-42'. 84 bp × 84 bp paired end Illumina/Solexa sequences yielded 25.5, 21.4, 25.5 million sequences for 'Dr. Davis', 'F8, 1-42' and 'Georgia Belle', respectively. BWA/SAMtools were used for alignment of raw reads and SNP detection, with custom PERL scripts for SNP filtering. Velvet's Columbus module was used for sequence assembly. Comparison of aligned and overlapping sequences from both Roche 454 and Illumina/Solexa resulted in the selection of 6654 high quality SNPs for 'Dr. Davis' vs. 'F8, 1-42' and 'Georgia Belle', distributed on eight major peach genome scaffolds as defined from the 'Lovell' assembly. The eight scaffolds contained about 215-225 Mb of peach genomic sequences with one SNP/~ 40,000 bases. All sequences from Roche 454 and Illumina/Solexa have been submitted to NCBI for public use in the Short Read Archive database. SNPs have been deposited in the NCBI SNP database.

  11. Identification and validation of potential conserved microRNAs and their targets in peach (Prunus persica). (United States)

    Gao, Zhihong; Luo, Xiaoyan; Shi, Ting; Cai, Bin; Zhang, Zhen; Cheng, Zongming; Zhuang, Weibing


    MicroRNAs are a class of small, endogenous, non-coding RNA molecules that negatively regulate gene expression at the transcriptional or the post-transcriptional level. Although a large number of miRNAs have been identified in many plant species, especially from model plants and crops, they remain largely unknown in peach. In this study, 110 potential miRNAs belonging to 37 families were identified using computational methods. A total of 43 potential targets were found for 21 families based on near-perfect or perfect complementarity between the plant miRNA and the target sequences. A majority of the targets were transcription factors which play important roles in peach development. qRT-PCR analysis of RNA samples prepared from different peach tissues for 25 miRNA families revealed that miRNAs were differentially expressed in different tissues. Furthermore, two target genes were experimentally verified by detection of the miRNA-mediated mRNA cleavage sites in peach using RNA ligase-mediated 5' rapid amplification of cDNA ends (RLM-RACE). Finally, we studied the expression pattern of the two target genes in three different tissues of peach to further understand the mechanism of the interaction between miRNAs and their target genes.

  12. Identification of miRNAs and their target genes in peach (Prunus persica L.) using high-throughput sequencing and degradome analysis. (United States)

    Luo, Xiaoyan; Gao, Zhihong; Shi, Ting; Cheng, Zongming; Zhang, Zhen; Ni, Zhaojun


    MicroRNAs play critical roles in various biological and metabolic processes. The function of miRNAs has been widely studied in model plants such as Arabidopsis and rice. However, the number of identified miRNAs and related miRNA targets in peach (Prunus persica) is limited. To understand further the relationship between miRNAs and their target genes during tissue development in peach, a small RNA library and three degradome libraries were constructed from three tissues for deep sequencing. We identified 117 conserved miRNAs and 186 novel miRNA candidates in peach by deep sequencing and 19 conserved miRNAs and 13 novel miRNAs were further evaluated for their expression by RT-qPCR. The number of gene targets that were identified for 26 conserved miRNA families and 38 novel miRNA candidates, were 172 and 87, respectively. Some of the identified miRNA targets were abundantly represented as conserved miRNA targets in plant. However, some of them were first identified and showed important roles in peach development. Our study provides information concerning the regulatory network of miRNAs in peach and advances our understanding of miRNA functions during tissue development.

  13. Detection of seed dormancy QTL in three F2 families of peach (Prunus persica) (United States)

    Dormancy is a condition that delays or inhibits growth in seed, vegetative buds, and floral buds. In peach, seed germination occurs when seed accumulate sufficient stratification and growing degree hours to break dormancy and begin growing. Correlations have been reported between mean seed stratifi...

  14. Modelling of Peach Tree (Prunus persica) Full Blooming Dates Using APCC MME Seasonal Forecasts (United States)

    Chun, Jong; Kim, Sung; Lee, Hyojin; Han, Hyun-Hee; Son, In-Chang; Cho, Kyung Hwa


    Due to global warming, recently, bud-burst and flowering dates of fruit crops have become earlier and the abnormal climate increases the variabilities of temperature in spring, suggesting that the risk of frost damage has increased. However, the full blooming date prediction model for peach tree used by the Rural Developmental Administration (RDA) were developed using only one cultivar (Youmyeong) and observations from a station (Suwon). This model might not adequately reflect the characteristics of peach cultivars or local orchards. the objectives of this study were to develops the site-and cultivar-specific blooming date prediction models for major peach cultivation regions and cultivars and presents a framework for applications of the APEC Climate Center Multimodel Ensemble (APCC MME) seasonal datasets.Developmental rate (DVR), and Sequential dormancy models (Chill day, New chill day, and fraction-time models) were used to develop the locally tailored full blooming date prediction models for major peach cultivars. For the development of these models, bud-burst and full blooming dates of peach tree for 5 cultivars (Cheonhong, Youmyeong, Changbangjosaeng, Cheonjoongdo, and Janghowon) were collected from the 6 major peach cultivation sites: Chuncheon, Suwon, Cheongwon, Cheongdo, Naju, and Jinju. For the chill day model, those measures for the entire dataset regardless the location and cultivar were 2.31%, 0.79, and 3.36 day for MAPE, R2, RMSE, respectively. For the new chill day model, those values (2.19%, 0.82, and 3.16 day for MAPE, R2, RMSE, respectively) were slightly better than those of the chill day model. The model results showed that the new chill day model was found slightly highest performance than others. Based on the considerations of the predictability of the statistical downscaling method and the observed periods of the full blooming dates at each site, we determined that the APCC MME seasonal datasets were applied for the new chill day model for the

  15. Supercritical fluid extraction of peach (Prunus persica) almond oil: process yield and extract composition. (United States)

    Mezzomo, Natália; Mileo, Bruna R; Friedrich, Maria T; Martínez, Julian; Ferreira, Sandra R S


    Peach kernels are industrial residues from the peach processing, contain oil with important therapeutic properties and attractive nutritional aspects because of the high concentration of oleic and linoleic acids. The extraction method used to obtain natural compounds from raw matter is critical for product quality definition. Thus, the aim of this work was to compare peach almond extraction yields obtained by different procedures: soxhlet extractions (Sox) with different solvents; hydrodistillation (HD); ethanolic maceration (Mac) followed by fractionation with various solvents, and supercritical fluid extraction (SFE) at 30, 40 and 50 degrees C and at 100, 200 and 300bar, performed with pure CO(2) and with a co-solvent. The extracts were evaluated with respect to fatty acid composition (FAC), fractionated chemical profile (FCP) and total phenolic content (TPC). The Sox total yields were generally higher than those obtained by SFE. The crossover pressure for SFE was between 260 and 280bar. The FAC results show oleic and linoleic acids as main components, especially for Sox and SFE extracts. The FCP for samples obtained by Sox and Mac indicated the presence of benzaldehyde and benzyl alcohol, components responsible for almond flavor and with important industrial uses, whereas the SFE extracts present a high content of a possible flavonoid. The higher TPC values were obtained by Sox and Mac with ethanol. In general, the maximum pressure in SFE produced the highest yield, TPC and oleic acid content. The use of ethanol at 5% as co-solvent in SFE did not result in a significant effect on any evaluated parameter. The production of peach almond oil through all techniques is substantially adequate and SFE presented advantages, with respect to the quality of the extracts due to the high oleic acid content, as presented by some Sox samples. Copyright (c) 2010 Elsevier Ltd. All rights reserved.

  16. Carbohydrate-free peach (Prunus persica and plum (Prunus domestica juice affects fecal microbial ecology in an obese animal model.

    Directory of Open Access Journals (Sweden)

    Giuliana D Noratto

    Full Text Available BACKGROUND: Growing evidence shows the potential of nutritional interventions to treat obesity but most investigations have utilized non-digestible carbohydrates only. Peach and plum contain high amounts of polyphenols, compounds with demonstrated anti-obesity effects. The underlying process of successfully treating obesity using polyphenols may involve an alteration of the intestinal microbiota. However, this phenomenon is not well understood. METHODOLOGY/PRINCIPAL FINDINGS: Obese Zucker rats were assigned to three groups (peach, plum, and control, n = 10 each, wild-type group was named lean (n = 10. Carbohydrates in the fruit juices were eliminated using enzymatic hydrolysis. Fecal samples were obtained after 11 weeks of fruit or control juice administration. Real-time PCR and 454-pyrosequencing were used to evaluate changes in fecal microbiota. Over 1,500 different Operational Taxonomic Units at 97% similarity were detected in all rats. Several bacterial groups (e.g. Lactobacillus and members of Ruminococcacea were found to be more abundant in the peach but especially in the plum group (plum juice contained 3 times more total polyphenolics compared to peach juice. Principal coordinate analysis based on Unifrac-based unweighted distance matrices revealed a distinct separation between the microbiota of control and treatment groups. These changes in fecal microbiota occurred simultaneously with differences in fecal short-chain acids concentrations between the control and treatment groups as well as a significant decrease in body weight in the plum group. CONCLUSIONS: This study suggests that consumption of carbohydrate-free peach and plum juice has the potential to modify fecal microbial ecology in an obese animal model. The separate contribution of polyphenols and non-polyphenols compounds (vitamins and minerals to the observed changes is unknown.

  17. A genome-wide analysis of MADS-box genes in peach [Prunus persica (L.) Batsch]. (United States)

    Wells, Christina E; Vendramin, Elisa; Jimenez Tarodo, Sergio; Verde, Ignazio; Bielenberg, Douglas G


    MADS-box genes encode a family of eukaryotic transcription factors distinguished by the presence of a highly-conserved ~58 amino acid DNA-binding and dimerization domain (the MADS-box). The central role played by MADS-box genes in peach endodormancy regulation led us to examine this large gene family in more detail. We identified the locations and sequences of 79 MADS-box genes in peach, separated them into established subfamilies, and broadly surveyed their tissue-specific and dormancy-induced expression patterns using next-generation sequencing. We then focused on the dormancy-related SVP/AGL24 and FLC subfamilies, comparing their numbers and phylogenetic relationships with those of other sequenced woody perennial genomes. We identified 79 MADS-box genes distributed across all eight peach chromosomes and frequently located in clusters of two or more genes. They encode proteins with a mean length of 248 ± 72 amino acids and include representatives from most of the thirteen Type II (MIKC) subfamilies, as well as members of the Type I Mα, Mβ, and Mγ subfamilies. Most Type I genes were present in species-specific monophyletic lineages, and their expression in the peach sporophyte was low or absent. Most Type II genes had Arabidopsis orthologs and were expressed at much higher levels throughout vegetative and fruit tissues. During short-day-induced growth cessation, seven Type II genes from the SVP/AGL24, AGL17, and SEP subfamilies showed significant changes in expression. Phylogenetic analyses indicated that multiple, independent expansions have taken place within the SVP/AGL24 and FLC lineages in woody perennial species. Most Type I genes appear to have arisen through tandem duplications after the divergence of the Arabidopsis and peach lineages, whereas Type II genes appear to have increased following whole genome duplication events. An exception to the latter rule occurs in the FLC and SVP/AGL24 Type II subfamilies, in which species-specific tandem

  18. Response of early-peach [Prunus persica (L.)] trees to deficit irrigation

    Energy Technology Data Exchange (ETDEWEB)

    Abrisqueta, I.; Tapia, L. M.; Conejero, W.; Sanchez-Toribio, M. I.; Abrisqueta, J. M.; Vera, J.; Ruiz-Sanchez, C.


    The effect of different irrigation strategies in water relations, vegetative growth and yield of early maturing peach trees, growing in Murcia, (Spain) was studied during two years. Treatments consisted on: a control T1, full irrigated (150% of ETc); T2, continuous deficit irrigation at 50% of ETc; T3, regulated deficit irrigation (RDI), irrigated at 100% of ETc only during stage III of fruit growth and 25% the rest of the growing season; and T4, with automatic control of irrigation based on capacitance FDR-type probe data, varying threshold values. The results indicated that irrigation deficits in T2 and T3 treatments induced the lowest soil water content and stem water potential(?stem) values during the post harvest period (e.g {psi}{sub s}tem up to -1.8 MPa in T3 during summer 2008); thus, a reduction in trunk growth and pruning weight, respect to control treatment values, was noted in both years. Also, peach yield was significantly reduced in both deficit irrigated treatments. The greatest irrigation water saving in T3 treatment (=60%) caused the higher water use efficiency values in this treatment. For these reasons, water deficit during the post harvest periods (extended in the early maturing varieties) must be limited if fruit yield is not to be reduced. Irrigation scheduling based on capacitance probes have become a useful tool in the control of soil water content. When threshold values were precisely defined, the slight water deficits limited only vegetative growth while maintaining similar peach yield to that of well irrigated trees. (Author) 31 refs.

  19. Genome-wide analysis of the AP2/ERF superfamily in peach (Prunus persica). (United States)

    Zhang, C H; Shangguan, L F; Ma, R J; Sun, X; Tao, R; Guo, L; Korir, N K; Yu, M L


    We identified 131 AP2/ERF (APETALA2/ethylene-responsive factor) genes in material from peach using the gene sequences of AP2/ERF amino acids of Arabidopsis thaliana (Brassicaceae) as probes. Based on the number of AP2/ERF domains and individual gene characteristics, the AP2/ERF superfamily gene in peach can be classified broadly into three families, ERF (ethylene-responsive factor), RAV (related to ABI3/VP1), and AP2 (APETALA2), containing 104, 5, and 21 members, respectively, along with a solo gene (ppa005376m). The 104 genes in the ERF family were further divided into 11 groups based on the group classification made for Arabidopsis. The scaffold localizations of the AP2/ERF genes indicated that 129 AP2/ERF genes were all located on scaffolds 1 to 8, except for two genes, which were on scaffolds 17 and 10. Although the primary structure varied among AP2/ERF superfamily proteins, their tertiary structures were similar. Most ERF family genes have no introns, while members of the AP2 family have more introns than genes in the ERF and RAV families. All sequences of AP2 family genes were disrupted by introns into several segments of varying sizes. The expression of the AP2/ERF superfamily genes was highest in the mesocarp; it was far higher than in the other seven tissues that we examined, implying that AP2/ERF superfamily genes play an important role in fruit growth and development in the peach. These results will be useful for selecting candidate genes from specific subgroups for functional analysis.

  20. Reductions in flesh discolouration and internal morphological changes in Nanhui peaches (Prunus persica (L.) Batsch, cv. Nanhui) by electrolysed water and 1-methylcyclopropene treatment during refrigerated storage. (United States)

    Zhou, Ran; Zhang, Guixiang; Hu, Yunsheng; Wu, Hui; Xie, Jing; Luo, Yudan


    The effects of electrolysed water (EW) and EW in combination with 1-methylcyclopropene (EW/MCP) on flesh discolouration of Nanhui peaches (Prunus persica (L.) Batsch, cv. Nanhui) were examined during storage at 2°C. Changes in flesh colour, ethylene production, membrane permeability, malondialdehyde (MDA), total phenolic contents and the activities of polyphenol oxidase (PPO) and peroxidase (POD) were assayed periodically after harvest and during 44days of storage. The internal morphological characteristics of Nanhui peaches were monitored using magnetic resonance imaging (MRI) at the beginning and end of storage. These data revealed that the EW/MCP treatment is more effective than the EW treatment for decreasing ethylene production and maintaining fruit cell membrane integrity, delaying increases in MDA and total phenolic contents, and lessening changes in PPO and POD activities and the internal morphology of peaches. Each of these effects contributes to suppressing flesh discolouration and maintaining the quality of Nanhui peaches during storage. Crown Copyright © 2012. Published by Elsevier Ltd. All rights reserved.

  1. Rootstock and fruit canopy position affect peach [Prunus persica (L.) Batsch] (cv. Rich May) plant productivity and fruit sensorial and nutritional quality. (United States)

    Gullo, Gregorio; Motisi, Antonio; Zappia, Rocco; Dattola, Agostino; Diamanti, Jacopo; Mezzetti, Bruno


    The right combination of rootstock and training system is important for increased yield and fruit sensorial and nutritional homogeneity and quality with peach [Prunus persica (L.) Batsch]. We investigated the effects of rootstock and training system on these parameters, testing the effect of vigorous GF677 and weaker Penta rootstock on 'Rich May' peach cultivar. Fruit position effects regarding photosynthetically active radiation availability, along the canopy profile using the Y training system, were investigated. The positive relationships between total polyphenols content and antioxidant capacity according to canopy vigour and architecture were determined for the two scion/stock combinations. Changes in fruit epicarp colour and content of bioactive compounds were also determined. Lower-vigour trees from Penta rootstock grafting yielded larger fruit with improved skin overcolour, and greater total polyphenols content and antioxidant capacity. GF677 rootstock produced more vigorous trees with fruit with lower sensorial and nutritional parameters. Canopy position strongly affects fruit sensorial and nutritional qualities. These data define potential for improvements to peach production efficiency and fruit quality, particularly for southern Europe peach cultivation conditions. Copyright © 2013 Elsevier Ltd. All rights reserved.

  2. Dormancy-associated MADS genes from the EVG locus of peach [Prunus persica (L.) Batsch] have distinct seasonal and photoperiodic expression patterns. (United States)

    Li, Zhigang; Reighard, Gregory Lynn; Abbott, Albert Glenn; Bielenberg, Douglas Gary


    Mapping and sequencing of the non-dormant evg mutant in peach [Prunus persica (L.) Batsch] identified six tandem-arrayed DAM (dormancy-associated MADS-box) genes as candidates for regulating growth cessation and terminal bud formation. To narrow the list of candidate genes, an attempt was made to associate bud phenology with the seasonal and environmental patterns of expression of the candidates in wild-type trees. The expression of the six peach DAM genes at the EVG locus of peach was characterized throughout an annual growing cycle in the field, and under controlled conditions in response to a long day-short day photoperiod transition. DAM1, 2, 4, 5, and 6 were responsive to a reduction in photoperiod in controlled conditions and the direction of response correlated with the seasonal timing of expression in field-grown trees. DAM3 did not respond to photoperiod and may be regulated by chilling temperatures. The DAM genes in peach appear to have at least four distinct patterns of expression. DAM1, 2, and 4 are temporally associated with seasonal elongation cessation and bud formation and are the most likely candidates for control of the evg phenotype.

  3. Variation in minerals, phenolics and antioxidant activity of peel and pulp of different varieties of peach (Prunus persica L.) fruit from Pakistan. (United States)

    Manzoor, Maleeha; Anwar, Farooq; Mahmood, Zahed; Rashid, Umer; Ashraf, Muhammad


    Peach (Prunus persica L.), being a potential source of bioactive compounds, has been demonstrated to have medicinal benefits. In this study variation of minerals and antioxidant characteristics (total phenolic contents, total flavonoid contents, reducing power, inhibition of peroxidation using linoleic acid system and DPPH free radical scavenging activity) between peel and pulp parts of different peach varieties, namely Golden, Shireen, and Shahpasand were investigated. The peel and pulp extracts, derived from the varieties analyzed, exhibited an appreciable amount of total phenolics (TP) and total flavonoids (TF), ranging from 1,209.3-1,354.5, 711.7-881.3 mg GAE/100 g and 599.7-785.5, 301.3-499.7 mg CE/100 g on a dry weight basis, respectively. Reducing power of peel and pulp extracts (12.5 mg/mL concentration) ranged from 2.57-2.77 and 1.54-1.99.The inhibition of linoleic acid peroxidation and DPPH scavenging activity of the extracts varied from 70.8-80.9% and 66.8-76.5% in peels, and 51.9-60.1% and 43.4-49.1% in pulps. The mineral analysis revealed that the content of K was highest in both parts of the peach fruit followed by Mg, Ca, Fe, Mn and Zn. The results of our present study indicate that peach peel had significantly higher levels of minerals, antioxidant capacity and phenolics than those of the pulp, suggesting the intake of unpeeled peach as a potential source of high-value components. The peach peel can be a useful as a viable source of natural antioxidants for functional foods and nutraceutical applications.

  4. Variation in Minerals, Phenolics and Antioxidant Activity of Peel and Pulp of Different Varieties of Peach (Prunus persica L. Fruit from Pakistan

    Directory of Open Access Journals (Sweden)

    Muhammad Ashraf


    Full Text Available Peach (Prunus persica L., being a potential source of bioactive compounds, has been demonstrated to have medicinal benefits. In this study variation of minerals and antioxidant characteristics (total phenolic contents, total flavonoid contents, reducing power, inhibition of peroxidation using linoleic acid system and DPPH free radical scavenging activity between peel and pulp parts of different peach varieties, namely Golden, Shireen, and Shahpasand were investigated. The peel and pulp extracts, derived from the varieties analyzed, exhibited an appreciable amount of total phenolics (TP and total flavonoids (TF, ranging from 1,209.3–1,354.5, 711.7–881.3 mg GAE/100 g and 599.7–785.5, 301.3–499.7 mg CE/100 g on a dry weight basis, respectively. Reducing power of peel and pulp extracts (12.5 mg/mL concentration ranged from 2.57–2.77 and 1.54–1.99.The inhibition of linoleic acid peroxidation and DPPH scavenging activity of the extracts varied from 70.8–80.9% and 66.8–76.5% in peels, and 51.9–60.1% and 43.4–49.1% in pulps. The mineral analysis revealed that the content of K was highest in both parts of the peach fruit followed by Mg, Ca, Fe, Mn and Zn. The results of our present study indicate that peach peel had significantly higher levels of minerals, antioxidant capacity and phenolics than those of the pulp, suggesting the intake of unpeeled peach as a potential source of high-value components. The peach peel can be a useful as a viable source of natural antioxidants for functional foods and nutraceutical applications.

  5. Effect of aqueous sprays of ammonium fluoride on oxygen consumption and firmness of suture and dorsal tissues of Early Improved Elberta peaches. [Prunus persica

    Energy Technology Data Exchange (ETDEWEB)

    Facteau, T.J.; Rowe, K.E.


    Aqueous ammonium fluoride (NH/sub 4/F) sprays on Early Improved Elberta peaches (Prunus persica (L.) Batsch) resulted in increased O/sub 2/ consumption of suture tissue and inconsistent changes in O/sub 2/ consumption of dorsal tissue as the spray concentration was increased. Flesh firmness on the suture side of treated fruit was less than non-sprayed fruit and decreased as either the NH/sub 4/F spray concentration or number of sprays increased. The effect of spray on the dorsal side differed from year to year. Levels of fluoride (F) in the fruit tissue were associated with F concentration and number of F sprays applied only within the same year. 3 references, 1 table.

  6. Analysis of basic leucine zipper genes and their expression during bud dormancy in peach (Prunus persica). (United States)

    Sun, Ming-Yue; Fu, Xi-Ling; Tan, Qiu-Ping; Liu, Li; Chen, Min; Zhu, Cui-Ying; Li, Ling; Chen, Xiu-De; Gao, Dong-Sheng


    Dormancy is a biological characteristic developed to resist the cold conditions in winter. The bZIP transcription factors are present exclusively in eukaryotes and have been identified and classified in many species. bZIP proteins are known to regulate numerous biological processes, however, the role of bZIP in bud dodormancy has not been studied extensively. In total, 50 PpbZIP transcription factor-encoding genes were identified and categorized them into 10 groups (A-I and S). Similar intron/exon structures, additional conserved motifs, and DNA-binding site specificity supported our classification scheme. Additionally, chromosomal distribution and collinearity analyses suggested that expansion of the PpbZIP transcription factor family was due to segment/chromosomal duplications. We also predicted the dimerization properties based on characteristic features of the leucine zipper and classified PpbZIP proteins into 23 subfamilies. Furthermore, qRT-PCR results indicated that PpbZIPs genes may be involved in regulating dormancy. The same gene of different species might participate in different regulating networks through interactions with specific partners. Our expression profiling results complemented the microarray data, suggesting that co-expression patterns of bZIP transcription factors during dormancy differed among deciduous fruit trees. Our findings further clarify the molecular characteristics of the PpbZIP transcription factor family, including potential gene functions during dormancy. This information may facilitate further research on the evolutionary history and biological functions of bZIP proteins in peach and other rosaceae plants. Copyright © 2016 Elsevier Masson SAS. All rights reserved.

  7. Pomological and biochemical peculiarities of peach hybrids and varieties for genus Persica Mill. (Prunus persica Borkh. with anthocyanidin Persica vulgaris Mill, pigmentation of fruits pulp and leaves

    Directory of Open Access Journals (Sweden)

    О. О. Ріхтер


    Full Text Available The chemical composition and the links between different groups of substances (content of dry substances, monosaccharides, saccharose, sum of sugars, titratable acids, proanthocyanidins, anthocyanidins, water soluble pectine, protopectin, sum of pectines and sugar-acid index have been studied in hybrids fruits of Persica vulgaris Mill, subsp. erytrocarpa Zajats and Persica vulgaris Mill, subsp. atropurpurea (Schneid. Zajats. The obtained data were compared with the characteristics typical for fruits of P. vulgaris Mill, subsp. nectarina (Ait. Shof. and P. vulgaris Mill. Brief information about the biology of obtained distant hybrids forms have been given. The content of anthocyanine pigments (Cy-3-Glu, Cy-3- Ara, Cy-3-(6-Kum- Glu in fruits and leaves of different taxons for genus Persica Mill, has been analysed.

  8. Reação de clones de umezeiro (Prunus mume Sieb. et Zucc. e cultivares de pessegueiro [Prunus persica (L. Batsch] ao nematóide anelado Mesocriconema xenoplax (Nemata: Criconematidae Reaction of mume clones (Prunus mume Sieb. et Zucc. and peach tree cultivars [Prunus persica (L. Batsch] to ring nematode Mesocriconema xenoplax (Nemata: Criconematidae

    Directory of Open Access Journals (Sweden)

    Newton Alex Mayer


    Full Text Available Com o objetivo de avaliar a reação de clones de umezeiro (Prunus mume Sieb. et Zucc. e cultivares de pessegueiro [Prunus persica (L. Batsch] ao nematóide anelado Mesocriconema xenoplax (Raski Loof & de Grise, realizou-se o presente estudo em casa de vegetação do Departamento de Fitossanidade da FCAV/UNESP, Câmpus de Jaboticabal-SP. As plantas foram mantidas em vasos de cerâmica com 6 litros de capacidade, contendo uma mistura de solo e areia (1:1, v/v, previamente autoclavada a 121°C e por 2 horas. Cada planta foi inoculada com 10mL de uma suspensão de 200 M. xenoplax por mL. Com os resultados obtidos, após 105 dias da inoculação, pode-se concluir que os Clones 05; 10 e 15 de umezeiro e as cultivares Okinawa e Aurora-1 de pessegueiro são suscetíveis a M. xenoplax. A cultivar Aurora-1 apresentou maior Fator de Reprodução (93,06.With the objective of evaluating the reaction of mume clones (Prunus mume Sieb. et Zucc. and peach tree cultivars [Prunus persica (L. Batsch] to ring nematode Mesocriconema xenoplax (Raski Loof & de Grise, was conducted the present study at a greenhouse, belonging to the Phytosanity Department of Faculdade de Ciências Agrárias e Veterinárias (FCAV/UNESP, Jaboticabal Campus, São Paulo State, Brazil. The plants were maintained in ceramic boxes with 6 liters of capacity, contends a soil-sand mixture (1:1, v/v, previously autoclaved at 121°C and for 2 hours. Each plant was inoculated with a 10mL suspension of 200 M. xenoplax/mL. With the results, after 105 days of inoculation, was verified that mume Clones 05, 10 and 15 and 'Okinawa' and 'Aurora-1' peach tree cultivars are susceptible to M. xenoplax. The cultivar 'Aurora-1' presented larger reproduction factor (93,06.

  9. Characterization and expression analysis of AGAMOUS-like, SEEDSTICK-like, and SEPALLATA-like MADS-box genes in peach (Prunus persica) fruit. (United States)

    Tani, Eleni; Polidoros, Alexios N; Flemetakis, Emmanouil; Stedel, Catalina; Kalloniati, Chrissanthi; Demetriou, Kyproula; Katinakis, Panagiotis; Tsaftaris, Athanasios S


    MADS-box genes encode transcriptional regulators that are critical for flowering, flower organogenesis and plant development. Although there are extensive reports on genes involved in flower organogenesis in model and economically important plant species, there are few reports on MADS-box genes in woody plants. In this study, we have cloned and characterized AGAMOUS (AG), SEEDSTICK (STK) and SEPALLATA (SEP) homologs from peach tree (Prunus persica L. Batsch) and studied their expression patterns in different tissues as well as in fruit pericarp during pit hardening. AG- STK- and SEP-like homologs, representative of the C-, D-, E-like MADS-box gene lineages, respectively, play key roles in stamen, carpel, ovule and fruit development in Arabidopsis thaliana. Sequence similarities, phylogenetic analysis and structural characteristics were used to provide classification of the isolated genes in type C (PPERAG), type D (PPERSTK) and type E (PPERSEP1, PPERSEP3, PPERFB9) organ identity genes. Expression patterns were determined and in combination with phylogenetic data provided useful indications on the function of these genes. These data suggest the involvement of MADS-box genes in peach flower and fruit development and provide further evidence for the role of these genes in woody perennial trees that is compatible with their function in model plant species.

  10. Expressional regulation of PpDAM5 and PpDAM6, peach (Prunus persica) dormancy-associated MADS-box genes, by low temperature and dormancy-breaking reagent treatment


    Yamane, Hisayo; Ooka, Tomomi; Jotatsu, Hiroaki; Hosaka, Yukari; Sasaki, Ryuta; Tao, Ryutaro


    The present study investigated the expressional regulation of PpDAM5 and PpDAM6, two of the six peach (Prunus persica) dormancy-associated MADS-box genes, in relation to lateral bud endodormancy. PpDAM5 and PpDAM6 were originally identified as homologues of Arabidopsis SHORT VEGETATIVE PHASE/AGAMOUS-LIKE 24 identified in the EVERGROWING locus of peach. Furthermore, PpDAM5 and PpDAM6 have recently been suggested to be involved in terminal bud dormancy. In this study, seasonal expression analys...

  11. Effect prediction of identified SNPs linked to fruit quality and chilling injury in peach [Prunus persica (L.) Batsch]. (United States)

    Martínez-García, Pedro J; Fresnedo-Ramírez, Jonathan; Parfitt, Dan E; Gradziel, Thomas M; Crisosto, Carlos H


    Single nucleotide polymorphisms (SNPs) are a fundamental source of genomic variation. Large SNP panels have been developed for Prunus species. Fruit quality traits are essential peach breeding program objectives since they determine consumer acceptance, fruit consumption, industry trends and cultivar adoption. For many cultivars, these traits are negatively impacted by cold storage, used to extend fruit market life. The major symptoms of chilling injury are lack of flavor, off flavor, mealiness, flesh browning, and flesh bleeding. A set of 1,109 SNPs was mapped previously and 67 were linked with these complex traits. The prediction of the effects associated with these SNPs on downstream products from the 'peach v1.0' genome sequence was carried out. A total of 2,163 effects were detected, 282 effects (non-synonymous, synonymous or stop codon gained) were located in exonic regions (13.04 %) and 294 placed in intronic regions (13.59 %). An extended list of genes and proteins that could be related to these traits was developed. Two SNP markers that explain a high percentage of the observed phenotypic variance, UCD_SNP_1084 and UCD_SNP_46, are associated with zinc finger (C3HC4-type RING finger) family protein and AOX1A (alternative oxidase 1a) protein groups, respectively. In addition, phenotypic variation suggests that the observed polymorphism for SNP UCD_SNP_1084 [A/G] mutation could be a candidate quantitative trait nucleotide affecting quantitative trait loci for mealiness. The interaction and expression of affected proteins could explain the variation observed in each individual and facilitate understanding of gene regulatory networks for fruit quality traits in peach.

  12. Differential responses of peach (Prunus persica) seedlings to elevated ozone are related with leaf mass per area, antioxidant enzymes activity rather than stomatal conductance. (United States)

    Dai, Lulu; Li, Pin; Shang, Bo; Liu, Shuo; Yang, Aizhen; Wang, Younian; Feng, Zhaozhong


    To evaluate the ozone (O3) sensitivity among peach tree (Prunus persica) cultivars widely planted in Beijing region and explore the possible eco-physiological response mechanisms, thirteen cultivars of peach seedlings were exposed to either charcoal-filtered air or elevated O3 (E-O3, non-filtered ambient air plus 60 ppb) for one growing season in open-top chambers. Leaf structure, stomatal structure, gas exchange and chlorophyll a fluorescence, photosynthetic pigments, antioxidant defense system and lipid peroxidation were measured in three replicated chambers. Results showed that E-O3 significantly reduced abaxial epidemis thickness, but no effects on the thicknesses of adaxial epidemis, palisade parenchyma and spongy parenchyma. Stomatal area, density and conductance were not significantly affected by E-O3. E-O3 significantly accelerated leaf senescence, as indicated by increased lipid peroxidation and more declines in light-saturated photosynthetic rate and pigments contents. The reduced ascorbate content (ASC) was decreased but antioxidant enzyme activity (CAT, APX and SOD) and total antioxidant capacity (TAC) were significantly increased by E-O3 among cultivars. The cultivars with visible symptoms also had more reductions in net photosynthetic rate than those without visible symptoms. Ozone sensitivity among cultivars was strongly linked to leaf mass per area (LMA), antioxidant enzymes activity e.g. SOD, APX rather than stomatal parameters (stomatal area, density and conductance) and ASC. Results could provide a theoretical basis for selecting and breeding the ozone-resistant cultivars of peach trees grown in high O3-polluted regions. Copyright © 2017 Elsevier Ltd. All rights reserved.

  13. Identification of Known and Novel microRNAs and Their Targets in Peach (Prunus persica) Fruit by High-Throughput Sequencing. (United States)

    Zhang, Chunhua; Zhang, Binbin; Ma, Ruijuan; Yu, Mingliang; Guo, Shaolei; Guo, Lei; Korir, Nicholas Kibet


    MicroRNAs (miRNAs) are a group of non-coding RNAs that have functions in post-transcriptional gene regulation in plants. Although the most important economic component of peach trees (Prunus persica) is the fruit, not much is known about miRNAs in this organ. In this study, miRNAs and their targets were identified and characterized from libraries of small RNAs of peach fruit through Solexa based-sequencing and bioinformatics approaches. A total of 557 known peach miRNAs belonging to 34 miRNA families were identified, and some of these miRNAs were found to be highly conserved in at least four other plant species. Using the most current criteria for miRNA annotation, 275 putative novel miRNAs were predicted, and the sequencing frequencies of these novel miRNAs were less than those of the conserved miRNAs. In total, 3959 and 1614 target genes for 349 known and 193 novel miRNAs, respectively, were predicted with the criteria that a single target gene can be targeted by different miRNAs and that a single miRNA can also have a large number of target genes. Three targets were even found to be targeted by 13 novel miRNAs that contained the same complete miRNA sequence at different locations and had different scaffolds. The proteins predicted to be targeted by the miRNAs identified in this study encompass a wide range of transcription factors and are involved in many biological processes and pathways, including development, metabolism, stress responses and signal transduction. A total of 115 and 101 target genes were identified to be cleaved by 60 known miRNAs and 27 novel miRNAs through degradome sequencing, respectively. These miRNAs induce cleavage of their targets precisely at the position between nucleotides 10 and 11 of the miRNA sequences from the 5' to the 3' end. Thirty conserved miRNAs and 19 novel miRNAs exhibited differential expression profiles in the peach, and the expression patterns of some miRNAs appeared to be tissue- or developmental stage-specific. The

  14. Genome-wide identification of miRNAs responsive to drought in peach (Prunus persica) by high-throughput deep sequencing. (United States)

    Eldem, Vahap; Çelikkol Akçay, Ufuk; Ozhuner, Esma; Bakır, Yakup; Uranbey, Serkan; Unver, Turgay


    Peach (Prunus persica L.) is one of the most important worldwide fresh fruits. Since fruit growth largely depends on adequate water supply, drought stress is considered as the most important abiotic stress limiting fleshy fruit production and quality in peach. Plant responses to drought stress are regulated both at transcriptional and post-transcriptional level. As post-transcriptional gene regulators, miRNAs (miRNAs) are small (19-25 nucleotides in length), endogenous, non-coding RNAs. Recent studies indicate that miRNAs are involved in plant responses to drought. Therefore, Illumina deep sequencing technology was used for genome-wide identification of miRNAs and their expression profile in response to drought in peach. In this study, four sRNA libraries were constructed from leaf control (LC), leaf stress (LS), root control (RC) and root stress (RS) samples. We identified a total of 531, 471, 535 and 487 known mature miRNAs in LC, LS, RC and RS libraries, respectively. The expression level of 262 (104 up-regulated, 158 down-regulated) of the 453 miRNAs changed significantly in leaf tissue, whereas 368 (221 up-regulated, 147 down-regulated) of the 465 miRNAs had expression levels that changed significantly in root tissue upon drought stress. Additionally, a total of 197, 221, 238 and 265 novel miRNA precursor candidates were identified from LC, LS, RC and RS libraries, respectively. Target transcripts (137 for LC, 133 for LS, 148 for RC and 153 for RS) generated significant Gene Ontology (GO) terms related to DNA binding and catalytic activities. Genome-wide miRNA expression analysis of peach by deep sequencing approach helped to expand our understanding of miRNA function in response to drought stress in peach and Rosaceae. A set of differentially expressed miRNAs could pave the way for developing new strategies to alleviate the adverse effects of drought stress on plant growth and development.

  15. Genome-wide identification of miRNAs responsive to drought in peach (Prunus persica by high-throughput deep sequencing.

    Directory of Open Access Journals (Sweden)

    Vahap Eldem

    Full Text Available Peach (Prunus persica L. is one of the most important worldwide fresh fruits. Since fruit growth largely depends on adequate water supply, drought stress is considered as the most important abiotic stress limiting fleshy fruit production and quality in peach. Plant responses to drought stress are regulated both at transcriptional and post-transcriptional level. As post-transcriptional gene regulators, miRNAs (miRNAs are small (19-25 nucleotides in length, endogenous, non-coding RNAs. Recent studies indicate that miRNAs are involved in plant responses to drought. Therefore, Illumina deep sequencing technology was used for genome-wide identification of miRNAs and their expression profile in response to drought in peach. In this study, four sRNA libraries were constructed from leaf control (LC, leaf stress (LS, root control (RC and root stress (RS samples. We identified a total of 531, 471, 535 and 487 known mature miRNAs in LC, LS, RC and RS libraries, respectively. The expression level of 262 (104 up-regulated, 158 down-regulated of the 453 miRNAs changed significantly in leaf tissue, whereas 368 (221 up-regulated, 147 down-regulated of the 465 miRNAs had expression levels that changed significantly in root tissue upon drought stress. Additionally, a total of 197, 221, 238 and 265 novel miRNA precursor candidates were identified from LC, LS, RC and RS libraries, respectively. Target transcripts (137 for LC, 133 for LS, 148 for RC and 153 for RS generated significant Gene Ontology (GO terms related to DNA binding and catalytic activities. Genome-wide miRNA expression analysis of peach by deep sequencing approach helped to expand our understanding of miRNA function in response to drought stress in peach and Rosaceae. A set of differentially expressed miRNAs could pave the way for developing new strategies to alleviate the adverse effects of drought stress on plant growth and development.

  16. Identification of Known and Novel microRNAs and Their Targets in Peach (Prunus persica) Fruit by High-Throughput Sequencing (United States)


    MicroRNAs (miRNAs) are a group of non-coding RNAs that have functions in post-transcriptional gene regulation in plants. Although the most important economic component of peach trees (Prunus persica) is the fruit, not much is known about miRNAs in this organ. In this study, miRNAs and their targets were identified and characterized from libraries of small RNAs of peach fruit through Solexa based-sequencing and bioinformatics approaches. A total of 557 known peach miRNAs belonging to 34 miRNA families were identified, and some of these miRNAs were found to be highly conserved in at least four other plant species. Using the most current criteria for miRNA annotation, 275 putative novel miRNAs were predicted, and the sequencing frequencies of these novel miRNAs were less than those of the conserved miRNAs. In total, 3959 and 1614 target genes for 349 known and 193 novel miRNAs, respectively, were predicted with the criteria that a single target gene can be targeted by different miRNAs and that a single miRNA can also have a large number of target genes. Three targets were even found to be targeted by 13 novel miRNAs that contained the same complete miRNA sequence at different locations and had different scaffolds. The proteins predicted to be targeted by the miRNAs identified in this study encompass a wide range of transcription factors and are involved in many biological processes and pathways, including development, metabolism, stress responses and signal transduction. A total of 115 and 101 target genes were identified to be cleaved by 60 known miRNAs and 27 novel miRNAs through degradome sequencing, respectively. These miRNAs induce cleavage of their targets precisely at the position between nucleotides 10 and 11 of the miRNA sequences from the 5’ to the 3’ end. Thirty conserved miRNAs and 19 novel miRNAs exhibited differential expression profiles in the peach, and the expression patterns of some miRNAs appeared to be tissue- or developmental stage

  17. Effects of iron chlorosis and iron resupply on leaf xylem architecture, water relations, gas exchange and stomatal performance of field-grown peach (Prunus persica). (United States)

    Eichert, Thomas; Peguero-Pina, José Javier; Gil-Pelegrín, Eustaquio; Heredia, Antonio; Fernández, Victoria


    There is increasing evidence suggesting that iron (Fe) deficiency induces not only leaf chlorosis and a decline of photosynthesis, but also structural changes in leaf morphology, which might affect the functionality of leaves. In this study, we investigated the effects of Fe deficiency on the water relations of peach (Prunus persica (L.) Batsch.) leaves and the responses of previously chlorotic leaves to Fe resupply via the root or the leaf. Iron deficiency induced a decline of maximum potential photosystem II (PSII) efficiency (F(V)/F(M)), of rates of net photosynthesis and transpiration and of water use efficiency. Iron chlorosis was associated with a reduction of leaf xylem vessel size and of leaf hydraulic conductance. In the course of the day, water potentials in chlorotic leaves remained higher (less negative) than in green leaves. In chlorotic leaves, normal stomatal functioning was disturbed, as evidenced by the lack of opening upon withdrawal of external CO(2) and stomatal closure after sudden illumination of previously darkened leaves. We conclude that the Fe deficiency induced limitations of xylem conductivity elicited a water saving strategy, which poses an additional challenge to plant growth on high pH, calcareous soils. Fertilisation with Fe improved photosynthetic performance but the proper xylem structure and water relations of leaves were not fully restored, indicating that Fe must be available at the first stages of leaf growth and development.

  18. Mites fluctuation population on peach tree (Prunus persica (L. Batsch and in associated plants Flutuação populacional de ácaros na cultura do pessegueiro (Prunus persica (L. Batsch e em plantas associadas

    Directory of Open Access Journals (Sweden)

    Carla Rosana Eichelberger


    Full Text Available Despite the importance of peach (Prunus persica (L. Batsch in Rio Grande do Sul, little is known about mites fluctuation population considered important to this crop. The objective of this study was to know the population diversity and fluctuation of mite species associated with Premier and Eldorado varieties in Roca Sales and Venâncio Aires counties, Rio Grande do Sul. The study was conducted from July 2008 to June 2009 when 15 plants were randomly chosen in each area. The plants were divided in quadrants and from each one a branch was chosen from which three leaves were removed: one collected in the apical region, another in the medium and the other in the basal region, totalizing 180 leaves/area. Five of the most abundant associated plants were collected monthly in enough amounts for the screening under the stereoscopic microscope during an hour. A total of 1,124 mites were found belonging to 14 families and 28 species. Tetranychus ludeni Zacher, 1913, Panonychus ulmi (Koch, 1836 and Mononychellus planki (McGregor, 1950 were the most abundant phytophagous mites, whereas Typhlodromalus aripo Deleon, 1967 and Phytoseiulus macropilis (Banks, 1904 the most common predatory mites. The period of one hour under stereoscopic microscope was enough to get a representative sample. In both places evaluated the ecologic indices were low, but little higherin Premier (H' 0.56; EqJ: 0.43 when compared to Eldorado (H' 0.53; EqJ 0.40. In Premier constant species were not observed and accessory only Brevipalpus phoenicis (Geijskes, 1939, T. ludeni and T. aripo. Higher abundance was observed in December and January and bigger amount in April. Already in Eldorado, T. ludeni and P. ulmi were constants. Greater abundance was observed in November and December, whereas grater richness in December and January. In both orchards were not found mites in buds. Tetranychus ludeni is the most abundant phytophagous mites with outbreak population in November, December and

  19. Dormancy in Peach (Prunus persica L.) Flower Buds : I. Floral Morphogenesis and Endogenous Gibberellins at the End of the Dormancy Period. (United States)

    Luna, V; Lorenzo, E; Reinoso, H; Tordable, M C; Abdala, G; Pharis, R P; Bottini, R


    Flower buds of peach (Prunus persica L.) trees, cv Novedad de Cordoba (Argentina), were collected near the end of the dormant period and immediately before anthesis. After removal of scale leaves, morphological observations of representative buds, made on transverse and longitudinal microtome sections, showed that all verticils making up the flower are present in an undifferentiated form during the dormant period (June). Flower buds collected at the end of dormant period (August) showed additional growth and differentiation, at which time formation of two ovules was beginning in the unicarpelar gynoecium. Dehiscence of anthers had not yet occurred 10 days before full bloom, and the ovules were still developing. Free endogenous gibberellin (GA)-like substances were quantified by bioassay (Tan-ginbozu dwarf rice microdrop) after SiO(2) partition column chromatography, reversed phase C18-high performance liquid chromatography, and finally Nucleosil [N(CH(3))(2)]high performance liquid chromatography. Bioactive fractions were then subjected to capillary gas chromatography-mass spectrometry-selected ion monitoring (GC-MS-SIM). Gibberellins A(1), A(3), and A(8) were tentatively identified in peach flower buds using GC-SIM and Kovat's retention indices, and relative amounts approximated by GC-SIM (2:8:6 for GA(1), GA(3), and GA(8), respectively). The highest concentration (330 nanograms per gram dry weight) of free GA(1)/GA(3) was found in dormant buds (June) and diminished thereafter. The concentration free of GA(1)/GA(3) did not increase immediately prior to bud break. However, high GA(1)/GA(3) concentrations occurred during stages where rate of growth and cellular differentiation of (mainly fertile) verticils can be influenced.

  20. Gene regulation of anthocyanin biosynthesis in two blood-flesh peach (Prunus persica (L.) Batsch) cultivars during fruit development. (United States)

    Jiao, Yun; Ma, Rui-juan; Shen, Zhi-jun; Yan, Juan; Yu, Ming-liang


    The blood-flesh peach has become popular in China due to its attractive anthocyanin-induced pigmentation and antioxidant properties. In this study, we investigated the molecular mechanisms underlying anthocyanin accumulation by examining the expression of nine genes of the anthocyanin biosynthesis pathway found in the peach mesocarp. Expression was measured at six developmental stages in fruit of two blood-flesh and one white-flesh peach cultivars, using quantitative reverse transcription polymerase chain reaction (qRT-PCR). Results show that the expression of the chalcone synthase (CHS) gene was closely related to anthocyanin accumulation in both of the blood-flesh peaches. In the white-flesh peach, we found that the transcription level of phenylalanine ammonia-lyase (PAL) during fruit development was much lower than that in the blood-flesh peach, even though all other genes of the anthocyanin biosynthesis pathway were highly expressed, suggesting that the PAL gene may be limiting in anthocyanin production in the white-flesh peach. Moreover, the transcription levels of the CHS and UDP-glucose-flavonoid 3-O-glucosyltransferase (UFGT) genes were markedly up-regulated at three days after bag removal (DABR) in the blood-flesh peach, suggesting that CHS and UFGT are the key genes in the process of anthocyanin biosynthesis for both of the blood-flesh peaches. The present study will be of great help in improving understanding of the molecular mechanisms involved in anthocyanin accumulation in blood-flesh peaches.

  1. Genome-wide identification and analysis of FK506-binding protein gene family in peach (Prunus persica). (United States)

    Zhang, Yanping; Han, Jan; Liu, Dan; Wen, Xicheng; Li, Yu; Tao, Ran; Peng, Yongbin; Fang, Jinggui; Wang, Chen


    The FKBP protein family has prolyl isomerase activity and is related in function to cyclophilins. FKBPs are known to be involved in many biological processes including hormone signaling, plant growth, and stress responses through a chaperone or an isomerization of proline residues during protein folding. The availability of complete peach genome sequences allowed the identification of 21 FKBP genes by HMMER and BLAST analyses. Scaffold locations of these FKBP genes in the peach genome were determined and the protein domain and motif organization of peach FKBPs were analyzed. The phylogenetic relationships between peach FKBPs were also assessed. The expression profiles of peach FKBP gene results revealed that most peach FKBPs were expressed in all tissues, while a few peach FKBPs were specifically expressed in some of the tissues. This data could contribute to better understanding of the complex regulation of the peach FKBP gene family, and also provide valuable information for further research in peach functional genomics. Copyright © 2013 Elsevier B.V. All rights reserved.

  2. Occupational Allergy to Peach (Prunus persica) Tree Pollen and Potential Cross-Reactivity between Rosaceae Family Pollens. (United States)

    Jiang, Nannan; Yin, Jia; Mak, Philip; Wen, Liping


    Orchard workers in north China are highly exposed to orchard pollens, especially peach and other Rosaceae family pollens during pollination season. The aim of this study was to investigate whether occupational allergy to peach tree pollen as a member of Rosaceae family is IgE-mediated and to evaluate the cross-reactivity among Rosaceae family pollens. Allergen skin test and conjunctival challenge test were performed; enzyme linked immune-sorbent assay (ELISA), inhibiting ELISA, western immunoblotting and inhibiting western immunoblotting were done with Rosaceae family orchard pollens, including peach, apricot, cherry, apple and pear tree pollens. Mass spectrometry was also performed to probe the main allergen component and cross-reactive protein. Sensitizations to peach pollen were found in both skin test and conjunctival challenge in the patients. Serum specific IgE to three pollens (peach, apricot and cherry) were detected through ELISA. When peach pollen used as solid phase, ELISA inhibition revealed other four kinds of pollens capable of inducing partial to strong inhibitions (45% to 87%), with the strongest inhibition belonging to apricot pollen (87%). Western blotting showed predominant IgE binding to a 20 KD protein among these pollens, which appeared to be a cross-reactive allergen component through western blotting inhibition. It was recognized as a protein homologous to glutathione s-transferase 16 from Arabidopsis thaliana. Peach and other Rosaceae family tree pollen may serve as a potential cause of IgE mediated occupational respiratory disease in orchard workers in north China.

  3. Genome-Wide Identification and Analysis of the Type-B Authentic Response Regulator Gene Family in Peach (Prunus persica). (United States)

    Zeng, Jingjue; Zhu, Xudong; Haider, Muhammad S; Wang, Xicheng; Zhang, Cheng; Wang, Chen


    The type-B authentic response regulator (ARR-B) family members serve as DNA-binding transcriptional regulators, whose activities are probably regulated by phosphorylation/dephosphorylation, resulting in the rapid induction of type-A ARR genes. Type-B ARRs are believed to be involved in many biological processes, including cytokinin signaling, plant growth, and stress responses through a chaperone or by isomerization of proline residues during protein folding. The public availability of complete peach genome sequences allows the identification of 23 ARR-B genes by HMMER and blast analysis. Scaffold locations of these genes in the peach genome were determined, and the protein domain and motif organization of peach type-B ARRs were analyzed. The phylogenetic relationships between peach type-B ARRs were also assessed. The expression profiles of peach ARR-B genes revealed that most of the type-B ARRs showed high expression levels in tissues undergoing rapid cell division and may engage more cytokinins, like half-opened flowers, fruits at expansion stages, and young leaves. These findings not only contribute to a better understanding of the complex regulation of the peach ARR-B gene family, but also provide valuable information for future research in peach functional genomics. © 2017 S. Karger AG, Basel.

  4. The Impact of Maturity Stage on Cell Membrane Integrity and Enzymatic Browning Reactions in High Pressure Processed Peaches (Prunus persica). (United States)

    Techakanon, Chukwan; Gradziel, Thomas M; Zhang, Lu; Barrett, Diane M


    Fruit maturity is an important factor associated with final product quality, and it may have an effect on the level of browning in peaches that are high pressure processed (HPP). Peaches from three different maturities, as determined by firmness (M1 = 50-55 N, M2 = 35-40 N, and M3 = 15-20 N), were subjected to pressure levels at 0.1, 200, and 400 MPa for 10 min. The damage from HPP treatment results in loss of fruit integrity and the development of browning during storage. Increasing pressure levels of HPP treatment resulted in greater damage, particularly in the more mature peaches, as determined by shifts in transverse relaxation time (T2) of the vacuolar component and by light microscopy. The discoloration of peach slices of different maturities processed at the same pressure was comparable, indicating that the effect of pressure level is greater than that of maturity in the development of browning.

  5. Antioxidant capacity, quality, and anthocyanin and nutrient contents of several peach cultivars [Prunus persica (L.) Batsch] grown in Spain. (United States)

    Reig, G; Iglesias, I; Gatius, F; Alegre, S


    Antioxidant capacity, quality, and anthocyanin and nutrient contents of 106 peach cultivars from different breeding programs were evaluated at the Estació Experimental de Lleida, IRTA (Catalonia, Spain), during two growing seasons (2010 and 2011). High variability was found among cultivars within each quality trait, where different cultivars were scored as the best and the worst. For example, a 5-fold range (2.17-12.07 g of malic acid L⁻¹), 6-fold range (144.20-711.73 μg of Trolox g⁻¹ of FW), and 11-fold range (0.70-11.43 mg of cyanidin-3-glucoside kg⁻¹ of FW) were observed in titratable acidity, relative antioxidant capacity, and anthocyanin content, respectively. The breeding program within each fruit type (melting peach, nectarine, and flat peach) and qualitative pomological traits also had significant effects on the quality. Nevertheless, each breeding program had specific characteristics that distinguished it from the others. Even so, within each breeding program, there is high variability among cultivars. Therefore, growers should not base their strategy exclusively on the choice of breeding program. Principal component analysis for each fruit type (melting peach, nectarine, nonmelting peach, and flat peach) allowed a selection of a set of cultivars from different breeding programs with the highest quality performance. For example, cultivars such as 'Azurite', 'IFF 1230', 'Amiga', 'Fire Top', 'African Bonnigold', 'Ferlot', 'Mesembrine', and 'Platifirst' had higher sweetness and flavor compared to the others. Therefore, this study could help breeders to make decisions for the selection of new cultivars able to improve the quality features of fruit intake, technicians to know better quality performance of peach cultivars, and consumers to meet their expectations for fruit with high health benefits and a specific taste.

  6. The study of a SPATULA-like bHLH transcription factor expressed during peach (Prunus persica) fruit development. (United States)

    Tani, Eleni; Tsaballa, Aphrodite; Stedel, Catalina; Kalloniati, Chrissanthi; Papaefthimiou, Dimitra; Polidoros, Alexios; Darzentas, Nikos; Ganopoulos, Ioannis; Flemetakis, Emmanouil; Katinakis, Panagiotis; Tsaftaris, Athanasios


    Extensive studies on the dry fruits of the model plant arabidopsis (Arabidopsis thaliana) have revealed various gene regulators of the development and dehiscence of the siliques. Peach pericarp is analogous to the valve tissues of the arabidopsis siliques. The stone (otherwise called pit) in drupes is formed through lignification of the fruit endocarp. The lignified endocarp in peach can be susceptible to split-pit formation under certain genetic as well as environmental factors. This phenomenon delays processing of the clingstone varieties of peach and causes economical losses for the peach fruit canning industry. The fruitfull (FUL) and shatterproof (SHP) genes are key MADS-box transcription protein coding factors that control fruit development and dehiscence in arabidopsis by promoting the expression of basic helix-loop-helix (bHLH) transcription factors like Spatula (SPT) and Alcatraz (ALC). Results from our previous studies on peach suggested that temporal regulation of PPERFUL and PPERSHP gene expression may be involved in the regulation of endocarp margin development. In the present study a PPERSPATULA-like (PPERSPT) gene was cloned and characterized. Comparative analysis of temporal regulation of PPERSPT gene expression during pit hardening in a resistant and a susceptible to split-pit variety, suggests that this gene adds one more component to the genes network that controls endocarp margins development in peach. Taking into consideration that no ALC-like genes have been identified in any dicot plant species outside the Brassicaceae family, where arabidopsis belongs, PPERSPT may have additional role(s) in peach that are fulfilled in arabidopsis by ALC. Copyright © 2011 Elsevier Masson SAS. All rights reserved.

  7. The peach (Prunus persica L. Batsch) genome harbours 10 KNOX genes, which are differentially expressed in stem development, and the class 1 KNOPE1 regulates elongation and lignification during primary growth. (United States)

    Testone, Giulio; Condello, Emiliano; Verde, Ignazio; Nicolodi, Chiara; Caboni, Emilia; Dettori, Maria Teresa; Vendramin, Elisa; Bruno, Leonardo; Bitonti, Maria Beatrice; Mele, Giovanni; Giannino, Donato


    The KNOTTED-like (KNOX) genes encode homeodomain transcription factors and regulate several processes of plant organ development. The peach (Prunus persica L. Batsch) genome was found to contain 10 KNOX members (KNOPE genes); six of them were experimentally located on the Prunus reference map and the class 1 KNOPE1 was found to link to a quantitative trait locus (QTL) for the internode length in the peach×Ferganensis population. All the KNOPE genes were differentially transcribed in the internodes of growing shoots; the KNOPE1 mRNA abundance decreased progressively from primary (elongation) to secondary growth (radial expansion). During primary growth, the KNOPE1 mRNA was localized in the cortex and in the procambium/metaphloem zones, whereas it was undetected in incipient phloem and xylem fibres. KNOPE1 overexpression in the Arabidopsis bp4 loss-of-function background (35S:KNOPE1/bp genotype) restored the rachis length, suggesting, together with the QTL association, a role for KNOPE1 in peach shoot elongation. Several lignin biosynthesis genes were up-regulated in the bp4 internodes but repressed in the 35S:KNOPE1/bp lines similarly to the wild type. Moreover, the lignin deposition pattern of the 35S:KNOPE1/bp and the wild-type internodes were the same. The KNOPE1 protein was found to recognize in vitro one of the typical KNOX DNA-binding sites that recurred in peach and Arabidopsis lignin genes. KNOPE1 expression was inversely correlated with that of lignin genes and lignin deposition along the peach shoot stems and was down-regulated in lignifying vascular tissues. These data strongly support that KNOPE1 prevents cell lignification by repressing lignin genes during peach stem primary growth.

  8. Treated Dixiland Prunus persica Fruits: Common and Distinct Response to Heat and Cold


    Lauxmann, Martin Alexander; Brun, Bianca; Borsani, Julia; Bustamante, Claudia Anabel; Budde, Claudio; Lara, Maria Valeria; Drincovich, Maria Fabiana


    Cold storage is extensively used to slow the rapid deterioration of peach (Prunus persica L. Batsch) fruit after harvest. However, peach fruit subjected to long periods of cold storage develop chilling injury (CI) symptoms. Post-harvest heat treatment (HT) of peach fruit prior to cold storage is effective in reducing some CI symptoms, maintaining fruit quality, preventing softening and controlling post-harvest diseases. To identify the molecular changes induced by HT, which may be associated ...

  9. Genome-wide analysis of the homeodomain-leucine zipper (HD-ZIP) gene family in peach (Prunus persica). (United States)

    Zhang, C H; Ma, R J; Shen, Z J; Sun, X; Korir, N K; Yu, M L


    In this study, 33 homeodomain-leucine zipper (HD-ZIP) genes were identified in peach using the HD-ZIP amino acid sequences of Arabidopsis thaliana as a probe. Based on the phylogenetic analysis and the individual gene or protein characteristics, the HD-ZIP gene family in peach can be classified into 4 subfamilies, HD-ZIP I, II, III, and IV, containing 14, 7, 4, and 8 members, respectively. The most closely related peach HD-ZIP members within the same subfamilies shared very similar gene structure in terms of either intron/exon numbers or lengths. Almost all members of the same subfamily shared common motif compositions, thereby implying that the HD-ZIP proteins within the same subfamily may have functional similarity. The 33 peach HD-ZIP genes were distributed across scaffolds 1 to 7. Although the primary structure varied among HD-ZIP family proteins, their tertiary structures were similar. The results from this study will be useful in selecting candidate genes from specific subfamilies for functional analysis.

  10. Prunus hybrids rootstocks for flat peach

    Directory of Open Access Journals (Sweden)

    Pilar Legua


    Full Text Available Peach (Prunus persica L. is the most important stone fruit tree grown in Spain and is the second most important fruit crop in Europe. The influence of eight Prunus rootstocks (GF-677, Krymsk® 86, PADAC 97-36, PADAC 99-05, PADAC 9912-03, PADAC 0024-01, PAC 0021-01 and PAC 0022-01 on vigor, yield and fruit quality traits of 'UFO 3' flat peach cultivar was studied. The highest trunk cross sectional area was exhibited by GF-677 and the lowest by PADAC 99-05, while intermediate values were found on the other rootstocks. The highest yield efficiency was found on PADAC 99-05, PAC 0021-01, PAC 0022-01 and PADAC 0024-01 and the lowest was shown on Krymsk® 86. The fruit quality parameters measured were color, fruit and stone weights, equatorial diameter, pulp thickness, pulp yield, firmness, pH, soluble solids content and titratable acidity. 'UFO 3' grafted on GF-677 resulted in the largest fruit weight, while the smallest was on PADAC 99-05. Fruits of 'UFO 3' showed a tendency to have higher firmness, higher red colored skin and RI when grafted on PADAC 99-05.

  11. Potassium contributes to zinc stress tolerance in peach (Prunus persica) seedlings by enhancing photosynthesis and the antioxidant defense system. (United States)

    Song, Z Z; Duan, C L; Guo, S L; Yang, Y; Feng, Y F; Ma, R J; Yu, M L


    Zinc (Zn) is considered to be a major industrial pollutant because excessive amounts can impair plant growth. In this paper, we found that peach 'Yoshihime' seedlings are promising Zn tolerant plants. However, heavy Zn toxicity (2 mM) damaged plant performance by disrupting biochemical processes, including photosynthesis, proline production, and K(+) nutrition. Notably, elevated external K(+) supply (10 mM) alleviated peach seedlings from Zn toxicity, evidenced by enhanced photosynthesis, antioxidant defense systems, and plant K(+) nutritional status. Moreover, the transcript levels of KUP (K(+) uptake) genes involved in K(+) acquisition, transport, and homeostasis were significantly upregulated following supply of sufficient K(+) upon Zn toxicity. In general, K(+) favorably contributes to improvements in internal K(+) homeostasis, via the help of K(+) transporters, further protecting plant photosynthesis and the antioxidative defense system. Our findings further benefit the study of the mechanisms underpinning heavy metal tolerance in woody plants.

  12. Gamma irradiation induced enhancement of phenylalanine ammonia-lyase (PAL) and antioxidant activity in peach ( Prunus persica Bausch, Cv. Elberta) (United States)

    Hussain, Peerzada R.; Wani, Ali M.; Meena, Raghuveer S.; Dar, Mohd A.


    Effect of medium dose gamma irradiation on PAL and antioxidant activity of peach fruit was investigated. Peach fruit after harvest at commercial maturity was irradiated in the dose range 1.0-2.0 kGy, stored under refrigerated conditions (3±1 °C, RH 80%) and evaluated at intervals of 7 days. The antioxidant activity as determined by DPPH and FRAP methods revealed significant ( p≤0.05) increase particularly in the dose range 1.6-2.0 kGy. During storage, maximum increase in both PAL and antioxidant activity was observed after 21 days. Positive correlation ( r=0.75) existed between antioxidant activity and total phenols. EC 50 values as obtained from DPPH and FRAP experiments were significantly ( p≤0.05) lower in irradiated fruits compared to control.

  13. Complete nucleotide sequences of two isolates of cherry green ring mottle virus from peach (Prunus persica) in China. (United States)

    Wang, Lihui; Jiang, Dongmei; Niu, Feiqing; Lu, Meiguang; Wang, Hongqing; Li, Shifang


    Two complete nucleotide sequences of cherry green ring mottle virus (CGRMV) isolated from peach in Hebei (Hs10) and Fujian (F9) Provinces, China, were determined. Five open reading frames (ORFs) were found in the genomes of both isolates. The F9 and Hs10 isolates shared 82.2 % and 83.4-94.4 % nucleotide sequence identity, respectively, with two CGRMV isolates from cherry. Analysis of the nucleotide and amino acid sequences from the five ORFs of both isolates showed that Hs10 shares the greatest sequence identity with P1A (GenBank AJ291761) from cherry. Phylogenetic analysis indicated that CGRMV isolates from peach and cherry are closely related to members of the genus Foveavirus.

  14. Gamma irradiation induced enhancement of phenylalanine ammonia-lyase (PAL) and antioxidant activity in peach (Prunus persica Bausch, Cv. Elberta)

    Energy Technology Data Exchange (ETDEWEB)

    Hussain, Peerzada R., E-mail: [Nuclear Research Laboratory, Bhabha Atomic Research Centre, Zakura, Srinagar 190006, Kashmir (India); Wani, Ali M.; Meena, Raghuveer S.; Dar, Mohd A. [Nuclear Research Laboratory, Bhabha Atomic Research Centre, Zakura, Srinagar 190006, Kashmir (India)


    Effect of medium dose gamma irradiation on PAL and antioxidant activity of peach fruit was investigated. Peach fruit after harvest at commercial maturity was irradiated in the dose range 1.0-2.0 kGy, stored under refrigerated conditions (3{+-}1 {sup o}C, RH 80%) and evaluated at intervals of 7 days. The antioxidant activity as determined by DPPH and FRAP methods revealed significant (p{<=}0.05) increase particularly in the dose range 1.6-2.0 kGy. During storage, maximum increase in both PAL and antioxidant activity was observed after 21 days. Positive correlation (r=0.75) existed between antioxidant activity and total phenols. EC{sub 50} values as obtained from DPPH and FRAP experiments were significantly (p{<=}0.05) lower in irradiated fruits compared to control.

  15. Acyl-CoA oxidase 1 is involved in γ-decalactone release from peach (Prunus persica) fruit. (United States)

    Zhang, Liping; Li, Haiyan; Gao, Ling; Qi, Yujie; Fu, Wanyi; Li, Xiongwei; Zhou, Xiang; Gao, Qikang; Gao, Zhongshan; Jia, Huijuan


    γ-Decalactone accumulation in peach mesocarp was highly correlated with ACX enzyme activity and natural PpACX1 content. Adding the purified recombinant PpACX1 induced γ-decalactone biosynthesis in cultured mesocarp discs in vitro. Previous gene expression studies have implied that acyl coenzyme A oxidase (ACX) is related to lactones synthesis, the characteristic aroma compounds of peach. Here, we analysed the correlation between γ-decalactone content and ACX enzyme activity in mesocarp of five different types of fully ripe peach varieties. Furthermore, 'Hu Jing Mi Lu' ('HJ') and 'Feng Hua Yu Lu' ('YL'), which have strong aroma among them, at four ripening stages were selected to study the role of ACX in lactone biosynthesis. The result showed that γ-decalactone was the most abundant lactone compound. γ-Decalactone accumulation was highly correlated with ACX enzyme activity. Mass spectrometry (MS) showed that PpACX1 was the most abundant PpACX protein in fully ripe mesocarp of cv. 'HJ'. To further elucidate the function of the PpACX1 protein, the PpACX1 gene was heterologously expressed in a bacterial system and characterized in vitro. MS identification gave the molecular weight of the recombinant PpACX1 as 94.44 kDa and the coverage rate of the peptide segments was 47.3%. In cultured mesocarp discs in vitro, adding the purified recombinant PpACX1 and C16-CoA substrate induced the expected γ-decalactone biosynthesis. Using a sandwich ELISA based on mixed mono- and polyclonal antibodies against recombinant PpACX1, PpACX1 content in mesocarp was found to be highly correlated with γ-decalactone accumulation in mesocarp of five fully ripe varieties and four ripening stages of 'HJ' and 'YL'. This study revealed the vital function of PpACX1 in γ-decalactone biosynthesis in peach fruit.

  16. Screening Quality Evaluation Factors of Freeze-Dried Peach (Prunus Persica L. Batsch Powders from Different Ripening Time Cultivars

    Directory of Open Access Journals (Sweden)

    Chun-ju Liu


    Full Text Available The quality evaluation of processed products is complex. To simplify the quality evaluation process and improve the efficiency, fourteen evaluation factors of freeze-dried powders of seventeen cultivars of peach at different ripening times were analyzed. The most important evaluation indicators and criteria were obtained by analysis of variance (ANOVA, correlation analysis (CA, principal component analysis (PCA, system cluster analysis (SCA, and analytic hierarchy process (AHP. Results showed that the peach powders had the significant differences in quality (P<0.05, and some processing factors were related with some physicochemical and nutritional factors. Five principle components were extracted by PCA and the cumulative contribution achieved was 84.46%. Through the score plot of the first two principal components, a clear differentiation among ripening times was found and three distinct groups were separated according to ripening time. Five characteristic factors were obtained as titratable acid, browning index, hemicellulose, hygroscopicity, and vitamin C by SCA. Their weights of 0.1249, 0.3007, 0.0514, 0.4916, and 0.0315 were obtained by AHP, respectively. The peach cultivars were divided into four evaluation grades by the comprehensive quality score.

  17. The early spring N uptake of young peach trees (Prunus persica) is affected by past and current fertilizations and levels of C and N stores. (United States)

    Jordan, Marie-Odile; Vercambre, Gilles; Gomez, Laurent; Pagès, Loïc


    In deciduous trees, shoot development in early spring is assumed to be achieved mainly at the expense of nitrogen (N) stores. Indeed, the possible compensation for poor autumn N storage by early spring N uptake has been little studied. We therefore determined the dynamics of spring N uptake in relation to spring N supply, carbon and N storage and shoot development. Young peach trees (Prunus persica L. Batsch, cv. 'GF305') were raised outdoors in a hydroponic set-up during the spring and summer, with an excessive N supply. During the autumn, half of the trees were then N limited. The following spring, the N supply remained either high or low, or changed from high to low or low to high. Between 6 March and 13 May, N uptake was measured automatically on an hourly basis, while shoot growth was monitored once a week. These in situ measurements were completed by three destructive harvests to assess organ composition in N and total non-structural carbohydrates (TNC). Until the end of April, N uptake was dependent on the autumn N treatment, being higher in trees that had been N limited in the autumn. Total non-structural carbohydrate mobilization was also higher in those trees that had lost at least 17 g TNC by 24 April, while TNC levels in non-limited trees remained stable or even rose. Shoot development, estimated by the number of elongated axes and leaves per axis, was also slightly delayed by an N limitation in autumn. After 24 April, N uptake rates increased notably under all treatments and was determined by the spring N supply. In trees receiving a high N supply in the spring, the uptake rates also displayed marked short-term variations. That reduced the differences between treatments and by 13 May no differences could be evidenced between the trees in terms of organ biomass and TNC and N contents, whatever the treatment. We concluded that in the early spring, N uptake may compensate for a deficit of N storage insofar as large quantities of TNC can be mobilized for

  18. Association between Chloroplast and Mitochondrial DNA sequences in Chinese Prunus genotypes (Prunus persica, Prunus domestica, and Prunus avium). (United States)

    Pervaiz, Tariq; Sun, Xin; Zhang, Yanyi; Tao, Ran; Zhang, Junhuan; Fang, Jinggui


    The nuclear DNA is conventionally used to assess the diversity and relatedness among different species, but variations at the DNA genome level has also been used to study the relationship among different organisms. In most species, mitochondrial and chloroplast genomes are inherited maternally; therefore it is anticipated that organelle DNA remains completely associated. Many research studies were conducted simultaneously on organelle genome. The objectives of this study was to analyze the genetic relationship between chloroplast and mitochondrial DNA in three Chinese Prunus genotypes viz., Prunus persica, Prunus domestica, and Prunus avium. We investigated the genetic diversity of Prunus genotypes using simple sequence repeat (SSR) markers relevant to the chloroplast and mitochondria. Most of the genotypes were genetically similar as revealed by phylogenetic analysis. The Y2 Wu Xing (Cherry) and L2 Hong Xin Li (Plum) genotypes have a high similarity index (0.89), followed by Zi Ye Li (0.85), whereas; L1 Tai Yang Li (plum) has the lowest genetic similarity (0.35). In case of cpSSR, Hong Tao (Peach) and L1 Tai Yang Li (Plum) genotypes demonstrated similarity index of 0.85 and Huang Tao has the lowest similarity index of 0.50. The mtSSR nucleotide sequence analysis revealed that each genotype has similar amplicon length (509 bp) except M5Y1 i.e., 505 bp with CCB256 primer; while in case of NAD6 primer, all genotypes showed different sizes. The MEHO (Peach), MEY1 (Cherry), MEL2 (Plum) and MEL1 (Plum) have 586 bps; while MEY2 (Cherry), MEZI (Plum) and MEHU (Peach) have 585, 584 and 566 bp, respectively. The CCB256 primer showed highly conserved sequences and minute single polymorphic nucleotides with no deletion or mutation. The cpSSR (ARCP511) microsatellites showed the harmonious amplicon length. The CZI (Plum), CHO (Peach) and CL1 (Plum) showed 182 bp; whileCHU (Peach), CY2 (Cherry), CL2 (Plum) and CY1 (Cherry) showed 181 bp amplicon lengths. These results

  19. Studies on enhancing the keeping quality of peach ( Prunus persica Bausch) Cv. Elberta by gamma-irradiation (United States)

    Hussain, P. R.; Meena, R. S.; Dar, M. A.; Wani, A. M.


    The effect of gamma-irradiation on keeping quality of peach fruit was studied. The fruit, after harvesting at proper maturity stage, was irradiated in the dose range of 1.0-2.0 kGy, stored under ambient (temp. 25±2 °C, RH 70%) and refrigerated (temp. 3±1 °C, RH 80%) conditions and evaluated periodically for firmness, total soluble solids (TSS), anthocyanins, water-soluble pectic fractions, loss in weight and decay percentage. The anthocyanin evaluation of the fruits revealed that irradiation enhanced the colour development under both the storage conditions. The gamma-irradiation dose range of 1.2-1.4 kGy proved effective in maintaining higher TSS concentration, reducing weight loss and significantly ( p⩽0.05) delaying the decaying of the fruit by 6 days under ambient conditions and by 20 days under refrigerated storage conditions.

  20. Studies on enhancing the keeping quality of peach (Prunus persica Bausch) Cv. Elberta by gamma-irradiation

    Energy Technology Data Exchange (ETDEWEB)

    Hussain, P.R.; Meena, R.S.; Dar, M.A. [Nuclear Research Laboratory, Bhabha Atomic Research Centre, Zakura, Srinagar-190006 (India); Wani, A.M. [Nuclear Research Laboratory, Bhabha Atomic Research Centre, Zakura, Srinagar-190006 (India)], E-mail:


    The effect of gamma-irradiation on keeping quality of peach fruit was studied. The fruit, after harvesting at proper maturity stage, was irradiated in the dose range of 1.0-2.0 kGy, stored under ambient (temp. 25{+-}2 deg. C, RH 70%) and refrigerated (temp. 3{+-}1 deg. C, RH 80%) conditions and evaluated periodically for firmness, total soluble solids (TSS), anthocyanins, water-soluble pectic fractions, loss in weight and decay percentage. The anthocyanin evaluation of the fruits revealed that irradiation enhanced the colour development under both the storage conditions. The gamma-irradiation dose range of 1.2-1.4 kGy proved effective in maintaining higher TSS concentration, reducing weight loss and significantly (p{<=}0.05) delaying the decaying of the fruit by 6 days under ambient conditions and by 20 days under refrigerated storage conditions.

  1. Carbohydrate-Free Peach (Prunus persica) and Plum (Prunus salicina) [corrected] Juice Affects Fecal Microbial Ecology in an Obese Animal Model. (United States)

    Noratto, Giuliana D; Garcia-Mazcorro, Jose F; Markel, Melissa; Martino, Hercia S; Minamoto, Yasushi; Steiner, Jörg M; Byrne, David; Suchodolski, Jan S; Mertens-Talcott, Susanne U


    Growing evidence shows the potential of nutritional interventions to treat obesity but most investigations have utilized non-digestible carbohydrates only. Peach and plum contain high amounts of polyphenols, compounds with demonstrated anti-obesity effects. The underlying process of successfully treating obesity using polyphenols may involve an alteration of the intestinal microbiota. However, this phenomenon is not well understood. Obese Zucker rats were assigned to three groups (peach, plum, and control, n = 10 each), wild-type group was named lean (n = 10). Carbohydrates in the fruit juices were eliminated using enzymatic hydrolysis. Fecal samples were obtained after 11 weeks of fruit or control juice administration. Real-time PCR and 454-pyrosequencing were used to evaluate changes in fecal microbiota. Over 1,500 different Operational Taxonomic Units at 97% similarity were detected in all rats. Several bacterial groups (e.g. Lactobacillus and members of Ruminococcacea) were found to be more abundant in the peach but especially in the plum group (plum juice contained 3 times more total polyphenolics compared to peach juice). Principal coordinate analysis based on Unifrac-based unweighted distance matrices revealed a distinct separation between the microbiota of control and treatment groups. These changes in fecal microbiota occurred simultaneously with differences in fecal short-chain acids concentrations between the control and treatment groups as well as a significant decrease in body weight in the plum group. This study suggests that consumption of carbohydrate-free peach and plum juice has the potential to modify fecal microbial ecology in an obese animal model. The separate contribution of polyphenols and non-polyphenols compounds (vitamins and minerals) to the observed changes is unknown.

  2. A simple model to predict the probability of a peach (Prunus persicae tree bud to develop as a long or short shoot as a consequence of winter pruning intensity and previous year growth.

    Directory of Open Access Journals (Sweden)

    Daniele Bevacqua

    Full Text Available In many woody plants, shoots emerging from buds can develop as short or long shoots. The probability of a bud to develop as a long or short shoot relies upon genetic, environmental and management factors and controlling it is an important issue in commercial orchard. We use peach (Prunus persicae trees, subjected to different winter pruning levels and monitored for two years, to develop and calibrate a model linking the probability of a bud to develop as a long shoot to winter pruning intensity and previous year vegetative growth. Eventually we show how our model can be used to adjust pruning intensity to obtain a desired proportion of long and short shoots.

  3. Responses of canopy transpiration and canopy conductance of peach (Prunus persica) trees to alternate partial root zone drip irrigation (United States)

    Gong, Daozhi; Kang, Shaozhong; Zhang, Jianhua


    We investigated canopy transpiration and canopy conductance of peach trees under three irrigation patterns: fixed 1/2 partial root zone drip irrigation (FPRDI), alternate 1/2 partial root zone drip irrigation (APRDI) and full root zone drip irrigation (FDI). Canopy transpiration was measured using heat pulse sensors, and canopy conductance was calculated using the Jarvis model and the inversion of the Penman-Monteith equation. Results showed that the transpiration rate and canopy conductance in FPRDI and APRDI were smaller than those in FDI. More significantly, the total irrigation amount was greatly reduced, by 34.7% and 39.6%, respectively for APRDI and FPRDI in the PRDI (partial root zone drip irrigation) treatment period. The daily transpiration was linearly related to the reference evapotranspiration in the three treatments, but daily transpiration of FDI is more than that of APRDI and FPRDI under the same evaporation demand, suggesting a restriction of transpiration water loss in the APRDI and FPRDI trees. FDI needed a higher soil water content to carry the same amount of transpiration as the APRDI and FPRDI trees, suggesting the hydraulic conductance of roots of APRDI and FPRDI trees was enhanced, and the roots had a greater water uptake than in FDI when the average soil water content in the root zone was the same. By a comparison between the transpiration rates predicted by the Penman-Monteith equation and the measured canopy transpiration rates for 60 days during the experimental period, an excellent correlation along the 1:1 line was found for all the treatments (R2 > 0.80), proving the reliability of the methodology.

  4. The contribution of stored malate and citrate to the substrate requirements of metabolism of ripening peach (Prunus persica L. Batsch) flesh is negligible. Implications for the occurrence of phosphoenolpyruvate carboxykinase and gluconeogenesis. (United States)

    Famiani, Franco; Farinelli, Daniela; Moscatello, Stefano; Battistelli, Alberto; Leegood, Richard C; Walker, Robert P


    The first aim of this study was to determine the contribution of stored malate and citrate to the substrate requirements of metabolism in the ripening flesh of the peach (Prunus persica L. Batsch) cultivar Adriatica. In the flesh, stored malate accumulated before ripening could contribute little or nothing to the net substrate requirements of metabolism. This was because there was synthesis and not dissimilation of malate throughout ripening. Stored citrate could potentially contribute a very small amount (about 5.8%) of the substrate required by metabolism when the whole ripening period was considered, and a maximum of about 7.5% over the latter part of ripening. The second aim of this study was to investigate why phosphoenolpyruvate carboxykinase (PEPCK) an enzyme utilised in gluconeogenesis from malate and citrate is present in peach flesh. The occurrence and localisation of enzymes utilised in the metabolism of malate, citrate and amino acids were determined in peach flesh throughout its development. Phosphoenolpyruvate carboxylase (essential for the synthesis of malate and citrate) was present in the same cells and at the same time as PEPCK and NADP-malic enzyme (both utilised in the dissimilation of malate and citrate). A hypothesis is presented to explain the presence of these enzymes and to account for the likely occurrence of gluconeogenesis. Copyright © 2016 Elsevier Masson SAS. All rights reserved.

  5. Expressional regulation of PpDAM5 and PpDAM6, peach (Prunus persica) dormancy-associated MADS-box genes, by low temperature and dormancy-breaking reagent treatment. (United States)

    Yamane, Hisayo; Ooka, Tomomi; Jotatsu, Hiroaki; Hosaka, Yukari; Sasaki, Ryuta; Tao, Ryutaro


    The present study investigated the expressional regulation of PpDAM5 and PpDAM6, two of the six peach (Prunus persica) dormancy-associated MADS-box genes, in relation to lateral bud endodormancy. PpDAM5 and PpDAM6 were originally identified as homologues of Arabidopsis SHORT VEGETATIVE PHASE/AGAMOUS-LIKE 24 identified in the EVERGROWING locus of peach. Furthermore, PpDAM5 and PpDAM6 have recently been suggested to be involved in terminal bud dormancy. In this study, seasonal expression analyses using leaves, stems, and lateral buds of high-chill and low-chill peaches in field conditions indicated that both genes were up-regulated during the endodormancy period and down-regulated with endodormancy release. Controlled environment experiments showed that the expression of both PpDAM5 and PpDAM6 were up-regulated by ambient cool temperatures in autumn, while they were down-regulated by the prolonged period of cold temperatures in winter. A negative correlation between expression levels of PpDAM5 and PpDAM6 and bud burst percentage was found in the prolonged cold temperature treatment. Application of the dormancy-breaking reagent cyanamide to endo/ecodormant lateral buds induced early bud break and down-regulation of PpDAM5 and PpDAM6 expression at the same time. These results collectively suggest that PpDAM5 and PpDAM6 may function in the chilling requirement of peach lateral buds through growth-inhibiting functions for bud break.

  6. Six-year performance of 14 Prunus rootstocks at 11 sites in the 2001 NC-140 peach trial (United States)

    Fourteen Prunus rootstock cultivars and selections budded with either ‘Redtop’, ‘Redhaven’ or ‘Cresthaven’ peach [Prunus persica (L.) Batsch] were planted at 11 locations in North America in 2001 in a randomized block design with a tree spacing of 5 by 6 m and 8 replicates. This test planting was a...

  7. Flutuação populacional e previsão de gerações de Grapholita molesta (Busck, 1916 (Lepidoptera: Tortricidae em pessegueiro, Prunus persica (Linnaeus Batsch = Populational fluctuation and generation prediction of Grapholita molesta (Busck, 1916 (Lepidoptera: Tortricidae in peach, Prunus persica (Linnaeus Batsch

    Directory of Open Access Journals (Sweden)

    Francisco Jorge Cividanes


    Full Text Available A mariposa-oriental, Grapholita molesta (Busck, 1916, encontra-se distribuída em quase todas as partes do mundo, constituindo importante praga do pessegueiro, Prunus persica (Linnaeus Batsch. Este estudo foi desenvolvido em pomar comercial de pessegueiro localizado em Taiúva, São Paulo, durante os anos 1997 a 2003, visando obter a flutuação populacional de adultos de G. molesta relacionando-a com fatores meteorológicos. O estudo também visou determinar uma data biofix adequada para prever a ocorrência de gerações da praga por meio de um modelo de graus-dia. A amostragem da mariposa-oriental e de insetos predadores foi efetuada com armadilha plástica com suco de pêssego e armadilha adesiva amarela, respectivamente. A influência de fatores físicos e biológicos foi avaliada por análise de correlação linear simples. Os maiores picos populacionais de G. molesta ocorreram nos meses de maio, julho e outubro. As correlações obtidas sugerem que a baixa umidade ambiental pode ter sido fator de mortalidade para G. molesta. O elevado número de pulverizações de inseticida pode ter causado impacto negativo sobre inimigos naturais contribuindo para a elevada densidade do inseto-praga no período de 1998 a 1999. A data de constatação dapresença de gemas vegetativas e de flor diferenciadas no pessegueiro mostrou-se adequada para se iniciar a contagem de graus-dia para prever gerações de G. molesta. Esses resultados devem ajudar aimplementação de programas para prever picos populacionais de adultos de G. molesta visando à aplicação de inseticidas. Recomenda-se a validação do modelo de graus-dia em outras localidades para comprovar os resultados obtidos.The oriental fruit moth, Grapholita molesta (Busck, 1916, is spread around the world and is considered an important pest on peach, Prunus persica (Linnaeus Batsch. This work was carried out at a commercial peach orchard located in Taiúva, State of São Paulo, Brazil, from 1997 to

  8. Atividade da peroxidase durante o período hibernal de plantas de pessegueiro (Prunus persica (L. Batsch. cv. jubileu com e sem sintomas da morte precoce Peroxidase activity during the rest period of peach trees (Prunus persica (L. Batsch cv. jubileu in plants with and without symptoms ofpeach-tree-short-life (PTSL

    Directory of Open Access Journals (Sweden)

    Anderson Carlos Marafon


    Full Text Available A morte precoce do pessegueiro (Prunus persica (L. Batsch é uma síndrome caracterizada por um colapso da planta durante a floração ou no início da brotação, após drástica redução da temperatura. O objetivo do presente trabalho foi determinar a atividade da peroxidase (UE min-1 g-1 MF durante o período hibernal, em gemas e ramos de plantas de pessegueiro cv. Jubileu, com e sem sintomas de morte precoce. Foram conduzidos dois experimentos separadamente, um para cada tipo de tecido, em dois pomares próximos, ambos com quatro anos de implantação, situados na região colonial de Pelotas - RS, nas localidades de Santa Helena e Cascata. As amostras foram constituídas por dois tipos de tecidos (gemas e ramos e foram coletadas em quatro datas (11-06, 11-07, 29-07 e 05-08 durante o inverno de 2003. As determinações da atividade da peroxidase nos tecidos foram realizadas no Laboratório de Fisiologia Vegetal da Embrapa Clima Temperado. As plantas com sintomas de morte precoce apresentaram, durante a dormência, maior atividade da peroxidase nos dois tipos de tecidos, quando comparadas com as plantas sem sintomas da síndrome. Provavelmente, o desencadeamento da síndrome provoca alterações na dormência das plantas afetadas, que resultam na antecipação da retomada do crescimento das gemas e na exposição dos tecidos recém-formados aos danos causados pelas baixas temperaturas. Os níveis populacionais donematoide-anelado (Mesocriconema xenoplax e dos nematoides do gênero Helicotylenchus sp. foram superiores nas amostras de solo coletadas na rizosfera das plantas com sintomas de morte precoce do que os verificados nas amostras coletadas das plantas sem sintomas da síndrome, resultando também na maior atividade da peroxidase em ambos os tecidos (gemas e ramos, durante o período hibernal das plantas afetadas.Peach Tree Short Life (PTSL is a syndrome characterized by a collapse of the peach trees (Prunus persica (L. Batsch during the


    Directory of Open Access Journals (Sweden)

    Fánor Casierra-Posada


    Full Text Available El raleo de frutos es un práctica agrícola común en los árboles de melocotón con miras a una cosecha moderada a abundante. Sin embargo, a pesar de las muchas ventajas del raleo, demostradas a lo largo de años de experiencia en la zona templada, esta práctica es a menudo una de las operaciones conducidas de manera ineficiente en el cultivo del duraznero. Árboles de duraznero (Prunus persica L. Batsch cv. ‘Rubidoux’ se ralearon manualmente con el objeto de mejorar la calidad comercial del fruto. Se evaluaron los cambios en el crecimiento del fruto, los sólidos solubles totales, la relación pulpa: semilla, la producción, la calidad del fruto y el diámetro de la fruta, durante una temporada de crecimiento de los frutos según el efecto de la relación hoja: fruto (10; 20; 30; 40 y 50 hojas por fruto, en Guasca - Cundinamarca - Colombia. El raleo se realizó 85 días después de plena floración. Los árboles del tratamiento control no se ralearon. Se observaron diferencias en las curvas de crecimiento del fruto, en el promedio de fruto cosechado, en el peso fresco de los frutos y en su calidad comercial. El contenido de sólidos solubles totales en los frutos y la relación pulpa:semilla aumentaron con el raleo. Al momento de la cosecha, la producción se redujo en los árboles raleados, pero se mejoró la cantidad del fruto comercial. Los tratamientos con 40 y 50 hojas por fruto tuvieron la mayor proporción de frutos de mejor calidad en comparación con los árboles control.Fruit thinning is a standard practice on peach trees carrying a moderate to heavy crop. However, in spite of the many benefits from thinning demostrated through long years of experience in the temperate zone, fruit thinning is too often one of the most unefficiently conducted operations in peach growing. With a view to improve marketable yield and fruit quality, trees of peach (Prunus persica L. Batsch cv. ‘Rubidoux’ were subjected to hand thinning. Changes

  10. The effects of foliar fertilization with iron sulfate in chlorotic leaves are limited to the treated area. A study with peach trees (Prunus persica L. Batsch) grown in the field and sugar beet (Beta vulgaris L.) grown in hydroponics. (United States)

    El-Jendoubi, Hamdi; Vázquez, Saúl; Calatayud, Angeles; Vavpetič, Primož; Vogel-Mikuš, Katarina; Pelicon, Primož; Abadía, Javier; Abadía, Anunciación; Morales, Fermín


    Crop Fe deficiency is a worldwide problem. The aim of this study was to assess the effects of foliar Fe applications in two species grown in different environments: peach (Prunus persica L. Batsch) trees grown in the field and sugar beet (Beta vulgaris L. cv. "Orbis") grown in hydroponics. The distal half of Fe-deficient, chlorotic leaves was treated with Fe sulfate by dipping and using a brush in peach trees and sugar beet plants, respectively. The re-greening of the distal (Fe-treated) and basal (untreated) leaf areas was monitored, and the nutrient and photosynthetic pigment composition of the two areas were also determined. Leaves were also studied using chlorophyll fluorescence imaging, low temperature-scanning electron microscopy microanalysis, scanning transmission ion microscopy-particle induced X-ray emission and Perls Fe staining. The distal, Fe-treated leaf parts of both species showed a significant increase in Fe concentrations (across the whole leaf volume) and marked re-greening, with significant increases in the concentrations of all photosynthetic pigments, as well as decreases in de-epoxidation of xanthophyll cycle carotenoids and increases in photochemical efficiency. In the basal, untreated leaf parts, Fe concentrations increased slightly, but little re-greening occurred. No changes in the concentrations of other nutrients were found. Foliar Fe fertilization was effective in re-greening treated leaf areas both in peach trees and sugar beet plants. Results indicate that the effects of foliar Fe-sulfate fertilization in Fe-deficient, chlorotic leaves were minor outside the leaf surface treated, indicating that Fe mobility within the leaf is a major constraint for full fertilizer effectiveness in crops where Fe-deficiency is established and leaf chlorosis occurs.

  11. The effects of foliar fertilization with iron sulfate in chlorotic leaves are limited to the treated area. A study with peach trees (Prunus persica L. Batsch grown in the field and sugar beet (Beta vulgaris L. grown in hydroponics

    Directory of Open Access Journals (Sweden)

    Hamdi eEl-Jendoubi


    Full Text Available Crop Fe deficiency is a worldwide problem. The aim of this study was to assess the effects of foliar Fe applications in two species grown in different environments: peach (Prunus persica L. Batsch trees grown in the field and sugar beet (Beta vulgaris L. cv. ‘Orbis’ grown in hydroponics. The distal half of Fe-deficient, chlorotic leaves was treated with Fe sulfate by dipping and using a brush in peach trees and sugar beet plants, respectively. The re-greening of the distal (Fe-treated and basal (untreated leaf areas was monitored, and the nutrient and photosynthetic pigment composition of the two areas were also determined. Leaves were also studied using chlorophyll fluorescence imaging, low temperature-scanning electron microscopy microanalysis, scanning transmission ion microscopy-particle induced X-ray emission and Perls Fe staining. The distal, Fe-treated leaf parts of both species showed a significant increase in Fe concentrations (across the whole leaf volume and marked re-greening, with significant increases in the concentrations of all photosynthetic pigments, as well as decreases in de-epoxidation of xanthophyll cycle carotenoids and increases in photochemical efficiency. In the basal, untreated leaf parts, Fe concentrations increased slightly, but little re-greening occurred. No changes in the concentrations of other nutrients were found. Foliar Fe fertilization was effective in re-greening treated leaf areas both in peach trees and sugar beet plants. Results indicate that the effects of foliar Fe-sulfate fertilization in Fe-deficient, chlorotic leaves were minor outside the leaf surface treated, indicating that Fe mobility within the leaf is a major constraint for full fertilizer effectiveness in crops where Fe-deficiency is established and leaf chlorosis occurs.

  12. The effects of foliar fertilization with iron sulfate in chlorotic leaves are limited to the treated area. A study with peach trees (Prunus persica L. Batsch) grown in the field and sugar beet (Beta vulgaris L.) grown in hydroponics (United States)

    El-Jendoubi, Hamdi; Vázquez, Saúl; Calatayud, Ángeles; Vavpetič, Primož; Vogel-Mikuš, Katarina; Pelicon, Primož; Abadía, Javier; Abadía, Anunciación; Morales, Fermín


    Crop Fe deficiency is a worldwide problem. The aim of this study was to assess the effects of foliar Fe applications in two species grown in different environments: peach (Prunus persica L. Batsch) trees grown in the field and sugar beet (Beta vulgaris L. cv. “Orbis”) grown in hydroponics. The distal half of Fe-deficient, chlorotic leaves was treated with Fe sulfate by dipping and using a brush in peach trees and sugar beet plants, respectively. The re-greening of the distal (Fe-treated) and basal (untreated) leaf areas was monitored, and the nutrient and photosynthetic pigment composition of the two areas were also determined. Leaves were also studied using chlorophyll fluorescence imaging, low temperature-scanning electron microscopy microanalysis, scanning transmission ion microscopy-particle induced X-ray emission and Perls Fe staining. The distal, Fe-treated leaf parts of both species showed a significant increase in Fe concentrations (across the whole leaf volume) and marked re-greening, with significant increases in the concentrations of all photosynthetic pigments, as well as decreases in de-epoxidation of xanthophyll cycle carotenoids and increases in photochemical efficiency. In the basal, untreated leaf parts, Fe concentrations increased slightly, but little re-greening occurred. No changes in the concentrations of other nutrients were found. Foliar Fe fertilization was effective in re-greening treated leaf areas both in peach trees and sugar beet plants. Results indicate that the effects of foliar Fe-sulfate fertilization in Fe-deficient, chlorotic leaves were minor outside the leaf surface treated, indicating that Fe mobility within the leaf is a major constraint for full fertilizer effectiveness in crops where Fe-deficiency is established and leaf chlorosis occurs. PMID:24478782

  13. Firmness prediction in Prunus persica 'Calrico' peaches by visible/short-wave near infrared spectroscopy and acoustic measurements using optimised linear and non-linear chemometric models. (United States)

    Lafuente, Victoria; Herrera, Luis J; Pérez, María del Mar; Val, Jesús; Negueruela, Ignacio


    In this work, near infrared spectroscopy (NIR) and an acoustic measure (AWETA) (two non-destructive methods) were applied in Prunus persica fruit 'Calrico' (n = 260) to predict Magness-Taylor (MT) firmness. Separate and combined use of these measures was evaluated and compared using partial least squares (PLS) and least squares support vector machine (LS-SVM) regression methods. Also, a mutual-information-based variable selection method, seeking to find the most significant variables to produce optimal accuracy of the regression models, was applied to a joint set of variables (NIR wavelengths and AWETA measure). The newly proposed combined NIR-AWETA model gave good values of the determination coefficient (R(2)) for PLS and LS-SVM methods (0.77 and 0.78, respectively), improving the reliability of MT firmness prediction in comparison with separate NIR and AWETA predictions. The three variables selected by the variable selection method (AWETA measure plus NIR wavelengths 675 and 697 nm) achieved R(2) values 0.76 and 0.77, PLS and LS-SVM. These results indicated that the proposed mutual-information-based variable selection algorithm was a powerful tool for the selection of the most relevant variables. © 2014 Society of Chemical Industry.

  14. Assessment of Prunus persica fruit softening using a proteomics approach. (United States)

    P, Ricardo Nilo; Campos-Vargas, Reinaldo; Orellana, Ariel


    Fruit ripening in Prunus persica involves a number of physiological changes, being one of the most significant the mesocarp softening in melting varieties. In order to get a better understanding of the molecular processes involved in this phenomenon, the protein accumulation patterns in firm and soft fruit of three peach and two nectarine melting flesh varieties were assessed using 2D gel analysis. A General Linear Model (GLM) two-way analysis of variance determined that 164 of the 621 protein spots analyzed displayed a differential accumulation associated with the softening process. Among them, only 14 proteins changed their accumulation in all the varieties assessed, including proteins mostly involved in carbohydrates and cell wall metabolism as well as fruit senescence. The analysis among varieties showed that 195 and 189 spots changed within the firm and soft fruit conditions, respectively. Despite the changes in relative abundance in the spot proteins, the proteome is conserved among varieties and during the transition from firm to soft fruit. Only two spots proteins exhibited a qualitative change in all the conditions assessed. These results are in agreement with the notion that Prunus persica commercial varieties have a narrow genetic background. Copyright © 2011 Elsevier B.V. All rights reserved.

  15. Controle da infestação natural de ceratitis capitata (Wied., 1824 (Diptera, Tephritidae em pêssegos(Prunus persica através das radiações gama Control of naturally infested peaches (Prunus persica by mediterranean fruit fly (Ceratitis capitata through the use of gamma radiation

    Directory of Open Access Journals (Sweden)

    V. Arthur


    Full Text Available Determinou-se a dose desinfestante de radiações gama para pêssegos, Prunus persica, infestados com larvas da mosca do Mediterrâneo, Ceratitis capitata. Utilizaram-se frutas de procedência conhecida no campo fazendo-se uma amostragem prévia, constatando-se que cada fruta continha em média nove larvas do último ínstar da mosca praga. As frutas foram irradiadas em uma fonte de Cobalto-60 com as seguintes doses de radiação gama: 0 (test., 25, 50, 100, 200, 400, 600, 800, 1000 e 1200 Gy, sob uma taxa de 58 Gy por minuto. Após a irradiação as frutas foram colocadas em câmaras climatizadas com a temperatura variando entre 23 e 27°C e a umidade relativa variando entre 65 e 75%. Aguardou-se que as larvas deixassem as frutas e se transformassem em pupas e adultos. A dose letal para larvas, pelos resultados obtidos no experimento, concluiu-se ser de 600 Gy. A dose letal para pupas provenientes de larvas irradiadas dentro das frutas foi de 50 Gy, impedindo totalmente a emergência de adultos.Determination of the dose of gamma radiation to disinfest peaches, Prunus pérsica infested with larvae of Ceratitis capitata (Wied., 1824 was made. Fruits were collected in the field, each one holding about nine larvae of the last instar of the fruit-fly. The fruits were irradiated with Cobalt-60 gamma radiation source at the following doses: 0 (control, 25, 50, 100, 200, 400, 600, 800, 1000 and 1200 Gy; at a dose rate of 58 Gy per minute. After irradiation the fruits were kept in a climatic chamber with the temperature adjusted between 23 and 27°C, and relative humidity between 65 and 75 percent, until the larvae left the fruits and were transformed into pupae and adults. It was concluded that the lethal dose of gamma radiation for larvae at the last instar, in naturally infested peaches, was 600 Gy and the dose of 50 Gy inhibited completely the emergency of adults.

  16. Comportamento do pessegueiro (Prunus persica L. Batsch cv. Chimarrita em diferentes sistemas de condução Behavior of the peach tree (Prunus persica L. Batsch cv. Chimarrita in different training systems

    Directory of Open Access Journals (Sweden)

    Clevison Luiz Giacobbo


    Full Text Available A persicultura, no Brasil, é praticada há bastante tempo, porém poucos estudos foram realizados visando alternativas de manejo nos pomares para aumento de produtividade. Este trabalho teve por objetivo avaliar o desenvolvimento anual do diâmetro do tronco e produção nos terceiro e quarto anos, em pessegueiro cv. Chimarrita, enxertado sobre o porta-enxerto Capdeboscq. Foram avaliados quatro sistemas de condução: I - espaçamento de 0,5 m entre plantas, conduzido em 'Áxis colunar'; II e III - 1,0 m e 2,0 m, respectivamente, conduzidos em 'Y' e IV - 4,0 m em 'Vaso' (sistema tradicional. Entre as linhas de plantio o espaçamento foi constante de 5,0 m para todos os sistemas de condução. O pomar foi implantado em julho de 1997 na Fazenda experimental do Centro Agropecuário da Palma, propriedade da Universidade Federal de Pelotas, localizada no município de Capão do Leão, RS. Avaliou-se a taxa de crescimento anual do diâmetro do tronco, produtividade, qualidade físico-química das frutas e ocorrência de podridão parda. Os resultados obtidos na taxa de crescimento foram semelhantes em ambos os anos, porém observou-se maior incremento relativo no período 2000/2001, no sistema de condução I. A produtividade foi superior no sistema I e II diferindo do sistema IV, no entanto, a qualidade físico-química e a ocorrência de podridão parda foram semelhantes em todos os sistemas.The peach culture has been practiced for a long time in Brazil but a few studies were performed aiming to define choices of orchard management for increasing productivity. The purpose of this study was to evaluate fruit production and annual growth rate of the trunk diameter in the third and fourth year after planting of peach-trees cv. "Chimarrita" on Capdeboscq rootstock. Four training systems were evaluated, as follow: I -spacing of 0,5 m among plants trained as "columnar axis"; II and III - spacing of 1 and 2 m, respectively trained as an "Y shape" and IV

  17. Influência do ácido indolbutírico e ethefon no enraizamento de estacas de pessegueiro (Prunus persica (L. Batsch Influence of indolebutyric acid and ethephon on rooting of cuttings of peach (Prunus persica (L. Batsch

    Directory of Open Access Journals (Sweden)

    Adilson Tonietto


    Full Text Available Este trabalho foi conduzido no Departamento de Fitotecnia da Faculdade de Agronomia Eliseu Maciel, Universidade Federal de Pelotas, em estufa com nebulização intermitente, com o objetivo de verificar o efeito do ácido indolbutírico(AIB e ethefon (ácido 2-cloroetil fosfônico no enraizamento de estacas de ramos de pessegueiro. Utilizou-se estacas medianas retiradas de ramos de plantas com seis anos de idade, da cultivar Diamante, com comprimento de 15cm. Efetuou-se duas lesões laterais na base das estacas que foram tratadas com ácido indolbutírico nas concentrações 0; 1000; 2000 e 3000ppm, na forma líquida e, ethefon nas concentrações de 0; 50; 100 e 150ppm. Após a imersão de 5 segundos, acondicionou-se as estacas em sacos de polietileno contendo como substrato a mistura de areia+cinza (2:1 v/v. Pelos resultados obtidos concluiu-se que o ácido indolbutírico aumentou o percentual de estacas realizadas até a concentração de 1752ppm. e o número de raízes até a concentração de 1791ppm. O ethefon não apresentou resultados significativos na forma e concentração utilizadas.This work was conducted at the Plant Science Departament Eliseu Maciel Agronomy College of Federal University of Pelotas, in greenhouse with intermitent mist, aiming to evaluate the effect of indolebutyric acid and ethephon (2-chloroetyl phosphonic acid on peach hranch cutting rooting. Median cuttings with 15cm length removed from Diamante cultivar branch were used. Two lateral lesions were made on cutting basis and they were treated with indolebutyric acid in liquid at 0; 1000; 2000; and 3000ppm concentrations and ethefon at 0; 50; 100 and 150ppm concentrations. The immersion time was five seconds and the cuttings were packed in polietylene sacks containing a mixture of sand and rice husk ash substrate (2:1 v/v. Results showed that the indolebutyric acid increased the rooted cuttings percentage up to 1752ppm concentration and the number of roots until 1791

  18. Cianamida hidrogenada no raleio químico de flores e frutos de pessegueiros (Prunus persica, L. Batsch cv. Eldorado Hydrogen cyanamide on chemical thinning of peach-tree (Prunus persica, L. Batsch Flowers and fruits of Eldorado cultivar

    Directory of Open Access Journals (Sweden)

    Alexandre Couto Rodrigues


    Full Text Available O trabalho foi realizado com o objetivo de avaliar o efeito da cianamida hidrogenada (CH2N2 no raleio de flores e frutos de pessegueiros do cultivar Eldorado. Utilizaram-se plantas com idade de 6 anos, conduzidas sob a forma de vaso e espaçamento de 6,0 x 4,0m, localizadas no Centro Agropecuário da Palma - UFPel. Os tratamentos (0; 0,15; 0,3; 0,45 e 0,6% de CH2N2 foram pulverizados em cobertura sobre ramos selecionados aleatoriamente, até o início de gotejamento, quando 100% das flores encontravam-se totalmente abertas. O produto comercial utilizado foi o Dormex (52% de CH2N2. O delineamento experimental foi o inteiramente casualizado, com três repetições. As variáveis avaliadas foram: percentual de flores raleadas 36 dias após a aplicação do produto e percentual de frutos raleados, peso médio, coloração, diâmetro, firmeza da polpa e sólidos solúveis totais por ocasião da colheita. A maior intensidade de raleio de flores (50,96% foi obtida com utilização de 0,5% de CH2N2. Na percentagem de frutos raleados, observou-se valor máximo de 9,53%, utilizando-se CH2N2 a 0,6%. O peso dos frutos aumentou com o raleio químico, porém, este não interferiu nos sólidos solúveis totais, firmeza de polpa e índice de cor dos frutos.The objective of this research was to evaluate the effect of hydrogen cyanamide (CH2N2 on the chemical thinning of peach-tree flowers and fruits of Eldorado cultivar. Six-year plants localized at Agricultural Center of Palma - UFPel were used and conducted in vase with spacing of 6.0 x 4.0m. Treatments with 0, 0.15, 0.3, 0.45 and 0.6% of CH2N2 were sprayed on randomly selected shoots until drip point, when 100% of the flowers were totally blown. Dormex (52% of hydrogen cyanamide was the commercial chemical used. A completely randomized experimental design was used, with three replications. Percentage of flowers thinned 36 days after chemical application and percentage of thinned fruits, mean fruit weight

  19. Exceso de agua en el suelo: efecto sobre la calidad del fruto del duraznero prunus persica (L. batsch Excess water in the soil: effect on fruit quality of peach prunus persica (l. batsch

    Directory of Open Access Journals (Sweden)

    Mirta G. González


    Full Text Available El duraznero es un cultivo perenne que requiere para su crecimiento un suelo sin limitaciones, en base a ello el objetivo de este trabajo fue estudiar los cambios químicos producidos en el suelo en condiciones de anegamiento, desde floración hasta fructificación, relacionándolo a la calidad y cantidad de la fruta. Se trabajó con un suelo Argiudol de características vérticas, con un destacado horizonte Bt que posee 35-38% de arcilla. Se realizaron dos tratamientos: control, sin anegamiento (C y con anegamiento (T. En el tratamiento (C, la disponibilidad hídrica de los mismos estuvo sujeta a las condiciones climáticas que se presentaron durante el ensayo, incluyendo la realización de riego complementario permitiendo en todo momento que el suelo se mantenga en condiciones óptimas de humedad. Los resultados del ensayo estuvieron relacionados a los cambios en las características químicas del suelo, planta y fruto. Los suelos anegados tuvieron, contenidos de fósforo y potasio deficientes que repercutió en un menor rendimiento (peso del fruto fresco y seco. Los análisis químicos en planta siguieron la misma tendencia en relación a los contenidos de nitrógeno total, fósforo y potasio que disminuyeron sustancialmente como así también el contenido de materia seca. Estas variables determinaron la disminución de la calidad de fruta en relación a su firmeza y tamaño.Peach is a perennial culture that requires for its growth soils without limitations, on the basis of it the objective of this work was to study the chemical changes produced in soils on flooding conditions, from flowering to fruit production, relating it to the quality and amount of the fruit. The experiment was a done at an Argiudoll soil of vertic characteristics, with an outstanding Bt horizon that has 35- 38% of clay. Two treatments were made: control, without flooding (c and with flooding (T. In the treatment (C, the hydric availability was subject to the climatic

  20. PpYUC11, a strong candidate gene for the stony hard phenotype in peach (Prunus persica L. Batsch), participates in IAA biosynthesis during fruit ripening. (United States)

    Pan, Lei; Zeng, Wenfang; Niu, Liang; Lu, Zhenhua; Liu, Hui; Cui, Guochao; Zhu, Yunqin; Chu, Jinfang; Li, Weiping; Fang, Weichao; Cai, Zuguo; Li, Guohuai; Wang, Zhiqiang


    High concentrations of indole-3-acetic acid (IAA) are required for climacteric ethylene biosynthesis to cause fruit softening in melting flesh peaches at the late ripening stage. By contrast, the fruits of stony hard peach cultivars do not soften and produce little ethylene due to the low IAA concentrations. To investigate the regulation of IAA accumulation during peach ripening [the transition from stage S3 to stage S4 III (climacteric)], a digital gene expression (DGE) analysis was performed. The expression patterns of auxin-homeostasis-related genes were compared in fruits of the melting flesh peach 'Goldhoney 3' and the stony hard flesh peach 'Yumyeong' during the ripening stage. It is revealed here that a YUCCA flavin mono-oxygenase gene (PpYUC11, ppa008176m), a key gene in auxin biosynthesis, displayed an identical differential expression profile to the profiles of IAA accumulation and PpACS1 transcription: the mRNA transcripts increased at the late ripening stage in melting flesh peaches but were below the limit of detection in mature fruits of stony hard peaches. In addition, the strong association between intron TC microsatellite genotypes of PpYUC11 and the flesh texture (normal or stony hard) is described in 43 peach varieties, indicating that this locus may be responsible for the stony hard phenotype in peach. These findings support the hypothesis that PpYUC11 may play an essential role in auxin biosynthesis during peach fruit ripening and is a candidate gene for the control of the stony hard phenotype in peach. © The Author 2015. Published by Oxford University Press on behalf of the Society for Experimental Biology.

  1. Construction of a genetic linkage map for identification of molecular markers associated with resistance to Xanthomonas arboriciola pv. pruni in peach [Prunus persica (L.) Batsch (United States)

    Bacterial spot, caused by Xanthomonas campestris pv. pruni, is a serious disease that can affect peach fruit quality and production. The molecular basis of its tolerance and susceptibility is yet to be understood. To study the genetics of the peach in response to bacterial spot, an F2 population of ...

  2. Changes in fruit sugar concentrations in response to assimilate supply, metabolism and dilution: a modeling approach applied to peach fruit (Prunus persica)

    National Research Council Canada - National Science Library

    Génard, M; Lescourret, F; Gomez, L; Habib, R


    ...) fruit during the main stage of fruit enlargement was analyzed with the SUGAR model of Génard and Souty (1996). The model predicts the partitioning of carbon into sucrose, sorbitol, glucose and fructose in the mesocarp of peach fruit...

  3. Inactivation of contaminated fungi and antioxidant effects of peach (Prunus persica L. Batsch cv Dangeumdo) by 0.5-2 kGy gamma irradiation

    Energy Technology Data Exchange (ETDEWEB)

    Kim, Kyoung-Hee; Kim, Mi-Seon [Department of Food and Nutrition, Chungnam National University, Daejeon 305-764 (Korea, Republic of); Kim, Hong-Gi [Department of Applied Biology, Chungnam National University, Daejeon 305-764 (Korea, Republic of); Yook, Hong-Sun, E-mail: [Department of Food and Nutrition, Chungnam National University, Daejeon 305-764 (Korea, Republic of)


    The effect of gamma irradiation (0.5-2 kGy) on the physicochemical properties of peaches was investigated during a 6-day storage at 20+-3 deg. C. Gamma irradiation is able to inactivate the four pathogens, namely Botrytis cinerea, Penicillium expansum, Rhizopus stolonifer var. stolonifer and Monilinia fructicola in peaches. Hardness significantly decreased with the increment of irradiation dose level whereas soluble solid and total polyphenol contents increased with increment of irradiation dose level. 1,1-diphenyl-2-picrylhydrazyl (DPPH) radical-scavenging activity of the irradiated peach was higher than that of control, and its activity increased with increment of irradiation dose level. These results suggest that gamma irradiation of peaches improved antioxidant activity, but dramatically affects the hardness throughout the entire storage time.

  4. Inactivation of contaminated fungi and antioxidant effects of peach ( Prunus persica L. Batsch cv Dangeumdo) by 0.5-2 kGy gamma irradiation (United States)

    Kim, Kyoung-Hee; Kim, Mi-Seon; Kim, Hong-Gi; Yook, Hong-Sun


    The effect of gamma irradiation (0.5-2 kGy) on the physicochemical properties of peaches was investigated during a 6-day storage at 20±3 °C. Gamma irradiation is able to inactivate the four pathogens, namely Botrytis cinerea, Penicillium expansum, Rhizopus stolonifer var. stolonifer and Monilinia fructicola in peaches. Hardness significantly decreased with the increment of irradiation dose level whereas soluble solid and total polyphenol contents increased with increment of irradiation dose level. 1,1-diphenyl-2-picrylhydrazyl (DPPH) radical-scavenging activity of the irradiated peach was higher than that of control, and its activity increased with increment of irradiation dose level. These results suggest that gamma irradiation of peaches improved antioxidant activity, but dramatically affects the hardness throughout the entire storage time.

  5. Polyphenolics from peach (Prunus persica var. Rich Lady) inhibit tumor growth and metastasis of MDA-MB-435 breast cancer cells in vivo. (United States)

    Noratto, Giuliana; Porter, Weston; Byrne, David; Cisneros-Zevallos, Luis


    The tumor growth inhibition and anti-metastatic effects of peach polyphenolics were investigated in vivo using a xenograft model and MDA-MB-435 breast cancer cells. Results showed that tumor growth and lung metastasis were inhibited in vivo by peach polyphenolics in a dose range of 0.8-1.6 mg/day, and these effects were mediated by inhibition of metalloproteinases gene expression. Modulation of metalloproteinase-2, metalloproteinase-3 and metalloproteinase-13 gene expression may be some of the molecular targets for anti-metastatic activity of peach polyphenolics. Therefore, these compounds may constitute a novel chemopreventive tool to reduce the risk of metastasis in the combination therapy when primary cancer is diagnosed. Conversion to equivalent human intake for future clinical studies using the body surface area normalization method gave a dose of ~370.6 mg/day for a human adult of 60 kg, which can be supplied by consuming two to three peach fruit per day or alternatively using a dietary supplement peach polyphenol extract powder. Copyright © 2014 Elsevier Inc. All rights reserved.



    Fánor Casierra-Posada; José Israel Rodríguez Puerto; Julián Cárdenas Hernández


    El raleo de frutos es un práctica agrícola común en los árboles de melocotón con miras a una cosecha moderada a abundante. Sin embargo, a pesar de las muchas ventajas del raleo, demostradas a lo largo de años de experiencia en la zona templada, esta práctica es a menudo una de las operaciones conducidas de manera ineficiente en el cultivo del duraznero. Árboles de duraznero (Prunus persica L. Batsch cv. ‘Rubidoux’) se ralearon manualmente con el objeto de mejorar la calidad comercial del frut...

  7. DNA-based identification of Armillaria isolates from peach [Prunus persica (l.) batsch] orchards in méxico state, Mexico (United States)

    Ruben D. Elias-Roman; Ned B. Klopfenstein; Mee-Sook Kim; Dionicio Alvarado-Rosales; John W. Hanna; Amy L. Ross-Davis; Remigio Anastacio Guzman-Plazola; Guillermo Calderon-Zavala; Antonio Mora-Aguilera


    A collaborative project between the Programa de Fitopatología, Colegio de Postgraduados, Texcoco, Edo. de México and the USDA Forest Service-RMRS, Moscow Forest Pathology Laboratory began in 2011 to identify which species of Armillaria are causing widespread and severe damage to the peach orchards from México State, México. We are employing a DNA-based approach in...

  8. Complete nucleotide sequences of the genomes of two isolates of apple chlorotic leaf spot virus from peach (Prunus persica) in China. (United States)

    Niu, Feiqing; Pan, Song; Wu, Zujian; Jiang, Dongmei; Li, Shifang


    The complete nucleotide sequences of two isolates of apple chlorotic leaf spot virus (Z1 and Z3) collected from peach in Henan Province, China, were determined. The genomes of both Z1 and Z3 were found to contain three open reading frames (ORFs). Sequence analysis showed that genomic sequences of Z1 and Z3 isolates shared 67.4%-82.9% and 67.2%-82.6% identity, respectively, with the other eight isolates of ACLSV that have been reported previously. Based on the putative amino acid sequences of the products of the three ORFs, Z1 and Z3 isolates showed the greatest identity to isolate PBM1 (GenBank accession number AJ243438) from plum and the least identity with isolate Ta Tao5 (GenBank Accession Number: EU223295) from peach. Considering the low level of sequence identity between Z1/Z3 isolate and Ta Tao5 isolate, two types of ACLSV may exist in peach.

  9. Expression of ABA Metabolism-Related Genes Suggests Similarities and Differences Between Seed Dormancy and Bud Dormancy of Peach (Prunus persica). (United States)

    Wang, Dongling; Gao, Zhenzhen; Du, Peiyong; Xiao, Wei; Tan, Qiuping; Chen, Xiude; Li, Ling; Gao, Dongsheng


    Dormancy inhibits seed and bud growth of perennial plants until the environmental conditions are optimal for survival. Previous studies indicated that certain co-regulation pathways exist in seed and bud dormancy. In our study, we found that seed and bud dormancy are similar to some extent but show different reactions to chemical treatments that induce breaking of dormancy. Whether the abscisic acid (ABA) regulatory networks are similar in dormant peach seeds and buds is not well known; however, ABA is generally believed to play a critical role in seed and bud dormancy. In peach, some genes putatively involved in ABA synthesis and catabolism were identified and their expression patterns were studied to learn more about ABA homeostasis and the possible crosstalk between bud dormancy and seed dormancy mechanisms. The analysis demonstrated that two 9-cis-epoxycarotenoid dioxygenase-encoding genes seem to be key in regulating ABA biosynthesis to induce seed and bud dormancy. Three CYP707As play an overlapping role in controlling ABA inactivation, resulting in dormancy-release. In addition, Transcript analysis of ABA metabolism-related genes was much similar demonstrated that ABA pathways was similar in the regulation of vegetative and flower bud dormancy, whereas, expression patterns of ABA metabolism-related genes were different in seed dormancy showed that ABA pathway maybe different in regulating seed dormancy in peach.

  10. Seasonal CO[sub 2] exchange patterns of developing peach (Prunus persica) fruits in response to temperature, light and CO[sub 2] concentration

    Energy Technology Data Exchange (ETDEWEB)

    Pavel, E.W.; DeJong, T.M. (Dept. of Pomology, Univ. of California, Davis, CA (United States))


    CO[sub 2] exchange rates per unit dry weight, measured in the field on attached fruits of the late-maturing Cal Red peach cultivar, at 1200 [mu]mol photons m[sup -2] s[sup -1] and in dark, and photosynthetic rates, calculated by the difference between the rates of CO[sub 2] evolution in light and dark, declined over the growing season. Photosynthetic rates per fruit increased with increasing fruit dry matter, but declined in maturing fruits, coinciding with the loss of chlorophyll. Slight net fruit photosynthetic rates were measured in midseason under optimal temperature and light conditions. Fruit photosynthetic rates increased with increasing temperatures and photon flux densities during fruit development. Dark respiration rates per unit dry weight doubled within a temperature interval of 10 deg. C; the mean seasonal Q[sub 10] value was 2.03 between 20 and 30 deg. C. Highest photosynthetic rates were measured at 35 deg. C. Fruit photosynthesis was stimulated by high internal CO[sub 2] concentrations via CO[sub 2] refixation. At 15 deg. C, fruit photosynthetic rates were saturated at about 600 [mu]mol photons m[sup -2] s[sup -1]. Young peach fruits responded to increasing ambient CO[sub 2] concentrations with decreasing net CO[sub 2] exchange rates in light, but mature fruits did not. Fruit CO[sub 2] exchange rates in the dark were uninfluenced by ambient CO[sub 2] concentrations. Photosynthetic rates of younger peach fruits approached saturation at 370 [mu]l CO[sub 2] l[sup -1]. In CO[sub 2]-free air, fruit photosynthesis was dependent on CO[sub 2] refixation. Young peach fruits were able to take up CO[sub 2] from the external atmosphere. CO[sub 2] uptake by peach fruits contributed between 28 and 16% to the fruit photosynthetic rate early in the season, whereas photosynthesis in maturing fruits was supplied entirely by CO[sub 2] refixation. (AB) (42 refs.)

  11. Genotyping by Sequencing for SNP-Based Linkage Map Construction and QTL Analysis of Chilling Requirement and Bloom Date in Peach [Prunus persica (L.) Batsch]. (United States)

    Bielenberg, Douglas Gary; Rauh, Bradley; Fan, Shenghua; Gasic, Ksenija; Abbott, Albert Glenn; Reighard, Gregory Lynn; Okie, William R; Wells, Christina Elizabeth


    Low-cost, high throughput genotyping methods are crucial to marker discovery and marker-assisted breeding efforts, but have not been available for many 'specialty crops' such as fruit and nut trees. Here we apply the Genotyping-By-Sequencing (GBS) method developed for cereals to the discovery of single nucleotide polymorphisms (SNPs) in a peach F2 mapping population. Peach is a genetic and genomic model within the Rosaceae and will provide a template for the use of this method with other members of this family. Our F2 mapping population of 57 genotypes segregates for bloom time (BD) and chilling requirement (CR) and we have extensively phenotyped this population. The population derives from a selfed F1 progeny of a cross between 'Hakuho' (high CR) and 'UFGold' (low CR). We were able to successfully employ GBS and the TASSEL GBS pipeline without modification of the original methodology using the ApeKI restriction enzyme and multiplexing at an equivalent of 96 samples per Illumina HiSeq 2000 lane. We obtained hundreds of SNP markers which were then used to construct a genetic linkage map and identify quantitative trait loci (QTL) for BD and CR.

  12. Genotyping by Sequencing for SNP-Based Linkage Map Construction and QTL Analysis of Chilling Requirement and Bloom Date in Peach [Prunus persica (L. Batsch].

    Directory of Open Access Journals (Sweden)

    Douglas Gary Bielenberg

    Full Text Available Low-cost, high throughput genotyping methods are crucial to marker discovery and marker-assisted breeding efforts, but have not been available for many 'specialty crops' such as fruit and nut trees. Here we apply the Genotyping-By-Sequencing (GBS method developed for cereals to the discovery of single nucleotide polymorphisms (SNPs in a peach F2 mapping population. Peach is a genetic and genomic model within the Rosaceae and will provide a template for the use of this method with other members of this family. Our F2 mapping population of 57 genotypes segregates for bloom time (BD and chilling requirement (CR and we have extensively phenotyped this population. The population derives from a selfed F1 progeny of a cross between 'Hakuho' (high CR and 'UFGold' (low CR. We were able to successfully employ GBS and the TASSEL GBS pipeline without modification of the original methodology using the ApeKI restriction enzyme and multiplexing at an equivalent of 96 samples per Illumina HiSeq 2000 lane. We obtained hundreds of SNP markers which were then used to construct a genetic linkage map and identify quantitative trait loci (QTL for BD and CR.

  13. Aplicação de revestimentos comestíveis em pêssego (Prunus persica Use of edible coating in peaches

    Directory of Open Access Journals (Sweden)

    Giselle de Assis Jacometti


    Full Text Available O objetivo do trabalho foi avaliar a influência de revestimentos comestíveis sobre a vida-de-prateleira, perda de massa, atividade metabólica e contaminação microbiológicas em pêssegos in natura. Foram utilizados pêssegos brancos cv. Perola de Mairinque (IAC 769-8 revestidos com soluções de 1% de goma gelana (p/v e 1% goma gelana + 1% sorbitol (p/v, embalados em caixas de papelão e armazenados a 10ºC / 80-85% UR por 16 dias. Frutos sem revestimento serviram de controle. Os revestimentos à base de goma gelana e gelana+sorbitol não alteraram a atividade fisiológica dos pêssegos, medida através da taxa de respiração, teor de sólidos solúveis e acidez titulável ao longo da armazenagem. Não houve diferença entre as taxas de perda de massa, que ficaram em torno de 1,4g/100g.dia. Os revestimentos não alteraram a aceitação dos pêssegos em termos de sabor e em termos de aparência, o controle obteve notas superiores aos revestidos devida a opacidade que o revestimento conferiu aos frutos. Na contagem total de microrganismos aeróbios mesófilos e bolores e leveduras não houve diferença entre os tratamentos ao longo da armazenagem, mas em termos de microrganismos psicrotróficos os frutos revestidos apresentaram uma menor contagem em relação ao controle. Revestimentos à base de goma gelana e gelana+sorbitol não aumentaram a vida-de-prateleira de pêssegos armazenados sob refrigeração devido à composição do revestimento, que não reduziu a perda de massa nem a atividade fisiológica dos frutos.The objective of this work was to evaluate the influence of edible coatings on shelf-life, weight loss, metabolic activity and microbial contamination of peaches in natura. White peaches cv. Perola de Mairinque (IAC 769-8 were coated with 1% gelan gum (p/v and 1% gelan gum + 1% sorbitol (p/v solutions, packed in paperboard box and stored at 10ºC/80-85% RH during 16 days. No coated fruits served as control. Gelan and gelan

  14. The KNOTTED-like genes of peach (Prunus persica L. Batsch) are differentially expressed during drupe growth and the class 1 KNOPE1 contributes to mesocarp development. (United States)

    Testone, Giulio; Condello, Emiliano; Di Giacomo, Elisabetta; Nicolodi, Chiara; Caboni, Emilia; Rasori, Angela; Bonghi, Claudio; Bruno, Leonardo; Bitonti, Maria Beatrice; Giannino, Donato


    The Knotted-like transcription factors (KNOX) contribute to plant organ development. The expression patterns of peach KNOX genes showed that the class 1 members act precociously (S1-S2 stages) and differentially during drupe growth. Specifically, the transcription of KNOPE1 and 6 decreased from early (cell division) to late (cell expansion) S1 sub-stages, whilst that of STMlike1, 2, KNOPE2, 2.1 ceased at early S1. The KNOPE1 role in mesocarp was further addressed by studying the mRNA localization in the pulp cells and vascular net at early and late S1. The message signal was first diffuse in parenchymatous cells and then confined to hypodermal cell layers, showing that the gene down-tuning accompanied cell expansion. As for bundles, the mRNA mainly featured in the procambium/phloem of collateral open types and subsequently in the phloem side of complex structures (converging bundles, ducts). The KNOPE1 overexpression in Arabidopsis caused fruit shortening, decrease of mesocarp cell size, diminution of vascular lignification together with the repression of the major gibberellin synthesis genes AtGA20ox1 and AtGA3ox1. Negative correlation between the expression of KNOPE1 and PpGA3ox1 was observed in four cultivars at S1, suggesting that the KNOPE1 repression of PpGA3ox1 may regulate mesocarp differentiation by acting on gibberellin homeostasis. Copyright © 2015 Elsevier Ireland Ltd. All rights reserved.

  15. Influence of antioxidant compounds, total sugars and genetic background on the chilling injury susceptibility of a non-melting peach (Prunus persica (L.) Batsch) progeny. (United States)

    Abidi, Walid; Cantín, Celia M; Jiménez, Sergio; Giménez, Rosa; Moreno, María Ángeles; Gogorcena, Yolanda


    To identify genotypes with good organoleptic properties, antioxidant-rich content and low susceptibility to chilling injury (CI), fruits from 130 peach cultivars were studied over three consecutive years. Pomological traits, l-ascorbic acid, flavonoids, total phenolics, relative antioxidant capacity (RAC) and sugars were determined. Major symptoms of CI developed at 5 °C, such as leatheriness, flesh browning, bleeding and loss of flavor, were evaluated. The population exhibited wide phenotypic variation in agronomic and biochemical traits. Six genotypes with high total phenolics, RAC, flavonoids and total sugars were selected. The progeny also showed variability for all evaluated CI symptoms, and 16 genotypes showed considerably lower susceptibility to CI. After 2 weeks of cold storage, leatheriness and bleeding were the main CI symptoms observed, whereas flesh browning was predominant after 4 weeks. It was possible to find varieties with high phenolic concentration and relatively low or intermediate CI susceptibility (22, 33, 68, 80, 81, 96 and 120). However, the correlations observed between CI and phenolic contents highlight their potential influence on susceptibility to internal browning. This relationship should be considered in the current breeding programs to select cultivars with high bioactive compound contents, health-enhancing properties and good postharvest performance. © 2014 Society of Chemical Industry.

  16. Ectopic expression of a novel peach (Prunus persica) CBF transcription factor in apple (Malus × domestica) results in short-day induced dormancy and increased cold hardiness. (United States)

    Wisniewski, Michael; Norelli, John; Bassett, Carole; Artlip, Timothy; Macarisin, Dumitru


    Low, non-freezing temperatures and/or short daylength (SD) regulates cold acclimation and dormancy in fruit trees. Regarding cold acclimation, C-repeat binding factor (CBF/DREB) transcriptional activator genes have the well-documented ability to induce the expression of a suite of genes associated with increased cold tolerance. We isolated a full-length cDNA of a peach CBF gene, designated PpCBF1 (GenBank Accession HM992943), and constitutively expressed it using an enhanced 35S promoter in apple. Unexpectedly, constitutive overexpression of the PpCBF1 in apple resulted in strong sensitivity to short daylength. Growth cessation and leaf senescence were induced in transgenic lines exposed to SD and optimal growth temperatures of 25°C over a 4-week period. Following 1-4 weeks of SD and 25°C trees were returned to LD and 25°C in the greenhouse. Control (untransformed) plants continued to grow while transgenic lines receiving two or more weeks of SD remained dormant and began to drop leaves. Constitutive overexpression of the PpCBF1 in apple resulted in a 4-6°C increase in freezing tolerance in both the non-acclimated and acclimated states, respectively, compared with untransformed M.26 trees. This is the first instance that constitutive overexpression of a CBF gene has resulted in SD-induction of dormancy and to our knowledge the first time apple has been shown to strongly respond to short daylength as a result of the insertion of a transgene.

  17. Results of primary study of the remote hybrids of nectarine (Prunus persica L. Batsh var. Nucipersica (Suckow Sc and peach (Prunus persipa L. Batsh with amygdalys ordinary (Amygdalus communis L.

    Directory of Open Access Journals (Sweden)

    Є. П. Шоферістов


    Full Text Available Created in Nikitskyi botanical garden Remote hybrids of nectarine and peach with almond ordinary can be used in Breeding of nectarine and peach fok high resistauce to fundi, as wengs for creation of varieties of nectarine with high drought resistance, sweet seed kernels, high contents of organic substance, and other important Breeding characteristics. Late blossoming hybrid forms can be used in Breeding of almond fok late time of flowering and selfcompatibility.

  18. Prokinetic Activity of Prunus persica (L. Batsch Flowers Extract and Its Possible Mechanism of Action in Rats

    Directory of Open Access Journals (Sweden)

    Wei Han


    Full Text Available The peach tree, Prunus persica (L. Batsch, is widely cultivated in China, and its flowers have been used for centuries in traditional Chinese medicine to treat gut motility disorders. But few studies have explored the pharmacological effect of Prunus persica (L. Batsch flowers on gastrointestinal motility. In this study, the activities of different extracts from Prunus persica (L. Batsch flowers on the smooth muscle contractions were evaluated using isolated colon model, and the ethyl acetate extract (EAE showed the strongest effects in vitro. EAE (10−8–10−5 g/mL caused a concentration-dependent stimulatory effect in rat colonic tissue. Additionally, ketotifen (100 µM, cimetidine (10 µM, and pyrilamine (1 µM produced a significant inhibition of contractions caused by EAE. Furthermore, immunofluorescence and toluidine blue staining revealed increased numbers of mast cells in the EAE group, and EAE increased histamine release from the colonic tissues. These data indicate that EAE has significant prokinetic activity and acts by a mechanism that mainly involves mast cell degranulation. Our study provides a pharmacological basis for the use of an extract of Prunus persica (L. Batsch flowers in the treatment of gut motility disorders.

  19. Prokinetic activity of Prunus persica (L.) Batsch flowers extract and its possible mechanism of action in rats. (United States)

    Han, Wei; Xu, Jing Dong; Wei, Feng Xian; Zheng, Yong Dong; Ma, Jian Zhong; Xu, Xiao Dong; Wei, Zhen Gang; Wang, Wen; Zhang, You Cheng


    The peach tree, Prunus persica (L.) Batsch, is widely cultivated in China, and its flowers have been used for centuries in traditional Chinese medicine to treat gut motility disorders. But few studies have explored the pharmacological effect of Prunus persica (L.) Batsch flowers on gastrointestinal motility. In this study, the activities of different extracts from Prunus persica (L.) Batsch flowers on the smooth muscle contractions were evaluated using isolated colon model, and the ethyl acetate extract (EAE) showed the strongest effects in vitro. EAE (10(-8)-10(-5) g/mL) caused a concentration-dependent stimulatory effect in rat colonic tissue. Additionally, ketotifen (100 µM), cimetidine (10 µM), and pyrilamine (1 µM) produced a significant inhibition of contractions caused by EAE. Furthermore, immunofluorescence and toluidine blue staining revealed increased numbers of mast cells in the EAE group, and EAE increased histamine release from the colonic tissues. These data indicate that EAE has significant prokinetic activity and acts by a mechanism that mainly involves mast cell degranulation. Our study provides a pharmacological basis for the use of an extract of Prunus persica (L.) Batsch flowers in the treatment of gut motility disorders.

  20. Fluidized bed combustion residue as an alternative liming material and Ca source. [Prunus persica

    Energy Technology Data Exchange (ETDEWEB)

    Edwards, J.H.; Horton, B.D.; White, A.W. Jr.; Bennett, O.L.


    Fluidized bed combustion residue (FBCR), a by-product of fossil fuel fired boilers, was evaluated as a liming material and a source of calcium for peaches (Prunus persica (L.) Batsch). Incubation studies involving a medium textured soil indicated that FBCR (calcite (FBCRC) or dolomitic (FBCRD) sources) was as effective a liming amendment as the respective agricultural limestone. Maximum soil pH occurred after 26 days incubation with FBCRC, but soil pH increased continuously throughout 137 days incubation with dolomitic limestone. Ammonium acetate extractable Ca was not affected by calcitic source, but Mg concentration increased with rates with the two dolomitic sources, and was highest in the FBCRD source after 137 days incubation. In greenhouse studies with Elberta peach seedlings, FBCRC was more effective in neutralizing soil acidity and increasing extractable soil Ca than calcitic limestone.

  1. Bioactive compounds contents, antioxidant and antimicrobial activities during ripening of Prunus persica L. varieties from the North West of Tunisia. (United States)

    Belhadj, Feten; Somrani, Imen; Aissaoui, Neyssene; Messaoud, Chokri; Boussaid, Mohamed; Marzouki, M Nejib


    Bioactive molecules from fruits of four varieties of Prunus persica at different stages of ripening (green, small orange, red) were studied. For example, contents on polyphenols (20.36mg GAE/g FW) and flavonoids (0.764mg RE/g FW) were high and varied according variety. The antioxidant activity, using four different tests (DPPH radical scavenging activity, reducing power, β carotene bleaching system and TBARS assay) showed that the variety Chatos exhibited the highest antioxidant activity comparing with others varieties. The antibacterial activity of Prunus persica varieties studied seems to be more sensitive against Staphylococcus aureus and Listeria monocytogenes. The capacity of peach DMSO extracts to inhibit Candida albicans growth was more pronounced, especially, in the presence of Chatos DMSO extract. Enzymes inhibition gives results which correlate with polyphenols, flavonoids and condensed tannins contents, and so, confirm the fascinating bioactivity of this fruit. Copyright © 2016 Elsevier Ltd. All rights reserved.

  2. Lesser peachtree borer (Lepidoptera: Sesiidae) oviposition on Prunus germplasm (United States)

    Synanthedon pictipes (Grote and Robinson) (Lepidoptera: Sesiidae) was used as an oviposition surrogate for the congeneric S. exitiosa (Say) to examine possible preference for Prunus germplasm. We assayed limbs of a peach cultivar (Prunus persica), peach rootstocks, plum-peach hybrid rootstocks, the...

  3. Genome wide identification of chilling responsive microRNAs in Prunus persica. (United States)

    Barakat, Abdelali; Sriram, Aditya; Park, Joseph; Zhebentyayeva, Tetyana; Main, Dorrie; Abbott, Albert


    MicroRNAs (miRNAs) are small RNAs (sRNAs) approximately 21 nucleotides in length that negatively control gene expression by cleaving or inhibiting the translation of target gene transcripts. Within this context, miRNAs and siRNAs are coming to the forefront as molecular mediators of gene regulation in plant responses to annual temperature cycling and cold stress. For this reason, we chose to identify and characterize the conserved and non-conserved miRNA component of peach (Prunus persica (L.) Batsch) focusing our efforts on both the recently released whole genome sequence of peach and sRNA transcriptome sequences from two tissues representing non-dormant leaves and dormant leaf buds. Conserved and non-conserved miRNAs, and their targets were identified. These sRNA resources were used to identify cold-responsive miRNAs whose gene targets co-localize with previously described QTLs for chilling requirement (CR). Analysis of 21 million peach sRNA reads allowed us to identify 157 and 230 conserved and non-conserved miRNA sequences. Among the non-conserved miRNAs, we identified 205 that seem to be specific to peach. Comparative genome analysis between peach and Arabidopsis showed that conserved miRNA families, with the exception of miR5021, are similar in size. Sixteen of these conserved miRNA families are deeply rooted in land plant phylogeny as they are present in mosses and/or lycophytes. Within the other conserved miRNA families, five families (miR1446, miR473, miR479, miR3629, and miR3627) were reported only in tree species (Populustrichocarpa, Citrus trifolia, and Prunus persica). Expression analysis identified several up-regulated or down-regulated miRNAs in winter buds versus young leaves. A search of the peach proteome allowed the prediction of target genes for most of the conserved miRNAs and a large fraction of non-conserved miRNAs. A fraction of predicted targets in peach have not been previously reported in other species. Several conserved and non

  4. Genome wide identification of chilling responsive microRNAs in Prunus persica

    Directory of Open Access Journals (Sweden)

    Barakat Abdelali


    Full Text Available Abstract Background MicroRNAs (miRNAs are small RNAs (sRNAs approximately 21 nucleotides in length that negatively control gene expression by cleaving or inhibiting the translation of target gene transcripts. Within this context, miRNAs and siRNAs are coming to the forefront as molecular mediators of gene regulation in plant responses to annual temperature cycling and cold stress. For this reason, we chose to identify and characterize the conserved and non-conserved miRNA component of peach (Prunus persica (L. Batsch focusing our efforts on both the recently released whole genome sequence of peach and sRNA transcriptome sequences from two tissues representing non-dormant leaves and dormant leaf buds. Conserved and non-conserved miRNAs, and their targets were identified. These sRNA resources were used to identify cold-responsive miRNAs whose gene targets co-localize with previously described QTLs for chilling requirement (CR. Results Analysis of 21 million peach sRNA reads allowed us to identify 157 and 230 conserved and non-conserved miRNA sequences. Among the non-conserved miRNAs, we identified 205 that seem to be specific to peach. Comparative genome analysis between peach and Arabidopsis showed that conserved miRNA families, with the exception of miR5021, are similar in size. Sixteen of these conserved miRNA families are deeply rooted in land plant phylogeny as they are present in mosses and/or lycophytes. Within the other conserved miRNA families, five families (miR1446, miR473, miR479, miR3629, and miR3627 were reported only in tree species (Populustrichocarpa, Citrus trifolia, and Prunus persica. Expression analysis identified several up-regulated or down-regulated miRNAs in winter buds versus young leaves. A search of the peach proteome allowed the prediction of target genes for most of the conserved miRNAs and a large fraction of non-conserved miRNAs. A fraction of predicted targets in peach have not been previously reported in other

  5. The peach (Prunus persica [L.] Batsch) homeobox gene KNOPE3, which encodes a class 2 knotted-like transcription factor, is regulated during leaf development and triggered by sugars. (United States)

    Testone, Giulio; Condello, Emiliano; Verde, Ignazio; Caboni, Emilia; Iannelli, Maria Adelaide; Bruno, Leonardo; Mariotti, Domenico; Bitonti, Maria Beatrice; Giannino, Donato


    Class 1 KNOTTED1-like transcription factors (KNOX) are known to regulate plant development, whereas information on class 2 KNOX has been limited. The peach KNOPE3 gene was cloned, belonged to a family of few class 2 members and was located at 66 cM in the Prunus spp. G1 linkage-group. The mRNA localization was diversified in leaf, stem, flower and drupe, but recurred in all organ sieves, suggesting a role in sap nutrient transport. During leaf development, the mRNA earliest localized to primordia sieves and subsequently to mesophyll cells of growing leaves. Consistently, its abundance augmented with leaf expansion. The transcription was monitored in leaves responding to darkening, supply and transport block of sugars. It peaked at 4 h after darkness and dropped under prolonged obscurity, showing a similar kinetic to that of sucrose content variation. Feeding leaflets via the transpiration stream caused KNOPE3 up-regulation at 3 h after fructose, glucose and sucrose absorption and at 12 h after sorbitol. In girdling experiments, leaf KNOPE3 was triggered from 6 h onwards along with sucrose and sorbitol raise. Both the phloem-associated expression and sugar-specific gene modulation suggest that KNOPE3 may play a role in sugar translocation during the development of agro-relevant organs such as drupe.



    Enrique Quevedo García; Martha Esperanza Arévalo González; Giovanni Orlando Cancino Escalante


    Abstract. A study was conducted to determine the variables that estimated the leaf limbo area and the leaf limbo dry weight of peach Prunus persica (L.) Batsch cv. Jarillo. Fifty leaves, aged 2.5 months, were selected and measured: leaf limbo length and width, petiole length, leaf length, petiole diameter, leaf limbo fresh weight, petiole fresh weight, leaf fresh weight, leaf limbo dry weight, petiole dry weight, leaf dry weight, length/width limbo, petiole length/limbo length and leaf limbo ...

  7. Determination of a mathematical model to estimate the area and dry weight of the leaf limbo of prunus persica cv. jarillo / determinación de un modelo matemático para la estimación del área foliar y peso seco del limbo de prunus persica cv. jarillo


    Quevedo García, Enrique; Arévalo González, Martha Esperanza; Cancino Escalante, Giovanni Orlando


    study was conducted to determine the variables that estimated the leaf limbo area and the leaf limbo dry weight of peach Prunus persica (L.) Batsch cv. Jarillo. Fifty leaves, aged 2.5 months, were selected and measured: leaf limbo length and width, petiole length, leaf length, petiole diameter, leaf limbo fresh weight, petiole fresh weight, leaf fresh weight, leaf limbo dry weight, petiole dry weight, leaf dry weight, length/ width limbo, petiole length/limbo length and leaf limbo area. Th...

  8. Identification of genes associated with bud dormancy release in Prunus persica by suppression subtractive hybridization. (United States)

    Leida, Carmen; Terol, Javier; Martí, Gracia; Agustí, Manuel; Llácer, Gerardo; Badenes, María Luisa; Ríos, Gabino


    To better understand the molecular and physiological mechanisms underlying maintenance and release of seasonal bud dormancy in perennial trees, we identified differentially expressed genes during dormancy progression in reproductive buds from peach (Prunus persica [L.] Batsch) by suppression subtractive hybridization (SSH) and microarray hybridization. Four SSH libraries were constructed, which were respectively enriched in cDNA highly expressed in dormant buds (named DR), in dormancy-released buds (RD) and in the cultivars with different chilling requirement, 'Zincal 5' (ZS) and 'Springlady' (SZ), sampled after dormancy release. About 2500 clones picked from the four libraries were loaded on a glass microarray. Hybridization of microarrays with the final products of SSH procedure was performed in order to validate the selected clones that were effectively enriched in their respective sample. Nearly 400 positive clones were sequenced, which corresponded to 101 different unigenes with diverse functional annotation. We obtained DAM4, 5 and 6 genes coding for MADS-box transcription factors previously related to growth cessation and terminal bud formation in the evergrowing mutant of peach. Several other cDNAs are similar to dormancy factors described in other species, and others have been related to bud dormancy for the first time in this study. Quantitative reverse transcription polymerase chain reaction analysis confirmed differential expression of cDNAs coding for a Zn-finger transcription factor, a GRAS-like regulator, a DNA-binding protein and proteins similar to forisome subunits involved in the reversible occlusion of sieve elements in Fabaceae, among others.

  9. A review on the complexity of insect-plant interactions under varying levels of resources and host resistance: the case of Myzus persicae-Prunus persica

    Directory of Open Access Journals (Sweden)

    Verdugo, JA.


    Full Text Available Introduction. Insect-plant interactions are affected directly or indirectly by stress factors. The effect of environmental resource availability on insect-plant interactions is here reviewed. Subsequently, the analysis focuses on aphid-host plant interactions, particularly in the system composed by the green peach aphid Myzus persicae and its primary host plant Prunus persica. Literature. Plant defenses arise in two ways: resistance and tolerance, both are affected by abiotic factors. The information gathered from studies (n = 29 on plant-aphid interactions addressing the reduction in water availability on plant resistance, showed that in 41,4% of the studies, drought stress elicits lower resistance, while 34.5%, 20.1% and 3.4%, showed higher, no change and conditional effects on plant resistance, respectively. Conclusions. Water stress elicits mixed effects on plant resistance to aphids. However, the literature review also suggests that cultural practices play a role in the fate of the peach-aphid interactions, whereas the development of predictive models aimed to assist crop-pest management systems still requires more basic information. Aphid responses to plant defenses under stressed conditions are still largely unexplored.

  10. Host Plant Resistance to Green Peach Aphid, Myzus persicae (Sulzar), by Some Wild Types of Watermelon (United States)

    The green peach aphid, Myzus persicae (Sulzar), is an important pest of many vegetable crops. It damages crops by feeding and vectoring viruses. Potential sources of plant resistance against M. persicae were examined for watermelon. A multiple choice experiment was conducted with leaves of six wi...

  11. Discovery and Annotation of Plant Endogenous Target Mimicry Sequences from Public Transcriptome Libraries: A Case Study of Prunus persica. (United States)

    Karakülah, Gökhan


    Novel transcript discovery through RNA sequencing has substantially improved our understanding of the transcriptome dynamics of biological systems. Endogenous target mimicry (eTM) transcripts, a novel class of regulatory molecules, bind to their target microRNAs (miRNAs) by base pairing and block their biological activity. The objective of this study was to provide a computational analysis framework for the prediction of putative eTM sequences in plants, and as an example, to discover previously un-annotated eTMs in Prunus persica (peach) transcriptome. Therefore, two public peach transcriptome libraries downloaded from Sequence Read Archive (SRA) and a previously published set of long non-coding RNAs (lncRNAs) were investigated with multi-step analysis pipeline, and 44 putative eTMs were found. Additionally, an eTM-miRNA-mRNA regulatory network module associated with peach fruit organ development was built via integration of the miRNA target information and predicted eTM-miRNA interactions. My findings suggest that one of the most widely expressed miRNA families among diverse plant species, miR156, might be potentially sponged by seven putative eTMs. Besides, the study indicates eTMs potentially play roles in the regulation of development processes in peach fruit via targeting specific miRNAs. In conclusion, by following the step-by step instructions provided in this study, novel eTMs can be identified and annotated effectively in public plant transcriptome libraries.

  12. Dinâmica populacional e incidência de moscas-das-frutas e parasitoides em cultivares de pessegueiros (Prunus Persica L. Batsch no município de presidente prudente-sp Population dynamic and occurrence of fruit flies and their parasitoids in peach cultivars (Prunus persica L. Batsch in presidente prudente municipality, sp

    Directory of Open Access Journals (Sweden)

    Sônia Maria Nalesso Marangoni Montes


    Full Text Available Esta pesquisa teve como objetivos avaliar a dinâmica populacional e registrar a diversidade de moscas-das-frutas (Diptera: Tephritoidea em cultivares de pessegueiro Tropical, Talismã, Aurora 2, Aurora 1, Dourado 2 e Doçura 2, enxertadas sobre os porta-enxertos 'Okinawa' e Umê, em Presidente Prudente-SP. Foram realizadas as correlações da dinâmica populacional com a temperatura e a precipitação, e também a infestação com as características químicas dos frutos, Sólidos Solúveis e Acidez Titulável. No período de julho de 2004 a dezembro de 2006, a dinâmica populacional de moscas-das-frutas foi obtida através de coletas semanais de moscas-das-frutas em armadilhas McPhail, e a incidência foi determinada através da coleta de 30 frutos/planta/cultivar. O delineamento estatístico adotado foi o inteiramente casualizado, com cinco repetições. Ceratitis capitata foi predominante nas cultivares de pessegueiros estudadas. Não foi observada correlação significativa entre população de moscas-das-frutas e as variáveis de temperatura e precipitação, e sólidos solúveis e ácidez titulável. Entre as cultivares de pêssego, Aurora 2 apresentou maior infestação por C. capitata, da ordem de 22 e 23% nos anos 2004 e 2006, respectivamente. Também foi registrada a incidência de Neosilba spp. em frutos de pêssego. Doryctobracon areolatus (Braconidae, Tetrastichus giffardianus (Eulophidae e Pachycrepoideus vindemmiae (Pteromalidae foram recuperados de pupários de Tephritidae.The objectives of this research were evaluate the population dynamic and diversity of fruit flies (Diptera: Tephritoidea on peach cultivars Tropical, Talisma, Aurora 2, Aurora 1, Dourado 2 and Doçura 2, under the rootstocks 'Okinawa' and Umê, in Presidente Prudente, São Paulo, Brazil. The dynamic population of fruit flies was correlated with temperature and precipitation. The fruit fly infestation was correlated with chemical characteristics of fruits

  13. Genotypic differences in cyanogenic glycosides levels of compatible Prunus persica P. persica and incompatible P. persica P. mume combinations

    Directory of Open Access Journals (Sweden)

    Ivan dos Santos Pereira


    Full Text Available ABSTRACT Graft incompatibility is a phenomenon associated with complex physiological, biochemical, and genetic interactions between scion and rootstock. The main objective of this work was to assess the role of cyanogenic glycosides (CGs, amygdalin and prunasin, in the graft incompatibility of Prunus and possible biochemical effects in compounds of the phenylpropanoid pathway. Graft compatibility, amygdalin and prunasin content, phenylalanine ammonia-lyase activity, total phenolic compounds content and antioxidant activity, were studied in different graft combinations (Chimarrita/Capdeboscq; Chimarrita/Tsukuba 1; Chimarrita/Umezeiro; Maciel/Capdeboscq; Maciel/’Tsukuba 1; Maciel/Umezeiro and ungrafted genotypes. The results indicate that there was graft incompatibility of Chimarrita and Maciel cultivars grafted into Umezeiro rootstock. Combinations identified as incompatible showed higher prunasin concentration and phenylalanine ammonialyase (PAL activity in rootstock and greater concentration of total phenolics compounds and antioxidant activity in scion and rootstock. The results indicate that large differences in CGs concentration, especially prunasin, can be the graft incompatibility cause between Prunus persic. and P. mume. The prunasin concentration may be considered a promising marker to predict graft compatibility between P. persica and P. mume.

  14. Characterization of cytokinin signaling and homeostasis gene families in two hardwood tree species: Populus trichocarpa and Prunus persica. (United States)

    Immanen, Juha; Nieminen, Kaisa; Duchens Silva, Héctor; Rodríguez Rojas, Fernanda; Meisel, Lee A; Silva, Herman; Albert, Victor A; Hvidsten, Torgeir R; Helariutta, Ykä


    Through the diversity of cytokinin regulated processes, this phytohormone has a profound impact on plant growth and development. Cytokinin signaling is involved in the control of apical and lateral meristem activity, branching pattern of the shoot, and leaf senescence. These processes influence several traits, including the stem diameter, shoot architecture, and perennial life cycle, which define the development of woody plants. To facilitate research about the role of cytokinin in regulation of woody plant development, we have identified genes associated with cytokinin signaling and homeostasis pathways from two hardwood tree species. Taking advantage of the sequenced black cottonwood (Populus trichocarpa) and peach (Prunus persica) genomes, we have compiled a comprehensive list of genes involved in these pathways. We identified genes belonging to the six families of cytokinin oxidases (CKXs), isopentenyl transferases (IPTs), LONELY GUY genes (LOGs), two-component receptors, histidine containing phosphotransmitters (HPts), and response regulators (RRs). All together 85 Populus and 45 Prunus genes were identified, and compared to their Arabidopsis orthologs through phylogenetic analyses. In general, when compared to Arabidopsis, differences in gene family structure were often seen in only one of the two tree species. However, one class of genes associated with cytokinin signal transduction, the CKI1-like family of two-component histidine kinases, was larger in both Populus and Prunus than in Arabidopsis.

  15. Characterization of cytokinin signaling and homeostasis gene families in two hardwood tree species: Populus trichocarpa and Prunus persica (United States)


    Background Through the diversity of cytokinin regulated processes, this phytohormone has a profound impact on plant growth and development. Cytokinin signaling is involved in the control of apical and lateral meristem activity, branching pattern of the shoot, and leaf senescence. These processes influence several traits, including the stem diameter, shoot architecture, and perennial life cycle, which define the development of woody plants. To facilitate research about the role of cytokinin in regulation of woody plant development, we have identified genes associated with cytokinin signaling and homeostasis pathways from two hardwood tree species. Results Taking advantage of the sequenced black cottonwood (Populus trichocarpa) and peach (Prunus persica) genomes, we have compiled a comprehensive list of genes involved in these pathways. We identified genes belonging to the six families of cytokinin oxidases (CKXs), isopentenyl transferases (IPTs), LONELY GUY genes (LOGs), two-component receptors, histidine containing phosphotransmitters (HPts), and response regulators (RRs). All together 85 Populus and 45 Prunus genes were identified, and compared to their Arabidopsis orthologs through phylogenetic analyses. Conclusions In general, when compared to Arabidopsis, differences in gene family structure were often seen in only one of the two tree species. However, one class of genes associated with cytokinin signal transduction, the CKI1-like family of two-component histidine kinases, was larger in both Populus and Prunus than in Arabidopsis. PMID:24341635

  16. Changes in biochemical compounds in flesh and peel from Prunus persica fruits grown in Tunisia during two maturation stages. (United States)

    Dabbou, Samia; Lussiana, Carola; Maatallah, Samira; Gasco, Laura; Hajlaoui, Hichem; Flamini, Guido


    Plants can synthesize tens to hundreds of thousands of primary and secondary metabolites with diverse biological properties and functions. Fatty acids (FA), phenolic compounds (PC) and volatile compounds (VC) of flesh and peel from three Prunus persica cultivars were evaluated at the Regional Centre of Agricultural Research--Experimental Farm (Sidi Bouzid, Tunisia) during two maturation stages. Palmitic, oleic and linoleic acids are the most abundant FA in Prunus persica cultivars. A genetic effect on FA composition was observed throughout the two sampling periods. Peel was rich in oleic acid with the highest content (31.3% on total FA) in 'O'Henry' cultivar at the commercial ripening date; flesh was rich in linoleic acid with the highest content (44.7% on total FA) in 'Sweet Cap' cultivar at the full ripening date. The monounsaturated/polyunsaturated fatty acids ratios were higher in the commercial ripe than in the full ripe fruits. The analysis of the composition of the VC led to the characterization of 98 different compounds, showing a very high variability among the cultivars. The full ripe fruit (peel and flesh) exhibited the highest total number of terpenoids. Commercial ripe peels were richest in the percentage of hydrocarbons. Comparing cultivars, 'Sweet Cap' cultivar showed the lowest contents of alcohols in peel and flesh of full ripe fruit but highest in peel of commercial ripe fruit, and lowest content of aldehydes in peel and flesh of commercial ripe fruit but highest in peel of ripe ones and the highest ones of lactones. Among PC, the highest contents were observed for o-diphenols and the values showed varietal influence. Total phenols contents decreased during ripening process (p peel and flesh tissues, except found for 'Sweet Cap' cultivar. In conclusion, to achieve better FA composition and greater VC and PC production of the peach fruit, P. persica cultivars should be harvested at the commercial ripening date. Copyright © 2015 Elsevier Masson SAS

  17. Progress in developing Armillaria resistant rootstocks for use with peach (United States)

    GuardianTM (BY520-9) peach seedling rootstock was released in 1993 to provide a rootstock with superior resistance to peach tree short life (PTSL) which at the time was the number one cause of premature death of peach (Prunus persica L. [Batsch]) trees in the southeastern US. Since that time Guardi...

  18. Progress in the management of peach fungal gummosis (Botryosphaeria dothidea) in the Southeastern U.S. peach industry (United States)

    Peach fungal gummosis, incited by Botryosphaeria dothidea (Moug.:Fr.) Ces. & De Not., has been shown to be capable of reducing growth and yield by up to 40% on susceptible peach [Prunus persica (L.) Batsch] cultivars. Initial field screens demonstrated that several important peach cultivars utilize...

  19. Transcriptional Responses in root and leaf of Prunus persica Under Drought Stress Using RNA Sequencing

    Directory of Open Access Journals (Sweden)

    Najla Ksouri


    Full Text Available Prunus persica L. Batch, or peach, is one of the most important crops and it is widely established in irrigated arid and semi-arid regions. However, due to variations in the climate and the increased aridity, drought has become a major constraint, causing crop losses worldwide. The use of drought-tolerant rootstocks in modern fruit production appears to be a useful method of alleviating water deficit problems. However, the transcriptomic variation and the major molecular mechanisms that underlie the adaptation of drought-tolerant rootstocks to water shortage remain unclear. Hence, in this study, high-throughput sequencing (RNA-seq was performed to assess the transcriptomic changes and the key genes involved in the response to drought in root tissues (GF677 rootstock and leaf tissues (graft, var. Catherina subjected to 16 days of drought stress. In total, 12 RNA libraries were constructed and sequenced. This generated a total of 315M raw reads from both tissues, which allowed the assembly of 22,079 and 17,854 genes associated with the root and leaf tissues, respectively. Subsets of 500 differentially expressed genes (DEGs in roots and 236 in leaves were identified and functionally annotated with 56 gene ontology (GO terms and 99 metabolic pathways, which were mostly associated with aminobenzoate degradation and phenylpropanoid biosynthesis. The GO analysis highlighted the biological functions that were exclusive to the root tissue, such as locomotion, hormone metabolic process, and detection of stimulus, indicating the stress-buffering role of the GF677 rootstock. Furthermore, the complex regulatory network involved in the drought response was revealed, involving proteins that are associated with signaling transduction, transcription and hormone regulation, redox homeostasis, and frontline barriers. We identified two poorly characterized genes in P. persica: growth-regulating factor 5 (GRF5, which may be involved in cellular expansion, and AtHB12

  20. Transcriptional Responses in Root and Leaf of Prunus persica under Drought Stress Using RNA Sequencing. (United States)

    Ksouri, Najla; Jiménez, Sergio; Wells, Christina E; Contreras-Moreira, Bruno; Gogorcena, Yolanda


    Prunus persica L. Batsch, or peach, is one of the most important crops and it is widely established in irrigated arid and semi-arid regions. However, due to variations in the climate and the increased aridity, drought has become a major constraint, causing crop losses worldwide. The use of drought-tolerant rootstocks in modern fruit production appears to be a useful method of alleviating water deficit problems. However, the transcriptomic variation and the major molecular mechanisms that underlie the adaptation of drought-tolerant rootstocks to water shortage remain unclear. Hence, in this study, high-throughput sequencing (RNA-seq) was performed to assess the transcriptomic changes and the key genes involved in the response to drought in root tissues (GF677 rootstock) and leaf tissues (graft, var. Catherina) subjected to 16 days of drought stress. In total, 12 RNA libraries were constructed and sequenced. This generated a total of 315 M raw reads from both tissues, which allowed the assembly of 22,079 and 17,854 genes associated with the root and leaf tissues, respectively. Subsets of 500 differentially expressed genes (DEGs) in roots and 236 in leaves were identified and functionally annotated with 56 gene ontology (GO) terms and 99 metabolic pathways, which were mostly associated with aminobenzoate degradation and phenylpropanoid biosynthesis. The GO analysis highlighted the biological functions that were exclusive to the root tissue, such as "locomotion," "hormone metabolic process," and "detection of stimulus," indicating the stress-buffering role of the GF677 rootstock. Furthermore, the complex regulatory network involved in the drought response was revealed, involving proteins that are associated with signaling transduction, transcription and hormone regulation, redox homeostasis, and frontline barriers. We identified two poorly characterized genes in P. persica: growth-regulating factor 5 (GRF5), which may be involved in cellular expansion, and AtHB12

  1. Electronic nose to detect volatile compound profile and quality changes in 'spring Belle' peach (Prunus persica L.) during cold storage in relation to fruit optical properties measured by time-resolved reflectance spectroscopy. (United States)

    Rizzolo, Anna; Bianchi, Giulia; Vanoli, Maristella; Lurie, Susan; Spinelli, Lorenzo; Torricelli, Alessandro


    The aim of this research was to study the relationships between electronic nose (E-nose) pattern, maturity class of peaches assessed at harvest by means of absorption coefficient at 670 nm (μ(a)670) measured in fruit pulp by time-resolved reflectance spectroscopy (TRS), and quality evolution during a 4 week cold storage. 'Spring Belle' peaches were measured for μ(a)670 by TRS, ranked according to decreasing μ(a)670 value, divided into three TRS maturity classes (less (LeM), medium (MeM), and more (MoM) mature), and randomized into 9 samples of 30 fruit each, so that fruits from the whole μ(a)670 range were present in each sample. At harvest and after 1, 2, 3, and 4 weeks of storage at 0 and 4 °C, fruits of each sample were evaluated for firmness, expressible juice, μ(a)670, and ethylene production. LeM and MoM peaches of each sample were analyzed for aroma pattern by a commercial electronic nose and by static HS-GC and for sugar (glucose, fructose, sucrose, and sorbitol) and organic acid (quinic, malic, and citric acids) compositions by HPLC. Principal component analysis (PCA) of electronic nose data emphasized the ability of the E-nose to assess the ripening stage of fruit associated with maturity class, storage time, and storage temperature. The sensors having the highest influence on the pattern were W5S in PC-1, W1S in PC-2, and W2S in PC-3. From linear correlation analysis between PCs and firmness, flavor, and volatile compounds, it was found that PC-1 was related to ethylene production and volatile compounds (mainly acetate esters and ethanol); the highest PC-1 scores were found for fruit belonging to the MoM class after 2 weeks of storage at 4 °C, which showed the rise in ethylene production coupled with the highest total volatile production and sugar and acid composition of ripe peach fruits. PC-2 correlated with hexanal, ethyl acetate, and sugar composition, and PC-3 was mainly related to flavor compounds; both functions significantly changed with

  2. The morphological variation of Myzus persicae (Hemiptera: Aphididae from peach and tobacco in Serbia and Montenegro

    Directory of Open Access Journals (Sweden)

    Vučetić Anđa


    Full Text Available Multivariate morphometric analysis was used to compare nine characteristics of 47 populations of Myzus persicae (Sulzer originating from two host-plants, peach and tobacco, from 13 localities in 2004 and 34 localities in 2005, in Serbia and Montenegro. Multivariant discriminant analysis showed there to be a distinct discrimination between the populations from the peach and tobacco host-plants. The most important discrimination characteristics are the ultimate rostral segment length and processes terminalis length, which are greater in the aphids from tobacco than in those from peach. This is the first indication that in this part of Europe there are two subspecies: M. persicae (Sulzer and M. persicae nicotianae Blackman. .

  3. Performance of Prunus rootstocks in the 2001 NC-140 peach trial (United States)

    Fourteen Prunus rootstock cultivars and selections budded with either ‘Redtop’, ‘Redhaven’ or ‘Cresthaven’ peach were planted at 11 locations in North America in 2001 in a randomized block design with a tree spacing of 5 by 6 m and 8 replicates. These rootstocks included three peach seedling rootst...

  4. Transcriptomic profiling during the post-harvest of heat-treated Dixiland Prunus persica fruits: common and distinct response to heat and cold. (United States)

    Lauxmann, Martin A; Brun, Bianca; Borsani, Julia; Bustamante, Claudia A; Budde, Claudio O; Lara, María V; Drincovich, María F


    Cold storage is extensively used to slow the rapid deterioration of peach (Prunus persica L. Batsch) fruit after harvest. However, peach fruit subjected to long periods of cold storage develop chilling injury (CI) symptoms. Post-harvest heat treatment (HT) of peach fruit prior to cold storage is effective in reducing some CI symptoms, maintaining fruit quality, preventing softening and controlling post-harvest diseases. To identify the molecular changes induced by HT, which may be associated to CI protection, the differential transcriptome of peach fruit subjected to HT was characterized by the differential display technique. A total of 127 differentially expressed unigenes (DEUs), with a presence-absence pattern, were identified comparing peach fruit ripening at 20°C with those exposed to a 39°C-HT for 3 days. The 127 DEUs were divided into four expression profile clusters, among which the heat-induced (47%) and heat-repressed (36%) groups resulted the most represented, including genes with unknown function, or involved in protein modification, transcription or RNA metabolism. Considering the CI-protection induced by HT, 23-heat-responsive genes were selected and analyzed during and after short-term cold storage of peach fruit. More than 90% of the genes selected resulted modified by cold, from which nearly 60% followed the same and nearly 40% opposite response to heat and cold. Moreover, by using available Arabidopsis microarray data, it was found that nearly 70% of the peach-heat responsive genes also respond to cold in Arabidopsis, either following the same trend or showing an opposite response. Overall, the high number of common responsive genes to heat and cold identified in the present work indicates that HT of peach fruit after harvest induces a cold response involving complex cellular processes; identifying genes that are involved in the better preparation of peach fruit for cold-storage and unraveling the basis for the CI protection induced by HT.

  5. Susceptibility to Xylella fastidiosa in a first generation hybrid from a non-traditional peach-almond cross (United States)

    To facilitate development of Prunus rootstocks with desirable agronomic traits, domesticated peach (Prunus persica) and almond (P. dulcis) were crossed with wild almond relatives. This work reports that a hybrid from a P. webbii x P. persica cv Harrow Blood cross is susceptible to almond leaf scorch...

  6. Green synthesis of nitrogen-doped graphitic carbon sheets with use of Prunus persica for supercapacitor applications

    Energy Technology Data Exchange (ETDEWEB)

    Atchudan, Raji, E-mail: [School of Chemical Engineering, Yeungnam University, Gyeongsan 38541 (Korea, Republic of); Edison, Thomas Nesakumar Jebakumar Immanuel [School of Chemical Engineering, Yeungnam University, Gyeongsan 38541 (Korea, Republic of); Perumal, Suguna [Department of Applied Chemistry, Kyungpook National University, Daegu 41566 (Korea, Republic of); Lee, Yong Rok, E-mail: [School of Chemical Engineering, Yeungnam University, Gyeongsan 38541 (Korea, Republic of)


    Highlights: • N-GCSs was synthesized from the unripe Prunus persica by direct hydrothermal method. • The resulting N-GCSs-2 exhibit an excellent graphitization with 9.33% of nitrogen. • N-GCSs-2 provide high C{sub s} of 176 F g{sup −1} at current density of 0.1 A g{sup −1} in 1 M H{sub 2}SO{sub 4}. • N-GCSs-2 have high capacitance retention and 20% capacity growth after 2000 cycles. • First time, N-GCSs resulted from peach via green route for flexible supercapacitors. - Abstract: Nitrogen-doped graphitic carbon sheets (N-GCSs) were prepared from the extract of unripe Prunus persica fruit by a direct hydrothermal method. The synthesized N-GCSs were examined by high resolution transmission electron microscopy (HRTEM), nitrogen adsorption-desorption isotherms, X-ray diffraction (XRD), Raman spectroscopy, X-ray photoelectron spectroscopy (XPS), and Fourier transform infrared (FT-IR) spectroscopy. HRTEM showed that the synthesized carbon sheets were graphitic with lattice fringes and an inter-layer distance of 0.36 nm. Doping with the nitrogen moiety present over the synthesized GCSs was confirmed by XPS, FT-IR spectroscopy, and energy dispersive X-ray spectroscopy elemental mapping. The fruit extract associated with hydrothermal-carbonization method is economical and eco-friendly with a single step process. The resulting carbon sheets could be modified and are promising candidates for nano-electronic applications, including supercapacitors. The synthesized N-GCSs-2 provided a high specific capacitance of 176 F g{sup −1} at a current density of 0.1 A g{sup −1}. This electrode material has excellent cyclic stability, even after 2000 cycles of charge-discharge at a current density of 0.5 A g{sup −1}.

  7. Bioinformatics prediction of miRNAs in the Prunus persica genome with validation of their precise sequences by miR-RACE. (United States)

    Zhang, Yanping; Bai, Youhuang; Han, Jian; Chen, Ming; Kayesh, Emrul; Jiang, Weibing; Fang, Jinggui


    We predicted 262 potential MicroRNAs (miRNAs) belonging to 70 miRNA families from the peach (Prunus persica) genome and two specific 5' and 3' miRNA rapid amplification of cDNA ends (miR-RACE) PCR reactions and sequence-directed cloning were employed to accurately validate 61 unique P. persica miRNAs (Ppe-miRNAs) sequences belonging to 61 families comprising 97 Ppe-miRNAs. Validation of the termini nucleotides in particular can define the real sequences of the Ppe-miRNAs on peach genome. Comparison between predicted and validated Ppe-miRNAs through alignment revealed that 43 unique orthologous sequences were identical, while the remaining 18 exhibited some divergences at their termini nucleotides. Quantitative real-time polymerase chain reaction (qRT-PCR) was further employed to analyze the expression of all the 61 miRNAs and 10 putative targets of 8 randomly selected Ppe-miRNAs in peach leaves, flowers and fruits at different stages of development, where both the miRNAs and the putative target genes showed tissue-specific expression. Copyright © 2012 Elsevier GmbH. All rights reserved.

  8. Activities of sucrose and sorbitol metabolizing enzymes in vegetative sinks of peach and correlation with sink growth rate (United States)

    Riccardo Lo Bianco; Mark Rieger; Shi-Jean S. Sung


    Terminal portions of 'Flordaguard' peach roots (Prunus persica ((L.) Batsch) were divided into six segments and the activities of NAD+-dependent sorbitol dehydrogenase (SDH), sorbitol oxidase (SOX), sucrose synthase (SS), soluble acid invertase (AI),...

  9. Grass competition may benefit high density peach orchards (United States)

    Previous research demonstrated that grass competition dwarfed and reduced the yield of individual peach trees [Prunus persica (L.) Batsch] grown in narrow vegetation free areas (VFA). In this report, the area-based yield of two peach cultivars, 'Redskin' and 'Jersey Dawn' on 'Lovell', was estimated...

  10. Variation Of Odour Profile Detected In The Floral Stages of Prunus Persica (L) Batsch Using An Electronic Nose (United States)

    Valeria, Messina; Silvia, Radice; Rosa, Baby; de Reca Noemí, Walsöe


    Bees use signals from plants to identify worthwhile visits. They learn quickly to differentiate mainly their floral odor than their colour. In some species the flowers remain open, intact and turgid until they are pollinated (anthesis) after which they are no longer attractive to pollinators (post-anthesis). Pollinators use fragrance for distance orientation, approach, landing, feeding and associative learning. The aim of this work was to study the variation of odor profile between anthesis and post-anthesis produced in flowers of different cultivars of Prunus Persica (L.) batsch, using an electronic nose since odor is a communication between flowering plants and bees. Visual results on field showed that peach flowers are generally more visited in the anthesis stage. Among all the analysed cultivars, Forastero cultivar was the only one visited in this floral stage. Statistical analysis of the electronic nose data showed that doped semiconductuvtive SnO2 sensors could differentiate between stages (anthesis and post-anthesis) only in case of Forastero cultivar.

  11. Anti-allergic inflammatory effects of cyanogenic and phenolic glycosides from the seed of Prunus persica. (United States)

    Kim, Geum Jin; Choi, Hyun Gyu; Kim, Ji Hyang; Kim, Sang Hyun; Kim, Jeong Ah; Lee, Seung Ho


    A methanol extract of the seed of Prunus persica (Rosaceae) was found to inhibit histamine release in human mast cells. Activity-guided fractionation of the methanol extract yielded three cyanogenic glycosides (1-3) and other phenolic compounds (4-8). To evaluate their anti-allergic and anti-inflammatory activities, the isolates (1-8) were tested for their inhibitory effects on histamine release and on the gene expressions of tumor necrosis factor (TNF)-alpha and interleukin (IL)-6 in human mast cells. Of these, phenolic glycosides 7 and 8 suppressed histamine release and inhibited the pro-inflammatory cytokines TNF-alpha and IL-6. These results suggest that isolates from P. persica are among the anti-allergic inflammatory principles in this medicinal plant.

  12. Variabilidad interspecifica de duraznos (Prunus persica L. Batsch.) y ciruelos (Prunus domestica) usando RAMs

    National Research Council Canada - National Science Library

    Ana Cruz Morillo Coronado; Yacenia Morillo Coronado; Leonardo Ariel González Mendoza; Iván Adiel Ávila Morales


      A sample of 41 Prunus materials from the deciduous collection of the Pedagogical and Technological University of Colombia was selected to evaluate its genetic diversity using eight primers for Random...

  13. Taxonomy Icon Data: peach [Taxonomy Icon

    Lifescience Database Archive (English)

    Full Text Available g Prunus_persica_NS.png ...

  14. Abundance and consumption rate of glassy-winged sharpshooter (Hemiptera: Cicadellidae) on peaches and plums (United States)

    Homalodisca vitripennis, also known as the glassy-winged sharpshooter, is a primary vector of phony peach and plum leaf scald diseases caused by Xylella fastidiosa Wells et al. Two of the following scions, (Prunus persica L. Batch cvs. Flordaking and June Gold and Prunus salicina L. cvs. Methley an...

  15. Analysis of visual symptomatology in peach and plum inoculated with U.S. PPV isolates (United States)

    Plum pox potyvirus (PPV) is an economically devastating potyvirus that affects Prunus species. Discovered in the United States, in 1999, the Pennsylvania PPV isolates were primarily found in peaches (Prunus persica). When several of these original Pennsylvania isolates were inoculated onto plums (...

  16. Genome-Wide Analysis Characterization and Evolution of SBP Genes in Fragaria vesca, Pyrus bretschneideri, Prunus persica and Prunus mume

    Directory of Open Access Journals (Sweden)

    Muhammad Abdullah


    Full Text Available The SQUAMOSA promoter binding protein (SBP-box proteins are plant-specific transcriptional factors in plants. SBP TFs are known to play important functions in a diverse development process and also related in the process of evolutionary novelties. SBP gene family has been characterized in several plant species, but little is known about molecular evolution, functional divergence and comprehensive study of SBP gene family in Rosacea. We carried out genome-wide investigations and identified 14, 32, 17, and 17 SBP genes from four Rosacea species (Fragaria vesca, Pyrus bretschneideri, Prunus persica and Prunus mume, respectively. According to phylogenetic analysis arranged the SBP protein sequences in seven groups. Localization of SBP genes presented an uneven distribution on corresponding chromosomes of Rosacea species. Our analyses designated that the SBP genes duplication events (segmental and tandem and divergence. In addition, due to highly conserved structure pattern of SBP genes, recommended that highly conserved region of microsyneteny in the Rosacea species. Type I and II functional divergence was detected among various amino acids in SBP proteins, while there was no positive selection according to substitutional model analysis using PMAL software. These results recommended that the purifying selection might be leading force during the evolution process and dominate conservation of SBP genes in Rosacea species according to environmental selection pressure analysis. Our results will provide basic understanding and foundation for future research insights on the evolution of the SBP genes in Rosacea.

  17. Microsatellite marker analysis of peach-potato aphids (Myzus persicae, Homoptera: Aphididae) from Scottish suction traps. (United States)

    Malloch, G; Highet, F; Kasprowicz, L; Pickup, J; Neilson, R; Fenton, B


    The peach-potato aphid Myzus persicae (Sulzer) is an important vector of plant viruses. A network of suction traps collects aerial samples of this aphid in order to monitor and help predict its spatial distribution and likely impact on virus transmission in crops. A suction trap catch is thought to be a good representation of the total aphid pool. Sensitive molecular markers have been developed that determine the genetic composition of the M. persicae population. In Scotland, UK, these were applied to field collections revealing a limited number of clones. Molecular markers are less successful when applied to specimens that have been preserved in an ethanol-based trap fluid designed to preserve morphology. An assessment of different DNA extraction and PCR techniques is presented and the most efficient are used to analyse M. persicae specimens caught in the Dundee suction trap in 2001, a year when exceptionally high numbers were caught. The results reveal that the majority of the M. persicae caught belonged to two highly insecticide resistant clones. In addition, it was possible to compare the relative frequencies of genotypes caught in the trap with those collected at insecticide treated and untreated field sites in the vicinity. These results indicate that, in addition to suction trap data, the ability to sample field sites provides valuable early warning data which have implications for pest control and virus management strategies.

  18. Diversity of low chill peaches from Asia, Brasil, Europe and the USA (United States)

    One hundred fifty-five peach (Prunus persica) cultivars, from Asia, Brazil, Europe, and the USA, were examined using eleven SSRs to study the genetic relationships among low chill as compared to high chill peach germplasm. Data was analyzed by NTSYSpc to form a similarity matrix using Nei and Li’s ...

  19. Perspectives of breeding fungal diseases resistant cultivars of nectarine (Prunus persica (L. Batsch. subsp. nectarina (Ait. Shof.

    Directory of Open Access Journals (Sweden)

    Є. П. Шоферістов


    Full Text Available There are allocated some forms of distant hybrids with weak degree of fungal diseases lesion (Taphrina deformans (Berk. Tul., Sphaerotheca pannosa (Lev. var. persicae Woron., Clasterosporium carpophilum Aderh., Monilia cinerea Bonord. и Monilia fructigena Fr. that are of practical interest for breeding such cultivars of peach and nectarine that will resist these pathogens.

  20. Unravelling early events in the Taphrina deformans-Prunus persica interaction: an insight into the differential responses in resistant and susceptible genotypes. (United States)

    Svetaz, Laura A; Bustamante, Claudia A; Goldy, Camila; Rivero, Nery; Müller, Gabriela L; Valentini, Gabriel H; Fernie, Alisdair R; Drincovich, María F; Lara, María V


    Leaf peach curl is a devastating disease affecting leaves, flowers and fruits, caused by the dimorphic fungus Taphrina deformans. To gain insight into the mechanisms of fungus pathogenesis and plant responses, leaves of a resistant and two susceptible Prunus persica genotypes were inoculated with blastospores (yeast), and the infection was monitored during 120 h post inoculation (h.p.i.). Fungal dimorphism to the filamentous form and induction of reactive oxygen species (ROS), callose synthesis, cell death and defence compound production were observed independently of the genotype. Fungal load significantly decreased after 120 h.p.i. in the resistant genotype, while the pathogen tended to grow in the susceptible genotypes. Metabolic profiling revealed a biphasic re-programming of plant tissue in susceptible genotypes, with an initial stage co-incident with the yeast form of the fungus and a second when the hypha is developed. Transcriptional analysis of PRs and plant hormone-related genes indicated that pathogenesis-related (PR) proteins are involved in P. persica defence responses against T. deformans and that salicylic acid is induced in the resistant genotype. Conducted experiments allowed the elucidation of common and differential responses in susceptible versus resistant genotypes and thus allow us to construct a picture of early events during T. deformans infection. © 2017 John Wiley & Sons Ltd.

  1. Differences in cold hardiness, carbohydrates, dehydrins and related gene expressions under an experimental deacclimation and reacclimation in Prunus persica. (United States)

    Shin, Hyunsuk; Oh, Youngjae; Kim, Daeil


    To boost our understanding of a recent outbreak of freezing injury, we sought to confirm distinctive features between the shoot tissues of the peach (Prunus persica) cultivars Daewol and Kiraranokiwami by mimicking unseasonable changes of temperatures that occur in the early spring through repeated deacclimation and reacclimation treatments. Patterns of cold hardiness declined dramatically during the deacclimation and rose during the reacclimation in both cultivars. Our results indicated that 'Daewol' possessed higher capacity in response to repeated deacclimation and reacclimation treatments than 'Kiraranokiwami'. 'Daewol' showed more sensitive changes in the carbohydrates in response to warm and low temperatures compared with 'Kiraranokiwami'. 'Daewol' indicated almost similar repeated down- and up-patterns in soluble sugar content in response to repeated deacclimation and reacclimation, whereas it indicated repeated up- and down-patterns in starch content. However, 'Kiraranokiwami' showed a progressive increase in the soluble sugar content and a progressive decrease in starch content. Notably, patterns of accumulation of a 60-kDa dehydrin protein encoded by the PpDhn1 gene were confirmed through western blotting and paralleled fluctuations of cold hardiness in both cultivars. Expression of this dehydrin was weak in both cultivars during deacclimation but its band intensity increased during reacclimation. Changes in related genes (β-amylase, PpDhn1, PpDhn2 and PpDhn3) were positively correlated with changes in cold hardiness throughout the experiment. Our results indicate that recent repeated warm periods may cause premature deacclimation in the early spring, and that more cold-tolerant cultivar may be more resilient to freezing injury caused by unstable temperature conditions. © 2014 Scandinavian Plant Physiology Society.

  2. Transcriptional regulation of flavonoid biosynthesis in nectarine (Prunus persica) by a set of R2R3 MYB transcription factors. (United States)

    Ravaglia, Daniela; Espley, Richard V; Henry-Kirk, Rebecca A; Andreotti, Carlo; Ziosi, Vanina; Hellens, Roger P; Costa, Guglielmo; Allan, Andrew C


    Flavonoids such as anthocyanins, flavonols and proanthocyanidins, play a central role in fruit colour, flavour and health attributes. In peach and nectarine (Prunus persica) these compounds vary during fruit growth and ripening. Flavonoids are produced by a well studied pathway which is transcriptionally regulated by members of the MYB and bHLH transcription factor families. We have isolated nectarine flavonoid regulating genes and examined their expression patterns, which suggests a critical role in the regulation of flavonoid biosynthesis. In nectarine, expression of the genes encoding enzymes of the flavonoid pathway correlated with the concentration of proanthocyanidins, which strongly increases at mid-development. In contrast, the only gene which showed a similar pattern to anthocyanin concentration was UDP-glucose-flavonoid-3-O-glucosyltransferase (UFGT), which was high at the beginning and end of fruit growth, remaining low during the other developmental stages. Expression of flavonol synthase (FLS1) correlated with flavonol levels, both temporally and in a tissue specific manner. The pattern of UFGT gene expression may be explained by the involvement of different transcription factors, which up-regulate flavonoid biosynthesis (MYB10, MYB123, and bHLH3), or repress (MYB111 and MYB16) the transcription of the biosynthetic genes. The expression of a potential proanthocyanidin-regulating transcription factor, MYBPA1, corresponded with proanthocyanidin levels. Functional assays of these transcription factors were used to test the specificity for flavonoid regulation. MYB10 positively regulates the promoters of UFGT and dihydroflavonol 4-reductase (DFR) but not leucoanthocyanidin reductase (LAR). In contrast, MYBPA1 trans-activates the promoters of DFR and LAR, but not UFGT. This suggests exclusive roles of anthocyanin regulation by MYB10 and proanthocyanidin regulation by MYBPA1. Further, these transcription factors appeared to be responsive to both

  3. Pós-colheita de pêssegos (Prunus pérsica L. Bastsch revestidos com filmes a base de amido como alternativa à cera comercial Postharvest of peaches (Prunus persica L. Bastsch covered with film-forming of cassava starch as alternative to the commercial wax

    Directory of Open Access Journals (Sweden)

    Marcelo Alvares de Oliveira


    Full Text Available O presente trabalho objetivou prolongar a conservação póscolheita de pêssegos, armazenando-os à temperatura ambiente. Inicialmente selecionou-se uma microemulsão à base de fécula de mandioca e cera de abelha. Posteriormente ela foi testada, aplicando-a na superfície dos frutos em comparação com "Fruit wax" (cera comercial, com o intuito de se verificar o efeito dos diferentes tratamentos na composição química, física e físico-química dos mesmos. Utilizaram-se pêssegos 'Biuti' colhidos manualmente em 14/01/1999, ao atingirem o ponto de maturação fisiológica. Do lote colhido foram selecionados 120 frutos sendo os mesmos analisados quanto a perda de massa fresca, taxa respiratória, textura, sólidos solúveis totais, acidez total titulável e pH, a cada 3 dias. Os frutos receberam os tratamentos: Testemunha, "Fruit Wax", Fécula e Microemulsão. Os tratamentos "Fruit Wax" e "Microemulsão" proporcionaram melhor eficiência em relação à perda de massa fresca que os frutos dos tratamentos Testemunha e Fécula. Quanto à taxa de respiração, verificou-se picos da ordem de 40mg de . Quanto aos açúcares, verificou-se que a sacarose foi o açúcar encontrado em maior quantidade, com apenas traços de glicose e frutose em algumas amostras. Quanto aos teores de sólidos solúveis totais, os frutos tratados com "Fruit Wax" apresentaram valores inferiores aos do tratamento Testemunha. O efeito da Microemulsão mostrou-se similar ao da cera "Fruit Wax" em todos os atributos e, superior ao dos tratamentos Testemunha e Fécula na redução da perda de massa fresca.The main objective of this work was to prolong the shelf life of peaches at ambient conditions. Initially, the studies were to get a film forming of cassava starch and bee wax with similar properties of commercial waxes. The second pass was apply in the surface of the fruits, commercial wax (" Fruit wax" or film-forming of cassava starch and bee wax. The

  4. The evolution of insecticide resistance in the peach potato aphid, Myzus persicae. (United States)

    Bass, Chris; Puinean, Alin M; Zimmer, Christoph T; Denholm, Ian; Field, Linda M; Foster, Stephen P; Gutbrod, Oliver; Nauen, Ralf; Slater, Russell; Williamson, Martin S


    The peach potato aphid, Myzus persicae is a globally distributed crop pest with a host range of over 400 species including many economically important crop plants. The intensive use of insecticides to control this species over many years has led to populations that are now resistant to several classes of insecticide. Work spanning over 40 years has shown that M. persicae has a remarkable ability to evolve mechanisms that avoid or overcome the toxic effect of insecticides with at least seven independent mechanisms of resistance described in this species to date. The array of novel resistance mechanisms, including several 'first examples', that have evolved in this species represents an important case study for the evolution of insecticide resistance and also rapid adaptive change in insects more generally. In this review we summarise the biochemical and molecular mechanisms underlying resistance in M. persicae and the insights study of this topic has provided on how resistance evolves, the selectivity of insecticides, and the link between resistance and host plant adaptation. Copyright © 2014 The Authors. Published by Elsevier Ltd.. All rights reserved.

  5. Suppression of plant defenses by a Myzus persicae (green peach aphid) salivary effector protein. (United States)

    Elzinga, Dezi A; De Vos, Martin; Jander, Georg


    The complex interactions between aphids and their host plant are species-specific and involve multiple layers of recognition and defense. Aphid salivary proteins, which are released into the plant during phloem feeding, are a likely mediator of these interactions. In an approach to identify aphid effectors that facilitate feeding from host plants, eleven Myzus persicae (green peach aphid) salivary proteins and the GroEL protein of Buchnera aphidicola, a bacterial endosymbiont of this aphid species, were expressed transiently in Nicotiana tabacum (tobacco). Whereas two salivary proteins increased aphid reproduction, expression of three other aphid proteins and GroEL significantly decreased aphid reproduction on N. tabacum. These effects were recapitulated in stable transgenic Arabidopsis thaliana plants. Further experiments with A. thaliana expressing Mp55, a salivary protein that increased aphid reproduction, showed lower accumulation of 4-methoxyindol-3-ylmethylglucosinolate, callose and hydrogen peroxide in response to aphid feeding. Mp55-expressing plants also were more attractive for aphids in choice assays. Silencing Mp55 gene expression in M. persicae using RNA interference approaches reduced aphid reproduction on N. tabacum, A. thaliana, and N. benthamiana. Together, these results demonstrate a role for Mp55, a protein with as-yet-unknown molecular function, in the interaction of M. persicae with its host plants.

  6. Peach is an occasional host for Rhagoletis pomonella (Walsh, 1867) (Diptera: Tephritidae) larvae in Western Washington State, USA (United States)

    Peach, Prunus persica (L.) Batsch (Rosaceae), has been reported to be a host of the apple maggot fly, Rhagoletis pomonella (Walsh), 1867 (Diptera: Tephritidae), an important quarantine pest of apple (Malus domestica Borkhausen) (Rosaceae) in the western U.S.A. However, all reports of peach as a hos...

  7. Cinnamyl alcohol dehydrogenases in the mesocarp of ripening fruit of Prunus persica genotypes with different flesh characteristics: changes in activity and protein and transcript levels. (United States)

    Gabotti, Damiano; Negrini, Noemi; Morgutti, Silvia; Nocito, Fabio F; Cocucci, Maurizio


    Development of fruit flesh texture quality traits may involve the metabolism of phenolic compounds. This study presents molecular and biochemical results on the possible role played by cinnamyl alcohol dehydrogenase (CAD; EC during ripening [S3, S4 I (pre-climacteric) and S4 III (climacteric) stages] of peach [Prunus persica (L.) Batsch] fruit with different flesh firmness [non-melting flesh (NMF) 'Oro A'/melting flesh (MF) 'Springcrest' and 'Sanguinella'] and color (blood-flesh Sanguinella). A total of 24 putative full-length PRUPE_CAD genes were identified (in silico analysis) in the peach genome. The most abundant CAD isoforms, encoded by genes located on scaffolds 8 and 6, were probed by specifically developed anti-PRUPE_CAD sc8 and by anti-FaCAD (PRUPE_CAD sc6) polyclonal antibodies, respectively. PRUPE_CAD sc8 proteins (SDS-PAGE and native-PAGE/western blot) appeared responsible for the CAD activity (in vitro/in-gel assays) that increased with ripening (parallel to PRUPE_ACO1 transcripts accumulation and ethylene evolution) only in the mesocarp of Oro A and blood-flesh Sanguinella. Accumulation of PRUPE_CAD sc8 transcripts (semi-quantitative RT-PCR) occurred in all three cultivars, but in Oro A and Springcrest it was not always accompanied by that of the related proteins, suggesting possible post-transcriptional regulation. Flesh firmness, as well as levels of lignin, total phenolics and, where present (Sanguinella), anthocyanins, declined with ripening, suggesting that, at least in the studied peach cultivars, CAD activity is related to neither lignification nor differences in flesh firmness (NMF/MF). Further studies are necessary to clarify whether the high levels of CAD activity/expression in Sanguinella play a role in determining the characteristics of this blood-flesh fruit. © 2014 Scandinavian Plant Physiology Society.

  8. Growth and Yield of Peaches on Rootstocks of Prunus tomentosa and Prunus persica


    中野, 幹夫; 島村, 和夫


    モモ栽培の省力化を目的に台木及び仕立方を異にした低木・密植栽培を試みた. すなわち,ユスラウメ台を用いた主幹仕立,共台を用いた架線仕立と平行並列仕立である. ユスラウメ台樹の生育は品種及び個体により大きく変異したが,共台に比べ強くわい化した. 収穫期は早く,果実の品質も良かった. 収量はほぼ生育と一致し,品種及び個体により大きく変異したが,生育の良い場合には共台樹より多収であった. したがって,台木の系統選抜などにより健全で均一な生育が得られれば,有望な栽培様式となりえよう. 共台樹では平行並列仕立の方が架線仕立より収量,品質とも優れた. その原因は,平行並列仕立の方が目標樹冠面積が大きく,自由に生長させられたのに対し,架線仕立樹はそれが狭く,しかも,主枝を早くから低く誘引したため,樹勢が強すぎ,徒長的な側枝が多発し,過繁茂となったためであろう。...

  9. Insecticide Resistance Mechanisms in the Green Peach Aphid Myzus persicae (Hemiptera: Aphididae) I: A Transcriptomic Survey (United States)

    Silva, Andrea X.; Jander, Georg; Samaniego, Horacio; Ramsey, John S; Figueroa, Christian C.


    Background Insecticide resistance is one of the best examples of rapid micro-evolution found in nature. Since the development of the first synthetic insecticide in 1939, humans have invested considerable effort to stay ahead of resistance phenotypes that repeatedly develop in insects. Aphids are a group of insects that have become global pests in agriculture and frequently exhibit insecticide resistance. The green peach aphid, Myzus persicae, has developed resistance to at least seventy different synthetic compounds, and different insecticide resistance mechanisms have been reported worldwide. Methodology/Principal Findings To further characterize this resistance, we analyzed genome-wide transcriptional responses in three genotypes of M. persicae, each exhibiting different resistance mechanisms, in response to an anti-cholinesterase insecticide. The sensitive genotype (exhibiting no resistance mechanism) responded to the insecticide by up-regulating 183 genes primarily ones related to energy metabolism, detoxifying enzymes, proteins of extracellular transport, peptidases and cuticular proteins. The second genotype (resistant through a kdr sodium channel mutation), up-regulated 17 genes coding for detoxifying enzymes, peptidase and cuticular proteins. Finally, a multiply resistant genotype (carrying kdr and a modified acetylcholinesterase), up-regulated only 7 genes, appears not to require induced insecticide detoxification, and instead down-regulated many genes. Conclusions/Significance This study suggests strongly that insecticide resistance in M. persicae is more complex that has been described, with the participation of a broad array of resistance mechanisms. The sensitive genotype exhibited the highest transcriptional plasticity, accounting for the wide range of potential adaptations to insecticides that this species can evolve. In contrast, the multiply resistant genotype exhibited a low transcriptional plasticity, even for the expression of genes encoding

  10. Insecticide Resistance Mechanisms in the Green Peach Aphid Myzus persicae (Hemiptera: Aphididae) II: Costs and Benefits (United States)

    Silva, Andrea X.; Bacigalupe, Leonardo D.; Luna-Rudloff, Manuela; Figueroa, Christian C.


    Background Among herbivorous insects that have exploited agro-ecosystems, the peach-potato aphid, Myzus persicae, is recognized as one of the most important agricultural pests worldwide. Uses over 400 plant species and has evolved different insecticides resistance mechanisms. As M. persicae feeds upon a huge diversity of hosts, it has been exposed to a wide variety of plant allelochemicals, which probably have promoted a wide range of detoxification systems. Methodology/Principal Findings In this work we (i) evaluated whether insecticide resistance mutations (IRM) in M. persicae can give an advantage in terms of reproductive fitness when aphids face two hosts, pepper (Capsicum annuum) a suitable host and radish (Raphanus sativus) the unfavorable host and (ii) examined the transcriptional expression of six genes that are known to be up-regulated in response to insecticides. Our results show a significant interaction between host and IRM on the intrinsic rate of increase (rm). Susceptible genotypes (not carrying insensitivity mutations) had a higher rm on pepper, and the transcriptional levels of five genes increased on radish. The rm relationship was reversed on the unfavorable host; genotypes with multiple IRM exhibited higher rm, without altering the transcriptional levels of the studied genes. Genotypes with one IRM kept a similar rm on both hosts, but they increased the transcriptional levels of two genes. Conclusions/Significance Although we have studied only nine genotypes, overall our results are in agreement with the general idea that allelochemical detoxification systems could constitute a pre-adaptation for the development of insecticide resistance. Genotypes carrying IRM exhibited a higher rm than susceptible genotypes on radish, the more unfavorable host. Susceptible genotypes should be able to tolerate the defended host by up-regulating some metabolic genes that are also responding to insecticides. Hence, our results suggest that the trade-off among

  11. Insecticide resistance mechanisms in the green peach aphid Myzus persicae (Hemiptera: Aphididae I: A transcriptomic survey.

    Directory of Open Access Journals (Sweden)

    Andrea X Silva

    Full Text Available BACKGROUND: Insecticide resistance is one of the best examples of rapid micro-evolution found in nature. Since the development of the first synthetic insecticide in 1939, humans have invested considerable effort to stay ahead of resistance phenotypes that repeatedly develop in insects. Aphids are a group of insects that have become global pests in agriculture and frequently exhibit insecticide resistance. The green peach aphid, Myzus persicae, has developed resistance to at least seventy different synthetic compounds, and different insecticide resistance mechanisms have been reported worldwide. METHODOLOGY/PRINCIPAL FINDINGS: To further characterize this resistance, we analyzed genome-wide transcriptional responses in three genotypes of M. persicae, each exhibiting different resistance mechanisms, in response to an anti-cholinesterase insecticide. The sensitive genotype (exhibiting no resistance mechanism responded to the insecticide by up-regulating 183 genes primarily ones related to energy metabolism, detoxifying enzymes, proteins of extracellular transport, peptidases and cuticular proteins. The second genotype (resistant through a kdr sodium channel mutation, up-regulated 17 genes coding for detoxifying enzymes, peptidase and cuticular proteins. Finally, a multiply resistant genotype (carrying kdr and a modified acetylcholinesterase, up-regulated only 7 genes, appears not to require induced insecticide detoxification, and instead down-regulated many genes. CONCLUSIONS/SIGNIFICANCE: This study suggests strongly that insecticide resistance in M. persicae is more complex that has been described, with the participation of a broad array of resistance mechanisms. The sensitive genotype exhibited the highest transcriptional plasticity, accounting for the wide range of potential adaptations to insecticides that this species can evolve. In contrast, the multiply resistant genotype exhibited a low transcriptional plasticity, even for the expression

  12. Blossom thinning in apple and peach with an essential oil (United States)

    A series of experiments were conducted with apple (Malus xdomestica) and peach [Prunus persica (L.) Batsch] from 2003-2008 to evaluate the flower thinning efficacy of eugenol and a eugenol-based essential oil. Flower thinning effects by hand defoliation and alternative chemical agents were compared...

  13. MP-29, a clonal interspecific hybrid rootstock for peach (United States)

    MP-29 rootstock has been jointly released for grower trial by the U.S. Department of Agriculture, Agricultural Research Service (Byron, GA) and Florida Agricultural Experiment Station. MP-29 is suggested for trial as a rootstock for peach (Prunus persica L. Batsch) varieties on Armillaria root rot ...

  14. Increasing chilling reduces heat requirement for floral budbreak in peach (United States)

    Response to chilling temperatures is a critical factor in the suitability of peach [Prunus persica (L.) Batsch] cultivars to moderate climates such as in the southeastern United States. Time of bloom depends on the innate chilling requirement of the cultivar as well as the timing and quantity of co...


    An early-season peach, “Crimson Lady” (Prunus persica (L.) Batsch), is generally harvested in late May to early June in central California. To reduce water use, regulated deficit irrigation may be applied to these trees for the remaining and also most water demanding season (mid June to November). ...

  16. Role of Myzus persicae (Hemiptera: Aphididae) and its secondary hosts in plum pox virus propagation. (United States)

    Manachini, B; Casati, P; Cinanni, L; Bianco, P


    Plum pox virus (family Potyviridae, genus Potyvirus, PPV) is one of the most important viral pathogens of plants in the genus Prunus, particularly Prunus persica L. The role of the Myzus persicae (Sulzer) (Hemiptera: Aphididae) as a vector of PPV-M, and its role in spreading PPV-M, was investigated. PPV-M-infected peach trees were used as inoculum sources, and transmission to 15 herbaceous species commonly present in and around peach orchards was evaluated. The presence of PPV-M in secondary hosts after aphid transmission was verified by reverse transcription-polymerase chain reaction tests. The results indicate that Saponaria ocymoides L., Pisum sativum L., Trifolium repens L., Trifolium pratense L., Lepidium sativum L., Matricaria chamomilla L., Centaurea cyanus L., Bellis perennis L., Papaver rhoeas L., and Zinnia elegans L. became infected. Although Lupinus polyphyllus Lindley, Taraxacum officinale L., Achillea millefolium L., Amaranthus retroflexus L., and Linum rubrum L. did not become infected, they are hosts of M. persicae. Among the 10 positive species that were infected, the species most common in peach orchards, T. pratense, T. repens, B. perennis, and M. chamomilla, were used as source plants for the transmission studies to the peach tree. Our study reveals the ability of M. persicae to transmit PPV-M from herbaceous hosts to peach trees, describes PPV-M symptoms in herbaceous species, and discusses the role of M. persicae and its hosts as a source of PPV-M in peach orchards.

  17. 'Candidatus Phytoplasmas pruni', a novel taxon associated with X-disease of stone fruits, Prunus spp.: multilocus characterization based on 16S rRNA, secY, and ribosomal protein genes (United States)

    X-disease is one of the most serious diseases known in peach (Prunus persica). Based on RFLP analysis of 16S rRNA gene sequences, peach X-disease phytoplasma strains from eastern and western United States and eastern Canada were classified in 16S rDNA RFLP group 16SrIII, subgroup A. Phylogenetic a...

  18. Peaches Preceded Humans: Fossil Evidence from SW China (United States)

    Su, Tao; Wilf, Peter; Huang, Yongjiang; Zhang, Shitao; Zhou, Zhekun


    Peach (Prunus persica, Rosaceae) is an extremely popular tree fruit worldwide, with an annual production near 20 million tons. Peach is widely thought to have origins in China, but its evolutionary history is largely unknown. The oldest evidence for the peach has been Chinese archaeological records dating to 8000-7000 BP. Here, we report eight fossil peach endocarps from late Pliocene strata of Kunming City, Yunnan, southwestern China. The fossils are identical to modern peach endocarps, including size comparable to smaller modern varieties, a single seed, a deep dorsal groove, and presence of deep pits and furrows. These fossils show that China has been a critical region for peach evolution since long before human presence, much less agriculture. Peaches evolved their modern morphology under natural selection, presumably involving large, frugivorous mammals such as primates. Much later, peach size and variety increased through domestication and breeding.

  19. Identification of the Population Structure of Myzus persicae (Hemiptera: Aphididae) on Peach Trees in China Using Microsatellites. (United States)

    Li, Jie; Cao, Jinjun; Niu, Jianqun; Liu, Xiaoxia; Zhang, Qingwen


    In this study, we characterized the genetic structure of Myzus persicae (Sulzer) (Hemiptera: Aphididae) populations in China using microsatellites. We expected that these data will reveal the genetic relationships among various populations of M. persicae and will be of value in the development of better methods for pest control. Four hundred sixty individuals from 23 areas over 13 provinces were collected in the early spring of 2010, all from their primary host, Prunus persicae. The markers analyzed were highly polymorphic, as demonstrated by the expected heterozygosity value (He = 0.861) and the Polymorphism Information Content (PIC = 0.847), which indicated that M. persicae maintains a high level of genetic diversity. Analysis of molecular variance revealed an intermediate level of population differentiation among M. persicae populations (F(ST) = 0.1215). Geographic isolation existed among these populations, and, consequently, the genetic structure of the populations was split into a southern group and a northern group divided by the Yangtse River. © The Author 2015. Published by Oxford University Press on behalf of the Entomological Society of America.

  20. Insecticide resistance mechanisms in the green peach aphid Myzus persicae (Hemiptera: Aphididae II: Costs and benefits.

    Directory of Open Access Journals (Sweden)

    Andrea X Silva

    Full Text Available BACKGROUND: Among herbivorous insects that have exploited agro-ecosystems, the peach-potato aphid, Myzus persicae, is recognized as one of the most important agricultural pests worldwide. Uses over 400 plant species and has evolved different insecticides resistance mechanisms. As M. persicae feeds upon a huge diversity of hosts, it has been exposed to a wide variety of plant allelochemicals, which probably have promoted a wide range of detoxification systems. METHODOLOGY/PRINCIPAL FINDINGS: In this work we (i evaluated whether insecticide resistance mutations (IRM in M. persicae can give an advantage in terms of reproductive fitness when aphids face two hosts, pepper (Capsicum annuum a suitable host and radish (Raphanus sativus the unfavorable host and (ii examined the transcriptional expression of six genes that are known to be up-regulated in response to insecticides. Our results show a significant interaction between host and IRM on the intrinsic rate of increase (r(m. Susceptible genotypes (not carrying insensitivity mutations had a higher r(m on pepper, and the transcriptional levels of five genes increased on radish. The r(m relationship was reversed on the unfavorable host; genotypes with multiple IRM exhibited higher r(m, without altering the transcriptional levels of the studied genes. Genotypes with one IRM kept a similar r(m on both hosts, but they increased the transcriptional levels of two genes. CONCLUSIONS/SIGNIFICANCE: Although we have studied only nine genotypes, overall our results are in agreement with the general idea that allelochemical detoxification systems could constitute a pre-adaptation for the development of insecticide resistance. Genotypes carrying IRM exhibited a higher r(m than susceptible genotypes on radish, the more unfavorable host. Susceptible genotypes should be able to tolerate the defended host by up-regulating some metabolic genes that are also responding to insecticides. Hence, our results suggest that

  1. Prunus persica crop management as step toward AMF diversity conservation for the sustainable soil management (United States)

    Alguacil, M. M.; Torrecillas, E.; Lozano, Z.; Garcia-Orenes, F.; Roldan, A.


    We investigated the diversity of arbuscular mycorrhizal fungi (AMF) in roots of Prunus persica under two fertilization treatments (CF: consisted of application of chicken manure (1400 kg.ha-1), urea (140 kg.ha-1), complex fertilizer 12-12-17/2 (280 kg.ha-1), and potassium sulfate (40 kg.ha-1) and IF: consisted of application of urea (140 kg.ha-1), complex fertilizer 12-12-17/2 (400 kg.ha-1) and potassium sulfate (70 kg.ha-1)) combined with integrated pest management (IM) or chemical pest management (CM), in a tropical agroecosystem in the north of Venezuela. Our goal was to ascertain how different fertilizers/pest management can modify the AMF diversity colonizing P. persica roots as an important step towards sustainable soil use and therefore protection of biodiversity. The AM fungal small-subunit (SSU) rRNA genes were subjected to PCR, cloning, sequencing and phylogenetic analyses. Twenty-one different phylotypes were identified, which were grouped in five families: Glomeraceae, Paraglomeraceae, Acaulosporaceae, Gigasporaceae and Archaeosporaceae. Sixteen of these sequence groups belonged to the genus Glomus, two to Paraglomus, one to Acaulospora, one to Scutellospora and one to Archaeospora. A different distribution of the AMF phylotypes as consequence of the difference between treatments was observed. Thus, the AMF communities of tree roots in the (IF+CM) treatment had the lowest diversity (H'=1.78) with the lowest total number of AMF sequence types (9). The trees from both (CF+IM) and (IF+IM) treatments had similar AMF diversity (H'?2.00); while the treatment (CF+CM) yielded the highest number of different AMF sequence types (17) and showed the highest diversity index (H'=2.69). In conclusion, the crop management including combination of organic and inorganic fertilization and chemical pest control appears to be the most suitable strategy with respect to reactivate the AMF diversity in the roots of this crop and thus, the agricultural and environmental

  2. Seasonal variation of Prunus necrotic ringspot virus concentration in almond, peach, and plum cultivars

    Directory of Open Access Journals (Sweden)

    N. Salem


    Full Text Available Levels of Prunus necrotic ringspot virus (PNRSV infection in almond, peach, and plum cultivars over the course of an entire year were determined by testing different plant parts of naturally infected trees, using the double antibody sandwich-enzyme linked immunosorbent assay (DAS-ELISA. The data showed that spring was the best time of year for PNRSV detection in flowers, active growing buds, and young leaves. PNRSV detection was less reliable during the summer months. Young leaves of all cultivars were the most reliable source for distinguishing between healthy and infected plants, while flowers and buds yielded high values in some cultivars but not in others. Seasonal fluctuations in virus concentration did not follow the same pattern in all cultivars. It is therefore impossible to distinguish between infected and healthy trees on the basis of one single sampling time for all cultivars.

  3. Prunus persica crop management differentially promotes arbuscular mycorrhizal fungi diversity in a tropical agro-ecosystem. (United States)

    Alguacil, Maria del Mar; Torrecillas, Emma; Lozano, Zenaida; Torres, Maria Pilar; Roldán, Antonio


    Due to the important role of arbuscular mycorrhizal fungi (AMF) in ecosystem functioning, determination of the effect of management practices on the AMF diversity in agricultural soils is essential for the sustainability of these agro-ecosystems. The objective of this study was to compare the AMF diversity in Prunus persica roots under two types of fertilisation (inorganic, with or without manure) combined with integrated or chemical pest management in a Venezuelan agro-ecosystem. The AM fungal small-subunit (SSU) rRNA genes were subjected to PCR, cloning, sequencing and phylogenetic analyses. Twenty-one different phylotypes were identified: 15 belonged to the genus Glomus, one to Claroideoglomus, two to Paraglomus, one to Acaulospora, one to Scutellospora and one to Archaeospora. The distribution of the AMF community composition differed as a consequence of the treatment effects. The treatment combining organic and inorganic fertilisation with chemical pest control had the highest AMF richness and the treatment combining inorganic fertilisation with chemical pest had the lowest. The real causes and effects of these differences in the AMF community are very difficult to establish, since the crop management regimes tested were composed of several interacting factors. In conclusion, the crop management practices can exert a significant influence on the populations of AMF. The treatment combining organic and inorganic fertilisation with chemical pest control appears to be the most suitable agricultural management strategy with respect to improving the AMF diversity in this crop under tropical conditions, and thus for maintaining the agricultural and environmental sustainability of this agro-ecosystem.

  4. Polinização entomófila em pessegueiro (Prunus persica L.

    Directory of Open Access Journals (Sweden)

    Manoel Octávio Silveira da Mota


    Full Text Available Este experimento, realizado na região de Jaboticabal (SP, utilizou uma cultura de pêssego (Prunus persica L., durante a sua florada com a finalidade de verificar a atuação dos insetos visitantes nas flores na produção de frutos. A concentração média de açucares no néctar e a quantidade média produzida por dia de néctar é de 27,9% e de 3,2 mg, respectivamente. O peso médio das anteras por flor foi de 1,59 mg. A abelha Apis mellifera (73% foi o principal inseto visitante seguida da Trigona spinipes (17% e Xylocopa sp (4%. Observou-se a presença de beija-flores (6%, coletando néctar. A freqüência máxima das abelhas A. mellifera, para coleta de néctar e pólen, ocorreu as 12 horas. O número de frutos resultantes do tratamento em que as flores recebiam as visitas foi 14% maior que no tratamento em as flores não eram visitadas. Do total de frutos colhidos no tratamento coberto (sem visitas, 82% apresentaram-se perfeitos, com boa formação e simetria. No tratamento descoberto, 90,2% apresentaram-se com boa formação, havendo diferença estatística entre os dois tratamentos.

  5. Carbohydrate metabolism of vegetative and reproductive sinks in the late-maturing peach cultivar 'Encore' (United States)

    Riccardo Lo Bianco; Mark Rieger; Shi-Jean S. Sung


    Activities of NAD+-dependent sorbitol dehydrogenase (SDH), sorbitol oxidase (SOX), sucrose synthase (SS), acid invertase (AI), and neutral invertase (NI) in ?Encore? peach (Prunus persica L.) fruits and developing shoot tips were assayed during the growing season to determine whether carbohydrate metabolizing enzymes could...

  6. Novel peach flower types in a segregating population from ‘Helen Borchers’ (United States)

    Several new peach (Prunus persica) flower types were discovered in an F2 segregating population from an open-pollinated, non-showy-flowered F1 seedling of ‘Helen Borchers’, a double-flowered ornamental cultivar. The novel flower types were white and red single-flowered, non-showy blooms, as well as ...

  7. CBF gene expression in peach leaf and bark tissues is gated by a circadian clock (United States)

    CBF transcription factors are part of the AP2/ERF domain family of DNA-binding proteins that recognize a C-repeat response cis-acting element that regulates a number of cold-responsive genes (CBF-regulon). In peach (Prunus persica), five CBF genes are situated in tandem on scaffold (Linkage Group) ...

  8. Integrated QTL detection for key breeding traits in multiple peach progenies

    NARCIS (Netherlands)

    Hernández Mora, José R.; Micheletti, Diego; Bink, Marco; Weg, Van de Eric; Cantín, Celia; Nazzicari, Nelson; Caprera, Andrea; Dettori, Maria Teresa; Micali, Sabrina; Banchi, Elisa; Campoy, José Antonio; Dirlewanger, Elisabeth; Lambert, Patrick; Pascal, Thierry; Troggio, Michela; Bassi, Daniele; Rossini, Laura; Verde, Ignazio; Quilot-Turion, Bénédicte; Laurens, François; Arús, Pere; Aranzana, Maria José


    Background: Peach (Prunus persica (L.) Batsch) is a major temperate fruit crop with an intense breeding activity. Breeding is facilitated by knowledge of the inheritance of the key traits that are often of a quantitative nature. QTLs have traditionally been studied using the phenotype of a single

  9. Dynamics of concomitant populations of Pratylenchus vulnus and Meloidogyne incognita on peach (United States)

    The interaction between Meloidogyne incognita and Pratylenchus vulnus on nematode reproduction and vegetative growth of Prunus persica ‘Lovell’ peach was studied in field microplots. Pratylenchus vulnus suppressed the population density of M. incognita second-stage juveniles, whereas the presence o...

  10. A functional genomics approach identifies candidate effectors from the aphid species Myzus persicae (green peach aphid.

    Directory of Open Access Journals (Sweden)

    Jorunn I B Bos


    Full Text Available Aphids are amongst the most devastating sap-feeding insects of plants. Like most plant parasites, aphids require intimate associations with their host plants to gain access to nutrients. Aphid feeding induces responses such as clogging of phloem sieve elements and callose formation, which are suppressed by unknown molecules, probably proteins, in aphid saliva. Therefore, it is likely that aphids, like plant pathogens, deliver proteins (effectors inside their hosts to modulate host cell processes, suppress plant defenses, and promote infestation. We exploited publicly available aphid salivary gland expressed sequence tags (ESTs to apply a functional genomics approach for identification of candidate effectors from Myzus persicae (green peach aphid, based on common features of plant pathogen effectors. A total of 48 effector candidates were identified, cloned, and subjected to transient overexpression in Nicotiana benthamiana to assay for elicitation of a phenotype, suppression of the Pathogen-Associated Molecular Pattern (PAMP-mediated oxidative burst, and effects on aphid reproductive performance. We identified one candidate effector, Mp10, which specifically induced chlorosis and local cell death in N. benthamiana and conferred avirulence to recombinant Potato virus X (PVX expressing Mp10, PVX-Mp10, in N. tabacum, indicating that this protein may trigger plant defenses. The ubiquitin-ligase associated protein SGT1 was required for the Mp10-mediated chlorosis response in N. benthamiana. Mp10 also suppressed the oxidative burst induced by flg22, but not by chitin. Aphid fecundity assays revealed that in planta overexpression of Mp10 and Mp42 reduced aphid fecundity, whereas another effector candidate, MpC002, enhanced aphid fecundity. Thus, these results suggest that, although Mp10 suppresses flg22-triggered immunity, it triggers a defense response, resulting in an overall decrease in aphid performance in the fecundity assays. Overall, we


    Directory of Open Access Journals (Sweden)

    Enrique Quevedo García


    Full Text Available Abstract. A study was conducted to determine the variables that estimated the leaf limbo area and the leaf limbo dry weight of peach Prunus persica (L. Batsch cv. Jarillo. Fifty leaves, aged 2.5 months, were selected and measured: leaf limbo length and width, petiole length, leaf length, petiole diameter, leaf limbo fresh weight, petiole fresh weight, leaf fresh weight, leaf limbo dry weight, petiole dry weight, leaf dry weight, length/width limbo, petiole length/limbo length and leaf limbo area. The results allowed to obtain regression equations for estimating the leaf area and the limbo dry weight. Using the lineal models LA = b1 + b2 (LLL x LLW and LA= b1+ b2LLL + b3LLW a leaf area equation was determined. Alternative models to calculate limbo dry weight were evaluated LLDW = -b1+ b2 LLFW and LLDW= - b1 + b2LLL + b3PL. The best equations found with an R2 of 0.99 were LA = 1.572 + 0.65169(LLL x LLW, LA=-23.106+2.8064LLW + 3.6761LLL and LLDW = -0.002+0.401(LLFW.Resumen. Se realizó un estudio para determinar las variables que estimaran el área del limbo foliar y el peso seco del limbo de durazno Prunus persica (L. Batsch cv. Jarillo. Se seleccionaron cincuenta hojas con 2,5 meses de edad, fueron medidos: ancho del limbo, longitud del limbo, longitud del peciolo, longitud hoja, diámetro peciolo, peso fresco del limbo, peso fresco del peciolo, peso fresco de la hoja, peso seco del limbo, peso seco peciolo, peso seco de la hoja, longitud /ancho limbo, longitud del peciolo/longitud del limbo, área foliar del limbo. Los resultados alcanzados permitieron obtener ecuaciones de regresión para estimar el área foliar del limbo y el peso seco del limbo. Se halló una ecuación para la determinación del área foliar del limbo con los modelos lineales LA = b1 + b2 (LLL x LLW y LA= b1 + b2LLL + b3LLW. También se evaluaron modelos alternativas para calcular el peso seco del limbo, LLDW = -b1+ b2LLFW y LLDW= - b1 + b2LLL + b3PL. Las mejores ecuaciones

  12. Genome-Wide Analysis Suggests the Relaxed Purifying Selection Affect the Evolution of WOX Genes in Pyrus bretschneideri, Prunus persica, Prunus mume, and Fragaria vesca. (United States)

    Cao, Yunpeng; Han, Yahui; Meng, Dandan; Li, Guohui; Li, Dahui; Abdullah, Muhammad; Jin, Qing; Lin, Yi; Cai, Yongping


    WUSCHEL-related homeobox (WOX) family is one of the largest group of transcription factors (TFs) specifically found in plant kingdom. WOX TFs play an important role in plant development processes and evolutionary novelties. Although the roles of WOXs in Arabidopsis and rice have been well-studied, however, little are known about the relationships among the main clades in the molecular evolution of these genes in Rosaceae. Here, we carried out a genome-wide analysis and identified 14, 10, 10, and 9 of WOX genes from four Rosaceae species (Fragaria vesca, Prunus persica, Prunus mume, and Pyrus bretschneideri, respectively). According to evolutionary analysis, as well as amino acid sequences of their homodomains, these genes were divided into three clades with nine subgroups. Furthermore, due to the conserved structural patterns among these WOX genes, it was proposed that there should exist some highly conserved regions of microsynteny in the four Rosaceae species. Moreover, most of WOX gene pairs were presented with the conserved orientation among syntenic genome regions. In addition, according to substitution models analysis using PMAL software, no significant positive selection was detected, but type I functional divergence was identified among certain amino acids in WOX protein. These results revealed that the relaxed purifying selection might be the main driving force during the evolution of WOX genes in the tested Rosaceae species. Our result will be useful for further precise research on evolution of the WOX genes in family Rosaceae.

  13. Genome-Wide Analysis Suggests the Relaxed Purifying Selection Affect the Evolution of WOX Genes in Pyrus bretschneideri, Prunus persica, Prunus mume, and Fragaria vesca

    Directory of Open Access Journals (Sweden)

    Yunpeng Cao


    Full Text Available WUSCHEL-related homeobox (WOX family is one of the largest group of transcription factors (TFs specifically found in plant kingdom. WOX TFs play an important role in plant development processes and evolutionary novelties. Although the roles of WOXs in Arabidopsis and rice have been well-studied, however, little are known about the relationships among the main clades in the molecular evolution of these genes in Rosaceae. Here, we carried out a genome-wide analysis and identified 14, 10, 10, and 9 of WOX genes from four Rosaceae species (Fragaria vesca, Prunus persica, Prunus mume, and Pyrus bretschneideri, respectively. According to evolutionary analysis, as well as amino acid sequences of their homodomains, these genes were divided into three clades with nine subgroups. Furthermore, due to the conserved structural patterns among these WOX genes, it was proposed that there should exist some highly conserved regions of microsynteny in the four Rosaceae species. Moreover, most of WOX gene pairs were presented with the conserved orientation among syntenic genome regions. In addition, according to substitution models analysis using PMAL software, no significant positive selection was detected, but type I functional divergence was identified among certain amino acids in WOX protein. These results revealed that the relaxed purifying selection might be the main driving force during the evolution of WOX genes in the tested Rosaceae species. Our result will be useful for further precise research on evolution of the WOX genes in family Rosaceae.

  14. Toxicity of newly isolated piperideine alkaloids from the red imported fire ant, Solenopsis invicta Buren, against the green peach aphid, Myzus persicae (Sulzer) (United States)

    The green peach aphid, Myzus persicae (Sulzer), is a major insect pest of many agronomic and horticultural crops and is distributed worldwide Aphid management is often based on application of insecticides. However, the aphid is now resistant to many of these and much interest has recently develope...

  15. Molecular cloning, characterisation and mRNA expression of the ryanodine receptor from the peach-potato aphid, Myzus persicae. (United States)

    Troczka, B J; Williams, A J; Bass, C; Williamson, M S; Field, L M; Davies, T G E


    The peach potato aphid, Myzus persicae, is one of the most important agricultural pests of temperate climates. It is mainly controlled through the judicious application of insecticides; however, over time, aphids have developed resistance to many insecticidal classes. The recent introduction of synthetic diamide insecticides, with a novel mode of action, potentially offers new tools to control aphid populations. These diamides act on the ryanodine receptor (RyR), a large endoplasmic calcium release channel. In this study we have cloned cDNAs encoding the complete open reading frame of the RyR from M. persicae. The open reading frame is 15,306 base pairs long and encodes a protein of 5101 amino acids. The aphid RyR shares many of the features of other insect and vertebrate RyRs, including a highly conserved transmembrane region. However, unlike the other RyRs characterised to date, the M. persicae channel does not display alternative splicing at any stage of its developmental cycle, so it cannot generate functional variants of the channel. Copyright © 2014. Published by Elsevier B.V.

  16. Leaf N and P in different growth habits of peach: effects of root system morphology and transpiration (United States)

    Adequate mineral nutrition is critical for high fruit quality and sustained yield of fruit trees. In this experiment, peach [Prunus persica L. (Batch)] trees with different shoot and root growth habits were evaluated for leaf nitrogen (N) and phosphorus (P) concentrations after fertilizer applicati...

  17. Constitutive expression of a peach AP2/ERF transcription factor in apple confers short day cessation of growth (United States)

    Cold acclimation and dormancy in Prunus persica (peach) are regulated by both photoperiod and temperature, whereas in Malus x domestica (apple), they are regulated solely by temperature. To understand the process of cold acclimation and dormancy regulation in fruit crops, we have begun a functional...

  18. Towards further understanding on the antioxidative activities of Prunus persica fruit: A comparative study with four different fractions (United States)

    Dhingra, Naveen; Sharma, Rajesh; Kar, Anand


    In the present study we have evaluated the antioxidant activities of different fractions (hexane, ethyl acetate, n-butanol and aqueous fractions) of Prunus persica fruit. For extraction simple warring blender method was employed and total phenolic and flavonoid contents were correlated with different antioxidant activities (total antioxidant, 2,2-diphenyl-1-picrylhydrazyl (DPPH), H2O2 scavenging, superoxide radical scavenging, iron chelating and their reducing power properties). Different in vitro antioxidant studies showed that ethyl acetate and n-butanol fractions had the maximum activities that were well correlated with total phenolic and flavonoid contents. Maximum yield (25.14 ± 2.2%) was obtained in its aqueous fraction. Both ethyl acetate and n-butanol fractions showed significant inhibitory effects on different antioxidant activities. A significantly high correlation coefficient existed between total antioxidant activities and with total phenolic as well as total flavonoid contents. It appears that ethyl acetate and n-butanol fractions of P. persica may serve as new potential sources of natural antioxidants and could be of therapeutic use in treating several diseases.

  19. Genome-Wide Transcriptional Profile Analysis of Prunus persica in Response to Low Sink Demand after Fruit Removal. (United States)

    Duan, Wei; Xu, Hongguo; Liu, Guotian; Fan, Peige; Liang, Zhenchang; Li, Shaohua


    Prunus persica fruits were removed from 1-year-old shoots to analysis photosynthesis, chlorophyll fluorescence and genes changes in leaves to low sink demand caused by fruit removal (-fruit) during the final stage of rapid fruit growth. A decline in net photosynthesis rate was observed, accompanied with a decrease in stomatal conductance. The intercellular CO2 concentrations and leaf temperature increased as compared with a normal fruit load (+fruit). Moreover, low sink demand significantly inhibited the donor side and the reaction center of photosystem II. 382 genes in leaf with an absolute fold change ≥1 change in expression level, representing 116 up- and 266 down-regulated genes except for unknown transcripts. Among these, 25 genes for photosynthesis were down-regulated, 69 stress and 19 redox related genes up-regulated under the low sink demand. These studies revealed high leaf temperature may result in a decline of net photosynthesis rate through down-regulation in photosynthetic related genes and up-regulation in redox and stress related genes, especially heat shock proteins genes. The complex changes in genes at the transcriptional level under low sink demand provided useful starting points for in-depth analyses of source-sink relationship in P. persica.

  20. Carbohydrate metabolism changes in Prunus persica gummosis infected with Lasiodiplodia theobromae. (United States)

    Li, Z; Gao, L; Wang, Y T; Zhu, W; Ye, J L; Li, G H


    Peach gummosis represents a significant global disease of stone fruit trees and a major disease in the south peach production area of the Yangtze River of China. In this study, the carbohydrate composition of peach shoots during infection by Lasiodiplodia theobromae was examined. The expression of genes related to metabolic enzymes was also investigated. Control wounded and noninoculated tissue, lesion tissue, and wounded and inoculated surrounding lesion tissue of peach shoots were analyzed. Soluble sugars, glucose, mannose, arabinose, and xylose significantly increased in inoculated tissues of peach shoots compared with control tissues at different times after inoculation. Accumulation of polysaccharides was also observed by section observation and periodic acid Schiff's reagent staining during infection. Analysis using quantitative reverse-transcription polymerase chain reaction revealed that the abundance of key transcripts on the synthesis pathway of uridine diphosphate (UDP)-D-glucuronate, UDP-D-galactose, and UDP-D-arabinose increased but the synthesis of L-galactose and guanosine diphosphate-L-galactose were inhibited. After inoculation, the transcript levels of sugar transport-related genes (namely, SUT, SOT, GMT, and UGT) was induced. These changes in sugar content and gene expression were directly associated with peach gum polysaccharide formation and may be responsible for the symptoms of peach gummosis.

  1. Structure–property characterization of the crinkle-leaf peach wood phenotype: a future model system for wood properties research? (United States)

    Alex C. Wiedenhoeft; Rafael Arévalo; Craig Ledbetter; Joseph E. Jakes


    Nearly 400 million years of evolution and field-testing by the natural world has given humans thousands of wood types, each with unique structure– property relationships to study, exploit, and ideally, to manipulate, but the slow growth of trees makes them a recalcitrant experimental system. Variations in wood features of two genotypes of peach (Prunus persica L.)...

  2. QTL mapping and breeding value estimation through pedigree-based analysis of fruit size and weight in four diverse peach breeding programs

    NARCIS (Netherlands)

    Fresnedo-Ramírez, Jonathan; Frett, Terrence J.; Sandefur, Paul J.; Bink, Marco C.A.M.; Weg, van de Eric


    The narrow genetic base of peach (Prunus persica L. Batsch) challenges efforts to accurately dissect the genetic architecture of complex traits. Standardized phenotypic assessment of pedigree-linked breeding germplasm and new molecular strategies and analytical approaches developed and conducted

  3. Resistance of Arabidopsis thaliana to the green peach aphid, Myzus persicae, involves camalexin and is regulated by microRNAs (United States)

    Kettles, Graeme J; Drurey, Claire; Schoonbeek, Henk-jan; Maule, Andy J; Hogenhout, Saskia A


    Small RNAs play important roles in resistance to plant viruses and the complex responses against pathogens and leaf-chewing insects. We investigated whether small RNA pathways are involved in Arabidopsis resistance against a phloem-feeding insect, the green peach aphid (Myzus persicae). We used a 2-wk fecundity assay to assess aphid performance on Arabidopsis RNA silencing and defence pathway mutants. Quantitative real-time polymerase chain reaction was used to monitor the transcriptional activity of defence-related genes in plants of varying aphid susceptibility. High-performance liquid chromatography-mass spectrometry was employed to measure the accumulation of the antimicrobial compound camalexin. Artificial diet assays allowed the assessment of the effect of camalexin on aphid performance. Myzus persicae produces significantly less progeny on Arabidopsis microRNA (miRNA) pathway mutants. Plants unable to process miRNAs respond to aphid infestation with increased induction of PHYTOALEXIN DEFICIENT3 (PAD3) and production of camalexin. Aphids ingest camalexin when feeding on Arabidopsis and are more successful on pad3 and cyp79b2/cyp79b3 mutants defective in camalexin production. Aphids produce less progeny on artificial diets containing camalexin. Our data indicate that camalexin functions beyond antimicrobial defence to also include hemipteran insects. This work also highlights the extensive role of the miRNA-mediated regulation of secondary metabolic defence pathways with relevance to resistance against a hemipteran pest. PMID:23528052

  4. Resistance of Arabidopsis thaliana to the green peach aphid, Myzus persicae, involves camalexin and is regulated by microRNAs. (United States)

    Kettles, Graeme J; Drurey, Claire; Schoonbeek, Henk-jan; Maule, Andy J; Hogenhout, Saskia A


    · Small RNAs play important roles in resistance to plant viruses and the complex responses against pathogens and leaf-chewing insects. · We investigated whether small RNA pathways are involved in Arabidopsis resistance against a phloem-feeding insect, the green peach aphid (Myzus persicae). We used a 2-wk fecundity assay to assess aphid performance on Arabidopsis RNA silencing and defence pathway mutants. Quantitative real-time polymerase chain reaction was used to monitor the transcriptional activity of defence-related genes in plants of varying aphid susceptibility. High-performance liquid chromatography-mass spectrometry was employed to measure the accumulation of the antimicrobial compound camalexin. Artificial diet assays allowed the assessment of the effect of camalexin on aphid performance. · Myzus persicae produces significantly less progeny on Arabidopsis microRNA (miRNA) pathway mutants. Plants unable to process miRNAs respond to aphid infestation with increased induction of PHYTOALEXIN DEFICIENT3 (PAD3) and production of camalexin. Aphids ingest camalexin when feeding on Arabidopsis and are more successful on pad3 and cyp79b2/cyp79b3 mutants defective in camalexin production. Aphids produce less progeny on artificial diets containing camalexin. · Our data indicate that camalexin functions beyond antimicrobial defence to also include hemipteran insects. This work also highlights the extensive role of the miRNA-mediated regulation of secondary metabolic defence pathways with relevance to resistance against a hemipteran pest. © 2013 The Authors. New Phytologist © 2013 New Phytologist Trust.

  5. Clonal turnover of MACE-carrying peach-potato aphids (Myzus persicae (Sulzer), Homoptera: Aphididae) colonizing Scotland. (United States)

    Kasprowicz, L; Malloch, G; Foster, S; Pickup, J; Zhan, J; Fenton, B


    Peach-potato aphids, Myzus persicae (Sulzer), collected in Scotland in the years 1995 and 2002-2004 were characterized using four microsatellite loci and three insecticide resistance mechanisms. From 868 samples, 14 multilocus genotypes were defined (designated clones A-N). Five of these (denoted A, B, H, M and N) carried modified acetylcholinesterase (MACE) resistance, the most recent resistance mechanism to have evolved in M. persicae. The current paper shows that the continued presence of MACE aphids is due to turnover, as clones A and B were replaced in field samples by clones H, M and N in later seasons. Thus, insecticide-resistant populations in Scotland can be attributed to multiple waves of rapid clone colonisations and not to the continued presence of stable resistant clones or mutation or sexual recombination in local populations. The MACE clones carried varying levels of the other insecticide resistance mechanisms, kdr and esterase. The presence of these mechanisms could alter the clones success in the field depending on insecticide spraying (positive selection) and resistance fitness costs (negative selection).

  6. Comparative analysis of genome sequences from four strains of the Buchnera aphidicola Mp endosymbion of the green peach aphid, Myzus persicae. (United States)

    Jiang, Zhijie; Jones, Derek H; Khuri, Sawsan; Tsinoremas, Nicholas F; Wyss, Tania; Jander, Georg; Wilson, Alex C C


    Myzus persicae, the green peach aphid, is a polyphagous herbivore that feeds from hundreds of species of mostly dicot crop plants. Like other phloem-feeding aphids, M. persicae rely on the endosymbiotic bacterium, Buchnera aphidicola (Buchnera Mp), for biosynthesis of essential amino acids and other nutrients that are not sufficiently abundant in their phloem sap diet. Tobacco-specialized M. persicae are typically red and somewhat distinct from other lineages of this species. To determine whether the endosymbiotic bacteria of M. persicae could play a role in tobacco adaptation, we sequenced the Buchnera Mp genomes from two tobacco-adapted and two non-tobacco M. persicae lineages. With a genome size of 643.5 kb and 579 predicted genes, Buchnera Mp is the largest Buchnera genome sequenced to date. No differences in gene content were found between the four sequenced Buchnera Mp strains. Compared to Buchnera APS from the well-studied pea aphid, Acyrthosiphon pisum, Buchnera Mp has 21 additional genes. These include genes encoding five enzymes required for biosynthesis of the modified nucleoside queosine, the heme pathway enzyme uroporphyrinogen III synthase, and asparaginase. Asparaginase, which is also encoded by the genome of the aphid host, may allow Buchnera Mp to synthesize essential amino acids from asparagine, a relatively abundant phloem amino acid. Together our results indicate that the obligate intracellular symbiont Buchnera aphidicola does not contribute to the adaptation of Myzus persicae to feeding on tobacco.

  7. Evaluation of the reference genes for expression analysis using quantitative real-time polymerase chain reaction in the green peach aphid, Myzus persicae. (United States)

    Kang, Zhi-Wei; Liu, Fang-Hua; Tian, Hong-Gang; Zhang, Meng; Guo, Shan-Shan; Liu, Tong-Xian


    The green peach aphid, Myzus persicae Sulzer (Hemiptera, Aphididae), is an important cosmopolitan pest. Real time qRT-PCR has been used for target gene expression analysis on M. persicae. Using real time qRT-PCR, the expression levels are normalized on the basis of the reliable reference genes. However, to date, the stability of available reference genes has been insufficient. In this study, we evaluated nine candidate reference genes from M. persicae under diverse experimental conditions. The tested candidate genes were comprehensively ranked based on five alternative methods (RefFinder, geNorm, Normfinder, BestKeeper and the comparative ΔC t method). 18s, Actin and ribosomal protein L27 (L27) were recommended as the most stable reference genes for M. persicae, whereas ribosomal protein L27 (L27) was found to be the least stable reference genes for abiotic studies (photoperiod, temperature and insecticide susceptibility). Our finding not only sheds light on establishing an accurate and reliable normalization of real time qRT-PCR data in M. persicae but also lays a solid foundation for further studies of M. persicae involving RNA interference and functional gene research. © 2016 Institute of Zoology, Chinese Academy of Sciences.

  8. The molecular basis for tree growth habit in Prunus persica (peach) (United States)

    The large size and spreading growth habit of trees requires excessive labor, land space, and pesticides. Genetically improving tree shapes so they can be planted at higher density and/or more readily adapted to mechanization would increase productivity and be more environmentally friendly. Current...

  9. Green synthesis of nitrogen-doped graphitic carbon sheets with use of Prunus persica for supercapacitor applications (United States)

    Atchudan, Raji; Edison, Thomas Nesakumar Jebakumar Immanuel; Perumal, Suguna; Lee, Yong Rok


    Nitrogen-doped graphitic carbon sheets (N-GCSs) were prepared from the extract of unripe Prunus persica fruit by a direct hydrothermal method. The synthesized N-GCSs were examined by high resolution transmission electron microscopy (HRTEM), nitrogen adsorption-desorption isotherms, X-ray diffraction (XRD), Raman spectroscopy, X-ray photoelectron spectroscopy (XPS), and Fourier transform infrared (FT-IR) spectroscopy. HRTEM showed that the synthesized carbon sheets were graphitic with lattice fringes and an inter-layer distance of 0.36 nm. Doping with the nitrogen moiety present over the synthesized GCSs was confirmed by XPS, FT-IR spectroscopy, and energy dispersive X-ray spectroscopy elemental mapping. The fruit extract associated with hydrothermal-carbonization method is economical and eco-friendly with a single step process. The resulting carbon sheets could be modified and are promising candidates for nano-electronic applications, including supercapacitors. The synthesized N-GCSs-2 provided a high specific capacitance of 176 F g-1 at a current density of 0.1 A g-1. This electrode material has excellent cyclic stability, even after 2000 cycles of charge-discharge at a current density of 0.5 A g-1.

  10. Chemometric evaluation of trace metals in Prunus persica L. Batech and Malus domestica from Minićevo (Serbia). (United States)

    Alagić, Slađana Č; Tošić, Snežana B; Dimitrijević, Mile D; Petrović, Jelena V; Medić, Dragana V


    The samples of spatial soils and different organs of Prunus persica L. Batech and Malus domestica were analyzed by methods such as inductively coupled plasma optical emission spectroscopy (ICP-OES), Hierarchical Cluster Analysis (HCA), One-way ANOVA, and calculation of biological accumulation factors (BAFs) with the aim of investigating whether these methods may help in the evaluation of trace metals in plants, as well as in the estimation of plant bioaccumulation potentials. ICP-OES provided accurate data on present concentrations of Cu, Zn, Pb, As, Cd, and Ni which showed that most concentrations were in normal ranges, except in some cases for Cu, Zn, and As. HCA illustrated nicely various specifics in the distribution of metals in both investigated systems plant-soil. One-way ANOVA pointed successfully on the existing statistical differences between metal concentrations. Calculated BAFs showed that both plants had very low accumulation rates for all elements; they acted as metal excluders. Copyright © 2016 Elsevier Ltd. All rights reserved.

  11. Anti-allergic inflammatory activity of the fruit of Prunus persica: role of calcium and NF-kappaB. (United States)

    Shin, Tae-Yong; Park, Seung-Bin; Yoo, Jin-Su; Kim, In Kyeom; Lee, Hyun-Shik; Kwon, Taeg Kyu; Kim, Moon Kyu; Kim, Jung Chul; Kim, Sang-Hyun


    Mast cell-mediated allergic symptoms are involved in many diseases, such as asthma and sinusitis. In this study, we investigated the effect of ethanol extract of fruits of Prunus persica (L) Batsch (FPP) on the mast cell-mediated allergic inflammation and studied the possible mechanism of action. FPP dose-dependently inhibited compound 48/80-induced systemic anaphylaxis and immunoglobulin E-mediated local allergic reactions. Histamine releasing from mast cells was reduced by FPP, which was mediated by modulation of intracellular calcium. In addition, FPP attenuated the phorbol 12-myristate 13-acetate and calcium ionophore A23187 (PMACI)-stimulated expression and secretion of pro-inflammatory cytokines in human mast cells. The inhibitory effect of FPP on pro-inflammatory cytokines was nuclear factor (NF)-kappaB dependent. Our findings provide evidence that FPP inhibits mast cell-derived allergic inflammation and involvement of calcium and NF-kappaB in these effects. Copyright (c) 2010 Elsevier Ltd. All rights reserved.

  12. The green peach aphid Myzus persicae perform better on pre-infested Chinese cabbage Brassica pekinensis by enhancing host plant nutritional quality. (United States)

    Cao, He-He; Liu, Hui-Ru; Zhang, Zhan-Feng; Liu, Tong-Xian


    The green peach aphid, Myzus persicae Sulzer, is a notorious pest on vegetables, which often aggregates in high densities on crop leaves. In this study, we investigated whether M. persicae could suppress the resistance level of Chinese cabbage Brassica pekinensis. M. persicae performed better in terms of weight gain (~33% increase) and population growth (~110% increase) when feeding on previously infested (pre-infested) Chinese cabbage compared with those on non-infested plants. However, when given a choice, 64% of the aphids preferred to settle on non-infested leaves, while 29% of aphids chose pre-infested leaves that had a 2.9 times higher concentration of glucosinolates. Aphid feeding significantly enhanced the amino acid:sugar ratio of phloem sap and the absolute amino acid concentration in plant leaves. Aphid infestation significantly increased the expression levels of salicylic acid (SA) marker genes, while it had marginal effects on the expression of jasmonate marker genes. Exogenously applied SA or methyl jasmonate had no significant effects on M. persicae performance, although these chemicals increased glucosinolates concentration in plant leaves. M. persicae infestation increase amino acid:sugar ratio and activate plant defenses, but aphid performed better on pre-infested plants, suggesting that both nutrition and toxics should be considered in insect-plant interaction.

  13. Consumer peach preferences and purchasing behavior: a mixed methods study. (United States)

    Kelley, Kathleen M; Primrose, Rachel; Crassweller, Robert; Hayes, John E; Marini, Richard


    Peaches (Prunus persica (L.) Stokes) are grown in several regions throughout the USA, are eaten fresh, and used as ingredients in value-added processed products. An Internet survey was conducted to investigate Mid-Atlantic consumers' fresh and processed peach purchasing behaviors, and whether packaging certain numbers of peaches together, providing information about nutritional content, and other factors would increase purchases. Additionally, laboratory-based sensory testing was used to better understand peel color, texture, sweetness, sourness, and flavor preferences for cultivars commonly grown in the Mid-Atlantic region. Irrespective of fresh peach consumption frequency, certain value-added products were of interest. For some products, interest in purchasing was higher than reported purchasing behavior. Preference for certain fresh peach characteristics, such as peel color, differed between less frequent fresh peach consumers and those who consumed fresh peaches more often. Of the four peach cultivars included in the sensory test, most were liked; however, there were some cultivar differences pertaining to color, texture, sweetness, tartness, and flavor liking. Potential marketing strategies can be developed based on frequency of fresh peach consumption and household demographics. Data can be used to select peaches that best appeal to consumers. © 2015 Society of Chemical Industry. © 2015 Society of Chemical Industry.

  14. Discovery of metabolic resistance to neonicotinoids in green peach aphids (Myzus persicae) in Australia. (United States)

    de Little, Siobhan C; Edwards, Owain; van Rooyen, Anthony R; Weeks, Andrew; Umina, Paul A


    Myzus persicae is a serious pest that attacks a broad range of agricultural crops. This species has developed chemical resistance to many insecticides globally, and within Australia resistance to multiple chemical groups has been identified. Resistance to neonicotinoid insecticides has been discovered in several countries, but has not previously been confirmed in Australia. We use biomolecular assays and bioassays on field-collected populations to investigate neonicotinoid resistance in M. persicae within Australia. Several geographically and genetically distinct populations showed evidence for resistance in bioassays. Genetic markers identified that the mechanism of neonicotinoid resistance in Australia is metabolic resistance through the enhanced expression of a cytochrome P450 gene, CYP6CY3. M. persicae populations in parts of Australia are now resistant to four different insecticide chemical groups, raising concerns about the long-term management of this pest. While higher copy numbers of CYP6CY3 were seen in all resistant populations, the number of gene copies was not strongly correlated with the level of resistance as determined by LD 50 values generated through bioassays. This finding sheds further light on the complexity of the P450 genes in regulating neonicotinoid resistance. © 2016 Society of Chemical Industry. © 2016 Society of Chemical Industry.

  15. Evaluación productiva, económica y social del agua de riego de durazno (Prunus persica L. Batsch) en Zacatecas (México)


    José Luis Ríos-Flores; Miriam Torres-Moreno; José Ruiz-Torres; Marco Antonio Torres-Moreno; Jesús Enrique Cantú-Brito


    La escasez de agua limita la agricultura, por lo que su uso debe ser más eficiente en la producción de alimentos. El objetivo de este trabajo fue determinar la productividad económica, física y social del agua del cultivo de durazno (Prunus persica L. Batsch), en la región del Distrito de Desarrollo Rural 183 —correspondiente a Fresnillo, Zacatecas— para el ciclo 2012; se desarrollaron modelos matemáticos para estimar la productividad y eficiencia del agua. En Zacatecas se cosecharon 817 ha d...

  16. Evaluation of Antioxidant Compounds and Total Sugar Content in a Nectarine [Prunus persica (L. Batsch] Progeny

    Directory of Open Access Journals (Sweden)

    Yolanda Gogorcena


    Full Text Available Epidemiological studies suggest that consumption of fruit rich in phenolic compounds is associated with health-protective effects due to their antioxidant properties. For these reasons quality evaluation has become an important issue in fruit industry and in breeding programs. Phytochemical traits such as total phenolics, flavonoids, anthocyanins, L-ascorbic acid, sugar content and relative antioxidant capacity (RAC were analyzed over four years in flesh fruit of an F1 population “Venus” × “Big Top” nectarines. Other traits such as harvesting date, yield, fruit weight, firmness, soluble solids concentration (SSC, pH, titratable acidity (TA and ripening index (RI were also determined in the progeny. Results showed high variability among genotypes for all analyzed traits. Total phenolics and flavonoids showed significant positive correlations with RAC implying that both are important antioxidant bioactive compounds in peaches. We found genotypes with enhanced antioxidant capacity and a better performance than progenitors, and in consequence the best marketability.

  17. Evaluation of antioxidant compounds and total sugar content in a nectarine [Prunus persica (L.) Batsch] progeny. (United States)

    Abidi, Walid; Jiménez, Sergio; Moreno, María Ángeles; Gogorcena, Yolanda


    Epidemiological studies suggest that consumption of fruit rich in phenolic compounds is associated with health-protective effects due to their antioxidant properties. For these reasons quality evaluation has become an important issue in fruit industry and in breeding programs. Phytochemical traits such as total phenolics, flavonoids, anthocyanins, L-ascorbic acid, sugar content and relative antioxidant capacity (RAC) were analyzed over four years in flesh fruit of an F1 population "Venus" × "Big Top" nectarines. Other traits such as harvesting date, yield, fruit weight, firmness, soluble solids concentration (SSC), pH, titratable acidity (TA) and ripening index (RI) were also determined in the progeny. Results showed high variability among genotypes for all analyzed traits. Total phenolics and flavonoids showed significant positive correlations with RAC implying that both are important antioxidant bioactive compounds in peaches. We found genotypes with enhanced antioxidant capacity and a better performance than progenitors, and in consequence the best marketability.

  18. Effect of Water Deficit Stress on Peach Growth under Commercial Orchard Management Conditions


    Rahmati, M; Gh. Davarynejad; M. Bannayan Awal; Azizi, M


    In order to study the sensitivity of vegetative growth to water deficit stress of a late-maturing peach (Prunus persica L. cv. Elberta) under orchard conditions, an experiment was conducted as randomized complete-block design with three treatments and four repetitions in Shahdiran commercial orchard in Mashhad during 2011. Three irrigation treatments including 360 (low stress), 180 (moderate stress) and 90 (severe stress) m3ha-1week-1 using a drip irrigation system (minimum stem water potenti...

  19. Prunus rootstocks influence stem water potential, C/N ratio and shoot ash content in peach (United States)

    Many peach rootstocks have been released in recent years with limited information about their physiological effects on scion vigor and productivity. In this study, two trials were established with ‘Redhaven’ on 9 (planted 2006) and 18 (planted 2009) rootstock cultivars at the Musser Fruit Research ...

  20. Incidence and phylogenetic analyses of Armillaria spp. associated with root disease in peach orchards in the State of Mexico, Mexico (United States)

    R. D. Elias-Roman; R. A. Guzman-Plazola; N. B. Klopfenstein; D. Alvarado-Rosales; G. Calderon-Zavala; J. A. Mora-Aguilera; M.-S. Kim; R. Garcia-Espinosa


    Incidence of peach [Prunus persica (L.) Batsch] tree mortality attributed to Armillaria root disease was assessed from 2009 to 2011 in 15 orchards in the State of Mexico, Mexico. Incidence increased gradually every year of assessment, reaching average values of 9.7, 15.3 and 20.3% tree mortality and 23.2, 24.7 and 28.3% disease-impacted area of the orchards during 2009...

  1. Effects of Fe-chlorosis on the stomatal behaviour and water relations of field-grown peach leaves


    Eichert, Thomas; Peguero-Pina, Jose J.; Gil-Pelegrin, Eustaquio; Fernández, Victoria


    We investigated the effects of Fe nutrition on the stomatal behaviour and water relations of peach leaves (Prunus persica (L.) Batsch, cv. Miraflores), under field conditions. Transpiration rates, net photosynthesis and water use efficiency were significantly lower in chlorotic leaves than in healthy green leaves. In the course of the day, the water potentials in healthy leaves strongly declined to –2.0 MPa, whereas in chlorotic leaves the minimum water potential was only -1.0 MPa. The hydrau...

  2. Rice-straw mulch reduces the green peach aphid, Myzus persicae (Hemiptera: Aphididae) populations on kale, Brassica oleracea var. acephala (Brassicaceae) plants. (United States)

    Silva-Filho, Reinildes; Santos, Ricardo Henrique Silva; Tavares, Wagner de Souza; Leite, Germano Leão Demolin; Wilcken, Carlos Frederico; Serrão, José Eduardo; Zanuncio, José Cola


    Organic mulches, like peel and rice-straw, besides other materials affect the UV and temperature, which cause a reduction in the aphid arrival. The aim was to evaluate the effect of covering the soil with straw on the populations of the green peach aphid, Myzus persicae on the kale, Brassica oleracea var. acephala plants. The first experiment evaluated the direct effect of the rice-straw mulch and the second its indirect effect on aphid immigration, testing the plant characteristics that could lead to the landing preference of this insect. The third experiment evaluated the direct effect of the mulch on the aphid population. In the second and third experiments, four plants, each in a 14 L polyethylene pot with holes at the bottom, were used in areas with and without soil mulching. These pots were changed between areas, after seven days, to evaluate the effects of this change on the arrival of the winged aphids to the plants. Each plant was covered with anti-aphid gauze and inoculated with one winged M. persicae. Winged and apterous adults of this insect were counted per plant after 15 days. The temperature increased in the mulched plots to a maximum of 21-36°C and to 18-32°C in the plots with or without soil covering, respectively. Plant growth reduced the numbers of the winged aphids landing before and after they were moved to the bare soil plots. The nutrient content was similar in plants in both the mulched and no mulched plots. The population growth of M. persicae was higher in the control than in the mulched plots. This was partially due to temperatures close to 30°C in these plots and changes in the plant physiology. The soil mulching with rice-straw decreased the M. persicae landing, increased the plot temperatures and improved the vegetative growth of the kale plants.

  3. Rice-straw mulch reduces the green peach aphid, Myzus persicae (Hemiptera: Aphididae populations on kale, Brassica oleracea var. acephala (Brassicaceae plants.

    Directory of Open Access Journals (Sweden)

    Reinildes Silva-Filho

    Full Text Available Organic mulches, like peel and rice-straw, besides other materials affect the UV and temperature, which cause a reduction in the aphid arrival. The aim was to evaluate the effect of covering the soil with straw on the populations of the green peach aphid, Myzus persicae on the kale, Brassica oleracea var. acephala plants. The first experiment evaluated the direct effect of the rice-straw mulch and the second its indirect effect on aphid immigration, testing the plant characteristics that could lead to the landing preference of this insect. The third experiment evaluated the direct effect of the mulch on the aphid population. In the second and third experiments, four plants, each in a 14 L polyethylene pot with holes at the bottom, were used in areas with and without soil mulching. These pots were changed between areas, after seven days, to evaluate the effects of this change on the arrival of the winged aphids to the plants. Each plant was covered with anti-aphid gauze and inoculated with one winged M. persicae. Winged and apterous adults of this insect were counted per plant after 15 days. The temperature increased in the mulched plots to a maximum of 21-36°C and to 18-32°C in the plots with or without soil covering, respectively. Plant growth reduced the numbers of the winged aphids landing before and after they were moved to the bare soil plots. The nutrient content was similar in plants in both the mulched and no mulched plots. The population growth of M. persicae was higher in the control than in the mulched plots. This was partially due to temperatures close to 30°C in these plots and changes in the plant physiology. The soil mulching with rice-straw decreased the M. persicae landing, increased the plot temperatures and improved the vegetative growth of the kale plants.

  4. Aluminum-induced calcium deficiency in peach seedlings

    Energy Technology Data Exchange (ETDEWEB)

    Edwards, J.H.; Horton, B.D.


    Total nutrient content, uptake rates, and distribution were determined for seedlings of peach (Prunus persica (L.) Batsch) grown in nutrient solutions containing 0, 222, 666, and 2000 Al. Generally, total nutrient content decreased in the peach seedling organs as Al concentration increased. The responses obtained with increased Al concentration were linear with some nutrients and curvilinear with others and varied with the plant organ. As Al concentration increased, the uptake rates for P, Ca, Mg, Zn, and Mn decreased by those for K and Fe increased. Aluminum did not alter the translocation of most nutrients; however, a greater percentage of the absorbed Ca accumulated in the leaves than in the roots or stems. Thus, aluminum toxicity in peaches may be related to a reduction in Ca uptake rate and not to inhibition in translocation of Ca.

  5. Aluminum toxicity symptoms in peach seedlings

    Energy Technology Data Exchange (ETDEWEB)

    Edwards, J.H.; Horton, B.D.; Kirkpatrick, H.C.


    Elberta (Prunus persica (L.) Batsch) peach seedlings were grown in nutrient solutions for 27 days with aluminum concentrations of 0, 222, 666 and 2000 concentration induced Al toxicity symptoms in leaves and severely restricted root growth. The early stage of Al toxicity was characterized by marginal chlorosis that later developed into necrotic areas that extended along the veins toward the midrib. Advanced stages of toxicity were characterized by collapse of the midrib, terminal dieback and defoliation of the seedlings which are typical symptoms of calcium deficiency in peaches. At high Al concentrations roots died back and new roots developed as irregularly shaped cylinders with constrictions and enlargements at the root apex.

  6. Evidence of differences between the communities of arbuscular mycorrhizal fungi colonizing galls and roots of Prunus persica infected by the root-knot nematode Meloidogyne incognita. (United States)

    Alguacil, Maria del Mar; Torrecillas, Emma; Lozano, Zenaida; Roldán, Antonio


    Arbuscular mycorrhizal fungi (AMF) play important roles as plant protection agents, reducing or suppressing nematode colonization. However, it has never been investigated whether the galls produced in roots by nematode infection are colonized by AMF. This study tested whether galls produced by Meloidogyne incognita infection in Prunus persica roots are colonized by AMF. We also determined the changes in AMF composition and biodiversity mediated by infection with this root-knot nematode. DNA from galls and roots of plants infected by M. incognita and from roots of noninfected plants was extracted, amplified, cloned, and sequenced using AMF-specific primers. Phylogenetic analysis using the small-subunit (SSU) ribosomal DNA (rDNA) data set revealed 22 different AMF sequence types (17 Glomus sequence types, 3 Paraglomus sequence types, 1 Scutellospora sequence type, and 1 Acaulospora sequence type). The highest AMF diversity was found in uninfected roots, followed by infected roots and galls. This study indicates that the galls produced in P. persica roots due to infection with M. incognita were colonized extensively by a community of AMF, belonging to the families Paraglomeraceae and Glomeraceae, that was different from the community detected in roots. Although the function of the AMF in the galls is still unknown, we hypothesize that they act as protection agents against opportunistic pathogens.

  7. Adaptability and stability of fruit set and production of peach trees in a subtropical climate

    Directory of Open Access Journals (Sweden)

    Idemir Citadin


    Full Text Available Brazilian peach breeding programs have been established to improve peach [Prunus persica (L. Batsch] production, yield consistency, quality, and disease resistance. Every year several genotypes are selected and their traits must be assessed. This study aimed to evaluate adaptability and stability of fruit set and production of peach genotypes in a subtropical climate, using the GGE biplot methodology. The experimental design was completely randomized with three replicates (trees in a factorial arrangement of 29 × 3 for genotype and growing season, respectively. The genotypes 'Conserva 1129', 'Rubimel', 'Kampai', 'Tropic Beauty', and 'Cascata 967' had the greatest adaptability and stability for fruit set. The genotypes 'Conserva 681', 'Santa Áurea', 'Atenas', 'Kampai', 'Cascata 962', 'Tropic Beauty' and 'Cascata 967' had the greatest production adaptability and stability. The GGE-biplot methodology classified the peach tree genotypes with regard to adaptability and stability of fruit set and production.

  8. Fitness trade-off in peach-potato aphids (Myzus persicae) between insecticide resistance and vulnerability to parasitoid attack at several spatial scales. (United States)

    Foster, S P; Denholm, I; Poppy, G M; Thompson, R; Powell, W


    Insecticide-resistant clones of the peach-potato aphid, Myzus persicae (Sulzer), have previously been shown to have a reduced response to aphid alarm pheromone compared to susceptible ones. The resulting vulnerability of susceptible and resistant aphids to attack by the primary endoparasitoid, Diaeretiella rapae (McIntosh), was investigated across three spatial scales. These scales ranged from aphids confined on individual leaves exposed to single female parasitoids, to aphids on groups of whole plants exposed to several parasitoids. In all experiments, significantly fewer aphids from insecticide-susceptible clones became parasitised compared to insecticide-resistant aphids. Investigations of aphid movement showed at the largest spatial scale that more susceptible aphids than resistant aphids moved from their inoculation leaves to other leaves on the same plant after exposure to parasitoids. The findings imply that parasitoids, and possibly other natural enemies, can influence the evolution and dynamics of insecticide resistance through pleiotropic effects of resistance genes on important behavioural traits.

  9. A fruit quality gene map of Prunus

    Directory of Open Access Journals (Sweden)

    Bliss Fredrick A


    Full Text Available Abstract Background Prunus fruit development, growth, ripening, and senescence includes major biochemical and sensory changes in texture, color, and flavor. The genetic dissection of these complex processes has important applications in crop improvement, to facilitate maximizing and maintaining stone fruit quality from production and processing through to marketing and consumption. Here we present an integrated fruit quality gene map of Prunus containing 133 genes putatively involved in the determination of fruit texture, pigmentation, flavor, and chilling injury resistance. Results A genetic linkage map of 211 markers was constructed for an intraspecific peach (Prunus persica progeny population, Pop-DG, derived from a canning peach cultivar 'Dr. Davis' and a fresh market cultivar 'Georgia Belle'. The Pop-DG map covered 818 cM of the peach genome and included three morphological markers, 11 ripening candidate genes, 13 cold-responsive genes, 21 novel EST-SSRs from the ChillPeach database, 58 previously reported SSRs, 40 RAFs, 23 SRAPs, 14 IMAs, and 28 accessory markers from candidate gene amplification. The Pop-DG map was co-linear with the Prunus reference T × E map, with 39 SSR markers in common to align the maps. A further 158 markers were bin-mapped to the reference map: 59 ripening candidate genes, 50 cold-responsive genes, and 50 novel EST-SSRs from ChillPeach, with deduced locations in Pop-DG via comparative mapping. Several candidate genes and EST-SSRs co-located with previously reported major trait loci and quantitative trait loci for chilling injury symptoms in Pop-DG. Conclusion The candidate gene approach combined with bin-mapping and availability of a community-recognized reference genetic map provides an efficient means of locating genes of interest in a target genome. We highlight the co-localization of fruit quality candidate genes with previously reported fruit quality QTLs. The fruit quality gene map developed here is a

  10. A fruit quality gene map of Prunus (United States)


    Background Prunus fruit development, growth, ripening, and senescence includes major biochemical and sensory changes in texture, color, and flavor. The genetic dissection of these complex processes has important applications in crop improvement, to facilitate maximizing and maintaining stone fruit quality from production and processing through to marketing and consumption. Here we present an integrated fruit quality gene map of Prunus containing 133 genes putatively involved in the determination of fruit texture, pigmentation, flavor, and chilling injury resistance. Results A genetic linkage map of 211 markers was constructed for an intraspecific peach (Prunus persica) progeny population, Pop-DG, derived from a canning peach cultivar 'Dr. Davis' and a fresh market cultivar 'Georgia Belle'. The Pop-DG map covered 818 cM of the peach genome and included three morphological markers, 11 ripening candidate genes, 13 cold-responsive genes, 21 novel EST-SSRs from the ChillPeach database, 58 previously reported SSRs, 40 RAFs, 23 SRAPs, 14 IMAs, and 28 accessory markers from candidate gene amplification. The Pop-DG map was co-linear with the Prunus reference T × E map, with 39 SSR markers in common to align the maps. A further 158 markers were bin-mapped to the reference map: 59 ripening candidate genes, 50 cold-responsive genes, and 50 novel EST-SSRs from ChillPeach, with deduced locations in Pop-DG via comparative mapping. Several candidate genes and EST-SSRs co-located with previously reported major trait loci and quantitative trait loci for chilling injury symptoms in Pop-DG. Conclusion The candidate gene approach combined with bin-mapping and availability of a community-recognized reference genetic map provides an efficient means of locating genes of interest in a target genome. We highlight the co-localization of fruit quality candidate genes with previously reported fruit quality QTLs. The fruit quality gene map developed here is a valuable tool for dissecting the

  11. The NIa-Pro protein of Turnip mosaic virus improves growth and reproduction of the aphid vector, Myzus persicae (green peach aphid). (United States)

    Casteel, Clare L; Yang, Chunling; Nanduri, Ananya C; De Jong, Hannah N; Whitham, Steven A; Jander, Georg


    Many plant viruses depend on aphids and other phloem-feeding insects for transmission within and among host plants. Thus, viruses may promote their own transmission by manipulating plant physiology to attract aphids and increase aphid reproduction. Consistent with this hypothesis, Myzus persicae (green peach aphids) prefer to settle on Nicotiana benthamiana infected with Turnip mosaic virus (TuMV) and fecundity on virus-infected N. benthamiana and Arabidopsis thaliana (Arabidopsis) is higher than on uninfected controls. TuMV infection suppresses callose deposition, an important plant defense, and increases the amount of free amino acids, the major source of nitrogen for aphids. To investigate the underlying molecular mechanisms of this phenomenon, 10 TuMV genes were over-expressed in plants to determine their effects on aphid reproduction. Production of a single TuMV protein, nuclear inclusion a-protease domain (NIa-Pro), increased M. persicae reproduction on both N. benthamiana and Arabidopsis. Similar to the effects that are observed during TuMV infection, NIa-Pro expression alone increased aphid arrestment, suppressed callose deposition and increased the abundance of free amino acids. Together, these results suggest a function for the TuMV NIa-Pro protein in manipulating the physiology of host plants. By attracting aphid vectors and promoting their reproduction, TuMV may influence plant-aphid interactions to promote its own transmission. © 2013 The Authors The Plant Journal © 2013 John Wiley & Sons Ltd.

  12. Controle da cochonilha-parda Parthenolecanium persicae (Fabricius, 1776 (Hemiptera: Coccidae na cultura da videira Control of the european peach scale Parthenolecanium persicae (Fabricius, 1776 (Hemiptera: Coccidae in vineyards

    Directory of Open Access Journals (Sweden)

    Ana Paula Schneid Afonso


    Full Text Available A cochonilha-parda Parthenolecanium persicae é considerada uma das principais pragas da videira na região sul do Brasil. Com o objetivo de avaliar inseticidas fosforados e neonicotinóides foram conduzidos dois experimentos avaliando-se os produtos fitossanitários: dimetoato (Tiomet 400 CE, 100mL/100L de água, fenitrotion (Sumithion 500 CE, 150mL/100 L de água, metidation (Supracid 400 CE, 100mL/100L de água, paratiom metil (Folidol 600 CE, 100mL/100L de água e triclorfon (Dipterex 500 SNAqC, 300mL/100L de água em 2001 e, imidacloprid (Provado 200 SC, 30, 40 e 50mL/100L de água, tiacloprid (Calypso 480 SC, 20, 30 e 40mL/100L, tiametoxam (Actara 250 WG, 20, 30 e 40g/100L de água e paratiom metil (Folidol 600 CE, 100mL/100L em 2002. Os produtos foram aplicados via foliar num volume de 800L.ha-1. Os fosforados fenitrotion, metidation, paratiom metil e os neonicotinóides imidacloprid e tiametoxam foram eficientes no controle de ninfas do terceiro ínstar de P. persicae. Os inseticidas dimetoato e tiacloprid não atingiram 50% de controle da cochonilha-parda na cultura da videira.The european peach scale Parthenolecanium persicae is one of the most important grape pest in southern Brasil. The insecticides dimetoato (Tiomet 400 CE, 100mL/100L, fenitrotion (Sumithion 500 CE, 150mL/100L, metidation (Supracid 400 CE, 100mL/100L, paratiom metil (Folidol 600 CE, 100mL/100L and triclorfon (Dipterex 500 SNAqC, 300mL/100L were evaluated in a field experiment in 2001 and imidacloprid (Provado 200 SC, 30, 40 and 50mL/100L, tiacloprid (Calypso 480 SC, 20, 30 and 40mL/100L, tiametoxam (Actara 250 WG, 20, 30 and 40 g/100L and paratiom metil (Folidol 600 CE, 100mL/100L in 2002. Insecticides were sprayed using 800L of water.ha-1 seeking third instar nymphs. Phosporous insecticides fenitrotion, metidation, paratiom metil and triclorfon and the neonicotinoid imidacloprid and tiametoxam were efficient for P. persicae control. Dimetoato and tiacloprid were

  13. Comparison of the genetic determinism of two key phenological traits, flowering and maturity dates, in three Prunus species: peach, apricot and sweet cherry. (United States)

    Dirlewanger, E; Quero-García, J; Le Dantec, L; Lambert, P; Ruiz, D; Dondini, L; Illa, E; Quilot-Turion, B; Audergon, J-M; Tartarini, S; Letourmy, P; Arús, P


    The present study investigates the genetic determinism of flowering and maturity dates, two traits highly affected by global climate change. Flowering and maturity dates were evaluated on five progenies from three Prunus species, peach, apricot and sweet cherry, during 3-8 years. Quantitative trait locus (QTL) detection was performed separately for each year and also by integrating data from all years together. High heritability estimates were obtained for flowering and maturity dates. Several QTLs for flowering and maturity dates were highly stable, detected each year of evaluation, suggesting that they were not affected by climatic variations. For flowering date, major QTLs were detected on linkage groups (LG) 4 for apricot and sweet cherry and on LG6 for peach. QTLs were identified on LG2, LG3, LG4 and LG7 for the three species. For maturity date, a major QTL was detected on LG4 in the three species. Using the peach genome sequence data, candidate genes underlying the major QTLs on LG4 and LG6 were investigated and key genes were identified. Our results provide a basis for the identification of genes involved in flowering and maturity dates that could be used to develop cultivar ideotypes adapted to future climatic conditions.

  14. Current-year and Subsequent-year Effects of Crop-load Manipulation and Epicormic-shoot Removal on Distribution of Long, Short and Epicormic Shoot Growth in Prunus persica (United States)

    Gordon, D.; Dejong, T. M.


    Background and Aims The distribution of canopy growth among different shoot types such as epicormic, long and short shoots is not well understood in the peach tree. In this experiment, the effects of crop load and early epicormic sprout removal on current and subsequent-year distribution of vegetative growth among epicormic, long and short shoots was investigated in Prunus persica. Methods Field trials were conducted in Winters, California, in 2003–2004. Crop load was manipulated with fruit thinning in 2003 to produce trees that were de-fruited, commercially thinned or full crop, and half of the trees in each cropping treatment had all current year epicormic sprouts removed at the time of fruit thinning. Yield was recorded and trunk and root carbohydrates were sampled to confirm the effect of 2003 crop load differences on tissue carbohydrate concentration. All current-season vegetative-shoot extension growth was harvested from half of the trees in each treatment in the autumn of 2003 and from the other half in the autumn of 2004. Epicormic, long and short shoots were separately evaluated for dry weight, node number and leaf-stem parameters. Key Results In 2003, long-shoot dry weight and node number were significantly affected by crop load; however, short-shoot dry weight and node number were not significantly affected. The 2003 crop-load treatments did not affect 2004 vegetative growth of any shoot type. Some re-growth of epicormic shoots followed early epicormic sprout removal: by the end of the 2003 season, trees in the early shoot-removal treatment had approximately one-third of the epicormic-shoot dry weight as unpruned trees. Conclusions Fruit thinning promoted distribution of growth similar to that of de-fruited trees. While thinning was effective in increasing fruit size, it exacerbated the problem of epicormic sprouting. Early epicormic sprout removal did not stimulate the excessive epicormic re-growth in the same or subsequent year relative to previously

  15. Effects of Manduca sexta allatostatin and an analogue on the peach-potato aphid Myzus persicae (hemiptera: aphididae) and degradation by enzymes in the aphid gut. (United States)

    Matthews, H June; Down, Rachel E; Audsley, Neil


    The oral toxicity of the C-type allatostatin, Manduca sexta allatostatin (Manse-AS) and the analogue δR³δR⁵Manse-AS, where R residues were replaced by their D-isomers, were tested against the peach-potato aphid Myzus persicae by incorporation into an artificial diet. Both peptides had significant dose-dependent effects on mortality, growth, and fecundity compared with control insects. The analogue, δR³δR⁵Manse-AS, had an estimated LC₅₀ of 0.31 µg/µl diet and was more potent than Manse-AS (estimated LC₅₀ of 0.58 µg/µl diet). At a dose of 0.35 µg δR³δR⁵Manse-AS/µl diet, 76% of the aphids were dead after 6 days and all were dead after 10 days. In comparison, three times the dose of Manse-AS was required to achieve 74% mortality after 8 days and 98% mortality after 16 days. The degradation of both peptides by extracts prepared from the gut of M. persicae was investigated. The estimated half-life of Manse-AS, when incubated with the gut extract from M. persicae, was 31 min. Degradation was due to a cathepsin L-like cysteine protease, carboxypeptidase-like activity, endoprotease activity with glutamine specificity, pyroglutamate aminopeptidase activity, and possibly trypsin-like proteases. The half-life of the δR³δR⁵ Manse-AS analogue was enhanced (73 min) with the D-isomers of R appearing to prevent cleavage around the R residues by cathepsin L-like cysteine proteases or from trypsin-like proteases. The greater stability of the analogue may explain its increased potency in M. persicae. This work demonstrates the potential use of Manse-AS and analogues, with greater resistance to enzymatic attack, in aphid control strategies. © 2010 Wiley Periodicals, Inc.

  16. Lesser peachtree borer (Lepidoptera: Sesiidae) oviposition on Prunus germplasm. (United States)

    Cottrell, T E; Beckman, T G; Horton, D L


    The lesser peachtree borer, Synanthedon pictipes (Grote and Robinson) (Lepidoptera: Sesiidae), is a serious pest of peach, Prunus persica (L.) Batsch, across the southeastern United States. We examined oviposition by S. pictipes on field-grown Prunus scion and rootstock cultivars and two endemic Prunus spp. when sawn limbs, not roots, were assayed in the laboratory. A choice test compared oviposition on the peach scion 'Harvester', peach rootstock 'Guardian', plum×peach hybrid rootstock 'MP-29', and the plum hybrid rootstock 'Sharpe'. A significantly lower percentage of eggs occurred on limbs of Sharpe rootstock than other choices. A choice test using two endemic hosts, black cherry (P. serotina Ehrh.) and Chickasaw plum (P. angustifolia Marsh.), along with Sharpe rootstock, found a lower percentage of eggs on limbs of Sharpe than either endemic host. However, when only limbs of Sharpe and a decoy were used, almost all eggs were laid on Sharpe. Interestingly, when Harvester and Sharpe limbs were paired side by side, a higher percentage of eggs were recovered from the Harvester limb than from the Sharpe limb. An analysis of volatiles from Sharpe may identify why fewer eggs were laid on it. Because S. pictipes attacks host trees above ground and Sharpe rootstock on grafted trees grows below ground, this rootstock might be a management option against the congeneric, root-attacking peachtree borer, S. exitiosa (Say). Our results suggest that high budding a peach scion onto Sharpe rootstock, thus allowing the rootstock to serve as the trunk, warrants further investigation against S. exitiosa under orchard conditions.

  17. Effect of insecticidal fusion proteins containing spider toxins targeting sodium and calcium ion channels on pyrethroid-resistant strains of peach-potato aphid (Myzus persicae). (United States)

    Yang, Sheng; Fitches, Elaine; Pyati, Prashant; Gatehouse, John A


    The recombinant fusion proteins Pl1a/GNA and Hv1a/GNA contain the spider venom peptides δ-amaurobitoxin-PI1a or ω-hexatoxin-Hv1a respectively, linked to snowdrop lectin (GNA). Pl1a targets receptor site 4 of insect voltage-gated sodium channels (NaCh), while Hv1a targets voltage-gated calcium channels. Insecticide-resistant strains of peach-potato aphid (Myzus persicae) contain mutations in NaCh. The pyrethroid-resistant kdr (794J) and super-kdr (UKO) strains contain mutations at residues L1014 and M918 in the channel α-subunit respectively, while the kdr + super-kdr strain (4824J), insensitive to pyrethroids, contains mutations at both L1014 and M918. Pl1a/GNA and Hv1a/GNA fusion proteins have estimated LC50 values of 0.35 and 0.19 mg mL(-1) when fed to wild-type M. persicae. For insecticide-resistant aphids, LC50 for the Pl1a/GNA fusion protein increased by 2-6-fold, correlating with pyrethroid resistance (wild type < kdr < super-kdr < kdr + super-kdr strains). In contrast, LC50 for the Hv1a/GNA fusion protein showed limited correlation with pyrethroid resistance. Mutations in the sodium channel in pyrethroid-resistant aphids also protect against a fusion protein containing a sodium-channel-specific toxin, in spite of differences in ligand-channel interactions, but do not confer resistance to a fusion protein targeting calcium channels. The use of fusion proteins with differing targets could play a role in managing pesticide resistance. © 2014 Society of Chemical Industry.

  18. Genetic diversity in peach [Prunus persica (L.) Batsch] at the University of Florida: past present and future (United States)

    The University of Florida (UF) stone fruit breeding and genetics program was created in 1952 to develop early ripening stone fruit cultivars with high quality, adaptation to summer rainfall, low chilling requirements, and the ability to withstand high disease pressure. Diverse germplasm sources were...

  19. Mapping quantitative trait loci associated with chilling requirement, heat requirement and bloom date in peach [Prunus persica (L.) Batsch (United States)

    Chilling requirement (CR), together with heat requirement (HR), determines blooming date (BD) and climatic distribution of genotypes of temperate tree species. However, information on the genetic components underlying these important traits remains unknown or fragmentary. Here the identification o...

  20. Fibra dietaria de durazno (Prunus persica L.): influencia de la técnica de obtención en las propiedades químicas, físicas y funcionales


    Nieto Calvache, Jhon Edinson


    Se estudió la optimización de las condiciones de proceso en relación a la obtención de fracciones enriquecidas en fibra dietaria a partir de residuos de duraznos (Prunus persica L.). Se evaluó la influencia de la relación etanol/muestra durante la extracción de la fibra y de la temperatura de secado con microondas, sobre las propiedades funcionales evaluadas: capacidad de atrapamiento de agua, de retención de agua, de hinchamiento, porcentaje de retención de agua, capacidad de absorción de ac...

  1. Carotenoids, Phenolic Profile, Mineral Content and Antioxidant Properties in Flesh and Peel of Prunus persica Fruits during Two Maturation Stages. (United States)

    Dabbou, Samia; Maatallah, Samira; Castagna, Antonella; Guizani, Monia; Sghaeir, Wala; Hajlaoui, Hichem; Ranieri, Annamaria


    Carotenoids and phenolic profile, antioxidant activity as well as concentrations of selected macronutrients (K, N, Mg, Ca and Na) and micronutrients (Zn, Cu and Mn) in flesh and peel of peach fruit were recorded at two harvest dates. Predominant mineral was potassium, followed by calcium, magnesium and sodium. The concentration of most micronutrients was greater in the peel than in the flesh especially in early season. The concentration of most elements in flesh and peel decreased during fruit maturation. Total carotenoids content varied with respect to the cultivar. β-cryptoxanthin and β-carotene were the major carotenoids in both tissues and flesh contain the lowest amounts. Neochlorogenic acid, chlorogenic acid, catechin, epicatechin, gallic acid, rutin, quercetin-3-O-galactoside, cyanidin-3-O-glucoside, cyanidin-3-O-rutinoside, were detected in both peel and flesh, with chlorogenic acid and catechin being the predominant components. Peel extracts showed markedly higher antioxidant activities, when estimated by ABTS or DPPH assays, than the flesh counterparts, consistent with the observed higher phenolic content. Overall, total phenolics levels increased at full ripening stage in both peel and flesh. The results found herein provide important data on carotenoids, phenolic and macro- and micronutrient changes during fruit growth, and emphases peach fruit as a potential functional food.

  2. Phenology and reproductive traits of peaches and nectarines in Central-East Argentina


    Norberto Francisco Gariglio; Marisa Mendow; Marcela Emilce Weber; María Alejandra Favaro; Diego Esteban González-Rossia; Rubén Andrés Pilatti


    In Santa Fe, the central-east area of Argentina, the expansion of fruit tree crops requires the introduction and evaluation of low chilling varieties. The aims of this study was to characterize the phenological behaviour and the reproductive traits of peach (Prunus persica L. Batsch) and nectarine varieties with chilling requirements ranging from 150 to 650 chilling hours (CH). Low chilling varieties (< 450 CH) had higher flower density (22.0-56.5 flowers m-1), fruit set (26.0-56.7%), fruit y...

  3. Elaboración de néctar de durazno (Prunus persica L., endulzado con sucralosa como aprovechamiento de pérdidas poscosecha

    Directory of Open Access Journals (Sweden)

    Darío Alberto Pinto Medina


    Full Text Available En el durazno (Prunus persica L, así como en la mayoría de los frutos climatéricos, la calidad y el tiempo de vida útil comercial son afectados por los inadecuados manejos durante la cosecha, transporte y empaque, evidenciados por una serie de daños y defectos que el consumidor rechaza a la hora de adquirir el producto en fresco y que representan cuantiosas pérdidas al final del proceso de mercadeo, esta investigación se basó principalmente en el aprovechamiento de las pérdidas en durazno en el eslabón de la poscosecha, agroindustrializando la materia prima; se realizaron pruebas sensoriales para determinar la variedad más aceptada de tres probadas: Rubidoux, Dorado y Rubidoux-Dorado, no se evidenciaron diferencias significativas entre las muestras. Para darle valor agregado al producto, se fabricó néctar de la variedad Rubidoux endulzado con sucralosa, se realizaron análisis fisicoquímicos, microbiológicos y bromatológicos siguiendo la normatividad vigente. Se encontró que la sucralosa contribuyó a disminuir considerablemente el aporte calórico en el néctar elaborado, pasando de 48 Kcal/100g a 38,69 Kcal/100g. Se concluye que el costo de producción unitario para envase de 350ml ($ 1.054 resulta favorable, puesto que la rentabilidad puede superar el 40%, para un precio de venta de $1.476, generando un producto competitivo en el mercado, dada la calidad y el valor agregado como alimento funcional

  4. The attack of the clones: tracking the movement of insecticide-resistant peach-potato aphids Myzus persicae (Hemiptera: Aphididae). (United States)

    Fenton, B; Malloch, G; Woodford, J A T; Foster, S P; Anstead, J; Denholm, I; King, L; Pickup, J


    Myzus persicae (Sulzer) collected in Scotland were characterized for four microsatellite loci, intergenic spacer fingerprints and the resistance mechanisms modified acetylcholinesterase (MACE), overproduced carboxylesterase and knockdown resistance (kdr). Microsatellite polymorphisms were used to define a limited number of clones that were either fully susceptible to insecticides or possessed characteristic combinations of resistance mechanisms. Within these clones, intergenic spacer fingerprints could either be very consistent or variable, with the latter indicating ongoing evolution within lineages, most likely derived from the same zygote. Two clones (termed A and B) possessed all three resistance mechanisms and predominated at sites treated with insecticides. Their appearance on seed potatoes and oilseed rape in Scotland in 2001 coincided with extensive insecticide use and severe control failures. Clones C, I and J, with no or fewer resistance mechanisms, were found in samples from 1995 and were dominant at untreated sites in 2001. A comparison of Scottish collections with those from other UK and non-UK sites provides insight into the likely origins, distribution and dynamics of M. persicae clones in a region where asexual (anholocyclic) reproduction predominates, but is vulnerable to migration by novel genotypes from areas of Europe where sexual (holocyclic) reproduction occurs.

  5. Peach genetic resources: diversity, population structure and linkage disequilibrium (United States)


    Background Peach (Prunus persica (L.) Batsch) is one of the most important model fruits in the Rosaceae family. Native to the west of China, where peach has been domesticated for more than 4,000 years, its cultivation spread from China to Persia, Mediterranean countries and to America. Chinese peach has had a major impact on international peach breeding programs due to its high genetic diversity. In this research, we used 48 highly polymorphic SSRs, distributed over the peach genome, to investigate the difference in genetic diversity, and linkage disequilibrium (LD) among Chinese cultivars, and North American and European cultivars, and the evolution of current peach cultivars. Results In total, 588 alleles were obtained with 48 SSRs on 653 peach accessions, giving an average of 12.25 alleles per locus. In general, the average value of observed heterozygosity (0.47) was lower than the expected heterozygosity (0.60). The separate analysis of groups of accessions according to their origin or reproductive strategies showed greater variability in Oriental cultivars, mainly due to the high level of heterozygosity in Chinese landraces. Genetic distance analysis clustered the cultivars into two main groups: one included four wild related Prunus, and the other included most of the Oriental and Occidental landraces and breeding cultivars. STRUCTURE analysis assigned 469 accessions to three subpopulations: Oriental (234), Occidental (174), and Landraces (61). Nested STRUCTURE analysis divided the Oriental subpopulation into two different subpopulations: ‘Yu Lu’ and ‘Hakuho’. The Occidental breeding subpopulation was also subdivided into nectarine and peach subpopulations. Linkage disequilibrium (LD) analysis in each of these subpopulations showed that the percentage of linked (r2 > 0.1) intra-chromosome comparisons ranged between 14% and 47%. LD decayed faster in Oriental (1,196 Kbp) than in Occidental (2,687 Kbp) samples. In the ‘Yu Lu’ subpopulation there

  6. Insecticide resistance monitoring and metabolic mechanism study of the green peach aphid, Myzus persicae (Sulzer) (Hemiptera: Aphididae), in Chongqing, China. (United States)

    Li, Yong; Xu, Zhifeng; Shi, Li; Shen, Guangmao; He, Lin


    Myzus persicae (Sulzer) is one of the most important agricultural pests in China, which caused serious losses every year. For resistance monitoring, twelve populations of this pest were collected from tobacco field in Chongqing, China, and their sensitivities to 4 insecticides were tested. Results showed that only WL (RR=6.51) and FJ (RR=6.03) populations have developed minor resistance to imidacloprid, and the others still remained susceptible. One population (NC) has reached a high resistance level to cyhalothrin (RR=41.28), five populations showed medium level (10.36≤RR≤20.45), and the other six remained susceptible (0.39≤RR≤3.53). As regards carbosulfan, three populations have developed medium resistance, four populations showed only minor resistance, and the other five (0.81≤RR≤3.97) were still susceptible. Population SZ developed a medium level (RR=14.83) to phoxim, the other 11 were susceptible (0.29≤RR≤2.41). To analysis the potential resistance mechanism, inhibition effects of synergists and detoxifying enzyme activities were detected. The results indicated that the MFO was the most important detoxifying enzyme conferring imidacloprid resistance, and CarE was most important to cyhalothrin, carbosulfan and phoxim. Our study provided a comprehensive survey of insecticide resistance of M. persicae in Chongqing, and suggested that different counties should take corresponding management to delay the insecticide resistance development and prolong the usefulness of insecticides. Copyright © 2015 Elsevier Inc. All rights reserved.

  7. Effects of orchard host plants (apple and peach) on development of oriental fruit moth (Lepidoptera: Tortricidae). (United States)

    Myers, Clayton T; Hull, Larry A; Krawczyk, Grzegorz


    Studies were designed to examine the effects of host plants (apple, Malus domestica Borkh., and peach, Prunus persica L.) on the development of oriental fruit moth, Grapholita molesta (Busck) (Lepidoptera: Tortricidae). Oriental fruit moth larvae developed faster on peach than on apple, both on fruit as well as on growing terminal shoots. On fruit, these differences were shown to cause significant changes in both the rate (approximately 20-60 degree-days earlier emergence on peach than on apple) and patterns of adult emergence among several cultivars of peaches and apples. Slopes of female emergence plots varied by host in 2003, with emergence occurring over a longer period on peach cultivars than on apple cultivars (with one exception). Slopes of male emergence curves did not differ by cultivar in 2003. These host-driven effects could impact the efficacy of traditional pest management approaches and probably complicate efforts to predictively model G. molesta populations in mixed cultivar orchards. Such developmental effects may help to explain previously observed differences in patterns of pheromone trap captures in peach versus apple orchards. Host-associated effects should be incorporated into future models to develop more realistic predictive tools and thus improve integrated pest management efforts.

  8. Resistência de genótipos de batata ao pulgão Potato genotypes resistance to the green peach aphid Myzus persicae

    Directory of Open Access Journals (Sweden)

    Fernando M. Lara


    for resistance (and antibiosis to the green peach aphid Myzus persicae, in experiments carried out with potted plants using vases (no choice tests, in Jaboticabal, São Paulo State, Brazil. Sixteen genotypes were used in six experiments: 'Achat', 'Apuã', 'Aracy', 'Aracy Ruiva', 'Bintje', 'Ibitu Açu', 'Itararé', 'N 140-201', 'NYL 235-4', '288.719-13', '288.764-26', '288.776-3', '288.776-6', '288.794-19', '288.801-6' and '288.814-7'. In each experiment different combinations of these genotypes were used. In the first two experiments the plants were infested with 30 adults distributed in three leaves; after infestation three evaluations were done during the subsequent weeks. The third experiment was carried out arresting two adult females inside small cages fastened in the lower surface of the leaflets; the reproduction of the aphid was evaluated after seven days using two plantings. In the fourth experiment, 15 aphids were placed on each plant to evaluate the growth of the population, by counting the number of aphids/plant in three subsequent weeks. In the fifth experiment the number of nymphs/female was evaluated, while in the sixth experiment the nymphs weight was evaluated at the seventh day of life. The density of glandular trichomes was measured on lower laminar surface and on the main vein of mature leaves. The functionality of the glandular trichomes was also evaluated. The commercial genotype Ibitu Açu presented a high degree of antibiosis to M. persicae; the genotypes 288.776-3 and 288.794-19 also presented this mechanism of resistance, in moderate degree; '288.719-13' and '288.764-26' were also resistant to the green peach aphid, probably due to the presence of functional glandular trichomes, types A and B, in their leaflets (antixenosis. The commercial genotype Bintje and the clone 288.801-6 were the most susceptible.

  9. Evaluación productiva, económica y social del agua de riego de durazno (Prunus persica L. Batsch en Zacatecas (México

    Directory of Open Access Journals (Sweden)

    José Luis Ríos-Flores


    Full Text Available La escasez de agua limita la agricultura, por lo que su uso debe ser más eficiente en la producción de alimentos. El objetivo de este trabajo fue determinar la productividad económica, física y social del agua del cultivo de durazno (Prunus persica L. Batsch, en la región del Distrito de Desarrollo Rural 183 —correspondiente a Fresnillo, Zacatecas— para el ciclo 2012; se desarrollaron modelos matemáticos para estimar la productividad y eficiencia del agua. En Zacatecas se cosecharon 817 ha de durazno; mismas que produjeron 3,954.1 t; con un valor de $32.79 millones de pesos, utilizando un total de 8.17 Mm3 en todo el estado; mientras que en el DDR183-Fresnillo (compuesto por los municipios Fresnillo y Valparaíso se emplearon 3.39 Mm3. La determinación de la huella hídrica azul mostró que, por cada kg de durazno se emplearon 2,066 L en Zacatecas, 2,000 L en Fresnillo, y 1,851 L en Valparaíso. En cuanto al ingreso por metro cúbico, se determinó que en Zacatecas se obtuvo un ingreso de $4.01 m-3, $4.38 m-3 en Fresnillo y $4.83 m-3 en Valparaíso. Mientras, la productividad laboral en Zacatecas fue 97.53 h t-1, en Fresnillo 94.40 h t-1, y en Valparaíso 87.35 h t-1. El trabajador adscrito a la producción de durazno en Zacatecas generó $97.53 h-1, en Fresnillo $94.40 h-1, y $87.35 h-1 en Valparaíso. La producción de durazno en Valparaíso resultó altamente eficiente y productiva, lo que se tradujo en una menor huella hídrica; ello promueve la sustentabilidad del recurso agua en esa región.

  10. Fighting Sharka in Peach: Current Limitations and Future Perspectives

    Directory of Open Access Journals (Sweden)

    Marco Cirilli


    Full Text Available Sharka, caused by Plum Pox Virus (PPV, is by far the most important infectious disease of peach [P. persica (L. Batsch] and other Prunus species. The progressive spread of the virus in many important growing areas throughout Europe poses serious issues to the economic sustainability of stone fruit crops, peach in particular. The adoption of internationally agreed-upon rules for diagnostic tests, strain-specific monitoring schemes and spatial-temporal modeling of virus spread, are all essential for a more effective sharka containment. The EU regulations on nursery activity should be modified based on the zone delimitation of PPV presence, limiting open-field production of propagation materials only to virus-free areas. Increasing the efficiency of preventive measures should be augmented by the short-term development of resistant cultivars. Putative sources of resistance/tolerance have been recently identified in peach germplasm, although the majority of novel resistant sources to PPV-M have been found in almond. However, the complexity of introgression from related-species imposes the search for alternative strategies. The use of genetic engineering, particularly RNAi-based approaches, appears as one of the most promising perspectives to introduce a durable resistance to PPV in peach germplasm, notwithstanding the well-known difficulties of in vitro plant regeneration in this species. In this regard, rootstock transformation to induce RNAi-mediated systemic resistance to PPV would avoid the transformation of numerous commercial cultivars, and may alleviate consumer resistance to the use of GM plants.

  11. Fighting Sharka in Peach: Current Limitations and Future Perspectives (United States)

    Cirilli, Marco; Geuna, Filippo; Babini, Anna R.; Bozhkova, Valentina; Catalano, Luigi; Cavagna, Beniamino; Dallot, Sylvie; Decroocq, Véronique; Dondini, Luca; Foschi, Stefano; Ilardi, Vincenza; Liverani, Alessandro; Mezzetti, Bruno; Minafra, Angelantonio; Pancaldi, Marco; Pandolfini, Tiziana; Pascal, Thierry; Savino, Vito N.; Scorza, Ralph; Verde, Ignazio; Bassi, Daniele


    Sharka, caused by Plum Pox Virus (PPV), is by far the most important infectious disease of peach [P. persica (L.) Batsch] and other Prunus species. The progressive spread of the virus in many important growing areas throughout Europe poses serious issues to the economic sustainability of stone fruit crops, peach in particular. The adoption of internationally agreed-upon rules for diagnostic tests, strain-specific monitoring schemes and spatial–temporal modeling of virus spread, are all essential for a more effective sharka containment. The EU regulations on nursery activity should be modified based on the zone delimitation of PPV presence, limiting open-field production of propagation materials only to virus-free areas. Increasing the efficiency of preventive measures should be augmented by the short-term development of resistant cultivars. Putative sources of resistance/tolerance have been recently identified in peach germplasm, although the majority of novel resistant sources to PPV-M have been found in almond. However, the complexity of introgression from related-species imposes the search for alternative strategies. The use of genetic engineering, particularly RNA interference (RNAi)-based approaches, appears as one of the most promising perspectives to introduce a durable resistance to PPV in peach germplasm, notwithstanding the well-known difficulties of in vitro plant regeneration in this species. In this regard, rootstock transformation to induce RNAi-mediated systemic resistance would avoid the transformation of numerous commercial cultivars, and may alleviate consumer resistance to the use of GM plants. PMID:27625664

  12. Soybean oil-degrading bacterial cultures as a potential for control of green peach aphids (Myzus persicae). (United States)

    Kim, Seul Ki; Kim, Seo Ri; Choi, Min Seok; Park, Chang Eon; Kim, Young Cheol; Kim, Kil Yong; Whang, Kyung Sook; Oh, Kyung-Taek; Kim, In Seon


    Microorganisms capable of degrading crude oil were isolated and grown in soybean oil as a sole carbon source. The microbial cultures were used to control green peach aphids in vitro. Approximately 60% mortality of aphids was observed when the cultures were applied alone onto aphids. To examine the cultures as a pesticide formulation mixture, the cultures were combined with a low dose of the insecticide imidacloprid (one-fourth dose of recommended field-application rate) and applied onto aphids. The cultures enhanced significantly the insecticidal effectiveness of imidacloprid, which was higher than imidacloprid alone applied at the low dose. The isolated microorganisms exhibited high emulsifying index values and decreased surface tension values after being grown in soybean oil media. GC/MS analyses showed that microorganisms degraded soybean oil to fatty acids. The cultures were suggested to play the roles of wetting, spreading, and sticking agents to improve the effectiveness of imidacloprid. This is the first report on the control of aphids by using oil-degrading microbial cultures.

  13. Development and Evaluation of a 9K SNP Array for Peach by Internationally Coordinated SNP Detection and Validation in Breeding Germplasm (United States)

    Scalabrin, Simone; Gilmore, Barbara; Lawley, Cynthia T.; Gasic, Ksenija; Micheletti, Diego; Rosyara, Umesh R.; Cattonaro, Federica; Vendramin, Elisa; Main, Dorrie; Aramini, Valeria; Blas, Andrea L.; Mockler, Todd C.; Bryant, Douglas W.; Wilhelm, Larry; Troggio, Michela; Sosinski, Bryon; Aranzana, Maria José; Arús, Pere; Iezzoni, Amy; Morgante, Michele; Peace, Cameron


    Although a large number of single nucleotide polymorphism (SNP) markers covering the entire genome are needed to enable molecular breeding efforts such as genome wide association studies, fine mapping, genomic selection and marker-assisted selection in peach [Prunus persica (L.) Batsch] and related Prunus species, only a limited number of genetic markers, including simple sequence repeats (SSRs), have been available to date. To address this need, an international consortium (The International Peach SNP Consortium; IPSC) has pursued a coordinated effort to perform genome-scale SNP discovery in peach using next generation sequencing platforms to develop and characterize a high-throughput Illumina Infinium® SNP genotyping array platform. We performed whole genome re-sequencing of 56 peach breeding accessions using the Illumina and Roche/454 sequencing technologies. Polymorphism detection algorithms identified a total of 1,022,354 SNPs. Validation with the Illumina GoldenGate® assay was performed on a subset of the predicted SNPs, verifying ∼75% of genic (exonic and intronic) SNPs, whereas only about a third of intergenic SNPs were verified. Conservative filtering was applied to arrive at a set of 8,144 SNPs that were included on the IPSC peach SNP array v1, distributed over all eight peach chromosomes with an average spacing of 26.7 kb between SNPs. Use of this platform to screen a total of 709 accessions of peach in two separate evaluation panels identified a total of 6,869 (84.3%) polymorphic SNPs. The almost 7,000 SNPs verified as polymorphic through extensive empirical evaluation represent an excellent source of markers for future studies in genetic relatedness, genetic mapping, and dissecting the genetic architecture of complex agricultural traits. The IPSC peach SNP array v1 is commercially available and we expect that it will be used worldwide for genetic studies in peach and related stone fruit and nut species. PMID:22536421

  14. Leaf extrafloral nectaries enhance biological control of a key economic pest, Grapholita molesta (Lepidoptera: Tortricidae), in peach (Rosales: Rosaceae). (United States)

    Mathews, Clarissa R; Brown, Mark W; Bottrell, Dale G


    Extrafloral nectaries (EFNs) in many plant species produce sugary secretions that commonly attract ants. This research determined the impact of peach (Prunus persica L. Batsch) EFNs on the biological control of the oriental fruit moth, Grapholita molesta (Busck) (Lepidoptera: Tortricidae), a key economic pest in peach orchards, and studied interactions of EFNs and ants. Studies (2002-2005) in peach orchards of the mid-Atlantic United States showed that 'Lovell' peach trees with EFNs supported more parasitic Hymenoptera in the spring and increased the parasitism of G. molesta larvae later in the season than those trees without EFNs. Ant exclusion experiments revealed that trees with EFNs harbored fewer G. molesta larvae when ants were permitted access to the tree canopies. Furthermore, the trees with EFNs had approximately 90% less fruit injury by G. molesta, indicating that EFNs have a protective role for the fruit as well. The results show that the combined actions of ants and parasitic Hymenoptera confer an EFN-mediated protective effect spanning the whole fruit growing season. When EFNs are present, naturally occurring biological control agents can reduce damage by G. molesta in peach orchards without insecticide inputs. The EFNs are an important host-plant characteristic that should be retained in future peach cultivar selections as a means of enhancing biological control.

  15. Three distinct mutational mechanisms acting on a single gene underpin the origin of yellow flesh in peach (United States)

    Falchi, Rachele; Vendramin, Elisa; Zanon, Laura; Scalabrin, Simone; Cipriani, Guido; Verde, Ignazio; Vizzotto, Giannina; Morgante, Michele


    Peach flesh color (white or yellow) is among the most popular commercial criteria for peach classification, and has implications for consumer acceptance and fruit nutritional quality. Despite the increasing interest in improving cultivars of both flesh types, little is known about the genetic basis for the carotenoid content diversity in peach. Here we describe the association between genotypes at a locus encoding the carotenoid cleavage dioxygenase 4 (PpCCD4), localized in pseudomolecule 1 of the Prunus persica reference genome sequence, and the flesh color for 37 peach varieties, including two somatic revertants, and three ancestral relatives of peach, providing definitive evidence that this locus is responsible for flesh color phenotype. We show that yellow peach alleles have arisen from various ancestral haplotypes by at least three independent mutational events involving nucleotide substitutions, small insertions and transposable element insertions, and that these mutations, despite being located within the transcribed portion of the gene, also result in marked differences in transcript levels, presumably as a consequence of differential transcript stability involving nonsense-mediated mRNA decay. The PpCCD4 gene provides a unique example of a gene for which humans, in their quest to diversify phenotypic appearance and qualitative characteristics of a fruit, have been able to select and exploit multiple mutations resulting from a variety of mechanisms. PMID:23855972

  16. Effects of exogenous polyamine and ultrasound treatment to improve peach storability

    Directory of Open Access Journals (Sweden)

    Erdinc Bal


    Full Text Available Peach (Prunus persica [L.] Batsch is a perishable product and its storage period may be extended by using different postharvest methods. For this purpose, peaches harvested at the commercial ripening stage were treated with individual and combined effects of putrescine (1 mM and ultrasonic treatment (32 kHz for 10 min; postharvest storage quality of peach fruit was evaluated during storage at 0-1 °C for 28 d. Quality characteristics such as weight loss, fruit firmness, respiration rate, total sugar, total soluble solid content, titratable acidity, chilling injury, and decay rate were determined at the beginning and during the storage period at 1-wk intervals. The result showed that individual and combined effects of putrescine and ultrasonic treatment, when compared to control fruits, could increase peach fruit postharvest life by inducing resistance to different diseases and chilling injury with no noticeable effect on fruit quality attributes such as weight loss, total soluble solids, and total sugar. At the same time, a combined putrescine and ultrasound treatment was found to be more effective than other treatments in decreasing respiration rate and maintaining firmness and acidity. Peach storability could be extended with a combined putrescine and ultrasound treatment because it delays the ripening processes.

  17. Carbon Monoxide Fumigation Improved the Quality, Nutrients, and Antioxidant Activities of Postharvest Peach

    Directory of Open Access Journals (Sweden)

    Shaoying Zhang


    Full Text Available Peaches (Prunus persica cv. Yanhong were fumigated with carbon monoxide (CO at 0, 0.5, 5, 10, and 20 μmol/L for 2 hours. The result showed that low concentration CO (0.5–10 μmol/L might delay the decrease of firmness and titrable acid content, restrain the increase of decay incidence, and postpone the variation of soluble solids content, but treating peaches with high concentration CO (20 μmol/L demonstrated adverse effects. Further research exhibited that exogenous CO could induce the phenylalnine ammonialyase activity, maintain nutrient contents such as Vitamin C, total flavonoid, and polyphenol, and enhance antioxidant activity according to reducing power and 2,2-diphenyl-1-(2,4,6-trinitrophenyl hydrazyl radical scavenging activity. Treating peaches with appropriate concentration CO was beneficial to the quality, nutrients, and antioxidant activity of postharvest peaches during storage time. Therefore, CO fumigation might probably become a novel method to preserve postharvest peach and other fruits in the future.

  18. Commercial scale irradiation for insect disinfestation preserves peach quality (United States)

    McDonald, Heather; McCulloch, Mary; Caporaso, Fred; Winborne, Ian; Oubichon, Michon; Rakovski, Cyril; Prakash, Anuradha


    Irradiation is approved as a generic quarantine treatment by the US Department of Agriculture, Animal and Plant Health Inspection Service. Due to the effectiveness of irradiation in controlling insects on commodities, there is a growing need to understand the effects of low dose irradiation on fruit quality. The goal of this study was to determine the sensitivity of peaches (Prunus persica) to irradiation, and secondly, to determine the effect of commercial scale treatment on shelf-life, overall quality and consumer liking. Six varieties of peaches were irradiated in small batches at 0.29, 0.49, 0.69 and 0.90 kGy to observe the sensitivity of peaches at different dose levels. Changes in quality were evaluated by 8 trained panelists using descriptive analysis. Sensory characteristics (color, smoothness, aroma, touch firmness, mouth firmness, graininess, overall flavor and off-flavor) were evaluated at 2-4 day intervals and untreated samples served as control. To simulate commercial treatment, peaches were irradiated in pallet quantities at a target dose level of 0.4 kGy. The average absorbed dose was 0.66 kGy with an average dose uniformity ratio of 1.57. Commercially treated peaches were evaluated by 40-80 untrained consumers for acceptability routinely throughout the shelf life. Titratable acidity, Brix, texture and weight loss were also monitored for both commercial and small scale irradiated peaches. There was no dose effect on TA, Brix and weight loss due to irradiation. Peaches irradiated at 0.69 and 0.90 kGy were darker in flesh color, more juicy and less firm as determined by the trained panel and analytical pressure tests. Commercial scale irradiation did not adversely affect shelf life but was seen to enhance ripening. This, however, was perceived as a positive change by consumers. Overall, consumers rated the acceptability of irradiated peaches higher than untreated peaches. Statistical analysis was performed using linear mixed models to find determinates

  19. Identification of woolliness response genes in peach fruit after post-harvest treatments. (United States)

    González-Agüero, Mauricio; Pavez, Leonardo; Ibáñez, Freddy; Pacheco, Igor; Campos-Vargas, Reinaldo; Meisel, Lee A; Orellana, Ariel; Retamales, Julio; Silva, Herman; González, Mauricio; Cambiazo, Verónica


    Woolliness is a physiological disorder of peaches and nectarines that becomes apparent when fruit are ripened after prolonged periods of cold storage. This disorder is of commercial importance since shipping of peaches to distant markets and storage before selling require low temperature. However, knowledge about the molecular basis of peach woolliness is still incomplete. To address this issue, a nylon macroarray containing 847 non-redundant expressed sequence tags (ESTs) from a ripe peach fruit cDNA library was developed and used. Gene expression changes of peach fruit (Prunus persica cv. O'Henry) ripened for 7 d at 21 degrees C (juicy fruit) were compared with those of fruit stored for 15 d at 4 degrees C and then ripened for 7 d at 21 degrees C (woolly fruit). A total of 106 genes were found to be differentially expressed between juicy and woolly fruit. Data analysis indicated that the activity of most of these genes (>90%) was repressed in the woolly fruit. In cold-stored peaches (cv. O'Henry), the expression level of selected genes (cobra, endopolygalacturonase, cinnamoyl-CoA-reductase, and rab11) was lower than in the juicy fruit, and it remained low in woolly peaches after ripening, a pattern that was conserved in woolly fruit from two other commercial cultivars (cv. Flamekist and cv. Elegant Lady). In addition, the results of this study indicate that molecular changes during fruit woolliness involve changes in the expression of genes associated with cell wall metabolism and endomembrane trafficking. Overall, the results reported here provide an initial characterization of the transcriptome activity of peach fruit under different post-harvest treatments.

  20. Exceso de agua en el suelo: efecto sobre la calidad del fruto del duraznero prunus persica (L.) batsch Excess water in the soil: effect on fruit quality of peach prunus persica (l.) batsch


    Mirta G González; Gisela Moreno; Giardina, Ernesto B.; Mariano Di Miro


    El duraznero es un cultivo perenne que requiere para su crecimiento un suelo sin limitaciones, en base a ello el objetivo de este trabajo fue estudiar los cambios químicos producidos en el suelo en condiciones de anegamiento, desde floración hasta fructificación, relacionándolo a la calidad y cantidad de la fruta. Se trabajó con un suelo Argiudol de características vérticas, con un destacado horizonte Bt que posee 35-38% de arcilla. Se realizaron dos tratamientos: control, sin anegamiento (C)...

  1. Comparative analysis of Solanum stoloniferum responses to probing by the green peach aphid Myzus persicae and the potato aphid Macrosiphum euphorbiae. (United States)

    Alvarez, Adriana E; Broglia, Viviana G; Alberti D'Amato, Anahí M; Wouters, Doret; van der Vossen, Edwin; Garzo, Elisa; Tjallingii, W Fred; Dicke, Marcel; Vosman, Ben


    Plants protect themselves against aphid attacks by species-specific defense mechanisms. Previously, we have shown that Solanum stoloniferum Schlechtd has resistance factors to Myzus persicae Sulzer (Homoptera: Aphididae) at the epidermal/mesophyll level that are not effective against Macrosiphum euphorbiae Thomas (Homoptera: Aphididae). Here, we compare the nymphal mortality, the pre-reproductive development time, and the probing behavior of M. persicae and M. euphorbiae on S. stoloniferum and Solanum tuberosum L. Furthermore, we analyze the changes in gene expression in S. stoloniferum 96 hours post infestation by either aphid species. Although the M. euphorbiae probing behavior shows that aphids encounter more probing constrains on phloem activities-longer probing and salivation time- on S. stoloniferum than on S. tuberosum, the aphids succeeded in reaching a sustained ingestion of phloem sap on both plants. Probing by M. persicae on S. stoloniferum plants resulted in limited feeding only. Survival of M. euphorbiae and M. persicae was affected on young leaves, but not on senescent leaves of S. stoloniferum. Infestation by M. euphorbiae changed the expression of more genes than M. persicae did. At the systemic level both aphids elicited a weak response. Infestation of S. stoloniferum plants with a large number of M. persicae induced morphological changes in the leaves, leading to the development of pustules that were caused by disrupted vascular parenchyma and surrounding tissue. In contrast, an infestation by M. euphorbiae had no morphological effects. Both plant species can be regarded as good host for M. euphorbiae, whereas only S. tuberosum is a good host for M. persicae and S. stoloniferum is not. Infestation of S. stoloniferum by M. persicae or M. euphorbiae changed the expression of a set of plant genes specific for each of the aphids as well as a set of common genes. © 2012 The Authors Insect Science © 2012 Institute of Zoology, Chinese Academy of

  2. Interactions among cooling, fungicide and postharvest ripening temperature on peaches

    Energy Technology Data Exchange (ETDEWEB)

    Fernandez-Trujillo, J. Pablo; Cano, Antonio; Artes, Francisco [Postharvest and refrigeration Lab., Dept. of Food Science and Technology, CEBAS-CSIC, Murcia (Spain)


    Peach fruit (Prunus persica L. cv. 'Miraflores') harvested at the firm-ripe stage, treated or not with 2 g l{sup -1} iprodione, were cooled or not at 1{sup o}C and ripened at 15 or 20{sup o}C and 95% RH for 10 days. During ripening, weight loss, fungal development and changes in quality parameters (firmness, soluble solids content, titratable acidity, pH and ground and flesh color), and carbon dioxide and ethylene production were monitored. Cooling alone or combined with iprodione avoided Rhizopus nigricans decay during ripening at either ripening temperatures. A skin damage not previously reported on fungicide treated peach was observed at 20{sup o}C. Cooled fruit ripened at 15{sup o}C showed an anomalous respiration rate and ethylene production after the climacteric peak, a loss of firmness and a drop in titratable acidity after 7 days of storage, and reduced endo-polygalacturonase activity in presence of continuous pectinmethylesterase activity during the first week. Cooling before ripening at 20{sup o}C led to the best flavor without excessive total losses. These results helped in the optimization of warming cycles during cold storage used to avoid chilling injuries development on peaches. (Author)

  3. [Genome-wide identification and expression analysis of the WRKY gene family in peach]. (United States)

    Gu, Yan-bing; Ji, Zhi-rui; Chi, Fu-mei; Qiao, Zhuang; Xu, Cheng-nan; Zhang, Jun-xiang; Zhou, Zong-shan; Dong, Qing-long


    The WRKY transcription factors are one of the largest families of transcriptional regulators and play diverse regulatory roles in biotic and abiotic stresses, plant growth and development processes. In this study, the WRKY DNA-binding domain (Pfam Database number: PF03106) downloaded from Pfam protein families database was exploited to identify WRKY genes from the peach (Prunus persica 'Lovell') genome using HMMER 3.0. The obtained amino acid sequences were analyzed with DNAMAN 5.0, WebLogo 3, MEGA 5.1, MapInspect and MEME bioinformatics softwares. Totally 61 peach WRKY genes were found in the peach genome. Our phylogenetic analysis revealed that peach WRKY genes were classified into three Groups: Ⅰ, Ⅱ and Ⅲ. The WRKY N-terminal and C-terminal domains of Group Ⅰ (group I-N and group I-C) were monophyletic. The Group Ⅱ was sub-divided into five distinct clades (groupⅡ-a, Ⅱ-b, Ⅱ-c, Ⅱ-d and Ⅱ-e). Our domain analysis indicated that the WRKY regions contained a highly conserved heptapeptide stretch WRKYGQK at its N-terminus followed by a zinc-finger motif. The chromosome mapping analysis showed that peach WRKY genes were distributed with different densities over 8 chromosomes. The intron-exon structure analysis revealed that structures of the WRKY gene were highly conserved in the peach. The conserved motif analysis showed that the conserved motifs 1, 2 and 3, which specify the WRKY domain, were observed in all peach WRKY proteins, motif 5 as the unknown domain was observed in group Ⅱ-d, two WRKY domains were assigned to GroupⅠ. SqRT-PCR and qRT-PCR results indicated that 16 PpWRKY genes were expressed in roots, stems, leaves, flowers and fruits at various expression levels. Our analysis thus identified the PpWRKY gene families, and future functional studies are needed to reveal its specific roles.

  4. Transcriptome Analysis of Differentially Expressed Genes Relevant to Variegation in Peach Flowers (United States)

    Yu, Faxin; Li, Shuxian; Yin, Tongming


    Background Variegation in flower color is commonly observed in many plant species and also occurs on ornamental peaches (Prunus persica f. versicolor [Sieb.] Voss). Variegated plants are highly valuable in the floricultural market. To gain a global perspective on genes differentially expressed in variegated peach flowers, we performed large-scale transcriptome sequencing of white and red petals separately collected from a variegated peach tree. Results A total of 1,556,597 high-quality reads were obtained, with an average read length of 445 bp. The ESTs were assembled into 16,530 contigs and 42,050 singletons. The resulting unigenes covered about 60% of total predicted genes in the peach genome. These unigenes were further subjected to functional annotation and biochemical pathway analysis. Digital expression analysis identified a total of 514 genes differentially expressed between red and white flower petals. Since peach flower coloration is determined by the expression and regulation of structural genes relevant to flavonoid biosynthesis, a detailed examination detected four key structural genes, including C4H, CHS, CHI and F3H, expressed at a significantly higher level in red than in white petal. Except for the structural genes, we also detected 11 differentially expressed regulatory genes relating to flavonoid biosynthesis. Using the differentially expressed structural genes as the test objects, we validated the digital expression results by using quantitative real-time PCR, and the differential expression of C4H, CHS and F3H were confirmed. Conclusion In this study, we generated a large EST collection from flower petals of a variegated peach. By digital expression analysis, we identified an informative list of candidate genes associated with variegation in peach flowers, which offered a unique opportunity to uncover the genetic mechanisms underlying flower color variegation. PMID:24603808

  5. Do asexual morphs of the peach-potato aphid, Myzus persicae, utilise the aphid sex pheromone? Behavioural and electrophysiological responses of M. persicae virginoparae to (4aS,7S,7aR)-nepetalactone and its effect on aphid performance. (United States)

    Fernández-Grandon, G Mandela; Woodcock, Christine M; Poppy, Guy M


    The aphid sex pheromone component (4aS,7S,7aR)-nepetalactone is considered to be a potential tool for enhancing biological control of aphids. Studies have confirmed its potential to attract parasitoids, increase parasitism rates in the field and also alter the spatial distribution of parasitoids. An important aspect that has been overlooked is the impact that the introduction of nepetalactone may have on aphid populations already present in field or glasshouse environments. The most prevalent pest aphid populations in glasshouse and field environments are the asexual morphs, which are capable of exponential growth if populations are not controlled. The short-term implications of the sex pheromone on asexual aphids were observed through their behavioural response. Using Y-tube olfactometry, it is shown that virginoparae of the peach-potato aphid, Myzus persicae, are repelled by high concentrations of nepetalactone. Long-term effects of the pheromone which may span the aphid's life, or even generations, were assessed via mean relative growth rate (MRGR) and the intrinsic rate of natural increase (rm). Electroantennography also demonstrated that asexual female aphids are able to detect aphid sex pheromone components. To our knowledge, this is the first time it has been reported that M. persicae virginoparae are able to detect aphid sex pheromone components or that their behavioural response and/or performance has been studied. The implications of these results and their significance in understanding semiochemical communication are discussed.

  6. Mutation scanning of peach floral genes

    Directory of Open Access Journals (Sweden)

    Wilde H Dayton


    Full Text Available Abstract Background Mutation scanning technology has been used to develop crop species with improved traits. Modifications that improve screening throughput and sensitivity would facilitate the targeted mutation breeding of crops. Technical innovations for high-resolution melting (HRM analysis are enabling the clinic-based screening for human disease gene polymorphism. We examined the application of two HRM modifications, COLD-PCR and QMC-PCR, to the mutation scanning of genes in peach, Prunus persica. The targeted genes were the putative floral regulators PpAGAMOUS and PpTERMINAL FLOWER I. Results HRM analysis of PpAG and PpTFL1 coding regions in 36 peach cultivars found one polymorphic site in each gene. PpTFL1 and PpAG SNPs were used to examine approaches to increase HRM throughput. Cultivars with SNPs could be reliably detected in pools of twelve genotypes. COLD-PCR was found to increase the sensitivity of HRM analysis of pooled samples, but worked best with small amplicons. Examination of QMC-PCR demonstrated that primary PCR products for further analysis could be produced from variable levels of genomic DNA. Conclusions Natural SNPs in exons of target peach genes were discovered by HRM analysis of cultivars from a southeastern US breeding program. For detecting natural or induced SNPs in larger populations, HRM efficiency can be improved by increasing sample pooling and template production through approaches such as COLD-PCR and QMC-PCR. Technical advances developed to improve clinical diagnostics can play a role in the targeted mutation breeding of crops.

  7. Postharvest Sensory and Phenolic Characterization of ‘Elegant Lady’ and ‘Carson’ Peaches Caracterización Fenólica y Sensorial en Poscosecha de Duraznos ‘Elegant Lady’ y ‘Carson’


    Rodrigo Infante; Loreto Contador; Pía Rubio; Danilo Aros; Álvaro Peña-Neira


    High quality fruits are increasingly demanded along with the need to ensure this attribute to consumers. Thus, this study was aimed at characterizing a melting (‘Elegant Lady’) and a non-melting flesh (‘Carson’) peach (Prunus persica (L.) Batsch) varieties by considering both their bioactive compound contribution and their sensory quality in ripe fruit at harvest and after a prolonged period of cold storage. Cultivars were evaluated at harvest (F0) and after 30 d of cold storage (F30), as wel...

  8. Isolation and characterization of a TERMINAL FLOWER 1 homolog from Prunus serotina Ehrh. (United States)

    Wang, Ying; Pijut, Paula M


    Flowering control is one of the several strategies for gene containment of transgenic plants. TERMINAL FLOWER 1 (TFL1) is known to be involved in the transcriptional repression of genes for inflorescence development. Two TFL1 transcripts with different 3' UTR were cloned from black cherry (Prunus serotina Ehrh.) using reverse transcription-polymerase chain reaction (RT-PCR) and rapid amplification of cDNA ends (RACE). Corresponding to the two TFL1 transcripts, two PsTFL1 gene sequences, 1248 bp and 1579 bp, were obtained and both contained the same 519 bp coding region which encoded a putative protein of 172 amino acid residues. The phylogenetic analysis of the amino acid sequences showed high identity of PsTFL1 to TFL1 orthologs of other Prunus species, including Yoshino cherry (Prunus × yedoensis Matsum.), peach (Prunus persica (L.) Batsch), apricot (Prunus armeniaca L.) and Japanese apricot (Prunus mume Sieb. et Zucc.). The real-time quantitative PCR detected a single copy of PsTFL1 gene sequences in the black cherry genome with two alleles. The gene expression of PsTFL1 was examined in several tissues including the stems, leaves, shoot tips, and vegetative and floral buds. The highest mRNA level was detected in shoot tips, and the lowest level in the leaves. Transgenic Arabidopsis thaliana (L.) Heynh. plants overexpressing PsTFL1 showed significantly delayed flowering. These plants also showed largely increased vegetative growth, plant height, number of nodes, trichome density, and the conversion of flower to shoot was observed at each node and shoot apex.

  9. Evaluation of Adaptability, and Vegetative and Generative Traits of Some Peach Cultivars under Meshkinshahr Environmental Condition

    Directory of Open Access Journals (Sweden)

    H. Fathi


    Full Text Available Peach [Prunus persica (L. Batsch] is one of the important stone fruits cultivated in subtropical and temperate zones. In temperate zones, peach faces many problems such as late spring cold, incompatibility, low quality, quantity and low yield. In order to select the best peach cultivars in Meshkinshahr, 25 cultivars of peach were planted in Simple Lattice design (SLD with two replications and 25 experimental blocks with four trees in each block and 3×4 m spacing. In 3 years’ research (from 2008- 2010 vegetative traits such as trunk diameter, annual growth, tree height and canopy extension and repoductive traits (beginning and ending of flowering, flowering period, harvest date, fruit growth period, yield, TSS, acidity, flesh and skin color were evaluated. After combined analysis of variance, most cultivars showed proper morphological and pomological compatibility in the studied zone. SunCrest, Dixired, Robin, SpringCrest, Earligold, Amesdn, Alberta, Earlired, Red top, Baby gold 7 and Paeez e Meshkin cultivars showed the best compatibility of vegetative traits. J. H. Hale, Red skin, Loring, Red top, Dixired, Baby gold 7, SunCrest and Meril sundans had the highest yield. SpringCrest, Earliglo, Dixired and Earlired were recommended as early cultivars, Alberta, Loring, Redtop, Baby gold 7 and SunCrest as midseason cultivars, and J. H. Hale, Red skin, Meril sundans and Paeez e Meshkin as late season cultivars. Therefore, the latter cultivars are recommended for planting new orchards.

  10. Genetic variation in target-site resistance to pyrethroids and pirimicarb in Tunisian populations of the peach potato aphid, Myzus persicae (Sulzer) (Hemiptera: Aphididae). (United States)

    Charaabi, Kamel; Boukhris-Bouhachem, Sonia; Makni, Mohamed; Fenton, Brian; Denholm, Ian


    We used molecular assays to diagnose resistance to pyrethroids and pirimicarb in samples of Myzus persicae from field crops or an insect suction trap in Tunisia. Genotypes for resistance loci were related to ones for polymorphic microsatellite loci in order to investigate breeding systems and patterns of genetic diversity, and to inform resistance management tactics. The kdr mutation L1014F conferring pyrethroid resistance was found in all samples. The M918T s-kdr mutation also occurred in most samples, but only in conjunction with kdr. We discovered a previously unreported genotype heterozygous for L1014F but homozygous for M918T. Samples with modified acetylcholinesterase (MACE) conferring resistance to pirimicarb were less common but widespread. 16% of samples contained both the kdr and MACE mutations. Many unique microsatellite genotypes were found, suggesting that M. persicae is holocyclic in Tunisia. There were no consistent associations between resistance and microsatellite markers. This first study of insecticide resistance in M. persicae in North Africa showed genetic variation in insecticide resistance within microsatellite multilocus genotypes (MLG M s) and the same resistance mechanisms to be present in different MLG M s. This contrasts with variation in northern Europe where M. persicae is fully anholocyclic. Implications for selection and control strategies are discussed. © 2016 Society of Chemical Industry. © 2016 Society of Chemical Industry.

  11. Prunus domestica, Prunus persica and Prunus avium extracts ...

    African Journals Online (AJOL)

    water emulsions. DPPH (2, 2-diphenyl-1-picrylhydrazyl) ... Test formulations containing fruit extracts (6%) showed good stability compared to control formulations and pH and conductivity were found as desired. Formulations were studied for patch ...


    Directory of Open Access Journals (Sweden)

    Danilo Couto


    Full Text Available

    O efeito de cinco inseticidas aplicados no tomateiro (Lycopersicum sculentum Mill, visando ao controle do pulgão verde, Myzus persicae SULZER e de vaquinha, Diabrotica speciosa GERM, foi testado em um experimento realizado na área experimental do Departamento de Horticultura da Escota de Agronomia da Universidade Federal de Goiás, no período de maio a setembro de 1994. Os tratamentos foram aplicados via pulverização e constaram de Bulldock 125 SC (dosagem de 100 ml/ 100 1 de água; Bulldock 50 CE (25 e 30 ml/100 l de água; Tamaron BR (100 ml/ 100 l de água; Orthene 750 BR (100 ml/ l00 1 de água e Folidol 600 (100 ml/l00 1 de água; e ainda uma testemunha (sem inseticida. Os resultados obtidos mostraram que todos os tratamentos foram eficientes no controle de M. persicae até sete dias após a aplicação. Aos 14 dias após a aplicação, o Bulldock 50 CE na dosagem de 25 ml/ 100 l de água e o Folidol 600 a 100 ml/ 100 l de água não apresentaram eficiência satisfatória. Com relação à D. speciosa, todos esses produtos foram igualmente eficientes até sete dias após aplicação.

    PALAVRAS-CHAVE: Myzus persicae; diabrotica speciosa; tomateiro; controle químico.

    A trial to control the green peach aphid myzus persicae and tomato leaf beetle Diabrotica speciosa was carried out in Goi

  13. Comparison of Peach Cultivars for Provision of Extrafloral Nectar Resources to Harmonia axyridis (Coleoptera: Coccinellidae). (United States)

    Mathews, Clarissa R; Brown, Mark W; Wäckers, Felix L


    Incorporating nonprey sugar resources into apple orchards is a potential means of enhancing biological control services, but little is known about the impacts of extrafloral nectars on aphidophagous coccinellids. We explored peach Prunus persica (L.) Batsch extrafloral nectar as a supplemental resource for Harmonia axyridis (Pallas), a key aphid predator in the mid-Atlantic United States. Extrafloral nectar quantity, temporal production, and carbohydrate profile were assessed for four peach cultivars in orchard and greenhouse culture. Seasonal densities of H. axyridis visiting extrafloral nectaries were estimated, and the propensity of beetles to feed upon extrafloral nectar was compared by cultivar in the laboratory. We also compared survival of newly eclosed adult pairs that were starved or fed aphids with or without extrafloral nectar. Peach extrafloral nectar contained six carbohydrates, with sucrose dominant for all cultivars, but extrafloral nectar production varied significantly by cultivar and collection date, with 'Lovell' yielding higher average seasonal volume than the other cultivars. Harmonia axyridis continuously foraged on peach trees lacking prey, and beetle abundance was positively correlated with the number of leaves actively producing extrafloral nectar. In laboratory assays, newly emerged adult beetles preferentially selected and consumed extrafloral nectar of Lovell peach shoots. Furthermore, when prey were initially unavailable to adult H. axyridis, the beetles were sustained by extrafloral nectar and experienced longer survival compared with beetles without the supplemental resource. Collectively, these results suggest that peach extrafloral nectar is a beneficial resource that could potentially sustain H. axyridis in orchards when prey are scarce. © The Authors 2016. Published by Oxford University Press on behalf of Entomological Society of America. All rights reserved. For Permissions, please email:

  14. Development and Fecundity Performance of Oriental Fruit Moth (Lepidoptera: Tortricidae) Reared on Shoots and Fruits of Peach and Pear in Different Seasons. (United States)

    Du, Juan; Li, Guangwei; Xu, Xiangli; Wu, Junxiang


    The oriental fruit moth Grapholita molesta (Busck) is a globally important insect pest. In some parts of its geographic range, the oriental fruit moth shifts its attack from peach orchards to pear orchards late in the growing season. The phenological effects of host plants on the performance of the moth were evaluated by examining the development and fecundity of the moth reared on peach (Prunus persica variety "Shahong") and pear (Pyrus bretshneideri variety "Dangshan Su") collected at various times of the growing season under laboratory conditions. Results showed that the moth developed faster on shoots and fruits of peach than on those of pear. The preimaginal survival rate was the highest on peach shoots, and the moth could not survive on pear fruit collected on May 10. For both peach and pear, the boring rates of neonatal larvae were significantly higher on shoots than on fruits, and the pupal mass of females was significantly higher on fruits than on shoots. The boring rate increased with pear fruits growing during later days. Fecundity was significantly less on pear shoots than on the other plant materials. The results of this study suggest a possible host adaptation process in oriental fruit moth. © The Authors 2015. Published by Oxford University Press on behalf of Entomological Society of America. All rights reserved. For Permissions, please email:

  15. Characterization of polymorphic SSRs among Prunus chloroplast genomes (United States)

    An in silico mining process yielded 80, 75, and 78 microsatellites in the chloroplast genome of Prunus persica, P. kansuensis, and P. mume. A and T repeats were predominant in the three genomes, accounting for 67.8% on average and most of them were successful in primer design. For the 80 P. persica ...

  16. Deciphering the interplay among genotype, maturity stage and low-temperature storage on phytochemical composition and transcript levels of enzymatic antioxidants in Prunus persica fruit. (United States)

    Manganaris, George A; Drogoudi, Pavlina; Goulas, Vlasios; Tanou, Georgia; Georgiadou, Egli C; Pantelidis, George E; Paschalidis, Konstantinos A; Fotopoulos, Vasileios; Manganaris, Athanasios


    The aim of this study was to understand the antioxidant metabolic changes of peach (cvs. 'Royal Glory', 'Red Haven' and 'Sun Cloud') and nectarine fruits (cv. 'Big Top') exposed to different combinations of low-temperature storage (0, 2, 4 weeks storage at 0 °C, 90% R.H.) and additional ripening at room temperature (1, 3 and 5 d, shelf life, 20 °C) with an array of analytical, biochemical and molecular approaches. Initially, harvested fruit of the examined cultivars were segregated non-destructively at advanced and less pronounced maturity stages and qualitative traits, physiological parameters, phytochemical composition and antioxidant capacity were determined. 'Big Top' and 'Royal Glory' fruits were characterized by slower softening rate and less pronounced ripening-related alterations. The coupling of HPLC fingerprints, consisted of 7 phenolic compounds (chlorogenic, neochlorogenic acid, catechin, epicatechin, rutin, quecetin-3-O-glucoside, procyanidin B1) and spectrophotometric methods disclosed a great impact of genotype on peach bioactive composition, with 'Sun Cloud' generally displaying the highest contents. Maturity stage at harvest did not seem to affect fruit phenolic composition and no general guidelines for the impact of cold storage and shelf-life on individual phenolic compounds can be extrapolated. Subsequently, fruit of less pronounced maturity at harvest were used for further molecular analysis. 'Sun Cloud' was proven efficient in protecting plasmid pBR322 DNA against ROO attack throughout the experimental period and against HO attack after 2 and 4 weeks of cold storage. Interestingly, a general down-regulation of key genes implicated in the antioxidant apparatus with the prolongation of storage period was recorded; this was more evident for CAT, cAPX, Cu/ZnSOD2, perAPX3 and GPX8 genes. Higher antioxidant capacity of 'Sun Cloud' fruit could potentially be linked with compounds other than enzymatic antioxidants that further regulate peach

  17. Variation in minerals, phenolics and antioxidant activity of peel and pulp of different varieties of peach (Prunus persica L.) fruit from Pakistan

    National Research Council Canada - National Science Library

    Manzoor, Maleeha; Anwar, Farooq; Mahmood, Zahed; Rashid, Umer; Ashraf, Muhammad


    .... In this study variation of minerals and antioxidant characteristics (total phenolic contents, total flavonoid contents, reducing power, inhibition of peroxidation using linoleic acid system and DPPH free radical scavenging activity...

  18. Ecotopic expression of a novel peach (Prunus persica) CBF transcription factor in apple (Malus x domestica) results in short-day induced dormancy and increased cold hardiness (United States)

    Regulation of growth and dormancy in temperate perennials such as fruit trees is essential, as is the ability to acclimate to freezing temperatures. Depending on the species, the onset of either dormancy and or cold acclimation can be triggered to varying degrees by either or both low, non-freezing...

  19. Overexpression of a peach (Prunus persica) AP2/ERF-family transcription factor in apple (Malus x domestica) induces growth cessation in response to short photoperiod (United States)

    Climate change will result in extreme swings in temperature during late fall and early spring that will have a negative impact on woody plants. Apple may be especially sensitive to the predicted weather patterns since growth cessation is regulated by low temperature rather than daylength. We have ...

  20. Insecticidal and Synergistic Activities of Two Essential Oils from Pistacia lentiscus and Mentha pulegium Against the Green Peach Aphid Myzus persicae


    Fatma Behi; Olfa Bachrouch; Ibtissem Ben Fekih; Sonia Boukhris-Bouhachem


    Chemical composition of two essential oils (EOs) extracted from Mentha pulegium and Pistacia lentiscus was investigated. Volatile compounds were characterized. Major ones were pulegone (45.89%), cis-menthone (23.25 %) and trans-menthone (14.73 %) for M. pulegium and α-pinene (28.57%), β-myrcene (21.03%) and L-limonene (6.97%) for P. lentiscus. Then, the insecticidal and synergistic activities of the EOs were studied against Myzus persicae. The results showed that both EOs were ...

  1. Application of GFP-tagged Plum pox virus to study Prunus-PPV interactions at the whole plant and cellular levels. (United States)

    Lansac, M; Eyquard, J P; Salvador, B; Garcia, J A; Le Gall, O; Decroocq, V; Schurdi-Levraud Escalettes, V


    The Sharka disease caused by the potyvirus Plum pox virus (PPV) is one of the most serious viral diseases affecting stone fruit trees. The study of PPV/Prunus interaction under greenhouse controlled conditions is space, time, labor consuming. While the PPV/Prunus interactions are now quite well known at the whole plant level, few data however are available on the interactions between the virus and the Prunus host plants at the cellular level. Using a green fluorescent protein (GFP)-tagged M type PPV strain, combined to an in vitro inoculation procedure, we developed a novel tool to track PPV invasion in Prunus persica (peach) cv. GF305 and Prunus armeniaca (apricot) cv. Screara susceptible hosts. Different graft combinations were performed using in vitro-maintained healthy or GFP-tagged PPV infected 'GF305' and 'Screara'. Contact for 30 days in grafts between the inoculum and the genotype to be tested were found sufficient to allow the systemic spread of the recombinant virus: fluorescence from GFP-tagged PPV could easily be detected in the entire plant under a binocular microscope allowing quick and reliable sorting of infected plants. Using a fluorescence stereomicroscopy or confocal microscopy, GFP could also be observed in stem cross-sections especially in epidermis and pith cells. In vitro grafting inoculation with GFP-tagged PPV provides a new and powerful tool to facilitate mid-term virus maintenance. Moreover, this tool will be of special importance in the study of PPV infection dynamics in Prunus, allowing as well precise observations of cellular events related to PPV/Prunus interactions.

  2. Caracterização de três genótipos de umezeiro (Prunus mume Sieb. et Zucc. por marcadores RAPD Characterization of three mume genotypes (Prunus mume Sieb. et Zucc. by RAPD markers

    Directory of Open Access Journals (Sweden)

    Newton Alex Mayer


    Full Text Available Um projeto de pesquisa visando à utilização de clones de umezeiro (Prunus mume Sieb. et Zucc. como porta-enxertos para pessegueiro [Prunus persica (L. Batsch] está sendo conduzido na FCAV/UNESP, Câmpus de Jaboticabal-SP, com promissoras perspectivas de sucesso. Três genótipos de umezeiro foram selecionados de acordo com características agronômicas desejáveis para esta finalidade. A distinção dos três genótipos entre si, baseada exclusivamente em características morfológicas, apresenta limitações. Dessa forma, o objetivo do presente trabalho foi identificar marcadores RAPD capazes de diferenciar e caracterizar os Clones 05, 15 e a cv. Rigitano (Clone 10 de umezeiro, utilizando-se das cultivares Aurora-1 e Okinawa de pessegueiro como outgroup. Dos 220 primers testados, foram selecionados 42, que amplificaram todos os cinco genótipos. Verificou-se que os marcadores RAPD permitiram a distinção entre o Clone 05, o Clone 15 e a cv. Rigitano de umezeiro, demonstrando a existência de variabilidade genética entre os mesmos. Dentre os três genótipos de umezeiro estudados, constatou-se que a similaridade genética é maior entre o Clone 05 e o Clone 15.A research project with the objective do develop mume clones (Prunus mume Sieb. et Zucc., to be used as rootstocks for peach tree [Prunus persica (L. Batsch] is been carried out at the Faculdade de Ciências Agrárias e Veterinárias (FCAV/UNESP, Jaboticabal Campus, São Paulo State, Brazil. These project showed promising perspectives of success, with three clones that were selected according to their characteristics for peach rootstock. But the distinction of the three clones among them, based only in morphologic characteristics, has presented limitations. The objective of the present research was to identify RAPD markers able to characterize and differentiate the 05 and 15 Clones and Rigitano mume cultivar, using Aurora-1 and Okinawa peach tree as outgroup. Among the 220 tested

  3. Harpin-induced expression and transgenic overexpression of the phloem protein gene AtPP2-A1 in Arabidopsis repress phloem feeding of the green peach aphid Myzus persicae (United States)


    Background Treatment of plants with HrpNEa, a protein of harpin group produced by Gram-negative plant pathogenic bacteria, induces plant resistance to insect herbivores, including the green peach aphid Myzus persicae, a generalist phloem-feeding insect. Under attacks by phloem-feeding insects, plants defend themselves using the phloem-based defense mechanism, which is supposed to involve the phloem protein 2 (PP2), one of the most abundant proteins in the phloem sap. The purpose of this study was to obtain genetic evidence for the function of the Arabidopsis thaliana (Arabidopsis) PP2-encoding gene AtPP2-A1 in resistance to M. persicae when the plant was treated with HrpNEa and after the plant was transformed with AtPP2-A1. Results The electrical penetration graph technique was used to visualize the phloem-feeding activities of apterous agamic M. persicae females on leaves of Arabidopsis plants treated with HrpNEa and an inactive protein control, respectively. A repression of phloem feeding was induced by HrpNEa in wild-type (WT) Arabidopsis but not in atpp2-a1/E/142, the plant mutant that had a defect in the AtPP2-A1 gene, the most HrpNEa-responsive of 30 AtPP2 genes. In WT rather than atpp2-a1/E/142, the deterrent effect of HrpNEa treatment on the phloem-feeding activity accompanied an enhancement of AtPP2-A1 expression. In PP2OETAt (AtPP2-A1-overexpression transgenic Arabidopsis thaliana) plants, abundant amounts of the AtPP2-A1 gene transcript were detected in different organs, including leaves, stems, calyces, and petals. All these organs had a deterrent effect on the phloem-feeding activity compared with the same organs of the transgenic control plant. When a large-scale aphid population was monitored for 24 hours, there was a significant decrease in the number of aphids that colonized leaves of HrpNEa-treated WT and PP2OETAt plants, respectively, compared with control plants. Conclusions The repression in phloem-feeding activities of M. persicae as a result

  4. Harpin-induced expression and transgenic overexpression of the phloem protein gene AtPP2-A1 in Arabidopsis repress phloem feeding of the green peach aphid Myzus persicae

    Directory of Open Access Journals (Sweden)

    Sun Weiwei


    Full Text Available Abstract Background Treatment of plants with HrpNEa, a protein of harpin group produced by Gram-negative plant pathogenic bacteria, induces plant resistance to insect herbivores, including the green peach aphid Myzus persicae, a generalist phloem-feeding insect. Under attacks by phloem-feeding insects, plants defend themselves using the phloem-based defense mechanism, which is supposed to involve the phloem protein 2 (PP2, one of the most abundant proteins in the phloem sap. The purpose of this study was to obtain genetic evidence for the function of the Arabidopsis thaliana (Arabidopsis PP2-encoding gene AtPP2-A1 in resistance to M. persicae when the plant was treated with HrpNEa and after the plant was transformed with AtPP2-A1. Results The electrical penetration graph technique was used to visualize the phloem-feeding activities of apterous agamic M. persicae females on leaves of Arabidopsis plants treated with HrpNEa and an inactive protein control, respectively. A repression of phloem feeding was induced by HrpNEa in wild-type (WT Arabidopsis but not in atpp2-a1/E/142, the plant mutant that had a defect in the AtPP2-A1 gene, the most HrpNEa-responsive of 30 AtPP2 genes. In WT rather than atpp2-a1/E/142, the deterrent effect of HrpNEa treatment on the phloem-feeding activity accompanied an enhancement of AtPP2-A1 expression. In PP2OETAt (AtPP2-A1-overexpression transgenic Arabidopsis thaliana plants, abundant amounts of the AtPP2-A1 gene transcript were detected in different organs, including leaves, stems, calyces, and petals. All these organs had a deterrent effect on the phloem-feeding activity compared with the same organs of the transgenic control plant. When a large-scale aphid population was monitored for 24 hours, there was a significant decrease in the number of aphids that colonized leaves of HrpNEa-treated WT and PP2OETAt plants, respectively, compared with control plants. Conclusions The repression in phloem-feeding activities of

  5. De novo transcriptome assembly of two different peach cultivars grown in Korea

    Directory of Open Access Journals (Sweden)

    Yeonhwa Jo


    Full Text Available Peach (Prunus persica is one of the most popular stone fruits worldwide. Next generation sequencing (NGS has facilitated genome and transcriptome analyses of several stone fruit trees. In this study, we conducted de novo transcriptome analyses of two peach cultivars grown in Korea. Leaves of two cultivars, referred to as Jangtaek and Mibaek, were harvested and used for library preparation. The two prepared libraries were paired-end sequenced by the HiSeq2000 system. We obtained 8.14 GB and 9.62 GB sequence data from Jangtaek and Mibaek (NCBI accession numbers: SRS1056585 and SRS1056587, respectively. The Trinity program was used to assemble two transcriptomes de novo, resulting in 110,477 (Jangtaek and 136,196 (Mibaek transcripts. TransDecoder identified possible coding regions in assembled transcripts. The identified proteins were subjected to BLASTP search against NCBI's non-redundant database for functional annotation. This study provides transcriptome data for two peach cultivars, which might be useful for genetic marker development and comparative transcriptome analyses.

  6. Adaptation to nicotine feeding in Myzus persicae. (United States)

    Ramsey, John S; Elzinga, Dezi A; Sarkar, Pooja; Xin, Yi-Ran; Ghanim, Murad; Jander, Georg


    Lineages of the generalist hemipteran herbivore Myzus persicae (green peach aphid) that have expanded their host range to include tobacco often have elevated nicotine tolerance. The tobacco-adapted M. persicae lineage used in this study was able to reproduce on nicotine-containing artificial diets at concentrations that were 15-fold higher than those that were lethal to a non-adapted M. persicae lineage. Fecundity of the nicotine-tolerant M. persicae lineage was increased by 100 μM nicotine in artificial diet, suggesting that this otherwise toxic alkaloid can serve as a feeding stimulant at low concentrations. This lineage also was pre-adapted to growth on tobacco, exhibiting no drop in fecundity when it was moved onto tobacco from a different host plant. Although growth of the non-tobacco-adapted M. persicae lineage improved after three generations on tobacco, this higher reproductive rate was not associated with increased nicotine tolerance. Myzus persicae gene expression microarrays were used to identify transcripts that are up-regulated in response to nicotine in the tobacco-adapted lineage. Induced expression was found for CYP6CY3, which detoxifies nicotine in M. persicae, other genes encoding known classes of detoxifying enzymes, and genes encoding secreted M. persicae salivary proteins.

  7. Use of electrical penetration graphs (EPG) and quantitative PCR to evaluate the relationship between feeding behaviour and Pandora neoaphidis infection levels in green peach aphid, Myzus persicae. (United States)

    Chen, Chun; Ye, Sudan; Hu, Huajun; Xue, Chengmei; Yu, Xiaoping


    A real-time qPCR method was developed, validated, and used to quantity the fungal pathogen, P. neoaphidis, within aphids at different times during infection; colonization rate fitted the Gompertz model well (R 2  = 0.9356). Feeding behaviour of P. neoaphidis-infected and uninfected M. persicae were investigated, for the first time, using DC-electrical penetration graphs (DC-EPG) that characterized the waveforms made during different aphid stylet probing periods corresponding to epidermis penetration, salivation and ingestion. In the 6 h following the 12-h incubation period (to achieve infection), there were significant differences in the number of events of Np (non-probing) and C (stylet pathway) between infected and uninfected aphids. However, the difference between total duration of Np and C were not significantly different between infected and uninfected aphids. There were no significant differences in the number of events or total duration of E1 (phloem salivation) or E2 (phloem ingestion) between infected and uninfected aphids. There were significant differences in mean number of events and total duration of the pd waveform (intracellular punctures) in infected and uninfected aphids. In the 16 h prior to death, the same differences in behaviour were observed but they were even more obvious. Furthermore, the total duration time of E2 was significantly greater in uninfected aphids than infected aphids, a change that had not been observed in the first 6 h observation period. In conclusion, qPCR quantification demonstrated 'molecular' colonization levels throughout infection, and EPG data analysis during the two periods (during early infection and then during late infection just prior to death) demonstrated the actual physical effects of fungal infection on feeding behaviour of M. persicae; this has the potential to decrease the aphid's capacity of transmission and dispersal. These studies increase our understanding of the interaction between P

  8. New insights into the properties of pubescent surfaces: peach fruit as a model. (United States)

    Fernández, Victoria; Khayet, Mohamed; Montero-Prado, Pablo; Heredia-Guerrero, José Alejandro; Liakopoulos, Georgios; Karabourniotis, George; Del Río, Víctor; Domínguez, Eva; Tacchini, Ignacio; Nerín, Cristina; Val, Jesús; Heredia, Antonio


    The surface of peach (Prunus persica 'Calrico') is covered by a dense indumentum, which may serve various protective purposes. With the aim of relating structure to function, the chemical composition, morphology, and hydrophobicity of the peach skin was assessed as a model for a pubescent plant surface. Distinct physicochemical features were observed for trichomes versus isolated cuticles. Peach cuticles were composed of 53% cutan, 27% waxes, 23% cutin, and 1% hydroxycinnamic acid derivatives (mainly ferulic and p-coumaric acids). Trichomes were covered by a thin cuticular layer containing 15% waxes and 19% cutin and were filled by polysaccharide material (63%) containing hydroxycinnamic acid derivatives and flavonoids. The surface free energy, polarity, and work of adhesion of intact and shaved peach surfaces were calculated from contact angle measurements of water, glycerol, and diiodomethane. The removal of the trichomes from the surface increased polarity from 3.8% (intact surface) to 23.6% and decreased the total surface free energy chiefly due to a decrease on its nonpolar component. The extraction of waxes and the removal of trichomes led to higher fruit dehydration rates. However, trichomes were found to have a higher water sorption capacity as compared with isolated cuticles. The results show that the peach surface is composed of two different materials that establish a polarity gradient: the trichome network, which has a higher surface free energy and a higher dispersive component, and the cuticle underneath, which has a lower surface free energy and higher surface polarity. The significance of the data concerning water-plant surface interactions is discussed within a physiological context.

  9. Genome-wide association links candidate genes to resistance to Plum Pox Virus in apricot (Prunus armeniaca). (United States)

    Mariette, Stéphanie; Wong Jun Tai, Fabienne; Roch, Guillaume; Barre, Aurélien; Chague, Aurélie; Decroocq, Stéphane; Groppi, Alexis; Laizet, Yec'han; Lambert, Patrick; Tricon, David; Nikolski, Macha; Audergon, Jean-Marc; Abbott, Albert G; Decroocq, Véronique


    In fruit tree species, many important traits have been characterized genetically by using single-family descent mapping in progenies segregating for the traits. However, most mapped loci have not been sufficiently resolved to the individual genes due to insufficient progeny sizes for high resolution mapping and the previous lack of whole-genome sequence resources of the study species. To address this problem for Plum Pox Virus (PPV) candidate resistance gene identification in Prunus species, we implemented a genome-wide association (GWA) approach in apricot. This study exploited the broad genetic diversity of the apricot (Prunus armeniaca) germplasm containing resistance to PPV, next-generation sequence-based genotyping, and the high-quality peach (Prunus persica) genome reference sequence for single nucleotide polymorphism (SNP) identification. The results of this GWA study validated previously reported PPV resistance quantitative trait loci (QTL) intervals, highlighted other potential resistance loci, and resolved each to a limited set of candidate genes for further study. This work substantiates the association genetics approach for resolution of QTL to candidate genes in apricot and suggests that this approach could simplify identification of other candidate genes for other marked trait intervals in this germplasm. © 2015 INRA, UMR 1332 BFP New Phytologist © 2015 New Phytologist Trust.

  10. The impact of a novel peach gum-derived polysaccharide on postprandial blood glucose control in streptozotocin-induced diabetic mice. (United States)

    Wang, Yuting; Lin, Dingbo; Wang, Xiaoli; Zhu, Wei; Ye, Junli; Li, Guohuai; Ma, Zhaocheng; Deng, Xiuxin


    Peach [Prunus persica (L.)] gum exudates are produced by the trunks and fruits in peach gummosis. Clinically, these exudates have been used to treat diabetes in China, though the molecular mechanism underlying remains unclear. In the current study, a novel peach gum-derived polysaccharide was isolated, designated as PGPSD, and its anti-diabetic effect was assessed in mice. This polysaccharide was composed of arabinose, xylose and galactose in the molar ratio of 5.98:1:3.55, with the average molecular weight at 1.00×10 6 Da. The animal study demonstrated that the PGPSD polysaccharide significantly lowered the postprandial blood glucose in streptozotocin-induced diabetic mice. Histology and immunohistochemistry results further confirmed that the application of PGPSD polysaccharide partially restored the pancreatic islets in diabetic mice, and enhanced the expression of pancreatic duodenal homeobox-1, insulin and hexokinase1. Collectively, the data suggested that the peach gum-derived polysaccharide had a meaningful potential as a non-insulin therapeutic compound in the treatment of diabetes. Copyright © 2017 Elsevier B.V. All rights reserved.

  11. Effect of Macerase, Oxalic Acid, and EGTA on Deep Supercooling and Pit Membrane Structure of Xylem Parenchyma of Peach. (United States)

    Wisniewski, M; Davis, G; Arora, R


    The object of this study was to determine if calcium cross-linking of pectin in the pit membrane of xylem parenchyma restricts water movement which results in deep supercooling. Current year shoots of ;Loring' peach (Prunus persica) were infiltrated with oxalic acid or EGTA solutions for 24 or 48 hours and then either prepared for ultrastructural analysis or subjected to differential thermal analysis. The effect of 0.25 to 1.0% pectinase (weight/volume) on deep supercooling was also investigated. The use of 5 to 50 millimolar oxalic acid and pectinase resulted in a significant reduction (flattening) of the low temperature exotherm and a distinct swelling and partial degradation of the pit membrane. EGTA (10 millimolar) for 24 or 48 hours shifted the low temperature exotherm to warmer temperatures and effected the outermost layer of the pit membrane. A hypothesis is presented on pectin-mediated regulation of deep supercooling of xylem parenchyma.

  12. The interactions of piperonyl butoxide and analogues with the metabolic enzymes FE4 and CYP6CY3 of the green peach aphid Myzus persicae (Hemiptera: Aphididae). (United States)

    Panini, Michela; Tozzi, Francesco; Bass, Chris; Zimmer, Christoph T; Field, Linda; Borzatta, Valerio; Mazzoni, Emanuele; Moores, Graham


    Piperonyl butoxide (PBO) is a well-known insecticide synergist capable of interacting with phase 1 metabolic enzymes, specifically esterases and cytochrome P450s. In this study, structure-activity relationship analyses were used to characterise the interaction of around 30 analogues of PBO with the esterase FE4 and the P450 CYP6CY3 from insecticide-resistant Myzus persicae (Sulzer), in order to predict the synthesis of more potent inhibitors. Enzyme inhibition studies were performed against esterase and oxidase activities and, together with in silico modelling, key activity determinants of the analogues were identified and optimised. Novel analogues were then designed and synthesised, some of which showed greater inhibition against both enzymatic systems: specifically, dihydrobenzofuran moieties containing an alkynyl side chain and a butyl side chain against FE4, and benzodioxole derivatives with a propyl/butyl side chain and an alkynyl ether moiety for CYP6CY3. In vitro assays identified potential candidate synergists with high inhibitory potency. The in vivo confirmation of such results will allow consideration for a possible use in agriculture. © 2016 Society of Chemical Industry. © 2016 Society of Chemical Industry.

  13. Predation of the Peach Aphid Myzus persicae by the mirid Predator Macrolophus pygmaeus on Sweet Peppers: Effect of Prey and Predator Density

    Directory of Open Access Journals (Sweden)

    Lara De Backer


    Full Text Available Integrated Pest Management strategies are widely implemented in sweet peppers. Aphid biological control on sweet pepers includes curative applications of parasitoids and generalist predators, but with limited efficiency. Macrolophus pygmaeus is a zoophytophagous predator which has been reported to predate on aphids, but has traditionally been used to control other pests, including whiteflies. In this work, we evaluate the effectiveness of M. pygmaeus in controlling Myzus persicae (Homoptera: Aphididae by testing different combinations of aphid and predator densities in cage-experiments under greenhouse conditions. The impact of the presence of an alternative factitious prey (E. kuehniella eggs was also investigated. Macrolophus pygmaeus, at densities of four individuals/plant, caused rapid decline of newly established aphid populations. When aphid infestations were heavy, the mirid bug reduced the aphid numbers but did not fully eradicate aphid populations. The availability of a factitious prey did not influence M. pygmaeus predation on aphids. Based on our data, preventive application of M. pygmaeus, along with a supplementary food source , is recommended to control early infestations of aphids.

  14. Antioxidant potential of thuja (Thuja occidentalis) cones and peach (Prunus persia) seeds in raw chicken ground meat during refrigerated (4 ± 1 °C) storage. (United States)

    Yogesh, K; Ali, Jamshed


    The antioxidant activity of thuja (Thuja occidentalis) cones extract (TCE) and peach (Prunus armeniaca) seeds extract (PSE) were estimated by DPPH free radical scavenging activity method. Total phenolics, total flavonoids and reducing power were also estimated in these extracts. Antioxidant potential of these by products was also evaluated in raw chicken ground meat (GM) during refrigerated (4 ± 1 °C) storage. Total phenolics in TCE and PSE were 7.80 ± 0.04 and 1.92 ± 0.04 mg TAE/gdw respectively. Both extract also showed remarkable DPPH radical scavenging activity (25.52 ± 1.92% and 24.99 ± 0.32%). The reducing powerOD700 was observed more in TCE as compared to PSE (3.32 ± 0.01 and 0.49 ± 0.01). Total flavonoids contents were 7.48 ± 0.02 and 0.85 ± 0.01 mg CE/gdw respectively. Addition of these extract significantly (P < 0.01) affected cooking losses and WHC of GM. During refrigerated storage (4 °C) the TBARS values at 8 d were significantly (P < 0.01) more in control than TCE and PSE treated groups.

  15. Convergent evolution at the gametophytic self-incompatibility system in Malus and Prunus.

    Directory of Open Access Journals (Sweden)

    Bruno Aguiar

    Full Text Available S-RNase-based gametophytic self-incompatibility (GSI has evolved once before the split of the Asteridae and Rosidae. This conclusion is based on the phylogenetic history of the S-RNase that determines pistil specificity. In Rosaceae, molecular characterizations of Prunus species, and species from the tribe Pyreae (i.e., Malus, Pyrus, Sorbus revealed different numbers of genes determining S-pollen specificity. In Prunus only one pistil and pollen gene determine GSI, while in Pyreae there is one pistil but multiple pollen genes, implying different specificity recognition mechanisms. It is thus conceivable that within Rosaceae the genes involved in GSI in the two lineages are not orthologous but possibly paralogous. To address this hypothesis we characterised the S-RNase lineage and S-pollen lineage genes present in the genomes of five Rosaceae species from three genera: M. × domestica (apple, self-incompatible (SI; tribe Pyreae, P. persica (peach, self-compatible (SC; Amygdaleae, P. mume (mei, SI; Amygdaleae, Fragaria vesca (strawberry, SC; Potentilleae, and F. nipponica (mori-ichigo, SI; Potentilleae. Phylogenetic analyses revealed that the Malus and Prunus S-RNase and S-pollen genes belong to distinct gene lineages, and that only Prunus S-RNase and SFB-lineage genes are present in Fragaria. Thus, S-RNase based GSI system of Malus evolved independently from the ancestral system of Rosaceae. Using expression patterns based on RNA-seq data, the ancestral S-RNase lineage gene is inferred to be expressed in pistils only, while the ancestral S-pollen lineage gene is inferred to be expressed in tissues other than pollen.

  16. Convergent Evolution at the Gametophytic Self-Incompatibility System in Malus and Prunus (United States)

    Cunha, Ana E.; Fonseca, Nuno A.; Iezzoni, Amy; van Nocker, Steve; Vieira, Cristina P.


    S-RNase-based gametophytic self-incompatibility (GSI) has evolved once before the split of the Asteridae and Rosidae. This conclusion is based on the phylogenetic history of the S-RNase that determines pistil specificity. In Rosaceae, molecular characterizations of Prunus species, and species from the tribe Pyreae (i.e., Malus, Pyrus, Sorbus) revealed different numbers of genes determining S-pollen specificity. In Prunus only one pistil and pollen gene determine GSI, while in Pyreae there is one pistil but multiple pollen genes, implying different specificity recognition mechanisms. It is thus conceivable that within Rosaceae the genes involved in GSI in the two lineages are not orthologous but possibly paralogous. To address this hypothesis we characterised the S-RNase lineage and S-pollen lineage genes present in the genomes of five Rosaceae species from three genera: M. × domestica (apple, self-incompatible (SI); tribe Pyreae), P. persica (peach, self-compatible (SC); Amygdaleae), P. mume (mei, SI; Amygdaleae), Fragaria vesca (strawberry, SC; Potentilleae), and F. nipponica (mori-ichigo, SI; Potentilleae). Phylogenetic analyses revealed that the Malus and Prunus S-RNase and S-pollen genes belong to distinct gene lineages, and that only Prunus S-RNase and SFB-lineage genes are present in Fragaria. Thus, S-RNase based GSI system of Malus evolved independently from the ancestral system of Rosaceae. Using expression patterns based on RNA-seq data, the ancestral S-RNase lineage gene is inferred to be expressed in pistils only, while the ancestral S-pollen lineage gene is inferred to be expressed in tissues other than pollen. PMID:25993016


    Directory of Open Access Journals (Sweden)

    Július Rozák


    Full Text Available The aim of this study was to determine the incidence of viral phytopathogen Plum pox virus, Prunus necrotic ringspot virus and Prunus dwarf virus in selected localities of Slovakia and diagnose them using a molecular and biological methods. Forty samples of fruit trees of the genus Prunus, twenty samples from intensive plantings and twenty samples from wild subject were analysed. Biological diagnostic by using biological indicators Prunus persica cv. GF 305, Prunus serrulata cv. Schirofugen and molecular diagnostic by mRT-PCR were applied. Five samples with Plum pox virus were infected. The two samples positive for Prunus necrotic ringspot virus and one sample for Prunus dwarf virus were confirmed. The two samples were found to be infected with two viruses Prunus necrotic ringspot virus and Prunus dwarf virus. This work focuses on two techniques, their application to the diagnosis of stone fruit viruses and their routinely used for sanitary and certification programmes.

  18. Época e ciclo de maturação de pêssegos e nectarinas no estado de São Paulo Ripening season of peaches and nectarines in the state of São Paulo, Brazil

    Directory of Open Access Journals (Sweden)

    Wilson Barbosa


    Full Text Available Na Estação Experimental de Jundiaí (23°08'S, do Instituto Agronômico (IAC, controlou-se o número de dias entre a antese e a maturação dos frutos de vinte cultivates de pêssegos (Prvnus persica L. Batsch e nectarinas (P. persica L. Batsch var. nucipersica. Com base nos resultados obtidos, elaborou-se nova tabela classificatória para ciclos de frutificação, da qual constam, respectivamente, a faixa de maturação, o número de dias entre a flora da e a colheita dos frutos e os cultivares: ultraprecoce,181 dias (Bolão.Twenty peach (Prunus persica L. Batsch and nectarine (P. persica L. Batsch var. nucipersica cultivars were evaluated for ripening season over seven years at Jundiaí (23°08'S, State of São Paulo, Brazil. A new classification table was elaborated for the Institute Agronômico cultiva rs. It contains, respectively, maturation period, days between full bloom and fruit maturity and cultivars: ultra-early, 181 days (Bolão.

  19. Peace, a MYB-like transcription factor, regulates petal pigmentation in flowering peach 'Genpei' bearing variegated and fully pigmented flowers. (United States)

    Uematsu, Chiyomi; Katayama, Hironori; Makino, Izumi; Inagaki, Azusa; Arakawa, Osamu; Martin, Cathie


    Flowering peach Prunus persica cv. Genpei bears pink and variegated flowers on a single tree. The structural genes involved in anthocyanin biosynthesis were expressed strongly in pink petals but only very weakly or not at all in variegated petals. A cDNA clone encoding a MYB-like gene, isolated from pink petals was strongly expressed only in pink petals. Introduction of this gene, via biolistics gave magenta spots in the white areas of variegated petals, therefore this gene was named as Peace (peach anthocyanin colour enhancement). Differences in Peace expression determine the pattern of flower colouration in flowering peach. The R2R3 DNA-binding domain of Peace is similar to those of other plant MYBs regulating anthocyanin biosynthesis. Key amino acids for tertiary structure and the motif for interaction with bHLH proteins were conserved in Peace. Phylogenetic analysis indicates that Peace is closely related to AtMYB123 (TT2), which regulates proanthocyanidin biosynthesis in Arabidopsis, and to anthocyanin regulators in monocots rather than to regulators in dicots. This is the first report that a TT2-like R2R3 MYB has been shown to regulate anthocyanin biosynthesis.

  20. Identification and differential expression dynamics of peach small GTPases encoding genes during fruit development and ripening (United States)

    Falchi, Rachele; Cipriani, Guido; Marrazzo, Teresa; Nonis, Alberto; Vizzotto, Giannina; Ruperti, Benedetto


    The function of monomeric GTPases of the RAS superfamily in fruit development and ripening has been partially characterized. Here the identification of peach (Prunus persica) small GTPases of the RAS superfamily expressed in fruit and the characterization of their expression profiles during fruit development are described. Extensive searches on expressed sequence tag (EST) databases led to the selection of a total of 24 genes from peach encoding proteins with significant similarity to Arabidopsis small GTPases. Sequence similarity analyses and identification of conserved motifs, diagnostic of specific RAS families and subfamilies, enabled bona fide assignment of fourteen PpRAB, seven PpARF/ARL/SAR, two PpROP and one PpRAN GTPases. Transcriptional expression profiles of peach monomeric GTPases, analysed by real-time quantitative reverse transcription-PCR, were obtained for mesocarp samples, collected in two consecutive years. Reproducible patterns of expression could be identified for five peach RAB-encoding genes (PpRABA1-1, PpRABA2, PpRABD2-1, PpRABD2-2, and PpRABC2), two ARFs (PpARFA1-1 and PpARLB1), and two ROPs (PpROP3 and PpROP4). Interestingly, the transient transcriptional up-regulation of PpARF genes and of PpRAB genes of the A and D clades, putatively controlling the exocytic delivery of cell wall components and modifying enzymes, appeared to coincide with peaks of growth speed and sugar accumulation and with the final phases of ripening. To our knowledge, this is the first description of the co-ordinated differential expression of a set of genes encoding small GTPases of the ARF and RAB families which takes place during key moments of fruit development and maturation. PMID:20501747

  1. Residue levels and storage responses of nectarines, apricots, and peaches after dip treatments with fludioxonil fungicide mixtures. (United States)

    D'Aquino, Salvatore; Schirra, Mario; Palma, Amedeo; Tedde, Marco; Angioni, Alberto; Garau, Anna; Cabras, Paolo


    Mature apricots (Prunus armeniaca), nectarines [Prunus persica var. nectarine (Ait.)], and peaches [P. persica (L.) Batsch.] were subjected to a 2 min dip treatment with warm water at 48 degrees C or with fludioxonil (FLU) at 100 mg L-1 and 20 degrees C or at 25 mg L-1 FLU and 48 degrees C and then stored at 5 degrees C and 90-95% relative humidity (RH) for 1 week plus 1 additional week at 18 degrees C and approximately 80% RH. Fruit residue uptake was determined as a function of fungicide concentration, dip temperature, treatment time (only on nectarines), and fruit storage conditions. FLU residue level was closely related to fungicide concentration and treatment temperatures and was dependent on fruit species. FLU residues showed great persistence over both storage and shelf life. Fruit dipping in water at 48 degrees C effectively reduced decay development in cvs. 'May Grand' nectarines and 'Pelese' apricots but was ineffective in cvs. 'Red Top' and 'Sun Crest' nectarines during 7 days of storage compared with nontreated fruit. Decay rates in cvs. 'Glo Haven' peaches and 'Fracasso' apricots were very low in fruit dipped in water at both 20 and 48 degrees C. Fungicide treatments at 20 and 48 degrees C resulted in the total or almost total suppression of decay in all cultivars. During shelf life, fruit became very prone to decay, averaging 25.7-100% depending on the cultivar. Fruit dipping in hot water effectively reduced decay in 'Pelese' and 'Fracasso' apricots, 'Sun Crest' peaches, and 'May Grand' nectarines as compared to control, but was ineffective in 'Glo Haven' and 'Red Top' peaches. Fungicide treatments at 20 degrees C were more effective than hot water in most cultivars. The combination of FLU with water at 48 degrees C further improved the fungicide performance. Indeed, reduced levels (a fourth) of active ingredient were required to achieve a control of decay comparable to that for treatment at 20 degrees C. Residue levels in fruit after treatment with

  2. Differential Sensitivity of Fruit Pigmentation to Ultraviolet Light between Two Peach Cultivars (United States)

    Zhao, Yun; Dong, Weiqi; Wang, Ke; Zhang, Bo; Allan, Andrew C.; Lin-Wang, Kui; Chen, Kunsong; Xu, Changjie


    Anthocyanins provide nutritional benefits and are responsible for red coloration in many fruits. Light affects anthocyanin biosynthesis in peach (Prunus persica). However, some cultivars show differential sensitivity to light. In the present study, ‘Hujingmilu (HJ),’ a naturally deeply colored cultivar, and ‘Yulu (YL),’ showing low pigmentation, were used to study the mechanism underlying UV-light-induced anthocyanin biosynthesis. Both UVA and UVB induced fruit pigmentation of ‘HJ,’ but ‘YL’ was only sensitive to UVB. Transcriptomic analyses showed over 5000 genes were differentially expressed by pairwise comparisons of RNA libraries isolated from tissue of each cultivar treated with darkness, UVA and UVB. Twenty-three genes related to anthocyanin biosynthesis were identified from the transcriptome data, which were coordinately up-regulated during accumulation of anthocyanins, and down-regulated in the dark. Altered expression of several light receptors, as well as CONSTITUTIVE PHOTOMORPHOGENIC10 (COP10) and ELONGATED HYPOCOTYL 5 homolog (HYH), and a specific anthocyanin transporter glutathione S-transferase (GST), in ‘YL’ fruit appears to be responsible for the insensitivity to UVA of this cultivar. Expression profiles of several transcription factors of the families MYB, bHLH, bZIP and NAC were highly correlated with those of the anthocyanin biosynthesis genes. The study provides a valuable overview of the underlying molecular mechanisms of UV-light induced anthocyanin response using peach cultivars with differing light sensitivities. PMID:28943881

  3. Interactions between extrafloral nectaries, ants (Hymenoptera: Formicidae), and other natural enemies affect biological control of Grapholita molesta (Lepidoptera: Tortricidae) on peach (Rosales: Rosaceae). (United States)

    Mathews, Clarissa R; Bottrell, Dale G; Brown, Mark W


    Extrafloral nectaries (EFNs) are reported to benefit some plants when ants (Hymenoptera: Formicidae) use their secretions and fend off herbivores, but in some cases resulting competitive interactions may reduce biological control of specific herbivores. This research examined the interactions between ants and other natural enemies associated with the EFNs of peach [Prunus persica (L.) Batcsh] and the implications for biological control of a key pest, the oriental fruit moth [Grapholita molesta (Busck)]. Studies using sentinel G. molesta placed on peach trees ('Lovell' cultivar) with EFNs present and absent revealed that several natural enemy groups associated with the EFNs contribute to reductions in G. molesta eggs, larvae, and pupae in peach orchards. Ants on trees with EFNs antagonized the G. molesta egg parasitoid Trichogramma minutum (Riley), but the ants were crucial in reducing G. molesta in both the larval and pupal stages. Overall, individual trees with EFNs experienced higher ant and other (nonant) natural enemy densities and subsequent pest reductions, as compared with trees without EFNs. However, the implications of EFN-natural enemy-pest interactions to orchard-level biological control will likely depend on local G. molesta population dynamics. © 2011 Entomological Society of America

  4. Peace, a MYB-like transcription factor, regulates petal pigmentation in flowering peach ‘Genpei’ bearing variegated and fully pigmented flowers (United States)

    Uematsu, Chiyomi; Inagaki, Azusa


    Flowering peach Prunus persica cv. Genpei bears pink and variegated flowers on a single tree. The structural genes involved in anthocyanin biosynthesis were expressed strongly in pink petals but only very weakly or not at all in variegated petals. A cDNA clone encoding a MYB-like gene, isolated from pink petals was strongly expressed only in pink petals. Introduction of this gene, via biolistics gave magenta spots in the white areas of variegated petals, therefore this gene was named as Peace (peach anthocyanin colour enhancement). Differences in Peace expression determine the pattern of flower colouration in flowering peach. The R2R3 DNA-binding domain of Peace is similar to those of other plant MYBs regulating anthocyanin biosynthesis. Key amino acids for tertiary structure and the motif for interaction with bHLH proteins were conserved in Peace. Phylogenetic analysis indicates that Peace is closely related to AtMYB123 (TT2), which regulates proanthocyanidin biosynthesis in Arabidopsis, and to anthocyanin regulators in monocots rather than to regulators in dicots. This is the first report that a TT2-like R2R3 MYB has been shown to regulate anthocyanin biosynthesis. PMID:24453228

  5. Comportamento de duas cultivares de pessegueiro com interenxerto da ameixeira 'Januária' Behavior of two peach cultivars with 'Januária' as a Japanese plum interstock

    Directory of Open Access Journals (Sweden)



    Full Text Available Os efeitos da utilização de interenxerto (filtro da ameixeira 'Januária' (Prunus salicina L. foram verificados em duas cultivares de pessegueiro (Prunus persica L., Tropical e Ouromel-2. O porta-enxerto básico utilizado foi o pessegueiro 'Okinawa'. Foram avaliadas duas safras, respectivamente, na 4ª e 5ª folha de plantas enxertadas e estabelecidas no campo em 1994. O uso do enxerto intermediário diminuiu o vigor das plantas -- perímetro e área da secção do tronco, perímetro das pernadas e comprimento dos entrenós -- e aumentou o peso do fruto e a produção por planta, em comparação com as copas-controle enxertadas diretamente no 'Okinawa'. A eficiência produtiva, o índice de fertilidade, o florescimento e a frutificação efetiva foram incrementados com o uso do filtro. A interenxertia com ameixeira 'Januária' apresenta adequadas características de compatibilidade com o pessegueiro, como forma de compactar as copas e aumentar a produtividade e o tamanho do fruto.The effects of interstock with 'Januária' Japanese plum (Prunus salicina L. were verified in the performance of peach (Prunus persica L. cultivars Tropical and Ouromel-2. The basic rootstock used was 'Okinawa' peach. Two crops were evaluated at fourth and fifth leaves of plants established in 1994. The interstock caused decrease of the vigour of the plants -- perimeter and cross-sectional area of the trunk, perimeter of the primary branches and length of the internodes -- and increased fruit weight and production per plant, in comparison to the plant control without interstock budded on 'Okinawa'. Yield efficiency, fertility index, flowering and fruit set were increased with 'Januária' interstock. This interstock process presents an adequate characteristic of compatibility for the peach tree, as a form of compacting the plants, increasing the productivity and the fruit size.

  6. Carbon metabolism of peach fruit after harvest: changes in enzymes involved in organic acid and sugar level modifications. (United States)

    Borsani, Julia; Budde, Claudio O; Porrini, Lucía; Lauxmann, Martin A; Lombardo, Verónica A; Murray, Ricardo; Andreo, Carlos S; Drincovich, María F; Lara, María V


    Peach (Prunus persica L. Batsch) is a climacteric fruit that ripens after harvest, prior to human consumption. Organic acids and soluble sugars contribute to the overall organoleptic quality of fresh peach; thus, the integrated study of the metabolic pathways controlling the levels of these compounds is of great relevance. Therefore, in this work, several metabolites and enzymes involved in carbon metabolism were analysed during the post-harvest ripening of peach fruit cv 'Dixiland'. Depending on the enzyme studied, activity, protein level by western blot, or transcript level by quantitative real time-PCR were analysed. Even though sorbitol did not accumulate at a high level in relation to sucrose at harvest, it was rapidly consumed once the fruit was separated from the tree. During the ripening process, sucrose degradation was accompanied by an increase of glucose and fructose. Specific transcripts encoding neutral invertases (NIs) were up-regulated or down-regulated, indicating differential functions for each putative NI isoform. Phosphoenolpyruvate carboxylase was markedly induced, and may participate as a glycolytic shunt, since the malate level did not increase during post-harvest ripening. The fermentative pathway was highly induced, with increases in both the acetaldehyde level and the enzymes involved in this process. In addition, proteins differentially expressed during the post-harvest ripening process were also analysed. Overall, the present study identified enzymes and pathways operating during the post-harvest ripening of peach fruit, which may contribute to further identification of varieties with altered levels of enzymes/metabolites or in the evaluation of post-harvest treatments to produce fruit of better organoleptic attributes.

  7. Utilizing immunomarking techniques to track Halyomorpha halys (Hemiptera: Pentatomidae movement and distribution within a peach orchard

    Directory of Open Access Journals (Sweden)

    Brett R. Blaauw


    Full Text Available In this study we focus on the invasive brown marmorated stink bug, Halyomorpha halys (Stål (Hemiptera: Pentatomidae, which has a strong dispersal capacity and has had a significant impact on several cropping systems, including peach (Prunus persica (L.. Management of H. halys has relied on intensive insecticide use, and thus a better understanding of its dispersal behavior may assist in developing improved management strategies. In order to investigate H. halys movement and distribution patterns within a peach orchard we applied ecologically safe, food protein markers to the trees along the orchard border (chicken egg albumin in the form of liquid egg whites and to the trees within the orchard interior (bovine casein in the form of cow’s milk. We used enzyme-linked immunosorbent assays (ELISA to assess whether collected H. halys were “marked” with either of the two protein markers, revealing where in the orchard the bugs had visited. From the density data we determined that H. halys is a perimeter-driven pest in peaches, with a significantly higher density of bugs collected along the orchard border. Interestingly, this trend is primarily driven by the distribution of male bugs. The protein marking data revealed that a small proportion of male H. halys move equally between the orchard border and interior, while a small proportion of females move predominately to the border after visiting the interior. The verification of a strong edge-effect, although potentially sex-specific, implies that H. halys displays a dispersal behavior that may also be exploited for management, which may help growers more efficiently and more effectively manage H. halys.

  8. Effect of Water Deficit Stress on Peach Growth under Commercial Orchard Management Conditions

    Directory of Open Access Journals (Sweden)

    M. Rahmati


    Full Text Available In order to study the sensitivity of vegetative growth to water deficit stress of a late-maturing peach (Prunus persica L. cv. Elberta under orchard conditions, an experiment was conducted as randomized complete-block design with three treatments and four repetitions in Shahdiran commercial orchard in Mashhad during 2011. Three irrigation treatments including 360 (low stress, 180 (moderate stress and 90 (severe stress m3ha-1week-1 using a drip irrigation system (minimum stem water potential near harvest: -1.2, -1.5 and -1.7 MPa, respectively from the mid-pit hardening stage (12th of June until harvest (23rd of Sep. applied. Predawn, stem and leaf water potentials, leaf photosynthesis, transpiration, stomatal conductance and leaf temperature, the number of new shoots on fruit bearing shoots and vegetative shoots lengths during growing season as well as leaf area at harvest were measured. The results showed that water deficit stress had negative effects on peach tree water status, thereby resulting in decreased leaf gas exchange and tree vegetative growth. As significant decreased assimilate production of tree was resulted from both decreased leaf assimilation rate (until about 23 % and 50 %, respectively under moderate and severe stress conditions compared to low stress conditions and decreased leaf area of tree (until about 57% and 79%, respectively under moderate and severe stress conditions compared to low stress conditions at harvest. The significant positive correlation between leaf water potential and vegetative growth of peach revealed that shoot growth would decrease by 30% and 50% of maximum at leaf water potential of –1.56 and –2.30 MPa, respectively.

  9. Field evaluation of traps and lures for monitoring plum curculio (Coleoptera: Curculionidae) in Alabama peaches. (United States)

    Akotsen-Mensah, Clement; Boozer, Robert; Fadamiro, Henry Y


    The plum curculio, Conotrachelus nenuphar (Herbst) (Coleoptera: Curculionidae), is a key pest of peaches, Prunus persica (L.) Batsch, in North America. We evaluated the effectiveness of two widely used trap types (pyramid versus Circle traps) and commercially available synthetic lures for monitoring the pest in two peach orchards in Alabama during 2008 and 2009. The lures evaluated alone or in combinations included benzaldehyde (BZ) (a component of fruit odor), plum essence (PE) (a mixture of fruit odor extracted from food grade plum), and grandisoic acid (GA) (a male-produced aggregation pheromone of plum curculio). In general, pyramid traps captured more plum curculio adults than Circle traps, particularly during the first generation. Trap performance was improved numerically by the addition of BZ, PE, or GA alone (single lures) and was significantly enhanced by the addition of the combined BZ + PE lure. In both first and second generations, the combined BZ + PE lure increased plum curculio captures (significant in some trials) over unbaited traps and traps baited with single lures by approximately 1.5-21-fold and had the highest response indices (RIs), which is indicative of high attractiveness. The combined BZ + GA lure and the three-component BZ + PE + GA lure also captured numerically more plum curculio adults than unbaited traps or traps baited with single lures but the differences were rarely significant. Analysis of ratios of interaction suggests the possibility of synergistic interactions between BZ and PE and between BZ and GA; however, additive effects were concluded due to high sample errors. These results are discussed in relation to the physicochemical properties of the lures and the potential of using baited monitoring traps to aid plum curculio management decisions in peach orchards.

  10. Shelf life of peaches treated with 1-methylcyclopropene Vida útil de pêssegos tratados com 1-metilciclopropeno

    Directory of Open Access Journals (Sweden)

    Ricardo Alfredo Kluge


    Full Text Available Peaches [Prunus persica (L. Bastch] present reduced post-harvest shelf life, partially, due to their high respiratory rate and fast ripening. These processes are related to ethylene production, as well as its action. Peaches, cv. Aurora-1, were picked at two different ripening stages (mature green and ripe and treated with 1-methylcyclopropene (1-MCP, the ethylene's competitive antagonist, at concentrations of 0, 100, 300 and 900 nL L-1 for 12 hours at 25ºC. After treatment, the fruits were stored at room temperature (25ºC for six days. Fruits treated with 1-MCP presented better firmness and less ground color loss than non-treated fruits. The 1-MCP antagonist reduced the development of fruit rot at the mature green stage, but not at the ripe one. The 1-MCP shows commercial application potential in the treatment of peaches in order to delay the ripening process and increase their shelf life.Pêssegos [Prunus persica (L. Bastch] apresentam reduzida vida útil pós-colheita devido, em parte, a sua alta taxa respiratória e amadurecimento rápido. Estes processos estão relacionados com a produção e a ação do etileno. Pêssegos cv. Aurora-1 foram colhidos em dois estádios de maturação (verde e maduro e tratados com o antagonista competitivo do etileno 1-metilciclopropeno (1-MCP nas concentrações de 0, 100, 300 e 900 nL L-1, durante 12 horas a 25ºC. Após o tratamentos os frutos foram armazenados em condições ambientais (25ºC durante seis dias. Os frutos tratados com 1-MCP apresentaram maior firmeza de polpa e menor perda de coloração de fundo se comparado com os frutos não tratados. O 1-MCP reduziu o desenvolvimento de podridões em frutos do estádio verde, mas não em frutos maduros. O 1-MCP apresenta potencial de aplicação comercial em pêssegos, visando retardar o amadurecimento e aumentar sua vida útil de prateleira.

  11. Field assessment of vulnerability to fungi diseases of varieties and forms of nectarine (Prunus persica (L. Batsch. subsp. nectarina (Ait. Shof. displaying male sterility characteristic from Niktskyi Botanic Garden collection

    Directory of Open Access Journals (Sweden)

    Ю. О. Іващенко


    Full Text Available The varieties and forms of nectarine resistant to fungi diseases (Clasterosporium carpophilum (Lev. Aderh., Taphrina deformans Tul., Sphaerotheca pannosa (Wallr. Fr. Lev. var. persicae Woronich having the practical interest for modern technology growing and for breeding on these characteristics have been selected.

  12. Genomic characterization of putative allergen genes in peach/almond and their synteny with apple

    Directory of Open Access Journals (Sweden)

    Weg Eric


    Full Text Available Abstract Background Fruits from several species of the Rosaceae family are reported to cause allergic reactions in certain populations. The allergens identified belong to mainly four protein families: pathogenesis related 10 proteins, thaumatin-like proteins, lipid transfer proteins and profilins. These families of putative allergen genes in apple (Mal d 1 to 4 have been mapped on linkage maps and subsequent genetic study on allelic diversity and hypoallergenic traits has been carried out recently. In peach (Prunus persica, these allergen gene families are denoted as Pru p 1 to 4 and for almond (Prunus dulcisPru du 1 to 4. Genetic analysis using current molecular tools may be helpful to establish the cause of allergenicity differences observed among different peach cultivars. This study was to characterize putative peach allergen genes for their genomic sequences and linkage map positions, and to compare them with previously characterized homologous genes in apple (Malus domestica. Results Eight Pru p/du 1 genes were identified, four of which were new. All the Pru p/du 1 genes were mapped in a single bin on the top of linkage group 1 (G1. Five Pru p/du 2 genes were mapped on four different linkage groups, two very similar Pru p/du 2.01 genes (A and B were on G3, Pru p/du 2.02 on G7,Pru p/du 2.03 on G8 and Pru p/du 2.04 on G1. There were differences in the intron and exon structure in these Pru p/du 2 genes and in their amino acid composition. Three Pru p/du 3 genes (3.01–3.03 containing an intron and a mini exon of 10 nt were mapped in a cluster on G6. Two Pru p/du 4 genes (Pru p/du 4.01 and 4.02 were located on G1 and G7, respectively. The Pru p/du 1 cluster on G1 aligned to the Mal d 1 clusters on LG16; Pru p/du 2.01A and B on G3 to Mal d 2.01A and B on LG9; the Pru p/du 3 cluster on G6 to Mal d 3.01 on LG12; Pru p/du 4.01 on G1 to Mal d 4.03 on LG2; and Pru p/du 4.02 on G7 to Mal d 4.02 on LG2. Conclusion A total of 18 putative peach

  13. Presence and impact of allelic variations of two alternative s-kdr mutations, M918T and M918L, in the voltage-gated sodium channel of the green peach aphid Myzus persicae. (United States)

    Panini, Michela; Anaclerio, Matteo; Puggioni, Vincenzo; Stagnati, Lorenzo; Nauen, Ralf; Mazzoni, Emanuele


    Pyrethroids have been widely employed in order to control several agricultural pests, including Myzus persicae. Target-site resistance is the main mechanism that confers insensitivity to this class of compounds, and the most common amino acid substitutions are kdr (L1014F) and s-kdr (M918T), but recently another mutation in the s-kdr locus (M918L) has been described in French and Korean populations of M. persicae. Molecular analysis of several Italian populations of M. persicae by pyrosequencing revealed the presence of the new s-kdr mutation (M918L) in different forms. It was found in two different nucleotide polymorphisms (a/t or a/c substitution), in heterozygous or homozygous status, and also in combination with the classic kdr and s-kdr. Bioassays on populations carrying the M918L mutation show that it strongly affects pyrethroid efficacy, particularly of type II pyrethroids such as lambda-cyhalothrin, while it has no effect against DDT. This work provides more information about the new s-kdr M918L mutation in M. persicae, describing a more complicated situation arising from the possible combination with the classic L1014F and M918T. Our data open new questions concerning the origin of these new genotypes with different combinations of target-site mutations, and also their possible influence on control strategies. © 2014 Society of Chemical Industry.

  14. Season-long volatile emissions from peach and pear trees in situ, overlapping profiles, and olfactory attraction of an oligophagous fruit moth in the laboratory. (United States)

    Najar-Rodriguez, A; Orschel, B; Dorn, S


    Insect herbivores that have more than one generation per year and reproduce on different host plants are confronted with substantial seasonal variation in the volatile blends emitted by their hosts. One way to deal with such variation is to respond to a specific set of compounds common to all host plants. The oriental fruit moth Cydia (=Grapholita) molesta is a highly damaging invasive pest. The stone fruit peach (Prunus persica) is its primary host, whereas pome fruits such as pear (Pyrus communis) are considered secondary hosts. In some parts of their geographic range, moth populations switch from stone to pome fruit orchards during the growing season. Here, we tested whether this temporal switch is facilitated by female responses to plant volatiles. We collected volatiles from peach and pear trees in situ and characterized their seasonal dynamics by gas chromatography-mass spectrometry. We also assessed the effects of the natural volatile blends released by the two plant species on female attraction by using Y-tube olfactometry. Finally, we related variations in volatile emissions to female olfactory responses. Our results indicate that the seasonal host switch from peach to pear is facilitated by the changing olfactory effect of the natural volatile blends being emitted. Peach volatiles were only attractive early and mid season, whereas pear volatiles were attractive from mid to late season. Blends from the various attractive stages shared a common set of five aldehydes, which are suggested to play an essential role in female attraction to host plants. Particular attention should be given to these aldehydes when designing candidate attractants for oriental fruit moth females.

  15. Determination of Resistance Levels of Myzus persicae (Sulzer by Biochemical Methods

    Directory of Open Access Journals (Sweden)

    Olivera Petrović-Obradović


    Full Text Available Peach/potato aphid Myzus persicae (Sulzer has developed three mechanisms of resistance: overproduction of one or two closely related carboxylesterases (E4 and FE4, production of modified acetylcholinesterase (MACE and knockdown resistance. Biochemicaldiagnostic methods can be used to identify levels of carboxylesterase production and sensitivity of modified acetylcholinesterase and, based on the values acquired we can classify aphids into one of the resistance cathegories. We used two tests: the total esterase activitytest and test for checking sensitivity of acetylcholinesterase (MACE. Myzus periscae persicae from peach and Myzus persicae nicotianae from tobacco were tested. The total esterase activity test showed that 65% of the aphids tested were moderately resistant and 35% were highly resistant. Resistance based on the production of modified acetylcholinesterase is less represented because 80% of the aphids tested were susceptible to pirimicarb, which was used in the experiment. Also, both tests showed that aphids from tobacco were more susceptible than aphids from peach.

  16. The Change of First-flowering Date over South Korea Projected from Downscaled IPCC AR5 Simulation: Peach and Pear (United States)

    Ahn, J. B.; Hur, J.


    The variations in the first-flowering date (FFD) of peach (Prunus persica) and pear (Pyrus pyrifolia) under future climate change in South Korea are investigated using simulations obtained from five models of the fifth Coupled Model Intercomparison Project. For the study, daily temperature simulations with Historical (1986-2005), and RCP (2071-2090) 4.5 and 8.5 scenarios are statistically downscaled to 50 peach and pear FFD (FFDpeach and FFDpear, respectively) observation sites over South Korea. The number of days transformed to standard temperature (DTS) method is selected as the phenological model and applied to simulations for estimating FFDpeach and FFDpear over South Korea, due to its superior performance on the target plants and region compared to the growing degree days (GDD) and chill days (CD) methods. In the analysis, mean temperatures for early spring (February to April) over South Korea in 2090 under RCP4.5 and 8.5 scenarios are expected to have increased by 1.9K and 3.3K, respectively. Among the early spring months of February to April, February shows the largest temperature increase of 2.1K and 3.7K for RCP4.5 and 8.5 scenarios, respectively. The increased temperature during February and March accelerates the plant growth rate and thereby advances FFDpeach by 7.0 and 12.7 days and FFDpear by 6.1 and 10.7 days, respectively. These results imply that the present flowering of peach and pear in the middle of April will have advanced to late March or early April by the end of this century. Acknowledgements This work was carried out with the support of the Rural Development Administration Cooperative Research Program for Agriculture Science and Technology Development under Grant Project No. PJ009953, Republic of Korea.

  17. Novel Phaeoacremonium species associated with necrotic wood of Prunus trees

    NARCIS (Netherlands)

    Damm, U.; Mostert, L.; Crous, P.W.; Fourie, P.H.


    The genus Phaeoacremonium is associated with opportunistic human infections, as well as stunted growth and die-back of various woody hosts, especially grapevines. In this study, Phaeoacremonium species were isolated from necrotic woody tissue of Prunus spp. (plum, peach, nectarine and apricot) from

  18. Dynamics of soil water content during depletion cycles in peach orchards in a semiarid region

    Directory of Open Access Journals (Sweden)

    Cristian Paltineanu


    Full Text Available Due to the competition for water resources, increasing efforts are done in order to use more efficiently irrigation water in agriculture. The purpose of this paper is to find out daily soil water content (SWC dynamics during depletion cycles in order to emphasize its pattern and compare daylight vs. night (dark and morning vs. afternoon SWC dynamics in an irrigated peach (Prunus persica [L.] Batsch orchard under various soil water regimes. To do this, four depletion cycles were studied after irrigation application in two treatments: fully irrigated (T1 and water stressed (T2, in a semiarid region of Romania. Soil water potential was continuously measured with Watermark resistance blocks. Daylight soil water discharge (SWD is higher than night SWD (1.87 ratio in T1 and 1.50 in T2 mainly due to solar radiation (Rs, higher vapor pressure deficit (VPD, and wind speed (U, with crop transpiration and crop water uptake being higher during daylight vs. nighttime. SWD during 14:00-20:00 h is greater than 08:00-14:00 h due to higher afternoon values of air temperature (T, VPD, and U. The results help understand better the relations between the daily dynamics of SWC and Rs, T, VPD, and U, and could be utilized by fruit growers to improve water management and conservation in semiarid regions with similar environmental conditions.

  19. Caracterización con RAMs de la colección de durazno (Prunus persica L. Batsch) existente en la Universidad Pedagógica y Tecnológica de Colombia


    Ana Cruz Morillo Coronado; Yacenia Morillo Coronado; Elberth Hernando Pinzón Sandoval


    Utilizando ocho cebadores Microsatélites Amplificados al Azar (RAMs) fue evaluada la diversidad genética de 31 materiales de Prunus de la colección de caducifolios existente en la Universidad Pedagógica y Tecnológica de Colombia. Se generaron un total de 121 amplicones con pesos moleculares entre 260 y 1000 Kb. Con un coeficiente de similitud de 0.75, se formaron tres grupos, de acuerdo principalmente con las características del fruto, encontrando en el grupo 2 las variedades de importancia e...

  20. Caracterización con rams de la colección de durazno (prunus persica (l.) batsch existente en la universidad pedagógica y tecnológica de colombia


    Morillo Coronado, Ana Cruz; Morillo Coronado, Yacenia; Pinzón Sandoval, Elberth Hernando


    Utilizando ocho cebadores Microsatélites Amplificados al Azar (RAMs) fue evaluada la diversidad genética de 31 materiales de Prunus de la colección de caducifolios existente en la Universidad Pedagógica y Tecnológica de Colombia. Se generaron un total de 121 amplicones con pesos moleculares entre 260 y 1000 Kb. Con un coeficiente de similaridad de a 0.75 se formaron tres grupos, de acuerdo principalmente con las características del fruto, encontrando en el grupo 2 las variedades de importan...

  1. Airborne Thermal Imagery to Detect the Seasonal Evolution of Crop Water Status in Peach, Nectarine and Saturn Peach Orchards

    Directory of Open Access Journals (Sweden)

    Joaquim Bellvert


    Full Text Available In the current scenario of worldwide limited water supplies, conserving water is a major concern in agricultural areas. Characterizing within-orchard spatial heterogeneity in water requirements would assist in improving irrigation water use efficiency and conserve water. The crop water stress index (CWSI has been successfully used as a crop water status indicator in several fruit tree species. In this study, the CWSI was developed in three Prunus persica L. cultivars at different phenological stages of the 2012 to 2014 growing seasons, using canopy temperature measurements of well-watered trees. The CWSI was then remotely estimated using high-resolution thermal imagery acquired from an airborne platform and related to leaf water potential (ѰL throughout the season. The feasibility of mapping within-orchard spatial variability of ѰL from thermal imagery was also explored. Results indicated that CWSI can be calculated using a common non-water-stressed baseline (NWSB, upper and lower limits for the entire growing season and for the three studied cultivars. Nevertheless, a phenological effect was detected in the CWSI vs. ѰL relationships. For a specific given CWSI value, ѰL was more negative as the crop developed. This different seasonal response followed the same trend for the three studied cultivars. The approach presented in this study demonstrated that CWSI is a feasible method to assess the spatial variability of tree water status in heterogeneous orchards, and to derive ѰL maps throughout a complete growing season. A sensitivity analysis of varying pixel size showed that a pixel size of 0.8 m or less was needed for precise ѰL mapping of peach and nectarine orchards with a tree crown area between 3.0 to 5.0 m2.

  2. Evaluation of hydrophobic and hydrophilic kaolin particle films for peach crop, arthropod and disease management. (United States)

    Lalancette, Norman; Belding, Robert D; Shearer, Peter W; Frecon, Jerome L; Tietjen, William H


    Hydrophobic and/or hydrophilic kaolin particle film treatments to peach (Prunus persica (L) Batsch) trees were evaluated for crop and pest management capabilities in six studies from 1997 to 2000. Unsprayed control and standard treatments, the latter consisting of a commercial pesticide program, were included for comparison. Treatments in initial studies were applied via handgun, which resulted in a uniform and heavy deposit of kaolin after the first application. In contrast, treatments in subsequent studies used airblast equipment, which provided a uniform but less dense coverage, even after multiple applications. Results showed that both formulations of kaolin provided control of oriental fruit moth (Grapholita molesta (Busck)), plum curculio (Conotrachelus nenuphar (Herbst)) and Japanese beetle (Popillia japonica Newman) that was comparable with or better than the standard pesticide program. Effective management of late season catfacing insects (tarnished plant bugs Lygus lineolaris (Palisot de Beauvois) and stinkbugs Acrosternum hilare (Say), Euschistus servus (Say), and E tristigmus (Say)) and leafrollers (undetermined species) was also observed, although kaolin applications significantly increased phytophagous mite (Panonychus ulmi (Koch)) levels. In contrast to arthropod management, kaolin failed to control either peach scab (Cladosporium carpophilum (Von Thumen)) or rusty spot (Podosphaera leucotricha (Ell and Ev) ES Salmon) in any of the 4 years of the study. However, hydrophobic kaolin provided effective brown rot (Monilinia fructicola (G Winter) Honey) control when applied via handgun, and partial control when applied via airblast; hydrophilic kaolin failed to provide any control. These results suggest that hydrophobicity and deposit density may be important factors for effective disease management. The application of kaolin significantly delayed fruit maturation, increased fruit size and increased soluble solids relative to the standard. This effect

  3. Mediation of deep supercooling of peach and dogwood by enzymatic modifications in cell-wall structure. (United States)

    Wisniewski, M; Davis, G; Schafter, K


    Treatment of stem sections of peach (Prunus persica (L.) Batsch) and flowering dogwood (Cornus florida L.) with macerase, an enzyme mixture rich in pectinase, for 24-48 h resulted in a complete flattening of the low-temperature exotherm (LTE) as determined by differential thermal analysis (DTA). Ultrastructural analysis of macerase-treated tissue demonstrated a nearly complete digestion of the pit membrane (black cap and primary cell-wall) of nearly 100% of the xylem-parenchyma cells examined after 48 h of exposure to the enzyme. Additionally, the underlying amorphous layer was partially degraded in up to 57% of the cells examined. The macerase treatment had no visible effect on secondary cell-walls of xylem tissue. In contrast, treatment of stem tissue with cellulysin (mostly cellulase) resulted in a shift of the LTE to warmer temperatures as determined by DTA, and a digestion of only the outermost layer of the pit membrane in nearly 100% of the cells examined, with little or no effect on the underlying layers. Treatment of tissue with 25 mM sodiumphosphate buffer also resulted in a shift of the LTE to warmer temperatures but the shift was not as great as in cellulysin-treated tissue. The shift was associated with a partial degradation of the outermost layer of the pit membrane in dogwood (33-45% of the cells examined) but not in peach (3-7% of the cells). Collectively, the data indicate that pectins may be an integral structural element of the pit membrane and that this portion of the cell-wall, along with the underlying amorphous layer, play a major role in forming a barrier to water movement and growth of ice crystals. This barrier allows xylem parenchyma of some species of woody plants to undergo deep supercooling.

  4. Caracterización con RAMs de la colección de durazno (Prunus persica L. Batsch existente en la Universidad Pedagógica y Tecnológica de Colombia

    Directory of Open Access Journals (Sweden)

    Ana Cruz Morillo Coronado


    Full Text Available Utilizando ocho cebadores Microsatélites Amplificados al Azar (RAMs fue evaluada la diversidad genética de 31 materiales de Prunus de la colección de caducifolios existente en la Universidad Pedagógica y Tecnológica de Colombia. Se generaron un total de 121 amplicones con pesos moleculares entre 260 y 1000 Kb. Con un coeficiente de similitud de 0.75, se formaron tres grupos, de acuerdo principalmente con las características del fruto, encontrando en el grupo 2 las variedades de importancia económica. El número de loci polimórficos varió entre 5 y 16 para los cebadores GT y CCA, respectivamente. El valor promedio de heterocigosidad fue de 0.22, más bajo que los encontrados en otros estudios de diversidad genética en el género Prunus; por tanto, se deben buscar estrategias para incrementar la variabilidad genética de la colección como la introducción de nuevos materiales o híbridos interespecíficos. La técnica RAMs es útil para evaluar la diversidad genética en especies caducifolias.

  5. Selection of reliable reference genes for gene expression studies in peach using real-time PCR

    Directory of Open Access Journals (Sweden)

    Zhou Jun


    Full Text Available Abstract Background RT-qPCR is a preferred method for rapid and reliable quantification of gene expression studies. Appropriate application of RT-qPCR in such studies requires the use of reference gene(s as an internal control to normalize mRNA levels between different samples for an exact comparison of gene expression level. However, recent studies have shown that no single reference gene is universal for all experiments. Thus, the identification of high quality reference gene(s is of paramount importance for the interpretation of data generated by RT-qPCR. Only a few studies on reference genes have been done in plants and none in peach (Prunus persica L. Batsch. Therefore, the present study was conducted to identify suitable reference gene(s for normalization of gene expression in peach. Results In this work, eleven reference genes were investigated in different peach samples using RT-qPCR with SYBR green. These genes are: actin 2/7 (ACT, cyclophilin (CYP2, RNA polymerase II (RP II, phospholipase A2 (PLA2, ribosomal protein L13 (RPL13, glyceraldehyde-3-phosphate dehydrogenase (GAPDH, 18S ribosomal RNA (18S rRNA, tubblin beta (TUB, tubblin alpha (TUA, translation elongation factor 2 (TEF2 and ubiquitin 10 (UBQ10. All eleven reference genes displayed a wide range of Cq values in all samples, indicating that they expressed variably. The stability of these genes except for RPL13 was determined by three different descriptive statistics, geNorm, NormFinder and BestKeeper, which produced highly comparable results. Conclusion Our study demonstrates that expression stability varied greatly between genes studied in peach. Based on the results from geNorm, NormFinder and BestKeeper analyses, for all the sample pools analyzed, TEF2, UBQ10 and RP II were found to be the most suitable reference genes with a very high statistical reliability, and TEF2 and RP II for the other sample series, while 18S rRNA, RPL13 and PLA2 were unsuitable as internal controls



    Danilo Couto; Iraídes Fernandes Carneiro; Antônio Lopes da Silva; Claúdio Aparecido da Silveira


    O efeito de cinco inseticidas aplicados no tomateiro (Lycopersicum sculentum Mill), visando ao controle do pulgão verde, Myzus persica...

  7. Enraizamento de estacas herbáceas de quatro clones de umezeiro (Prunus mume Sieb. et Zucc. durante o inverno ameno, em Jaboticabal-SP Rooting of herbaceous cuttings of four mume clones (Prunus mume Sieb. et Zucc. during soft winter, in Jaboticabal, São Paulo state, Brazil

    Directory of Open Access Journals (Sweden)

    Newton Alex Mayer


    Full Text Available Estudos realizados no Brasil com o umezeiro (Prunus mume Sieb. et Zucc. relatam promissoras perspectivas de utilização desta espécie como porta-enxerto para pessegueiro e nectarineira, em função de sua rusticidade, adaptação ao inverno brando, compatibilidade com Prunus persica, redução do vigor das plantas e melhoria da qualidade dos frutos. Entretanto, em função da propagação por sementes, tem sido observadas diferenças de vigor entre as plantas, resultando em pomares muito heterogêneos. Assim, o presente estudo teve por objetivo estudar o enraizamento de estacas herbáceas de quatro clones de umezeiro (Clones 02, 05, 10 e 15 durante o inverno ameno, em Jaboticabal-SP. O experimento foi conduzido entre os meses de junho e agosto, sendo avaliado aos 70 dias após a estaquia. Pelos resultados obtidos, foi possível concluir que é viável a propagação dos clones estudados por enraizamento de estacas herbáceas durante o inverno. Foram observadas diferenças entre os clones quanto à porcentagem de enraizamento, porcentagem de estacas com calo, número e comprimento das raízes. No conjunto das variáveis analisadas, os melhores resultados foram obtidos com os Clones 10 e 15.Studies developed in Brazil with the mume (Prunus mume Sieb. et Zucc. have shown promising perspectives of using this species as rootstock for peach and nectarine trees, in function of its rusticity, adaptation to soft winter, compatibility with Prunus persica, plant vigor reduction and improvement of the fruit quality. However, due to seed propagation, vigor differences have been observed among plants, resulting in very heterogeneous orchards. Thus, the present study had the objective of studying the rooting of herbaceous cuttings of four mume clones (Clones 02, 05, 10 and 15 in intermittent mist during the soft winter, in Jaboticabal, São Paulo State, Brazil. The experiment was carried out between June and August, being evaluated 70 days after the cutting

  8. Fine mapping and identification of a candidate gene for a major locus controlling maturity date in peach. (United States)

    Pirona, Raul; Eduardo, Iban; Pacheco, Igor; Da Silva Linge, Cassia; Miculan, Mara; Verde, Ignazio; Tartarini, Stefano; Dondini, Luca; Pea, Giorgio; Bassi, Daniele; Rossini, Laura


    Maturity date (MD) is a crucial factor for marketing of fresh fruit, especially those with limited shelf-life such as peach (Prunus persica L. Batsch): selection of several cultivars with differing MD would be advantageous to cover and extend the marketing season. Aims of this work were the fine mapping and identification of candidate genes for the major maturity date locus previously identified on peach linkage group 4. To improve genetic resolution of the target locus two F2 populations derived from the crosses Contender x Ambra (CxA, 306 individuals) and PI91459 (NJ Weeping) x Bounty (WxBy, 103 individuals) were genotyped with the Sequenom and 9K Illumina Peach Chip SNP platforms, respectively. Recombinant individuals from the WxBy F2 population allowed the localisation of maturity date locus to a 220 kb region of the peach genome. Among the 25 annotated genes within this interval, functional classification identified ppa007577m and ppa008301m as the most likely candidates, both encoding transcription factors of the NAC (NAM/ATAF1, 2/CUC2) family. Re-sequencing of the four parents and comparison with the reference genome sequence uncovered a deletion of 232 bp in the upstream region of ppa007577m that is homozygous in NJ Weeping and heterozygous in Ambra, Bounty and the WxBy F1 parent. However, this variation did not segregate in the CxA F2 population being the CxA F1 parent homozygous for the reference allele. The second gene was thus examined as a candidate for maturity date. Re-sequencing of ppa008301m, showed an in-frame insertion of 9 bp in the last exon that co-segregated with the maturity date locus in both CxA and WxBy F2 populations. Using two different segregating populations, the map position of the maturity date locus was refined from 3.56 Mb to 220 kb. A sequence variant in the NAC gene ppa008301m was shown to co-segregate with the maturity date locus, suggesting this gene as a candidate controlling ripening time in peach. If confirmed on other

  9. Reaction of peach tree genotypes to bacterial leaf spot caused by Xanthomonas arboricola pv. prunis Reação de genótipos de pessegueiro a mancha foliar causada por Xanthomonas arboricola pv. pruni

    Directory of Open Access Journals (Sweden)

    José Gilberto Sousa Medeiros


    Full Text Available Bacterial leaf spot (BLS, caused by Xanthomonas arboricola pv. pruni, is one of the most important diseases in Brazilian peach [Prunus persica (L. Batsch] orchards and all over the world. The main objective of this study was to evaluate for BLS sensitivity of peach genotypes. Evaluations of thirty genotypes were carried out during the onset of the disease, for incidence, severity and defoliation, in field conditions. Pearson's correlations between the percentage of defoliation and leaf severity rating were performed. Genotypes 'Conserva 985', 'Conserva 871', 'Conserva 1129', and 'Tropic Snow', as resistance sources, and 'Conserva 1153', 'Bonão', 'Conserva 1125', and 'Atenas', as susceptible to BLS, were submitted to detached-leaf bioassay and greenhouse evaluation. The peach genotypes showed different reactions to the BLS, and none was immune to the pathogen. 'Conserva 985' and 'Conserva 1129' confirmed resistance responsiveness while 'Conserva 1153', 'Conserva 1125' and 'Atenas' were found susceptible for the detached-leaf bioassay.A bacteriose foliar causada por Xanthomonas arboricola pv. pruni é uma das mais importantes doenças do pessegueiro [Prunus persica (L. Batsch] no Brasil e no mundo. Avaliou-se a sensibilidade de genótipos de pessegueiro a X. arboricola pv. pruni. Trinta genótipos foram avaliados em campo, quanto à incidência, severidade e desfolha causada pela bactéria. Calculou-se a correlação entre desfolha e severidade da doença. A partir dos resultados obtidos em campo, foram selecionados quatro genótipos resistentes ('Conserva 985', 'Conserva 871', 'Conserva 1129' e 'Tropic Snow' e quatro suscetíveis ('Conserva 1153', 'Bonão', 'Conserva 1125' e 'Atenas' para serem novamente avaliados pelo bioensáio com folhas destacadas e em casa de vegetação. Os genótipos diferiram quanto a reação ao patógeno, não sendo observada imunidade. Confirmou-se a resistência para 'Conserva 985' e 'Conserva 1129' e a

  10. Influence of Silicon on Resistance of Zinnia Elegans to Myzus Persicae (Hemiptera: Aphididae) (United States)

    Studies were conducted to examine the effect of treating Zinnia elegans Jacq. with soluble silicon on the performance of the green peach aphid, Myzus persicae (Sulzer). Zinnia elegans plants were irrigated every 2 days throughout the duration of the experiment with a nutrient solution amended with ...

  11. National Plant Diagnostic Network, Taxonomic training videos: Aphids under the microscope - Myzus persicae (United States)

    Training is a critical part of aphid (Hemiptera: Aphididae) identification. This video provides provides training to identify the green peach aphid, Myzus persicae, using a compound microscope and an electronic identification key called “LUCID.” The video demonstrates key morphological structures t...

  12. Intensidade de raleio de frutos em pessegueiros 'flordaprince' conduzidos em pomar com alta densidade de plantio Intensity of fruit thinning in peaches 'flordaprince' conducted in orchard of high density

    Directory of Open Access Journals (Sweden)



    Full Text Available O objetivo deste trabalho foi verificar o comportamento de pessegueiros (Prunus persica (L. Batsch. cultivar Flordaprince, conduzidos em pomar com alta densidade (3.333 plantas/ha, submetidos a diferentes intensidades de raleio manual de frutos. Os tratamentos utilizados foram 120, 100 e 80 frutos por planta, e o controle sem raleio (230 frutos por planta. As plantas submetidas ao raleio produziram frutos significativamente maiores e mais pesados do que os do controle. A produção por planta (kg e a produtividade estimada (t/ha foram maiores nas plantas sem raleio, mas a classificação comercial e a receita bruta (R$/ha desse tratamento foram menores, devido ao menor tamanho e peso dos frutos. Os tratamentos 100 e 80 frutos por planta (56,52% e 65,21% de raleio, respectivamente apresentaram os melhores resultadosThe objective of this paper was to test the behavior of peaches (Prunus persica (L. Batsch. cultivar Flordaprince carried out in high dense orchard (3,333 plants/ha submitted to different intensities of hand thinning of fruits. The treatments tested were 120, 100 and 80 fruits per plant and without thinning (230 fruits per plant. The thinned plants produced larger and weightier fruits if compared with control plants. The yield per plant (kg and estimated productivity (ton/ha were higher in plants not thinned, but marketing classification and gross income were lower in this treatment due to small fruit size and weight. The treatments 100 and 80 fruits per plant (56.52% and 65.21% of thinning, respectively presented the best results.

  13. Incremento no desenvolvimento do porta-enxerto de pessegueiro "Aldrighi" por fungos micorrízicos arbusculares autóctones Development increase of 'Aldrighi' peach rootstocks by indigenous arbuscular mycorrhizal fungi

    Directory of Open Access Journals (Sweden)

    José Luis da Silva Nunes


    Full Text Available Objetivou-se, neste trabalho, avaliar a influência de três espécies de fungos micorrízicos arbusculares (FMA isolados de pomares de pessegueiro sobre o crescimento vegetativo, nutrição mineral e substâncias de reserva em plantas do porta-enxerto de pessegueiro cv. Aldrighi [Prunus persica (L. Batsch]. O delineamento experimental utilizado foi o de blocos casualizados, com dez plantas por parcela e quatro repetições. As plantas inoculadas com Glomus etunicatum apresentaram maior altura, diâmetro, área foliar, biomassa fresca e seca, nutrição mineral e substâncias de reserva da parte aérea, enquanto as inoculadas com Glomus clarum induziram um crescimento intermediário, superior àquelas inoculadas com Gigaspora margarita, que apresentaram resultados semelhantes às plantas não inoculadas. O desempenho foi relacionado com as taxas de colonização que nas plantas inoculadas com Glomus etunicatum e Glomus clarum foram de 92% e 77% respectivamente, enquanto Gigaspora margarita colonizou somente 30% das raízes.This work aimed to evaluate the influence of three arbuscular mycorrhizal fungi (AMF species on the vegetative growth, mineral nutrition and carbohidrate contents on peach rootstocks cv. Aldrighi [Prunus persica (L. Batsch]. The experimental desing was the one of randomized blocks, with ten plants per plots and four repetitions. Plants inoculated with Glomus etunicatum presented larger stem height, stem diameter, foliar area, fresh and dry shoot biomass, leaf mineral nutrition and carbohidrate contents, while those inoculated with Glomus clarum induced an intermediate growth, higher to those inoculated with Gigaspora margarita that presented results similar to the non inoculated plants. Plant growth performance was related to colonization taxes, which were, respectively, 92%, 77% and 30% to Glomus etunicatum, Glomus clarum and Gigaspora margarita inoculated plants.

  14. Structure-Property Characterization of the Crinkle-Leaf Peach Wood Phenotype: A Future Model System for Wood Properties Research? (United States)

    Wiedenhoeft, Alex C.; Arévalo, Rafael; Ledbetter, Craig; Jakes, Joseph E.


    Nearly 400 million years of evolution and field-testing by the natural world has given humans thousands of wood types, each with unique structure-property relationships to study, exploit, and ideally, to manipulate, but the slow growth of trees makes them a recalcitrant experimental system. Variations in wood features of two genotypes of peach ( Prunus persica L.) trees, wild-type and crinkle-leaf, were examined to elucidate the nature of weak wood in crinkle-leaf trees. Crinkle-leaf is a naturally-occurring mutation in which wood strength is altered in conjunction with an easily observed `crinkling' of the leaves' surface. Trees from three vigor classes (low growth rate, average growth rate, and high growth rate) of each genotype were sampled. No meaningful tendency of dissimilarities among the different vigor classes was found, nor any pattern in features in a genotype-by-vigor analysis. Wild-type trees exhibited longer vessels and fibers, wider rays, and slightly higher specific gravity. Neither cell wall mechanical properties measured with nanoindentation nor cell wall histochemical properties were statistically or observably different between crinkle-leaf and wild-type wood. The crinkle-leaf mutant has the potential to be a useful model system for wood properties investigation and manipulation if it can serve as a field-observable vegetative marker for altered wood properties.

  15. Susceptibility, Oviposition Preference, and Biology of Grapholita molesta (Lepidoptera: Tortricidae) in Prunus Spp. Rootstock Genotypes. (United States)

    Bernardi, D; Lazzari, J C; Andreazza, F; Mayer, N A; Botton, M; Nava, D E


    Studying the susceptibility of peach trees to Grapholita molesta (Busck) is one of the major steps in the development of pest-resistant peach varieties. This work evaluated the susceptibility of 55 genotypes of the "Prunus Rootstock Collection" ("Coleção Porta-enxerto de Prunus") of Embrapa Temperate Climate (Pelotas, Rio Grande do Sul, Brazil) to the natural infestation of G. molesta, assessed the oviposition preference of G. molesta in choice and no-choice bioassays, and estimated the biological parameters and the fertility life table on different Prunus spp. genotypes in the laboratory. Genotypes Prunus kansuensis (Rehder), I-67-52-9, and I-67-52-4 were the most susceptible to G. molesta infestation in the field (>60% of branches infested), while 'Sharpe' (Prunus angustifolia x Prunus spp.) and Prunus sellowii (Koehne) were the least infested (0% of branches infested). In choice and no-choice bioassays, G. molesta preferred to oviposit on P. kansuensis when compared with Sharpe. The Sharpe genotype also showed an antibiosis effect, resulting in negative effects on the fertility life table parameters when compared with the genotypes P. kansuensis and 'Capdeboscq.' The results found in the present study can provide information to initiate a long-term breeding program moving desired G. molesta resistance traits from the rootstock into the Prunus spp. cultivars. © The Authors 2017. Published by Oxford University Press on behalf of Entomological Society of America. All rights reserved. For Permissions, please email:

  16. Transcription of densovirus endogenous sequences in the Myzus persicae genome. (United States)

    Clavijo, Gabriel; van Munster, Manuella; Monsion, Baptiste; Bochet, Nicole; Brault, Véronique


    Integration of non-retroviral sequences in the genome of different organisms has been observed and, in some cases, a relationship of these integrations with immunity has been established. The genome of the green peach aphid, Myzus persicae (clone G006), was screened for densovirus-like sequence (DLS) integrations. A total of 21 DLSs localized on 10 scaffolds were retrieved that mostly shared sequence identity with two aphid-infecting viruses, Myzus persicae densovirus (MpDNV) and Dysaphis plantaginea densovirus (DplDNV). In some cases, uninterrupted potential ORFs corresponding to non-structural viral proteins or capsid proteins were found within DLSs identified in the aphid genome. In particular, one scaffold harboured a complete virus-like genome, while another scaffold contained two virus-like genomes in reverse orientation. Remarkably, transcription of some of these ORFs was observed in M. persicae, suggesting a biological effect of these viral integrations. In contrast to most of the other densoviruses identified so far that induce acute host infection, it has been reported previously that MpDNV has only a minor effect on M. persicae fitness, while DplDNV can even have a beneficial effect on its aphid host. This suggests that DLS integration in the M. persicae genome may be responsible for the latency of MpDNV infection in the aphid host.

  17. Population survey of phytoseiid mites and spider mites on peach leaves and wild plants in Japanese peach orchard. (United States)

    Wari, David; Yamashita, Jun; Kataoka, Yoko; Kohara, Yoko; Hinomoto, Norihide; Kishimoto, Hidenari; Toyoshima, Shingo; Sonoda, Shoji


    A population survey of phytoseiid mites and spider mites was conducted on peach leaves and wild plants in Japanese peach orchards having different pesticide practices. The phytoseiid mite species composition on peach leaves and wild plants, as estimated using quantitative sequencing, changed during the survey period. Moreover, it varied among study sites. The phytoseiid mite species compositions were similar between peach leaves and some wild plants, such as Veronica persica, Paederia foetida, Persicaria longiseta, and Oxalis corniculata with larger quantities of phytoseiid mites, especially after mid-summer. A PCR-based method to detect the ribosomal ITS sequences of Tetranychus kanzawai and Panonychus mori from phytoseiid mites was developed. Results showed that Euseius sojaensis (specialized pollen feeder/generalist predator) uses both spider mites as prey in the field.

  18. Gene flow in Prunus species in the context of novel trait risk assessment. (United States)

    Cici, S Zahra H; Van Acker, Rene C


    Prunus species are important commercial fruit (plums, apricot, peach and cherries), nut (almond) and ornamental trees cultivated broadly worldwide. This review compiles information from available literature on Prunus species in regard to gene flow and hybridization within this complex of species. The review serves as a resource for environmental risk assessment related to pollen mediated gene flow and the release of transgenic Prunus. It reveals that Prunus species, especially plums and cherries show high potential for transgene flow. A range of characteristics including; genetic diversity, genetic bridging capacity, inter- and intra-specific genetic compatibility, self sterility (in most species), high frequency of open pollination, insect assisted pollination, perennial nature, complex phenotypic architecture (canopy height, heterogeneous crown, number of flowers produced in an individual plant), tendency to escape from cultivation, and the existence of ornamental and road side Prunus species suggest that there is a tremendous and complicated ability for pollen mediated gene movement among Prunus species. Ploidy differences among Prunus species do not necessarily provide genetic segregation. The characteristics of Prunu s species highlight the complexity of maintaining coexistence between GM and non-GM Prunus if there were commercial production of GM Prunus species. The results of this review suggest that the commercialization of one GM Prunus species can create coexistence issues for commercial non-GM Prunus production. Despite advances in molecular markers and genetic analysis in agroecology, there remains limited information on the ecological diversity, metapopulation nature, population dynamics, and direct measures of gene flow among different subgenera represented in the Prunus genus. Robust environmental impact, biosafety and coexistence assessments for GM Prunus species will require better understanding of the mechanisms of gene flow and hybridization

  19. Marker list: QM99273 [PGDBj Registered plant list, Marker list, QTL list, Plant DB link and Genome analysis methods[Archive

    Lifescience Database Archive (English)

    Full Text Available QM99273 Prunus persica Rosaceae MA024a SSR AACCCAATCCAATATCAACC GGGGGATCTCTCAACTCAA almond...-peach hybrid GN22|self-fertilization of almond-peach hybrid GN22 (GN22) LG_02 ... R_MiaNem gene (contr

  20. Marker list: QM99261 [PGDBj Registered plant list, Marker list, QTL list, Plant DB link and Genome analysis methods[Archive

    Lifescience Database Archive (English)

    Full Text Available QM99261 Prunus persica Rosaceae ssrPACITA27 SSR GATCCCTCAACTGAATCTCTC CGTCACAACAATAGATGCGAAGG almond...-peach hybrid GN22|Myrobalan plum P.2175|self-fertilization of almond-peach hybrid GN22 (G

  1. Airborne Thermal Imagery to Detect the Seasonal Evolution of Crop Water Status in Peach, Nectarine and Saturn Peach Orchards


    Joaquim Bellvert; Jordi Marsal; Joan Girona; Victoria Gonzalez-Dugo; Elías Fereres; Ustin, Susan L; Zarco-Tejada, Pablo J.


    In the current scenario of worldwide limited water supplies, conserving water is a major concern in agricultural areas. Characterizing within-orchard spatial heterogeneity in water requirements would assist in improving irrigation water use efficiency and conserve water. The crop water stress index (CWSI) has been successfully used as a crop water status indicator in several fruit tree species. In this study, the CWSI was developed in three Prunus persica L. cultivars at different phenologica...

  2. Avaliação da necessidade de frio em pessegueiro Avaliation of chilling requirement in peach

    Directory of Open Access Journals (Sweden)

    Idemir Citadin


    Full Text Available A necessidade de frio de seis cultivares de pessegueiro [Prunus persica (L. Batsch] foi estudada em plantas de um e dois anos, em vasos, submetidas a 150; 300; 450 e 600 horas a 2ºC, e em ramos coletados periodicamente em plantas sob condições de frio natural, a campo. Considerando os resultados obtidos nos dois experimentos, estima-se que a necessidade de frio de 'Precocinho' é em torno de 300 horas a 2ºC, equivalente a 150 unidades de frio (UF pelo modelo de Utah, ou próxima a 200 horas abaixo de 12ºC; para 'Eldorado' e 'Rio grandense', em 450 horas a 2ºC (225 UF ou 365 horas abaixo de 12ºC; para 'BR-1', em 450 horas a 2ºC (225 UF ou 418 horas abaixo de 12ºC; e para 'Planalto' e 'Della Nona', acima de 600 horas a 2ºC (>300 UF. Não foi possível estabelecer a necessidade de frio abaixo de 12ºC para 'Della Nona'.Chilling requirement was investigated in six peach [Prunus persica (L. Batsch] cultivars observing plants in containers, with one or two years, artificially chilled by 150, 300, 450, and 600 hours at 2ºC, and in excised shoots that were periodically taken from the orchard during the rest period. Chilling requirement of 'Precocinho' is 300 hours at 2ºC (around 150 chilling units - CU - using Utah Model or around 200 hours under 12ºC; 'Riograndense' and 'Eldorado' have 450 chilling hours at 2ºC (225 CU or 365 chilling hours under 12ºC; 'BR-1' is 450 chilling requirement at 2ºC (225 CU or 418 chilling hours under 12 ºC; and 'Planalto' and 'Della Nona' are over 600 chilling hours at 2ºC (>300 CU. It was not possible to estimate chilling requirement in 'Della Nona' using temperatures under 12 ºC.

  3. Use of Genetic Diversity of the Genus Prunus L. in Selection of Clonal Rootstocks for Stone Fruit Crops and Features of Their Reproduction

    Directory of Open Access Journals (Sweden)

    Eremin Gennadiy V.


    Full Text Available On the basis of diversity of wild types of the genus Prunus L. (P. cerasifera, P. armeniaca, P. persica, P. fruticosa, P. lannesiana, P. maackii, P. tomentosa, P. pumila, and P. incana in the collection of the Krymsk Experiment Breeding Station, highly adaptive, medium or weak vigour clonal rootstocks for stone fruit crops with good compatibility with grafted cultivars were selected: for plum, apricot and peach - Kuban 86, VVA-1, Evrika 99, Zarevo (Glow, Alab 1, Speaker, Best, VSV-1; and for sweet cherries and sour cherries - L-2, LC-52, VSL-1, VSL-2, and RVL-9. Part of the rootstocks were tested and successfully used in different parts of Russia and some near and far countries. The applied integration of tissue culture in vitro in the selection process at the station considerably promoted the rapid introduction of new rootstocks into world production. Technologies were developed for microclonal reproduction, and green and woody cuttings. The revealed light rooting of woody cuttings of stocks Kuban 86, Evrika 99, Zarevo, Best, VSL-1, RVL-9 (50-80% allowed to develop technology for growing of young plants on these rootstocks directly in the first field of the nursery.

  4. Response of Green Peach Aphids and Other Arthropods to Garlic Intercropped with Tobacco

    NARCIS (Netherlands)

    Lai, R.; You, M.; Lotz, L.A.P.; Vasseur, L.


    The green peach aphid, Myzus persicae (Sulzer), is an insect pest that causes extensive damage to tobacco (Nicotiana tabacum L.) in China. Field trials were conducted in 2008 and 2009 at Longyan in the Fujian Province (China) to evaluate the effects of garlic (Allium sativum L.) as a deterrent to

  5. O pessegueiro em pomar compacto. IX. dez anos de produção de cultivares sob poda drástica bienal The peach meadow orchard system. IX. yield of cultivars during ten years on biennial drastic pruning

    Directory of Open Access Journals (Sweden)

    Wilson Barbosa


    Full Text Available O objetivo deste trabalho foi comparar o desenvolvimento vegetativo e reprodutivo de quatorze cultivares e seleções de pessegueiro (Prunus persica L. Batsch e nectarineira cultivadas no espaçamento de 4 x 1,5 m (1.667 pl/ha, sob poda drástica bienal da copa. Pelos resultados obtidos no decênio 1986-95, verificou-se que as cultivares e seleções mais produtivas foram (número e kg de frutos/planta respectivamente: Aurora-1 (112; 9,2, IAC 680-178 (94; 8,5, IAC 680-13 (95; 8,1, Talismã (99; 8,1, Régis (98; 7,8 e Flordaprince (91; 7,7. No ano agrícola de 1995, as variáveis analisadas, área da secção transversal do tronco, área da folha, número e massa dos frutos por cm² de tronco, apresentaram diferenciação estatística entre cultivares e seleções. A poda drástica bienal da copa ocasionou, tanto em material precoce quanto mediano, diminuição de produção a cada duas safras, não chegando, porém, a prejudicar a produtividade média do pomar.Fourteen peach (Prunus persica L. Batsch and nectarine cultivars and selections, budded on Okinawa rootstock, were grown under the meadow orchard system, with biennial drastic pruning at 4 x 1.5 m spacing. Results obtained during ten years of experiments (1986-95 clearly indicate that 'Aurora-1', IAC 680-178, IAC 680-13, 'Talismã', 'Régis' and 'Flordaprince' peaches were the best, with an average yield (fruits per tree of 112, 9.2; 94, 8.5; 95, 8.1; 99, 8.1; 98, 7.8 and 91, 7.7 number and kg/tree respectively. The biennial drastic pruning decreased the yield of trees every two years, without affecting the average decennial productivity. In 1995, data on trunk cross-sectional area, fruits and mass per cm² of trunk and leaf area presented significant differences among cultivars and selections.

  6. Caracterização de cultivares de pessegueiro e de nectarineira por marcadores moleculares Characterization of peach and nectarine cultivars through molecular markers

    Directory of Open Access Journals (Sweden)

    Marli Rocha Lima


    Full Text Available Em espécies de estreita base genética, como o pessegueiro e a nectarineira (Prunus persica (L. Batsch, a utilização de marcadores moleculares para a caracterização de cultivares é de grande importância, além do potencial de uso para fins de proteção. As técnicas de eletroforese em gel e RAPD foram empregadas com o objetivo de caracterizar as cultivares de pessegueiro Granada, Esmeralda, Jade, Eldorado, Riograndense, Capdeboscq, Aldrighi, Precocinho, Diamante, Turmalina, Maciel, BR-1, Pepita, Coral, Chinoca, Marfim, Chiripá, Della Nona e Planalto, e as de nectarineira Dulce e Anita. Foram analisadas isoenzimas de 6-fosfogluconato desidrogenase e fosfatase ácida em pólen, peroxidase, fosfoglucoisomerase, aspartato transaminase e isocitrato desidrogenase em folhas, e malato desidrogenase, leucina aminopeptidase e fosfoglucomutase em pólen e folhas. Dos 50 primers testados, 11 foram escolhidos para análise de RAPD em folhas. As análises de similaridade e de agrupamento entre os genótipos foram feitas empregando-se o coeficiente de Jaccard e o método da média aritmética não ponderada. Apesar das diferenças detectadas nas isoenzimas de malato desidrogenase em pólen e folhas de pessegueiro e nectarineira, o baixo polimorfismo apresentado pelos demais sistemas não permitiu a caracterização de todas as cultivares por essa técnica. Os marcadores RAPD, associados ou não à eletroforese de isoenzimas, foram eficientes para caracterizar as cultivares de pessegueiro e nectarineira.In species with a narrow genetic basis, such as peach and nectarine (Prunus persica (L. Batsch, the utilization of molecular markers in cultivar characterization is very important, besides the potential of use for protection. Gel electrophoresis and RAPD techniques were used to characterize peach cultivars Granada, Esmeralda, Jade, Eldorado, Riograndense, Capdeboscq, Aldrighi, Precocinho, Diamante, Turmalina, Maciel, BR-1, Pepita, Coral, Chinoca, Marfim

  7. Irrigation and weed control alter soil microbiology and nutrient availability in North Carolina Sandhill peach orchards. (United States)

    Zhang, Yi; Wang, Liangju; Yuan, Yongge; Xu, Jing; Tu, Cong; Fisk, Connie; Zhang, Weijian; Chen, Xin; Ritchie, David; Hu, Shuijin


    Orchard management practices such as weed control and irrigation are primarily aimed at maximizing fruit yields and economic profits. However, the impact of these practices on soil fertility and soil microbiology is often overlooked. We conducted a two-factor experimental manipulation of weed control by herbicide and trickle irrigation in a nutrient-poor peach (Prunus persica L. cv. Contender) orchard near Jackson Springs, North Carolina. After three and eight years of treatments, an array of soil fertility parameters were examined, including soil pH, soil N, P and cation nutrients, microbial biomass and respiration, N mineralization, and presence of arbuscular mycorrhizal fungi (AMF). Three general trends emerged: 1) irrigation significantly increased soil microbial biomass and activity, 2) infection rate of mycorrhizal fungi within roots were significantly higher under irrigation than non-irrigation treatments, but no significant difference in the AMF community composition was detected among treatments, 3) weed control through herbicides reduced soil organic matter, microbial biomass and activity, and mineral nutrients, but had no significant impacts on root mycorrhizal infection and AMF communities. Weed-control treatments directly decreased availability of soil nutrients in year 8, especially soil extractable inorganic N. Weed control also appears to have altered the soil nutrients via changes in soil microbes and altered net N mineralization via changes in soil microbial biomass and activity. These results indicate that long-term weed control using herbicides reduces soil fertility through reducing organic C inputs, nutrient retention and soil microbes. Together, these findings highlight the need for alternative practices such as winter legume cover cropping that maintain and/or enhance organic inputs to sustain the soil fertility. Copyright © 2017 Elsevier B.V. All rights reserved.

  8. PpeTAC1 promotes the horizontal growth of branches in peach trees and is a member of a functionally conserved gene family found in diverse plants species. (United States)

    Dardick, Chris; Callahan, Ann; Horn, Renate; Ruiz, Karina B; Zhebentyayeva, Tetyana; Hollender, Courtney; Whitaker, Michael; Abbott, Albert; Scorza, Ralph


    Trees are capable of tremendous architectural plasticity, allowing them to maximize their light exposure under highly competitive environments. One key component of tree architecture is the branch angle, yet little is known about the molecular basis for the spatial patterning of branches in trees. Here, we report the identification of a candidate gene for the br mutation in Prunus persica (peach) associated with vertically oriented growth of branches, referred to as 'pillar' or 'broomy'. Ppa010082, annotated as hypothetical protein in the peach genome sequence, was identified as a candidate gene for br using a next generation sequence-based mapping approach. Sequence similarity searches identified rice TAC1 (tiller angle control 1) as a putative ortholog, and we thus named it PpeTAC1. In monocots, TAC1 is known to lead to less compact growth by increasing the tiller angle. In Arabidopsis, an attac1 mutant showed more vertical branch growth angles, suggesting that the gene functions universally to promote the horizontal growth of branches. TAC1 genes belong to a gene family (here named IGT for a shared conserved motif) found in all plant genomes, consisting of two clades: one containing TAC1-like genes; the other containing LAZY1, which contains an EAR motif, and promotes vertical shoot growth in Oryza sativa (rice) and Arabidopsis through influencing polar auxin transport. The data suggest that IGT genes are ancient, and play conserved roles in determining shoot growth angles in plants. Understanding how IGT genes modulate branch angles will provide insights into how different architectural growth habits evolved in terrestrial plants. © 2013 The Authors The Plant Journal © 2013 John Wiley & Sons Ltd.

  9. Gum spots in black cherry caused by natural attacks of peach bark beetle (United States)

    Charles O. Rexrode


    Peach bark beetles, Phloeotribus liminaris (Harris), made abortive attacks on healthy black cherry, Prunus serotina Ehrh., trees. The beetle attacks caused five types of gum spots in the wood and a gummy exudate on the bark. The most extensive and common types of gum spot were single and multiple rows of interray gum spots that...

  10. Structure-function characterization of the crinkle-leaf peach wood phenotype: a future model system for wood properties research? (United States)

    Variations in wood features of two genotypes of Prunus persica L. trees, wild-type and crinkle-leaf, were examined to elucidate the nature of weak wood in crinkle-leaf trees. Trees from three vigor classes (low, average, and high) of each genotype were sampled. No meaningful tendency of dissimilarit...

  11. Phenology and reproductive traits of peaches and nectarines in Central-East Argentina Fenologia e comportamento reprodutivo de pêssego no centro-leste da Argentina

    Directory of Open Access Journals (Sweden)

    Norberto Francisco Gariglio


    Full Text Available In Santa Fe, the central-east area of Argentina, the expansion of fruit tree crops requires the introduction and evaluation of low chilling varieties. The aims of this study was to characterize the phenological behaviour and the reproductive traits of peach (Prunus persica L. Batsch and nectarine varieties with chilling requirements ranging from 150 to 650 chilling hours (CH. Low chilling varieties (500 CH. The phenology of high chilling requirement varieties had the advantage that blooming and fruit set happened after the period of late frost occurrence. However, they did not satisfy their chilling requirement, showing an inadequate vegetative and reproductive behaviour. Low chilling varieties began to sprout during July, and the period of full bloom occurred from July 14th to August 4th. Fruit harvest was initiated on October 19th with the cv. 'Flordastar' and it extended for 58 days. However, on low chilling varieties the harvest time was reduced in ten days. Flower density, fruit set and fruit yield showed a negative relationship with the chilling requirement of the variety.Na região centro-leste do estado de Santa Fé, Argentina, para a expansão dos frutais é preciso introduzir variedades de baixo requerimento de frio. O objetivo deste estudo foi caracterizar o comportamento durante as fases de crescimento e frutificação de variedades de pêssego (Prunus persica L. Batsch e nectarina com requerimentos de frio que variam entre 150-650 horas de frio (CH. As variedades de pêssego de baixa necessidade de frio (500 CH. As variedades de maior necessidade de frio tiveram a vantagem da floração, e o estabelecimento dos frutos aconteceu depois do período de risco de geadas. Porém, essas variedades não têm satisfeita sua necessidade de frio, apresentando comportamento vegetativo e reprodutivo inadequado. As variedades de baixa necessidade de frio brotaram entre 4 a 31 de julho e o período de plena floração aconteceu entre 14 de julho a

  12. Genomic resources for Myzus persicae: EST sequencing, SNP identification, and microarray design

    Directory of Open Access Journals (Sweden)

    Malloch Gaynor


    Full Text Available Abstract Background The green peach aphid, Myzus persicae (Sulzer, is a world-wide insect pest capable of infesting more than 40 plant families, including many crop species. However, despite the significant damage inflicted by M. persicae in agricultural systems through direct feeding damage and by its ability to transmit plant viruses, limited genomic information is available for this species. Results Sequencing of 16 M. persicae cDNA libraries generated 26,669 expressed sequence tags (ESTs. Aphids for library construction were raised on Arabidopsis thaliana, Nicotiana benthamiana, Brassica oleracea, B. napus, and Physalis floridana (with and without Potato leafroll virus infection. The M. persicae cDNA libraries include ones made from sexual and asexual whole aphids, guts, heads, and salivary glands. In silico comparison of cDNA libraries identified aphid genes with tissue-specific expression patterns, and gene expression that is induced by feeding on Nicotiana benthamiana. Furthermore, 2423 genes that are novel to science and potentially aphid-specific were identified. Comparison of cDNA data from three aphid lineages identified single nucleotide polymorphisms that can be used as genetic markers and, in some cases, may represent functional differences in the protein products. In particular, non-conservative amino acid substitutions in a highly expressed gut protease may be of adaptive significance for M. persicae feeding on different host plants. The Agilent eArray platform was used to design an M. persicae oligonucleotide microarray representing over 10,000 unique genes. Conclusion New genomic resources have been developed for M. persicae, an agriculturally important insect pest. These include previously unknown sequence data, a collection of expressed genes, molecular markers, and a DNA microarray that can be used to study aphid gene expression. These resources will help elucidate the adaptations that allow M. persicae to develop compatible

  13. Resistência de clones de umezeiro e cultivares de pessegueiro a Meloidogyne incognita (nemata: Heteroderidae Resistance of mume clones and peach tree cultivars to Meloidogyne incognita (nemata: heteroderidae

    Directory of Open Access Journals (Sweden)

    Newton Alex Mayer


    Full Text Available O presente estudo teve por objetivo avaliar a reação dos Clones 05; 10 e 15 de umezeiro (Prunus mume Sieb. et Zucc. e das cultivares Okinawa, Aurora-1 e Dourado-1 de pessegueiro [Prunus persica (L. Batsch] a Meloidogyne incognita (Kofoid and White Chitwood, em condições de casa de vegetação. As plantas foram mantidas em vasos de cerâmica contendo uma mistura de solo e areia (1:1, v/v, previamente autoclavada a 121ºC e por 2 horas. Aos 60 dias após o plantio, cada planta foi inoculada com 2.000 ovos e juvenis de segundo estádio de Meloidogyne incognita. O experimento foi conduzido em delineamento inteiramente casualizado, com 6 tratamentos (genótipos e 9 repetições. Transcorridos 116 dias após a inoculação, as plantas foram colhidas para avaliação do sistema radicular. Foi possível verificar que o número de galhas por sistema radicular, o número de ovos e juvenis por 10g de raízes e por sistema radicular foi nulo ou praticamente nulo em todos os clones e nas cultivares estudadas, de forma que os respectivos fatores de reprodução foram todos inferiores a 1. Conclui-se que os Clones 05; 10 e 15 de umezeiro, assim como as cultivares Okinawa, Aurora-1 e Dourado-1 de pessegueiro são resistentes a Meloidogyne incognita.The present study had for objective to study the reaction of mume Clones 05, 10 and 15 (Prunus mume Sieb. et Zucc. and 'Okinawa', 'Aurora-1' and 'Dourado-1' peach tree cultivars [Prunus persica (L. Batsch] to Meloidogyne incognita (Kofoid and White Chitwood, in greenhouse conditions. The plants were maintained in ceramic boxes containing a soil-sand mixture (1:1, v/v, previously autoclaved at 121ºC and 1 for 2 hours. On the sixtieth day after planting, each plant was inoculated with 2,000 eggs in the second stage juvenile of Meloidogyne incognita. The experiment was carried out in randomized design with 6 treatments (genotypes and 9 repetitions. After 116 days from inoculation, plants were

  14. Peach water relations, gas exchange, growth and shoot mortality under water deficit in semi-arid weather conditions. (United States)

    Rahmati, Mitra; Davarynejad, Gholam Hossein; Génard, Michel; Bannayan, Mohammad; Azizi, Majid; Vercambre, Gilles


    In this study the sensitivity of peach tree (Prunus persica L.) to three water stress levels from mid-pit hardening until harvest was assessed. Seasonal patterns of shoot and fruit growth, gas exchange (leaf photosynthesis, stomatal conductance and transpiration) as well as carbon (C) storage/mobilization were evaluated in relation to plant water status. A simple C balance model was also developed to investigate sink-source relationship in relation to plant water status at the tree level. The C source was estimated through the leaf area dynamics and leaf photosynthesis rate along the season. The C sink was estimated for maintenance respiration and growth of shoots and fruits. Water stress significantly reduced gas exchange, and fruit, and shoot growth, but increased fruit dry matter concentration. Growth was more affected by water deficit than photosynthesis, and shoot growth was more sensitive to water deficit than fruit growth. Reduction of shoot growth was associated with a decrease of shoot elongation, emergence, and high shoot mortality. Water scarcity affected tree C assimilation due to two interacting factors: (i) reduction in leaf photosynthesis (-23% and -50% under moderate (MS) and severe (SS) water stress compared to low (LS) stress during growth season) and (ii) reduction in total leaf area (-57% and -79% under MS and SS compared to LS at harvest). Our field data analysis suggested a Ψstem threshold of -1.5 MPa below which daily net C gain became negative, i.e. C assimilation became lower than C needed for respiration and growth. Negative C balance under MS and SS associated with decline of trunk carbohydrate reserves--may have led to drought-induced vegetative mortality.

  15. Botryosphaeriaceae as potential pathogens of prunus species in South Africa, with descriptions of Diplodia africana and Lasiodiplodia plurivora sp. nov

    NARCIS (Netherlands)

    Damm, Ulrike; Crous, Pedro W; Fourie, Paul H


    Botryosphaeriaceae are common dieback and canker pathogens of woody host plants, including stone fruit trees. In the present study the diversity of members of the Botryosphaeriaceae isolated from symptomatic wood of Prunus species (plum, peach, nectarine and apricot) was determined in stone

  16. Botryosphaeriaceae as potential pathogens of Prunus species in South Africa, with descriptions of Diplodia africana and Lasiodiplodia plurivora sp. nov.

    NARCIS (Netherlands)

    Damm, U.; Crous, P.W.; Fourie, P.H.


    Botryosphaeriaceae are common dieback and canker pathogens of woody host plants, including stone fruit trees. In the present study the diversity of members of the Botryosphaeriaceae isolated from symptomatic wood of Prunus species (plum, peach, nectarine and apricot) was determined in stone

  17. 2,6-Di-hidroxiacetofenona e tipo de corte basal no enraizamento de estacas semi-lenhosas de pessegueiro ‘Okinawa’ 2,6-Di-hydroxyacetophenone and basal cuts on rooting of the peach semi-hardwood cuttings

    Directory of Open Access Journals (Sweden)

    Mauro Brasil Dias Tofanelli


    Full Text Available A propagação do pessegueiro (Prunus persica no Brasil é baseada na enxertia sobre porta-enxertos oriundos de sementes. Outros métodos de propagação de frutíferas poderiam ser utilizados para o pessegueiro visando obtenção de materiais de melhor qualidade. Neste trabalho objetivou-se avaliar o efeito do 2,6-di-hidroxiacetofenona aplicado previamente ao ácido indol-butírico em estacas semi-lenhosas de pessegueiro da cultivar Okinawa preparadas com diferentes tipos de corte basal. Foram coletados ramos do porta-enxerto ‘Okinawa’ em dezembro de 2001 para o preparo das estacas sem folhas, com 12cm de comprimento, 7mm de diâmetro, quatro gemas e diferentes tipos de cortes basais (corte longitudinal, corte lateral e corte da casca tratado-as na base com 0 e 300mg L-1 de 2,6-di-hidroxiacetofenona por 4h em aeração (oxigenação e depois com 2500mg L-1 ácido indol-butírico por 5s. As estacas foram plantadas em bandejas de poliestireno expandido (72 células com vermiculita fina e colocadas em casa de nebulização por 45 dias. A aplicação de 300mg L-1 de 2,6-DHAP e a realização de lesões nas bases das estacas foram eficientes para aumentar o enraizamento das estacas semi-lenhosas do pessegueiro ‘Okinawa’, demonstrando que estas técnicas podem ser utilizadas para a propagação de pessegueiro por estaquia.The Peach (Prunus persica propagation in Brazil is basically by grafting on rootstock propagated by seeds. Others methods for fruit tree propagation could be used for peach to obtain high quality plants. The objective of this work was to evaluate the effect of the 2,6-di-hydroxyacetoplenone applied previously to the indol-butyric acid in peach semi-hardwood cuttings prepared with different types of cuts in the bases. The cuttings were prepared with 12cm in length, 7mm in diameter, 4 shoots, and with different basal cuts (longitudinal incision, lateral incision and husk incision and treated with 0 and 300mg L-1 of 2,6-di

  18. Effects of mti-2 Transgenic Potato Plants on the Aphid Myzus persicae (Sternorrhyncha: Aphididae

    Directory of Open Access Journals (Sweden)

    Julien Saguez


    Full Text Available Overexpressed in transgenic plants, protease inhibitors showed insecticidal effects against several insect taxa. We transformed potato internodes with the mustard trypsin inhibitor mti-2 gene. Among the 35 independent transgenic potato lines obtained via Agrobacterium tumefasciens transformation, four (DM6, DM7, DM11, and DM19 were selected for their high level of MTI-2 (at least to 30% of trypsin activity inhibition. Feeding assays were carried out to evaluate their effects on the green-peach aphid, Myzus persicae (Sternorrhyncha: Aphididae. Prereproductive period, nymphal mortality, adult fecundity, and doubling time of M. persicae populations were monitored on nontransformed potato plants (NT and the four selected DM lines. Compared to NT plants, DM19 did not induce any effect on M. persicae. In contrast, DM7 and DM11 increased nymphal survival by approximately 20%. DM6 and DM11 lines slightly enhanced M. persicae daily fecundity and intrinsic rate of natural increase, leading to a reduction of the doubling time of the populations by 1 day. DM6 did not impact nymphal mortality, whereas with the DM11 almost all the nymphs survived. Potato plants transformed with the mti-2 gene variably affected the life history of M. persicae but did not show any insecticidal effect on the aphid.

  19. Effect of Bag Removing with Reflective Film Mulching Before Harvest on Fruit Coloration and Expression of Anthocyanin Related Genes in Peach

    Directory of Open Access Journals (Sweden)

    Zhang Binbin


    Full Text Available Appearance quality is the main element forming the fruit quality. Both bagging and reflective film application can improve appearance comprehensive quality. In order to determine the effects of bagging and reflective film on peach fruit coloration, this study explored the effects of applying reflective film before harvest on fruit appearance quality of peach (Prunus persica, and discussed the influencing mechanism on fruit coloration. Yellow outside and black inside double-layer bags were removed from fruit twelve days d before harvest. Peel color, pigment content, enzyme activity as well as the gene expression related to fruit coloration of a well-colored and late-ripening peach cultivar ‘Xiahui 8’ with different treatments (non-bagging with non-reflective film mulching, debagging with non-reflective film mulching, debagging with reflective film mulching were researched. The results showed that both debagging with non-reflective film mulching and debagging with reflective film mulching could significantly improve red and green color difference value (a*, a*/b* (b* is yellow and blue color difference value, chroma (C, anthocyanin (Ant content and reduce hue angle (h, while debagging with reflective film mulching had higher Ant content than debagging with non-reflective film mulching (P < 0.05. The two treatments up-regulated the transcript level of anthocyanin biosynthetic related genes (UFGT, CHS at the beginning of the experiment, however, the expression of DFR, LDOX and F3H were enhanced along with the testing process. A downward trend on peel phenylalanine ammonia lyase (PAL activity of non-bagging with non-reflective film mulching was observed during the experiment, however, the peel PAL activity of the other two treatments first increased and then decreased. What’s more, peel PAL activity of debagging with reflective film mulching was higher than debagging with non-reflective film mulching. These results suggested that Ant synthesis

  20. Auxin and expression of TAC1 and MAX1-4 in different growth habits of peach (United States)

    Branch orientation and distribution are fundamental aspects of tree architecture that influence orchard design and management. The goal of the study was to identify genetically modifiable regulatory processes or those that can be managed culturally to customize tree architecture. Peach [Prunus per...

  1. Efeito do comprimento de estacas herbáceas de dois clones de umezeiro (Prunus mume Sieb & Zucc. no enraizamento adventício Effect of the length of herbaceous cuttings of two clones of japanese apricot (Prunus mume Sieb & Zucc. in adventicious rooting

    Directory of Open Access Journals (Sweden)



    Full Text Available O umezeiro (Prunus mumeSieb & Zucc. é uma rosácea de folhas caducas, nativa da China, cujos frutos e flores são muito apreciados pelos povos orientais. No Brasil, alguns estudos foram realizados visando a sua utilização como porta-enxerto para pessegueiro e nectarineira, dadas as suas características de adaptação, rusticidade, redução do porte da planta e compatibilidade com algumas cultivares de Prunus persica. O presente estudo foi conduzido em câmara de nebulização sob ripado, pertencente ao Departamento de Produção Vegetal da FCAV/UNESP, Câmpus de Jaboticabal-SP. Objetivou-se verificar a influência de quatro comprimentos de estacas herbáceas no enraizamento de dois clones de umezeiro. O material vegetal, identificado como Clone 10 e Clone 15, foi oriundo do Programa de Melhoramento Genético do Instituto Agronômico de Campinas-SP. O experimento foi constituido de fatorial 2 x 4, em blocos casualizados, sendo o fator clone em 2 níveis (Clone 10 e Clone 15 e o fator comprimento de estaca em 4 níveis (12; 15; 18 e 25cm. Pelos resultados observados, verificou-se diferença entre os clones somente na porcentagem de estacas brotadas e número de raízes por estaca. O comprimento da estaca influenciou na porcentagem de enraizamento e na mortalidade das estacas, sendo que estacas maiores tenderam a apresentar maiores porcentagens de enraizamento e menores de mortalidade. As estacas com 12cm, embora apresentando menor número de raízes por estaca, são recomendadas por permitirem a obtenção de um maior número de estacas por planta-matriz. Houve efeito significativo da interação entre os fatores para número e comprimento de raízes.The japanese apricot (Prunus mume Sieb & Zucc. is a Rosaceae of falling leaves, native of China, whose fruits and flowers are quite appreciated by the oriental people. In Brazil, some studies were accomplished seeking its use as rootstock for peach and nectarine trees, due its adaptation


    Directory of Open Access Journals (Sweden)



    Full Text Available ABSTRACT Nursery trees of stone fruits (Prunus spp. are traditionally produced by union of two distinct genotypes - the rootstock and the scion - which, by grafting, form a composite plant that will be maintained throughout of all plant life. In Brazil, the rootstocks are predominantly seed propagated and therefore usually results in heterogeneous trees for vigor and edaphic adaptation. However, with advances in rootstock breeding programs that released cultivars and certification in several countries (notably in Europe, the system will come gradually evolving for vegetative propagation (cuttings and tissue culture and use of seeds of selected rootstocks with specific characteristics and potted nursery trees production. For scion cultivar propagation, the budding system (with its many variations has predominantly been adopted in major producing countries. This review had as objective to comment main propagation methods adopted for rootstocks and scion in peach, nectarine and plum, and recent technical progress obtained as well as the needs of improvement for nursery tree production.

  3. Survey of resistance to four insecticides and their associated mechanisms in different genotypes of the green peach aphid (Hemiptera: Aphididae) from Chile (United States)

    The green peach aphid, Myzus persicae (Sulzer) (Hemiptera: Aphididae) is a major pest of agriculture worldwide that is particularly adept at evolving insecticide resistance very frequently develop insecticide resistance. Seven mechanisms that confer resistance to many insecticide types have been des...

  4. Postharvest quality of peaches harvested from integrated and conventional production systems Qualidade pós-colheita de pêssegos cultivados em sistema de produção integrada e convencional

    Directory of Open Access Journals (Sweden)

    Eduardo Seibert


    Full Text Available Over three years the postharvest quality of 'Marli' peaches harvested from the integrated (IFP and conventional production (CFP systems was evaluated. The peaches were harvested from commercial orchards of Prunus persica at two locations close to the city of São Jerônimo, RS, Brazil, and stored at 0.5°C for 10, 20 or 30 days. The peaches were evaluated at harvest, at retrieval from storage and after ripening periods at 20°C. No differences in fruit weight losses were determined. Decay incidence was low, and no differences were detected amongst systems in both 2001 and 2002 seasons, but in the 2000 season CFP peaches were more decayed. Flesh firmness of peaches from the IFP system were greater than CFP fruits in the years 2000 and 2001. In 2002, firmness changed little during storage and ripening. Peaches from the IFP in 2000 had higher titratable acidity and lower soluble solids. In the 2000 season, flesh browning was observed in decayed fruits, always at ripening after 20 or 30 days of cold storage Chilling injuries such as browning, woolliness and leatheriness ocurred in 2002. There were no differences amongst systems related to peach quality.A qualidade pós-colheita de pêssegos 'Marli', cultivados nos sistemas de produção integrada (PIF ou convencional (PCF, foi avaliada durante três anos consecutivos. Os pêssegos foram colhidos em duas áreas distintas, em pomares comerciais, no Município de São Jerônimo, RS, e foram armazenados a 0,5ºC por 10, 20 ou 30 dias. Os pêssegos foram avaliados na colheita, nas retiradas do armazenamento e após os períodos de amadurecimento a 20ºC. Não foram observadas diferenças na perda de peso entre os sistemas de produção. A ocorrência média de podridões foi baixa e sem diferenças entre os sistemas em 2001 e 2002, mas em 2000, os pêssegos da PCF apresentaram mais podridões. A firmeza da polpa foi superior nos pêssegos da PIF em 2000 e 2001. Em 2002, a firmeza pouco variou durante a

  5. 21 CFR 582.40 - Natural extractives (solvent-free) used in conjunction with spices, seasonings, and flavorings. (United States)


    ... source Algae, brown Laminaria spp. and Nereocystis spp. Algae, red Porphyra spp. and Rhodymenia palmata... (see algae, brown). Peach kernel (persic oil) Prunus persica Sieb. et Zucc. Peanut stearine Arachis...

  6. Sublethal Effects of Thiamethoxam on the Demographic Parameters of Myzus persicae (Hemiptera: Aphididae). (United States)

    Wang, Pan; Zhou, Li-Lin; Yang, Fan; Li, Mang; Liu, Xiao-Ming; Wang, Yong; Lei, Chao-Liang; Si, Sheng-Yun


    The green peach aphid, Myzus persicae Sulzer (Hemiptera: Aphididae), is an important sap-sucking pest of many crops, including Chinese cabbage, Brassinca oleracea L. The neonicotinoid insecticide thiamethoxam has been used as an effective insecticide to control M. persicae in cabbage fields. In this study, we assessed the effects of sublethal concentrations of thiamethoxam on demographic parameters of M. persicae. In leaf-dip bioassays, thiamethoxam showed a relatively high toxicity against M. persicae with an LC50 of 6.80 mg liter-1. The duration of the preadult stage was not significantly affected in the sublethal bioassay. Additionally, the longevity and adult preoviposition period were not significantly affected by sublethal thiamethoxam. However, sublethal thiamethoxam significantly increased fecundity (LC10) and prolonged the total preoviposition period (LC40). Consequently, the finite rate of increase (λ) and the intrinsic rate of increase (rm) of aphids exposed to the LC40 were significantly lower than those of control aphids, whereas the net reproductive rate (R0) was higher, and the generation time (T) and the population doubling time (DT) were longer in the treated group. Based on these results, hormesis was induced by sublethal thiamethoxam in M. persicae, with the population growth of M. persicae negatively affected at higher sublethal concentrations of thiamethoxam. Therefore, our study indicated that the possible effects of thiamethoxam on aphids require further study to develop optimized integrated pest management strategies. © The Authors 2017. Published by Oxford University Press on behalf of Entomological Society of America. All rights reserved. For Permissions, please email:

  7. Dicty_cDB: AFJ471 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available 3e-12 3 BU044708 |BU044708.1 PP_LEa0020E04f Peach developing fruit mesocarp Prunus persica cDNA clone PP_LEa0020E04f...3e-10 2 BU040616 |BU040616.1 PP_LEa0006L02f Peach developing fruit mesocarp Prunus persica cDNA clone PP_LEa0006L02f

  8. Dicty_cDB: VSF671 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available 010 1 BU044432 |BU044432.1 PP_LEa0019F12f Peach developing fruit mesocarp Prunus persica cDNA clone PP_LEa0019F12f...010 1 BU041024 |BU041024.1 PP_LEa0008A18f Peach developing fruit mesocarp Prunus persica cDNA clone PP_LEa0008A18f

  9. Dicty_cDB: SFC695 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available 2e-21 2 BU044708 |BU044708.1 PP_LEa0020E04f Peach developing fruit mesocarp Prunus persica cDNA clone PP_LEa0020E04f...1e-10 2 BU040616 |BU040616.1 PP_LEa0006L02f Peach developing fruit mesocarp Prunus persica cDNA clone PP_LEa0006L02f

  10. Dicty_cDB: CHK177 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available 4e-10 2 BU044708 |BU044708.1 PP_LEa0020E04f Peach developing fruit mesocarp Prunus persica cDNA clone PP_LEa0020E04f...4e-10 2 BU040616 |BU040616.1 PP_LEa0006L02f Peach developing fruit mesocarp Prunus persica cDNA clone PP_LEa0006L02f

  11. Dicty_cDB: SFH572 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available 5e-14 2 BU042811 |BU042811.1 PP_LEa0014A23f Peach developing fruit mesocarp Prunus persica cDNA clone PP_LEa0014A23f...3e-06 1 BU045895 |BU045895.1 PP_LEa0024G21f Peach developing fruit mesocarp Prunus persica cDNA clone PP_LEa0024G21f

  12. Dicty_cDB: AFF179 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available 8e-20 2 BU044708 |BU044708.1 PP_LEa0020E04f Peach developing fruit mesocarp Prunus persica cDNA clone PP_LEa0020E04f...2e-11 2 BU040616 |BU040616.1 PP_LEa0006L02f Peach developing fruit mesocarp Prunus persica cDNA clone PP_LEa0006L02f

  13. Dicty_cDB: AFJ440 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available 2e-12 3 BU044708 |BU044708.1 PP_LEa0020E04f Peach developing fruit mesocarp Prunus persica cDNA clone PP_LEa0020E04f...3e-10 2 BU040616 |BU040616.1 PP_LEa0006L02f Peach developing fruit mesocarp Prunus persica cDNA clone PP_LEa0006L02f

  14. Dicty_cDB: AFI655 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available 7e-10 2 BU044708 |BU044708.1 PP_LEa0020E04f Peach developing fruit mesocarp Prunus persica cDNA clone PP_LEa0020E04f...7e-10 2 BU040616 |BU040616.1 PP_LEa0006L02f Peach developing fruit mesocarp Prunus persica cDNA clone PP_LEa0006L02f

  15. Dicty_cDB: SSG238 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available 2e-21 2 BU044708 |BU044708.1 PP_LEa0020E04f Peach developing fruit mesocarp Prunus persica cDNA clone PP_LEa0020E04f...2e-10 2 BU040616 |BU040616.1 PP_LEa0006L02f Peach developing fruit mesocarp Prunus persica cDNA clone PP_LEa0006L02f

  16. Dicty_cDB: SSF821 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available 2e-21 2 BU044708 |BU044708.1 PP_LEa0020E04f Peach developing fruit mesocarp Prunus persica cDNA clone PP_LEa0020E04f...2e-10 2 BU040616 |BU040616.1 PP_LEa0006L02f Peach developing fruit mesocarp Prunus persica cDNA clone PP_LEa0006L02f

  17. Dicty_cDB: VSK338 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available 009 2 BU041769 |BU041769.1 PP_LEa0010G24f Peach developing fruit mesocarp Prunus persica cDNA clone PP_LEa0010G24f...010 1 BU042820 |BU042820.1 PP_LEa0014B11f Peach developing fruit mesocarp Prunus persica cDNA clone PP_LEa0014B11f

  18. Dicty_cDB: AFK171 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available 3e-12 3 BU044708 |BU044708.1 PP_LEa0020E04f Peach developing fruit mesocarp Prunus persica cDNA clone PP_LEa0020E04f...3e-10 2 BU040616 |BU040616.1 PP_LEa0006L02f Peach developing fruit mesocarp Prunus persica cDNA clone PP_LEa0006L02f

  19. Dicty_cDB: AFJ723 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available 2e-12 3 BU044708 |BU044708.1 PP_LEa0020E04f Peach developing fruit mesocarp Prunus persica cDNA clone PP_LEa0020E04f...2e-10 2 BU040616 |BU040616.1 PP_LEa0006L02f Peach developing fruit mesocarp Prunus persica cDNA clone PP_LEa0006L02f

  20. Dicty_cDB: SSL893 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available 7e-07 1 BU044708 |BU044708.1 PP_LEa0020E04f Peach developing fruit mesocarp Prunus persica cDNA clone PP_LEa0020E04f...5e-06 2 BU040616 |BU040616.1 PP_LEa0006L02f Peach developing fruit mesocarp Prunus persica cDNA clone PP_LEa0006L02f

  1. Dicty_cDB: CFG804 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available 2e-14 3 BU041060 |BU041060.1 PP_LEa0008C18f Peach developing fruit mesocarp Prunus persica cDNA clone PP_LEa0008C18f...10 BU040467 |BU040467.1 PP_LEa0006C14f Peach developing fruit mesocarp Prunus persica cDNA clone PP_LEa0006C14f

  2. Dicty_cDB: AFN717 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available 2e-12 3 BU044708 |BU044708.1 PP_LEa0020E04f Peach developing fruit mesocarp Prunus persica cDNA clone PP_LEa0020E04f...2e-10 2 BU040616 |BU040616.1 PP_LEa0006L02f Peach developing fruit mesocarp Prunus persica cDNA clone PP_LEa0006L02f

  3. Life cycle variation of Myzus persicae (Hemiptera: Aphididae) in Greece. (United States)

    Margaritopoulos, J T; Tsitsipis, J A; Goudoudaki, S; Blackman, R L


    During the years 1995-1999 the life cycle category of 2797 clones of Myzus persicae (Sulzer) was examined. The clones originated from primary and secondary hosts from different localities of North and Central Greece and the island of Crete in the south. Four different overwintering life cycle strategies were found that have also been described for M. persicae and other heteroecious species previously. A geographical variation was found in the proportion of holocyclic clones from tobacco and other secondary hosts associated with the abundance of the primary host in the sampling regions. In Central Macedonia, around the main peach-growing regions, the proportion of holocyclic clones was mostly above 50% and in some cases reached 100%. In localities of East Macedonia, holocyclic clones were also frequent. On the other hand, further south or in north-eastern Greece, where peach is not common, the proportion of holocyclic clones varied between 0 and 33%. Fifty seven percent of examined anholocyclic clones produced males under short day conditions, suggesting that androcyclic clones in Greece represent an important factor of genetic variability. Intermediate clones were sampled from all host-plants but at low frequencies (3.6% of total examined clones and 6.9% of non-holocyclic ones). Moreover, a regional variation was found in different colour forms feeding on tobacco plants. Red clones were predominant in regions where aphids overwinter parthenogenetically on weeds or winter crops. However, almost all clones from the primary host were green. The ecological aspects of life cycle variation are discussed.

  4. Susceptibility of Australian Myzus persicae (Hemiptera: Aphididae) to Three Recently Registered Insecticides: Spirotetramat, Cyantraniliprole, and Sulfoxaflor. (United States)

    de Little, Siobhan C; Umina, Paul A


    The green peach aphid, Myzus persicae (Sulzer), is a significant agricultural pest that has developed resistance to a large number of insecticides globally. Within Australia, resistance has previously been confirmed for multiple chemical groups, including pyrethroids, carbamates, organophosphates, and neonicotinoids. In this study, we use leaf-dip and topical bioassays to investigate susceptibility and potential cross-resistance of 12 field-collected populations of Australian M. persicae to three recently registered insecticides: sulfoxaflor, spirotetramat, and cyantraniliprole. Despite all 12 populations carrying known resistance mechanisms to carbamates, organophosphates, and pyrethroids, and two populations also exhibiting low-level metabolic resistance to neonicotinoids, we found little evidence of variation in susceptibility to sulfoxafor, spirotetramat, or cyantraniliprole. This provides further evidence that cross-resistance to spirotetramat, cyantraniliprole, and sulfoxaflor in M. persicae is not conferred by the commonly occurring resistance mechanisms MACE, super-kdr, amplification of the E4 esterase gene, or enhanced expression and copy number of the P450 gene, CYP6CY3. Importantly, this study also established toxicity baseline data that will be important for future monitoring of insecticide responses of M. persicae from both broadacre and horticultural crops. © The Authors 2017. Published by Oxford University Press on behalf of Entomological Society of America. All rights reserved. For Permissions, please email:

  5. Drug: D06769 [KEGG MEDICUS

    Lifescience Database Archive (English)

    Full Text Available PD:C00249], Octadecanoic acid [CPD:C01530] Prunus persica [TAX:3760] Same as: E00139 Therapeutic category: 5100 Rosacea...ach kernel; Powdered peach kernel; Peach kernel Crude drugs [BR:br08305] Dicot plants: rosids Rosaceae (rose family) D06769 Peach kernel PubChem: 47208420 ...

  6. Genética de la introgresión de genes del almendro (prunus dulcis Mill.) en el melocotonero [P. persica (l.) Batsch]: desarrollo de una estrategia de selección de líneas casi isogénicas (Nils) con marcadores moleculares


    Donoso Contreras, José M.


    El melocotonero es el frutal de hueso más importante a nivel mundial, y el tercer árbol de fruta dulce cultivada después del manzano y el peral. A nivel genético es una de las especies mejor caracterizadas de la familia Rosaceae. El melocotonero presenta un bajo nivel de variabilidad genética pero es sexualmente compatible con otras especies de Prunus, como el almendro, los cuales podrían ser una posible fuente de nuevos genes para enriquecer su pool genético. Estudiamos un conjunto de caract...

  7. Whole-Genome Analysis of Diversity and SNP-Major Gene Association in Peach Germplasm.

    Directory of Open Access Journals (Sweden)

    Diego Micheletti

    Full Text Available Peach was domesticated in China more than four millennia ago and from there it spread world-wide. Since the middle of the last century, peach breeding programs have been very dynamic generating hundreds of new commercial varieties, however, in most cases such varieties derive from a limited collection of parental lines (founders. This is one reason for the observed low levels of variability of the commercial gene pool, implying that knowledge of the extent and distribution of genetic variability in peach is critical to allow the choice of adequate parents to confer enhanced productivity, adaptation and quality to improved varieties. With this aim we genotyped 1,580 peach accessions (including a few closely related Prunus species maintained and phenotyped in five germplasm collections (four European and one Chinese with the International Peach SNP Consortium 9K SNP peach array. The study of population structure revealed the subdivision of the panel in three main populations, one mainly made up of Occidental varieties from breeding programs (POP1OCB, one of Occidental landraces (POP2OCT and the third of Oriental accessions (POP3OR. Analysis of linkage disequilibrium (LD identified differential patterns of genome-wide LD blocks in each of the populations. Phenotypic data for seven monogenic traits were integrated in a genome-wide association study (GWAS. The significantly associated SNPs were always in the regions predicted by linkage analysis, forming haplotypes of markers. These diagnostic haplotypes could be used for marker-assisted selection (MAS in modern breeding programs.

  8. The Peach v2.0 release: high-resolution linkage mapping and deep resequencing improve chromosome-scale assembly and contiguity. (United States)

    Verde, Ignazio; Jenkins, Jerry; Dondini, Luca; Micali, Sabrina; Pagliarani, Giulia; Vendramin, Elisa; Paris, Roberta; Aramini, Valeria; Gazza, Laura; Rossini, Laura; Bassi, Daniele; Troggio, Michela; Shu, Shengqiang; Grimwood, Jane; Tartarini, Stefano; Dettori, Maria Teresa; Schmutz, Jeremy


    The availability of the peach genome sequence has fostered relevant research in peach and related Prunus species enabling the identification of genes underlying important horticultural traits as well as the development of advanced tools for genetic and genomic analyses. The first release of the peach genome (Peach v1.0) represented a high-quality WGS (Whole Genome Shotgun) chromosome-scale assembly with high contiguity (contig L50 214.2 kb), large portions of mapped sequences (96%) and high base accuracy (99.96%). The aim of this work was to improve the quality of the first assembly by increasing the portion of mapped and oriented sequences, correcting misassemblies and improving the contiguity and base accuracy using high-throughput linkage mapping and deep resequencing approaches. Four linkage maps with 3,576 molecular markers were used to improve the portion of mapped and oriented sequences (from 96.0% and 85.6% of Peach v1.0 to 99.2% and 98.2% of v2.0, respectively) and enabled a more detailed identification of discernible misassemblies (10.4 Mb in total). The deep resequencing approach fixed 859 homozygous SNPs (Single Nucleotide Polymorphisms) and 1347 homozygous indels. Moreover, the assembled NGS contigs enabled the closing of 212 gaps with an improvement in the contig L50 of 19.2%. The improved high quality peach genome assembly (Peach v2.0) represents a valuable tool for the analysis of the genetic diversity, domestication, and as a vehicle for genetic improvement of peach and related Prunus species. Moreover, the important phylogenetic position of peach and the absence of recent whole genome duplication (WGD) events make peach a pivotal species for comparative genomics studies aiming at elucidating plant speciation and diversification processes.

  9. Eugenol bloom thinner on peach (United States)

    Peaches must be thinned to obtain annual crops of marketable size fruit. Traditionally, peach thinning has been accomplished by hand in the absence of reliable chemical thinners. Peach thinning is a labor intensive, expensive cultural practice. Previous studies in our lab have demonstrated that e...


    Directory of Open Access Journals (Sweden)

    Marcelo de Almeida Reis


    Full Text Available

    Seedling quality is essential for producing quality fruits and keeping the producer revenue. The main goal of this research was to investigate the effect of different environmental conditions and three grafting methods in the production of peach-tree seedlings (Prunus persica (L. Batsch. The experiment took place at the Universidade Federal de Lavras, Minas Gerais State, Brazil. The experimental design was completely randomized, in a 3x3 factorial scheme (three environments: plastic greenhouse, mesh of 50% of shading, and open field; and three grafting methods: shield budding, patch budding, and cleft grafting, with four replications and 12 plants per plot. ‘Okinawa’ was the rootstocks used, and buddings and grafts originated from the ‘Diamante’ peach-tree cultivar. The features evaluated were graft-take (% and time to reach the first formation pruning (days. It was concluded that the mean average graft-take percentage for all three grafting methods was 91.94%, independently of the environment. For all three environmental conditions studied, seedlings grafted according to the cleft grafting method were the fastest ones to reach the first formation pruning, while the patch budding method allowed less time for the first formation pruning, for the open field and mesh environments, when compared with the shield budding method.

  11. Influência do manejo do solo e da intensidade de raleio de frutas, no crescimento e qualidade de pêssegos, cvs. Cerrito e Chimarrita Influence of the soil management and fruits thinning intensity, in the growth and quality of peaches, cvs. Cerrito and Chimarrita

    Directory of Open Access Journals (Sweden)

    Fernando Rogério Costa Gomes


    Full Text Available Com o objetivo de avaliar a influência das práticas de manejo do solo e intensidades de raleio de frutas no crescimento e classificação comercial de pêssegos das cultivares Cerrito e Chimarrita, foi instalado o experimento em pomares de pessegueiros (Prunus persica L. Batsch, localizados no município de Pelotas-RS. Nestes, parcelas de solo vêm sendo manejadas desde 1996, com cobertura de aveia-preta (Avena strigosa Schreb, sistema de produção integrada de pêssego (PIP e parcelas mantidas com gradagens, arações e emprego de herbicidas, sistema convencional (PC. As plantas, nos dois sistemas de manejo do solo (PIP e PC, foram submetidas a três intensidades de raleio de frutas, tomando-se por referência a relação, o número de de área da secção transversal do tronco, medida a 20 cm da superfície do solo, permanecendo: 4; 5 e 6 Avaliaram-se, nas frutas, no período de pós-raleio à colheita, o crescimento semanal do diâmetro sutural e, na colheita, a classificação comercial (tipo 1; 2 e 3. Na cv. Cerrito, não ocorreu influência do sistema de manejo do solo, assim como das intensidades de raleio, no crescimento final e classificação comercial das frutas, e não houve interferência da cobertura total do solo com aveia-preta, com o crescimento das frutas nos distintos períodos de avaliação, quando comparado ao sistema de manejo convencional do solo (PC.With the objective of evaluating the influence of soil management practices and the intensity of fruit thinning during their growth and the commercial classification of peach' cultivars Cerrito and Chimarrita, an experiment was conducted in peach orchards (Prunus persica L. Batsch, in the rural area of Pelotas/RS. Since 1996, in these orchards, plots have been managed with a sod of black-oat (Avena strigosa Schreb as well as weeds soil cleaning through tilling and/or use of herbicides. These are common practices in the Peach Integrated Production

  12. The apoplastic antioxidant system in Prunus: response to long-term plum pox virus infection. (United States)

    Diaz-Vivancos, P; Rubio, M; Mesonero, V; Periago, P M; Barceló, A Ros; Martínez-Gómez, P; Hernández, J A


    This work describes, for the first time, the changes taking place in the antioxidative system of the leaf apoplast in response to plum pox virus (PPV) in different Prunus species showing different susceptibilities to PPV. The presence of p-hydroxymercuribenzoic acid (pHMB)-sensitive ascorbate peroxidase (APX) (class I APX) and pHMB-insensitive APX (class III APX), superoxide dismutase (SOD), peroxidase (POX), NADH-POX, and polyphenoloxidase (PPO) was described in the apoplast from both peach and apricot leaves. PPV infection produced different changes in the antioxidant system of the leaf apoplast from the Prunus species, depending on their susceptibility to the virus. In leaves of the very susceptible peach cultivar GF305, PPV brought about an increase in class I APX, POX, NADH-POX, and PPO activities. In the susceptible apricot cultivar Real Fino, PPV infection produced a decrease in apoplastic POX and SOD activities, whereas a strong increase in PPO was observed. However, in the resistant apricot cultivar Stark Early Orange, a rise in class I APX as well as a strong increase in POX and SOD activities was noticed in the apoplastic compartment. Long-term PPV infection produced an oxidative stress in the apoplastic space from apricot and peach plants, as observed by the increase in H2O2 contents in this compartment. However, this increase was much higher in the PPV-susceptible plants than in the resistant apricot cultivar. Only in the PPV-susceptible apricot and peach plants was the increase in apoplastic H2O2 levels accompanied by an increase in electrolyte leakage. No changes in the electrolyte leakage were observed in the PPV-inoculated resistant apricot leaves, although a 42% increase in the apoplastic H2O2 levels was produced. Two-dimensional electrophoresis analyses revealed that the majority of the polypeptides in the apoplastic fluid had isoelectric points in the range of pI 4-6. The identification of proteins using MALDI-TOF (matrix-assisted laser

  13. Age-Specific Functional Response of Aphidius matricariae and Praon volucre (Hymenoptera: Braconidae) on Myzus persicae (Hemiptera: Aphididae). (United States)

    Tazerouni, Z; Talebi, A A; Fathipour, Y; Soufbaf, M


    The green peach aphid, Myzus persicae (Sulzer), is one of the most important aphid pests on pepper. Aphidius matricariae Haliday and Praon volucre (Haliday) are known as biological control agents for aphids in vegetable crops. In this research, age-specific functional responses of these two parasitoids were evaluated on different densities of 2, 4, 8, 16, 32, and 64 green peach aphids. Type of functional response varied from type II to type III for different ages of A. matricariae, but type of functional response was not affected by female age for P. volucre. The functional response of P. volucre was determined as type II in the whole parasitoid lifetime. The searching efficiency (a), b, and handling time (T h ) were estimated using the Rogers equations. The highest searching efficiency (a) and lowest handling time were observed during the first half of lifetime of A. matricariae and P. volucre. Aphidius matricariae and P. volucre caused reasonable mortality of the green peach aphid by parasitism of 52.17 and 47.05 host aphids, respectively, in 24 h. Therefore, they are suggested as suitable candidates for control of M. persicae in pepper greenhouses.

  14. Abscisic acid deficiency increases defence responses against Myzus persicae in Arabidopsis. (United States)

    Hillwig, Melissa S; Chiozza, Mariana; Casteel, Clare L; Lau, Siau Ting; Hohenstein, Jessica; Hernández, Enrique; Jander, Georg; MacIntosh, Gustavo C


    Comparison of Arabidopsis thaliana (Arabidopsis) gene expression induced by Myzus persicae (green peach aphid) feeding, aphid saliva infiltration and abscisic acid (ABA) treatment showed a significant positive correlation. In particular, ABA-regulated genes are over-represented among genes that are induced by M. persicae saliva infiltration into Arabidopsis leaves. This suggests that the induction of ABA-related gene expression could be an important component of the Arabidopsis-aphid interaction. Consistent with this hypothesis, M. persicae populations induced ABA production in wild-type plants. Furthermore, aphid populations were smaller on Arabidopsis aba1-1 mutants, which cannot synthesize ABA, and showed a significant preference for wild-type plants compared with the mutant. Total free amino acids, which play an important role in aphid nutrition, were not altered in the aba1-1 mutant line, but the levels of isoleucine (Ile) and tryptophan (Trp) were differentially affected by aphids in wild-type and mutant plants. Recently, indole glucosinolates have been shown to promote aphid resistance in Arabidopsis. In this study, 4-methoxyindol-3-ylmethylglucosinolate was more abundant in the aba1-1 mutant than in wild-type Arabidopsis, suggesting that the induction of ABA signals that decrease the accumulation of defence compounds may be beneficial for aphids. © 2015 BSPP AND JOHN WILEY & SONS LTD.

  15. Temperature-Mediated Effects of Host Alternation on the Adaptation of Myzus persicae (Hemiptera: Aphididae). (United States)

    Li, Dan; Zhao, Huiyan; Gao, Huanhuan; Hu, Zuqing; Hu, Xiangshun


    Local adaptation, an important phenomenon in ecological speciation, occurs in Myzus persicae (Sulzer), with the tobacco-adapted line proposed as a subspecies. Recent studies showed that temperature could alter the selection strength and direction in host-herbivore interactions. To understand the formation of host-adapted speciation and the effects of temperature on host adaptation, the parthenogenetic progeny of an M. persicae egg were conditioned on two hosts for >10 generations. Then, their life table parameters were studied after reciprocal transfer under a temperature gradient. The results showed that aphids habituated on tobacco (Nicotiana tabacum L.) and rape (Brassica napus L.) had different optimal temperatures, including different upper thresholds of development and reproduction on original and alternative hosts. After habituation for >10 generations, local adaptation of aphids on the host of origin was formed, which was observed as the better performance of the native aphids compared with the foreign ones. The M. persicae that habituated on rape appeared more generalized to the host plants than the aphids that habituated on tobacco. The adaptation patterns of green peach aphids on two hosts varied differentially according to temperature, which verified the temperature-mediated effects of host selection on herbivores, implying the presence of a demographic basis of aphid seasonal migration. © The Authors 2015. Published by Oxford University Press on behalf of Entomological Society of America. All rights reserved. For Permissions, please email:

  16. Uso de cuatro extractos organicos para el control del pulgon verde (Myzus persicae Sulz (ING

    Directory of Open Access Journals (Sweden)

    Hernán Rodríguez Navas


    Full Text Available Extracts of leaves and stems of Neurolaena lobata; leaves, stems and fruits of Momordica charantia, wood of Quassia amara and seeds of Annona muricata, were tested regarding their effectiveness for control of green peach aphid (Myzus persicae. In a first stage, groups of 10 individuals of M. persicae were placed inside petri dishes together with a small and slight piece of synthetic cloth soaked with either substance extracted. Several concentrations were used. After two hours; more than 50% of the individuals had been killed in every petri dish, which allowed all extracts to pass on to the second stage. The second stage consisted of two experiments. The first one was done in spring at a greenhouse day temperature of 10°C,  using only the first three substances, each of them diluted 1:100. The second one was conducted in Summer at about 25°C with the four substances. Distilled water acted as a control in both experiments. Tobacco plants (Nicotiana tabacum infested with M. persicae were sprayed with the solutions and survivors counted 24 and 72 hours later. In the first experiment Q amara  and M. charantia had 78% and 77% effectiveness respectively, which were statiscally (P< 0.05 higher than that of N. lobata  (63%. In the second experiment, because of the warmer weather, they improved their performance, specially N. lobata (98%. This and A. muricata were found statistically (P< 0.05 higher than the others.

  17. Induced senescence promotes the feeding activities and nymph development of Myzus persicae (Hemiptera: Aphididae) on potato plants. (United States)

    Machado-Assefh, Cristina R; Lucatti, Alejandro F; Alvarez, Adriana E


    The effect of dark-induced senescence on Solanum tuberosum L. (Solanales: Solanaceae) plants was assessed on the feeding behavior and performance of the green peach aphid, Myzus persicae Sulzer (Hemiptera: Aphididae). Senescence was induced by covering the basal part of the plant with a black cloth for 5 d, avoiding the light passage, but keeping the apical buds uncovered. The basal part of control plants was covered with a white nonwoven cloth. The degree of senescence was determined by measuring the chlorophyll content of the covered leaves. The performance and feeding behavior of M. persicae were studied on the uncovered nonsenescent apical leaves. The aphid's performance was evaluated by measuring nymphal mortality and prereproductive time. Aphid feeding behavior was monitored by the electrical penetration graph technique. In plants with dark-induced senescence, the aphids showed a reduction in their prereproductive time. Aphids also spent more time ingesting sap from the phloem than in control plants and performed more test probes after the first sustained ingestion of phloem sap. These data suggest that M. persicae's phloem activities and nymph development benefit from the nutritional enrichment of phloem sap, derived from dark-induced senescence on potato plants. The induced senescence improved plant acceptance by M. persicae through an increase in sap ingestion that likely resulted in a reduction in developmental time. © The Author 2014. Published by Oxford University Press on behalf of the Entomological Society of America.

  18. Comparative antifeedant activities of polygodial and pyrethrins against whiteflies (Bemisia tabaci) and aphids (Myzus persicae). (United States)

    Prota, Neli; Bouwmeester, Harro J; Jongsma, Maarten A


    Polygodial, a sesquiterpene dialdehyde of the drimane family, has been shown to have deterrent and antifeedant effects on various insect species, including Myzus persicae (Sulzer), Spodoptera spp. and Leptinotarsa decemlineata (Say). This compound may have potential as a broad-spectrum biocontrol agent, similar to pyrethrins, given that it was previously reported to improve yield when sprayed on barley fields. This study compares the deterrent effect of polygodial and pyrethrins against the silverleaf whitefly Bemisia tabaci (Gennadius) and the green peach aphid M. persicae in dual-choice assays using compound-coated tomato leaf discs. B. tabaci adults were deterred by polygodial at an ED50 (effective dose at which 50% of the insects are deterred) of about 25 µg g(-1) fresh weight (FW), and green peach aphids at about 54 µg g(-1) FW. Bioassays were benchmarked with pyrethrins that had a 20-fold lower ED50 of approximately 1.4 µg g(-1) FW against whiteflies, but only a twofold lower ED50 (about 28 µg g(-1) FW) against peach aphids. Polygodial showed moderate phytotoxic effects (score of 2 on a scale of 1-5) on tomato leaves at concentrations above the ED50 concentrations (≥ 90 µg g(-1) FW). The sesquiterpene dialdehyde polygodial is 2-20 times less deterrent than pyrethrins, depending on the insect species, but it could provide a useful complement to pyrethrin sprays as it has a different mode of action, is food grade and has low volatility. However, a formulation that reduces the risks of phytotoxic effects should be developed. © 2013 Society of Chemical Industry.

  19. Reaction of Prunus Rootstocks to Meloidogyne incognita and M. arenaria in Spain. (United States)

    Marull, J; Pinochet, J; Verdejo-Lucas, S; Soler, A


    Prunus rootstocks were evaluated for their reaction to Meloidogyne incognita and M. arenaria. Most rootstocks were peach-almond hybrids of Spanish origin. In one experiment three selections of Garfi x Nemared (G x N) and Hansen-5 were highly resistant to M. incognita, but four other rootstocks were susceptible showing high galling indices and population increases. In two experiments with M. arenaria, the hybrid selections G x N nos. 1 and 9 were immune, GF-305 and Hansen-5 were resistant, but nine other rootstocks expressed various degrees of susceptibility. All Spanish rootstocks were susceptible to both Meloidogyne species except for the three G x N selections. The root-knot nematode resistant peach Nemared used as a male parent with Garfi was found to transmit a high degree of resistance to M. incognita and immunity to M. arenaria. Progenies of P. davidiana (Ga x D no. 3), a known source of resistance to root-knot nematodes, were susceptible.

  20. New strategies for thinning peaches (United States)

    An evaluation of two mechanical thinners was conducted in four commercial peach orchard blocks in 2007. A mechanical blossom thinner designed by a German grower for thinning apple trees that employed nylon cords (strings) to remove blossoms was tested on peach trees trained to either a perpendicula...

  1. Protein (Viridiplantae): 939130 [PGDBj - Ortholog DB

    Lifescience Database Archive (English)


  2. Dicty_cDB: VSF219 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available 0.009 2 BU042820 |BU042820.1 PP_LEa0014B11f Peach developing fruit mesocarp Prunus persica cDNA clone PP_LE...a0014B11f, mRNA sequence. 52 0.010 1 BU041769 |BU041769.1 PP_LEa0010G24f Peach developing...32.1 PP_LEa0019F12f Peach developing fruit mesocarp Prunus persica cDNA clone PP_LEa0019F12f, mRNA sequence.

  3. Dicty_cDB: SSK530 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available 708 |BU044708.1 PP_LEa0020E04f Peach developing fruit mesocarp Prunus persica cDNA clone PP_LEa0020E04f, mRN...A sequence. 62 8e-11 2 BU040616 |BU040616.1 PP_LEa0006L02f Peach developing fruit

  4. Insecticidal activity of citronella grass essential oil on Frankliniella schultzei and Myzus persicae Atividade inseticida do óleo essencial de capim-citronela sobre Frankliniella schultzei e Myzus persicae

    Directory of Open Access Journals (Sweden)

    Patrícia Fontes Pinheiro


    Full Text Available The thrips, Frankliniella schultzei, and green peach aphid, Myzus persicae, cause direct damage to plants of economic importance and transmit phytoviruses, causing large economic losses. Chemical constituents of essential oils present a wide range of biological activities. The aim of this work was to evaluate insecticidal activity of essential oil from citronella grass, Cymbopogon winterianus, on F. schultzei and M. persicae. This essential oil was obtained by steam distillation and components were identified by GC/FID and GC/MS. A Potter spray tower was used to spray insects with the essential oil. The major constituents are geraniol (28.62%, citronellal (23.62% and citronellol (17.10%. Essential oil of C. winterianus at 1% (w v-1 causes mortality in F. schultzei and M. persicae at 34.3% and 96.9%, respectively. The LC50 value for M. persicae was 0.36% and LC90 0.66%. Thus, citronella grass essential oil at 1% (w v-1 is more toxic to M. persicae than F. schultzei. This essential oil shows promise for developing pesticides to manage M. persicae.O tripes, Frankliniella schultzei, e o pulgão-verde, Myzus persicae, além de causarem danos diretos a plantas de importância econômica, também são importantes transmissores de fitoviroses, acarretando grandes perdas econômicas. Os constituintes químicos dos óleos essenciais têm sido cada vez mais estudados, pois apresentam uma ampla gama de atividades biológicas. Neste trabalho, objetivou-se avaliar a atividade inseticida do óleo essencial de capim-citronela, Cymbopogon winterianus, sobre F. schultzei e M. persicae. O óleo essencial foi obtido por hidrodestilação e a identificação dos seus componentes foi realizada por CG/DIC e CG/EM. Uma torre de Potter foi utilizada para pulverizar os insetos com óleo essencial. Os componentes majoritários encontrados são geraniol (28,62%, citronelal (23,62% e citronelol (17,10%. O óleo essencial de C. winterianus a 1% (m v-1 causa mortalidade de F

  5. Sublethal Effects of Cyantraniliprole and Imidacloprid on Feeding Behavior and Life Table Parameters of Myzus persicae (Hemiptera: Aphididae). (United States)

    Zeng, Xianyi; He, Yingqin; Wu, Jiaxing; Tang, Yuanman; Gu, Jitao; Ding, Wei; Zhang, Yongqiang


    The green peach aphid, Myzus persicae (Sulzer) (Hemiptera: Aphididae), is an agricultural pest that seriously infests many crops worldwide. This study used electrical penetration graphs (EPGs) and life table parameters to estimate the sublethal effects of cyantraniliprole and imidacloprid on the feeding behavior and hormesis of M. persicae The sublethal concentrations (LC30) of cyantraniliprole and imidacloprid against adult M. persicae were 4.933 and 0.541 mg L(-1), respectively. The feeding data obtained from EPG analysis indicated that the count probes and number of short probes (<3 min) were significantly increased when aphids were exposed to LC30 of imidacloprid-treated plants. In addition, the phloem-feeding behavior of M persicae was significantly impaired on fed tobacco plants treated with cyantraniliprole and imidacloprid at LC30 Analysis of life table parameters indicated that the growth and reproduction of F1 generation aphids were significantly affected when initial adults were exposed to LC30 of cyantraniliprole and imidacloprid. The nymphal period, female longevity, total preoviposition period, and mean generation time were significantly prolonged when initial adults were exposed to LC30 of imidacloprid. By comparison, these parameters were prolonged but not significantly in the cyantraniliprole treatment. The fecundity and gross reproductive rate were significantly increased in the treated groups. Similarly, the net reproductive rate was greater in the treated group than the control group. Our results indicate that treatment with LC30 of imidacloprid and cyantraniliprole would lead to a hormetic response of M. persicae, with higher likelihood of occurrence when initial adults were exposed to LC30 of cyantraniliprole. © The Authors 2016. Published by Oxford University Press on behalf of Entomological Society of America. All rights reserved. For Permissions, please email:

  6. Identification and expression analysis of the SQUAMOSA promoter-binding protein (SBP)-box gene family in Prunus mume. (United States)

    Xu, Zongda; Sun, Lidan; Zhou, Yuzhen; Yang, Weiru; Cheng, Tangren; Wang, Jia; Zhang, Qixiang


    SQUAMOSA promoter-binding protein (SBP)-box family genes encode plant-specific transcription factors that play crucial roles in plant development, especially flower and fruit development. However, little information on this gene family is available for Prunus mume, an ornamental and fruit tree widely cultivated in East Asia. To explore the evolution of SBP-box genes in Prunus and explore their functions in flower and fruit development, we performed a genome-wide analysis of the SBP-box gene family in P. mume. Fifteen SBP-box genes were identified, and 11 of them contained an miR156 target site. Phylogenetic and comprehensive bioinformatics analyses revealed that different groups of SBP-box genes have undergone different evolutionary processes and varied in their length, structure, and motif composition. Purifying selection has been the main selective constraint on both paralogous and orthologous SBP-box genes. In addition, the sequences of orthologous SBP-box genes did not diverge widely after the split of P. mume and Prunus persica. Expression analysis of P. mume SBP-box genes revealed their diverse spatiotemporal expression patterns. Three duplicated SBP-box genes may have undergone subfunctionalization in Prunus. Most of the SBP-box genes showed high transcript levels in flower buds and young fruit. The four miR156-nontargeted genes were upregulated during fruit ripening. Together, these results provide information about the evolution of SBP-box genes in Prunus. The expression analysis lays the foundation for further research on the functions of SBP-box genes in P. mume and other Prunus species, especially during flower and fruit development.

  7. Flavonoids from Prunus serotina Ehrh. (United States)

    Olszewska, Monika


    In the course of chemotaxonomic study of the genus Prunus, seven flavonol glycosides were isolated from the leaves of Prunus serotina Ehrh., characterized by UV and NMR spectroscopy, and identified finally as three quercetin monosides: hyperoside, avicularin, reynoutrin, three quercetin biosides: 3-O-(6"-O-alpha-L-rhamnopyranosyl)-beta-D-glucopyranoside, 3-O-(2"-O-alpha-L-rhamnopyranosyl)-beta-D-glucopyranoside and 3-O-(2"-O-alpha-L-rhamnopyranosyl)-beta-D-galactopyranoside as well isorhamnetin 3-O-(6"-O-alpha-L-rhamnopyranosyl)-beta-D-glucopyranoside. The presence of determined flavonoids in the flowers was confirmed by TLC.

  8. Tracking the global dispersal of a cosmopolitan insect pest, the peach potato aphid

    Directory of Open Access Journals (Sweden)

    Kasprowicz Louise


    Full Text Available Abstract Background Global commerce and human transportation are responsible for the range expansion of various insect pests such as the plant sucking aphids. High resolution DNA markers provide the opportunity to examine the genetic structure of aphid populations, identify aphid genotypes and infer their evolutionary history and routes of expansion which is of value in developing management strategies. One of the most widespread aphid species is the peach-potato aphid Myzus persicae, which is considered as a serious pest on various crops in many parts of the world. The present study examined the genetic variation of this aphid at a world scale and then related this to distribution patterns. In particular, 197 aphid parthenogenetic lineages from around the world were analysed with six microsatellite loci. Results Bayesian clustering and admixture analysis split the aphid genotypes into three genetic clusters: European M. persicae persicae, New Zealand M. persicae persicae and Global M. persicae nicotianae. This partition was supported by FST and genetic distance analyses. The results showed two further points, a possible connection between genotypes found in the UK and New Zealand and globalization of nicotianae associated with colonisation of regions where tobacco is not cultivated. In addition, we report the presence of geographically widespread clones and for the first time the presence of a nicotianae genotype in the Old and New World. Lastly, heterozygote deficiency was detected in some sexual and asexual populations. Conclusion The study revealed important genetic variation among the aphid populations we examined and this was partitioned according to region and host-plant. Clonal selection and gene flow between sexual and asexual lineages are important factors shaping the genetic structure of the aphid populations. In addition, the results reflected the globalization of two subspecies of M. persicae with successful clones being spread at

  9. Host suitability analysis of the bark beetle Scolytus amygdali (Coleoptera: Curculionidae: Scolytinae). (United States)

    Zeiri, A; Ahmed, M Z; Braham, M; Qiu, B-L


    Scolytus amygdali is a polyphagous insect pest that feeds on fruit trees and forest trees. Our study assessed the host preference and reproductive potential of S. amygdali on four tree species: almond (Prunus dulcis), apricot (Prunus armeniaca), peach (Prunus persica), and plum (Prunus domestica). Females of S. amygdali produced maternal galleries that were longer on peach than the other three trees, and female fecundity was highest on peach. Females with longer maternal galleries produced more eggs, indicating a positive correlation between maternal gallery length and female fertility. The under-bark development time of S. amygdali is significantly shorter on plum (45 days) and almond (56 days) than on apricot (65 days) and peach (64 days). Despite this longer development time on peach, our results still suggest that, of the four types of tree tested, peach is the most preferred host for S. amygdali.

  10. Eficiência de fungos micorrízicos arbusculares sobre o crescimento do porta-enxerto de pessegueiro 'aldrighi Efficiency of arbuscular mycorrhizal fungi on growth of 'aldrighi' peach tree rootstock

    Directory of Open Access Journals (Sweden)

    José Luis da Silva Nunes


    Full Text Available Este trabalho visou avaliar a eficiência de diferentes espécies de fungos micorrízicos arbusculares (FMAs sobre o crescimento vegetativo e o conteúdo de nutrientes de plantas do porta-enxerto de pessegueiro (Prunus persica cv. Aldrighi. O experimento foi realizado no município de Eldorado do Sul (RS, entre 2004 e 2005. Foram utilizados quatro tratamentos de inoculação de estirpes de FMAs (Acaulospora sp. Trappe, Glomus clarum Nicol. & Schenck, Glomus etunicatum Becker & Gerd e Scutellospora heterogama Nicol. & Gerd. e um tratamento testemunha, sem inoculação. O delineamento experimental utilizado foi o de blocos casualizados, com 20 plantas por parcela e quatro repetições. A altura das plantas, o diâmetro do colo, a área foliar, as biomassas fresca e seca, o conteúdo em nutrientes e em substâncias da parte aérea e das raízes e a colonização das raízes foram avaliados aos 180 dias após a semeadura. O uso das espécies de FMAs beneficia o desenvolvimento de plantas do porta-enxerto cv. Aldrighi, e a eficiência da simbiose planta-FMAs é variável com a espécie de FMAs inoculada. As plantas submetidas à inoculação com S. heterogama e G. etunicatum destacaram-se das demais, com maior crescimento vegetativo e maiores teores de nitrogênio, fósforo e potássio nos tecidos.This work aimed to evaluate the eficiency of four species of arbuscular mycorrhizal fungi (AMF on the vegetative growth and the nutrient contents of peach tree rootstocks (Prunus persica cv. Aldrighi. The experiment was conducted at the Estação Experimental Agronômica (EEA of the Universidade Federal do Rio Grande do Sul (UFRGS, Eldorado do Sul, RS, during 2004 and 2005. Four treatments of AMF inoculation strains (Acaulospora sp. Trappe, Glomus clarum Nicol. & Schenck, Glomus etunicatum Becker & Gerd e Scutellospora heterogama Nicol. & Gerd. and one with non-inoculated plants were used. A randomized block design was used, with 20 plants per plot and four

  11. Arabidopsis thaliana - Myzus persicae interaction: shaping the understanding of plant defense against phloem-feeding aphids

    Directory of Open Access Journals (Sweden)

    Joe eLouis


    Full Text Available The phloem provides a unique niche for several organisms. Aphids are a large group of Hemipteran insects that utilize stylets present in their mouthparts to pierce sieve elements and drink large volumes of phloem sap. In addition, many aphids also vector viral diseases. Myzus persicae, commonly known as the green peach aphid (GPA, is an important pest of a large variety of plants that includes Arabidopsis thaliana. This review summarizes recent studies that have exploited the compatible interaction between Arabidopsis and GPA to understand the molecular and physiological mechanisms utilized by plants to control aphid infestation, as well as genes and mechanisms that contribute to susceptibility. In addition, recent efforts to identify aphid-delivered elicitors of plant defenses and novel aphid salivary components that facilitate infestation are also discussed.

  12. Proteomic analysis of Arabidopsis thaliana (L.) Heynh responses to a generalist sucking pest (Myzus persicae Sulzer). (United States)

    Truong, D-H; Bauwens, J; Delaplace, P; Mazzucchelli, G; Lognay, G; Francis, F


    Herbivorous insects can cause severe cellular changes to plant foliage following infestations, depending on feeding behaviour. Here, a proteomic study was conducted to investigate the influence of green peach aphid (Myzus persicae Sulzer) as a polyphagous pest on the defence response of Arabidopsis thaliana (L.) Heynh after aphid colony establishment on the host plant (3 days). Analysis of about 574 protein spots on 2-DE gels revealed 31 differentially expressed protein spots. Twenty out of these 31 differential proteins were selected for analysis by mass spectrometry. In 12 of the 20 analysed spots, we identified seven and nine proteins using MALDI-TOF-MS and LC-ESI-MS/MS, respectively. Of the analysed spots, 25% contain two proteins. Different metabolic pathways were modulated in Arabidopsis leaves according to aphid feeding: most corresponded to carbohydrate, amino acid and energy metabolism, photosynthesis, defence response and translation. This paper has established a survey of early alterations induced in the proteome of Arabidopsis by M. persicae aphids. It provides valuable insights into the complex responses of plants to biological stress, particularly for herbivorous insects with sucking feeding behaviour. © 2015 German Botanical Society and The Royal Botanical Society of the Netherlands.

  13. Prunus Rootstock Evaluation to Root-knot and Lesion Nematodes in Spain. (United States)

    Pinochet, J; Aglès, M; Dalmau, E; Fernández, C; Felipe, A


    Two screening and one resistance verification trial involving 20 Prunus rootstocks were conducted under greenhouse conditions against Meloidogyne spp. and Pratylenchus vulnus. Most of the rootstocks were experimental genotypes or new commercial peach and plums of Spanish and French origin. Nearly all are interspecific hybrid rootstocks. In the first trial, the rootstocks Bruce, Cadaman, Mirac, G x N No. 15, Cachirulo x (G x N No. 9), and P. myra x peach were immune or resistant to a mixture of seven isolates of M. incognita. In the second screening trial, the hybrid plum P 2588 was a poor host to a mixture of four isolates of P. vulnus. The remaining seven rootstocks were good hosts to the root-lesion nematode. In the resistance verification trial GF-31, G x N No. 15, Torinel, AD- l 01, Monpol, Nemaguard, and Cadaman maintained a high level of resistance when tested against a mixture of 17 isolates comprising M. incognita, M. javanica, M. arenaria, M. hapla, and M. hispanica. Barrier peach suffered a partial loss of resistance not detected in previous tests.

  14. Bioassay-guided isolation and identification of an antibacterial compound from Ferula persica var. persica roots

    Directory of Open Access Journals (Sweden)

    Ahmad-Reza Shahverdi


    Full Text Available The antibacterial activities of the chloroform and water extracts of Ferula persica var. persica (Apiaceaeroots were studied by the disk diffusion method. While the chloroform extract of F. persica roots showed antibacterial activity, the water extract of the roots at the concentrations that tested did not show any activity. By bioassay-guided fractionation of the chloroform extract of the roots by preparative thin layer chromatography (PTLC a compound was found which was active against some bacteria. By conventional spectroscopy methods the active fraction was identified as umbelliprenin. This coumarin was mostly active against B. subtillis, B. cereus, E. coli, K. ponumoniae, S. typhi, S. aureus, and S. epidermilis.

  15. (E)-β-farnesene synthase genes affect aphid (Myzus persicae) infestation in tobacco (Nicotiana tabacum). (United States)

    Yu, Xiudao; Jones, Huw D; Ma, Youzhi; Wang, Genping; Xu, Zhaoshi; Zhang, Baoming; Zhang, Yongjun; Ren, Guangwei; Pickett, John A; Xia, Lanqin


    Aphids are major agricultural pests which cause significant yield losses of the crop plants each year. (E)-β-farnesene (EβF) is the alarm pheromone involved in the chemical communication between aphids and particularly in the avoidance of predation. In the present study, two EβF synthase genes were isolated from sweet wormwood and designated as AaβFS1 and AaβFS2, respectively. Overexpression of AaβFS1 or AaβFS2 in tobacco plants resulted in the emission of EβF ranging from 1.55 to 4.65 ng/day/g fresh tissues. Tritrophic interactions involving the peach aphids (Myzus persicae), predatory lacewings (Chrysopa septempunctata) demonstrated that the transgenic tobacco expressing AaβFS1 and AaβFS2 could repel peach aphids, but not as strongly as expected. However, AaβFS1 and AaβFS2 lines exhibited strong and statistically significant attraction to lacewings. Further experiments combining aphids and lacewing larvae in an octagon arrangement showed transgenic tobacco plants could repel aphids and attract lacewing larvae, thus minimizing aphid infestation. Therefore, we demonstrated a potentially valuable strategy of using EβF synthase genes from sweet wormwood for aphid control in tobacco or other economic important crops in an environmentally benign way.

  16. [Geostatistical analysis on distribution dynamics of Myzus persicae (Sulzer) in flue-cured tobacco field]. (United States)

    Xia, Peng-liang; Liu, Ying-hong; Fan, Jun; Tan, Jun


    Abstract: Myzus persicae belonging to Aphididae, Hemiptera, is an important migratory pest in tobacco field. As nymph and adult, it sucks the juice, breeds the mildew stains disease, spreads tobacco virus diseases and causes huge losses to the yield and quality. The distribution pattern and dynamics of winged and wingless aphids in the field were investigated from the transplanting of tobacco to the harvesting stage of mid-place tobacco leaves in Enshi, Hubei. The semivariable function characteristics were analyzed by geostatistical method, and the field migration pattern were simulated. The results showed that the population dynamics of winged aphids in Enshi were of bimodal curve, with two peaks at 3 weeks after transplanting and 2 weeks after multi-topping of tobacco leaves, and there were five-step process such as random, aggregation, random, aggregation and random. The population dynamics of wingless peach aphids were of single-peak curve, getting its peak before multi-topping, and had random, aggregation, random three-step process. Human factors and the hosts had considerable effects on the population density. Spatial distribution simulation-interpolation-figure could clearly reflect the dynamics of tobacco aphids. Combined with the Pearson correlation analysis, we found that the population density was low and highly concentrated as winged type in the immigration period, which was the key period for the management of peach aphids.

  17. Detecting the presence of target-site resistance to neonicotinoids and pyrethroids in Italian populations of Myzus persicae. (United States)

    Panini, Michela; Dradi, Davide; Marani, Gabriele; Butturini, Alda; Mazzoni, Emanuele


    Myzus persicae is a key pest of peach, which in commercial orchards is mainly controlled by chemical treatments. Neonicotinoids represent the main control strategy, but resistance monitoring programmes in Southern Europe have shown the widespread presence of populations highly resistant to this insecticide class in peach orchards. Moreover, in Italy reports of neonicotinoid application failures are increasing. This work describes the status of the main target-site mutations associated with neonicotinoid and pyrethroid resistance in Italian populations collected in 2012. R81T mutation linked with neonicotinoid resistance was found in 65% of analysed aphids (35.5% with a homozygous resistant genotype). For the first time, R81T was found in samples collected from herbaceous hosts. Bioassays on a few genotyped populations also revealed the involvement of P450-based metabolic resistance. Only a few individuals without kdr (L1014F) and s-kdr (M918T) target-site mutations were collected. A new single nucleotide polymorphism in the s-kdr locus producing M918L substitution was found. Target-site resistance to neonicotinoids is common in specialised peach-growing areas, and it is spreading in other Italian regions and on herbaceous hosts. The high frequency of target-site mutations and data obtained from bioassays confirm the presence of multiple resistance mechanisms and suggest the importance of coordinated control strategies. © 2013 Society of Chemical Industry.


    Directory of Open Access Journals (Sweden)



    Full Text Available A atividade de peroxidase e concentração de fenóis foi determinada com o objetivo de se avaliar aspectos de compatibilidade entre porta-enxertos e enxertos. As amostras foram processadas e obtidas a partir da casca e lenho dos porta-enxertos de pessegueiros (GF 677, Okinawa, Capdeboscq e Aldrighi e de ameixeiras (Mirabolano e Marianna, enxertados ou não com as cultivares Diamante, Eldorado e Santa Rosa. Concluiu-se que a atividade de peroxidase e a concentração de fenóis foram relacionadas com união entre enxerto e porta-enxerto, particularmente, em Marianna e Mirabolano, onde a atividade de peroxidase e a concentração de fenóis foram mais elevados. A cultivar Santa Rosa foi compatível tanto com os porta-enxertos de ameixeiras quanto com os de pessegueiros.The work was accomplished aiming to quantify the peroxidase activity and total phenols, in order to verify the physiological and biochemical processes in grafting of Prunus sp. cultivars. The samples were processed and obtained in bark and wood of the peach rootstocks (GF 677, Okinawa, Capdeboscq and Aldrighi and plum rootstocks (Mirabolano and Marianna, after they had or not been grafted with the stock Diamante, Eldorado and Santa Rosa. It could be concluded that the peroxidase and the total phenols activity influenced the union between stock and rootstock; after grafting, the incompatibility degree is related with high peroxidase activity and total phenols in the rootstock Marianna and Mirabolano. The Santa Rosa plum graft is as compatible to plum rootstocks as to the peach ones.

  19. Host Plant-Herbivore-Predator Interactions in Chrysoperla carnea (Neuroptera: Chrysopidae) and Myzus persicae (Homoptera: Aphididae) on Four Plant Species Under Laboratory Conditions. (United States)

    Farrokhi, Milad; Gharekhani, Gholamhossein; Iranipour, Shahzad; Hassanpour, Mahdi


    The common green lacewing, Chrysoperla carnea (Stephens) (Neuroptera: Chrysopidae), is a well-known biocontrol agent. The current study examined host plant-herbivore-predator interactions with C. carnea and Myzus persicae on four host plants (peach, almond, pepper, and potato). The experiments were carried out at 25 ± 1°C and 65 ± 5% RH at a photoperiod of 16:8 (L:D) h). Duration of the preadult growth period, adult longevity, fecundity, and population growth parameters were analyzed based on the age-stage, two-sex life table theory. The shortest and longest preadult developmental times of the predator were observed on the peach and potato, respectively. The highest and lowest predation rate, oviposition period, and male and female longevity of predator were also observed on the peach and potato, respectively. The lowest intrinsic rate of increase (r) and finite rate of increase (λ) were observed on the potato (0.1087 and 1.11 d-1, respectively) and the highest on the peach (0.1460 and 1.15 d-1, respectively). The maximum and minimum mean generation times (T) were 41.84 and 35.59 d in the potato and peach, respectively. Overall, peach was found to be a more appropriate host than the other host plants for development and predation fitness of C. carnea. These findings reveal that information on tritrophic interactions and subsequent life table evaluation of natural enemies improves integrated pest management programs. Published by Oxford University Press on behalf of Entomological Society of America 2017. This work is written by (a) US Government employee(s) and is in the public domain in the US.

  20. Comparative survival rates of oriental fruit moth (Lepidoptera: Tortricidae) larvae on shoots and fruit of apple and peach. (United States)

    Myers, Clayton T; Hull, Larry A; Krawczyk, Grzegorz


    Studies were designed to examine the effects of host plants on oriental fruit moth, Grapholita molesta (Busck) (Lepidoptera: Tortricidae), survival. G. molesta larval survival in the orchard was comparable between apple (Malus spp.) and peach (Prunus spp.) shoots, indicating that both host species can harbor large larval populations during the early season. G. molesta larvae used multiple shoots for feeding and development on peaches but usually only damaged single shoots in apple. Survival differences were present between peach and apple fruit, but this survival was affected by fruit maturity level. Generally, larval survival higher was in ripening peach fruit than in green, immature apple fruit. Larval survival varied among several apple cultivars, indicating that cultivar-level variability needs to be considered. These host-associated effects may impact efforts to predictively model G. molesta populations in commercial orchards where multiple host plant species, or different cultivars of the same species are often grown in proximity. Thus, host-associated dynamics should be included into future population models that underlie management programs.

  1. Differential response to root-knot nematodes in prunus species and correlative genetic implications. (United States)

    Esmenjaud, D; Minot, J C; Voisin, R; Pinochet, J; Simard, M H; Salesses, G


    Responses of 17 Prunus rootstocks or accessions (11 from the subgenus Amygdalus and 6 from the subgenus Prunophora) were evaluated against 11 isolates of Meloidogyne spp. including one M. arenaria, four M. incognita, four M. javanica, one M. hispanica, and an unclassified population from Florida. Characterization of plant response to root-knot nematodes was based on a gall index rating. Numbers of females and juveniles plus eggs in the roots were determined for 10 of the rootstocks evaluated against one M. arenaria, one M. incognita, one M. javanica, and the Florida isolate. These 10 rootstocks plus Nemaguard and Nemared were retested by growing three different rootstock genotypes together in containers of soil infested individually with each of the above four isolates. Garfi and Garrigues almonds, GF.305 and Rutgers Red Leaf peaches, and the peach-almond GF.677 were susceptible to all isolates. Differences in resistance were detected among the other rootstocks of the subgenus Amygdalus. The peach-almond GF.557 and Summergrand peach were resistant to M. arenaria and M. incognita but susceptible to M. javanica and the Florida isolate. Nemaguard, Nemared, and its two hybrids G x N no. 15 and G x N no. 22 were resistant to all but the Florida isolate. In the subgenus Prunophora, Myrobalan plums P.1079, P.2175, P.2980, and P.2984; Marianna plum 29C; and P. insititia plum AD.101 were resistant to all isolates. Thus, two different genetic systems of RKN resistance were found in the subgenus Amygdalus: one system acting against M. arenaria and M. incognita, and another system also acting against M. javanica. Prunophora rootstocks bear a complete genetic system for resistance also acting against the Florida isolate. The hypotheses on the relationships between these systems and the corresponding putative genes of resistance are presented.

  2. Some effects of fuel oil on plants. [Lycopericum esculentum; Prunus persica

    Energy Technology Data Exchange (ETDEWEB)

    Fuller, G.D.; Leadbeater, M.R.


    Commercial fuel oil has a harmful effect on plants when brought into contact with their roots, through the soil. The effect becomes fatal when the quantity is raised above the critical point for a species. The effect may or may not be due to penetration. If the oil has penetrated the tissues, it is most commonly found in the primary xylem; to a lesser extent it enters the secondary xylem, and the intercellular spaces of the pith and cortex. Contact does not seem to be a primary cause of death.

  3. Arabidopsis thaliana-Myzus persicae interaction: shaping the understanding of plant defense against phloem-feeding aphids. (United States)

    Louis, Joe; Shah, Jyoti


    The phloem provides a unique niche for several organisms. Aphids are a large group of Hemipteran insects that utilize stylets present in their mouthparts to pierce sieve elements and drink large volumes of phloem sap. In addition, many aphids also vector viral diseases. Myzus persicae, commonly known as the green peach aphid (GPA), is an important pest of a large variety of plants that includes Arabidopsis thaliana. This review summarizes recent studies that have exploited the compatible interaction between Arabidopsis and GPA to understand the molecular and physiological mechanisms utilized by plants to control aphid infestation, as well as genes and mechanisms that contribute to susceptibility. In addition, recent efforts to identify aphid-delivered elicitors of plant defenses and novel aphid salivary components that facilitate infestation are also discussed.

  4. Low incidence of Peach latent mosaic viroid in peach mother blocks in Serbia

    Directory of Open Access Journals (Sweden)

    Darko Jevremović


    Full Text Available Peach latent mosaic viroid (PLMVd is the causal agent of peach latent mosaic disease that is common on peaches and nectarines worldwide. Most of the isolates do not cause any symptoms on the foliage and the disease may be latent for years. A survey to investigate the presence of PLMVd in selected peach mother blocks in 9 Serbian districts was carried out in 2011 through 2013. A total of 315 trees/samples originating from 43 mother blocks, representing 35 peach and nectarine varieties and 2 rootstocks, were tested by Reverse Transcription - Polymerase Chain Reaction (RT-PCR. PLMVd was detected in 13 samples (4.13% belonging to 7 varieties and one vineyard peach rootstock. Infected samples were found in 7 mother blocks from 3 districts. Our results indicated a low incidence of PLMVd in the analyzed peach mother blocks.

  5. An efficient viral vector for functional genomic studies of Prunus fruit trees and its induced resistance to Plum pox virus via silencing of a host factor gene. (United States)

    Cui, Hongguang; Wang, Aiming


    RNA silencing is a powerful technology for molecular characterization of gene functions in plants. A commonly used approach to the induction of RNA silencing is through genetic transformation. A potent alternative is to use a modified viral vector for virus-induced gene silencing (VIGS) to degrade RNA molecules sharing similar nucleotide sequence. Unfortunately, genomic studies in many allogamous woody perennials such as peach are severely hindered because they have a long juvenile period and are recalcitrant to genetic transformation. Here, we report the development of a viral vector derived from Prunus necrotic ringspot virus (PNRSV), a widespread fruit tree virus that is endemic in all Prunus fruit production countries and regions in the world. We show that the modified PNRSV vector, harbouring the sense-orientated target gene sequence of 100-200 bp in length in genomic RNA3, could efficiently trigger the silencing of a transgene or an endogenous gene in the model plant Nicotiana benthamiana. We further demonstrate that the PNRSV-based vector could be manipulated to silence endogenous genes in peach such as eukaryotic translation initiation factor 4E isoform (eIF(iso)4E), a host factor of many potyviruses including Plum pox virus (PPV). Moreover, the eIF(iso)4E-knocked down peach plants were resistant to PPV. This work opens a potential avenue for the control of virus diseases in perennial trees via viral vector-mediated silencing of host factors, and the PNRSV vector may serve as a powerful molecular tool for functional genomic studies of Prunus fruit trees. © 2016 The Authors. Plant Biotechnology Journal published by Society for Experimental Biology and The Association of Applied Biologists and John Wiley & Sons Ltd.

  6. Physicochemical, antioxidant, and sensorial properties of peach ...

    African Journals Online (AJOL)

    High potentiality of medicinal benefits of peach have increased its demand, however, supply of fresh fruit to meet the demand is challenging as it grows in specific climatic regions and in particular season. Preparation of varieties of processed peach products could be a good option to supply in lean season. Objective of the ...

  7. Alarm pheromone habituation in Myzus persicae has fitness consequences and causes extensive gene expression changes. (United States)

    de Vos, Martin; Cheng, Wing Yin; Summers, Holly E; Raguso, Robert A; Jander, Georg


    In most aphid species, facultative parthenogenetic reproduction allows rapid growth and formation of large single-genotype colonies. Upon predator attack, individual aphids emit an alarm pheromone to warn the colony of this danger. (E)-beta-farnesene (EBF) is the predominant constituent of the alarm pheromone in Myzus persicae (green peach aphid) and many other aphid species. Continuous exposure to alarm pheromone in aphid colonies raised on transgenic Arabidopsis thaliana plants that produce EBF leads to habituation within three generations. Whereas naive aphids are repelled by EBF, habituated aphids show no avoidance response. Similarly, individual aphids from the habituated colony can revert back to being EBF-sensitive in three generations, indicating that this behavioral change is not caused by a genetic mutation. Instead, DNA microarray experiments comparing gene expression in naive and habituated aphids treated with EBF demonstrate an almost complete desensitization in the transcriptional response to EBF. Furthermore, EBF-habituated aphids show increased progeny production relative to EBF-responsive aphids, with or without EBF treatment. Although both naive and habituated aphids emit EBF upon damage, EBF-responsive aphids have a higher survival rate in the presence of a coccinellid predator (Hippodamia convergens), and thus outperform habituated aphids that do not show an avoidance response. These results provide evidence that aphid perception of conspecific alarm pheromone aids in predator avoidance and thereby bestows fitness benefits in survivorship and fecundity. Therefore, although habituated M. persicae produce more progeny, EBF-emitting transgenic plants may have practical applications in agriculture as a result of increased predation of habituated aphids.

  8. Mp10 and Mp42 from the aphid species Myzus persicae trigger plant defenses in Nicotiana benthamiana through different activities. (United States)

    Rodriguez, Patricia A; Stam, Remco; Warbroek, Tim; Bos, Jorunn I B


    Aphids are phloem-feeding insects that, like other plant parasites, deliver effectors inside their host to manipulate host responses. The Myzus persicae (green peach aphid) candidate effectors Mp10 and Mp42 were previously found to reduce aphid fecundity upon intracellular transient overexpression in Nicotiana benthamiana. We performed functional analyses of these proteins to investigate whether they activate defenses through similar activities. We employed a range of functional characterization experiments based on intracellular transient overexpression in N. benthamiana to determine the subcellular localization of Mp10 and Mp42 and investigate their role in activating plant defense signaling. Mp10 and Mp42 showed distinct subcellular localization in planta, suggesting that they target different host compartments. Also, Mp10 reduced the levels of Agrobacterium-mediated overexpression of proteins. This reduction was not due to an effect on Agrobacterium viability. Transient overexpression of Mp10 but not Mp42 activated jasmonic acid and salicylic acid signaling pathways and decreased susceptibility to the hemibiotrophic plant pathogen Phytophthora capsici. We found that two candidate effectors from the broad-host-range aphid M. persicae can trigger aphid defenses through different mechanisms. Importantly, we found that some (candidate) effectors such as Mp10 interfere with Agrobacterium-based overexpression assays, an important tool to study effector activity and function.

  9. Characterization of non-LTR retrotransposable TRAS elements in the aphids Acyrthosiphon pisum and Myzus persicae (Aphididae, Hemiptera). (United States)

    Monti, Valentina; Serafini, Chiara; Manicardi, Gian Carlo; Mandrioli, Mauro


    A non-LTR TRAS retrotransposon (identified as TRASAp1) has been amplified in the pea aphid Acyrthosiphon pisum and its presence has been assessed also in the peach potato aphid Myzus persicae. This TRAS element possesses 2 overlapping ORFs (a gag-ORF1 and a pol-ORF2 containing the reverse transcriptase and the endonuclease domains) that show a similarity ranging from 40% to 48% to proteins coded by other TRAS elements identified in insects (including the beetle Tribolium castaneum and the moth Bombyx mori). The study of the TRAS chromosomal insertion sites, performed by standard fluorescent in situ hybridization (FISH) and fiber FISH, showed that TRAS elements were located in a subtelomeric position, just before the telomeric (TTAGG) n repeats. In both the aphid species, TRAS elements were present at all termini of autosomes, but the 2 X chromosome telomeres show a clear-cut structural difference. Indeed, cromomycin A3 staining, together with FISH using a TRAS probe, revealed that TRAS signals only occur at the telomere opposite to the NOR-bearing one. Lastly, the analysis of the distribution of TRAS retrotransposons in a M. persicae strain possessing spontaneous fragmentations of the X chromosomes assessed that TRAS elements were not involved in the healing of de novo telomeres.

  10. Early growth performances of various seed sources of black (Prunus ...

    African Journals Online (AJOL)

    Early growth performances of various seed sources of black (Prunus serotina Erhr.) and wild cherry ( Prunus avium L.) seedlings on low and high elevation sites in the western Black Sea Region of Turkey.

  11. Trade-Off Between Fitness Gain and Cost Determines Profitability of a Peach Aphid Parasitoid. (United States)

    Khatri, Diwas; He, Xiong Z; Wang, Qiao


    Aphidius colemani (Viereck) (Hymenoptera: Aphidiidae) is commercially produced and utilized for biological control of peach aphid Myzus persicae (Sulzer) (Hemiptera: Aphididae) on greenhouse crops in many countries. To provide knowledge for the evaluation of parasitoid-host interactions and development of effective mass rearing programs, we investigated how and why host age or size affected fitness gain in A. colemani We show that the parasitoid was significantly more likely to encounter larger hosts and that an encounter almost always triggered an attack attempt. However, the attack attempt did not proportionally translate into oviposition because larger aphids had greater ability to defend themselves and the parasitoid spent more time in handling larger aphids. The host age at parasitization had no effect on emergence rates and sex ratio of parasitoid progeny, suggesting that pupae and larvae have similar survival rate in hosts of different ages and/or the parasitoid females do not adjust sex allocation based on host size. When parasitizing mid-aged hosts, the parasitoid gained maximum fitness for their progeny in developmental period, body size, and parasitism. Taking all findings together, we suggest that parasitizing mid-aged green peach aphid nymphs is most profitable for A. colemani. © The Authors 2016. Published by Oxford University Press on behalf of Entomological Society of America. All rights reserved. For Permissions, please email:

  12. Feeding on Leaves of the Glucosinolate Transporter Mutant gtr1gtr2 Reduces Fitness of Myzus persicae. (United States)

    Madsen, Svend Roesen; Kunert, Grit; Reichelt, Michael; Gershenzon, Jonathan; Halkier, Barbara Ann


    As aphids are a pest on various crops worldwide, a better understanding of the interaction between aphids and plant host defenses is required. The green peach aphid (Myzus persicae) feeds on a variety of plant species, including the model plant Arabidopsis thaliana (Arabidopsis), in which glucosinolates function as a major part of the chemical defense. Several studies have shown that glucosinolates play a role in interactions between Arabidopsis and the green peach aphid. In this work, we used a recently identified Arabidopsis glucosinolate transporter mutant (gtr1gtr2 dKO), with altered glucosinolate content in the vasculature, to investigate the role of defense compound transport in aphid infestation. By monitoring aphid performance on caged leaves and analyzing glucosinolates in leaf tissue and phloem sap, as well as inside aphids, we examined if a change in spatial distribution of glucosinolates within a leaf influences aphid performance. Based on reduced glucosinolate content in the phloem sap of the transporter mutant, we hypothesized that aphids would perform better on gtr1gtr2 dKO leaves compared to WT. Unexpectedly, aphids performed poorly on gtr1gtr2 dKO leaves. Our data suggest that higher glucosinolate content in tissues surrounding the phloem of the double transporter mutant may play a role in reducing aphid performance on this genotype.

  13. The evaluation of occurrence of PPV symptoms in young peach orchard according to the used rootstock

    Directory of Open Access Journals (Sweden)

    Klára Gogolková


    Full Text Available The degree of PPV occurrence was monitored in a young peach orchard during 2010–2011. This study evaluates the percentage of infected trees in 2010 as well as the intensity of PPV symptoms in 2011 in two peach varieties „Royal Glory“ and „Symphony“ grafted on seven different rootstocks of Prunus species after the natural infection. The different intensity of PPV symptoms was proved on infected parts such as flowers, leaves, fruits and from rootstocks’ point of view.In 2010 were PPV symptoms most often detected in variety ’Royal Glory’ grafted on rootstock Julior where 100% of trees were infected. No visible symptoms were observed in trees of variety ’Symphony’ on Pumiselect rootstock. As for the rootstocks evaluation, PPV symptoms were most numerous in trees grafted on MRS 2/5 rootstock (94.78%, at least were monitored on Lesiberian rootstock (28.47%.The intensity of PPV symptoms on flowers, leaves and fruits in each combination was evaluated in 2011. Generally, the PPV symptoms were present mainly on flowers and less on fruits.


    Directory of Open Access Journals (Sweden)

    Evelia Schettini


    Full Text Available The aim of this paper was to investigate the radiometric properties of coloured nets used to protect a peach cultivation. The modifications of the solar spectral distribution, mainly in the R and FR wavelength band, influence plant photomorphogenesis by means of the phytochrome and cryptochrome. The phytochrome response is characterized in terms of radiation rate in the red wavelengths (R, 600-700 nm to that in the farred radiation (FR, 700-800 nm, i.e. the R/FR ratio. The effects of the blue radiation (B, 400-500 nm is investigated by the ratio between the blue radiation and the far-red radiation, i.e. the B/FR ratio. A BLUE net, a RED net, a YELLOW net, a PEARL net, a GREY net and a NEUTRAL net were tested in Bari (Italy, latitude 41° 05’ N. Peach trees were located in pots inside the greenhouses and in open field. The growth of the trees cultivated in open field was lower in comparison to the growth of the trees grown under the nets. The RED, PEARL, YELLOW and GREY nets increased the growth of the trees more than the other nets. The nets positively influenced the fruit characteristics, such as fruit weight and flesh firmness.

  15. Detection of a new luteovirus in imported nectarine Trees: A case study to propose adoption of metagenomics in post-entry quarantine (United States)

    In spring 2013, five year-old nectarine (Prunus persica) trees, grafted on peach rootstock Nemaguard, were found stunted in a propagation block in California. These trees had been propagated from budwood of three nectarine cultivars imported from France and cleared through the post-entry quarantine ...

  16. Highly efficient in vitro adventitious shoot regeneration of Adenosma ...

    African Journals Online (AJOL)



    Apr 10, 2012 ... perfume plant Adenosma buchneroides Bonati. In: Proceed. Seventh. Perfume Plant Congress, pp. 26-29. Zhou HC, Li M, Zhao X, Fan XC, Guo AG (2010). Plant regeneration from in vitro leaves of the peach rootstock 'Nemaguard' (Prunus persica × P. davidiana). Plant Cell, Tiss. Org. Cult. 101: 79-87.

  17. Where are we now as we merge genomics into plant breeding and what are our limitations? Experiences from RosBREED (United States)

    The complete genomic sequences of apple (Malus × domestica Borkh), peach (Prunus persica (L.) Batsch), and diploid strawberry (Fragaria vesca L.) – one member of each of the three main fruit-producing branches of the Rosaceae family tree – were available in 2010. Despite this achievement, virtually ...

  18. Dicty_cDB: CFK405 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available 0 9 BU042811 |BU042811.1 PP_LEa0014A23f Peach developing fruit mesocarp Prunus persica cDNA clone PP_LEa0014A23f...BQ806838 |BQ806838.1 WHE3583_G06_M11ZS Wheat developing grains cDNA library Triticum aestivum cDNA clone

  19. Dicty_cDB: CFJ795 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available 0 9 BU042811 |BU042811.1 PP_LEa0014A23f Peach developing fruit mesocarp Prunus persica cDNA clone PP_LEa0014A23f...BQ806838 |BQ806838.1 WHE3583_G06_M11ZS Wheat developing grains cDNA library Triticum aestivum cDNA clone

  20. Dicty_cDB: SFF142 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available 0 9 BU042811 |BU042811.1 PP_LEa0014A23f Peach developing fruit mesocarp Prunus persica cDNA clone PP_LEa0014A23f...BQ806838 |BQ806838.1 WHE3583_G06_M11ZS Wheat developing grains cDNA library Triticum aestivum cDNA clone

  1. Dicty_cDB: CFC586 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available 10 BU042811 |BU042811.1 PP_LEa0014A23f Peach developing fruit mesocarp Prunus persica cDNA clone PP_LEa0014A23f...BQ806838 |BQ806838.1 WHE3583_G06_M11ZS Wheat developing grains cDNA library Triticum aestivum cDNA clone

  2. Dicty_cDB: SFJ704 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available 0 8 BU042811 |BU042811.1 PP_LEa0014A23f Peach developing fruit mesocarp Prunus persica cDNA clone PP_LEa0014A23f...BQ806838 |BQ806838.1 WHE3583_G06_M11ZS Wheat developing grains cDNA library Triticum aestivum cDNA clone

  3. Dicty_cDB: SFB124 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available 0 9 BU042811 |BU042811.1 PP_LEa0014A23f Peach developing fruit mesocarp Prunus persica cDNA clone PP_LEa0014A23f...BQ806838 |BQ806838.1 WHE3583_G06_M11ZS Wheat developing grains cDNA library Triticum aestivum cDNA clone

  4. Dicty_cDB: VSG250 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available 2 BU574126 |BU574126.1 PA__Ea0006F03f Almond developing seed Prunus dulcis cDNA clone PA__Ea0006F03f...010 1 BU044788 |BU044788.1 PP_LEa0020I02f Peach developing fruit mesocarp Prunus persica cDNA clone PP_LEa0020I02f

  5. Behavioural avoidance and enhanced dispersal in neonicotinoid-resistant Myzus persicae (Sulzer). (United States)

    Fray, Lucy M; Leather, Simon R; Powell, Glen; Slater, Russell; McIndoe, Eddie; Lind, Robert J


    The peach potato aphid Myzus persicae is a major agricultural pest capable of transmitting over 100 plant viruses to a wide range of crops. Control relies largely upon treatment with neonicotinoid insecticides such as thiamethoxam (TMX). In 2009, a strain denoted FRC, which exhibits between 255- and 1679-fold resistance to current neonicotinoids previously linked to metabolic and target site resistance, was discovered in France. Dispersal behaviour may potentially further enhance the resistance of this strain. This study investigated this possibility and is the first to compare the dispersal behaviour of aphid clones of the same species with differing levels of neonicotinoid resistance. Comparing the dispersal behaviour of the FRC strain with that of a clone of lower neonicotinoid resistance (5191A), and a susceptible clone (US1L) highlighted several differences. Most importantly, the FRC strain exhibited an increased ability to locate untreated areas when presented with an environment consisting of both TMX-treated and untreated plant tissue. The altered dispersal behaviour of the FRC may partially account for the high level of neonicotinoid resistance exhibited by this strain in the field. Since the dispersal of aphid vectors is key to the transmission of viruses across crop fields this has implications for current crop protection practice. © 2013 Society of Chemical Industry.

  6. Plant Essential Oils Synergize and Antagonize Toxicity of Different Conventional Insecticides against Myzus persicae (Hemiptera: Aphididae). (United States)

    Faraone, Nicoletta; Hillier, N Kirk; Cutler, G Christopher


    Plant-derived products can play an important role in pest management programs. Essential oils from Lavandula angustifolia (lavender) and Thymus vulgaris (thyme) and their main constituents, linalool and thymol, respectively, were evaluated for insecticidal activity and synergistic action in combination with insecticides against green peach aphid, Myzus persicae (Sulzer) (Hemiptera: Aphididae). The essential oils and their main constituents exerted similar insecticidal activity when aphids were exposed by direct sprays, but were non-toxic by exposure to treated leaf discs. In synergism experiments, the toxicity of imidacloprid was synergized 16- to 20-fold by L. angustifolia and T. vulgaris essential oils, but far less synergism occurred with linalool and thymol, indicating that secondary constituents of the oils were probably responsible for the observed synergism. In contrast to results with imidacloprid, the insecticidal activity of spirotetramat was antagonized by L. angustifolia and T. vulgaris essential oils, and linalool and thymol. Our results demonstrate the potential of plant essential oils as synergists of insecticides, but show that antagonistic action against certain insecticides may occur.

  7. Variability of vineyard peach tree characteristics

    Directory of Open Access Journals (Sweden)

    Zec Gordan


    Full Text Available Vineyard peach seedlings are the most important rootstock for peach in Serbia and abroad. High variability is a characteristic of the vineyard peach planting material that is used as rootstock in nursery production. Through work of many years, vineyard peach genotypes with qualitative traits were selected and collected. Seedlings that are progeny of the nine selected genotypes and resulted from self and open pollination were examined. The vineyard peach seedlings resulted from uncontrolled pollination and with different geographical origin served as reference. A goal of research was to get vineyard peach genotypes that would give more uniform generative progeny with qualitative traits. This paper presents the results of two-year research of morphological traits of more than 500 vineyard seedlings. Based on the results, positive genotypes were selected for further inbreeding. Further, the seedlings of the selection 6 have the lowest coefficients of variation for trunk thickness, tree height and number of branches, which points to the self-pollination as a good method for getting more uniform progeny. .

  8. Plum pox virus accumulates mutations in different genome parts during a long-term maintenance in Prunus host plants and passage in Nicotiana benthamiana. (United States)

    Vozárová, Z; Kamencayová, M; Glasa, M; Subr, Z


    Plum pox virus (PPV) isolates of the strain PPV-M prevalently infect peaches under natural conditions in Middle Europe. Comparison of complete genome sequences obtained from subisolates of a PPV-M isolate maintained experimentally over a 6-year period in different Prunus host species and passaged in Nicotiana benthamiana was performed with the aim to highlight the mutations potentially connected with the virus-host adaptation. The results showed that the lowest number of non-silent mutations was accumulated in PPV-M maintained in peach (original host species), approximately two times higher diversity was recorded in plum, apricot and N. benthamiana, indicating the genetic determination of the PPV host preference. The sequence variability of Prunus subisolates was distributed more or less evenly along the PPV genome and no amino acid motif could be outlined as responsible for the host adaptation. In N. benthamiana the mutations were accumulated notably in the P1 and P3 genes indicating their non-essentiality in the infection of this experimental host plant.

  9. Using Perls Staining to Trace the Iron Uptake Pathway in Leaves of a Prunus Rootstock Treated with Iron Foliar Fertilizers. (United States)

    Rios, Juan J; Carrasco-Gil, Sandra; Abadía, Anunciación; Abadía, Javier


    The aim of this study was to trace the Fe uptake pathway in leaves of Prunus rootstock (GF 677; Prunus dulcis × Prunus persica) plants treated with foliar Fe compounds using the Perls blue method, which detects labile Fe pools. Young expanded leaves of Fe-deficient plants grown in nutrient solution were treated with Fe-compounds using a brush. Iron compounds used were the ferrous salt FeSO4, the ferric salts Fe2(SO4)3 and FeCl3, and the chelate Fe(III)-EDTA, all of them at concentrations of 9 mM Fe. Leaf Fe concentration increases were measured at 30, 60, 90 min, and 24 h, and 70 μm-thick leaf transversal sections were obtained with a vibrating microtome and stained with Perls blue. In vitro results show that the Perls blue method is a good tool to trace the Fe uptake pathway in leaves when using Fe salts, but is not sensitive enough when using synthetic Fe(III)-chelates such as Fe(III)-EDTA and Fe(III)-IDHA. Foliar Fe fertilization increased leaf Fe concentrations with all Fe compounds used, with inorganic Fe salts causing larger leaf Fe concentration increases than Fe(III)-EDTA. Results show that Perls blue stain appeared within 30 min in the stomatal areas, indicating that Fe applied as inorganic salts was taken up rapidly via stomata. In the case of using FeSO4 a progression of the stain was seen with time toward vascular areas in the leaf blade and the central vein, whereas in the case of Fe(III) salts the stain mainly remained in the stomatal areas. Perls stain was never observed in the mesophyll areas, possibly due to the low concentration of labile Fe pools.

  10. Investigation on the pollen morphology of traditional cultivars of Prunus species in Sicily

    Directory of Open Access Journals (Sweden)

    Anna Geraci


    Full Text Available In this study pollen grains of 13 cultivars and 3 rootstocks belonging to 5 species (P. armeniaca, P. domestica, P. dulcis, P. persica, P. avium of the genus Prunus collected from North-East Sicily were examined for the micromorphological characterization through the scanning electron microscopy (SEM. The length of polar axis (P and the equatorial diameter (E of grain, P/E ratio, the length of colpi (C, diameter of perforations (DP and the number of perforations in 25 μm2 (PN, the width of muri (WM, the distance between muri (DM and their number in 25 μm2 (MN, the width of grooves (WG were measured and their variation was compared among studied taxa. Moreover multivariate statistical analysis was carried out to distinguish morphometric information from measured parameters. All pollen grains are trizonocolpate, isopolar, medium-large sized and their shape varies from prolate to perprolate. Regarding outline pollen grains are subtriangular in polar view and elliptic in equatorial view. Exine sculpturing is striate with perforations on grain surface. The arrangement of ridges appears roughly parallel but too sloped (sometimes curved compared to polar axis, or branched and oriented in different directions, or perfectly parallel or more irregular with bifurcated ridges often sinuous. The analyses showed a great variability (particularly in P. domestica cultivars related in some cases to the diversity in the morphological features of the leaves and the fruits of the investigated entities.

  11. Prunus spp. intoxication in ruminants: a case in a goat and diagnosis by identification of leaf fragments in rumen contents. (United States)

    Radi, Zaher A; Styer, Eloise L; Thompson, Larry J


    Prunus serotina Ehrh. (black cherry) intoxication was diagnosed on postmortem examination of a goat. The clinical signs were weakness, depression, seizure-like activity, and lateral recumbency. Natural cases of black cherry intoxication have not been reported in goats in the United States. In the absence of a history of access to black cherry or the ability to detect cyanide or cyanogenic glycosides in blood or tissues, black cherry intoxication may be diagnosed in ruminants by the identification of black cherry leaves in rumen contents. Three distinctive features facilitate identification of black cherry leaves or leaf fragments: 1) a pair of small glands that protrude from the sides of the petiole just below the base of the blade, 2) incurved, gland-tipped (callous) teeth along the margins of the leaf, and 3) a band of hairs to each side of the lower half of the midvein on the surface of the leaf. Shape of the marginal teeth, presence or absence of glands at the tips of these teeth, the morphology of these glands, and presence or absence of petiolar glands and their morphology may allow identification and differentiation of small fragments of leaves from the 6 most important cyanogenic Prunus spp. in eastern North America: black cherry, Carolina laurel cherry, peach, English laurel cherry, choke cherry, and fire cherry.

  12. Host Suitability of Eight Prunus spp. and One Pyrus communis Rootstocks to Pratylenchus vulnus, P. neglectus, and P. thornei. (United States)

    Pinochet, J; Verdejo-Lucas, S; Marull, J


    The effects of Pratylenchus vulnus on rootstocks of eight commonly used Prunus spp. and one Pyrus communis were evaluated under greenhouse conditions during a 15-month period. In a first experiment, two almonds (Moncayo and Garrigues), one peach (GF-305), and two peach-almond hybrids (GF-677 and Adafuel) inoculated with 2,000 nematodes per plant proved to be good hosts of P. vulnus. Highest (P < 0.05) numbers of nematodes per gram of fresh root weight were recovered from Adafuel and GF-677. Root weights were higher in uninoculated compared to inoculated plants of all rootstocks, whereas top weights of uninoculated Garrigues, GF-305, and GF-677 differed (P < 0.05) from those of inoculated plants. In a second experiment, three plum (Marianna 2624, Myrobalan 605, and San Julian 655-2) and one pear (OHF-333) rootstocks were also found to be good hosts of P. vulnus, although significantly fewer nematodes were recovered from Myrohalan 605 roots than from the other three materials. Inoculated OHF-333 and San Julian 655-2 differed (P < 0.05) in root weights over uninoculated plants. Only inoculated San Julian 655-2 showed differences in top weights over uninoculated treatments. Rootstocks were poor or non-hosts for P. neglectus and P. thornei.

  13. Assessment of the Dominance Level of the R81T Target Resistance to Two Neonicotinoid Insecticides in Myzus persicae (Hemiptera: Aphididae). (United States)

    Mottet, Claire; Fontaine, Séverine; Caddoux, Laëtitia; Brazier, Christine; Mahéo, Frédérique; Simon, Jean-Christophe; Micoud, Annie; Roy, Lise


    Myzus persicae (Sulzer, 1776), a major crop pest worldwide, displays insecticide resistance to most molecules. The R81T substitution on the β1 subunit of nicotinic receptors of acetylcholine (nAChR) confers target site resistance to neonicotinoids and is widespread in aphid populations colonizing peach tree orchards in Southern Europe. But the impact of this resistance in the field, as well as ways to optimize its management, depends largely on the dominance level of the R81T mutation. In this study, we measured by in vitro assays the response of R81T mutation to two neonicotinoids (imidacloprid and thiacloprid) in 23 M. persicae clones with different resistance genotypes in order to assess the dominance status of this allele. In this study, all homozygous clones for the R81T mutation (genotype 81(TT)) showed a much higher level of resistance to both active substances than other clones. The heterozygous clones 81(RT) displayed a slightly higher level of resistance than wild homozygous, though resistance phenotypes against both neonicotinoids in these two genotypes were overlapping. A great variation of resistance level was found within these two latter clones' categories. The dominance level of insecticide resistance (DLC) strongly suggested that the mutant allele 81T is semirecessive (the wild 81R allele being rather dominant) for both insecticide molecules under test. Mean DLC values were 0.316 for imidacloprid and 0.351 for thiacloprid. Cross-resistance was shown between imidacloprid and thiacloprid. This partial recessivity is valuable information to broaden the knowledge on neonicotinoid resistance, a prerequisite for devising adapted management strategies against insecticide-resistant populations of M. persicae. © The Authors 2016. Published by Oxford University Press on behalf of Entomological Society of America. All rights reserved. For Permissions, please email:

  14. Insecticide resistance profiles can be misleading in predicting the survival of Myzus persicae genotypes on potato crops following the application of different insecticide classes. (United States)

    van Toor, Ron F; Malloch, Gaynor L; Anderson, Eric A; Dawson, Greg; Fenton, Brian


    The accuracy of predicting the survival of insecticide-resistant aphids following the application of commonly used insecticides from the carbamate, the pyrethroid, a mix of the two or the neonicotinoid chemical classes was evaluated in a potato field in Scotland. Equal proportions of five genotypes of the peach-potato aphid, Myzus persicae (Sulzer), with none, resistance to dimethyl-carbamates, resistance to pyrethroids or combinations conferring resistance to both chemical classes were released into potato field plots. The insecticides were sprayed separately onto these plots, the aphid populations were analysed after 6-8 days and the process repeated. For each assessment after the three separate spray events, plots treated with the carbamate had 48, 147 and 28%, those treated with pyrethroid 53, 210 and 89%, those treated with carbamate/pyrethroid 28, 108 and 64% and those treated with neonicotinoid 43, 55 and 11% of the numbers of M. persicae by comparison with untreated controls. Only the proportions of surviving aphids from the genotype containing no insecticide resistance traits and the genotype containing elevated carboxylesterases matched ratios predicted from the selective advantage afforded by the resistance traits alone. Survival of aphids from the other three genotypes that carried 1-3 of the insecticide resistance traits differed from expectations in all cases, possibly owing to physiological differences, including their vulnerability to predators and hymenopterous parasitoids present at the site and/or their carrying unknown insecticide resistance mechanisms. Control strategies based on knowledge of the genetically determined insecticide resistance profile of an M. persicae population alone are insufficient. Hence, other important factors contributing to aphid survival under insecticide pressure need to be considered. Copyright © 2012 Society of Chemical Industry.

  15. Silvical characteristics of black cherry (Prunus serotina) (United States)

    Ashbel F. Hough


    Black cherry (Prunus serotina Ehrh.) is the largest of the native cherry trees of the United States. It may grow to more than 100 feet in height, and to as much as 5 feet in diameter. It is the only species of its genus that provides lumber for commerce. And this lumber, because of its stability and its superior working qualities, is one of the most...

  16. Arsenic Removal from Aqueous Solutions by Salvadora persica Stem Ash

    Directory of Open Access Journals (Sweden)

    Ferdos Kord Mostafapour


    Full Text Available Arsenic is a naturally occurring metalloid, which is widely distributed in nature and is regarded as the largest mass poisoning in history. In the present study, the adsorption potential of Salvadora persica (S. persica stem ash in a batch system for the removal of As(V from aqueous solutions was investigated. Isotherm studies were carried out to evaluate the effect of contact time (20–240 min, pH (2–11, initial arsenic concentration (50–500 μg/L, and adsorbent dose on sorption efficiency. Maximum removal efficiency of 98.33% and 99.32% was obtained at pH 6, adsorbent dosage 3.5 g/L, initial As(V concentration 500 μg/L, and contact time 80 and 60 min for S. persica stem ash at 300 °C and 500 °C, respectively. Also, the adsorption equilibriums were analyzed by the Langmuir and Freundlich isotherm models. Such equilibriums showed that the adsorption data was well fitted with the Freundlich isotherm model for S. persica stem ash at both 300 °C and 500 °C (R2=0.8983 and 0.9274, resp.. According to achieved results, it was defined that S. persica stem ash can be used effectively for As(V removal from the aqueous environment.

  17. Dicty_cDB: VSD657 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available 2 BU574126 |BU574126.1 PA__Ea0006F03f Almond developing seed Prunus dulcis cDNA clone PA__Ea0006F03f, mRNA ...sequence. 52 0.010 1 BU044788 |BU044788.1 PP_LEa0020I02f Peach developing fruit m...esocarp Prunus persica cDNA clone PP_LEa0020I02f, mRNA sequence. 52 0.010 1 BU042820 |BU042820.1 PP_LEa0014B11f Peach developing

  18. Dicty_cDB: VSF567 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available 0.009 2 BU047638 |BU047638.1 PP_LEa0030I23f Peach developing fruit mesocarp Prunus persica cDNA clone PP_LEa...0030I23f, mRNA sequence. 52 0.010 1 BU574126 |BU574126.1 PA__Ea0006F03f Almond developing... seed Prunus dulcis cDNA clone PA__Ea0006F03f, mRNA sequence. 52 0.010 1 BU044788 |BU044788.1 PP_LEa0020I02f Peach developing

  19. Dicty_cDB: VSF237 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available mRNA sequence. 40 0.009 2 BU574126 |BU574126.1 PA__Ea0006F03f Almond developing seed Prunus dulcis cDNA PA__Ea0006F03f, mRNA sequence. 52 0.010 1 BU044788 |BU044788.1 PP_LEa0020I02f Peach developing... |BU042820.1 PP_LEa0014B11f Peach developing fruit mesocarp Prunus persica cDNA clone PP_LEa0014B11f, mRNA s

  20. Postharvest Sensory and Phenolic Characterization of ‘Elegant Lady’ and ‘Carson’ Peaches Caracterización Fenólica y Sensorial en Poscosecha de Duraznos ‘Elegant Lady’ y ‘Carson’

    Directory of Open Access Journals (Sweden)

    Rodrigo Infante


    Full Text Available High quality fruits are increasingly demanded along with the need to ensure this attribute to consumers. Thus, this study was aimed at characterizing a melting (‘Elegant Lady’ and a non-melting flesh (‘Carson’ peach (Prunus persica (L. Batsch varieties by considering both their bioactive compound contribution and their sensory quality in ripe fruit at harvest and after a prolonged period of cold storage. Cultivars were evaluated at harvest (F0 and after 30 d of cold storage (F30, as well as after a maturation period at 20 °C for both F0 and F30 (R0 and R30, respectively. Fruit weight, flesh firmness, soluble solid content (SSC, titratable acidity (TA, and background color (Hue were recorded at each stage. Furthermore, total phenol content was measured and a phenolic characterization by HPLC (High-Performance Liquid Chromatography was performed for both varieties to detect the major low molecular weight phenolic compounds present in the fruit. Finally, a trained panel assessed the main sensorial parameters at R0 and R30. Total phenol content did not change significantly as a result of cold storage and differences were probably attributed only to genotype. Low molecular weight phenolic compounds were detected in ‘Elegant Lady’ and ‘Carson’, 15 and 12, respectively; (+-catechin was the major compound found in both cultivars, but in higher concentrations in ‘Elegant Lady’. In the phenolic characterization, ‘Elegant Lady’ was observed more closely than ‘Carson’ for flavonoids. After 30 d of cold storage, ‘Elegant Lady’ was unacceptable for consumption due to the appearance of physiological disorders such as wooliness while ‘Carson’ showed a mean score within the acceptability range.La demanda de fruta de alta calidad se ha incrementado junto con la necesidad de asegurar este atributo a los consumidores. En este sentido, el objetivo de este estudio fue caracterizar durazno (Prunus persica (L. Batsch de variedades

  1. Pheromones control oriental fruit moth and peach twig borer in cling peaches


    Pickel, Carolyn; Hasey, Janine; Bentley, Walt; Olson, William H.; Grant, Joe


    Slow-release pheromone tech-nology can successfully control oriental fruit moth and peach twig borer while eliminating in-season insecticide sprays in cling peaches. In conjunction with a demon-stration program, we compared mating disruption for these two pests with standard grower pest-control methods in the Sacramento and San Joaquin valleys, and monitored for pest damage, yield and grower costs. While the mating-disruption program was effective in controlling the targeted pests, costs were...

  2. Interspecific hybridizations in ornamental flowering cherries (Prunus species) (United States)

    Flowering cherries belong to the genus Prunus L., consisting primarily of species native to Asia. Despite the popularity of ornamental cherry trees in the landscape, most ornamental Prunus planted in the U.S. are derived from a limited genetic base of Japanese flowering cherry taxa. Controlled cross...

  3. A molecular ph